diff --git "a/deduped/dedup_0828.jsonl" "b/deduped/dedup_0828.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0828.jsonl"
@@ -0,0 +1,54 @@
+{"text": "The Atlantic Forest is represented on the coast of Brazil by approximately 7,5% of remnants, much of these concentrated on the country's SE coast. Within these southeastern remnants, we still find the coastal Cai\u00e7aras who descend from Native Indians and Portuguese Colonizers. The maintenance of such populations, and their existence in spite of the deforestation that occurred on the Atlantic Forest coast, deserves especial attention and analysis. In this study, I address, in particular, the Cai\u00e7aras who live on the coast of S\u00e3o Paulo and Rio de Janeiro States, illustrating with examples of coastal inhabitants from other areas, such as Bahia State (NE coast) and of other forested areas (riverine caboclos of the Amazon). The major focus of this study, based on previous research, performed since 1986 in several populations or villages of the Atlantic Forest coast, is to understand the resilience of the Cai\u00e7aras, which is analyzed using ecological concepts, such as metapopulation, resilience and adaptive cycles. The Cai\u00e7ara populations are located on islands  and on the coast . Information gathered about the Cai\u00e7aras regarding the economic cycles of the local regions, along with ecological, historical and economic data available, are used to understand such resilience, and are complemented with comparative examples from the Brazilian Amazon and with variables such as the local restrictions imposed by environmental governmental agencies. Concepts in ecology have been, for a long time, useful in order to understand processes within and between human populations, and their environment. Examples of the uses of these concepts are found in disciplines such as Ethnobiology or Human Ecology ,2. This 2, or 12% of the land surface of the country . No. No32]. The degree of connectedness influences the internal and external processes of populations and as a part of adaptive cycles it is implicitly tied to resilience . The adaAssociating the metapopulation of the Cai\u00e7aras Figure  with theI) Cai\u00e7aras adapted to different economic cycles through a relative flexibility in dealing with the environment and with the regional and national economy. They extracted local resources and participated in local and regional economy. Populations maintained their sizes, and maintained connections through migrations. Release was followed by reorganization in the economy towards a new cycle  be resilient, contributing to the ecological and social resilience of the Atlantic Forest and of the Cai\u00e7aras?II) In metapopulations I and II , and the various communication systems in the Mamirau\u00e1 Sustainable Development Reserve are examples of channels that integrate local residents and help in the decision processes concerning their environment and their economic activities. On the other hand, such lack of communication among Cai\u00e7aras does not imply that they could not be helpful in local management programs. The occurrence of local rules and practices, such as related to manioc cultivation and its local diversity [I Figure , it may iversity ,43 or reiversity ,19 are ea. In terms of communication channels, how does the relative slow connectedness of Cai\u00e7aras affect their capacity to overcome the impositions from the external system ?b. How does the lack of communication channels among the Cai\u00e7aras decrease their empowerment capacity?c. Are the external impositions , which exclude the local rules developed by the Cai\u00e7aras, already a result of a weak local power?d. How does this weak local empowerment affect the Cai\u00e7aras' ecological and cultural resilience?e. How will the extinction of the local Cai\u00e7aras affect the resilience of the last remnants of the Atlantic Forest coast?pau de jangada (Apeiba tibournou) [Estrada do Coco (coconut highway), is reforested in some parts by exotic species, such as by Pinus. Would it not be wiser to include fishers in the management of the raft wood (pau de jangada) by planting such trees in available and suitable sites? Summing up, metapopulation analyses can be helpful in understanding interactions within these populations, and among populations and the environment. I am leaving many questions that could serve as a guide for future studies towards the sustainability of the last remnants of the Atlantic Forest coast and their inhabitants, the Cai\u00e7aras.The examples given here, describing the northern coast of S\u00e3o Paulo State, are part of the ecological-historical processes that occurs in the rest of the Brazilian coast. In Bahia, for example, during fieldwork in January 2005, I observed the last rafts used for fishing at Porto Sau\u00edpe, a community distant about 50 miles from Salvador. At neighboring communities, such as at Baixios, raft construction, according to local fishers, was forbidden by environmental agencies because of the use of bournou)  to buildbournou)  such a r"}
+{"text": "Mangrove forests, though essentially common and wide-spread, are highly threatened. Local societies along with their knowledge about the mangrove also are endangered, while they are still underrepresented as scientific research topics. With the present study we document local utilization patterns, and perception of ecosystem change. We illustrate how information generated by ethnobiological research can be used to strengthen the management of the ecosystem. This study was conducted in the Godavari mangrove forest located in the East-Godavari District of the state Andhra Pradesh in India, where mangroves have been degrading due to over-exploitation, extensive development of aquaculture, and pollution from rural and urbanized areas (Kakinada).Avicennia marina (Forsk.) Vierh., a dominant species in the Godavari mangroves, is used most frequently as firewood and for construction. Multiple products of the mangrove included the bark of Ceriops decandra (Griff.) Ding Hou to dye the fishing nets and improve their durability, the bark of Aegiceras corniculatum (L.) Blanco to poison and catch fish, and the leaves of Avicennia spp. and Excoecaria agallocha L. as fodder for cattle. No medicinal uses of true mangrove species were reported, but there were a few traditional uses for mangrove associates. Utilization patterns varied in the two zones that we investigated, most likely due to differences in their ecology and legal status. The findings are discussed in relation with the demographic and socio-economic traits of the fisherfolk communities of the Godavari mangroves and indicate a clear dependency of their livelihood on the mangrove forest.One hundred interviews were carried out among the fisherfolk population present in two mangrove zones in the study area, a wildlife sanctuary with strong conservation status and an adjacent zone. Results from the interviews indicated that A posteriori comparisons between sequential satellite imagery (retrospective till 1977) and respondents that were at least 15 years back then, revealed a mangrove decrease which was however perceived to different extents depending on the area with which the fishermen were familiar. While local needs had not been incorporated in the existing policy, we created a framework on how data on ethnobotanical traditions, fishery-related activities and local people's perceptions of change can be incorporated into management strategies.Reported changes in the Godavari mangrove cover also differed in the two zones, with significantly less perceptions of a decrease in the protected area, as compared to the adjacent non-protected area.  Mang. Mange.ge.g., ,7-13. Th, e.g., -17]. For. Fore.g., . Howeve, e.g., ,4,21], t,21, te.g, , an, an59], Ceriops decandra bark, to colour and preserve fishing nets. This traditional way of better preserving fishing nets was very relevant in the past when fishing nets were manufactured in cotton . How. Howe.g.e.g., ,63-65. Te.g., ,33. Theye.g., ,41.a posteriori confrontation with remote sensing data. They reported for instance the dramatic expansion of the mangrove associate Acanthus ilicifolius, but this type of distinction of herbaceous plants is possible only with imagery with submeter spatial resolution, such as IKONOS . The de km.hr-1 , killed  km.hr-1 . Yet onlApart from change in the mangrove area, fishermen also reported a number of fishery-related causes to declining catches. Up to 27% of the mangrove fishermen accuse their peers of overharvesting shrimp larvae, juvenile and adults (offshore trawling), leading to the decrease in catch within the mangroves. This argument is confirmed by R\u00f6nnb\u00e4ck et al. , who repe.g., , ecolog, , ethnob, , and thcf. ]. Althoucf. cf. ,66]..cf. b [***]CHAPTER IVSanctuaries, National Park, 1[****] and Closed AreasSanctuaries18. Declaration of Sanctuary.- (2) The notification referred to in sub-section (1) shall specify, as nearly as possible, the situation and limits of such area.Explanation. - For the purposes of the this section, it shall be sufficient to describe the area by roads, rivers, ridges, or other well-known or readily intelligible boundaries19. Collector to determine rights.-  the collector shall inquire into, and determine the existence, nature and extent of the rights of any person in or over the land comprised within the limits of the sanctuary.20. Bar of accrual of rights.- After the issue of a notification under Sec.\"18, no right shall be acquired in, or over the land comprised within the limits of the area specified in such notification, except by succession, testamentary or intestate.21. Proclamation by Collector. \u2013 When a notification has been issued under Sec.18 the Collector shall publish in the regional language in every town and village in or in the neighborhood of the area comprised therein, a progamation:(a) specifying, as nearly as possible, the situation and the limits of the sanctuary; and(b) requiring any person, claiming any right mentioned in Sec. 19, to prefer before the collector\" within two months from the date of such proclamation, a written claim in the prescribed form specifying the nature and extent of such right, with necessary details and the amount and particulars of the compensation, if any, claimed in respect thereof.22. Inquiry by Collector. \u2013 The Collector shall, after service of the prescribed notice upon the claimant, expeditiously inquire into(a) the claim preferred before him under Cl. (b) of Sec.21, and(b) the existence of any right mentioned in Sec.19 and not claimed under Cl.(b) of Sec.21, so far as the same may be ascertainable from the records of the State Goven-iments and the evidence of any person acquainted with the same.23. Powers of Collector. \u2013 For the purpose of such inquiry, the Collector may exercise the following powers, namely(a) the power to enter in or upon any land and to survey, demarcate, and make a map of the same or to authorise any other officer to do so;(b) the same powers as are vested in a civil court for the trial of suits.24. Acquisition of rights. \u2013 (1) In the case of a claim to a right in or over any land referred to in Sec.19, the Collector shall pass an order admitting or rejecting the same in whole or in part.(2) If such claim is admitted in whole or in part, the Collector may either(a) exclude such land from the limits of the proposed sanctuary, or(b) proceed to acquire such land or rights, except where by an agreement between the owner of such land or the holder of rights and the Government the owner or holder of such rights has agreed to surrender his rights to the Government, in or over such land, and payment of such compensation, as is provided in the Land Acquisition Act, 1894 (1 of 1894)4(c) allow, in consultation with the Chief Wildlife Warden, the continuance of any right of any person in, or over any land within the limits of the sanctuary.]27. Restriction on entry in sanctuary. - (1) No person other than,(a) a public servant on duty;(b) a person who has been permitted by the Chief Wildlife Warden or the authorised officer to reside within the limits of the sanctuary;(c) a person who has any right over immovable property within the limits of the sanctuary;(d) a person passing through the sanctuary along a public highway, and(e) the dependents of the person referred to in CI. (a), (b) or (c). shall enter or reside in the sanctuary, except under and in accordance with the conditions of a permit granted under section 28.(2) Every person shall, so long as he resides in the sanctuary, be bound(a) to prevent the commission, in the sanctuary, or an offence against this Act;(b) where there is reason to believe that any such offence against this Act has been committed in such sanctuary, to help in discovering and arresting the offender;(c) to report the death of any wild animal and to safeguard its remains until the Chief Wildlife Warden or the authorised officer takes charge thereof;(d) to extinguish any fire in such sanctuary of which he has knowledge or information and to prevent from spreading by any lawful means in his power, any fire within the vicinity of such sanctuary of which he has knowledge or information; and(e) to assist any forest officer, Chief Wildlife Warden, Wildlife Warden or police officer demanding his aid for preventing the commission of any offence against this Act or in the investigation of any such offence.6(3) No person shall, with intent to cause damage to any boundary-mark of a sanctuary or to cause any wrongful gain as defined in the Indian Penal Code (45 of 1860), alter, destroy, move, or deface such boundary-mark.][7(4) No person shall tease or molest any wild animal or litter the grounds or sanctuary.]30. Causing fire prohibited. \u2013 No person shall set fire to a sanctuary, or kindle any fire, or leave any fire burning, in a sanctuary, in such manner as to endanger such sanctuary.31 Prohibition of entry into sanctuary with weapon. \u2013 No person shall enter a sanctuary with any weapon except with the previous permission in writing of the Chief Wildlife Warden or the authorised officer.32. Ban on use of injurious substances. \u2013 No person shall use in a sanctuary, chemicals, explosives or any other substances which may cause injury to, or endanger, any wildlife in such sanctuary.33. Control of sanctuaries. \u2013 The Chief Wildlife Warden shall be the authority who shall control, manage and maintain all sanctuaries and for that purpose, within the limits of any sanctuary,(a) may construct such roads, bridges, buildings, fences or barrier gates, and carry out such other works as he may consider necessary for the purposes of such sanctuary;(b) shall take such steps as will ensure the security of wild animals in the sanctuary and the preservation of the sanctuary and wild animals, therein;(c) may take such measures, in the interests of wildlife, as he may consider necessary for the improvement of any habitat.(d) may regulate, control or prohibit, in keeping with the interests of wildlife, the grazing or movement of [livestock].(e) [omitted 1991]933A. Immunisation of livestock. 34. Registration of certain persons in possession of arms. \u2013 (41) Within three months from the declaration of any area as a sanctuary, every person residing in or within ten kilometres of any such sanctuary and holding a licence granted under the Arms Act, 1959 (54 of 1959), for the possession of arms or exempted from the provisions of that Act and possessing arms, shall apply in such form, on payment of such fee, and within such time as may be prescribed, to the Chief Wildlife Warden or the authorised officer, for the registration of his name.(2) On receipt of an application under sub-section (1), the Chief Wildlife Warden or the authorised officer shall register the name of the applicant in subject manner as may be prescribed.103) No new licences under the Arms Act, 1959 (54 of 1959), shall be granted within a radius of ten kilometres of a sanctuary without the prior concurrence of the Chief Wildlife Warden.][(2) The notification referred to in sub-section (1) shall define the limits of the area which is intended to be declared as a National Park.1219 to 26-A (both inclusive except clause (c) of sub-section (2) of section 24)] shall, as far as may be, apply to the investigation and determination of claims and extinguishment of rights, in relation to any land in such area as they apply to the said matters in relation to any land in a sanctuary.(3) Where any area is intended to be declared as a National Park, the provisions of Sec.  shall be permitted in a National Park and no livestock shall be allowed to enter except where such [livestock] is used as a vehicle by a person authorised to enter such National Park.(7) No grazing of any [livestock14] and sec.34 shall, as far as may be, apply in realtion to a National Park as they apply in relation to a sanctuary.(8) The provisions of secs. 27 and 28, secs.30 to 32 (both inclusive), and CIS, (a), (b) and (c) of 37. Declaration of closed area. \u2013 (1) The State Government may, by notification, declare any area closed to hunting for such period as may be specified in the notification.(2) No hunting of any wild animal shall be permitted in a closed area during the period specified in the notification referred to in sub-section(1).38. Power of Central Government to declare areas as Sanctuaries or National Park, \u2013 (1) Where the State Government leases or otherwise transfers any area under its control, not being an area within a Sanctuary, to the Central Government the Central Government may, if it is satisfied that the conditions specified in sec.18 are fulfilled in relation to the area so transferred to it, declare such area, by notification, to be a sanctuary and the provisions of [sec 18 to 35 (both inclusive)16], 54 and 55 shall apply in relation to such sanctuary as they apply in relation to a sanctuary declared by the State Government.(2) The Central Government may, if it is satisfied that the conditions specified in sec.35 are fulfilled in relation to any area referred to in sub-section (1), whether or not such area has been declared, to be a sanctuary by the Central Government, or the State Government, declare such area, by notification, to be a National Park and the provisions of secs.35. 54 and 55 shall apply to such National Park as they apply in relation to a National Park declared by the State Government.(3) In relation to a sanctuary or National Park declared by the Central Government, the powers and duties of the Chief Wildlife Warden under the section referred to in sub-section (1) and (2). shall be exercised and discharged by the Director or by such other officer as may be authorised by the Director in this behalf and references in the sections aforesaid to the State Government, shall be construed as reference to the Central Government and reference therein to the Legislation of the State shall be construed as a reference to Parliament.---------------------------------------------------------------------a Substituted by Act 44 of 1991, sec. 2(w.e.f. 2.10.1991)b Preamble omitted by Act 44 of 1991, sec. 3.1 Chapter IV \"Game Reserves\" omitted by Act 44 of 1991, sec. 14.2 Sec 18(l) substituted by Act 44 of 199 1, sec. 15.3 Sec. 19 \"Whenever any area is declared to be a sanctuary\" Substituted by Act 44 of 1991, sec. 16.4 Sec.24(2)(c) Inserted by Act 44 of 1991, sec. 175 Sec.26A inserted by Act 44 of 1991, sec. 18.6 Sec.27(3) Inserted by Act 44 of 1991, sec. 19.7 Sec.27(4) Inserted by Act 44 of 1991, sec. 19.8 Sec.29. Hunting in sanctuary without permit phohibited. (1) Notwithstanding anything contained elsewhere in this Act, no person shall hunt any wild animal in a sanctuary or remove therefrom any wild animal, whether alive or dead, or any trophy, uncured trophy, or meat derived from such animal.Provided that if the Chief Wildlife Warden is satisfied that it is necessary that any wild animal in a sanctuary should be hunted or removed.(a) for the better protection of wildlife, or(b) for any other good and sufficient reason he may, with the previous approval of the State Government, grant a permit authorising any person to hunt or remove such wild animal under the direction of an office authorised by him or cause it to by hunted or removed.(2) A permit granted under sub-section(1) shall specify the kind and number of wild animal that may be hunted or removed by the holder of such permit.(3) The Chief Wildlfe Warden may, for good and sufficient reason, to be recorded in writing, cancel any permit granted under sec.28 or under this section.Provided that no such cancellation shall he made except after giving the holder of the permit a reasonable opportunity of being heard.(4) Any person aggrieved by the cancellation of a permit under sub-section (3) may, within 15 days from the date of such cancellation, appeal to the State Government, whose decision shall be final.Provided that the State Government may admit any appeal preferred after the expiry of the period aforesaid if it is satisfied that the applicant had sufficient cause for not preferring the appeal in time.\"Substituted by Act 44 of 1991, Sec. 20,9 Sec.33A inserted by Act 44 of 1991, sec.22.10 Sec.34(3) inserted by Act 44 of 1991, sec.22A.11 Sec.35(l) Provision added by Act 44 of 199 1, sec.2312 Sec. 35(3) \" 19 to 26 (both inclusive)\" between \"the provisions of sections' and \"shall, as far as\" substituted by Act 44 of 199 1, sec.23.13 Sec.35(7) \"cattle\" substituted by \"livestock\" by Act 44 of 1991, sec.23.14 Sec.35(8) \"section 33\" after \"clause (a), (b) and (c) of \"substituted by Act 44 of 1991, sec.23.15 Sec.36 Declaration of \"Game Reserve\".-(1) The State Government may, by notification, declare any area closed to hunting for such period as may be specified in the notification.(2) No hunting of any wild animal shall be permitted in such reserve except under and in accordance with a licence, issued under this section by the Chief Wildlife Warden or the authorised officer.\" omitted by Act 44 of 1991, sec. 24.16 Sec38. \"Section 19 to 35 after \"provisions of' susbstituted by Act 44 of 1991, sec.25.This text was available from http://envfor.nic.in/legis/legis.html and from its subdirectory http://envfor.nic.in/legis/wildlife/wildlife1.htmlQuestionnaire numberDate :Name of the villageSexAgeReligionFamily status : Bachelor/Married/WidowedHousehold size : Male, adult (> 15 yrs)/Female, adult (> 15 yrs)/Children (< 15 yrs)/Others, allied and joint familySince how many years are you living in this village ?What is your job ? All year round ?What are the sources of family in come (in order) ?What is the level of annual income (Indian Rupees) of the family ?Which assets does the family have ? Agricultural land (area and crops)/Trees (number and species)/Cattle (number and species)/Boat (number)  (with motor ?)/Woodcart (number)/Bicycle (number)/Motorcycle (number)/TV (number)/Fridge (number)/Gas cooker/Kerosene stove/Electrical currentWhich type of house do you have ? pucca/semi-pucca/kutcha/semi-kutchaWhat do you understand by the term mangrove? Vegetation, wood/The whole area, ecosystem/Other How many species of mangroves do you know ? What are your main uses of the mangrove (in order) ? A. Fishing /B. Fuelwood /C. Construction and service wood /D. Medicinal, chemical & hygienic purposes /E. Fodder or feed for or animals /F. Others (specify)What do you collect from the mangrove related to fisheries (in order) ? Crabs/Finfish/Bivalves, shells/Shrimps, prawns/Others How frequently do you go out fishing per week ?How far away do you travel from the village where you live to the place where you go to fish ? (in kilometers or in time)Are the catches of crabs, fish, shrimps for sale, for home consumption or for both ?Has the number of best marketable fish, prawn, crab species increased or decreased over de last 10 years ? Why ?In general, do you catch more or less than 10 years ago ? Why ?Do you think this change is related to a change in the mangroves ? Which change ?Which species of mangrove do you use related to fuelwood (in order) and in what quantity ?Which are the two best species for burning and what are the criteria and characteristics making the mangrove species appropriate as fuelwood ? High calorific value/Little or no smoke/Convenient size/AvailabilityIf you personally collect, how frequently do you visit the mangrove to collect fuelwood ?How far away do you travel from the village where you live to the place where you go to collect fuelwood ? (in kilometers or in time)Do you collect or buy any non-mangrove fuel source ?What species of mangrove do you use related to timber for construction purposes (in order) ? Which part of the species do you use, and for what specific purpose ?Which are the two best species for construction and what are the criteria and characteristics making the mangrove species appropriate as construction wood ? High durability/Strong/Convenient in size/Abundant/AestheticalDo you collect or buy any non-mangrove construction items ?Which local or Ayurvedic medication based on mangrove plants do you know ?How important are the mangroves for your livelihood ? Very important/A little important/Not much important/Not at all important/I don't knowWhich changes have you noticed in the mangrove forest during your lifetime in this village (and to what can these changes be attributed ?) ? Increase in cover/Decrease in cover/No change/I don't knowHow has the accessibility of the mangrove forest changed during your lifetime in this villageHave you noticed any changes in animal diversity in the mangrove forest during your lifetime (and to what can these changes be attributed ?) ? The mangrove has become easier to access/The mangrove has become more difficult to access/There has been no change/I don't knowWhat do you think about the actual management rules implemented by the Forest Department regarding the protection and exploitation of mangroves ?"}
+{"text": "The Center for Disability Resources (CDR) Library is the largest collection of its kind in the Southeastern United States, consisting of over 5,200 books, videos/DVDs, brochures, and audiotapes covering a variety of disability-related topics, from autism to transition resources. The purpose of the library is to support the information needs of families, faculty, students, staff, and other professionals in South Carolina working with individuals with disabilities. The CDR Library is funded on a yearly basis; therefore, maintaining high usage is crucial. A variety of promotional efforts have been used to attract new patrons to the library. Anyone in South Carolina can check out materials from the library, and most of the patrons use the library remotely by requesting materials, which are then mailed to them. The goal of this project was to identify areas of low geographic usage as a means of identifying locations for future library marketing efforts.Nearly four years worth of library statistics were compiled in a spreadsheet that provided information per county on the number of checkouts, the number of renewals, and the population. Five maps were created using ArcView GIS software to create visual representations of patron checkout and renewal behavior per county.Out of the 46 counties in South Carolina, eight counties never checked out materials from the library. As expected urban areas and counties near the library's physical location have high usage totals.The visual representation of the data made identification of low usage regions easier than using a standalone database with no visual-spatial component. The low usage counties will be the focus of future Center for Disability Resources Library marketing efforts. Due to the impressive visual-spatial representations created with Geographic Information Systems, which more efficiently communicate information than stand-alone database information can, librarians may benefit from the software's use as a supplemental tool for tracking library usage and planning promotional efforts. The Center for Disability Resources Library (CDR Library) is a special library that serves anyone living in South Carolina, especially professionals who work with individuals with disabilities and family members of children with special needs. The CDR Library is a collaborative effort between BabyNet/South Carolina Department of Health and Environmental Control, the Center for Disability Resources, the South Carolina Department of Disabilities and Special Needs, and the University of South Carolina School of Medicine Library. The CDR Library consists of over 5,200 books, videos, brochures, and audiotapes covering a variety of disability-related topics. Since 2001, the CDR Library has been part of the University of South Carolina School of Medicine Library, which is located in Columbia, South Carolina. The library is funded by a yearly contract; thus, the library's utilization is vital to its existence.Approximately 651,000 people in South Carolina have a disability .The librarians working with the CDR collection have attempted to promote the library and its services in a variety of ways. A monthly newsletter is distributed to patrons via mail and/or email to increase awareness of new resources and to promote the CDR librarians' monthly outreach activities. Librarians also give presentations and tours of the CDR Library to local support groups, University of South Carolina classes, and organizations supporting individuals with disabilities. Other marketing efforts include distributing CDR Library pamphlets by mail, advertising the library in various organizations' newsletters, and participating in live radio spots promoting the collection. The major focus of these efforts in the past has involved promoting the collection to particular groups by exhibiting at various professional conferences instead of publicizing library services to specific areas of the state. Myrtle Beach (Horry County), Charleston (Charleston County), Columbia (Richland County), and Greenville (Greenville County) are common locations for these conferences.Geographic Information Systems (GIS) can be a very useful problem solving, planning, and service development tool for libraries. GIS has been used by libraries to study community demographics for collection development purposes. One study used demographic data that was visually represented to determine whether to add a consumer health collection in a public library . LibrariThe objective of this study was to identify prime locations for future library promotion efforts by determining which counties in South Carolina were utilizing the Center for Disability Resources Library the least.Nearly four years worth of circulation statistics from June 1, 2001, to February 17, 2005, were compiled by running a report in Innovative Interfaces, the library's integrated library system. Circulation statistics obtained included the number of items checked out and renewed per patron. This information was added to an Excel spreadsheet  software. The spreadsheet data was merged with an existing shape file database containing South Carolina county location data.Five South Carolina county maps were created: Total Checkouts per County Figure , Total RAs expected, urban counties, or those nearest to major metropolitan areas like Aiken, Charleston, Greenville and Richland, and counties closest to the library's physical location had high usage totals. There are 46 counties in South Carolina. The following ten counties had the highest number of items checked out from the library: Aiken, Anderson, Charleston, Greenville, Greenwood, Horry, Lexington, Richland, Sumter, and York Figure . Six couThe northeast and southwest regions of South Carolina were regions of lower usage. Eight counties, Allendale, Barnwell, Clarendon, Dillon, Edgefield, Jasper, Marlboro, and McCormick, had never borrowed materials from the library Figure . In addiThe maps accurately reflect the use of print and audiovisual materials, but the library usage data does not account for information photocopied or web article links emailed to patrons. Though these services are readily available at the library, the fact that items such as photocopies and web article links cannot be traced back to individual patrons required their exclusion from the data-gathering process, and may potentially threaten the validity of the data obtained.Other potential confounding variables not discussed in this paper include the number of patrons by county, those patrons who moved between counties or out of the state altogether; the driving distance required of patrons to use the library in person; the relative proportion of special needs individuals by county; and, the relative availability of disability-related materials by public library and each public library's respective location within its county. While it would have been most useful to have a shared legend for comparison purposes, the extreme data distributions required that each map's quintiles be adjusted accordingly.Using GIS to identify low usage areas of library materials is an effective means for identifying future marketing areas. The visual representation of the data made identification of low usage regions easier than using a standalone database with no visual-spatial component. Not only could low usage counties be identified, regions of low checkouts and renewals were also evident in the maps. These maps may now be used to communicate visually to the Center for Disability Resources director the need for increased funding for outreach efforts aimed specifically at low usage counties. Moreover, in addition to suggesting counties where new patrons may be solicited, the maps illustrate, literally, those areas with existing users who should continually be encouraged, via marketing and outreach efforts, to take advantage of the library's valuable resources.There are a number of ways to market the library to new patrons based on location. Since each county has a Disability and Special Needs (DSN) Board that serves individuals with disabilities and their families, CDR Librarians could offer to give presentations to DSN Boards in low usage counties. CDR Librarians may also identify support groups and occupations designed to help individuals with disabilities and their families in these low use areas. Local libraries and relevant businesses could house CDR Library pamphlets or a temporary display about the collection. Future studies using ArcView GIS may determine how successful such marketing efforts are at attracting new patrons to various library collections and services.CDR = Center for Disability ResourcesDSN = Disability and Special NeedsGIS = Geographic Information SystemsThe author(s) declare that they have no competing interests.RPM created the database, the maps, and drafted the manuscript. SPW managed patron usage statistics and identified patron counties. SPW edited and revised the manuscript. All authors read and approved the final manuscript."}
+{"text": "In the post-genome era, most research scientists working in the field of proteomics are confronted with difficulties in management of large volumes of data, which they are required to keep in formats suitable for subsequent data mining. Therefore, a well-developed open source laboratory information management system (LIMS) should be available for their proteomics research studies.We developed an open source LIMS appropriately customized for 2-D gel electrophoresis-based proteomics workflow. The main features of its design are compactness, flexibility and connectivity to public databases. It supports the handling of data imported from mass spectrometry software and 2-D gel image analysis software. The LIMS is equipped with the same input interface for 2-D gel information as a clickable map on public 2DPAGE databases. The LIMS allows researchers to follow their own experimental procedures by reviewing the illustrations of 2-D gel maps and well layouts on the digestion plates and MS sample plates.Our new open source LIMS is now available as a basic model for proteome informatics, and is accessible for further improvement. We hope that many research scientists working in the field of proteomics will evaluate our LIMS and suggest ways in which it can be improved. As part of the Human Genome Project that was carried out by an international consortium, a laboratory information management system (LIMS) was developed for genome research and evaluated as an essential tool for advanced studies in the life sciences ,2. It isMost of the software for 2-D gel image analysis carries out detection of protein spots on 2-D gel images, matching the spots among multiple gel images and quantifying the spot density automatically. The software for mass spectrometry analysis picks out peaks in mass spectra and searches them against a database, the so-called \"peptide-mass fingerprint\", for protein identification.Members of a research project team are often required to carefully consider their experimental schedules, which have to run in parallel with the processing of data imported from various analyzers. A LIMS that is optimized for proteomics would undoubtedly be helpful for scheduling experiments in proteomic research projects and for processing bulk data imported from 2-D gel image analyzers and mass spectrometers. At the same time, it has been widely acknowledged since the inception of proteomics research that data sharing among researchers worldwide is essential. Accordingly, many research groups have attempted to construct public proteome databases on web-based servers.In many of these proteome databases, information about protein masses, post-translational modifications, expression and variation have been assembled onto 2-D gel images. These are known as \"2DPAGE databases\", such as SWISS-2DPAGE  and TMIGMany of the LIMS for proteomics designed in the past have a web interface instead of special client software, and have adopted the format of an Internet-based public proteome database. Moreover they have often been linked to public proteome databases, and attempted to support XML format as a communication format.For researchers in the field of proteomics, it would be highly advantageous to develop a LIMS that would allow export and import of data in a standard format. The Human Proteome Organization Proteomics Standards Initiative, HUPO-PSI, began steps to establish a standard format in 2004 -13. InitWe have developed an original open source LIMS for 2-D gel electrophoresis-based proteomics workflow on the basis of the above background. The major features of our LIMS are compactness, flexibility, and connectivity to public databases.We developed the LIMS on the PC Servers PowerEdge 700 and PowerEdge SC420 (Dell Corp.). The operating system is Red Hat Linux 9. We decided to use a web browser as the user interface of the LIMS, because it is universally available on most client systems, even though it is not a full-featured database client. Internet Explorer version 6.0 or later, Netscape version 7.1 or later, or Firefox version 1.03 or later should be installed in the client PC. We also adopted a PHP-Hypertext Preprocessor 4.3.7-involved GD-Graphics Library to make the screen of the web page dynamic. PHP works as an interface between the web server and RDB in our LIMS. Our LIMS has the typical architecture of an \"Apache-PHP-PostgreSQL\" system. Within the framework of the interfaces of the RDB, although Java is a more portable software that runs well on a variety of computing platforms, we decided to use PHP because it is easier for software programming and has a better performance.The contents of the RDB include raw data files imported from Kompact mass spectrometry software , PDF files (Portable Document Format) from the Mascot database search system (Matrix Science Ltd.), and JPEG image files from the PDQUEST image analyzing system (Bio-Rad Laboratories Inc.). Kompact, Adobe Reader and some other application software packages are needed on the client system for the LIMS. They must be registered as helper applications to work on the web browser.The inclusion of raw data in the contents makes the LIMS architecture simpler, but disturbs data conversion for exportation. The contents of the RDB also include datasets for constructing our public TMIG-2DPAGE database. We convert the datasets of the LIMS to the contents of the mirror TMIG-2DPAGE database in our institution's intranet. The XML format data and JPEG image files in the TMIG-2DPAGE database are opened for public access via the Internet. While developing the system, many PHP script files became extremely complex, but improvable. Our LIMS is not designed to work only on a very high-performance hardware system. We verified the performance of the system client using Internet Explorer 6.0, Netscape 7.1 and Firefox 1.5 on the Windows XP platform, and using Netscape 7.1 on the MacOS 9.1 and MacOS 10.3 platforms.To access the LIMS server using a web-based client PC, the user must first login with an authorized username and a given password see . At the The second guide mode is a \"keyword search mode\". To access the result of a keyword search, users must enter their username and a given password on the login page. They are then allowed to enter or edit data at any step of the proteomics workflow.Figure Figure Figure While entering the corresponding SSP number and the corresponding well IDs in the digestion plate and the MS plate, the user can move and browse the various steps of proteomics workflow by clicking the linked button. If it is necessary to change the SSP number after the entering the data for some steps, the user enters the reference SSP number . The user is allowed to use the reference SSP number in the map for the public database.Only the administrator of the LIMS can add the user and his attribution using the web interface. Only individual users can change their respective passwords. The LIMS does not have a special interface for entering the attribution of the administrator and the types of plates. Only the administrator of the PostgreSQL can enter them with the sql command on the server console.Figure We have developed an open source LIMS, which is compatible with a variety of data, formats and data sizes for current proteomic research. The data in the LIMS including raw files work as a backup of personal experimental data for permanent storage. Users are able to store their data with a certain degree of security. We have also encoded scripts for dumping and transferring all of the data automatically to a data backup server via Ethernet by FTP.We have achieved a common \"look and feel\" in the LIMS. The \"look and feel\" that is designed with buttons and illustrations in the user interface supports user-friendly operation. Development of a LIMS featuring the above concepts is quite challenging because the 2-D gel electrophoresis-based workflow varies among laboratories.Our intention was to develop a compact \"personal\" LIMS that is appropriate for small laboratories. Our LIMS can be customized easily by any laboratory. The LIMS we have developed may be a practical tool for proteome researchers at any institutions where 2-D gel-electrophoresis-based proteomics research is being conducted.We have developed an open source LIMS optimized for proteomics after completion of the development of a commercial base LIMS, WorksBase, by Bio-Rad Laboratories Inc. We have experienced the experimental operation of WorksBase, which is an integrated bioinformatics platform for 2-D gel electrophoresis-based proteomics. In view of the severe competition that exists in the field of life science research, both security and perfection of the experimental information in WorksBase were considered important. However, data management using WorksBase was still troublesome for some reason or other. We discussed the specifications and problems inherent to WorksBase and designed our own LIMS based on our experience with its operation. We considered that simplicity and usefulness were more important than perfection for a LIMS in our laboratory. The major features of our LIMS are compactness, flexibility and compatibility with the public database.Many proteomics researchers have been awaiting the development of a LIMS for 2-D gel electrophoresis-based workflow. Up to now, however, most commercial LIMS have not supported 2-D gel electrophoresis-based workflow because the concept is more complex than other workflows employed in proteomics LIMS. Therefore we designed our LIMS to specifically support 2-D gel electrophoresis-based proteomics workflow. Consequently, the content of our LIMS is not satisfactory for allowing all proteomics researchers to manage all proteomic information properly. We think that the content of the standardized format established by HUPO-PSI is appropriate for proteomics in general, but the linkages within it are too complex for our LIMS. Thus we were unable to organize these linkages, which had been established in XML format, in our LIMS. We intend to develop a LIMS without a XML native database to allow more rapid use. We would like to further improve the LIMS in order to support the contents of HUPO-PSI with the function of conversion.Currently, many proteomics researchers are eager to use effective data-mining tools for analysis of proteomic data. However, we think that our proteomics LIMS should be developed as a module separate from the data-mining tools in our \"Bio-Medic DB\" bioinformatics platform that will be constructed in the future Figure . We are We are also planning to develop a new interface of the LIMS for XML format files exported from PDQuest (Bio-Rad Laboratories Inc.). PDQuest compares 2D gel images to determine differential protein expression. We intend to develop special client software running a data-upload function in Windows XP because the XML format files exported from PDQuest are too complex for web applications.In 2005, Garden, Alm and Hakkinen developed PROTEIOS: an open source proteomics initiative . PROTEIOWe have developed a basic model for an open source LIMS that is effective for 2-D gel electrophoresis-based proteomics workflow. We expect that the open source LIMS will be a powerful tool in advance proteome researches in many small laboratories. We hope many proteomics researchers to download and use our open source LIMS, and wish to receive feedback about their experience in operating it in order to draw up guidelines for a proteomics LIMS. Please see the additional file that includes all PHP scripts, sql and html files of our LIMS see . by following the web link.. Project home page: . Operating system: Red Hat Linux 9. Programming language: PHP, PostgreSQL. Requirements: Apache revision 1.3.34 or later, PostgreSQL revision 7.4.3 or later, PHP revision 4.3.7 or later. License: Lesser General Public License by following the web link.The source file of the new LIMS for proteomics can be accessed using a web browser at LIMS, Laboratory information management system: XML, Extensible markup language: PHP, Hypertext Preprocessor: 2-D PAGE, Two-dimensional polyacrylamide gel electrophoresis: MS, Mass spectrometry: TMIG, Tokyo Metropolitan Institute of Gerontology: RDB, Relational database: SSP number, Standard spot numberOur program of LIMS. The file is a compressed file that includes all PHP scripts, sql and html files of our LIMS. Please install Apache revision 1.3.34 or later, PostgreSQL revision 7.4.3 or later, PHP revision 4.3.7 or later and GD library revision 2.0.27 or later in advance of setting up the LIMS. The LIMS is licensed under GNU Lesser General Public License. Please set up as follows. tar zxvf LIPAGE_0.88.tar.gz. mv LIMS/usr/local/apache/htdocs. Please read/usr/local/apache/htdocs/LIMS/README.Click here for fileThe documentation of simple usage for our LIMS. The file is a documentation of simple usage for our LIMS.Click here for file"}
+{"text": "The Library's collection building strategy, resource and information types, editorial policies, quality checklist, taxonomy for content indexing, organisation and navigation, and user interface are all presented in detail. The paper also explores the expected impact and utility of the new Library, as well as some possible future directions for further development.The Skin Conditions Specialist Library is not just another new Web site that dermatologists might want to add to their Internet favourites then forget about it. It is intended to be a practical, \"one-stop shop\" dermatology information service for everyday practical use, offering high quality, up-to-date resources, and adopting robust evidence-based and knowledge management approaches. Dermatology is currently undergoing enormous changes in the way it is practised, and much of this is a result of a fundamental change in the manner in which information is exchanged through information technology and the Internet. The Web is increasingly becoming an indispensable tool for healthcare professionals caring for people with skin disease in their everyday clinical practice -8. or Google Scholar  can be tried, but such an approach can be very time consuming and frustrating. Search engine results, including those from Google, contain too much \"noise\" in the form of irrelevant or low-quality material. Choosing suitable search terms, including skin disease or drug synonyms/variants, is an art in itself, and once a list of hits is obtained, the user has to wade through them to separate \"the wheat from the chaff\".There are many quality online information resources on skin conditions, but locating these sources of information quickly and easily, and bringing together related information into one place, remains a big challenge for the average Internet user. Internet search engines such as Google Although some quality dermatology Internet portals specialise in images, patient information leaflets, online tutorials, etc., nowhere does this information appear to be pulled together into one trustworthy source. \u2013 Figure This is where the new UK National Library for Health Skin Conditions Specialist Library , to bring together resources for a range of clinical subject areas. Just as there are specialist sections in a real library branching off from the central general reading section, so too there are virtual specialist libraries in the NeLH, catering for more specialist groups and knowledge requirements. The Skin Conditions Specialist Library was one of these, and now even more Specialist Libraries are in the process of being commissioned, taking the number up to 26.In 2003, 19 Specialist Libraries were commissioned within the National electronic Library for Health  to combine the national digital resource managed by the existing NeLH with the physical content of books and journals and the skills and resources of health libraries .Recently, the NeLH was subsumed into a bigger whole, the National Library for Health (NLH), with a new URL and home page  is an Internet information gateway for dermatology. It aims to provide an organised, easily accessible and up-to-date directory of key documents, reviewed evidence, and appraised information on skin conditions, including patient information resources. The emphasis is on quality and an evidence-based approach.The NLH Skin Conditions Specialist Library The subject remit of the Skin Conditions Specialist Library is the diagnosis, treatment, management and prevention of skin conditions, and the effect of skin conditions on quality of life. The scope is deliberately wide and includes disfigurement, skin cancer, skin surgery, wound care, sexually transmitted diseases that affect the skin, alternative and complementary treatments, consumer skin care, and cosmetic aspects such as skin ageing.Identification of potential subject overlap is important, so that the various Specialist Libraries within the NLH can work together collaboratively to avoid unnecessary duplication of effort. The database used for the NLH Specialist Libraries allows cross-referencing where resources overlap and a synergistic, efficient use of resources.The Skin Conditions Specialist Library has identified subject overlaps with cancer, child health, wound care, plastic surgery, sexually transmitted diseases, allergy, and alternative and complementary medicine. It has been proposed that plastic surgery and disfigurement should be housed within the Skin Conditions Specialist Library, at least for now.Although anyone connected to the Internet in the UK and elsewhere in the world, including patients with skin diseases and their relatives, is able to access the Skin Conditions Specialist Library, the Library's purpose is primarily to support UK healthcare professionals. As the Library's content develops, it is hoped that the Skin Conditions Specialist Library will become an important and well-used resource for all National Health Service (NHS) professionals dealing with skin conditions, including dermatology consultants and specialist registrars, junior doctors, dermatology nurses, general practitioners, practice nurses and health visitors. The Library should also prove useful to medical students and student nurses studying dermatology at undergraduate and postgraduate levels.). The core Project Team consists of the Clinical Lead, Professor Hywel Williams, Professor of Dermato-Epidemiology and Co-ordinating Editor of the Cochrane Skin Group, and the Information Specialist, Dr Douglas Grindlay.The National Library for Health Skin Conditions Specialist Library is based at the Centre of Evidence Based Dermatology at the University of Nottingham  and the British Dermatological Nursing Group (BDNG \u2013 ), along with other information scientists, provides advice on major issues of policy, content and quality (see ).A small Editorial Team, which includes members from the British Association of Dermatologists  and five of the larger patient support groups. Another group of stakeholders included are health information providers, with representation from other NLH Specialist Libraries, NHS Direct Online , the OMNI database , the TRIP database , and the Chartered Institute of Library and Information Professionals (CILIP \u2013 ).A wide-ranging Stakeholders Group has also been set up to ensure that the needs and views of all potential users are taken into account. The Stakeholders Group includes representatives from professional organisations such as the BAD, the BDNG, the Primary Care Dermatology Society Table Individual Web resources on specific topics are discovered through systematic and regular trawling and searching of a core set of \"sources of resources\" that have been identified for this purpose:, PRODIGY  and BAD - Sources for guidelines, pathways and policy documents, such as the NLH Guidelines Finder - Sources for systematic reviews and quality-assured synopses of evidence, such as the Cochrane Library - Sources appraising primary research, such as Bandolier - Sources for education and continuing professional development, such as BAD and BDNG and OMNI - Internet resource guides, such as Health on the Net Foundation HONselect - Web sites of professional bodies, skin research charities, support groups and other organisations concerned with skin conditions- Sources of evaluated patient information/leaflets, such as BAD and PRODIGY- Sources for news and events, e.g. NLH Hitting the Headlines and other news feeds and e-mail alertsThe relevant sections of each \"source of resources\" (in particular content lists and indexes) will be regularly visited and scanned for new documents, with the date of each search and the search strategy being recorded.. Again, the date of each search and query terms used will be recorded.Internet search engines will also be regularly searched for relevant resources, helped by meta-search tools like Copernic best current knowledge and evidence are indexed in the National Library for Health Skin Conditions Specialist Library [Quality benchmarking and filtering of candidate resources is an issue of prime importance in ensuring that only those resources providing the  Library . Resourc1. The resource falls under the subject scope for the Skin Conditions Specialist Library and is relevant to its intended users.2. The resource and information it contains are of a type specified for inclusion in the Skin Conditions Specialist Library (see 'Resource and information types' above).3. The resource has a stable enough presence on the Internet to be useful.4. The resource is freely available on the Internet, or is accessible to NHS health professionals.5. The resource is not strictly local in context.6. Authorship of the resource can be ascertained and contact details are available.7. Qualified individuals or groups take responsibility for the resource, coming from reputable organisations or having recognised expertise and authority in the field.8. There is a process of refereeing of the clinical content by qualified health professionals or appropriate specialists.9. The source of the content is verifiable and there is proper attribution.10. Sources of information are clearly identified.latest version of guidelines) and kept up-to-date. Resources published more than ten years ago will not be included, unless they are judged to have special significance and value by the Editorial Team. Inclusion of resources will be reconsidered every year, and resources will be removed if out-of-date or superseded by others.11. The information is current  TriangleMark scheme . Readability of patient information material [Patient information resources present particular problems with assessing provenance and quality. The resource material  may perhA formal record will be kept of all resources that are rejected, with reasons. For example, we have recently come across a non-UK online dermatology image database that seemed a very good candidate for inclusion in our resource database, but was nevertheless rejected on quality grounds because it had no information as to provenance and the authority of the person producing it. and Figure ) terminology project in the future, so that as NHS electronic patient records are developed using SNOMED CT, it should be relatively easy to refer across to the Skin Conditions Specialist Library [A major advantage of the Skin Conditions Specialist Library is the organisation of its content by skin topic and resource type , to facilitate retrieval by users Figure . The nav Library .Tagging of resources in the Skin Conditions Specialist Library has been as detailed as possible, with tagging to multiple topics when this will help retrieval by users Figure . Resourcet al. [However, the authors appreciate that their navigational classification of skin conditions based on the BAD Diagnostic Index will more likely suit the needs of specialist dermatologists rather than those of non-specialists and novices. In fact, in a classification task reported by Norman et al. , novicesFortunately, the NLH also incorporates powerful search functions, allowing users to search just the Skin Conditions Specialist Library, other Specialist Libraries, or all NLH collections in one go. This complementary search facility should care for the needs of many users, especially those who are non-specialists and less familiar with the formal classifications, terminology and diagnostic features of skin diseases used in our navigation menu.The usability of the Skin Conditions Specialist Library is very much determined centrally by the parent organisation, the NLH. The user interface of the Library is consistent with the interfaces of other NLH Specialist Libraries in order to permit familiarity when moving from one Specialist Library to another, as a primary care practitioner will often need to do. In fact, nearly all of the Specialist Libraries are currently using the same content management system, and all should migrate to this system in the near future.We know the fate of Web interfaces that fail to take into account all the stakeholders, and indeed the reader might think that in our case interface requirements are imposed by management rather than coming from actual users. However, this is not true for the NLH Specialist Libraries. Their shared content management system/interface, which is under continual improvement, is the result of ongoing analyses of users' requirements and consultations handled centrally by the NLH and covering a wide range of user types. One aim is to ensure interface consistency and a unified look and feel across the different parts of the NLH. Another aim is to free the time of the different Specialist Library Teams, so that they may concentrate on their primary roles in analysing the information needs of their specific users, and in finding and indexing quality online information.The National Library for Health Skin Conditions Specialist Library is intended to provide a \"one-stop shop\", a single portal that can be used as a service to find quality, evidence-based information on dermatology that is relevant for UK health professionals. The Skin Conditions Specialist Library provides an organised, easily accessible and up-to-date collection of key documents, reviewed evidence, and appraised information on skin conditions, including selected patient information resources.As with the rest of the NLH, the initial focus on content is currently on NHS-branded or NHS-funded information. The Skin Conditions Specialist Library is very much a work in progress, and with time we expect it to grow to include more and more external resources . The core resources will always be those based on the highest level of clinical evidence, such as systematic reviews, critically appraised synopses of the evidence and guidelines.With just one full-time information specialist working on the Skin Conditions Specialist Library, the priority has to be searching for, identifying, and signposting existing information that is relevant and of high quality. The resources and opportunities for specific new content generation in house will be limited, at least initially.. However, there are so many chronic skin diseases where patients can become experts in their own conditions [The initial source of information for patients is intended to be NHS Direct Online nditions . They wi, PRODIGY, and Informed Health Online . While this information will then be available directly to patients and relatives using the NLH, it will also be an important resource for dermatologists, GPs and nurses when they are looking for information to give out during consultations.For this reason, we hope the Library will also act as a single source for high quality patient information, such as that produced by the BAD, NHS Direct Online, DermNet As skin conditions are often chronic, disfiguring and difficult to treat, we believe very strongly in this role for the Library and in the need for patients to be consulted as the Library develops (hence the inclusion of patient groups in our Stakeholders Group).The Skin Conditions Specialist Library should have an important role in identifying gaps in the evidence and knowledge base, which will help to prioritise future research, reviews of the evidence and policy development. Our consultations so far have identified a need for the Library to include quality, evidence-based information on the \"rarer\" skin conditions. Finding such information is probably the main reason experienced dermatologists will want to use the service initially, but ironically it is just this information that is most often lacking, at least in electronic form. As stated above, the main function of the Library is to bring together existing quality resources rather than generating new content. A potential role in discovering the gaps and fostering the production of appropriate electronic resources to fill them has been identified, working in co-operation with our Stakeholders' organisations.Another important function of the Skin Conditions Specialist Library is to provide a current awareness service, to alert our users to important new research, systematic reviews, guidelines, policy developments, news and conferences that are relevant to the Library's remit. This function should develop and expand with time.To be used regularly by its target audience, the Skin Conditions Specialist Library needs to provide an added-value service over and above a mere directory of links. The aim is to build an active community of repeat users who will make our Library their starting point in answering all their dermatology information needs.quality resources might even act as distracting \"noise\"). One of the Library's major functions is knowledge management, i.e., avoiding information overload by striving to present results relevant to our users (according to their roles), and by highlighting the most important resources (e.g. those that provide a comprehensive overview of a subject). Key resources should eventually be tagged in the Library using a new \"Editor's pick\" function.Depending on users' particular needs and current situation, not all quality resources will have the same practical relevance to them . It would also be of great use to students. There are two (complementary) possibilities for such systems, either as a separate diagnostic program or as pop-up tool embedded into electronic patient records . In the meantime, the Library already includes a topic heading for Images, with links to several dermatology image databases.Another major issue for the Library to resolve is the tension between organising resources on the basis of a condition/diagnosis, and accessing information when a diagnosis is unknown, for example by symptoms/lesion morphology and location on the body. Both approaches are needed, but the latter would be important for non-specialists such as GPs and NHS Direct nurses, particularly in view of the large number of skin conditions that exist. Probably some form of diagnostic and learning facility/decision support tool will be required in the future. An example of such a tool is . Another possibility is to have a \"Web site of the month\" feature.Another long-term goal for the Skin Conditions Specialist Library team is to develop special features such as learning and continuing professional development resources, quizzes and commissioned briefings. Contributions from users could also be incorporated, for example suggestions on useful Web sites, hence the importance of including a comment return system on the Library's homepage ).There is also the possibility of using RSS  feeds to provide our users with regular updates on relevant new Library content, a feature already available elsewhere on the NLH  of the Skin Conditions Specialist Library as our stakeholders. Comments and suggestions for improvement are always welcome, and we hope with time to develop a community of interest in skin conditions in the UK supported by newsletters and regular updates via the Library pages.The author(s) declare that they have no competing interests.As member of the Library's Editorial Team, MNKB advised on and participated in formulating many of the Library's aspects, including its editorial policies and quality checklist. MNKB also conceived and drafted this manuscript. The Library's core Project Team comprises DG, the Library's Information Specialist, and HCW, the Library's Clinical Lead, who together are responsible for developing and managing the Library, and organising the activities of its Editorial Team and Stakeholders Group. DG and HCW also revised and edited the first drafts of this manuscript and provided valuable input that helped improving it. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "A general theory of sampling and its application in tissue based diagnosis is presented. Sampling is defined as extraction of information from certain limited spaces and its transformation into a statement or measure that is valid for the entire (reference) space. The procedure should be reproducible in time and space, i.e. give the same results when applied under similar circumstances. Sampling includes two different aspects, the procedure of sample selection and the efficiency of its performance. The practical performance of sample selection focuses on search for localization of specific compartments within the basic space, and search for presence of specific compartments.When a sampling procedure is applied in diagnostic processes two different procedures can be distinguished: I) the evaluation of a diagnostic significance of a certain object, which is the probability that the object can be grouped into a certain diagnosis, and II) the probability to detect these basic units. Sampling can be performed without or with external knowledge, such as size of searched objects, neighbourhood conditions, spatial distribution of objects, etc. If the sample size is much larger than the object size, the application of a translation invariant transformation results in Kriege's formula, which is widely used in search for ores. Usually, sampling is performed in a series of area (space) selections of identical size. The size can be defined in relation to the reference space or according to interspatial relationship. The first method is called random sampling, the second stratified sampling.Random sampling does not require knowledge about the reference space, and is used to estimate the number and size of objects. Estimated features include area (volume) fraction, numerical, boundary and surface densities. Stratified sampling requires the knowledge of objects (and their features) and evaluates spatial features in relation to the detected objects . It serves also for the definition of parameters of the probability function in so \u2013 called active segmentation.. It can also be applied for the search of \"objects possessing an amplification function\", i.e. a rare event with \"steering function\". A formula to calculate the efficiency and potential error rate of the described sampling procedures is given.The method is useful in standardization of images derived from immunohistochemically stained slides, and implemented in the EAMUS\u2122 system  Diagnostic surgical pathology or tissue \u2013 based diagnosis is confronted with remarkable changes in its environment and workflow. The technological progress has led to a broad application of molecular biological methods such as Fluorescent in Situ Hybridization (FISH), and other DNA \u2013 sequence amplification techniques ,2. CommeIn the early days of telepathology, which can be considered to be the \"mother of the digital pathologist's world\", several authors reported on the diagnostic accuracy of viewing digitized slides in comparison to conventional microscopy -8. The rSurgical pathology is a medical discipline that \"extracts\" information from human tissue and classifies the information in distinct terms that are called diagnoses. The common performance is to screen an organ or a tissue section for those spaces or areas that contain the most significant information, and try to classify this information seen in the specific field of view. Thus, tissue \u2013 based diagnosis is based upon a procedure to search for small samples that allow to derive information that is valid for the whole (or even patient). In other words, an appropriate sampling procedure is a precondition to evaluate accurate and reproducible diagnoses ,4,11-15.The definition includes the term information, which has again to be defined: Information is a property that is exchanged between a sender and a receiver. Information is a property that can be understood by, and allows the receiver to react in an adequate, i.e., predictive manner. This definition of sampling includes two different aspects, which depend upon each other:1. the method of sampling, and2. the aim of the sampling procedure, i.e., which information should be extracted.Different aims can require different methods of sampling, or at least different parameters of the same algorithm. The inclusion of an \"aim\" or \"goal\" to be assessed introduces the calculation of efficiency, or a cost/benefit estimation.The most frequently used sampling goals are\u27a2 search for localization of specific items within the basic space, with the knowledge or assumption, that the space under consideration contains such items, and\u27a2 search for presence of specific items , where the exact localisation of these items is of minor interest .The prepositions to apply an adequate sampling procedure in tissue \u2013 based diagnosis include that number and size of the samples are limited. In addition, the detectable information has to be known. This information commonly depends upon additional  factors, and can be translated into diagnostic features that allow the detection and identification of a probe within the sampling space. These features can depend upon the size of the probes, their number, and their position within the collective, or even within the sampling space.Let us assume that the final goal of our sampling method is the extraction of information from the entire space, and the classification of this information into a diagnosis. The diagnostic process can be separated into two different procedures:I) the evaluation of a diagnostic significance of a certain object or \"basic unit\" which is the probability that the object can be grouped into a certain diagnosis, andII) the probability to detect these basic units within the entire space.D. ID is the probability to state the diagnosis I within the frame D by the object i, or ID = s. Basic examples are given in figure D into the two different procedures, namely a) the detection (geometric significance) and into the diagnostic contribution reflects to the applied segmentation algorithms. These distinguish between areas (pixels) that contributed to the object and those that do not. Measurements of objects can only be done if the object is completely covered by the sample frame. The spatial selection of the samples can either be performed randomly, or dependent upon the localization of already segmented objects (stratified sampling). Stratified sampling is based upon the general law of self organization, i.e., similar biological systems tend to be localized in a neighbourhood relation. In other words, to detect a cancer cell is more likely in the neighbourhood of an already identified cancer cell than elsewhere. The function of diagnostic significance is often of exponential nature, and in light microscopy related to three different image properties, namely the texture, the object, and the object \u2013 associated structure , as demonstrated in figure tructure ,16-19.Sampling is basically an information detection and transformation procedure, and thus undertaken to reach a certain final aim, for example to state a diagnosis, or to identify the presence or absence of certain objects. A time and space invariant translation of the sampling procedure can be assumed as long as we want to obtain reproducible results figure . Such a The prerequisite of any  sampling is at least a binary image, i.e. a foreground defining the basic units and a background have to exist. Any sampling procedure can be performed either as random or stratified sampling figure Random sampling is the selection of biological meaningful units  at random. It is used to measure\u27a2 the frequency of the analyzed units in relation to each other or to the basic space (structure);\u27a2 certain features of the biological units in relation to the basic space (to further identify and classify the objects).x/A (number of hits x/reference area A) two-dimensional  parameters can be derived. These include the area density (Aa), the volume density (Vv), the boundary density (Ba), the numerical density (Na), and the surface density (Sv). It should be noted, that this quite easily applied procedure permits the estimation of significant three \u2013 dimensional object features without any sophisticated three dimensional reconstruction , with f = ,0, with . In otheActive sampling is a different approach. It is provided by an objective-specific relation between the objects and the grid (intersections). The probability that a pixel belongs to an object ranges between . The intersection has a probability function p, i.e., the probability to detect the pixels that belong to a certain object depends on the object itself and its neighborhood . For exaThe probability function p can be calculated if we separate p in its two components: p = gr * af.gr is the frequency distribution of different objects in the reference space v,af is the detection probability in the space v.If we assume that af = const in the reference space v, we can estimate p by a set of measurements in different sample spaces and transform p =  if gr is rare within the basic population.2. It has to possess regular neighborhood relations to objects of the basic population.3. It has to be randomly distributed within the reference space.The proposed algorithm tries to evaluate the distance properties between the rare events and the frequent events, and the general distribution of rare events within the reference space as follows:O) within the basic population Ni (to estimating O [Ni]).1. We perform a random sampling of the specific (rare) object (Ni(0)).2. We perform a stratified sampling \"around\" each detected specific object (to estimating 3. If Ni(O) = constant we can assume a specific function of the object (cell) within the basic population .An example is shown in figure As we have defined sampling, it is a procedure that wants to describe space and time-related properties in surgical pathology, i.e. in tissue \u2013 based diagnosis. Such an investigation can be performed in different manners, which can be of different efficiencies. How can sampling efficiency be measured? Obviously, any sampling efficiency is closely related to the spatial distribution of the events searched for in the reference space. If the spatial distribution is known we can adjust the sampling procedure correspondingly. However, its spatial distribution is often not known, and we have to start with a random selection of certain compartments (samples). We can then measure the spatial distribution (frequency) p = s(N)/v, and the variation of p is the error E(p), which should be small in order to have an efficient sampling procedure. Usually, we can state that the reference space v >> s(Ne) (size of element e). The error E(p) can then be calculated according towithE(Ne) = error of detecting an individual event E(B(n)) = error of measuring all elements in the reference space E(Ne/v) = error of measuring the size of events e in relation to size of sampling space S (frequency of e in sample space sv).We can derive the following statements from this formula:1. We obtain the smallest sampling error if we select the reference volume as sample size, and if we are dealing with regular tissue .2. The smaller the sample sizes in relation to the size of events, the bigger is the sampling error, as long as the error to segment (identify) per event is not increasing.3. The sampling error is increasing if we choose different sizes of the samples.To take and to analyze samples of a broad variety of tissues is a basic procedure in surgical pathology, or in tissue \u2013 based diagnosis. All diagnostic algorithms depend upon a correct and reliable sampling procedure, and extensive training in surgical pathology addresses to identify and sample those tissue compartments that probably contain the most significant information to classify the disease present ,19,34-38In addition to medical applications, sampling plays a dominant role in geology, especially mining. In fact, Krige's sampling analysis can be considered to be the first approach to develop a \"sampling theory\" ,20.In this article we want to derive a scheme of sampling that permits a principle view of sampling, its different methods, and to calculate the efficiency of the used sampling method. In principle, two different algorithms exist, the random sampling and the stratified sampling ,9. RandoIn addition to the discussed principle differences between random and stratified sampling procedures, passive and active sampling plays a major role in image segmentation algorithms. The common principle of active sampling associates neighbourhood knowledge  to the object under investigation, for example to accurately define its boundaries . EspeciaIn aggregate, a general theory of sampling is derived that possesses its applications in numerous, if not all natural sciences. They range from agriculture to mining, from aircraft maintenance to medicine. In surgical pathology it is of major importance that all diagnostic investigations start with appropriate sampling.The authors declare that they have no competing interests.KK and EV initialized the study and drafted the paper. HS, TG, JG and GK were involved in generating and evaluating the data and in the writing of the manuscript."}
+{"text": "Burkholderia pseudomallei. Environmental sampling is important to identify geographical distribution of the organism and related risk of infection to humans and livestock. The aim of this study was to evaluate spatial distribution of B. pseudomallei in soil and consider the implications of this for soil sampling strategies.Melioidosis is a frequently fatal infectious disease caused by the soil dwelling Gram-negative bacterium B. pseudomallei in soil in two environmental sites (disused land covered with low-lying scrub and rice field) in northeast Thailand. Semivariogram and indicator semivariogram were used to evaluate the distribution of B. pseudomallei and its relationship with range between sampling points. B. pseudomallei was present on culture of 80/100 sampling points taken from the disused land and 28/100 sampling points from the rice field. The median B. pseudomallei cfu/gram from positive sampling points was 378 and 700 for the disused land and the rice field, respectively (p\u200a=\u200a0.17). Spatial autocorrelation of B. pseudomallei was present, in that samples taken from areas adjacent to sampling points that were culture positive (negative) for B. pseudomallei were also likely to be culture positive (negative), and samples taken from areas adjacent to sampling points with a high (low) B. pseudomallei count were also likely to yield a high (low) count. Ranges of spatial autocorrelation in quantitative B. pseudomallei count were 11.4 meters in the disused land and 7.6 meters in the rice field.A fixed-interval sampling strategy was used as the basis for detection and quantitation by culture of B. pseudomallei in soil for future environmental studies, and describe a range of established geostatistical sampling approaches that would be suitable for the study of B. pseudomallei that take account of our findings.We discuss the implications of the uneven distribution of  Burkholderia pseudomallei. Soil sampling is important to identify geographic regions where humans and animals are at risk of exposure. The purpose of this study was to examine a factor that has a major bearing on the accuracy of soil sampling: the spatial distribution of B. pseudomallei in soil of a specified sampling site. Soil sampling was performed using a fixed-interval grid of 100 sampling points in each of two sites (disused land and rice field) in northeast Thailand, and the presence and amount of B. pseudomallei determined using culture. Mapping of the presence and B. pseudomallei count demonstrated that samples taken from areas adjacent to sampling points that were culture positive (negative) for B. pseudomallei were also likely to be culture positive (negative), and samples taken from areas adjacent to sampling points with a high (low) B. pseudomallei count were also likely to yield a high (low) count . These data were used as the basis for highlighting several pitfalls in current approaches to soil sampling, together with a discussion of the suitability of a range of sampling strategies in different geographical locations and for different study objectives.Melioidosis is a severe infection caused by the environmental bacterium  Burkholderia pseudomallei is the cause of melioidosis and a category B select agent. This organism is present in soil and water across much of southeast Asia and in northern Australia and is increasingly being detected elsewhere, including areas of South America B. pseudomallei. The route of infection is likely to be through direct skin inoculation or contamination of wounds, and more rarely by inhalation and ingestion B. pseudomallei in an effort to identify geographical distribution of the organism and related risk of infection to humans and livestock B. pseudomallei has also been sampled from the environment to define the population genetic structure of the organism, to compare this with isolates associated with disease, and during outbreak investigations The Gram-negative bacterium B. pseudomallei that minimize the false negative rate. Common soil sampling strategies for B. pseudomallei are to randomly select multiple sites, and then randomly select one to seven sampling points in each site to collect the soil and test for presence of the organism Despite its importance as a cause of natural disease and a bio-threat agent, there is limited information on which to base sampling strategies for B. pseudomallei over distance between two sampling points (lag distance). The aim of this study was to apply the semivariogram to datasets from two large environmental sampling studies, which previously defined the presence and quantitation of B. pseudomallei in disused land B. pseudomallei.The semivariogram is a geostatistical tool for determination of the range over which measurements of soil properties are related Soil samples were collected from two locations situated in a rural rice-growing region in Ubon Ratchathani province, northeast Thailand. Sampling of an area of disused land situated to one side of road 231 in Amphoe Meung was performed in September 2005 (the rainy season), as previously described 2) was marked out using string and wooden stakes. Plots were referenced using letters , and numbers . A square experimental grid was used in the rice field. A grid comprising 10\u00d710 plots each measuring 2.5 m by 2.5 m (625 m2) was marked out using string and wooden stakes. Sampling plots were also referenced using letters (A to J) for horizontal rows as viewed with back against the earth walkway, row A lying closet to the dirt road) and numbers (1 to 10 from left to right). Soil sampling was performed at the center of each plot. A standard soil sampling technique was performed, as previously described The disused land site was rectangular and a rectangular experimental grid was located at its center. A grid comprising 5\u00d720 plots placed 2.5 m apart on the vertical axis and 1.25 m apart on the horizontal axis  B. pseudomallei, and a colony count performed to allow calculation of the number of B. pseudomallei colonies per gram of soil at each sampling point. The lower and upper limit of detection of the methodology were 1 to \u226510,000 CFU/gm soil, respectively. Proportions of positivity were compared by the Chi-square test and bacterial counts were compared using the Wilcoxon-Mann-Whitney test.Soil was cultured for the presence of B. pseudomallei count and lag distance between sampling points. To reduce the effect of skew, log10 transformation after adding one to the number of B. pseudomallei count was performed. The formula used for the semivariogram was defined as one half the average of the squared difference of log CFU count between all pairs of observations that are the distance h apart h) is a semivariogram at lag distance of h, N(h) is the total number of sampling point pairs that are a lag distance apart of h, and z(ix) is log CFU count at location ix. nugget variance, which could be caused by measurement error, random variation or undefined spatial autocorrelation over distances less than the smallest sampling interval. The semivariogram generally rises to an upper asymptote called the sill. The sill indicates that the variance at this level is stable and not affected by spatial autocorrelation. The lag distance at which this occurs is called the range of spatial autocorrelation or the limit of spatial dependence.Spatial autocorrelation was analysed to quantify the relationship between 0C is a parameter quantifying the nugget effect, 1C is a spatially structured component of the model, and a is the range of spatial autocorrelation. The Gaussian model was fitted with non-linear least square regressions.The semivariogram was modelled using the Gaussian equation B. pseudomallei counts in both fields. The assumption of normality was rarely held because most sampling points in the rice field were culture negative for B. pseudomallei. The indicator semivariogram, a robust method of semivariogram, was also used ix) with a binary variable (1 if culture was positive and 0 if culture was negative). The indicator semivariogram was then rescaled by the indicator variance. Semivariograms and indicator semivariograms were also computed for different directions in order to determine whether the pattern of spatial variability changed with direction in the field.The semivariogram requires assumptions of stationarity and normality. Stationarity is the condition that mean and variance do not vary significantly in space. Exploratory spatial data analysis (ESDA) described by Cressie The nugget/sill ratio was used to determine nugget effect on overall variability. A value approaching 1.0 indicates that a large degree of the variability is associated with within sample measurements, and that relatedness between spatially separated measurements is limited. A value close to zero indicates that the relatedness of spatially separated measurements within the range is strong.All analyses were calculated using Stata 9.0  and S-plus 6.0 with Spatial Stats module .B. pseudomallei, compared with 28 (28%) positive points in the rice field site . The median B. pseudomallei count for the disused land was 378 cfu/gram soil  55 to 1119), while the median count for the rice field was 700 cfu/gram soil . There was no difference in B. pseudomallei count in the positive points of the two sites . Further statistics relating to log B. pseudomallei counts are available in B. thailandensis was not detected in either field.A total of 80 (80%) sampling points in the disused land site were culture positive for B. pseudomallei counts showed that sampling plots with high (low) B. pseudomallei count were likely to be surrounded by sampling points with high (low) count  was similar in both fields. Stationarity of log B. pseudomallei counts was tested; no major trends of mean and variance were observed with direction in either field. Therefore, correlation (semivariogram) between any two locations depended only on the lag distance between them, not their exact locations.Mapping of log w) count . The higB. pseudomallei counts in the disused land and the rice field was present for up to 11.4 meters and 7.6 meters of lag distance, respectively . However, in the disused land where the proportion of positive points was very high, spatial autocorrelation for presence of B. pseudomallei was lower (nugget/sill ratio 0.79), indicating that variability of test positivity in this field was mainly caused by measurement error or random variation. A directional semivariogram and directional indicator semivariogram showed that the patterns of spatial variability were not different with direction in either field  . If 100 samples are taken, the exact 95% binomial CI is 0 to 3.6%, and if 1000 samples are taken the CI is 0 to 0.4%, and so on  . For exand so on . The numB. pseudomallei in soil using a geostatistical approach to analyse datasets from two large environmental sampling studies. We found that B. pseudomallei was not uniformly distributed in the soil, but rather was randomly distributed with spatial autocorrelation. Samples taken from areas adjacent to sampling points with a high (low) B. pseudomallei count were also likely to yield a high (low) count. This finding is consistent with previous studies of other microorganisms present in soil The aim of this study was to define the spatial distribution B. pseudomallei in the disused land site versus the rice field site, despite the observation that the B. pseudomallei counts per gram of soil at positive spots were not different between the two sites. This was reflected in the shorter range of spatial autocorrelation for log CFU count in the rice field compared with the disused land (7.6 meters versus 11.4 meters). Rice fields undergo repeated flooding, ploughing, planting, rice stubble burning and the application of chemical fertilizers and pesticides. B. pseudomallei may also be influenced by the presence of rice. A difference in bacterial communities present in rice field and disused land has been described previously in regions where B. pseudomallei was not present, and agricultural practices have been reported to lead to reversible changes in the community structure of environmental Burkholderia species other than B. pseudomalleiB. pseudomallei in disused land is higher than in rice fields because the number of sites sampled is low and the sampling points within each field were correlated. Intensive sampling to determine the distribution of B. pseudomallei in a field has not been subjected previously to systematic study. Future studies are required to investigate whether these findings are reproducible.This study also demonstrated a marked difference in the proportion of samples positive for B. pseudomallei in a field, regardless of whether the prevalence of the organism is high or low. Our study was based on a fixed-interval sampling strategy which was used for its simplicity, and because this is a recommended strategy for the generation of semivariograms B. pseudomallei prevalence varies across the study area. We showed that sampling less than 10 sampling points per site may give a false negative result, even if the actual probability that an independent sampling point will be positive is as high as 28%. Adaptive sampling may be a suitable approach for the detection of B. pseudomallei in an area where the presence and/or distribution of B. pseudomallei is unknown. For example, a pilot study could be performed in a defined experimental area in which 20 random points are sampled and tested for the presence of B. pseudomallei. If any sampling point is positive for B. pseudomallei, this confirms the presence of the organism and therefore an area of risk to humans and livestock. If no sampling points are positive for B. pseudomallei, a second round of sampling is done in which a larger number of random points or all possible sampling grid points are sampled in the same area. Based on our analysis, we recommend that a minimum of 100 sampling points for an area of land measuring 30 m\u00d730 m should be taken during stage 2 in the event that the first round of sampling is negative.The best soil sampling strategy should have adequate power to detect the presence of B. pseudomallei throughout southeast Asia and northern Australia B. pseudomallei load is higher in areas of south Asia including northeast Thailand and Laos than in northern Australia. However, the sampling strategies such as those previously used in which a small number of sampling points were tested per field and/or distances between the points were short could potentially underestimate the geographical distribution of positive sites, particularly in an area of low prevalence.Random sampling with ad hoc strategies have been used previously to define the presence of B. pseudomallei within an endemic region such as the province of Ubon Ratchathani. This sampling method involves considering a primary sample unit such as field, and a secondary sample unit such as sampling point in each field. Defined areas of land (the primary sample unit) are selected from the entire region using a sample size calculation. Each experimental area is then sampled using an adequate number of sampling points using an initial sampling grid size (in northeast Thailand) of 2.5 to 3.5 meters  or based on new data generated from future studies. Sampling strategies in each field could be based on random sampling, fixed-interval sampling, stratified sampling or adaptive sampling, as described above. This extensive dataset would give a broad insight into the distribution of B. pseudomallei across the region.We propose that a multilevel approach is suitable to determine the geographical distribution of B. pseudomallei count in soil within and between different countries is well described B. pseudomallei count in soil is markedly different from that found in this study, since the range of autocorrelation is likely to differ The optimal sampling grid size should be calculated based on the spatial autocorrelation (semivariogram) of the presence of organism in a given area and the level of precision required B. pseudomallei from soil involved the addition of water to the soil sample followed by vigorous manual mixing and overnight sedimentation, after which the supernatant was removed for culture B. pseudomallei may either replicate or die during the overnight sample preparation, and some strains may not grow in the culture medium. Molecular detection techniques such as PCR may resolve this problem. DNA extraction from soil followed by detection of B. pseudomallei by real-time PCR has been reported to be more sensitive than culture B. pseudomallei in the environment. Further studies are now required to extend our understanding of the global distribution of B. pseudomallei in the environment, together with an evaluation of factors such as the physical properties of soil and the effect of vegetation that influence its spatial distribution.The moderate degree of nugget sill ratio found in this study could be due to variation in the soil sampling technique used. The standard methodology for culture of B. pseudomallei in the environment. Our data are likely to be specific to northeast Thailand and our focus was primarily the issue of false negatives. As such, it does not attempt to determine optimal strategies necessary for all applications, such as the strategy necessary to obtain an unbiased snapshot of bacterial population genetic structure. However, our findings have major implications for future environmental studies of B. pseudomallei, and highlight both the critical importance of study design and methodological approach and the need for further studies in this area.This is the first published study to define spatial distribution of Figure S1B. pseudomallei (log cfu/gram soil) over the lag distance (in meters) in the disused land at N45E (1A) and N45W (1B), and in the rice field at N45E (1C) and N45W (1D).Directional semivariograms for quantitation of (0.43 MB TIF)Click here for additional data file.Figure S2B. pseudomallei over the lag distance (in meters) in the disused land at N45E (1A) and N45W (1B), and in the rice field at N45E (1C) and N45W (1D).Directional indicator semivariograms for presence of (0.43 MB TIF)Click here for additional data file.Table S1B. pseudomallei data from the disused land and the rice field in log cfu/gram of soil.Summary statistics for quantitative (0.04 MB DOC)Click here for additional data file."}
+{"text": "This work explores the potential contribution of bioenergy technologies to 60% and 80% carbon reductions in the UK energy system by 2050, by outlining the potential for accelerated technological development of bioenergy chains. The investigation was based on insights from MARKAL modelling, detailed literature reviews and expert consultations. Due to the number and complexity of bioenergy pathways and technologies in the model, three chains and two underpinning technologies were selected for detailed investigation: (1) lignocellulosic hydrolysis for the production of bioethanol, (2) gasification technologies for heat and power, (3) fast pyrolysis of biomass for bio-oil production, (4) biotechnological advances for second generation bioenergy crops, and (5) the development of agro-machinery for growing and harvesting bioenergy crops. Detailed literature searches and expert consultations  led to the development of an 'accelerated' dataset of modelling parameters for each of the selected bioenergy pathways, which were included in five different scenario runs with UK-MARKAL (MED). The results of the 'accelerated runs' were compared with a low-carbon (LC-Core) scenario, which assesses the cheapest way to decarbonise the energy sector.Bioenergy was deployed in larger quantities in the bioenergy accelerated technological development scenario compared with the LC-Core scenario. In the electricity sector, solid biomass was highly utilised for energy crop gasification, displacing some deployment of wind power, and nuclear and marine to a lesser extent. Solid biomass was also deployed for heat in the residential sector from 2040 in much higher quantities in the bioenergy accelerated technological development scenario compared with LC-Core. Although lignocellulosic ethanol increased, overall ethanol decreased in the transport sector in the bioenergy accelerated technological development scenario due to a reduction in ethanol produced from wheat.There is much potential for future deployment of bioenergy technologies to decarbonise the energy sector. However, future deployment is dependent on many different factors including investment and efforts towards research and development needs, carbon reduction targets and the ability to compete with other low carbon technologies as they become deployed. All bioenergy technologies should become increasingly more economically competitive with fossil-based technologies as feedstock costs and flexibility are reduced in line with technological advances. Renewable energy is required as part of the future UK energy portfolio in order to meet CO2 reduction targets and improve energy security. An 80% reduction in CO2 emissions by 2050 coupled to the EU target of 15% supply of UK energy from renewables by 2020, represents ambitions that will require technology innovation, and better renewable deployment, as highlighted in the 2007 Stern Review [The UK Government states in the Energy White Paper 2007  that theThe IEA's Technology Perspective  draws at2 emissions, if it is produced in a sustainable way, and currently contributes approximately 80% of renewable power production in the UK [Bioenergy is one of the most prominent options to reduce COn the UK . Most ofn the UK . It is pn the UK .Bioenergy technologies are numerous and varied, incorporating many feedstocks, methods of conversion and supply routes to end products and end uses. In addition, bioenergy technologies can be found at all levels of maturity ranging from well established proven technologies, to new technologies that are in the research and development (R&D) phase. As a consequence, it is not possible to characterise the maturity of the bioenergy field as a whole. This can also partially explain why bioenergy research remains extensive and cross-disciplinary. Finally, such multi-disciplinarity and complexity means that it is not yet well understood how influential technological development will be for bioenergy's contribution to future low carbon energy systems.The main objective of this paper is to explore the possible contribution of emerging bioenergy technology to the UK energy system by 2050, by outlining the potential for accelerated technology development (ATD) of bioenergy systems in the UK. We aim to gain insight into how bioenergy technologies may contribute to meeting the 80% carbon reduction targets for a low carbon energy system in the UK, by using a MARKAL model complemented by relevant qualitative storylines highlighting key factors underpinning modelled technological development.et al. [et al. [The UK Energy Research Centre (UKERC) Energy 2050 project focuses on how the UK energy system may move towards a resilient, low-carbon system by 2050, while providing energy security . A fulleet al.  and the  [et al. .Bioenergy pathways are represented in MARKAL by more than 100 directly relevant technologies in the different modules of the model (and more than 200 indirectly relevant ones). Figure The methodology is summarised in Figure development of the bioenergy technology field, not accelerated deployment. Bioenergy is a wide field, representing a large number of chains with many feedstocks, conversions and supply routes that feed into heat, power and liquid biofuels in the UK [In order to explore accelerated technology development of bioenergy, this research focused specifically on accelerated n the UK  and it wn the UK . Based oThis was chosen because considerable technological advances are likely  and becaAlthough this is not a new technology, gasification was selected as it a process working towards deployment at demonstration and commercial scale and technology development is possible . This moThis is a technology largely at the early commercial stage; however, the production of transport fuels via fast pyrolysis is still in the R&D stage with potential for further advances . This exThis represents one of the underpinning technologies, as feedstock prices underpin many of the costs associated with bioenergy chains. The focus was on improvements through better breeding to advance dedicated second generation energy grasses and trees, not food crops. We focused on non-GM crops and domestic (UK) crops. The focus on domestic crops only was to reflect long-term environmental sustainability goals.The other underpinning technological improvement selected was the potential for improved machinery for growing and harvesting dedicated bioenergy crops. Good site preparation and weed elimination are highly influential on the performance of many energy crops, and improvements in these areas are important. There are also crop losses associated with inefficient harvesting/picking up of cut energy crops for example, which need to be addressed. Improvement in both agro-machinery and bioengineering of energy crops are likely to affect learning curves and supply costs for multiple bioenergy chains .The current status of each of the five chains and their potential for acceleration were assessed using data collected on both a qualitative  and a quantitative basis. This information was obtained from published literature, government reports and expert consultation.Qualitative information for the scenarios was used to estimate possible future technology developments until 2050, through processes such as gradual changes, step changes and innovation, as well as gaining an understanding of the possible milestones for each technology.The ATD bioenergy quantitative dataset was compiled for each of the five technologies using optimistic figures from literature searches and expert consultation to represent accelerated technology development from 2000 to 2050. The information available varied widely between the five technologies chosen. Accordingly, the assumptions and the process by which the data in the literature was used to determine the accelerated dataset are described below for each technology separately. The data collected consisted of figures on capital cost, operating and maintenance cost, technical efficiency, defined as the ratio between the useful output of energy conversion to the input, annual availability, defined as the share of the installed capacity that is used during a year (average share of the year), plant lifetime in the case of electricity generation and for biotechnological advances for second generation bioenergy crops, energy content and yield. Acceleration was represented through reducing costs, increasing efficiencies and including earlier availability for the technologies, in line with the literature and expert consultation. Since the UK-MARKAL database costs are in pounds sterling (GBP), all cost data were converted to GBP on a year 2000 basis.Once the data on accelerated technology development for selected bioenergy pathways was compiled, it was included in the modelling of five different 'accelerated' scenarios Table  to exploThis paper focuses on the contribution of bioenergy to decarbonising the energy system; however, further exploration of the other technology scenarios can be found in the forthcoming ATD report from UKERC Energy 2050 .The representation of technological development in MARKAL has been done by the introduction of technologies' vintages  with differing parameters corresponding to technological evolution, to represent learning effects or other advances in technology development. These parameters include capital cost, efficiency, operating and maintenance (O&M) costs, both fixed and variable, and where appropriate, availability, contribution to peak load, and plant life time.It is important to have an understanding of the R&D needs of a technology pathway when assessing its potential for accelerated technology development. Understanding the major hurdles to development and deployment is also critical when considering the likelihood of technology breakthroughs and step changes within a technology pathway.Bioenergy is diverse and flexible, covering many feedstock resources, conversion pathways and outputs . As suchThe development of new dedicated bioenergy crops for feedstocks is one of the most fundamental R&D needs for bioenergy, as this underpins the development and cost of many bioenergy conversion technologies . The UKEImproved establishment of dedicated bioenergy crops on marginal and idle land, as recommended by the Gallagher Review  would alAdvances in site preparation, weed elimination  and imprTechnical improvements in existing conversion technologies such as gasification, and novel conversion technologies like fast pyrolysis, are also needed. R&D needs for both of these technologies include increasing conversion efficiency, reducing overall technology costs, increasing fuel flexibility so that a variety of new energy crops can be utilised as feedstocks and improving product quality through gas cleaning in gasification and producing cleaner bio-oil from fast pyrolysis ,18,21-25in-situ enzyme systems for wall disassembly [The economic competitiveness of biofuels compared with conventional fuels is a key barrier in the deployment of biomass in the transport sector . In ordeassembly ,26. Bettassembly  to make Table Major technology improvements and accelerated development which will reduce overall costs and increase efficiency of lignocellulosic conversion to ethanol are expected from a combination of improvements in feedstock quality, with reduced lignin for better breakdown of cell walls, cheaper enzymes and more efficient conversion technologies, which require less pre-processing, plus an improvement in the fermentation process Table .Parameters changed within MARKAL included capital costs and O&M costs. All other costs associated with this technology were kept the same as the core scenario. The parameters used to model lignocellulosic ethanol conversion were changed as follows to represent accelerated development Table .Lignocellulosic ethanol is available in the model from 2010. In the core scenario, it is modelled with an annual availability of 100%, which was reduced slightly to 90% in the accelerated scenario.et al. [In the core scenario the efficiency is modelled as 90%. Although this figure is too high, with expected efficiencies to be around 30 to 40% , the efficiency was kept at 90% in order to keep it comparable to the non-accelerated scenario and to avoid any drastic model 'deceleration', as this would be contrary to the aim of the exercise. Laser et al.  suggeste-1, which is in line with recent US Department of Energy (DOE) research [-1 by 2050. These changes in investment costs are likely to occur as economies of scale are obtained when it is possible to construct larger plants  .The investment costs of lignocellulosic ethanol conversion in the core scenario are 23 GBP.GJresearch . In the -1) seems too high. In the accelerated scenario, O&M costs were reduced to 5% of the investment costs in 2000 and 2010, and to 2% of the total investment costs by 2050. These percentages are in line with expert analysis and estimates on expected development of the technology .For the variable O&M costs, the data used in the core scenario   (a forerEnergy crop gasification is represented in MARKAL by existing gasification (2000) and a number of technology 'vintages' in the model, including one at 2010, 2020, 2030 and 2040. The following data were used for the ATD gasification scenario , but was increased to 47% in 2010 and 2020, and 50% in 2030 and 2040 in the accelerated scenario .e-1, reducing to 1,450 GBP.kWe-1 in 2010, and 700 GBP.kWe-1 by 2020 as reported in the DTI [Capital costs for the accelerated scenario were kept the same in 2000 as in the core scenario at 2,200 GBP.kW the DTI  and coule.yr)-1, decreasing to 51.5 GBP.(kWe.yr)-1 in 2010 and to 30 GBP.(kWe.yr)-1 by 2030 to 2040 to be consistent with figures reported in the DTI ecomomics report and NREL powerbook [Under the accelerated technology scenario, the fixed O&M costs in 2000 were kept at 66 GBP.  and the literature available, the costs were kept the same for both the core and accelerated scenario in 2005 at 32.4 GBP.GJ-1. In the accelerated scenario, however, O&M costs were reduced after 2000 to represent a figure of 4% of the capital costs, dropping to 1 GBP.GJ-1 by 2050 (to be consistent with the literature [The efficiency of fast pyrolysis in the accelerated scenario did not change from the 90% found in the core scenario. Variable O&M costs were modelled in 2000 in both scenarios at 3 GBP.GJterature ).Acceleration of bioengineering of energy plants focused on domestic energy crops (within the UK) to reflect the environmental sustainability criteria. Imported energy crops were not accelerated. Improvements in the yield of energy crops are predicted to be the major factor that will accelerate the development of energy crops Table , and theA literature review of energy crop costs highlighted the wide range of plants suitable as bioenergy crops. Data obtained for this scenario, however, focused only on those crops which are suitable to be grown in the UK .-1) using an assumption of average yield of 12 t.(ha.yr)-1 increasing to a future yield of 24 t.(ha.yr)-1 in 2050.Although there are a wide variety of bioenergy crops with different crop costs, MARKAL uses an average figure to represent all energy crops. The estimates for crops from the literature e.g. -34 there-1, but in the ATD scenario this was decreased to 2.9 GBP.GJ-1 in 2010 and 1.45 GBP.GJ-1 by 2050, to represent a gradual improvement in biotechnology from 2000 to 2050 . Although energy crops are utilised in both scenarios in 2010, there is a much larger uptake of bioenergy crops across all vintages in the ATD scenario from 2010 to 2050 Figure . The lanThe production of electricity from biomass (primarily from gasification) reaches a peak of 277 PJ of electricity  in 2035 in the ATD scenario, compared with a peak of only 62 PJ in the LC-Core in 2025 Figure . This inIn the ATD scenario, the use of solid biomass for electricity generation increases until 2040, when it reaches 481 PJ of energy crops. After 2040 the use of energy crops for electricity generation decreases, reaching 284 PJ by 2050 .The deployment of gasification in the ATD scenario also has some smaller effects on the levels of adoption of other bioenergy technologies. For instance, biomass district heating technologies (heat only) in the ATD Bioenergy scenario are used more than in the LC-Core scenario in the short term, but significantly less in the longer term. In addition, the deployment of gasification also means that biomass CHP plant (LTH) is never deployed in the ATD scenario whereas it was deployed from 2035 onwards in the LC-Core scenario.Accelerated technology development of bioenergy creates changes in the residential heating sector when compared with the LC-Core scenario Figure . There iIn the service sector, woodchips are displaced by pellets (from energy crops) from 2040 onwards in the ATD scenario, unlike the LC-Core scenario where wood is used until 2050. The increasing use of energy crops for the residential and service sectors in the long term corresponds to the timing of the declining use of energy crops for electricity and the continuing increase in production of energy crops.Overall, final energy demand from biomass in the transport sector does not differ significantly between the LC-Core and ATD Bioenergy scenarios. The total transport fuel demand is the same in both scenarios until 2035 to 2040, when the total transport fuel demand in the ATD is slightly higher (152 PJ) than in the LC-Core (142 PJ) Figure . Howevervs. 103 PJ in ATD Bioenergy). However, there is an increase in the uptake of the accelerated lignocellulosic ethanol in the ATD scenario from 2035 onwards (this technology was not deployed after 2035 in the LC-Core scenario). However, the increase in lignocellulosic ethanol is smaller than the decrease in traditional wheat ethanol and therefore there is an overall reduction in the level of ethanol in the ATD scenario.The overall impact of acceleration on ethanol is negative because less domestic ethanol is produced in the ATD scenario. Imported ethanol remains at similar levels in both scenarios. There are two pathways for the production of ethanol in MARKAL: traditional straw fermentation and lignocellulosic conversion to ethanol. In the ATD scenario, traditional ethanol from wheat straw fermentation is deployed later and at lower levels  scenario at 60% carbon reduction, there is less biomass for electricity after 2040 than there was in ATD Bioenergy Figure . This isWhen accelerating all the technologies together at an 80% carbon reduction, there are again major changes to the distribution of biomass. While there are still high levels of biomass being utilised in LC Acctech (no fuel cells) (80%), the biomass is being distributed to the sectors differently.In LC Acctech (no fuel cells) 80%) there is much less biomass deployed for electricity production (a peak of 150 PJ as opposed to 290 PJ in LC Acctech (no fuel cells) (60%)  are accelerated for a 60% carbon reduction target then bioenergy is used more for electricity generation than in any other scenario (including the single technology acceleration-ATD Bioenergy) Figure . HoweverWhen all the technologies (including fuel cells) are accelerated with an 80% carbon reduction target then biomass is used less for electricity generation than in the other accelerated scenarios Figure . TranspoThis study highlights the potential for innovation throughout the bioenergy supply chain to contribute to the decarbonisation of multiple sectors of the UK energy system. Based on the research narratives developed and techno-economic modelling scenarios, the results suggest that bioenergy has the potential to be an affordable option to decarbonise not only the electricity and residential heat sectors, but also the transport sector under an 80% carbon reduction target given further technological development.When bioenergy technologies are accelerated in isolation in the ATD Bioenergy scenario, electricity production from biomass is highly deployed in the medium term followed by increased residential heat from pellets (energy crops) in the long term. Until 2035, a similar pattern was seen for electricity generation from biomass in the aggregated scenario (LC Acctech (60%) with fuel cells) with a 60% carbon reduction. However, in the 60% aggregated scenario without fuel cells, there was less electricity production from 2040 to 2050 and much more biomass for residential heating than in the ATD Bioenergy scenario. This suggests that in the aggregated scenarios, electricity produced from bioenergy crops becomes less economically competitive than other accelerated low carbon electricity options such as marine, wind power and solar PV. The flexibility of bioenergy means it can be used in multiple end use sectors, while the other renewables cannot. Biomass therefore becomes better used as a low cost option to decarbonise residential heating in the aggregated scenarios when competing with other renewables.Under the increased carbon reduction targets in the aggregated 80% scenario without fuel cells (LC Acctech (80%) no fuel cells scenario), the distribution of biomass changes. There is significantly less electricity and residential heat generated from biomass but more biomass in the transport sector (biofuels) in the 80% scenarios. The higher carbon reduction target of 80% results in more pressure on the transport sector to decarbonise compared with the 60% scenarios. Without fuel cell acceleration, there are few affordable options to decarbonise transport and biofuels is the cheapest option. Therefore the model shifts much of the biomass away from electricity and heat and towards transport biofuels. This suggests that with a limited resource like biomass there should be a thorough investigation into the optimal utilisation of the resource to decarbonise the economy.When fuel cells, an alternative option for decarbonising the transport sector, are introduced in LC Acctech with fuel cells at a 60% or 80% carbon reduction, the fuel cells are deployed for decarbonisation of the transport sector. In the 60% scenario this leads to biomass being used primarily for electricity generation and heat while in the 80% scenario biomass is used earlier for residential heating. This reinforces the message that the optimal distribution of biomass depends on the ambition of the carbon target and the availability of alternative low carbon technologies. A whole system mentality must be used when determining how to best use biomass resources.Given the importance of low cost biomass resources in the increased uptake of bioenergy in the ATD Bioenergy scenario, cheaper feedstocks are clearly important for the future deployment of bioenergy technologies. This suggests that much of the scope for accelerated deployment of bioenergy comes from the development of more efficient, low cost energy crops. This can be achieved through increasing the yield, crop resistance to disease and pest species and by increasing successful establishment of perennial species. Feedstock flexibility is also important for many of the bioenergy technologies, and therefore improvements in this area will increase the economic competitiveness of bioenergy.The results from all the scenarios suggest that using biomass for residential heat is a potential option to decarbonise the UK's energy market when bioenergy is competing with other accelerated technologies under 60% carbon reduction targets. However, in 80% carbon reduction scenarios, transport biofuels are deployed at much higher rates. This suggests that to achieve a higher level of decarbonisation, transport will need to be highly decarbonised and that lignocellulosic ethanol could be one way to achieve this. Given the uncertainties surrounding the ATD figures and our 'what-if' rather than a predictive approach, however, it remains to be seen whether bioenergy technologies will develop and be deployed in this way.Fast pyrolysis for bio-oil production was not deployed in any of the scenarios. This certainly does not mean that fast pyrolysis technology is without potential. To fully understand why fast pyrolysis was not deployed, a sensitivity analysis would need to be undertaken on the costs of pyrolysis technology within the model; however, due to time constraints this was not possible. It is additionally important to highlight that the model may not capture some key advantages in using fast pyrolysis in an energy system which are beyond cost competitiveness. MARKAL is used for 'what-if' analysis and focuses on 'least-cost' solutions for the energy system over the time horizon chosen. Consequently, MARKAL will select the technologies which supply energy at the lowest cost, even if this only represents a marginal cost saving. One of the consequences of this modelling paradigm is that some technologies/pathways may not be selected by the model as part of the 'optimal' energy system configuration even if in reality they could be developed. In addition the MARKAL modelling framework can only capture some of the 'non-economic' benefits of certain energy technologies/pathways, which influences its choice of 'solutions'. Although the UKERC 2050 MARKAL model has, additionally, been thoroughly tested , it has not been built specifically to explore bioenergy pathways. Within the time constraints of the project, it was not possible to improve the bioenergy chains represented within the model. Within the TSEC-BIOSYS modelling exercise, however, bioenergy chains were specifically improved. 'Domestic' fast pyrolysis also was not deployed in the system; however, imported bio-oil was deployed most notably in the industrial sector within the TSEC-BIOSYS model (unpublished data). The 'imported' bio-oil pathway is currently not modelled within the MARKAL model used for UKERC 2050 and this highlights an area where the model needs to be improved.Land availability within the UK for growing bioenergy crops is, additionally, a big issue within the bioenergy field. In MARKAL, the upper bounds of available energy crops were capped to reflect the limited availability of land for biomass in the UK. However, there are also other issues associated with bioenergy that could further limit biomass levels in the UK. Bioenergy is often considered controversial due to issues surrounding direct and indirect land use change ,35, realA further key factor in determining the use of UK land for energy crop production will be the availability and price of imported biomass. This is important given that at least half of the current biomass supply is sourced from outside the UK  and thatSocial and environmental limitations on bioenergy development and deployment, such as the wide-scale environmental costs and benefits of bioenergy deployment on ecosystem services, and direct and indirect land use displacement, may make deployment of bioenergy technologies challenging. Overall, however, the work suggests that bioenergy can contribute significantly to a low carbon UK energy future. However, it is important to keep in mind that (1) the modelling overlooks many barriers to development and deployment other than costs; (2) the modelling does not properly model some key aspects linked to bioenergy infrastructure, both spatial and temporal, and (3) the figures used in the ATD scenarios are uncertain and should be taken with caution. This work offers insights into the potential accelerated technology development and deployment that could occur along selected bioenergy chains in the UK. It should be taken as an illustration, rather than a prediction, of how bioenergy could be deployed in the future UK energy system. The analysis undertaken contributes mostly from the illustration of 'what could be done' with MARKAL to look into the potential of ATD and bioenergy.Our findings are limited by the uncertainty on the values chosen to represent future ATD. For example, the results for the deployment of lignocellulosic ethanol are based on very high conversion efficiencies, and should be taken with caution, and not as a prediction of the capability of lignocellulosic technology deployment. Rather, the results from this should be looked at as an illustration of the capability of the model, and as highlighting where further work is needed. The UK-MARKAL database is iteratively constructed and improved, and this has been corrected for further runs. However, as a consequence of time constraints, it was not possible to include this revised value for the ATD runs for the present work.In addition, the focus was mostly on one scenario. A single ATD Bioenergy scenario was modelled in MARKAL which combined the accelerated development input data of the five bioenergy chains that were selected for exploration. Although the use of different scenarios would help to account for some of the uncertainties in the figures used in the scenarios, this was not possible given the time constraints of the project. In future, these uncertainties would need to be taken into account, for instance, by using different scenarios, including the use of more bioenergy chains, and by undertaking sensitivity analyses to determine which parameters are most influential on the deployment of the bioenergy technologies explored.Moreover, the scenarios focused on five select technologies/bioenergy chains. There are other promising bioenergy technologies which have the potential to be economically viable and sustainable, especially those where active research is being conducted both in the UK and internationally. Some technologies, like algal fuels, have potential but are currently not represented within MARKAL.It is also important to highlight that the failure of a technology to be deployed in these scenarios does not mean that technology is without potential. As MARKAL is a least-cost optimisation model, it will select the cheapest technology to serve the demand while satisfying the constraints, even if those cost savings are only marginal.Although the UKERC 2050 MARKAL model has, additionally, been thoroughly tested , it has not been built specifically to explore bioenergy pathways. Consequently, this means our approach is challenging, but innovative nonetheless. Here the authors have illustrated the possibilities of the model, but within the time constraints of the project, it was not possible to improve the bioenergy chains represented within the model. The 'imported' bio-oil pathway is currently not modelled within the UKERC 2050 model and this highlights an area where the model needs to be improved.The costs used in the modelling were additionally calibrated on a 2000 base year and we are conscious of the limitations of this approach and the possibility of improvement to represent more carefully the 'short term'. The value of the modelling exercise, however, may be more in exploring the longer term trends.Further work is needed to build on our proposed approach and it could be useful to systematically look at the pathways to answer the question 'how much improvement is necessary in the different biotechnologies before they can be expected to have a significant role in the future energy system?'This paper has highlighted the applicability of an original modelling approach, but future work should be focused to address some of the above limitations. It is also important to note that the modelling has been underpinned by clear qualitative stories, including R&D directions and potential and policy implications, which give the modelling results context. The UK-MARKAL model is an 'iteratively built' database and model and by highlighting its possibilities as well as current gaps in data representation and/or capabilities, we continue to contribute to the future improvements of the model.This work explores the potential of bioenergy technologies to contribute to carbon reductions in the UK energy system through accelerated technology development. The analysis undertaken represents an illustration of 'what-if' scenarios in MARKAL to explore accelerated technology development of bioenergy technologies.The exercise has highlighted that there is much potential for accelerated technology development in the five bioenergy technologies investigated in this paper, particularly in bio-engineering of energy crops as it underpins many bioenergy chains. Given further development, bioenergy technologies could become increasingly more economically competitive with fossil-based technologies as feedstock costs are reduced in line with crop improvements due to plant breeding efforts, the ability to grow energy crops on marginal lands, increased crop resistance to disease and pests, cheaper enzymes for lignocellulosic conversion to bio-ethanol, and improvements in gasification and fast pyrolysis technologies. There is additional potential for advances in other bioenergy technologies not assessed in this paper, which could help to drive the commercial availability and competitiveness of bioenergy technologies in the R&D stage further forward.This paper highlights the unique flexibility of bioenergy technologies to potentially decarbonise multiple sectors. Under all the scenarios there was a high deployment of bioenergy, which implies that it is possible that bioenergy will be a valuable part of the pathway to a decarbonised economy. It is important to highlight, however, that figures used in the ATD scenario were uncertain and should be taken as an illustration of how much improvement is needed in the five technologies for the levels of market penetration seen in the model output. Interestingly, carbon reduction targets influenced the bioenergy mix deployed in the UK energy market. Lower targets (60%) resulted in more electricity and residential heat, while higher targets (80%) resulted in increased deployment of biomass for biofuels. Acceleration of bioenergy without other technologies accelerated, however, led to more electricity from biomass because other low carbon electricity options were less cost competitive.Innovation at all stages of the bioenergy supply chain is important and can contribute to increased chance of deployment. Future R&D efforts and innovation are therefore essential at all points along the supply chain.Ultimately, the future deployment of bioenergy technologies is dependent on many different factors including investment and R&D efforts, carbon reduction targets and the ability to compete with other low carbon technologies as they become deployed.ATD: accelerated technological development; BERR: Department for Business, Enterprise and Regulatory Reform; CCC: Committee on Climate Change; DTI: Department of Trade and Industry; GBP: pounds sterling; NREL: National Renewable Energy Laboratory; O&M: operating and maintenance; R&D: research and development; RD&D: research, development and demonstration; UKERC: UK Energy Research Centre.The authors declare that they have no competing interests.DC collected quantitative and qualitative data for most of the chains, interpreted the results and drafted the manuscript. SJ collected quantitative and qualitative data for the lignocellulosic chain, and helped to draft the manuscript. BM helped with data collection, interpreted the results and also drafted the manuscript. GA undertook the modeling work and commented on the manuscript. GT helped draft the manuscript. All authors read and approved the final manuscript."}
+{"text": "Accurate determination of the properties of biomass is of particular interest in studies on biomass combustion or cofiring. The aim of this paper is to develop a methodology for prompt analysis of heterogeneous solid fuels with an acceptable degree of accuracy. Special care must be taken with the sampling procedure to achieve an acceptable degree of error and low statistical uncertainty. A sampling and error determination methodology for prompt analysis is presented and validated. Two approaches for the propagation of errors are also given and some comparisons are made in order to determine which may be better in this context. Results show in general low, acceptable levels of uncertainty, demonstrating that the samples obtained in the process are representative of the overall fuel composition. Cofiring increases the operational flexibility of the process, reducing dependence on fossil fuels such as coal, but its main drawbacks are the additional cost of adapting combustion facilities and the increase in fouling and corrosion of equipment [Several different technologies are normally applied in cofiring processes . The maiquipment .To avoid some of these problems, it is important properly to define the composition of the biomass used for cofiring. This is made more difficult by the high intrinsic heterogeneity of solid biofuels, so a well-defined measurement methodology must be developed to ensure declared characteristics with an acceptable, clearly defined level of uncertainty. Many reference studies have been published dealing with this issue \u201314 and pThe present paper presents a new methodology for solid biomass fuel sampling and error determination independently of the origin, appearance and packaging of the batch. To validate this procedure, prompt analysis of different biofuels is carried out. Moisture, volatile matter and ash content are obtained directly from a series of samplings and fixed carbon content is inferred from them. Moisture content influences the low heating value, ash is critical in the effects of fouling and corrosion ,16 and vSince fixed carbon content can be calculated as a function of moisture, volatile matter and ash content, the uncertainties of these last three properties propagate the uncertainty of fixed carbon. In this paper a new approach for approximating error propagation is derived. This expression is compared to the traditional formula that can be seen in . The res2.All materials manipulations were developed in the same laboratory and by the same analyst. As the materials exposure after sampling to environmental conditions are less than half an hour in the worst case, we ignore the effects of environmental variations in the material properties (temperature and relative humidity variations in the laboratory are considered insignificant in such a short period of time). Laboratory instruments have been verified and calibrated in order to assure the accuracy of the experimental methodology. Errors registered during the realization of the experiments are considered to be non-systematic errors and therefore related to the precision of the experiment. These latest errors are quantified in the total sampling error.2.1.Several different materials from agriculture and forestry were selected for the study, covering a broad spectrum of solid biomass which could be used as fuel in cofiring processes. The agricultural materials were stored in big-bags and the forestry materials, in pellet form, were stored in sacks. The materials of agricultural origin selected were pine kernel shells, almond shells, hazelnut shells and ground olive stones. The materials of forest origin were pine pellets, oak pellets, brassica pellets and poplar pellets.2.2.\u22123 kg to 730 \u00d7 10\u22123 kg. Fuel samples were obtained through a tube sampler, which was designed to work with all kinds of solid biomass. In its construction special attention was paid to the fact that biofuels are supplied in sacks or big-bag. The nominal maximum size \u201cd\u201d of the material sampled is taken as 20 mm [min = 0.05 \u00d7 d = 0.05 \u00d7 20 = 1 dm3 = 10\u22123 m3 [Depending on the material, sampled masses vary from 320 \u00d7 10as 20 mm , so the  10\u22123 m3 .The tube sampler comprises three parts . The fir2.2.1.3 approximately) were Hazelnut shell, Pine nut shell, Almond shell and ground Olive stone, each biomass in its own big-bag. Nine samples of approximately 10\u22123 m3 volume were extracted [The different biomasses contained in big-bags (1.5 mxtracted . The upp2.2.2.3 approximately) were poplar pellets (nine sacks), brassica pellets (25 sacks), oak pellets (10 sacks) and pine pellets (24 sacks). Samples of about 10\u22123 m3 volume were collected from 5 selected sacks using a table of random numbers [The different biomasses contained in sacks  of the wet sample obtained by the reduction procedure described above. Aluminium trays with an interior diameter of 0.093 m which were free from corrosion and had no moisture adsorption were used.\u22128 kg. The empty tray was weighed, then the sample was uniformly distributed over the surface of the tray with less than 10\u22123 kg/10\u22124 m2. The weighed samples of each material were simultaneously placed in the furnace at a temperature of 105 \u00b0C. The time spent on stabilizing these conditions was 180 minutes, to ensure constant mass. Moisture content when wet (Mi) was obtained by the following equation [i (10\u22123 kg) indicate:1mEmpty tray2mTray and sample before drying3mTray and sample after drying4mReference tray at room temperature before drying5mTray after drying when reference is still hot6mMoisture of the packing if necessaryThe samples were weighed using the \u201cGreat Series VXI-110\u201d scale, which is accurate to 10equation :(1)Mi= indicate:1mempty crucible.2mcrucible and sample.3mcrucible and ash.The ash is the residual inorganic mass which remained after combustion of a biofuel sample at a controlled temperature of 550 \u00b1 10 \u00b0C in oven air until constant mass was established . To set sistance . The samlated by .(2)Ai= with a maximum temperature of 1100 \u00b0C . The sam\u22128 kg1mMass of the empty crucible with the lid2mMass of the crucible with lid and the sample before heating3mMass of the crucible with lid and the sample after heatingCrucible tips fitted perfectly and the sample was uniformly distributed over their inner surfaces. Volatile matter content was determined by weight difference, as shown in 2.5.2.5.1.Following , the batL is the heterogeneity invariant given by:The fundamental error is related to the constitutional heterogeneity, is never zero and is the minimum sampling error that can be made. The variance in the fundamental error can be expressed as:mM = LM, or the material is completely homogeneous, ia = La, i = 1,2, \u2026, FN.In view of the above expressions, it is easy to deduce that the variance of the fundamental error is zero if, and only if, the sample is the whole batch, 2 (SGE), cannot be calculated, but as the relationship: 0 \u2264 \u03c32 (SGE) \u2264 \u03c32 (FE) is verified, then the following relationship can be easily deduced:The segregation and grouping error is related to distributional heterogeneity. The variance in the grouping and segregation error, \u03c3i.e., SE \u223c N ), we can ensure with a confidence level of 95% that:Assuming that the sampling error follows a normal distribution, m <<<ML, it is easy to get to:Finally, assuming that MIf the mass of the sample is constant, the sampling error has an upper bound of a maximum sampling error given by:If a maximum sampling error is set then the mass of the sample should be:Using the latest inequality some useful bounds, with a confidence level of 95%, can be inferred for the sampling error and the mass of the sample:More details about these results can be seen in .2.5.2.FC = 100-M-V-A), a study of the propagation of error can be carried out. Given the linear relationship between fixed carbon and the other properties and since there is no correlation between moisture, volatiles content and ash content, a straightforward application of the simple propagation of error formula leads to an approximation of the maximum sampling error for fixed carbon:Since the percentage of fixed carbon can be obtained directly from the other properties of the materials (maxSE(M), maxSE(V) and maxSE(A) stand for the maximum sampling error for moisture, volatiles and ash respectively.Here L stands for the heterogeneity invariant and M\u0304, V\u0304, \u0100, and FC are the sample means of moisture, volatiles, ash and fixed carbon, respectively. On the other hand, no significant correlation is found between the properties of the different materials. Due to this lack of correlation some of the terms included in the latest equation are zero. Then:On the other hand, using the linear relationship between the properties, some simple arithmetic can be used to get a new expression for the heterogeneity invariant of fixed carbon:By applying expression 6 it is easy to show the following relationship between the heterogeneity invariant of the properties:Finally, using expression 10 a second approximation for the sampling error can be obtained:3.The results of the experimental tests are compiled in this section. A look at the variance in the properties for all the samples in It can be concluded from an analysis of the variances in moisture and ash obtained for the different materials that the sampling methodology is somewhat dependant on the nature of the biofuel. The properties of each material need to be taken into account if adequate accuracy and reliability are to be achieved. For example, materials such as olive stones, pine pellets and oak pellets have a very low variance for ash. On the other hand, their moisture contents vary significantly. The results for almond shell and pine nut shell are surprising, with contrasting variance levels for the two properties. This calls for different sampling plans if the same accuracy and reliability levels are to be achieved in the results. As the moisture in each material depends on its inherent characteristics and on external actions to which it is subjected, greater variances were expected than for ash. This hypothesis was confirmed in only five of the materials.i.e., ash and volatiles, since there is no linear relationship between them. All three need to be studied separately and no previous analysis of one property can be used to infer the levels of the others.A correlation analysis of the properties of the biofuels was conducted and no statistically significant correlations were found. This means that the figures for one property, say moisture, cannot be explained by the figures for the others, 3.1.i = 1, so that the mass sample is represented as NF sampling units. To determine the accuracy of the approximations deduced in the previous section, and since the exact sampling error is impossible to determine, the figures for of SE1 (FC) and SE2 (FC) were compared to those obtained using maxSE(FC). The latter is the best approximation of the actual sampling error that can be achieved, and close coincidence with this figure should indicate a good approximation of the actual sampling error.For the calculations shown below, the fragment is assumed to be a dimensionless unit of mass MmaxSE(FC) and SE1 (FC). The correlation coefficient between the second and third columns of the table is \u22123.64E-02 with a p-value of 0.93, which means a lack of correlation between the maximum sampling error and this first approximation.SE2 (FC), assuming a sample size of one unit, are included in the fourth column of \u22121, with a negligible p-value, which indicates a significant correlation between the maximum sampling error and this second approximation. Notice that to calculate SE1 (FC) and SE2 (FC) only the moisture, volatiles and ashes of the materials need to be known, which means that both approximations can be derived from previous studies of the materials. Nevertheless the second approximation seems to work better than the first since additional studies of the data are used.Values of L shown in By applying the statistical treatment described above to the sample data, the values of HIGiven a maximum acceptable sample error, with these tables it is possible to establish a minimum sample size for determining levels of moisture, ash, volatiles and fixed carbon, respectively with a confidence level of 95%,  and 13. 4.When the representative properties of heterogeneous biomass substances are determined in batches, a sampling methodology must be established for each property. This paper introduces a new sampling process and provides a statistical analysis, defining a sampling error or level of uncertainty associated with the properties measured. This is crucial for learning the subsequent propagation of error in future calculations with the set property level. The new methodology is validated by means a prompt analysis variance analysis.Although they are heterogeneous materials, the biofuels studied here show reasonable limits. In other words, despite the heterogeneity of the fuel itself a well-planned campaign of samples can extrapolate the properties of samples from the entire batch with a controlled, analyzed, quantified level of uncertainty.The paper also shows that sample variance cannot accurately quantify error levels. The statistical uncertainty associated with this property needs to be determined for errors to be quantified precisely. The sampling procedure and statistical determination techniques can be extrapolated to any other solid material in granular form with approximately homogeneous sizes.Sampling errors are significantly correlated with sample variances. Thus, materials with high levels of sample variance will, in general, have higher sampling errors. In the case of moisture, the correlation coefficient between the sampling error and the sample variance is 0.69. Correlation increases to 0.79 for ash, 0.96 for volatiles and up to 0.98 for fixed carbon. It can thus be deduced that sample variance is more of a qualitative than a quantitative indicator of sampling errors but that in no case can it be estimated. Perfect correlation (1.00) is achieved between the coefficient of variation (ratio of the standard deviation to the mean) and the sampling error. This result applies to all materials and is a consequence of the mathematical expression of the heterogeneity invariant and, therefore, of the expression used to obtain the maximum sampling error.maxSE(CF) and aproximation SE1(CF) given in the previous section.The correlation coefficients between the maximum sampling errors obtained for the different properties were calculated. Only the correlation between moisture and ashes seemed to be significant, with a coefficient of \u22120.76. Further study of the data leads to the conclusion that this figure is a consequence of the atypical behaviour of the almond shell. When this single observation is omitted the coefficient changes to \u22120.48. In view of these coefficients, the maximum sampling error of a given property should not be approximated from the maximum sampling errors of the other properties. This might explain the lack of correlation between"}
+{"text": "The haptic perception of the curvature of an object is essential for adequate object manipulation and critical for our guidance of actions. This study investigated how the ability to perceive the curvature of an object is altered by Parkinson's disease (PD).Eight healthy subjects and 11 patients with mild to moderate PD had to judge, without vision, the curvature of a virtual \u201cbox\u201d created by a robotic manipulandum. Their hands were either moved passively along a defined curved path or they actively explored the curved curvature of a virtual wall. The curvature was either concave or convex (bulging to the left or right) and was judged in two locations of the hand workspace\u2013a left workspace location, where the curved hand path was associated with curved shoulder and elbow joint paths, and a right workspace location in which these joint paths were nearly linear. After exploring the curvature of the virtual object, subjects had to judge whether the curvature was concave or convex. Based on these data, thresholds for curvature sensitivity were established. The main findings of the study are: First, 9 out 11 PD patients (82%) showed elevated thresholds for detecting convex curvatures in at least one test condition. The respective median threshold for the PD group was increased by 343% when compared to the control group. Second, when distal hand paths became less associated with proximal joint paths (right workspace), haptic acuity was reduced substantially in both groups. Third, sensitivity to hand trajectory curvature was not improved during active exploration in either group.Our data demonstrate that PD is associated with a decreased acuity of the haptic sense, which may occur already at an early stage of the disease. The major symptoms of Parkinson's disease (PD) affect the motor system and lead to problems in movement initiation and movement speed. Yet, a growing body of research demonstrates that PD is also associated with an array of sensory or perceptual deficits, such as impairments in olfactory function, tactile discrimination and weight perception Little is known about how haptic perception is affected by PD. The term haptic perception refers to an individual's sensibility to its adjacent surroundings by the use of his body This study evaluated the acuity of haptic perception in PD patients who were in the early to middle stages of disease (mild to moderate severity). Moving one's hand along a curved path provides a method for investigating the acuity of the haptic sense. Recent studies examining haptic perception have used a two-joint robot manipulandum to create curved \u201cvirtual walls\u201d in free space which healthy subjects explored by moving a handle attached to the end of the robotic arm Specifically, this study addressed the following questions: a) Do PD patients have decreased sensitivity to detect the curvature of their own hand paths when they cannot rely on vision? b) Is curvature sensitivity differentially affected in PD during active versus passive limb motion? Finding that curvature sensitivity is decreased in PD would indicate an impaired mechanism of processing and integrating proprioceptive and tactile information. In addition, demonstrating that curvature sensitivity is less affected in PD during active than passive motion would indicate that kinematic information derived from an efference copy of the underlying motor commands may be used to compensate for a loss in proprioceptive or tactile sensitivity.Eleven patients with PD participated in the study . Eight age-matched healthy subjects between 50\u201376 years without neurological disease served as a control group . All participants were dominant right-handers based on the results of the Edinburgh Handedness Inventory PD patients were recruited from the movement disorders outpatient clinic at the University of Minnesota. The eleven patients were clinically diagnosed as having idiopathic PD Interactive Motion Technologies, InMotion2). They sat facing the robot holding the robot handle above waist level. Vision was blocked by having subjects wear opaque glasses. To reduce haptic information, participants wore a synthetic gauze glove, which reduced friction between skin and handle, and thus minimized the amount of tactile and pressure-related haptic information  that kept the participant's hand within a virtual box (5 cm\u00d715 cm) with a curved left wall. At the boundary, the experienced resistance was comparable to hitting a wall. Subjects actively moved their hand within the box. In a second condition, the subject's hand was moved passively at a constant velocity of 0.033 m/s by the robot along a path with the same dimensions as the box in the active condition. Curvature of the left side of the active or passive box was either concave or convex with curvature values ranging from 7 to \u22127 m\u22121. A curvature of 7 m\u22121 translated to a 2.1 cm deviation from the straight path . Based on this judgment, the curvature of the virtual wall was adjusted in the subsequent trial using an adaptive staircase procedure. We used an adaptive staircase algorithm proposed by Kesten called accelerated stochastic approximation . The implementation of the algorithm led to asymmetric step sizes. That is, as the subject approached his/her perceptual threshold the presented step size of the stimulus became smaller for a correct answer and increased for an incorrect answer. For example, when a subject correctly identified a convex curvature at 4 m\u22121, the subsequent curvature value decreased by 0.75 m\u22121 in the following trial. However, if the subject's response was incorrect the curvature was increased to 4.75 m\u22121 and then decreased by 2/3 of last step size in the subsequent trial, effectively approaching the incorrect response value in smaller increments. The method guaranteed that the sequence of curvature values converged to the threshold almost monotonically for all conditions . This allowed for a more precise determination of the threshold when compared to a fixed staircase paradigm At the beginning of testing the initial curvature was set to either 7 to \u22127 msensitivity threshold as follows:curv is the presented curvature stimulus determined by three levels  for the 46th to 50th trial of each block. That is, we obtained a threshold for detecting convex and one for detecting concave curvatures.For each trial, we recorded the location of the virtual box, the curvature value of its left wall, and the associated judgment of the subject. Data analysis was performed using customized algorithms based on the MATLAB technical programming language. We computed the curvature The computation of a single sensitivity threshold, which is customary for determining a single detection threshold, was not a sensible procedure for many PD data sets. Using the data of both staircase procedures to compute a single threshold would require both staircase procedures to converge to a common value. However, the data of many PD patients did not show the necessary convergence see . For eacAll reported statistics were computed using SAS 9.1 software. Because we had no data about the true variance and distribution of each population, we performed non-parametric Wilcoxon signed-rank tests to eliminate the assumptions for population distributions required for parametric tests.Absolute joint amplitudes naturally depended on the arm anthropometrics. To obtain information about the range of arm joint amplitudes while the hand moved along the curved virtual wall, we collected electrogoniometer measurements during trials from a tall (184 cm) and a small (162 cm) participant. We found that the ranges of their shoulder joint angles in the right hemi-workspace were 3.8 to 7.8 times larger when compared to the left workspace . Similarly, elbow joint amplitudes were approximately twice as large in the right hemi-workspace in contrast to the left hemi-workspace . Since the hand path did not differ between the two workspaces, the larger joint amplitudes implied that the joint motions had to be faster. When compared to the left hemi-workspace mean shoulder angular velocity increased seven- to tenfold, while elbow angular velocity approximately doubled.\u22121. However, only four of the 11 PD patients (36%) revealed such convergence of curvature values in at least one of the four test conditions.For each movement type (active vs. passive) and in each hemi-workspace, subjects were presented with two series of stimuli, one starting with left curved curvatures  and one with right curved curvatures . To appreciate the observed range of performance between subjects, Based on the two staircase series, we computed the thresholds for each staircase stimulus series for each subject. The respective group data for the convex and concave staircases are presented in \u22121 in the control group and 0.14 m\u22121 in the PD group (see The median sensitivity thresholds for detecting concave curvatures (\u201ccurved to the right\u201d) were 0.16 mroup see . A Wilco\u22121 in the control group and 1.33 m\u22121 in the PD group. A Wilcoxon signed-rank test on sensitivity thresholds for convex curvatures yielded a significant effect for group, z\u200a=\u200a\u22123.10, p\u200a=\u200a0.001 . The corresponding Wilcoxon signed-rank test yielded a significant effect for hemi-workspace for convex curvature thresholds in PD group . However, no significant difference was found between right and left hemi-workspace for the control group see .\u22121 during passive movement and 0.49 m\u22121 during active movement in the control group. In the PD group, the median thresholds for detecting convex curvatures were 0.71 m\u22121 during passive movement and 1.32 m\u22121 during active movement. Although the median thresholds were larger during active movement, the corresponding Wilcoxon signed-rank test did not yield a significant effect for movement type for convex curvature thresholds (p>0.05).Comparing the curvature sensitivity during active movement with the sensitivity during passive motion showed that the median thresholds for detecting curvature were generally lower in the passive condition in both groups. The median thresholds for detecting convex curvatures were 0.16 mtotal and UPDRSmotor scores were computed to be r\u200a=\u200a\u22120.22 and r\u200a=\u200a\u22120.19, respectively. Neither correlation was statistically significant.To examine the relationship between curvature detection and medication we performed a set of correlation analyses. The Pearson product-moment correlation between convex curvature threshold and levodopa equivalent dosage yielded a value of r\u200a=\u200a0.305 (p\u200a=\u200a0.044). The correlation was significant, but meant that levodopa dosage explained less than 10% of the variance in curvature threshold. In a second step we investigated how clinical markers of disease severity were associated with thresholds of curvature detection. The correlations between curvature thresholds and UPDRSThis study examined whether the sensitivity to perceive the curvature of one's hand trajectory is affected by PD. The haptic perception of geometric properties such as the curvature of a curvature is based on the availability of somatosensory cues about the motions and forces experienced during exploratory actions. Signals from proprioceptive receptors and from cutaneous and mechanoreceptors provide the primary sources of information for this perception. Recent research suggests that the perception of actual hand trajectories is likely not derived from sensing force feedback, but is inferred from proprioceptive feedback The main findings of the study can be summarized as follows: First, PD reduces the sensitivity in perceiving hand path curvature. Second, healthy controls and the PD patients showed a decrement in curvature sensitivity when the accuracy of proprioceptive information was diminished due to an increased speed of joint rotations or because the curvature of the proximal arm joint paths was less correlated with the curved hand paths. This was the case when moving in the right hemi-workspace. Third, sensitivity to hand trajectory curvature was not improved during active movement in either the PD or the healthy control group.In this experiment we asked subjects to judge the curvature of their own hand path. Humans use sensory information derived through vision, tactile sensation of the skin or kinaesthetic sensation of the position and movement of the joints to perceive the curvature of objects or the curvedness of one's movement trajectories. If vision is blocked and the availability of tactile information is reduced by wearing a glove made of a low friction material, as in our experiment, then humans need to rely mainly on proprioceptive information to make such judgments. Since the hand is the distal part of the arm, the perception of one's hand position and movement in space requires the processing and integration of proprioceptive information across the wrist, elbow and shoulder joints. Given that the afferents from mechanoreceptors in the hand were not fully blocked through local anesthesia in this study, tactile information from the skin could have contributed to the perception of hand path curvature. That is, the haptic perception of hand path curvature was likely based on two processes of sensory integration: The integration of proprioceptive information across several joints and the integration of multijoint proprioceptive information with information derived from tactile receptors of the fingers and palm.\u22121 implies that a lateral deviation of 1.4 mm was detected over a movement amplitude of approximately 15 cm.With respect to kinaesthesia it is known that humans detect and can match joint angles with a maximum precision of around 1\u00b0 With respect to the type of curvedness, we found that subjects were in general more sensitive in judging concave curvatures (\u201ccurved to the right\u201d). This perceptual bias for convex curved curvature has been reported in earlier studies A main finding of this study is that the thresholds for detecting convex hand path curvature (\u201ccurved to the left\u201d) were elevated in PD patients. Such loss in sensitivity is likely common in PD, considering that 82% of our PD patients revealed detection thresholds outside the control group range in at least one experimental condition and 5 out of 11 patients showing reduced haptic acuity in two or more of the four test conditions. The median detection threshold for convex curvature was increased by 343% when compared to healthy controls see . KnowingWe then investigated whether the differences in perceptual performance were related to disease duration, disease severity or to medication. Using the clinical UPDRS scores as markers of disease severity we found no strong association between disease severity, disease duration and detection thresholds. This stands in contrast to previous research reporting that disease severity as measured by UPDRS correlated strongly with a loss of sensitivity in the sole of the foot With respect to the role of medication, we found a small, but significant positive correlation between levodopa equivalent dosage and convex curvature thresholds (r\u200a=\u200a0.3). This hints, as other studies have suggested We presented the virtual curved walls in two different locations of a person's workspace. Given the geometry of the arm and the task constraints moving within the two different hemi-workspaces gave rise to different joint paths and joint velocities. Moving within the right box was mainly associated with simple extension at both the shoulder and elbow and higher joint angular velocities. In comparison, moving within the left box yielded more sinusoidal joint paths that corresponded more closely to the curvature of the hand path. That is, proprioceptive information derived from the proximal joints contained less information about the curvedness of the virtual wall when participants moved within the right hemi-workspace. In addition, joints rotated faster in the right when compared to the left location, even though hand motion had a similar speed. Given the higher speed and the more linear joint paths of the right workspace movements the processing of proprioceptive information was likely less accurate and we expected that subjects would be less sensitive in that condition.This expectation was confirmed when we found that for motion in the right box, the curvature sensitivity was approximately reduced by a factor of 2 for the control as well as for the patient group see . This meWe provided PD patients with the opportunity for active exploration of a virtual arc to investigate whether the active generation of movement would help restore a potential loss in passive motion sensitivity. The rationale for measuring curvature sensitivity during active movement was that PD patients could use information derived from an efference copy of their motor commands to predict the curvedness of their hand trajectories via the use of an internal forward dynamics model The results from this experiment add to the growing body of literature indicating that PD is associated with a loss of proprioceptive function. Previous studies documented that limb position and passive motion sense are affected in PD at the level of a single joint"}
+{"text": "The goal of this study was to identify genes whose mRNA levels are differentially expressed in human cells with acquired cisplatin (cDDP) resistance. Using the parental UMSCC10b head and neck carcinoma cell line and the 5.9-fold cDDP-resistant subline, UMSCC10b/Pt-S15, two suppressive subtraction hybridization (SSH) cDNA libraries were prepared. One library represented mRNAs whose levels were increased in the cDDP resistant variant (the UP library), the other one represented mRNAs whose levels were decreased in the resistant cells (the DOWN library). Arrays constructed with inserts recovered from these libraries were hybridized with SSH products to identify truly differentially expressed elements. A total of 51 cDNA fragments present in the UP library and 16 in the DOWN library met the criteria established for differential expression. The sequences of 87% of these cDNA fragments were identified in Genbank. Among the mRNAs in the UP library that were frequently isolated and that showed high levels of differential expression were cytochrome oxidase I, ribosomal protein 28S, elongation factor 1\u03b1, \u03b1-enolase, stathmin, and HSP70. The approach taken in this study permitted identification of many genes never before linked to the cDDP-resistant phenotype. \u00a9 2000 Cancer Research Campaign"}
+{"text": "This study illustrates the effectiveness of an advanced incisal table surface, featuring adjustable curvature, in the sake of more accurate articulator kinematics in anterior teeth reconstruction. Prosthetic articulators, used by dental technicians in reconstructive dentistry, are adjustable instruments that simulate the motion of mastication between dental casts: usually, the forward motion (protrusion) of the mandible is guided by sliding a pin over a flat table in order to recreate those movements when incisal teeth are missing. However, such protrusion is an approximation of the exact motion, since flat incisal tables have a limited set of adjustments. Customized software has been developed in order to simulate the kinematics of articulators in three-dimensional space: animations and measures of the envelope of teeth profiles show the unfeasibility of reconstructing with good approximation the profile of incisive teeth, when a simple \u2018flat' incisal table is used. A new incisal table with an adjustable curvature has been proposed, simulated, and built, and computer simulations demonstrated the superior precision of the new design when compared to a conventional articulator which uses a flat incisal table. Prosthetic articulators are mechanical devices used in dentistry to assist in the fabrication of prosthodontic restorations and appliances. Casts of the maxillary and mandibular teeth are fixed to two arms that reproduce the motion of the mandible respect to the maxilla . TypicalConventional articulators usually allow the adjustment of the inclination of the incisal table but, since the surface in contact with the incisal pin is a flat plane, the end of the pin must follow a simple straight trajectory. This fact advocates the adoption of an incisal table that exploits also an adjustable curvature, so that the original shape of the incisors could be replicated with higher precision. Such outlook is also supported by experimental data: when sliding upper and lower casts of a healthy man, the envelope of motion of the incisal pin engraves a concave hole in a mold block placed on the incisal table , 3. This work presents a kinematical analysis of the protrusive movement by means of multibody simulation software \u20137 and deNumerical simulations show that the reconstructed profile of the incisors is an inexact approximation of the original shape if conventional flat incisal tables are used. Indeed, the adjustment of the inclination of the plane is enough to obtain a limited set of profiles featuring an almost flat concavity, not adjustable, whereas profiles with more varied curvatures might be desirable, even for the same table pitch.If curvatures are ignored, as in traditional flat tables, the concavity of the incisal guidance can be underestimated, therefore causing the maxillary incisors to be thicker. This inaccuracy, if modeled prosthesis are not corrected, may affect the occlusion mechanism \u201313. Finally, we propose a compliant device that can be used to implement the concept of the curved incisal table using a small amount of mechanical parts: a thin deformable section is bent up to the desired curvature by turning a knob which bends the surface, hence obtaining the approximation of the needed curvature .Chrono::Engine, customized with special features for the analysis of such problems. The model is made of two moving parts, mandible and maxilla, and of two holonomic constraints for anterior and posterior guidance  is studied using two different modesFor the posterior guidance, a sliding constraint (curvilinear glyph) represents the condylar guides, while anterior guidance is represented by a sliding constraint between surfaces of maxillary and mandibular incisors. This mode simulates the physiological kinematics of the occlusion; For the posterior guidance, a sliding constraint (curvilinear glyph) is used for the condylar guides, while anterior guidance is obtained by means of a sliding constraint between the incisal pin and the incisal table. This mode simulates the mechanical behavior of the articulator as constrained by the incisal table, ignoring the effect of the contact between incisors.MODE B-flat, a conventional flat incisal table is used, thus giving approximate results. This simulation mode can be divided in two further subcases. In MODE B-curved, ideal, an exact incisal table is used, obtained as the envelope of the hemisphere at the apex of the incisal pin during a simulation performed with MODE A. The conjugate profile of the incisal pin is concave: the surface has a downward curvature, denoted with the s symbol in In MODE A show that the incisal pin, driven by contact between true incisors and motion of condyles in the glenoidal fossa, describes a trajectory that, in general, exploits some kind of variable curvature. Simulations for MODE A to simulations performed in MODE B-flat. In the latter case, the top end of the incisal pin is constrained on the flat surface of the incisal table: despite all the admissible settings of alignment for a standard incisal table, it will be difficult to obtain a close approximation of the profile of the original incisal guide, represented by true contact between healthy teeth. In fact, if a flat table is rotated in order to obtain a good approximation of the incisal guide for the initial part, the thickness of the maxillary incisors will be underestimated. On the other hand, if the table is rotated so that the last part is approximated more accurately  about 7-8\u2009mm away from the position of centric occlusion. The curvature radius can change depending to many factors. In general, given a spherical incisal pin with radius Changes in the shape of the condylar guides have small effects either on the average inclination of the ideal incisal table or on its curvature; on the other hand, changes in the shape of the incisal guide have noticeable consequences on the shape of the ideal incisal table. There is almost a linear relation between the average inclination of the ideal incisal table and the average inclination of the incisal guidance of real teeth. Also, for growing values of incisal guidance curvature there are growing values of incisal table curvature.pR may be adjusted up to Rp = \u221e depending on user needs) and a straight \u2018\u2018B\u201d section, without curvature. Moreover, the entire profile can be rotated forward/backward by an angle \u03b1. The case Rp = \u221e would correspond to null curvature, as in the case of flat tables for conventional articulators. Given the requirement of a simple and intuitive method to adjust the articulator, a single parameter, namely, the curvature, could be used to approximate the ideal anterior guidance using a bendable table . This prIn order to test the precision of this kind of profile, heretofore defined \u2018\u2018simplified\u201d because it can be easily implemented by means of a mechanical device featuring adjustable curvature, the multibody software performed simulations  which coFigures \u03c3y: to avoid plasticizing, the maximum bending stress, in the case of maximum curvature, must be \u03c3max < \u03c3y. According to the Euler-Bernoulli theory for pure bending, given a foil with thickness b and moment of inertia J subject to a moment M about neutral axis, we have \u03c3max = Mb(2J)\u22121 and curvature \u03b3 = Rp\u22121 = M(EJ)\u22121. With few substitutions, one getsRp limit as low as possible, we adopt high-strength laminated steel with Young modulus E = 200\u2009GPa and \u03c3y = 900\u2009MPa. Since Rp = Ra + Rc, where the curvature Rc of the trajectory of the center of pin must be as low as 4\u2009mm to approximate the discussed kinematic requirements, we used a foil thickness b = 0.1\u2009mm and a pin radius Ra = 10\u2009mm. Larger Ra values would allow even larger b thickness still satisfying , but the surface would be too delicate. Moreover, we used a pack of 20 layered foils for a total thickness of the incisal table of btot = 20\u2009\u2009b = 2\u2009\u2009mm; this avoids that the pressure of the pin over the table could cause damages such as wear or unwanted deformations.The compliant surface is a critical part of the design because it must withstand strong curvatures without breaking or plasticizing. Since polymeric materials can feature early plasticization, steel foils have been preferred. However, curvature of a steel foil is limited by the yield strength Multibody simulations made possible to obtain the ideal shape of the incisal table by computing the conjugate profile of the incisal pin during the simulation of an ideal, physiological protrusion. Software analysis showed the superior precision of a prosthetic articulator featuring an adjustable curvature of the incisal table, when compared to a conventional articulator with a simple flat incisal table. A prototype of table with adjustable curvature, where the user can modify the profile of the table by acting on a knob, is currently under testing and clinical results will follow."}
+{"text": "The objectives of this project were to determine the spatial and seasonal in-situ nutrient limitation and trophic status at eight sites in five streams in the Lake Waco/Bosque River Watershed in north-central Texas from July 1997 through October 1998. The chlorophyll a production in the periphytometers was used as an indicator of baseline chlorophyll a productivity and of maximum primary productivity (MPP) in response to nutrient enrichment (nitrogen and phosphorus). We evaluated the lotic ecosystem trophic status index (LETSI) using the ratio of baseline primary productivity to MPP, and evaluated the trophic class of each site.We used the passive diffusion periphytometer to measure The rivers and streams in the Lake Waco/Bosque River Watershed exhibited varying degrees of nutrient enrichment over the 18-month sampling period. The North Bosque River at the headwaters (NB-02) located below the Stephenville, Texas wastewater treatment outfall consistently exhibited the highest degree of water quality impact due to nutrient enrichment. Sites at the outlet of the watershed (NB-04 and NB-05) were the next most enriched sites. Trophic class varied for enriched sites over seasons.in situ responses and sensitivities to nutrient enrichment. Nutrient enrichment periphytometers show significant potential for use in nutrient gradient studies.Seasonality played a significant role in the trophic class and sensitivity of each site to nutrients. Managing rivers and streams for nutrients will require methods for measuring  Algae have been used to determine stream ecosystem impacts from human activities for more than 50 years . IncreasAlgal growth, like plants, is limited by the nutrient in least supply relative to their needs ,7. If alHowever, these overly simplistic generalizations do not provide meaningful guidance in managing water quality in a specific water body. When a water body is enriched with nutrients, the kinetics of nutrient enrichment can shift over time and space rather quickly . Lotic  level has been a difficult challenge since the Clean Water Act was implemented over 30 years ago. The United States Environmental Protection Agency has developed nutrient criteria recommendations for managing water quality in rivers and streams . The USEoduction . Measuriet al.[Water quality throughout the Lake Waco/Bosque River watershed has been in decline due to nutrient enrichment . In the et al. determina at a given site over a given sampling period. The MPP represents the level of periphytic growth (measured as chlorophyll a production) that should occur when nutrients are not limiting. Of course, primary productivity (carbon fixed per unit time per area or mass of biomass) is NOT the same as chlorophyll a production, but chlorophyll a is the parameter most often utilized in management of water resources. The LETSI is then defined as the ratio of the baseline algal chlorophyll a production rate to the MPP. Theoretically, the LETSI ranges from 0 to 1.0, representing the proportion of the control chlorophyll production rate to the chlorophyll production rate that could occur over the sample period (14 days) under in situ conditions . Thus, LETSI represents a potential metric for measuring stream nutrient status in the context of all the other variables that affect algal growth at a given stream site. The trophic classification recommended by USEPA [2 (mean) and 6 \u03bcg/cm2 (maximum) represented the transition from oligotrophic to mesotrophic, and 7.0 \u03bcg/cm2 (mean) and 20 \u03bcg/cm2 (maximum) from mesotrophic to eutrophic classification.The lotic ecosystem trophic status index (LETSI) was developed as a tool for making comparisons of stream biotic response to nutrients . The undby USEPA  for Eco-in situ periphytic trophic status in the Lake Waco/Bosque River watershed, determine the seasonal variability in the lotic ecosystem trophic status index (LETSI) at each site as indicators of the Bosque River' trophic classification [in situ using the passive diffusion periphytometer. The hypotheses tested were:The objectives of this project were to determine the spatial and seasonal fication ,16, and Ho1: Stream trophic status did not vary throughout the seasons across sites; andHo2: Periphytic chlorophyll a growth in response to nutrient enrichment from the passive diffusion periphytometer was independent of nutrient enrichment concentration.The Bosque River Watershed covers about 430,000 ha in central Texas, 74% of which is represented by the drainage of the North Bosque River Fig. . Other mEight stream sample sites on five streams in the Lake Waco/Bosque River Watershed, each with different nutrient characteristics, were targeted to determine the limiting nutrient and to compare lotic ecosystem trophic status under varying conditions during July, 1997 and April, May, August and October 1998. The stream sample locations  has episodic nutrient loading associated with runoff . This saFlow in the Bosque River stream systems during the sample period 1997\u20131998) was characterized by high intensity rainfall events in February 1997 and March 1998 97\u20131998 w, and repWe measured the periphytic nutrient trophic status (limiting nutrient) in streams and rivers at eight locations in the watershed over seasons using in situ passive diffusion periphytometers . The perLimiting nutrients  were determined for each stream site using passive diffusion periphytometers constructed of a 0.45 micron nylon membrane filter (Cole Parmer CN 2916-44) as a biofilter and Whatman 934-AH glass fiber filter as the growth substrate, attached to the top of a 1-liter low density polyethylene container with a 2.5 inch diameter hole cut in the lid , consisting of deionized water, with a nominal conductivity of 30 \u03bcS/cm;3 in de-ionized water;2. Nitrate (N), consisting of a solution of 0.35 mM (30 ppm) NaNO2HPO4-7H2O in deionized water;3. Phosphate (P), consisting of a solution of 0.11 mM (30 ppm) of Na3 and 30 ppm of Na2HPO4-7H2O in deionized water.4. Nitrate and Phosphate (N+P), consisting of a solution of 30 ppm NaNO3). The estimated concentrations, in \u03bcg/l PO4-P, were: P1 \u2013 20, P2 \u2013 45, P3 \u2013 90, P4 \u2013 200, and P5 \u2013 500.We deployed a gradient of phosphorus treatments in passive diffusion periphytometers to determine the critical concentration, or that concentration which elicits a significant algal biomass production response, at NB-03 and NB-05 during the summer condition . The concentrations were designed to simulate the following in-stream phosphorus concentrations, and were calculated as the instantaneous average mass flux through the membrane volume  per unit of exposed surface area of the filter (6.6 cm2) for comparison. Mean chlorophyll a concentrations for all treatments across sites were compared using Student-Newman-Keuls' (SNK) and Waller \u2013 Duncan K Ratio (WD) tests (\u03b1 = 0.05) in SAS/STAT\u00ae [At the end of the 14-day growth period, the colonized glass fiber filters were placed in 5 ml of 90 percent acetone solution saturated with magnesium carbonate at 5\u00b0C, wrapped in aluminum foil, and transported to the laboratory for analysis. Chlorophyll was extracted from the filters for direct measurement in the laboratory using EPA Standard Method 10200H.3 . ChloropAS/STAT\u00ae . The SNKAS/STAT\u00ae ,24. The AS/STAT\u00ae .a productivity at NC of 0.48 \u03bcg cm-2was not significantly different from sites NB-01 (0.88 \u03bcg cm-2), and MB (0.47 \u03bcg cm-2). Similarly, the MPP at site MB (5.87 \u03bcg cm-2) was not significantly different from sites NB-02 (5.19 \u03bcg cm-2), and NB-04 (5.73 \u03bcg cm-2). Site NB-02, the North Bosque River below the Stephenville WWTP, was one of the most nutrient-enriched sites of the five sites measured , the reference sub-watershed, was phosphorus limited, MB and NB-04 were co-limited by nitrogen (N) and phosphorus (P); the periphytic community at NB-01 and NB-02 was limited by something other than nutrients (perhaps light) (Table The Lotic Ecosystem Trophic Status Indices measured at these five sites ranged from 0.08 to 0.90 Table . Of the -2) was not significantly different than MB (0.56 \u03bcg cm-2) . The baseline productivity was significantly different than all of the other sites monitored during this period. This site was not nutrient limited. The North Bosque River north of the WWTP (NB-01) and Hog Creek (HC) were at maximum potential productivity, while their production rates were five to 15 times less than NB-02. Sites NB-04 and NB-05 were phosphorous limited  represents a reasonable estimator of baseline chlorophyll a productivity for the Bosque River watershed. The chlorophyll a values for the N+P treatments (MPP) were compared between all of the sites sampled , but not at P4 (200 \u03bcg/l PO4-P). The other phosphorous concentrations did not elicit a growth response significantly different from the control. These results should not be interpreted the same as a dose-response nutrient enrichment assay, because it is reasonable to assume the algae on the periphytometer filter surface have greater access to the P molecules diffusing through the filter than those algal cells attached to rocks have to P in the water column. Thus the actual effective concentration of P that elicited the increased growth rate was not known.A phosphorus enrichment gradient was deployed at sites NB-03 and NB-05  versus spring (April and May) were significantly different (\u03b1 = 0.05); thus we failed to reject the alternate hypotheses HA1: \"Stream trophic status varied throughout the seasons across sites.\" The significance of this finding is that the Bosque River has been managed for phosphorus alone, while these conclusions indicate phosphorus is not the only nutrient affecting algal growth rates. Establishing a single nutrient criteria for N or P may not be adequate to protect water quality; rather, a season-specific and reach-specific nutrient criteria may be necessary.The rivers and streams in the Lake Waco/Bosque River Watershed exhibited varying degrees of nutrient enrichment over the 18-month duration of this project. The North Bosque River at NB-02 consistently exhibited the highest degree of water quality impact due to nutrient enrichment. Sites NB-04 and NB-05 were the next most enriched sites. Chlorophyll et al.[et al. [Seasonality plays a significant role in the magnitude of the biological response to nutrients, suggesting seasonal differences in phosphorus assimilative capacity in the system. The highest assimilative capacity is in the late spring to early summer, while the lowest assimilative capacity was in the late fall. These results are similar to those of Stanley et al. in Texas.[et al.  in OklahHA2: \"Periphytic chlorophyll a growth in response to nutrient enrichment from the passive diffusion periphytometer was independent of nutrient enrichment concentration.\" Passive diffusion periphytometers induce a nutrient growth response dependent upon the concentration of nutrient enriched media, and thus are a viable nutrient bio-assay for water quality management. These results are analogous to the results of algal growth potential studies in lakes and reservoirs [The nutrient gradient treatments applied at two different sites demonstrated that algae responded to phosphorus enrichment progressively, thus we failed to reject servoirs .These findings confirm previous findings that phosphorus biotic dynamics in streams are controlled by complex ecological processes that require spatial and temporal resolution to quantify and understand. In addition, these results support the emerging understanding that point source loadings of phosphorus are particularly problematic in streams due to their persistent nature \u2013 phosphorus is loaded to the stream at a constant rate, resulting in potential sorption to sediment in the stream banks and bed, and potential modification of nutrient spiraling throughout the system.Management of stream water quality with regards to nutrient loads requires intensive characterization of seasonal sensitivity to nutrient loads to prevent algal biomass blooms and other deleterious effects from nutrient enrichment. Just measuring the trophic class of a water body  does not indicate the potential or sensitivity of the water body to nutrient enrichment. Passive diffusion periphytometers represent a potentially valuable method for estimating stream algae sensitivity to nutrient enrichment. However, for this approach to be quantitative we must have a better understanding of the relationship between the other variables that control algal growth: light, temperature, turbidity, grazing, and others.LETSI Lotic ecosystem trophic status indexMPP Maximum potential productivityN NitrogenNP Nitrogen plus phosphorusP PhosphorusSNK Student-Newman-Keuls' TestWD Waller \u2013 Duncan K Ratio TestWWTP Wastewater Treatment PlantThe author(s) declare that they have no competing interests.AR collected primary data, conducted laboratory analyses, provided statistical analyses of the data, and drafted the manuscript as part of her thesis. MM designed the experiments, identified sites, provided technical and analytical support for field and laboratory work, participated in primary data collection and analysis, interpreted the data with AL, and revised the MS thesis into manuscript format. Both authors read and approved the final manuscript."}
+{"text": "Population-based sample surveys and sentinel surveillance methods are commonly used as substitutes for more widespread health and demographic monitoring and intervention studies in resource-poor settings. Such methods have been criticised as only being worthwhile if the results can be extrapolated to the surrounding 100-fold population. With an emphasis on measuring mortality, this study explores the extent to which choice of sampling method affects the representativeness of 1% sample data in relation to various demographic and health parameters in a rural, developing-country setting.Data from a large community based census and health survey conducted in rural Burkina Faso were used as a basis for modelling. Twenty 1% samples incorporating a range of health and demographic parameters were drawn at random from the overall dataset for each of seven different sampling procedures at two different levels of local administrative units. Each sample was compared with the overall 'gold standard' survey results, thus enabling comparisons between the different sampling procedures.All sampling methods and parameters tested performed reasonably well in representing the overall population. Nevertheless, a degree of variation could be observed both between sampling approaches and between different parameters, relating to their overall distribution in the total population.Sample surveys are able to provide useful demographic and health profiles of local populations. However, various parameters being measured and their distribution within the sampling unit of interest may not all be best represented by a particular sampling method. It is likely therefore that compromises may have to be made in choosing a sampling strategy, with costs, logistics the intended use of the data being important considerations. The majority of the world's people remain outside of any kind of systematic health surveillance ,2. In thPopulation-based sample surveys and sentinel surveillance methods, such as Demographic and Health Surveys (DHS), are commonly used as substitutes for more widespread health and demographic monitoring and intervention studies ,5. SimilConceptually similar to other population-based surveys, DSSs are concerned with longitudinally tracking the demographic and health indicators of individuals in a clearly defined study area through regular household surveys. Some DSSs are set up around specific intervention studies, thus the selection of the demographic surveillance area (DSA) will have already been determined. There are also examples of DSSs being established for demographic and health surveillance as the primary purpose, with the selection of the DSA being determined by logistical factors, such as distance from managing and academic institutions, as well as scientific factors, such as trying to select a DSA that may reflect wider local or national diversity and population distributions. Once the DSA has been selected, the way in which populations are sampled within study areas varies greatly between sites. For example, the Butajira Rural Health Programme (BRHP) DSS in Ethiopia is based on 10 communities within the entire Butajira DSA. This sample of communities covers approximately 10% of Butajira district and is relatively dispersed geographically, with the selected communities ranging from lowland to highland and rural to semi-urban ,10. In cGathering valid and representative data on mortality and its risk factors through DSSs and other population sample-based surveys is key to epidemiology and to the planning, implementation and evaluation of health programmes in otherwise data-poor settings. Nevertheless, the specific reasons for collecting mortality data and end-user needs vary considerably . SimilarEmpirical modelling of population sampling using the English national census highlighted the potential effects of various sampling methods and demonstrated that it is possible to achieve representative data by taking 1% of a national population in a sentinel surveillance approach . HoweverFormal statistical methods can only be used as a theoretical framework for designing survey samples where there is adequate prior knowledge at the population level. Therefore, this study applied an empirical approach to the evaluation of various survey sampling methods, using data from a large household census carried out in Burkina Faso in 2006 as part of a wider safe-motherhood evaluation study conducted by Immpact  and descd\u00e9partements' (8 in each province), which can be considered as districts; 507 'zones d\u00e9nombrement' (ZDs) which are enumeration areas roughly equating to villages; and 44,072 'concessions', which are clusters of individual households ('m\u00e9nages') within a ZD.Ouargaye town, the provincial centre of Koup\u00e9logo, is approximately 230 km from the national capital, Ouagadougou, and the province borders Togo to the south. Diapaga town, the provincial centre of Tapoa, is approximately 370 km from Ouagadougou, and the province borders Benin to the south and Niger to the east. The two areas are very similar in terms of social systems, infrastructure and physical geography, with many features common to rural settings across the African continent ,19. As iFrom the large number of parameters captured in the census, a selection was made in an attempt to represent the range of different variables and their associated distributions that are of key importance to demographic and health surveys, with a particular emphasis on parameters relevant to understanding mortality patterns and risk factors. The selected parameters were gender , age (proportion under 5 years), education (proportion of population who have completed secondary level education or above), economics  and number of maternal deaths that occurred in the last 5 years, which were identified using a verbal autopsy (VA) method and computerised VA interpretation method . In addiA range of commonly used survey sampling methods exist, seven of which have been used in this study. The simplest method is to make a random selection of administrative units until the target population is reached. A more complex procedure of sampling with probability proportional to size (PPS) increases the probability of sampling more populous units, in an attempt to make any individual's chance of being included in the sample similar, irrespective of the size of the unit in which they live,22. StraModelling of these sampling strategies using the Burkina Faso data was carried out by drawing 20 repeated random samples according to the above strategies, using either ZD or concession as the sampling unit and stratifying between the relatively 'urban' areas of Ouargaye and Diapaga towns and the remaining d\u00e9partements. Each of the total 280 samples was then analysed by the individual parameters, and the results for each sampling approach were compared with the 'gold standard' of the complete census. The concept of accuracy within the samples, i.e. the extent to which a particular sample represents the whole population, was evaluated according to whether the mean of the 20 samples from each sampling approach lay within a particular tolerance of the unsampled value.Data were extracted from the Immpact database and only cases with complete information on each of the variables of interest were used for modelling, giving a total population of 85,428 households and 512,878 individuals. Data were aggregated at concession, ZD and d\u00e9partement level and repeated 1% random samples were drawn as above using SPSS version 13 syntax routines. On the basis of the impracticability of surveying part units, the concept of 1% sampling was taken to mean the selection of whole sampling units until the total sampled population exceeded the 1% target.Table The results from the means of the 280 samples are shown as percentages of the true unsampled value for each parameter by each sampling approach in Table Table By empirically modelling survey sampling procedures on a large dataset from a rural African setting this study has attempted to evaluate several commonly used sampling methods with regard to how well samples represent the 'true' unsampled population value of various parameters. Overall, all sampling methods and parameters tested here performed reasonably well in representing the overall population. Nevertheless, a degree of variation could be observed both between sampling approaches and between different parameters.As demonstrated in a similar study using English census data  the reliThe strategies presented in this study relate to the level above the household level and data from all households within selected concessions or ZDs were summarised once the concession or ZD had been chosen. However, the mean size of concessions is approximately 12 individuals . This is perhaps not surprising since such concessions are more likely to be comprised of family units and must always include the under-fives plus at least one carer. Random approaches to each of the sampling methods at concession level consistently gave a mean of the samples that underestimated the proportion of under-fives  as well as theoretical (population modelling) techniques. More extensive modelling using large existing data sets may create opportunities for generating realistic population simulations that could enable more sophisticated understanding of regular biases associated with differing methods, and subsequently more evidence-based selection of sampling strategies.Sample surveys are able to provide useful demographic and health profiles of local populations and, to be cost-effective, need be generalisable to the surrounding population. Sampling strategies are thus an important consideration, but various parameters being measured and their distribution within the sampling unit of interest may not all be best represented by a particular sampling method. It is likely therefore that compromises may have to be made in choosing a sampling strategy. Simple sampling approaches are not always less appropriate than more complex methods and are able to provide useful information for local public health planning, monitoring and evaluation, whilst needing less specialist expertise. Understanding the potential advantages and limitations of possible sampling methods in particular contexts is important for avoiding inappropriate population survey designs, particularly in settings lacking sampling frames.DHS: Demographic and Health Survey; DSS: Demographic Surveillance Site; DSA: Demographic Surveillance Are; ZD: Zone d\u00e9nombrement; VA: Verbal Autopsy; MMR: Maternal Mortality Rate; PPS: Probability Proportional to Size (sampling method); Conc. (in figures only): Concession.The authors declare that they have no competing interests.Both authors were involved in data acquisition and design of the study. EF performed data manipulation, analysis, and interpretation and drafted the first version of the manuscript. PB contributed significantly to the interpretation of findings and revision of the manuscript. Both authors read and approved the final manuscript."}
+{"text": "High throughput laboratory techniques generate huge quantities of scientific data. Laboratory Information Management Systems (LIMS) are a necessary requirement, dealing with sample tracking, data storage and data reporting. Commercial LIMS solutions are available, but these can be both costly and overly complex for the task. The development of bespoke LIMS solutions offers a number of advantages, including the flexibility to fulfil all a laboratory's requirements at a fraction of the price of a commercial system. The programming language Perl is a perfect development solution for LIMS applications because of Perl's powerful but simple to use database and web interaction, it is also well known for enabling rapid application development and deployment, and boasts a very active and helpful developer community. The development of an in house LIMS from scratch however can take considerable time and resources, so programming tools that enable the rapid development of LIMS applications are essential but there are currently no LIMS development tools for Perl.We have developed ArrayPipeline, a Perl toolkit providing object oriented methods that facilitate the rapid development of bespoke LIMS applications. The toolkit includes Perl objects that encapsulate key components of a LIMS, providing methods for creating interactive web pages, interacting with databases, error tracking and reporting, and user and session management. The MT_Plate object provides methods for manipulation and management of microtitre plates, while a given LIMS can be encapsulated by extension of the core modules, providing system specific methods for database interaction and web page management.This important addition to the Perl developer's library will make the development of in house LIMS applications quicker and easier encouraging laboratories to create bespoke LIMS applications to meet their specific data management requirements. High throughput investigation techniques such as microarrays are now well established in scientific research. As the costs of these techniques fall, greater numbers of laboratories are adopting these approaches. High throughput techniques and the equipment associated with them provide researchers with a number of new challenges, one of which is the management and storage of the vast quantities of data they generate. Laboratory notebooks and computer spreadsheets still form the data management strategy for many research scientists, and this simple approach has advantages in the ease of storage and viewing of the data for low throughput approaches however this approach is inadequate for the amounts of data generated using the latest laboratory techniques.The solution to this data management challenge is the implementation of a Laboratory Information Management System (LIMS), a computer application designed to track samples, store data generated by laboratory equipment and experiments and report these data. There are numerous commercial LIMS applications available however these can be very costly and sometimes overly complex. The system may also fail to support all the requirements a laboratory has, such as for a specialised piece of equipment with unique data import and export formats. For all of these reasons the development of an in house bespoke LIMS is often the best solution for a laboratory's data management requirements.The programming language Perl  has estaAs the creation of LIMS can take considerable time and resources, tools that can assist developers in common development tasks such as database interfacing and user interface programming are essential. Currently there are no LIMS development tools available for Perl; as a result we have developed the ArrayPipeline Toolkit providing object oriented methods for the rapid deployment of LIMS applications.ArrayPipeline has been developed as a suite of Perl modules written in an object oriented style to provide reusable code that behaves in a consistent manner. The toolkit includes a number of methods that extend the functionality of two Perl modules; DBI.pm the standard database interface module for Perl and CGI.pm, the common gateway interface class for Perl. Alongside Perl the toolkit has been developed using two other standards in bioinformatics application development; the open source database MySQL  and the LIMS::Controller is the core component of the ArrayPipeLine toolkit. It provides a single object handle for the multiple sessions and routes of data input and output created by the many tools necessary for building LIMS, such as CGI and DBI libraries, and also handles many basic administration functions. LIMS::Controller inherits from classes within two modules, LIMS::Web::Interface and LIMS::Database::Util, which independently control CGI and DBI services respectively. The methods for database interaction available in LIMS::Database::Util create a fully featured object layer to any relational MySQL database, with the majority of methods compatible with any SQL based database. The methods that make up the database object layer all extend code from Perl DBI (DataBase Interface) library, providing methods for inserting, updating and retrieving database rows. All the available methods are simple and easy to use but still provide flexibility to perform more complex database operations. There is also flexibility in the data structures used for inserting, updating and retrieving data. Other file formats, such as file formats, are handled as binary objects for storage in the database.The development of interactive web pages for user interaction, using HTML and the common gateway interface (CGI) protocol, is supported by a number of methods in the LIMS::Web::Interface module. The majority of these are extensions of methods from the Perl CGI library. Firstly upon the creation of a new LIMS object a Perl CGI object is automatically created, which can then be used to create web fill-out forms and parse their contents. One challenge associated with developing CGI applications is the maintenance of state across multiple pages. The creation of correctly formatted URLs incorporating CGI parameter values can be complex, so the LIMS::Web::Interface module contains forwarding methods that will transfer data across multiple CGI pages. The use of formatting methods also means that URLs are not hard coded into the CGI script, so any change to a URL can be made to a single configuration file rather than to multiple CGI scripts.via LIMS::Controller, provide a single consistent interface for capturing and reporting errors from Perl, CGI and DBI. One significant extension to the DBI library code is in the case of database inserts and updates; upon the generation of any errors, the LIMS object will issue a rollback command cancelling any changes made to the database during the transaction. The objects 'kill' method can test if any errors have been captured, and if so kill the script and print out the errors in either plain text or formatted HTML.The Perl language and the CGI and DBI libraries all have extensive error capture and reporting capabilities. The modules described above both contain error handling methods that, 'user_information' table in the LIMS database. If this step is successful then a session is automatically generated, however if inactive for longer than the set session time the session expires and authentication is again required. A 'log_out' method is also provided for ending the current session.Key to a successful LIMS is maintenance of data integrity, and this can be achieved through restricting access to sensitive pages to known and trusted users. The LIMS::Controller module extends Apache and MySQL authorization and security by providing methods for verifying the username and password of anyone attempting to access a restricted web page, using a One of the key components of high-throughput technologies is the microtiter plate, used for storage and manipulation of experimental samples. The LIMS::MT_Plate module encapsulates a microtitre plate, providing methods for creating and manipulating microtitre plate objects of different formats including 96, 384 and 1536 well plates, as well as individual tubes. A plate object for each microtitre format can be created, as child classes of the parental plate class they inherit all standard methods as well as specific information pertaining to each format. The standard features which can be used by all plate objects include methods for filling multiple and individual wells, the identity of samples in plate can be returned either as individual wells or collectively. Some of the most useful features of the plate object are concerned with whole plate manipulations, and methods are available to perform plate to plate transfers, join plates of a similar format into a larger format, or combine plates. The LIMS::MT_Plate module contains further methods for dealing with plates and samples, and is extremely useful for developing applications for tracking and manipulating samples contained in microtitre plates. This is a standalone module, which can also inherit from the LIMS package to automate data input and export.The LIMS object encapsulates a given LIMS, it inherits from LIMS::Controller, and enables simplified interaction with all the components of the LIMS including the database, web pages and plates. The object can quickly and easily be setup to work with a specific LIMS through editing a configuration file with parameters appropriate to the system in question. The configuration file parameters include database connection details, web set-up, directory structure and sections of HTML code for common web elements such as the page headers, footers and menus.Once configured, the LIMS object will significantly increase the speed of development of applications for the associated LIMS, such as in the creation of new web pages. Each web page is divided into a header, sidebar and footer, the HTML for which is stored in the configuration file. The generation of the LIMS object includes user session control utilising form parameters, and provides methods for formatting the HTML layout of a new page quickly and easily; the header and sidebar are both printed using a single method call, the page content is then added, and finally the page footer and parameter forwarding is printed with another method call.LIMS::ArrayPipeLine is an example of a LIMS object, and is the module that encapsulates our own laboratory's microarray LIMS. Together with a database schema, configuration file and cgi scripts, this module serves as a suitable template for most LIMS requirements, including the manipulation of microtitre plates, recording procedure and protocol information, and tracking individual protocol components. Access to LIMS::Controller functions is provided by a single class, LIMS::ArrayPipeLine::Pipeline_Owner, which enables the simple creation of inheriting classes that can interact with the LIMS database. An example of this is the module LIMS::ArrayPipeLine::Pipeline_Plate, which also inherits from LIMS::MT_Plate and provides methods that enable the creation of MT_Plate objects from database entries and vice versa.LIMS::Sample is a 'stripped down' version of LIMS::ArrayPipeLine, and is provided in the LIMS::Controller distribution as an example system. It consists of the components required for the tracking of microtitre plates and their contents, and includes a database schema, configuration file, CGI scripts and detailed installation instructions. Detailed annotation of the CGI scripts in this example system help to explain many of the features of the LIMS::Controller toolkit.The LIMS toolkit provides tools for the rapid development of LIMS applications including methods for the automation of web page development tasks, database interaction and for dealing with microtitre plates. These tools combine to provide the efficient creation of web pages for user interaction, allowing the developer to concentrate on functionality rather than layout. Methods for the creation and manipulation of microtitre plate objects importantly provide a consistent way for dealing with experimental samples contained in plates or tubes. The methods for database interaction provide a simple and consistent interface to any SQL based database for routine tasks such as inserts, updates and selects. The toolkit also provides flexibility in the methods, allowing more complex database operations to be performed. This provides consistency of design and purpose, while reducing the risk of errors in the code.This important addition to the Perl developer's library will facilitate the rapid development of bespoke LIMS applications using Perl.Project name: ArrayPipelineProject home page: Operating systems(s): Platform independentProgramming Language: PerlOther Requirements: Perl 5 or higherLicense: GNU General Public License (GPL)Restrictions: NoneThe author(s) declare that they have no competing interests.CJ led ArrayPipeline project development. JAM and CJ wrote all of the ArrayPipeline code and prepared this manuscript. IJJ and SAG provided infrastructure and funding support. SAG is the Director of Research at the Translational Research Laboratories. All authors have read and approve the final manuscript."}
+{"text": "This article reviews the application of the human airway Calu-3 cell line as a respiratory model for studying the effects of gas concentrations, exposure time, biophysical stress, and biological agents on human airway epithelial cells. Calu-3 cells are grown to confluence at an air-liquid interface on permeable supports. To model human respiratory conditions and treatment modalities, monolayers are placed in an environmental chamber, and exposed to specific levels of oxygen or other therapeutic modalities such as positive pressure and medications to assess the effect of interventions on inflammatory mediators, immunologic proteins, and antibacterial outcomes. Monolayer integrity and permeability and cell histology and viability also measure cellular response to therapeutic interventions. Calu-3 cells exposed to graded oxygen concentrations demonstrate cell dysfunction and inflammation in a dose-dependent manner. Modeling positive airway pressure reveals that pressure may exert a greater injurious effect and cytokine response than oxygen. In experiments with pharmacological agents, Lucinactant is protective of Calu-3 cells compared with Beractant and control, and perfluorocarbons also protect against hyperoxia-induced airway epithelial cell injury. The Calu-3 cell preparation is a sensitive and efficient preclinical model to study human respiratory processes and diseases related to oxygen- and ventilator-induced lung injury.  The airway epithelial is involved in the pathogenesis and treatment of many lung diseases, including adult and neonatal respiratory distress syndrome (RDS), chronic obstructive pulmonary disease (COPD), asthma, the adverse effects of positive pressure mechanical ventilation \u20134, and sin vitro models have been developed to study the mechanism of hyperoxia or positive pressure-induced lung injury and to evaluate any new therapies [Understanding the role of the airway epithelium and its response to injurious stimuli, therapeutic drugs, and interventions will aid in determining the mechanisms of airway injury and should facilitate the development of novel therapies for lung diseases. This experimental approach is one component of a robust approach to assess multiple aspects of respiratory pathophysiology. With the inherent difficulties of primary human lung cell culture and the limit of whole-animal studies, herapies , 7.in vitro models have been explored to study the airway epithelium response, we have focused on the Calu-3 cell line for the following reasons. (1) The Calu-3 cell line  is a well-differentiated and characterized cell line, that is derived from human bronchial submucosal glands [in vivo, serves as the barrier layer between inspired gas and other visceral tissues. This attribute is particularly advantageous for the evaluation of airway injury and response to medical treatments and respiratory therapeutic interventions. Air-liquid interface culture enables the approximation of the in vivo situation of mechanical ventilation and oxygen toxicity better than other in vitro models [3\u2212 and Cl\u2212 secretion, which reflects the transport properties of native submucosal gland serous cells [Although numerous l glands . In the l glands \u201312. By co models , such aso models , pulmonao models , and baco models . Devor eus cells .in vitro and in vivo. Partial liquid ventilation with PFC attenuates oxidative injury in experimental models of lung injury [in vivo [We have developed a sensitive and efficient model using Calu-3 cells cultured in an environmental chamber as a respiratory model to study the effects of oxygen concentration and exposure time , biophysg injury , 18. PFCg injury . Surfactg injury . Sinulpeg injury , preventg injury . An anim[in vivo .Apical fluid and protein secretions in Calu-3 cultures are similar to those from primary airway cultures and model many aspects of the intraluminal condition in the conducting airways of the lung. This model allows for the analysis of airway tissue tolerance of oxygen exposure without the confounding variables of a whole-animal model. in vitro experiments, clinically relevant outcomes were measured to assess the effect of respiratory interventions. Since airway inflammation is commonly a result of barotrauma and oxygen toxicity, ELISA techniques detect changes in the proinflammatory cytokines IL-6 and IL-8. Pulmonary edema also results from airway injury, and, to model this outcome, total protein is measured in the apical wash fluid. Similarly, Calu-3 monolayer integrity and cellular physiology are assessed by measuring changes in transepithelial electrical resistance (TER). In previous studies, we found that TER correlates with FITC dextran flux from the basolateral to the apical aspect of the monolayer [In these onolayer . FinallyThis article introduces specific experimental methods for inducing environmental changes on Calu-3 cells, which are similar to clinical interventions practiced in respiratory management. In this regard, the methods discussed enable the study of changes in environment, gas concentrations, biophysical stresses, and therapeutic interventions on airway epithelial cells as a function of time and treatment.Calu-3 cell culture techniques are well described elsewhere , 12, 13.Apical surface fluid washings are the source of biologically active substances secreted apically by Calu-3 cells, and this fluid is used to model the airway compartment of the lung. A sample of the Calu-3 apical surface fluid (ASF) is collected from each transwell insert for each experimental condition so that the response of individual monolayers is assayed. Experiments are designed so that each monolayer is used only once. Therefore, it is necessary to use multiple plates over the course of each experiment. For example, if the response of Calu-3 monolayers to a specific concentration of oxygen is assayed over a 48-hour period, three plates are used. The first plate is used for the control condition, the second for 24-hour outcomes, and the third for outcomes at 48 hours.\u03bcL of sterile normal saline. Washes are combined for a total of 280\u2009\u03bcL for each individual monolayer per sample. Samples are centrifuged for 15 minutes at 13,000\u2009rcf and at 4\u00b0C, and the supernatants stored in aliquots at \u221270\u00b0C for subsequent analysis. The levels of IL-6 and IL-8 in Calu-3 ASF were measured with quantitative ELISA using human IL-6 and IL-8 Quantikine ELISA kits . Calu-3 ASF washings used in the assay were appropriately diluted. All standards and samples were assayed in duplicate. The test sensitivity for respective immunoassays was as follows: IL-6 (0.039\u2009pg/mL) and IL-8 (10\u2009pg/mL). Interassay and intraassay coefficients of variance are less than 10%.ASF from Calu-3 cells is collected in the following fashion , 12. The\u03bcm thick) and stained with hematoxylin and eosin (H&E) for histological analysis  obtained by harvesting the cells from transwell filters by trypsinization. Using 20\u2009with H&E . CytomorTo establish specific environmental conditions for the experiments described below, a sterile modular incubator chamber  is used. Cell culture plates are placed into the chamber, and it is sealed with Dow Corning high vacuum grease . With the chamber sealed and airtight, it is ready to be pressurized to a maximum of 2 pounds per square inch (PSI). To finalize the chamber setup, the appropriate devices and gas sources with or without a humidifier are attached to the chamber inlet. A three-way stopcock is used to attach a pressure gauge, oxygen analyzer, or flow meter to the outlet of the chamber .Supplemental oxygen administration is an important component of patient care in respiratory medicine and is critical to the maintenance of organ homeostasis and neurological function; however, oxygen can be toxic to tissues of the lung and airway. The mechanisms of this toxicity include oxidative injury with the generation of free radicals and direct disruption of cell membranes. Strategies to control oxygen concentration and exposure time are employed clinically as a means to control airway oxidative injury. In the laboratory, it is possible to study the thresholds and exposure times that can be detrimental to airway epithelial cells, and these findings may provide clinically relevant insights into bedside management. 2 are exposed to normoxia  or graded hyperoxia  using the chamber described above. To obtain the desired oxygen concentration, the inlet and outlet ports of the chamber are opened and attached to a Servo O2-air 960 mixer , a 95% oxygen tank, 5% CO2, and air balance tank. The blended gas is warmed and humidified with an MR730 respiratory humidifier . The appropriate gas concentration is flushed through the airtight chamber for 20 minutes at a flow rate of 3 LPM. The chamber oxygen level is monitored with an oxygen analyzer (MAXO2) . After the chamber is purged, the gas source is disconnected; the chamber is sealed and placed into a continuous flow CO2 incubator at 37\u00b0C. The gas in the chamber and the medium in the plates are changed every 24 hours by following the same procedure.The effect of oxygen concentration on Calu-3 cell structure and function is assessed in the following manner . Calu-3 in vitro modeling. Injury due to positive pressure can result from pressure, stretch, or both [Positive pressure support is also a commonly employed strategy to support respiration in the face of respiratory failure. Positive pressure may be fixed (continuous positive pressure) or cycled (intermittent mandatory ventilation) depending upon the clinical situation and requirements of the patient. As with oxygen therapy, positive pressure ventilation can be damaging to the lung and airways, and strategies to minimize airway injury can be developed through  or both , 26, but2) and hyperoxia (60%\u2009\u2009FiO2) with and without +20\u2009cmH2O pressure for 24 or 72 hours. When the manometer reading reached the desired level and the temperature reading was 37\u00b0C, the inlet and outlet of the chamber were clamped and disconnected from the gas. The gas in the chamber and the medium in the plates were changed every 24 hours and the conditions again verified.To model the airway injury due to the effects of continuous positive airway pressure (CPAP), monolayers are exposed to the experimental conditions designed to model continuous positive pressure therapy using the incubator chamber. The desired gas concentrations are achieved by following the protocol as described above. The outlet of the chamber was attached to a R\u00fcsch pressure manometer  to achieve normoxia  or basolateral (blood side) treatment of monolayers and explore potential differences between these modes of drug delivery. As is discussed below and in the results reported later, our laboratory has evaluated a number of clinically relevant compounds and medications to assess the effect of treatment on Calu-3 cell responses to various stresses. The agent of interest is layered onto the apical surface of the monolayer.2 = 21%, FiCO2 = 5%, balance nitrogen) or hyperoxic  conditions.Mature Calu-3 monolayers treated with perfluorochemical liquid perflubron (PFB) were exposed to normoxic , or Beractant . Treated monolayers were exposed to normoxic  or hyperoxic  conditions using a modular environmental chamber for 24 or 72 hours in an incubator at 37\u00b0C.Calu-3 cell monolayers cultured at an air-liquid interface were treated apically with 140\u2009P < .05; n = at least 6 monolayers for each condition.The experimental design used was an independent group method in which each experiment was performed on a unique monolayer. At least 6 samples were used for each group. Statistical analysis was performed using Statistical Package for the Social Sciences  software. All data are expressed as mean \u00b1 SEM. Differences between conditions for each parameter were analyzed using two-way analyses of variance (ANOVA). Where applicable, one-way ANOVA were run across groups at each time interval , and post-hoc analyses were done using Bonferroni comparisons. Significance was accepted with 2) demonstrate cell dysfunction and inflammation in a dose-dependent manner [2 groups. IL-6 secretion was elevated in all hyperoxic groups at 24 hours, and both IL-6 and IL-8 levels were greater in the 40% FiO2 group compared with all other groups at 72 hours [Calu-3 cells exposed to graded oxygen concentrations  but not in the control and hyperoxia only groups, which were not different from each other at 24 hours (P > .05). By 72 hours, cell viability was different in all groups, in which the hyperoxia-exposed group was less than the control group (P < .05) and greater than both pressure-exposed groups (P < .001) (P < .001). At 72 hours, TER for the hyperoxia-exposed monolayers was less than that for the other treated groups (P < .001). Similarly, both IL-6 (P < .001) but not in the control and hyperoxia alone groups. The pressure-exposed groups were greater than the control and hyperoxia groups (P < .001) but not different from each other (P > .05). Cytospin preparations of Calu-3 cells showed normal cellular histology in the 21% FiO2 group at both time points, whereas the pressure- and hyperoxia-exposed groups showed more swollen nuclei and intracellular vacuoles  . In Figuoth IL-6  and IL-8oth IL-6  increasevacuoles .2 for 24 or 72 hours [Calu-3 monolayers treated with either normal saline, Lucinactant, or Beractant were exposed to 60% FiOCalu-3 cells treated with perflubron (PFB) and hyperoxia showed an increase in TER value, improved histology, decreased total protein secretion in ASF washings, and unaltered IL-8 secretion . CytomorIn this paper, we present our experience using Calu-3 cells as a model for assessing the effects of oxygen concentration, positive airway pressure, and several clinically relevant pharmacological agents on various parameters of lung and airway injury. Under atmospheric conditions, Calu-3 cells have been widely used to model lung pathophysiology and therapeutics. Although immortalized, Calu-3 cells are of human derivation  and exhi2O), or a combination of hyperoxia and positive pressure, a group effect for cell viability revealed that hyperoxia was less detrimental than pressure, but both insults in combination are more detrimental than either independently. At 24 hours, TER decreased acutely in all treated Calu-3 monolayers, and there appeared to be at least partial recovery in some groups by 72 hours. In the current experiments, the proinflammatory mediators IL-6 and IL-8 secretion increased over time for up to 72 hours for pressure groups. We can speculate that positive pressure triggered airway epithelial cells to secrete more proinflammatory mediators than hyperoxia alone, and the combination of positive pressure and hyperoxia did not appear to be additive. The lack of IL-6 and IL-8 secretion in response to hyperoxia was somewhat surprising but suggests that a higher FiO2 may be required to elicit a response in this model. Cell morphology of Calu-3 cells after exposure to 72 hours of normoxia or hyperoxia with or without +20\u2009cmH2O pressure showed more swollen nuclei and intracellular vacuoles for pressure-treated cells than that for the control and hyperoxia alone groups, whereas normoxia-exposed cells exhibited normal cellular histology. These data suggest that Calu-3 monolayers are sensitive to hyperoxia and positive pressure, but that pressure may exert a greater injurious effect and cytokine response. These effects vary with the severity and duration of the stress.In the model of continuous positive airway pressure, in which Calu-3 monolayers were exposed to normoxia (control), hyperoxia, pressure . However, it should be noted that the absence of systemic inflammation, circulatory factors, and other paracrine systemic influences is a potential limitation of the isolated cell system and should be carefully considered for certain investigations."}
+{"text": "All mothers donating umbilical cord blood units to the NHS cord blood bank undergo an assessment for the likelihood of prior exposure to malaria infection. Those deemed at risk due to a history of travel to, or residence in, malaria endemic regions are screened serologically to detect anti-malaria antibodies. A positive result excludes the use of the cord blood for transplant therapy unless a risk assessment can ensure that malaria transmission is extremely unlikely. This paper details the screening of cord blood units from malaria serology positive mothers to detect malaria parasite DNA using a highly sensitive nested PCR.Uninfected blood from a healthy volunteer was spiked with known quantities of malaria parasites and 5 millilitre and 200 microlitre aliquots were subjected to DNA extraction using QIAamp DNA maxi and DNA mini kits respectively. Nested PCR, to detect malarial SSU rRNA sequences, was performed on the purified DNA samples to determine the limit of detection for this assay with both extraction methodologies. Following assay validation, 54 cord blood units donated by mothers who were positive for anti-malaria antibodies were screened by this approach.When DNA was purified from 5 millilitres of blood it was possible to routinely detect as few as 50 malaria parasites per millilitre using nested PCR. This equates to a significant increase in the sensitivity of the current gold standard nucleic acid amplification technique used to detect malaria parasites (routinely performed from > 200 microlitre volumes of blood). None of the 54 donated cord blood units from serology positive mothers tested positive for malaria parasites using this scaled up DNA preparation method.Serological testing for malaria parasites may be overly conservative, leading to unnecessary rejection of cord blood donations that lack malaria parasites and which are, therefore, safe for use in stem cell therapy. Umbilical cord blood units (CBUs) are a rich source of stem cells. An ever increasing number of conditions have been treated using cord blood stem cells, with an estimated 20,000 people having received such therapy to date for conditions such as malignancies, immunodeficiencies , metabolCurrently, nested PCR  is the mPlasmodium falciparum. Parasites were synchronized using sorbitol to remove all forms other than ring-stage (early) trophozoites [9 per ml, this equates to 1.5 \u00d7 108 parasites per ml. Serial dilutions in the same uninfected blood were made to produce samples with effective parasite densities of 5000, 500 and 50 parasites per ml. DNA (both human and parasite) was purified from 5 ml and 200 \u03bcl of frozen blood using the QIAamp DNA Blood maxi kit and the QIAamp DNA blood mini kit respectively , as per manufacturer's instructions. For the 5 ml and 200 \u03bcl samples the final elution used 1 ml and 100 \u03bcl of buffer EB. From each eluate, 5 \u03bcl was analysed using a nested PCR approach as per published methods to amplify P. falciparum, Plasmodium vivax, Plasmodium malariae and Plasmodium ovale small sub-unit ribosomal RNA sequences [Plasmodium ovale is best described as two sister species of which can be differentiated by use of the nested PCR; DNA from the so-called variant type  does not amplify with this assay [P. ovale curtisi and P. ovale wallikeri reliably. To ensure the spiked blood samples contained the correct density of parasites, the QIAamp DNA mini eluates were titred using a real-time PCR assay against DNA from 200 \u03bcl aliquots of a ten fold dilution series of the WHO international standard for P. falciparum [Assay validation was performed with in vitro cultured parasites of the 3D7 strain of hozoites . The purequences . Plasmodis assay . To overis assay . The reslciparum ,18. All Plasmodium species DNA as above. The study was granted ethical approval by the Research Ethics Committee (REC) of University College London Hospitals (REC reference 07/Q0505/60) and all mothers gave written informed consent that CBUs could be used for research if they were rejected for use in transplant therapies.Following assay validation, DNA was extracted from 54 umbilical CBU donations from mothers who were positive for malaria antibodies by the EIA assay and the DNA was amplified to determine the presence or absence of In validation experiments, uninfected umbilical cord blood spiked with cultured malaria parasites was routinely positive by amplification for samples with parasite densities at or above 500 parasites per millilitre. This was true for DNA extracted from either 5 ml or 200 \u03bcl of this blood. With spiked blood containing 50 parasites per millilitre, positive amplification was achieved in 85% (17/20) of PCR reactions using DNA prepared from 5 ml of blood. By contrast, only 30% (6/20) of PCR reactions showed positive amplification when using DNA prepared from a 200 \u03bcl aliquot. Thus, at this level of parasite density there is a significant improvement in the rate of detection when using the larger blood volume for DNA preparation . No amplification was seen with DNA preparations from uninfected adult human peripheral blood or umbilical cord blood spiked with lower levels of parasites.None of the 54 CBUs analysed using manual extraction of 5 ml by the maxi preparation method showed the presence of detectable parasite DNA from any of the five parasite species tested in the assay. All positive control DNAs from infected patient samples amplified correctly in these assays.P. falciparum parasites using nested PCR. This can be readily explained by the density of parasite genomes in the resultant eluates. 5 ml of blood with a parasite density of 50 parasites per ml will contain approximately 250 parasites. Assuming a 100% recovery of DNA in the 1 ml eluate, then on average there will be 1.25 parasites genomes within the 5 \u03bcl of eluate assayed. When only 200 \u03bcl of blood is extracted using Qiagen miniprep kits, such a parasite density would result in at best 0.5 parasite genomes within an amplification reaction, even where 100 \u03bcl of elution buffer is used to purify DNA in order to maximize DNA concentration. Even with the multi copy target used in this assay, 0.5 parasite genomes appears to be too little DNA to support reliable amplification. In addition to this increased DNA concentration, the ability to sample a much larger volume of blood will decrease sampling variability and also serve to increase the reliability of the assay.The use of larger blood volumes for DNA preparation offers a significant improvement in the limit of sensitivity of detection for the diagnosis of P. falciparum using real-time amplification allows an unbiased estimation of parasite density and therefore a greater confidence of the limits of detection of a given assay. Our reported limits of detection for nested PCR using QIAamp mini kit derived DNA are also in good accordance with a comparable study [Within the literature there are reports of amplification from blood samples containing as few as 20 parasites per ml . It is hle study .Even though the extraction of 5 ml blood volumes represents a significant improvement in diagnostic sensitivity, it most likely that the time and costs involved in the manual extraction of large volumes of blood and the subsequent analysis by nested PCR would preclude such a technology for the routine diagnosis of malaria. Nor could such an approach feasibly be applied to the wide spread identification of very low level infections as part of a malaria elimination programme, as again the cost in materials and personnel-hours would be prohibitive. However, for applications such as the screening of material for transplantation, where it is essential that sensitivity is maximized to prevent the transference of parasites into an immuno-compromized person, the assay could prove a valuable method to help ensure the safety of donations from Ab-positive individuals.P. falciparum variants known to preferentially target pregnant women and establish placental infections [From studies within locations endemic for malaria, the probability of detecting malaria parasites within CBUs has been shown to be significantly increased by a high density of parasites in the mother's peripheral blood and intervillous placental blood. Within a cohort of Kenyan women, those with peripheral blood parasite densities in the highest tercile  had a three fold higher probability of having malaria parasites in their cord blood  compared to the middle tercile . However, a lack of detectable parasites in the peripheral blood is not refractory to the presence of parasites in the cord blood (6.5% of women who had no detectable circulating parasites had parasites in their cord blood) . It is tfections ,20. HoweGiven that this assay requires 5 ml of blood it may be unrealistic to run the assay routinely on all CBU donations from mothers potentially exposed to malaria, but as standard practice in the NHS cord blood bank is to collect blood samples for red cell grouping from red cell \"waste\" product removed during the processing of CBUs, an additional 5 ml sample could be taken for malaria PCR testing in the event of a positive malaria antibody result. Even where CBUs are not to be tested directly, the risk of malaria infection from serologically positive mothers needs to be re-evaluated in the light of this work. This would be especially relevant in the cases of recipients suffering from illnesses with high childhood mortality, and where prognosis has been shown to be dramatically improved following transplantation of umbilical cord blood stem cells .Malaria antibody positivity in a UK mother who donates cord blood should not be an automatic contraindication to its subsequent use in stem cell transplantation. Transplantation could proceed after an individual risk assessment, preferably including NAAT, with careful monitoring of the recipient.The authors declare that they have no competing interests.Study design by CJS, SDP, PLC, MH and FR; maternal malaria risk data collected by MH; DNA extraction and amplification was performed by SDP; Manuscript was written by SDP, CJS, FR and PLC. All authors read and approved the final manuscript."}
+{"text": "Farm workers are at a very high risk of occupational diseases due to exposure to pesticides resulting from inadequate education, training and safety systems. The farm worker spends a lot of time exposed to these harmful agrochemicals. Numerous acute cases with symptoms typical of agrochemical exposure were reported from the commercial farms. We assessed the health effects of agrochemicals in farm workers in commercial farms of Kwekwe District (Zimbabwe), in 2006.An analytical cross sectional study was conducted amongst a sample of 246 farm workers who handled agrochemicals when discharging their duties in the commercial farms. Plasma cholinesterase activity in blood specimens obtained from farm workers was measured using spectrophotometry to establish levels of poisoning by organophosphate and/or carbamates. Information on the knowledge, attitudes and practices of farm workers on agrochemicals use was collected using a pre-tested interviewer administered questionnaire. Bivariate and multivariate analyses were conducted to determine factors that were associated with abnormal cholinesterase activity.1:=1 year, Q3:=7 years). Ninety eight (41.5%) farm workers knew the triangle colour code for the most dangerous agrochemicals. Not being provided with personal protective equipment  and lack of knowledge of the triangle colour code for most dangerous agrochemicals  were significantly associated with abnormal cholinesterase activity.The prevalence of organophosphate poisoning, indicated by cholinesterase activity of 75% or less, was 24.1%. The median period of exposure to agrochemicals was 3 years (QThere was organophosphate poisoning in the commercial farms. Factors that were significantly associated with the poisoning were lack of protective clothing and lack of knowledge of the triangle colour code for most dangerous agrochemicals. We recommended intensive health education and training of farm workers on the use of agrochemicals, provision of adequate and proper personal protective equipment as mitigation measures to this problem. Agriculture mortality rates have remained consistently high throughout the world in the last decade in contrast to other dangerous occupations . Farm woZimbabwe is one of the developing countries whose economy is mainly based on agriculture and in order to make foodstuffs of high quality and quantity, extensive use of agrochemicals is implemented . In viewAgrochemicals are known to find their way in the blood systems of human beings through the mouth, nose, intact skin and the eyes. Several adverse health effects are known to result from exposure to pesticides including temporary acute effects like irritation of eyes and excessive salivation as well as chronic diseases like cancer, reproductive and developmental disorders. Effects on the Central Nervous System (CNS) like restlessness, loss of memory, convulsions and coma are also common. In addition, effects on parasympathetic and sympathetic nervous system have been widely reported including respiratory paralysis which is fatal .More than 25% of the population of Zimbabwe is in commercial farming areas and with the current land reform programme, the figures are increasing. Although no official statistics regarding chemical poisoning have been reported in Zimbabwe, researchers have established through biological monitoring that prevalence due to agrochemical poisoning is as high as 30% . With thKwekwe District is in the Midlands Province of Zimbabwe and has approximately 291 large and small scale commercial farms. The use of agrochemicals in these farms is rampant. The district repeatedly reported high incidence (26%) of acute cases like excessive irritation, salivation, diarrhoea and fever which are typical symptoms that are associated with agrochemical exposure and were coming mainly from its commercial farming areas . This stAn analytical cross sectional study was conducted in Kwekwe District commercial farms among farm workers who handle agrochemicals when discharging their duties. Eleven farms were randomly selected using the lottery method from 30 farms in the southern part of the district. We excluded farms in the northern areas where indoor residual spraying for malaria control was conducted annually to avoid chemical poisoning due to malaria vector control.For our sample size we assumed 95% confidence level and expected prevalence of pesticide exposure (p) of 20%  and abso2 \u00d7 246 \u00d7 (p \u00d7 (1\u2212p)/d2)The required sample n=zStratified sampling was conducted from one farm to the next until the required sample size was achieved. At each farm, farm workers whose duties involved contact with agrochemicals were categorized into the seven types of exposures that were identified namely, spraying, mixing, stores management, loading, repairing spraying equipment, working in recently sprayed areas and waste management of the agro-chemicals. A sampling fraction at each farm was calculated based on the numbers of farm workers in the types of exposures studied. This sampling method was conducted from one farm to the next until the required sample of 246 participants was achieved. These were then interviewed and 1\u00b5l of blood samples was collected from those who consented to the required blood test.Plasma cholinesterase activity in blood specimens obtained from farm workers was measured using spectrophotometry to establish levels of poisoning by organophosphate and/or carbamates. A mixture of blood, indicator (bromothymol blue) and acetylcholine perchlorate was prepared and allowed to stand for 10-15 minutes. The change in pH during this time period was measured by comparing the colour of the mixture with a set of permanent coloured glass standards contained in a disc. The change of pH was a measure of the level of cholinesterase activity in the blood. Harmful exposure to agrochemicals was defined as blood cholinesterase activity levels of 75% or less ,9. A bloThe design of the questionnaire was guided by the Health Belief Model (HBM) . All theEthical approval to conduct the research was obtained from Medical Research Council and permission from relevant government structures and farm owners. Confidentiality was assured to the participants and a signed informed consent form was used to prove that each participant had agreed to be interviewed and to have blood collected and tested.We analyzed the data using Epi Info 2002 to generate frequencies, Odds Ratios (OR), 95% Confidence Intervals (CI) and p-values. Bivariate and multivariate analyses were conducted to determine factors that were associated with abnormal cholinesterase activity. Data from farm management were captured and analyzed by grouping together similar important points as well as noting some important contrasting information if there was any.1=22 years, Q3=37 years). The median period of working with agrochemicals was 3 years . More than half (51.6%) of the respondents had at least attained secondary education. One hundred and fifty five (63%) were married, 64 (26%) were single and the remainder were either widowed or divorcees. Hundred (64.5%) of the married respondents had their spouses working as farm workers at the same farm or another farm.One hundred and forty nine (60.6%) of the respondents were males and 97 (39.4%) were females. The median age was 28 years (QOut of 241 (98%) respondents who consented to blood test for cholinesterase activity, 58 (24.1%) of them had abnormal cholinesterase activities of 75% or less. More females than males were affected although the difference was not statistically significant (p=0.05). The most affected age group was the 21 -30 years with 24 (41.4%) of the cases. Amongst the 58 farm workers with abnormal cholinesterase activity the most affected were sprayers (50%), followed by those who worked in previously sprayed areas 49%, loaders (31%), mixers (29%), repairers (22%), waste disposers (9%) and lastly stores managers (7%).The respondents generally knew all possible routes of entry of agrochemicals into the human blood system. The routes of entry of agrochemicals were stated as nose (96%), mouth (95%), eyes (88%) and skin (83%).One hundred and ninety eight (80.8%) knew that triangle colour codes on agrochemical containers represent degree of toxicity of the agrochemicals. Ninety eight (41.5%) knew that the most dangerous triangle colour code was purple. Those who did not know the meaning of any triangle colour code of agrochemical were more than 2 times  likely to have abnormal cholinesterase activity  than those who were knowledgeable .Two hundred and eleven (85.8%) of the respondents knew and agreed that they were at risk of agrochemical exposures. In addition, the respondents knew that personal protective equipment (PPE) could protect them from agrochemical exposure (95.5%), periodic medical checks were beneficial (98.4%), reporting ill health to management was beneficial (91.1%) and that health education on agrochemicals was beneficial (97.6%). The perceived barriers to avoiding agrochemical exposure were the unavailability of alternative jobs (75%), management not adequately protecting workers (54%), PPE not provided (29%), fear by farm workers to report ill health to management (18%) and PPE causing discomforts and therefore could not use them (15%).Twenty five (22.5%) reported to management when they got ill, 44 (39.6%) visited health facilities, 25 (22.5%) did nothing, whilst 6 (5.4%) treated themselves with drugs. The commonly implicated agrochemicals were Gramaxone 60 (36.6%), Tamarone 40 (24.4%), Monochrotophos 23 (14.0%), Rogor 20 (12.2%), Karate 20 (12.2%) and Dimethoate 19 (11.6%).One hundred and eleven (45.1%) stated that they once suffered an illness that they knew or suspected to have been caused by agrochemicals. The five most common symptoms reported were headache (66.7%), cold/flu (62.2%), weakness (45.9%), dizziness (41.1%) and skin irritation (39.0%). The study did not however establish any significant association between the different forms of symptoms and abnormal cholinesterase activity .One hundred and seventy six (71%) respondents were provided with at least one form of PPE. The commonest type of PPE provided was overalls (65%), gumboots (43%), gloves (22%), face masks (15%), hat 5% and goggles (4%). More males than females (130/149 vs. 44/97) were provided with PPE. Not being provided with PPE was significantly associated with abnormal cholinesterase activity . In addition, being provided with a face mask was also found to be significantly associated with abnormal cholinesterase activity  .The association of number of hours of exposure to agrochemicals with abnormal cholinesterase activity was explored using those who were working with agrochemicals for less than 2 hours as the reference population. It was established that working for more than 8 hours per day with agrochemicals was significantly associated with abnormal cholinesterase activity  .Logistic regression with the several variables under KAP, provision of PPE, health symptoms and frequency of exposure to agrochemicals based on the outcome of either having or not having abnormal cholinesterase activity was conducted using the step down regression approach and lack of knowledge on triangle colour codes and having no PPE emerged as the significant risk factors .All the farm owners agreed that their farm workers were susceptible to agrochemical exposures. They all did not have workplace health and safety programs in place. The major precaution they highlighted was the provision of PPE to the farm workers and close supervision to ensure proper use of agrochemicals. Farm owners reported making sure that farm workers were not eating or smoking during handling of agrochemicals. In addition, they restricted workers who conduct spraying to the lowest number possible in circumstances where boom spraying was not possible. The farm workers did not undergo pre-employment and routine annual medical checks to ensure that they were fit for the job they were employed for and to obtain baseline data. Responsibility for the health and safety of the farm workers was on the farm owners themselves.The farmers stated that there were no guidelines in use to cater for the welfare of the farm workers. They also reported that they were burning all chemical waste containers and made sure that all chemicals prepared for use each day were all used. Empty chemical containers were not allowed to be taken home by farm workers for their own use. This was put in place in order to avoid chemical poisoning in the homes of the farm workers.The major challenges highlighted by the farmers were deaths related to absenteeism from illnesses like headache, abdominal pains, weakness and the like. The nearby clinic was reported having inadequate stocks of drugs to treat diseases that most farm workers were suffering from.The study revealed that the prevalence of abnormal cholinesterase activity due to agrochemical poisoning amongst the farm workers was 24.1%. The farm workers were exposed to unacceptably high levels of pesticides . The result is consistent with previous studies conducted in Zimbabwe before the resettlement program ,11\u201313. TThis study also established that provision of PPE to the farm workers was lacking and where it was provided, it was inadequate. Although this study did not include the issues of appropriateness and proper usage of the PPE we cannot rule out this to be an aggravating factor. Being provided with face masks was found to be a significant risk factor. This might mean the type of PPE was either inappropriate or was not being used properly. The face masks were possibly concentrating the agrochemicals close to the nasal areas increasing risk of poisoning through inhalation or they were not being used at all because they were perceived as a hindrance to smooth air flow by the farm workers.This study also revealed that males were less likely to have abnormal cholinesterase activity compared to females although this was not statistically significant. We established that women were mainly working in areas that would have been sprayed previously without any PPE and indirectly came into contact with residual or suspended aerosols of pesticide. Lu showed that those who re-entered recently sprayed areas had higher risk of poisoning than those who did not . On the More than 80% of our participants knew the routes of entry of pesticides in the human body and the triangle colour coding. They even knew the pesticides that were responsible for their poisoning. Contrary to this, a study in Tanzania established that majority of farm workers knew that pesticides could enter the human body and showed awareness of potential health hazards of the different pesticides used in their service areas but they did not recognize what pesticides were responsible for the poisonings .However, not knowing the triangle colour code for the most dangerous agrochemicals (purple triangle) was significantly associated with abnormal cholinesterase activity. The workers may not have taken precautionary measures when handling agrochemicals due to ignorance resulting in high exposures that affected their cholinesterase activity. Other studies have shown that the preventive measures that were taken by farm workers were low, and the lower their knowledge was, the lower were the preventive measures applied .Forty five percent of the participants stated that they had suffered some multiple symptoms at one point in time that they knew or suspected to have been caused by pesticide exposure. Salameh et al also established that agricultural workers have a higher prevalence of multiple symptoms, which may be due to sub-acute intoxications by pesticides that did not need hospitalization. In addition, the workers had a higher risk of having an acute intoxication due to pesticides thereby exposing them to life-threatening situations .Working for more than 8 hrs per day was significantly associated with abnormal cholinesterase activity. It is expected that working more than the stipulated number of hours per day can be strenuous and fatigue cripples in thereby reducing compliance to the stipulated precautionary measures.Spray men were affected more by chemical exposure followed by those who were working in sprayed areas. The repairers and waste disposers were the least affected. Unlike other studies, none of the types of exposures studied here was significantly associated with cholinesterase activity ,13. AlthSome limitations in our study were that we did not have time to look at the process of handling agrochemicals from stores to disposal due to time and resource constraints and we relied on the self reported information. Recall bias cannot be ruled out.The prevalence of abnormal cholinesterase activity among the farm workers due to chemical poisoning was high. The major exposures were spraying and working in the sprayed areas. Ignorance of the colour codes for the dangerous agrochemicals, working for more than 8 hours per day, not being provided with PPE and being provided with face masks were significantly associated with abnormal cholinesterase activity. Intensification of health education and trainings on agrochemicals handling and use, reduction of number of working hours to normal 8 hours or less, provision of adequate and proper PPE and periodic medical checks for farm workers were recommended from the findings of the study."}
+{"text": "Early recurrence after resection of colorectal liver metastases (CLM) is common. Patients at risk of early recurrence may be candidates for enhanced preoperative staging and/or earlier postoperative imaging. The aim of this study was to determine if there are any risk factors that specifically predict early liver-only and systemic recurrence.Retrospective analysis of prospective database of patients undergoing liver resection (LR) for CLM from 2004 to 2006 was undertaken. Early recurrence was defined as occurring within 18\u00a0months of LR. Patients were classified into three groups: early liver-only recurrence, early systemic recurrence and recurrence-free. Preoperative factors were compared between patients with and without early recurrence.P\u2009<\u20090.05). Sixty-six patients (27%) developed early systemic recurrence. Tumour size \u22653.6\u00a0cm and tumour number (>2) were significantly associated with early systemic recurrence (P\u2009<\u20090.001).Two hundred and forty-three consecutive patients underwent LR for CLM. Twenty-seven patients (11%) developed early liver-only recurrence. Dukes C stage and male sex were significantly associated with early liver-only recurrence (It is possible to stratify patients according to the risk of early liver-only or systemic recurrence after resection of CLM. High-risk patients may be candidates for preoperative MRI and/or computed tomography-positron emission tomography (CT-PET) scan and should receive intensive postoperative surveillance. The liver and lungs are the most frequent sites of distant metastases from colorectal cancer (CRC). Following diagnosis, 50% to 60% of patients with CRC will develop colorectal liver metastasis (CLM) , and 11%Despite surgical resection, the relatively high recurrence rate is likely due to occult micro-metastases. Local and/or systemic recurrence may develop within months to years after LR . Early ret al. have shown that T3-T4, synchronous CLM and limited resection margins increase the risk of recurrence [The risk factors for recurrence after LR are well documented and relate to the biology and stage of the primary tumour, the burden of liver metastases and the response to chemotherapy ,5,18. Recurrence . In addicurrence . These pPatients at risk of early recurrence may also benefit from neoadjuvant or adjuvant chemotherapy. The aim of this study was to identify predictors of early liver-only or systemic recurrence after resection of CLM.We reviewed our prospectively held departmental database to identify all patients who had undergone LR for CLM between January 2004 and December 2006 inclusive. Two hundred forty-three patients were identified. Patients were considered for LR after clinical evaluation and pre-operative staging with a chest, abdominal and pelvic CT scan. All patients were discussed within a specialist hepatobiliary multidisciplinary team meeting. MRI was performed selectively in patients with advanced primary tumours (T4 or N2) or synchronous metastases. CT-PET was performed in selected patients to assess any suspicious extra-hepatic lesions detected by CT.After initial LR, patients underwent regular clinical assessment, serial serum CEA measurement and surveillance CT scans at 1 and 2\u00a0years postoperatively. In this study, early recurrence was defined by the presence of either liver-only or systemic (with or without liver involvement) disease within 18\u00a0months after liver resection. Eighteen months was selected as a cut-off based on an analysis of the timing and pattern of postoperative recurrence in the entire cohort. The reason for opting for this time period is illustrated in Figure\u00a0post hoc pairwise tests were performed between the non-recurrence group and both recurrence groups, in order to test for significant differences. A similar approach was applied to the binary variables in which a Fisher\u2019s exact test was performed on all three groups initially, with post hoc tests used to compare the non-recurrent patients with patients in the other two groups. Patient survival was calculated using Kaplan-Meier estimates. P values <0.05 were considered statistically significant.It is unlikely that enhanced preoperative staging  would detect additional sites of disease in patients who subsequently develop recurrence beyond 18\u00a0months after surgery. Potential risk factors for early recurrence were identified including clinical, radiological and pathological parameters: age, gender, site and nodal status of the primary CRC, the size and number of hepatic tumours. Pre-operative CEA was not included in the analysis due to incomplete data. Initially, for the purposes of analysis, a range of variables was compared between the three study groups (No recurrence/Liver recurrence/Systemic recurrence). For the continuous variables, a Kruskal-Wallis test was performed to test for variations between the three groups. Where this was significant, In this study, 243 patients underwent LR of CLM with curative intent between January 2004 and December 2006 inclusive. Table\u00a0vs. 9.5 [P\u2009=\u20090.841). In patients with early liver-only recurrence, 19 patients (70%) had treatable lesions , and 8 patients were suitable for palliative treatment only. Seventeen patients (26%) with early systemic recurrence were amenable to further surgery  or ablation (N\u2009=\u20094). Twenty-seven patients (41%) received palliative chemotherapy and the remaining 22 (33%) were suitable for best supportive care only. Five-year overall and disease-free survival rates in the entire cohort were 47% and 42%, respectively. Median survival in patients with disease recurrence (liver or systemic) was 6.5\u00a0months (range 2 to 26\u00a0months). As expected, disease recurrence was associated with significantly worse overall survival , 93 patients (38%) developed early recurrence (defined as within 18\u00a0months of surgery), including 27 patients (11%) with liver-only recurrence and 66 patients (27%) with systemic recurrence (with or without liver recurrence). Thirty-five patients 14%) developed late recurrence and 115 patients (47%) were recurrence-free at follow-up  were significant risk factors for early liver-only recurrence  increased the risk of early liver-only recurrence. Such patients may be candidates for pre-operative MRI, and they may also benefit from enhanced postoperative surveillance. Early post-operative imaging (CT or MRI) in high-risk patients may identify liver-only recurrence at an earlier, treatable stage, which may potentially influence long-term survival although there remains no conclusive data from the available literature. Other groups also investigating the risk factors for CLM recurrence after LR have failed to show any affect of gender unlike the reported study . The preThe second aim of our study was to identify any potential risk factors that predict systemic recurrence specifically in the early post-operative period. Our data has indicated that patients with multiple tumours (three or more) or tumours greater than 3.6\u00a0cm are at high risk of early systemic recurrence. This group of patients is unlikely to benefit from LR as an isolated strategy and should be considered for pre-operative CT-PET and systemic chemotherapy. Using this approach, some patients with detectable FDG avid extra-hepatic disease may be spared from futile liver surgery . PET/CT In summary, it is possible to identify patients at high risk of early liver-only or systemic recurrence after LR for CLM. Such patients may be candidates for enhanced pre-operative staging to detect occult metastases and may also benefit from early post-operative imaging. A tailored approach to pre-operative staging in patients with CLM warrants further evaluation in a prospective study."}
+{"text": "The aim of the study was to identify the incidence and the predictors of recurrence after curative resection and the clinical significance of epithelial-mesenchymal transition (EMT) and stem cell-like phenotypes in gastric cancer.In a total of 1,463 patients that underwent curative resection for gastric cancer between January 2001 and January 2008 at Drum Tower Hospital, 402 (27.5%) experienced recurrence. They were divided into early recurrence (within two years) and late recurrence (more than two years). The clinicopathological characteristics, including five EMT-related proteins  and the gastric cancer stem cell markers CD44 and CD54, therapeutic modalities, survival time after recurrence, and recurrence patterns were compared between the two groups.Loss of E-cadherin expression and aberrant expression of vimentin and the known gastric cancer stem cell maker CD44 were significantly associated with aggressive clinicopathologic features. Multivariate analysis showed that stage III gastric cancer patients with early recurrence had larger tumors and more lymph node metastasis, coupled with aberrant expression EMT and cancer stem cell marker, than patients with late recurrence. Early recurrence was associated with more distant metastasis than late recurrence and patients tended to die within two years of recurrence.Combined EMT with cancer stem cell-like marker is a predictor of recurrence after radical resection for gastric cancer. Advanced TNM stage was associated with early cancer death after recurrence. Even after gastrectomy and lymphadenectomy, every year many patients die of recurrence. The epithelial-mesenchymal transition (EMT), a developmental process in which epithelial cells show reduced intercellular adhesion and acquire migratory fibroblastic properties, is considered to be critical for invasive and metastatic progression in cancer . The proet al.  showed tet al. .et al. [Previously, Ryu et al.  showed tBetween January 2001 and January 2008, excluding patients who were lost to follow-up or poor compliance, a total of 1,463 patients underwent curative resection for gastric cancer at Drum Tower Hospital. A total of 402 (27.5%) of these patients experienced recurrence and were subsequently included in the study; thus the recurrence rate in our study was 27.5%. The mean age of the 402 patients was 64.7\u00a0years (range: 26 to 91\u00a0years), with a male:female ratio of 1.87:1. Medical charts and pathology reports were reviewed to record clinical and pathological data. To evaluate whether the expression profiles of the various EMT markers were different between primary and metastatic gastric cancers, cases with regional lymph node metastasis were also evaluated. In terms of the timing of recurrence, some tumors recur within the first year after resection, and in these cases, inadequate radical surgical approach or systematic metastasis at operation may be suspected. In our study, we defined early recurrence as recurrence within two years after surgery. Late recurrence was defined as recurrence more than two years after surgery. These 402 patients were divided into two groups, namely the early recurrence group, which contained 248 patients, and the late recurrence group, which contained 154 patients. Exclusion criteria included synchronous gastric double cancer, a previous history of surgery for gastric cancer, gastric stump cancer, or cancer anatomically classified as esophageal cancer according to the American Joint Committee on Cancer (AJCC) seventh edition [The study was approved by the clinical research ethics committees of the Drum Tower Hospital and informed consent was obtained from all patients.et al. [All samples in the study were removed from formalin-fixed paraffin-embedded gastric cancer tissues. For all of the arrays, three cores from different areas of the tumor in each case were removed and placed into a new blank recipient paraffin block as previously described by Hsu et al. , and 4-\u03bcet al. , 5.As for statistical analysis of multiple markers, the specimen was recorded as having positive immunoreactivity for each antibody, excluding E-cadherin, if more than 5% of the cancer cells were immunoreactive, and tumor cells with less than 5% were considered as negative. The scoring criteria for E-cadherin were defined as \u2018positive (intact)\u2019 when immunoreactivity on the cell membrane was present in more than 25% of the gastric cancer cells.Patterns of recurrence reported represent the first sites of documented recurring disease after curative resection. Recurrence was documented from the first clinical or radiological signs of disease with an unrelenting course leading to tumor progression and/or death. Confirmation through biopsy was recommended for any evidence of recurrent disease or distant metastases. Recurrence patterns were classified as locoregional, peritoneal, or hematogenous. Locoregional recurrence was defined as any cancer recurrence at the resection margin or lymph nodes  or operation bed within the region of the resection . Peritoneal recurrence was defined as any cancer recurrence within the abdominal cavity due to intraperitoneal distribution including visceral metastasis, rectal shelf, pericholedochal, and periureteral infiltration. Hematogenous recurrence was defined as any metastatic lesion detected in liver, lung, bone, and other distant organs.After surgery, all patients were followed up on regularly. Follow-up assessments were performed every three months for the first five years after surgery, and every six months thereafter until the patient\u2019s death. The follow-up procedures included a medical history, physical examination, routine blood tests, liver function tests, measurement of tumor marker levels (carcinoembryonic antigen and carbohydrate antigen 199), a chest radiograph, and other imaging studies. All routine procedures were performed by a surgeon, esophagogastroduodenoscopy was performed by a gastroenterologist, and upper gastrointestinal series, abdominal sonogram, and computed tomography (CT) scans were performed by a radiologist. For confirmed recurrent disease or distant metastases, biopsies were not obtained for new, multiple pulmonary lesions or for lesions characteristic of osseous metastases noted on CT or whole-body bone scans. When metastasis was suspected, further techniques were utilized, such as bone scan, positron emission tomography (PET), and biopsy sampling.2 test and continuous variables using the independent-samples t-test. Logistic regression multivariate analysis was conducted to determine the differences between the two groups. Analysis of survival was performed by the Kaplan-Meier method, and differences between the curves were tested using a two-tailed log-rank test. P <0.05 was considered to be statistically significant. Statistical analysis was performed using SPSS  software.All values are expressed as the mean\u2009\u00b1\u2009standard deviation. Categorical variables were analyzed using the \u03c7Table\u00a0The median time to recurrence was 17.0\u00a0months (range: 2.0 to 89.0). Most recurrences in our study group  occurred within two years after curative surgery Table\u00a0. In the P <0.001, log-rank test)  died within two years after recurrence. The median survival time after recurrence was 8.1\u00a0months in early recurrence and 13.3\u00a0months in late recurrence, respectively. A total of 16 patients survived more than five years after recurrence: 10 with early recurrence and six with late recurrence. Among the 10 patients with early recurrence, the recurrence pattern included one liver metastasis, two lung metastasis, three anastomosis recurrences, two hepatoduodenal ligament recurrences, one abdominal wall recurrence, and one peritoneal seeding. Among the six patients with late recurrence, the recurrence patterns included one abdominal incision recurrence, two liver metastases, one remnant stomach relapse, one hepatoduodenal ligament recurrence, and one anastomosis recurrence with liver invasion. Survival time after recurrence was significantly shorter in the early group , and E-cadherin expression was lost in 112 (45.2%) of 248 early recurrence cancers, but only 35 late recurrence (22.7%) cancers showed loss of E-cadherin expression (P <0.001). These findings demonstrate that the transformation of the gastric epithelial cells could promote tumor recurrence and metastasis. CD44 and CD54 expressions were also found more frequently in early recurrence patients than those of late recurrence , suggesting that stem cell markers could be taken as a promoter for tumor progress.In the present study, expression of mesenchymal marker vimentin was more frequent in early recurrence than in late recurrence cancers . Despite poor survival after recurrence of cancer and an unfavorable response to the chemotherapy in some patients, 16 patients had long-term survival of more than five years after recurrence. We suggest that close follow-up with B-ultrasound and endoscopies are important, especially in the first two years, in order to prolong survival.Survival times after recurrence have rarely been documented in previous studies, although a new study performed by Wu et al.  reportedHematogenous metastasis was found to be common in patients that experienced recurrence within two years of curative resection, and patients with large tumor size (\u22655\u00a0cm) and advanced TNM stage (stage III) were found to be more prone to early recurrence. EMT and stem cell-like phenotypes are correlated with aggressive clinical features in gastric cancer, and the three proteins, E-cadherin, vimentin, and CD44, may be the best combination for predicting patient recurrence."}
+{"text": "Oligometastatic disease can potentially be cured when an optimal approach is performed. Early recurrence after liver resection is an intractable problem, and the clinical implications remain unknown in colorectal liver oligometastases (CLOM) patients. This study aimed to investigate the clinical characteristics, risk factors, and prognosis related to early recurrence in these patients.A total of 307 consecutive patients with CLOM undergoing curative liver resection were retrospectively reviewed between September 1999 and June 2016. Early recurrence was defined as any recurrence or death from CLOM that occurred within 6\u00a0months of liver resection.P\u00a0<\u00a00.001) or later recurrence . Moreover, early recurrence was identified as an independent predictor of 3-year OS . In multivariate analysis, a node-positive primary tumor [odds ratio (OR) 2.316; 95% CI 1.097\u20134.892, P\u00a0=\u00a00.028) and metastatic diameter\u00a0>\u00a03\u00a0cm  were shown to be risk factors for early recurrence. The salvage liver resection rate for patients with early recurrence was significantly lower than that for patients with later recurrence .With a median follow-up time of 31.7\u00a0months, the 3-year overall survival (OS) and recurrence-free survival rates were 68.7 and 42.5%, respectively. Forty-nine (16.0%) patients developed early recurrence and showed a poorer 3-year OS than those with non-early recurrence (22.3 vs. 75.8%, Early recurrence should be investigated in routine clinical practice, even in patients with CLOM after curative liver resection. Detailed preoperative comprehensive measurements might help stratify high-risk patients, and a non-surgical treatment for early recurrence might represent an effective alternative. Colorectal cancer (CRC) has become a leading cause of cancer-related death both in China and worldwide  Consensus Guidelines, the clinical value of oligometastatic disease (OMD) was highlighted, and metastatic CRC was divided into OMD and widespread systemic disease ; R1 or R2 resection (n\u00a0=\u00a037); loss to follow-up (n\u00a0=\u00a02); and number of colorectal liver metastases\u00a0>\u00a05 (n\u00a0=\u00a017). In total, 307 eligible patients including 176 (57.3%) patients with postoperative recurrence and 131 (42.7%) patients without postoperative recurrence were attentively reviewed for demographic data as well as the tumor characteristics and treatment patterns using an electronic medical record system. The follow-up results were reviewed in detail from the follow-up system at Sun Yat-sen University Cancer Center. All procedures performed in studies involving human participants were in accordance with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. Institutional Review Board approval was also obtained from the independent ethics committee at Sun Yat-sen University Cancer Center. Informed consent was waived for this non-interventional, observational, and retrospective study, in which the patient data used were kept strictly confidential.A total of 413 consecutive patients with CRLM undergoing liver resection between September 1999 and June 2016 at Sun Yat-sen University Cancer Center were retrospectively reviewed. The inclusion criteria were as follows: (1) histologically confirmed adenocarcinoma; (2) colorectal liver oligometastases (\u2264\u00a05 metastases); (3) no preoperative extrahepatic metastases; (4) R0 resection for both primary and metastatic tumors; and (5) a minimum follow-up time of 6\u00a0months. We excluded 106 patients based on the following exclusion criteria: preoperative extrahepatic metastasis  at the time of diagnosis. The carcinoembryonic antigen (CEA) and cancer antigen (CA) 199 levels were measured before liver resection. Synchronous metastases were defined as liver metastases diagnosed before colorectal resection or at the time of surgery. The treatment strategy and operability of liver metastases for each patient were determined according to the final agreement of the multidisciplinary team (MDT). Patients considered potentially resectable or at high risk of postoperative recurrence were recommended to receive preoperative chemotherapy first.After liver resection, patients were monitored through subsequent visits every 3\u00a0months for the first 2\u00a0years and then semiannually until 5\u00a0years. At each clinical review, blood tests were performed for CEA and CA 19-9 levels, along with computed tomography (CT) imaging of the chest, abdomen, and pelvis at 3, 6, 12, and 18\u00a0months, 2\u00a0years, and annually thereafter. Liver MRI was used to define suspicious lesions indicated on CT or in cases of negative CT results with rising CEA or CA 19-9 levels. The final follow-up visit occurred in June 2017. Overall survival (OS) was defined as the time interval from liver resection to death from any cause or the last follow-up date, while recurrence-free survival (RFS) was defined as the time interval from liver resection to disease recurrence, death from disease, or the last follow-up date. According to the previous data, early recurrence was defined as disease recurrence or death from liver resection within 6\u00a0months after liver resection  and Graphpad Prism version 6.01 . Values are presented as the median (range) and percentage. The correlation between clinicopathologic parameters and early recurrence was compared using the Chi-square test or Fisher\u2019s exact test as appropriate. Variables that were statistically significant in univariate analysis were further assessed with a logistic regression model for multivariate analysis to identify independent factors associated with early recurrence, and odds ratios (ORs) and 95% confidence intervals (CIs) were subsequently calculated. The OS and RFS rates were estimated with the Kaplan\u2013Meier method, and differences between groups were assessed with the log-rank test. Parameters showing statistical significance for OS in univariate Cox models were further assessed using multivariate Cox models. Hazard ratios (HRs) and 95% CIs were subsequently calculated. All statistical tests used in this study were two-sided, and a Table\u00a0P\u00a0<\u00a00.001, Fig.\u00a0P\u00a0<\u00a00.001, Fig.\u00a0P\u00a0<\u00a00.001), multiple metastatic tumors , metastases diameter\u00a0>\u00a03\u00a0cm , and bilobar liver metastases  were significantly associated with worse 3-year OS rates. In the multivariate Cox model, early recurrence  and multiple metastatic tumors  were identified as independent predictors of 3-year OS  and metastatic diameter\u00a0>\u00a03\u00a0cm  showed significantly higher chances of early recurrence (Table\u00a0P\u00a0=\u00a00.028) and metastatic diameter\u00a0>\u00a03\u00a0cm  were identified as independent risk factors for early recurrence after CLOM resection . There were no significant differences in the rate of acceptance of recurrence treatment, palliative chemotherapy, and radiofrequency ablation (RFA) between the two groups. Nevertheless, the salvage liver resection rate was significantly lower in patients with early recurrence than in those with later recurrence .As shown in Table\u00a0Accumulating evidence has shown that fewer liver metastases are significantly associated with less recurrence, thus translating to better survival after R0 hepatic resection for CRLM patients . Within a shorter postoperative period, several factors could impede the performance of surgical resection, including worsened condition status, potential surgical complications, and development of unresectable metastases. As a result, the low probability of salvage liver resection for early recurrence disease could contribute to the poorer long-term survival for these patients. Nevertheless, early recurrence should not be considered a hopeless situation. Early engagement and communication among members of an MDT that includes surgeons, medical oncologists, radiation oncologists, and other specialists are needed to combine local ablative and systemic treatment to optimize the chance for a cure  status were not available for the majority of patients in this study. Thus, future studies should include an evaluation of these molecular biomarkers.Early recurrence occurred in 16.0% of CLOM patients, even those undergoing curative liver resection, and was identified as the independent predictor of poor prognosis. The risk factors for predicting early recurrence included the presence of a node-positive primary tumor and metastases diameter\u00a0>\u00a03\u00a0cm. Our study results suggest that early recurrence should be investigated in the routine treatment of CLOM patients before liver resection. Detailed preoperative comprehensive measurements might be needed to stratify high-risk patients, and non-surgical treatment for early recurrence might represent an effective alternative."}
+{"text": "MIG) was as/more effective than field\u2010based descriptors in this environment and evaluated the response of insectivorous bats to structural complexity in urban green spaces. Bat activity and species richness were assessed with ultrasonic devices at 180 locations within green spaces in Vienna, Austria. Vegetation complexity was assessed using 17 field\u2010based descriptors and by calculating the mean information gain (MIG) using digital images. Total bat activity and species richness decreased with increasing structural complexity of canopy cover, suggesting maneuverability and echolocation  challenges for bat species using the canopy for flight and foraging. The negative response of functional groups to increased complexity was stronger for open\u2010space foragers than for edge\u2010space foragers. Nyctalus noctula, a species foraging in open space, showed a negative response to structural complexity, whereas Pipistrellus pygmaeus, an edge\u2010space forager, was positively influenced by the number of trees. Our results show that MIG is a useful, time\u2010 and cost\u2010effective tool to measure habitat complexity that complemented field\u2010based descriptors. Response of insectivorous bats to structural complexity was group\u2010 and species\u2010specific, which highlights the need for manifold management strategies  to fulfill different species\u2019 requirements and to conserve insectivorous bats in urban green spaces.Structural complexity is known to determine habitat quality for insectivorous bats, but how bats respond to habitat complexity in highly modified areas such as urban green spaces has been little explored. Furthermore, it is uncertain whether a recently developed measure of structural complexity is as effective as field\u2010based surveys when applied to urban environments. We assessed whether image\u2010derived structural complexity ( The resulting habitat loss and degradation represent critical threats to biodiversity  differ in their response to structural complexity. Species foraging at edges or inside vegetation (edge\u2010space foragers) would show a positive response to structural complexity, whereas species hunting in open space would exhibit a negative response to structural complexity.The aims of this study were twofold: (1) to assess whether image\u2010derived structural complexity (MIG) is as/more effective than field\u2010based descriptors as metric to characterize urban green spaces and (2) to determine whether structural complexity in urban green spaces influences bat activity and species richness. We tested the following hypotheses: (1) measuring structural complexity from digital images complements standard field\u2010based descriptors. We expected that MIG calculated from images would reflect vegetation parameters recorded in the field and that its inclusion would improve model fit. (2) Bat activity and species richness correlate positively with structural complexity (MIG) because sites with higher vegetation complexity would provide access to resources such as prey and roosts. (3) Functional groups  and representative species , Austria Figure\u00a0. In addi2.2A land use map  by the Vienna municipal department of urban development and planning MA18) was used as a baseline for selecting the sampling locations. We focused on nine classes referring to green spaces, including cemeteries, health purpose areas, housing units with gardens, parks, sports areas, tree\u2010lined streets, forests, vineyards, and pastures. Only green spaces larger than 0.25\u00a0ha were included. To provide a gradient of size, these areas were divided into quartiles and separated into four different size classes . Five points were randomly chosen for each size class, resulting in 20 data points for each green space type and a total of 180 sampling points . The images were taken simultaneously with descriptors of vegetation structure measured in the field to insure equal conditions, and always between 09:30 and 15:30 to insure similar illumination. The camera was installed at the center of the sampling point with a tripod placed at a fixed height of 1\u00a0m above the ground. Images were taken using automatic mode  and the camera pointing in the four cardinal directions in turn, with the (imaginary) horizon parting the scene in half horizontally. Additionally, one image was taken facing upwards to account for canopy cover.We converted the RGB color space of all images to hue, saturation, value (HSV) to separate the pure color component (hue) from chroma (saturation) and intensity  as suggested by Proulx and Parrott . Conversp (\u03c7i) is the probability of finding a specific spatial configuration \u03c7i made of k neighboring pixels in the image (k\u00a0=\u00a04 representing a 2\u00a0\u00d7\u00a02\u2010pixel neighborhood). p (\u03b3i) denotes the probability of observing a pixel\u2032s intensity value \u03b3i independently of its location in the image. M is the number of frequency bins of pixel values, and Mk represents the maximum number of possible pixel configurations in a four\u2010pixel neighborhood. To retain as much image information as possible, we chose the highest possible value of M.We used mean information gain (MIG) to quantify structural complexity because it is a well\u2010established measure of spatial complexity patterns  ranges from zero, for completely uniform spatial patterns across pixels (order), which would represent a single color, to one for completely random patterns (disorder) , ground cover (vegetation cover on the ground), canopy cover, vegetation height, tree density, and number and diameter at breast height of large trees (DBH\u00a0>\u00a00.30\u00a0m). To determine vegetation profile, ground cover, canopy cover, and vegetation height, we used the cover\u2010board method Nudds,  as a bas2.5Plecotus spec.) or be influenced by habitat features  which were placed on an attachment rod of approximately 2\u2010m height and at least 2\u00a0m away from any structure in each direction. The manufacturer's default settings  were used, and a fully automatic recording was started 1\u00a0hr before sunset and ended 1\u00a0hr after sunrise. Surveys were only conducted during suitable weather conditions . Although acoustic sampling may misrepresent bats that use echolocation calls of lower intensity . Species richness was defined as the total number of species recorded during all three surveys.Species identification was performed using automated systems as they provide a standardized identification and is less time\u2010consuming than manual identification especially when many recordings are available  to assess the relationship between MIG and field\u2010based descriptors , and between MIG and bat activity and species richness.We used Pearson\u2032s correlation coefficient  and open\u2010space foragers . To examine potential differences between individual species, activity of N.\u00a0noctula  and P.\u00a0pygmaeus  was analyzed as representative species.Analyses were performed for total bat activity, total species richness, and the following functional groups according to Schnitzler and Kalko  and DenzExploratory analyses revealed that average night temperature and length of the night had no correlation with any of the response variables ; hence, these variables were not considered further. Because bat activity (but not species richness) varied between different green space types, we included green space type when modeling bat activity. Bat activity was log\u2010transformed, and continuous predictor variables were standardized to have a mean of zero and standard deviation of one. Variance inflation factor (VIF) was used to identify multicollinearity (VIF\u00a0>\u00a02) using the \u201cusdm\u201d package v. 1.1\u201015 Naimi, . As predWe conducted generalized linear mixed models with Gaussian error distribution to analyze which variables influenced bat activity using the function lmer from the \u201clme4\u201d package v. 1.1\u201012 , tree density (r\u00a0=\u00a0.64), vertical heterogeneity (r\u00a0=\u00a0.58), vegetation height (r\u00a0=\u00a0.64), and number of trees (r\u00a0=\u00a0.54). MIG sides were correlated with vertical heterogeneity (r\u00a0=\u00a0.54), whereas MIG top was correlated with canopy cover (r\u00a0=\u00a0.62) and vegetation height (r\u00a0=\u00a0.54).Mean information gain (MIG) was correlated with several field\u2010based descriptors Figure . Mean inr\u00a0=\u00a0\u2212.07) or species richness (r\u00a0=\u00a0\u2212.18), nor was there a correlation between MIG sides and bat activity (r\u00a0=\u00a0.12) or species richness (r\u00a0=\u00a0.03). A slight negative correlation was found between MIG top and both bat activity (r\u00a0=\u00a0\u2212.33) and species richness  parameters had no effect on activity of P.\u00a0pygmaeus , H.\u00a0savii (73%), and P.\u00a0pipistrellus (61%). The acoustic group M.\u00a0mystacinus/M.\u00a0brandtii was relatively common, occurring at one\u2010third of the sites. Six other species were detected at <10% of the sites  as a useful ecological tool to describe vegetation complexity in an urban environment and assessed the response of insectivorous bats to structural complexity of urban green spaces.4.1Image\u2010derived structural complexity (MIG) complemented field\u2010based descriptors and captured vegetation patterns in urban green spaces, although models conducted with only field\u2010based data generally showed higher explanatory power compared to models that only used MIG. There are different possible explanations for these results. MIG was able to depict vegetation structure ; indeed, MIG top view replaced canopy cover and vegetation height due to high collinearity Figure . AlthougNonetheless, the strength of structural complexity derived from digital images was apparent. MIG parameters analyzed separately had considerable explanatory power. It is remarkable that models performed solely with MIG parameters accounted for up to one\u2010fourth of the variation explained, given the relatively small effort involved in their sampling. While photographs were taken in a very brief time period (5\u00a0min per site), recording field\u2010based descriptors lasted 1\u00a0hr on average and up to 2\u00a0hr in places with high vegetation complexity. In addition, processing the images and calculation of MIG took 5\u00a0min per site (1\u00a0min per image), whereas processing field data required an average of 40\u00a0min per site. This adds up to a saving of +270\u00a0hr and makes MIG an efficient way to sample a large number of sites.Besides being labor intensive, field\u2010based descriptors may be limited in their ability to describe important structural complexity attributes, given the variety of possible measures and the need to consider a suite of attributes simultaneously to reflect the inherent characteristics of a site  of urban green spaces had a significant negative effect on bats. This effect remained even when field\u2010based descriptors were included. The negative effect of canopy complexity in green spaces indicates that areas with open canopy may facilitate foraging activity for some bat species. This is supported by previous findings where bat activity decreased with canopy closure and increased with relative area of open canopy , which was surprising because complex habitats comprise more niches and would therefore be expected to increase the number of species . This result supports previous findings that P.\u00a0pygmaeus uses urban woodlands or seminatural habitats  is a time\u2010 and cost\u2010effective tool for capturing complexity of vegetation and complements field\u2010based descriptors. No method is likely to meet all needs. When time and money are a serious constraint and research questions do not aim to identify underlying ecological mechanisms, MIG is a suitable sampling tool. Otherwise, other measures such as field\u2010based descriptors should be considered.N.\u00a0noctula showed a higher avoidance of vegetation clutter at the upper layers and tree canopy than edge\u2010space foragers. In contrast, P.\u00a0pygmaeus, an edge\u2010space forager, was positively influenced by the number of trees.We demonstrated that insectivorous bats respond to structural complexity in urban green spaces. Additionally, a proportion of vegetation covering the ground and number of large trees favor total bat activity. Although canopy complexity had a negative effect in most cases, bats\u2019 response to structural complexity was group\u2010 and species\u2010specific. Open\u2010space foragers as well as The group\u2010 and species\u2010specific response to vegetation\u2010structural complexity highlights the need for manifold management strategies in urban green spaces: increasing or reinstating the extent of ground vegetation cover, including seedlings and grass; managing complex vegetation in multiple strata, such as promoting shrubs and bushes while simplifying higher strata; or balancing out areas of high complexity with areas encompassing shorter and simplified vegetation and open spaces. Lastly, retaining large and mature trees would support sensitive species. These strategies would insure conservation of the full spectrum of insectivorous bat species occurring in urban green spaces.The authors declare that they have no competing interests.MSR and AB conceived the ideas; MSR designed the study; CI collected the data; MSR, CI, and AB analyzed the data; MSR and CI led the writing of the manuscript. All authors contributed critically to the drafts and approved the final manuscript.https://doi.org/10.5061/dryad.5g52tData available on Dryad Digital Repository: \u00a0Click here for additional data file.\u00a0Click here for additional data file.\u00a0Click here for additional data file."}
+{"text": "Several aspects of human physiology and behavior are dominated by 24-h circadian rhythms with key impacts on health and well-being. These include mainly the sleep\u2013wake cycle, vigilance and performance patterns, and some hormone secretions. The rhythms are generated spontaneously by an internal \u201cpacemaker,\u201d the suprachiasmatic nuclei within the anterior hypothalamus. This master clock has, for most humans, an intrinsic rhythm slightly longer than 24\u2009h. Daily retinal light exposure is necessary for the synchronization of the circadian rhythms with the external 24-h solar environment. This daily synchronization process generally poses no problems for sighted individuals except in the context of jetlag or working night shifts being conditions of circadian desynchrony. However, many blind subjects with no light perception had periodical circadian desynchrony, in the absence of light information to the master clock leading to poor circadian rhythm synchronization. Affected patients experience cyclical or periodic episodes of poor sleep and daytime dysfunction, severely interfering with social, academic, and professional life. The diagnosis of Non-24 Sleep\u2013Wake Rhythm Disorder, also named free-running disorder, non-entrained disorder, or hypernycthemeral syndrome, remains challenging from a clinical point of view due to the cyclical symptoms and should be confirmed by measurements of circadian biomarkers such as urinary melatonin to demonstrate a circadian period outside the normal range. Management includes behavioral modification and melatonin. Tasimelteon, a novel melatonin receptor 1 and 2 agonist, has demonstrated its effectiveness and safety with an evening dose of 20\u2009mg and is currently the only treatment approved by the FDA and the European Medicines Agency. Non-24-h sleep\u2013wake rhythm disorder is an orphan disease in the general population but common in the totally blind.Lack of light information to the suprachiasmatic nucleus, the central biological clock leads to the patient\u2019s biological rhythms following their innate period, which is often longer than 24\u2009h.This circadian drift leads to cyclical sleep disturbances and daytime sleepiness which pose a major handicap.Accurate diagnosis and treatment with both behavioral therapy and medication targeting circadian rhythms, such as melatonin and melatonin agonists, improves symptoms.Most biological processes display an endogenous, entrainable oscillation with a period of about 24\u2009h, a rhythm driven by a circadian clock named \u201ccircadian rhythm\u201d (from circa\u2009=\u2009around and dies\u2009=\u2009a day) , 2. The N-acetyl-5-methoxytryptamine) discovered in 1958 is synthesized by the pineal gland and inhibited by light  which play a key role in mammals in circadian photoentrainement. mRGC projections extend across the dorsolateral geniculate nucleus up to the pretectal nucleus in the midbrain and are known to drive the pupillomotor light reflex. Photoreceptors drive the circadian photoentrainment across different light intensities , 9 and avia the retinohypothalamic tract with signals traveling to the cervical superior ganglion and the pineal gland that responds by inhibiting melatonin synthesis. A regulatory feedback loop involving melatonin modulates SCN activity. Melatonin levels peak during the night, decrease at the end of the night and remain low during daytime, rising again as darkness falls. The nocturnal peak is associated with maximum sleep propensity, and a nadir in the associated rhythms of core body temperature, vigilance, mental performance, and metabolisms.Light that reaches the retina photoreceptors activates SCN via the MT1 and MT2 receptors that are G protein-coupled receptors with seven transmembrane domains  had sleep/wake disorders, and 40% of them recognized that symptoms were cyclical. A previous study (n\u2009=\u2009794) in which over 83% reported at least one sleep problem  vs 57% of controls, and 18% of the blind subjects vs 8% of controls having clinical criteria for non-24 SWRD. In a survey of 388 blind subjects, sleep disorders were reported by 48.7% of blind subjects compared to 9% in controls, and in up to 66% of those with a complete loss of light perception  when the circadian rhythm promotes sleep in the middle of the day. In addition to sleep\u2013wake problems, other rhythms such as the melatonin and the cortisol secretion are leading to problems with other circadian functions such as appetite and digestion.The frequency of symptomatic periods depends on the daily delay. The magnitude of the daily delay varies as a function of the endogenous circadian period from less than 30\u2009min  to more than 1\u2009h . A patient with an intrinsic period of 25.2\u2009h will delay his/her clock by just over an hour every day and, thus, be in phase with the solar cycle for a short period every 3\u2009weeks. During this time, they will be asymptomatic but as their circadian rhythms continue to drift the symptoms will become more severe, peaking when their circadian rhythm is in opposition to the solar cycle, which will occur around 10\u2009days later. As the period of the instrinsic clock varies widely between patients, the frequency of symptomatic periods is also variable and may vary from 3 to 26\u2009weeks. Diagnosis is complicated by the high prevalence of non-circadian sleep disorders , depression, and anxiety in blind subjects, which may also lead to variable sleep complaints. The measurement of circadian biomarkers is, thus, mandatory in the diagnosis of underlying circadian disorders in complex cases.Measurement of the main melatonin metabolite, 6-sulfatoxymelatonin (aMT6s) is recommended to confirm non-24 SWRD , 22, 28 Due to its rarity in the general population, non-24 SWRD remains poorly understood and patients often experience a long delay  before diagnosis. This diagnostic delay is exacerbated by the lack of sleep physicians with knowledge of circadian disorders available to diagnose and manage the disease. As prevalence is much higher in blind patients, an 8-item pre-screening questionnaire for visually impaired subjects has been developed to help physicians  both in via a complex protocol including periods with ad-lib sleep and entrainment , showed desynchronization of the circadian rhythms of body temperature, vigilance, performance, cortisol secretion, and urinary electrolyte excretion, with a 24.9 circadian period, explaining the drift of his circadian rhythms and cyclical presentation of symptoms.The first description of non-24 SWRD was reported by Miles  in the cFurther studies of sleep disorders in blind subjects were reported by Sack and by Lockley , 31 reinAll these results showed a striking relationship between blindness and abnormal circadian rhythms. Melatonin secretion during the day due to abnormal circadian rhythms is associated with daytime naps, strongly suggesting that abnormally timed endogenous melatonin induce hypersomnolence in blind subjects. The internal phase relationship between sleep\u2013wake cycles and the circadian melatonin rhythm in entrained subjects leads to differences in the daily profile of vigilance, mood, emotion, and performance. Disruption of such relationship in blind individuals with non-24 SWRD resulted in impaired functioning in cerebral wake systems during the day.Altogether, the frequency of sleep disturbances in blind individuals is close to 60\u201380% and over half of totally blind patients may have non-24 SWRD. The prevalence, gender, and ethnic differences of non-24 SWRD in adults and children remain unknown. The natural course of non-24 SWRD remains to be explored: onset is not always synchronous with total loss of vision, occurs in both congenitally blind children and adults, and the evolution of symptoms over time is unclear. The frequency of this condition in sighted people is unknown but certainly extremely rare even in the context of traumatic brain injury, developmental intellectual disability , dementia or severe mental illness (example of schizophrenia) . In thesTreatment of totally blind patients suffering from non-24 SWRD is considered effective when circadian rhythms are entrained to a normal 24\u2009h cycle. Once rhythms are entrained, the patient remains synchronized with a normal 24-h day and the periodic symptoms of insomnia and excessive daytime sleepiness disappear.First-line management consists of non-drug therapies, which aim to reinforce alternative zeitgebers (synchronizers of circadian rhythms). Patients are encouraged to set regular bedtime, getting up times, and meal schedules to participate in physical activities in the morning. If some light perception persists, daylight or bright light exposure in the morning is recommended. Stimulation of the wake systems by intellectual activities, cold showers, or intense physical exercise in the morning may be helpful.Drug therapy includes rapid release melatonin (available without prescription in many countries), melatonin prolonged release, and melatonin agonists. Initiation of treatments may be most effective when the patient is in phase with the solar cycle as the aim of treatment is to prevent further circadian drift. It may be necessary to wait until the patient\u2019s bed and wake times are approximately normal. However, this may not always be possible.Melatonin has a short half-life, ranging from 20 to 45\u2009min , being lSeveral studies have reported the effects of rapid release melatonin in totally blind patients with non-24 SWRD , 43\u201348 a\u00ae)] has been shown to improve sleep duration compared to placebo in 13 blind patients which is consistent with a circadian effect , has been approved for the treatment of non-24 SWRD by the FDA and the European Medicines Agency (EMA). Tasimelteon is a potent and specific melatonin MT1 and MT2) receptor agonist with two to four times greater affinity for the MT2 receptor. Peak plasma concentration is reached 0.5 to 3\u2009h after administration with a half-life of 1.3\u2009h. Tasimelteon has been shown to affect circadian phase in healthy individuals . Two tri and MT2 The master clock plays a vital role in the regulation of the circadian rhythms of several major biological processes. Its natural period is slightly longer than 24\u2009h and requires daily synchronization with the solar cycle by exposure to morning light. Melatonin is important in the regulation of the circadian rhythms: its production is inhibited by light and a feedback loop favors circadian synchronization. In totally blind people, the absence of light impairs circadian synchronization, and in some this leads to gradual drift of their circadian rhythms following the underlying period of their biological clock. This gradual desynchronization leads to non-24 SWRD characterized by cyclical periods of severe insomnia and excessive daytime sleepiness maximal when a patient\u2019s circadian phase is in opposition to the solar day. The resulting social and professional handicap may be severe and lead to social isolation and psychological difficulties. Rare in the general population and considered an orphan disease, non-24 SWRD is common in the totally blind. Diagnosis requires demonstration of a drifting sleep\u2013wake cycle using sleep diary or actimetry and can be confirmed by repeated measurement of circadian biomarkers such as melatonin. Treatment to entrain and maintain circadian rhythms is effective and should combine behavioral and drug approaches. Treatments that have been shown to be safe and effective in this disorder include melatonin and the melatonin agonist Tasimelteon. Tasimelteon is to date the only treatment approved by the FDA and the EMA for non-24 SWRD in totally blind persons.MAQS and YD reviewed all the literature and wrote the first draft of the manuscript. DL and SH revised the manuscript.YD received funds for seminars, board engagements, and travel to conferences by UCB Pharma, Jazz, Theranexus, Actalion, Vanda, Takeda, Flamel, and Bioprojet. DL is or has been consulted as the main investigator in studies sponsored by Actelion, Agence Spatiale Europ\u00e9enne, Ag2R, Bioprojet, CNES, DGA, ESAI, iSommeil, Jazz, Vanda, Merck, NASA, Philips, Resmed, Sanofi, Rhythm, Vinci Fondation, and Vitalaire in the last 5\u2009years. MS received funds for seminars, board engagements, and travel to conferences by IRIS, BIOCODEX, and VANDA. SH received funds for conference participation from SOS Oxyg\u00e8ne."}
+{"text": "Table olives are one of the most popular plant-derived fermented products. Their enhanced nutritional value due to the presence of phenolic compounds and monounsaturated fatty acids makes olives an important food commodity of the Mediterranean diet. However, despite its economic significance, table olive fermentation is mainly craft-based and empirically driven by the autochthonous microbiota of the olives depending on various intrinsic and extrinsic factors, leading to a spontaneous process and a final product of variable quality. The use of microorganisms previously isolated from olive fermentations and studied for their probiotic potential and technological characteristics as starter cultures may contribute to the reduction of spoilage risk resulting in a controlled fermentation process. This review focuses on the importance of the development and implementation of multifunctional starter cultures related to olives with desirable probiotic and technological characteristics for possible application on table olive fermentation with the main purpose being the production of a health promoting and sensory improved functional food. Clostridium, Pseudomonas, and Staphylococcus and occasionally moulds [Table olives are fermented fruits with a great impact on the economy worldwide and especially in the Mediterranean countries. Because of their high nutritional value and their content in fibers, amino acids, unsaturated fatty acids, vitamins and antioxidant compounds, table olives are considered to be an important functional food. The fermentation process provides preservation, enhanced nutritional and technological characteristics, as well as health benefits. Diverse microbial populations are involved in olive fermentation including members of lactic acid bacteria (LAB) and yeasts, which are the dominant species of the fermentation, as well as Enterobacteriaceae, y moulds . These my moulds . Moreovey moulds . Table olive fermentation occurs spontaneously by the microbiota of the olive, without adding any starter culture. In general, the fermentation process is carried out by LAB and/or yeasts . LAB are(i)improvement of table olives sensory attributes;(ii)control of the fermentation process;(iii)monitoring of the correct evolution of the process;(iv)maintenance and/or improvement of nutritional and healthy features of the product;(v)protection from undesirable spoilage and pathogenic microorganisms;(vi)fortification of table olives with microorganisms exhibiting probiotic potential;(vii)enhancement of product stability and extension of shelf life.However, spontaneous fermentations have many disadvantages compared to fermentations with starter cultures, as any deviations from the required conditions, such as the growth of undesirable strains and thereby metabolites can lead to an abnormal fermentation and a defective final product . Inocula(i)isolation and \u201cin vitro\u201d selection; isolation from the fermentation environment and characterization of the strains is an important step for the selection;(ii)validation on a laboratory scale;(iii)validation at industrial scale; their characteristics and properties shown on the laboratory scale should be validated on large-scale fermentations.However, the selection of specific strains displays important difficulties. The conditions during the fermentation process may be inhibitory for the growth of the selected strains. Moreover, the selection of inappropriate strains may lead to negative results such as the production of undesirable metabolites or even the diversion of the process. The selection and implementation of a starter culture is a crucial and complicated process for the success of the fermentation and although, there are no specific rules for the selection, there are three main steps to be followed :(i)isolMicroorganisms should be easily adapted to the environment of the fermentation and have non-pathogenic, probiotic and technological characteristics. More specifically, the selected strains should have the ability to (i) decrease the pH value of the brine through their metabolic activity (production of specific organic acids), (ii) grow under the conditions of the fermentation , (iii) degrade phenolic compounds (oleuropein), (iv) produce desirable aroma and taste through the production of volatile compounds, (v) possess specific enzymes which contribute positively to the final product, and (vi) have probiotic, health promoting and disease preventing properties. In addition, their ability to grow and dominate the indigenous microbiota is a perquisite for their selection as starter cultures in olive fermentation. Although selected starter culture strains differentiate among various fermented foods, they should display some common characteristics. There are specific in vitro tests for the determination of these characteristics as shown in The use of strains previously isolated from table olives, with probiotic and technological characteristics may lead to the production of a functional food which apart from its nutritional value provides a matrix for probiotic microorganisms. Microstructure of olives, in combination with their consistency of several components protects probiotic microorganisms during digestion. Moreover the ability of LAB to co-aggregate and form biofilms on the surface of olives creates new perspectives of table olives as a functional probiotic food.6\u2013107 colony forming units/g) [Lactobacillus spp., Bifidobacterium spp., Streptococcus spp., some Enterococcus and Lactococcus lactis. Moreover, Saccharomyces cerevisiae var. boulardii is the only yeast species recognized as safe.Functional foods have no universally accepted definition. The term was first used in Japan in the 1980s when the Ministry of Health and Welfare initiated a regulatory system to approve certain foods with documented health benefits. Because of the fact that all foods provide taste, aroma and nutritive value, all foods can be considered as functional to some extent. However, foods are further studied for added physiological beneficial properties, which may optimize health . An acceunits/g) ,41. Therunits/g) ,43. TherThe ability of LAB to colonize the surface of olives and the formation of biofilms during fermentation in combination with the microstructure of the olive surface that protects microorganisms during digestion establish new perspectives for the use of table olives not only as a nutritional fermented product but also as a probiotic carrier and hence a functional food with high added value ,43,44,45In order to be characterized as potential probiotics, microorganisms \u201cshould be resistant to gastric juices and be able to grow in the presence of bile\u201d . TherefoAuto-aggregation and co-aggregation are of significant importance for probiotic strains as they are linked with their ability to adhere on epithelial cells. Moreover, co-aggregation may contribute to the inhibition of the colonization of pathogenic bacteria ,47,48. IThe ability of both LAB and yeasts to adhere to intestinal mucosa is a crucial property for the exclusion of pathogens and undesirable bacteria. production of antimicrobial compoundsproduction of bacteriocinscompetitive action on nutrientsinhibition of binding due to competitionformation of immune systemPossible antimicrobial mechanisms of specific microorganisms, for the control of pathogens are indicated below :productSome microorganisms act like biocontrol agents, because of their ability to produce substances such as ethanol and toxin proteins or glycoproteins, called killer factors. These factors can inhibit the growth of fungi and other undesirable microorganisms such as yeasts and bacteria ,52. Bile salt hydrolase (BSH) activity is considered to be an important property for probiotic strains. Several studies have shown that microbial BSH function in bile salts detoxification may contribute to the intestinal survival and persistence of producing strains and boost its survival in the hostile conditions of the gastrointestinal tract. Moreover, liberation of amino acids during bile salt deconjugation could be used as carbon, nitrogen, and energy sources and therefore provides a nutritional advantage on hydrolytic strains . Bile saPhytic acid is the main form of storage of phosphorous in mature seeds of plants and it is particularly abundant in olives. This acid, because of its ability to form chelates with metal ions such as calcium, iron and magnesium, creates insoluble complexes whose degradation requires specific enzymes. Because of the absence of these enzymes into the human gastrointestinal tract, the dephosphorylation of these complexes could be succeeded by microorganisms\u2019 enzymes ,58,59.Lactobacillus plantarum and Lactobacillus pentosus, contributed to a higher inactivation rate in comparison with the spontaneous fermentation [Lactobacillus pentosus B281 and Pichia membranifaciens M3A inoculated in a fermentation of Conservolea natural black olives was studied by [L. pentosus and its ability to survive on the olive and form a biofilm with the indigenous microbiota in combination with its probiotic and technological properties makes it a possible starter for the production of a physicochemical and sensory acceptable final product with functional character. Moreover, despite the inability of P. membranifaciens M3A to recover at the end of the fermentation, the inoculation of the brine with the specific yeast strain resulted in the proper fermentation and a milder final product. The intake of probiotic strains from the consumption of table olives stimulates a protective immune response against pathogens and microbial balance into the intestine [Yersinia enterocolitica. Seven strains belonging to Lactobacillus spp. isolated from olive brines were studied for their ability to adhere to Caco-2 cells, to tolerate low pH values and conditions that occur during digestion, as well as their antagonistic activity against the pathogenic bacterium Yersinia enterocolitica [L. paracasei IMPC2.1 met the main criteria for probiotic potential, namely, inhibition of the pathogen, strong adhesion to Caco-2 cell as well as survival during simulated digestion. Moreover, another study has shown that another ureolytic human pathogen Helicobacter pylori was inhibited by the presence of the probiotic strain Lactobacillus casei [Biofilm formation could also simultaneously enhance their viability during digestion. An important characteristic of starter cultures is their ability to adhere on the surface of the olive fruit ,60. The entation . The potudied by . L. pentntestine ,67. Probntestine ,69,70. Intestine . A possicolitica . One strus casei .Several studies have been undertaken in order to assess the probiotic potential of microorganisms related to table olive fermentation .Apart from their potential probiotic character, microorganisms implicated in table olive fermentation are considered to have important technological characteristics that affect the process one way or another as described below.Yeasts are known for their ability to produce different compounds such as ethanol, glycerol, higher alcohols, esters and other volatiles which contribute decisively to the formation of flavor while maintaining the texture of the olive fruit during fermentation ,81,82. Lactobacillus plantarum strains isolated from dairy products and table olives showed a high degree of oleuropein degradation in modified MRS broth in which glucose had been substituted with 1.0% (w/v) of oleuropein; in particular strains Lp793, Lp790 and B51 hydrolyzed 93.6, 85.9 and 82% of oleuropein that corresponded to the presence in the medium of 101.5, 206.3 and 274.7 ppm of residual glucoside, respectively.Oleuropein is the main phenolic compound of the olive fruit responsible for its bitter taste. In table olives processing, in order to degrade oleuropein at an acceptable level, olive fruits are subjected to chemical treatment with lye solution (NaOH). Many LAB and yeasts have the ability to biodegrade oleuropein during table olive processing by the production of \u03b2-glucosidase . AccordiNatural black olive fermentation is taking place into brine containing 8\u201310% (w/v) NaCl, concentrations which could be an inhibitory factor for growth for several starters. For this reason, the ability of starters to grow in high salt levels could induce not only which will grow during the fermentation, but also the dominant species as well as the interactions among them . Low salFolic acid is the main co-factor for the biosynthesis of nucleotides. An adequate consumption of folic acid could reduce the risk of heart diseases and cancer. Yeasts follow the folic acid production biosynthetic path ,58. The increase of cholesterol levels in blood could be of great danger for the development of chronic heart diseases. Several microorganisms may contribute to the reduction of these levels due to their properties such as bile salt hydrolytic activity, bounding of their cells with cholesterol and cholesterol bioassimilation ,54. AccoMicroorganisms such as yeasts and LAB, as well as their extracts, have been recognized as a good source of antioxidants . These nDetoxification activity occurs because of the detachment of the mycotoxins on the compounds of the cell wall ,52,92. AThe coexistence of yeasts and LAB as the dominant species during table olive fermentation is of a great importance. Yeasts can not only produce specific compounds such as vitamins, amino acids and purines but also hydrocarbons which are crucial for the growth of LAB. This synergistic symbiosis is particularly crucial for the development of a controlled and stable fermentation. The majority of the reactions taking place in live organisms cannot be performed at adequate rates without catalysis. The catalysts of the biological reactions are enzymes . The stuAnother important characteristic is the production of \u03b2-glucosidase that is related to the deconstruction of phenolic compounds and specifically of oleuropein. The activity of this enzyme leads to the debittering of olives, resulting in the reduced use of chemical compounds and proposes a more biological approach . AlkalinLactobacillus spp. have been successfully studied in pilot plan indicating their potential use during table olive fermentation processing for the production of a high added value functional product [Table olives are considered by many food scientists as the \u201cfood of the future\u201d owing to the healthy bioactive compounds they contain. Undoubtedly, the use of starter cultures for table olive fermentation becomes attractive for the food industry as it contributes to the reduction of cost, fermentation process time, risk of spoilage, as well as to the improvement of the process by enhancing the sensory characteristics of the final product and ensuring safety. Several strains belonging to  product . The fut"}
+{"text": "Gsdf is a key gene for testicular differentiation in teleost. However, little is known about the function of Gsdf in Chinese tongue sole (Cynoglossus semilaevis). In this study, we obtained the full-length Gsdf gene (CS-Gsdf), and functional characterization revealed its potential participation during germ cell differentiation in testes. CS-Gsdf transcription was predominantly detected in gonads, while the levels in testes were significantly higher than those in ovaries. During the different developmental stages in male gonads, the mRNA level was significantly upregulated at 86 dph, and a peak appeared at 120 dph; then, the level decreased at 1 and 2 yph. In situ hybridization revealed that CS-Gsdf mRNA\u00a0was mainly localized in the Sertoli cells, spermatogonia, and spermatids in mature testes. After CS-Gsdf knockdown in the male testes cell line by RNA interference, a series of sex-related genes was influenced, including several sex differentiation genes, CS-Wnt4a, CS-Cyp19a1a and CS-Star. Based on these data, we speculated that CS-Gsdf may play a positive role in germ differentiation and proliferation via influencing genes related to sex differentiation. Amhy, Amhr2, GsdfY and Gdf6Y5. Studies on these genes have focused on Gsdf , including its specific expression in teleosts, such as Danio rerio, Takifugu rubripes and Oryzias latipes8. In general, Gsdf performs vital functions in male germ cell proliferation and testicular differentiation9, and as a teleost-specific gene, it is predominantly expressed in Sertoli cells and surrounding cells in mature gonads of Oryzias luzonensis and Oncorhynchus mykiss10. In addition, in O. luzonensis, a Y-chromosome localized Gsdf was reported to be the male-determining gene3, and its deletion could cause feminization12. Gsdf has been shown to be an excellent candidate for understanding the sex-determination events in Anoplopoma fimbria13.In teleost, several genes that belong to TGF-\u03b2 signal components have been identified to have sex-determination functions, including Gsdf functions as a male sex initiator and initiate testicular differentiation, which has been proven to be an early marker in the gonads of males in Oryzias latipes and Oreochromis niloticus15. As Dmy-independent sex-determining gene during sex-chromosome evolution18, Gsdf could play an important role in sex differentiation by interacting with Dmy or Dmrt1, and affecting oestrogen production20. Additional features of the Gsdf gene included the regulation of primordial germ cell proliferation and meiotic germ cell proliferation or differentiation10.Despite the divergent role, accumulated data now support that autosomal Cynoglossus semilaevis) is an economically important marine flatfish that is widely cultured in China. This species exhibits sexual growth dimorphism and females grow 2\u20134 times faster than males21; thus, increasing the proportion of females would increase the culturing productivity. However, many limiting factors result in low female ratios in aquaculture; for instance, genetic females (ZW) could sex-reverse to phenotypic males under some conditions23. In Chinese tongue sole, several genes have been reported to be involved in male sex determination and differentiation, including Dmrt1, Tesk1, Piwil2 and Neurl327. Among these genes, Dmrt1 was previously demonstrated to be the male-determining gene24, while the others were found to be involved in spermatogenesis. More and more reports focused on the relationship between environmental factors and sex differentiation/gonad development29. Although, in our lab, epigenomics data in Shao et al. revealed that Gsdf is an important sex-related gene, its expression is mediated by DNA methylation in C. semilaevis30, while little is known about the features and functions of the Gsdf gene.Chinese tongue sole . Furthermore, RNA interference (RNAi) of CS-Gsdf was performed in the testicular cell line, and a series of sex-related genes were analysed.To investigate the role of The complete cDNA sequence is 1,244\u2009bp in length, containing a 139\u2009bp 5\u2032 untranslated region (UTR), a 615\u2009bp open reading frame (ORF) and a 470\u2009bp 3\u2032 UTR. The ORF encoded a putative protein with 204 amino acids (GenBank accession number: MG891889) Figs.\u00a0 and S2. CS-Gsdf in Chinese tongue sole, we analysed the expression levels in 10 different tissues of 1-year post-hatching female and male tongue sole by qRT-PCR. CS-Gsdf was expressed in only the gonads, and the expression level was much higher in the testis than that in the ovary  and ish Fig.\u00a0.CS-Gsdf during the differentiation and development of male gonads, we measured the expression levels in testes at different developmental stages. As shown in Fig.\u00a0CS-Gsdf transcripts were detected at 20 days post-hatching (dph) and continued to be expressed at very low levels before sharply increasing at 86 dph. At 120 dph, the expression reached its peak in the testis and then declined at 1-year post-hatching (yph) and 2 yph.To study the expression of CS-Gsdf was mainly expressed in Sertoli cells, spermatogonia and spermatids with intensive hybridization signals at 120 dph and 1 yph . To determine the silencing effects of RNAi, CS-Gsdf expression in CSGC was detected by qRT-PCR 48\u2009h after siRNA transfection. The results revealed that the silencing efficiencies of CS-Gsdf were approximately 79.1%, 70.9% and 71.3% in the si-cse-Gsdf 01, 02 and 03 treatments, respectively  family, which is important for the regulation of cell growth, differentiation, and migration32. Moreover, recent reports found that members of the TGF-beta family may have a function in the sex-determining process33. To determine the role of CS-Gsdf in tongue sole, we initiated this study.CS-Gsdf cDNA. The predicted protein contained a highly conserved TGF-beta region, which is characterized by 7 conservative cysteine residues called the conserved cysteine knot motif  in O. latipes, 16 dpf in D. rerio35 and 30 dpf in O. mykiss10, which are all prior to testicular differentiation17. As histological differentiation occurred at 50\u201365 dph in C. semilaevis, and 70\u201390 dph were selected to represent appearance of oogonium/spermatogonia, whereas cellular differentiation occurred at 120\u2013150 dph, including oocyte/spermatocyte and so on37. CS-Gsdf exhibited high expression at 86 dph and peak expression at 120 dph in testes. However, the expression subsequently declined in mature testes which nearly completed cellular differentiation and seminiferous tubule formation39. During germ cells divide rapidly, and Sertoli cells actively regulate the surrounding congregated spermatogonia40. Thus, the relatively strong signals in Sertoli cells suggested steroidogenesis and spermatogenesis functions44. Furthermore, the lowest CS-Gsdf expression levels were found in Dmrt1-deficient tongue sole , which proved Gsdf affected oestrogen production during sex differentiation20. Simultaneously, Wnt4a is a key gene in the Wnt4/\u03b2-catenin1 pathway that regulates gonad development/differentiation54. CS-wnt4a was also upregulated after RNAi, although the mechanisms remain elusive. Interestingly, CS-Gsdf obviously declined in Dmrt1-deficient gonads, which might be positively regulated by sex-determination genes. In conclusion, CS-Gsdf transcription could affect gene expression related to gonadal hormone genes but exert a negative effect on female Foxl2 gene.After the lls Fig.\u00a0, qRT-PCRCS-Gsdf from Chinese tongue sole. CS-Gsdf was specifically expressed in gonads, with much higher expression levels in testes than those in ovaries. In testes, the threshold of CS-Gsdf transcription was detected at 20 dph, increased at 86 dph, and peaked at 120 dph, Its mRNA was mainly localized in Sertoli cell and spermatogonia. After in vitro RNAi in the testicular cell line, several sex-related genes were affected. Based on these data, we proposed that CS-Gsdf participates in germ cells differentiation and proliferation of testes, while further studies are needed to elucidate its detailed role.In summary, we cloned and characterized The handling of experimental fish was approved by the Animal Care and Use Committee of the Chinese Academy of Fishery Sciences, and all protocols were performed in accordance with the guidelines of the Animal Care and Use Committee. To minimize fish suffering, tissues were collected under MS222 anaesthesia.55. Ten individuals of each scope  participated in this work. The brain, heart, intestine, gill, kidney, liver, muscle, skin, spleen, and gonads were collected from 1-year-old fish, immediately subjected to liquid nitrogen and then stored at \u221280\u2009\u00b0C until RNA extraction. The gonads at different developmental stages  were picked from one side and frozen in liquid nitrogen until RNA extraction. The contralateral gonads were also picked and divided into two sections: one was placed in 4% paraformaldehyde (PFA) for in situ hybridization (ISH), and the other was simultaneously placed in Bouin\u2019s fixative for histological analysis of phenotypic sex. The tail fins of all experimental fish were collected and preserved in 100% ethanol for DNA extraction and subsequent genetic sex determination.The Chinese tongue sole used in this study were purchased from the Haiyang High-Tech Experimental Base . Temperature treatments were performed to induce pseudo-males, as previously described56, which was then used as a template for subsequent analysis after quantification.The process used to extract genomic DNA followed the standard phenol-chloroform extraction methodTotal RNA was extracted using TRIzol reagent  and then quantified by NanoVue Plus . The first-strand cDNA was synthesized using a PrimeScript RT reagent Kit with gDNA Eraser . A total of 800\u2009ng of total RNA from each sample was reverse transcribed into first-strand cDNA and used as the template for qRT-PCR.57. The genetic sex was determined by following the methods of Liu et al.58. The sex-specific simple sequence repeat (SSR) markers scaffold68-2F and scaffold68-2R  was performed using the SMART RACE cDNA Amplification Kit . RACE-ready first-strand cDNA was synthesized from total RNA according to the manufacturer\u2019s instructions, and the gene-specific primers for outer and nest amplification were designed . Purified products were cloned into a pMD18-T vector  and sequenced.To obtain the full-length cDNA of ed Table\u00a0. The outCS-Gsdf cDNA sequence, and their specificity was verified by a single distinct peak obtained in a melting curve analysis. QRT-PCR was conducted using a 7500 ABI real-time PCR system (Applied Biosystems) with SYBR Green Master Mix (TaKaRa). \u03b2-actin was used as the internal control59. Three randomly selected individuals were subjected to qRT-PCR, and the experiment was performed in triplicate for each sample.QRT-PCR primers Table\u00a0 were des\u2212\u0394\u0394Ct method. All data were tested using one-way ANOVA followed by Duncan multiple comparison tests using SPSS 18.0 . Significance was accepted only when p\u2009<\u20090.05. All assays in the qRT-PCR complied with the MIQE guidelines60.The relative mRNA expression of target genes was calculated by the 2CS-Gsdf ORF sequence. The PCR product was cloned into a pBluescriptSKII plasmid and then linearized with PstI and SalI (TaKaRa). Probes were labelled using DIG RNA Labeling Mix . The ISH was performed following a previously described method61 using samples from three different individuals. Images were captured with a Nikon E80i microscope  and then analysed.After dehydration in ethanol, the stored gonad samples were fixed in paraffin wax and sheared as 5\u2009\u00b5m sections. A pair of primers Table\u00a0 for RNA Gsdf-specific small interfering RNAs  were designed and synthesized by RayBiotech C. Ltd. In addition, a nonspecific siRNA negative was used as a control (NC) during the experiment . The testicular (CSGC) cell line, which was previously created in our laboratory, was employed for RNAi silencing. The CSGC cells were recovered as described by Zhang et al.62, and then transferred to six-well plates. After cultivating at 24\u2009\u00b0C for 12\u2009h, the cells completely attached to the plates, and then the labelled siRNAs were transfected into the cells using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer\u2019s instructions. The calculated average transfection efficiency was approximately 80%. Both the treated groups  and the control group (using NC siRNA) were transfected at a concentration of 30\u2009nM. The collected cells were cultivated at 24\u2009\u00b0C for 48\u2009h. The total RNA was extracted from the cells, and cDNA was synthesized as described above. The relative expression levels of the genes related to sex differentiation, such as Star, Cyp19a1a, Foxl2 and Wnt4a, were evaluated by qRT-PCR, and all experiments were performed in triplicate.The three Supplementary Information"}
+{"text": "The potential use of iron-loaded alginate beads to fortify oil-in-water (O/W) emulsions was studied. Iron-loaded alginate beads with different sizes  were produced by ionic gelation with calcium chloride, leading to 81% encapsulation efficiency (EE) of ferrous sulfate. These beads were added to O/W emulsions to investigate their effect on lipid oxidation. The use of iron-loaded alginate beads inhibited lipid oxidation in emulsions, compared to a control emulsion with the same concentration of free ferrous sulfate in the continuous phase, but did not totally prevent it. Results obtained with scanning electron microscopy and energy dispersive X-ray spectroscopy (EDX) analysis showed that some reactive iron was present at the surface of the beads. Oxidation of the lipid droplets was slightly higher for smaller alginate beads, suggesting that the reaction could be linked to the total bead surface. When covering iron-loaded beads with an extra layer of alginate, lipid oxidation was inhibited, which confirmed the role of reactive surface-bound iron. This study shows that the location of iron within the encapsulates plays a crucial role in the chemical stability of fortified foods and should be taken as a starting point in the design of iron-fortified food products. Iron deficiency anemia is a worldwide health problem, for which the fortification of foods with iron is the most cost-effective prevention strategy . HoweverOver the years, alginate hydrogels have been successfully used for the encapsulation of numerous food ingredients such as probiotics , lipids Phaeophyceae) [+2, Ba+2, Fe+2, Fe+3, Al+3) and forms a so-called \u201cegg box\u201d structure, whereas classical gels are held together by van der Waals forces. Since the beads have a considerable size, the process of ionic gelation starts at the outer layers of the bead, and continues to the center through the diffusion of the metal ions, which takes some time [Alginate is a natural anionic polysaccharide typically obtained from brown seaweed (phyceae) . Becausephyceae) . Alginatome time ; dependiome time . Ionic gelation has been successfully used to encapsulate soluble iron in alginate beads ,17,18,19From the above, it is clear that alginate beads are promising vehicles for iron encapsulation but, in order to prevent undesired lipid oxidation, more mechanistic information is needed. The purpose of the present study was to investigate the pro-oxidant activity of iron-loaded alginate beads in oil-in-water (O/W) emulsions, representing model food systems that contain oil droplets. Besides being a convenient measuring system, the sensitivity to oxidative effects allows us to evaluate the efficiency of encapsulation. The oxidative stability of O/W emulsions fortified with iron-loaded alginate beads was compared to that of control emulsions that contained empty alginate beads, or non-encapsulated ferrous sulfate. We systematically varied alginate bead size to modulate the fraction of surface-bound iron, which is potentially the reactive fraction with regard to lipid oxidation. We also successfully mitigated the issue of reactive surface iron by applying a second alginate layer onto the iron-loaded beads. 4, 7H2O), alumina powder, para-anisidine, 3-(2-pyridyl)-5,6-di(2-furyl)-1,2,4-triazine-5\u2032,5\u2033-disulfonic acid disodium salt, n-propanol, hexane, L-ascorbic acid, sodium acetate trihydrate, and acetic acid were purchased from Sigma Aldrich . Ultrapure water, purified by a Millipore Milli-Q system , was used throughout the study.Rapeseed oil purchased from a local supermarket was stripped by means of alumina to eliminate impurities and tocopherols . Sodium \u22121 into 25 mL of the hardening bath (5 wt% CaCl2) that was kept under magnetic stirring. The nozzle tip  was positioned 6\u20137 cm above the bath. Ionically cross-linked alginate hydrogel beads were produced through the injection method shown in the 2+, and subsequently stored in the same CaCl2 solution overnight at 4 \u00b0C to form strongly gelled beads. All beads were stored in the fridge in CaCl2 solution until use. Before further use, the beads were collected from the CaCl2 solution and washed with ultrapure water for 10 min to remove unbound Ca2+ ions and free Fe2+ irons, after which the beads were filtered using filter paper (Whatman 41). Some alginate beads were also produced without ferrous sulfate (referred to as empty beads) and used for reference experiments.The bead size was controlled through the air pressure, and 0.2, 1, 2, and 3 bar were used to produce very large- (VL), large- (L), medium- (M) and small- (S) sized beads, respectively. After production, the beads were stirred in the hardening bath at room temperature for 30 min to allow crosslinking with CaThe bead size was determined by static light scattering , using refractive indices of 1.33 and 1.47 for water and beads, respectively. The obscuration was kept between 4 and 7%.2 solution to harden for 30 min. Again, these beads were stored in the fridge in a CaCl2 solution until use.For the production of double beads, very large (VL) beads were used as a starting point and immersed in a 1% alginate solution for 30 min to allow for an extra alginate coverage, after which they were transferred into a 5% CaClThe iron content of alginate beads was determined by the spectrophotometric ferene method . In brieTo measure ferrous iron, a dissociation agent is used, which is a mixture of ascorbic acid (0.25 M) and acetate buffer . This mixture was added to the sample (liquid phase surrounding the beads) and mixed with ferene solution (6 mM). After 5 min, the absorbance at 593 nm was measured. A calibration curve was used to determine the concentration. The amount of free iron  and the elemental composition of the bead surface was determined using energy-dispersive X-ray spectroscopy with a field emission scanning electron microscope .Sample preparation was as follows: alginate beads were cleaned with ultrapure water, filtered and air-dried at 40 \u00b0C for 90 min. Next, the samples were mounted on metal stubs, using double-sided adhesive tape, coated with a layer of gold under vacuum, and then examined at 2 kV. The experiments were performed twice using independent batches.Emulsion preparation. Tween 20 solution (1 wt%) was added to ultrapure water and stirred overnight at room temperature. A primary emulsion was prepared by homogenizing 10 wt% stripped rapeseed oil with 90 wt% of the aqueous phase mention earlier using a high-speed rotor stator homogenizer  at 7000 rpm for 2 min. Subsequently, the primary emulsion was passed through a high-pressure homogenizer  equipped with an F12Y chamber at 800 bar, for 3 cycles. To limit temperature rise during the emulsification process, the cooling jacket of the homogenizer was filled with iced water. Emulsion preparation was performed twice to obtain independent duplicates. The procedure for the addition of iron or beads is described in the next section. Particle size distribution. The emulsion droplet size was determined by static light scattering . The obscuration was between 8 and 12%; the refractive index (RI) of the dispersant was set to 1.33 for water, and to 1.46 for the dispersed rapeseed oil. Zeta potential. The surface charge  of the emulsion droplets was measured with a dynamic light scattering instrument . Samples were 100-fold diluted with ultrapure water prior to measurement. The results are expressed in mV, as the mean value \u00b1 standard deviation. Physical characterization of the emulsions was performed immediately after emulsification, and at the end of the incubation period. For the samples containing alginate beads, the latter did not interfere with the characterization of the oil droplets, as the beads sedimented to the bottom of the tubes as soon as agitation was stopped, due to their large size.Incubation conditions. Emulsions were partitioned in 50-mL tubes (40 g per tube) and analyzed over 8 days. Four different systems were studied: control emulsions (no iron added), emulsions containing iron-loaded alginate beads or empty beads (0.28 g beads per tube) and emulsions containing non-encapsulated (free) ferrous sulfate. For both iron-containing systems, the final iron concentration in the emulsions was 200 \u00b5M, which is much lower than the solubility limit of ~1 M. For the emulsion added with free iron, ferrous sulfate was added as dry powder that dissolved instantly upon vigorous mixing. For the emulsions that contained beads, appropriate bead amounts were added, and the samples were quickly mixed by hand. All samples were then incubated at 25 \u00b0C, on a rotating agitation device (5 rpm) to prevent creaming/sedimentation and ensure sample homogeneity. Primary lipid oxidation products. The amount of conjugated diene hydroperoxides was measured using the method described by Lethuaut and co-workers [g for 4 min. The absorbance of the supernatant was recorded between 200 and 310 nm using a UV/VIS spectrophotometer . Results were expressed in mmol conjugated diene hydroperoxides per kg of oil (mmol CD kg\u22121 oil) using 27,000 M\u22121 cm\u22121 as the molar extinction coefficient of conjugated dienes at 233 nm.-workers . BrieflySecondary lipid oxidation products. The para-anisidine value (pAV), which is a global measurement for the formation of aldehydes, was determined by first mixing 0.3 g emulsion with 1.5 mL n-hexane: n-propanol mixture (3:1 v/v). The absorbance of the top hexane phase (Ab) was measured at 350 nm, using pure hexane as a blank. Then, 1 mL of this top hexane phase was added to 0.2 mL para-anisidine solution (2.5 M in acetic acid) and mixed. After 10 min, the absorbance was measured at 350 nm (As), using as blank pure hexane similarly mixed with the para-anisidine solution. The pAV was calculated as shown in Equation (2).m is the mass (g) of oil per mL hexane.Acid value. The acid base titration technique described in the Association of Official Agricultural Chemists (AOAC) Official Method 969.17 [d 969.17  was usedp < 0.05 applying Tukey\u2019s post-hoc test.Statistical analysis was performed using the SPSS software . One-way analysis of variance (ANOVA) was conducted using six individual results from two independent repetitions and least significant differences were calculated at +2 binds to guluronic acid (G-) and mannuronic-gluronic acid (MG-) blocks, Ba+2 to G- and mannuronic acid (M-) blocks, Sr+2 to G-blocks only, and Fe+2 to G- and M-blocks [The size  and encaM-blocks ,27,28. IFerrous sulfate could successfully be encapsulated in alginate beads, with an EE that is approximately 80% . This vaThe surface morphology of dried empty and iron-loaded beads was investigated . In line4,3d) of approximately 130 nm were found, irrespective of the incubation time and presence of alginate beads and/or iron. This indicates that all tested emulsions were physically stable. The starting pH of the iron-free emulsions was approximately 7.0, whereas the emulsion containing non-encapsulated ferrous sulfate had an initial pH of 4.0, that decreased further in time  and secondary (pAV) lipid oxidation markers were recorded . After oformation of hydroperoxides but can effectively delay their decomposition into secondary lipid oxidation products. This can be because the formation of hydroperoxides occurs through an autocatalytic radical chain reaction, where peroxyl radicals (LOO\u25cf), formed from O2 addition to an alkyl radical (L\u25cf), abstract hydrogen atoms from other unsaturated lipids (L\u2019H) to form hydroperoxides (LOOH). Conversely, the decomposition of hydroperoxides in alkoxyl radicals (LO\u25cf) is a fast reaction promoted by low valence transition metals such as ferrous iron, which themselves become oxidized through the process [There was a clear difference in the formation kinetics of secondary oxidation markers (pAV) in the free iron emulsion compared to the other emulsions. The free iron emulsion had a pAV of nine (AU) after 1 day, which increased continuously up to 34. The pAV in the emulsion containing iron-loaded beads slowly increased to approximately 10 and remained below seven in the other two. This, therefore, shows that even though primary lipid oxidation products formed in a quite similar manner for both iron-containing emulsions, this was not the case for the secondary lipid oxidation products. This indicates that encapsulating ferrous sulfate in alginate beads only has a minor effect on the  process .From these results, it is clear that the encapsulation of iron in alginate beads increased the oxidative stability of the emulsion, which is important for the sensory quality of food, which is linked to the formation of secondary oxidation products. In earlier work , we also43d = 0.82 mm), if encapsulation in alginate beads reduces the concentration of reactive iron by approximately 20 times, this implies that the layer containing reactive iron represents approximately 5% of the bead volume, i.e., it is approximately 1.2 \u00b5m.The previous results imply that encapsulating ferrous surface in alginate beads reduces its pro-oxidant activity, but that a fraction of iron is still reactive, which could be the fraction located close to the bead surface. In order to test this surface iron hypothesis, and to estimate how large this reactive fraction is, we measured lipid oxidation in emulsions containing different amounts of free iron, and in emulsions fortified with iron-loaded beads with different bead sizes (which is expected to correlate with differences in available surface iron). The formation of primary and secondary lipid oxidation markers is shown in An analysis of the elemental composition of the alginate bead surface by energy-dispersive X-ray spectroscopy (EDX) is shown in In an attempt to suppress the pro-oxidant activity of surface-bound iron in alginate beads, a second alginate layer  was applied on very large iron-loaded alginate beads that are relatively easy to handle , which wThe results show that the localization and chemical availability of soluble iron has a great influence on the oxidative stability of emulsions. Encapsulating ferrous sulfate into alginate beads leads to the considerable improvement of the oxidative stability of ion-fortified emulsions, compared to the use of free iron, especially in relation to the formation of secondary oxidation markers. The most efficient inhibition of the pro-oxidant activity of iron was obtained when preventing contact between the surrounding emulsion matrix and the iron-containing surface of the beads, by application of a second alginate layer. Such advanced encapsulates seem highly effective for delivering soluble iron without compromising the chemical stability of the food systems. Ferrous sulfate can be encapsulated at high efficiency (>80%) in an alginate gel matrix. Such iron-loaded alginate beads showed high physical stability and improved the oxidative stability of emulsions compared to emulsions containing free iron. The presence of some reactive iron at the bead surface was associated with a residual pro-oxidant activity, which could be completely inhibited by applying a second alginate layer. The developed double-layer iron-loaded alginate beads show interesting potential for the fortification of foods without causing negative side effects, such as lipid oxidation."}
+{"text": "The primary endpoint was the change in phase angle (PhA). Secondary endpoints included changes in standardized PhA (SPA), fat\u2010free mass index (FFMI), body weight, muscle strength, and CT toxicity (CTCAE 4.0 events). In patients with the primary endpoint assessed (modified intention\u2010to\u2010treat population), counseling plus WPI (N\u00a0=\u00a066) resulted in improved PhA compared to nutritional counseling alone (N\u00a0=\u00a069): mean difference, 0.48\u00b0  (P\u00a0=\u00a0.027). WPI supplementation also resulted in improved SPA (P\u00a0=\u00a0.021), FFMI (P\u00a0=\u00a0.041), body weight (P\u00a0=\u00a0.023), muscle strength (P\u00a0<\u00a0.001), and in a reduced risk of CT toxicity , particularly of severe (grade\u00a0\u2265\u00a03) events . In malnourished advanced cancer patients undergoing CT, receiving nutritional counseling, a 3\u2010month supplementation with WPI resulted in improved body composition, muscle strength, body weight, and reduced CT toxicity. Further trials, aimed at verifying the efficacy of this nutritional intervention on mid\u2010 and long\u2010term primary clinical endpoints in newly diagnosed specific cancer types, are warranted.In recent years, whey proteins (WP) have attracted increasing attention in health and disease for their bioactive functions. The aim of this study was to evaluate the benefit of WP isolate (WPI) supplementation in addition to nutritional counseling in malnourished advanced cancer patients undergoing chemotherapy (CT). In a single\u2010center, randomized, pragmatic, and parallel\u2010group controlled trial ( Whey proteins (WP) have attracted increasing attention in health and disease for their bioactive functions. In malnourished advanced cancer patients undergoing chemotherapy (CT) and receiving nutritional counseling, a 3\u2010month supplementation with WP resulted in improved body composition, muscle strength, and reduced CT toxicity. The use of measured bioelectrical parameter, such as phase angle (PhA), using bioelectrical impedance vector analysis (BIVA), was demonstrated to reliably reflect cell integrityThe aim of this randomized trial was to evaluate the effect of WPI supplementation on PhA and other predefined outcomes , over 3\u00a0months in malnourished advanced cancer patients undergoing CT, and receiving nutritional counseling as a standard of care.22.1We performed a single\u2010center, randomized (1:1), pragmatic, and parallel\u2010group controlled clinical trial . Allocation of the two intervention groups was performed according to a computer\u2010generated random blocks randomization list (varying block sizes). The randomization list was prepared by a local statistician, who was not involved in the selection and enrollment of patients. Concealment was achieved using sealed envelopes.2.2Adult (age\u00a0\u226518\u00a0years), malnourished  advanced cancer patients  candidate to or undergoing CT, were screened and considered eligible for study inclusion when they presented an Eastern Cooperative Oncology Group (ECOG) performance status\u00a0\u226422.3In addition to standard CT regimens, patients were randomized to receive nutritional counseling with or without WPI supplementation, for 3\u00a0months. Nutritional counseling consisted of a personalized dietary prescription to achieve estimated protein\u2010calorie requirements. Total daily energy requirements were calculated by multiplying the estimated resting energy expenditure (Harris\u2010Benedict equation) by a correcting factor of 1.5. Daily protein requirements were set at 1.5\u00a0g/kg of actual body weight.If oral intakes were\u00a0<60% of estimated requirements for two consecutive weeks despite the use of ONS, artificial nutrition support  was started.In addition to nutritional counseling, patients allocated to the WPI group received two sachets/day of lipid\u2010 and lactose\u2010free, highly purified (microfiltration), and low temperature\u2010dried (cysteine\u2010rich) cow milk WP  providing 20\u00a0g of proteins. The WPI supplement was mixed both in water and in foods according to patients\u2019 preferences. A short booklet of recipes with specific suggestions was also provided, in order to facilitate assumption. Caregivers and dietitians assessed and monitored compliance, recording with a diary the number of sachets consumed every day.2.4Information was collected based on age, gender, tumor localization, stage, and related treatments.Body weight and height were measured using the same calibrated scale  using a stadiometer and BMI was calculated.For the assessment of protein\u2010calorie intake at a baseline and throughout the study, participants were asked to provide detailed information on quality and quantities of food  and beverages consumed in the days before each visit  and telephone call . A validated atlas of food portions was also consulted to improve the accuracy of estimation.Global QoL was assessed using the European Organization for the Research and Treatment of Cancer Quality of Life Questionnaire (EORTC QLQ\u2010C30).Finally, tolerance to CT was continuously monitored. In particular, patients were regularly examined by the same oncologists  to assess the occurrence of toxicity according to the National Cancer Institute Common Toxicology Criteria (CTCAE 4.0).2.5The primary outcome was the change in PhA at 3\u00a0months. Secondary outcome variables included: changes in PhA at 1\u00a0month; changes in SPA, FFMI, body weight, and HG at both 1\u00a0month and 3\u00a0months; changes in global QoL at 3\u00a0months; CT toxicity .2.6No serious adverse event associated with WPI supplementation was expected. Patients were actively monitored for the occurrence of gastrointestinal disorders (common adverse events).2.7In the absence of preliminary data, we estimated that to detect a clinically meaningful difference (mean treatment difference/standard deviation [effect size]\u00a0=\u00a00.5) for the primary outcome measure with a power of 80% and two\u2010tailed type I error\u00a0<5%, at least 64 patients per arm reaching the primary endpoint evaluation were required.The analysis was conducted following a modified intention\u2010to\u2010treat (ITT) principle. The change in PhA at 3\u00a0months was investigated in the set of patients reaching the primary endpoint evaluation (primary efficacy population) using a generalized linear regression model. Then a series of supportive analyses of the primary endpoint was performed. First, to perform full ITT analysis, we conducted chained multiple imputation of the missing primary endpoint, assuming that missing values were at random, since dropouts were not clinically and statistically different from patients remaining in the study (data not shown). Independent variables for the imputation were age, gender, tumor site and stage, BMI, WL, HG, protein\u2010calorie intake, and global QoL. The analysis of the primary endpoint was repeated in the imputed cohort, while accounting for multiple imputations. Second, we refitted the model of primary efficacy analysis on the cohort of patients receiving at least three CT cycles during the study, and on the subset of the supplemented patients consuming at least 50% of the study product (against the entire control group); we also fitted a model adjusting for baseline PhA, gender, and stage.The effect of WP on changes in continuous secondary endpoints was analyzed in the primary efficacy population using a generalized linear regression model. Finally, the data on CT toxicity  were evaluated in the randomized population and in the subgroup of patients receiving at least three CT cycles, using the Fisher's exact test.All patients consuming at least one sachet of WP were included in the safety analysis. The following causes of dropout were observed: death, lost to follow\u2010up, hospitalization, artificial nutrition, and withdrawal.Descriptive statistics of continuous variables were reported as a mean and standard deviation or median, while categorical variables were presented as counts and percentages.P\u2010value\u00a0<.05.The study statistician was blinded to treatment assignment. All statistical analyses were performed using the STATA 15.1 statistical software (Stata Corporation). The level of significance was set at the two\u2010tailed 2.8The study was conducted in accordance with the Declaration of Helsinki and approved by the local Ethics Committee. All patients provided a written informed consent before the study entry.3In total, 225 patients were screened for inclusion and 166 were randomized to interventions .P\u00a0=\u00a0.015). Compliance to WPI supplementation was fair . Nonetheless, the consumption of the study product was sufficient to result in a significantly higher change in mean protein intake: +8.5\u00a0g/d  (P\u00a0=\u00a0.007) . Mean protein intakes (mean\u00a0\u00b1\u00a0SD) in the two groups were: counseling\u00a0+\u00a0WPI, 1.26\u00a0\u00b1\u00a00.38\u00a0g\u00a0kg\u22121\u00a0d\u22121; counseling alone, 1.05\u00a0\u00b1\u00a00.30\u00a0g\u00a0kg\u22121\u00a0d\u22121. No difference between groups was observed in the change of calorie intake: adjusted mean difference, +0.40\u00a0kcal\u00a0kg\u22121\u00a0d\u22121 ; P\u00a0=\u00a0.72 .Both study interventions were effective in maintaining and improving calorie and protein intakes; 58 patients required the prescription of ONS , the mean change in PhA at 3\u00a0months in the WPI group was\u00a0+0.20\u00b0  as compared to \u22120.28\u00b0  in the control group: mean difference, 0.48\u00b0  (P\u00a0=\u00a0.040), while in patients receiving at least three CT cycles the adjusted mean difference was\u00a0+0.48\u00b0  (P\u00a0=\u00a0.035). Finally, after excluding patients with low compliance (<50% of prescribed WPI dose), the treatment effect was computed to\u00a0+0.64\u00b0  (P\u00a0=\u00a0.007). When adjusting for baseline PhA, gender, and stage, the treatment effect was computed to\u00a0+\u00a00.47\u00b0  (P\u00a0=\u00a0.027).All sensitivity analyses yielded results consistent with the primary analysis. Multiple imputation of missing outcomes resulted in a mean difference between groups of\u00a0+0.40\u00b0  (3.2P\u00a0=\u00a0.041), body weight (P\u00a0=\u00a0.023), and HG (P\u00a0<\u00a0.001) in favor of WPI was also found at 3\u00a0months. No significant differences were found in the change of QoL (P\u00a0=\u00a0.35) at the end of the study. Finally, the effect of WPI on CT toxicity was investigated (Table P\u00a0=\u00a0.009), particularly of multiple toxicity (P\u00a0=\u00a0.007) and severe toxicity events (P\u00a0=\u00a0.001). The sensitivity analysis restricted to patients receiving at least three CT cycles, confirmed these findings.A significant effect of WPI supplementation on PhA was already present at 1\u00a0month Table . Changest P\u00a0=\u00a0.02, and HG In both analysis populations, risk reduction in Grade\u00a0\u22653 events was mainly for gastrointestinal toxicity.3.3No apparent gastrointestinal intolerance event was recorded. As reported above, six patients died during the study, but no death was related to the study intervention. No other intervention\u2010related adverse events occurred.4In the present trial, we found that the additional provision of WPI to malnourished cancer patients receiving nutritional counseling during CT, improved body composition, muscle strength, body weight, and resulted in reduced CT toxicity.This is the first adequately powered study supporting the efficacy of this particular nutritional intervention in combination with nutritional counseling, although there is some previous positive evidence supporting WPI supplementation in cancer patients.\u22121\u00a0d\u22121 and up to 1.2\u20101.5\u00a0g of protein/kg/d,Individualized nutritional counseling, including the use of ONS, is currently recommended as the standard of care for all cancer patients at nutritional risk, receiving anti\u2010cancer treatments.We can argue that in our trial all positive outcomes were linked with each other. A higher protein\u2010calorie intake resulted in improved body composition and muscle function, which is also related to muscle protein stores. Reduced muscle mass has been associated with dose\u2010limiting toxicity in patients receiving systemic therapy Therefore, our trial highlights the importance of integrating appropriate nutritional care in malnourished patients receiving anti\u2010cancer treatment, in order to interrupt a downward spiral, potentially resulting in worse clinical outcome.We acknowledge that our study has some limitations. First, our findings apply only to malnourished patients with different cancer types, receiving CT for a short period. However, considering the high prevalence of malnutrition in oncology, we cannot exclude a potentially positive effect also in nonmalnourished patients, and in the medium to long term. This certainly requires further investigation by adequately designed trials, involving specific cancer\u2010type populations. Indeed, nutritional counseling is the standard of care and WPI supplementation should be considered only in combination with it. Second, this was a single\u2010site trial, which restricts data generalizability, though it facilitated a homogeneous approach to all patients.Finally, it would have been interesting to explore the effect of WPI in a double\u2010blinded trial, comparing different protein sources. However, we chose a pragmatic study design, which closely resembles real\u2010world clinical practice.In conclusion, in malnourished advanced cancer patients undergoing CT and receiving nutritional counseling, a 3\u2010month supplementation with WPI resulted in improved body composition, muscle strength, body weight, and reduced CT toxicity, which may lead to improved treatment efficacy. Further trials, aimed at verifying the efficacy of this nutritional intervention on mid\u2010 and long\u2010term primary clinical endpoints in newly diagnosed specific cancer types, are warranted.The authors have no conflict of interest to declare.Dr Caccialanza, Dr Cereda, Dr Klersy, and Dr Pedrazzoli had full access to all of the data in the study, and take responsibility for the integrity of the data and the accuracy of the data analysis. Riccardo Caccialanza, Emanuele Cereda, and Catherine Klersy conceptualized and designed the study. Riccardo Caccialanza, Annalisa Turri, and Alessandra Ferrari provided the administrative support. Luca Arcaini, Marco Benazzo, Valeria Borioli, Alessandra Ferrari, Riccardo Caccialanza, Silvia Cappello, Marilisa Caraccia, Emanuele Cereda, Andrea Riccardo Filippi, Silvia Brugnatelli, Teresa Monaco, Paolo Pedrazzoli, Silvia Chiellino, Giulia Maria Stella, and Annalisa Turri provided the study materials or patients. Luca Arcaini, Marco Benazzo, Valeria Borioli, Alessandra Ferrari, Riccardo Caccialanza, Silvia Cappello, Marilisa Caraccia, Emanuele Cereda, Andrea Riccardo Filippi, Catherine Klersy, Silvia Brugnatelli, Teresa Monaco, Paolo Pedrazzoli, Silvia Chiellino, Giulia Maria Stella, and Annalisa Turri collected and assembled the data. Riccardo Caccialanza, Emanuele Cereda, Catherine Klersy, Paolo Pedrazzoli, and Annalisa Turri analyzed and interpreted the data. Riccardo Caccialanza, Emanuele Cereda, and Catherine Klersy wrote the manuscript. All authors approved the final manuscript. All authors are accountable for all aspects of the work."}
+{"text": "To evaluate ocular surface changes after withdrawal of Benzalkonium chloride (BAK) in patients with glaucoma in monotherapy with BAK-preserved prostaglandin. This was a prospective observational study. All patients underwent complete ophthalmologic examination and evaluation of ocular surface. A questionnaire was filled regarding symptoms of dry eye (Ocular Surface Disease Index [OSDI]) at the beginning of study. The treatment was switched to preservative-free tafluprost for 6 weeks and after this period, all patients were re-evaluated. All patients reported improvement of symptoms. The green lissamine test showed a significant improvement of the ocular surface, with most patients classified as light dry eye (P < 0.001). A significant improvement in the score (P < 0.001) was also found, with an average of 17.95 \u00b1 5.35 points, which classifies the patients' symptoms in the normal to light zone. Benzalkonium chloride withdrawal reduced the signs and symptoms of dry eye in patients with primary open angle glaucoma (POAG). Glaucoma is a chronic disease and the second leading cause of irreversible blindness in the world . The maiThere are many studies indicating that more than 60% of patients with glaucoma have signs and symptoms of ocular surface disease (OSD). Therefore, the purpose of this study was to evaluate ocular surface changes after withdrawal of BAK in patients with glaucoma who use eyedrops of prostaglandin analogs preserved with BAK .This prospective observational study adhered to the tenants of the Declaration of Helsinki and was approved by the Institutional Review Board. Additionally, a written informed consent was obtained from all participants. We enrolled patients with primary open angle glaucoma. The definition of glaucoma was based on the presence of repeatable (\u2265 2 consecutive) abnormal standard automatic perimetry (SAP) test results on the 24-2 program of the VF  or if progressive glaucomatous optic disc changes were noted on stereo photographs, regardless of the results of SAP. We have described abnormal SAP results as those with a pattern standard deviation index outside the 95% confidence limits and/or glaucoma hemifield test results outside the reference range. The inclusion criteria were age > 18 years, treatment for glaucoma with monotherapy prostaglandin for at least 6 months and symptoms of dry eyes. The exclusion criteria were Sjogren\u2019s syndrome, Steven\u2019s Johnson syndrome, ocular surgery in the last year including refractive surgery, allergy to some component of eye drops, pregnancy, systemic diseases affecting the ocular surface or any systemic medication affecting the ocular surface.All patients underwent complete ophthalmologic examination at the beginning of the study , complete anamnesis where the complaints were recorded. However, a questionnaire of ocular surface disease was filled for each patient to evaluate the impact of ocular surface changes on daily activities. The diagnostic tests used in this study were Schirmer's test, Green lissamine test, tear film break-up time (BUT) and Goldmann applanation tonometry. Tear film BUT was measured following the guidelines described in the Dry Eye Workshop (DEWS) report . StaininThe patient was asked to close the eye, and after 5 minutes, the wetting of the Schirmer paper was measured. Intraocular pressure measured with a slit lamp\u2013mounted Goldmann applanation tonometer. Dry eye symptoms were assessed using the Ocular Surface Disease Index (OSDI). The questionnaire underlying the OSDI is specifically designed for patients with dry eye syndrome and asks patients regarding the frequency of specific symptoms and their impact on vision-related functioning. After the exams, patients received sufficient free samples of tafluprosta (Saflutan) eye drops for the use of a drop once overnight for 6 weeks. Such samples were provided by the examiner to avoid discontinuation of treatment for socioeconomic reasons.After 6 weeks, all patients underwent a new evaluation with the same exams and questionnaire. In this work, the diagnosis of dry eye was established as tear film BUT less than 5 seconds, Schirmer test less than 5 mm and / or Green lissamine test greater than 3 according to the van Bijsterveld scale 0 to 9) [ [9] Fig.Descriptive statistics were calculated for demographic and clinical characteristics. The means and standard deviations (SD) presented for the normally distributed variables and medians and interquartile ranges presented for non-normally distributed variables. Paired t-test was used to compare differences in the scores before and after the medication change. All statistical analyses were performed with Stata computer software . The alpha level was set at 0.05.Eleven patients (22 eyes) were evaluated, 8 women and 3 men. All patients had the diagnosis of primary open-angle glaucoma and used BAK preserved prostaglandin analog eye drops as monotherapy for at least one year. The mean age was 64.9 \u00b1 6.07 years. In this sample, 6 patients used bimatoprost 0.3%, 2 Travoprost 0.004% and 3 latanoprost 0.005%. At the beginning of the study, all patients had a dry eye diagnosis with at least 2 diagnostic exams with altered results and had an important complaint of foreign body sensation and burning eyes. The Schirmer test had a mean score of 5.0.9 \u00b1 2.75 mm (range 1-10 mm); The tear film BUT presented an average of 6.68 \u00b1 2.07 seconds (range 3-10 seconds); The green lissamine test was a moderate to severe dry eye in 15 eyes with a Bijsterveld index with a mean of 6.27 \u00b1 2.72 (range 1-6). Intraocular pressure showed an average of 11.5 \u00b1 1.56 mmHg (range 9 - 14mmHg). All patients answered 10 questions of the OSDI questionnaire, since 2 questions did not apply to any patient in the study. The average score obtained in the analysis of the questionnaire was 35.27 \u00b1 10.67 points (range 17.5 - 60 points), characterizing the patients' symptoms in mild to moderate.After 6 weeks, all patients were re-examined. All reported improvement of symptoms and only 4 patients complained of a slight sensation of sand in the eyes. The Schirmer test presented a mean \u00b1 SD of 4.36 \u00b1 2.40 mm (range 1-12 mm) without significant improvement (P = 0.198); tear film BUT score had a mean \u00b1 SD of 5.5 \u00b1 2.15 seconds (range 3-10 seconds) without significant improvement (P = 0.113); the green Lissamine test showed a significant improvement of the ocular surface, with most patients classified as light dry eye (P < 0.001). The Bijsterveld index presented a mean \u00b1 SD of 3.04 \u00b1 1.25 (range 1-5). A significant improvement in the score (P < 0.001) was also found, with a mean \u00b1 SD of 17.95 \u00b1 5.35 points (range 5-25 points), which classifies the patients' symptoms in the normal to light zone.This study demonstrated a significant improvement in OSDI and in van Bijsterveld\u2019s scale in patients who were using PG with BAK replaced by PG without BAK. This is the first study to evaluate ocular surface using OSDI and clinical evaluation in patients using PG with and without BAK. Currently, the only accepted way for preserving visual function in patients with glaucoma is reducing IOP. Although the disease is multifactorial, IOP remains the only modifiable risk factor for prevention or delay of visual deterioration. Chronic use of hypotensive eyedrops is associated with several adverse effects such as allergies, conjunctivitis, contact dermatitis, punctate keratitis and even failure of filtering surgery. This toxicity appears to be more associated with the preservative BAK than with the active component of the medication. From this point of view, single-dose preservative-free preparations would be a viable alternative to the currently used multiple-dose drops of eyedrops , 13. ThiFurthermore, we found a considerable improvement in self-reported quality of life of patients with glaucoma in accordance with previous studies that analyze symptoms and signs with preserved and preservative-free glaucoma medications in general , 15, 16.In patients with glaucoma, tear dysfunction is mainly attributed to chronic administration of preserved glaucoma medications. Benzalkonium chloride is known to damage the ocular surface, reduce the density of epithelial and goblet cells and alter the lipid layer. These changes result in an impaired tear film with excessive evaporation . There aA significant improvement was seen in the OSDI as a reduction in complaints about symptoms related to ocular surface. This result associated with a decrease in ocular surface staining, and consequently improvement of keratitis, as observed in our study may suggest that avoiding BAK exposure improves the health of the ocular surface. This study had some limitations; the sample size was limited to 22 eyes. However, this is one of the first studies comparing two medications with and without BAK, therefore, these preliminary results confirm the effect of BAK in ocular surface of patients with glaucoma. Second, there was no randomization without mask and data collection was performed by only one examiner, which allows patient or observer bias, mainly at the assessment of OSDI symptoms. Besides, this was a cross-sectional study. Longitudinal studies have to be performed to evaluate the BAK effect during a certain period. Lastly, the effect of ocular surface in quality of life of patients with glaucoma was not assessed. Further studies would be necessary to measure the real impact of BAK effect in these patients. As glaucoma requires a continuous treatment, it is important to assure the adherence to the treatment. Nevertheless, some signs and symptoms of ocular surface disease, like conjunctival hyperemia, foreign body sensation or irritation difficult this adherence [We found similar results to those found in the literature, which makes it possible to suggest that change of prostaglandin analogs BAK-preserved to tafluprost preservative-free is possible and can bring some benefits for patients like improvement of self-reported symptoms and reduction of clinical signs of dry eye in patients with glaucoma maintaining effective IOP control."}
+{"text": "Physician-patient interaction through email poses several concerns regarding the security, efficiency, and misinterpretation of critical information. Incoming emails received by a single university-based physician in 2013 were analyzed in order to determine whether a general non-patient specific email is appropriate for patient use. Emails received were divided into seven categories: Informational, Academic, Advertisement, Organization/Department/ University, Mission Critical, Personal, and Patient. A total of 9,102 emails were received and read by the physician, with an average of 25 emails per day, out of which 823 (9%) emails were directly sent by patients. The total time spent reading emails was five days, seven hours, and 24 minutes. General email is not an effective means of streamlining physician-patient communication. Non-essential emails, which represent a majority of incoming messages, decrease the productivity of physicians and prevent them from responding to urgent messages in a timely manner. Additionally, this creates the chance for critical patient information getting lost with the volume of received emails. This could be detrimental to patient care and satisfaction. Recently, an online portal was instated to provide a method of secure communication, and less than five patient emails were received in the physician\u2019s personal email since then. Follow-up appointments tend to be scheduled based on calendar availability rather than on patient need, leading to an increased necessity for doctor-patient communication between appointments . PatientWhen personal email is used, there are insufficient defenses to address security concerns . The FedThe demanding workload of physicians can be further hindered by unnecessary emails. Hospitalists reported that feeling overworked often prevents them from being able to fully discuss treatment options with their patients, and over 20% believe that stress from their average workload could have led to patient transfers, morbidity, or mortality . WorkloaWhen a patient does reach out to his or her physician via email, it usually relays vital and medically relevant information that may require a response . It is cPhysicians already spend a lot of time reading and responding to professional emails. This reduces available time for other endeavors. Our goal here is to quantify the time a physician spends reading emails\u00a0and to compare the volume of patient emails to the full range of emails crowding the inbox. We thus hope to determine whether a general, non-patient-specific email inbox is appropriate for patient use.We analyzed the number of emails delivered to an account accessible to both patients and university members. The data are the emails received by a single university-based physician received during the 2013 calendar year. Emails were divided into seven categories: Informational, Academic, Advertisement, Organization/Department/University, Mission Critical, Personal, and Patient. Informational emails provided general organizational information. Advertisement emails were sent by companies to promote their products\u00a0or inform about ongoing sales and promotions. Organization/department/university emails were intended to notify staff about upcoming events or activities. Mission-critical emails were messages requiring immediate attention regarding organizational occurrence or a patient\u2019s condition\u00a0but were not sent directly by patients. Personal emails addressed the physician\u2019s life outside of the hospital. Patient emails came directly from the patient, containing information about the patient\u2019s conditions\u00a0or questions about care. The total time spent on opening and reading emails was recorded in minutes. The total time spent on responding to emails was not included.In 2013, a total of 9,102 emails were received by the physician, with an average of 25 emails per day. A total of 823 (9%) emails were directly sent by patients. The total time spent reading emails was five days, seven hours, and 24 minutes. The mean weekly reading time was two hours and 27 minutes.Organizational/departmental/university emails account for 29.32% of the total received emails, averaging eight emails per day. Informational, advertisement, academic, and personal emails represent 22.41% (6.3 per day), 15.10% (2.7 per day), 9.09% (4.4 per day), and 3.85% (1.3 per day), respectively. Patient emails and mission-critical emails were grouped together because both categories contain vital information relating to patient care. Collectively, these categories represented 8.13% of the total emails  avoid using a professional email account when making online purchases or signing up for promotions, 2) request that senders indicate the significance of the email in the subject line by marking if it is a real emergency, and 3) avoid hitting \u201creply all\u201d when responding to messages unless everyone in the email truly requires that piece of information. Eliminating promotional emails from product marketers to a professional email account will significantly decrease the number of emails received and, as a result, decrease the reading time as well. Assigning importance in the subject line of the email will help doctors skim their emails in search of critical information and help those in need as soon as possible.LimitationsThe data was only collected from one individual, and it may not be representative of the experience of all physicians. Additionally, the fact that this physician practices in a university-affiliated hospital means that the additional university-related emails that he receives would not be received by physicians who are not working in a teaching hospital.Future researchThe time physicians spend responding to emails was not quantified in this study\u00a0but can be explored in the future to get a better idea of time spent on emails. Additionally, a\u00a0statistical analysis of the contents of the inboxes of multiple physicians can reveal whether the number and types of incoming emails vary significantly.Physicians spend an extensive amount of time on reading emails\u00a0and even more time when they must respond to them, but a majority of the emails they receive are not directly related to their patient care. If the influx of unwanted emails is minimized,\u00a0essential emails are flagged important in the subject line, and patients are encouraged to use secure portals, there is potential to better utilize email as a means of fostering more communication between doctors and their patients."}
+{"text": "MEFV) gene. Despite a typical clinical expression, many patients have either a single or no mutation in MEFV. The current work is aimed to revisit the genetic landscape of FMF disease using high\u2010coverage whole genome sequencing. In atypical patients (carrying a single or no mutation in MEFV), we revealed many rare variants in genes associated with auto\u2010inflammatory disorders, and more interestingly, we discovered a novel variant ( a 2.1\u2010Kb deletion) in exon 11 of IL1RL1 gene, present only in patients. To validate and screen this patient\u2010specific variant, a tandem of allele\u2010specific PCR and quantitative real\u2010time PCR was performed in 184 FMF patients and 218 healthy controls and we demonstrated that the novel deletion was absent in controls and was present in more than 19% of patients. This study sheds more light on the mutational landscape of FMF. Our discovery of a disease\u2010specific variant in IL1RL1 gene may constitute a novel genetic marker for FMF. This finding suggesting a potential role of the IL33/ST2 signalling in the disease pathogenicity highlights a new paradigm in FMF pathophysiology.Familial Mediterranean fever (FMF) is the most common auto\u2010inflammatory disease. It is transmitted as autosomal recessive trait with mutations in MEditerranean FeVer ( The gene can harbour multiple mutations in different exons; however, exon 2 and exon 10 are two mutational hot spots, with exon 10 having the largest number of mutations. The five founder mutations are p.Met694Val, p.Met694Ile, p.Val726Ala and p.Met680Ile present in exon 10 and p.Glu148Gln in exon 2, together they represent more than 80% of the disease\u2010causing mutations.The causing gene of FMF is the MEditerranean FeVer .The lack of comprehensive genetic analyses of FMF patients with single or no mutated allele in 22.1MEFV variant or with no identified MEFV variants. The 184 FMF patients were randomly selected from a large cohort of patients for whom Sanger sequencing of 10 exons of MEFV gene was performed, and who, based on copies of MEFV mutated allele, were stratified into three groups: (a) zero mutation: patients without any mutation in MEFV gene; (b) single mutation: patients with only one mutation in MEFV gene; and (c) double mutation: patients with two MEFV mutations. In order to increase the chance to identify novel and/or modifier genes for FMF, we purposely enriched our study cohort with more patients with a single or no variant in MEFV gene. We performed WGS on 50 patient samples  randomly selected from the 3\u2014Sanger sequencing\u2014defined subcategories and that of 26 healthy control subjects.The study population consisted of 402 unrelated Lebanese subjects including 184 FMF patients  recruited from several medical centres in Beirut, Lebanon, and 218 gender and ethnicity matched healthy controls recruited among subjects visiting the hospitals for routine health check\u2010up and who were free from any chronic inflammatory and autoimmune disease. Blood sample collection and storage was managed by the Medical Center CEMEDIPP and the American University of Science and Technology in Beirut, Lebanon. The diagnosis of FMF in our patients was made according to the established criteria of both Sohar (Tel Hashomer criteria) The study protocol was approved by ethics committee of Sidra Medicine, Doha, Qatar (Protocol number # 1511002018). All study subjects signed a written informed consent prior to be enrolled in the study.2.2Peripheral blood samples were collected from patients and controls in EDTA tubes and genomic DNA was extracted by standard salt\u2010precipitation methods.2.3https://www.qiagenbioinformatics.com/products/ingenuity\u2010variant\u2010analysis)] from QIAGEN, Inc\u201d) was used to filter variants based on various parameter: (a) Variants with low\u2010call quality (<20), low coverage (<10), which failed in VQSR filter and which were present in low complexity region were excluded, (b) variants with allele frequencies more than 1% in public database including 1000G phase3,Paired\u2010end raw fastq files were mapped to the reference human genome, build GrCh37, using BWA\u2010MEM aligner: 0.7.12\u2010r1039,https://github.com/ryanlayer/samplot).For copy number variant (CNV) analysis, we used three structural variant callers: Delly version 0.7.8, Speedseq version 0.1.2 and GenomeSTRiP version 2.00.171, and we applied the best practices recommended by authors of the tools. The annotation of structural variant was carried out using AnnTools version 1.0.https://www.lovd.nl).We have submitted all the variants reported here to LOVD website , identified by WGS, was performed in all 402 subjects using a tandem of 2 PCR assays ]). First, samples are analysed by AS\u2010PCR using primers flanking a genomic region of 3\u00a0Kb encompassing the 2.1\u2010Kb deletion. A simultaneous amplification of a 3\u2010Kb fragment and a 0.9\u2010Kb fragment corresponds to the presence of a heterozygous deletion of exon 11 of the IL1RL1 gene, and an amplification of a 3\u2010Kb fragment only indicates the absence of such deletion. In order to confirm the outcome of the AS\u2010PCR, a qRT\u2010PCR was performed to quantify the copy number of the region flanking the 2.1\u2010Kb deletion.Screening for the presence of the novel variant (2.1\u2010Kb deletion) of TM MP Imaging System (Bio\u2010Rad).Briefly, 50\u00a0ng of genomic DNA was subjected to a total of 25\u00a0\u03bcL PCR containing 200\u03bcM dNTP, 0.5\u00a0\u03bcmol/L each of forward and reverse primer and 0.5 unit Phusion\u00ae High\u2010Fidelity DNA polymerase (NEB), with a PCR program of 95\u00b0C for 1\u201930\u2019\u2019, followed by 35 cycles at 94\u00b0C for 25\u201d, 65\u00b0C for 30\u201d and 72\u201d for 1\u201940\u201d in a Veriti Thermal Cycler (Applied Biosystems). Primers were designed to amplify a 3.0\u2010Kb fragment encompassing the 2.1\u2010Kb deletion: Forward primer 5\u2019\u2010 TCTCACACTCAAGCTTGTGCTG\u20103\u2019 and reverse primer 5\u2019\u2010AGAGCTCTCATACACAACTGGTG\u20103\u2019. All PCR products were examined by electrophoresis on 1.5% agarose gels and photographed with a ChemiDocT (\u0394\u0394CT) method.To confirm the outcome of the AS\u2010PCR, the qRT\u2010PCR was performed using two sets of pair of primers; one set was used to amplify a DNA fragment within the 2.1\u2010Kb deletion (forward primer 5\u2019\u2010AGAAGCAATAGTGCCTGCTG\u20103\u2019 and reverse primer 5\u2019\u2010ATTCCTGCTCCTCACACTTC\u20103\u2019), and another set to amplify, as an endogenous control, a DNA fragment upstream the 2.1\u2010Kb deletion (forward primer 5\u2019\u2010AACGGCTCAAGAGACTTGTG\u20103\u2019 and reverse primer 5\u2019\u2010TACTTCTACCTGCATGGGTG\u20103\u2019). The qRT\u2010PCR was performed in a total volume of 20\u00a0\u03bcL containing 15\u00a0ng genomic DNA, 10\u03bcl GoTaq\u00ae qPCR Master Mix (Promega) and 0.5\u00a0\u03bcmol/L each of forward and reverse primer using a cycling program of 2\u2019 at 50\u00b0C, 2\u2019 at 95\u00b0C, 40 cycles consisting of 15\u201d at 95\u00b0C and 45\u201d at 60\u00b0C, and a dissociation curve analysis step of 15\u201d of a rapid ramp to 95\u00b0C, 15\u201d at 60\u00b0C and 15\u201d of a slow ramp to 95\u00b0C on a QuantStudio 6 Flex Real\u2010Time PCR system (Applied Biosystems) in Fast 96\u2010well plate format. qPCR for each amplicon of each patient was performed in triplicate, and AS\u2010PCR\u2013verified WGS patients with and without the 2.1\u2010Kb deletion were included for each plate as controls. The results were analysed using the comparative CMEFV mutation vs patients with 2 MEFV mutations), and the Phi coefficient was used to generate the effect size of this novel variant in patients.Chi\u2010square test was used to compare the frequency between the two groups of patients  patients had biallelic variants of the MEFV gene, 57 (31.0%) patients were heterozygous, while 69 (37.5%) patients did not carry any coding mutations in MEFV gene. The mutational analysis showed that the Met694Val mutation was the most frequent mutation, followed by the Val726Ala, p.Pro158Ser/p.Pro369Ser, p.Arg197Gln/p.Arg408Gln and Met694Ile. This result is in agreement with previous studies.The 184 FMF patients of the present study were randomly selected from a large cohort for which Sanger sequencing of coding sequence of 3.2MEFV gene, we analysed the WGS data of 50 patients, randomly selected from the 3 subcategories of patients, and that of 26 healthy control subjects.To investigate the potential presence of variants in novel pathogenic and/or modifiers genes in FMF patients with single or no mutated allele in We performed the identity by descent (IBD) estimation MEFV mutations in patients, initially defined by Sanger sequencing, was confirmed by WGS. The list of all MEFV variants, identified by WGS, found in the 50 patients with FMF is shown in Table\u00a0MEFV variants were exclusively present in FMF cases and were absent in controls. In addition, WGS revealed in our patients three novel variants in the promoter region of MEFV gene: c.\u2010123A\u00a0>\u00a0G, c.\u2010397C\u00a0>\u00a0G and c.\u20101309G\u00a0>\u00a0A (reference sequence: NC_000016.9). These heterozygous promoter variants were present in only 3 FMF cases and were predicted to cause loss of the promoter function of the gene. Beside non\u2010synonymous and promoter variants, two synonymous heterozygous variants (p.Pro124Pro and p.Arg290Arg/p.Arg501Arg) were found in FMF cases.The status of 3.3http://www.autoinflammatory\u2010search.org/)) and Infever database.PRF1 NM_005041.4:c.272C\u00a0>\u00a0T , NM_005041.4:c.1153C\u00a0>\u00a0T (p.Arg385Trp) and STXBP2 NM_006949.3:c.1034C\u00a0>\u00a0T (p.Thr345Met) variants present in 3 patients each, while variants in other known FHL\u2010associated genes (RAB27A and UNC13D) were present in one FMF case each. PRF1 p.Ala91Val variant is classified as DFP  in the Human Gene Mutation Database (HGMD) MEFV revealed also the presence of variants in PSTPIP1 (NM_003978.4:c.203C\u00a0>\u00a0A (p.Thr68Lys) and a splice site variant NC_000015.9(NM_003978.4):c.37\u201010081C\u00a0>\u00a0G), TNFRSF11A (NM_003839.3:c.1234G\u00a0>\u00a0T (p.Asp412Tyr), NM_003839.3:c.1348C\u00a0>\u00a0T (p.Arg450Trp)) and in NLRP3 (NM_001079821.2:c.2861C\u00a0>\u00a0T (p.Thr954Met)). Furthermore, four different variants in NOD2 gene (NM_022162.2:c.2230C\u00a0>\u00a0T (p.Arg744Trp), NM_022162.2:c.2127G\u00a0>\u00a0A (p.Trp709*), NM_022162.2:c.676_691del (p.Arg227fs*145) and NC_000016.9(NM_022162.2):c.2883\u20102A\u00a0>\u00a0G) were also observed in FMF cases. Other auto\u2010inflammatory disorder genes, which had missense substitution in our present cohort of FMF cases, were IFIH1 (NM_022168.3:c.1126G\u00a0>\u00a0A (p.Glu376Lys), and NM_022168.3:c.2597C\u00a0>\u00a0T (p.Pro866Leu)), PLCG2 (NM_002661.4:c.82A\u00a0>\u00a0T (p.Met28Leu)), TNFAIP3 (NM_001270508.1: c.406C\u00a0>\u00a0T (p.Arg136Cys)) and SH3BP2 (NM_001145856.1:c.1600C\u00a0>\u00a0T (p.Arg534Trp)). We observed also three predicted pathogenic variants in genes associated with Psoriasis 2 and 15 (CARD14 NM_024110.4:c.1789C\u00a0>\u00a0T (p.Arg597Trp) and NM_024110.4:c.1789C\u00a0>\u00a0T (p.Arg597Trp) and AP1S3 NM_001039569.1:c.11T\u00a0>\u00a0G (p.Phe4Cys)) in FMF cases, with AP1S3 (p.Phe4Cys) listed as disease\u2010causing mutation (DM) for psoriasis 15 in the HGMD.After filtering out variants which had high prevalence in the general population  or were present in controls, we first examined variants in known AID\u2010associated genes. More than 50 genes associated with auto\u2010inflammatory disorders were selected from Systemic autoinflammatory disease ) was the most common variant among FMF cases, and it was present in 7 out of 50 FMF cases (from the three FMF subgroups). IFNAR2 associates with IFNAR1 to form a receptor for interferons alpha (IFNA1) and beta (IFNB1). In the present study, FMF cases also had variants in IFNAR1 (NM_000629.2:c.954G\u00a0>\u00a0C (p.Trp318Cys)) and in IFNB1 (NM_002176.3:c.498A\u00a0>\u00a0G (p.Ile166Met)), which were present in two FMF cases and one FMF case, respectively. A more comprehensive screening from the list of inflammatory genes identified from Ingenuity revealed that our FMF patients had many variants in genes of the superfamily of TNF and its receptors. A stop gain variant in TNFRSF4 (NM_003327.3:c.384C\u00a0>\u00a0A (p.Cys128*)) was present in two FMF cases, whereas missense variants in TNFRSF8 (NM_001243.4:c.1511G\u00a0>\u00a0A (p.Arg504Gln)) and TNFRSF9 (NM_003811.3:c.716G\u00a0>\u00a0A (p.Arg239Gln)) were present in single FMF case each. We also identified two variants in genes involved in TLR pathway: TLR1 (NM_003263.3:c.1013T\u00a0>\u00a0C (p.Met338Thr)) and TRAFD1 (NM_001143906.1:c.908A\u00a0>\u00a0C (p.Glu303Ala). Many interleukins and their receptors sequences were also found to be altered in FMF patients like IL17RB (NM_018725.3:c.529G\u00a0>\u00a0A (p.Gly177Arg)), IL17RD (NM_017563.4:c.1696C\u00a0>\u00a0T (p.Pro566Ser)), IL1R2 (NM_004633.3:c.932T\u00a0>\u00a0C (p.Ile311Thr)), IL20 (NC_000001.10(NM_018724.3):c.225\u00a0+\u00a01G>T), IL12A ) and IL1A (NM_000575.4:c.526G\u00a0>\u00a0C (p.Asp176His)), with IL17RB (NM_018725.3:c.529G\u00a0>\u00a0A (p.Gly177Arg)) and IL1R2 (NM_004633.3:c.932T\u00a0>\u00a0C (p.Ile311Thr)) variants present in three patients each, and the remaining other variants present in one case each. Among NLR family of genes, NLRC3 NM_178844.3:c.2401G\u00a0>\u00a0A: (p.Ala801Thr), NLRP2 NM_017852.4:c.2672G\u00a0>\u00a0T  and NLRX1 NM_024618.3:c.1480G\u00a0>\u00a0A  were present in one FMF case each. A missense variant in CASP14 gene (NM_012114.2:c.418G\u00a0>\u00a0A (p.Gly140Ser)) was observed in one FMF case. Endoplasmic reticulum aminopeptidases genes, ERAP1 and ERAP2, which encode proteins involved in peptide trimming for HLA class I molecules,LILRB1 NM_006669.6:c.997G\u00a0>\u00a0T (p.Gly333Cys), RAB27B NM_004163.4:c.274G\u00a0>\u00a0A (p.Ala92Thr) and ICAM1 NM_000201.2:c.1099C\u00a0>\u00a0T (p.Arg367Cys).Variants in known AID\u2010associated genes identified in our cohort were not sufficient to completely draw the genetic variation pattern in our FMF patients. We further looked for the predicted pathogenic variants in inflammatory genes either interacting with known genes associated to AIDs or involved in auto\u2010inflammation processes, using knowledge base of Ingenuity variant analysis. The list of variants in inflammatory genes found in the 50 FMF patients is shown in Table\u00a03.5IL1RL1 gene, which was consistently detected by all three software. This heterozygous deletion in exon 11 of IL1RL1 gene  was around 2.1\u00a0Kb in size and was present in 9 FMF cases carrying one mutated allele of the MEFV gene and reported by three software on same subjects. For the visualization and confirmation of structural variants, we used SAMPlot. The representative figure of IL1RL1 deletion in FMF cases and controls is shown in Figure S1. The search of the identified IL1RL1 variant in the 1000G phase 3 data set showed the presence of a larger deletion of 3.1\u00a0Kb , overlapping with the 2.1\u2010Kb IL1RL1 deletion, in only one subject among 2504.Beside point mutations and small indels, we also looked for the structural variants in the whole genome of the 50 FMF cases. Variant calling was done using Delly version 0.7.8, GenomeSTRiP version 2.00.17.1 and Speedseq version 0.1.2 using best practices recommended by authors of the tools. Later, final output from these 3 tools annotated with Anntools version 1.0. After removing variants, which either were present in controls or were located in non\u2010coding regions, 164 deletions were identified by GenomeSTRiP version 2.00.17.1, 704 variants  were found by Speedseq version 0.1.2 and 1178 variants  were identified by Delly version 0.7.8. For genotyping structural variants, we used their respective genotyper modules or tools such as SVTyper for speedseq, SVGenotyper module of GenomeSTRiP and integrated genotyper of Delly. We performed manual inspection of all these variants and found a deletion in IL1RL1 deletion variant) per patient to demonstrate the genotype of all FMF patients at these loci. There is no distinct pattern of distribution of AID\u2010associated variants and inflammatory gene variants among three subgroup of FMF patients  IL1RL1 deletion variant was particularly enriched in FMF patient with single MEFV variant in WGS cohort. Few FMF patients had burden of several rare variants of AID and/or inflammatory genes.Table\u00a03.6IL1RL1\u00a0gene was performed in all 402 study subjects using allele\u2010specific PCR (AS\u2010PCR) followed by quantitative real\u2010time PCR (qRT\u2010PCR). No discrepancies in\u00a0IL1RL1 variant genotyping were found between AS\u2010PCR and qRT\u2010PCR. Figure\u00a0IL1RL1 gene and the quantification by qRT\u2010PCR of the copy number of the region flanking the 2.1\u2010Kb deletion. The distribution of the IL1RL1\u00a0deletion in FMF according to the number of the mutated\u00a0MEFV\u00a0alleles is shown in\u00a0Table\u00a0IL1RL1\u00a0was found in FMF patients only. More than 19% of FMF patients are carriers of the\u00a0IL1RL1\u00a0deletion. The frequency of\u00a0IL1RL1\u00a0variant was found higher in patients with a single or no mutation in\u00a0MEFV\u00a0gene compared to that in patients carrying 2\u00a0MEFV\u00a0mutations  with an effect size of 0.12. No control subject was found to be a carrier of this variant.To validate the finding revealed by WGS and CNV analysis, a search of the 2.1\u2010Kb deletion detected in the\u00a04MEFV gene, with several patients carrying a burden of rare variants in auto\u2010inflammatory genes.In the present report, we showed significant genetic heterogeneity in FMF patients having single or no mutated allele of MEFV gene in FMF cases to characterize MEFV mutations and to stratify patients based on the number of mutated alleles of MEFV. The most common MEFV mutation in our patient group was pMet694Val followed by p.Val726Ala, which is similar to other published reports in Lebanese and Middle Eastern populations.We first performed Sanger sequencing of coding region of NLRP3, TNFRSF1A and MVK,PRF1, STXBP2, RAB27A and UNC13D) associated with familial haemophagocytic lymphohistiocytosis (FHL) were present in about 20% of our FMF patients. Genes associated with FHL are known to encode cytotoxic proteins: PRF1 encodes perforin, which permeabilizes the target cell membrane, UNC13D encodes Munc13\u20104 protein that causes cytolytic granule fusion with the cell membrane during degranulation, RAB27A encodes small Rab GTPase, which plays a role in exocytosis of cytotoxic vesicles, while STXBP2 is involved in the release of cytotoxic granules by natural killer cells.As some recent familial and non\u2010familial studies on FMF have identified the role of selected auto\u2010inflammatory genes like IFNAR2 NM_207585.2:c.611C\u00a0>\u00a0G: (p.Thr204Arg), which was present in 14% of FMF cases from all subcategories  and which is involved in type 1 interferon signalling.We further investigated variations in novel genes, which are reported to interact with known auto\u2010inflammatory genes or which may have a role in auto\u2010inflammation process. The top candidate variant identified in this analysis was IL1RL1) gene. This deletion initially revealed by WGS was present in 9 FMF patients with a single mutated allele of the MEFV gene. The high frequency of this genetic alteration in our patients compared to controls and its relevance to the pathophysiology of inflammatory diseases stimulated the search of its presence in all 402 study subjects. Interestingly, the IL1RL1 variant, absent in controls, was confirmed in more than 19% of FMF patients belonging to the different MEFV subgroups. The IL1RL1 variant was found even higher in FMF patients carrying a single or no mutation in MEFV gene.Our initial search for rare structural variants in exonic regions performed on the 76 WGS (50 FMF cases and 26 controls) led to the discovery of a novel (2.1\u2010Kb deletion) variant in interleukin\u20101 receptor\u2010like 1  in atypical FMF patients (carrying a single or no mutation in MEFV), supports the multigenic inheritance model of FMF, a large\u2010scale typing in Lebanese FMF patients is needed. The small number of healthy control subjects included in the Genome sequencing analysis constitutes a potential limitation of our study. Replication of the present findings in other populations will be useful to determine whether the association between these genetic markers and FMF can be generalized. We believe that our findings could have potential implications in the diagnostic and disease management of FMF. The extreme variability of clinical presentation and disease severity of FMF constitute a significant challenge for clinicians. As pointed out by Gangemi et al,MEFV genotype\u2010phenotype correlation in FMF patients has been intensively investigated, a clear consensus has not yet been reached. Several hypotheses have been proposed to explain the clinical heterogeneity of FMF but the clinical and diagnostic dilemma remain unsolved. While the current study showed that FMF patients carried a large spectrum of variants in several inflammatory genes, certain variants seem to be quite prevalent in patients carrying a single or no mutation in MEFV gene including variants in the 4 genes  associated with FHL and the novel variant that we have discovered in the IL1RL1 gene. A more holistic approach integrating clinical data and comprehensive genetic investigations, not limited to MEFV, could constitute the most effective diagnostic process to confirm or refute the diagnosis of FMF. A large phenotype\u2010genotype study will be undertaken to identify potential associations between the numerous genetic variants herein reported and specific clinical features of FMF.Although this current study, showing the presence of many rare variants in genes associated with auto\u2010inflammatory disorders and a novel variant (a 2.1\u2010Kb deletion) in exon 11 of IL1RL1 gene variant that we have identified in a significant proportion of our patients qualifies as an additional genetic marker for FMF. These findings pave the way for future studies that would provide more insight into the molecular mechanisms underlying FMF and for the design of new and more effective genetic tests for the diagnosis of FMF.In conclusion, this study provides novel evidence supporting a multigenic model of inheritance in FMF. The novel The authors confirm that there are no conflicts of interest.Meenakshi Umar: Data curation ; Investigation ; Methodology ; Writing\u2010original draft (lead); Writing\u2010review & editing (supporting). Andre Megarbane: Conceptualization (supporting); Data curation ; Investigation ; Resources (lead). Jingxuan Shan: Investigation ; Methodology (supporting); Writing\u2010original draft (supporting). Najeeb Syed: Data curation ; Formal analysis . Eliane Chouery: Data curation ; Formal analysis . Elbay Aliyev: Data curation ; Formal analysis . Puthen Jithesh: Data curation (supporting); Formal analysis . Ramzi Temanni: Data curation (supporting); Formal analysis . Issam Mansour: Data curation (supporting); Resources (supporting). Lotfi Chouchane: Conceptualization ; Project administration (supporting); Supervision ; Writing\u2010original draft ; Writing\u2010review & editing . Aouatef Ismail Chouchane: Conceptualization ; Funding acquisition (lead); Project administration (lead); Supervision (lead); Writing\u2010original draft ; Writing\u2010review & editing .Fig S1Click here for additional data file.Table S1Click here for additional data file."}
+{"text": "The past decade has seen the rise of omics data for the understanding of biological systems in health and disease. This wealth of information includes protein-protein interaction (PPI) data derived from both low- and high-throughput assays, which are curated into multiple databases that capture the extent of available information from the peer-reviewed literature. Although these curation efforts are extremely useful, reliably downloading and integrating PPI data from the variety of available repositories is challenging and time consuming.http://www.reading.ac.uk/bioinf/PINOT/PINOT_form.html) to optimise the collection and processing of PPI data from IMEx consortium associated repositories (members and observers) and WormBase, for constructing, respectively, human and Caenorhabditis elegans PPI networks.We here present a novel user-friendly web-resource called PINOT . PINOT provides the user with information on detection methods and publication history for each downloaded interaction data entry and outputs the results in a table format that can be straightforwardly further customised and/or directly uploaded into network visualization software.Video abstract During the past two decades the use of omics data to understand biological systems has become an increasingly valued approach . This inHowever, the process of collating PPI data is currently hampered by the fact that no single data source encompasses the full extent of PPIs reported in literature; hence, users are required to merge  information mined from multiple different primary databases. Merging such data is not straightforward due to inconsistencies in data format and differences in data curation across the PPI databases (e.g. IMEx member vs non-member databases).To optimize the use of PPI data within the public domain, we developed a user-friendly tool that assists PPI data extraction and processing: the Protein Interaction Network Online Tool (PINOT). This tool represents the development (and automation) of our previous PPI analysis framework, termed Weighted Protein-Protein Interaction Network Analysis (WPPINA) , 11\u201315. http://www.reading.ac.uk/bioinf/PINOT/PINOT_form.html (hereafter referred to as \u201cweb tool\u201d). A choice of parameters is integrated by default as explained further below and in Supplementary Materials per user choice.PINOT can be run automatically at A list of proteins of interest (seeds) can be queried to identify their literature-reported interactors that have been curated into PPI databases Fig.\u00a0.Fig. 1PHomo sapiens (taxonomy ID: 9606) the seed identifiers submitted into the query field must be in an approved HUGO Gene Nomenclature Committee (HGNC) gene symbol [via API: Shannon, P. (2020) PSICQUIC R package, DOI: 10.18129/B9.bioc.PSICQUIC [https://www.mechanobio.info), MINT [For e symbol  or validPSICQUIC , IntAct PSICQUIC , MBInfo nnon, P. 20 PSICQUo), MINT . The dowCaenorhabditis elegans (taxonomy ID: 6239) the seed identifiers must be in an approved WormBase gene ID [C. elegans query consists of: i) a network file , which is a tab-spaced text file containing the processed PPIs for the seeds in the initial query list; and ii) a log file  reporting proteins that have been discarded within the data processing procedure.For  gene ID , 23 form gene ID , 24. TheThe PINOT pipeline is coded in R and runs on a Linux server at the University of Reading, with java servlets processing user\u2019s submissions via the web interface.We have tested the PINOT pipeline using multiple input query lists structured as follows: i) small input lists (less than 20 seed proteins), selected randomly or in association with typical processes suspected to be functionally relevant for Parkinson\u2019s Disease (PD); and ii) a large input list\u2009=\u2009941 proteins, the human mitochondrial proteome as reported by MitoCarta2.0 .C. elegans data). For this analysis, query parameters were selected (where possible) to maximize the extraction of protein interactions: HIPPIE was used with confidence score\u2009=\u20090 and no filters on confidence level, interaction type or tissue expression; and MIST was used with no filter by rank parameter to download all PPIs regardless of the assigned confidence score. It is noteworthy to highlight that files from HIPPIE and MIST required manual parsing after download to remove entries that do not include a PMID and/or conversion method code (incomplete entries). Data were downloaded on 18th September 2019 (H. sapiens) and on 24th September 2019 (C. elegans).PINOT was compared to two alternative yet related online PPI query tools, Human Integrated Protein-Protein Interaction Reference  and Molecular Interaction Search Tool  as input, queries PSICQUIC at submission and returns an up-to-date table containing a comprehensive list of PPIs - published in peer-reviewed literature \u2013 centred upon the seeds. This table consists of a variable number of rows and 11 columns Fig. c. Each rThe PINOT output can be imported into Cytoscape  for netwIn Fig.\u00a0The performance of PINOT was compared to that of alternative resources for both small and large lists of seeds. Regarding the former, five different small seed lists were used as input for PPI query in HIPPIE  and MISTPINOT, HIPPIE and MIST retrieved a similar number of PPIs. PINOT with stringent filtering applied, was always extracting fewer interactions; this is an expected outcome since this filter option is built with the purpose of retaining only annotations that have survived stringent screening, largely based on completeness of curated data entries.Results for the large input list query were compared, PINOT vs HIPPIE. These\u00a0two web tools allowed for easy processing of more than 900 seeds within the submission list. The number of retrieved interactors was slightly higher for HIPPIE in comparison with PINOT when the stringent quality control (QC) filter was applied; however PINOT retrieved more interactions than HIPPIE when the lenient filter option was selected Fig. b. FurtheC. elegans PPI data was tested alongside the C. elegans query option in MIST, assessing interaction networks of different dimensions  facilitating the prioritisation of experimental results for validation. PINOT is also useful to evaluate interactors of different proteins/genes of interest within an input seed list simultaneously. The analysis of the combined interactomes of such seeds can reveal the existence of communal interactors, can provide a base to cluster the seeds into groups and can support further functional analysis to better characterize the functional landscape of seeds of interest.Alternative tools that appear to be similar to PINOT are HIPPIE and MIST. STRING  is a conPINOT has access to the most up-to-date interactions that could be retrieved at a given time from PSICQUIC .PINOT implements QC filtering, which involves discarding PPI data entries that are curated without a PMID or with multiple PMIDs and/or without a interaction detection method annotation. Therefore the output file from PINOT does not require any further QC by the user, while output data from HIPPIE and MIST require manual parsing and inspection before analysis to remove incomplete data entries through a time consuming, post-hoc processing procedure.Another distinctive feature of the PINOT pipeline is the implementation of a unique interaction detection method conversion step. During this step, the interaction detection method annotation for each downloaded interaction data entry is converted based on a conversion table  . MIST siAdditional file 1: S1.\u00a0=\u2009supplementary materials and methods.Additional file 2: S2.\u00a0=\u2009supplementary file 1: \u2018interaction detection method conversion\u2019."}
+{"text": "ITGBL1 inhibited immune cell cytotoxicity against melanoma cells by inhibiting NK cells cytotoxicity and counteracting beneficial effects of anti-PD1 treatment, both in vitro and in vivo. Mechanistically, MITF inhibited RUNX2, an activator of ITGBL1 transcription. Interestingly, VitaminD3, an inhibitor of RUNX2, improved melanoma cells to death by immune cells. In conclusion, our data suggest that inhibition of ITGBL1 might improve melanoma response to immunotherapies.Resistances to immunotherapies remains a major hurdle towards a cure for melanoma in numerous patients. An increase in the mesenchymal phenotype and a loss of differentiation have been clearly associated with resistance to targeted therapies. Similar phenotypes have been more recently also linked to resistance to immune checkpoint therapies. We demonstrated here that the loss of MIcrophthalmia associated Transcription Factor (MITF), a pivotal player in melanocyte differentiation, favors the escape of melanoma cells from the immune system. We identified Integrin beta-like protein 1 (ITGBL1), a secreted protein, upregulated in anti-PD1 resistant patients and in MITFThe online version contains supplementary material available at 10.1186/s12943-020-01306-2. Despite recent therapeutic improvements, the prognosis of patients with metastatic melanoma is still very pejorative. Targeted therapies (TT) using BRAF in combination with MEK inhibitors, have shown very high response rates. However, quasi systematic acquired resistances have limited the improvement of patient survival . Immuno-Genetic events, including mutations that cause resistance to TT or ICT have been extensively described. However, the main cause of resistance to TT is non-genetic. It implies a rewiring of the transcriptional program allowing the adaptation of melanoma cells to stressful conditions imposed by the micro-environment or by the treatment itself. Despite the diversity of non-genetic mechanisms of resistance, loss of MITF, loss of differentiation, as well as implementation of a pseudo-EMT and inflammatory phenotype  are centMITF silencing with 2 different MITF siRNA, caused a 2-fold decrease in 501Mel cells death induced by activated PBMCs  compare to control (shScr)  and used melanoma cells with no MITF. These experiments have demonstrated that modulation of MITF regulates RUNX2 and ITGBL1 (sup. fig. We also investigated the role of beta-catenin, an upstream regulator of MITF and RUNX2. In 501Mel cells, known to have a \u03b2-catenin activating mutation, we confirmed a high LEF/TCF activity in 501Mel compared to A375. As expected, WNT3a activated the LEF/TCF luciferase reporter in A375 cells, but not in 501Mel cells (sup. fig. Our results have identified ITGBL1 as a new immunomodulator secreted by melanoma cells. ITGBL1 inhibits immune cell-mediated destruction of melanoma cells through the modulation of tumoral innate immune system and the decrease in NK cell activity. Importantly, studies in immunocompetent mouse model, shows that ITGBL1 impairs the anti-tumor effect of anti-PD1, suggesting that ITGBL1 might be key player in the resistance to ICT. At a mechanistic point of view, MITF represses RUNX2 which is strong transcriptional activator of ITGBL1. Interestingly, vitamin D3, a RUNX2 inhibitor, that have already shown to have a positive effect on the innate immune system , decreasAdditional file 1."}
+{"text": "Sclerochoroidal calcification (SCC), a rare condition found in elderly people, is idiopathic or occasionally secondary to disorders affecting calcium metabolism. Findings of multimodal imaging including choroidal circulation are, however, largely unknown. We present a patient of SCC with systemic background, who underwent multimodal imaging evaluations.A 70-year-old Japanese man was referred to our clinic because of bilateral fundus lesions. He had a history of chronic kidney disease (CKD) and secondary hyperparathyroidism. Fundus photography showed a cluster of choroidal folds in the superotemporal extra-macular region OS. Swept-source optical coherence tomography demonstrated ellipsoid zone disruption OD, retinal pigment epithelium undulation OS, dilated Haller layer veins OU, and central choroidal thickening OU and thinning of the overlying choroid due to scleral elevation OS. Fluorescein angiography detected macular hyperfluorescence OD. Indocyanine green angiography demonstrated choroidal vascular hyperpermeability together with numerous scattered hypofluorescent lesions OU. Fundus autofluorescence showed multiple hypoautofluorescent spots surrounded by hyperautofluorescent areas OD. Laser speckle flowgraphy exhibited choroidal blood flow reduction represented by a cold color pattern OU. B-mode echography displayed hyperechoic solid lesions with acoustic shadowing and orbital computed tomography revealed high density areas in the sclera, both of which were consistent with calcification. The patient was diagnosed with SCC, and these imaging findings remained unchanged 7\u2009months after the diagnosis.We reported a case of SCC with the background of CKD. Our detailed multimodal observations indicated choroidal hypoperfusion possibly caused by mechanical compression due to calcium deposition in the sclera. Sclerochoroidal calcification (SCC) is a rare condition that can be incidentally identified as abnormal fundus lesions in the elderly during routine ophthalmological examinations . In addiA 70-year-old Japanese man complained of blurred vision in both eyes and was referred to our clinic because of bilateral fundus lesions. He had a history of CKD and secondary hyperparathyroidism with no family history. CKD is defined as any renal disorder lasting more than 3\u2009months, the severity of which is classified into 1 to 5 stages based on its etiology, urine protein levels and renal function. This patient suffered stage 5 CKD  of unknown etiology, having received hemodialysis for 35\u2009years.His best-corrected visual acuity was 0.9 OD and 1.0 OS with mild myopia, and his intraocular pressure was normal OU. Slit-lamp microscopy did not detect any findings except mild cataract OU. Color fundus photography (CFP) revealed pale choroidal lesions in the inferior mid-periphery OD and in the superior and inferonasal regions OS Fig.\u00a0e and f. Laboratory tests revealed that serum creatinine levels increased at 6.35\u2009mg/dl. Serum calcium and phosphorus levels slightly decreased to 8.3\u2009mg/dl , and 2.6\u2009mg/dl , respectively. Vitamin D3 levels decreased to 9\u2009pg/ml . Since he had taken a daily oral use of the vitamin D analogue alfacalcidol, parathyroid hormone levels were within the normal range. The patient was diagnosed with SCC based on the multimodal imaging characteristics. The patient\u2019s ocular manifestation was observed with no treatment. His ophthalmological findings remained unchanged 7\u2009months after the diagnosis.The present study demonstrated novel findings on SCC via multimodal imaging techniques, so as to better understand clinical manifestations of the disease. To the best of our knowledge, this report is the first to show choroidal blood flow impairment in SCC. As seen in the current case, outer retinal abnormalities , RPE disFung et al. analyzed 9 cases of SCC using EDI-OCT, and demonstrated that calcium deposition developed exclusively within the sclera exerting compression to the overlying choroid. They referred to the anterior surface of the calcified sclera as \u201crocky\u201d and \u201crolling\u201d appearances . The rocHyperautofluorescent findings on FAF are typically related to increased lipofuscin accumulation in metabolically stressed or diseased RPE. Along with progressive RPE dysfunction, hyperautofluorecence then turns to hypoautofluorescence indicative of RPE atrophy. Caminal-Mitjana et al. compared FAF and spectral-domain OCT findings in 3 cases of SCC and revealed a mixture of hyper- and hypoautofluorescence depending on the degree of compression . They hyThere were few reports describing ICGA findings in patients with SCC. In a previous case report, ICGA showed hyperfluorescence, which appeared to be CVH, in the corresponding region of SCC . In our In conclusion, we reported a case of SCC with the background of CKD. Our detailed multimodal imaging analyses for the first time demonstrated choroidal circulation disturbance possibly caused by mechanical compression due to massive calcium deposition in the sclera. Further investigation into SCC patients without CKD would be needed in the future to validate our current hypothesis."}
+{"text": "Monozygotic multiple pregnancy is rare in horses, but may be more common after transfer of an in vitro produced (IVP) embryo.To determine the occurrence, incidence, characteristics and outcome of monozygotic siblings arising from in vivo and IVP equine embryos.Retrospective case series.A total of 496 fresh in vivo and 410 frozen\u2010thawed IVP blastocysts, produced by intracytoplasmic sperm injection (ICSI) of in vitro matured oocytes from Warmblood mares, were transferred into recipient mares. The likelihoods of pregnancy and multiple pregnancy were calculated, and the clinical features and outcome of any multiple pregnancy were recorded.The likelihood of pregnancy after transfer of a single IVP or in vivo embryo was 62% (254/410) and 83% (413/496) respectively. The incidence of multiple pregnancy was 1.6% (4/254) and 0% (0/413) for IVP and in vivo blastocysts, respectively. More specifically, three IVP blastocysts yielded twin embryo propers/fetuses, and one IVP conceptus developed three distinct embryonic bodies. Interestingly, only one embryonic vesicle was detected at all ultrasonographic examinations prior to embryo proper development. Multiple embryonic bodies only became apparent at later scans to check for an embryo proper and heartbeat, or when the recipient mare aborted. Two twin pregnancies aborted spontaneously at 3 and 9\u00a0months, respectively, while the heartbeat was lost from all three embryos in the triplet pregnancy before day 35 of gestation. Twin reduction by per rectum compression of one fetal thorax was attempted at day 50 of gestation in the fourth case; however, both fetuses were lost.Small number of cases.In vitro embryo production resulted in a higher incidence of multiple monozygotic pregnancy, which could only be diagnosed after development of the embryo proper and is likely to result in pregnancy loss later in gestation if left untreated. In vitro embryo production (IVEP) by intracytoplasmic sperm injection (ICSI) of in vitro matured oocytes has become an increasingly popular technology in the equine breeding industry because it offers a solution for subfertility of mares and stallions, and allows scarce or expensive frozen semen to be used efficiently Cases described in this series were derived from a clinical equine OPU/ICSI program. Briefly, immature oocytes were collected by transvaginal follicle aspiration and shipped overnight at 22\u00b0C to an assisted reproductive laboratory where in vitro maturation of oocytes, ICSI and in vitro culture of embryos to the blastocyst stage were performed A multiparous Warmblood recipient mare with a foal\u2010at\u2010foot was transported to Utrecht University 5\u00a0days after ovulation for transfer of a frozen\u2010thawed IVP embryo from a 23\u2010year\u2010old Warmblood donor mare. A single embryonic vesicle was detected by transrectal ultrasonography 10\u00a0days after ET, equivalent to approximately day 15 of gestation. The mare was next examined by a referring veterinarian at 88\u00a0days of gestation; this confirmed that the mare was still pregnant, although the existence of twins was not established. The mare aborted two fetuses one week later; one of the aborted fetuses was mummified  when a single 29\u00a0mm embryonic vesicle was detected at the base of the right uterine horn, although no embryo proper was detectable. Seven days later (23\u00a0days after ET), two embryo propers both with a heartbeat were detected; however, the volume of yolk sac fluid was less than expected for a normal pregnancy. Two days later, the heartbeat of both embryos was slow, and by day 30 after ET no heartbeat was detectable in either embryo. The conceptus was flushed out of the uterus using lactated Ringer\u2019s solution and a sterile endotracheal tube with an internal diameter of 20\u00a0mm. The vesicle was evaluated using a dissecting microscope which revealed the presence of a single yolk sac but three separate embryonic bodies, with distinct head and eyes, and each of which had its own amniotic sac and developing allantois (Fig None of the recovered conceptuses or aborted fetuses in any of the cases were genotyped to confirm that they were genetically identical. Nonetheless, each IVP embryo was produced by injecting a single spermatozoon into an oocyte. Furthermore, none of the recipient mares were exposed to a stallion prior to ET.et al. et al. Roberts The fact that a single IVP embryo can give rise to a multiple pregnancy is intriguing and, therefore, several hypotheses have been proposed to explain the underlying mechanism This case series emphasises the importance of pregnancy examination after expected development of the embryo proper, even following transfer of a single embryo, because only one embryonic vesicle was detected by ultrasonography 7\u201310\u00a0days after transfer of an IVP equine embryo in at least two of the cases. Although a single embryonic vesicle was also reported in the other two cases, it is not possible to rule out the presence of a second embryonic vesicle during the mobility phase, not least because none of the follow\u2010up pregnancy examinations revealed a twin either. In this respect, it appears that the twins were missed by the referring veterinarians at 45 and 88\u00a0days of gestation, respectively, primarily because the existence of twins was not considered possible. The presence of a single embryonic vesicle before appearance of the embryo proper has also been described in the majority of the multiple pregnancy cases after transfer of a single in vivo equine embryo The outcome of a multiple pregnancy derived from a single IVP embryo was poor; both mares with undiagnosed twins aborted while the triplet pregnancy died spontaneously during the embryonic period. However, loss of the triplet pregnancy could also be a result of poor quality of the IVP embryo rather than a direct consequence of the multiple pregnancy since the embryonic vesicle in this case was \u2018small for age\u2019 having been first detected as an unusually small vesicle on day 9 after ET. We recently reported that a small embryonic vesicle on day 7 after transfer of an IVP embryo was associated with an increased incidence of early embryonic loss In conclusion, in vitro production of horse embryos by ICSI and in vitro culture appears to be associated with an increased incidence of monozygotic twinning. These monozygotic twins appear to be monochorionic and can, therefore, only be diagnosed after development of the embryo proper. Although the exact underlying mechanism is unknown, it is likely the ICM divides within the early embryo or generates more than one primitive streak. Irrespective of the mechanism, the outcome of those multiple pregnancies is poor.The authors have no competing interest.Research ethics committee oversight not required by this journal: retrospective case series.Owners of mares included in the case series gave consent for their animals' inclusion.A. Dijkstra and A. Claes contributed to study design. A. Dijkstra, A. Claes, J. Cuervo\u2010Arango and T. Stout contributed to study execution, data analysis and interpretation, and preparation of the manuscript. All authors gave their final approval of the manuscript."}
+{"text": "In the past 40 years, scientific research has shown how Whole Body Vibration concept represents a strong stimulus for the whole organism. Low (<30 Hz), medium (30\u201380 Hz), and high (>80 Hz) frequency vibrations can have both positive and negative effects, depending on the oscillation type and duration of exposure to which the body is subjected. However, very little is known about the effects of vibratory training on the brain. In this regard, we verified whether three vibratory training protocols, differing in terms of vibration frequency and exposure time to vibration, could modulate synaptic plasticity in an experimental mouse model, by extracellular recordings in vitro in hippocampal slices of mice of 4 and 24 months old. Our results showed that vibratory training can modulate synaptic plasticity differently, depending on the protocol used, and that the best effects are related to the training protocol characterized by a low vibration frequency and a longer recovery time. Future studies will aim to understand the brain responses to various types of vibratory training and to explore the underlying mechanisms, also evaluating the presence of any structural and functional changes due to vibratory training. Many studies on vibrations published in the previous century have focused on the harmful effects of mechanical vibrations in the workplace . It has Despite numerous evidence about the beneficial effects of WBV on the human body, very little is known about the effects of vibratory training on the brain. It is assumed that WBV induces sensory stimulation in the cerebral cortical regions through the activation of skin, tendon and muscle receptors that respond to vibrations ,22,23,24Based on this evidence, the aim of our work was to verify whether vibratory training can modulate synaptic plasticity in an experimental mouse model, evaluating the presence of any functional changes by extracellular recordings in vitro in mouse hippocampal slices. In this regard, we applied three different vibratory training protocols, to assess whether any effects observed at the hippocampal level could depend on the use of different training protocols in terms of vibration frequency and exposure time to vibration. Finally, since it is known that synaptic plasticity is closely related to age ,27, in oWild type BALB/c male mice were used in accordance with guidelines and regulations of the European Union Council Directive (86/609/European Economic Community). All the experimental protocols were approved by the Italian Ministry of Public Health (authorization n. 86/2018-PR). We used a total of 32 mice, divided into groups based on age and vibratory training protocol. Specifically, the 4-month-old mice were divided into five groups: three groups of trained mice (4 mice per group), each one submitted to different vibratory training protocol, and two control groups (4 mice per group). As for the 24-month-old mice, they were divided into three groups (4 mice per group): a trained group and two control groups. For both age groups, one control group (CTRL SED) included sedentary mice not subjected to any type of training; while the other control group (CTRL WBV) included mice subjected to the same regimen of placement on the box in the platform, the same environmental exposure including motor sounds, but are not subjected to vibratory training. The health status of animals was monitored daily by resident veterinarians and experimenters, who also measured animal weight during the training period. All experimental animals were kept under the same housing conditions and diet.Each experimental group underwent vibratory training sessions using a vibrating platform  a. It is Vibratory training was conducted using three protocols , which differ in terms of vibration frequency and exposure time to vibration b. A and 2PO4 1.25, MgSO4 2, CaCl2 2, NaHCO3 26, and Glucose 10. The hippocampal slices were prepared according to conventional procedures [2, 5% CO2) at 32\u201334 \u00b0C (pH 7.4). Extracellular recordings of the population spikes (PSs) were made in the stratum pyramidale of the CA1 subfield, with glass microelectrodes filled with 2 M NaCl (resistance 5\u201310 M\u03a9). Orthodromic stimuli  were delivered through a platinum electrode placed in the stratum radiatum in the Schaffer collateral/commissural CA1 pathways. The test stimulus intensity of 50-ms square pulses was adjusted to give a PS of 2\u20134 mV at 0.03 Hz. The PS amplitude, measured every time, corresponds to an average of 6 recordings/min. After recording stable signals (15\u201320 min), a tetanic stimulation  was delivered to induce the Long-term Potentiation (LTP) at the same stimulus intensity used for the baseline responses. Signals were acquired, digitized, and stored using a personal computer with standard acquisition software . Signal was fed to a computer interface  for subsequent analysis with the software PCLAMP10 .The animals belonging to the different experimental groups were sacrificed after the 12 weeks of training as well as the sedentary animals. All efforts were made to minimize the number of animals used and their suffering. Under anesthesia with halothane , the animals were decapitated, and brains were quickly removed and placed in cold, oxygenated artificial cerebral spinal fluid (ACSF), whose composition in mM was: NaCl 124, KCl 2, KHocedures . The hipn represent the number of slices analyzed. Data were compared with Two-way ANOVA and Tukey\u2019s Multiple Comparison Test and were considered significantly different if p < 0.05.Statistical analysis was performed using GraphPad Prism 8 Software . For electrophysiological experiments, data were expressed as mean \u00b1 SEM and p < 0.0001). In fact, mean body weight prior to initiation of the training sessions was 20.0 \u00b1 0.8 g in the A-TRAINED group, 19.5 \u00b1 0.3 g in the B-TRAINED group and 19.0 \u00b1 0.4 g in the C-TRAINED group. At the age of 4 months, after training sessions were completed, the mean body weight was 29.8 \u00b1 1.0 g in the A-TRAINED group, 31.0 \u00b1 0.4 g in the B-TRAINED group and 30.3 \u00b1 0.5 g in the C-TRAINED group. For the control groups, instead, we observed an increase in body weight of only about 14% in both cases, with mean body weight values of 18.5 \u00b1 0.3 g (CTRL WBV) and 18.6 \u00b1 0.2 g (CTRL SED) for mice at 1 month of life and 21.0 \u00b1 0.4 g (CTRL WBV) and 21.3 \u00b1 0.3 g (CTRL SED) for mice at 4 months of life (** p < 0.01). We monitored the mice weight during the entire experimental period to verify if vibratory training had any effect on it. p = 0.01).Contrary to the results obtained for the young mice, we observed a slight decrease in body weight in old C-TRAINED mice at the end of the training period b, which p < 0.01). In the remaining recording time, the PS amplitude did not seem to be affected in the B-TRAINED group; on the contrary, for the A-TRAINED group, it was considerably reduced, with statistically significant values compared to the other experimental groups (** p < 0.01). Furthermore, as shown in the insert of The effects of different vibratory training protocols on the synaptic plasticity expression were analyzed in the CA1 region of hippocampal slices of young and old mice. p < 0.0001), with stable PS values until the end of the electrophysiological recording. Based on the results obtained for young mice, we thought to apply to the old mice only the C training protocol, which was the only one that positively modulate synaptic plasticity. Furthermore, this protocol seemed to be the least stressful and, therefore, most suitable for mice that, at this age, are particularly fragile and more susceptible to death. As far as we know, this was the first experimental study designed to determine whether hippocampal synaptic plasticity could be modulating by exposure to vibratory training, applying three different protocols in terms of vibration frequency and exposure time to vibration to 4- and 24-months old mice. We first checked whether vibratory training had effects on physical parameters, such as body weight. Our results showed that all three types of training protocols induce significant weight increase in young mice. In detail, we recorded a weight increase of 49% in A-TRAINED mice and 59% both in B- and C-TRAINED mice, while in the control groups the weight increase was only 14%. These results are very satisfactory and confirm the beneficial effects of vibratory training. In fact, for the control groups, we can assert that the slight weight increase is due to the physiological development process that occurs during the growth phase. As regards the groups of trained mice, the weight increase could also depend on an increase in muscle volume determined precisely by exposure to vibratory training. In this regard, it has been shown that the application of mechanical vibrations, varying in intensity and duration, produces positive effects on bone, muscle, and joint structure, so that both tissue mass and strength are maintained at a high level, with a consequent reduction in muscle and bone loss . It woulSince it has been reported that exercise exerts beneficial effects on brain function ,32,33 anOur results show that vibrations of different frequencies can have opposite effects on synaptic plasticity. In this regard, it is known that vibratory perception constitutes a mechanical type of sensitivity involving mechanoreceptors, i.e., receptor structures capable of receiving vibratory signals from different parts of the body ,23. It hBased on the obtained results, we thought of training old mice with only the C protocol, which would seem the least stressful and, therefore, the most suitable for them, which, at this age, are particularly fragile and more susceptible to death. It is well known that aging is a biological process associated with physiological cognitive decline, as it can impair quality of life and cause deficits in declarative and working memory, spatial learning and attention . AlthougThe problem of how temporal lobe epilepsy affects brain structure and cognition during lifespan remains a topic of interest and concern. To date, it is known that brain structures related to memory are directly involved in the epileptic process: in fact, memory disorders and deficits are common in patients with epilepsy, especially for people suffering by Temporal Lobe Epilepsy (TLE). In recent decades, epidemiological studies have shown that the highest incidence of epileptic seizures is found in the elderly . In factThe results obtained from this experimental study suggest that vibratory training exerts positive effects on cognitive processes provided that certain principles, such as the vibration frequency and the exposure time to vibration, are respected, in order to plan the right parameters quantitative and qualitative and appropriate recovery periods. Furthermore, we can speculate that any alteration in neuronal transmission from the vibratory sensors to the somatosensory cortex could influence vibratory sensations, with specific effects at the hippocampal level. Specifically, depending on the vibration frequency used, a change in the analysis of proprioceptive information may occur, while the persistence of the effects could suggest the actual induction of plastic changes in the proprioceptive circuit. Furthermore, we suggest that the effects of vibration training on cognitive processes may vary with age, which in turn appears to be closely related to synaptic plasticity. Thus, vibration training may be considered an important factor in protecting and/or preventing the development of age-related cognitive impairments. Further studies will aim to understand brain responses to various types of vibratory training protocol and explore the underlying mechanisms."}
+{"text": "Our results showed that protocols characterized by a low vibration frequency and/or a longer recovery time exert positive effects at both hippocampal and muscular level, and that these effects improve significantly by varying both parameters, with an action comparable with a dose\u2013response effect. Thus, we suggested that vibratory training may be an effective strategy to counteract cognitive impairment, which is already present in the early stages of the aging process, and the onset of sarcopenia, which is closely related to a sedentary lifestyle. Future studies are needed to understand the underlying molecular mechanisms and to determine an optimal vibratory training protocol.Whole body vibration plays a central role in many work categories and can represent a health risk to the musculoskeletal system and peripheral nervous system. However, studies in animal and human models have shown that vibratory training, experimentally and/or therapeutically induced, can exert beneficial effects on the whole body, as well as improve brain functioning and reduce cognitive decline related to the aging process. Since the effects of vibratory training depend on several factors, such as vibration frequency and vibration exposure time, in this work, we investigated whether the application of three different vibratory protocols could modulate synaptic and muscle plasticity in a middle-aged murine model, counteracting the onset of early symptoms linked to the aging process. To this end, we performed  Long-term exposure to a whole body vibration (WBV) stimulus was studied to obtain information about the increased health risk to which certain classes of workers are exposed daily . It has However, in the last decades research has shown that mechanical vibration represents a strong stimulus for the entire organism and especially for the neuromuscular system. Not surprisingly, WBV is now considered a simple and effective training method to increase physical performance and is used for a variety of purposes, including not only training of elite athletes, but also treatment for osteoporosis and chronic low back pain as well as neurological rehabilitation to reduce spasticity . Althougin vitro  has been shown to improve brain function and prevent post-ischemic cognitive decline . It has in vitro .in vitro extracellular recordings in hippocampal slices from 4- to 24-month-old mice  show significant behavioral changes in terms of social interactions compared with young mice (3-month-old). This suggests that although cognitive and sensory function appears to be preserved in 9-month-old mice, some neuronal circuits may be particularly sensitive to the aging process . The levBased on this evidence, in the present work we evaluated the effects of three WBV protocols, differing in vibration frequency and vibration exposure time, on synaptic and muscle plasticity in a middle-aged murine model, to test whether WBV training could represent a tool to prevent and/or counteract the onset of the first symptoms of cognitive and muscle decline characterizing the aging process.Twenty 12-month-old male mice, belonging to the strain wild type BALB/c mice, were used according to the procedures established by the European Union Council Directive 2010/63/EU for animal experiments . All theResident veterinarians and experimenters daily monitored the housing conditions of animals, in terms of air/min replacement, humidity, and temperature, providing constant environmental enrichment of the cages with food and water. All experimental animals were kept in the same housing conditions and on the same diet and were housed individually. In addition, during the training period, physical condition of the animals was evaluated, considering weight, coat and skin condition, and body functions.g and a shift of 1.5 mm, and 90 Hz, with an acceleration of 2.8 g and a shift of 1.1 mm.A vibrating platform  was used to subject animals to WBV. It has a power supply of 220 V and a total maximum electrical power of 0.12 kW. The function generator generates a sinusoidal control signal at the frequencies used: 45 Hz, with an acceleration of 2 Vibration training was conducted using three protocols , which differ in terms of vibration frequency and exposure time to vibration . The A a2, 5% CO2) at 32\u201334\u00b0C (pH 7.4). The extracellular recordings of population spike (PS), that indicates the electrical activity of a neurons population, were made according to procedures previously indicated  and the pathological evaluation was performed blindly by two pathologists. To assess the diameter of muscle fibers, 150 fibers per biopsy were evaluated. To calculate muscle fiber diameters, H&E slides were scanned at 10 \u00d7 magnification by Nikon upright microscope ECLIPSE Ci-S/(Nikon Corp. Japan). Muscle fiber diameters were identified by a pathologist for each muscle biopsy and analyzed by Software NIS-ELEMENTS .3 of muscle tissue from left quadriceps biopsies were fixed in 4% paraformaldehyde and post-fixed in 2% osmium tetroxide (TM Software).One mmetroxide . After wetroxide . Ultra-tn represents the number of slices analyzed. For histomorphometric analysis, data were expressed as mean \u00b1 SEM, and n represents the number of fibers analyzed. Data were compared with two-way ANOVA and Dunnett\u2019s multiple comparison test and were considered significantly different if p < 0.05.Statistical analysis was performed using GraphPad Prism 8 Software . For electrophysiological experiments, data were expressed as mean \u00b1 SEM, and The effects of the three types of vibratory training on synaptic plasticity were analyzed in the CA1 region of mice hippocampal slices and the results are shown in The PS amplitude values recorded for each group of mice at various times are reported in \u2217\u2217p < 0.01; B-TRAINED 23.4 \u00b1 0.4, \u2217\u2217\u2217p < 0.001; and C-TRAINED 27.2 \u00b1 0.4,****p < 0.0001). Noteworthy, of the three groups undergoing WBV training, the mice trained with the C protocol had the highest muscle fiber diameter values.Muscle plasticity after exposure to WBV training was assessed by histomorphometric analysis of the muscle tissue of each experimental group. As shown in These results were confirmed by the ultrastructural analysis of the muscle tissue performed by TEM and shown in In our previous work, we reported that exposure to an appropriate WBV protocol improves learning and memory processes in old mice . These bin vitro extracellular recordings in hippocampal slices from 12-month-old mice to evaluate if the application of three WBV training protocols, differing in vibration frequency and vibration exposure time, had any effect on synaptic plasticity. We surprisingly observed that WBV training can counteract the LTP inhibition that characterized the control groups, although in a different way depending on the protocol used. Undoubtedly, we obtained better results for the groups trained with B and C protocols, in which the PS amplitude values, following a tetanic stimulus induced at the 15th minute of recording, remain significantly higher throughout the electrophysiological recording time, compared to the other experimental groups. In contrast, the A training protocol seems to modulate LTP in a biphasic manner, since we observed first a significant improvement  and then a drastic reduction in synaptic plasticity (from about the 45th minute of recording), with PS amplitude values significantly different from those of the other experimental groups. These results are in agreement with previously published data  resulted in significant damage in both brain and muscle, while partial and/or total recovery of age-related cognitive and muscular decline was found after the WBV training protocol application characterized by the same vibration exposure time, but by a lower vibration frequency (45 Hz). Surprisingly, the observed beneficial effects on synaptic and muscular plasticity are even greater after the WBV training protocol application characterized not only by a lower vibration frequency but also by a longer recovery time between one series and another, suggesting that the variation of this second parameter could be decisive for optimal physical performance. Therefore, these evidences indicate that the effects of WBV training depend not only on the vibration frequency and vibration exposure time but also on the recovery period between series, with an action comparable with a dose\u2013response effect.In conclusion, vibratory training, which has already proved to be an effective strategy to counteract the cognitive and motor decline typical of elderly subjects, can also represent an effective means of preventing and/or delaying the onset of the first symptoms typical of the aging process. Therefore, WBV can be used both to counteract the progression of age-related diseases, such as neurodegeneration and sarcopenia, and to reduce the deleterious effects of a sedentary lifestyle. Further studies will be necessary to determine the optimal WBV training protocol, also assessing the influence of parameters such as acceleration and displacement, which depend both on the vibration frequency and the intrinsic characteristics of different vibration platforms. In addition, it will be essential to understand the underlying mechanisms and investigate the presence of possible alterations in biological and molecular processes related to synaptic and muscle plasticity.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.All the experimental protocols were approved by the Italian Ministry of Public Health (authorization n. 86/2018-PR).IC, RB, GA, GD, and VT developed the hypotheses and designed the experimental plan. IC, RB, and MS performed and analyzed the experiments, and contributing to the interpretation of the data. IC and RB wrote and edited the manuscript. GA, EB, GD, and VT assisted in drafts and final version of the manuscript. All authors read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Previous studies have shown that the combination of mesenchymal stem cell (MSC) transplantation and electroacupuncture (EA) stimulation is a neuroprotective strategy for treating intracerebral hemorrhage (ICH). However, the underlying mechanisms by which the combined treatment promotes neuroprotection remain unclear. This study was designed to investigate the effects of the combined treatment on synaptic plasticity and elucidate their underlying mechanisms. Therefore, rat ICH models were established by injecting collagenase and heparin, and the animals were randomly divided into model control (MC), EA stimulation (EA), MSC-derived neuron-like cell transplantation (MSC-dNLCs), and MSC-dNLC transplantation combined with EA stimulation (MSC-dNLCs+EA) groups. We observed the ultrastructure of the brain and measured the brain water content (BWC) and the levels of the microtubule-associated protein 2 (MAP2), galactocerebrosidase (GALC), and glial fibrillary acidic protein (GFAP) proteins. We also measured the levels of the phosphorylated mammalian target of rapamycin (mTOR) and 70\u2009kDa ribosomal protein S6 kinase (p70S6K) proteins, as well as the expression of synapse-related proteins. The BWC increased in rats after ICH and decreased significantly in ICH rats treated with MSC-dNLC transplantation, EA stimulation, or combined therapy. Meanwhile, after ICH, the number of blood vessels increased more evidently, but only the combined treatment reduced the number of blood vessels among rats receiving the three treatments. Moreover, the levels of MAP2, GALC, postsynaptic density 95 (PSD95), and synaptophysin (SYP) proteins, as well as the levels of the phosphorylated mTOR and p70S6k proteins, increased in the MSC-dNLCs+EA group compared with those in the MSC-dNLCs and EA groups. Compared with the MC group, GFAP expression was significantly reduced in the MSC-dNLCs, EA, and MSC-dNLCs+EA groups, but the differences among the three treatment groups were not significant. In addition, the number of synapses increased only in the MSC-dNLCs+EA group compared to the MC group. Based on these data, the combination of MSC-dNLC transplantation and EA stimulation exerts a synergistic effect on improving the consequences of ICH by relieving cerebral edema and glial scarring, promoting the survival of neurons and oligodendrocytes, and activating mTOR/p70S6K signaling to enhance synaptic plasticity. Intracerebral hemorrhage (ICH) is a crucial cause of neurological morbidity and mortality worldwide \u20133 and isMesenchymal stem cells (MSCs) are considered promising seed cells for nervous system diseases because they have the properties of weak immunogenicity, good safety, and easy cultivation \u201312. ManyAfter ICH, the destroyed brain structure induces the destruction of the synaptic structure. Increasing synaptic plasticity and rebuilding neural functional networks are the basis of restoring neural function. Synaptic plasticity is the ability of neurons to modify their connections and is involved in brain network remodeling following brain damage . AlthougIn this experiment, we examined the effects of a combined treatment with MSC-derived neuron-like cells (MSC-dNLCs) and EA on the brain water content (BWC), numbers of blood vessels and synapses, expression of marker proteins of neurons, oligodendrocytes and astrocytes, synapse-associated proteins, and levels of phosphorylated mTOR and p70S6K proteins in rats with ICH. We also investigated the effect of the combined treatment on synaptic plasticity and possible mechanisms.Healthy adult Sprague\u2013Dawley rats weighing between 200 and 250\u2009g were provided by the SPF Laboratory Animal Center of Southwest Medical University . All of them were housed in the same animal care facility with a standard temperature (23 \u00b1 2\u00b0C), lighting (12/12\u2009h light/dark cycle), and relative humidity (65 \u00b1 5%) and free access to food and water. The procedures for the animal experiments were performed in accordance with the Guidance and Suggestions for the Care and Use of Laboratory Animals formulated by the Ministry of Science and Technology of China. The animal protocol was approved by the Animal Ethics Committee of the Animal Center of Southwest Medical University , and the experimental procedures were optimized to minimize the number of animals and alleviate the pain experienced by the experimental animals. The rats were randomly divided into five groups: the sham operation (SO) group, the model control (MC) group, the MSC-dNLC transplantation (MSC-dNLCs) group, the EA stimulation (EA) group, and the combined treatment with MSC-dNLC transplantation and EA stimulation (MSC-dNLCs+EA) group, which were assigned to the following five experimental procedures, respectively .les at the same level. The scalp was incised sagittally approximately 10\u2009mm; then, the anterior fontanelle was exposed after treatment with 30% H2O2. A burr hole (1\u2009mm) was drilled on the right calvarial bone at a point 3\u2009mm lateral and 0.2\u2009mm anterior to the anterior fontanelle. A mixture containing heparin  and collagenase I  was drawn into a 5\u2009\u03bcl microsyringe. The needle was fixed on the stereotaxic apparatus and inserted into the caudate nucleus (location: 6\u2009mm depth to the hole); the location of the injection point is shown in the schematic diagrams  while maintaining the anterior and posterior fontaneldiagrams . Then, tEA stimulation was conducted as described in our previous study . The rat\u03b1-MEM) (HyClone) supplemented with 10% fetal bovine serum , 100\u2009mg/ml streptomycin, and 100\u2009U/ml penicillin and incubated in a humidified atmosphere with 5% CO2 at 37\u00b0C. When the MSCs grew to 80% confluence, the cells were trypsinized using 0.25% trypsin and 1\u2009mM EDTA and passaged. MSCs at passages 3-6 were used for subsequent experiments.Rat MSCs labeled with green fluorescent protein (GFP)   were rem\u03b1-MEM supplemented with 10% FBS and 1\u2009mmol/l \u03b2-mercaptoethanol (\u03b2-ME) for 24 hours and then with neuronal induction medium composed of \u03b1-MEM supplemented with 1\u2009mmol/l \u03b2-ME, 2% dimethylsulfoxide (DMSO), and 1\u2009\u03bcmol/l all-trans retinoic acid (RA) (Sigma) for 6 hours. Afterward, MSC-dNLCs were collected, and the cell density was adjusted to 2.5 \u00d7 107 cells per ml. Then, an MSC-dNLC suspension (20\u2009\u03bcl) was extracted with a microsyringe and injected into the brains  of rats in the MSC-dNLCs+EA and the MSC-dNLCs groups at an injection rate of 2\u2009\u03bcl/min after 48 hours when the rats were successfully modeled. Then, the needle hole was sealed with bone wax, and the skin was sutured and disinfected.Before transplantation, MSCs were induced as described in our previous study . In brieThe BWC was measured using a previously reported method . Briefly\u03bcm with a freezing microtome .Rats were anesthetized by administering an intraperitoneal injection of an overdose of pentobarbital sodium and successively transcardially perfused with 0.9% normal saline and 4% paraformaldehyde in 0.01\u2009M phosphate-buffered saline . Subsequently, the brains were removed, postfixed, and dehydrated before frozen sections were cut at a thickness of 10\u2009w/v). The sections were incubated with the primary antibodies overnight at 4\u00b0C and then incubated with horseradish peroxidase- (HRP-) conjugated goat anti-rabbit or anti-mouse secondary antibodies  at RT for 1.5\u2009h. The sections were sequentially stained with diaminobenzidine and hematoxylin. Finally, the slices were imaged using a microscope .After permeabilization with 0.3% Triton X-100 in 0.01\u2009M PBS for 30\u2009min at room temperature (RT) and blocking with 10% goat serum, sections were immunostained with the following primary antibodies: rabbit anti-laminin , mouse anti-MAP2 , rabbit anti-GALC , mouse anti-GFAP , rabbit anti-mTOR , mouse anti-p70S6K , mouse anti-PSD95 , and mouse anti-synaptophysin (SYP) , which were diluted with 1% BSA/PBS  overnight at 4\u00b0C under humidified conditions and then incubated with Alexa Fluor 594-conjugated goat anti-mouse/rabbit IgG  at RT for 60\u2009min. Finally, sections were stained with 4\u2032,6-diamidino-2-phenylindole (DAPI) and covered with fluorescence mounting medium (Dako).\u03bcg) were separated by sodium dodecyl sulfate\u2013polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes. Then, the membranes were incubated with primary antibodies against MAP2 (diluted 1\u2009:\u20091000), GALC (diluted 1\u2009:\u20091000), GFAP (diluted 1\u2009:\u20091000), mTOR, p-mTOR , p70S6K, p-p70S6K , PSD95 (diluted 1\u2009:\u20091000), SYP (1\u2009:\u20091000), and GAPDH  at 4\u00b0C overnight. After incubation with HRP-conjugated goat anti-mouse/rabbit IgG  at RT for 2\u2009h, the membranes were immersed in an enhanced chemiluminescence (ECL) solution  and exposed using an Image-Quant ECL Imager. The protein levels were normalized to the corresponding amount of GAPDH and analyzed using Quantity One software.After anesthetization, the animals were decapitated, and brain tissues collected from rats in different groups were homogenized in ice-cold protein extraction reagent. Then, the total protein concentration in every sample from different groups was quantified using the BCA protein assay. Equal amounts of protein  . Digital images of the specimens were acquired using an integrated high-sensitivity complementary metal-oxide-semiconductor (CMOS) camera and analyzed by experienced electron microscopists.Rats were anesthetized, their brains were removed, and caudoputamen samples  were dissected into 1\u2009mmP < 0.05 was considered statistically significant.Parametric data were analyzed using GraphPad Prism 8 software and displayed as the means \u00b1 standard\u2009errors of the means (SEM). Significant differences between multiple groups were analyzed using one-way ANOVA, and MSCs labeled with GFP grew in a cluster shape and presented green fluorescence under a fluorescence microscope . After iP < 0.05), and the combined treatment significantly reduced the number of blood vessels (30.32 \u00b1 9.71%) compared with the MC group (P < 0.05), but the numbers of blood vessels in the three treatment groups were not significantly different (P > 0.05)  but was decreased in the EA, MSC-dNLCs, and MSC-dNLCs+EA groups compared with the MC group (P < 0.05)  . Moreove < 0.05) .P < 0.05, Figures P < 0.05, Figures P < 0.05, Figures The expression of the MAP2 (neuron marker), GALC (oligodendrocyte marker), and GFAP (astrocyte marker) proteins was detected using immunohistochemical staining and western blotting. Figures P < 0.05, Figures P < 0.05, Figures P < 0.05, Figures Figures \u03bcm2) in rats after ICH (P < 0.05). However, a significant difference in the number of synapses was not observed among the EA, MSC-dNLCs, and MSC-dNLCs+EA groups (P < 0.05, The synapse density was calculated to quantitatively investigate synaptic degradation, and the results showed a reduced number of synapses (per 100\u2009A groups . In addiP < 0.05, Figures P < 0.05, Figures P < 0.05, Figures Immunohistochemical staining showed that mTOR and p70S6K proteins were expressed in all groups Figures . The wesThe present study investigated the effect of the combination of MSC-dNLC transplantation and EA stimulation on synaptic plasticity and its molecular mechanisms in ICH rats. For this purpose, we evaluated cell survival, the number of synapses, the levels of synapse-associated proteins, and the levels of the phosphorylated mTOR and p70S6K proteins. The results suggested that the combined treatment exerts a synergistic effect on improving synaptic plasticity through mTOR/p70S6K signaling.After ICH, brain edema occurs early, with a substantial increase of approximately 75% of its maximum volume during the first 24 hours, and then continues to develop over an extended period of days to nearly 2 weeks , 38. BraICH may cause massive cell death, including glial cells and neurons , 47, in \u03b242-treated primary hippocampal neurons, and EA increases the levels of the SYP, PSD-95, and GAP-43 proteins, enhanced synaptic structural plasticity, and improved behavioral performance in rats exposed to chronic unpredictable mild stress [The effects of the combined treatment on synaptic plasticity in the focal area were indicated by the increased levels of synaptic structural molecules. PSD-95, a major component of glutamatergic excitatory synapses, is a scaffolding protein that modulates the synaptic localization of many adhesion molecules, channels, receptors, and signaling proteins , 58. Pred stress , 63. BasThe mTOR/p70S6K pathway is involved in stroke , 64. mTORecent studies have provided evidence that the neuroprotective effects of mTOR on stroke may be due to its ability to increase PSD95 and GAP-43 protein levels or promote neuronal structural stability in peri-infarct regions , 78. Li The present study has some limitations. First, the observations of mTOR/p70S6K signaling and its regulation were limited to the ICH rat model. This information should be carefully considered when using the results to discuss the role of the mTOR pathway in neurological disease. Second, we did not construct mTOR and p70S6K viruses to obtain further proof. mTOR/p70S6K signaling is an interesting target in hemorrhagic stroke that requires further investigation in subsequent research.In summary, despite the shortcomings of this study, we provide the first evidence for the synergistic effects of a combined treatment consisting of MSC-dNLC transplantation and EA stimulation on improving synaptic plasticity, which may be associated with activated mTOR/p70S6K signaling in rats with ICH. These findings not only provide new data for the neuroprotective effect of a combined treatment consisting of MSC-dNLC transplantation and EA stimulation but also supply positive insights that will improve our understanding of the underlying molecular mechanisms and help to develop more precise therapeutic drugs and treatments for alleviating the outcomes of ICH."}
+{"text": "Historically, the study of patients with spatial neglect has provided fundamental insights into the neural basis of spatial attention. However, lesion mapping studies have been unsuccessful in establishing the potential role of associative networks spreading on the dorsal-medial axis, mainly because they are uncommonly targeted by vascular injuries. Here we combine machine learning-based lesion-symptom mapping, disconnection analyses and the longitudinal behavioral data of 128 patients with well-delineated surgical resections. The analyses show that surgical resections in a location compatible with both the supplementary and the cingulate eye fields, and disrupting the dorsal-medial fiber network, are specifically associated with severely diminished performance on a visual search task  with intact performance on a task probing the perceptual component of neglect. This general finding provides causal evidence for a role of the frontal-medial network in the voluntary deployment of visuo-spatial attention. The authors show that damage to both the supplementary and the cingulate eye fields specifically causes visuo-motor exploratory neglect. This suggests that the medial eye field network contributes to the voluntary control of spatial attention Unified models of visuo-spatial attention assume that two anatomically segregated networks are specialized in distinct attentional subprocesses4. In particular, the dorsal attention network (DAN), mainly composed of the frontal eye field (FEF) and the intraparietal sulcus, may subserve the ability to purposely allocate attention to meaningful elements of the visual scene , whereas the ventral attention network (VAN), composed of the ventro-lateral prefrontal cortex and the temporo-parietal junction, may be engaged when an unexpected but behaviorally relevant event occurs and attention must be reoriented towards the new visual target \u2014though this dual-pathway anatomo-functional organization would be less marked than previously thought6. Context-sensitive integration across these two attention networks is hypothesized to allow the dynamic and flexible control of visuo-spatial attention4. Beyond this holistic view of attention processing, however, a great deal of uncertainty remains about the exact role of \u201csatellite\u201d but potentially relevant areas in the voluntary deployment of visuo-spatial attention, in particular those lodged in the medial sector of the brain. This is typically the case of the supplementary eye field7 (SEF) and the cingulate eye field8 (CEF), two cortical nodes being integrated components of the complex neural circuitry involved in the initiation and the regulation of visually-guided behaviors10, but to date poorly characterized in humans compared to their sister area, i.e., the FEF.Orienting visual attention towards salient or relevant elements of the surrounding and fast-changing environment is a vital process for adaptive behaviors and survival, especially in species where most behaviors require visual guidance. In humans, accumulating evidence from neuroimaging, behavioral and lesion studies have led to the undisputed view that visuo-spatial attention is maintained through the coordinated activity of networks spreading on the dorsal face of the brain12. This view was initially supported by repeated evidence that low-intensity electrostimulation of the FEF is capable of producing contralateral eye movements in humans16 and primates19, and further bolstered by convergent fMRI findings showing the recurrent activity of this area in various forms of oculomotor activities, including saccadic eye movements12. However, it has become increasingly accepted that the FEF serves as an interfacing area between the visuo-motor and visuo-spatial attention systems, as it is activated (together with the SEF and the CEF) by saccadic eye movements and by visually triggered overt and covert shifts of attention as well20. In addition, the FEF has dense and reciprocal anatomical connections with both functional systems, a connective pattern that is largely shared with the SEF and CEF22. It is also established that these three anterior eye-related areas are closely interconnected with each other with bidirectional fibers22. Overall, the FEF is assumed to play a central role in the voluntary control of eye movement and attention towards the contralateral side. The respective role of the SEF and the CEF, however, clearly remains an open question. Current hypotheses suggest the SEF as possibly involved in the higher cognitive aspects of oculomotor behaviors, whereas the CEF would rather be implicated in the motivational aspects of visually-guided actions10. However, little is known about the contribution of these medial areas to the voluntary control of visual attention, especially in humans. Accordingly, the main goal of the current study was to examine the extent to which damage to the SEF and the CEF as well as their connective inputs could affect the process of deploying attention towards the contralesional space.In view of its specific cytoarchitectonic, the FEF has long been considered as strictly involved in the visuo-motor aspect of oculomotor control, including preparation, initiation and execution of saccades23. It is also established that disconnective breakdown of dorsal white-matter tracts, especially the layers II and III of the superior longitudinal fasciculus (SLF) has a detrimental effect on the functional integration within the attention network25 and is associated with the most severe forms of neglect28. Collectively, these observations have supported the emerging view that spatial neglect may be better conceptualized as stemming from a brain-wide network dysfunction34. One of the accepted shortcomings of lesion mapping studies, however, lies in their inability to fully gauge the entire set of structures that may contribute to a deficit in general, and to spatial neglect in particular, mainly because of the typical non-random distribution of vascular damage36. As the dominating lesion model has been invariably stroke injury, neuropsychological studies have faced difficulty in delineating the exact role of the dorsomedial structures, which are uncommonly targeted by this particular pathophysiological condition37.The exploration of patients with spatial neglect  has been a central catalyst for research on the neural basis of visuo-spatial attention. From available qualitative and quantitative meta-analyses, it clearly emerges that spatial neglect can result from damage to a large set of cortical areas  mainly lodged in the dorsal system of the brain or from injuries to subcortical structures such as the thalamus and the caudate nucleus40. Over alternate lesion models, the advantage of this particular one is threefold: (i) slow-growing tumors frequently affect the fronto-medial structures40; (ii) patients can be evaluated longitudinally before, immediately after and a while after surgery, allowing to gauge both the immediate and longer-term neuropsychological effects of surgical excisions41; (iii) the removed structures can be clearly delineated on anatomical MRIs. To assess spatial neglect, two well-tried behavioral paradigms were employed, both of which have been previously associated with task-specific lesion patterns44. The line bisection task allows assessing how symmetrical is perceived a visual scene, thus probing the \u201cperceptual\u201d aspect of neglect 43. The related performances are predominantly affected by parietal lesions45. By contrast, the cancellation task requires patients to voluntarily explore and thus orient attention towards the contralesional space to reach pre-specified items among distractors42. Performances on this type of visual search task have been shown to be affected by lesions damaging the DAN, especially at the level of the FEF46. Accordingly, if the medial network is implicated in the voluntary deployment of attention, then surgical excisions of structures shaping it (in particular the SEF and CEF) are expected to be associated with an impaired ability to identify targets in the contralesional space with spared performances on a line bisection task . However, a strict double dissociation is unlikely because target cancellation performances can be affected by perceptive neglect.To assess the potential role of the right medial network in visuo-spatial attention, we relied on the behavioral data of a large cohort of patients presenting with a lower-grade glioma \u2013 a rare cerebral tumor mainly characterized by a slow-growth kinetics and preferentially spreading along the white-matter connectivity48, a multivariate evolution of the standard mass-univariate lesion mapping approach developed earlier49 and recently applied to the study of spatial neglect50. SVR-LSM represents an interesting option as the method takes into consideration the inter-dependent nature of the voxels forming a given lesion map. By this means, we were able to capture a powerful but transient  statistical association between surgical resections targeting both the SEF and the CEF and performances on the cancellation task, not on the line bisection task. The latter one was uniquely affected by parietal resections, as previously shown43. We further replicated this pattern of results in an exceptionally rare patient who benefited from a two-step sequential surgery to remove a tumor-infiltrating the right cingulum, involving first the pre-SMA and the caudal part of the anterior cingulate  and 6 months later the right superior parietal lobule and the neighboring precuneus.To test this straightforward hypothesis, we first used support vector regression lesion-symptom mapping (SVR-LSM)29. While the association between SLF II and III and spatial neglect has been experimentally evidenced51, the exact contribution of SLF_I remains to be clearly elucidated. In view of its known cortical projections in medial frontal areas, we assumed that resective interruption of this tract should impair visual exploration of the contralesional space. To ascertain the extent to which cerebral disconnection predicted behavioral outputs, we used a novel method of estimating the number of fibers interrupted by the operative procedure, based on the population-averaged diffusion data of the Human Connectome Project (HCP). The results confirmed the central role of the SLF I in spatial neglect but also showed similarities and dissimilarities in the disconnectivity patterns associated with impoverished performances in each task.In the second line of analyses, we were interested in precisely identifying the role of disconnective disruptions in the emergence of spatial neglect. Current anatomo-functional models of visuo-spatial attention suggest that layers III and I of the SLF may provide white-matter connectivity for the VAN and the DAN, respectively, whereas layer II may allow both attention systems to communicateOverall, the current work shows that surgical resections in a location compatible with both the supplementary and the cingulate eye fields, and damaging the dorsal-medial white-matter network, are specifically associated with severely diminished performance on a visual search task with intact performance on a task probing the perceptual component of neglect. This suggests that the medial eye field network contributes to the voluntary deployment of visuo-spatial attention.3\u2009\u00b1\u200949.0, whereas the average volume of postoperative resection cavities was 47.2 cm3\u2009\u00b1\u200939.7. Simple correlation analyses indicated that the behavioral measurements of visuo-spatial attention, including line bisection estimates, the total number of omitted bells , and the asymmetry score left minus right bells , were poorly associated with the demographic and clinical variables  = \u22121.13, p\u2009=\u20090.26; two-sided; 95% CI ), educational attainment (t(170) = 1.06, p\u2009=\u20090.29; two-sided; 95% CI ) and sex  (see Supplementary Tables\u00a0t(170) = \u22123.45, p\u2009<\u20090.001; two-sided; 95% CI ), total_bell (t(170) = \u22122.32, p\u2009=\u20090.02; two-sided; CI 95% ) but not for diff_bell (t(170) = 0.48, p\u2009=\u20090.63; two-sided; 95% CI ). The same analyses were performed considering A2 and A3. In brief, all behavioral measurements were strongly different between groups at A2, and the same pattern than that observed at baseline was identified at A3. All statistical analyses are fully described in Supplementary Table\u00a0To determine whether patients already showed a right bias in visuo-spatial attention before surgeries were performed, preoperative baseline performances A1) were statistically compared to those gained from a healthy control group (44 participants) matched in terms of age  = 14.7, p\u2009<\u20090.001, \u03b72p\u2009=\u20090.10; two-sided). Pairwise, post-hoc analyses conducted with the Scheff\u00e9 test revealed that average estimates of line centers significantly shifted toward the right side just after surgery , but this effect was only transitory , so that preoperative and 3-month postoperative estimates did not differ   = 4.34, p\u2009<\u20090.001; two-sided; 95% CI )  ANOVA was performed on the line bisection performance, using assessment time {A1, A2, A3} as the main factor. The results showed that behavior significantly differed across the three measures (9]) Fig.\u00a0. This wa3]) Fig.\u00a0.Fig. 2CoF = 45.05, p\u2009<\u20090.001, \u03b72p\u2009=\u20090.26; two-sided) , but not 3 months after  \u2013 meaning that patients fully recovered in average. The difference between \u22061 (mean 3.39\u2009\u00b1\u20095.84) and \u22062 (mean \u22120.16\u2009\u00b1\u20092.94) was strongly significant (t(127) = 7.89, p\u2009<\u20090.001; two-sided; 95% CI )  Fig.\u00a0. It was 5]) Fig.\u00a0.F = 30.34, p\u2009<\u20090.001, \u03b72p\u2009=\u20090.19; two-sided). Compared to the preoperative baseline, it was greater immediately after surgery  but comparable 3 months later   = 5.60, p\u2009<\u20090.001; two-sided; 95% CI )  also evolved across the three assessments (3]) Fig.\u00a0. Accordi1]) Fig.\u00a0.In summary, neurosurgeries impaired task performance, but only in the immediate postoperative period. For the bell test, items situated on the left side were considerably more affected than those placed on the right side  \u2013 a typical sign of spatial neglect.r128\u2009=\u20090.23, p\u2009=\u20090.008; two-sided) and for \u22061 , suggesting that the underlying impaired neurocognitive mechanisms did not fully overlap across the two tasks. Note that this correlation disappeared when \u22062 was considered . Correlation matrices are displayed in Supplementary Table\u00a0To determine whether patterns of performances converged between both tasks, simple non-parametric correlations were performed. Only a slight association was observed between line bisection estimates and diff_bell at A1 (\u03b3 and C) of SVR-LSM models (see \u201cMethods\u201d section). With respect to A1, we failed to identify a combination of hyper-parameters associated with a good prediction accuracy and a high level of reproducibility for the three measures of interest  total_bell  and diff_bell  , no combinations of hyper-parameters were found to be associated with good model fit and reproducibility for \u22062  versus located in the medial frontal lobe (n\u2009=\u200921)  = 5.92, p\u2009=\u20090.02, \u03b72p\u2009=\u20090.14; two-sided) and assessment time  = 24.57, p\u2009<\u20090.001, \u03b72p\u2009=\u20090.40; two-sided), and most importantly a significant interaction effect between both factors  = 12.86, p\u2009<\u20090.001, \u03b72p\u2009=\u20090.26; two-sided). Post-hoc analyses revealed that performances differed between both groups, but only at A2   = 29.05, p\u2009<\u20090.001, \u03b72p\u2009=\u20090.44; two-sided) but not for group  = 0.56, p\u2009=\u20090.46, \u03b72p\u2009=\u20090.015; two-sided). Both factors did not interact significantly  = 0.72, p\u2009=\u20090.49, \u03b72p\u2009=\u20090.019; two-sided)  Fig.\u00a0. A two-wA3) Fig.\u00a0. With reed) Fig.\u00a0. The samIn summary, the above analyses confirmed that the bell test was affected to the same extent by resections targeting either the parietal or the fronto-medial areas. By contrast, line bisection performances were uniquely impaired following parietal resections. This general finding is reflected in the individual patterns of performances  were computed for each candidate tract (see \u201cMethods\u201d for the procedure of selection) and correlated with behavioral measurements, in particular, \u22061 and \u22062.p-value (two-sided) was reached after Bonferroni correction . The amount of resected fibers within the superior thalamic radiations , SLF_I , fronto-parietal cingulum , and within SLF_II , positively correlated with \u22061 for the line bisection task. No significant correlations were found for \u22062.The results are illustrated in the form of a correlogram in Fig.\u00a0r128\u2009=\u20090.35, p\u2009<\u20090.001) and fronto-parietal cingulum . No significant correlations were found for \u22062.With regard to diff_bell, only two tracts were found to be associated with \u22061, including again, albeit more markedly, SLF_I , superior thalamic radiations , fronto-parietal cingulum , superior CST  and, marginally, fronto-para-hippocampal cingulum . For \u22062, only fronto-para-hippocampal cingulum  and marginally SLF_I  still correlated.The analyses were repeated for total_bell; a larger set of tracts was associated with the behavioral measures, especially for \u22061. This included SLF_I  may be preferentially affected by lesions damaging the posterior parietal cortex, whereas visuo-motor exploratory tasks (such as the bell test) may rather be affected by lesions targeting the frontal lobe46\u2014knowing that this general pattern may be in reality more complex as cancellation performances have been also found to be impaired following posterior or subcortical lesions . Our results contribute to this old but still topical and clinically relevant matter by indicating that such a simple fronto-parietal dissociation is indeed just part of the story. While rightward biases in line bisection were indeed associated with a cluster of parietal areas lodging in both the inferior and superior parietal lobules, bell omissions  were associated with both the posterior parietal cortex  and the fronto-medial cortex (in particular the pre-SMA and the anterior-to-middle cingulate). This finding was unequivocally replicated in the patient who benefited from a two-step surgery and further supported by the low-to-mild correlations found between task performances at the population-level.As already suggested by Mesulam thirty years ago58, but to eye behavior monitoring and conflict signaling. Likewise, the CEF may be indirectly involved in the control and regulation of saccadic eyes movements by motivational influence9, stemmed from the consequences of previously accomplished voluntary eye movements59. The role of the CEF in motivation may extend to visuo-spatial attention, but its lesion in isolation is apparently not enough to produce contralesional motivational neglect60. Our findings clearly demonstrate that damage to these two eye-related areas is able to produce visuo-motor exploratory neglect, though the underlying mechanisms cannot be fully elucidated here; it might be either the consequence of a deficit in initiating saccades towards the contralesional space, in line with the established behavioral affiliations of the medial frontal structures61, or the result of specific difficulties in deliberately orienting attention during visual search . The latter interpretation is more likely since ablation or inactivation studies in monkeys have generally shown not or only little impact of SEF/CEF damage on saccade initiation62. Finally, we cannot fully exclude the possibility that visuo-motor exploratory neglect partially arises from a functional diaschisis effect63 transiently impairing the FEF by deprivation of functional inputs\u2014the FEF, SEF, and CEF being densely interconnected22.The critical finding of the current study is the powerful and to date undocumented association between the medial frontal cortex and the emergence of visuo-motor exploratory neglect. From an anatomical standpoint, the cluster of significant voxels identified by SVR-LSM greatly overlapped with the consensual location of both the SEF (junction between the SMA and the pre-SMA) and the CEF . To date, the respective role of these two eye-related medial areas remains controversial, and almost undiscussed in the context of visuo-spatial attention. Studies performed in humans and monkeys converge towards the idea that the SEF may significantly contribute, not to saccade initiation per se32 and lesion mapping27 studies. Third, target cancellation performances  were associated with disconnective interruption of the superior cortico-striatal tract. This result is interesting to consider in view of its connective pattern. This tract indeed provides dense connections between the fronto-medial cortex  and the caudate, and is known to be part of the eye-related network64. Its inactivation through electrostimulation leads to contralateral eye deviation16. Moreover, the caudate influences visually-guided actions65 and its damage causes spatial neglect in humans23. To summarize, disruption to the medial fiber network and the cortico-striatal connections are more likely to disturb target visual search. This conclusion is bolstered by the observation that the likely interruption of the fibers forming the SLF_I and the cingulum following the first surgery did not result in rightward deviations in the single patient  were evaluated in the context of their standard medical care, and gave their informed consent to participate in this study. The study protocol was approved by Montpellier University Medical Center\u2019 institutional review board (N\u00b0202000557). All control participants who were enrolled retrospectively also provided informed consent to participate. IRB approval for this part of the study was obtained from the French College of Neurosurgery (N\u00b000011687).The sample consisted of 128 patients consecutively operated on for a lower-grade glioma invading the right hemisphere at University Montpellier Medical Center\u2019 Department of Neurosurgery over a period of 7 years (2013-2020). Patients fulfilling the following exclusion criteria were discarded at the outset: higher-grade glioma identified by histopathological analyses, adjuvant radiotherapy performed before or after surgery, a visual hemianopsia identified before or after surgery to avoid contaminating task performance, and a lack of longitudinal behavioral data. The patients\u2019 sociodemographic and clinical characteristics are given in Supplementary Table\u00a0A control group of 44 neurologically healthy participants matched in terms of age, educational attainment, and sex was further recruited to assess differences with the patient group , 4 days after surgery (noted elsewhere A2) and 3 months after surgery (noted elsewhere A3). They were asked to complete two well-tried visuo-spatial tasks, the performances of which are known to be affected by spatial neglect: the line bisection task69 and the bell test70\u2014the latter being a target cancellation task. With respect to the former, patients were required to estimate the true midpoint of ten horizontal lines of 18 cm in length and 3 mm in thickness. The task was adapted in a touchscreen environment so that patients used a digital stylus with the dominant hand to mark the estimated center of lines. Deviations from the true center were automatically computed across trials and then averaged to form the final measure. Patients with left spatial neglect behave in such way that the estimated center significantly shifts toward the right. In the bell cancellation task, patients are asked to encircle 35 bells among 280 distractors on a sheet of A4 paper displayed in landscape format. 17 bells are homogenously distributed on both sides, and one bell is placed in central position. In this study, there was not limit of time to perform the task. Patients were simply asked to notify the experimenter when s/he thought s/he had circled all of the bells. The total number of omitted bells, as well as the asymmetry score , were taken into consideration as two separate dependent variables. Patients with spatial neglect typically omit the bells situated on the left side, with some degree of variability as a function of neglect severity.Patients performed the behavioral assessment at three time points: the day before surgery (noted elsewhere effect of tumor invasion), the delta between the preoperative and the 4-day postoperative performances , and the delta between the preoperative and the 3-month postoperative performances . In this way, we had the chance to more directly appraise the consequences of surgical excisions on spatial attention.As we had in this study, a baseline assessment before the surgery was performed, most of the analyses described in the following were achieved on the preoperative performances  were preferred to map the surgical cavities. The imaging parameters were as follows: (i) preoperative FLAIR images (1.5\u2009T/3\u2009T): repetition time, 13,200/800\u2009ms; echo time, 109/108\u2009ms; inversion time, 2500/23,700\u2009ms; field of view 210 \u00d7 240/202 \u00d7 240\u2009mm, voxel size 0.898 \u00d7 0.898 \u00d7 6 mm3, slice thickness 5/3\u2009mm, spacing 5.5/3.6\u2009mm, and flip angle 150\u00b0; (ii) 3-month 3DT1 images (1.5\u2009T/3\u2009T): repetition time, 1880/1700 ms; echo time, 3.4/2.5\u2009ms; inversion time, 1100/922\u2009ms; field of view, 256 \u00d7 256\u2009mm; voxel size, 1 \u00d7 1 \u00d7 1 mm3, 176 axial slices, and flip angle 15\u00b0/9\u00b0. Note that the use of two different magnets was independent of the general purpose of this study.In this study, two MRI sequences were used to map the neuroanatomical data. In particular, FLAIR images were used to map the preoperative tumors because this sequence is known to yield the best contrast between normal 71. This procedure was performed with the SPM12 (https://www.fil.ion.ucl.ac.uk/spm/software/spm12/) Clinical Toolbox 72. The output resolution was 1*1*4\u2009mm for FLAIR images and 1-mm isometric for 3DT1 images. As a first step, the tumors/resection cavities were semi-automatically drawn using MRIcron package (https://github.com/neurolabusc/MRIcron) and further inflated by means of a three-dimensional smoothing procedure . The obtained masks were then binarized and inserted during the registration process . Before proceeding further, all normalized MRIs were systematically and carefully checked to identify and potentially exclude inaccurate registrations. All were satisfactory at this stage. Next, tumors and resections cavities were drawn again on the normalized MRIs, yielding two three-dimensional volumes of interest (VOI) by patients. These VOIs were spatially smoothed with a 2-mm FWHM Gaussian kernel (threshold of 0.4). The whole procedure was performed by the same experimenter who shows highly-skilled expertise in neuro-anatomy (the first author).To minimize the potential bias caused by abnormal lesion-related radiological signals, MRI datasets were registered to the MNI space using enantiomorphic normalization48 was used to explore the relationship between the location of tumors or resection cavities and behavioral measures of visuo-spatial attention. Contrary to standard mass-univariate voxel-based lesion-symptom mapping (VLSM) that assumes statistical independence across voxels49, SVR-LSM rather works at the level of the entire lesion map thus taking into consideration the necessary inter-dependent nature of the lesioned voxels. In practice, a non-linear function is used to train a SVR model, the goal of which is to predict as precisely as possible the behavioral scores using all voxels\u2019 lesion statuses simultaneously. This multivariate lesion mapping method may reach better sensibility and specificity over standard univariate approach47, especially when the sample size is large enough50, and is associated with a lower rate of false-positive outcomes73. It appears however that standard but conservative univariate LSM may remain a practical option if conducted with large populations73.Support vector regression-based lesion-symptom mapping (SVR-LSM)47 to perform all SVR-LSM analyses (https://github.com/yongsheng-zhang/SVR-LSM). Epsilon-SVR models with a radial basis kernel function (RBF) were used to estimate hyperplane. Hyper-parameters of SVR-LSM models were optimized using a grid searching procedure, in particular the cost (C) which corresponds to the penalty/regularization parameter and gamma (\u03b3) which represents the kernel coefficient. This optimization was performed by means of a 5-fold cross-validation procedure allowing to determine the combination of parameters that maximized prediction accuracy while maintaining a high level of reproducibility . In total, 66 couples of parameters were assessed for each behavioral measure of interest and for each time point i.e., A1, \u22061 and \u22062 , with C\u2009=\u2009[1 10 20 30 45 50] and \u03b3\u2009=\u2009[0.1 1 2 3 4 5 6 7 8 9 10]. Parameter assessment was done with a publicity available Matlab script 74 after it was checked for quality and modified for local use. Datasets associated with a poor prediction accuracy (rmax\u2009<\u20090.20) and/or an insufficient index of reproducibility (rmax\u2009<\u20090.90) were not eligible to subsequent SVR-LSM analyses.In this study, we used the Matlab script originally coded by Zhang et al.75 (q\u2009=\u20090.05)  was applied to threshold the resulting SVR-LSM p-maps. An extent threshold of 50 voxels was employed. Note that voxels were analyzed if they were lesioned in at least three patients. This rather low cut-off was originally selected to include structures relevant to spatial cognition, but typically less affected in the context of lower-grade glioma . Results are reported within the AAL atlas76.Prior to running SVR-LSM analyses, the DTLVC  option was chosen to control for lesion volume directly to the lesion data (and not to the behavior performances). Note that this parameter was also taken into consideration during the optimization procedure of hyper-parameters. A bootstrap permutation procedure (5000 permutations) was first used to estimate the significance of the voxels\u2019 feature weight. Then, a FDR correction77\u2014a new Matlab toolbox that employs different population-based approaches to provide multiple measures of white-matter disconnection severity, including tract-level disconnection measures  and used as regions-of-interest. The used atlas has the clear advantage of being constructed on an unprecedented sample of subjects. Moreover, compared to older versions , it integrates clear distinctions between the different strata of the superior longitudinal fasciculus  and between the different pathways forming both the striatal and thalamic projection systems. As detailed in Griffis et al.77, the fibers of each HCP tract are loaded and filtered in such a way that only fibers intersecting the lesion map are retained. For each tract, an estimate of disconnection severity (in percentage) is provided. Compared to other methods based on the amount of tract damage, the advantage here is to deal with a measure with greater biological value. To avoid selecting tracts to be analyzed on an arbitrary basis and to maintain statistical power, we included only tracts if they were damaged in at least 25% of patients at a proportion of at least 5%. Accordingly, the following 25 tracts were subjected to analysis : anterior commissure (33.6%), arcuate fasciculus (53.1%), the four strata of the cingulum bundle, including the fronto-parietal (33.6%), fronto-parahippocampal (31.1%), parahippocampal (25%) and parahippocampal-parietal (27.4) pathways, three parts of the corpus callosum, including the anterior (49.21%), mid-anterior (52.3%) and posterior (41.4%), the frontal cortico-pontine tract (41.4%), the anterior (48.4%) and superior (44.5%) fronto-striatal tract, the extreme capsule (50.8%), the fornix (27.34%), the frontal aslant tract (48.4%), the inferior fronto-occipital fasciculus (50.8%), and the inferior longitudinal fasciculus (42.2%), the middle longitudinal fasciculus (28.9%), layers I (28.7%), II (54.7%) and II. (27.3%) of the superior longitudinal fasciculus, the anterior (44.5%) and superior (47.6%) parts of the thalamic radiations and the uncinate fasciculus (48.4%). Non-parametric Spearman correlations were performed between disconnection estimates and behavioral measures. A Bonferroni correction was applied to control for the number of tracts to be analyzed . Note that more complex analyses to model the impact of cerebral disconnections on behavioral measurements of visuo-spatial attention were not performed in view of both the strong nonnormality and orthogonality of potential predictors.To estimate the severity with which the main white-matter tracts were damaged by the surgical resection, we used the lesion quantification toolbox (LQT)https://brainvisa.info, version 4.6). In addition, the cerebral disconnections caused by the surgical procedure were estimated with LQT (see above). The patient benefited from an assessment of visuo-spatial attention in the context of both surgeries.In a separate analysis, we analyzed the case of a patient who has benefited from a two-step, sequential neurosurgery to remove a tumor invading the right cingulum. To access the anterior part of the tumor, the first surgery selectively targeted the pre-SMA and the caudal part of the anterior cingulate as well as, laterally the postero-dorsal part of SFG. To access the posterior part of the tumor, the anterior part of both the SPL and precuneus was removed 6 months later. To better identify the cortical structures damaged by these two successive neurosurgeries, a pial mesh of the patient\u2019s brain was reconstructed with BrainVISA/anatomist ; all these tests were two-tailed and a p-value of less than 0.05 was considered as statistically significant. Post-hoc, pairwise multiple comparisons analyses were conducted with the Scheff\u00e9 test which controls for the familywise error rate.In this study, we used parametric statistics to assess between-group and within-subject differences . The results were strictly the same. For the sake of completeness, these analyses are provided in the supplementary information file (Supplementary Tables\u00a0Further information on research design is available in the\u00a0Supplementary InformationPeer Review FileReporting summary"}
+{"text": "S. aureus (MRSA) are resistant to beta-lactams, but synergistic activity between beta-lactams and glycopeptides/lipopeptides is common. Many have attributed this synergy to the beta-lactam-glycopeptide seesaw effect; however, this association has not been rigorously tested. The objective of this study was to determine whether the seesaw effect is necessary for synergy and to measure the impact of beta-lactam exposure on lipid metabolism. We selected for three isogenic strains with reduced susceptibility to vancomycin, daptomycin, and dalbavancin by serial passaging the MRSA strain N315. We used whole genome sequencing to identify genetic variants that emerged and tested for synergy between vancomycin, daptomycin, or dalbavancin in combination with 6 beta-lactams with variable affinity for staphylococcal penicillin binding proteins (PBPs), including nafcillin, meropenem, ceftriaxone, ceftaroline, cephalexin, and cefoxitin, using time-kills. We observed that the seesaw effect with each beta-lactam was variable and the emergence of the seesaw effect for a particular beta-lactam was not necessary for synergy between that beta-lactam and vancomycin, daptomycin, or dalbavancin. Synergy was more commonly observed with vancomycin and daptomycin based combinations than dalbavancin in time-kills. Among the beta-lactams, cefoxitin and nafcillin were the most likely to exhibit synergy using the concentrations tested, while cephalexin was the least likely to exhibit synergy. Synergy was more common among the resistant mutants than the parent strain. Interestingly N315-D1 and N315-DAL0.5 both had mutations in vraTSR and walKR despite their differences in the seesaw effect. Lipidomic analysis of all strains exposed to individual beta-lactams at subinhibitory concentrations suggested that in general, the abundance of cardiolipins (CLs) and most free fatty acids (FFAs) positively correlated with the presence of synergistic effects while abundance of phosphatidylglycerols (PGs) and lysylPGs mostly negatively correlated with synergistic effects. In conclusion, the beta-lactam-glycopeptide seesaw effect and beta-lactam-glycopeptide synergy are distinct phenomena. This suggests that the emergence of the seesaw effect may not have clinical importance in terms of predicting synergy. Further work is warranted to characterize strains that don\u2019t exhibit beta-lactam synergy to identify which strains should be targeted with combination therapy and which ones cannot and to further investigate the potential role of CLs in mediating synergy.Methicillin-resistant  Some inIn a previous study, we selected for a series of isogenic mutants by serial passage and identified isolates that do and do not exhibit the seesaw effect with a panel of six different beta-lactams . We founSerial passage, susceptibility testing, and time\u2013kill experiments were performed in Mueller\u2013Hinton II broth (MHB). Tryptic soy agar (TSA) was used for subculture of organisms and colony enumeration. Beta-lactams and vancomycin were purchased commercially from Sigma-Aldrich and Thermo Fisher Scientific. Ceftaroline-2-HCl and dalbavancin were acquired from Allergan, and daptomycin was purchased from Merck. The well-characterized MRSA strain N315 and three strains derived from N315 were evaluated. These strains were selected for by serial passage in escalating concentrations of vancomycin (VAN), leading to N315-VAN8, daptomycin (DAP), leading to N315-DAP1, and dalbavancin (DAL), leading to N315-DAL0.5, as described previously .LC/MS grade water and acetonitrile, ammonium acetate and brain heart infusion (BHI) media were purchased from Thermo Fisher Scientific. Phosphatidylcholines (PC) and phosphatidylethanolamines (PE) Standards for lipidomics were purchased from Avanti Polar Lipids and Nu-Chek prep and prepared as described previously .6\u00a0cfu/ml in accordance with CLSI guidelines  under BioProject number PRJNA547605.DNA from N315 and antibiotic-selected derivatives was extracted using the Ultraclean microbial DNA isolation kit (Mo Bio). Sequencing libraries were prepared as described elsewhere , with seThe N315 parent strain and three N315 mutants  were grown in 1\u00a0ml of BHI medium with addition of various beta-lactams targeting at different penicillin binding proteins (PBPs), including nafcillin (PBP non-specific), cephalexin (PBP3), meropenem (PBP1), ceftriaxone (PBP2), cefoxitin (PBP4), and ceftaroline (PBP2a) as shown in g to separate the organic and aqueous layers. The organic layers were collected to clean 1.5\u00a0ml polypropylene microcentrifuge tubes  and dried in a vacuum concentrator. The dried lipid extracts were reconstituted with 500\u00a0\u00b5L of 2:1 acetonitrile/methanol and transferred to glass vials for storage prior to LC-MS analysis.Briefly, bacteria broth was collected after cultivation overnight in the absence or presence of individual beta-lactams, rinsed with 1x PBS, spun and dried with a speed-vac. 150 \u03bcL of water was then added to the pelleted and dried bacteria. The resulting suspensions were sonicated in an ice bath for 30\u00a0min to dislodge the dried pellets and homogenize the suspension. A chilled solution of chloroform and methanol  was added to each tube, followed by 5\u00a0min of vortex and the addition of 150\u00a0\u03bcL of chilled chloroform and 150\u00a0\u03bcL of chilled water. The samples were then rigorously vortexed for 1\u00a0min and centrifuged for 10\u00a0min at 4\u00b0C and 2,000 \u00d7 Bacterial lipids were separated by a Waters UPLC  as described previously . Brieflym/z 50-1200 was performed with sodium formate. Calibration of ion mobility (IM) measurements was performed as previously described (m/z 50-1200 with a 1\u00a0s scan time. Untargeted MS/MS (MSE) was performed in the transfer region with a collision energy ramp of 35\u201345\u00a0eV. Mass and drift time correction was performed post-acquisition using the leucine enkephalin lockspray signal.The Waters Synapt G2-XS platform was used for lipidomics analysis. Effluent from the UPLC was introduced through the electrospray ionization (ESI) source. ESI capillary voltages of +2.0 and \u22122.0\u00a0kV were used for positive and negative analyses, respectively. Additional ESI conditions were as follows: sampling cone, 40\u00a0V; extraction cone, 80\u00a0V; source temperature, 150\u00b0C; desolvation temperature, 500\u00b0C; cone gas, 10\u00a0L/h; desolvation gas, 1000\u00a0L/h. Mass calibration over escribed . IM sepaThe effects of beta-lactam exposure on membrane fluidity was measured in each of the strains as previously described.. Brieflym/z (within 10\u00a0ppm mass accuracy), retention time, and CCS with an in-house version of LipidPioneer, modified to contain the major lipid species observed in S. aureus, including free fatty acids (FFAs), DGDGs, PGs, CLs, and LysylPGs with fatty acyl compositions ranging from 25:0 to 38:0 , and LiPydomics . A pooled quality control sample was used as the alignment reference. The default \u201cAll Compounds\u201d method of normalization was used to correct for variation in the total ion current amongst samples. PCA analysis was performed with the online tool, MetaboAnalyst 4.0 . PearsonPydomics .2 fold-change in MIC, respectively, compared to the N315 parent strain. N315-Van8 strain, aside from the above 2 beta-lactams inducing 5 log2 fold-change, ceftriaxone also showed significant decreases in MIC with 3 log2 fold-change relative to the parent. For N315-Dal0.5 strain, no general seesaw effect was observed in our susceptibility testing, notably, ceftriaxone and nafcillin even displayed increased MICs. Generally there was cross-resistance among VAN/DAL/DAP similar to what has been reported previously  was performed on all selected strains to identify mutations which arose relative to the parental N315 . MutatioDAP-, VAN- and DAL-non-susceptible N315 mutants (4 replicates) as well as the N315 parent strains (4 replicates) were treated with 6 beta-lactams targeting different PBPs at the same concentrations used in the time kill experiments and combination MICs , then harvested for lipidomic analysis  showed cUsing Pearson correlation analysis, the difference in individual lipid species abundance in a strain given a series of beta-lactam exposure was correlated with the changes in VAN, DAL, or DAP MIC for the same strain given the same beta-lactam exposure . In geneThe difference in individual lipid species abundance for a strain given a series of beta-lactam exposure was also correlated with the changes in activity in time kills between VAN, DAL, or DAP alone or in combination with that same beta-lactam exposure using Pearson correlation analysis . For CLsvraTSR operon and walK, the seesaw effect phenotype was discordant. We do not know how the function of these genes was affected by the different mutations, but this discordance suggests that WalKR and/or VraTSR modulate cell envelope metabolism that favors or hinders beta-lactam susceptibility independently from any effect on VAN/DAP/DAL susceptibility. However, we also report the emergence of the seesaw effect and VAN/DAP/DAL cross resistance in a VISA strain that did not carry mutations in genes known to affect susceptibility these drugs or cell envelope metabolism. This finding reinforces the idea that beta-lactam susceptibility and VAN/DAP/DAL susceptibility are indeed closely linked metabolically.In this study, we demonstrated that synergy between VAN/DAL/DAP and beta-lactams against MRSA is not dependent on the emergence of the seesaw effect. While N315-DAL0.5 did not exhibit the beta-lactam seesaw effect after becoming resistant to these peptide drugs, most combinations of VAN, DAP, or DAL with beta-lactams were still synergistic against this strain. Despite that N315-DAL0.5 and N315-DAP1 both acquired mutations in the in vitro PK/PD models against dalbavancin susceptible strains  positively correlated with the levels of LysylPGs. LysylPGs contain a positively charged headgroup, and increased level of LysylPGs has been associated with daptomycin resistance . Since Lsistance . Interessistance . For mossistance . HoweverIn previous studies, beta-lactam exposure in daptomycin-resistant MRSA leads primarily to decreased cell membrane (CM) fluidity, but sometimes it is increased or unchanged . Thus, dPrsA chaperone  by which beta-lactams modulate lipidomic phenotypes and how the lipidomic changes affect the synergies between VAN/DAP/DAL and beta-lactams in MRSA.Future studies are needed to understand the roles of"}
+{"text": "D13 (N-(4-methoxybenzyl)-2-oxo-N--1,2,3,4-tetrahydroquinoline-6-sulfonamide exhibited the strongest inhibitory effect on the proliferation of HeLa (IC50: 1.34 \u03bcM), and this value correlated well with the inhibitory activities of the compound against tubulin polymerization (IC50: 6.74 \u03bcM). In summary, a new type of quinoline-sulfonamide derivative with tubulin polymerization inhibitory activity was discovered, and it can be used as a lead compound for further modification.In this paper, a small series of novel quinoline sulfonamide derivatives was synthesized, and their structure of the target compounds were confirmed by 1H NMR and MS. The screening of the news target compounds\u2019 in vitro cytotoxic activities against tumor cell lines by the MTT method was performed. Among them, compound  The mortality rate and the incidence of cancer are increasing year by year. The number of patients who die of malignant tumors worldwide has risen to the second place among various causes of death, which seriously threatens human health ,2. A micD13) were investigated.By 2016, there were already seven active binding sites on tubulin. Among them, five binding sites are located on the \u03b2 subunit of tubulin, including the paclitaxel binding site, laulimalide binding site, vinblastine binding site, maytansine binding site and colchicine binding site. Meanwhile, two binding sites are located on the \u03b1 subunit of tubulin, including the evipabulin binding site and pironetin binding site ,13,14,15H)-one and sulfonic chloride were chlorosulfonated to obtain intermediate A. Moreover, 3,4,5-trimethoxyaniline and different substituted aldehydes were subjected to the Schiff\u2019s base reaction to obtain different intermediates B +: 483.16, found: 483.18.White powder; yield 52%; m.p. 96\u201398 \u00b0C. 1H NMR  \u03b4 8.64 , 7.57\u20137.53 , 7.41 , 7.15 , 6.90 , 6.17 , 4.64 , 3.82 , 3.68 , 3.03  and 2.71 . 13C NMR  \u03b4 170.98, 152.92 (2C), 142.32, 137.79, 135.17, 134.41, 131.61, 131.44 (2C), 130.25 (2C), 127.55 (2C), 123.71, 121.60, 115.51, 106.47 (2C), 60.75, 56.06 (2C), 54.49, 30.25 and 25.14. MS (m/z) calculated for C25H27BrN2O6S+[M+H]+: 561.07, found: 561.20.White powder; yield 63%; m.p. 112\u2013114 \u00b0C. 1H NMR  \u03b4 8.56 , 7.56 , 7.23 , 7.02\u20136.87 , 6.15 , 4.66 , 3.82 , 3.67 , 3.03  and 2.71 . 13C NMR  \u03b4 170.81, 160.93, 152.91 (2C), 143.11, 137.46, 134.98, 133.22, 130.98, 130.76, 130.70, 127.86, 127.77, 124.66, 115.63, 115.53, 115.46, 106.99 (2C), 60.47, 56.37 (2C), 53.55, 30.34 and 24.85. MS (m/z) calculated for C25H27FN2O6S+[M+H]+: 501.15, found: 501.19.White powder; yield 51%; m.p. 108\u2013110 \u00b0C. 1H NMR  \u03b4 8.64 , 7.58\u20137.53 , 7.28\u20137.17 , 6.90 , 6.17 , 4.66 , 3.82 , 3.67 , 3.03  and 2.71 . 13C NMR  \u03b4 170.80, 152.92 (2C), 143.14, 137.47, 136.15, 135.00, 132.44, 130.85 (2C), 130.52 (2C), 128.76, 127.88, 127.78, 124.66, 115.53, 106.94 (2C), 60.48, 56.40 (2C), 53.56, 30.34 and 24.84. MS (m/z) calculated for C25H27ClN2O6S+[M+H]+: 517.12, found: 517.16.White powder; yield 61%; m.p. 119\u2013121 \u00b0C. 1H NMR  \u03b4 8.91 , 7.56 , 7.10 , 6.97 , 6.17 , 4.64 , 3.81 , 3.66 , 3.01 , 2.69  and 2.31 . 13C NMR  \u03b4 170.82, 153.01 (2C), 143.60, 137.72, 137.23, 134.94, 134.35, 130.75, 130.53, 130.27, 128.02, 127.95, 127.86, 126.00, 124.61, 115.51, 107.63 (2C), 60.70, 56.83 (2C), 56.21, 31.76, 24.87 and 19.22. MS (m/z) calculated for C26H29N2O6S+[M+H]+: 497.17, found: 497.17.White powder; yield 65%; m.p. 128\u2013130 \u00b0C. 1H NMR  \u03b4 8.20 , 7.64\u20137.51 , 7.07 , 6.86 , 6.60 , 6.17 , 4.60 , 3.82 , 3.66 , 3.02 , 2.92  and 2.76\u20132.65 . 13C NMR  \u03b4 170.82, 152.79 (2C), 150.20, 142.93, 137.28, 135.13, 131.31, 129.75, 127.79, 127.71, 124.60, 123.74, 115.45, 112.48, 107.01, 60.47, 56.35, 53.93, 30.35 and 24.85. MS (m/z) calculated for C27H32N3O6S+[M+H]+: 526.20, found: 526.22.White powder; yield 63%; m.p. 127\u2013129 \u00b0C. 3, ppm) \u03b4 9.14 , 7.57 , 7.10 , 6.94 , 6.18 , 4.66 , 3.81 , 3.66 , 3.03 , 2.71  and 2.30 . 13C NMR  \u03b4 170.82, 152.79 (2C), 143.08, 137.48, 137.23, 134.94, 134.35, 130.75, 130.53, 130.27, 128.02, 127.95, 127.86, 126.00, 124.61, 115.51, 107.00 (2C), 60.50, 56.36, 52.64, 45.91, 30.36, 24.87 and 19.22. MS (m/z) calculated for C26H29N2O6S+[M+H]+: 497.17, found: 497.18.White powder; yield 67%; m.p. 120\u2013122 \u00b0C. 1H NMR  \u03b4 8.90 , 7.56 , 7.27\u20137.19 , 7.12\u20136.86 , 6.19 , 4.69 , 3.82 , 3.68 , 3.03  and 2.71 . 13C NMR  \u03b4 170.88, 16.85, 152.74 (2C), 142.30, 137.56, 135.96, 134.54, 131.75, 128.49 (2C), 128.25 (2C), 127.59, 127.41, 123.63, 115.46, 106.53 (2C), 60.65, 55.95 (2C), 55.07, 30.23 and 25.10. MS (m/z) calculated for C25H26FN2O6S+[M+H]+: 501.15, found: 501.18.White powder; yield 56%; m.p. 138\u2013140 \u00b0C. 1H NMR  \u03b4 8.64 , 7.58\u20137.53 , 7.28\u20137.17 , 6.90 , 6.17 , 4.66 , 3.82 , 3.67 , 3.03  and 2.71 . 13C NMR  \u03b4 170.83, 152.90 (2C), 143.16, 137.59, 135.05, 134.19, 133.21, 131.50, 130.73, 129.81, 129.76, 127.96, 127.85, 127.62, 124.66, 115.51, 107.00 (2C), 60.51, 56.38 (2C), 52.21, 30.33 and 24.84. MS (m/z) calculated for C25H26ClN2O6S+[M+H]+: 517.12, found: 517.15.White powder; yield 54%; m.p. 117\u2013119 \u00b0C. 1H NMR  \u03b4 8.57 , 7.54 , 7.37 , 7.14 , 6.90 , 6.19 , 4.64 , 3.83 , 3.70 , 3.03  and 2.71 . 13C NMR  \u03b4 170.81, 152.99 (2C), 143.22, 138.46, 137.55, 134.95, 131.31, 131.04, 130.63, 130.53, 130.43, 128.94, 127.95, 127.82, 124.69, 115.54, 106.92 (2C), 60.49, 56.43 (2C), 53.07, 30.32 and 24.84. MS (m/z) calculated for C25H25Cl2N2O6S+[M+H]+: 551.08, found: 551.09.White powder; yield 64%; m.p. 123\u2013125 \u00b0C. 1H NMR  \u03b4 8.86 , 7.69\u20137.54 , 7.14 , 6.99\u20136.79 , 6.21 , 4.89 , 3.80 , 3.66 , 3.04  and 2.71 . 13C NMR  \u03b4 170.83, 160.87, 152.67 (2C), 143.21, 137.78, 134.58, 130.43, 128.04, 127.95, 126.03, 124.63, 121.95, 121.81, 115.46, 114.96, 114.78, 107.01 (2C), 60.55, 56.22 (2C), 46.42, 30.34 and 24.85. MS (m/z) calculated for C25H25ClFN2O6S+[M+H]+: 535.11, found: 535.14.White powder; yield 67%; m.p. 124\u2013126 \u00b0C. 1H NMR  \u03b4 8.63 , 7.59\u20137.52 , 7.18 , 6.92 , 6.84\u20136.77 , 6.20 , 4.67 , 3.82 , 3.77 , 3.67 , 3.03  and 2.70 . 13C NMR  \u03b4 170.80, 159.61, 152.87 (2C), 143.09, 138.59, 137.40, 135.15, 131.00, 129.83, 127.86, 127.76, 124.65, 120.83, 115.52, 114.09, 113.34, 106.93 (2C), 60.47, 56.38, 55.42, 54.14, 45.86, 30.34 and 24.85. MS (m/z) calculated for C26H29N2O7S+[M+H]+: 513.17, found: 513.19.White powder; yield 45%; m.p. 121\u2013123 \u00b0C. 1H NMR  \u03b4 8.36 , 7.59\u20137.53 , 7.15 , 6.88 , 6.80 , 6.16 , 4.63 , 3.82 , 3.78 , 3.66 , 3.03  and 2.70 . 13C NMR  \u03b4 170.80, 159.61, 152.87 (2C), 143.09, 138.59, 137.40, 135.15, 131.00, 129.83, 127.86, 127.76, 124.65, 120.83, 115.52, 114.09, 113.34, 106.93 (2C), 60.47, 56.38, 55.42, 54.14, 45.86, 30.34 and 24.85. MS (m/z) calculated for C26H29N2O7S+[M+H]+: 513.17, found: 513.19.White powder; yield 48%; m.p. 122\u2013124 \u00b0C. 1H NMR  \u03b4 8.24 , 7.62\u20137.52 , 6.89 , 6.86 , 6.75\u20136.65 , 6.17 , 4.63 , 3.85 , 3.84 , 3.82 , 3.67 ,3.03  and 2.75\u20132.66 . 13C NMR  \u03b4 170.81, 152.84 (2C), 148.92, 148.54, 143.04, 137.36, 135.08, 131.08, 128.95, 127.87, 127.76, 124.62, 121.18, 115.52, 112.28, 111.86, 107.03 (2C), 60.47, 56.38 (2C), 55.82, 53.97, 45.88, 30.34 and 24.85. MS (m/z) calculated for C27H31N2O8S+[M+H]+: 543.18, found: 543.15.White powder; yield 49%; m.p. 116\u2013118 \u00b0C. 1H NMR  \u03b4 8.42 , 7.62\u20137.50 , 7.04 , 6.88 , 6.76\u20136.67 , 6.30 , 4.74 , 3.81 , 3.76 , 3.69 , 3.63 , 3.03  and 2.70 . 13C NMR  \u03b4 170.80, 153.36, 152.84 (2C), 151.47, 143.07, 137.40, 135.55 (2C), 131.20, 127.84, 127.73, 125.70, 124.60, 115.80, 115.49, 113.65, 112.34, 106.89 (2C), 60.50, 56.36, 56.26, 55.81, 49.42, 30.34 and 24.85. MS (m/z) calculated for C27H31N2O8S+ [M+H]+: 543.18, found: 543.13.White powder; yield 62%; m.p. 127\u2013129 \u00b0C. 1H NMR  \u03b4 10.54 , 7.51 , 7.03 , 6.54 , 6.32 , 4.65 , 3.68 , 3.56 , 3.02\u20132.90  and 2.50 . MS (m/z) calculated for C28H33N2O9S+[M+H]+: 573.19, found: 573.13.White powder; yield 62%; m.p. 131\u2013133 \u00b0C. 4 cells per well. We placed the inoculated 96-well plate in an incubator at 37 \u00b0C and 5% CO2 for 4 h. After the cells adhered to the wall, we removed the medium. We added 150 \u03bcL of medicated medium (1% DMEM) to each well of the experimental group, and the control group was added with an equal volume of solvent, with 3 replicate holes for each concentration. Then, we put it in the incubator and continued to incubate for 48 h. After that, we added MTT reagent in the dark, continued incubating for 4 h, discarded the supernatant, added 150 \u00b5L DMSO to each well and shook it for 10 min in the dark to fully dissolved the formazan. The absorbance was read at 492 nm by a microplate reader . The HeLa, HCT-116, A549 and HepG-2 cells in the logarithmic growth phase were trypsinized, diluted with 10% DMEM medium and evenly seeded in a 96-well plate with 1 \u00d7 10The inhibition rate (%) = ; we drew a logarithmic curve diagram according to the inhibition rate and the dosing concentration to obtain the half inhibitory concentration.2, 0.5 mM EGTA, 1.0 mM GTP, and 10.2% of glycerol. First, 5 \u03bcL of the tested compounds at the indicated concentrations was added, and the mixture was warmed to 37 \u00b0C for 1 min; then, the reaction was initiated by the addition of 55 uL of the tubulin solution. The fluorescence intensity enhancement was recorded every 30 s for 40 min in a multifunction microplate reader  . The area under the curve was used to determine the concentration that inhibited the tubulin polymerization by 50% (IC50), and was calculated using GraphPad Prism Software version5.02 .A tubulin polymerization assay was performed by measuring the increase in the fluorescence intensity, which can be easily recorded due to the incorporation of a fluorescent reporter, DAPI , a fluorophore that is known to be a DNA intercalator. In our experiment, a commercial kit  purchased from Cytoskeleton  was used for the tubulin polymerization. The final buffer used for tubulin polymerization contained 80.0 mM of piperazine-N,N\u2019-bis(2ethanesulfonic acid) sequisodium salt (pH 6.9), 2.0 mM MgClhttps://www.rcsb.org/structure/3HKC, accessed on 15 October 2021). The docking process was performed according to the CDOCKER protocol, where the technical parameter Pose Cluster Radius was reset to 0.5 and the other parameters were unchanged. The docking of the active site was set to the coordinates x = 39.42, y = 52.17 and z = \u22129.19 as the center, with a radius of 7.43 \u00c5 spheres. The docking result was treated with DS Client.Molecular docking was performed using the Discovery Studio (DS) 2017 Software. The protein and ligand samples were prepared, water molecules were deleted and a DS Server added hydrogen ("}
+{"text": "The burden of frailty on cardiac surgical outcomes is incompletely understood. Here we perform a systematic review and meta-analysis of studies comparing frail versus pre-frail versus non-frail patients following cardiac surgery.We searched MEDLINE and EMBASE databases until July 2018 for studies comparing cardiac surgery outcomes in \u201cfrail\u201d, \u201cpre-frail\u201d and \u201cnon-frail\u201d patients. Data was extracted in duplicate. Primary outcome was operative mortality.p\u2009<\u20090.0001) and pre-frailty  were associated with increased operative mortality compared with non-frail patients. Frailty was also associated with greater risk of prolonged hospital stay  and intermediate care facility discharge . Frail  and pre-frail patients  had worse mid-term mortality (median follow-up 1\u2009years [range 0.5\u20134\u2009years]). After adjustment for baseline imbalances, frailty was still associated with greater operative mortality , intermediate care facility discharge  and midterm mortality .There were 19 observational studies with 66,448 patients. Frail patients were more likely female , older  with greater comorbidities and higher STS-PROM. Frailty (RR2.35; 95%CI:1.57\u20133.51; In patients undergoing cardiac surgery, frailty and pre-frailty were associated with 2-fold and 1.5-fold greater adjusted operative mortality, respectively, greater adjusted perioperative complications and frailty was associated with almost 5-fold risk of non-home discharge.Burden of frailty and pre-frailty on cardiac surgical outcomes.The online version contains supplementary material available at 10.1186/s13019-021-01541-8. Patients undergoing cardiac surgery are progressively older with greater comorbidities . This caPatients who are deemed frail have been observed to experience higher operative mortality, prolonged intensive care unit (ICU) and hospital length of stay and more frequent discharge to secondary facilities . DespiteWe systematically searched OVID versions of MEDLINE and EMBASE  for studies that mentioned \u201cfrail*\u201d and \u201ccoronary artery bypass\u201d or \u201ccoronar*\u201d or \u201ccard*\u201d and \u201csurg*\u201d in the title or abstract . This stCitations were reviewed independently by two reviewers. We included all studies examining adults (no age cut-off) undergoing primarily CABG and valve surgery \u201329. One Three reviewers independently abstracted data including details of the publication, inclusion/exclusion criteria, patient demographics and cardiac risk factors, description of the interventions used, and outcome definitions and events. Study quality was assessed looking at the following indicators: retrospective versus prospective data collection, concurrent controls, comparable baseline characteristics, completeness of follow-up, and internal consistency of data presented. Disagreements on article inclusion were resolved by consensus.I2, defined as the percentage of total variability across studies attributable to heterogeneity rather than chance, and used published guidelines for low (I2\u2009=\u200925 to 49%), moderate (I2\u2009=\u200950 to 74%) and high (I2\u2009\u2265\u200975%) heterogeneity [p-value was used to estimate the standard error  and random effects models, which incorporate between-trial heterogeneity and give wider and more conservative confidence intervals (CI) when heterogeneity is present . We asseogeneity . For perne study ). Indivin\u2009=\u20097) of the studies, 1\u2009year for all patients in a third (n\u2009=\u20096), and variable durations  in the remaining third.The initial search resulted in 1297 citations from MEDLINE and EMBASE and 78 studies were retrieved for full text review , Deficit Index (17%), Bespoke Frailty Score (17%), Clinical Frailty Score (8%) and Katz Index (8%). The most common objective tests were walking velocity (71%), 6-min walk test (14%) and psoas muscle measurement (14%).p\u2009<\u20090.0001) and more likely to be female  than non-frail patients  and serum albumin , chronic obstructive pulmonary disease , previous stroke , peripheral vascular disease , chronic kidney disease , congestive heart failure , dementia  and other comorbidities , Logistic European System for Cardiac Operative Risk Evaluation (EuroSCORE)  and EuroSCORE II    and pre-frailty  were associated with increased operative mortality compared with non-frail patients  and pre-frailty ; longer  and pre-frail patients   reported by a smaller group of five studies  was higher for both frail  excluding [p\u2009=\u20090.01) excluding [p\u2009<\u00a00.00001) excluding [p\u2009<\u00a00.00001) excluding [p\u2009<\u00a00.0001) excluding [p\u2009=\u20090.11) and deep sternal wound infection  were no longer statistically significant after excluding [p\u2009=\u20090.02) excluding [p\u2009=\u20090.0005) excluding [p\u2009<\u00a00.00001) excluding [p\u2009=\u20090.07) excluding [Sensitivity analyses were performed by removing the results of one or more of the largest studies , 14, 24 xcluding . The pooxcluding . For lonTo address the variability in the frailty measures used among studies, we analyzed the only 4 studies that used the same frailty measure , 18, 19,To our knowledge, this is one of the first systematic reviews and meta-analysis comparing the outcomes of frail, pre-frail and non-frail patients undergoing cardiac surgery. A strength of this review is that it systematically summarizes all the published data in this field with the inclusion of a large number studies. We found that 1) a range of frailty scores and objective measures were used to assess frailty; 2) frail patients were older, more likely to be female and had greater co-morbidities; 3) frailty as well as pre-frailty were associated with greater operative mortality and decreased long term survival post-cardiac surgery, even after adjusting for differences in baseline risk; 4) frailty was associated with greater risk of stroke, sternal wound complications, extended stay in hospital and discharge to an intermediate care facility.https://clinicaltrials.gov/ct2/show/NCT02219815).Despite improvements in surgical outcomes, frailty still portends an almost doubling in adjusted operative mortality. This is of particular relevance to patients, their caregiver and their healthcare providers in the timing and potentially the type of surgical intervention including the decision to not undergo surgery. For such patients, one may consider less invasive transcatheter procedures for coronary or valvular disease. Alternatively, preoperative rehabilitation or \u201cprehab\u201d \u2013 a set of interventions to improve patient mental, nutritional status and/or physical capacity to \u201cdefrail\u201d elective patients \u2013 may be considered . This isI2\u00a0=\u20090\u201322%) among the different measures  with 95% CI was calculated using random-effects models. To include Marshall et al. [Supplementary Fig.\u00a03: Forest Plot for baseline and operative characteristics in frail vs non-frail patients undergoing primarily CABG and valve surgery (binary outcomes). The pooled risk ratios (RRs) with 95% CI were calculated using random-effects models. Supplementary Fig.\u00a04: Forest Plot for baseline and operative characteristics in frail vs non-frail patients undergoing primarily CABG and valve surgery (continuous outcomes). The pooled mean differences (MDs) with 95% CI were calculated using random-effects models. To include Marshall et al. [p\u2009<\u20090.0001, 14 studies, 14,321 v 41,901 patients; 2) log EuroSCORE (%) \u2013 MD\u2009+\u20093.68, 95%CI:\u20130.27 to +\u20097.62, p\u2009=\u20090.07, 3 studies, 112 v 430 patients; and 3) EuroSCORE II (%) \u2013 MD\u2009+\u20090.96, 95%CI:+\u20090.61 to +\u20091.31, p\u2009<\u20090.00001, 3 studies, 152 v 350 patients. Supplementary Fig.\u00a05: Forest Plot for stroke. Individual study and pooled unadjusted risk ratios (RRs) of frail vs non-frail patients undergoing primarily CABG and valve surgery. The pooled RRs with 95% CI were calculated using random-effects models. Sensitivity analysis \u2013 Risk of stroke higher if the study with the largest weighting is excluded [: RR 1.97, 95% CI 1.17\u20133.30, p\u2009=\u20090.01, I2\u00a0=\u20090%.Supplementary Fig.\u00a06: Forest Plot showing differences in 1\u2009year mortality results for each of the 6 different frailty measures used in Afilalo et al. [l et al. , which pl et al.  does notl et al. , which pl et al.  does notAdditional file 2 Supplementary Table\u00a01: Characteristics of included studies. Supplementary Table\u00a02: Comparisons of Pooled Outcomes Using All Studies vs Only Studies Using the Same 5 Metre/6\u2009Second Walk Test Frailty Measure"}
+{"text": "MicroRNAs (miRNAs) are a group of endogenous, small (\u223c22 nts in length) noncoding RNA molecules that function specifically by base pairing with the mRNA of genes and regulate gene expression at the post\u2010transcriptional level. Alterations in miR\u201032 expression have been found in numerous diseases and shown to play a vital role in cell proliferation, apoptosis, oncogenesis, invasion, metastasis and drug resistance. MiR\u201032\u00a0has been documented as an oncomiR in the majority of related studies but has been also verified as a tumour suppressor miRNA in conflicting reports. Moreover, it has a crucial role in metabolic and cardiovascular disorders. This review provides an in\u2010depth look into the most recent finding regarding miR\u201032, which is involved in the expression, regulation and functions in different diseases, especially tumours. Additionally, this review outlines novel findings suggesting that miR\u201032\u00a0may be useful as a noninvasive biomarker and as a targeted therapeutic in several diseases. They are also used as noninvasive biomarkers and targeted therapeutics in several diseases, including atherosclerosis,In 2017, our group constructed a miR\u201032\u20105p knockout mouse for the first time by using CRISPR/Cas9 technology , on chromosome 9.3With the growing number of elders and obesity people, the incidence of cardiovascular and metabolic\u2010related diseases is increasing sharply, which greatly influence the morbidity and mortality of the general adults.3.1Cardiovascular diseases (CVDs), especially ischaemic heart disease, are the leading causes of deaths globally; approximately 17\u00a0million CVD\u2010caused deaths occur annually worldwide, and acute myocardial infarction (AMI)\u2010related mortality accounts for approximately 13% of these deaths.Extracellular vehicles (EVs) including exosomes are nano\u2010sized lipid\u2010bound vesicles that are released from cells into the extracellular space.Angiogenesis has both beneficial and deleterious effects.On the one hand, angiogenesis is beneficial for tissue growth and regeneration. On the downside, vessels can fuel inflammatory, malignant diseases and promote tumour metastasis. In addition, insufficient vessel growth or maintenance can lead to ischaemic disease like stroke, AMI, ulcerative disorders and neurodegeneration.VC is a high\u2010incidence and high\u2010risk disease with increasing morbidity and high mortality.3.2The prevalence of type 2 diabetes mellitus (T2DM) increases in parallel with the ongoing global obesity epidemic.Dual\u2010specificity protein phosphatase (DUSP) is known as a mitogen\u2010activated protein kinase (MAPK) phosphatase and is expressed at low levels in the myocardium of diabetic rats.Approximately 70% of patients with T2DM have fatty liver disease and exhibit a course of liver fibrosis with increased severity.4MiRNAs may act as oncogenes by targeting tumour suppressor genes or as tumour suppressors by either inhibiting cellular oncogene expression or regulating cell death Figure\u00a0. Moreove4.1Breast cancer is the most common malignant tumour in women worldwide and is curable in ~70%\u201380% of patients with non\u2010metastasis breast cancer. However, advanced breast cancer with distant organ metastases is considered incurable with current strategies and agents.LncRNAs are an extraordinary group of nonprotein\u2010coding RNAs that are longer than 200 nts in length but absence of protein\u2010coding potential.4.2Osteosarcoma (OS) is a primary malignant tumour in children and adolescents.4.3Retinoblastoma is a highly malignant tumour that appears in retinal development and is the most common primary intraocular tumour in childhood and infancy.4.4The incidence of ovarian cancer ranks sixth among female tumours. Meanwhile, its mortality ranks first among gynaecological tumours, with at least 120,000 deaths worldwide annually.4.5Acute myeloid leukaemia (AML)\u00a0is\u00a0an aggressive\u00a0haematopoietic\u00a0malignancy and the most\u00a0common\u00a0form of\u00a0acute\u00a0leukaemia in adults. Resistance\u00a0to\u00a0chemotherapy\u00a0contributes\u00a0to\u00a0the\u00a0poor\u00a0outcome\u00a0of AML. Although the application of new targeted therapies, multidrug combination chemotherapy and haematopoietic stem cell transplantation has greatly improved the prognosis of patients in recent years, an effective treatment for refractory and recurrent cases does not exist, and the prognosis of approximately 50% of patients remains poor due to chemotherapy resistance and recurrence.LncRNA SNHG5 is aberrantly overexpressed in AML relative to that in donors. SNHG5 functions as competitive RNA with miR\u201032 to regulate DNAJB9 expression. SNHG5 increases chemotherapy resistance in AML cells by regulating autophagy via the miR32/DNAJB9 axis.T\u2010cell acute lymphoblastic leukaemia (T\u2010ALL) is an aggressive and malignant neoplasm that arises from haematopoietic T\u2010cell precursors.Myeloma remains an incurable plasma\u2010cell cancer.4.6Colorectal cancer (CRC) is one of the most malignant cancers worldwide, which had caused several millions of deaths annually due to its late\u2010stage diagnosis, metastasis trend and high recurrence.A PCR analysis of 28 pairs of CRC tissues and adjacent normal tissues has revealed that the expression of miR\u201032 is significantly increased in CRC and that the overexpression of miR\u201032 in LoVo cells promotes cell proliferation and migration through the direct targeting of tumour suppressor bone morphogenetic protein 5, whereas the inhibition of miR\u201032 in HCT\u2010116 cells shows the opposite pattern.Another study reported the opposite result. SNHG14\u00a0serves as a tumour promoter that can facilitate breast cancer cell proliferation and invasion.Promoter methylation and other epigenetic events contribute to miRNA expression regulation in tumours.4.7Lung\u00a0cancer\u00a0is\u00a0one\u00a0of\u00a0the\u00a0most\u00a0common\u00a0cancers\u00a0that threaten\u00a0human\u00a0life and health worldwide. Non\u2010small cell lung cancer (NSCLC) is a heterogeneous class of tumours that accounts for approximately 85% of newly diagnosed lung cancer cases, and 70% of patients with NSCLC are at an advanced stage at the time of diagnosis.Another study showed that the levels of miR\u201032\u00a0have no significant difference in\u00a0NSCLC\u00a0patients pre\u2010and\u00a0post\u2010treatment.\u00a0However, plasma\u00a0levels\u00a0of\u00a0miR\u201032\u00a0were\u00a0significantly\u00a0higher after chemotherapy than those observed before chemotherapy. Moreover, high miR\u201032\u00a0levels are associated with improved chemotherapy efficacy. Thus, changes in plasma miR\u201032\u00a0levels are prognostic indicators for lung cancer patients receiving platinum\u2010based chemotherapy.4.8Enhancer of zeste homolog 2 (EZH2) is the catalytic subunit of the polycomb repressive complex 2 (PRC2), which participates in cell cycle regulation and carcinogenesis through methylating H3K27.4.9Nasopharyngeal carcinoma (NPC) is a highly malignant epithelial carcinoma arising from the epithelial lining of the nasopharynx.4.10Oesophageal squamous cell carcinoma\u00a0(ESCC) is recognized as a malignant tumour with poor prognosis.4.11Cervical cancer (CCa) is one of the most common female cancers globally.4.12Prostate cancer (PC) is the second most common urological malignancy and the sixth leading cause of cancer\u2010associated mortality in males worldwide.Chemotherapeutic insensitivity remains a massive challenge in PC treatment. The downregulation of miR\u201032\u20105p by cisplatin induces the expression of KLF4 by directly binding to the promoter of BIK, facilitating its transcription and promoting prostate cell apoptosis; these events result in an increase in the chemosensitivity of PC.LncRNA growth arrest\u2010specific transcript 5 (GAS5) is a well\u2010known tumour suppressor gene in several human cancers.4.13Cutaneous malignant melanoma is among the deadliest human cancers that is broadly resistant to most clinical therapies.4.14Gastric cancer (GC) is a high\u2010incidence malignant tumour with a poor prognosis that poses a serious threat to global health. The International Agency for Research on Cancer reported approximately 951,000 newly diagnosed cases of gastric cancer worldwide and 723,000 related deaths in 2012. Among all cancers, GC ranks the fourth and the fifth respectively among males and females worldwide in terms of incidence rate, while it ranks the third and the fifth respectively in terms of mortality rate.MiR\u201032 acts as an oncogene by directly targeting KLF4, a member of the KLF family of transcription factors, which acts as tumour suppressor in certain cancers, including GC, by regulating proliferation, differentiation, apoptosis and somatic cell reprogramming. The knockdown of KLF4 can mimic the effect of miR\u201032 overexpression on cell proliferation, invasion and metastasis. The levels of KLF4\u00a0mRNA in 43\u00a0clinical gastric carcinoma tissue and their adjacent normal tissue samples from the same patient with miR\u201032 expression were examined by using qPCR. The results showed that KLF4\u00a0mRNA is expressed at significantly lower levels in GC than in adjacent tissues. Moreover, the authors identified a significant inverse correlation between miR\u201032 and KLF4 in GC,4.15Although clear\u2010cell renal cell carcinoma (ccRCC) is the most common histologic subtype of renal cell carcinoma and accounts for 70% of the cases of this malignancy, its detailed metastasis mechanisms remain unclear.5In the past decade, we and other groups have found through deep and extensive studies that miR\u201032\u00a0has a broad regulatory role in biological events, especially in tumorigenesis and cardiovascular system. The upstream of miR\u201032 is mainly regulated by a series of lncRNAs that act as competing endogenous RNAs Figure\u00a0. The expConsidering the considerable effects of miR\u201032 on cell proliferation and survival, miR\u201032\u00a0may be involved in a variety of pathophysiological processes, such as atherosclerosis, diabetes, ageing and tumours. Great space and value for exploration in these areas remain. Moreover, recent studies have found that another important function of microRNA is to act as a communication medium among cells and organs.The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.ZL Zeng: Data curation; Software; Visualization; Writing\u2010original draft; Writing\u2010review & editing. Qingyun Zhu: Data curation; Writing\u2010original draft. Zhibo Zhao: Data curation; Writing\u2010review & editing . Xuyu Zu: Conceptualization Supervision . Jianghua Liu: Conceptualization; Supervision."}
+{"text": "Prenatal posttraumatic stress disorder (PTSD) is often overlooked in obstetric care, despite evidence that untreated PTSD negatively impacts both mother and baby. OB-GYN clinics commonly screen for depression in pregnant patients; however, prenatal PTSD screening is rare. Although the lack of PTSD screening likely leaves a significant portion of pregnant patients with unaddressed mental health needs, the size of this care gap has not been previously investigated.This retrospective chart review study included data from 1,402 adult, pregnant patients who completed PTSD  and depression  screenings during a routine prenatal care visit. Descriptive statistics identified screening rates for PTSD and depression, and logistic regression analyses identified demographic variables associated with screening outcomes and assessed whether screening results  were associated with different provider intervention recommendations.11.1% of participants screened positive for PTSD alone, 3.8% for depression alone, and 5.4% for both depression and PTSD. Black  and Latinx  patients were more likely to screen positive for PTSD compared to White patients, while those on public insurance were 1.64 times  more likely to screen positive compared to those with private insurance. Patients who screened positive for both depression and PTSD were most likely to receive referrals for behavioral health services (44.6%), followed by -PCL/\u2009+\u2009EPDS (32.6%),\u2009+\u2009PCL/-EPDS (10.5%), and -PCL/-EPDS (3.6%). A similar pattern emerged for psychotropic medication prescriptions.Over ten percent of pregnant patients in the current study screened positive for PTSD without depression, highlighting a critical mental health need left unaddressed by current obstetric standards of care. Routine PTSD screening during prenatal care alongside strategies aimed at increasing referral resources and access to mental health services are recommended. Prenatal posttraumatic stress disorder (PTSD) is a significant pregnancy complication affecting millions of individuals worldwide each year. Epidemiological studies reveal PTSD prevalence rates ranging from 3.3 to 19.0% among pregnant people, with rates varying widely depending on sample characteristics such as trauma exposure and medical/psychiatric risk \u20136.Perinatal depression screening is recommended by the American College of Obstetricians and Gynecologists (ACOG) and required by law in some U.S. jurisdictions , 8. HoweIn 2019, our prenatal clinics added PTSD screening to the standard depression screening conducted during initial prenatal care visits. This retrospective chart review included electronic medical record data spanning 9\u00a0months from 1,402 pregnant, adult patients who completed both PTSD and depression screenings during their prenatal visit  and theAnalyses were conducted in SAS 9.4 . Using descriptive statistics and logistic regression, we examined screening rates for PTSD and depression and tested whether race/ethnicity and insurance status were associated with different screening results. Logistic regression models also assessed whether screening results  were associated with differences in medication prescriptions and provider referrals for behavioral/mental health services .n\u2009=\u2009234) of pregnant patients screened positive for PTSD and 9.2% (n\u2009=\u2009111) screened positive for depression. A total of 11.1% (n\u2009=\u2009133) screened positive for PTSD alone, 3.8% (n\u2009=\u200946) for depression alone, and 5.4% (n\u2009=\u200965) for both depression and PTSD.Fully 16.7% \u2009=\u200917.05, p\u2009=\u20090.001) and depression \u2009=\u20099.46, p\u2009=\u20090.024) screening results \u2009=\u200910.10, p\u2009=\u20090.002) and depression \u2009=\u200911.52, p\u2009=\u20090.001) screening results \u2009=\u2009190.76, p\u2009<\u20090.0001; see Table Participants\u2019 screening results were associated with the likelihood that they received a referral for behavioral health services \u2009=\u200916.93, p\u2009=\u20090.001; see Table Screening results were also significantly associated with the likelihood that pregnant patients were prescribed a psychotropic medication within one month of their visit . In. In15]).Untreated PTSD in pregnancy has been linked to several pregnancy complications and adverse birth outcomes, including preeclampsia, gestational diabetes, low birth weight, and preterm birth \u20136. In paLeft untreated, PTSD often persists into the postpartum period , produciand PTSD are warranted.PTSD and depression involve overlapping symptoms  and are highly co-morbid . OptimalOur additional recommendations for implementing PTSD screening into routine OB-GYN care include: 1) universal screening for all OB-GYN patients, regardless of perceived risk, 2) use of brief, validated screening measures and 3) ongoing screening that extends into the postpartum period. Screening measures should be standardized and validated in pregnant samples, consistent with ACOG recommendations for depression screening . The curand postpartum.While screening during pregnancy is critical for early intervention and risk mitigation, there is also compelling meta-analytic evidence supporting continued screening in the postpartum period because there is small increase in PTSD prevalence rates from pregnancy to 4\u20136\u00a0weeks postpartum . There aEven with attention to PTSD screening, pregnant patients who screened positive only for PTSD were less likely to receive a behavioral health referral or psychotropic medication prescription compared to individuals who screened positive for depression alone, suggesting that treatment access was more restricted for PTSD compared to depression. The reasons for this are likely multifactorial and occur at the patient, provider, organization, and health system levels. Prior research suggests that OB-GYN providers feel under-trained and unprepared to assess patients\u2019 trauma histories and intervene effectively . ProvideSystem-level barriers also prevent effective mental health screening in obstetrics and perinatal care. Lessons learned from perinatal depression screening initiatives have clearly shown that impact is diminished unless screening is combined with comprehensive and ongoing mental health training for all staff, adequate staff support, and integration of mental health into OB-GYN clinics using stepped-care or co-located care models . Mental Thus, screening for PTSD in prenatal settings may improve mental health treatment, but screening must be coupled with appropriate training, referral resources, and adequate access to PTSD behavioral health services. Perinatal mental health concerns are complex and often overlooked relative to medical conditions in pregnancy despite conferring high risk for maternal and infant health outcomes. Provider, patient, and system-level interventions with adequate reimbursement are necessary to adequately address these mental health concerns during this sensitive period of life.The current study included electronic medical record data from a large, diverse sample of pregnant patients who completed screening measures as part of their routine prenatal care, thus enhancing ecological validity. However, PTSD prevalence rates varied depending on patient and contextual factors, and our reliance on retrospective chart review data precluded collection of participant information that may have shed more light on additional demographic  and clinical characteristics  that distinguish pregnant patients who screen positive for PTSD in obstetric clinic settings. Additionally, we were unable to assess whether participants had already established care with a psychiatrist or behavioral health specialist prior to their prenatal care visit; thus, provider referral data presented in this report may underestimate how often patients were able to connect to these services. Finally, data were not available to assess longitudinal maternal or infant outcomes. Future prospective work is needed to evaluate the long-term impact of prenatal PTSD screening on patients and families.The current study identifies a missed opportunity in current obstetric care practice that could be remedied with routine, universal screening for PTSD during prenatal care. Further studies are needed to evaluate the long-term effects of PTSD screening implementation and identify multi-tiered access-to-care interventions that address additional barriers to connecting patients with mental health resources."}
+{"text": "Adverse effects of morphine on locomotor function after moderate to severe spinal cord injury (SCI) have been reported; however, the effects after mild SCI without damage of lumbar \u03b1-motoneurons have not been investigated. We investigated the effects of lumbar intrathecal morphine on locomotor function after mild thoracic SCI and the involvement of classic opioid receptor activation. A mild thoracic contusive SCI was induced in adult rats at the T9-T10 spine level under sevoflurane anesthesia. We evaluated the effects of single doses of intrathecal morphine and selective \u03bc-, \u03b4-, and \u03ba-opioid receptor agonists, continuous infusion of intrathecal morphine for 72 hours, and administration of physiological saline on locomotor function and muscle tone in the hindlimbs. The numbers of damaged and total \u03b1-motoneurons in the lumbar spinal cord were also investigated. Single doses of morphine aggravated residual locomotor function after SCI but did not affect functional recovery. Single doses of morphine and \u03bc- and \u03b4-opioid receptor agonists significantly aggravated residual locomotor function with increases in muscle tone after SCI, and the effects of the drugs were reversed by naloxone. In contrast, continuous infusion of morphine led to persistent decline in locomotor function with increased muscle tone, which was not reversed by naloxone, but did not increase the number of damaged lumbar \u03b1-motoneurons. These results indicate that a single dose of morphine at an analgesic dose transiently increases muscle tone of the hindlimbs via activation of spinal \u03bc- and \u03b4- opioid receptors, resulting in further deterioration of locomotor function in the acute phase of mild SCI. Our results also suggest that an increased dose of morphine with prolonged administration leads to persistent decline in locomotor function with increased muscle tone via mechanisms other than direct activation of classical opioid receptors. Morphine should be used cautiously even after mild SCI. Spinal cord injury (SCI) frequently leads to alterations in ambulatory and many other bodily functions that affect the quality of life. Opioids, such as morphine and fentanyl, have been commonly used as analgesics for the treatment of acute pain arising from not only damage to musculoskeletal structures but also from surgical injuries for spine decompression and stabilization in patients with SCI . HoweverIn previous studies in which ischemic SCIs were produced by occlusion of the descending aorta \u20134, 8 or This study was therefore designed to investigate whether IT morphine leads to aggravation of locomotor function, what kind of changes in motor tone occur, and whether activation of spinal opioid receptors is involved in them in the early phase of mild contusive thoracic SCI distant from the lumbar region, which is a clinically common traumatic SCI . MorphinAll of the protocols of this study were approved by the Animal Care and Use Committee of Shinshu University School of Medicine (number 190151). Animals were treated in accordance with the guidelines of the National Institutes of Health. Adult male Sprague-Dawley rats, 8\u20139 weeks old (weighing 240\u2013300 g), were obtained from Nippon SLC  and housed in 40 \u00d7 60 \u00d7 30 cm plastic cages with soft bedding under a 12:12 h day: night cycle at 22-24\u00b0C. Each animal was separated and given water and food pellets ad libitum. Every effort was made to reduce the number of animals used in this study.The rats were anesthetized with sevoflurane  in oxygen delivered via a face mask. A PE-10 polyethylene catheter  was inserted 15 mm cephalad into the lumbar subarachnoid space at the L4-L5 intervertebral space. The catheter was then tunneled subcutaneously to emerge at the neck. The wound at the lumbar region was sutured in layers. Rats showing motor weakness or paralysis of lower limbs were excluded from the study. Lidocaine (10 \u03bcg)  was injected to confirm the location of the catheter. Rats that were not paralyzed by lidocaine were excluded from the study (n = 3). Penicillin G   was administered subcutaneously every 2 days after surgery throughout the experiments. The drugs remaining in the catheter were always washed out by 15 \u03bcl of saline.At least 6 days after implantation of the catheter, a T9-T10 laminectomy was performed under sevoflurane anesthesia. The thoracic vertebrae were immobilized with a stereotaxic instrument. SCI was produced using the New York University impactor device   by droppLocomotor function was assessed using the Basso, Beattie, and Bresnahan (BBB) locomotor rating scale in open fields (120 \u00d7 120 cm) -enkephalin acetate salt: DAMGO), \u03b4 , and \u03ba  selective opioid receptor agonists were obtained from Sigma . Morphine , DAMGO , DPDPE , or U50,488H  was administered through the IT catheter 6 hours after the SCI or after the sham operation without SCI, and the BBB and Ashworth scores were evaluated at 30 min after administration of each drug. Naloxone (60 \u03bcg/15 \u03bcl) , an opioid receptor antagonist, was then intrathecally injected to the rats with decrease in the BBB scores at the highest doses of the drugs , and the BBB and Ashworth scores were recorded again at 30 min after administration of naloxone.\u03bc (Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0Partly********** <font color=\"black\"> 2. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #1:\u00a0Yes********** <font color=\"black\"> 3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0No********** <font color=\"black\"> 4. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0Yes********** <font color=\"black\"> 5. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0One of the underlying goals of this work is to determine how a single dose of opioids influences lower extremity function acutely following a high thoracic injury where the HL MNs are presumably intact. A second goal is to determine how continuous delivery of opioids influences locomotor recovery over a slightly longer period. The key outcomes are the BBB scale for hindlimb function during stepping and the Ashworth scale that looks at hindlimb rigidity.Overall, the study addresses important issues. Some of the data/results are of interest, however there are some fairly serious experimental design issues that render the data hard to interpret for both major components of the study.Major issues:The authors indicate multiple times that previous literature shows intrathecally delivered morphine to increase spinal cord injury lesion size, specifically around the epicenter of the injury site. The authors speculate that this phenomenon may contribute to the locomotor deficits that are seen in the study, however, no analysis was performed on the injury epicenter, spared white matter, or the extent of damage after SCI. This renders the results very hard to interpret, in particular in light of the issues mentioned below.The study design does not allow the interpretation that 72h infusion of morphine induces a lasting functional difference, just a delay in recovery. The text should clearly reflect this.The graphs in Figures 1, 3a and 4 represent the data as continuous without scaling the x-axis for time. This is misleading and the graphs need to be re-done to clearly show what is continuous and the temporal relationships in the data.More specifically:Results:It is a shame that the experiment was not extended out to day 28, because it appears that the significant difference shown in Figure 4 would be gone by days 21 or 28. This suggests that whatever impact continuous morphine had on the circuitry is not going to induce a change in terminal function. The relationship between Ashworth and BBB data should be investigated using a scatterplot to look for correlations on an animal by animal basis.MN counts. Please described if and how you used stereological principles and prevented double-counting MNs given that the sections were 5\u00b5m in diameter and MNs may appear in several consecutive sections. Also, more information is necessary for the reader to understand the criteria you used to identify both uninjured and injured or damaged MNs. Did you only count MNs with visible nucleoli? Did damaged MNs also have to be greater than 25\u00b5m in diameter?The images in Figure 5 are confusing and the location of the MNs in a is quite different from in b and c. Are you certain the orientation of the sections are similar?How long did you wait after introducing the next drug or drug concentration before assessing the BBB and ashworth? This is an important detail.For the data shown in Figure 4, did you \u201cwash out\u201d morphine before delivering naloxone, and for how long?Discussion:On pages 18 and 19 (lines 318 to 322) you discuss damage to the MNs, but there are a couple issues of logic. First of all, the section shown in Figure 5a shouldn\u2019t have any injured MNs because it is a control animal that received morphine only. Thus, the lack of increase following injury is in question. The second logic problem is the presumption that a mild contusion injury at T9-10 did not \u201cextend to the lumbar spinal cord\u201d. No doubt that the frank injury and cavitation did not, but even a mild injury disrupts descending and propriospinal input onto motoneurons and pre-motor neurons which could definitely influence their \u201chealth\u201d. This should be re-stated and re-interpreted. This is particularly important because of the discussion on lines 335- about the descending input into the lumbar spinal cord.Figures:Figure 1. This figure is important and interesting, but shows each time point as having the same value over time. This is very misleading and mis-represents the data. I suggest showing this as two separate graphs, one to illustrate the Pre-SCI, Sci, 30min and day 1, and one to show the whole dataset (without the 30min), with the x-axis scaled to time. Or, keep the data all on one graph but scale the x-axis to time.Same thing for Figure 3a. This is very misleading and in fact doesn\u2019t even indicate the influence of the single dose of morphine given prior to the 30min assessment. This is absolutely critical and needs to be shown in some other way.In Figure 2, although the and \u03ba-opioid receptor agonist did not cause significant changes in function, Panels d and h should include the effects of reversing the \u03ba-opioid receptor agonist with naloxone as Panels a-c/e-j showed for the other agonists and morphine.In Figure 4a, the naloxone data is not collected on day 4 and thus the data points should not be shown connected. Same thing for figure 4b .********** <font color=\"black\"> 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0Nohttps://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 16 Jan 2022We would like to thank the academic editor and reviewer for carefully reading out manuscript (PONE-D-21-29555) and for the insightful comments. The comments led us to an improvement of the work. Detailed responses to the academic editor and reviewer are shown in the file \u201cResponses to Reviewers\u201d. Thank you for giving us the opportunity to strengthen our manuscript with your valuable comments and queries.AttachmentResponces to Reviewers.docxSubmitted filename: Click here for additional data file. 25 Apr 2022 <div> PONE-D-21-29555R1 </div> Intrathecal morphine exacerbates paresis with increasing muscle tone of hindlimbs in rats with mild thoracic spinal cord injury but without damage of lumbar a-motoneuronsPLOS ONEDear Dr. Tanaka,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.==============================While one reviewer has acknowledged some revisions and offers more, they point out that there remain shortcomings mentioned in the previous reviews that should be addressed to strengthen the report. Another reviewer has posed further pertinent queries that must be addressed equally, in particular discussion of current literature that differs from current contentions regarding morphine treatment after SCI in rodents.\u00a0==============================plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Jun 09 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at\u00a0Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: We look forward to receiving your revised manuscript.Kind regards,Alexander Rabchevsky, Ph.D.Academic EditorPLOS ONE[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0(No Response)Reviewer #2:\u00a0(No Response)********** <font color=\"black\"> 2. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0PartlyReviewer #2:\u00a0Yes********** <font color=\"black\"> 3. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 5. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0While the authors have been reasonably responsive to the reviews, and the manuscript is much improved, there remain some shortcomings mentioned in the previous review that, if addressed, would greatly strengthen the interpretation.1. The authors speculate in the discussion section that motor neurons below the level of the lesion may receive more excitatory input after SCI, contributing to the observed changes in muscle tone. However, they don\u2019t provide any evidence for this, even though it would be quite easy. IHC for CGRP and analysis of afferent sprouting would be very revealing.2. An additional very easy assessment, assessment of descending, supraspinal input onto lumbar motor neurons (IHC for 5-HT for example) would be very helpful.3. An analysis of opioid receptor populations and their distributions.4. The motor neuron viability/damage analysis is problematic, in particular in light of the authors contention that mechanical injury might occur during pump implantation. These groups should be compared to normal non-implanted animals (with and without administration of morphine) to help strengthen the motor neuron viability component of the paper.Minor suggestions/comments:Page 8. It might be better to say that \u201cEach rat\u2019s bladder was manually expressed twice daily\u201d, since this action is a little more subtle than just squeezing.Page 9. 5 rats met ethical endpoints. Which groups were they in? If morphine influenced the expression of autophagy or lethargy then this should be explained and hopefully explored?For the data shown in Figure 1, it is important that the reader knows that the morphine was given after the 6hr BBB assessment, and that you acknowledge the slight difference in group BBB at that time . This group difference persists even if it is not statistically significant, and may have nothing to do with morphine. Please add the detail that morphine was given after the 6hr BBB assessment (to the legend or to the text in the results section).Related to #4 above, the concept that MNs densely stained with nissl are damaged or dying should be supported by a reference (or references) in the methods, results and discussion.Reviewer #2:\u00a0This study adds to the growing evidence of adverse effects of morphine on the prognosis for recovery after SCI. Using a mild SCI model, the data demonstrates that continuous administration of morphine, for 3 days, undermines recovery. The study also documents the spastic hypertonia that is noted with acute morphine administration, while it is active. While many of the findings are not particularly novel, the paper is important, increasing the data on effects of early opioid administration after SCI, a highly significant clinical concern.For the methods, please clarify where the tip of the catheter lay in relation to the spinal injury, was it caudal or centered over the lesion site? What experimental groups were the 5 rats that were euthanized before 14 days in? Was there a bias with increased autophagia noted in morphine-treated subjects, as has been seen in other studies? With the implanted osmotic pump, how did you verify that it was active and released sufficient morphine over the 14 days? What is the half-life of DPDPE, DAMGO and U50488H, relative to morphine?Withdrawal from continuous morphine administration, with or without naloxone did not improve recovery. It would have been interesting to know whether early naloxone administration blocked the effects of continuous morphine . Are there any previous studies addressing this? This should be included in the discussion.I am not 100% sure of the point of the short-term tests of each of the opioids on locomotor recovery. To some extent it seems logical that the rats may reduce locomotion, and appear less coordinated, while opioids are actively inhibiting activity in the spinal cord. A statement regarding the hypothesis being tested, or the implications of these studies, would be helpful, either in the methods or as part of the discussion.In some ways, the results of this study also differ significantly from previously published reports (see papers by Faden and Aceves) that implicate kappa opioid receptor activation in reducing recovery after SCI. The authors should acknowledge and discuss these differences, with any explanation as to why the studies may be different. For example, are there differences in the mechanistic action of U50488H, GR89696, and dynorphin that could explain the disparate results?********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0NoReviewer #2:\u00a0Nohttps://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 3 Jun 2022We would like to thank the academic editor and reviewers for carefully reading our manuscript and for the insightful comments. The comments led to an improvement of the work. Detailed responses to the reviewers are shown below. The comments from the reviewers are shown in black and our replies are shown in red. In this revised version, changes to our manuscript within the document were all highlighted by using red-colored text (with underlining) in the file named \u201cRevised Manuscript with Track Changes\u201d.Reply to Reviewer #1Reviewer #1: While the authors have been reasonably responsive to the reviews, and the manuscript is much improved, there remain some shortcomings mentioned in the previous review that, if addressed, would greatly strengthen the interpretation.1. The authors speculate in the discussion section that motor neurons below the level of the lesion may receive more excitatory input after SCI, contributing to the observed changes in muscle tone. However, they don\u2019t provide any evidence for this, even though it would be quite easy. IHC for CGRP and analysis of afferent sprouting would be very revealing.We greatly appreciate the useful suggestions. A number of studies have shown that CGRP fibers become more prevalent both rostral and caudal to the injured spinal cord, and this has been generally interpreted as sprouting of the fibers . CGRP immunostaining studies would provide useful information on regeneration of sensory fibers. The area of CGRP-immunoreactive fibers was increased in all cord segments at 2 weeks but not at 1 week after spinal cord transection (Krenz and Weaver). It is presumed that the impact of sensory fiber regeneration on motor function is small at 6 hours and 3 days after spinal cord injury (SCI), when morphine was administered in our study. Therefore, we did not investigate regeneration of the sensory fibers after administration of morphine to rats with thoracic SCI.Nonetheless, the reviewer\u2019s suggestions are important, and we have included your point as a consideration for future study. The following description (underlined) has been added to the Discussion section in the revised manuscript, in line 394.\u201cThe lesion epicenter in the thoracic spinal cord was not histologically investigated. Neuronal sprouting in the spinal cord was not histologically investigated in the present study because sprouting of primary afferent fibers and the corticospinal tract does not occur immediately after SCI . Mechanisms other than involvement of activation of spinal opioid receptors could not be revealed from the present study. Further work will be necessary to clarify the mechanisms of morphine-induced deterioration in locomotor recovery from mild SCI.\u201d2. An additional very easy assessment, assessment of descending, supraspinal input onto lumbar motor neurons (IHC for 5-HT for example) would be very helpful.As the reviewer pointed out, an immunohistochemical study for 5-HT could be a useful method for assessing the disruption and regeneration of descending serotonergic projections to the spinal motor areas. Corticospinal tract (CST) sprouting occurs between 3 weeks and 3 months after contusive SCI . Therefore, it is presumed that the impact of CST sprouting on the spinal motor areas is small at 6 hours and 3 days after spinal cord injury (SCI), when morphine was administered in our study. Therefore, damage of descending fibers in the spinal cord was not investigate in this study.3. An analysis of opioid receptor populations and their distributions.Thank you for your important suggestion. The proportions of the three main types of opioid binding sites in the spinal cord are considered to be as follows: 70.4-74.3%, 18.4-20.3% and 7.3-9.5% for \u03bc, \u03b4, and \u03ba sites, respectively . After SCI, the number of \u03bc opioid receptors decreases , the number of \u03b4 opioid receptors remains unchanged, and the number of \u03ba opioid receptors increases (Krumins SA and Faden AI. Ann Neurol 1986). However, we did not investigate changes in opioid receptor expression after SCI. In line 399, we have added the following sentences (underlined) in the Discussion section.\u201cSome limitations exist regarding the present study. First, while DPDPE and U50,488H used in this study agonize \u03b41- and \u03ba1-opioid receptors, respectively , involvement of other subtypes such as \u03b42- and \u03ba2-opioid receptors remains unknown from the present study. Second, it has been reported that the expression of opioid receptors below the SCI changes within one or two days after SCI . In the present study, changes in the expression of opioid receptors after mild SCI was not investigated. Third, locomotor function recovery assessed by the BBB rating scale has been reported to be correlated with the spared tissues. However, rats can recover nearly normal locomotion even if some damage remains in the epicenter region . Histological assessment in the lesion epicenter is required in a future study to investigate how or whether morphine affects the spinal cord after mild injury\u201d4. The motor neuron viability/damage analysis is problematic, in particular in light of the authors contention that mechanical injury might occur during pump implantation. These groups should be compared to normal non-implanted animals (with and without administration of morphine) to help strengthen the motor neuron viability component of the paper. &#x0f061; -motoneurons in the lumbar spinal cord of non-catheterized rats were not histologically evaluated. In this revised version of the manuscript, we added data showing \ufffd &#x0f061; -motoneurons of catheterized rats without thoracic SCI and without administration of morphine. The number of dark-stained \ufffd &#x0f061; -motoneurons in this group was similar to that in other groups . The tip of the catheter was located in the lumbar spinal cord. Therefore, it is presumed that the insertion of the catheter may have damaged a small number of \ufffd &#x0f061; -motoneurons to the extent that it did not lead to locomotor dysfunction. It is important to emphasize from figure 5 that continuous infusion of IT morphine did not result in increased loss of \ufffd &#x0f061; -motoneurons in the lumbar spinal cord of rats with thoracic SCI. In the present study, \ufffdIn this revised version, we changed in line 368 as follows (underlined).  &#x0f061; -motoneurons in the lumbar spinal cord were darkly stained (damaged) in all four groups with or without SCI and with or without morphine administration. It has been shown that intrathecal catheter placement can induce subclinical damage in the spinal cord and fascicles in contact with the catheter . Intrathecal catheters were placed in rats in all four groups in the present study. The tip of the intrathecal catheter was located at the lumbar enlargement of the spinal cord. Therefore, damage of some \ufffd &#x0f061; -motoneurons observed in the three four groups is was more likely to be due to mechanical contact of the intrathecal catheter. than the thoracic SCI or morphine. Implantation of the intrathecal catheter but not. Our results showed that continuous infusion of morphine did not increase the number of darked-stained \ufffd &#x0f061; -motoneurons in the lumbar spinal cord. continuous infusion of IT morphine per se would cause some loss of motoneurons in the lumbar spinal cord of rats with thoracic SCI.\u201d \u201cAs shown in Figure 5, approximately 15 percent of the \ufffdMinor suggestions/comments:Page 8. It might be better to say that \u201cEach rat\u2019s bladder was manually expressed twice daily\u201d, since this action is a little more subtle than just squeezing.Thank you for the advice. According to the reviewer\u2019s suggestion, we have changed as follows in line 114 \u201cEach rat\u2019s bladder was manually expressed twice daily.\u201dPage 9. 5 rats met ethical endpoints. Which groups were they in? If morphine influenced the expression of autophagy or lethargy then this should be explained and hopefully explored?All five animals that met humane endpoints received continuous infusion of morphine after thoracic SCI (SCI+MOR group). Three of the rats were lethargic and two displayed self-mutilation. Autophagia is thought to result from neuropathic pain in animals with lesions in the central nervous system . It has been reported that intrathecal morphine treatment did appear to enhance autophagia in animals with SCI, suggesting that morphine produces symptoms of neuropathic pain . Aceves et al. reported that body weight in animals decreases in the acute phase of SCI . In addition, Hook et al. reported that animals that received morphine exhibited greater weight loss than that in controls . Thus, in addition to SCI, morphine administration may lead to deterioration of the general condition.In line 119, we added the following sentences. Five rats that received continuous infusion of morphine after thoracic SCI met the humane endpoints. Three of the rats were lethargic and two displayed self-mutilation. It has been reported that morphine administration leads to an increase in the incidence of autophagia and weight loss in animals with SCI compared to that without morphine . For the data shown in Figure 1, it is important that the reader knows that the morphine was given after the 6hr BBB assessment, and that you acknowledge the slight difference in group BBB at that time . This group difference persists even if it is not statistically significant, and may have nothing to do with morphine. Please add the detail that morphine was given after the 6hr BBB assessment (to the legend or to the text in the results section).As the reviewer pointed out, figure 1 may be difficult to understand.In line 213, we have added the following sentences in the Results section.\u201cSCI at the T9-T10 spine level led to locomotor dysfunction but not complete paralysis of the hindlimbs. There were no significant differences in the BBB scores between the groups at 6 h after SCI before morphine administration (P = 0.085). The BBB score of the morphine group at 30 min after administration (6.5 hours after SCI) was significantly lower than that of the saline group (P = 0.006).\u201d In addition, \u201cAn arrow indicates the timing of administration of drugs \u201d was added to line 225 in the legend of figure 1.Related to #4 above, the concept that MNs densely stained with nissl are damaged or dying should be supported by a reference (or references) in the methods, results and discussion.Kl\u00fcver-Barrera staining, which enables detection of abnormalities in the nucleus and myelin sheath at low magnification, has been used to evaluate motoneurons in the spinal cord. As in previous studies, darkly-stained \u03b1-motoneurons localized in the ventral horn were counted as impaired neurons .We added the reference in the Methods section. &#x0f06d; m in thickness were obtained by cutting the spinal cord at the level of the lumbar enlargement and were stained by the Kl\u00fcver-Barrera method to assess neuronal damage .\u201d\u201cTransversal sections of 5 \ufffdReply to Reviewer #2Reviewer #2: This study adds to the growing evidence of adverse effects of morphine on the prognosis for recovery after SCI. Using a mild SCI model, the data demonstrates that continuous administration of morphine, for 3 days, undermines recovery. The study also documents the spastic hypertonia that is noted with acute morphine administration, while it is active. While many of the findings are not particularly novel, the paper is important, increasing the data on effects of early opioid administration after SCI, a highly significant clinical concern.Thank you very much for your comments.For the methods, please clarify where the tip of the catheter lay in relation to the spinal injury, was it caudal or centered over the lesion site? In lines 95-97 in the previous version of the manuscript, it was stated that \u201cA PE-10 polyethylene catheter  was inserted 15 mm cephalad into the lumbar subarachnoid space at the L4-L5 intervertebral space.\u201d. In other words, the tip of the intrathecal catheter was located at the lumbar enlargement of the spinal cord below the level of injury. Therefore, it is unlikely that SCI at T9-T10 was affected by the mechanical contact of the intrathecal catheter.In line 373, we have added the following description. \u201cThe tip of the intrathecal catheter was located at the lumbar enlargement of the spinal cord.\u201d What experimental groups were the 5 rats that were euthanized before 14 days in? Was there a bias with increased autophagia noted in morphine-treated subjects, as has been seen in other studies?\u3000As we responded to another reviewer, all five animals that met humane endpoints received continuous infusion of morphine after thoracic SCI (SCI+MOR group). Three of the rats were lethargic and two displayed self-mutilation. Autophagia is thought to result from neuropathic pain in animals with lesions in the central nervous system . It has been reported that intrathecal morphine treatment did appear to enhance autophagia in animals with SCI . With the implanted osmotic pump, how did you verify that it was active and released sufficient morphine over the 14 days? &#x0f06d; l/h. A pump filled with 72 \ufffd &#x0f06d; l of morphine or saline was implanted. Under sevoflurane anesthesia, the pump was removed at 14 days after the start of continuous infusion. Then it was confirmed that there was no residual solution in the pump. Because the pump seemed to be functioning without any problems, it was presumed that morphine or saline has been continuously infused for 3 days (72 hours).The osmotic pump (ALZET model 1003D) used in this study delivers solutions continuously at a rate of 1 \ufffdIn line 187, we have added the following sentences in the Methods section. \u201cUnder sevoflurane anesthesia, the pump was removed at 14 days after the start of continuous infusion. Then it was confirmed that there was no residual solution in the pump.\u201dWhat is the half-life of DPDPE, DAMGO and U50488H, relative to morphine?When given intrathecally in mice, the half-lives of morphine, DAMGO, DPDPE are between 10 and 15 min . We could not find any report showing the half-life of U50,448H. Kakinohana et al. reported that the maximal effects of intrathecal morphine, DAMGO, DPDPE and U50,448H on the residual locomotor function after ischemic SCI appeared in 30 \u2013 60 min . Based on these results, we evaluated locomotor function and muscle tone 30 min after administration of the drugs .Withdrawal from continuous morphine administration, with or without naloxone did not improve recovery. It would have been interesting to know whether early naloxone administration blocked the effects of continuous morphine . Are there any previous studies addressing this? This should be included in the discussion.That is an interesting point. In the present study, continuous infusion of morphine-induced decreases in locomotor function assessed by the BBB scale were not reversed by naloxone administered at 72 hours after SCI. However, to the best of our knowledge, there has been no report about the effects of naloxone given in the early stage of continuous infusion of morphine on locomotor function and muscle tone after SCI. The half-life of naloxone is approximately 10 min . Therefore, it is presumed that a single shot of naloxone at the beginning of continuous infusion of morphine does not improve subsequent recovery during continuous infusion of morphine. The effect of continuous administration of naloxone during continuous infusion of morphine was not investigated in this study. Further research is needed on these matters.In line 385, we have the added following sentences.\u201cThe half-life of naloxone is approximately 10 min . Therefore, it is presumed that subsequent locomotor recovery in rats with continuous infusion of morphine was not improved even if a single shot of naloxone was administered at the beginning of continuous infusion of morphine. The effect of continuous administration of naloxone during continuous infusion of morphine was not investigated in this study.\u201dI am not 100% sure of the point of the short-term tests of each of the opioids on locomotor recovery. To some extent it seems logical that the rats may reduce locomotion, and appear less coordinated, while opioids are actively inhibiting activity in the spinal cord. A statement regarding the hypothesis being tested, or the implications of these studies, would be helpful, either in the methods or as part of the discussion. &#x0f06d; g) did not affect recovery but deteriorated locomotor function in the short term . The half-life of morphine is between 10 and 15 min . In contrast, continuous administration of morphine for 72 hours delayed functional recovery from SCI . It has been reported that a single dose of 90 \ufffd &#x0f06d; g morphine delays locomotor functional recovery after moderate SCI . Therefore, locomotor functional recovery from SCI may vary depending on the dose of morphine and duration of morphine administration. The present study showed that a single dose of IT morphine . However, decreases in locomotor function after continuous infusion of morphine were not reversed by naloxone.The data in Figure 2 were obtained to investigate which opioid receptors are involved in this short-term deterioration of locomotor function. The deterioration in locomotor function by DAMGO and DPDPE was probably due to an increase in muscle tone. The short-term morphine-induced locomotor dysfunction seen in Figure 1 was thought to be mediated by \ufffdThe important findings of this study were that a single dose of morphine after mild thoracic SCI rapidly aggravated locomotor function with increases in muscle tone and that continuous infusion of morphine delayed recovery. In line 341, we have added the following sentences. &#x0f06d; g morphine delays locomotor functional recovery after moderate SCI . Therefore, locomotor functional recovery from SCI may vary depending on the dose of morphine and duration of morphine administration.\u201d\u201cIt has been reported that a single dose of 90 \ufffdIn some ways, the results of this study also differ significantly from previously published reports (see papers by Faden and Aceves) that implicate kappa opioid receptor activation in reducing recovery after SCI. The authors should acknowledge and discuss these differences, with any explanation as to why the studies may be different. For example, are there differences in the mechanistic action of U50488H, GR89696, and dynorphin that could explain the disparate results?Thank you for your important suggestion. Faden et al. reported that WIN44,441-3, a kappa opioid receptor antagonist, promoted motor recovery at 4 weeks after SCI . Aceves et al. showed that nor-Binaltorphimine, a kappa opioid receptor antagonist, reversed morphine (single dose)-induced attenuation of locomotor recovery at 21 days after SCI (J Neurotrauma 2017). These results suggest that activation of kappa-opioid receptors at the acute phase of SCI is involved in deterioration of recovery at 3 to 4 weeks after SCI. In contrast to the studies described above, we administered a single dose of naloxone, a pan-opioid receptor antagonist, after continuous infusion of morphine for 72 hours . In other words, naloxone was administered later in the present study than in the previous studies in which the roles of kappa-opioid receptors were investigated. In addition, the duration of morphine administration was also longer in the present study than in the previous studies.Our results suggest that the acute exacerbation of motor function following morphine-induced thoracic spinal injury is at least partially due to hypertonia of hindlimb muscles through activation of \u03bc-opioid and \u03b4-opioid receptors but not activation of \u03ba-opioid receptors .In contrast, as shown in Figure 4, naloxone did not reverse the locomotor dysfunction after 3-day continuous infusion of morphine, but it reversed the dysfunction caused by a single dose of morphine following 3-day continuous infusion of saline. This indicated that an increased dose of morphine with extended duration of administration affects motor function via mechanisms other than direct activation of opioid receptors. In line 385, the following sentences were added to the Discussion section. &#x0f06b; -opioid receptors at the acute phase of SCI is involved in deterioration of recovery at 3 to 4 weeks after SCI . The role of opioid receptors in motor function and recovery after SCI may change from time to time and differ by subtypes of opioid receptors\u201d.  \u201cOur results indicate that morphine-induced acute aggravation of locomotor function after thoracic SCI is due to hypertonia of the hindlimb muscles via activation of \u03bc- and/or \u03b4- opioid receptors but not \u03ba-opioid receptors . We did not investigate the impact of selective opioid receptor antagonists on the motor recovery after SCI because naloxone did not reverse the locomotor dysfunction after 3-day continuous morphine infusion . It has been reported that activation of \ufffdFor example, are there differences in the mechanistic action of U50488H, GR89696, and dynorphin that could explain the disparate results?U50,488H is an agonist of kappa 1, GR 89696 is an agonist of kappa 2, and dynorphin is an agonist of kappa 1 and kappa 2. Aceves et al. showed  that GR 89696 (kappa 2 agonist) worsened recovery after SCI. These results indicate that the kappa 2 receptor is involved in the recovery of gait function after SCI. We used U50,448H, a kappa 1 agonist, to examine the acute effects of opioid receptor activation on attenuated locomotor function after SCI . In the Limitations section of the previous version of the manuscript, we already described as follows: \u201cFirst, while DPDPE and U50,488H used in this study agonize \u03b41- and \u03ba1-opioid receptors, respectively , involvement of other subtypes such as \u03b42- and \u03ba2-opioid receptors remains unknown from the present study\u201d \"In line 399, we have added the following sentences.\u201d It has been reported that GR 89696, a \u03ba2-opioid receptor agonist, attenuates motor recovery at 3 weeks after SCI. We evaluated the acute effects, but not the long-term effects, of morphine and selective opioid receptors on motor function after SCI.\u201dTo make it easier for the reader to understand the manuscript, we have changedor added the following sentences. In line 176, from \u201cinto three groups,\u201d to \u201cinto four groups,\u201dIn line 178, from \u201c3) sham-operated rats without SCI that received continuous IT morphine,\u201d to \u201c3) sham-operated rats without SCI that received continuous IT morphine, and 4) sham-operated rats without SCI that received continuous IT physiological saline.\u201dIn line 179, from \u201cIn these 3 groups,\u201d to \u201cIn these 4 groups,\u201d &#x0f06d; l/hour) for 72 hours to rats with SCI  \u201c to \u201cPhysiological saline was continuously administered  for 72 hours to rats with SCI  and sham-operated rats without SCI .\u201d In line 280, from \u201cPhysiological saline was continuously administered , IT normal saline to rats with mild thoracic SCI , or morphine  to rats with mild thoracic SCI. Images of the left ventral horns are shown in this figure. The number of \u03b1-motoneurons in the left ventral horn of the lumbar spinal cord (d) was counted. Dark-stained \u03b1-motoneurons (considered to be damaged) (arrowhead) were seen in all of the groups and the ratios of damaged /total \u03b1-motoneurons (e) were calculated.\u201d To \u201cThe ventral horns in the lumbar spinal cord were stained by the Kl\u00fcver-Barrera method after 72-hour continuous infusion of IT normal saline to rat without SCI , IT morphine  to rats without SCI, IT normal saline to rats with mild thoracic SCI , or morphine  to rats with mild thoracic SCI. Images of the left ventral horns are shown in this figure. The number of \u03b1-motoneurons in the left ventral horn of the lumbar spinal cord (e) was counted. Dark-stained \u03b1-motoneurons (considered to be damaged) (arrowhead) were seen in all of the groups and the ratios of damaged /total \u03b1-motoneurons (f) were calculated. &#x0f06d; g)\u201cIn line 329, from \u201ca single dose of morphine\u201d to \u201ca single dose of morphine : 769-775. https://doi.org/10.1097/00000542-198601000-00009 PMID: 286772230. Yaksh TL, Noueihed RY, Durant PA. Studies of the pharmacology and pathology of intrathecally administered 4-anilinopiperidine analogues and morphine in the rat and cat. Anesthesiology. 1986; 64(1): 54-66. https://doi.org/10.1097/00000542-199611000-00028 PMID: 891683731. Sakura S, Hashimoto K, Bollen AW, Ciriales R, Drasner K. Intrathecal catheterization in the rat. Improved technique for morphologic analysis of drug-induced injury. Anesthesiology. 1996; 85(5): 1184-1189. https://doi.org/10.1016/0024-3205(86)90099-8 PMID: 302209532. Heyman JS, Koslo RJ, Mosberg HI, Tallarida RJ, Porreca F. Estimation of the affinity of naloxone at supraspinal and spinal opioid receptors in vivo: studies with receptor selective agonists. Life Sci. 1986 ;39(19): 1795-1803. https://doi.org/10.1016/0196-9781(85)90006-3 PMID: 2995941 33. Faden AI, Knoblach S, Mays C, Jacobs TP. Motor dysfunction after spinal cord injury is mediated by opiate receptors. Peptides. 1985 ;6 Suppl 1: 15-17. https://doi.org/10.1089/neu.2016.4601. PMID: 2773631834. Aceves M, Bancroft EA, Aceves AR, Hook MA. Nor-Binaltorphimine Blocks the Adverse Effects of Morphine after Spinal Cord Injury. J Neurotrauma. 2017 ;34(6): 1164-1174. https://doi.org/10.1016/s0306-4522(97)00622-2. PMID: 9622243 35. Krenz NR, Weaver LC. Sprouting of primary afferent fibers after spinal cord transection in the rat. Neuroscience. 1998 ;85(2):443-458. https://doi.org/10.1016/j.expneurol.2007.06.009. PMID: 17662717 36. Donnelly DJ, Popovich PG. Inflammation and its role in neuroprotection, axonal regeneration and functional recovery after spinal cord injury. Exp Neurol. 2008 ;209(2):378-388. https://doi.org/10.1179/1743132815Y.0000000057 PMID: 2603970138. Michael FM, Mohapatra AN, Venkitasamy L, Chandrasekar K, Seldon T, Venkatachalam S. Contusive spinal cord injury up regulates mu-opioid receptor (mor) gene expression in the brain and down regulates its expression in the spinal cord: possible implications in spinal cord injury research. Neurol Res. 2015 ;37(9): 788-796. https://doi.org/10.1002/ana.410190514 PMID: 301307739. Krumins SA, Faden AI. Traumatic injury alters opiate receptor binding in rat spinal cord. Ann Neurol. 1986; 19(5): 498-501. Again, thank you for giving us the opportunity to strengthen our manuscript with your valuable comments and queries.AttachmentResponses to Reviewers.docxSubmitted filename: Click here for additional data file. 28 Jun 2022 <div> PONE-D-21-29555R2 </div>  <div> Intrathecal morphine exacerbates paresis with increasing muscle tone of hindlimbs in rats with mild thoracic spinal cord injury but without damage of lumbar a-motoneurons </div>  <div> PLOS ONEDear Dr. Tanaka,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Specifically, you must edit and clarify your contentions per the requests delineated\u00a0by of one of the reviewers.\u00a0 Please submit your revised manuscript by Aug 12 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at\u00a0 </div> A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. <div> If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.Please include the following items when submitting your revised manuscript:https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: We look forward to receiving your revised manuscript.Kind regards,Alexander Rabchevsky, Ph.D.Academic EditorPLOS ONEJournal Requirements:Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article\u2019s retracted status in the References list and also include a citation and full reference for the retraction notice.Additional Editor Comments (if provided):While most of the previous queries have been adequately addressed, one of the reviewers has noted that \"some of the amendments in the paper are difficult to follow. i.e., pp. 24, line 399-pp 25, line 412. The ideas seem a little muddled in this section. Please work to improve the clarity of this text, and the 2 separate points you are making: 1. the limitation of the current study not using continuous naloxone together with continuous morphine, and 2. the discrepancy between the current results and previous studies with kappa opioid receptor agonists. Also consider rephrasing from \"time to time.\" I assume you mean with acute activation of the opioid receptors versus more chronic engagement of the opioid receptors with continual morphine?\"In order to be accepted, your edited manuscript in the ensuing submission must address these issues brought up above, categorically.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressedReviewer #2:\u00a0All comments have been addressed********** <font color=\"black\"> 2. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 3. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 5. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0(No Response)Reviewer #2:\u00a0The authors addressed all of my concerns. However, some of the amendments in the paper are difficult to follow. i.e., pp. 24, line 399-pp 25, line 412. The ideas seem a little muddled in this section. Please work to improve the clarity of this text, and the 2 separate points you are making: 1. the limitation of the current study not using continuous naloxone together with continuous morphine, and 2. the discrepancy between the current results and previous studies with kappa opioid receptor agonists. Also consider rephrasing from \"time to time.\" I assume you mean with acute activation of the opioid receptors versus more chronic engagement of the opioid receptors with continual morphine?********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0NoReviewer #2:\u00a0No**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step. </div> While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 31 Jul 2022We would like to thank the academic editor and reviewers for carefully reading our manuscript and for the insightful comments. The comments led to an improvement of the work. Detailed responses to the reviewers are shown below. The comments from the reviewers are shown in black and our replies are shown in red. In this revised version, changes to our manuscript within the document were all highlighted by using red-colored text (with underlining) in the file named \u201cRevised Manuscript with Track Changes\u201d.Reply to Reviewer #2Reviewer #2: The authors addressed all of my concerns. However, some of the amendments in the paper are difficult to follow. i.e., pp. 24, line 399-pp 25, line 412. The ideas seem a little muddled in this section. Please work to improve the clarity of this text, and the 2 separate points you are making: We wish to thank the reviewer for making important suggestions. We have deleted the sentences in lines 397-412 of the revised manuscript with track changes of the previous version. We have added new sentences as described later. Reviewer #2:\u3000the limitation of the current study not using continuous naloxone together with continuous morphine, The half-life of naloxone is approximately 10 min . The half-life of intrathecal morphine in humans is approximately 90 min . Therefore, investigation of the effects of continuous infusion of intrathecal naloxone during continuous infusion of morphine would be required in order to clarify the roles of opioid receptors in the morphine-induced persistent decline of locomotor function. However, it was not tested in our study. In addition, we investigated short-term effects of opioid receptor subtype-selective agonists on locomotor function , but we did not investigate their long-term effects. Thus, our results did not reveal how activation of opioid receptors is involved in the persistent decline and delayed recovery of locomotor function in rats with mild SCI receiving continuous infusion of morphine for 72 hours. In line 397, we have added the following sentences in the Discussion section.These results suggest that the mechanisms of persistent decline in locomotor function caused by continuous infusion of morphine are different from those of acute and transient decline of locomotor function caused by a single dose of morphine. We investigated the short-term effects of opioid receptor subtype-selective agonists on locomotor function , but we did not investigate their long-term effects. Continuous infusion of naloxone would be required to completely block the activation of opioid receptors during continuous infusion of morphine because the half-life of naloxone is approximately 10 min [32]. However, it was not tested in this study. Therefore, our results did not reveal in detail how activation of opioid receptors is involved in the persistent decline and delayed recovery of locomotor function in rats with mild SCI receiving continuous infusion of morphine for 72 hours.Reviewer #2:\u3000the discrepancy between the current results and previous studies with kappa opioid receptor agonists.  &#x0f06d; mol  of morphine hydrochloride caused a transient deterioration of locomotor function after mild SCI via activation of \ufffd &#x0f06d; - and \u03b4-opioid receptors but did not affect functional recovery at 14 days after mild SCI . In addition, we observed that continuous infusion of morphine  caused acute deterioration and persistent decline of locomotor function after SCI . In our study, a single dose of 0.08 \ufffd &#x0f06b; -opioid receptor antagonist  promotes functional recovery from traumatic spinal cord injury in cats . Aceves et al. (J Neurotrauma 2017) reported that pretreatment with nor-Binaltorphimine (norBNI), a selective \ufffd &#x0f06b; -opioid receptor antagonist, blocked the adverse effects of 0.32 \ufffd &#x0f06d; mol of morphine sulfate on long-term recovery of locomotor function at 2 to 3 weeks after SCI. In addition, it has been shown that administration of GR89696, a selective \ufffd &#x0f06b; -opioid receptor agonist, does not cause acute deterioration of locomotor function but undermines recovery after SCI . These results indicate that the \ufffd &#x0f06b; -opioid receptor plays a critical role in the morphine-induced attenuation of locomotor recovery. It has been suggested that a \ufffd &#x0f06b; -opioid receptor antagonist may prevent the morphine-induced persistent decline of locomotor function by reducing the extent of cell death at the site of injury [Aceves 2017].It has been shown that a \ufffdIt should be noted that morphine did not cause acute deterioration of locomotor function but delayed functional recovery in the SCI model of Aceves et al. Locomotor function at 1 day after moderate SCI in their study was lower than that in our study using rats with mild SCI. Therefore, it is likely that there was no room for further acute decline of locomotor function due to morphine administration in their model.  &#x0f06d; - and \u03b4-opioid receptors is involved in the morphine-induced acute deterioration of locomotor function in animals with mild SCI, but the role of opioid receptors in morphine-induced delayed functional recovery was not examined. In contrast, previous studies have demonstrated significant roles of the \ufffd &#x0f06b; -opioid receptor in long-term recovery of locomotor function in animals with moderate SCI receiving morphine. The novelty of our study is that we showed that morphine can cause acute deterioration of residual locomotor function in animals with mild SCI via activation of opioid receptors. The results of our study taken together with the results of previous studies  suggest that different subtypes of opioid receptors are involved in morphine-induced acute deterioration of locomotor function and delayed recovery. In summary, rats with mild SCI in which locomotor function was preserved to some extent were used in our study unlike in previous studies. Our results suggest that activation of \ufffdIn order to make it easier to understand the differences between the previous studies and the present study, we have added the following sentences in the Discussion section in line 412. &#x0f06b; -opioid receptor has been reported to attenuate the morphine-induced persistent decline of locomotor function by reducing the extent of cell death at the site of injury [33]. It has also been shown that an agonist of the \ufffd &#x0f06b; -opioid receptor undermines the recovery of locomotor function after a moderate degree of SCI [34]. These results indicate that the \ufffd &#x0f06b; -opioid receptor plays a critical role in the morphine-induced attenuation of locomotor recovery. It should be noted that there was a difference in the degrees of SCI in those previous studies  and our study. Locomotor function at 1 day after SCI in the previous studies was lower than that in our study using rats with mild SCI. Morphine-induced acute deterioration of locomotor function after SCI, which was observed in our study, may occur only in the case of mild SCI in which locomotor function is preserved to some extent. The results of our study taken together with the results of those previous studies  suggest that morphine has various impacts on residual locomotor function after mild SCI, including acute deterioration and attenuation of recovery, via different subtypes of opioid receptors.Antagonism of the \ufffdReviewer #2: Also consider rephrasing from \"time to time.\"Thank you for pointing out the confusing expression. Naloxone could reverse morphine-induced acute deterioration of locomotor function at 30 min after morphine administration . In contrast, a single dose of naloxone could not reverse the morphine-induced persistent decline of locomotor function at 72 hours after the start of continuous infusion . The role of opioid receptors may vary with the time elapsed after morphine administration. Therefore, we used the expression \u201ctime to time\u201d.Nonetheless, as the reviewer pointed out, \"time to time\" is vague and unclear, so we have deleted it.Reviewer #2: I assume you mean with acute activation of the opioid receptors versus more chronic engagement of the opioid receptors with continual morphine?The half-life of naloxone is approximately 10 min . The half-life of intrathecal morphine in humans is approximately 90 min . The duration of analgesia with morphine is short. Therefore, repeated or continuous administration is necessary for long-term analgesic effects. It is unlikely that a single administration of morphine causes chronic activation of opioid receptors.In our study, a single dose of morphine was given to produce transient activation of opioid receptors, and continuous infusion of morphine for 72 hours was given to produce prolonged activation of opioid receptors.There was a typo. We corrected it as follows.In line 453, \u201cU50,488H418\" to \u201cU50,488H''We have added the following reference and adjusted the serial number of other citations.https://doi.org/10.1038/sc.2016.28 PMID: 2692729334. Aceves M, Mathai BB, Hook MA. Evaluation of the effects of specific opioid receptor agonists in a rodent model of spinal cord injury. Spinal Cord. 2016 ;54(10): 767-777. Again, thank you for giving us the opportunity to strengthen our manuscript with your valuable comments and queries.AttachmentResponses to Reviewers.docxSubmitted filename: Click here for additional data file. 3 Aug 2022Intrathecal morphine exacerbates paresis with increasing muscle tone of hindlimbs in rats with mild thoracic spinal cord injury but without damage of lumbar a-motoneuronsPONE-D-21-29555R3Dear Dr. Tanaka,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Alexander Rabchevsky, Ph.D.Academic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments: 5 Aug 2022PONE-D-21-29555R3 Intrathecal morphine exacerbates paresis with increasing muscle tone of hindlimbs in rats with mild thoracic spinal cord injury but without damage of lumbar \u03b1-motoneurons Dear Dr. Tanaka:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Alexander Rabchevsky Academic EditorPLOS ONE"}
+{"text": "Toxoplasma gondii is a member of the apicomplexan phylum, a group of single\u2010celled eukaryotic parasites that cause significant human morbidity and mortality around the world. T.\u00a0gondii harbors two organelles of endosymbiotic origin: a non\u2010photosynthetic plastid, known as the apicoplast, and a single mitochondrion derived from the ancient engulfment of an \u03b1\u2010proteobacterium. Due to excitement surrounding the novelty of the apicoplast, the T.\u00a0gondii mitochondrion was, to a certain extent, overlooked for about two decades. However, recent work has illustrated that the mitochondrion is an essential hub of apicomplexan\u2010specific biology. Development of novel techniques, such as cryo\u2010electron microscopy, complexome profiling, and next\u2010generation sequencing have led to a renaissance in mitochondrial studies. This review will cover what is currently known about key features of the T.\u00a0gondii mitochondrion, ranging from its genome to protein import machinery and biochemical pathways. Particular focus will be given to mitochondrial features that diverge significantly from the mammalian host, along with discussion of this important organelle as a drug target. Mitochondria are double membrane\u2010bound organelles that play central roles in energy production and cellular metabolism. The origin of mitochondria can be traced back to a significant evolutionary event that occurred around 1.5 billion years ago. One theory holds that the advent of mitochondria stemmed from a single endocytic event in which a proto\u2010eukaryote engulfed an \u03b1\u2010proteobacterium and retained it as an organelle  cycle along with an electron transport chain (ETC) that enables oxidative phosphorylation (OXPHOS), and biosynthetic pathways such as the iron\u2010sulfur cluster, heme, and pyrimidine synthetic pathways  that provide a framework for the protein complexes involved in cellular energy production. Whereas most yeast and mammalian cells harbor mitochondria with lamellar cristae  along with fragmented mitochondrial ribosomal RNA (rRNA) genes. To this day, all sequenced apicomplexan mitochondrial genomes have the same size, but the genome architecture along with the gene orientation vary across the phylum  of T.\u00a0gondii were unsuccessful. This was likely due to the presence of nuclear\u2010encoded sequence fragments of mitochondrial origin (NUMTs) in the T.\u00a0gondii nuclear genome. NUMTs are fragments of mtDNA that integrate into the nuclear genome following a DNA double\u2010strand break. These sequences can interfere with mtDNA isolation, amplification and in silico genome assembly approaches. The unprecedented number of NUMTs (over 9000) found in T.\u00a0gondii consequently made any attempt to characterize the mtDNA of this parasite a daunting task  from the cytosol, since the mtDNA of T.\u00a0gondii does not encode any tRNA genes . Notably, homologs of Tom20, Tom70, or Tom5 could not be identified  complex, which facilitates protein transport from the cytoplasm across the outer mitochondrial membrane (OMM)  complex to get to their final destination. Specifically, for carrier proteins on their way to the IMM, the TIM22 complex serves as a chaperone : an N\u2010terminal domain with an overall positive charge and amphipathic \u03b1\u2010helices   into dihydroxyacetone phosphate (DHAP) . MQO, found in many bacteria and single\u2010celled eukaryotes, catalyzes the conversion of malate to oxaloacetate as part of the TCA cycle. While MQO catalyzes this conversion in an irreversible reaction and reduces CoQ, the canonical mammalian malate dehydrogenase (MDH) catalyzes the same reaction reversibly and ultimately reduces NAD+  , which oxidizes NADH and reduces CoQ , which are not found in mammalian cells . In two successive cycles, two reduced CoQ molecules are oxidized at the Q0\u00a0site of complex III and their electrons are transferred to two cytochrome c molecules. During this process, one oxidized CoQ molecule is reduced to QH2 at the Qi site and four protons are pumped into the IMS   localized to the apicoplast. As this enzyme is necessary to convert pyruvate\u2013produced via cytosolic glycolysis\u2013into acetyl\u2010CoA to feed the mitochondrial TCA cycle, it became unclear how the parasites could generate acetyl\u2010CoA to power OXPHOS  shunt, which allows glutamate and glutamine to fuel the TCA cycle via GABA , shares significant structural similarities and regulatory mechanisms with PDH  that plays a key downstream role in isoprenoid synthesis  leads to defects in bradyzoite differentiation or cyst burdens  also target complex III and are effective drugs against T.\u00a0gondii and P.\u00a0falciparum , have been shown to inhibit the type II NADH dehydrogenases (NDH2) of T.\u00a0gondii focus on tachyzoites, the active, fast\u2010replicating stage of the parasite. Bradyzoites, the cyst\u2010forming stage of T.\u00a0gondii, are impervious to current drug treatments (Alday & Doggett, T.\u00a0gondii mitochondrion would leave its mammalian host unaffected. This organelle should, therefore, remain a prime target for therapeutic interventions.It is worth mentioning that most drug therapies against T.\u00a0gondii provides unique opportunities to study apicomplexan\u2010specific biology and vulnerabilities. The role of numerous apicomplexan\u2010specific mitochondrial proteins remains to be elucidated, and we can be certain that studying them will yield insights into the unique functions they perform in these parasites. Moreover, since apicomplexans diverged from most model organisms ~400\u00a0million years ago, their mitochondrion could also shed light on the evolutionary pathway that this organelle took across different eukaryotic lineages.From its highly fragmented and reduced mtDNA, to the protein complexes and enzymes essential for survival of the parasite, the mitochondrion of T.\u00a0gondii (Li et al., In apicomplexans, the mitochondrion has been coevolving with another endosymbiotic\u2010derived organelle: the apicoplast. These organelles harbor essential biosynthetic and metabolic pathways, and, as exemplified by the heme biosynthetic pathway, they depend on each other for optimal functioning. Several studies have observed the mitochondrion and the apicoplast in close proximity (Kobayashi et al., T.\u00a0gondii was not only regarded as unremarkable, it was also overshadowed by the novelty and excitement surrounding the apicoplast. Nonetheless, with the advent of new sequencing, electron microscopy, and biochemical approaches, we now know that the mitochondrion is a hub of apicomplexan and myzozoan\u2010specific biology, and a compelling organelle in its own right. Numerous aspects of the T.\u00a0gondii mitochondrion require further investigation. Among those, the mitoribosome composition and structure, and the mitochondrial metabolism of bradyzoites are some of the most pressing and exciting topics. Their study will undoubtedly generate valuable insights, and given that numerous mitochondrial proteins are absent from their mammalian hosts, the mitochondrion will certainly remain a prime drug target for novel therapeutics against T.\u00a0gondii and other apicomplexans.Historically, the mitochondrion of Table S1. Gene names and IDs mentioned in this review.Click here for additional data file."}
+{"text": "In this study, we found that CCL18 expression was positively correlated with the density of CD10+GPR77+ CAFs in breast cancer and associated with a poor response to chemotherapy. Moreover, CCL18 secreted by tumor-associated macrophages (TAMs) activated a CD10+GPR77+ CAF phenotype in normal breast-resident fibroblasts (NBFs), which could then enrich cancer stem cells (CSCs) and induce chemoresistance in breast cancer cells. Mechanistically, CCL18 activated NF-\u03baB signaling via PITPNM3 and thus enhanced the production of IL-6 and IL-8. Furthermore, intratumoral CCL18 injection significantly induced the activation of NBFs and the chemoresistance of xenografts in vivo. In addition, targeting CCL18 by anti-CCL18 antibody could inhibit the formation of CD10+GPR77+ CAFs and recover the chemosensitivity in vivo, leading to effective tumor control. Collectively, these findings reveal that inflammatory signaling crosstalk between TAMs and fibroblasts is responsible for the formation of the CD10+GPR77+ CAFs, suggesting CCL18\u2013PITPNM3 signaling is a potential therapeutic target to block the activation of this specific CAF subtype and tumor chemoresistance.The heterogeneity of cancer-associated fibroblasts (CAFs) might be ascribed to differences in origin. CD10 and GPR77 have been reported to identify a chemoresistance-inducing CAF subset in breast cancer. However, the precise mechanism for the formation of the CD10 Cancer-associated fibroblasts are abundant in the stroma of a variety of malignant tumors, have been proven to generally promote tumor progression by inducing angiogenesis , promotiCAF heterogeneity might be ascribed to the different potential cellular sources of CAFs and variant activation mechanisms, which remain unknown. CAFs are potentially derived from several cell types that are recruited to the tumor or undergo differentiation in situ, including normal resident fibroblasts and stellate cells \u201312, bone+GPR77+ CAF subset and the underlying mechanism, with the goal of finding strategies to inhibit the enrichment of this subset and suppress the protumorigenic effects in early-stage malignancies.A unique protumorigenic CAF subset expressing CD10 and GPR77 provides a survival niche for cancer stem cells (CSCs) during chemotherapy for breast and lung cancer  and was +GPR77+ CAF subset was derived from normal breast tissues and activated or differentiated by the tumor microenvironment in situ, we isolated different cell types from normal breast tissues, including NBFs, pericytes, adipocytes, epithelial cells and endothelial cells, and mesenchymal stem cells (MSCs) from bone marrow, followed by treatment with the conditioned medium (CM) of fresh breast cancer tissues. These fresh breast cancer tissues were obtained from vacuum-assisted biopsies prior to chemotherapy and cultured for CM collection. Then, the patients received neoadjuvant chemotherapy and were divided into the chemosensitive or chemoresistant group according to treatment response. Consistent with the previous reports [+GPR77+ CAFs in their biopsy samples than the chemosensitive patients (those with a complete response (CR) or partial response (PR)) ) Fig. . InteresR)) Fig. , while CR)) Fig. , which wR)) Fig. , flow cyR)) Fig.  and realR)) Fig. . MoreoveR)) Fig. . Since Cand IL-8 , we exam+GPR77+ CAFs and from chemoresistant breast cancer with abundant CD10+GPR77+ CAFs were analyzed using a RayBio Human Cytokine Antibody Array  was dramatically higher than that from responsive patients (n\u2009=\u2009156) , CCL18 is a chemokine predominantly produced by monocyte-derived cells with M2 phenotype and TAMs [+GPR77+ CAFs were identified by triple immunostaining for CD10, GPR77 and -SMA in the serial sections. We found that the infiltration of CCL18+ TAMs was positively correlated with the number of CD10+GPR77+ CAFs . Furthermore, we analyzed this correlation by chemosensitivity stratification. Although the infiltration of CCL18+TAMs was much less in the chemosensitive cohort than chemoresistant cohort  and human epidermal growth factor receptor-2 amplification (HER2+), 46 cases of HR-HER2+ and 35 cases of triple-negative breast cancer (TNBC)  Fig. , implyin56) Fig. . Unexpec56) Fig. . We thenand TAMs . We perfort Fig. , the pos+ TAMs and CD10+GPR77+ CAFs, we analyzed single-cell RNA sequencing (scRNA-seq) data for 46 cases of treatment-naive breast cancer from GEO series GSE161529 and 14 cases of treatment-naive breast cancer from the pancancer TME blueprint (https://lambrechtslab.sites.vib.be/en/pan-cancer-blueprint-tumour-microenvironment-0). After quality filtering by read count and a low number of mitochondrial reads, 195,905 total cells were retained for subsequent analysis. Using the Seurat analysis package, data from individual samples were integrated and clustered based on canonical correlation analysis (CCA), and the combined profiles were visualized by t-distributed stochastic neighbor embedding (t-SNE) dimension reduction. Epithelial cells were first annotated based on the expression of the canonical marker EPCAM  in comparison to those with low CCL18+ macrophage enrichment  of cancer cells induced by CCL18-producing TAMs . In addiAFs Fig. , suggestAFs Fig.  and IL-6AFs Fig.  in CCL18+ breast cancer cells was considerably higher in the xenografts formed by MCF-7 cells coinjected with NBFs and treated with CCL18   Fig. , we founM+) Fig. . FurtherAFs Fig. . In addi+GPR77+ CAF, was derived from NBFs and activated by the TAM-secreting CCL18. TAMs, the most abundant inflammatory cells in the tumor microenvironment [CAFs are one of the most abundant stromal cells in the tumor microenvironment and have prominent roles in cancer progression, including remodeling the ECM for tumor invasion , providiironment , are keyironment , neoangiironment , 50, andironment . In the ironment . In prosironment , 54. Recironment . All the+GPR77+ CAFs is essential for these cells to maintain their functional phenotype. We further revealed that the p65 acetylation responsible for sustaining NF-\u03baB activation in CD10+GPR77+ CAFs stemmed from the self-production of C5a and was independent of IKK or I\u03baB activity [+GRP77+ CAFs. On the contrary, the TGF-\u03b2-induced myofibroblast transition of NBFs did not involve the generation of a chemoresistance-inducing phenotype. TGF-\u03b2 signaling derived from cancer cells or stromal cells initiates the differentiation of fibroblasts into myofibroblasts by inducing SMAD2 activity and contributes to malignant progression, especially distant metastasis [NF-\u03baB signaling is one of the most important inflammatory pathways in cancer development, not only in cancer cells but also in infiltrating stromal cells. During incipient neoplasia, dermal fibroblasts can be educated and transformed into CAFs by IL-1\u03b2-triggered NF-\u03baB activation . Consistactivity . Howevertastasis , 56. Thutastasis , 46.+ T cells are recruited to breast tumors by CCL18 and converted to functional immunosuppressive Tregs [+ T cells in a humanized mouse tumor model significantly attenuated primary tumor cell survival in situ and lung metastasis by promoting antitumor immunity [+GPR77+ CAFs in vivo, and recover the chemosensitivity, leading to effective tumor control. Our findings further expand our knowledge of extensive PITPNM3 expression and its functional role in the tumor microenvironment, suggesting that CCL18-PITPNM3 could be an attractive therapeutic target in the tumor microenvironment. Blocking CCL18\u2013PITPNM3 signaling could not only impede tumor cell metastasis, reverse immunosuppression, suppress angiogenesis and inhibit tumor progression but also block the evolution of tumor-promoting CAFs in the early stage of tumor progression.It has been well established that PITPNM3 is a functional receptor of CCL18 in breast tumor cells and T lymphocytes , 40. PITve Tregs . Furtherve Tregs . In concve Tregs  and NF\u03baBve Tregs . PITPNM32 plus cyclophosphamide 600\u2009mg/m2) every 3 weeks and paclitaxel (80\u2009mg/m2) weekly for 12 weeks or four cycles of TC (docetaxel 75\u2009mg/m2 plus cyclophosphamide 600\u2009mg/m2) every three weeks. RECIST  was used to evaluate therapeutic efficacy. Patients with a complete response (CR) and a partial response (PR) were classified as chemotherapy-sensitive, while those with stable disease (SD) and progressive disease (PD) were classified as chemotherapy-resistant. The scRNA-seq data from 50 breast cancer specimens and 13 normal breast samples were obtained from GEO: GSE161529 and the Pancancer TME Blueprint (https://lambrechtslab.sites.vib.be/en/pan-cancer-blueprint-tumour-microenvironment-0).Primary invasive breast carcinoma tissues were obtained from 259 patients at Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, between 2006 and 2019. All patients received neoadjuvant chemotherapy after a definitive diagnosis using puncture specimens, and the chemotherapy regimens were as follows: four cycles of AC  at 37\u2009\u00b0C with gentle agitation for the indicated time (2.5\u2009h for fibroblasts and 1\u2009h for TAMs). The dissociated tissues were resuspended and filtered through a 70-\u03bcm cell strainer to obtain a cell suspension, which was centrifuged at 250\u2009x\u2009g for 5\u2009min to acquire the stromal fraction. Fibroblasts were further purified using anti-fibroblast microbeads . To isolate TAMs and T lymphocytes, the primary cell suspension was centrifuged at 400\u2009\u00d7\u2009g for 5\u2009min, and then, CD14-positive cells or T cells were further purified by using CD14 microbeads  or a Pan T Cell Isolation Kit . After verification [Primary normal breast fibroblasts (NBFs) were isolated from reduction mammaplasty samples, and primary cancer-associated fibroblasts (CAFs), tumor-associated macrophages (TAMs) and T lymphocytes were isolated from treatment-naive breast carcinoma samples obtained during breast cancer resection. Briefly, tissues were cut into fragments of approximately 1\u2009mmfication , the isofication , 42, 62.3 and then placed on top of sponges in a 12-well cell culture dish. Then, all the tissues were cultured with explant medium  at 37\u2009\u00b0C and 5% CO2 for 36\u2009h.To harvest tumor CM, treatment-naive breast carcinoma samples were cut into fragments of approximately 1\u2009mmAll samples were collected from patients who provided written informed consent, and the related protocols were reviewed and approved by the Ethics Committee of Sun Yat-Sen Memorial Hospital.Cells were lysed in RIPA buffer (Millipore) supplemented with protease and phosphatase inhibitors , and the proteins were collected by centrifugation at 4\u2009\u00b0C. A Pierce BCA Protein Assay kit  was used for protein quantification. Equivalent amounts of protein from each sample were resolved by 10% SDS\u2013PAGE and then transferred to PVDF membranes, which were then probed with primary antibodies against \u03b1-SMA , FAP , CD10, GPR77, caspase-3 , cleaved caspase-3 , PARP , cleaved PARP , phospho-IKK\u03b1/\u03b2 , IKK\u03b1 , IKK\u03b2 , SMAD2/3 , phospho-SMAD2 , phospho-SMAD3 , PITPNM3 , and GAPDH , followed by incubation with an HRP-linked secondary antibody (CST). The antigen\u2013antibody reactions were visualized by chemiluminescence-based immunodetection .To detect cell surface markers, cells suspended in PBS containing 1% FBS and 2\u2009mM EDTA were treated with FcR blocking reagent  and then incubated with specific fluorescence-linked antibodies against CD10 , GPR77 , CD44 , CD24 , CCR6  and CCR8  for 30\u2009min at 4\u2009\u00b0C. To evaluate cell surface PITPNM3 expression, cells were incubated at 4\u2009\u00b0C with anti-PITPNM3 primary antibody  for 60\u2009min and then incubated with a fluorescein-conjugated secondary anti-rabbit IgG antibody  at 4\u2009\u00b0C for 45\u2009min. In addition, to detect ALDH1 activity, an ALDEFLUOR kit was used according to the manufacturer\u2019s instructions . To detect apoptosis, tumor cells with indicated treatment were dissociated using 0.25% trypsin-EDTA and then harvested by centrifugation. Cell apoptosis was assessed by using the Annexin V Apoptosis Detection Kit . Briefly, cells were incubated with 5\u2009\u00b5L FITC-conjugated Annexin V antibody in 100\u2009\u03bcL binding buffer at room temperature for 15\u2009min. Then, the cells were rinsed and resuspended in 200\u2009\u03bcL buffer supplemented with 5\u2009\u03bcL propidium iodide. Specimens were subsequently analyzed on a BD Accuri C6 or Thermo Attune NxT flow cytometer.For immunostaining of paraffin sections, the sections were deparaffinized, and antigen retrieval was then performed in 0.01\u2009M citrate buffer (pH 6.0). For immunostaining of cultured cells, the cells were fixed with paraformaldehyde and then permeabilized with 0.1% Triton X-100 on ice for 15\u2009min. Nonspecific antigen epitope binding was blocked by incubation with phosphate buffer containing 5% BSA for 1\u2009h. Next, sections or cells were probed overnight at 4\u2009\u00b0C with specific primary antibodies, including goat anti-human \u03b1-SMA , rabbit anti-human \u03b1-SMA , mouse anti-human ALDH1 , rabbit anti-human CD10 , mouse anti-human GPR77 , sheep anti-human FAP , rabbit anti-human CD68 , goat anti-human CCL18 , rabbit anti-human p65 , rabbit anti-human ac-p65 , goat anti-human IL6  and mouse anti-human IL8 . Then, antigen\u2013antibody binding was visualized by using Alexa Fluor-conjugated secondary antibodies (Invitrogen) according to the manufacturer\u2019s instructions. DAPI  was used for nuclear counterstaining, and laser scanning confocal microscopy  was used for imaging. Staining cells quantification was counted in at least five fields per section and the mean of counts was used for statistical analysis.The cytokine profile of tissue culture medium was determined by using a Human Cytokine Antibody Array V kit (RayBiotech). Briefly, membrane arrays were incubated with 1\u2009mL tissue culture medium overnight at 4\u2009\u00b0C, and the next day, biotin-linked antibodies were used to create an antibody\u2013antigen\u2013antibody sandwich. Next, an HRP-conjugated secondary antibody was used to amplify the signal, which was detected by incubation with a chemiluminescent substrate and X-ray exposure. Quantitative analysis was conducted with Array Vision Evaluation 8.0 .Fresh breast cancer puncture specimens or cells exposed to the indicated treatment were cultured in DMEM supplemented with 10% FBS for 24\u2009h, and the supernatant was collected by centrifugation for subsequent ELISA analysis. IL-6 (eBioscience Cat# 88-7066-86), IL-8 (eBioscience Cat# 88-8086-86) and CCL18 (R&D Systems Cat #DCL180B) ELISA kits were used according to the manufacturers\u2019 instructions.Paraffin sections were deparaffinized, and then, antigen retrieval was performed in 0.01\u2009M citrate buffer (pH 6.0). The sections were then incubated overnight at 4\u2009\u00b0C with a primary antibody against CCL18 , and the signal was amplified with an HRP-conjugated secondary antibody and visualized using DAB (Dako). Upright metallurgical microscope  was used for imaging. Staining cells quantification was counted in at least five fields per section and the mean of counts was used for statistical analysis and the calculation and the statistical analysis was performed by two independent researchers.https://lambrechtslab.sites.vib.be/en/pan-cancer-blueprint-tumour-microenvironment-0) were combined using the Seurat analysis package. Conservative quality control cutoffs were set according to the number of genes/cell (>500) and the percentage of mitochondrial unique molecular identifier (UMI) counts (<20%). Unless otherwise stated, the cluster resolution was set to 0.5 for t-distributed stochastic neighbor embedding (t-SNE). EPCAM-negative nonepithelial cells were subjected to further regrouping, and cell clusters in the microenvironment were annotated based on canonical cell type markers for fibroblasts , macrophages (CD14 and CD68), endothelial cells (VWF), T cells , B cells (CD79A) and pericytes (NG2). The positive threshold was set as log expression level >0.5 for subsequent analysis.Multiple breast samples from GEO series GSE161529 and the Pancancer TME Blueprint . Then, quantitative reverse transcription PCR (qRT\u2013PCR) was performed using a SYBR Premix Ex Taq kit  according to the manufacturer\u2019s instructions, and data were collected and analyzed with a LightCycler 480 instrument (Roche). The primer sequences are listed in Supplementary Table 4 cancer cells were seeded in each upper chamber, and 5\u2009\u00d7\u2009104 pretreated fibroblasts were seeded in each lower chamber. The cocultured cells were passaged when they reached 90% confluence.MCF-7, BT474, BT549 and SKBR3 breast cancer cells were obtained from American Type Culture Collection (ATCC) and tested regularly for Mycoplasma infection. A six-well Transwell apparatus with a 0.4\u2009\u00b5m pore size (Corning Incorporated) was used for the coculture experiments. A total of 5\u2009\u00d7\u2009103 tumor cells/well were plated in 96-well plates and then treated with the indicated chemotherapy agent for the indicated time. Then, MTT solution was added, and the plates were incubated at 37\u2009\u00b0C for 4\u2009h. Thereafter, the media were removed, and the formazan crystals were dissolved in DMSO (150\u2009mL/well). Then, the absorbance was measured at 540\u2009nm using an Infinite F500 (Tecan).A 3-22,5-diphenyltetrazolium bromide  assay was used to determine cell viability. Briefly, 1\u2009\u00d7\u2009103 cells/mL) were cultured in DMEM-F12 (GIBCO) supplemented with 20\u2009ng/mL EGF, B27 , 4\u2009mg/mL insulin, and 0.4% BSA in 6-well ultralow adhesion plates for two weeks. Then, cell spheres with a diameter >75\u2009mm were counted.Tumor cells (1\u2009\u00d7\u200910+GPR77+ and CD10+GPR77+-depleted) were selected by fluorescence-activated cell sorting (FACS). Before cell sorting, primary CAFs were resuspended in PBS containing 1% FBS and incubated with antibodies against CD10 and GPR77 for 30\u2009min at 4\u2009\u00b0C. The purity of the sorted populations was verified by flow cytometry.Using a BD Influx flow cytometer, different subsets of CAFs  were transfected into cells using Lipofectamine 3000 . The luciferase activity of transfected cells treated as indicated was determined with the Dual-Luciferase Reporter Assay System (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity for each sample.Paraffin sections were deparaffinized, and then, cell death was detected by using the In Situ Cell Death Detection Kit POD  according to the manufacturer\u2019s instructions.Sample size and number of animals were chosen based on our prior experience  to achieFemale NOD/SCID mice were randomly selected to each group (12 mice per group). Model A: serial concentrations of MCF-7 cells alone or mixed with primary NBFs were coinjected into the mammary fat pads of 6-weeks-old NOD/SCID mice at a ratio of 1:3 as previously described [Female NOD/SCID mice were randomly selected to each group (8 mice per group). The MCF-7 xenograft mouse model was generated as described above (model A) or generated by co-inoculating MCF-7 cells with or without NBFs and TAMs into the mammary fat pads of NOD/SCID mice (model B). In model B, MCF-7 cells were treated with 10\u2009ng/ml TNF-\u03b1 for 2 weeks as described in our previous study  and PBMC3)\u2009=\u2009(length\u2009\u00d7\u2009height2)/2.The xenografts were harvested, fixed in 10% formaldehyde solution, and embedded in paraffin for further analysis. Tumor size was assessed weekly by calipers, and tumor volume was determined according to the standard formula: Volume  or the standard deviation (SD)), as mentioned in each figure legend. P\u2009<\u20090.05 was considered to indicate statistical significance. No blind analysis was performed in this study.The detailed statistical analysis results are indicated in the figure legends or methods. Unless otherwise described in the figure legends or methods, the statistical analyses were performed using GraphPad Prism 8.0. Pearson correlation was used to assess the association between the infiltration of CCL18Supplementary Figures and Tablesemail responses from co-authors"}
+{"text": "This article presents an ethics support instrument for healthcare professionalscalled CURA. It is designed with a focus on and together with nurses and nurseassistants in palliative care. First, we shortly go into the background and thedevelopment study of the instrument. Next, we describe the four steps CURAprescribes for ethical reflection: (1) Concentrate, (2) Unrush, (3) Reflect, and(4) Act. In order to demonstrate how CURA can structure a moral reflection amongcaregivers, we discuss how a case was discussed with CURA at a psychogeriatricward of an elderly care home. Furthermore, we go into some considerationsregarding the use of the instrument in clinical practice. Finally, we focus onthe need for further research on the effectiveness and implementation ofCURA. In the case of a moral conflict, values or obligations thatmatter in the situation are at odds with each other. Moral conflicts arise eitherwhen others involved in the situation  think differently about what constitutes \u201cgood care\u201d in that situation,or when someone experiences an internal conflict between the norms and values that(implicitly) guide them in their daily work.9 In palliative care, moralconflicts may, for instance, arise from different perspectives on whether tocontinue life-prolonging interventions or not, or from having to choose betweenadhering to protocols and guidelines or diverging from them in order to meet apatient\u2019s wishes at the end of life.10Although giving palliative care to patients is generally experienced as veryrewarding by many professionals,moral distress, that is, psychological distress in relation toa moral event.12 When moral distress remains unresolved, it may lead toexhaustion, feelings of disengagement, depersonalization, and numbness.15 Furthermore,moral distress is associated with decreased job satisfaction,16 lower qualityof care,18 andburn-out.19These moral conflicts may deeply impact health care professionals and may cause10 Nurses are found toexperience higher levels of moral distress than physicians.21Levels of moral distress are found to be high in palliative care, in particular inthe context of generalistic health care settings.moralcompetences: skills and qualities such as a reflective attitude, beingable to identify and articulate ethical challenges, exploring and understanding themoral perspectives of other stakeholders in the situation, and coming to principledactions based on careful deliberation.23 These moral competences areargued to be important for the quality of  careitself.18 Furthermore, developing moralcompetences is argued to foster \u201cmoral resilience,\u201d that is, being able to deal withand overcome moral distress, which is essential to the well-being of careprofessionals.14Considering the above, it is important that professional caregivers, especiallynurses, are able to deal well with the moral conflicts they experience in palliativecare practice. Their ability to do so can be strengthened by building 26 For this purpose, clinicalethics support instruments (CES instruments) have been developed, that is, tools andmethods that provide guidance in dealing with moral issues in clinical practice, forinstance by methodically structuring a joint reflection process.27To support professionals in dealing with moral conflicts and to train their moralcompetences, clinical ethics support services (CESS) are offered. CESS address moralconflicts in clinical settings, often by fostering reflection among professionals ontheir own moral dilemmas in health care practice.28 the Nijmegen Method of ethical case deliberation29 orMETAP.30 The feasibility and outcomes of (some of) these instrumentshave been studied,34 and they are found to improve caregivers\u2019 moral competences andto reduce moral distress.35Different ethics support instruments already exist, such as Moral CaseDeliberation,37However, existing CES instruments are not always optimally tailored to specifichealth care settings, and are found to have limitations. For instance, with regardto Moral Case Deliberation, caregivers report that clinical ethics support sessionsare often time-consuming, as they may take between one and 2\u00a0hours, making itdifficult to implement them in daily routines. Furthermore, many existinginstruments require the guidance of a trained facilitator or ethicist due to theircomplexity. This guidance is not always available when an urgent situationoccurs.Therefore, in the context of a large national programme to improve the quality ofpalliative care in The Netherlands, we developed CURA, a four-step CES instrument tosupport health care professionals in dealing with their moral conflicts inpalliative care practice. By tailoring it to the needs and wishes of professionalsworking in various palliative care settings in the Netherlands, we sought toovercome the aforementioned limitations. In this article, we present thisinstrument. First, we will shortly go into the way in which CURA was developed inclose collaboration with stakeholders from practice. Subsequently, we will describethe four steps of CURA, and present a case discussion in order to illustrate the wayin which CURA is used (Box 1). Subsequently, we provide some considerations on theuse of the instrument. Finally, we provide an outlook on further research. Theinstrument itself is added as an CURA is the result of a 2-year study on the basis of a participatory developmentdesign: a participatory development study involves close collaboration betweenresearchers and participants, departing from the idea that, if you want tocreate useable services or instruments, you should involve the people who aregoing to have to use them, as well as other important stakeholders.Reflectfamily members, it might be important that theirmother is both calm and clean. Furthermore, they indicated that they donot want their mother to be a burden to the health care providers. Thephysician is responsible for a safe environment,for both the client and the staff, the participants argued. Hence,(taking responsibility for) safety could be a concern for her.Furthermore, deciding on a treatment plan that all parties can agreewith might be important for the physician as well. For thecolleagues of the nurse who were involved inshowering Mrs. A., \u201cgood care\u201d is important, meaning that clients arewashed. The nurse explains that, in this care home, caregivers takegreat pride in their clients being fresh and well-dressed. Furthermore,safety is be important, and that the client is at ease and not in anydistress.First, the participants ventured into the perspectives of those involvedand thought about what might have been important to them. For Mrs. A.,they argued, it might be important that her boundaries and bodilyintegrity are respected, that her wishes are acknowledged, and that shedoes not have to undergo activities against her will. It might also beimportant for her to be comfortable, and not anxious. For theThe nurse who presented the case indicated it is important to her thatshe is able to constantly attune to the needs of the client whileproviding care. In this case, this means being able to connect andcommunicate with Mrs. A. while washing her. Sedating Mrs. A. makes herloose this connection. Subsequently, a brief inventory of relevant laws,protocols, and guidelines is made. The Dutch Care and Coercion Act forpsychogeriatric and mentally disabled clients (2019) is mentioned. Thislaw aims to limit coercion and involuntary care as much as possible,meaning that it is only allowed when no other alternatives are feasibleand when there is a risk of \u201cserious harm\u201d for either the client and/orcaregivers. The participants agreed to look into the details of this lawafterward. The participants also wondered whether there would bealternatives that could be tried, such as washing her with washclothsrather than in the shower, and how the client\u2019s family would feel aboutthis.ActAfter carefully considering what had been discussed thus far, theparticipants considered for themselves what should be prioritized intaking action. After having a dialogue on their considerations, thenurse came to conclude that for her, \u201cgood care\u201d first and foremostimplies being able to connect to the client, and being able to attend toher caring needs. In this case, she argued, these needs are primarilynot being forced into a situation that causes great anxiety and being ascomfortable as possible. Also, she cannot properly connect to Mrs. A.when she is sedated. Therefore, she decided that she will talk to thephysician, her colleagues and, if possible, to the family. She intendedto express the reasons for her hesitation to use sedatives, and todiscuss whether there are other ways to wash Mrs. A., for instance atthe basin with washcloths. This action is in accordance with what shestands for as a professional, she argued, because she strongly believesthat attentiveness to the client\u2019s needs is essential for good care.The participants ended with evaluating the process. The nurse mentionedshe feels supported and relieved. She no longer felt \u201cunfit\u201d for herprofession because of her doubts. Furthermore, she realized that hercolleagues also wanted to provide \u201cgood care,\u201d but have a differentunderstanding of what this entails. This helps her to be more engagedwith the team, she concluded.The following week, the nurse told the researcher that, after aconversation with the physician and her colleagues, her colleagues alsobecame less comfortable with giving Mrs. A. sedatives and showering her.The team agreed not to do this any longer, and to look for alternativeways to wash Mrs. A., and to discuss this with the family.38 It also promotes co-ownership and responsibility amongthe intended users, and thus it supports implementation of theintervention.39 Furthermore, the development process optimally benefitsfrom the  knowledge of stakeholders. For instance, with regard towhat would best fit the care setting(s) in which the intervention is intended tobe used.38The benefits of a participatory approach to the development of a health careintervention\u2014in this case a CES instrument\u2014is that stakeholders\u2019 wishes, needs,and demands can be taken into account from the very beginning of the developmentprocess, which promotes the feasibility and acceptability of theintervention.community ofpractice (CoP), that is, a group of people sharing a commoninterest or goal that can develop new forms of practice.40 Themembers of the CoP consisted of nurses and other caregivers (the envisionedprimary end users of CURA), educators and trainers, implementation experts,managers, palliative care consultants, patient representatives, andrepresentatives of volunteer organizations.We developed CURA together with a so-called The development process consisted of four phases. In phase one, user needs andpreferences were identified: the members of the CoP indicated whichcharacteristics the instrument should and should not have, on the basis of whichwe established a very first concept. Phase two focused on further developing andredesigning the instrument on the basis of an iterative process of co-creation.We did four rounds of testing in practical and educational settings. After eachround, we evaluated and adapted the instrument. Phase three focused ondisseminating the finalized instrument, now called \u201cCURA.\u201d Among other things,we organized a national conference in which CURA was introduced to a wideraudience, and in which frontrunners shared their experiences. The fourth phasefocused on joint evaluation of the process and making plans for implementationin both in health care and educational settings.n=221). Respondents found CURA accessible and easyto use, its steps being clear, and found that CURA was helpful in dealing withthe moral challenges they encountered in their work. However, respondentsindicated that they would need (more) organizational support  for optimal use of CURA in daily practice.41Both qualitative and quantitative methods for data collection were used.Participative observation was used during try-out sessions and the CoP worksessions were carefully documented. Two focus groups with caregivers wereorganized to discuss the feasibility and implementation of CURA in practice.Furthermore, a questionnaire on CURA\u2019s feasibility and perceived effects wasdistributed . Third, CURA isan acronym, referring to the four steps of the moral reasoning process it seeks tofoster: 1) Concentrate, (2) Unrush, (3) Reflect, and (4) Act.The name CURA was chosen for several reasons. First of all, the Latin wordmost important, and decide whatshould be leading in taking principled actions. In the following, we will elaborateon these four steps. Complementary to this hand-out, we developed a manual in whichwe provide more elaborate instructions and guidelines for users.In the first step, Concentrate, users focus on elucidating the details of thesituation that is experienced as morally troublesome and carefully articulatingtheir moral doubts regarding \u201cgood care\u201d in that specific situation. In the secondstep, Unrush, users explore their emotions and initial judgments of the situation.The third step, Reflect, focuses on examining the moral perspectives of thoseinvolved in the situation, and on relating these perspectives to what relevantguidelines, protocols, or legislation prescribe. In the fourth step, Act, usersreflect on what they consider to be Step 1: Concentrateconcentrate on thesituation and their experience of it as morally difficult or questionable.The first question is:Take a moment to reflect on the situation. Describethis situation briefly.\u2022 The aim of this first step is to What are your doubts concerning good care?\u2022 One participant, the \u201ccase presenter,\u201d describes the actual situation basedon his or her experience , refraining frommoral judgments and hypothetical considerations, and withholding conclusionson how to deal with the situation. Significant details should not be omittedin elucidating the situation, however, being too broad should be avoided.Other participants may ask questions in order to further clarify the case,but should not address normative aspects, or bring in their own experiences,judgments or solutions yet. Subsequently, the case presenter is asked toarticulate his or her moral doubts with regard to the situation:moral doubt, that is, adoubt concerning the right thing to do in order to promote \u201cgood care\u201d inthe situation at hand . This doubt may be articulated in differentways. For instance, it may be phrased as a moral dilemma,that is, an actual choice between two courses of action that could bedescribed as a choice between \u201ctwo evils.\u201d It may also be formulated in amore general way, such as \u201cWhat should we do in order to provide good care to this patient in this situation?.\u201d In any case, it isconducive for the quality of the deliberation when the case presenterdescribes his or her doubt as precisely as possible.Importantly, this doubt should be a Step 2: Unrushinitial cognitive, emotional, and physical responses tothe situation. Situations that are experienced as morally difficult oftenevoke strong first judgments and emotions, sometimes accompanied by bodilyreactions . This isunderstandable, as health care is a practice in which caregivers are bodily,socially, and emotionally immersed. Although the value and role of emotionsare recognized in some approaches to clinical ethics support,42 mostCES instruments do not explicitly and/or methodically pay attention toemotions. Nonetheless, addressing them is important in dealing well withmoral issues. First of all, becoming attentively aware of these negativeemotions is conducive to dealing well with moral distress and to buildingmoral resilience.14 Second, paying attention to emotions is importantbecause of their moral value; we can learn from our emotions about what istruly important or worthy of protection to us in a givensituation.43 Finally, becoming aware of your initial response toa moral conflict may help you to postpone or criticallyexplore a prejudice, allowing for a more open mind when venturing into themoral positions of other parties involved.44The central aim of this step is to become aware of one\u2019sIdentify your initial reaction to the situation and tothose involved (first judgments and emotions).\u2022 \u201cPark\u201d your initial reaction for a while so that youcan explore the situation with an open mind.\u2022 Therefore, participants are asked to perform the following actions:In a joint deliberation, it is important that participants have a dialogue onthe above, and take some time to listen to each other without judgment.Step 3: Reflectwhom  and what . The former pertains to the unique moral perspectives ofindividuals immersed in the situation, whereas the latter pertains to a moregeneral \u2018impersonal\u2019 moral perspective related to the issue at hand.The aim of this step is to broaden one\u2019s moral perspective on the situationand gaining new insights by means of exploring what is important in thesituation according to What is important in this situation?\u2022 For the patientFor others involved For youFirst, this step is about examining moral perspectives of stakeholders,starting with the patient. Participants are also invited to consider what isof value for themselves:Essentially, this question inquires after people\u2019s values, norms andprinciples, that is, what people deem important, what they strive for andlive by, although participants do not need to distinguish between thesecategories. Participants should focus on what is relevant to the situationat hand. This exploration can provide new perspectives on the case that leadto a deepened an enriched understanding of what is valuable in thesituation. If moral perspectives are explored of people who are not presentduring the reflection, the group should focus on reconstructing theirperspective as good as possible. They can do so by putting themselves intheir shoes, and by departing from what they know about them.What do laws, protocols or guidelines say?\u2022 The next question inquires after general moral perspectives on the situationas embodied in laws, protocols, and guidelines:Discussing what is known to the participants at that particular moment issufficient, as searching for relevant legislation, protocols and guidelinesmight be too time-consuming, and distract from the reflection. This can bedone either beforehand or afterward.What is still unknown or uncertain to you?\u2022 Finally, there might be things still unknown or uncertain to the participantsthat might be relevant to the reflection. Becoming aware of these lacunasmay prevent making incorrect or incomplete assumptions, for instance aboutwhat is important to someone who is not present. Hence, the final questionof this step is focused on the identification of uncertainties or lacunas inunderstanding the situation, which might be further explored afterward:Step 4: Actmostimportant. It is about moral judgment in relation to takingaction, that is, deciding what is the right thing to do basedon a careful consideration and prioritization of all that morally matters inthe situation. This requires a \u201cbalancing act\u201d not far removed from the wayin which Beauchamp and Childress describe making balanced judgments, whichalways involves \u201csome intuitive and subjective weightings (\u2026) just as theyare everywhere in life when we must balance competing goods.\u201d At the sametime, they insist that \u201cbalancing (\u2026) is a process of justification only ifadequate reasons are presented.\u201d . In thisstep, participants are therefore asked:What do you find most important inthis situation?\u2022 The fourth and final step of CURA focuses on what to do in the difficultsituation at hand, whereas the former step focused on exploring what isimportant from various perspectives, this step aims at weighing andbalancing what has emerged, and establishing what is how to act upon this. Hence thequestion:On this basis, what are you going to do?\u2022 Ideally, participants can also explain why they prioritize certain values orconsiderations over others. For this process, participants need to take sometime. Intrinsically connected to the prioritization of what is mostimportant is the question It needs to be noted that \u201cdoing\u201d is not always a question of rolling up yoursleeves: sometimes \u201ctaking action\u201d just means speaking up, initiating aconversation, or even accepting the situation as it is. Whatever decision ismade, it is wise here to consider what possible negative consequences yourchosen line of action may have, and how these can be prevented orlimited.This step does not explicitly inquire after how to reconcile differences inperspectives among the participants of the reflection process. However,sharing and comparing moral judgments and engaging in a dialogue isrecommended. In some cases, consensus might be necessary in order to dealwith the situation in a good way, for instance if the participants are allpart of the same treatment team, whereas in other cases, exploringdifferences in judgments on what should be action-guiding in the situationmay encourage moral learning\u2014even when differences remain.How does this relate to what you stand for as aprofessional?\u2022 The third question of this step is:45 Cynda Rushton describes this as \u201cmoral integrity,\u201dthat is, consistently aligning one\u2019s actions with one\u2019s ethical values,especially in times of adversity.46 This allows you toact in line with what you deem important even if the situation does notevolve the way you would have wanted it to.In order to answer this question, participants can consider their motives forworking in palliative care, and establish whether and how their choice for acourse of action in this particular situation relates to these motives.Dealing with this question is not strictly necessary in dealing with themoral conflict at hand. However, research shows that consciously actingaccording to what you stand for may help you in dealing with moral distressin your work.Have you gained new insights?\u2022 Have your feelings about the situationchanged?\u2022 The final questions of this last step of CURA focus on the evaluation of bothprocess and outcomes. Which insights were gained? Has your moralunderstanding of the situation changed? Have your feelings towards thesituation changed? Has your moral doubt diminished?If your doubts and/or negative emotions have decreased, this may be anindication that you have found a good way to deal with the situation, and/orwith the emotional burden or moral distress that the situation brings about.However, it may be the case that you come to conclude here that you have notyet sufficiently dealt with the moral issue at hand, and that you want toinvolve another resource or party, such as an ethicist, ethics committee,and/or organize a different kind of ethical reflection. In the box below, wegive an example of the way in which CURA is used in practice.Box 1: A case exampleThe following reflection with CURA took place among two nurse assistants andone nurse, all working in a nursing home. They all had some previousexperience with using CURA. The researcher (MvS) observed and made fieldnotes\u2014but did not take part in the reflection herself. The participants gaveboth written and verbal consent for the use of this case for academicpurposes. We adjusted some details of the case in order to warrant theprivacy of those involved.Mrs. A. is an 80-year-old woman who has been living in thenursing home for years. Some time ago, she moved to thepsychogeriatric ward because her Alzheimer\u2019s disease hadprogressed. She now needs 24/7 specialized care. On the ward,clients are showered two times a week. However, due to atraumatic experience as a child, Mrs. A. is afraid of water.Because of this trauma, she always used to wash herself at thesink. But now, the nurse explains, \u201cwe need to wash her, as sheno longer can do this herself. My colleagues want to shower her,just like we do with the other clients. But every time, this ishorrible. She strongly resists, panics, and strikes, scratchesand kicks us. Her daughter and son), her physician and mycolleagues discussed the situation and came to a shareddecision: we will shower her once a week and give her sedativesbeforehand. Consequently, she will not be anxious and we can doour work safely and calmly. However, I am in doubt: is thisreally good care for Mrs. A?\u201dThe nurse presented the following case:Subsequently, the two other participants asked questions to gain a betterunderstanding of the situation. For instance, they asked what therelationship between Mrs. A and her family members were like. Accordingto the nurse presenting the case, they have a good relationship and thefamily is very involved.In this step, the participants shared their initial response to thesituation. Some of the reactions they expressed were: \u201cI feel sad forthe client\u201d (nurse assistant 1). \u201cIt gives me a feeling of disengagementand cynicism. We might as well sedate all our clients\u201d (nurse). \u201cOn theother hand, I wouldn\u2019t want to get a black eye. Our safety isimportant.\u201d (nurse assistant 2). \u201cI feel physical unease, I want to walkaway from the situation.\u201d (nurse). Furthermore, the nurse maintained: \u201cIguess I am probably not fit to work in healthcare. My colleagues, thephysician and the family all think this is a good idea. Am I the onewho\u2019s crazy?.\u201d Sharing these first responses created a space for theparticipants, especially for the nurse who presented the case, toacknowledge and share their emotions and doubts concerning thesituation. Also, they found that their initial reactions gave them afirst indication of what is important to them, such as the staff\u2019ssafety, and the client\u2019s well-being. Finally, the participants made aconscious effort to postpone these initial responses in order enter thenext step of the reflection with an open mind.We would like to address some considerations with regard to the use of CURA. Theseconsiderations concern preconditions for proper use of CURA in palliative carepractice as a CES instrument as well as some instructions as they emerged from ourdevelopment study.48 and helpcaregivers in dealing with the aftermath of the situation.49First of all, CURA may be used either prospectively, that is, in anticipation ofmaking a decision in a morally difficult situation, or in retrospect, that is,looking back at that situation. In the former case, CURA may contribute to making awell-considered choice for a course of action. In the latter case, CURA may be usedto reflect on a situation in the (recent) past, especially when doubts are stilllingering as to whether the moral conflict experienced in that situation was dealtwith in a good way. This may offer valuable lessons for future situations,48Second, CURA is developed to be used either individually or jointly. In the firstcase, CURA might help to structure your thoughts, articulate your moral doubts, tobecome aware of the way in which a situation affected you, of what is important toyou and to others involved, and to make up your mind about how to deal with thesituation. It is, however, preferable to go through the reflection process togetherwith others, because engaging in a reflective dialogue on a moral problem fostersmoral learning. For one thing, it might broaden one\u2019s perspective on the situationas other participants might add valuable knowledge about the situation or points ofview you did not yet take into consideration.Third, CURA is developed as a low-threshold CES instrument; no formal training isnecessary to initiate, lead or participate in a reflection with CURA. To providesupport in properly using CURA, either as moderator or as participants, we developedmaterials such as a manual and e-book that offer instructions and context.Fourth, when using CURA jointly, we do advise appointing to one of the participantsthe role of moderator or \u201cfacilitator\u201d of the reflection with CURA. The moderatormay (1) ensure that the group goes through all steps of the method in the right wayand order, (2) manage the time available, (3) encourage a dialogical attitude of theparticipants, and (4) help to focus on an in-depth reflection on the case at hand,and not diverge into other situations or subjects.50Fifth, we sought to develop an instrument that could be used\u2014after users have gainedsome experience with it\u2014in approximately 30\u201345 min, as stakeholders participating inour CoP told us that this time frame makes it easier to embed CURA in care settingsin which time for reflection is often scarce, and to promote the integration ofethical reflection in existing meetings. Yet, studying the use of CURA in palliativecare practice, we found that people sometimes need more time, for instance incomplex cases, when a larger group of caregivers took part in the reflection, and/orwhen participants are new to CURA. Hence, this time frame is merely an indication,and should not dictate the length of the reflection.As we designed CURA as a relatively simple method for ethical reflection among healthcare professionals that can be easily embedded in daily work routines, we recommendto use it in a relatively small group (2\u20136 participants) in an informal setting.CURA can be used with larger groups in a more formal setting. However, this asks foradditional skills, most of all from the facilitator of the reflection, as well asmore time.good ethicalreflection. We therefore recommend CURA users to take on a dialogical and reflectiveattitude, such as postponing your judgments and ideas for actions, criticallyexploring your own thoughts, actively putting yourself in the position of others,asking questions and listening rather than trying to convince others of your ownpoint of view.47Sixth, we would like to stress that merely following a series of steps in order tostructure an ethical reflection is not a panacea for a good ethicalreflection. We therefore recommend CURA users to take on a dialogical and reflectiveattitude (Table 1). In addition, we recommend users to take recourse to other formsof ethics support  if the reflection with CURA is experienced as insufficientto deal with the moral issue at hand.Finally, we would like to stress that merely following a series of steps in order tostructure an ethical reflection is not a panacea for a In this article, we presented CURA, a CES instrument developed with and for healthcare professionals in palliative care. With CURA, we sought to develop an instrumentthat is feasible in every day practice, taking into account the preferences andneeds of end users and other stakeholders. CURA presents a relatively simple methodfor ethical reflection, and can be used without elaborate training within arelatively short time-frame (ca. 30\u201345 min). Materials with instructions, examples,and best practices are available online.13CURA differs from other CES instruments (as mentioned in the Introduction) because(a) of its simple structure (four steps), (b) it can be used within a short timeframe (30\u201345 min Is indicated), (c) it pays explicit attention to embodiedexperience . From our research upuntil now, we observe that these specific characteristics of CURA have the followingbenefits: (1) the simple structure makes CURA easily accessible and useable for avariety of caregivers, also because they do not need to engage an extensivelytrained facilitator or ethicist, (2) it is easier to integrate CURA in daily workroutines\u2014in which time is often scarce, (3) paying attention to emotional responsesto a situation that is experienced as morally troublesome is considered to beimportant by caregivers in dealing well with the burden  that mayresult from moral conflict.41 However, more research isneeded to assess the effectiveness of CURA and its feasibility in different healthcare and educational contexts. For instance, does CURA result in moral resilienceand/or reduce moral distress in the long term? Does it foster the moral competencesof health care professionals who use it on a structural basis? A 3-year mixed-methodstudy in 10 Dutch health care organizations, which we started in 2020, aims toprovide us with more insight on CURA\u2019s effects. In order to measure the effect onprofessionals\u2019 moral competences, we use the European Moral Case Deliberation(Euro-MCD) Scale.35 In order to measure CURA\u2019s effect on moral resilience, we usethe Rushton Moral Resilience Scale (RMRS), of which we made a translation into Dutchas well as a context validation for the Dutch health care setting.52 In order togain a deeper understanding of the effects of CURA, we combine these scales withqualitative research (interviews and focus groups).These observations are reflected in the results of our feasibility study. This studyhas shown that nurses perceive CURA to be easy to use and helpful in building moralcompetences such as perspective taking and articulating their moral challenges. Itis also experienced to reduce moral distress.Furthermore, research is needed to gain insight in how CURA can best be implementedin various health care settings. What are organizational preconditions? What arestrategies to overcome obstacles in using CURA on a structural basis? Parallel toour effectivity study, we therefore started an implementation study in the same 10organizations. In the context of this implementation study, we therefore developed ablended learning training program in order to train so-called \u201cCURA-ambassadors.\u201dThese ambassadors are to introduce, initiate, and facilitate ethics support sessionswith CURA, and thus contribute to its implementation within their organization.As CURA was developed in the context of a national programme that seeks to improvethe quality of palliative care, our focus was on developing ethics supportspecifically for palliative care professionals, especially nurses. During our study,we observed that CURA is used for a wide variety of palliative care cases, rangingfrom moral dilemmas in dealing with wishes of the patient or family, treatmentdecisions, collaboration with other professionals, to dilemmas related tophysician-assisted dying. In addition, CURA was frequently used to reflect onCOVID-19 cases, especially with regard to end-of-life situations and difficulttreatment decisions. We notice that users tend to focus on individual patient caseswhen using CURA, rather than, for instance, on more encompassing (policy)issues.all care settings, and we have been collaborating with them inadapting our materials for this purpose. However, more research is needed to assessthe feasibility and effectivity of CURA for purposes beyond providing ethics supportto professionals in palliative care. In addition, it is key to explore how CURA canbe best implemented in education: as many participants in our research indicated, itis important that health care professionals are trained in ethical reflection duringtheir training in order to prepare them for dealing with moral conflicts in theirwork.53However, CURA was also positively received by other healthcare professionals, suchphysicians and volunteers, and is now used in other domains of health care as well.Recently, the Dutch syndicate for nurses and nurse assistants has adopted CURA as amethod for ethical reflection they recommend to their members inethicalreflection on a case rather than technical or medical reflection. It asks toarticulate one\u2019s doubts about \u201cgood care,\u201d and to reflect on what isimportant to those involved. The latter request is a relativelysimple and concrete way of asking after the values, norms, and principles thatunderlie perceptions of \u201cgood care\u201d in the situation at hand. The instructions onthe CURA handout  care? Answering these questionsis dependent on normative assumptions about what constitutes \u201cgood ethicalreflection,\u201d \u201cgood care,\u201d etc. These assumptions would have to be made explicitfirst, before this is empirically studied.To conclude, CURA is a promising four-step CES instrument, which we developedtogether with and for healthcare professionals working in palliative care. Theinstrument is relatively simple and can be used in a relatively short time frame. Itis developed to foster ethical reflection on everyday care by health professionalsthemselves, preferably in informal, smaller groups. Further research is needed, forinstance to assess the effectiveness of CURA in fostering moral competence and moralresilience."}
+{"text": "Physical performance was significantly reduced; however, there is only little evidence of a realistic simulation of typical ageing processes. Although positive effects of ASS are supported to some extent, more diverse study populations and high-quality controlled designs are needed. Further, validation studies examining whether the simulation indeed reflects \u201creal\u201d ageing are needed and should build on reference data generated by standardized geriatric assessments or adequate comparison groups of older adults.Age simulation suits (ASS) are widely used to simulate sensory and physical restrictions that typically occur as people age. This review has two objectives: first, we synthesize the current research on ASS in terms of the observed psychological and physical effects associated with ASS. Second, we analyze indicators able to estimate the validity of ASS in simulating \u201ctrue\u201d ageing processes. Following the PRISMA guidelines, eight electronic databases were searched . Qualitative and quantitative studies addressing effects of ASS interventions regarding psychological outcomes  or physical parameters  were included. The Mixed Methods Appraisal Tool was applied for quality assessment. Of 1890 identified citations, we included 94 for full-text screening and finally 26 studies were examined. Publication years ranged from 2001 to 2021. Study populations were predominantly based on students in health-related disciplines. Results suggest that ASS can initiate positive effects on attitudes toward (Prospero registration: 232686.The online version contains supplementary material available at 10.1007/s10433-022-00722-1. The application of age simulation suits (ASS) has been undergoing continuous development since the 1990s, when the automotive industry started to use the first prototypes. ASS were originally constructed to raise engineers\u2019 awareness of age-related and differently caused physical impairments when designing new cars. Concurrently in the gerontological arena, educational programs involving ASS emerged with the ambition to reduce negative attitudes toward older adults in caregiving settings  or fourth age (80+). So far, predominantly young participants were included in ASS studies and there is some evidence that the simulated impairments did not correspond to old age but rather middle-adulthood. A realistic simulation  would also be of importance if ASS are used in the development phases of geriatric assistive devices, when the risk of falling is still high and older adults cannot be consulted for first pilot studies because of practical or ethical reasons. Although there is a relatively large body of case-like reports often containing positive experiences with the application of ASS, a comprehensive systematic overview of the currently existing research on the psychological and physical outcomes of wearing an ASS is missing. A scoping review on age simulation interventions was published in 2017, but included only two studies, which were conducted among nursing students  for similar systematic reviews on this topic or ongoing projects. No registered review could be found. The systematic review was prospectively registered in PROSPERO  and was conducted in accordance with the PRISMA statements  without time limits for publication years. Search terms and combinations were customized for each database as shown in the supplemental material, Table Studies were included if they (a) applied ASS to mimic physical and sensory limitations; (b) reported qualitative, quantitative, or mixed-methods outcomes regarding attitudes, understanding or empathy toward older adults and/or assessments of physical functioning ; and (c) if they were published in English or German language.We also included gray literature and excluded reviews, meta-analyses, comments, protocols, case reports and conference papers/presentations. Studies simulating specific medical conditions  were excluded, as we focused on typical and frequent ageing-related physical and sensory limitations. Educational board games or role-plays, which concentrated on single sensory or physical restrictions and did not explicitly report an intervention for all participants, were excluded. Studies which did not report any results or did not initially aim to study effects with a clear research question  were excluded as well.We screened all articles by title and abstract to identify potentially relevant manuscripts based on the inclusion criteria. At this level, only very obviously ineligible titles were removed. For the full-text screening, two authors  independently assessed 50% of the potentially eligible articles while one author (TG) independently assessed all. Disagreements were resolved through discussion and involvement of the respective uninvolved author (AS or LS). Subsequently, the first author extracted information on the study , study characteristics , participants\u2019 characteristics , and indices regarding self-reported psychological outcomes  and/or physical performance outcomes . If relevant data were not available, we contacted the authors of the study to request missing information.d) from the indices reported or received on request  for systematic mixed methods reviews was used , conference contributions (n\u2009=\u200911), not reporting respective results (n\u2009=\u20097), non-academic reports  (n\u2009=\u20097), language not English or German (n\u2009=\u20095), review articles (n\u2009=\u20093), unavailable after contacting the authors (n\u2009=\u20093). After the quality assessment, further studies were excluded due to insufficient data to answer the two screening questions . Finally, 26 articles were included in the synthesis. Of those, 15 studies had not been included in previous review articles.Figure\u00a0n\u2009=\u20091), quantitative randomized (n\u2009=\u20092), quantitative non-randomized designs (n\u2009=\u200916), quantitative descriptive designs (n\u2009=\u20092) and mixed methods studies (n\u2009=\u20095). One of the randomized trials also included qualitative results and was therefore assigned to the mixed methods category.The MMAT  or not implemented (n\u2009=\u20091). Among the sixteen quantitative non-randomized studies, eight studies did not describe nor analyze confounders, while two studies included participants that were not suitable or representative for their target population. For the two quantitative descriptive studies, it remained unclear if authors controlled for nonresponse bias in both studies and in one study, participants were not suitable or representative. Among the five mixed methods studies, there was one study missing an explanation for integrating qualitative and quantitative methods and one study missing a link between chosen methods and their interpretation. Furthermore, two studies lacked an explanation for divergences between quantitative and qualitative results (n\u2009=\u20092).Results of the MMAT indicated that eight articles met all five quality criteria of the respective design, twelve articles did not meet one criterion and six did not meet two criteria. More specifically, the qualitative study met all relevant criteria, the two quantitative randomized studies received good ratings, with the exception that assessors\u2019 blinding was unclear (n\u2009=\u200911), followed by Asia (n\u2009=\u20097), the United States (n\u2009=\u20093), Turkey (n\u2009=\u20092) and one from Australia, Egypt and Iran, respectively. Publication dates ranged from 2001 to 2021, with twelve of the 26 articles published in 2020 and 2021. Sample sizes varied depending on research method and design used. The nineteen studies collecting quantitative data with questionnaires reported the largest numbers of participants (range: N\u2009=\u200949-330), followed by studies on physical performance measurements (range: N\u2009=\u200920-178), and qualitative methods (range: N\u2009=\u200915-64). The majority of studies (n\u2009=\u200921) predominantly included participants between 20 and 30\u00a0years, due to the fact that most studies were conducted with pharmacy, medicine or nursing students, and younger health care staff. The duration of the procedures including the application of the ASS, habituation phase (if implemented) and the execution of a diverse range of tasks under ASS conditions ranged from 10\u00a0min  aimed to find starting points to enhance the quality of care, and therefore addressed empathy, attitudes, and/or understanding as these are assumed to be critical skills for health professions. These outcomes were measured by questionnaires, qualitative interviews, or evaluations of group discussions. Another six studies tried to fathom if ASS can simulate diverse age-related impairments and used quantitative performance measurements, e.g., heart rate to determine the physical load, geriatric assessments, gait analysis, and cognitive tasks in one study.Key characteristics of the included studies are presented in Table Detailed information on study results and calculated effect sizes can be found in Tables n\u2009=\u200912), followed by assessments of empathy and understanding (n\u2009=\u20099), willingness to care for (n\u2009=\u20092) or behavior toward older adults (n\u2009=\u20091). As different scales vary in their coding procedures , the term increased is used in the following to indicate more positive and the term decreased is used to indicate more negative attitudes or empathy. Hence, positive effect sizes (Cohen\u2019s d) represent an improvement within the respective construct.The predominant purpose of these studies was to investigate the usefulness of ASS to improve empathy and/or attitudes toward older adults and/or raise the awareness regarding challenges of the ageing process among samples of younger adults. The most frequent outcome measures were attitudes  with the reported scores of the two randomized controlled trials indicated small (d\u2009=\u20090.36) and medium-sized positive effects (d\u2009=\u20090.71). Our calculations on quantitative non-randomized studies (n\u2009=\u20098) revealed small positive effects , one large positive effect , two small negative effect sizes , and no effect , respectively. For the quantitative parts of the two mixed method studies, our calculations indicated one large positive (d\u2009=\u20090.95) and one medium negative (d\u2009=\u2009\u2212\u20090.63) effect. Of note, two studies that initially found negative effects on attitude measures after the ASS intervention reported positive changes in a later follow-up  for the randomized trial within the mixed methods design, small and medium effects  for the non-randomized quantitative designs, and one small and one large effect for the quantitative parts of the two mixed method studies . Two studies reported no adequate data to compute effect sizes. The weighted mean effect size from pre-to-post changes in empathy was d\u2009=\u20090.54, corresponding to a medium-sized effect. We additionally calculated effect sizes between groups for empathy , flexibility tests, range of motion , and parameters indicating altered gait  on a four-meter walkway. Watkins et al. (d\u2009=\u2009 -0.77), Timed Up and Go , and Berg Balance Scale . Vieweg and Schaefer . They also included a cognitive task conducted before and while wearing an ASS. Results of the Digit Symbol Test, an indicator of information processing speed, demonstrated an increased time to perform the task with the ASS, indicating a pronounced decline in this cognitive domain (d\u2009=\u2009 -1.77).Six studies assessed the effects of ASS on physical performance , subjective physical load (d\u2009=\u2009 -2.03), and completion time (d\u2009=\u2009 -1.02) increased, which characterized a decreased performance. Zijlstra et al. (d\u2009\u2009- 0.60) and respiratory rate (d\u2009=\u2009 -0.35), and were walking significantly slower (d\u2009=\u2009 -0.72); no significant changes were found in route efficiency (d\u2009=\u2009 -0.15).The two remaining studies used additional physiological and subjective indicators to quantify physical load. Scherf  monitorea et al.  assessedFive of the six studies on physical performance measures provided data that could be used for our second aim, namely to clarify if ASS are valid in terms of a realistic simulation of normative age-related performance decreases , flexibility (n\u2009=\u20093), functional mobility (n\u2009=\u20092), balance (n\u2009=\u20092), physiological changes (n\u2009=\u20092), strength (n\u2009=\u20091) and aerobic endurance (n\u2009=\u20091). Strongest decreases in terms of effect sizes due to wearing an ASS were found for flexibility and functional assessments, whereas smaller decreases appeared in balance tests. In most studies, established assessments such as the TUG, FFT, and gait performance were used (n\u2009=\u20095). Limitations with respect to accuracy  could be overcome with more advanced technical systems. Moreover, covariates such as participants\u2019 fitness level or physical activity habits should have been taken into account.Six included studies focused on a variety of performance-based measures addressing the areas of gait parameters  activities of daily living could be considered.For our second objective, to summarize and quantify indicators that can be used for estimations of validity, we were able to draw upon findings from five studies, with three studies assessing gait velocity. The consideration of gait variabilities offers a well-established quantification in locomotion, bearing the advantage that reference values are available for many parameters. Results indicated a decreased performance for young and middle-aged participants and resulted in an \u201cinstant ageing\u201d effect of about 20-40\u00a0years, when comparing established gait assessments to reference values. The extremely reduced gait velocity in one study . Some of the suppliers of ASS specify certain age ranges  that should be reached with their ASS or claim that users age 30 to 40\u00a0years , but those assumptions have not been verified with data yet. Our review provides first insights but points out the need for differentiation regarding the population under study with the ASS and the specific tests that are applied. The mentioned studies reinforced the attempt to use of ASS to mimic typical age-related impairments, but should be recognized as a start or proof of concept.This review\u2019s focus on rather homogeneous ASS interventions, thus excluding ageing and geriatric games, which are conducted with people only observing, giving not all participants the chance to experience the simulation, and the consideration of a broad range of outcomes can be seen as strengths and a new approach to the matter. While earlier reviews focused on psychological outcomes only  research designs, include follow-up measurements, and reduce the likelihood of social desirability, e.g., by using less obvious questions and drawing on anonymous questionnaires instead of \u201copen\u201d data collection methods in seminars. The diversity of study populations should be considered to a larger extent, in particular in terms of age range. For example, it would be important to know, considering the general population, whether the effects of wearing an ASS are different for those in early adulthood versus those in midlife versus those in young-old age. Further, as at least some adverse effects of wearing an ASS were observed, it seems appropriate to recommend that the ASS should only be used in combination with gerontological expert supervision able to provide a comprehensive and differentiated picture of the ageing process. Finally, more evidence supporting the validity of the age simulations by an ASS might help rehab scientists and engineers\u00a0who want to use ASS in the creation and improvement of technical devices for older adults.\u00a0That is, the ASS may in the long run serve ageing societies on multiple levels, if additional research proves its usefulness.Supplementary file1 (DOCX 15 KB)Below is the link to the electronic supplementary material."}
+{"text": "Cerebral blood flow is tightly regulated by cerebrovascular autoregulation (CVA), and intraoperative impairment of CVA has been linked with perioperative neurocognitive disorders. We aim to assess whether impairment of CVA during major oncologic surgery is associated with delayed neurocognitive recovery (DNCR) postoperatively. We performed a secondary analysis of prospectively collected data. Patients were included if they had undergone complete pre- and postoperative neuropsychological assessments, continuous intraoperative measurement of CVA, and major oncologic surgery for visceral, urological, or gynecological cancer. Intraoperative CVA was measured using the time-correlation method based on near-infrared-spectroscopy, and DNCR was assessed with a neuropsychological test battery. A decline in cognitive function before hospital discharge compared with a preoperative baseline assessment was defined as DNCR. One hundred ninety-five patients were included in the analysis. The median age of the study population was 65\u00a0years (IQR: 60\u201368); 11 patients (5.6%) were female. Forty-one patients (21.0%) fulfilled the criteria for DNCR in the early postoperative period. We found a significant association between impaired intraoperative CVA and DNCR before hospital discharge . The type of surgery  and premedication with midazolam  were significantly associated with the occurrence of DNCR in the early postoperative period. Intraoperative impairment of CVA is associated with postoperative neurocognitive function early after oncologic surgery. Therefore, intraoperative monitoring of CVA may be a target for neuroprotective interventions. The initial studies were retrospectively registered with primary clinical trial registries recognized by the World Health Organization .The online version contains supplementary material available at 10.1007/s10877-021-00706-z. Perioperative neurocognitive disorders are common complications after surgery . DelayedCerebral blood flow (CBF) is tightly regulated to ensure a continuous supply of oxygen and nutrients and to prevent cerebral hypo- and hyperperfusion . CerebroCerebrovascular autoregulation is influenced by patient-related factors such as higher age and procedure-related conditions including anesthetic medication and blood loss leading to blood pressure fluctuations , 10. PreEthical approval (protocol numbers PV4782 and PV4771) was obtained from the ethics committee at the Hamburg State Chamber of Physicians. The study protocols are in accordance with the ethical standards of the 1964 Declaration of Helsinki and its later amendments. All patients gave written informed consent prior to study participation. The studies were registered in primary clinical trial registries recognized by the World Health Organization (identifiers DRKS00010014 and NCT04101006).We performed a secondary analysis of pooled published and unpublished data from three prospective observational studies. The studies were primarily designed to (1) compare CVA between robot-assisted radical prostatectomy in the extreme Trendelenburg position and open retropubic surgery in the supine position ; (2) desCognitive function was assessed with a battery of four neuropsychological tests that has been reported in detail previously . In brie2). Cerebral oxygenation was measured non-invasively with near-infrared spectroscopy . Using the MAP and rSO2 values, the COx was calculated as a moving linear correlation based on a sliding 300-s window updated every 10\u00a0s . A positive correlation between rSO2 and MAP exceeding a COx of 0.3 indicates an impairment of CVA [Cerebrovascular autoregulation was measured continuously during surgery (from incision to closure) using the time-correlation method , 15. Cert of CVA .All patients received general anesthesia, which was induced with propofol (2\u20133\u00a0mg/kg) and sufentanil (0.3\u20130.5\u00a0\u00b5g/kg). General anesthesia was maintained with propofol (4\u20137\u00a0mg/kg/h) or sevoflurane with an age-adjusted MAC of 0.8\u20131.2, targeting a bispectral index of 30\u201340 . SufentaBaseline characteristics are displayed as median with interquartile range (IQR) or absolute numbers and percentages, depending on the level of measurement of the data. Variables were compared between patients with and without DNCR using Mann-Whiney-U tests, Chi square tests, Fisher\u2019s exact tests or Freeman-Halton tests, as appropriate. We used binary logistic regression to analyze the association between intraoperative CVA and DNCR in the early postoperative period. The independent variable of primary interest  and clinically relevant variables  were included in the multivariable model with DNCR as the dependent variable. The type of surgery was categorized for this approach . Stepwise backward elimination was used to obtain the final model. We performed a post-hoc power analysis for the variable of primary interest  using the R function \u201cpowerLogisticCon\u201d developed by W. Qui in 2020, based on data of Hsieh et al. . We usedContinuous measurement of intraoperative CVA was performed in 272 patients. Of these, 195 patients had completed the pre- and postoperative psychometric assessments and were included in the analysis , and the majority of patients were male n\u2009=\u2009184; 94.4%); 168 patients (86.2%) underwent radical prostatectomy for prostate cancer, and 27 patients (13.8%) had major surgery for visceral malignancy. Variables related to surgery and anesthesia are listed in Table 84; 94.4%p\u2009=\u20090.861). Patients, who had surgery other than radical prostatectomy, suffered more frequently from DNCR compared with patients, who underwent radical prostatectomy (24.4% vs. 11.0%).Delayed neurocognitive recovery was diagnosed in 41 (21.0%) patients. Postoperative assessments were performed at a median of four days after surgery . Additionally, the type of surgery  and sedative premedication with midazolam  were associated with DNCR  In a cohort of patients who underwent major oncologic surgery, the incidence of DNCR was 21%. (2) The intraoperative duration of impaired CVA was higher in patients with DNCR compared with patients without DNCR. (3) The proportion of surgical time with impaired CVA, sedative premedication with midazolam, and the type of surgery were significantly associated with DNCR in a multivariable analysis.Our results strengthen the possible role of impaired CVA in the development of perioperative neurocognitive disorders. To respond to the high metabolic demand, CBF is tightly regulated to ensure a continuous supply of oxygen and nutrients . Under pIntraoperative impairment of CVA is associated with adverse neurologic outcomes, such as brain cellular injury  and stroThe relation between impaired CVA and postoperative cognitive decline has been discussed controversially. Several observational studies have found no link between intraoperative cerebrovascular autoregulatory function and DNCR after cardiac, orthopedic, or major non-cardiac surgery \u201313. By cWhen interpreting these conflicting results, it is important to consider the methodological discrepancies in CVA measurement, the definition of impaired CVA, and the patient populations studied. The aforementioned trials used different surrogates for CBF, including xenon-133 clearance, transcranial Doppler sonography, and non-invasive monitoring of intracranial blood volume \u201314. LaflThe heterogeneity of patient populations, including cardiac and non-cardiac surgeries, is another factor that limits generalizability. Cerebral blood flow during cardiopulmonary bypass may be particularly vulnerable due to non-pulsatility and compromised microvascular perfusion . MoreoveWe found an association between the type of surgery and DNCR before hospital discharge, with patients undergoing radical prostatectomy less likely to experience DNCR than those undergoing other major oncologic surgeries. Prostate cancer is the most widespread malignancy among men in industrial countries , and surWe found that premedication with midazolam was associated with DNCR before hospital discharge. Benzodiazepines may be used to reduce preoperative anxiety . HoweverThere are several limitations to this observational trial. First, our results are of an exploratory nature, as we performed a secondary analysis of pooled data. Second, our study population comprised substantially more men than women, the majority of whom underwent radical prostatectomy, all of them without pre-existing cognitive impairment. Therefore, the generalizability of our findings is limited and should be reassessed prospectively in a more diverse study population. Third, we did not incorporate the mean sevoflurane MAC and propofol dose in the statistical model. This presents a source of potential confounding, considering the dose-dependent effects of volatile anesthetics on CVA , 43. FouAn important strength of this study is the extensive psychometric assessment that was performed pre- and postoperatively in all patients. We found a 21% prevalence of DNCR before hospital discharge. There is a substantial variability in the prevalence of perioperative neurocognitive disorders. This may be attributable to the heterogeneity in psychometric instruments used, the variance in definitions of postoperative cognitive decline, and the differences in patient populations investigated , 45. OurWe found that intraoperative impairment of CVA is associated with DNCR after major oncologic surgery. Therefore, the maintenance of intraoperative blood pressure within the autoregulatory range may be a target for future interventions aimed at reducing perioperative neurocognitive disorders. We also found an association between premedication with midazolam and DNCR, which underlines the need to restrict the use of benzodiazepines in perioperative care.Supplementary file1 (DOCX 16 kb)Below is the link to the electronic supplementary material."}
+{"text": "Non-digestible carbohydrates are an unavoidable component in a pig\u2019s diet, as all plant-based feeds contain different kinds of non-digestible carbohydrates. The major types of non-digestible carbohydrates include non-starch polysaccharides , resistant starch, and non-digestible oligosaccharides (such as fructo-oligosaccharide and xylo-oligosaccharide). Non-digestible carbohydrates play a significant role in balancing the gut microbial ecology and overall health of the swine by promoting the production of short chain fatty acids. Although non-digestible carbohydrates are rich in energy, swine cannot extract this energy on their own due to the absence of enzymes required for their degradation. Instead, they rely on gut microbes to utilize these carbohydrates for energy production. Despite the importance of non-digestible carbohydrate degradation, limited studies have been conducted on the swine gut microbes involved in this process. While next-generation high-throughput sequencing has aided in understanding the microbial compositions of the swine gut, specific information regarding the bacteria involved in non-digestible carbohydrate degradation remains limited. Therefore, it is crucial to investigate and comprehend the bacteria responsible for the breakdown of non-digestible carbohydrates in the gut. In this mini review, we have discussed the major bacteria involved in the fermentation of different types of non-digestible carbohydrates in the large intestine of swine, shedding light on their potential roles and contributions to swine nutrition and health. In the diets of pigs, carbohydrates contribute to the majority of feed energy, accounting for approximately 60\u201370% of overall energy intake. In addition, the digestion of carbohydrates has significant impacts on various aspects of colonic functions, including the metabolism, balance of commensal flora and the health of large intestine epithelial cells .DCs encompass a group of chemical substances and can be classified based on molecular sizes, ranging from simple mono- and disaccharides to complex compounds with intricate structures . MoreoveStarch is the principal source of energy for monogastric animals and cereals are the primary source of starch in animal feeds . Starch NSPs , RS and non-digestible oligosaccharides (NDOs) (Fructo-oligosaccharide and Xylo-oligosaccharide) are the major types of non-digestible carbohydrates (NDCs). The large intestine serves as an anaerobic digestive environment for complex molecules, such as NDCs. It is predominantly colonized by obligate anaerobic microorganisms, although a small number of aerobic and facultative microorganisms are also present , 8. ThesWith the aid of next-generation high-throughput sequencing, researchers have been able to comprehend the gut microbial composition of swine. However, knowledge concerning the gastrointestinal tract microbiome that facilitates the fermentation of NDCs remains limited, despite several research endeavors aimed at understanding such bacterial species. Therefore, this mini review aims to consolidate information regarding the major bacterial species involved in the fermentation of different types of NDCs in the large intestine of swine.2.DGCs are such carbs that can be digested by host\u2019s enzymatic system , whereasThe carbohydrates in the swine feed like cereal grains, legumes, oil seeds, and potato are also composed of DGCs and NDCs . The legAs summarized in NDCs are either water soluble or insoluble based on its solubility in water. Insoluble NDCs includes cellulose, hemicellulose, lignin, whereas soluble NDCs includes pectin, \u03b2-glucan, fructan, mucilage, gum, and psyllium fiber , 18. TheDigestion of simple carbs and starch occurs predominantly by enzymatic digestion, whereas the complex carbs that are resistant to host\u2019s digestive enzymes are degraded by microbial fermentation after reaching large intestine .Even though a host\u2019s genome does not encode the enzymes required to break down the linkage between the monomers in NSPs and NDOs, 20 to 25% of NSPs and 40 to 95% of NDOs is found to be degraded while passing through the small intestine . This brPrevotella, Clostridium, Ruminococcus, Lactobacillus, Faecalibacterium, Bacteroides, Fusobacterium, and Alloprevotella in a larger portion of studied healthy pigs , structural non-polysaccharide (lignin) and non-structural polysaccharides. , 27. NumBacteroides, Roseburia, Ruminococcus or Bifidobacterium species , one of the predominant and important cellulolytic bacteria, degrades cellulose and a variety of plant cell walls , is also a well-known specialist cellulose-degrading bacterium found in rumen and gastro-intestinal tract of herbivores, but it has also been isolated from swine gut (Ruminococcus champanellensis (R. champanellensis), a recently identified cellulolytic strain from human feces, ferments cellulose and xylase, while metabolizing cellobiose to acetate, succinate, ethanol, dihydrogen and small quantities of formate and lactate , which are normal inhabitants of the pig\u2019s intestine, also possess multi-enzyme system including cellulosome and xylanosome, which aid in the breakdown of complex cellulosic polymers and several cellulosic by-products  genes. These enzymes enable Bacteroides to degrade various components of plant cell wall, like glucronylxylans, xyloglucans and pectin (Bacteroidetes is the presence of polysaccharide utilization locus (PUL), which consists of linked genes involved in the saccharification of complex carbohydrates, such as glycans (Bacteroides ruminicola (B. ruminicola) and Bacteroides xylanisolvens (B. xylanisolvens) are significantly involved in the degradation of xylan (Bacteroides succinogens (B. succinogens), isolated from the swine\u2019s large intestine, also possesses the ability to degrade cellulose (Bacteroides fragilis (B. fragilis), Bacteroides heparinolyticus (B. heparinolyticus), Bacteroides stercoris (B. stercoris), Bacteroides thetaiotaomicron (B. thetaiotaomicron), Bacteroides uniformis (B. uniformis), and Bacteroides xylanisolvens (B. xylanisolvens). These bacteria have been found to possess the carbohydrate-active enzyme (CAZyme) genes involved in the degradation of starch, pectin, fucose oligosaccharides, rhamnose oligosaccharides, and other complex carbohydrates. Additionally, using metagenome-assembled genomes (MAGs), it has been predicted that B. thetaiotaomicron and Bacteroides ovatus (B. ovatus) possess PULs.d pectin . Moreove glycans , 54. Bacof xylan , 37. Anoellulose . MetagenFibrobacter, including Fibrobacter intestinalis  and Fibrobacter succinogenes (F. succinogenes), possess the ability to ferment NSPs. These species, found in the caeca of pigs, have gained significant attention due to their relatively higher fibrolytic activity  and play a major role in the degradation of pectin, a component of plant cell walls. However, it is important to note that while these bacterial genera contribute to the breakdown of various dietary carbohydrates, cellulose degradation is mainly carried out by other cellulolytic bacteria such as Ruminococcus, Fibrobacter, and certain species of Clostridium  is classified into five different types. RS1 refers to starches that are physically inaccessible as they are located inside a fiber-protein matrix and are resistant to breakdown even with normal cooking. RS2 is a type of starch found in green bananas and raw potatoes, which can be reduced by thermal treatment. RS3 refers to retrograded starches that occur when starchy foods like bread or potatoes are gelatinized through heating and then undergo retrogradation upon cooling. RS4 is a group of resistant starches that are generated through chemical modifications such as esterification, etherification, and cross-linking. RS5 is predominantly associated with amylose-lipid V-type complexes, such as starch-monoglycerides and starch-fatty acids , 58. GivSeveral types of gut bacteria are involved in fermenting resistant starch in the hindgut, which leads to the production of SCFAs , gasses , as well as lesser amounts of organic acids , branched SCFAs, and alcohols (such as methanol and ethanol) .Bifidobacteria and Lactobacillus genera. Specifically, Lactobacillus sobrius and Lactobacillus amylovorus have been identified as the major amylolytic genera in the digestive system of swine. It is important to note that not all Bifidobacteria species are involved in the degradation of RS. However, Bifidobacterium breve, Bifidobacterium dentium, and Bifidobacterium pseudolongum have shown extracellular starch-degrading activities (Bacteroides thetaiotaomicron (B. thetaiotaomicron), Ruminococcus bromii (R. bromii), Eubacterium rectale , and Bifidobacterium adolescentis (B. adolescentis), in the breakdown and utilization of RS. The findings of the study indicated that R. bromii exhibited a much greater capacity for RS degradation compared to the other three bacteria. However, all four bacteria demonstrated the ability to utilize RS  gene clusters, which play a role in binding and utilization of starch (R. bromii is believed to be attributed to cohesion (Coh)-dockerin interactions, which are particularly significant in cellulosomal enzyme systems .The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Background and aim: The dimension of purpose in life (PiL) is one of the core features of eudaimonia and plays a crucial role in developmental settings. However, few studies have examined purpose in life in younger generations and verified if it is amenable to improvements following a wellbeing-promoting intervention. The aim of the present investigation is to explore correlates and predictors of purpose in life in school children and to test if it can be ameliorated after school-based wellbeing interventions. Methods: A total of 614 students were recruited in various schools in Northern Italy. Of these, 456 belonged to junior high and high schools and were randomly assigned to receive a protocol of School Well-Being Therapy (WBT) or a psychoeducational intervention (controls). A total of 158 students were enrolled in elementary schools and received a positive narrative intervention based on fairytales or were randomly assigned to controlled conditions. All students were assessed pre- and post- intervention with Ryff scales of eudaimonic wellbeing (short version) and with other self-report measures of anxiety, depression and somatization. Additionally, the Strengths and Difficulties Questionnaire (SDQ) was administered to their schoolteachers as observed\u2013rated evaluation. Results: In both elementary and high schools, purpose in life after the intervention was predicted by initial depressive symptoms and by group assignment (positive interventions vs. controls). In older students, PiL was predicted by female gender and anxiety levels, while no specific strengths identified by teachers were associated with PiL. Conclusions: PiL plays an important and strategic role in developmental settings, where students can develop skills and capacities to set meaningful goals in life. Depressive symptoms and anxiety can be obstacles to developing PiL in students, while positive school-based interventions can promote this core dimension of eudaimonia. Over the past two decades, the growth of positive psychology research has yielded a renewed interest in youths\u2019 wellbeing. Various authors have emphasized the need to promote wellbeing in this population, particularly after the detrimental consequences of the COVID-19 pandemic ,3,4,5. AHowever, previous research focused on happiness and hedonic wellbeing in children and adolescents, which were considered as key ingredients to optimal development ,11. ConvIn fact, among all the different intercorrelated components of eudaimonia , purposeA recent review on the role of purpose in life in school psychology and counselling  summarizThus, purpose in life in youth can develop naturally as a consequence of identity maturation, and it could be considered an important indicator of eudaimonia, which is strongly associated with aspects of emotional and social wellbeing, and with a decreased risk of psychological distress ,27.However, in view of its important role in youth, purpose in life was considered an important target for teachers, coaches and educators, and specific psychoeducational interventions were created to promote/foster this characteristic in young generations ,30. One Another possible path to promote purpose in life is by targeting eudaimonic wellbeing as whole, since it is composed of interrelated dimensions ,34,35. PMore recently, the same group of investigators developed another school program to be implemented in elementary schoolchildren for promoting eudaimonic wellbeing in the early stages in life . In thisTaken together, these school programs have documented that the promotion of eudaimonic or existential wellbeing is feasible in youth, with various approaches and techniques. In these randomized controlled trials performed in schools, the wellbeing interventions (School WBT and Positive Narrative Intervention) were compared to controlled conditions and were found to be effective in improving most of the dimensions of eudaimonia, including purpose in life. Students assigned to the positive interventions reported significant pre-post improvements in their levels of eudaimonic wellbeing, together with decreased levels of anxiety, depression and somatization. Conversely, students assigned to the controlled conditions displayed a different pattern of change in their psychological dimensions: wellbeing dimensions did not improve at post-intervention assessment, and in some cases they also showed significant declines, particularly the subscales of purpose in life and personal growth . A total of 614 students  were recruited in various schools in Northern Italy. Of these, 456 belonged to middle (6\u20137th grade) and high schools (8\u20139th grade) and 158 students were enrolled in elementary schools (4\u20135th grade).Recruitment procedures, study design and intervention protocols are described in details in previous publications ,37,39. TStudy design: randomized controlled study. Randomization was performed at class level (not on single students). This means that in each school some classes received the eudaimonic wellbeing school programs, while other classes (same grade) acted as the control condition. In middle and high schools, students were randomized to receive a protocol of School WBT or a psychoeducative intervention (controls). In elementary schools, students were randomized to receive a positive narrative intervention based on fairytales, or they were assigned to a controlled condition, where fairytales were read and discussed with teachers as part of the traditional school curriculum  was administered to their schoolteachers as an observed\u2013rated evaluation. Assessment was performed by two psychologists not involved in the school interventions.Purpose in life was assessed with the subscale of Ryff\u2019s Psychological Well-Being Scales (PWB) (short version) [version) ,41,42. Iversion) . The psyversion) ,34. Howeversion) . PWB wasversion) ,41,44. IAnxiety was assessed with the Revised Children\u2019s Manifest Anxiety Scale (RCMAS) [ (RCMAS) . It is aDepression was assessed with the Cognitive Triad Inventory for Children (CTI-C) [ (CTI-C)  in eleme (CTI-C)  in middl (CTI-C) . In the Somatization was assessed using the Children\u2019s Somatization Inventory-Child Report Form (CSI) [rm (CSI)  in elemerm (CSI)  in middlrm (CSI) . In the Strengths and Difficulties Questionnaire (SDQ) [All students were also evaluated before and after the intervention by their teachers (one teacher for each class involved in the study) using the re (SDQ) . The SDQre (SDQ) . The CroThe sample characteristics were analyzed with descriptive statistics . Baseline differences among the classes were calculated using MANOVA, with class as a fixed factor, and purpose in life, CTI, SQ Depression and SQ Somatization, and CSI and R-CMAS Total Anxiety scale scores as dependent variables. Bonferroni post hoc tests were then applied to verify specific differences among the various classes.In order to evaluate the predictors of purpose in life (post-intervention scores) in elementary schoolchildren and in middle and high school students, two multivariate linear regression analyses (method enter) were performed: one for the subsample of elementary schoolchildren and one for the subsample of middle and high school students. In both cases a four-step model was used, where socio demographic factors  and intervention condition (wellbeing intervention vs. controls) (step 1); baseline teachers\u2019 evaluations (SDQ scores) (step 2); baseline anxiety levels (RCMAS scores) (step 3); and baseline depressive and somatization symptoms  (step 4) were entered to test if they significantly predicted purpose in life. Two separate regressive models were used for different reasons: age trajectories are particularly relevant in developmental settings; and elementary schoolchildren may present relevant differences in their cognitive skills and in the manifestation of psychological distress  compared to older students ,20,24,25All analyses were performed using Statistical Package for the Social Sciences (IBM-SPSS) version 28.p = 0.018), compared to another high school class. All other variables showed no significant differences due to class.Sample descriptive statistics are reported in p < 0.001). Particularly, lower depressive symptoms and being assigned to the wellbeing intervention predicted higher purpose in life scores   in elementary schoolchildren and in middle and high school students, respectively. The regression model performed in elementary schoolchildren revealed that variables included in the fourth model explained 55% of the variance  .p < 0.001). Particularly, female gender , lower scores in depression  and anxiety , and being assigned to the wellbeing intervention  predicted higher purpose in life scores.  were significantly improved after a short school program, when compared to controlled conditions ,37,39. IOur research, however, does not confirm the pro-social dimension of purpose in life ,24,27. VFinally, the present investigation documented that short school programs (four sessions) aimed at promoting eudaimonic wellbeing in students were able to significantly modify purpose in life when compared to control conditions. The contents of the programs and all the activities performed with students have been described in detail in previous investigations, where their efficacy was tested with controlled designs ,37,39. TThe present research is limited for the characteristics of the sample: students were homogeneous, they had no particular physical problems or mental health issues (students with learning disabilities were excluded) and no ethnic minorities were involved. Another limitation concerns the fact that assessment was largely performed with self-report questionnaires, and only one teacher per class provided observed ratings of children. Thus, also obtaining data from students\u2019 parents or other significant adults in their life would have provided a more reliable picture of their psychological characteristics . MoreoveHowever, the findings of this study extend previous research ,53,54,55Considering the important and strategic role of purpose in life in developmental settings , providi"}
+{"text": "Aims: This study aimed to analyze the process in which individual values and beliefs affected social distance against people with mental illness by mediating cognition, based on applying the justification\u2013suppression model to the stigma of mental illness. Methods: An online survey was conducted with 491 adults aged 20 to 64 years. Their sociodemographic characteristics, personal values, and beliefs, justification for discrimination, and social distance were measured to assess their perceptions of, and behaviors towards, persons with mental illness. Path analysis was performed to examine the magnitude and significance of the hypothetical relationship between variables. Results: Protestant ethic values and morality significantly affected the justification of inability and dangerousness and attribute responsibility. Excluding attribute responsibility, the justification of inability and dangerousness significantly predicted social distance. In other words, the higher the Protestant ethic values, the higher the morality of binding, and the lower the morality of individualizing, the higher the level of justification based on inability and dangerousness. Such justification has been found to increase social distance from persons with mental illness. In addition, mediating effects were the largest in the path of the morality of binding \u2192 justification of dangerousness \u2192 social distance. Conclusions: The study proposes various strategies to deal with individual values, beliefs, and justification logic to reduce social distance against those with mental illness. These strategies include a cognitive approach and empathy, both of which inhibit prejudice. Social stigma refers to the process through which people devalue and exclude certain identities. This process includes stereotypes as concepts learned in the process of socialization, prejudice as affective and cognitive responses to the stereotypes, and discrimination as behavioral responses based on the prejudice . DiscrimMental illness, a social identity stigmatized in any society, is associated with psychological and behavioral symptoms. However, it is also a social handicap in which the course of the disease is severely affected by cultural and social factors, such as stigma . Due to However, through the course of education and in the process of socialization, most people learn that it is wrong to discriminate against any identity, including mental illness. Based on learned social norms, people agree that all humans are equal and that it is unjust to devalue anyone . HoweverThis study focused on how the public justified unjust discrimination against persons with mental illness. Based on the JSM, the only difference between \u201crational\u201d treatment and \u201cunjust\u201d treatment of the stigmatized is the presence of the justification ideology, which is of two kinds . The firIn the JSM, Protestant ethic (PE), political orientations, social dominance, etc., were considered individual beliefs or values that justified the expression of prejudice . Among tBased on the JSM, this study examined the process through which PE and morality influenced SD meditated by the justification of inability, dangerousness, and AR of people with mental illness. In the JSM, PE, and morality were regarded as two of the several categories of justification; however, in this study, it was assumed that individual values and beliefs influenced the logic that served to justify one\u2019s discriminatory behavior toward people with mental illness. In other words, it was assumed that values and beliefs influenced cognition and judgment, which in turn determined behavior. Therefore, this study\u2019s research question was as follows: To what extent can individual PE and morality (IVM and BVM) predict SD, a behavioral indicator of discrimination, through the three justification logics\u2014inability, dangerousness, and AR\u2014of people with mental illness? In other words, the study intended to analyze the nine paths that the three personal values took on SD mediated by the three justification logics.This study was authorized by the Gyeongsang National University\u2019s Institutional Review Board (IRB). Through Macromill Embrain, a company with a platform for online surveys, the study was accessible to the public from February to March 2022. Online surveys begin with eligibility questions  by the population distribution in Republic of Korea and informed consent as approved by the study IRB. There was a total of 491 participants who responded anonymously, and no identifying data were gathered. Informed consent to take part in the survey was obtained from all participants.PE was defined as the dedication to the values of hard effort, to work as an end itself, and to the workplace as the preferred structure for fulfilling internalized values . The PE Morality was described as \u201cprescriptive judgments of rights, justice, etc., about how individuals should interact with one other\u201d . To measThe justification is a cognitive framework for expressing prejudice without internal or external sanction . In thisSD refers to the relative willingness to participate in some relationships or the degree desired to distance oneself from others and was commonly considered a public attitude toward persons with mental illness . SD was The data were analyzed using SPSS 27.0 and Amos 27.0 for Windows  program. Before analysis, the normality of the main variables was confirmed, and the goodness-of-fit of the measurement model was evaluated through confirmatory factor analysis (CFA). Cronbach\u2019s alpha was used to verify the scale\u2019s reliability. First, frequency and descriptive statistics were used to examine the sociodemographic features of the participants. Second, differences in the variables according to the features of the participants were analyzed by conducting independent samples t-test and using Pearson\u2019s correlation. Third, the multicollinearity between the independent variables was analyzed using Pearson\u2019s correlation and regression analysis. Fourth, path analysis was conducted to examine the validity of the causal relationship between the variables and the direct and indirect effects between them ,33. Thatp = 0.000), CMIN/DF = 3.205, SRMR = 0.0812, GFI = 0.913, AGFI = 0.873, NFI = 0.918, RFI = 0.892, IFI = 0.942, TLI = 0.923, CFI = 0.941, RMSEA = 0.067. Most of the indices satisfied the corresponding acceptance criteria.Through confirmatory factor analysis (CFA), the goodness-of-fit indices of the full measurement model were the chi-square = 416.604  significantly predicted JI and JD for people with mental illness. PE is based on beliefs such as \u201cpeople get what they deserve\u201d or \u201cpeople who work deserve success.\u201d . BVM is Third, among the three justification logics, JD was the most significant predictor of SD, followed by JI. JD stems from a long-standing prejudice that \u201cpersons with mental illness are dangerous.\u201d Prejudice regarding dangerousness has been a basis for paternalists justifying forced hospitalization or restricted freedom for the safety of the majority ,40,41. TFourth, this study assumed that PE and morality would predict SD mediated by AR based on an attributional approach. However, while both PE and morality significantly predicted AR for illness, AR-based justification did not predict SD significantly. Considering that previous studies ,51 reporFifth, the paths of PE, IVM, and BVM on SD mediated by the two justification logics were statistically significant in six pathways, which excluded AR. This indicated that personal values or beliefs influenced the logic of justifying discrimination based on inability and dangerousness, which in turn predicted SD. In general, morality and ethical beliefs are innate characteristics that do not change easily and work as a framework for recognizing the phenomenon; however, they can be modified through various experiences ,37. ThesBased on the JSM, this study analyzed the effect of individual values, PE, and morality (IVM and BVM), on SD mediated by the three justifications based on JI, JD, and AR. Unlike previous studies on social stigmas associated with mental illness , this study analyzed the process in which discrimination occurred and how people justified unjust discriminatory behavior against people with mental illness. Several suggestions were made based on the findings, as follows: First, the JSM presented egalitarianism, political liberalism, and internal standards based on the belief that they should be entirely non-prejudiced as suppression sources of expressing prejudice . These vUnlike previous studies on social stigma against people with mental illness, which analyzed the level of prejudice and discrimination, this study is novel in that it analyzed how discrimination was justified based on the JSM. However, this study has several limitations. First, although the original JSM model explained the meaningful relationship between suppression and justification factors, this study only focused on justification and predicted SD. This means that only a part of the JSM model has been verified. Therefore, a follow-up study should clarify the role of suppression by applying the original JSM model to mental illness. The influence of suppression is particularly important in suggesting a realistic alternative to anti-stigma. Second, considering the limited number of studies on how discrimination against people with mental illness was justified, we had difficulty finding an appropriate justification measure. The scale we used was extracted from the items that justified the violation of the liberty of people with mental illness. Therefore, the influence of various other factors related to justification, such as covering and social roles, could not be considered by applying only the justification logic based on inability, dangerousness, and AR, as revealed in previous studies ,18. Thir"}
+{"text": "Escherichia coli. However, companion animals are not typically included in these surveillance programs. Nevertheless, there have been reports of increasing levels of antimicrobial resistance in E. coli strains isolated from dogs worldwide. In Chile, there is limited information available on AMR in E. coli isolated from companion animals, which prevents the establishment of objective prevention and control measures.Antimicrobial resistance (AMR) is a major threat to animal and public health worldwide; consequently, several AMR surveillances programs have been implemented internationally in both human and veterinary medicine, including indicator bacteria such as E. coli strains isolated from healthy household dogs in Chile. For this purpose, a multi-stage sampling was carried out in the Metropolitan Region of Chile, obtaining samples from 600 healthy dogs. These samples were processed using traditional bacteriology and molecular techniques to isolate E. coli strains. We assessed the minimal inhibitory concentration of 17 antimicrobials and conducted a search of six antimicrobial resistance genes, as well as class 1 and 2 integrons, in the isolated strains.For this reason, the aim of this study was to characterize the phenotypic and genotypic AMR of E. coli were recovered, and 96.9% (n\u2009=\u2009217) showed resistance to at least one drug and only 3.1% (n\u2009=\u20097) were susceptible to all analyzed antimicrobials. Most strains were resistant to cefalexin , followed by ampicillin  and cefpodoxime . Moreover, 24.1% (n\u2009=\u200954) tested positive for extended-spectrum-\u03b2-lactamases and 34.4% (n\u2009=\u200977) were multidrug resistant. As for the AMR genes, the most detected was qnrB , followed by blaCTX-M , and blaTEM-1 . Additionally, 16.1% (n\u2009=\u200936) harbored class 1 integrons. Our study shows that E. coli strains isolated from healthy household dogs exhibit resistance to several relevant drugs and also antimicrobial resistance genes considered critical for human health. These results can be used as a starting point for the prevention and control of antimicrobial resistance from companion animals. This background should be considered when formulating future resistance surveillance programs or control plans in which companion animals must be included.Two-hundred and twenty-four strains of  CurrentEscherichia coli, Enterococcus faecium and E. faecalis are the most used. These bacteria are part of the normal microbiota of different animal species, including dogs and humans, and have the ability to acquire new AMR genes from other bacteria and transfer them to other zoonotic or pathogenic bacteria by horizontal gene transfer , the Food and Agriculture Organization of the United Nations (FAO), the World Health Organization (WHO) and the United Nations Environment Programme (UNEP) to jointly promote the responsible use of antimicrobials in humans, animals and plants, under the concept of \u201cOne Health\u201d , 4. Constransfer .According to WOAH data, companion animals receive almost 30% of the antimicrobials prescribed for animals, and many of these are the same as those used in human medicine, increasing the selection pressure for resistant bacterial strains . Thus, aIn Chile, the National Plan Against AMR has been implemented since 2017; however, to date no official AMR surveillance programs have yet been implemented in animals. Moreover, we have previously demonstrated that only a low percentage of veterinarians prescribe antibiotics with the support of microbiological diagnostic tools, and that the most frequently prescribed antimicrobials correspond to critical drugs, including penicillins, quinolones and cephalosporins , a situaE. coli strains isolated from healthy household dogs in the Metropolitan Region, Chile. In this way, we hope to reinforce current strategies that seek to increase awareness and regulation of the use of antimicrobials in dogs, as well as to generate updated scientific information that will allow the generation of therapeutic guidelines for the use of these drugs in companion animals.Considering the lack of information on AMR in bacteria isolated from companion animals in South America and Chile, coupled with the extensive use of critical drugs in those species, we aimed to characterize the phenotypic and genotypic AMR of 2.2.1.E. coli (a priori proportion was set at 50%), and a precision of 4%, and a 95% confidence interval. Dogs were selected through a multi-stage sampling process with veterinary clinics as the primary sampling unit and dogs as the secondary unit. The sampling frame for veterinary clinics was built upon all businesses tagged with the term \u201ccl\u00ednica veterinaria\u201d that were listed on Google Maps as of October 31, 2021; for each of them, the municipality and the macro-area were recorded. Between four and five veterinary clinics were selected from each of the seven MR macro-areas using a stratified random sampling scheme. Directors/owners of the selected veterinary clinics were contacted and invited to participate in the study. In the event of no response or a negative response to the invitation, another clinic was randomly selected from the same macro-area until the target sample size was reached. In each clinic, between 21 and 25 dogs that met the following conditions: (1) being healthy at the clinical examination, (2) not having been treated with antibiotics in the previous 4\u2009weeks, and (3) residing in the same macro-area where the clinic was located, were selected in order of arrival.The design of this study was cross-sectional. Dogs were selected from veterinary clinics located in the Metropolitan Region (MR), which is Chile\u2019s capital region. The sample size was calculated in 600 dogs using a sample size formula for estimating proportions proposed by Dohoo et al. , assumin2.2.Dogs were sampled with prior institutional (permit code 21439-VET-UCH) and signed owner consent in the MR. A total of 618 fecal samples belonging to the same number of dogs that attended 28 veterinary clinics during 2021\u20132022 were collected through rectal swabbing.From dogs of any age and sex, clinically healthy, and without use of antibiotics during the 4\u2009weeks prior to sampling, a swab with Cary Blair transport medium  was inserted approximately 2\u2009cm into the rectum and rotated gently for 10\u2009s. After collection, all the samples were immediately refrigerated and transported to the laboratory within 4\u2009h.2.3.E. coli, which were incubated at 42\u00b0C for 18\u201324\u2009h. Three of these plates were supplemented with a different antibiotic, including amoxicillin , cefotaxime , enrofloxacin , and one without antibiotics as a growth control. The selection of these drugs for plate supplementation was due to their critical relevance for both animal and human health and high reported use in companion animal clinical practice in Chile , according to the protocol described by Chen & Griffiths , following the manufacturer\u2019s instructions. Quality and concentration of DNA (260/280 absorbance ratio) was measured in a nanodrop . Samples with an absorbance ratio closest to the optimal range (1.8\u20132.0) were kept at \u201320\u00b0C for molecular analysis . E. coliriffiths . Table 12.5.E. coli strains was assessed using the automatized VITEK2 system  to quantify its phenotypic AMR. This was carried out using the ASTGN98 card according to the manufacturer\u2019s instructions, and clinical cut-off values according to the Clinical and Laboratory Standards Institute guidelines  of all confirmed idelines . The stridelines . The ASTidelines . Multidridelines . Additioidelines .2.6.E. coli strains was assessed by PCR in a LifeECO Thermocycler (Hangzhou Allsheng Instruments Co.) with previously obtained DNA. The genes analyzed included blaTEM\u2009\u2212\u20091 and blaCTX\u2009\u2212\u2009M for \u03b2-lactamases; qnrB, qnrS and aac(6\u2032)-Ib-cr for plasmid-mediated resistance to quinolones; and aac(6\u2032)-Ib for aminoglycosides-modifying enzymes. Additionally, the presence of class 1 and class 2 integrons was also assessed by detecting the intI1 and intI2 genes. These genes were selected given their reported distribution in E. coli strains and because they encode resistance to critically important drugs for human and veterinary medicine, posing a risk to animal and public health -Ib were further analyzed by digestion with BtsCI  to identify the aac(6\u2032)-Ib-cr allele, which lacks the BtsCI restriction site present in the wild-type gene  (data not published), were used as positive controls. ype gene , 30. All2.7.E. coli isolates. For the genotypic resistance analysis, MCA was aimed to assess the relationships of the presence/absence of AMR genes among the isolates. In all cases, MCAs were limited to the derivation of two dimensions. The relationships among the antibiotics\u2019 resistant/susceptible condition, and among the presence/absence of resistance genes were plotted by means of two-dimensional correspondence maps. All MCAs were carried out in Stata v15 .The phenotypic and genotypic resistance patterns were studied through multiple correspondence analysis (MCA). In the case of phenotypic resistance, MCA was used to evaluate the proximal relationships of the resistant/susceptible status to the different antibiotics among 3.3.1.E. coli isolates were recovered after plating onto any of the supplemented plates. From these isolates, 34.1% (n\u2009=\u2009211) were obtained on amoxicillin-supplemented plates; 9.2% (n\u2009=\u200957) on plates with cefotaxime; and 15.7% (n\u2009=\u200997) on plates with enrofloxacin. As some samples grew on more than one supplemented plate, 224 isolates were selected.From all samples, 489 (79.1%) 3.2.E. coli isolates, 224 were characterized on their MIC. Of the total strains, 96.9% (n\u2009=\u2009217) showed resistance to at least one drug and only 3.1% (n\u2009=\u20097) were susceptible to all analyzed antimicrobials. Thus, most of them were resistant to cefalexin , followed by ampicillin  and cefpodoxime . On the other hand, no strains were resistant to imipenem or nitrofurantoin. Additionally, 24.1% (n\u2009=\u200954) were positive for ESBL and 34.4% (n\u2009=\u200977) were MDR. 50 and MIC90 for each analyzed antibiotic.After selection of all n\u2009=\u200945), ampicillin-cefalexin , and ampicillin-cefalexin-cefpodoxime-cefovecin-ceftiofur and ampicillin-cefalexin-cefpodoxime-cefovecin-ceftiofur-ciprofloxacin-enrofloxacin-marbofloxacin-trimethoprim-sulfamethoxazole  the most frequently detected. Among resistant strains 72 resistance profiles were detected, with cefalexin alone , followed by blaCTX-M , blaTEM-1 , qnrS  and aac(6\u2019)Ib-cr . Additionally, 16.1% (n\u2009=\u200936) harbored class 1 integrons, while the gene aac(6\u2019)Ib and class 2 integrons were not detected. Twenty-four profiles of AMR genes were detected, were qnrB alone was the most frequent , followed by blaCTX-M alone , blaTEM-1 alone  and blaTEM-1-qnrB . All gene profiles are included in As for the AMR genes, the most detected was 3.4.E. coli isolates were susceptible to it. The first and second derived dimensions together accounted for 81.8% of the total variability of the resistant/susceptible status among antibiotics . The two-dimensional correspondence plot shows that the resistance/susceptibility status of the isolates was grouped according to the different antibiotics. Isolates sensitive to trimethoprim-sulfamethoxazole generally were also susceptible to chloramphenicol, doxycycline, marbofloxacin, ciprofloxacin and to a lesser extent to enrofloxacin; therefore, the isolates resistant to any of these drugs, generally, were also resistant to the others. An equivalent situation was observed with isolates susceptible/resistant to cefpodoxime, ceftiofur, cefovecin, and to a lesser extent to cefalexin and ampicillin. The plot also suggests that when an isolate was susceptible to amikacin, it was also susceptible to gentamicin, amoxicillin-clavulanic acid, and ceftazidime, but resistant to cefalexin and ampicillin  for the phenotypic analysis included all tested antibiotics, except imipenem since all picillin .blaTEM, blaCTX-M, qnrB, qnrS, aac(6\u2019)Ib-cr, and intI1 genes, as these were both present and absent across isolates. The resulting two-dimension model accounted for 76.0% of the total variance of the original variables . The MCA two-coordinate plot shows a clustering of the gene absence condition, which means that the isolates mainly agree in the absence of genes, rather than in the presence. Those pairs of genes in which this relationship was seen to be more marked were qnrS and aac(6\u2019)Ib-cr, as they both were absent in 88% of the isolates. The percentage of gene absence coincidence for the qnrS-intI1, blaTEM-intI1, and blaCTX-M-intI1 pairs were 76, 71, and 69%, respectively. The gene pair with the highest percentage of coincidence in the presence of genes was qnrS-blaCTX-M with only 5% of isolates , inadequate or nonexistent programs for infection prevention and control, poor-quality medications, weak laboratory capacity, inadequate surveillance, and insufficient regulation for the use of antimicrobials are crucial factors that contribute to the worldwide spread of AMR . Most stE. coli strains isolated from companion animals have been detected worldwide and represent one of the greatest challenges to public health, especially MDR, fluoroquinolone-resistant and ESBL-producing strains  and 27% (cefpodoxime); while the AMR to enrofloxacin was 86.5%, followed by ciprofloxacin (82.7%), levofloxacin (80.8%) and moxifloxacin (80.8%). On the other hand, among the 18 isolates from the control group, no resistant strains to third-generation cephalosporins or to fluoroquinolones were detected. Additionally, in 14 strains isolated from treated dogs ESBL were detected, while none was detected in the control group. Among those 14 strains, 50% harbored the genes blaCTX-M-1, blaTEM and blaPER-2; 35.7% blaCTX-M-14 and blaTEM; 7.1% blaCTX-M-1 and blaTEM; while 7.1% possessed blaCTX-M-14, blaTEM and blaPER-2. In the second study, Benavides et al. , amoxicillin-clavulanic acid (32\u2009\u03bcg/mL), cefalotin . More recently, Chen et al.  than the phenotypic resistance. In fact, here 125 out of the 205 E. coli strains resistant to cefalexin (60.9%) did not harbor blaTEM-1 or blaCTX-M genes, as did 79 out of the 153 strains resistant to ampicillin (51.6%) and 31 out of the 41 strains resistant to amoxicillin-clavulanic acid (75.6%). These discrepancies may be due to the presence of other \u03b2-lactamase encoding genes, such as blaTEM-2, blaTEM-10, plasmid-encoded AmpC or SHV and PER enzymes  gene. In our study, resistance against tetracyclines was the second highest detected, with 30.8% of resistance to doxycycline and a high MIC90 (>16\u2009\u03bcg/mL), but lower than expected due to the wide use of this family of drugs in the clinical practice of companion animals in Chile. However, the presence of tet genes was not investigated, which will be included in a subsequent whole genome sequencing study of these strains.Tetracyclines belong to a family of broad-spectrum antibiotics, where its efficacy, low cost, and the lack of side effects make them widely used in animals. In pets, doxycycline is an antibiotic of choice for different diseases; therefore, its use is common. In Chile, doxycycline has been reported to be the fourth most widely used antimicrobial in companion animals . Such wiotection . Efflux otection . In thisotection  reportedE. coli, this resistance may be due to chromosomal mutations of folP or folA genes, or by the plasmid-borne sul and dhfr genes  as a primary site and topoisomerase IV as a secondary target. Mutations in specific domains of gyrA, gyrB, parC, and parE cause changes in gyrase or topoisomerase IV that contribute to quinolone resistance, which can be transmitted vertically. In addition, to date, three families of plasmid-mediated mechanisms associated with quinolone resistance have been identified: Qnr proteins that protect the DNA gyrase and topoisomerase IV from inhibition by quinolones; aminoglycoside acetyltransferase variant aac(6\u2032)-Ib-cr that acetylates ciprofloxacin and norfloxacin; and efflux pumps QepA and OqxAB that remove antibiotics from bacterial cells Ib-cr. Noteworthy, only 10 fluoroquinolone-resistant strains harbored qnrB and only five qnrS, being mainly detected in susceptible strains. In the case of the three strains harboring the aac(6\u2019)Ib-cr, all of them were resistant to fluoroquinolones, but one also carried the qnrB and qnrS genes, and two the CTX-Mbla gene. This is not surprising because, plasmids harboring fluoroquinolone resistant genes often carry other antibiotic resistance genes conferring resistance to \u03b2-lactams, aminoglycosides, chloramphenicol, tetracycline, sulfonamides, trimethoprim, and rifampin, allowing the co-selection of MDR strains . Among the resistant strains, 72 resistance profiles were detected; and of these, six strains were resistant to 10 antibiotics simultaneously; one strain showed resistance to 11 antibiotics simultaneously; three strains to 12 antibiotics; and one strain to 13 antibiotics. Regarding the presence of integrons, only class 1 integrons were detected in 16.1% of the analyzed strains, and of them 69.4% showed MDR. Integrons are natural recombination and expression systems with the ability to acquire gene cassettes; and although they are not mobile elements, they are frequently associated with mobile elements such as conjugative plasmids, insertion sequences and transposons, making them one of the most important elements in the dissemination of resistance . More thAlthough current legislation in Chile establishes that antimicrobials should only be used for therapeutic or metaphylactic purposes; that fluoroquinolones and third and fourth generation cephalosporins should not be used as a first line of treatment, except when there are no effective alternatives; that the use of fluoroquinolones and third and fourth generation cephalosporins as a second therapeutic alternative should be supported by bacterial susceptibility studies; and that all antimicrobials should be sold with a veterinary prescription , our resE. coli strains isolated from healthy dogs exhibit resistance to several relevant drugs and also antimicrobial resistance genes considered critical for human health. As observed, healthy dogs have E. coli strains resistant to third-generation cephalosporins and fluoroquinolones, and many of them are resistant to both families of antimicrobials. These results can be used as a starting point for the prevention and control of antimicrobial resistance in companion animals. This background should be considered when formulating future resistance surveillance programs or control plans in which companion animals must be included.Finally, our study shows that The original contributions presented in the study are included in the article/The animal studies were approved by Comit\u00e9 Institucional de Cuidado y Uso de Animales of the Universidad de Chile (permit code 21439-VET-UCH). The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent was obtained from the owners for the participation of their animals in this study.NG, GA, and LL contributed to the conception and design of the study and wrote the first draft of the manuscript. NG, GA, LL, EP-O, and GG-R contributed with resources to the study. FS, BE, MM, SM, RV, CV, JP, and CZ performed the laboratory analyses. GA performed the statistical analysis. All authors contributed to the article and approved the submitted version.This work was supported by the Fondo Nacional de Desarrollo Cient\u00edfico y Tecnol\u00f3gico (FONDECYT) grant number 1210692.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Abcc6 knockout mice (ko), characterized by PPi deficiency, developed less severe RAKI despite similar rhabdomyolysis severity, and had similar hydroxyapatite deposition suggesting alternative mechanisms. This improved kidney outcome at day 2 translated to a trend in improved glomerular filtration rate at month 2 in Abcc6-/-mice and to significantly less interstitial fibrosis. In addition, whereas the pattern of infiltrating cells at day 2 was similar between wt and ko mice, kidneys of Abcc6-/- mice were characterized by more CD19+ B-cells, less CD3+ T-cells and a lower R1/R2 macrophage ratio at month 2. In summary, kidney calcium phosphate deposits are frequent in RAKI but hydration with sodium bicarbonate or sodium chloride does not modify the kidney outcome. Blocking ABCC6 emerges as a new option to prevent RAKI and subsequent transition toward kidney fibrosis.Rhabdomyolysis is a risk factor for acute kidney injury, transition towards chronic kidney disease, and death. The role of calcium phosphate deposits in the mechanisms of rhabdomyolysis-induced acute kidney injury (RAKI) is still unclear. Better insight of the role calcium in RAKI could lead to new therapeutic avenues. Here, we show in a mice model of RAKI that calcium phosphate deposits were frequent in the kidney (hydroxyapatite) and partly correlated with the severity of the kidney injury. However, the intensity of deposits was highly heterogeneous between mice. Treatment with sodium chloride, sodium bicarbonate or inorganic pyrophosphate , or combinations thereof, did not improve kidney outcomes and hydroxyapatite deposition during RAKI. Unexpectedly,  Beyond earthquakes and wars that are archetypical situations associated with severe rhabdomyolysis owing to crush and limb ischemia, several critical conditions can lead to rhabdomyolysis including infection, drugs and envenomation3. To date, the treatment of rhabdomyolysis is mostly symptomatic and aims to reverse the causes of rhabdomyolysis, prevent additional kidney injuries  and treat metabolic complications .Rhabdomyolysis is a life-threatening disorder with a high risk of the development of severe acute kidney injury (AKI), hyperkalemia and metabolic acidosis6. In addition to the release of high load of nephrotoxic molecules (uric acid and myoglobin) in the circulation, rhabdomyolysis and other cell lysis syndrome are also accompanied by severe hyperphosphatemia. Even though pathological data are scarce, acute hyperphosphatemia may directly induce AKI. This was reported in acute phosphate nephropathy induced by oral sodium phosphate bowel solutions7, and in some cases of RAKI8. Recently, we have reported that serum phosphorus at hospital admission was correlated with the risk to develop severe KDIGO stage 2\u20133 AKI, independently of the other markers of rhabdomyolysis severity2. Therefore, targeting phosphorus load in RAKI might be a valuable treatment option. However, before proposing a potential new treatment in RAKI, a better characterization of the role of calcium phosphate deposition within kidneys in AKI is required.Rhabdomyolysis-induced AKI (RAKI) is a complex disease that combines renal hypoperfusion (hypovolemic shock related to muscle edema and vasoconstriction related to myoglobin-dependent nitric oxide depletion), direct toxicity to proximal tubular cells (myoglobin and uric acid-induced cell necrosis), intra-renal inflammation  and distal tubule obstruction (myoglobin \u2013 uromodulin complex)9. Alkalinization of urine with, for example, sodium bicarbonate may prevent the development of myoglobin-uromodulin complex10, but also increase the rate of calcium phosphate deposition in alkaline conditions. Therefore, treatment strategies currently mainly recommend intensive hydration with sodium chloride solute, even if in turn this latter may theoretically decrease the urinary pH and subsequently increase myoglobin precipitation within tubules. However, the available data in animal models of RAKI or in humans are scarce, precluding treatment optimization. Modulating the risk of calcium phosphate crystallization with inorganic pyrophosphate (PPi) may be a therapeutic option, but has not been verified in preclinical models yet. Injection of PPi may reduce the rate of calcium phosphate crystallization11, whereas Abcc6 invalidation and subsequent PPI deficiency may increase the risk of vascular and kidney calcium phosphate deposits12.The goals of current treatment strategies to prevent or reverse RAKI are to avoid hypovolemia and increase the urinary elimination of myoglobin and potassiumIn this interventional study in mouse, we aimed to characterize the role of phosphorus deposition within the kidney during RAKI, identify the optimal hydration solute and test the ability of modulating PPi levels to prevent RAKI.6.All experimental procedures were performed in accordance with institutional guidelines for ani-mal studies and were approved by the national ethics committee . Rhabdomyolysis was induced in mildly sedated (isoflurane) 8\u201310-week-old male C57Bl6 mice  by intramuscular injection in each thigh caudal muscle with 7.5\u00a0ml/kg 50% glycerol , as previously reportedAccording to study groups, mice received intraperitoneal injection of sodium chloride (0.2\u00a0mL), sodium bicarbonate 4.2% (0.2\u00a0mL), or PPi (12.5\u00a0mg/kg diluted in 0.2\u00a0mL of sodium chloride).Abcc6-/- mice, formerly designated as Abcc6tm1Aabb were generated on a 129/Ola background, and then backcrossed into a C57Bl/6\u00a0J background more than ten times. These mice were maintained at the INSERM U1291 facilities . For experiments , which expressed a CRE-recombinase in proximal tubule cells in male mice (spontaneously) or in female mice (after exposition to testosterone), with a mouse line harboring a GFP gene flanked by Mice were sacrificed with a sublethal injection of Dolethal (0.182\u00a0mg per g of mice) and transcardially perfused with 2\u00a0ml PBS. For histology, kidneys were either fixed in 4% PFA or in Carnoy solution. For mRNA analysis, kidneys were snap-frozen in liquid nitrogen. Studies in animals were reported according with ARRIVE guidelines.Blood was collected from the mouse tail vein in EDTA tubes at 6\u00a0h, 2\u00a0days or 20\u00a0days after glycerol injection and was centrifuged at 2000\u00a0rpm for 5\u00a0min to separate plasma. Plasma BUN, phosphorus and CPK were analyzed on a Pentra 400 analyzer . For GFR determination, FITC-sinistrin half-life was measured. In short, under anesthesia, a transcutaneous device (MediBeacon) was attached to the depilated skin on the back of mice using a double-sided adhesive patch. Transcutaneous measurement started with background reading one to three minutes before FITC-Sinistrin was administered intravenously (7\u00a0mg/100\u00a0g body weight). Animals were allowed to fully recover and move freely until transcutaneous measurement was stopped after 60\u00a0min.-\u0394\u0394Ct method.mRNA was isolated from frozen kidneys using the RNeasy Plus Purification kit (Qiagen) and 500\u00a0ng were reverse-transcribed using High-Capacity cDNA reverse Transcriptase (Applied Biosystem) or not (RT\u2013) to exclude genomic DNA contamination. Real-time quantitative PCR was performed using the ONE Green PCR master mix (Ozyme). Analysis of GAPDH mRNA was performed to normalize gene expression using the 2Formalin or Carnoy fixed kidneys were embedded in paraffin, sectioned in 4\u00a0\u03bcm thick slices and stained with filtered Sirius red 1% (BDH laboratories), Masson\u2019s Trichrome, and Von Kossa staining. For immunohistochemistry, rabbit anti-myoglobin  and rat anti-uromodulin  antibodies were incubated for 1\u00a0h at room temperature. Following this, the specimens were washed twice with TBS 0.1% Tween 20 and incubated with Histofine simple stain MAX-PO (Nichirei) for 30\u00a0min. For detection of signals the Dako Envision system  was used. Finally, sections were counterstained with hematoxylin, dehydrated and mounted. Sections were scanned using a Nanozoomer 2.0 RS (Hamamatsu) and analyzed with image J software.TM55VP field emission-scanning electron microscope (FE-SEM). Measurements were performed at a low voltage (1.4\u00a0keV) and without the usual deposits of carbon at the surface of the sample.Tissue Sects.\u00a0(4\u00a0\u00b5m) were investigated with a Zeiss SUPRA\u22121. The spectra were recorded in the 4000\u2013700\u00a0cm\u22121 mid-InfraRed range. Each spectral image covering a substantial part of the tissue, consisted of about 40,000 spectra.Microcalcifications were characterised using Fourier Transform InfraRed microspectroscopy (\u00b5-FTIR). Tissue Sects.\u00a0(4-\u00b5m) were deposited on low-emission microscope slides . FTIR analysis was performed in serial sections adjacent to tissue sections stained with Yasue technique. FTIR hyperspectral images were recorded with a Spectrum spotlight 400 FT-IR imaging system (Perkin Elmer Life Sciences), with a spatial resolution of 6.25\u00a0\u00b5m and a spectral resolution of 8\u00a0cm\u00b5l, Qiagen). After red blood cell lysis, cells were passed through a 40-\u00b5m mesh and stained with Viobility (Biolegend). Then cells were incubated with anti-CD16/32 (Biolegend) and stained with anti-CD45-PE violet 770 (BD), anti-CD11b-PE violet 615 (BD), anti-F4/80-APC (BD), anti-Ly6C-PerCP violet 700 (BD), anti-Ly6G Alexa Fluor700 (Biolegend), anti-CD3-PE (BD), anti-CD4-APC Violet 770 (BD), anti-CD8a viogreen 520 (BD), anti-CD19 viobright 515 (BD), and anti-NK 1.1-Billant violet 605 (Biolegend). A known quantity of Countbright beads (Molecular Probes) was added. Acquisition was performed on a BD LSR-Fortessa cytometer. Standard analyses were performed on FACS Diva Software . Gates were made as follows: CD19+ B cells: CD45+ Viobility- CD11b- F4/80- CD3- CD19+ ; CD3+ T cells: CD45+ Viobility- CD11b- F4/80- CD3+; CD3+ CD8+ T cells: CD45+ Viobility- CD11b- F4/80- CD3+ CD8+; CD3+ CD4+ T cells: CD45+ Viobility- CD11b- F4/80- CD3+ CD4+; R0: CD45+ Viobility- CD11b+ F4/80- ; R1: CD45+ Viobility- CD11b+ F4/80low; R2: CD45+ Viobility- CD11b+ F4/80+Kidneys were decapsulated, minced, and incubated with collagenase  and DNAse (1KU/Quantitative variables are shown as mean\u2009\u00b1\u2009SEM and compared with the Mann\u2013Whitney test (2 groups) or Kruskal\u2013Wallis test, as appropriate. Qualitative variables are shown as number and percentages and compared with the Fischer exact test. Correlation between BUN and calcium phosphate deposits was assessed with the Spearman test. A p-value below 0.05 was considered significant.\u00a0The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.Following glycerol injection, C57BL/6\u00a0J mice developed rhabdomyolysis  and AKI (BUN: 95\u2009\u00b1\u200928\u00a0mmol/L at day 2) with frank hyperphosphoremia (phosphorus 8\u2009\u00b1\u20094\u00a0mmol/L at day 2)  Fig.\u00a0C\u2013E. InteKim1 mRNA expression  Fig.\u00a0A, treatmion Fig.\u00a0C, kidneyion Fig.\u00a0D and intion Fig.\u00a0A,B, 2\u00a0daAbcc6, a gene coding for an ATP transporter12.These surprising observations of the total absence of a benefit of these different treatments, employed in the clinic, on both severity and calcium phosphate deposition in this RAKI model sparked our interest to better understand the role of calcium phosphate deposition in RAKI. With this aim we focused our attention on crystallization inhibition by PPi by using a mouse model of PPi deficiency related to deletion of Abcc6 in proximal tubule cells but also identified Abcc6 mRNA in CD45\u2009+\u2009immune kidney cells   Fig.\u00a0B. Intersice Fig.\u00a0C.Abcc6-/- mice, we started to look for alternative hypotheses to decipher how ABCC6 could modulate the kidney outcome after RAKI. Therefore, we analyzed the immune cell infiltration pattern at day 2 and month 2 following rhabdomyolysis. As shown in Fig.\u00a0+ cells from the kidneys at day 2 showed an unmodified proportion of CD8+ and CD4+ CD3+ T-cells, R1 and R2 macrophages, as well as CD19+ B-cells in ko mice compared to wt mice. In contrast, at month 2, kidneys of Abcc6-/- mice were characterized by more CD19\u2009+\u2009B-cells, less CD3+ T-cells (with similar CD4+/CD8+ ratio) and a lower R1/R2 macrophage ratio , no or very few deposition was observed in mice with Abcc6 invalidation or their littermate Abcc6-/- mice would be more prone to develop severe RAKI and subsequent kidney fibrosis, we observed a better kidney outcome in these mice. ABCC6 (ATP binding cassette subfamily C member 6) is an ATP-dependent transporter mainly expressed in hepatocytes, but also at the basolateral membrane of kidney proximal tubules cells where its role is unknown14. Abcc6 is not expressed in other parts of the kidney. Inherited ABCC6 deficiency is associated with the development of pseudoxanthum elasticum, a rare inherited disease characterized by a PPi deficit, vascular calcification, and urolithiasis15. ABCC6 contributes to the outflow of ATP from cells to the extracellular environment, where it is hydrolyzed to AMP and PPi by ectonucleotidase ENPP1. AMP is subsequently converted to adenosine and phosphate by the ecto-5\u2019-nucleotidase CD7316. AMP and adenosine have various purinergic signaling-dependent effects including macrophage activation, vascular contractility, and cytoskeletal rearrangement in epithelial cells16. Independently of its role in PPi metabolism and circulating levels, deletion of Abcc6 may thus theoretically prevent several key pathogenic mechanisms of RAKI, including rhabdomyolysis-induced macrophage-dependent kidney inflammation6, myoglobin-induced nitric oxide-dependent vasoconstriction17 and ATP depletion-induced tubular cell injury5. In wild-type mice, the expression of Abcc6 decreases 2\u00a0days after RAKI and normalized thereafter. Further studies, including organ-specific deletion of Abcc6 will have to decipher how Abcc6 deletion protect kidneys from RAKI .Alternative therapies not targeting phosphorus are thus mandatory to improve the kidney and overall outcomes of patients developing rhabdomyolysis. Interestingly, while we hypothesized Abcc6 deficiency led to protection against both acute and chronic rhabdomyolysis-induced kidney injuries. At day 2, FACS analyses showed a similar kidney immune cell distribution suggesting that additional non-immune mechanisms prevented RAKI at early stages. On the other hand, at month 2, mice with Abcc6 deletion had lesser kidney fibrosis and displayed a significantly different kidney immune cell distribution then in wt mice  suggesting immune modulation and fibrosis prevention. In this study, we were unable to accurately assess the R2 sub-population that arose in Abcc6-/- mice after kidney injury. Since M2 macrophages (mainly represented in the R2 population) are not a single cell population but include anti-inflammatory cells (that prevent excessive kidney damage), as well as extra-cellular matrix-producing cells (which promote fibrosis), it will be important to better decipher the respective role of each macrophage sub-populations in the context of ABCC6 inhibition.Interestingly, Abcc6 is expressed in circulating leukocytes and some node lymphocytes14, suggesting that ABCC6 may have direct effect on immune cell activation or polarization. Indeed, we performed qPCR of FACS-sorted CD45+ immune cells extracted from kidneys and identified Abcc6 transcripts in these cells. Alternatively, baseline liver ABCC6 deficiency and subsequent changes in systemic metabolism may increase the ability of the kidney to resist to injury. These findings deserve further attention.Previous studies using immunohistochemistry reported that ABCC6 deficiency leads to pseudoxanthoma elasticum and urolithiasis in humans, further studies will also have to confirm the protective role of transient ABCC6 inhibition on kidney dysfunction.The lack of a specific ABCC6 inhibitor currently precludes the confirmation of our data by a pharmacological approach but our findings now point to ABCC6 as a new potential molecular target to prevent RAKI and its consequences on deterioration of kidney function in the long term. Because chronic In summary, phosphate deposits in the kidney are frequent in RAKI but hydration with sodium bicarbonate or sodium chloride does not modify their extent and the kidney outcome. Surprisingly, blocking the ABCC6 transporter emerges as a new option to prevent RAKI and subsequent transition toward kidney fibrosis.Supplementary Figures."
\ No newline at end of file