diff --git "a/deduped/dedup_1013.jsonl" "b/deduped/dedup_1013.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_1013.jsonl"
@@ -0,0 +1,39 @@
+{"text": "We report a case of pulmonary sarcoma which is a rare cause of the common symptom of dyspnea.A fifty-one year old previously healthy male presented to the emergency room with complaints of dyspnea on exertion. A cardiac workup including an exercise stress test was negative but an echocardiography showed pulmonary stenosis. Cardiac MRI showed a large mass extending from the pulmonic valve to both the right and left pulmonary arteries suggestive of sarcoma. A complete resection and repair of the pulmonary artery was done and adjuvant chemotherapy with doxorubicin and ifosfamide was recommended. The patient is currently disease free after eighteen months.Pulmonary artery sarcomas are a difficult diagnosis. The diagnosis may remain elusive for some time until the proper imaging techniques are utilized to make a diagnosis. Earlier and accurate diagnosis may lead to earlier interventions and improve survival. Dyspnea is a frequent presentation to the emergency room. The differential diagnosis is extensive and often the diagnosis remains obscure. Pulmonary sarcomas are a rare cause of dyspnea, but do present as such and are often initially misdiagnosed.A 51 year old previously healthy male presented to the emergency room with complaints of dyspnea, chest pain and palpitations while playing tennis. This was the second time over the last month that he experienced some palpitations and dyspnea with exertion. Previously, the patient was ruled out for a myocardial infarction and had a stress echocardiogram which showed mild/moderate pulmonic stenosis, normal right ventricle, and thickened pulmonic valve with doming, but otherwise normal stress test. He was sent home from the emergency room with follow-up with his primary care physician and cardiologist. His cardiologist ordered a cardiac MRI to further evaluate the pulmonic valve. The MRI revealed a large mass starting near the pulmonic valve and extending into the main pulmonary artery and 4 cm into the right pulmonary artery and 3 cm into the left pulmonary artery Fig . PET-FDGGross pathology showed a large intimal sarcoma filling the pulmonary artery Fig . It infiThe patient tolerated the surgery well and was discharged with oncology follow-up as an outpatient. Adjuvant chemotherapy with doxorubicin and ifosfamide was initiated soon thereafter. Eighteen months later and after 7 cycles of chemotherapy, he continues to remain disease free by imaging.Sarcoma of the great vessels are rare and are usually found in the aorta , inferior vena cava, or pulmonary artery. Typically, these sarcomas are rare and highly lethal that previously were diagnosed during surgery or autopsy. Patients typically present between the ages of 22 and 81 with female sex predominance. The prognosis is poor with a mean survival of 12 months after onset of symptoms and 1 and 2 year survival rates of 22% and 7% respectively-5. This The World Health Organization (WHO) classify sarcomas on the basis of hematoxylin-eosin, Masson-trichrome, and periodic acid-Schiff stained sections. SarcomaThe mainstay of treatment for sarcoma is surgical resection as this remains the only potentially curative modality. Adjuvant radiation and chemotherapy can be considered following surgical excision although their role remains undefined. An approximate 20% response rate can be expected with a combination chemotherapy regimen involving an anthracycline and an alkylating agent, however, the value of this regimen in the adjuvant setting for pulmonary artery sarcoma is unclear,9.CT \u2013 Computed TomographyMRI \u2013 Magnetic Resonance ImagingPET \u2013 Positron Emission TomographyFDG \u2013 FluorodeoxyglucoseThe author(s) declare that they have no competing interests."}
+{"text": "Primary cardiac sarcoma is a rare clinical entity, with anincidence of 0.0001% in collected autopsy series.The majority of the literature describes a uniformly dismal prognosis with amedian survival of only 6 months for these aggressive tumors.Standard surgery, adjuvant chemotherapy,and radiotherapy have been consistently unsuccessful.Early heart transplantation and novel radiation therapyapproaches may offer a survival benefit in nonmetastatic tumors,but up to 80% of the patients present with systemic metastasis at diagnosis.Though several chemotherapeutic regimens have been tried, therole of chemotherapy is not well established and outcomedata available is minimal. Liposomal doxorubicin (PLD) hasbeen shown to be useful in the treatment of soft tissue sarcomas,and our case supports its use in cardiac angiosarcoma. A 66-year old woman presented in July 1999 with 2-week history offlu-like illness and progressive exertional dyspnea. She was foundto have a cardiac mass on transesophageal echocardiogram.MRI-magnetic resonance imaging revealed a 3.5/4/4-cm mass in theright atrium and ventricle extending into the anterior superiormediastinum. The patient underwent sternotomy and exploration, andthe mass was found to be in the atrioventricular junction. Biopsyrevealed a high-grade angiosarcoma. Staging evaluation revealed apulmonary metastasis in the left base posteriorly. Her performancewas 2 on the ECOG scale. After detailed discussion of treatmentoptions, the patient opted for minimal intervention with minimaltoxicity. Liposomal doxorubicin has been used in soft tissuesarcoma and is well tolerated; hence she was treated with Doxil40\u201350 mg/m2 q 4 weeks for total 11cycles. She had anexcellent clinical response after 2 cycles and radiologicalresponse after the third cycle . Primary cardiac sarcoma seldom causes symptoms untillate in the course. Most common symptoms include dyspnea, chestpain, CHF, palpitation, fever, and myalgia. The clinicalpresentation is often found to mimic the more commoncardiopulmonary diseases, usually valvular heart diseases,although the most frequent presentation is that of right-sidedcongestive heart failure. Case reports in the literature describea variety of clinical manifestations which include arrhythmia,vena caval obstruction, pericardial effusion with or withoutfeatures of tamponade and conduction disturbances. In contrastwith benign tumors, usually located in the left atrium, malignanttumors are found almost exclusively in the right heart,particularly in the right atrium.Most reported series of cardiac sarcomas describe patients withprimary cardiac sarcomas and response to treatment and survival isanecdotal. Complete resection of cardiac sarcoma is difficult, inview of the location and extent of involvement. Often tumors areso large at the time of the operation that complete resectioncannot be done. Moreover, up to 80% of patients present withdistant metastasis at diagnosis .In geneCardiac sarcomas generally have a dismal prognosis with a mediansurvival of only 6 months . ApplyinThe use of radiotherapy is also restricted in many ways. Thetypical dose of radiation for sarcomas at most sites is6000 cgy to 6500 cgy following complete resection of thesarcoma. In unresectable lesions the dose of radiation is oftenincreased to 7000 cgy. Such high doses are not well toleratedby the heart. At a dose of 4000 cgy the incidence ofpericarditis is approximately 40%. Hyperfractionated radiotherapy(7050 cgy) along with a radiosensitizer (5-iododeoxyuridine) hasbeen shown to eradicate the tumor in a few cases for locoregionalcontrol, after surgical resection in nonmetastatic tumors .The role of adjuvant chemotherapy after surgically resectedcardiac sarcoma remains controversial. Some of thechemotherapeutic regimens used in the past include DECAV, DTIC,CYVADIC, and VAPAC with variable benefit. There is some evidenceto support adjuvant chemotherapy to relieve symptoms and prolongsurvival as part of the combined modality approach . While oIn our case the patient had a soft tissue mass situated betweenthe right atrium and right ventricle and extending into theanterior superior mediastinum. She also had a pulmonary mass atthe left base posteriorly. The patient underwent sternotomy, butthe tumor was unresectable. Owing to the metastatic disease onpresentation she opted for chemotherapy alone. Since outcome isquestionable and therapy is toxic, she preferred to have Doxiltherapy alone as opposed to other agents. She had a completeremission after 3 cycles of Doxil therapy. Subsequent CT scansshowed more than 90% reduction in the size of her primary tumorand resolution of the pulmonary metastasis. She had a disease-free survival of 11 months. She then recurred with extensivepulmonary metastasis and expired 16 months after initialdiagnosis.The liposomal delivery system has been developed to avoiddetection by the reticuloendothelial system (RES) and to increaseblood circulation time of doxorubicin. Once inside the tumor, theliposomal covering allows release of the encapsulated doxorubicin.Within the cell, the cytotoxic mechanism of action of doxorubicinis consistent with conventionally delivered doxorubicin. Liposomaldoxorubicin may be less susceptible to tumor resistance via themultidrug resistance (MDR) mechanism that is mediated through anoverexpression of a P170-glycoprotein than conventionaldaunorubicin. However, further investigations of PLD in softtissue sarcoma are necessary , 11.Studies using pegylated liposomal doxorubicin (PLD) in thetreatment of sarcomas at other sites have shown variable resultsin response rates with improved toxicity profile and at leastequivalent activity in comparison to doxorubicin \u201314.HoweDue to the rarity of cardiac angiosarcoma there are no largestudies comparing different chemotherapeutic regimens. Severalreports have demonstrated that PLD is at least as active as freedoxorubicin in soft tissue sarcomas. Notable, a recentarticle report0 PLD is uniquely active inangiosarcoma. Our current case provides further support for therole of PLD in the treatment of this rare tumor."}
+{"text": "Evolutionary trees are family trees that represent the relationships between a group of organisms. Phylogenetic heuristics are used to search stochastically for the best-scoring trees in tree space. Given that better tree scores are believed to be better approximations of the true phylogeny, traditional evaluation techniques have used tree scores to determine the heuristics that find the best scores in the fastest time. We develop new techniques to evaluate phylogenetic heuristics based on both tree scores and topologies to compare Pauprat and Rec-I-DCM3, two popular Maximum Parsimony search algorithms.Our results show that although Pauprat and Rec-I-DCM3 find the trees with the same best scores, topologically these trees are quite different. Furthermore, the Rec-I-DCM3 trees cluster distinctly from the Pauprat trees. In addition to our heatmap visualizations of using parsimony scores and the Robinson-Foulds distance to compare best-scoring trees found by the two heuristics, we also develop entropy-based methods to show the diversity of the trees found. Overall, Pauprat identifies more diverse trees than Rec-I-DCM3.Overall, our work shows that there is value to comparing heuristics beyond the parsimony scores that they find. Pauprat is a slower heuristic than Rec-I-DCM3. However, our work shows that there is tremendous value in using Pauprat to reconstruct trees\u2014especially since it finds identical scoring but topologically distinct trees. Hence, instead of discounting Pauprat, effort should go in improving its implementation. Ultimately, improved performance measures lead to better phylogenetic heuristics and will result in better approximations of the true evolutionary history of the organisms of interest. Tree of Life, the evolutionary history of the 10 to 100 million estimated organisms on earth. However, inferring evolutionary trees is not a trivial task. Since the true evolutionary history for a set of organisms is unknown, the problem is often reformulated as an NP-hard optimization problem. Trees are given a score, where trees with better scores are believed to be better approximations of the true evolutionary history. For n taxa, there are an exponential number of evolutionary hypotheses: (2n - 3)!! possible solutions to be exact. As a result, an exhaustive exploration of the space of possible solutions (or \"tree space\") is infeasible. Thus, the most popular techniques in the field use heuristics to reconstruct phylogenetic trees.Phylogenetics is concerned with inferring the genealogical relationships between a group of organisms (or taxa). These evolutionary relationships are typically depicted in a binary tree, where leaves represent the organisms of interest and edges represent the evolutionary relationships. Phylogenetic trees have been used successfully in designing more effective drugs, tracing the transmission of deadly viruses, and guiding conservation and biodiversity efforts ,2. The gscore and topology of the trees found. More specifically, our work centers around the following two questions.In this paper, we develop new techniques to compare the performance of phylogenetic heuristics. While phylogenetic heuristics are used to search stochastically for the best trees in tree space, their results often vary across each run of the heuristic. As a result, it is difficult to compare performance among heuristics that produce different solutions. Our work evaluates phylogenetic heuristics based on both the 1. What value (if any) do slower heuristics provide?2. How effective are parsimony scores in distinguishing between different tree topologies?Traditional techniques for comparing phylogenetic heuristics use convergence plots to show how the best score improves over time, as best scores are thought to symbolize more accurate trees. Under this measure, the heuristic that obtains the best score in the fastest time is desired. Given that different tree topologies may have identical tree scores, preference of good-scoring trees found by fast heuristics may result in overlooking potentially more accurate evolutionary histories that were found by slower approaches.We consider the performance of two well-known Maximum Parsimony (MP) search heuristics, Parsimony Ratchet  and Recurelative entropy, we show that for a given collection of trees, parsimony scores have less information content than topological distance measures such as Robinson-Foulds (RF) distance [Secondly, although different trees are found with the same parsimony score, it's interesting to consider whether maximum parsimony is effectively distinguishing between the trees, which has significant implications for understanding evolution. By using a measure called distance . In otheb, we found across the algorithms. For each dataset, both Pauprat and Rec-I-DCM3 find trees with the best score, b. Let x represent the parsimony score of a tree T . Then, tree T is x - b steps away from the best score. In Table 0, step1, and step2 represent trees that are 0, 1 and 2 steps away from the best score, b, respectively. It is clear that the top-scoring trees from Pauprat comprise a large proportion of the total collection of its 5,000 trees for the smaller datasets (60 and 174 taxa). On the other hand, the top trees for Rec-I-DCM3 comprise the majority of its collection of trees for the larger datasets (500 and 567 taxa).Table t \u00d7 t RF matrix is represented as a color. Darker (lighter) colors represent smaller (higher) RF rates. Since the RF matrix is symmetric, our heatmap is symmetric as well. For each heatmap, the right values are x coordinates and the values on the top are y coordinates. Consider the heatmap that represents the collection of 60 taxa trees. Cell  represents the set of step0 trees from the Pauprat heuristic. Each of the 1,508 step0 trees is compared to each other. Their resulting RF rates are 0%, which is denoted by a black coloring of the 1,508 \u00d7 1,508 block of cells. Hence, the best scoring trees found by the Pauprat heuristic are identical. A similar conclusion can be made concerning the 59 step0 trees found by Rec-I-DCM3 and denoted by cell  in the heatmap. If we look at the step0 trees from both Pauprat and Rec-I-DCM3, represented by cells , where x, y \u2264 2, the entire block of cells have a RF rate of 0%. Hence, for the 60 taxa dataset, the heuristics found identical best-scoring trees. For the step2 trees, reflected in cells  and , there is more variation among the 60 taxa trees. Neither heuristic found step1 trees. The heatmap also compares trees with different number of steps to the best. For example, cell  compares step0 Pauprat trees with step2 Rec-I-DCM3 trees and denotes that they have a wider range of topological differences between them.Figure 1 and step2 trees. The top-scoring trees found by Rec-I-DCM3 algorithm are more similar to each other than their Pauprat counterparts. Finally, the heatmaps show that Pauprat finds more topologically dissimilar trees than Rec-I-DCM3. Thus, the Rec-I-DCM3 stepi trees tend to form clusters that are distinct from the stepi Pauprat trees.Although the best trees are identical in the 60 taxa dataset, the heatmaps in Figure t trees. The heatmaps in this figure are read similarly to those in Figure i, j). For example, on the 60 taxa dataset, cell  represents the strict consensus resolution of the 1,508 step0 trees from Pauprat. Cell  is the strict resolution rate of the step0 Rec-I-DCM3 trees with step2 Pauprat trees. High resolution rates reflect high similarity among the trees of interest. Overall, the consensus resolution rate is the highest for the step0 trees. This corroborates the results shown in Figure 0 trees are more topologically similar to each other than higher scoring trees. Furthermore, the strict resolution rate is greater among Pauprat trees than its Rec-I-DCM3 counterparts. For both Pauprat and Rec-I-DCM3, the majority resolution of comparing the top trees always resulted in a rate greater than 90%  and not on wall-clock time . Although number of iterations is an architecture-independent measure, it may not be completely adequate as each algorithm may do more work than the other per iteration. We are comparing heuristics based on their input/output behavior, which is the collection of trees returned after 5 runs of a heuristic, where each run consists of 1,000 iterations. Thus, we believe that using iterations as a basis of time is adequate for the purposes of this paper.Figures In Figure In this paper, we used novel methods to assess the quality of two maximum parsimony heuristics, Pauprat and Rec-I-DCM3. The goal of this work was to both ascertain the value of slower heuristics and determine if parsimony score is effective in distinguishing between different tree topologies. We designed a new entropy-based measure, which we used in tandem with parsimony scores and Robinson-Foulds (RF) distance, to quantify levels of tree heterogeneity across the Pauprat and Rec-I-DCM3 heuristics over several datasets. In addition, we used heatmaps to visualize levels of tree diversity found by the heuristics.0, step1, and step2) trees, there is a wide-range of topological differences among these trees. In some cases, by using our relative entropy measure, parsimony scores are more diverse than the tree topologies found. This suggests that our topology-based methods may be more reliable in quantifying fine-grain differences between different heuristics, especially in larger datasets.Our results show that parsimony score masks tree diversity in large populations of equally parsimonious trees. By using relative entropy, there is more information content in topological distance measures (such as the RF distance) than in parsimony scores. Furthermore, when considering three groups of top-scoring  optimization criterion for inferring the evolutionary history between a collection of taxa. Each of the taxa in the input is represented by a molecular sequence such as DNA or RNA. These sequences are put into a multiple alignment, so that they all have the same length. Maximum parsimony then seeks a tree, along with inferred ancestral sequences, so as to minimize the total number of evolutionary events by counting only point mutations.Parsimony ratchet is a particular kind of phylogenetic search performed with alternating cycles of reweighting and Tree Bisection Recombination (TBR). The approach works as follows: starting with an initial tree, a few of the characters (between 5 \u2013 25%) are sampled, and reweighted. It suffices to say here that reweighting of characters involves duplicating the characters so that each shows up twice (or more) in the resulting dataset. Then, using these reweighted characters, TBR search is performed until a new starting tree is reached using this subset of data. This new starting tree is then used with the original data set to repeat the phylogenetic search. Parsimony ratchet tries to refine the search by generating a tree from a small subset of the data and using it as a new starting point. If the new tree is better than the old one, then the new one is used as the new starting tree. Otherwise, the old one is kept.Recursive-Iteration DCM3 (Rec-I-DCM3)  implemenRec-I-DCM3, involves all of the above DCM stages, but in addition, is both recursive and iterative. The recursive part concerns the divide stage of the DCM, where overlapping subsets of the input tree's leaf nodes may be further divided into yet smaller subsets (or subproblems). This is an important enhancement to the DCM approach since for very large datasets, the subproblems remain too large for an immediate solution. Thanks to the recursion, the subproblems are eventually small enough to be solved directly using some chosen base method. At this point, Rec-I-DCM3 uses strict consensus merger to do the work of recombining the overlapping subtrees to form a single tree solution. The iterative part of Rec-I-DCM3 refers to the repetition of the entire process just described. That is, the resulting tree solution becomes the input tree for a subsequent iteration of Rec-I-DCM3.t evolutionary trees, we would like to quantify the topological differences that exist between them. We compute the t \u00d7 t Robinson-Foulds (RF) matrix, which represents the dissimilarity between each pair of trees. Cell  in the t \u00d7 t RF matrix represents the RF distance between the two trees labeled Ti and Tj. The Robinson-Foulds (RF) distance computes the number of bipartitions (or evolutionary relationships) that differ between them. A bipartition is an internal edge e of a phylogenetic tree that separates the taxa on one side from the taxa on the other. The division of the taxa into two subsets is the bipartition Bi associated with edge ei. Let \u03a3 (T) be the set of bipartitions defined by all edges in tree T . The RF distance between trees T1 and T2 is defined asGiven a collection of RF rate, which is obtained by normalizing the RF distance by the number of internal edges and multiplying by 100. Assuming n is the number of taxa, there are n - 3 internal edges in a binary tree. Hence the maximum RF distance between two trees is n - 3, which results in an RF rate of 100%. The RF rate allows us to compare topological differences when the number of taxa is different. Thus, the RF rate varies between 0% and 100% signify that trees T1 and T2 are identical and maximally different, respectively.Our figures plot the relative entropy, which is a normalization of entropy, to allow the comparison of entropy values across different population sizes. Relative entropy ranges from 0% to 100%. Higher entropy values indicated more diversity (heterogeneity) among the population of trees. Lower entropy values indicate less diversity (homogeneity) in the population.Entropy represents the amount of chaos in the system. We use entropy to quantitatively capture the distribution of parsimony scores and RF rates among the collection of trees of interest. In our plots, we show \u03bb represent the total number of objects (parsimony scores or RF rates) in the population of trees. For example, suppose we want to partition a population of 10 trees based on their parsimony scores. Then, \u03bb = 10. However, if we are interested in partitioning the 10 trees based on the upper triangle of the corresponding 10 \u00d7 10 RF matrix, then \u03bb objects into P total partitions. Each partition i contains ni individuals with identical values. For RF, each individual in partition i will have the same RF value. An individual in the RF matrix refers to a cell location .Let ET) of the collection of parsimony scores as:We can compute the entropy (pi = Emax) is log \u03bb . Relative entropy (Erel) is defined as the quotient between the entropy ET and the maximum entropy Emax and multiplying by 100 to obtain a percentage. Thus,where n taxa, a resolved, unrooted binary tree will have n - 3 bipartitions . Trees with less than n - 3 bipartitions are considered to have unresolved relationships among the n taxa. In general, binary (or 100% resolved) trees are preferred by life scientists. The resolution rate of a tree is the percentage of bipartitions that are resolved. One common use of this measure is related to evaluating consensus trees, which are used to summarize the information from a set of t trees. The strict consensus method returns a tree such that the bipartitions of the tree are only those bipartitions that occur in all of the t trees. The majority consensus tree incorporates those bipartitions that occur in at least 50% of the t trees of interest. Highly resolved consensus trees denote that a high degree of similarity was found among the collection of trees.For We used the following biological datasets as input to study the behavior of the maximum parsimony heuristics.1. A 60 taxa dataset  of ensign wasps composed of three genes , 16S rRNA, and cytochrome oxidase I (COI)) . The bes2. A 174 taxa dataset  of insects and their close relatives for the nuclear small subunit ribosomal RNA (SSU rRNA) gene (18S). The sequences were manually aligned according to the secondary structure of the molecule . The besrbcL DNA sequences (759 parsimony-informative sites) [3. A set of 500 aligned e sites)  of seed rbcL, atpB, and 18s) aligned DNA sequences  of angiosperms [4. A set of 567 \"three-gene\" (uences 2,3 sites oT . The fourth taxon is added to the internal edge of T that results in the best MP score. This process continues until all taxa are added to the tree. The resulting tree is then used as the starting tree for a phylogenetic analysis.All methods used PAUP*'s random sequence addition module to generate the starting trees. First, the ordering of the sequences in the dataset is randomized. Afterwards, the first three taxa are used to create an unrooted binary tree, We set the parameters of the Pauprat and Rec-I-DCM3 algorithms according to the recommended settings in the literature. We use PAUP*  to analyWe used the HashRF algorithm ,17 to coThe authors declare that they have no competing interests.TW ran the maximum parsimony algorithms to obtain the phylogenetic trees studied in this manuscript. SS and SM wrote the algorithms to analyze the data from the maximum parsimony experiments. SS created all of the plots. All authors contributed to writing the manuscript and have approved its final contents."}
+{"text": "Intrinsic tooth discolorations after endodontic treatment are principally attributed to the composition of necrotic pulp tissue, hemorrhage within the pulp cavity, endodontic medicaments and/or filling materials. Residual sealer left in pulp chamber after obturation can cause discoloration. The objective of this in vitro study was to evaluate coronal discoloration created by AH26 and ZOE sealers after four months.Fifty intact human extracted maxillary central incisors were employed. Access cavities were prepared in all samples and root canals were instrumented; coronal orifices were then sealed using self-cure glass ionomer. The teeth were divided into two experimental groups (n=20) according to utilized sealer in pulp chambers including AH26 and Dorifill (ZOE). The remaining 10 teeth served as negative and positive controls (n=5). The access cavities were sealed with self-cure glass ionomer. Teeth were kept in incubator for four month. Preliminary digital images of the teeth were taken and then compared with those related to 4-month follow-up. The images were assessed using Photoshop software. Data was analyzed using paired t-test and independent samples t-test.The teeth which were filled with AH26 sealer showed significantly greater discoloration than those filled with ZOE sealer (Dorifill) (P<0.05).AH26 sealer causes greater discoloration of the crown compared to ZOE sealer. Despite the other disadvantage of AH26 sealer, it seems that Dorifill is more esthetically considerate. Anterior tooth discoloration is an esthetic problem for both the patient and dentist. Sources of coronal tooth discoloration can be natural (acquired) or iatrogenic (inflicted). Natural causes are those that occur as a result of tooth developing disturbances or due to patients\u2019 behavior, tooth caries, or traumatic injuries 2]3]4][3][4]2][[4][3][4][3][4]2]7].[7].6][7].[7].6]. Van. Van16].Results obtained from this study concurred with Van der Burgt et al. results; they showed that AH26 sealers cause a grayish discoloration and ZOE sealers cause a light red to orange discoloration . In thisIn this in vitro study, AH26 causes greater mean discoloration compared to Dorifill sealer after 4 months. Therefore, Dorifill (ZOE) sealers seem more appropriate for root canal treatment of anterior teeth. Similar studies with more samples and type of sealers and also periodical discoloration assessments are recommended."}
+{"text": "The five-membered thia\u00adzole ring adopts a slightly twisted envelope conformation and the pyrrole ring adopts an envelope conformation; in each case, the C atom linking the rings is the flap atom. The mol\u00adecular structure features inter- and intra\u00admolecular C\u2014H\u22efO inter\u00adactions. Furthermore, the crystal packing is stabilized by four inter\u00admolecular C\u2014H\u22ef\u03c0 inter\u00adactions.In the title compound, C \u00c5b = 9.2147 (2) \u00c5c = 23.9951 (5) \u00c5\u03b2 = 109.103 (1)\u00b0V = 3308.12 (13) \u00c53Z = 4K\u03b1 radiationMo \u22121\u03bc = 0.14 mmT = 293 K0.21 \u00d7 0.17 \u00d7 0.12 mmBruker Kappa APEXII diffractometerSADABS; Sheldrick, 1996Tmin = 0.967, Tmax = 0.974Absorption correction: multi-scan (40746 measured reflections9096 independent reflectionsI > 2\u03c3(I)5614 reflections with Rint = 0.039R[F2 > 2\u03c3(F2)] = 0.046wR(F2) = 0.118S = 1.029096 reflections434 parametersH-atom parameters constrainedmax = 0.25 e \u00c5\u22123\u0394\u03c1min = \u22120.33 e \u00c5\u22123\u0394\u03c1APEX2  used to solve structure: SHELXS97  global, I. DOI: 10.1107/S1600536812007271/zj2058Isup2.hklStructure factors: contains datablock(s) I. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "The piperidine connected to the octa\u00adhydro\u00adindolizine ring is in a half-chair conformation. The five-membered pyrrole ring adopts a slightly twisted envelope conformation with the piperidine C atom as the flap atom. The F and H atoms of both fluoro\u00adbenzene rings are disordered, with occupancy factors of 0.941\u2005(3):0.059\u2005(3) and 0.863\u2005(3):0.137\u2005(3). The mol\u00adecular structure features some intra\u00admolecular C\u2014H\u22efO inter\u00adactions. In the crystal, a supra\u00admolecular zigzag chain sustained by C\u2014H\u22efF inter\u00adactions parallel to the c axis is formed, generating a C(12) graph-set motif.In the title compound, C \u00c5b = 16.8176 (6) \u00c5c = 20.5195 (6) \u00c5\u03b2 = 99.845 (2)\u00b0V = 2895.53 (17) \u00c53Z = 4K\u03b1 radiationMo \u22121\u03bc = 0.09 mmT = 293 K0.30 \u00d7 0.30 \u00d7 0.25 mmBruker Kappa APEXII diffractometerSADABS; Sheldrick, 1996Tmin = 0.974, Tmax = 0.978Absorption correction: multi-scan (27283 measured reflections5702 independent reflectionsI > 2\u03c3(I)4231 reflections with Rint = 0.033R[F2 > 2\u03c3(F2)] = 0.052wR(F2) = 0.146S = 1.025702 reflections409 parameters23 restraintsH-atom parameters constrainedmax = 0.70 e \u00c5\u22123\u0394\u03c1min = \u22120.45 e \u00c5\u22123\u0394\u03c1APEX2  used to solve structure: SHELXS97  global, I. DOI: 10.1107/S1600536813019594/tk5239Isup2.hklStructure factors: contains datablock(s) I. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "In the pyrrolo\u00adthia\u00adzole fused-ring system, the pyrrole ring adopts an envelope conformation (with the C atom bound to the thia\u00adzole ring being the flap atom) and the thia\u00adzole ring also exhibits an envelope conformation (with the N atom bound to the pyrrole ring as the flap). The mol\u00adecular structure features a weak intra\u00admolecular C\u2014H\u22efO inter\u00adaction. In the crystal, a C\u2014H\u22efO inter\u00adaction forms a linear chain along the diagonal of the ac plane, generating a C(14) graph-set motif. A weak C\u2014H\u22ef\u03c0 inter\u00adaction also occurs. In the title compound, C \u00c5b = 20.1346 (12) \u00c5c = 14.3860 (8) \u00c5\u03b2 = 103.153 (1)\u00b0V = 3214.2 (3) \u00c53Z = 4K\u03b1 radiationMo \u22121\u03bc = 0.15 mmT = 293 K0.21 \u00d7 0.19 \u00d7 0.18 mmBruker Kappa APEXII diffractometerSADABS; Sheldrick, 1996Tmin = 0.967, Tmax = 0.974Absorption correction: multi-scan (26225 measured reflections5979 independent reflectionsI > 2\u03c3(I)4873 reflections with Rint = 0.024R[F2 > 2\u03c3(F2)] = 0.037wR(F2) = 0.104S = 1.075979 reflections415 parametersH-atom parameters constrainedmax = 0.29 e \u00c5\u22123\u0394\u03c1min = \u22120.27 e \u00c5\u22123\u0394\u03c1APEX2  used to solve structure: SHELXS97  global, I. DOI: 10.1107/S1600536813020084/gw2135Isup2.hklStructure factors: contains datablock(s) I. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "The mol\u00adecule contains four fused rings of which the six-membered ring A adopts a half-chair conformation, the six-membered ring B adopts a chair conformation, the five-membered ring C is almost planar (r.m.s. deviation = 0.015\u2005\u00c5) and the five-membered ring D adopts an envelope conformation with the quaternary C atom as the flap. The methyl and the eth\u00adoxy groups adopt a syn conformation and the A/B ring junction is cis-fused. No directional inter\u00admolecular inter\u00adactions could be identified in the crystal.The title compound, C \u00c5b = 13.0302 (4) \u00c5c = 14.1381 (9) \u00c5V = 1564.50 (12) \u00c53Z = 4K\u03b1 radiationCu \u22121\u03bc = 0.78 mmT = 294 K0.33 \u00d7 0.28 \u00d7 0.12 mmAgilent SuperNova  diffractometerCrysAlis PRO; Agilent, 2013Tmin = 0.743, Tmax = 1.000Absorption correction: multi-scan (14336 measured reflections2994 independent reflectionsI > 2\u03c3(I)2871 reflections with Rint = 0.027R[F2 > 2\u03c3(F2)] = 0.037wR(F2) = 0.103S = 1.032994 reflections202 parametersH-atom parameters constrainedmax = 0.13 e \u00c5\u22123\u0394\u03c1min = \u22120.18 e \u00c5\u22123\u0394\u03c1Absolute structure: Flack 1983Flack parameter: \u22120.1 (2)CrysAlis PRO  used to solve structure: SUPERFLIP  global. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "The information regarding the spatial variations in the abundance, the diversity and the composition of such ecologically important microbes, however, is quite limited at large scale. In this investigation, we studied the abundance, alpha diversity and geographical distribution of methanogenic archaeal communities in nine representative paddy sites, along a large latitudinal gradient in China, using pyrosequencing and real-time quantitative PCR. It is found that all paddy soils harbor constant methanogenic archaeal constituents, which is dominated by family Methanocellaceae (37.3%), Methanobacteriaceae (22.1%), Methanosaetaceae (17.2%), and Methanosarcinaceae (9.8%). Methanogenic archaeal abundance is primarily influenced by soil C  and N  contents, as well as alpha diversity by soil pH . Further exploration revealed that both spatial distance  and soil chemical variables mainly about soil C and N  are the two major factors affecting methanogenic archaeal community composition distribution in paddy soils. This finding will allow us to develop a better picture of the biogeographic ranges of these ecologically important microbes and get deeper insights into their ecology.Paddy field methanogenic archaea are responsible for methane (CH Methanogenesis is the final degradation process of organic matter in paddy fields. During this process, organic matters with large molecular weight in paddy soil are anoxically degraded into small molecules, such as methanol, acetate, formate and H2/CO2, by hydrolytic and fermenting microbes. Bacterial reducers of nitrate, Fe(III) and sulfate in paddy soil are thermodynamically more competitive with electron donors than methanogenic archaea, and they outcompete methanogens for utilizing these small molecular weight organic carbon and/or H2/CO2 to conduct biogeochemical cycling  content. With the above phenomena, we hypothesize that there is a geographical distribution in paddy methanogenic archaeal community, and their distribution is related to spatial distance and environmental variables. To better understand the large-scale information of paddy methanogenic archaeal community it is worthwhile to explore the patterns more specifically.Although no large-scale investigation has been conducted, several extant reports consistently have given the implications of the possible geographical distribution of paddy methanogenic archaea. By comparing the results from several field-scale investigations, it has been concluded that paddy methanogenic archaeal community composition could vary along geographic distance: the percentage of Methanocellaceae (Rice cluster I) in paddy methanogenic archaeal community decreases along latitude: 32.0% in Hainan Island, China (19.1\u00b0N) , 13.0% iFigure 1) were collected. These sample locations were strategically selected from seven provinces that jointly hold roughly 60% of China paddy soil  were extracted by 2 M KCl and determined using a continuous flow analyzer  . Inorganic N (NHerlands) . The conerlands) .\u00ae SPIN Kit for soil  according to the manufacturer\u2019s instructions. The extracted soil DNA was dissolved in 50 \u03bcl of TE buffer, quantified by a spectrophotometer and stored at -20\u00b0C until further use.For each replicate of soil sample, genomic DNA was extracted from the same amount of moist soil (0.5 g) on the day after sampling using a FastDNAEscherichia coli-derived vector plasmid pMD18-T (TaKaRa) containing a cloned target gene, using 102 to 108 gene copies \u03bcl-1. The reactions were performed in C1000TM Thermal Cycler equipped with CFX96TM Real-Time system . The 25-\u03bcl reaction mixture contained 12.5 \u03bcl of SYBR\u00aePremix Ex TaqTM (TaKaRa), primer set (0.5 \u03bcM each), 200 ng BSA \u03bcl-1, 1.0 \u03bcl template containing approximately 2\u20139 ng DNA. Negative control was always run with water as the template instead of soil DNA extract. The qPCR program used for methanogenic archaea was: 94\u00b0C for 5 min, followed by 35 cycles of 94\u00b0C for 30 s, 55\u00b0C for 30 s and 72\u00b0C for 60 s, and extension and signal reading. The specificity of the amplification products was confirmed by melting curve analysis, and the expected sizes of the amplified fragments were checked in a 1.5% agarose gel. qPCR was performed in triplicate and amplification efficiencies of 97.4\u2013104% were obtained with R2 values of 0.966\u20130.977.The copy numbers of methanogenic archaeal 16S rRNA genes [primer set 1106F (TTWAGTCAGGCAACGAGC)/1378R (TGTGCAAGGAGCAGGGAC)] of different samples were quantified by real-time qPCR following the protocols of Taq DNA polymerase with 0.4 \u03bcl , and 1 \u03bcl of template containing approximately 50 ng of genomic community DNA as a template. Thirty-five cycles  were performed with a final extension at 72\u00b0C for 7 min. The purified bar-coded PCR products from all samples were normalized in equimolar amounts before pyrosequencing using Genome Sequencer FLX System platform . The sequences were deposited in NCBI database (accession no. SRP071098).For each replicate of soil sample, the following primer set was used to amplify approximately 280 bp of methanogenic archaeal 16S rRNA gene fragments for sequencing on the 454 GS-FLX pyrosequencing platform: 1106F and 1378R . The oli2  1.7.0-dev pipeline2  using de2  and binn2  to the sA richness of phylotypes (Chao1) was calculated to compare community-level bacterial diversity at a single level of taxonomic resolution. We also estimated the PD using Faith\u2019s index , which pP < 0.05 were considered statistically significant. Correlation between the abundances and the diversity of methanogenic archaeal community and environmental variables were quantified using analysis of variance (ANOVA). R software (Version 3.1.2) was utilized to estimate the correlations between environmental variables and methanogenic archaeal community composition by Mantel test and partial Mantel test (vegan package), to conduct Anosim, mrpp, and Adonis analyses  Statistics for windows (Version 13). The data were expressed as the means with standard deviation (SD), and the letters indicated significant differences between the results of the different samples. Mean separation was conducted based on Tukey\u2019s multiple range test. Differences at Table 1. pH values ranges from 5.18 to 7.64, among which ZY and YZ had the highest values of 7.64 and 7.55 (P < 0.05), respectively. JX and TY had the highest NO3--N values of 21.98 and 21.89 \u03bcg/g d.w.s, followed by ZY, YZ, CS, HL, GS, LZ, and YT. For NH4+ -N, Total N and SOM, GS had all highest values of 114.88 \u03bcg/g d.w.s, 0.26 and 4.80%, respectively (P < 0.05), and HL had the lowest values of 4.17 \u03bcg/g d.w.s, 0.11 and 2.19%, respectively (P < 0.05). Besides, HL had the highest C/N value of 11.99 (P < 0.05), followed by TY, LZ, CS, YZ, YT, GS, JX, and ZY.The soil chemical properties of nine sampling sites are listed in Figure 1; Supplementary Figure Pyrosequencing revealed that the paddy methanogenic archaeal community was dominated by two classes, Methanomicrobia (77.9%) and Methanobacteria (22.1%). With higher resolution, it was found that Methanocellales were most abundant (37.3%), followed by Methanosarcinales (30.2%), Methanobacteriales (22.1%) and Methanomicrobiales (10.4%), at the order level. At the family level, the dominant methanogenic archaea were found to be Methanocellaceae (Rice cluster I) (37.3%) and Methanobacteriaceae (22.1%), followed by aceticlastic groups Methanosaetaceae (17.2%) and Methanosarcinaceae (9.8%). At the genus level, the dominant methanogenic groups were Methanocella (Rice-like) (21.9%), Methanobacterium (21.1%), Methanosaeta (17.2%) and Methanosarcina (9.8%) . At the genus level, the percentage of Methanosarcina is significantly higher in TY (27.8 \u00b1 1.6%) than in others (P < 0.05); the percentages of Methanocella are significantly higher in CS (39.6 \u00b1 1.2%), JX (38.7 \u00b1 3.3%), and ZY (23.3 \u00b1 0.4%) (P < 0.05). Besides, LZ has the highest percentage of Methanosaeta (55.3 \u00b1 17.4%) and YZ has the highest percentage of Methanocella (Rice-like) (55.1 \u00b1 15.8%) (P < 0.05).Each site has a different taxonomic distribution pattern (P < 0.05), with the copy numbers of 2.91 \u00d7 108 and 2.00 \u00d7 108 per d.w.s, respectively, followed by CS, TY, HL, JX, GS, YT, and LZ in order (Table 2). Paddy methanogenic archaeal diversity was evaluated by Chao1 and PD indices. Both indices had the similar changing patterns to each other among different paddy samples (Table 2). Briefly, HL and YT had the highest values of diversity indices (P < 0.05), followed by GS, CS, LZ, TY, ZY, and JX, and YZ had the lowest diversity values (P < 0.05).We used qPCR to evaluate paddy methanogenic archaea abundances. YZ and ZY had the highest abundances (Table 3). It is shown that the abundance is significantly positively correlated with total N, SOM, NO3--N, NH4+-N and atmospheric temperature . Combining the information of pyrosequencing and qPCR data, we analyzed the correlations of the absolute abundances of four dominant groups, Methanobacteriaceae, Methanocellaceae, Methanosaetaceae, and Methanosarcinaceae against soil properties (Table 3). They are generally correlated with C/N . Besides, PD diversity index is significantly negatively correlated with Total N (P < 0.05) and positively with C/N (P < 0.05) . We found that the soil samples with close latitudes were grouped together . Specifically, overall phylogenetic variability within paddy methanogenic archaeal communities at latitude \u2264 20.5\u00b0N (LZ), 28.38\u00b0N-28.95\u00b0N , 30.08\u00b0N-32.58\u00b0N , and \u226547.43\u00b0N (HL) clustered separately from each other as shown in Figure 2B, which are confirmed by the analyses of Anosim, mrpp, and Adonis . These results are supported by canonical correspondence analysis  and soil chemical variables  contribute to the variation of paddy methanogenic archaeal community composition, and spatial distance plays a more predominant role.Mantel test revealed the significant correlations between paddy methanogenic archaeal community composition based on the Bray\u2013Curtis distance and the different environmental variables as well as spatial distance listed from the highest to the lowest correlation scores: temperature, C/N, spatial distance, NOFigure 3A) as well as the latitude distances ranging from 0 to 27\u00b0N , finding the obvious linear correlations . These phenomena indicate that paddy methanogenic archaeal community composition varied along spatial distance as well as latitude distance. Besides, a significant negative correlation between latitude and temperature is shown in Supplementary Figure We analyzed the relationship between paddy methanogenic archaeal community composition (weighted pairwise UniFrac distances) and spatial distance  with latitudes higher than 29.52\u00b0N. This result partially echoed our Mantel test and partial Mental test findings of high correlation between spatial distance and paddy methanogenic archaeal community composition . In the left group, the impacting factors of paddy methanogenic archaeal community were in the sequence of pH (10.9% of contribution), NO3--N (3.9%) and SOM (2.4%). As a comparison, total N (8.9%) and pH (2.2%) are the two major contributors in the right group .The results of MRT analysis are shown in Figure 1; Supplementary Figure Figure 1; Supplementary Figure Generally, the methanogenic archaeal communities in nine paddy soils are dominated by the putative hydrogenotrophic phylotypes of Methanocellaceae (Rice cluster I) and Methanobacteriaceae, followed by the putative aceticlastic phylotypes of Methano saetaceae and Methanosarcinaceae . We believe the cause of this difference is not due to two rice cultivars (Indica and Japonica), as This result is consistent with the findings of the members of paddy methanogenic archaeal community in South Korea and Japan by DGGE or T-RFLP, targeting 16S rRNA or rA genes . Using prA genes . HoweverTable 2), but we found it is primarily correlated with soil C and N contents (Table 3). This finding is in agreement with results from the previous reports. Table 3). This phenomenon can well explain the strong positive correlation between paddy CH4 emission and SOM (3--N and NH4+-N is not surprising (Table 3).The total abundance of paddy methanogenic archaea varies among nine sampling sites . Specifically, the abundances of hydrogenotrophic methanogens, Methanobacteriaceae  and Methanocellaceae  are negatively correlated with C/N, while aceticlastic methanogens, Methanosaetaceae  and Methanosarcinaceae  are positively correlated. This result is in line with the report of 3--N or total N content (Table 3). The increase in hydrogenotrophic methanogens could outcompete aceticlastic methanogens for niche. Hence, a negative correlation between Methanosaetaceae abundance and N elements is observed (Table 3).For dominant groups , the C/N ratio is generally the predominant factor that impacts their abundances (Table 3).pH is a key variable in the soil environment, and differences in soil pH can arise from many factors . Thus, sTables 4 and 5; Figure 3A). Geographical distance has previously been described as one of important factors that determine microbial spatial distribution . And, Figure 3B shows an obvious correlation between the biodistance of paddy methanogenic archaeal community composition and latitude distance. Secondly, the significant negative correlation between latitude and temperature is shown in Supplementary Figure Table 4). We believe the underlying mechanism is that the degradation process of SOM is sensitive to atmospheric temperature, which in turn influences the substrates of methanogenic archaea and governs their composition. Many reports demonstrated that temperature influences, by controlling both microbial metabolism and their substrate availability (Table 3). This is consistent with findings by others. For example, In this investigation, we found that both spatial distance and soil chemical variables, mainly focusing on soil C and N significantly contribute to the variation of paddy methanogenic archaeal community composition. Between these two factors, spatial distance plays a larger role . This finding is similar to the report of Figure 4). This latitude is very close to the important geographical line of China (Qinling Mountains-Huaihe River line), which traditionally distinguishes the south  and the north (warm temperate zone) China. For natural reasons, the north and the south adopt different agricultural managements, such as fertilization and water regimes, which can greatly influence soil physico-chemical properties and microbial diversities and functions. Consequently, paddy methanogenic archaeal composition is also influenced.Besides temperature, soil chemical variables  also have significant impacts on paddy methanogenic archaeal composition (We analyzed nine representative paddy soil samples in China and revealed that they harbor a phylogenetically diverse and quantitatively abundant methanogenic archaeal community, which is dominated by family Methano cellaceae, Methanobacteriaceae, Methanosaetaceae, and Methanosarcinaceae. Their abundance is influenced by soil C and N contents as well as alpha diversity by pH value. Both spatial distance and soil chemical variables, mainly about soil C and N, contribute to the variation of paddy methanogenic archaeal community composition, and the former could play a more predominant role. Because only several soil chemical parameters were focused, the relative importance of environmental variables on the variation in paddy methanogenic archaeal community composition at large scale might have been underestimated in this investigation. Meantime, spatial distance hosts a wide range of co-variables. Thus, a more robust and explicit investigation is needed to address the geographical distribution of paddy methanogenic archaea properly in future. As the ecologically important microbe, paddy methanogenic archaea have a critical role in ecosystem functioning and climate change. Thus the information on their biogeographic patterns would help us to get deeper insights into their ecology.YF, XL, and ZJ designed the study. QZ and BW performed the experiments. QZ, YS, and YF analyzed the data. YF, LZ, YD, and QZ wrote the paper. All authors reviewed the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Phenol oxidases (POs) catalyze the oxidation of dopa and dopamine to melanin, which is crucial for cuticle formation and innate immune maintenance in insects. Although, Laccase 2, a member of the PO family, has been reported to be a requirement for melanin-mediated cuticle tanning in the development stages of some insects, whether it participates in cuticle construction and other physiological processes during the metamorphosis of mosquito pupae is unclear.Anopheles sinensis Laccase 2 (AsLac2) was assessed from pupation to adult eclosion. Individuals showing an expression deficiency of AsLac2 that was produced by RNAi and their phenotypic defects and physiological characterizations were compared in detail with the controls.The association between the phenotype and the expression profile of AsLac2 in pupae caused the cuticle to be unpigmented, and produced thin and very soft cuticles, which further impeded the eclosion rate of adults as well as their fitness. Moreover, melanization immune responses in the pupae were sharply decreased, leading to poor resistance to microorganism infection. Both the high conservation among Laccase 2 homologs and a very similar genomic synteny of the neighborhood in Anopheles genus implies a conservative function in the pupal stage.During the dominant expression period, knockdown of Laccase 2. Our findings strongly suggest that Laccase 2 is crucial for Anopheles cuticle construction and melanization immune responses to pathogen infections during pupal metamorphosis. This irreplaceability provides valuable information on the application of Lacccase 2 and/or other key genes in the melanin metabolism pathway for developing mosquito control strategies.To our knowledge, this is the first study to report the serious phenotypic defects in mosquito pupae caused by the dysfunction of The online version of this article (doi:10.1186/s13071-017-2118-4) contains supplementary material, which is available to authorized users. Melanin is not only the substrate used for cuticle tanning in insects, but it is also involved in innate immune responses against exogenous pathogen infections through melanotic encapsulation \u20138. Thus,During pupal development, the cuticle gradually darkens and sclerotizes, which provides enough support for pupae to break out of the puparium, protects them from mechanical injuries, and facilitates the emergence of adults; in addition, some intermediates of melanin metabolism are known to be involved in encapsulation, which is helpful for the survival of the pupae in natural ecosystems , 11\u201316. Laccase 1 and Laccase 2, that have been identified in many insects [Laccase 2 is enriched in the epidermis, we speculated that it is also expressed in immune tissues, such as hemolymph or fat body, and may be involved in melanin synthesis, which participates in melanotic encapsulation immune responses. However, knowledge of Laccase 2 functions in cuticle tanning and pathogen resistance during mosquito pupal development is still limited.The metabolism of melanin with the hydroxylation of tyrosine to dihydroxy phenylalanine (dopa) by the rate-limiting enzyme tyrosine hydroxylase (TH), followed by the decarboxylation of dopa to dopamine by the dopa decarboxylase (DDC) , 17\u201319.  insects \u201344. Lacc insects , 35, 37, insects \u201344. In t insects , 40, 42. insects . This evLaccase 2 gene (AsLac2) in the pupal stage was performed by RNAi to better understand its function in the pupal development of Anopheles sinensis. Our results revealed that the pupae with an unpigmented cuticle developed abnormally, had a severe mortality rate, and were susceptible to exogenous microorganism infection. These findings support that AsLac2 is not only required for cuticle tanning, but also for melanotic immune responses of the malaria vector mosquitoes, Anopheles sinensis. Moreover, the high genomic synteny of the neighborhood of Laccase 2 in species of the genus Anopheles may be a strong indicator of the gene functional conservation in the specific developmental stages. The present study deepens our understanding of the function of the AsLac2 gene in mosquitoes and provides a new reference for mosquito control.Knockdown of the Anopheles sinensis LS-WX strain was reared at 27 \u00b0C with 80% humidity under a 12 h/12 h (light/dark) photoperiod. The larvae in the different developmental stages were fed fry food in clean water, and the adults were provided 10% glucose solution.The Anopheles sinensis genome and transcriptome databases using three insect Laccase 2 proteins  as queries. Fragments from the transcriptome data [https://www.dnastar.com/). The signal peptide was predicted by SignalP 4.1  and conserved domains were analyzed by SMART (http://smart.embl-heidelberg.de/). Total RNA was extracted from the pupae (after pupation 32 h) using the TRizol reagent  according to the manufacturer\u2019s instructions. Total RNA (1 \u03bcg) was reverse-transcribed with random primer using the First-Strand cDNA Synthesis Kit . Five pairs of primers were designed based on the putative AsLac2 sequence to obtain the full open reading frame (ORF). The sequence of 3\u2032UTR was obtained by the rapid amplification of cDNA ends (RACE) technique using the GeneRacer kit . PCR products were isolated and subcloned into PMD-19 vector  for sequencing. The primers are listed in Additional file BLAST analysis was performed to search homologous Laccase from the ome data  were asshttp://www.ncbi.nlm.nih.gov/) and Vectorbase (http://www.vectorbase.org/) using the BLASTP program. Amino acid sequences of the divergence part in the C-terminus were aligned with MUSCLE (http://www.ebi.ac.uk/Tools/msa/muscle/). The best-fit evolutionary model (WAG\u2009+\u2009G) and the genetic distance were estimated by MEGA 5.0 (http://www.megasoftware.net/) [An. gambiae Laccase 2 gene and its adjacent genes were used as the templates to search for Laccase 2 homologs in other insect genomes, and their genome locations and distributions were compared in detail. We selected 7.5 kb upstream DNA sequences of the Laccase 2 gene to predict cis-acting regulatory elements would respond to hormonal signals during pupal development using JASPAR (http://jaspar.genereg.net/) with 90% confidence settings.Homologous Laccase were searched in the NCBI database (re.net/) . MaximumAsLac2. The cuticle, fat body, and hemolymph of the pupae were dissected at 32 h after pupation for tissue expression pattern analysis. Gene expression was determined by qRT-PCR as previously described [Ribosomal protein L49 (RPL49) gene was used as the internal control  for phenotype observations  and gene expression analysis of AsLac2  were synthesized with a T7 RiboMAX\u2122 Express RNAi System  according to the manufacturer\u2019s instructions. For microinjection, the dsRNA was dissolved in RNase-free water and the concentration was estimated. Based on AsLac2 temporal expression patterns, each of the pupae was injected with 800 ng of dsRNA (volume: 180\u2013200 nl) into the thorax through the back of the dorsal plate within 2 h after the pupation according to the temporal expression pattern of AsLac2. A red fluorescent protein gene (dsRed) was used as the control. The tanning degree of the pupae was checked at 38 h after dsLac2 or dsRed injection, while the checking time for adults was 3 h after the eclosion. Three pupae or adults in the dsLac2- and dsRed-injected groups at each sampling point were also collected for qRT-PCR analyses [Ribosomal protein L49 (RPL49) gene was used as the internal control. The primers used for dsRNA synthesis are listed in Additional file Double-stranded RNA (dsRNA) of analyses . Each sa volume: 80\u2013200 nlLac2- and dsRed-injected groups were dissected under the microscope . All of the tissue treatments and slice preparations were carried out as previously described [https://imagej.net/Welcome) as previously described [Lac2- and the dsRed-injected groups, respectively.The dorsal plates of the adults from dsescribed . The thiescribed . Four eqSerratia marcescens (Sm) and Bacillus bombyseptie (Bb), were incubated to the logarithmic phase (OD600\u2009=\u20090.6\u20130.8) in LB medium at 37 \u00b0C. Individuals in the dsLac2- (failed to pigment) and the dsRed-injected groups were sampled according to the melaninization degree, and then injected with 0.12 \u03bcl of bacteria solution at 26 h after pupation, respectively . The pupal survival rate was recorded every 2 h after being infected. Six pupae at the same developmental stage of the same size were homogenized at 4 \u00b0C with 400 \u03bcl of PBS (pH\u2009=\u20097.0) and centrifuged (500\u00d7 g for 5 min at 4 \u00b0C). Total protein concentrations (8\u00a0mg/ml) were determined using the Bradford method . Melanization reactions were incubated at 30 \u00b0C for 3 h, followed by adding 1 mM of phenylthiourea (PTU) to terminate the reactions and A490 nm values were measured to estimate the amount of melanin. Each sample was used to perform three biological repeats.The pathogens, Anopheles sinensis Laccase 2 (AsLac2) is 4,391 bp (without poly A) with a 2,265 bp ORF encoding 754 amino acids, and a 2,126 bp 3\u2032UTR (GenBank Number: KY132102); a 26-residue signal peptide was predicted, suggesting it is a secreted protein. Conserved domain prediction revealed that AsLac2 contains three domains: Cu-oxidase3, Cu-oxidase, and Cu-oxidase 2  was significantly stronger than that in the adults  without overlapping with dsLac2. There were 80 and 66% of individuals whose cuticle was not tanned and flexible that were obtained in the dsLac2 and dsLac2-2 groups, respectively   Fig.\u00a0 was onlyak) Fig.\u00a0 of that ak) Fig.\u00a0. The expoup Fig.\u00a0. Our preing Fig.\u00a0, b and cing Fig.\u00a0. Howeveroup Fig.\u00a0. Obviousups Fig.\u00a0. Some ofLac2-injected group, pupa death started at 2 h after Bb challenge, then the mortality increased with the time going from 2 to 10 h and all individuals died at 10 h after the injection    Fig.\u00a0. Althoug01) Fig.\u00a0. The in pae Fig.\u00a0. In concons Fig.\u00a0. These rvia catalyzing the cross-linking among various cuticular components, such as proteins-proteins, proteins-melanin, or proteins-other quinones and/or quinone methides [Laccase 2 in a specific developmental stage should reflect the characteristics and changes of the cuticle. In the present study, the expression of AsLac2 was significantly upregulated in the middle and the late pupal stage  and more fine tissues, which can further help to understand its functions.Two alternative isoforms of  insects , 38. Theot Lac2B , 38. Altot Lac2B . In this reports \u201342, 44. TH, DDC etc.) required for melanin synthesis are distributed in immune tissues including fat body and hemolymph [AsLac2 was expressed in the pupal immune tissues  is important for immune responses , 55, 56.emolymph , 57, 58.emolymph , 34, theAnopheles sinensis. As a rate-limiting enzyme in the final step of melanin metabolism, Laccase 2 has a similar expression pattern as the initial rate-limiting enzyme gene TH in Anopheles sinensis [Laccase 2 and TH are crucial for normal pupal development. Our studies further corroborated that melanin metabolism is indispensable for the normal development of mosquito pupae. Therefore, the key genes and/or their regulatory elements in the melanin metabolism pathway may be valuable targets for mosquito prevention and control.To our knowledge, the present results are the first to illustrate that the suppression of Laccase 2 results in serious adverse effects, which are almost lethal for the wild mosquitoes during the pupal development of sinensis . SilenciAdditional file 1: Table S1.Primers used in this study. (XLSX 11 kb)Additional file 2: Table S2.Amino acid sequence identity of Cu-oxidase domains of LAC2 orthologs. (PDF 109 kb)Additional file 3: Table S3.cis-acting transcriptional regulatory elements upstream. 7.5\u00a0kb of Laccase 2. (XLSX 9 kb)Prediction of Additional file 4: Table S4.Statistical analysis of pupal cuticle tanning degree in the RNAi experiment at 38 h after pupation. (DOC 28 kb)Additional file 5: Figure S1.a Predicted alternative splicing forms of AsLac2. Red and green boxes represent the special exon of Laccase 2A and Laccase 2B, respectively. b Maximum Likelihood phylogenetic tree of two Laccase 2 forms in different insect species. c Genetic distance estimations among LAC2As (red) and LAC2Bs (yellow). (PDF 97 kb)Alternative splicing and amino acid sequence analyses of Laccase 2 in representative insect species. Additional file 6:Anopheles sinensis. (DOCX 15 kb)Dataset 1. The identified Laccase 2A and the predicted Laccase 2B isoform in Additional file 7: Figure S2.AsLac2 in pupal cuticle, fat body, and hemolymph. AsRPL49 was used as the internal control. (PDF 72 kb)Gene expression patterns of"}
+{"text": "The peptide SP1-1 was targeted to the apoplast which is the primary infection site for plant pathogens, by fusing SP1-1 peptide to the signal peptide RsAFP1 of radish (Raphanus sativus). The pathogen inducibility of the expression was enabled by using an optimized inducible 4XW2/4XS promoter. As a result, the tomato fruits of independently generated SP1-1 transgenic lines were significantly more resistant to X. campestris pv. vesicatoria than WT tomato fruits. In transgenic lines, bacterial infection was reduced up to 65% in comparison to the infection of WT plants. Our study demonstrates that the combination of the 4XW2/4XS cis-element from parsley with the synthetic antimicrobial peptide SP1-1 is a good alternative to protect tomato fruits against infections with X. campestris pv. vesicatoria.Antimicrobial peptides (AMPs) are small peptides with less than 50 amino acids and are part of the innate immune response in almost all organisms, including bacteria, vertebrates, invertebrates and plants. AMPs are active against a broad-spectrum of pathogens. The inducible expression of AMPs in plants is a promising approach to combat plant pathogens with minimal negative side effects, such as phytotoxicity or infertility. In this study, inducible expression of the  The production of antimicrobial peptides (AMPs) is a conserved mechanism of the innate immune system to protect organisms against pathogens. AMPs can be generated by many different species ranging from bacteria and plants over to mollusks and vertebrates. Generally, AMPs are small peptides, between 8 to 50 amino acids in size and can be categorized according to their amino-acid composition, size and conformation. The largest group of AMPs is the cationic peptides, which can be further subdivided into three groups. Alpha helical peptides like magainins and cecropins, stabilize \u03b2-sheet peptides with several cysteine residues to form disulphide bonds like defensins and peptides, which contain proline- and arginine rich regions ,2.The classical mode of action of AMPs is permeabilization of target cell membranes by interacting with negatively charged compounds, such as hydroxylated phospholipids or teichonic acids ,4. Recenhttp://aps.unmc.edu/AP) . No. Nocis-eicatoria . All theFor improvement of a regeneration protocol, cotyledon explants of 7 to 10 days old tomato plants (Micro Tom) were used. Pre-cultivation of cotyledons on callus induction medium (PM) for 2 to 3 days followed by 2 weeks on shoot regeneration medium significantly improved shoot regeneration . For optAgrobacterium-mediated transformation approach. To avoid the uses of antibiotic or herbicide resistance marker genes for generation of tomato transgenic plants, mannose selection strategy has been chosen. The tomato plants derived from different calli were considered as independent events. In total, 14 plants were analysed. PCR amplification using primers annealing at the RsAFP1-TNos region confirmed the presence of the transgene in the lines T-583-4, T-583-5 and T-583-6, whereas no amplification was obtained in WT tomato samples , so for all further analyses T0 plants were used. Importantly, no significant difference in plant morphology, root and shoot development was observed between transgenic and wild type plants  were treated with Pep25 and were harvested at different time points . SP1-1 expression was monitored by RT-PCR. SP1-1 transcripts were detected in transgenic lines 3 hours after induction with Pep25 (SP1-1 expression was absent in untransformed tomato plants (negative control) and also in T583 line 22 h after induction. Additionally, we tested the induction of SP1-1 by X. campestris pv. vesicatoria in transgenic plants harboring PMIGW-4XW2/4XS::SP1-1. SP1-1 transcript levels were analysed by quantitative RT-PCR in tomato fruits of T0 lines . 36 h after inoculation enhanced expression of SP1-1 was observed in the different transgenic lines (3 to 40-fold)  . Those rX. campestris pv vesicatoria and infection symptoms of tomatoes were analyzed. For the resistance assays, plants from at least three independent transgenic lines  were selected and fruits were inoculated with X. campestris pv vesicatoria . However, a significant difference in PR1 expression between treated and untreated fruits  could be only observed in T583-5 plants, concluding that in general plant immune response upon bacterial challenge is quite low. Taken together, these results indicate that expression of SP1-1 significantly improves resistance in tomato fruit resistance against Xanthomonas vesicatoria pv campestris infection.The detection of recombinant peptide SP1-1 is not possible due to lack of anti-SP1-1 antibodies for immunoblot analyses. Therefore, synthesis and accumulation of SP1-1 was confirmed by resistance analysis of the transgenic plants. Tomato fruits from WT and transgenic tomato plants were inoculated with icatoria . Fruits icatoria . Brownisicatoria . The numicatoria . For linicatoria . SlightlPlant diseases, alongside climate change and soil erosion, are the leading cause of diminished crop yields worldwide. On average, at least 10% of crop yields are lost around the world due to plant infections . Chemicade-novo designed AMP SP1-1 under control of a pathogen inducible promoter were generated. We choose SP1-1 because this peptide has been optimized in terms of activity, specificity and reduced toxicity against human blood and plant cells [Nicotiana benthamiana plants has been described [Xanthomonas campestris pv. vesicatoria.In this study, transgenic tomato plants expressing the nt cells . In addiescribed . In geneescribed ,48. ThusPseudomonas solanacearum and Pseudomonas syringae pv tabaci although the plants were expressing the AMP. This surprising result could be explained by the degradation of the peptide by endogenous host proteases [Xanthomonas campestris pv. vesicatoria or tomato plant-apoplast fluid . Secondly, the functionality of 4XW2 cis-elements could be demonstrated by transient expression of GFP in tomato TH3 protoplasts. Interestingly, the protoplasts showed a low background expression in non-induced cells, which can be explained by a stress response to protoplast preparation. Previous reports in Arabidopsis demonstrated that W2 and S cis-elements from the PR1 and the EL17 promoter show both a low level of background expression and an induction of transcription by wounding [X. campestris pv. vesicatoria than WT plants  were transiently transformed into TH3 tomato protoplasts using a modified PEG method. GFP fluorescence was analysed 12 h after Pep25 treatment (A). Non-transformed protoplasts were used as a negative control (C-D). Scale bar: 25 \u03bcm.(PDF)Click here for additional data file.S2 Fig(A) Tomato seedlings growing in MS medium. (B) Shoot formation was induced on PM/SI-2 media after 4 weeks. (C) Callus and shoot formation was induced on PM3/SI-2 media after 4 weeks. (D) Plant regeneration rate in percent. (E) Fertile regenerated plants growing in a climate chamber.(PDF)Click here for additional data file.S3 FigA PCR was performed using primers targeting the binary vector backbone. The following primers have been used: Ext-Flanking-Forward 5`-GAAGCCATGAAAACCGCCAC-3`; Ext-Flanking-Reverse 5`-GCCTGTCGCGTAACTTAGGA-3`. The binary vector pMIGW7/SP1-1 was used as positive control.(PDF)Click here for additional data file.S4 FigRepresentative standard curves of Real-time PCR amplification of the Phosphomannose isomerase (PMI) gene (A) and the Lat52 endogenous gene (B). Representative standard curve were obtained from the amplification of twofold serial dilutions of DNA from line T583. Axis: Cycle threshold (Ct) value versus the logarithmic concentration (ng) of total DNA. Dark dots represent the 6 points analyzed by triplicate.(PDF)Click here for additional data file.S5 Fig2) or 1, 2 and 3 days after inoculation with X. campestris pv. vesicatoria. (B) Incidence of infection symptoms 1, 2 and 3 days after inoculation with X. campestris pv. vesicatoria is given in percentage. The values represent the mean of three independent experiments +/- SE.(A) Disease development in wild-type (WT) and T1 transgenic tomato fruits carrying the transgene SP1-1 , after mock treatment (MgCl(PDF)Click here for additional data file.S6 FigPR1 was analyzed by quantitative RT-PCR in tomato fruits of T583-4, T583-5 and T583-6 36 h after inoculation with X. campestris pv. vesicatoria and normalized to two internal reference genes (ubiquitin and actin). Expression of PR1 after Mock treatment (MgCl2) was set to 1. Fold change of expression of PR1 in X. campestris pv. vesicatoria treated samples is given relative to the expression in Mock treated samples. Data are the mean \u00b1SD of two to three biological replicates. Significant differences from the control are indicated: ***, P<0.001 **, P<0.01 and *, P<0.05.Expression of (PDF)Click here for additional data file."}
+{"text": "Objective: To investigate acute sleep deprivation (SD)-related regional brain activity changes and their relationships with behavioral performances.Methods: Twenty-two female subjects underwent an MRI scan and an attention network test at rested wakefulness (RW) status and after 24 h SD. The amplitude of low-frequency fluctuations (ALFF) was used to investigate SD-related regional brain activity changes. We used the receiver operating characteristic (ROC) curve to evaluate the ability of the ALFF differences in regional brain areas to distinguish the SD status from the RW status. We used Pearson correlations to evaluate the relationships between the ALFF differences in brain areas and the behavioral performances during the SD status.Results: Subjects at the SD status exhibited a lower accuracy rate and a longer reaction time relative to the RW status. Compared with RW, SD showed significant lower ALFF values in the right cerebellum anterior lobe, and higher ALFF areas in the bilateral inferior occipital gyrus, left thalamus, left insula, and bilateral postcentral gyrus. The area under the curve values of the specific ALFF differences in brain areas were . Further, the ROC curve analysis demonstrated that the ALFF differences in those regional brain areas alone discriminated the SD status from the RW status with high degrees of sensitivities  and specificities . The accuracy rate showed negative correlations with the left inferior occipital gyrus, left thalamus, and left postcentral gyrus, and showed a positive correlation with the right cerebellum.Conclusions: The ALFF analysis is a potential indicator for detecting the excitation\u2013inhibition imbalance of regional cortical activations disturbed by acute SD with high performances. Sleep is a necessary physical need for normal life, and we spend nearly one-third of our life sleeping. Sleep deprivation (SD), widespread in the current society, is caused by environmental factors or personal reasons and generally has deleterious effects on emotional regulation, memory, attention, and executive control function \u20135. Long-Resting state functional MRI (rfMRI) does not need the use of radioactive tracers and can combine functional and structural images, making the imaging method suitable for exploring the mechanisms of and obtaining insights into the pathophysiology of diseases ; furtherAmplitude of low-frequency fluctuations (ALFF) measurement has the ability to locate where (in which brain region) regional spontaneous brain activity was disturbed with less computation complexity and high test\u2013retest reliability characterization \u201324. ThesThe present study was approved by the Medical Research Ethical Committee. The Affiliated Huaian No.1 People's Hospital of Nanjing Medical University. Twenty-two healthy female subjects  were recruited. All subjects met the following criteria as in previous studies , 6: (1) Each of the subjects underwent the MRI scan twice, once during RW status and the other after 24 h acute SD. The acute SD session started from 19:00 p.m. on the first day and lasted until 7:00 p.m. on the second day. Before the MRI scan, all volunteers underwent an attention network test , 27. FooThe MRI examination was performed using an acquired clinical 3.0-Tesla MRI scanner  with a standard eight-channel head coil. First, we acquired a high-resolution 3D anatomical image with 176 T1-weighted images in a sagittal orientation: repetition time = 1,950 ms, gap = 0 mm, echo time = 2.3 ms, thickness = 1 mm, acquisition matrix = 248 \u00d7 256, flip angle = 9\u00b0, field of view = 244 \u00d7 252 mm. Second, we also acquired 240 functional images using a single-shot gradient-recalled echo-planar imaging pulse sequence .http://rfmri.org/DPABI) toolbox, adopting the Digital Imaging and Communications in Medicine (DICOM) standard for form transformation, slice timing, head motion correction, spatial normalization, and spatial smoothing using a Gaussian kernel of 8 \u00d7 8 \u00d7 8 mm3 full-width at half-maximum. Participants with more than 1.5 mm maximum translation in x, y, or z directions and 1.5\u00b0 of motion rotation were removed. After the head motion correction, the rest of the functional images were spatially normalized and resampled to Montreal Neurological Institute (MNI) space at a resolution of 3 \u00d7 3 \u00d7 3 mm3. Linear regression was applied to remove several sources of possible spurious covariates, including 24 head motion parameters obtained in the realigning step, signal from a region in the cerebrospinal fluid or/and centered in the white matter, and global signal averaged over the whole brain. After preprocessing, the time series were further linearly detrended and temporally band-pass filtered (0.01\u20130.1 Hz). The details of the ALFF calculation have been reported in previous studies , and a chi-squared (\u03c72) test was used for categorical data (gender). p < 0.05 was considered to be a significant difference.Data are presented as mean \u00b1 standard deviation (mean \u00b1 std). Pair t-test was used to investigate the ALFF differences in regional brain areas of the subjects during the acute SD status relative to the RW status with the gender, age, and years of education as nuisance covariates of no interest. AlphaSim correction  was used to determine the statistical differences.A pair p < 0.05.We used the ROC curve to evaluate the ability of the ALFF differences in regional brain areas to distinguish the SD status from the RW status, and we used Pearson correlations to evaluate the relationships between the ALFF differences in brain areas and the behavioral performances during the SD status. The statistical threshold was set at t = \u22122.125, p = 0.046) and a longer response in reaction time .Compared with the RW status, the acute SD status had a lower response in accuracy rate  and specificities  with cut-off points of \u22120.351, 0.206, 0.2065, 0.1155, \u22120.8015, \u22120.405, and \u22120.3095 , respectively .The accuracy rate demonstrated a positive correlation with the ALFF value in the right cerebellum anterior lobe , left thalamus, left insula BA 13), and bilateral postcentral gyrus. Furthermore, during the SD status, the accuracy rate showed correlations with the beta value of ALFF differences in those brain areas. Recently, the ROC curve is widely used to evaluate the reliability of a neuroimaging technique in distinguishing one group from another group , and bil, 24. In In a previous study, a total of 16 healthy subjects  were recruited, and SD was found to be associated with several ALFF differences in brain areas ; howeverThe hyperarousal and increased glucose utilization in patients with chronic primary insomnia were found in neurocognitive, neuroimaging, and physiological studies \u201332. Hyper = 0.496, p = 0.019). The decreased regional brain activity in the right cerebellum anterior lobe may reflect that the sleep-deprived brain needs to attempt to recruit more specific brain areas with advanced cognitive functions to accomplish the cognitive performance because of a continuing decline in the cerebellum activity. Interestingly, Wang et al. showed different findings of altered SD-related regional brain activities in several areas (The lower ALFF values in brain areas may indicate a consistent decrease of regional neuronal activity with poor synchronization and without in order . Poor real areas . Since tal areas , we therIn summary, the ALFF analysis is a useful index to locate the underlying altered regional brain activities in individuals during the SD status relative to the RW status with high degrees of sensitivities and specificities. SD is associated with the model of excitation\u2013inhibition imbalance of cortical activations. These findings expand our knowledge and may help in deeper understanding of the neurobiological mechanisms underlying acute SD. Furthermore, the gender factor should be taken into account in the neuroimaging studies of sleep disorders. However, there are several potential limitations that should be noted. First, our study has a relatively small sample size and future studies on a larger number of sample sizes are necessary to corroborate our findings. Second, in our study the design of replication is not addressed. Third, the electronystagmogram has been used to dynamically monitor the sleep.LC wrote the main manuscript text. JZ conceived and designed the whole experiment. LC and XQ collected the data. JZ analyzed the data.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Individual, social and situational factors might play an important role on the experience of anxiety during musical performances. The present research focused on the relationship between self-representations, including musical self, and performance anxiety among a sample of Italian professional and amateur musicians . We predicted that higher self-discrepancies  would be associated with higher performance anxiety in a musical setting , via musical self, and only in professional musicians. The results confirmed our hypothesis. Higher discrepancies between actual and future self-representations were positively associated with higher performance anxiety levels via the musical self only in participants who play instruments at a professional level. Furthermore, musical self influenced performance anxiety levels in a music related setting  but not in a non musical one . Musical performance requires high levels of skill in several areas. Musicians need years of intensive training to develop the required sensorial, cognitive, and behavioural skills . FurtherMany world-renowned musicians  have experienced music performance anxiety with negative physical and psychological consequences . It coulWhen an individual faces a threat, the human body reacts through a series of physical changes useful to facilitate fight, flight or freeze response behaviours . AnxietyResearch on musical performance anxiety has focused on several individual, social and situational factors like motivation, personality traits, emotions, type of instrument, performance setting, presence of an audience or type of performance . MotivatAccording Musicians tend to react differently to an audience depending on their professional level. Music students experienced high levels of anxiety in front of an audience but more experienced students performed better than less experienced peers under anxiety conditions . AdditioRepresentations about oneself shape and affect individuals\u2019 behaviors, cognitions and emotions. These representations might concern beliefs about one\u2019s own actual, ideal, undesired, future, or professional self . The terSelf-representations drive cognitions, emotions and behaviours and facilitate performances by focusing on explicit goals and by strategically implementing plans of actions . Self-rePerformances, goals and careers are also affected by self-concept . Self-imSome studies have examined the role of self representations in musicians  focusingThe present study focused on the relationship between self-representations and anxiety among a sample of Italian professional and amateur musicians. We predicted that self-discrepancies  would be negatively associated with musical self, thus higher self-discrepancies would be associated to a less positive representation of the musical self. We expected also that musical self would be negatively associated with music performance anxiety, thus a more positive representation of the musical self would be associated with lower levels of performance anxiety. Finally, we predicted that higher self-discrepancies  would be associated with higher performance anxiety in a musical setting as compared to a non-musical one, via the musical self, and only in professional musicians see .n = 50 professionals, n = 50 males) with an average age of 23.40  and an average of 11.26 years of playing an instrument .The sample consisted of 100 musicians  effects on self-representations discrepancies , musical self, and performance anxiety (exam and concert).t(98) = 4.757, p < .001 and on concert performance anxiety t(98) = 2.222, p = .03. Professional participants showed higher self-representations discrepancies and concert performance anxiety compared to amateur participants  ants see .In Amateur participants, we found medium negative correlations between self discrepancies and exam performance anxiety. Furthermore, we found medium negative correlation between musical self and concert performance anxiety. In Professional participants, self discrepancies were negatively related with musical self and positively with exam anxiety. Musical self was also negatively related with concert performance anxiety see .Zero order correlations, means and standard deviations for self-representations discrepancies , musical self, and performance anxiety (exam and concert) are shown in To test our hypothesis we followed Firstly, we tested through a multiple hierarchical regression analyses  the effeb = -.25, t(98) = -3.066, p = .003 on musical self, 2Radj = .10, F = 4.67, p = .004. The addition of the interaction term significantly contributed to the regression model, 2changeR = .04, changeF  = 6.39, p = .01. The interaction between self discrepancies and the professional level was significant, t(96) = -2.528, p = .01, suggesting that the effect of self discrepancies on musical self depends on professional level. Simple slopes analysis showed that self-discrepancies did not significantly affect musical self for amateur musicians. On the other hand, high discrepancies between actual and future self had a significant negative effect on musical self-representation for professional musicians, b = -.45, SE = .14, t(96) = -3.189, p = .002  = 17.944, p < .001. As hypothesized, musical self-representation and professional level were not significantly associated with performance anxiety in a non-musical setting (exam).After testing the path between the predictor and the proposed mediator, we tested the paths between musical self representation and performance anxiety (exam and concert) through a series of regression analyses with musical self representation and professional level entered simultaneously in the model. Only musical self-representation had significant influence on concert performance anxiety: more positive musical self-representation was significantly associated with lower concert performance anxiety, SE = 1.23, 95% CI , indicating that professional level moderated the mediation effect of musical self on the relationship between self-discrepancies and concert performance anxiety. Specifically, the indirect effect of self-discrepancies on concert performance anxiety via musical self was significant only for professional musicians, ab = 3.02, SE = 1.21, 95% CI .Finally, to test if the indirect effects of self-discrepancies on performance anxiety through musical self (mediator) depend on professional level or not, we used the Model 7 of the PROCESS macro . We testStudies on musicians\u2019 performance anxiety have explored different individual, social and situational variables like motivation, personality, emotions, or performance setting . PerformThe present research focused on the relationship between self-representations and anxiety among a sample of Italian professional and amateur musicians. More specifically, we predicted that higher self-discrepancies  would be associated with higher performance anxiety in a musical setting as compared to a non-musical one, via the musical self, and only in professional musicians.The results supported our prediction that self-discrepancies  were negatively associated with the representation of musical self, thus higher discrepancy between actual and future self was associated with less positive representation of musical self. These results seems support the motivational role of possible selves , especiaCoherently with previous results and with our predictions, musical self was negatively associated with performance anxiety only in a musical setting (concert). These results support the idea that performance setting could play an important role. Previous research  already A major concern of the present study was that music performance anxiety was measured with only a self-reported measure. Future studies should explore the effect of self dimensions on anxiety levels through the use of physiological and behavioural measures . FurtherAnother limit is related to the use of a correlational design. Previous studies have addressed already the causal path linking self-images discrepancies to anxiety  employinThe results of the present study showed for the first time that self-representations discrepancies were associated with performance anxiety in a musical setting , via musical self, only in professional musicians, thus extending previous literature on the relationship between possible selves  and musi"}
+{"text": "Chronic heavy drinking and alcoholism can have serious repercussions for the functioning of the entire nervous system, particularly the brain. These effects include changes in emotions and personality as well as impaired perception, learning, and memory. Neuropathological and imaging techniques have provided evidence of physical brain abnormalities in alcoholics, such as atrophy of nerve cells and brain shrinkage. At the cellular level, alcohol appears to directly affect brain function in a variety of ways, primarily by interfering with the action of glutamate, gamma-aminobutyric acid, and other neurotransmitters. Neurological disorders also can result from vitamin deficiency and liver disease, two health problems that commonly occur with alcoholism. Other hypotheses, based on factors such as aging, gender, and genetics, have been developed to explain various alcohol-related neurological consequences. Many pharmacological treatments to improve neuropsychological functioning in alcoholics have been tested, but none has proved entirely successful. With prolonged abstinence, however, slow recovery of cognitive functioning can occur in some cases. Alcohol consumption can damage the nervous system, including the brain. Consequently, alcoholicsImages of the brain created with modern neuroradiological techniques, such as magnetic resonance imaging (MRI) and computed tomography (CT), generally show a relationship between prolonged alcohol consumption and changes in the brain\u2019s structure . For exaThis article reviews some of the physical brain changes and neuropsychologicalAlcohol has effects on both major components of the nervous system\u2014the central nervous system  and the peripheral nervous system .Alcohol can have a negative effect on certain neurological processes, such as temperature regulation, sleep, and coordination. For example, moderate amounts of alcohol lower body temperature. Severe intoxication in a cold environment may produce massive, life-threatening declines in temperature . Many people mistakenly believe that alcohol can help warm them in cold weather. This notion can be especially dangerous for the homeless, for elderly people living in inadequately heated quarters, and for those exposed to prolonged cold temperatures outdoors.In addition to its effect on body temperature, alcohol interferes with normal sleep patterns. Relatively small doses of alcohol can cause early sedation or sleepiness, awaking during the night, and suppression of rapid-eye-movement (REM) sleep. REM sleep is the dreaming stage of sleep; when REM sleep occurs near wakefulness, it often produces vivid hallucinations. Most people fall asleep easily after one or more alcoholic drinksAnother prominent effect of chronic alcohol consumption is harm to the part of the brain called the cerebellum , resultiA peripheral nervous system disorder commonly seen in alcoholics is numbness and weakness in the hands and feet . This condition is thought to be largely a consequence of malnutrition in severe alcoholics. One type of peripheral nerve damage known as Saturday night palsy can occur when an alcoholic puts pressure on vulnerable nerves in the arm while lying in an intoxicated stupor, leaving him or her unable to extend the wrist for days to weeks.In addition to changes in temperature regulation, sleep, and coordination, alcoholism-related brain changes can cause abnormalities in mental functioning that are detectable using specialized neuropsychological tests. Behavioral neurologists and neuropsychologists use these sensitive tests to measure both the obvious and the subtle consequences of brain damage. Results of the tests often show changes in emotions and personality as well as impaired perception, learning, and memory  after damage to particular brain systems see .One of the most severe consequences of long-term alcoholism on mental functioning is Korsakoff\u2019s syndrome (KS), a devastating memory disorder in which a person appears to forget the incidents of his or her daily life as soon as they occur see . BecauseAlthough KS destroys short-term memory, it typically spares most long-term memories . Thus, overall intelligence, as measured by standardized IQ tests, does not necessarily deteriorate, because the types of information and abilities tapped by these tests usually involve long-term memory.Within the past 25 years, clinical and experimental observations of patients with and without KS have revealed many other neuropsychological dysfunctions associated with alcoholism. Alcoholics demonstrate poor attention to what is going on around them; need extra time to process visual information; have difficulty with abstraction, problem-solving, and learning new materials; exhibit emotional abnormalities and disinhibitions; and show reduced visuospatial abilities  . The oncThe type and extent of structural damage to brain tissue can be determined by autopsy  examination of the brain\u2019s components and individual nerve cells . In addition, neuroradiological techniques, such as MRI and CT scans, allow the brain to be viewed inside the skull of a living person. Other neuroimaging techniques  measure active brain functioning. Functional neuroimaging can reveal changes in the blood flow in and around the brain, brain metabolism, and brain electrical activity generated by nerve impulses .When applied to alcohol research, neuropathological and imaging techniques have helped to provide cumulative evidence of brain abnormalities in alcoholics, such as atrophyCountless intricate pathways of neurons link the different areas of the brain, including the regions implicated in alcohol-related neurological dysfunction. Because of the size and complexity of this network, the consequences of damage to one structure or system often can resemble the consequences of damage to another. The following sections describe alcohol-related structural and neuropsychological changes that can occur in the brain.The limbic system is an intricate network of structures located deep inside the brain; its functions are diverse and varied. One function of the limbic system receiving attention from alcohol researchers is memory. Memory loss similar to the amnesia in KS patients has been associated with damage to the hippocampus and the amygdala, parts of the limbic system that are located in the temporal lobes of the brain see . AlthougAlcohol researchers are interested in other functions of the limbic system as well. Damage to certain parts of the limbic system leads to abnormalities in emotional functioning, the sense of smell , and the ability to use one sense  to learn something in another sense  . In all these categories of function, researchers have observed deficits in alcoholics . MoreoveThe diencephalon, a region nestled in the center of the brain, acts like a way station for nerve signals moving from one area of the brain to another. Although it is not known precisely what role diencephalic structures play in human memory functioning, lesions in this region have been clearly documented in amnesic patients . ResearcThe cerebral cortex is the intricately folded outer layer of the brain composed of nerve cell bodies . It is considered to be the center of higher consciousness and the seat of all intelligent behavior. The cortex makes neural connections, both directly and indirectly, with all parts of the nervous system and, therefore, with all parts of the body.As noted previously, neuroradiological evidence has revealed a widening of the fissures and sulci of the cerebral cortex and enlargement of the ventricles in brains of alcoholics. These changes suggest cortical atrophy associated with alcoholism . The eviIn most studies of alcohol-related neurological disorders, researchers have assessed neuropsychological deficits in alcoholics without examining changes in alcoholics\u2019 brains. To better understand brain-behavior relationships, however, neuropsychological, structural, and functional changes must be evaluated to relate changes in behavior to damage in particular systems of the brain. In studies using both methods, in fact, results have not revealed consistent relationships between cortical damage and performance on neuropsychological tests. Some measures of brain structure or function have correlated with cognitive test scores, whereas others have not. For example, one study reported a relationship between certain neuropsychological test scores and measures of frontal brain metabolism in long-term alcoholics; the same study, however, found no correlation between neuropsychological performance and degree of cortical atrophy as seen using MRI . The resThe most consistently and frequently reported findings in alcoholics, based on functional and structural imaging techniques, have been abnormalities in frontal brain regions . Specialized proteins on the surface of neurons, known as receptors, recognize neurotransmitters and initiate the cell\u2019s response. Neurotransmitters and receptors cluster where nerve cells come into close contact; these contacts are called synapses. Some neurotransmitters stimulate  a response from the neurons that receive them; others inhibit neuronal response. Over periods of days and weeks, the levels of receptors change in response to chemical and environmental influences  on the neurons. Genes in the neuron\u2019s DNA are turned on or off, increasing or decreasing the synthesis of receptors. Over time, drugs that excite a given receptor generally lead to a reduction in  the numbers or activity of that receptor type. Drugs that inhibit a receptor eventually tend to lead to an increase in  that type of receptor. Up-and down-regulation are means by which the nervous system maintains a functional balance of neurotransmitters and receptors; when imbalances occur, effects can include seizures, sedation, depression, agitation, and other mood and behavioral disorders.The major excitatory neurotransmitter in the human brain is glutamate, an amino acid. Glutamate has a fundamental role in a cellular adaptation called long-term potentiation, which is a persistent increase in the efficiency of a neuron\u2019s response to a neurotransmitter. Long-term potentiation may be an important mechanism in learning and memory.Extremely small amounts of alcohol have been shown to interfere with glutamate action. This interference could affect multiple brain functions, including memory, and it may account for the short-lived condition referred to as \u201calcoholic blackout.\u201d Because of its inhibitory effect on glutamate, chronic consumption of alcohol leads to up-regulation of glutamate receptor sites in the hippocampus, an area that is crucial to memory and often involved in epileptic seizures. During alcohol withdrawal, glutamate receptors that have adapted to the continual presence of alcohol may become overactive. Glutamate overactivity has been linked repeatedly to cell death in situations ranging from strokes to seizures. Deficiencies of thiamine and magnesium, which are common in alcoholics as a result of malnutrition, may contribute to this potentially destructive overactivity.Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the central nervous system. Evidence suggests that alcohol initially potentiates GABA effects; in other words, it increases inhibition, and often the brain becomes mildly sedated. But over time, chronic alcohol consumption reduces the number of GABA receptors through the process of down-regulation. When alcohol is eventually withdrawn, the loss of its inhibitory effects, combined with a deficiency of GABA receptors, may contribute to overexcitation throughout the brain. This effect, in turn, can contribute to withdrawal seizures  within 1 or 2 days.Alcohol directly stimulates release of the neurotransmitter serotonin as well as natural substances related to opioids  that may contribute to the \u201chigh\u201d of intoxication. Serotonin helps regulate functions such as food and water intake, sexual response, and aggression. Changes in other neurotransmitters, such as acetylcholine  and the catecholamines (the decreased transmission of which has been linked to the memory deficits of patients with KS ), have bAlcohol disrupts neuron activity in various other ways. For example, over several weeks, alcohol reduces the level of nerve growth factors, proteins important for cellular adaptation and survival. In addition, alcohol may cause long-term adaptive changes in membrane lipids.Alcoholism is a multidimensional disorder, and no simple answers exist to questions such as: \u201cWhat are the neurological consequences of alcoholism?\u201d; \u201cWhat makes alcoholism affect different people in different ways?\u201d; or even \u201cWhat causes someone to become an alcoholic in the first place?\u201d Widespread individual differences occur in the manifestation of alcoholism. For example, according to one estimate, 50 to 85 percent of non-KS alcoholics exhibit signs of cognitive decline see . Thus, aTwo common health problems occurring with alcoholism are vitamin deficiency and liver disease, both of which can result in neurological disorders. As mentioned previously, prolonged drinking with improper diet and associated malnutrition can lead to thiamine deficiency, a possible factor in KS-related brain damage. Several investigators have stressed the idea that damage in the diencephalon of KS patients is caused by thiamine deficiency, whereas cortical abnormalities, most notably in the frontal lobes, are caused by alcohol neurotoxicity or other conditions frequently associated with alcoholism .Researchers differ in their explanations of how and why particular neuropsychological deficits are displayed in alcoholics. One theory proposes that alcoholics may fall into subgroups distinguished by whether their brains are vulnerable to the direct neurotoxic effects of alcohol, to thiamine deficiency, or to both factors . AccordiAlcohol-related liver disease also contributes to neurological disturbances associated with heavy drinking . The risaccelerated aging version of the hypothesis, aging starts to accelerate at whatever age problem drinking begins. This version predicts that young alcoholics will become old before their time and that neuropsychological and brain changes in alcoholics will mimic those found in chronologically older nonalcoholics. According to the increased vulnerability version of the premature aging hypothesis, vulnerability to alcohol-related brain damage is hastened only in people over age 50, in whom the normal manifestations of aging already have begun. This version suggests that because of the increased vulnerability of their brains to alcohol-related damage, older alcoholics will suffer more age-related symptoms and impairment than their nonalcoholic peers and younger alcoholics.When researchers first began to study the effects of alcohol on the brain, they observed structural brain changes in alcoholics similar to those seen in nonalcoholic subjects as a result of normal chronological aging. These observations gave rise to the \u201cpremature aging hypothesis.\u201d Two versions of the hypothesis exist, each with different propositions concerning the period in an alcoholic\u2019s life during which premature aging begins  also may increase alcohol-related problems in this group. For example, alcohol-medication interactions can have neuropsychological consequences ranging from drowsiness to disorientation; physical effects can include hemorrhage, malnutrition, and liver damage, which also can lead to neuropsychological problems.Controversy exists over whether and to what extent chronic alcoholism affects women\u2019s brains differently from men\u2019s brains . ResultsSince research suggests that alcohol may affect brain structure differently in men and women, one might also expect to see gender differences in the neuropsychological consequences of alcoholism. One way of studying possible neuropsychological disparities between male and female alcoholics is to examine gender differences in the functioning of the brain\u2019s two hemispheres . This question may be important because structural differences in men\u2019s and women\u2019s brains may be one factor underlying gender differences in perceptual asymmetries and other neuropsychological responses to alcohol. Normally, in both men and women, the left and right sides of the brain have disproportionate  abilities to process linguistic  and non-verbal  information. The left hemisphere usually is more efficient than the right with linguistic signals, and the right hemisphere is more efficient than the left for nonverbal signals. Scientists can study differences in hemispheric asymmetries using procedures called laterality tasks, which are sensitive to left and right hemisphere functioning. Laterality tasks allow researchers to conduct experiments in which conflicting visual, auditory, or tactual stimuli are sent simultaneously to the two halves of the brain. These tasks allow researchers to measure whether the left or the right side of the brain copes better with the competing information. With visual laterality tasks, the signals are presented on a computer screen; with auditory laterality tasks, the signals are presented through stereo earphones; and with touch tasks, the stimuli are given to the right and left hands. When research participants receive the stimuli, the side of the brain that is dominant for that material will favor the information coming into the side that is contralateral, or opposite, to that hemisphere. In experiments using auditory laterality tasks, for example, researchers may present two words  or two excerpts of music simultaneously to a subject, who then may be asked to identify the words or melodies he or she just heard. The left side of the brain, which is dominant for language, will favor words coming into the right ear, and the right half of the brain, which is dominant for music, will favor melodies coming into the left ear.Studies comparing the separate functions of the left and right cerebral hemispheres have relied mainly on male research participants; no consistent pattern of abnormalities in alcoholics has emerged . On tests sensitive to frontal lobe functions  however, only alcoholics with a positive family history of alcoholism performed poorly .Studies suggest that slow recovery of cognitive functioning occurs in alcoholics who remain abstinent for at least 4 weeks, and certain indicators of impairment  have been shown to improve with prolonged abstinence . AlthougFor example, in a study of cognitive recovery over a 14-month period, alcoholics who remained abstinent performed better than relapsers , but absSeveral hypotheses have been proposed to explain the diversity of neuropsychological abnormalities shown by chronic alcoholics: (1) In patients with KS, alcoholism can selectively interfere with short-term memory, emotion, and other functions associated with damage to limbic system and diencephalic structures; and (2) alcoholics can also suffer diffuse cortical damage that affects the functioning of both brain hemispheres . No definite relationships have been established, however, between damage to specific cortical regions and concurrent cognitive impairments, although findings from neuroimaging and neuropathology studies point to increased susceptibility of frontal brain systems.Factors that contribute to differences among people in the neurological consequences of alcoholism are numerous and include nutritional deficiencies, liver disease, the age and gender of the drinker, and family history of alcoholism. The notion that neurological disorders result from the prolonged consumption of alcohol by certain vulnerable alcoholics is a plausible hypothesis, but identifying what makes certain alcoholics \u201cvulnerable\u201d remains a problem for further investigation.Research on alcohol-related neurological disorders has centered on damage to the limbic system, diencephalon, and cerebral cortex. In addition, damage to central neurotransmitter systems has been considered as possibly contributing to alcohol-related abnormalities with harmful neurological consequences. Future research should help clarify the relative importance of the many biochemical effects of alcohol at all levels, from its effects on the preservation and replication of the genetic code embodied in DNA and the synthesis of new proteins, to the activities of neurotransmitters, receptors, neurons, and the entire brain. This information will link cellular changes directly to specific neurological consequences observed clinically. In the absence of a cure for alcohol addiction, a detailed understanding of the biochemical actions of alcohol on nerve cells may help in designing therapies to ameliorate its devastating neurological effects."}
+{"text": "Background: Skeletal muscle is central to whole body metabolic homeostasis, with age and disease impairing its ability to function appropriately to maintain health. Inadequate NAD+ availability is proposed to contribute to pathophysiology by impairing metabolic energy pathway use. Despite the importance of NAD+ as a vital redox cofactor in energy production pathways being well-established, the wider impact of disrupted NAD+ homeostasis on these pathways is unknown.Methods: We utilised skeletal muscle myotube models to induce NAD+ depletion, repletion and excess and conducted metabolic tracing to provide comprehensive and detailed analysis of the consequences of altered NAD+ metabolism on central carbon metabolic pathways. We used stable isotope tracers,  D-glucose and [U-13C] glutamine, and conducted combined 2D-1H,13C-heteronuclear single quantum coherence (HSQC) NMR spectroscopy and GC-MS analysis.Results: NAD+ excess driven by nicotinamide riboside (NR) supplementation within skeletal muscle cells resulted in enhanced nicotinamide clearance, but had no effect on energy homeostasis or central carbon metabolism. Nicotinamide phosphoribosyltransferase (NAMPT) inhibition induced NAD+ depletion and resulted in equilibration of metabolites upstream of glyceraldehyde phosphate dehydrogenase (GAPDH). Aspartate production through glycolysis and TCA cycle activity was increased in response to low NAD+, which was rapidly reversed with repletion of the NAD+ pool using NR. NAD+ depletion reversibly inhibits cytosolic GAPDH activity, but retains mitochondrial oxidative metabolism, suggesting differential effects of this treatment on sub-cellular pyridine pools. When supplemented, NR efficiently reversed these metabolic consequences. However, the functional relevance of increased aspartate levels after NAD+ depletion remains unclear, and requires further investigation.Conclusions: These data highlight the need to consider carbon metabolism and clearance pathways when investigating NAD+ precursor usage in models of skeletal muscle physiology. Maintaining NAD+/reduced NAD+ (NADH) redox homeostasis is important for effective ATP production, which is essential for metabolically active tissues to meet functional demand3. NAD+ has since also been recognised as a signalling molecule and is intracellularly consumed by enzymes such as sirtuins, poly-ADP-ribose polymerases (PARPs) and cADP-ribose synthases (CD38s). In order to maintain normal cellular function, it is critical for NAD+ to be replenished through either biosynthetic or salvage pathways6.Nicotinamide adenine dinucleotide , nicotinamide mononucleotide (NMN)) may be a means to improve metabolic capacity and function in a range of age-related disease states15. NR and NMN are often supplemented in large doses and can lead to increased cellular NAD+ content. Chronically increasing NAD+ beyond normal physiological levels could have a wider impact on metabolic homeostasis, which is yet to be fully understood.Pathological changes to skeletal muscle have consequences on whole body energy metabolism as seen in disease states such as obesity, diabetes and sarcopenia+ in accepting electrons from glycolytic and TCA cycle metabolites enables oxidative phosphorylation and highlights the NAD+/NADH redox couple as being vital to central carbon metabolism. Based on the decline in NAD+ observed in chronic disease we studied the impact this may have on energy homeostasis. In light of the recent work showing NR can safely elevate NAD+ concentration in human blood16, alongside the increasing focus on NAD+ precursors as a treatment strategy for metabolic diseases, we sought to explore the metabolic impact of altered NAD+ levels in the context of skeletal muscle18.The role of NAD+ excess and depletion, previously modelled in other studies20, and aimed to more intensively define the consequences of disrupted NAD+ on essential metabolic pathways in skeletal muscle, providing advances to the current work in the field. We initially employed 1D-1H-NMR, which has higher resolution and reproducibility than other quantification methods, such as GCMS21. Further to this, we utilised metabolic tracing to understand the impact of altered NAD+ levels on carbon metabolism. The stable isotope tracer  D-glucose was used to generate metabolite labelling patterns and visualised through advanced 2D-1H,13C-heteronuclear single quantum coherence (HSQC) nuclear magnetic resonance (NMR) spectroscopy and gas chromatography\u2013mass spectrometry (GC-MS) analysis22. This methodology allowed for in-depth analysis of glucose-derived carbon molecules, with the ability to determine information regarding specific metabolic pathways within different compartments23. Detailed analysis of lactate and alanine enable greater understanding of the changes to glycolysis and the pentose phosphate pathway (PPP) within the cytosol. Investigation of glutamate and aspartate, using this method, can determine whether synthesis has occurred from pyruvate entering the mitochondria via pyruvate dehydrogenase or pyruvate carboxylase23. Further to this, information regarding the number of rounds of the TCA cycle can be determined, which once again can be used to understand changes to the activity of the TCA cycle in response to differing NAD+ states.Here we established scenarios of NAD+ levels in skeletal muscle, which are reversible with short-term NR supplementation.Here we present detailed evidence of adaptations to pathway utilisation within central carbon metabolism in response to low NADUnless otherwise stated all materials and reagents were acquired from Sigma-Aldrich, UKC2C12 myoblasts were grown in Dulbecco\u2019s Modified Eagle\u2019s Medium (DMEM) 25 mM glucose supplemented with 10% foetal bovine serum (FBS) and 1% Penicillin/Streptomycin (P/S). Once cells reached 70% confluence, differentiation medium was added (DMEM 25 mM glucose supplemented with 5% horse serum (HS) and 1% P/S) and the cells were cultured for 5 days with fresh medium added every other day, sufficient to differentiate myoblasts into mature contractile myotubes.24.Experiments were conducted consistent with current UK Home Office regulations in accordance with the UK Animals (Scientific Procedures) Act 1986, and approved by the local Animal Welfare and Ethical Review Body. Gastrocnemius muscle was collected from 16-week-old male C57BL/6NJ mice and placed in 0.2% collagenase, to allow for myofibre detachment and digestion and then washed in DMEM. Myofibres were placed in wells coated with Matrigel (BD biosciences), with DMEM containing 30% FBS, 10% HS, 1% chick embryo extract (CEE), 1% P/S and 0.1% fibroblast growth factor (FGF). Following satellite cell migration the media was replaced with proliferation media; DMEM supplemented with 10% HS, 0.5% CEE and 1% P/S. Once cells had attained 70\u201380% confluence the media was replaced with differentiation media  and left to differentiate for 6 days, as previously described25.Cells were either left as control or treated with 50 nM FK866 for 24 or 48 hours and then co-treated with 0.5 mM NR  for 4 hours. NMN treatments were the same as NR; 0.5 mM NMN for 4 hours. These concentrations were selected to provide a maximal effect on cellular NAD levels following previously published work in myotubes6) were seeded into 15 cm dishes and differentiated for 5 days. For glucose labelling, freshly made flux media , diluted in 1 litre of distilled water, supplemented with 2 mM glutamine and 45 mM sodium bicarbonate) was added to the cells 24 hours prior to extraction; 10 mM13C2--D-Glucose was then added and the cells were left to metabolise. For glutamine labelling the media was alternatively supplemented with 10 mM glucose, 45 mM sodium bicarbonate and 2 mM13C5-glutamine.Cells  was added to the plate. The cells were scraped using a cell scraper and transferred to a falcon tube where 1.2 ml of HPLC-grade chloroform (-20\u00b0C) was added. The tube was rocked at 4\u00b0C for 10 minutes before 1.2 ml pre-chilled HPLC-grade H2O), pH 7.0. Samples were sonicated and transferred to glass vials before being moved to 1.7 mm NMR tubes using a Gilson robotic system.Dried NMR samples were re-suspended in 100 mM sodium phosphate buffer containing 500 \u00b5M 4,4-dimethyl-4-silapentant-1-sulfonic acid (DSS) and 10% deuterium (DMDDNMR (version 2.5) andNMRPipe (version 9.2) software28. All spectra were processed without baseline correction as this can present challenges for the multiplet analysis procedure.A Bruker Avance III 600 MHz NMR spectrometer equipped with a 1.7 mm z-PFG TCI Cryoprobe was used to acquire 2D 1H,13C-HSQC NMR spectra. The HSQC spectra were acquired with echo/anti-echo gradient coherence selection with an additional pre-saturation for suppressing the water resonance. The spectral widths were 13.018 ppm and 160.0544 ppm in the direct and indirect dimension, 512 complex data points were acquired for the 1H dimension and 29.9927% (2457) out of 8192 complex data points were acquired for the 13C indirect dimension using a non-uniform sampling scheme. The interscan relaxation delay was set to 1.5 s. 2D 1H,13C-HSQC spectra were reconstructed via the compressed sensing algorithm using the1H NMR spectrum with a relaxation delay of 4 s. Each sample underwent automatic tuning and matching before they were shimmed (1D-TopShimm) to a DSS line width of <1 Hz prior to acquisition of the first spectrum. Total experiment time was 4 h 45 min per sample; ~15 min for 1D-1H-NMR and 4.5 h for 2D-1H,13C-HSQC NMR spectra. All 1D-1H NMR spectra were processed usingMetaboLab software (version 1). Data analysis was performed using MetaboLab with the methyl group of lactate used to calibrate the chemical shift29. Prior to Fourier Transformation all 1D-1H-NMR spectra were zero-filled to 131,072 data points, the chemical shift was then calibrated by referencing the DSS signal to 0 ppm and the spectra were manually phase-corrected. Once complete, the baseline correction was conducted using a spline function (ref: 61) and the spectra were exported into Bruker format to allow for metabolite identification and quantification using theChenomx software package . All metabolite concentrations were normalised to pellet weight.A total of 128 transients were acquired for each 1D-Polar metabolites were solubilised in 2% methoxyamine hydrochloric acid (HCL) in pyridine. The samples were vortexed before being incubated at 60\u00b0C for 60 minutes. Following this incubation the derivatisation reagent was added; 60 \u03bcl N-tertbutyldimethylsilyl-N-methyltrifluoroacetamide (MTBSTFA) with 1% (w/v) tertbutyldimethyl-chlorosilane (TBDMSCI) (Sigma-Aldrich). The suspension was incubated for 1 h at 60\u00b0C in a closed tube to prevent evaporation. The samples were centrifuged at 13,000 rpm for 5 min and the clear supernatant was transferred to a chromatography vial with a glass insert (Thermo Fisher). Derivatised samples were analysed using an Agilent 7890B Series GC/MSD gas chromatograph with a medium polar range polydimethylsiloxane GC column (DB35-MS), in association with a mass spectrometer (GC-MS) (Agilent Technologies). Metabolite ion counts were normalised to pellet weight.Glycogen was extracted from differentiated C2C12s and quantified using a Glycogen Assay Kit (Sigma-Aldrich) according to the manufacturer\u2019s instructions.4-(trifluoromethoxy)phenylhydrazone (FCCP) titrations until maximal respiration increase to determine maximal uncoupled respiratory capacity, 0.5 \u00b5M rotenone for inhibition of complex I and assessment of complex II maximal respiratory capacity, and 2.5 \u00b5M antimycin A for inhibition of complex III to determine residual oxygen consumption. Following experiment chamber contents were collected, spun down, washed in PBS and a Bradford assay was conducted to calculate protein levels within each sample. These were then used to determine oxygen flux/mg of protein. Respiratory substrate stocks were diluted in ddH2O, while uncouplers and inhibitors were diluted in absolute ethanol.C2C12s were differentiated for 5 days and treated with 50 nM FK866 for 48 or 72 h. Mitochondrial function was then determined using a two-chamber Oxygraph (OROBOROS Instruments) derived from polarographic oxygen flux measurements. Prior to loading into the chambers cells were removed from the plates by Trypsin and spun down to form a pellet before being suspended in 2 ml DMEM. Once within the chambers the cells were left to incubate for 10 min to measure their endogenous respiration. Following this 10 \u00b5g/2 ml of digitonin was added to permeabilise the cells. Assessment of oxidation capacity was carried out by sequentially subjecting the cells to differing concentrations of substrate as follows; 2 mM malate and 10 mM glutamate as a substrate for complex I and determination of complex I respiratory capacity, 5 mM increments of ADP until maximal oxidative phosphorylation and induction of state III respiration, 10 \u00b5M cytochrome c as a control for mitochondrial membrane damage, 20 mM succinate as a substrate for complex II and assessment of complex I + II respiratory capacity, 0.5 mM carbonyl cyanide-ProteoWizard  and imported toMZMine (2.10) for peak extraction and sample alignment. A house-made database including all possible13C isotopic m/z values of the relevant metabolites was used for the assignment of LCMS signals. Finally the peak areas were used for comparative quantification.Prepared samples were analysed on a LCMS platform consisting of an Accela 600 LC system and an Exactive mass spectrometer (Thermo Scientific). A Sequant ZIC-pHILIC column  (Merck) was used to separate the metabolites with the mobile phase mixed by A= 20 mM ammonium carbonate in water and B= acetonitrile. A gradient program starting at 20% of A and linearly increasing to 80% at 30 min was used followed by washing (92% of A for 5 min) and re-equilibration (20% of A for 10 min) steps. The total run time of the method was 45 min. The LC stream was desolvated and ionised in the HESI probe. The Exactive mass spectrometer was operated in full scan mode over a mass range of 70\u20131,200 m/z at a resolution of 50,000 with polarity switching. The LCMS raw data was converted into mzML files by usingAll statistical analyses were carried out using the GraphPad Prism 6 software. One-way ANOVA analysis has been conducted on the concentrations of metabolites and percentages of label incorporation, with Dunnett\u2019s multiple comparisons post hoc test. This was to test differences between the treatment groups with statistical significance shown by * p<0.05, ** p<0.01, *** p<0.001, compared to control.+ availability has been extensively used in models of pathophysiology associated with NAD+ deficiency and impaired metabolism11. The wider metabolic consequences of increasing cellular NAD+ above physiological levels have yet to be established. Therefore, we first examined the consequences of NAD+ excess on metabolic pathway use and energetic status in muscle cells. Using 1D-1H-NMR spectroscopy we quantified changes to key metabolites involved in NAD+ metabolism following 0.5 mM NR or NMN supplementation in control cells. As expected, 4-hour NR and NMN were effective at significantly elevating intracellular NAD+ levels in C2C12 cells, with a similar significant increase seen in primary myotubes following NR supplementation   . NAM cle8-fold) . Interes8-fold) . We usedyotubes .+ excess on carbon metabolism we used  D-glucose and conducted combined analysis of GC-MS and 2D-1H,13C-HSQC spectra to elucidate changes to metabolic pathway utilisation , and malate in C2C12s and primary myotubes   and glycyotubes . NR rescyotubes .1H-13C-HSQC NMR spectroscopy. The resultant labelling patterns from the different metabolic routes are outlined in13C-label incorporation in carbon 1 of 48-hour FK866 samples compared to both control and 24-hour FK866 samples. This was interesting but could be anticipated as a result of glycolysis using  D-glucose  functioning as a result of perturbed cytosolic redox potential, as evidenced by the elevated lactate/pyruvate ratio. We tested this hypothesis using a MAS inhibitor in combination with [1,2-e ratio  and as ae ratio  and signe ratio . Howeverto more . NR was d cells . Asparta+ content in response to exercise32 and calorie restriction33 as a metabolic switch signalling augmented energy harvesting in muscle has prompted a focus on ways to increase NAD+ availability for treatment of metabolic disease in humans. Despite measurements linking a decline in NAD+ levels to altered metabolism, there is limited data showing the impact that NAD+ depletion, and also excess, could have on core cellular metabolism in muscle12.Observation of elevated cellular NAD+ precursors in untreated cells results in an \u2018NAD+-boost\u2019 above control levels. The methodology employed in this study is key to understanding changes to metabolic pathway usage. It was therefore surprising to discover that there was no alteration to the PPP activity or glycolysis in response to elevated NAD+. It became apparent that skeletal muscle cells rapidly adapt to an \u2018NAD+-boost\u2019 by increasing NAD+ clearance through NAM and MeNAM to protect the careful redox balance, seemingly to ensure central carbon metabolism is unaffected34.Supplementation of NAD+ excess is important. Increased clearance will lead to increased levels circulating in the blood and ultimately elevated excretion in the urine, with previous studies suggesting high levels may exhibit adverse effects37. With elevated NAM in the blood there is increased substrate availibility for eNAMPT, extracellular NAMPT. The role of eNAMPT, although controversial, has been linked to modulating the immune response and regulating glucose stimulated insulin secretion from \u03b2-cells of the pancreas38. This could suggest that excess NAM may affect glucose homeostasis within the body. In addition, these metabolites could also be taken up by various tissues and have shown to cross the blood-brain barrier where there is strong evidence that they exhibit neuroprotection41. However, at high concentrations NAM and MeNAM can have a toxic effect on neurons, as shown in Parkinson\u2019s and Huntington\u2019s disease models44. Similarly, NAM has been shown to be effective for management of hyperphosphatemia in patients with renal disease45; however, it is also suggested to be a uremic toxin contributing to thrombocytopenia47. Whilst there have been studies showing NR safely elevates NAD+ in human blood48 it is important to consider that creating a state of NAD+ excess and increasing clearance of NAM and MeNAM could potentially have unintended effects in the CNS and for kidney function, alongside other possible off-target effects.A better understanding of the potential consequences of increased NAM and MeNAM clearance following NAD15. This prompted us to utilise both of these supplements to create an NAD+ excess and understand the impact they have on a skeletal muscle cell. These data show a difference between the NAD+ precursors, with a greater elevation of the clearance products, NAM and MeNAM, in NR compared to NMN treated cells. In order for mammalian cells to take up NMN and utilise it for NAD+ synthesis, it must first be converted to NR, which could account for the apparent decreased clearance rate compared to NR49. This is consistent with recent work conducted in mice showing that skeletal muscle metabolises NR faster than NMN50. An alternative explanation for the elevated NAM detected with NR may be due to its relative instability compared to NMN in culture medium, meaning it is possible that we are measuring NAM taken up by cells from the media due to NR degradation as opposed to intracellular NAD+ consumption49.Supplementation with NR and NMN in pre-clinical animal studies has shown similar therapeutic effects in disease conditions to preserve metabolic health and ameliorate age-related decline+, confirming this as the main pathway for basal NAD+ synthesis within skeletal muscle12. NAM levels are carefully balanced between consumption, through NAD+ synthesis, and production, through NAD+ breakdown. NR rescue of FK866 treated cells causes an increase in NAM, suggestive of increased NAD+ breakdown, with NAMPT inhibition preventing NAM being used for NAD+ synthesis, therefore causing an accumulation. However, this build-up did not result in increased clearance through MeNAM possibly due to a delay in establishing NAD+ and NAM excess as FK866 treated cells must recover basal NAD+ levels first.NAMPT inhibition significantly depletes NAD+-depleted cells. The hydrolysis of phosphocreatine and the resultant release of a phosphate group provides an alternative route to ATP production, avoiding carbohydrate metabolism and oxidative phosphorylation, which are both NAD+ dependent52. However, the levels of PCr are finite and therefore the cell cannot rely on this method of ATP synthesis indefinitely35. Importantly, supplementation with NR was sufficient to normalise NAD+ levels and prevented requirement for alternative ATP synthesis.Evidence of disrupted energy homeostasis was seen with the reduction of the PCr/Cr ratio in NAD+ depletion is inhibition of GAPDH, the first NAD+-dependent step of glycolysis. The build-up of metabolites before the enzyme, coupled with the decrease in metabolites observed downstream in response to NAMPT inhibition corroborates previous studies in cancer cells and C2C12s19. The advanced analysis conducted through the combined NMR and GCMS methodology allowed us to confirm the reversal of the glycolytic reactions above the block, not just through steady-state metabolite levels, but also through label incorporation into fructose-6-phosphate. This highlighted that although changes to metabolite concentrations were observed after 24-hour FK866 treatment, the inhibition of cytosolic GAPDH, and reversal of glycolytic reactions, is not detected until the 48-hour time-point.A significant effect of NAD36. A key limitation of our experiment may be the mechanism of action of the inhibitor, given it indirectly inhibits the shuttle functioning by acting on cytosolic aspartate aminotransferase37. This therefore does not confirm whether a different aspect of the shuttle may be impaired in our model, but does show that the results are unlikely to be a result of compromised cytosolic aspartate aminotransferase activity. Aspartate is also a key component in the purine nucleotide cycle, which is active in skeletal muscle in response to energy depletion, removing AMP to promote ATP synthesis and could provide an alternative use for the aspartate build-up53. Elevated aspartate has also been reported in cells treated with the mitochondrial uncoupler FCCP54, supporting the notion that the effects are a result of perturbed cytosolic redox. Elevated GAP and G3P observed with NAMPT inhibition may represent an attempt to maintain the redox potential within the cytosol, by utilising the glycerol-3-phosphate/dihydroxyacetone phosphate shuttle to regenerate NAD+ and provide protons to the electron transport chain55.Aspartate is a partner in a number of cellular metabolic energy cycles. Previous work using a malate-aspartate shuttle inhibitor in vascular smooth muscle yielded similar results to our FK866 treatment of an increase in glucose-derived aspartate+ pool allowing for continued TCA cycle activity despite cytosolic NAD+ depletion. This is supported by our data indicating mitochondrial respiration still occurs despite severe NAD+ depletion. NAD+/NADH ratios differ greatly between subcellular compartments, with mitochondrial redox more tightly regulated compared to the cytosol57. The notion of a protected mitochondrial NAD+ pool is suggested in other studies, which have indicated that FK866 treatment affects cytosolic NAD+ but does not disrupt the mitochondrial NAD+ pool58. Together this suggests that skeletal muscle is able to resist disruptions to mitochondrial metabolism and maintain oxidative function despite severe NAD+ depletion.Aspartate could be a marker of a preserved mitochondrial NADThe methods employed in this study provide a high-resolution insight into metabolism and changes to metabolic pathways. Detailed analysis of energy metabolism pathways, as conducted here, could be key to understanding disease pathophysiology and may uncover novel cellular adaptations, which are not seen using other methods.+ depletion. NR and NMN in skeletal muscle cells does not impact carbon metabolism but does increase clearance products of NAD+, which may impact other tissues in whole body metabolism. We observed a change in aspartate production with regard to both concentration and route to production. Understanding whether this is a cellular adaptation to low NAD+ or if there is a functional use of the aspartate requires further investigation and could provide insight into how our skeletal muscle copes with energy stress.In conclusion, these data show NR is acutely effective at reversing changes to central carbon metabolism observed following severe NADhttps://doi.org/10.6084/m9.figshare.727157359. Included are raw NMR data, GC-MS data, and raw and processed concentrations of metabolites.Datasets for the study \u201cMetabolic tracing reveals novel adaptations to skeletal muscle cell energy production pathways in response to NAD+ depletion\u201d are available on figshare; DOI:Creative Commons Zero \"No rights reserved\" data waiver (CC0 1.0 Public domain dedication).Data are available under the terms of theThe supplementary figures are available to view on figshare, Supplementary Figure 1. Chronic NR supplementation.10.6084/m9.figshare.97851561D-1H-NMR spectroscopy shows (A) NAD+ and (B) NADP+ concentrations in C2C12s in response to 24-hour NR supplementation. Fold-change compared to control shown for (C) NAM and (D) MeNAM. Energetic status of the cell was investigated through (E) ATP and (F) PCr/Cr ratio. Combined analysis of 2D-1H,13C-NMR  and GC-MS data of (G) lactate and (H) aspartate. One-way ANOVA performed on raw data; Dunnett\u2019s multiple comparison test, treatment compared to control. All data are the mean \u00b1SEM, C2C12s n=4. DOI:Supplementary Figure 2. Glycolytic outputs, lactate and alanine, unaffected by NAD+ depletion.10.6084/m9.figshare.9785165Differentiated C2C12 and primary myotubes were treated with FK866 (50 nM) for 48 hours with and without NR (0.5 mM) for 4 hours. 1D-1H-NMR spectroscopy shows (A) Lactate concentration in C2C12 and primary myotubes (mM/mg of protein). Combined 2D-1H-13C-NMR and GC-MS analysis shows pathway contribution to lactate in (B) C2C12 and (C) primary myotubes. Alanine concentration (mM/mg of protein) in (D) C2C12s and (E) primary myotubes with alanine pathway analysis in (F) C2C12 and (G) primary myotubes. One-way ANOVA performed on all data, with individual pathways assessed independently; Dunnett\u2019s multiple comparison test, treatment compared to control. All data are the mean \u00b1SEM, n=4. DOI:Supplementary Figure 3. MAS Inhibitor does not have same effect as FK866 treatment.10.6084/m9.figshare.9785168Differentiated C2C12s were treated with 0.5 mM AOAA (MAS Inhibitor) for 24 hours with or without 0.5 mM NR for 4 hours. (A) Lactate/Pyruvate ratio from GC-MS analysis using the m=2 portion of the MID. GCMS ion count fold changes compared to control for (B) a-KG, (C) succinate and (D) aspartate. MIDs from GCMS analysis for (E) aspartate and (F) glutamate. 1D-1H-NMR spectroscopy shows (G) NAD+ concentration (mM/mg of protein). MAS \u2013 Malate aspartate shuttle. * p<0.05, ** p<0.01, ***p<0.005; One-way ANOVA performed on all data, with individual MIDs assessed independently; Dunnett\u2019s multiple comparison test, treatment compared to control. All data are the mean \u00b1SEM, n=3. DOI: et al. apply a combination of NMR and GC-MS based analyses and multiple heavy isotope labeling strategies to provide new insight into the metabolic consequences of perturbing NAD homeostasis in muscle cells. The experiments as presented appear technically sound and the interpretations are reasonable. However, the clarity of the manuscript could be substantially improved be more careful use of language and better explanations for the data presented in many of the figures.Oakey Specific points: 1. Flux is inferred or at least implied based on steady-state measurements in some cases. For example, an increased concentration of MeNAM is equated with increased NAM clearance when it could just as easily reflect decreased MeNAM secretion or decreased NAM consumption in another competing pathway. Similarly, lactate is presented as an indication of glycolytic flux. While the authors correctly use lactate labeling pattern as an indication of the relative flux through glycolysis vs. PPP, the distinction should be made that total flux cannot be determined this way. In this regard, monitoring the appearance of lactate in the media would be a very useful addition to the study. 2. Increased NAM following NR treatment is very likely the result of NR hydrolysis rather than NAD turnover. The authors make this point in the discussion, but at the time when the result is described, the text is suggestive of NAD turnover as the explanation. This seems unlikely given that NMN increases NAD just as much without causing the same degree of NAM accumulation. This could be easily addressed by monitoring the culture media. 3. There are a number of issues with the presentation of figure 4. Panels D and E appear to be transposed. Panel C is necessary to understand A and B and should probably come first. Since no data are presented relating to the PPP, it could be left out of the diagram for simplicity, and how the diagrammed F-6-P forms relate to the HSQC signals could be more clearly indicated on the figure and in the text. The change in labeling strategy should be indicated on the figure for (m + 6) F-1,6-BP and I am not sure what the label adds here or why the switch from showing F-6-P to showing F-1,6-BP. Can total pools, including labeled and unlabeled be represented for each experiment?\u00a0 4. Figure 5 should have separate diagrams to indicate labeling by glucose or glutamine tracers and the labeling criteria used to determine \u201cglycolysis\u201d or \u201cTCA rounds + PPP\u201d should be indicated more clearly. It appears that the majority of aspartate is unlabeled with either tracer \u2013 does this reflect aspartate in the media or another source being used for synthesis? 5. Wording could be improved in some places - in the opening sentence \u201cresponsible for driving\u201d implies that NAD levels determine the flux through these pathways, which is not clear above a minimal threshold of NAD concentration - \u201celevate NAD metabolism in human blood\u201d should probably be \u201celevate NAD concentration\u201d - \u201cDetailed analysis of lactate and alanine are key to underpinning changes to glycolysis and the pentose phosphate pathway (PPP) within the cytosol\u201d isn\u2019t quite grammatically correct.The metabolite extraction method is slightly unclear. Are the cell plates on dry ice while they are being washed? How were the cells removed from the plate?Figure 1D shows NADP+ is not increased by 4 hours of NR as described in the text, but Figure S1B shows the opposite resultO2 flux in Figure 2 has no unitsAbsolute NAD concentration shown in Figure 2 is much lower than expectedIt would be useful to show NAD depletion at 24 hours of FK866 to help understand why it takes 48 hours to see a major block in GAPDHI\u2019m not sure why Figure 3A shows GAP and 3B shows G3P when the rest of the panels show the same metabolite for each cell type. It would be easier to compare if both were shown for both cell types. Minor points:I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. This is an interesting and clearly written article providing important new information regarding muscle metabolism during NAD excess and depletion. The use of multiple state-of-the-art techniques has uncovered several novel effects of NAD excess and depletion which will be important when considering the utility of NAD boosting compounds as potential therapies for various pathophysiological conditions.\u00a0 Some minor comments/questions: 1) Details of NMN treatments are missing from the cell treatments section of the methods. 2) What is the justification for the concentrations of NR and NMN used? How similar are these to physiological levels, either in tissue or serum? 3) ADPR is mentioned in the schematics showing NAD metabolism. Were the authors able to detect changes in this metabolite in response to any treatments? 4) Why are some metabolites expressed as fold-change and some as absolute amounts? e.g. in fig1. 5) Page 8, para 3: ...'via the NRK enzymes'.\u00a0 Was the role of NRK enzymes assessed here? If not, it might be useful to add a relevant reference there. 6) Page 13, Discussion Para 3: states NAM and meNAM cross the BBB and are also taken up into the kidney. Are NAM and meNAM taken up into any other tissues? What physiological/pathophysiological effects might this have? 7) Could increased circulating NAM act as a substrate for eNAMPT  and how might that affect the outcomes of NR supplementation in vivo?I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard."}
+{"text": "The present study was conducted to investigate the relationship between serum levels of enolase and pathological findings obtained from CT scans of the brain in children with mild blunt brain trauma and help with a more accurate diagnosis of brain injuries.The present observational study was conducted on children presenting with head traumas to the emergency department (ED) of Golestan Hospital in Ahvaz, Iran in 2016. A venous blood sample was immediately taken by the ward nurse from all the eligible patients within 6 hrs of the incident after obtaining their information, performing initial examinations and their initial stabilization. Laboratory serum levels and the corresponding interpretations of CT scans of the brain were collected, recorded and then evaluated and analyzed.A total of 62 children with mild blunt brain trauma were included in the study. A significant difference was observed between the positive CT scan group (2.7\u00b19.74 \u00b5g/L) and the negative group (4.23\u00b11.33 \u00b5g/L) in terms of serum levels of enolase (P<0.0001). The area under the receiver operating characteristic (ROC) curve was 0.992 for serum levels of enolase in diagnosing brain lesions caused by mild head traumas. Moreover, with a cut-off point of 6.97 \u00b5g/L, brain lesions could be detected with a sensitivity of 93.55% and a specificity of 100%.Serum levels of enolase were found to be higher in patients with brain injuries. This highly accurate diagnostic biomarker can be recommended for estimating the presence of brain lesions associated with mild head traumas in infants. Traumatic brain injuries (TBIs) caused by an external pressure on the brain can temporarily or permanently disrupt the nervous function.5The mechanism of damage to the head varies with age. The damage caused by impacts is a major injury in infants and is accompanied by severe diffuse injury if repeated. Delays in treating these injuries are usually associated with hypoxic ischemia, which distinguishes it from other head traumas, and generally causes the worst outcomes in these patients compared to other cases of head trauma.6Non-penetrating head traumas are mostly mild, leading to a GCS score of 14\u201315. Standard CT scans of the brain are required for determining brain damage based on the symptoms of the injured.This study had been conducted according to the Standards for Reporting Diagnostic Accuracy (STARD).9After obtaining ethics code from the ethics committee of Jundishapur University as per the ethical principles stated for medical research involving human subjects in the Declaration of Helsinki, the present observational study was conducted on all children with head traumas presenting to the ED of Golestan Hospital in Ahvaz in 2016.After the initial examinations and stabilization of the patients with TBIs by a senior emergency medicine resident, CT scans of the brain were performed according to the latest guidelines in case the indications appeared, including an age of 6 months to 18 years, a GCS score of 14 and 15, the mechanism of damage being of the type of traffic accidents and domestic or sport injuries, the incident occurring within the previous 6 hrs, the parents giving consent for the participation of their children in the study, lack of pregnancy, no history of alcohol or drug abuse, no history of neurological diseases such as seizure and epilepsy and the absence of severe road traffic injuries such as overturned vehicle or being thrown out of the car.The exclusion criteria comprised a history or clinical evidence for stroke, cerebral hemorrhage, head trauma and infection of central nervous system within the previous 3 months, a history of brain tumors, having injuries other than mild brain trauma such as limb fractures, having a history of major diseases such as diabetes, heart problems and asthma, a BMI below the fifth percentile or above the 95th percentile, severe traffic injuries such as overturned vehicle or being thrown out of the car.In the present analytical epidemiological study, a venous blood sample was immediately taken by the ward nurse from all the eligible patients within 6 hrs of the incident after obtaining their information, performing initial examinations and their initial stabilization. The patients were then referred to an imaging unit for cranial CT scan. The initial data recorded in relevant forms involved the mechanism of injury, the presence of lacerations, scratches, contusions and the size and site of the lesion in the scalp and face, GCS score upon examination, headache, nausea, vomiting, dizziness, neurological defects, amnesia, reductions in levels of consciousness and their duration. The collected samples were then immediately transferred to the central laboratory of Golestan Hospital, centrifuged and their serum was separated and kept at \u221280\u00baC. After collecting the required number of samples, laboratory kits for measuring the biomarker of enolase  were used to individually determine and record the serum concentration of enolase in each sample according to the ELISA method without any knowledge of the results of CT scans of the brain. The initial CT scans of the brain of all the patients were performed by a CT scan machine, the results interpreted by an emergency medicine specialist, and the films subsequently interpreted independently by one neuro-radiologist, who was unaware of the results of enolase levels. The patients were dealt with according to the clinical protocol of handling head-trauma patients. After collecting and recoding the results of laboratory serum levels and the corresponding interpretations of CT scans of the brain, one group of the patients with positive-for-trauma pathological findings in CT scans and the other group with negative findings were analyzed based on the calculated sample size.t-test for the normally distributed quantitative data, and Mann\u2013Whitney U-test for the non-standard quantitative data. The ROC curve was plotted for the ability of NSE to diagnose mild blunt brain trauma in children and predict hospital mortality, and cut-off points with the highest sensitivity and specificity were determined. P<0.05 was set as the level of statistical significance.Statistical analyses were performed in SPSS. The normally distributed data were expressed as Mean \u00b1 Standard Deviation (SD). The Chi-square test was used for the qualitative data, the paired Sixty-two children with mild blunt brain traumas were studied in two groups of 31, namely the positive and negative CT scan groups. Serum levels of enolase were found to be 9.74\u00b12.7 \u00b5g/L in the positive CT scan group and 4.23\u00b11.33 \u00b5g/L in the negative group, suggesting a statistically significant difference (P<0.0001). In the positive CT scan group, the frequency of a GCS score of 14 was 17 (54.8%) and that of a GCS score of 15 was 14 (45.2%), and in the negative CT scan group, these frequencies were, respectively, 6 (19.4%) and 25 (80.6%), suggesting a statistically significant difference (P=0.004) .The area under the ROC curve for serum levels of enolase was found to be 0.992  in diagnosing brain lesions caused by mild head traumas  Figure . The optHead and neck traumas caused by accidents are common reasons for presenting to EDs.The present findings showed significantly higher serum levels of enolase in the children with mild head traumas and positive results of CT scans of the brain, ie, 9.74\u00b12.7 \u00b5g/L, compared to in another group of these children with negative CT scans (4.23\u00b11.33 \u00b5g/L). In contrast, de Kruijl et al (2001) found serum levels of enolase to be 9.8 \u00b5g/L in patients with mild head traumas and 9.4 \u00b5g/L in healthy patients, suggesting that brain trauma causes a negligible increase in the levels of this enzyme.According to the present study results, with a cut-off point of 5.74\u00b5g/L, serum levels of enolase were found to diagnose intracranial lesions with a sensitivity of 100% and a specificity of 87.1%. Moreover, with a cut-off point of 6.97\u00b5g/L, serum levels of enolase could be used to diagnose these lesions with a sensitivity of 93.5% and a specificity of 100%. These findings are consistent with positive CT scan results in girls and boys aged 2\u201310 years and 10\u201318 years. Meric et al (2008) investigated head traumas and changes in serum levels of enolase, and reported an area under the ROC curve of 0.931 with a cut-off point of 20.52 \u00b5g/L for serum levels of enolase and a sensitivity of 87% and a specificity of 82.1%,Bandyopadhyay et al (2005) investigated serum levels of enolase in patients suspected of head traumas, and found these levels to be a predictor of the GCS score after TBIs,Similar to the present study, Fridriksson et al (2000) found serum levels of enolase to be a predictor of intracranial lesions in a positive and a negative CT scan group, although they argued that this method should not be individually considered a method of diagnosing head and neck traumas given the low sensitivity obtained, ie, a cut-off point of 15.3 \u00b5g/L for serum levels of NSE with a sensitivity of 77% and a specificity of 52%.Serum levels of enolase were higher in patients with brain injuries. Furthermore, this highly accurate diagnostic biomarker can be recommended for identifying brain lesions associated with mild head traumas in infants. The cut-off point of 6.97 \u00b5g/L was also associated with a higher sensitivity and specificity compared to the findings of other studies."}
+{"text": "MBLs form a large and heterogeneous group of bacterial enzymes conferring resistance to \u03b2-lactam antibiotics, including carbapenems. A large environmental reservoir of MBLs has been identified, which can act as a source for transfer into human pathogens. Therefore, structural investigation of environmental and clinically rare MBLs can give new insights into structure\u2013activity relationships to explore the role of catalytic and second shell residues, which are under selective pressure.To investigate the structure and activity of the environmental subclass B1 MBLs MYO-1, SHD-1 and ECV-1.Escherichia coli. Purified enzymes were characterized with respect to their catalytic efficiency (kcat/Km). The enzymatic activities and MICs were determined for a panel of different \u03b2-lactams, including penicillins, cephalosporins and carbapenems. Thermostability was measured and structures were solved using X-ray crystallography (MYO-1 and ECV-1) or generated by homology modelling (SHD-1).The respective genes of these MBLs were cloned into vectors and expressed in E. coli resulted in the characteristic MBL profile, not affecting aztreonam susceptibility and decreasing susceptibility to carbapenems, cephalosporins and penicillins. The purified enzymes showed variable catalytic activity in the order of <5% to \u223c70% compared with the clinically widespread NDM-1. The thermostability of ECV-1 and SHD-1 was up to 8\u00b0C higher than that of MYO-1 and NDM-1. Using solved structures and molecular modelling, we identified differences in their second shell composition, possibly responsible for their relatively low hydrolytic activity.Expression of the environmental MBLs in These results show the importance of environmental species acting as reservoirs for MBL-encoding genes. Recombinant plasmids were transformed into E. coli C600Z1 (Expressys).,7\u2005cells/mL). The McFarland solution was uniformly dispersed with a swab onto the agar plates containing 100\u2009ng/mL anhydrotetracycline . Gradient diffusion strips  were applied and the MICs were determined after 19\u2009h of incubation at 37\u00b0C.All strains used for MIC determination have been published previously.blaMYO-1, blaECV-1 and blaSHD-1 in a pDest17 vector  with a TEV cleavage site placed prior to the bla genes. The genes were based on the bla genes found in M. odoratimimus,S. denitrificans and E. vietnamensis . The expression vectors were electroporated into E. coli BL21-AI . For protein expression, cultures were induced with L-arabinose  at an OD600 of \u223c0.5. Expression was performed in Terrific Broth including 100\u2009mg/L ampicillin (Sigma\u2013Aldrich) at 15\u00b0C and 225\u2009rpm. TEV cleavage and purification were done as previously described.For enzyme expression, we used synthetic and codon-optimized genes of 66) of purified protein in Zn(II)-depleted 50\u2009mM HEPES buffer (Chelex-HEPES buffer), pH 7.5. The Chelex buffer was prepared by stirring 2\u2009g of Chelex resin  in 100\u2009mL of 50\u2009mM HEPES buffer, pH 7.5. The resin was subsequently removed by sterile filtration . Purified proteins (\u223c10\u2009g/L) were diluted to 100\u2009mg/L in Chelex-HEPES buffer. Residual Zn(II) was removed from the proteins by washing with Chelex-HEPES buffer in centrifugal molecular cut-off filters . Samples were 1/16 diluted with 750\u2009\u03bcL of a diluent mixture containing Rh103  as internal standard. The diluent mixture consisted of Milli-Q water  with 2\u2009\u03bcg/L Rh103, 2.5% (v/v) ammonia solution , 0.08% (v/v) Triton X-100 , 10% (v/v) isopropanol (Honeywell Fluka) and 0.25\u2009\u03bcg/L Au (Inorganic Ventures) as stabilizer. The samples were introduced to the nebulizer (N2 gas flow 1.03\u2009mL/min) by an ESI-Fast SC2DX autosampler with a sample flow rate of 3\u2009rpm and further into the NexION 300\u2009D ICP-MS system . For the MS analysis the kinetic energy discrimination mode with a helium flow rate of 5.7\u2009mL/min, 20 sweeps per reading and a dwell time of 100\u2009ms/AMU for Zn(II) and 50\u2009ms/AMU for Rh103 were applied. The measurements were performed with the following instrumental settings: rf power, 1600\u2009W; plasma gas flow, 18\u2009mL/min Ar; auxillary gas flow, 1.2\u2009mL/min N2; RPQ voltage, 0.25\u2009V; and integration time, 2000\u2009ms. All Zn(II) concentrations were obtained by the internal standard method followed by a blank subtraction using the NexION software version 1.5 . The Zn(II) concentration within the samples was determined based on an external calibration curve.Inductive coupled plasma MS (ICP-MS) was used to determine the Zn(II) concentration (Zn4 (Sigma\u2013Aldrich) and 250\u2009mM NaCl . For the fluorescence signal, 12.5\u00d7 SYPRO orange (Sigma\u2013Aldrich) was used. Melting curves were recorded across a temperature gradient (10\u201375\u00b0C). Tests were performed in an MJ Minicycler  and melting temperatures were calculated by using the Bio-Rad CFX Manager (v. 3.1). All experiments were carried out in a final volume of 25\u2009\u03bcL and at least in triplicate. Purified NDM-1 was included as a control.Fluorescence-based thermal stability of the enzymes was determined.Km and kcat for recombinantly expressed enzymes were determined for ampicillin , piperacillin , nitrocefin , ceftazidime , cefepime , imipenem  and meropenem  by measuring the initial enzymatic reaction rate at 25\u00b0C. All determinations were performed at least in duplicate at a final assay volume of 100\u2009\u03bcL. For nitrocefin-dependent reactions, 96-well plates  were utilized. For all the other drugs, UV-transparent 96-well plates  were used. All tests were performed in HEPES buffer 50\u2009mM supplemented with 10\u2009\u03bcM ZnSO4 (Sigma\u2013Aldrich) and BSA (Sigma\u2013Aldrich) at a final concentration of 2\u2009\u03bcg/mL. Calculations were performed by using GraphPad Prism\u00ae 7.0 .,For ECV-1 (5\u2009mg/mL), crystals were grown from reservoirs with 25%\u201326% PEG3350 (Sigma\u2013Aldrich), 0.1\u2009M BIS-TRIS buffer pH 6 (Sigma\u2013Aldrich) and 0.2\u2009M sodium acetate (Sigma\u2013Aldrich) at 4\u00b0C. Crystal-containing drops were diluted with 10\u2009\u03bcL of reservoir solution and microcrystals were created. Microcrystals were seeded into drops of 2\u2009\u03bcL containing the same composition and 5\u2009mg/mL purified protein. For MYO-1 (5\u2009mg/mL), crystals were grown in 32%\u201336% PEG4000 (Sigma\u2013Aldrich) and 0.2 M ammonium sulphate at 4\u00b0C (drop size 2\u2009\u03bcL). Crystals were flash-frozen in liquid nitrogen using 10% ethylene glycol (Sigma\u2013Aldrich) in addition to the reservoir solution. Since crystallization of SHD-1 was not successful, we used SWISS-MODEL and the solved structure of TMB-1 (PDB ID: 5MMD) with sequence identity of 58%, to obtain a homology-modelled structure.1/2 >0.5 in the outer resolution shell and a mean <I> above 1.0 , France, at 100\u2009K, wavelength of 0.961\u2009\u00c5, and the diffraction images were indexed and integrated using XDS.E. coli expressing MYO-1, ECV-1 and SHD-1. The respective genes (not codon-optimized) were sub-cloned into pZE21-MSC1 and expression was induced with anhydrotetracycline in E. coli C600Z1 (Table\u2009E. coli C600Z1). The observed effect on carbapenem MICs was lower for MYO-1 and ECV-1. Still, the expression of MYO-1 and ECV-1 resulted in an 8- and 16-fold increase in their ertapenem MICs and a 16- and 8-fold increase in their meropenem MICs, respectively. In addition, MYO-1 led to a 4-fold increase in the imipenem MIC. Compared with NDM-1, which conferred MIC values of cephalosporins of up to >256\u2009mg/L, the MICs of cephalosporins tended to be lower for all the environmental MBLs, ranging from 0.25 to >256\u2009mg/L . With the exception of piperacillin for MYO-1 and ECV-1, the MICs of penicillins were increased by >4- to >32-fold. For MYO-1 and ECV-1, an 8- and 4-fold increase in their MICs of piperacillin was observed compared with a >256-fold increase for NDM-1 and SHD-1, respectively.The sequence identity of MYO-1, ECV-1 and SHD-1 was as low as 28% compared with the widespread MBL NDM-1 , 9\u2009mg (ECV-1) and 62\u2009mg (SHD-1) per litre of culture. The purity of the enzymes was >95%. Computed monoisotopic mass of tag-free MYO-1, ECV-1 and SHD-1 was confirmed by ESI-MS to be 26\u202f771.6\u205f\u00b1\u205f3.3, 26\u202f348.2\u205f\u00b1\u205f0.3 and 25\u202f741.2\u205f\u00b1\u205f1.1\u2009Da, respectively. The Zn(II) content of MYO-1, ECV-1, SHD-1 and NDM-1 was determined by ICP-MS and we found 2.0\u205f\u00b1\u205f0.1, 1.9\u205f\u00b1\u205f0.1, 1.7\u205f\u00b1\u205f0.1 and 1.7\u205f\u00b1\u205f0.1 Zn(II) atoms per enzyme, respectively. Thermostability measurements resulted in melting temperatures of 57.8\u205f\u00b1\u205f0.1, 60.8\u205f\u00b1\u205f0.3, 66.2\u205f\u00b1\u205f0.4 and 57.9\u205f\u00b1\u205f0.1\u00b0C, respectively.Synthetic, codon-optimized genes were used to overexpress MYO-1, ECV-1 and SHD-1 in Km >300\u2009\u03bcM) and lower turnover (kcat \u226410\u2009s\u22121). In line with the MIC results, the \u03b2-lactamase activities of the environmental MBLs were lower, ranging from <5% to \u223c70%, compared with NDM-1 . Due to lack of electron density in chain B, the regions of N60 to K66, L93 to I96 and K104 to S105 could not be built. The structure of ECV-1 was refined to an Rwork and Rfree of 0.16 and 0.19, respectively, with one molecule in the asymmetrical unit. For SHD-1, we used homology modelling since no crystal structure was obtained. In addition, we found that the conserved active site residues (first shell) coordinating Zn1  and Zn2  were present in all three enzymes . SHD-1 was identified in a Gammaproteobacterium, while the natural hosts of MYO-1 and ECV-1 belong to the distant phylum of BacteroidetesE. coli. Work on the subclass B1 SPM-1 has shown different drug selectivity when tested in the periplasm, in enzyme kinetic assays and in an MIC set-up.,Here, we present two new crystal structures and one homology model of MBLs identified in environmental bacteria.ms Table\u2009. We dete,ECV-1 and SHD-1 exhibited thermostabilities \u223c3 and \u223c8\u00b0C higher than MYO-1 and NDM-1. Studies have shown that lower thermostability was accompanied by higher flexibility, facilitating cephalosporin hydrolysis in \u03b2-lactamases.,,,Ka of Asp120, thus changing the pH-dependent activity of the enzyme.,,Since second shell residues have been reported to be under evolutionary pressure and their substitutions have created variants with changed enzymatic activity,E. coli. The lower activity towards cephalosporins and carbapenems could be, at least partially, explained by their second shell residues. These residues have been previously shown to be under selective pressure in other enzymes, and amino acid substituents may alter Zn(II) binding and extend their substrate specificity.,,,In conclusion, this work presents the structure and activity of three MBLs from environmental sources. We showed that these enzymes act as carbapenemases exhibiting increased catalytic activity and conferring elevated MICs when expressed in This work was funded by the Swedish Research Council (2013-08633 and 2018-02835).None to declare."}
+{"text": "The purpose of this meta-analysis was to assess the efficacy of intrathecal morphine (ITM) analgesia and local infiltration analgesia (LIA) for pain control in total joint arthroplasty (TJA).Embase, PubMed, the Cochrane Library, and Web of Science were systematically searched for randomized controlled trials (RCTs). All RCTs were comparing intrathecal analgesia and local infiltration analgesia in TJA. Primary outcomes were the visual analog scale (VAS) score with rest or mobilization up to 72\u2009h. Secondary outcomes were the total morphine consumption, length of hospital stay, and morphine-related complications.P\u200a = 0.000), length of hospital stay , and morphine-related complications (nausea and pruritus).Compared with the intrathecal analgesia group, the LIA group was associated with a reduction in VAS score with rest up to 72\u2009h. Moreover, LIA was associated with a decrease in VAS score with mobilization at 6\u2009h, 12\u2009h, 48\u2009h, and 72\u2009h. Moreover, LIA significantly reduced total morphine consumption (weighted mean difference (WMD)\u200a = \u2212 15.37, 95% CI \u2212\u200922.64 to \u2212\u20098.83, Local infiltration provided superior analgesia and morphine-sparing effects within the first 72\u2009h compared with ITM following TJA. Total joint arthroplasty (TJA) mainly includes total knee arthroplasty (TKA) and total hip arthroplasty (THA). TJA is considered an effective surgical method for the treatment of end-stage osteoarthritis (OA) \u20133. HowevSeveral methods  to evaluate the efficiency and safety of LIA and ITM for pain control in TJA.This meta-analysis was based on the recommendations of the Cochrane Handbook for Systematic Reviews of Interventions and was written in accordance with the PRISMA checklist .The following electronic databases were independently and extensively searched by two investigators from their inception through April 2019: Embase, PubMed, the Cochrane Library, and Web of Science. The search keywords were centered on the terms \u201clocal infiltration analgesia,\u201d \u201cintrathecal analgesia,\u201d \u201ctotal knee arthroplasty,\u201d and \u201ctotal hip arthroplasty,\u201d which were adjusted to each database as necessary. In addition, the bibliographies of the included studies and dissertations were searched for additional publications. The search language was restricted to English. As all analyses were on previously published studies, ethical approval was not necessary.The PRISMA guidelines were followed for the inclusion of studies in the meta-analysis. The detailed description of the inclusion criteria is as follows: (1) trials had to be properly randomized; (2) no additional agents or interventions confounded the comparison; (3) the patients in the trials were given a bolus dose via local injection; and (4) with respect to trials with several intervention groups, the eligibility of each individual group was evaluated, and only those qualified were included. Early studies published as a series of articles from the same institution or author that contained significant overlapping data were excluded for fear of multiple publication bias. Additionally, case reports, editorials, experimental studies, conference articles, commentaries, and other studies that failed to provide detailed results were excluded.After duplicates were removed and the study selection process was completed, the titles and abstracts were scanned by two independent investigators. The relevant data were extracted by adopting a predetermined standardized procedure that involved the first authors, year of publication, country, ASA, demographic characteristics of the participants , drug dose of LIA, drug dose of ITM, surgery type, follow-up length, and study type. We attempted to contact the study authors for supplementary information when there were insufficient or missing data in the articles.Two reviewers independently assessed the risk of bias in the RCTs using the Cochrane Collaboration\u2019s tool . The folPain was assessed using the visual analog scale (VAS) pain score . A VAS is a measurement instrument used to quantify the amount of pain reported by the patient. Scores can range from 0 (no pain) to 100 (severest pain). We collected VAS scores with rest or mobilization at 6\u2009h, 12\u2009h, 24\u2009h, 48\u2009h, and 72\u2009h, total morphine consumption, length of hospital stay, and the occurrence of nausea, pruritus, and respiratory depression in Microsoft\u00ae Excel .Q test and the I2 index, which express, as a percentage, the proportion of variability in the results due to heterogeneity as opposed to sampling error. Considerable heterogeneity was determined when Cochrane\u2019s Q test resulted in P < 0.10 and I2 greater than 75%. In such cases, a random effect model was selected for analysis. Otherwise, a fixed effect model was used. If needed, a subgroup analysis was conducted to identify and explain the heterogeneity. A P value less than 0.05 was considered significant for all statistical tests.Stata 12.0  was used to perform the meta-analyses. The overall effect size of each anesthetic was calculated as the weighted average of the inverse variance for study-specific estimates. For dichotomous variables, we listed individual and pooled statistics as odds ratios with 95% confidence intervals. For continuous data such as the VAS scores with rest or mobilization at 6\u2009h, 12\u2009h, 24\u2009h, 48\u2009h, and 72\u2009h, total morphine consumption, and length of hospital, we pooled the weighted mean time to union with associated 95% confidence intervals and listed the individual means and standard deviations. Heterogeneity among the individual studies was evaluated based on Cochrane\u2019s Figure The general characteristics of the included studies are shown in Table The risk of bias summary and risk of bias graph can be seen in Figs. I2\u200a = 98.8%, P\u200a = \u200a0.000). The pooled results demonstrated that the LIA group was associated with a reduction in the VAS score with rest at 6\u2009h compared with the ITM group  compared with ITM, LIA significantly reduced pain scores with rest or mobilization at 6\u2009h, 12\u2009h, 24\u2009h, 48\u2009h, and 72\u2009h and (2) LIA further reduced the total morphine consumption, length of hospital stay, and morphine-related complications.Only one relevant meta-analysis has been published . DiffereThis meta-analysis demonstrated that LIA conferred better analgesia with rest up to 72\u2009h. Moreover, LIA was associated with a reduction in morphine consumption compared with the ITM group. Yin et al.  conducteThe results found that LIA could significantly reduce pain scores with mobilization up to 72\u2009h. Pain with mobilization is more important than pain with rest. LIA is not only effective for pain control but also facilitates patients mobilizing early and returning to normal physiological functions quickly. Jia et al.  conducteCurrently, opioids are commonly administered for pain control after TJA. However, morphine was associated with many insupportable complications, such as nausea and vomiting. Thus, total morphine consumption was also measured as the degree of pain control. We found that LIA was associated with a reduction in morphine consumption compared with ITM. These results were in accordance with the reduction in pain.We measured morphine-related complications  between the LIA and ITM groups. The results found that LIA was associated with a reduction in the occurrence of nausea and pruritus. However, there was no significant difference between the LIA and ITM groups in terms of the occurrence of respiratory depression. Kuch\u00e1lik et al.  revealedThere were a total of 5 limitations in the current meta-analysis. (1) Economic costs and functional outcomes for the LIA and ITM groups were not compared due to insufficient data, and future studies should focus on the economic costs and functional outcomes of LIA and ITM. (2) We included TKA and THA patients, and thus, there was high heterogeneity between the included groups. (3) The dose of anesthetics was different in the included studies, and more studies should be focused on the optimal dose and anesthetic drugs for anesthesia. (4) Long-term follow-ups should be performed to reveal the differences in complications of LIA and ITM.Local infiltration provided superior analgesia and morphine-sparing effects within the first 72\u2009h compared with ITM following TJA. There were fewer adverse effects in the local infiltration anesthesia groups. However, it should be noted that these conclusions are based on a limited number of studies and patients. Future studies can focus on the economic costs, functional outcomes, and incidence of adverse events to provide more comprehensive results."}
+{"text": "PurposeTo evaluate clinical outcome after surgery of idiopathic epiretinal membranes (ERM) with internal limiting membrane (ILM) peeling using a commercial combination of Brilliant blue G  with 4% polyethylene glycol (PEG).MethodsIt was a prospective, single-center study. Macular surgery was performed due to ERM (n = 18) by two experienced surgeons. Exclusion criteria were secondary ERM, previous retinal surgery and pharmacological treatment. Best-corrected visual acuity (BCVA), optical coherence tomography (OCT), and multifocal ERG (RETIscan) were assessed at baseline and three months after surgery.Results2) was 53.5 \u00b1 32.1 in ring 1 and 35.9 \u00b1 20.1 in ring 2. Three months after surgery the mean P1 amplitude was comparable with 57.2 \u00b1 16.3 in ring 1 and 38.0 \u00b1 11.7 in ring 2 compared with the initial situation .The BCVA improved from baseline 0.4 \u00b1 0.13 logMAR to 0.3 \u00b1 0.2 logMAR after three months (p > 0.05). The mean central foveal thickness was reduced from 407 \u00b1 85 \u03bcm to 366 \u00b1 56 \u03bcm after three months (p > 0.05). At baseline, the mean P1 amplitude (nV/degConclusionBBG with 4% PEG can be used for ILM peeling in patients with idiopathic epiretinal membranes without any sign of short-term toxicity. A macular epiretinal membrane (ERM) is characterized by fibrocellular proliferation of the internal limiting membrane (ILM) . StandarThe surgeon's choice of dye is influenced by many factors, including color contrast, specific staining properties and most importantly potential toxicity . Some dyThe use of heavy dyes facilitating sedimentation on the retina without the need for fluid-air-exchange has become popular in the recent past . Two comIn this prospective study 24 patients underwent surgery due to idiopathic ERM\u00a0by two experienced surgeons (>4000 vitrectomies). They were evaluated from July 2018 to November 2018. Only one eye of the patient was included into the study. Six patients were excluded because of incomplete follow-up. The study followed the tenets of the Declaration of Helsinki and was approved by the local ethical committee . Informed consent was obtained from all patients before enrolment in the study.Exclusion criteria were secondary ERM . Patients with previous retinal surgery, high myopia (>6 diopters) or previous pharmacological treatment for ERM  were excluded from the study.Best-corrected visual acuity (BCVA), optical coherence tomography (OCT) , and multifocal ERG  were measured at baseline and three months after surgery. The photoreceptor status on OCT was classified into two groups: intact and disrupt.\u00a0An intact photoreceptor line was interpreted as a regular continuation of the inner segment/outer segment junction (ISOS).We performed a standard 23-gauge suture-less vitrectomy with ILM Blue\u00ae  assisted ERM/ILM removal. A standard ophthalmic operating microscope  and a regular vitrectomy setup  with endoillumination (80%) was used. During the procedure we used a two-dimensional cutter  set to 8000 cpm during core vitrectomy (maximum vacuum 450 mmHg), peripheral vitrectomy (maximum vacuum 250 mmHg) and shaving for all procedures. After the core vitrectomy we performed a detachment of the posterior hyaloid followed by a thorough peripheral vitrectomy. Afterwards ILM Blue  was injected into the BSS filled eye and removed after a staining period of 30-60 seconds Figure . SpecifiDescriptive and statistical analysis were performed using SPSS software  and presented in terms of mean, standard deviation (SD) and range or percentage, as appropriate. Comparison of data was performed using the\u00a0t-test, and chi-square test, as appropriate. Non-parametric data were evaluated using Wilcoxon-Mann-Whitney Test, Wilcoxon Signed Rank Test, and Kruskal Wallis Test, as appropriate. Associations between non-continuous variables were analysed using Fisher\u2019s exact Test. Statistical significance was considered with a p-value of < 0.05.Macular surgery was performed due to ERM n = 18). The baseline characteristics are shown in Table 8. The baThe improvement in visual acuity was \u22652 lines in 11 of 18 eyes (61%). No patient had a worse visual acuity postoperatively. Postoperative visual acuity showed no correlation between the two surgeons (p = 0.36). All patients had preoperative subjective metamorphopsia, which significantly improved in the final control after three months (16/18) (p < 0.05).After surgery, the central foveal thickness was improved in all cases. The mean central foveal thickness was reduced from 407 \u00b1 85 \u03bcm to 366 \u00b1 56 \u03bcm after three months (p > 0.05). Preoperatively, 7/18 patients showed a disrupted photoreceptor status, which improved postoperatively in only one case. In two cases a disrupted photoreceptor status developed postoperatively, which had a significant influence on the postoperative visual acuity after three months (p = 0.048).At baseline, the mean P1 amplitude (nV/deg2) was 53.5 \u00b1 32.1 in ring 1 and 35.9 \u00b1 20.1 in ring 2. Three months after surgery the mean P1 amplitude was comparable with 57.2 \u00b1 16.3 in ring 1 and 38.0 \u00b1 11.7 in ring 2 compared with the initial situation . There was a statistically significant correlation between P1 amplitude of ring 1 and visual acuity and retinal thickness at baseline and three months after surgery (p < 0.05).Ring 1 and 2 responses of the P1 waves were significantly decreased at baseline compared with the normal fellow eyes (p < 0.05)  and the disrupted ISOS preoperatively and three months after surgery (p > 0.05).In this study, we were able to show that ILM Blue\u00ae-assisted peeling is safe in a prospective, real life clinical setting. Our data are supported by cell culture experiments in which no toxicity of BBG was described ,21.BBG performs a selective ILM staining with a low affinity for ERM ,22. ThisA possible explanation of Januschowski et al. for the improved biocompatibility of ILM Blue could be that the dye solutions sold by a manufacturer place special emphasis on the purity of the ingredients and quality control . It coulThe mfERG as an objective assessment of retinal function can be influenced by several factors including traction membrane removal, photoreceptor status, cataract progression, intentional ILM removal and the use of vital dyes. Since all phakic patients underwent simultaneously performed phacoemulsification, the factor cataract could be ruled out.Previous reports have shown that mfERG responses decreased three months after ERM surgery with ILM peeling without significance compared to baseline -25. On tThe photoreceptor status also has a decisive influence on macular function and thus on the mfERG, and this photoreceptor status is also primarily determined by the surgical procedure. Therefore, we have limited this prospective study to two experienced surgeons. We could not show a significant difference between the pre- and postoperative photoreceptor status, which argues against a decisive influence of the ILM Blue on the photoreceptor status.The mfERG value can be influenced by numerous factors that we cannot recognize and control, e.g. the tension on the macula during membrane peeling can also affect the function of the macula , so thatThe limitations of our study are the small sample size and a relatively short follow-up time, which may have led to insufficient statistical analysis. Recently it has been shown that a sample size of more than 1000 would be required to detect subtle negative effects of a vital dye . HoweverIn summary, we can nevertheless show in this study that ILM Blue\u00ae can be used for ILM peeling without showing signs of short-term toxicity. Larger controlled studies are justified to improve our understanding of the changes that can occur after ILM surgery."}
+{"text": "In recent years, waterpipe smoking (WPS) has increased among adolescents in Iran. This study aimed to explain the experiences of high school students in Iran on predictors of WPS reduction based on a multi-theory model (MTM) of health behaviour change.This study was a qualitative study of directed content analysis that was conducted in high school male students in Hamadan, Iran, in 2017. In this study, 34 students who had smoked waterpipe (WP) in the last month were recruited through snowball sampling that was continued until data saturation. The data were collected through semi-structured, individual interviews and were then analyzed using directed qualitative content analysis.The data analysis resulted in the extraction of 104 final codes around the six themes of predetermined MTM constructs consisting of participatory dialogue, behavioural confidence, changes in the physical environment, emotional transformation, practice for change, and changes in the social environment. The findings of this study showed that this model has the potential to explain the behaviour of WPS reduction. The main predictors of reduction in WPS are behavioural confidence, social environment change, and participatory dialogue.Findings of the research showed that the belief in an individual\u2019s ability, support from friends and the benefits of WPS reduction are the most important factors in reducing WPS among students. Therefore, it is suggested that comprehensive interventions be developed to improve the individual and social factors that are effective in WPS reduction. This entails the use of tobacco in centuries-old tradition through what is differently named as hubble-bubble, waterpipe, hookah, or narghile2. WPS has multiple harmful effects. For example, lung cancer, respiratory diseases, low birth weight, periodontal disease, bladder cancer, nasopharyngeal cancer, oesophagal cancer, oral dysplasia, infertility and hepatitis C infection3 are all attributed to WPS. It is estimated that approximately 100 million people, particularly teenagers, use this kind of smoking4. Since the period 2009\u20132016, studies reporting on WPS indicated a 0.4% to 2.9% annual increase in current WPS in the Eastern Mediterranean and European Regions, and 0.3% to 1.0% increase in the USA7. Population data indicate that from 3.3% to 7.5% of US youths have tried waterpipe8.Waterpipe smoking (WPS) is the practice of inhaling tobacco smoke generated by a multi-stemmed device. Generally, charcoal pieces are placed on top of a perforated aluminium foil separating it from specially made tobacco that is usually flavored10. In the Mediterranean, the use of WPS is an important public health problem. There is a potential for increased usage and hence increased tobacco-related morbidity and mortality unless intervention measures are taken now11. In a study, 9.7% of the students consumed waterpipe in the past month, of which 66.6% were male and 33.4% were female, which indicates a higher prevalence in males4. In another study, the prevalence of current WPS was reported as 26.3% among male high school students12.Studies reported a high prevalence of WPS use among adolescents globally4. Students who smoke waterpipe have low self-efficacy to quit and find it cost-effective. Other factors associated with its use include enjoyment with friends, loss of friends if one was to quit, feeling unwell if one was to quit, and feeling of loneliness on quitting. Also, students believe that WPS is related to some factors such as high perceived rewards like a sign of manhood, sense of pleasure, filling the vacuum of loneliness, focusing more on doing things, increasing intellectual capability, becoming calm, getting friends together, and accepting friends13. Evidence suggests that there are different structural and social factors in shaping behaviour patterns of cigarette smoking and WPS, which requires behavioural change theories to analyze these behaviours. To achieve efficacy and effectiveness in WPS reduction, educational programs are needed for developing healthy behaviours15.In general, factors such as the pleasant smell, the attractive design of the waterpipe, availability and affordability, social acceptance due to cultural views and beliefs that WPS is less harmful compared to cigarette smoking influence WPS among adolescents16 recently proposed a multi-theory model (MTM) for health behaviour change, using constructs that have been extensively validated with a broad range of populations in cross-cultural settings. The MTM poses that three primary constructs explain and predict the initiation of health behaviour change including participatory dialogue , behavioural con-fidence  and changes in the physical environment . Also, three additional constructs in sustenance or maintenance of behaviour including emotional transformation , practice for change (supervision and reflection on behaviour) and changes in the social environment 18. Given that WPS is complex and rooted in people\u2019s beliefs, the use of qualitative methods can lead to in-depth information from waterpipe consumers19. Therefore, this study aimed to explain the experiences of high school students in Iran on predictors of WPS reduction based on MTM.Although a variety of theoretical models have been used to identify such factors, the existing health behaviour theories and models have conceptual problems, lack predictive power, are not parsimonious, and/or are too comprehensive, and consequently, impractical. In recognition of these issues, SharmaIn this study, the first- and second-grade high school male students of Hamadan city in Iran, who had experienced WPS in the last month, were included. At first, one school was selected from the upper part of the city and one from the lower city of Hamadan. After interviewing the first student who had a history of WPS in the past month (purposive sampling), he was asked to introduce his other friends who had smoked WP in the past month to the researchers . Selection of male students to obtain different views and perceptions was sought with the highest diversity . In this study, data were saturated after 34 interviews.20. To observe ethics in the research, researchers explained the reason for recording male students\u2019 voice during the interview and emphasized that all information received was confidential and was to be used solely for the purpose of the study only. During the interviews, a gift (notebook) was provided as an incentive. Also, researchers emphasized that the participants had the right to withdraw from the study at any time. Written consent was received from the people interested in participating in the study. The present study was approved by the Hamadan University of Medical Sciences Ethics Committee (ID: IR.UMSHA. REC.1396.21).The present study was qualitative and conducted using directed content analysis. To collect data, individual interviews were used during a 3-month period March\u2013July 2017. The interviews were conducted in one of the classes by an interviewer and a note-taker. All of the interviews and translations were conducted in Persian. In this type of qualitative research, since there are no established criteria for determining the number of contributors to the qualitative research before the study begins, this number is based on the information obtained and until the total saturation of the classes has occurred The interviews were conducted using the MTM constructs, which included participatory dialogue, behavioural confidence, changes in the physical environment, emotional transformation, practice for change, and changes in the social environment. All of the interviews lasted 20\u201340 minutes. Questions were open-ended such as: \u2018What do you think of the disadvantages and advantages of WPS reduction?\u2019, \u2018How sure are you that you can reduce WPS?\u2019, \u2018How sure are you that you can avoid WPS environments?\u2019, \u2018How sure are you that you can direct your feelings about WPS reduction?\u2019, \u2018How sure are you that you can supervise your WPS by keeping a diary?\u2019, \u2018How sure are you that you can get help from friends and family for WPS reduction?\u2019. Also, in the interviews some in-depth probing was conducted such as: \u2018Would you explain more?\u2019, What do you mean?\u2019, \u2018Can you give an example?\u2019. .21. In the directed content analysis method, initial coding begins with an established theory or results. This type of analysis aims to validate the theory or develop a conceptual framework. The theory chosen in this type of study can help in focusing the research question. On the other hand, theory can help in predicting interesting variables or relationships between variables. As a result, it is also useful in determining how the initial encodings occur and the relationships between the codes22.One of the methods of qualitative research, which is presented in 2005 by the Hsieh and Shannon analysis, is a directed content analysis method or theory-based content analysis method21, the interviews were heard several times and their transcripts were repeatedly reviewed. In this research, different methods were used to provide accreditation and analysis of data such as prolonged engagement in the information gathered and reading manuscripts multiple times and member checking method for comparing the researchers\u2019 and views of the participants. After several accurate readings, the text was analyzed by the researcher as an open coding system for the production of primary category. For this purpose, the texts of the interviews were first divided into semantic units and then summarized and converted into codes. Different codes were compared based on their similarities and differences and divided into categories. At this stage, the first classes were discussed and reviewed by three researchers to reach the themes24.After recording a participant\u2019s voice, the text of the interviews was written on paper at the first opportunity by two researchers . Given that in qualitative research, researchers must be immersed in the informationIn this study, we identified and categorized the whole content as it related to the particular phenomenon of our study. The entire text was studied, and those sections that were identified through the initial recognition by the researchers were noted. In the next step, based on predetermined codes (based on theory), the parts were marked and encoded.To provide and validate data credibility, there was a constant relationship with the male students to gain a better perception of their opinions. To confirm the coding method in the MTM constructs, a review was carried out by supervisors . The supervisors did not consider their own personal views about WPS  in their research.In this study, 34 male students in grades 8\u201312 with a mean age of 16.47 years were studied. The mean age of initiating WPS was 11.6 (2.83) years . After iThe participatory dialogue structure has already been divided into two main categories of perceived advantages and disadvantages of WPS reduction. Most of the students believed that WPS reduction has benefits such as being healthier, lower costs and having a better social image:\u2018The benefits of WPS reduction are to breath better, you do not have a headache or hypertension\u2019. \u2018I knew someone that wanted to smoke waterpipe, but did not smoke at that time to save his money. Two years later he saved a lot of money, also saving time is a benefit of WPS reduction.\u2019 \u2018If you reduce WPS, you have a better image in your family. Everything you want, they provide for you due to reducing WPS and reducing WPS causes reducing bad friends.\u2019 \u2018Reducing WPS helps you to do school homework better and you have good scores in the exams.\u2019 They also believe that less fun and physical and psychological dependence are the disadvantages of WPS reduction:\u2018If I reduce WPS, I will not be able to hang out with my friends. My friends split off, and I cannot see them.\u2019 \u2018Iranian adolescents\u2019 fun is just WPS. In our city adolescents have one fun, and it is WPS, so reducing WPS means to loss our fun.\u2019 Students believed that reducing WPS causes one to suffer from physical and psychological dependence:\u2018In fact, the disadvantages of reducing WPS are to suffer from dependence signs, for example having physical pain.\u2019 \u2018If I reduce WPS, I will suffer from mental dependence signs, for example, intensive temptations.\u2019 The self-efficacy is the main category of the behavioural confidence theme. The most important and influential factor in predicting the decrease in WPS in terms of students was the will and belief in individual ability to reduce and stop WPS. They believe that the individual\u2019s ability and will in the addiction issue, especially the WPS, play a more critical role than other factors, and one can begin to reduce the consumption of waterpipe from the will and beliefs of the individual:\u2018In my opinion, family and friends cannot help us to reduce WPS. Absolutely, the reduction of WPS is dependent on our ability and willingness.\u2019 \u2018I can reduce and quit WPS. Generally, whenever I want to reduce WPS, I can, and it is not difficult for me to reduce it.\u2019 WPS is inexpensive and able to afford it were the main categories of changes in the physical environment theme. Students believed that affordability, availability, and ability to buy waterpipe over other tobacco products such as cigarettes was a boost at the start and played a preventive role in reducing consumption:\u2018I think WPS is better than other options, for examples cigarette smoking and tobacco due to availability and easy to reach.\u2019 Students believed that waterpipe being inexpensive increases WPS in society:\u2018WPS is not expensive, and you can buy it at a low price. I think WPS cheapness causes that every adolescent starts to smoke it. In my opinion, cheapness does not help you to reduce it.\u2019 The pleasant feeling is the main category of the emotional transformation theme. Most students believed that the use of waterpipe would create a positive and supportive mood:\u2018I smoke waterpipe, so that I feel better. When I smoke waterpipe, I relax and enjoy it.\u2019 \u2018Actually, preparing and providing waterpipe is enjoyable for me and it gives me a good feeling. I like that mood.\u2019 The active reflection and reflective behaviour is the main category of practice for change theme. Students believed that using notes and memorizing, was considered an effective monitoring method to help reduce WPS:\u2018Writing the amount of WPS, using notes and memorizing can help you to reduce WPS. It helps you not to forget the amount of WPS. I think it is best idea for reducing WPS.\u2019 \u2018In my opinion, keeping a diary is useful for reducing WPS. It makes you feel better and gives you motivation for reducing. Also, the memorizing about the amount of smoking has its good points.\u2019 The social support is the main category of changes in the social environment theme. Most of the students believed that the role of friends and supporters, who could assist in terms of information and guidance on the side effects of waterpipe, play a vital role in reducing WPS:\u2018I think the most important thing about friends is their kindness, irrespective of being a smoker or not. A friend can give some advice about several harmful effects of WPS. His advice is so important for me, as in giving knowledge to me about WPS risks.\u2019 Students believed that as much as a friend could play a role in initiating and encouraging consumption, he could play a supportive role in reducing the issue and leaving the WPS:\u2018In fact, some of my friends can help me in reducing my WPS. I can rely on them due to their kindness and attention. I get on well with them and have a good relationship. I am not worried about reducing WPS, because I have helping friends.\u2019 \u2018I think the best friend who can help to reduce waterpipe is if he is not waterpipe smoker. If my friends do not smoke waterpipe, I can get help for my reducing waterpipe.\u2019 The findings of the present study showed that WPS reduction could be explained using MTM. According to the results of this study, most of the students understood the benefits of WPS reduction and stated that reducing the WPS has advantages such as being healthier, lower costs and having a better social image.25. Concerning this finding, the results of the same study showed that emphasis on benefits of reducing WPS behaviour  could have an active role and help to reduce WPS26. Therefore, educational interventions should emphasize the positive outcomes and benefits of adopting health behaviour or correcting negative health behaviour.Smokers\u2019 beliefs about the benefits of quitting are related to smoking cessation behaviour in smokers motivated to quit smokingIn connection with the disadvantages of reducing WPS, students said that if they reduce WPS, their entertainment will be lowered, they would lose their friends, and their leisure will be less. They also reported suffering from complications of quitting WPS that can be physical and mental.27. The results of other studies have shown that, besides being friends, keeping in touch with friends, being afraid of getting lonely and attracting friends are reasons why waterpipe smokers are turning to it and will not leave it28. In our study, suffering from complications of quitting  was a new result that other studies have not mentioned, so it seems WPS is not only a tobacco smoking behaviour but also a kind of social behaviour that waterpipe consumers use to get together with friends and have enjoyable moments. Therefore, WPS is suggested and presented within a community of fun and lively entertainment aimed at getting together for young people to spend pleasurable moments. The results of our study showed that students believed that the will and belief in individual ability  played an essential role in reducing and leaving the waterpipe.In general, those who use tobacco emphasize the perceived disadvantages can be a motivational predictor of the quitting and related factors29. Along with our result, the results of various studies have shown that self-efficacy and belief in individual ability play an important role in the behaviour of WPS30. It seems that by determining the level of self-efficacy of waterpipe smokers, self-efficacy enhancement strategies can be of great importance through the motivation and continuity of the behaviour, saying-no skill, the increase in self-esteem, and self-belief in one\u2019s ability to reduce and quit the behaviour.Self-efficacy is an estimate of the degree to which a person has the confidence to perform a particular behaviour or a chain of specific behaviours to control and manage situations17. Along with our results, recent studies have shown that the role of facilitating factors such as availability, price and ability to buy, increase the prevalence of WPS in the community33. It can be deduced that comprehensive policies and measures from health policymakers need to be taken to prevent, reduce or quit WPS, enhance or modify the physical environment including the removal of all signs and stimuli from WPS.Other results from this study were that students believed lower expense, availability, and ability to buy waterpipe had a significant role in WPS in the community. The physical environment in the discussion of drug use and tobacco behaviour can include the ability to access, accessibility, and provision of resources easily33. Various studies consistent with the results of our study have shown that the sensory properties of WPS include taste and smell35. Our study showed that the sense of relaxation in the preparation of the waterpipe creates a good mood that promotes smoking waterpipe. The tendency and feeling of people regarding WPS can be rooted in their desired attitude. Therefore, it seems that in educational interventions, based on the health risks of WPS, a positive attitude can change to a negative attitude towards WPS.The sense of relaxation of the preparation and the pleasure of WPS was one of the other results that were reported by students. Emotional changes, the ability to direct emotions and guide them towards the goal is important for helping to change health behaviour36. Consistent with the results of our study, the study by Evans et al.37 showed that students who had less self-regulated feelings than other students had a higher chance of starting smoking. Regarding the lack of studies in the field of the role of self-regulation in WPS, it seems that using the self-regulating process in students can create changes in them and direct them in reaching their goal, so that the probability increases for their behaviour to change to reduce waterpipe.Another finding of this study was that students considered effective monitoring methods, to help reduce WPS, memos and mentoring. They argue that their monitoring of the behaviour of their WPS can help reduce WPS. Self-regulation means a tendency to control internal modes, control momentums, and behaviours, and adapt them to criteria to achieve the goal22. Consistent with the results of our study, the study by Kong et al.38 showed that the use of social support could reduce the chance of smoking throughout the life of adolescents. Also, another study found that the role of friends and family members in WPS and cigarette smoking is important, and they can play an influential role for consumption when starting and continuing WPS39. Therefore, in educational planning and interventions, it is necessary to pay attention to the friends of the waterpipe smoker and to inform them about the harmful effects of WPS so that they also inform their friends about the harm caused by WPS.This study showed that the role of a friend in emotional support that is associated with compassion and helps reduce WPS, is one of the principles of social support and this can be important in reducing WPS and plays a significant role. Social support is the degree to which people give it to close relatives or to those in need in critical situations; this includes information, emotional support, material support, and feedback supportThis study has some limitations. First, this study is qualitative and limited to grade 8\u201312 high school students in Hamadan. Being qualitative it provides a snapshot in time and does not generalize to all community adolescents. Second, our study was not implemented among female students, because of challenges of getting permission to enter girls\u2019 high schools. Thus, implementation of the program to cover female students could give better estimates of WP use and associated factors among all Iranian adolescents. Third, the present study\u2019s design is limited in being able to draw a definitive conclusion regarding efficacy.The findings of this study indicate that WPS by students based on MTM is more influenced by the behavioural confidence, social environment and participatory dialogue constructs using a qualitative approach. In general, behavioural confidence, the role of student friends and awareness of the benefits of reducing WPS play an important role in adopting behaviours related to WPS. Therefore, health planners must design and implement comprehensive interventions in schools in order to improve individual and environmental factors in order to reduce WPS."}
+{"text": "The Five Factor Model (FFM) of normative personality is predictive of long-term outcomes, including well-being and anxiety. For example, people with anxiety disorders often report high Neuroticism and low Conscientiousness . Dementia-related anxiety (DRA) is concern about developing dementia that can occur in individuals of any age and cognitive status . This study assessed associations between the FFM and DRA and the extent to which other factors, such as demographics and variables related to DRA , contributed to relationships. Participants  completed measures of the FFM, DRA, locus of control, and dementia knowledge. Hierarchical regression  was computed. The set of predictors explained 17.9% of the variance in DRA, F = 9.69, p < 001. Being older, partnered, low on Conscientiousness and Openness, and having greater external locus of control and less dementia knowledge predicted higher DRA . Surprisingly, Neuroticism was not predictive of DRA after controlling for demographic and DRA-related factors, indicating that the trait-like tendency towards emotional instability does not explain DRA. Longitudinal research can explore the course of relationships among Conscientiousness, Openness, and DRA over time to further examine significant effects of age, as expressions of personality change across the lifespan. Research targeting potentially modifiable factors  could help identify methods of reducing DRA."}
+{"text": "Apis. In regions such as South America, Australia, and Southeast Asia, information on stingless bee bee bread is mainly sought to promote the meliponiculture industry for socioeconomic development. This review aims to highlight the physicochemical properties and health benefits of bee bread from the stingless bee. In addition, it describes the current progress on identification of beneficial microbes associated with bee bread and its relation to the bee gut. This review provides the basis for promoting research on stingless bee bee bread, its nutrients, and microbes for application in the food and pharmaceutical industries.Stingless bee-collected pollen (bee bread) is a mixture of bee pollen, bee salivary enzymes, and regurgitated honey, fermented by indigenous microbes during storage in the cerumen pot. Current literature data for bee bread is overshadowed by bee pollen, particularly of honeybee  Bees have a unique social life. In a social bee community, the queen dominates the reproduction and has a morphology different from other bees. The colonies live for many years  . StingleBee products are crucial for bee survival, and it is acquired for medicine, offering cosmetic, and everyday uses since 8000 BC . GradualBee bread is one the bee by-products made from pollen collected by the bee added with nectar and bee salivary enzymes before it undergoes lactic acid fermentation in beehives . Bee breConsumer interest and demand for natural products have influenced in-depth research for bee bread nutritional properties. Bee bread is rich in carbohydrate, protein, and lipids and contain other micronutrients such as minerals, vitamins, phenolic compounds, and essential amino acids . It possApis spp.) has been continuously reported [Research on bee pollen from European honeybee , which are essential for plant reproduction. It is either distributed through the wind (\u201canemophilous\u201d\u2014wind-pollinated) or by an insect (\u201centomophilous\u201d\u2014insect-pollinated). The global production of pollens was estimated as 1.36 million kg per year with China, Australia, and Argentina as the biggest contributors .Heterotrigona itama prefers foraging plants closest to their hive especially from white- and cream-coloured flowers [The process of stingless bee making bee bread begins from plant pollen, which is illustrated in  flowers ,21,22 wi flowers .Mimosa pudica [Mimosa caesalpiniaefolia [During foraging, forager bees collect nectar and store it in their honey stomach while their bodies are covered in pollen dust. Pollen profile collected by different stingless bees species has been documented in Southeast Asia ,26,27,28a pudica ,26 and Miaefolia .Apis. Bee pollen is acquired using a pollen trap installed at the hive entrance, which strips the pollen from the bee\u2032s leg by forcing the bees to crawl through a small tight hole [As the bees collect pollens, they use their salivary enzymes (amylase and glucosidase)  and honeght hole .If the bee pollen is not harvested, the worker bees pack the bee pollen inside a cerumen pot (for stingless bee)  or honeysambura\u201d is 247 USD/kg [A single stingless bee colony could produce up to 6 kg of bee bread per year depending on the species. In Brazil, the maximum price for bee bread, locally known as \u201c7 USD/kg . In Mala7 USD/kg .Because stingless bee\u2032s bee bread is stored in cerumen pot, its acquisition is different from those of honeybee. Honeybee bee bread is acquired either through manual extraction  or usageFlower pollen undergoes different development stages to become the end product known as bee bread. The biochemical profiles of flower pollen, bee pollen, and bee bread  are diffAloe greatheadii var. davyana and Helianthus anthuus (sunflower) showed that bee bread has significantly higher water and carbohydrate content, but lower protein, lipid, and fatty acid content than its fresh pollen [Comparing the chemical composition of monofloral pollens is more enticing . For exah pollen ,45. Flowh pollen ,45. Howeh pollen ,45.Melipona asilvai, M. quadrifasciata anthidioides, M. scutellaris, M. subnitida, Tetragona clavipes, and Plebeia sp. bee pollen. The pH for stingless bee bee bread will be discussed in the later section.Perhaps the noticeable change between bee pollen and bee bread is the pH. Bee bread is more acidic compared to bee pollen. Studies on pH changes of stingless bee pollen and bee bread are still lacking. However, when looking upon European bee pollen pH, it shows to be significantly reduced from pH 4.7 to 3.97 after transformation into bee bread . Duarte Scaptotrigona postica. A recent study also showed bee bread digestibility equivalent to those of fresh pollen even after consumption and digestion by Apis mellifera scutellata [Fermentation not only produces chemical changes in bee bread but also has been speculated to improve bee bread digestibility and bioavailability by degrading the outer pollen layer ,49,50. Nutellata . In thisNesocodon mauritianum) has purple pollen. Pollen colour tends to change into black once stored in hive due to oxidation [A stingless bee can carry a pollen weight of 10.9 mg  and the xidation . Bee proxidation , which rPollen wall has three different layers. The outermost layer is the pollenkitt followed by the outer wall (exine) and inner wall (intine). The exine consists of sporopollenin, while the intine is composed of cellulose and pectin . The exiBee bread contains accumulated pollen grains from various flowering plants. Although analysis of pollen colour could give an insight into its floral origin, a single pollen colour does not indicate monofloral source . This isMelissopalynology is the microscopic study of pollen grains in bee products such as honey, pollen, propolis, and royal jelly . Pollen Pollen morphology is species-specific; therefore, it provides valuable information on the pollen\u2019s botanical origin and plants preferentially visited by the bees ,63. ThisTetragonula angustula, Ptilotrigona and Frieseomelitta doederlini, and F. varia produce sweet bee bread, whereas Melipona and Scaptotrigona produce bitter bee bread [The taste of bee bread is different across species. For example, ee bread ,64. To ree bread .Apis mellifera pollen to be considered as an international standard. However, unlike bee pollen, bee bread standard has yet to be articulated. Due to this setback, researchers opt to compare the research data of stingless bee bee bread to the international standard of bee pollen Apis spp. [Importantly, 250 different compounds comprise bee bread, and these are macro- and micronutrients, vitamins, amino acids, fatty acids, and phenolic compounds . Bee brepis spp. .It is challenging to generalise bee bread nutritional values. Several factors including botanical and geographical origin, climatic condition, soil type, beekeepers\u2019 activities, or storage treatments in commercial production ,70 contrBee bread has shown to possess high moisture content. It is attributed to the pollen\u2019s hygroscopic properties, which attracts water from the environment. Bee bread accumulates water from the surrounding and also through the addition of bee saliva and honey resulting in a sticky end product. Storage in closed pots prevents water loss from bee bread . AccordiBecause pollen is hygroscopic, bee bread requires adequate drying parameters to achieve the desired moisture content. Different preservation methods are utilised in the beekeeping industry to preserve bee bread. Oven drying has been proven to be the best method to preserve bee bread over frozen and refrigeration method based on the reduction in moisture content and microbial load .w suitable for microbial colonisation, which is 0.60\u20131.00. The preservation method such as drying until Aw goes below this level and can help prolong the bee bread shelf life. High Aw of fresh bee bread provides a favourable environment for the growth of beneficial bacteria, pathogenic bacteria, fungi, or mould [w parameter should be critically observed for quality control during storage.Bee bread has water activity between 0.60 and 0.92  within tor mould ,73,74. Tor mould . TherefoMelipona scutellaris (pH 3.28) [As previously mentioned, bee bread is more acidic than bee pollen. Duarte et al.\u2032s  study onpH 3.28) . The pH pH 3.28)  suggestipH 3.28)  However,Aloe greatheadii var. davyana and Helianthus annuus bee bread in comparison to its fresh pollen.Tetragonula testaceitarsis bee bread had the lowest value with 43.1% [Tetragonula biroi Friese from the Philippines has the highest value with 59.94% [Most bee bread from Southeast Asia (SEA) is reported to have higher carbohydrate values than bee bread from other regions. Thailand\u2032s th 43.1% , while Th 59.94%  among SETetragonula biroi from the Philippines [Meliponini subnitida from Brazil [Trigona spp. from Malaysia [Tetragonula biroi bee bread [The sugar analysis comparison  shows relippines , Meliponm Brazil ,87, and Malaysia . Other oee bread .Apis mellifera L. salivary (thoracic) gland secretes invertase, amylase, and glucosidase [Meliponini, Trigonini, and Scaptotrigona spp. could digest pollen polysaccharides into simple sugar using enzymes \u03b1 and \u00df-amylase and \u03b1-glucosidase [Bee incorporates nectar and its salivary enzymes during pollen agglutination . Dependicosidase . Stinglecosidase . Simple Bee bread is rich in protein content, thus becoming the main protein source for bee development. The protein levels are varied across different geographical locations and between bee species (10.19\u201347.4%) . Pollen Tetragonula biroi from the Philippines and found mean values of only 1.83 g/100 g bee bread. Among the essential amino acids, leucine, and phenylalanine were highly present in the studied bee bread , and the most abundant saturated fatty acid was capric acid (1.89\u20135.66 g/100 g) and the common PUFAs were Omega-6 (\u03b1-linoleic acid) (0.50\u20131.63 g/100 g) and omega-3 (0.30\u20130.86 g/100 g) [Bee bread has diverse fatty acid profiles, which provides benefits to the bee nutrition and also for human health. According to Szcz\u0119sna , the mosg/100 g) .Tetragonula laeviceps bee bread. The ratio of polyunsaturated to saturated fatty acids was 1.59, higher than the ideal ratio of 1, which can slightly reduce HDL cholesterol level [Melipona mandacaia bee bread [trigona species using gas chromatography (GC-MS). Propanoic acid and palmitic acid were the most abundant saturated fatty acids in Trigona apicalis (4.04%) and Trigona thoracica (1.28%) bee bread, respectively. Meanwhile, minute amounts of omega-3 and omega-6 fatty acids were detected in range of (0.07\u20130.11%). In addition, analysis of volatile organic compounds (VOCs) found acetic acid as the sole organic acid in Australian Tetragonula carbonaria and Tetragonula hockingsi but absent in Austroplebeia australis [However, in another study, palmitic acid (1.65 g/100 g) was the prevalent fatty acid followed by omega-6 (1.52 g/100 g) in ol level . Similaree bread . Omar etee bread  analysedustralis .Phenolic compounds are secondary plant metabolites found widely in plants as a protective mechanism when encountering biotic or abiotic stress. They include phenolic acids, flavonoids, proanthocyanidins, and more. Intake of food containing phenolic compounds is sought to reduce the risk of gaining chronic diseases because of its antioxidant and anti-inflammatory properties . AccordiHeterotrigona itama bee bread yielded different amounts of polyphenols. Ethanolic extracts were found to have higher TPC (21.32\u201322.54 mg GAE/g) and TFC (16.48\u201326.57 mg QE/g) than aqueous extract [Austroplebeia spp. and Tetragonula spp. bee bread. [TPC and TFC content varies for different stingless bee species even from the same location . The sol extract . When coe bread. . HoweverTetragonula angustula bee bread. TPC ranged from 1053.1 to 2627.4 mg GAE/100 g pot-pollen, while the TFC was between 104.6 and 676.4 mg QE/100 g pot-pollen. In another study, Vit et al. [Frieseomelitta sp. and Melipona spp. with 1018.0\u20132085.0 mg GAE/100 g pot-pollen and 75.7\u2013656.3 mg QE/100 g pot-pollen, respectively.In Southern Venezuela, Vit et al.  determint et al.  detectedApis spp. [pis spp. , fruits pis spp. ,103.Heterotrigona itama bee bread contains an average of 0.1108 mg vitamin C/g bee bread, which is considerably low based on the daily recommended intake [Analysis of bee bread vitamin content is still scarce. d intake . Becaused intake ,108. Extd intake .Tetragonula biroi [The most abundant mineral in stingless bee bee bread is potassium followed by phosphorus. From the studies conducted , potassila biroi .Heterotrigona itama [H. itama samples exceeding the proposed limit for heavy metal [Tetragonula biroi Friese bee bread but at a safe level [Apart from minerals, toxic metals such as arsenic, mercury, lead, and cadmium were detected in bee bread of na itama  and withvy metal . Belina-fe level . Toxic mfe level  as a resThere has been a tremendous report published on bee pollen as it is shown to possess therapeutic properties such as antioxidant, anti-inflammatory, antibacterial, anti-fungicidal, hepatoprotective, and anti-atherosclerotic activities . In contM. compressipes manaosensis inhibited P. aeruginosa, M. smegmatis, and Candida albicans efficiently and also mosquito larva C. quinquefasciatus, a vector for human parasitic worm Wuchereria bancrofti, in a concentration-dependent manner.Bee bread extract contains phenolic compounds, which can be attributed to its antimicrobial properties. Therefore, its importance as an antimicrobial agent has to be acknowledged not only towards bacteria but also towards yeast and parasite. Carneiro et al.  demonstrHeterotrigona itama bee bread against Bacillus cereus, Staphylococcus aureus, Escherichia coli, and Salmonella sp. Gram-positive bacteria were more sensitive towards the bee bread extracts, whereas ethanolic extract demonstrated stronger antibacterial activity compared to hexane extract.Akhir et al.  used ethAustroplebeia australis, Tetragonula carbonaria, and Tetragonula hockingsi in Australia. The extracts were effective against both Gram-positive  and Gram-negative bacteria . Similarly, extraction using ethanol showed better results as shown by the lowest minimum inhibitory concentration recorded by ethanolic extracts of Tetragonula hockingsi bee bread.Meanwhile, Perez-Perez et al.  examinedFrieseomelitta, Melipona, and Tetragonisca spp. from Venezuela and found that they exhibited antibacterial effects against Bacillus subtilis, Staphylococcus aureus, Enterobacter cloacae, and Pseudomonas aeruginosa but not against Escherichia coli. The antibacterial activities were correlated to the phenolic content.Sulbar\u00e1n-Mora et al.  investigPhenolic compounds are one the most important natural antioxidants, which can be found in fruits, vegetables, tea, herbs, and essential oils. Antioxidant removes overproduced free radicals or reactive oxygen species (ROS), which cause molecular damages on DNA, protein, and lipid. Consequently, it has been linked with onset of diseases such as cancer and inflammation . StingleThere are multiple methods to assess the antioxidant activity of a plant extract and 2,2,-di-phenyl-2-picryl-hydrazyl (DPPH) is the most common in vitro method applied due to its simplicity, cost effectiveness, and rapidity . HoweverH. itama bee bread were determined using DPPH and 2,2-azinobis-(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) [Antioxidant activity is also affected by solvent extraction. For example, the antioxidant activities of ethanolic extract from ) (ABTS) . The ethAustroplebeia australis, Tetragonula carbonaria, and Tetragonula hockingsi bee bread when using ABTS, Fenton type reaction, and hydroxyl radical, respectively. The antioxidant activities also varied according to bee species. Comparison between trigona species showed Trigona thoracica bee bread with the highest DPPH inhibition (IC50/0.86 mg/mL) followed by Trigona apicalis (IC50/1.05 mg/mL) and Trigona itama (IC50/3.24 mg/mL) [However, Perez-Perez et al.  found si4 mg/mL) .Bee bread antioxidant ability corresponds to phenolic compounds ,107,119.Obesity is a public health concern. According to World Health Organisation , in 2016Heterotrigona itama bee bread reduced Lee obesity index and levels of total cholesterol (TC), low-density lipoprotein (LDL), fatty acid synthase (FAS) activity, atherogenic index, oxidised-LDL (oxLDL), and malondialdehyde (MDA) and significantly increased aortic antioxidant enzymes activities (superoxide dismutase (SOD) and glutathione peroxidase (GPx)) in high-fat diet (HFD)-induced obese rats. En face aorta images showed smaller adipocytes sizes and absence of atherosclerotic plaque in obese rats supplemented with bee bread [For example, ee bread .H. itama bee bread attenuated renal pathology caused by obesity by diminishing oxidative stress and downregulating the expressions of inflammatory markers and bax-mediated proapoptotic condition in the kidney of HFD obese rats.In another research, Eleazu et al.  studied Melipona fasciculata and Scaptotrigona affinis postica ethanolic bee bread extracts were administered in induced-oedema mice model in two separate studies [Some studies also suggest bee bread extract\u2019s ability to reduce inflammation.  studies ,106. TheMelipona fasciculata and Scaptotrigona affinis postica. Upon investigation, Melipona fasciculata bee bread extract (500 mg/kg) reduced the abdominal contort in mice suffering from acetic acid exposure better than indomethacin. Meanwhile, the formalin test showed bee bread extract efficiency similar to those of indomethacin in reducing biting/licking time in mice [Bee bread extract has the ability to block pain detection through its antinociceptive activity. In vivo studies were conducted on pain-induced mice administered with bee bread ethanolic extract of two different species\u2014 in mice .Scaptotrigona affinis postica ethanolic extract at lower dosage (250 mg/kg). The bee bread treatment showed similar effect to indomethacin in the acetic acid writhing test but significantly better than the drug (p < 0.005) in the formalin test. The presence of polyphenols and flavonoids was suggested to be responsible for these activities [In a different study, Lopes et al.  investigtivities ,106.Bee pollen conversion into bee bread via lactic acid fermentation is linked with microbial action. Bee bread has been assumed to undergo microbial fermentation to increase its nutritional value ,48. ThisBifidobacterium, Bacillus, and yeasts from different bee bread species are summarised in In this section, understanding the bee bread microbial ecology will include data of bee bread from other bee species such as the honeybee and solitary bee due to limited record on stingless bee bee bread microbes. Beneficial bacteria isolated from bee bread, such as LAB, Aspergillus niger, Zygosaccharomyces rouxii, and Candida sp. [Bacillus spp. from Heterotrigona itama bee bread with enzyme and antimicrobial-producing properties. In addition, Mohammad et al. [Regardless, isolation and identification of microbes from bee bread have been widely reported. Yet, the study on their functional properties towards the bee ecosystem and most importantly, their potential for industrial application is still incomprehensive ,124. Somdida sp. . To datedida sp.  identifid et al.  isolatedLactic acid bacteria (LAB) such as Lactobacillus, Enterococcus, Lactococcus, Leuconostoc, Pediococcus, Streptococcus, Carnobacterium, Aerococcus, Vagococcus, Oenococcus, Tetragenococcus, and Weisella  produce Apis mellifera species. Only a few studies have discussed on microorganisms in the stingless bee [Lactobacillus sp. particularly Lb. kunkeei is commonly found in bee bread [Apis mellifera belongs to Lactobacillus spp. which is largely composed of Lb. kunkeei [Lb. kunkeei was detected in low quantities in fresh bee bread of solitary bee Osmia cornuta and absent in the old bee bread of Osmia coruta and bee bread of H. itama [Current literature has conveyed extensive study conferring on microorganisms associated with honeybee bee bread or its ecosystem overall, particularly for less bee . The bacee bread ,129,130. kunkeei . HoweverH. itama ,130.Fructobacillus fructosus from H. itama bee bread. Fructobacillus spp. is a group of fructophilic LAB, which prefer fructose substrate over glucose [H. itama honey [Apis mellifera bee pollen, and bee bread [Recently, Mohammad et al.  isolated glucose  and can ma honey , honeybeee bread ,134 withApis without cultural bias. Oenococcus and Lactobacillus were the most active microbes in bee bread, comprising 52% and 60% of bacteria, respectively, suggesting its important contribution towards bee pollen conversion.Culture-independent studies help to provide more useful insight into the bee bread bacterial community, taking into account species which are unculturable under controlled condition. Mattila et al.  used 454Bacillus seem to hold its importance in the bee bread metabolic conversion. Although Gilliam [Bacillus in honeybee bee bread, the lactic acid production is less efficient than lactic acid bacteria fermentation. The functional role of Bacillus in bee bread was not defined until now. One of the early assumptions of Bacillus role in bee bread production was to produce enzymes for bee pollen conversion [Bacillus spp. such as B. subtilis [B. megaterium [B. licheniformis [Melipona fasciata [H. itama [Tetragonula biroi Friese [Apis mellifera [Osmia cornuta [Bacillus fermentation using bee pollen or bee bread is not yet reported.Lactic acid bacteria have been the integral focus when it comes to bee bread microbial fermentation, but other bacterial species such as  Gilliam  found Banversion . Few Bacsubtilis , B. megagaterium , and B. niformis  have exhfasciata , H. itamH. itama ,16, Tetri Friese , honeybeellifera , and sol cornuta . HoweverApis mellifera bee bread as opposed to bee pollen and flower pollen. Several studies had also attempted to describe the yeast communities not only in bee bread but also in bee colonies. In Brazil, yeasts such as Starmerella and Candida spp. are the most frequently found in the body, pollen, honey, and propolis of stingless bee species of Tetragonisca angustula, Melipona quadrifasciata, and Frieseomelitta varia [Starmerella spp. also has been highly associated with other stingless bee species. Teixeira et al. [Tetragonisca angustula\u2032s pollen to harbour Starmerella meliponinorum. Meanwhile, Daniel et al. [Starmerella neotropicalis as the most abundant in Melipona quinquefasciata bee bread and bee pollen.Fermentation is commonly linked with yeast. Yeasts association with fermentation of bee bread has been proposed by researchers. An early study by Gilliam  discoverta varia . Starmera et al.  found Tel et al.  have chaLactobacillus and 3 Bifidobacterium strains were isolated from A. mellifera bee bread [Natural fermentation of bee bread is somehow related to bee gut microbiota . Understee bread , which aee bread .The earlApis mellifera bee gut were also found in fresh flower and nectar, suggesting common horizontal transmission [The scale of contribution of bee gut towards bee bread microbial inoculation has been studied by Mattila et al. . It was smission . NeverthApis spp. is widely discussed [Meliponini beecheii , M. bocandei (Africa), and Trigona sp. (Borneo and Thailand) revealed their honey stomach harbours Lactobacillus and Bifidobacterium species [Understanding bee gut microbiome could get complicated because of diverse bacterial communities . By far,iscussed ,149 whil species .Austroplebeia australis, Tetragonula carbonaria, and Tetragonula hockingsi). Interestingly, the microbiome of these stingless bee is different intercolonies but almost similar to the microbiome of honeybee Apis mellifera [Gilliamella, Bifidobacterium, Lactobacillus Firm-4 and Lactobacillus Firm-5 comprising the core of the gut\u2019s microbiome, with Meliponini as the most diverse one [The gut microbiome not only varies between species but also between colonies. For example, Leonhardt and Kaltenpoth  focused ellifera . Comparierse one .A. mellifera gut microbiota through metagenomic analysis showed a possible link of these microbes to bee protection against pathogens and nutrition acquisition by degrading the pollen wall [Bee gut microbiota is maternally inherited , acquirelen wall . Zheng elen wall  found enApis mellifera to protect bee bread against bee pathogen M. plutonius in vivo and in vitro. However, these studies were heavily based upon honeybee Apis sp. More studies should be conducted on stingless bee, whether it will have similar outcomes or not.Understanding the functional role of bee gut, especially in bee bread fermentation, could be useful. According to Anderson et al. , fermentApis bee pollen in the current market and research focus. The food industry has seen tremendous changes in food trends from processed food to natural products with scientifically proven health benefits. The collective pieces of evidence in recent years have shown the potential of the stingless bee bee bread to be developed as a food ingredient, feed, or a supplement. It is rich in micronutrients, minerals, and phenolic compounds. However, research on their therapeutic values is still scarce. There are wide research opportunities to delve in on the bioactive compounds and their biological properties in vitro and in vivo. More research should be conducted so that an international standard for bee bread of stingless bee could be developed. More research on stingless bee bee bread can add to its commercial value and push to develop the meliponiculture industry. Bee bread has emerged as a reservoir to isolate beneficial microbes that contribute to bee bread preservation and can also provide newfound application in the industries.This review paper has summarised the physicochemical properties and health benefits of stingless bee bee bread and has discussed the microbial ecology of bee bread in general in relation to the bee gut. Bee bread is one of the overlooked stingless bee products, highly competing with"}
+{"text": "Epidemiological studies provide strong evidence for a role of endogenous sex hormones in the aetiology of breast cancer. The aim of this analysis was to identify genetic variants that are associated with urinary sex-hormone levels and breast cancer risk.We carried out a genome-wide association study of urinary oestrone-3-glucuronide and pregnanediol-3-glucuronide levels in 560 premenopausal women, with additional analysis of progesterone levels in 298 premenopausal women. To test for the association with breast cancer risk, we carried out follow-up genotyping in 90,916 cases and 89,893 controls from the Breast Cancer Association Consortium. All women were of European ancestry.CYP3A locus, annotated by rs45446698. The minor rs45446698-C allele was associated with lower oestrone-3-glucuronide ; in follow-up analyses, rs45446698-C was also associated with lower progesterone  and reduced risk of oestrogen and progesterone receptor-positive breast cancer .For pregnanediol-3-glucuronide, there were no genome-wide significant associations; for oestrone-3-glucuronide, we identified a single peak mapping to the CYP3A7*1C allele is associated with reduced risk of hormone receptor-positive breast cancer possibly mediated via an effect on the metabolism of endogenous sex hormones in premenopausal women.The  CYP3A7, the major isoform in the foetus, is generally silenced shortly after birth.13 In CYP3A7*1C carriers, a region within the foetal CYP3A7 promoter has been replaced with the equivalent region from the adult CYP3A4 gene;14 this results in adult expression of CYP3A7 in CYP3A7*1C carriers and may influence metabolism of endogenous hormones, exogenous hormones used in menopausal hormone treatment and clinically prescribed drugs, including agents used in treating cancer, in these individuals.15 In order to identify additional variants that are associated with premenopausal urinary hormone levels and to further characterise the associations at the CYP3A locus, we carried out a GWAS of urinary oestrone-3-glucuronide and pregnanediol-3-glucuronide levels, using mid-luteal-phase urine samples from women of European ancestry and followed up by testing for an association with breast cancer risk in cases and controls from the Breast Cancer Association Consortium (BCAC). To determine whether the CYP3A7*1C allele influences metabolism of exogenous hormones, we evaluated gene-environment interactions with menopausal hormone treatment for breast cancer risk, and to investigate whether adult expression of CYP3A7 impacts on agents used in treating cancer, we analysed associations with breast cancer-specific survival.The 16 Briefly, the Generations Study is a cohort study of more than 110,000 women from the UK general population, who were recruited beginning in 2003 and from whom detailed questionnaires and blood samples have been collected to investigate risk factors for breast cancer.Full details of the Generations Study have been published previously.17 Briefly, the British Breast Cancer Study is a national case\u2013control study of breast cancer, in which cases of breast cancer were ascertained through the cancer registries of England and Scotland and through the National Cancer Research Network. Cases were asked to invite a healthy female first-degree relative with no history of cancer and a female friend or non-blood relative to participate in the study.Full details of the British Breast Cancer Study have been published previously.18 Briefly, this is an observational study nested within a trial of annual mammography screening in young women that was conducted in Britain.19 Approximately 54,000 women aged 39\u201341 years were randomly assigned to the intervention arm from 1991 to 1997 and offered annual mammograms until age 48 years. From 2000 to 2003, women in the intervention arm who were still participating in this trial were invited to participate in the Mammography Oestrogens and Growth Factors study; they were asked to provide a blood sample and complete a questionnaire detailing demographic, lifestyle and reproductive factors. More than 8000 women were enrolled in the study.Full details of the Mammography Oestrogens and Growth Factors study have been published previously.N\u2009=\u2009184), the British Breast Cancer Study (N\u2009=\u2009284) and the Mammography Oestrogens and Growth Factors study (N\u2009=\u2009109). To be eligible for the GWAS analysis of oestrone-3-glucuronide and pregnanediol-3-glucuronide levels, women had to be having regular menstrual cycles  and not using menopausal hormone therapy or oral contraceptives. All of the women included in this analysis reported being of European ancestry, and none had been diagnosed with breast cancer at the time of study recruitment.GWAS subjects were drawn from the Generations Study  according to the manufacturer\u2019s instructions. For pregnanediol-3-glucuronide, the lower limit of detection was determined as 0.64\u2009nmol/l; intra- and inter-assay coefficients of variation were 3.7% and 5.2%, respectively. For oestrone-3-glucuronide, the lower limit of detection was determined as 19.6\u2009pmol/l; intra- and inter-assay coefficients of variation were 3.5% and 5.9%, respectively. Creatinine was determined using the creatininase/creatinase-specific enzymatic method20 using a commercial kit  adapted for use on a Cobas Fara centrifugal analyser . For within-run precision, the coefficient of variation was <3%, while for intra-batch precision, the coefficient of variation was <5%.The protocol for collecting timed urine samples has been published previously.\u00ae 20, Sigma-Aldrich, Inc., St. Louis, MO, USA). Standards, samples and controls (20\u2009\u00b5l per well) were added to each well, followed by 80\u2009\u00b5l of progesterone 3-HRP conjugate  at 1:10,000 in assay buffer (PBS pH 7.4 containing 0.1% BSA and 250\u2009ng/ml Cortisol), followed by 50\u2009\u03bcl of monoclonal progesterone Ab  1:50,000 in assay buffer. Plates were incubated at room temperature for 2\u2009h on a microtitre plate shaker , then washed five times with assay wash buffer and 120\u2009\u00b5l of substrate solution  was added to each well. Plates were incubated at room temperature without shaking in the dark. After 20\u2009min, the reaction was stopped by adding 80\u2009\u00b5l of 2\u2009N H2SO4 solution . Finally, the plates were read on a plate reader at 450\u2009nm. Standard curves were prepared with a total of eight different concentrations . Samples, standards and controls were included in duplicate. Inter- and intra-assay coefficients of variation were calculated from two controls of low and high progesterone in duplicate in each of eight assays. The inter-assay coefficients of variation for low and high pools, respectively, were 11.4 and 9.1%; the intra-assay coefficients of variation were 8.9 and 5.6%. The lower limit of detection was calculated at 0.1\u2009ng/ml. Cross-reaction with other steroids was oestrone: 0.17%, oestradiol: 0.28%, oestriol: 0.18%, dehydroepiandrosterone: 0.02%, testosterone: 0.36%, dihydrotestosterone: 0.15%, 17\u03b1-hydroxyprogesterone: 2.9%, androstenedione: 0.14%, 11-deoxycortisol: 0.46%, corticosterone: 0.18%, cortisone: 0.04% and cortisol: 0.04%.For 303 premenopausal women participating in the Generations Study , urinary progesterone levels were also measured using an \u201cin house\u201d ELISA. In all, 96-well plates  were coated with 100\u2009\u00b5l of 5\u2009\u00b5g/ml GAM  in ELISA coating buffer  covered and incubated in a fridge at 4\u2009\u00b0C overnight. Before use, the plates were washed three times with wash buffer 0.05\u2009M Tris/HCl and 0.05% Tween 20, pH 7.4 \u2009<\u20092% and those whose genotype frequencies deviated from Hardy\u2013Weinberg proportions at P\u2009<\u20091\u2009\u00d7\u200910\u201305. Following QC, 487,659 SNPs were successfully genotyped in 560 samples . Genome-wide imputation was performed using 1KGP Phase 3 reference data. Haplotypes were pre-phased using SHAPEIT2.22 Imputation was performed using IMPUTE2.23 Imputed SNPs with INFO scores <0.8 and MAFs\u2009<2% were excluded from subsequent analyses. After QC, a set of 7,792,694 successfully imputed SNPs were available for association analysis.DNA from 577 women was genotyped using Illumina Infinium OncoArray 500\u2009K BeadChips. We excluded samples for which <95% of SNPs were successfully genotyped. Identity-by-descent analysis was used to identify closely related individuals enabling exclusion of first-degree relatives. We applied SmartPCACYP3A7*1C allele, we sequenced this region in 31 women selected on the basis of their rs45446698 genotype (9 common homozygotes and 22 carriers). A 370-bp DNA region  was amplified using Phusion High-Fidelity DNA Polymerase  and primers CCATAGAGACAAGAGGAGA (forward) and CTGAGTCTTTTTTTCAGCAGC (reverse). The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen) and Sanger sequenced using a commercially available service .For the 119 Generations Study women who were not included in the GWAS but for whom progesterone was subsequently measured, rs45446698 was genotyped by TaqMan . The call rate was 100% with 100% concordance between 12 duplicates. To confirm that rs45446698 tags the 24 Test statistic inflation was assessed visually using a QQ Plot . For the single significant association (rs45446698), we used multivariate linear regression to adjust for potential confounders: age at menarche , age at collection of urine samples , body mass index  and parity .Tests of association between SNP genotypes and log-transformed creatinine-adjusted oestrone-3-glucuronide and pregnanediol-3-glucuronide adjusted for study were performed using linear regression in SNPTEST v2.5.25 and OncoArray.26 Full details of SNP selection, array design, genotyping and post-genotyping QC have been published.26 Participants genotyped in both collaborations were excluded from the iCOGS data sets with the exception of the GxE interaction analysis of menopausal hormone treatment, for which five studies  were excluded from OncoArray, rather than iCOGS, in order to maximise the number of studies with sufficient cases and controls for analysis. We excluded cases with breast tumours of unknown invasiveness, or in situ disease, and those for whom age at diagnosis was not known. After QC exclusions,26 the call rate for rs45446698 in OncoArray data was 99.66% and there was no evidence of deviation from Hardy\u2013Weinberg equilibrium in controls , we restricted our analyses to individuals of European ancestry and excluded studies with <50 cases or controls; there were 35 (iCOGS) and 56 (OncoArray) studies for the current case\u2013control analysis (Supplementary Tables\u00a026 and study. Stratum-specific carrier ORs were estimated for a set of pre-specified prognostic variables (oestrogen receptor\u00a0(ER), progesterone receptor\u00a0(PR), HER2, grade and stage). We excluded studies with <50 cases or controls in any individual stratum from stratified analyses. Interactions were assessed based on case-only models . In the subset of studies for which covariate data were available, we used multivariable logistic regression to adjust for reference age (defined as age at diagnosis for cases and age at interview for controls), age at menarche, BMI and parity (as above). Finally, we stratified our analyses on menopausal status at reference age. When menopausal status was missing, the reference age was used as a surrogate . To select the reference age that most accurately captured menopausal status in this group of studies, we generated AUC curves based on women who had reported natural menopause with different reference age cut-offs (50\u201356 years); on this basis, a reference age of 54 was selected. P values were estimated using likelihood ratio tests with one degree of freedom. All P values reported, for all analyses, are two-sided. Statistical analyses were performed using STATA version 11.0 .We combined heterozygote and rare homozygote genotypes and estimated carrier ORs using logistic regression, adjusted for 15 principal componentsPostmenopausal women from 13 (iCOGS) and 27 (OncoArray) studies provided the data on menopausal hormone treatment. Menopausal status and postmenopausal hormone use were derived as of the reference date (defined as date of diagnosis for cases and interview for controls); women with unknown age at reference date were excluded from this analysis. All analyses were conducted only in postmenopausal women. Carrier ORs for breast cancer risk were estimated using logistic regression stratified by current use of menopausal hormone treatment, oestrogen\u2013progesterone therapy and oestrogen-only therapy, respectively. Analyses were adjusted for study, ten principal components, reference age, age at menarche, parity, BMI, former use of menopausal hormone treatment and use of any menopausal hormone treatment preparation other than the one of interest in analyses of current use of menopausal hormone treatment by type. To account for potential heterogeneity of the main effects of menopausal hormone treatment/oestrogen\u2013progesterone therapy/oestrogen-only therapy by study design, we included an interaction term between the risk factor of interest and an indicator variable for study design . Interactions between rs45446698 and current use of menopausal hormone treatment, oestrogen\u2013progesterone therapy and oestrogen-only therapy were assessed using likelihood ratio tests, based on logistic regression models with and without interaction between rs45446698 and current use of menopausal hormone treatment, oestrogen\u2013progesterone therapy and oestrogen-only therapy, respectively. Statistical analyses were performed using SAS 9.4 and R (version 3.4.4).27 Follow-up was right-censored at the date of death (death known to be due to breast cancer considered an event), the date the patient was last known to be alive if death did not occur or at 10 years after diagnosis, whichever came first. Follow-up was censored at 10 years due to limited data availability after this time. Hazard ratios (HR) for association of rs45446698 genotype with breast cancer-specific survival were estimated using Cox proportional hazards regression implemented in the R package survival (v. 2.43\u20133) stratified by country. iCOGS and OncoArray estimates were combined using an inverse-variance-weighted meta-analysis.In total, 38 (iCOGS) and 63 (OncoArray) studies provided follow-up data for analysis of breast cancer-specific survival. Analysis of outcome was restricted to patients who were at least 18 years old at diagnosis and for whom vital status at, and date of the last follow-up were known. Patients ascertained for a second tumour were excluded. Time-to-event was calculated from the date of diagnosis. For prevalent cases with study entry after diagnosis, left truncation was applied, i.e., follow-up started at the date of study entry.CYP3A locus at chromosome 7q22.1 , but while there was no association between the rs45446698-C allele and urinary pregnanediol-3-glucuronide levels  in this group of women, the rs45446698-C allele was associated with significantly lower luteal-phase urinary progesterone levels . There was no evidence that the reduction in breast cancer risk associated with being a rs45446698-C carrier differed according to Her2 status, tumour grade or stage .To test for the association between rs45446698 and breast cancer risk, we combined genotype data from 56 studies  in current users of any menopausal hormone treatment but particularly in those who used combined oestrogen\u2013progesterone therapy  and premenopausal urinary oestrone-3-glucuronide. This finding alone is not novel; we have previously reported an association between the CYP3A7*1C allele, parent oestrogens and several oestrogen metabolites.5 What we have demonstrated for the first time is the extent to which this signal dominates the genetic architecture of hormone levels in premenopausal women of Northern European ancestry  and we estimate that 11.5% of the variance in urinary oestrone-3-glucuronide levels is explained by this one allele.This present GWAS identified a single, highly significant association between the CYP3A locus.10 This lack of replication may be explained by our choice of study population. The first GWAS9 was conducted in postmenopausal women (N\u2009=\u20091623) participating in the Nurses\u2019 Health Study and the Sisters in Breast Screening Study. The second was conducted within the Twins UK study (N\u2009=\u20092913) and included men as well as pre-, peri- and postmenopausal women. A strength of our GWAS is that all of the women were premenopausal and had regular menstrual cycles; circulating levels of oestrogens in premenopausal women are much higher compared with those in postmenopausal women.28 For each woman, we assayed a single urine sample taken in the mid-luteal phase of her cycle at exactly 7 days after her predicted day of ovulation. Thus, although our study is relatively small (N\u2009=\u2009560), we may have had greater power to detect an association at the CYP3A locus than previous studies due to the very homogeneous premenopausal study population that we selected.Two previous GWAS of circulating oestrogen levels have been published, neither reported an association with the CYP3A7*1C allele and oestrone  is more pronounced than the association with oestradiol  with the implication that measuring urinary oestrone-3-glucuronide (rather than plasma oestradiol) may have contributed to our positive findings. Similarly, by measuring pregnanediol-3-glucuronide and progesterone in premenopausal women from the Generations Study, we were able to demonstrate a significant association of rs45446698 with progesterone  in the absence of an association with pregnanediol-3-glucuronide .Our findings also demonstrate the potential significance of the choice of hormone or hormone metabolite; both of the previous GWAS assayed plasma oestradiol. In a targeted analysis of urinary oestrogen metabolites, we have previously shown that the association between the 3 and in a recent study that measured luteal-phase serum oestrogens and urinary oestrogen metabolites in 249 premenopausal women,29 serum oestradiol and oestrone were only moderately correlated with urinary oestrone . Our analysis of rs45446698 genotypes in 90,916 cases and 89,893 controls from BCAC, however, provides robust evidence of an association of the CYP3A7*1C allele with breast cancer risk overall  and a more pronounced protective effect on ER\u2009+\u2009/PR\u2009+\u2009breast cancers . The specificity of this association  and our replication of Ruth and colleagues report of a signal at the CYP3A locus in their analysis of circulating progesterone levels10 raise the possibility that premenopausal progesterone levels might influence risk of ER\u2009+\u2009/PR\u2009+\u2009breast cancers. This would be in contrast to the findings from Key et al. who reported no evidence of an association between premenopausal progesterone levels and breast cancer risk overall and no heterogeneity in estimates stratified by PR status.3 However, the number of cases of PR\u2009+ (N\u2009=\u2009158) and PR\u2212 (N\u2009=\u200961) breast cancer was small, and this analysis may have lacked power to detect modest associations in subgroups of cancers. Alternatively, the association of rs45446698 genotype with ER\u2009+\u2009/PR\u2009+\u2009breast cancer risk, specifically, may be due to the fact that PR is a marker for an intact oestrogen signalling pathway30 confirming a direct link between the levels of oestrogen  and proliferation in this subgroup of cancers.The fact that we measured a urinary oestrogen metabolite (oestrone-3-glucuronide) rather than serum or plasma oestrogens (oestradiol or oestrone) limits the interpretation of our results in terms of a causal association. Estimates of the association between circulating oestrogens and breast cancer risk are based on measurements of hormone levels in plasma or serum,CYP3A7*1C allele, menopausal hormone treatment and breast cancer risk was inconclusive; while the carrier ORs were consistent with a greater protective effect of this allele in women taking exogenous hormones, particularly oestrogen\u2013progesterone therapy, none of the interactions was statistically significant. Overall, there were 14,119 ER\u2009+\u2009/PR\u2009+\u2009breast cancer cases and 32,418 controls for this subgroup analysis, but for what was, arguably, the most pertinent subgroup , the number of cases who were current users was relatively small  and power was limited to detect modest interactions. There are limitations to this analysis; we focussed on current menopausal hormone treatment use (adjusted for past use) as it is for current use that the association with breast cancer risk is the strongest,31 but we did not have information on dose, duration or the formulation that was used.Our analysis of the CYP3A7*1C carrier status and survival in patients treated with tamoxifen, a known CYP3A substrate. This may reflect the fact that compared to CYP3A4, CYP3A7 is a poor metaboliser of tamoxifen,32 or that standard doses of tamoxifen achieve high levels of oestrogen receptor saturation.33 There was some evidence that breast cancer-specific survival was reduced in CYP3A7*1C carriers who were treated with a taxane, compared with non-carriers (P\u2009=\u20090.01); this may, however, be a chance finding given the number of comparisons that were tested.Finally, we found no association between CYP3A7*1C allele impacts on the metabolism of endogenous hormones, which in turn, reduces the risk of hormone receptor-positive breast cancer in carriers. Optimal strategies for breast cancer prevention in women at high risk of breast cancer and in the general population are an area of active research. In this context, CYP3A7*1C carriers represent a naturally occurring cohort in which the effects of reduced exposure to endogenous oestrogens and progesterones throughout a woman\u2019s premenopausal years can be further investigated. Our results regarding the impact of CYP3A7*1C carrier status on exogenous hormones and chemotherapeutic agents are preliminary but warrant further investigation, preferably in the setting of randomised trials.In conclusion, we present strong evidence that the Supplemental material"}
+{"text": "This paper considers parametricity and its resulting free theorems for nested data types. Rather than representing nested types via their Church encodings in a higher-kinded or dependently typed extension of System F, we adopt a functional programming perspective and design a Hindley-Milner-style calculus with primitives for constructing nested types directly as fixpoints. Our calculus can express all nested types appearing in the literature, including truly nested types. At the term level, it supports primitive pattern matching, map functions, and fold combinators for nested types. Our main contribution is the construction of a parametric model for our calculus. This is both delicate and challenging: to ensure the existence of semantic fixpoints interpreting nested types, and thus to establish a suitable Identity Extension Lemma for our calculus, our type system must explicitly track functoriality of types, and cocontinuity conditions on the functors interpreting them must be appropriately threaded throughout the model construction. We prove that our model satisfies an appropriate Abstraction Theorem and verifies all standard consequences of parametricity for primitive nested types."}
+{"text": "The chicken erythrocyte model system has been valuable to the study of chromatin structure and function, specifically for genes involved in oxygen transport and the innate immune response. Several seminal features of transcriptionally active chromatin were discovered in this system. Davie and colleagues capitalized on the unique features of the chicken erythrocyte to separate and isolate transcriptionally active chromatin and silenced chromatin, using a powerful native fractionation procedure. Histone modifications, histone variants, atypical nucleosomes (U-shaped nucleosomes) and other chromatin structural features (open chromatin) were identified in these studies. More recently, the transcriptionally active chromosomal domains in the chicken erythrocyte genome were mapped by combining this chromatin fractionation method with next-generation DNA and RNA sequencing. The landscape of histone modifications relative to chromatin structural features in the chicken erythrocyte genome was reported in detail, including the first ever mapping of histone H4 asymmetrically dimethylated at Arg 3 (H4R3me2a) and histone H3 symmetrically dimethylated at Arg 2 (H3R2me2s), which are products of protein arginine methyltransferases (PRMTs) 1 and 5, respectively. PRMT1 is important in the establishment and maintenance of chicken erythrocyte transcriptionally active chromatin. The chicken erythrocyte is a useful model system to study the organization and function of a vertebrate genome and to discover the salient features of transcriptionally active chromatin . The chiThe chicken red blood cell has an overall compact 30 nm fiber chromatin structure with a higher ratio of linker (H1 and H5) to nucleosomal  histones than any other chromatin source . Many soThe chicken erythrocyte genome is organized into compartments ; compartment B, silent, repressed chromatin (98\u201399%))  Figure . Unlike E) and solubilized chromatin (fraction SE) are isolated. The fraction PE contains expressed genes in addition to bulk chromatin and chromatin associated with the residual nuclear structure, the nuclear matrix. The SE chromatin is brought up to 150 mM in NaCl (step 4), resulting in the precipitation (fraction P150) of most of the chromatin, which is collected by centrifugation (step 5). The soluble chromatin fragments (fraction S150) are size-resolved by gel exclusion chromatography (step 6).When we first tested various chromatin fractionation procedures, we observed that transcriptionally competent \u03b2-globin DNA sequences isolated from chicken mature erythrocytes were present in 100 mM KCl-soluble oligonucleosomes, while repressed DNA  was in the salt-soluble mononucleosomes . Transcr150 is compartment B. Repressed chromatin in faction P150 forms 30 nm fibers. This fraction has H1/H5, poorly acetylated histones, uH2A and H4R3me2s (a repressive mark) [Expressed and competent DNA sequences are enriched in the salt-soluble poly- and oligonucleosomes (fractions F1\u2013F3). These fractions are depleted in repressed DNA sequences . The 150ve mark) ,24. ReprThe salt fractionation of micrococcal nuclease-generated chromatin fragments has been done with many chromatin sources  ,25,26. TOnly a small population (1 to 2%) of histones in mature and polychromatic erythrocytes are undergoing dynamic acetylation, and these acetylated histones are associated with the transcriptionally active chromatin fractions ,27,28. TE) and compartment B (fraction P150) is the intrinsically disordered regions in the N-terminal tails of the four core histones and the N- and C-terminal tails of the linker histone H1 and H5 [The basis of the chromatin fractionation procedure and the organization of the chicken erythrocyte compartments can be explained in the context of phase separation and a self-organizing system . An impo1 and H5 ,29,30. T1 and H5 .E; (3) the SE chromatin solution is brought up to 150 mM NaCl, which results in phase separation of compartment A and B chromatin fragments. Compartment B chromatin fragments form fiber\u2013fiber interactions in a self-organizing system involving unacetylated intrinsically disordered core histone tails and interaction with the intrinsically disordered tails of H1/H5 and separates out of the solution. Compartment A chromatin fragments remain soluble because fiber\u2013fiber interactions are not occurring due to acetylation increasing the ordered \u03b1-helical content in the core histone tails. Chromatin fraction PE has both compartment A and compartment B but these also are phase-separated. Compartment A is associated with chromatin-modifying enzymes such as KATs and HDACs, which are associated with the nuclear matrix. The nuclear matrix likely consists of multiprotein complexes including a massive protein\u2013RNA network with the transcriptional machinery, coactivators, transcription factors and RNA, which contributes to the phase separation of compartment A.With regard to the steps in the chromatin fractionation protocol, we envision the following occurring simultaneously: (1) micrococcal nuclease incubation of nuclei fragments the chromatin but the compartment A and B remain phase separated; (2) the nuclei are lysed in low ionic strength, phase separation is lost, and compartment A and B chromatin fragments are eluted from the nuclei, yielding fraction SThe acetylation of the N-terminal tail of H4, particularly at K16, has a major role in decondensation of the chromatin fiber and in phase separation ,32. In aHBBA) gene and competent \u03b5-globin (HBE) gene, is enriched in F1 chromatin. Other broad F1 domains covering highly expressed genes involved in oxygen carrying and innate immunity functions include \u03b1-globin , transferrin receptor , carbonic anhydrase , ferritin heavy chain 1  and interferon-related developmental regulator 1 . Moderately and low expressing genes (HDAC2 and PRMT7) had mostly the acetylated salt-soluble regions at the upstream promoter region of the gene. With the help of F1 DNA seq, it was possible to map all the salt-soluble acetylated domains across 38 autosomes and the sex chromosomes in female chickens. The genome-wide sequencing revealed that microchromosomes have a higher density of salt-soluble acetylated chromatin than macrochromosomes, implying that gene-dense chromosomes have more salt-soluble chromatin domains.To identify the DNA sequences enriched in the salt-soluble F1 chromatin, we used next-generation sequencing . The F1 The observation that the active gene-enriched chromatin oligonucleosomes presented as a smear rather than a discrete nucleosomal repeat when electrophoretically resolved was a demonstration that these expressed genes have a disrupted chromatin ,36. ThisThe mononucleosomes of active chromatin are more labile than canonical nucleosomes. These mononucleosomes were sensitive to ethidium bromide-induced dissociation relative to bulk nucleosomes . TogetheThe transcriptionally active polychromatic erythrocyte is arrested in the G0 phase of the cell cycle. In the G0 phase, the cells express the replacement histones  rather than the replication-dependent histones. The reassembly of nucleosomes undergoing dissolution during transcription or through the action of chromatin remodelers draws upon the pool of newly synthesized histones. Consistent with this scenario, we found that newly synthesized H2A, H2A.Z, H2B, H3.3 and H4 preferentially exchange with the transcriptionally active chromatin regions . Among tFurther analyses of the altered structure of the transcriptionally active chromatin were done using hydroxyapatite column chromatography, which showed the increased lability of the H2A:H2B dimer in active chromatin . InteresThe ability to isolate transcriptionally active chromatin allowed us to characterize the modified histones and variants associated with transcribed DNA sequences. The acetic acid\u2013urea\u2013Triton X-100 (AUT) PAGE system, which resolves histones according to size, charge and hydrophobicity, was central to the histone analyses . ApplyinTo locate the position of the histone PTMs, we applied the chromatin immunoprecipitation (ChIP) assay and ChIP seq. H3.3 S28ph is present at the promoter region of active genes . As in oWe are the only lab to report the genomic location of H4R3me2a together with H3R2me2s, the products of protein arginine methyltransferase 1 (PRMT1) and PRMT5, respectively . H4R3me2H3K4me3 preferentially locates with CpG islands  and, for150, F1\u2013F3) and low-ionic-strength insoluble chromatin fraction PE. Both F1\u2013F3 and PE chromatin have increased levels of highly acetylated core histones, H3K36me3, H3R2me2s and H4R3me2a, and H3 reactive (U-shaped) nucleosomes. However, one distinguishing feature of F1-F3 is the enrichment in uH2B, which is not observed in PE [E chromatin [Transcriptionally competent and active DNA sequences are found in the salt-soluble chromatin fragments  showed a similar pattern of feature distribution. Most of these genes have their promoter regions associated with a CpG island. The promoter (nucleosome-depleted region) is marked by a sharp FAIRE seq peak with the F1, H3K4me3 and H3K27ac marks on both sides of the FAIRE seq peak. The enhancer regions were identified in a similar manner. The \u03b2-globin domain is a classic example in which the enhancer (LCR) has been identified. The F1 DNA seq signals drop precisely where the FAIRE seq peaks/\u03b2-globin enhancers are located. This pattern is typical for most of the genes associated with the transcriptionally active domains. Another example is the erythroid-specific histone H5 gene (H1F0). The H1F0 gene, located in a salt-soluble 48-kb domain [H1F0 gene enhancers and promoters in mature and polychromatic erythrocytes [The location of nucleosome-depleted regions (regulatory regions) determined by formaldehyde-assisted isolation of regulatory elements (FAIRE) sequencing was aligned with F1 DNA sequences, ChIP seq data for PTMs and CpG profiling . Analysihrocytes . NF1, buhrocytes .A small percentage of the genes present an atypical chromatin signature. The chromatin organization of these genes is different from the other genes in the sense that these genes typically do not have a CpG island associated with their promoter and the gene body has broad nucleosome-depleted regions and highly modified  nucleosomes ,54. AmonE fraction [Dynamic histone acetylation is catalyzed by KATs and HDACs. Fractionation of chicken polychromatic erythrocytes has unveiled the role of the HDACs and KATs in transcriptionally active chromatin. We determined that 70 to 80% of the nuclear HDAC activity was associated with the Pfraction . The \u03b5- fraction . Furtherfraction ,64,65. Afraction ,21. In vfraction ,68,69,70A-globin and H2A.F), while unmodified HDAC2 was located at the coding region of these genes. We redesigned the X-ChIP protocol to include a protein\u2013protein cross-linking step using the cross-linker dithiobis(succinimidyl propionate) (DSP) [CA2 and GAS41 genes, while unmodified HDAC2 was found within the coding region. The association of HDAC2 to these active genes was partially dependent upon ongoing transcription.HDAC1 and HDAC2 are phosphorylated by protein kinase CK2 at several sites HDAC1: S421, S423)  in the C-terminal part of the protein. This phosphorylation is required for HDAC1/2 to form the Sin3, NuRD and CoREST complexes ,72,73. W, S423  were involved in pre-mRNA splicing, a result consistent with the association of unmodified HDAC2 with RNA. HDACs are often found in the spliceosome complexes . ProteinScientists have been testing splicing-directed inhibitors and epigenetic therapy strategies on animal models to treat diseases arising from abnormal splicing events. In chicken, Marek\u2019s disease viruses (MDV) initiate the onset of malignant T-cell lymphomas. All variants of MDVs encode for the Us3 protein kinases, which supports the virus growth. HDAC1 is the common substrate for Us3 for all variants of MDV  . MDV Us3 mediates phosphorylation of chicken HDAC1 and HDAC2 , regulating their transcription, regulatory interaction and stability. In Liao et al. , the aut150 and PE [As with HDAC1 and HDAC2, PRMT1 and PRMT5 were present in chromatin fractions S0 and PE . PRMT1 a0 and PE . H4R3me20 and PE , placing0 and PE . PRMT1 e0 and PE . In eryt0 and PE ,79. Thus0 and PE .In terms of compartmentalization, the HDAC2 association with transcriptionally active chromatin has proven to be a probe to compartment A. Cells were immunostained with anti-HDAC2 antibody and co-stained with DAPI. HDAC2, which is primarily bound to the active/competent chromatin in polychromatic erythrocytes, was located in the interchromatin channels, showing the location of compartment A  Figure . CompartInterestingly, CTCF is also located in the interchromatin channels of chicken erythrocytes ,81. AlthThrough use of a powerful chromatin fractionation procedure coupled with histone PTM ChIP seq, FAIRE seq and RNA seq, we have gained detailed information about the genome organization of the chicken erythrocyte. The chicken erythrocyte genome is organized into compartment A (active/competent genes) and compartment B (silent genes). The high levels of linker histones H1 and H5 stabilize the 30 nm fiber organization of compartment B, which presents a compact chromatin in the G0 phase nucleus. Of note, exogenous expression of H5 in cycling rat sarcoma cells resulted in the cessation of replication and arrest in G1. Expression of genes expressed in G1 and differentiation-specific genes did not appear to be affected . In the"}
+{"text": "Prostate cancer (PCa) is a prevalent cancer in males, with high incidence and mortality. Recent studies have shown the crucial role of long non-coding RNA (lncRNA) in PCa. Here, we aimed to explore the functional roles and inner mechanisms of lncRNA CCAT1 in PCa cells. qRT-PCR results showed that CCAT1 was upregulated in PCa tissues and cells. Functional assays demonstrated that CCAT1 knockdown suppressed cell proliferation, migration, invasion, yet promoted apoptosis, while CCAT1 promotion showed the opposite results. We also found that CCAT1 negatively regulated miR-490-3p expression and subsequently regulated FRAT1 expression. Inhibition of miR-490-3p or up-regulation of FRAT1 reversed the suppressive effects of CCAT1 knockdown on the PCa cells. In conclusion, CCAT1 regulated FRAT1 expression through miR-490-3p and then promote the PCa cells proliferation, migration, and invasion, which reveals the oncogenic function of CCAT1 in PCa progress. Prostate cancer (PCa) is one of the most commonly diagnosed tumors among males, especially in developing countries . ApproxiCurrently, long non-coding RNAs (lncRNA) have been reported to exert multifarious impacts on the cancerous process of prostate cells, ranging from the regulation of gene expression to the changes in biological behaviors . LncRNAsLncRNA colon cancer associated transcript 1 (CCAT1) is first identified as an oncogene in colorectal cancer by Nissan . MeanwhiMicroRNAs (miRNA), another group of non-coding RNAs, have been proved to interact with lncRNAs in various diseases . BesidesIn the current study, overexpression of CCAT1 was found in PCa tissues and cells. Knockdown of CCAT1 promoted the PCa cells proliferation, migration, and invasion, while CCAT1 overexpression inhibited the cell proliferation, migration, and invasion. We also found that CCAT1 regulated FRAT1 expression by miR-490-3p, which subsequently regulate the EMT process and led to PCa progression.LncRNA CCAT1 has been reported to be overexpressed in several malignancies of the digestive system, while little is known about CCAT1 in PCa. Hence, the expression of CCAT1 in both PCa tissues and adjacent normal tissues was detected using qRT- PCR. The result showed that expression of CCAT1 was remarkably up-regulated in PCa tissues compared with adjacent normal tissues . BesidesTo explore the effect of CCAT1 in PCa cells, LnCaP and PC3 cell lines were firstly transfected with si-CCAT1 to suppress the CCAT1 expression. qRT-PCR results showed that si-CCAT1 transfection greatly down-regulated the expression of CCAT1 . Then, MTo explore the downstream targets of CCAT1, GSE60117 was analyzed. 14 differentially expressed miRNAs were screened out , and miRTo explore the function of miR-490-3p in PCa cells, miR-490-3p expression was promoted or suppressed via miR-mimics or miR-inhibitor, respectively . SubsequTo investigate the interaction between CCAT1 and miR-490-3p, LnCaP and PC3 cells were transfected with si-CCAT1 or si-CCAT1+miR-inhibitor. As a result, miR-490-3p expression was notably enhanced in si-CCAT1-treated PCa cells and reversed with additional miR-inhibitor transfection . MTT assNext, we predicted target genes of miR-490-3p using TargetScan and miRanda databases. There were 3790 potential target genes predicted by TargetScan and 1913 potential target genes predicted by miRanda. Furthermore, GSE69223 was employed to analyze the differentially expressed genes in PCa, and 208 up-regulated genes were screened out . CombingLnCaP and PC3 cells were treated with si-FRAT1 and pcDNA-FRAT1 to explore the effects of FRAT1 on PCa cells. qRT-PCR and western blot results showed that FRAT1 expression was suppressed after transfection with si-FRAT1, while up-regulated after pcDNA-FRAT1 transfection . FurtherTo further explore the function of the CCAT1/miR-490-3p/FRAT1 axis in PCa, rescue assays were performed. Cells were transfected with si-CCAT1 or si-CCAT1+pcDNA-FRAT1 . MTT assPCa is the most frequent male malignancy, and its prognosis is closely related to the accuracy of diagnosis and the efficiency of treatment . At presAs mentioned before, earlier studies uncovered that CCAT1 was overexpressed in several categories of cancers , 28, andIn vitro functional assay confirmed the oncogenic role of FRAT1 in PCa. Additionally, rescue experiments suggested that FRAT1 overexpression could reverse the effects of CCAT1 suppression in PCa cells progression. Besides, FRAT1 were potent activators of Wnt/\u03b2-catenin signal transduction [Our results also revealed that FRAT1 was a target gene of miR-490-3p and indirectly regulated by CCAT1. Existing studies have reported the oncogenic role of FRAT1 in several cancers, such as leukemia , 36, cersduction , and dyssduction \u201343. ThusTo conclude, this study provides an outline of how CCAT1 plays a positive role in PCa progression and metastasis. The regulation of CCAT1/miR-490-3p/FRAT1 axis could be applied to future PCa treatment. In addition, interactions between lncRNA CCAT1 and its target miRNAs or downstream genes are numerous and complex. Therefore, findings in this study are of certain potential and also require deeper exploration in the future.Collectively, CCAT1 and FRAT1 were up-regulated, while miR-490-3p was down-regulated in PCa tissues and cell lines. Inhibition of CCAT1 suppressed cell proliferation, migration, and invasion in PCa cells. Moreover, CCAT1 regulated FRAT1 expression by miR-490-3p, which subsequently promoted EMT processes in PCa cells. Taken together, our study may provide a novel perspective for understanding PCa therapeutic strategy.https://www.ncbi.nlm.nih.gov/geo/). Differential expression analysis was performed with R software  using \u201climma\u201d R package. The differentially expressed miRNAs and mRNAs were screened out with the threshold: P value < 0.05 (adjusted by the BH method) and FC (Fold Change) >2.Microarray data of GSE60117 and GSE69223 were downloaded from National Center for Biotechnology Information (NCBI) Gene Expression Omnibus database  were obtained from BeNa Culture Collection . RWPE-1 cell was cultured in Dulbecco\u2019s Modified Eagle Medium , while the PCa cell lines were cultured in RPMI 1640 medium (Sigma). Before use, the medium was supplemented with 10% fetal bovine serum . Thereafter, five cell lines as mentioned above were separately cultured at 37\u00b0 C under a humidified atmosphere of 5% COTM III Reverse Transcriptase Kit (Invitrogen) was applied to lncRNA/mRNA reverse transcription while the miRCURY LNA RT Kit  was utilized for miRNA reverse transcription. qRT-PCR was conducted with THUNDERBIRD SYBR\u00ae qPCR Mix . Relative RNA expression was calculated with 2-\u0394\u0394Ct method. GAPDH was used as the internal reference for lncRNA and mRNA and U6 was used as the internal reference for miRNA. The primer sequences were listed in Total RNA from the samples was isolated with TRIzol reagent . RNA quality and concentration were confirmed using a NanoDrop 2000 . After that, total RNA was reversely transcribed to cDNAs. A SuperScriptTo confirm the roles of CCAT1 and FRAT1 in PCa cells, small interfering RNAs (siRNA) and expression vectors were designed and synthesized by GenePharma . For the determination of miR-490-3p function, miR-490-3p mimics and inhibitor were also obtained from GenePharma. All of the cell transfections were performed with Lipofectamine 2000 (Invitrogen) following the manufacturer's protocol. Detailed sequence information was supplied in LnCaP and PC3 cells were respectively grouped, transfected, and then maintained in 96- well plates. At 24, 48, 72 h after transfection, the cells were incubated with 10 \u03bcL MTT solution  at 37\u00b0 C for 4 hours. Thereafter, dimethyl sulfoxide  was added to dissolve the product. The absorbance at 490 nm was calculated by Microplate Reader ELx808 .An EdU Staining Proliferation Kit  was utilized to identify cell proliferation of PCa cells. Cells to be stained were firstly added with EdU solution and then incubated for 24 h under optimal growth conditions. After being washed, cells were supplemented with a fixative solution and incubated for 15 min. Subsequently, the permeabilization buffer was added for 15 min. After washed again, cells were added with reaction mix to fluorescently label EdU and incubated for 30 min. To capture the staining results, a fluorescence microscope was used to visualize cell proliferation level.Cell migration and invasion of LnCaP and PC3 cells with different treatments were determined by using 24-well Transwell chambers . Cells were maintained in serum-free medium to form suspension. For cell migration assay, the upper chambers were supplemented with 150-\u03bcL cell suspension of each group, and 500 \u03bcL DMEM medium with 10% FBS was mixed in the bottom chamber. For cell invasion assay, the upper chambers were supplemented with 150 \u03bcL cell suspension of each group and covered with Matrigel (Invitrogen), and 500 \u03bcL DMEM medium with 10% FBS was mixed in the bottom chamber. After 24 h maintenance and washing twice with PBS, the cells on the upper surface of the membrane were removed by cotton swabs. The migrated or invaded cells were counted in randomly selected fields and photographed under a microscope.TM II Flow Cytometer .PCa cells were initially maintained in 6- well plates and then received different treatments. After 48 h incubation, cells were harvested and then supplemented with the Annexin V-FITC Apoptosis Detection Kit  for 15 min. Thereafter, flow cytometry analysis for cell apoptosis was conducted on the FACSCantoThe target prediction was performed using the TargetScan database  and miRaTotal proteins were extracted after cell transfection by RIPA lysis buffer (Beyotime) and quantified using an Enhanced BCA Protein Assay Kit (Beyotime). Thereafter, 20 \u03bcg of total protein was separated by SDS-PAGE and transferred to PVDF membranes. After that, the membranes were blocked and incubated with the following antibodies overnight at 4\u00b0 C: anti-FRAT1 (ab108405), anti-E-cadherin (ab40772), anti-N-cadherin (ab76011), anti-Vimentin (ab92547) and anti-\u03b2-actin (ab8227) as the loading control. Secondary antibody (goat anti-rabbit IgG H&L (HRP), ab205718) was then added and incubated for another 1 h at room temperature. All of the mentioned antibodies were purchased from Abcam . Proteins were visualized by ECL-plus reagents  and the band density was measured by Image J software .t-test or one-way ANOVA. P value less than 0.05 was considered statistically significant.All the experiments in this study were performed in triplicate. Data were then analyzed with GraphPad  and expressed as mean \u00b1 standard deviation (SD). Correlations were analyzed by Person\u2019s correlation coefficient. Significant differences among groups were evaluated by student\u2019s two- tailed unpaired Supplementary Table 1Supplementary Table 2Supplementary Tables 3 and 4"}
+{"text": "The environment affects moral behavior. Previous research found that a beautiful environment leads to pro-social behavior, which is related to behavioral intention. However, the effect of environmental aesthetic value on immoral and moral behavior remains unclear. Therefore, in the present study, we explored the effect of environmental aesthetic value on behavioral intention and its possible mechanisms. We conducted four experiments. Experiment 1 adopted the priming paradigm and IAT paradigm to explore the relationship between environmental aesthetic value and behavioral intention. It used photographs of the environment as priming stimuli and scene drawings of behavior as target stimuli. The results showed that participants had a higher intention to engage in moral behavior in an environment with a high aesthetic value, and a lower intention to engage in immoral behavior, compared to in an environment with a low aesthetic value. Similarly, an environment with a low aesthetic value was related to immoral behavior. Experiment 2 further explored the possible mechanism for the above results: changes in moral judgment. The results showed that moral judgment in different environments may lead to different behavioral intentions. The current study extends prior research by demonstrating the effect of environmental aesthetic value on behavioral intention and moral judgment, and good knowledge about the relationship between environmental aesthetic value and moral behavior. In addition, it provides a new hypothesis for the relationship between environment and behavior according to the results of the environment\u2013behavior matching hypothesis, which can provide a new perspective on moral education. The environment plays an important role in behaviors ,2,3,4,5.Aestheticians share similar views regarding the important effect of the environment on behaviors, suggesting that a beautiful environment can positively influence moral behavior. Aesthetics is a psychological state of emotional pleasure caused by the properties of an object. It defines the characteristics of beauty as a pleasurable experience . Moral bMoral judgment refers to an individual\u2019s ability to judge the level and degree of moral justification of an action in a situation. Rest 1983) proposed a four-component model of morality by emphasizing the connection between internal changes in cognition and external behavior . Moral j83 proposThe phrase \u201cBeauty is good,\u201d for example, suggests that people perceive highly attractive faces to be more kind, intelligent, honest, enthusiastic, and to possess favorable personality traits ,30. StudTherefore, we proposed a mechanism in which the influence of an environmental aesthetic value on moral intention to act is due to a change in behavioral moral judgment for the effect of environments with different aesthetic values on behavioral intention see . Hence, We conducted four experiments to explore the relationship between the environmental aesthetic value and behavioral intention for moral and immoral behaviors, and the possible reasons for whether moral judgment changes under environments with different aesthetic conditions. We used explicit measurements (the priming paradigm) and implicit measurements (IAT) in Experiment 1 to explore this effect. In the present research, an environment with a high aesthetic value implied a beautiful environment, and an environment with a low aesthetic value indicated a not-beautiful environment. We hypothesized that an environment with a high aesthetic value would trigger higher moral behavior intention, compared to an environment with a low aesthetic value, which leads to a higher intention to engage in immoral behavior. Experiment 2 further tested the possible mechanisms of this effect in Experiment 1. In Experiment 2, we explored the effect of environments with different aesthetic values on moral judgment and the relationship between behavioral intention and moral judgment in such environments, to explain the effect of environmental aesthetic value on behavioral intention from the perspective of a changing moral judgment. Drawing from the predicted results of Experiment 1, Experiment 2 hypothesized that an environment with a high aesthetic value would lead to harsh moral judgment of immoral behavior and lenient moral judgment for moral behavior compared to an environment with a low aesthetic value. In other words, an environment with a low aesthetic value would lead to harsher judgments of moral behavior and tolerant judgments for immoral behavior, compared to an environment with a high aesthetic value.To explore the effects of environmental aesthetic value on behavioral intention for moral and immoral behaviors, Experiment 1a chose the behaviors of different moral styles as the target and used environmental photographs with high and low aesthetic values as the primary stimuli to explore whether the aesthetic value affects behavioral intention.Experiment 1a was a 2  \u00d7 2  within-subject experimental design. Participants were required to evaluate behavioral intention for the same behaviors under the same environmental photographs. The dependent variables were behavioral intention rating scores.M age = 21.16 years, SD = 0.98) were recruited and compensated for their participation. We used G * Power 3.1 to estimate the power (1-\u03b2 = 0.42) and effect size (d = 0.48). All participants had normal or corrected normal vision and normal color vision. Additionally, they signed an informed consent form. The protocol was approved by the Ethics Committee of South China Normal University (SCNU-PSY-2020-4-050).A total of 25 college students aged 18\u201330 years . The photographs were 500 \u00d7 300 pixels and processed using Adobe Photoshop. A separate group of 28 participants rated the photographs\u2019 aesthetic quality and complexity on a 7-point scale. The results of the two sets of materials showed significant differences in aesthetic quality  = 10.99, p < 0.05]), but no significant difference in terms of complexity (; high aesthetic value: 4.40 \u00b1 1.27, low aesthetic value: 4.21 \u00b1 1.42). The samples of the materials used in this study are shown in In this study, the classification of the high and low aesthetic values of the environment was made mainly through the subjective dichotomous division and the aesthetic rating  of the environmental pictures by the participants in a pilot study. Finally, we chose environmental photographs with high and low aesthetic values and found a significant difference in the aesthetic rating scores. A total of 36 color photographs of the social and natural environments with high or low aesthetic values were selected from the public archive at Scene drawings for moral behavior were made in three sessions. First, we selected terms that describe moral and immoral behaviors through the semantic evaluation of college students. Second, we recruited students majoring in art to draw cartoon characters according to these terms. Third, we recruited 23 college students  to judge the moral degree, artistry, and complexity of the cartoon figures on a 7-point scale. Finally, 30 scene drawings of moral behaviors and immoral behaviors were chosen as materials for our moral judgment. Each trial started with a fixation cross \u201c+\u201d for 500 ms followed by a 300 ms blank screen. Then, one of the environmental photographs was presented for 3000 ms, followed by a blank screen for 100 ms. Subsequently, a target image was presented until a key was pressed. Participants were instructed to report their possibility of engaging in these behaviors using subjective judgment on a scale ranging from 1  to 9 (very likely). The experimental procedure is shown in p > 0.05). We computed the mean score for each participant\u2019s behavioral intention and removed data with more than three standard deviations from the mean value as outliers (two data points were deleted). A 2  \u00d7 2  repeated-measures analysis of variance (ANOVA) with subjects as the random effect was conducted on rating scores on behavioral intention.The results showed that the data were normally distributed  = 0.16, p = 0.69 > 0.05, \u03b72 = 0.57. The main effect of the types of behavioral scene drawings was significant, with F  = 274.12, p < 0.001, \u03b72 = 0.93  = 13.55, p = 0.001, \u03b72 = 0.38  = 3.76, p = 0.065, \u03b72 = 0.15. Immoral behavior intention was significantly lower in an environment with a high aesthetic value than in an environment with a low aesthetic value, F  = 6.75, p = 0.016, \u03b72 = 0.24.0.93 see . The int0.38 see . Moral bThe results of Experiment 1 showed that an environmental aesthetic value influences moral behavior intention and immoral behavior intention; additionally, it could trigger a higher intention for moral behavior and a lower intention for immoral behavior, compared to an environment with a low aesthetic value. These results are consistent with the hypothesis of Experiment 1a. The subjective assessment method was used to measure moral behavioral intention in Experiment 1. However, under experimental conditions, participants may hide their real behavioral intentions due to hypocrisy and the fear of being judged ,35,36,37The objective of this experiment was to explore the association between environmental aesthetic value and behavior using IAT. In this study, participants were presented with a classification task in which they categorized environmental aesthetics using a standard IAT. If a participant performed the task quickly when an environment with a high aesthetic value was paired with moral behavior , it indicated a positive implicit relation between environmental aesthetic value and behavior.M age = 20.85 years, SD = 0.85), who did not participate in Experiment 1a, were recruited and paid for their participation. All participants had normal or corrected normal vision and normal color vision. We used G * Power 3.1 to estimate the power (1-\u03b2 = 0.81) and effect size (d = 0.64). The participants signed an informed consent form, and the experiment was approved by the Institute Ethics Committee of South China Normal University.A total of 34 college participants aged from 18 to 24 years  = 10.35, p = 0.001  and no significant difference in terms of complexity, with t (27) = 0.19, p = 0.84 . Participants completed an IAT task that measured their implicit associations between the environment and their behaviors.The scene drawings for moral behavior in Experiment 1b were similar to those in Experiment 1a. The environmental pictures were chosen according to the procedure of Experiment 1. All pictures were 500 \u00d7 300 pixels and adjusted using Adobe Photoshop. The rating results of the two sets of materials showed a significant difference in terms of beauty quality, with Each participant completed a total of seven classification tasks: (1) single categorization for the target ; (2) single categorization for the implicit association ; (3) combined categorization task-practice and data collection trials ; (4) the same as (3); (5) single categorization for the target concept (same as (2)) but with reversal of the side of the screen where the category into which the picture needed to be categorized was presented ; (6) combined categorization task-practice and data collection trials (same as (3)) but reversed categorization of target categories ; (7) same as (6). Only data from tasks (3), (4), (6), and (7) were used for the analysis.Participants completed an IAT task measuring the implicit associations between environments and behaviors . Subjectp < 0.05); therefore, non-parametric tests were used to compare differences in means.We applied a data reduction procedure: the first trial of each experimental task was removed before the analysis, and a latency longer than 10,000 ms and shorter than 300 ms was also removed . In thisWe compared the categorization of environments paired with moral and immoral behaviors. p < 0.05). Quicker RT for an environment with a high aesthetic value, together with moral behaviors, indicated the existence of an implicit association between the two.Participants had significantly shorter reaction times when the environments with a high aesthetic value were paired with moral behaviors, as compared to environments with a low aesthetic value paired with moral behaviors (p < 0.05).The result showed a higher accuracy when the environments with a high aesthetic value were paired with moral behaviors, as compared to the environments with a low aesthetic that were paired with immoral behaviors . Previous research suggested that the difference between the two groups of experimental effects is stronger when the d-score is greater than or equal to 0.8. In experiment 1b, the d-scores were 1.24, and the result showed a significant IAT effect.Compared to the RT of the two joint tasks, the results showed that the RT of the initial joint task was significantly longer than that of the reverse joint one .Experiment 2a mainly tested the positive relationship between moral judgment and behavioral intention: in other words, whether the changes in moral judgment were the same as the changes in behavioral intention.Experiment 2a was a single-factor, within-subject experiment design. The independent variable was the type of behavioral scene drawings . Every participant was instructed to make moral judgments and judgments of behavioral intention for the same behavioral scene drawings. The dependent variables were the rating scores for behavioral intention and moral judgment.M age = 18.40, SD = 1.03) were recruited and compensated for their participation. We used G * Power 3.1 to estimate the power (1-\u03b2 = 0.97) and effect size (d = 0.47). All participants had normal or corrected normal vision and normal color vision. They signed an informed consent form. The study was approved by the Institute Ethics Committee of South China Normal University.A new group of 62 college participants aged 18\u201324 years  to 9 . Finally, participants were instructed to report the possibility that they would engage in these behaviors using subjective judgment on a scale ranging from 1  to 9 (very likely).p < 0.05), and logarithmically transformed them into positively distributed data. Then, we performed a correlation analysis, the results of which are presented in We checked the data, determined that they were normally distributed . The mean scores of immoral judgments predicted the scores for immoral behavior intention .The mean scores of moral judgments predicted those of moral behavior intention  \u00d7 2  within-subject experimental design. The participants evaluated morality for the same behaviors in the same environment. The dependent variable was the rating score for moral judgment.M age = 22.03, SD = 1.15) were recruited and compensated for their participation. We used G * Power 3.1 to estimate the power (1-\u03b2 = 0.95) and the effect size (d = 0.24). All participants had normal or corrected normal vision and normal color vision. They signed an informed consent form. The study was approved by the Institute Ethics Committee of South China Normal University.A new group of 38 college students aged 18\u201324 years  to 9  when the target behavior was presented see .p > 0.05). We then conducted 2  \u00d7 2  repeated-measures ANOVA. The dependent variable was the rating score of moral judgment. The mean rating scores for moral judgment are shown in We checked the data and determined that they were normally distributed  = 4.69, p = 0.037, \u03b72 = 0.11. The condition of high aesthetic value was perceived as having lower morality than the condition of low aesthetic value. The main effect of the behavioral style was significant, with F  = 644.81, p < 0.001, \u03b72 = 0.95. The interaction between environmental style and behavioral style was also significant, with F  = 48.94, p < 0.001, \u03b72 = 0.57. The simple effect test showed that moral behavior was evaluated as having higher morality in an environment with a high aesthetic value compared to an environment with a low aesthetic value, with t (37) = 2.49, p = 0.017, 95% CI = . Immoral behavior was significantly higher in an environment with a high aesthetic value than in an environment with a low aesthetic value, with t (37) = \u22126.46, p < 0.001, 95% CI =  (see The results revealed that the main effect of the environmental style was significant, with .39] see .The results of Experiment 2 found that individuals in an environment with a high aesthetic value reported higher morality for moral behavior and lower morality for immoral behavior, compared to an environment with a low aesthetic value, which supports the hypothesis of Experiment 2. These results showed that the environment could affect moral judgment and confirmed the role of the environment in it. Based on the results of Experiments 1 and 2, we found a positive relationship between moral judgment and the intention to behave. When participants reported higher morality for moral behavior in an environment with a high aesthetic value, they also reported higher intention for these behaviors, compared to an environment with a low aesthetic value. Conversely, when participants reported lower morality for immoral behavior in an environment with a low aesthetic value, they reported lower immoral behavior intention, compared to a high aesthetic value.Experiment 1 explored the relationship between environmental aesthetic values and moral and immoral behavioral intentions. The results showed that an environment with a high aesthetic value leads to a higher behavioral intention for moral behavior, and a low aesthetic value leads to a higher behavioral intention for immoral behavior. The results of Experiment 1 confirmed that the environmental aesthetic value can increase moral behavioral intention, which is in line with the effect of beauty on pro-social behavior . Moral bPrevious researchers have pointed to the emotion hypothesis to explain the effect of environmental beauty on pro-social behaviors . DiffereIn addition, several environmental psychology theories, such as emotional arousal theory and environmental load theory, have been put forward to explain the relation between the environment and behavior. The former suggests that environmental stimuli affect individuals\u2019 level of emotional arousal, thereby triggering or inhibiting certain behaviors . The latThe environment plays an important role in human life ,42. Our In environmental psychology, many researchers have focused only on the effects of the natural environment. However, everyone relates to the social environment and accepts its effects; therefore, efforts should be made to explore the role of an aesthetic social environment in the future.In this experiment, Experiment 1 and Experiment 2 both had small samples that may lack some external validity. The results of this study support the view that aestheticians can shape and change human behavior through the environment. The broken windows theory determines the effect of a disorganized environment on moral behavior; in later studies, researchers and government officers empirically verified the power of the environment . Thus, tIn summary, the results of this study reveal that participants\u2019 moral judgment can be influenced by environments with different aesthetic values, which in turn influence behavioral intentions. The current research also provides a new viewpoint for understanding the relationship between the environment and behavior. The results of this study can help society positively influence people\u2019s social behavior through the environment as an objective setting. Whether it is in the family, school, or other public places, by shaping this beautiful environment, people\u2019s esthetic and moral education can be influenced."}
+{"text": "This has brought great challenges to the treatment of multidrug-resistant Escherichia coli and K. pneumoniae.Mobile colistin resistance like gene (K. pneumoniae 16BU137 and E. coli 17MR471 were isolated from the bus and subway handrails in Guangzhou, China. K. pneumoniae 19PDR22 and KP20191015 were isolated from patients with urinary tract infection and severe pneumonia in Anhui, China. Sequence analysis indicated that the mcr-1.1 gene was present on the chromosome of E. coli 17MR471, and the gene was in the gene cassette containing pap2 and two copies of ISApl1.The mcr-1.1 was found in the putative IncX4 type plasmid p16BU137_mcr-1.1 of K. pneumoniae 16BU137, but ISApl1 was not found in its flanking sequence. Mcr-8 variants were found in the putative IncFIB/ IncFII plasmid pKP20191015_mcr-8 of K. pneumoniae KP20191015 and flanked by ISEcl1 and ISKpn26.Enterobacteriaceae bacteria carrying mcr-like genes, and provides a reference for studying the spread of mcr-1 in China and globally.This study provides timely information on The online version contains supplementary material available at 10.1186/s12864-022-08301-5. Polymyxin is a cyclic lipopeptide antibiotic discovered by Ainsworth et al.  in the 1Enterobacteriaceae, such as Pseudomonas aeruginosa and Salmonella enterica server Typhimurium. PhoQ can phosphorylate and activate PhoP in the presence of polymyxin. PhoP can increase the positive charge of the outer membrane of the bacteria and the resistance to polymyxins by activating the pmrHFIJKLM operon, causing lipid A to be modified by 4-amino-4-arabinose. Hyperproduction of CPS generally occurs in K. pneumoniae. Some K. pneumoniae strains can reduce the interaction between polymyxin and bacterial surface by synthesizing large amounts of CPS, which leading to the development of polymyxin resistance. Efflux pumps of some Gram-negative bacteria (such as AcrAB [K. pneumoniae) can participate in the resistance of bacteria to polymyxins, but the molecular mechanism is not yet clear. Although bacteria have evolved multiple polymyxin-resistance mechanisms, these mechanisms often require sacrificing their own development and are difficult to disseminate horizontally between strains. These factors limit the spread of these resistant genes among strains. However, in 2015, China reported a new colistin resistance gene, mcr-1, carried by E. coli in the intestine of edible pigs, can be transferred horizontally in Enterobacteriaceae [mcr-1 positive strains have been reported in more than 40 countries [mcr-1 [mcr-1 not only subverted our understanding of polymyxin resistance genes, but also greatly increased the difficulty of treating MDR pathogenic microorganisms.The resistance mechanisms of bacteria to polymyxins are mainly divided into two categories, two-component system , 5 and has AcrAB  and KpnEas AcrAB  of K. pneriaceae . Accordiountries , spreadis [mcr-1 , 12. Themcr-1 forms a complex transposon Tn 6330 with the surrounding transposon sequence ISApl1 [mcr-1 (1626\u2009bp), a PAP2 superfamily protein encoding gene (765\u2009bp), and ISApl1 transposon insertions on both sides [Apl1 belongs to the IS30 family and therefore has similar functions and activities to IS30 members [IRL and IRR) and contains a 927\u2009bp open reading frame (orf). The ISApl1 transposon will self-cleave to form a circular sequence intermediate (ISApl1)2-mcr-1-pap2 [Apl1 transposon exists around the mcr-1 gene. The circular intermediate contains 2\u2009bp of host flanking DNA between adjacent ISApl1 transposon ends and generates 2\u2009bp of target site duplications (TSDs) after integration [mcr-1 circular intermediate is integrated into the plasmid or genome of another strain, there is a probability that the ISApl1 transposon sequence will be lost. Loss of ISApl1 stabilizes mcr-1 in the plasmid or genome, which is conducive to the widespread spread of mcr-1.MCR-1 is a phosphoethanolamine (PEA) transferase with a 5-fold hydrophobic transmembrane helix located in the periplasmic domain and can reduce the net negative charge of the outer membrane of the bacteria by modifying PEA on the negatively charged lipid A on the lipopolysaccharide (LPS) of the bacteria . The mode ISApl1 . The com1 [mcr-1 26\u2009bp, a  members . It is fr-1-pap2 , 19 if tegration . When thmcr-1 can be horizontally transferred in more than a dozen Enterobacteriaceae, mainly including E. coli, K. pneumoniae, Salmonella spp. [Enterobacter aerogenes [P. aeruginosa [Proteus putida [Enterobacter cloacae [Cronobacter sakazakii [Shigella sonnei [Kluyvera ascorbate [Raoultella ornithinolytica [Achromobacter spp [Citrobacter spp [mcr-1. The whole genome sequencing results of mcr-1 positive strains showed that the mcr-1-bearing plasmids were mainly IncI2, IncX4, IncHI2 [Epidemiological studies have found that lla spp. , Enteroberogenes , P. aeruruginosa , Proteuss putida , Enterob cloacae , Cronobaakazakii , Shigella sonnei , Kluyverscorbate , Raoultenolytica , Achromocter spp  and Citrcter spp . These bcter spp , 31, and, IncHI2 , IncP [3, IncHI2 , IncHI1 , IncHI2 , IncFI, , IncHI2 , IncFIB , IncHI2 , IncK [3, IncHI2 , IncY [3, IncHI2 , IncN [3, IncHI2 . Among tmcr-1 was discovered, not only twenty-five genetic variants of the mcr-1 gene  were reported all over the world [mcr-like genes were discovered, which were named mcr-1, mcr-2 [mcr-3 [mcr-4 [mcr-5 [mcr-6 [mcr-7 [mcr-8 [mcr-9 [mcr-10 [mcr-2 and mcr-3 were found in E. coli. Mcr-4, mcr-5 and mcr-9 were found in S. enterica subsp. The mcr-7 and mcr-8 were found in K. pneumoniae. The mcr-6 was found in Moraxella spp. These proteins encoded by these mcr-like genes have different amino acid sequence identity with MCR-1. MCR-6 has the highest amino acid sequence similarity to MCR-1 (82.7%), while MCR-4 has the lowest amino acid sequence similarity to MCR-1 (32.1%), so their sources are not the same. Among them, MCR-1 and MCR-2 are similar in structure, and there are PAP2 family protein coding genes downstream of the coding genes, and the transposition element located near mcr-2 is IS1595 instead of ISApl1. The structures of MCR-3, MCR-4 and MCR-9 are similar. In addition, Teo et al. [mcr-like genes did not significantly improve the polymyxin resistance of clinical Enterobacteriaceae strains.Since he world , 41, but1, mcr-2 , mcr-3 [2 [mcr-3 , mcr-4 [3 [mcr-4 , mcr-5 [4 [mcr-5 , mcr-6 [5 [mcr-6 , mcr-7 [6 [mcr-7 , mcr-8 [7 [mcr-8 , mcr-9 [8 [mcr-9  and mcr- [mcr-10 . Among to et al. , showed K. pneumoniae  and one strain of polymyxin B resistant E. coli (17MR471) from patients and environment. Then we combined with the phenotypes of related experiments to explain the resistance mechanism of mcr-like genes.In the current study, we performed a third-generation genome sequencing analysis of three strains of polymyxin B resistant K. pneumoniae  and one strain of E. coli (17MR471). According to the whole-genome three-generation sequencing results, E. coli 17MR471 and K. pneumoniae 16BU137 carried the mcr-1.1 genes, and K. pneumoniae KP20191015 carried the mcr-8.2 gene , 8\u2009\u03bcg/ml (K. pneumoniae 16BU137), 32\u2009\u03bcg/ml (K. pneumoniae KP20191015) and 64\u2009\u03bcg/ml (K. pneumoniae 19PDR22). Among these strains, K. pneumoniae 19PDR22 has the highest MIC value and E. coli 17MR471 has the lowest MIC value.We obtained four MDR strains resistant to polymyxin B, including three strains of mcr-like gene and K. pneumoniae-specific gene was performed on all transconjugants. Using wzi gene as a K. pneumoniae-specific gene  and other 28 ARGs. K. pneumoniae 19PDR22 belongs to ST11, while lacked known plasmid-mediated colistin resistance gene.According to third-generation whole genome sequencing, the complete genome sequence of E. coli isolates from Guangdong, China and K. pneumoniae isolates from Anhui and Guangdong, China in the NCBI database, and conducted a phylogenetic analysis on them /IncFII type plasmids, while astA is located on IncQ1/IncFII type plasmid.A total of 48 virulence factors were predicted in K. pneumoniae KP20191015 are similar to K. pneumoniae 19PDR22. Compared with K. pneumoniae 16BU137, K. pneumoniae KP20191015 and K. pneumoniae 19PDR22 may contain more colistin resistance related genes. Among the three strains, the types of arnD, eptB, mgrB, opgE, pmrA, pmrB, pmrC, and pmrD are the same. Both K. pneumoniae KP20191015 and K. pneumoniae 19PDR22 contain two types of emrA, two types of emrB, and three types of phoP. K. pneumoniae 16BU137 contains one type of emrA, one type of emrB, and two types of phoP. In addition, IS903 inserted on the upstream sequence of mgrB in K. pneumoniae 19PDR22  upstream and downstream in the same orientation. In K. pneumoniae 16BU137, mcr-1.1 located in an IncX4-type plasmid which named p16BU137_mcr-1.1 . Also, mcr-1-pap2 could be flanked by ISApl1 upstream , downstream  or both . Plasmids like PN42 (MG557854) and pCDF8 (MF175191) have truncated IS elements in flanking regions of mcr-1. It has been hypothesized that after the loss of ISApl1, mcr-1 is immobilized in the plasmids [The \u00a0mcr-1.1 . The mcrplasmids .Fig. 4CiK. pneumoniae KP20191015, a mcr-8 variant was found in an 107,661\u2009bp IncFIB/ IncFII plasmid which named pKP20191015_mcr-8. mcr-8 was flanked by a reverse ISEcl1-like element  upstream. Also, it was flanked by an ISKpn26-like element  at the same direction downstream. Consistent with the sequences in the mcr-8-carrying pKP91  [dgkA, baeS, and copR close to mcr-8   identified in K. pneumoniae in Switzerland; pKP121\u20132   identified in K. pneumoniae in China. They all carried plasmid transfer associated tra locus with different combination and the replicon encoding gene repB.In G736312) , both ofwnstream , and sig2+ and Ca2+ from cationic binding sites leading to disruption of bacterial membrane integrity [pmrCAB and arnBCADTEF  [Enterobacteriaceae strains. Among them, K. pneumoniae 16BU137 and E. coli 17MR471 carries mcr-1, and K. pneumoniae KP20191015 carry mcr-8. The mcr-1 in 17MR471 is located on the chromosome, and the surrounding sequence is a typical Tn 6330 structure, (ISApl1)2-mcr-1-pap2. The mcr-1 in 16BU137 lacks upstream ISApl1 and downstream ISApl1, but still retains pap2. ISApl1 may be lost due to its involvement in mcr-1 transposition [pap2 always exists downstream of mcr-1, which seems to suggest that pap2 may play an indispensable function for mcr-1. Through further experimental verification, we identified K. pneumoniae 19PDR22 which conferred high MIC of colistin, while no known plasmid-mediated colistin genes was found. We found an IS903B-like element (97% similarity to IS903B) inserted into the upstream sequence of mgrB. This insertion appeared at position \u2212\u200918\u2009bp of the mgrB, which may lead to the inactivation of mgrB by interrupting its promoter region. The inactivation of mgrB conferred colistin resistance has been reported previously [mgrB [903, a member of IS5 family, is implicated in antibiotic resistance. Insertion sequences of the IS5 family have also been reported to truncate mgrB in Klebsiella oxytoca and yield elevated MICs for colistin [mcr-1 has a higher transformation efficiency and stronger transmission ability than the plasmid carrying mcr-8. However, the experimental results still have limitations due to the small number of strains in this study. 16BU137 and KP20191015 carries the mcr-like genes, meanwhile carries a variety of ESBL genes, such as blaSHV, blaCTX and blaTEM. The existence of these resistance genes makes MDR enterobacteria a huge threat to public medical and health safety.Polymyxins are cyclic, positively charged peptides, which were first discovered to possess antibiotic properties in the 1940s . Polymyxntegrity , 59. Polntegrity . Colistintegrity . Bacterintegrity , 63. TheHFIJKLM)  which weHFIJKLM) , 66. MutHFIJKLM) , 68. MorHFIJKLM) . MutatioHFIJKLM) . Here, wposition , 19. Howly [mgrB . IS903, colistin . More stK. pneumoniae). The high-quality complete genome sequence generated in this study will help to further study the mechanism of polymyxin resistance of K. pneumoniae and the horizontal transfer pathway of mcr-like genes. Although two strains are isolated from the environment, they still have high polymyxin resistance. And the types of virulence factors are basically the same as clinical strains, and still have the risk of infecting humans. These also warns us that the multi-drug resistant K. pneumoniae has spread seriously in China and needs to be controlled as soon as possible.We present the complete genome of four polymyxin-resistant strains . The environmental isolates of K. pneumoniae 16BU137 and E. coli 17MR471 were obtained from our previous studies [mcr-1 and were resistant to polymyxin B. Briefly, the environmental samples were collected using sterilized swab with saline, and cultured by broth medium. Then, the cultured samples were plated on the MacConkey agar with colistin (2\u2009\u03bcg/mL) and cultured under 37\u2009\u00b0C overnight. Subsequently, we randomly selected 5 colonies for each plate which were subject to screen mcr-1 gene by PCR. Only one colony for each sample was included for the subsequent study. K. pneumoniae 19PDR22 was isolated from the urine of patient with urinary tract infection, and K. pneumoniae KP20191015 was isolated from the sputum of patient with severe pneumonia. Sputum and urine were plated on blood agar plates and cultured at 37\u2009\u00b0C to isolate bacterial clones. VITEK 2 Compact System  was used to identify positive culture strains.The MIC of polymyxin B was tested on the MDR clinical isolates isolated from the inpatients in Affiliated Hospital of Anhui University of Traditional Chinese Medicine and the Anhui Provincial Hospital in 2019, and two polymyxin B resistant isolates were obtained  medium so that the concentration of bacteria reached OD600\u2009=\u20090.4 and then diluted 200 times in MH medium [5. Each concentration gradient was divided into three parallel groups and grown at 37\u2009\u00b0C and 220\u2009rpm with shaking for 24 and 48\u2009h. The experiment was repeated three times independently.H medium . Mix 75\u2009E. coli J53  was used as the recipient, and the mcr-like gene-positive strain  was used as the donor. Overnight culture (2\u2009mL) of each donor and recipient bacteria was mixed together at a ratio of donor to recipient of 1:3. The mixture was added to a final volume of 5\u2009mL LB liquid medium, and incubate at 37\u2009\u00b0C for 12\u201318\u2009h. Then spotted the mixture on Muller-Hinton agar plates containing 100\u2009mg/L sodium azide and 2\u2009mg/L polymyxin B as a selective medium for E. coli J53 transconjugants. Detection of mcr-like gene by PCR confirmed the putative transconjugants. Use wzi gene primers, mcr-1 gene primers and mcr-8 gene primers to distinguish the recipient strain (16BU137 and KP20191015) from the donor strain (J53).K. pneumoniae and E. coli were cultured overnight in LB medium. Bacterial samples (5000\u2009g 10\u2009min at 4\u2009\u00b0C) were collected and frozen at \u2212\u200980\u2009\u00b0C. The genomes of four isolates were performed using a PacBio RS II platform and Illumina HiSeq 4000 platform at the Beijing Genomics Institute . Four SMRT cells Zero-Mode Waveguide arrays of sequencing, were used by the PacBio platform to generate the subreads set. PacBio subreads (length\u2009<\u20091\u2009kb) were removed. The program Pbdagcon (https://github.com/PacificBiosciences/pbdagcon) was used for self-correction. Draft genomic unitigs, which are uncontested groups of fragments, were assembled using the Celera Assembler against a high quality corrected circular consensus sequence subreads set. To improve the accuracy of the genome sequences, GATK (https://www.broadinstitute.org/gatk/) and SOAP tool packages  were used to make single-base corrections.https://github.com/tseemann/abricate) by aligning genome sequences to the ResFinder database [https://www-isfinder.biotoul.fr). In silico multilocus sequence typing (MLST) was performed by MLST 1.8 (https://cge.cbs.dtu.dk/services/MLST/). Plasmid replicon types were detected using PlasmidFinder v1.3 [De novo hybrid assembly both of short Illumina reads and long PacBio reads was performed using Unicycler v0.4.3 . Completdatabase . The virdatabase . Insertider v1.3 .E. coli strains from Guangdong, China and all 182\u2009K. pneumoniae strains from Guangdong and Anhui, China (182 strains from Guangdong and 70 from Anhui) in the NCBI database (https://www.ncbi.nlm.nih.gov/pathogens/) as of December 2020. HarvestTools kit  was used to perform comparative genomics analysis and phylogenetic analysis of different isolates, Interactive tree of life (iTOL) v5 (http://itol.embl.de/) was used to construct a maximum likelihood phylogenetic tree [We collected all 87 tic tree , 55.Additional file 1.Additional file 2.Additional file 3."}
+{"text": "The current study aimed to explore the mcr gene molecular epidemiology in extensively drug-resistant (XDR) bacteria. Col-R gram-negative bacterial strains were screened using a minimum inhibitory concentration (MIC) breakpoint \u22654 \u00b5g/mL. Resistant isolates were examined for mcr variants, extended-spectrum \u03b2-lactamase, AmpC, and carbapenemase genes using polymerase chain reaction (PCR). The MIC breakpoints for mcr-positive strains were determined using broth microdilution and E-test strips. Overall, 19/718 (2.6%) gram-negative rods (GNRs) harboring mcr were identified, particularly in pus (p = 0.01) and tracheal secretions (p = 0.03). Molecular epidemiology data confirmed 18/19 (95%) mcr-1 and 1/19 (5%) mcr-2 genes. Integron detection revealed 15/17 (88%) Int-1 and 2/17 (12%) Int-2. Common co-expressing drug-resistant \u03b2-lactamase genes included 8/16 (50%) blaCTM-1, 3/16 (19%) blaCTM-15, 3/3 (100%) blaCMY-2, 2/8 (25%) blaNDM-1, and 2/8 (25%) blaNDM-5. The MIC50 and MIC90 values (\u00b5g/mL) were as follows: Escherichia coli, 12 and 24; Klebsiella pneumoniae, 12 and 32; Acinetobacter baumannii, 8 and 12; and Pseudomonas aeruginosa, 32 and 64, respectively. Treatment of XDR strains has become challenging owing to the co-expression of mcr-1, mcr-2, multifarious \u03b2-lactamase genes, and integrons.Plasmid-mediated colistin resistance (Col-R) conferred by  The conr) genes .mcr-1 was initially reported among Enterobacteriaceae isolated from humans and food-producing animals in approximately thirty territories over five continents [Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and some other bacterial genera. Inherent resistance to this class of antibiotics has been identified in some strains of Proteus, Serratia, Neisseria, Burkholderia, and Providencia [In 2016, ntinents . The unbvidencia .mcr genes diminish bacterial affinity toward colistin by encoding phosphorylethanolamine transferase, which reduces the negative charge of the microbial outer membrane, resulting in the development of microbial resistance [mcr in bacterial strains has shifted the paradigm of MDR to XDR for several bacterial strains, and the dissemination of mcr appears to be associated with the rapid horizontal transmission of plasmids [mcr genes (mcr-1 to mcr-9) have been described during the last four years from different countries [Col-R relies on a reduction in the electrostatic attraction between colistin and the outer membrane of gram-negative bacteria . The mcrsistance . The incplasmids . Severalountries .mcr gene, mcr-1, has been reported in species of Escherichia coli and K. pneumoniae isolated from poultry, meat, and humans [mcr-1-harboring bacteria, which has been isolated from various phases of poultry development [mcr-1 has also been reported in bacteria isolated from humans, poultry, retail meat, pigs, pigeons, ducks, and geese in China [blaTEM, blaSHV, and blaCTX-M, which are considered major causes of hospital and community infections [E. coli is CMY-2, which has been recorded in various geographical areas, including Asia, North America, and Europe. In particular, the occurrence of Col-R in ESBL or carbapenemase-producing bacteria poses a serious health risk owing to the limited therapeutic options available for the treatment of these strains [mcr-1 have been identified in MDR Enterobacteriaceae isolates, including species that produce carbapenemases, such as K. pneumoniae carbapenemase (KPC), Verona integron-encoded metallo-\u03b2-lactamase (MBL)-producing (VIM) species, or New Delhi MBL (NDM)-producing species [mcr and NDM has been reported in specimens isolated from food-producing animals and clinical samples, increasing the public health burden associated with antimicrobial resistance [The occurrence of the most commonly isolated elopment . Resistafections . AmpC \u03b2-fections . The mos strains . The pla species . Since t species . The co-sistance .mcr bacterial species in animals and humans is an overwhelming and current problem that has jeopardized public health and may lead to the development of virtually untreatable infections. The present study aimed to explore the molecular epidemiology of mcr genes and rule out the co-existence of ESBLs, AmpCs, and carbapenemases in mcr encoded bacterial strains. This study\u2019s findings will help in understanding the co-existence of drug-resistant genes, the menace posed by horizontal gene transfer, and the minimum inhibitory concentrations (MICs) required for antibacterial drugs to treat these bacterial strains.The emergence of plasmid-mediated mcr genes were detected in 19 (2.6%) gram-negative strains, which represented 33.3% of the total Col-R strains  between the sex of the patients and the collection of mcr-positive isolates. The highest number of mcr genes was detected from the isolates obtained from the medical ward and intensive care unit (ICU), followed by nephrology, the outpatient department (OPD), and the orthopedic ward. However, only specimens obtained from the ICU and surgical wards (p = 0.01) were significantly associated with the presence of mcr genes. Among all sources, mcr-harboring isolates were significantly associated with pus (p = 0.01) and tracheal secretion (p = 0.03) specimens  Col-R and 661 (92.1%) Col-S strains. Overall,  strains . The frepecimens .E. coli, 9/185 (4.9%) K. pneumoniae, 4/52 (7.7%) A. baumannii, 2/90 (2.2%) P. aeruginosa, and 25/25 (100%) P. mirabilis were identified as Col-R species. No significant association was observed between Col-R and mcr gene-harboring strains. We detected mcr genes in 9/17 (52.9%) E. coli (p = 0.43), 5/9 (55.6%) K. pneumoniae (p = 0.78), 3/4 (75%) A. baumannii (p = 0.43), and 2/2 (100%) P. aeruginosa (p = 0.49) Col-R species. None of the P. mirabilis strains were positive for mcr genes; however, these strains were found to be Col-R owing to intrinsic resistance (mcr sources were observed in 6/312 (1.9%) urine samples, 5/119 (4.2%) pus swabs, 3/82 (3.7%) blood samples, 3/71 (4.2%) wound swabs, and 2/39 (5.1%) tracheal secretions  sistance . Col-R scretions .mcr variants among the Col-R strains. Overall, 18/19 (95%) strains harbored mcr-1, and 1/19 (5%) strain harbored mcr-2 among all Col-R clinical isolates. The source of the only isolate carrying mcr-2 was a tracheal secretion isolated from an ICU case. All mcr-positive strains co-expressed drug-resistant \u03b2-lactamase genes. The most common ESBL-producing gene variants were 8/16 (50%) blaCTM-1 and 3/16 (19%) blaCTM-15. The AmpC gene variant blaCMY-2 was detected in 3/3 (100%) strains. Carbapenemase-producing strains included 2/8 (25%) blaNDM-1, 2/8 (25%) blaNDM-5, and 1/8 (13%) each of blaIPM, blaOXA-48, blaOXA-51, and blaVIM, respectively. Notably, 17 bacterial strains co-harbored integrons, of which 15/17 (88%) were Int1 and 2/17 (12%) were Int-2  E. coli isolates were resistant to each of meropenem and doripenem, and three (33.3%) were resistant to piperacillin-tazobactam and imipenem. None of the isolates showed resistance to tigecycline  strains were resistant to amikacin, cefoxitin, and tigecycline, and only two isolates were resistant to (40%) co-trimoxazole  ecycline a. All ofmoxazole b. Extensecycline c. All P.floxacin d.50) and the MIC to inhibit 90% growth (MIC90) were observed using colistin (breakpoint \u2265 4 \u00b5g/mL) and other antibiotic groups, based on their respective breakpoints. The colistin MIC50 and MIC90 values were as follows: E. coli, 12 and 24 \u00b5g/mL; K. pneumoniae 12 and 32 \u00b5g/mL; A. baumannii 8 and 12 \u00b5g/mL; and P. aeruginosa 32 and 64 \u00b5g/mL, respectively. The MIC50 and MIC90 of all the isolates against each tested drug are listed in The MIC to inhibit 50% growth  as Col-R and 661 (92.1%) as Col-S. These findings are consistent with a previous report from Colombia, in which (8.7%) Col-R was detected among clinical isolates [mcr-positive bacterial strains (MCRPBS) among human sources than among animal sources, which could indicate that plasmid-mediated colistin resistance first evolved in animal strains and then transferred to humans [The recent appearance of plasmid-mediated Col-R isolates . The datisolates ,17 straimcr in our study was 2.6%, similar to an earlier report, which showed a prevalence in Pakistan of 2.8% [mcr rates among clinical isolates of 3% and 3.2%, respectively [mcr-1 gene is most commonly found in E. coli compared with other bacterial species globally [E. coli, five K. pneumoniae, three A. baumannii, and two P. aeruginosa isolates harboring mcr genes, which are similar proportions as those reported by a study performed in Korea [mcr-harboring E. coli isolates, primarily recovered from urine, followed by pus swabs, blood, wound swabs, and tracheal secretions, which agrees with previous reports [mcr genes among clinical isolates was higher among women than men, consistent with an Iranian study [mcr detection and sex, and the only explanation for the higher occurrence in females is associated with the source of MCRPBS. Most of the mcr-harboring isolates were detected from the urinary samples, and urinary tract infections occur more frequently in women.The prevalence of  of 2.8% . The finectively ,20. The globally ,22. We iin Korea . Our fin reports ,25. The mcr variants among the Col-R strains, 95% mcr-1 and 5% mcr-2, consistent with global surveillance reports in which mcr-1 was detected in 75.8% of isolates from 18 countries [mcr-positive strains [E. coli strains were resistant to aztreonam, cefuroxime, ceftriaxone, cefotaxime, ceftazidime, and cefepime and presented a variable spectrum of resistance to other classes of drugs. K. pneumoniae strains emerged as MDR and presented resistance to cephalosporin, aztreonam, co-amoxiclav, gentamicin, and doripenem. The findings of our study are consistent with those of an earlier report [A. baumannii showed extensive drug resistance, and the diverse XDR strains had been reported by other studies [The molecular analysis showed two ountries . Colisti strains , which hr report . A. baum studies ,28,29.mcr-harboring isolates were characterized with an MDR profile, with particular resistance against third-generation cephalosporins. The expression of ESBLs and AmpC can explain the expansion of cephalosporin drug resistance, which is consistent with previously reported findings [blaCTM-1 and blaCTM-15), one AmpC gene variant (blaCMY-2), and carbapenemase-producing genes . These results agree with a previous report, in which 50% of mcr-harboring E. coli strains were found to be resistant to third-generation cephalosporins owing to the co-expression of blaCTX-M-2, and five isolates also expressed blaNDM and blaKPC [mcr-1 and blaNDM in several strains, which agrees with a previous report [P. aeruginosa co-harboring mcr-1 and blaNDM-5, which was recovered from urine, similar to a previous study in which a strain of E. coli co-expressing mcr-1 with blaNDM-5 was recovered from urine [blaCTM-1 and 3/16 (19%) blaCTM-15, suggesting the possible dissemination between humans and animals owing to selective pressure between the animal and human environment.The expanded drug resistance to \u03b2-lactams, aminoglycosides, carbapenems, and other antimicrobial drugs poses a significant global threat ,31. We ffindings . MCRPBS d blaKPC . Our stus report . This stom urine . The mosInt-1 and 12% were Int-2. Integrons are active in the development and dissemination of antibiotic resistance in gram-negative pathogens [mcr-1 to mcr-5 variants. We were unable to examine all of the mcr variants and sub-variants in the bacterial strains of clinical significance owing to limited resources.Integrons contain a drug-resistance gene cassette that can act against many drug categories and represent a core component of multidrug resistance. We found 17 bacterial strains that co-harbored integrons, of which 88% were athogens . One limBacterial strains were collected prospectively from various clinical settings located in Faisalabad and Lahore, Pakistan. The study design followed the ethical principles described by the World Medical Association (WMA) and the Declaration of Helsinki . The stuA total of 6879 clinical specimens were collected over six months from various sources and examined for bacterial isolation. The patients\u2019 sources include blood, urine, pus, tracheal secretion, cerebrospinal fluid (CSF), stool, and different swabs. No environmental swabs or water samples from the hospital environment were included for analysis. Blood and MacConkey\u2019s agar were used to culture all clinical specimens, except for blood and urine specimens. The blood samples were inoculated first in brain heart infusion broth. After a period of incubation following bacterial growth indicators, these cultures were subcultured on blood and MacConkey\u2019s agar. The urine specimens were processed on cystine\u2013lactose\u2013electrolyte-deficient (CLED) agar. All the cultures were incubated at 35\u201337 \u00b0C overnight in an aerobic incubator.5 colony-forming units (CFU)/mL were considered significant bacteriuria.Bacterial strains were phenotypically (growth characteristics) and biochemically characterized using Gram\u2019s stain, conventional biochemical tests , and analytical profile index (API) 20E and 20NE (bioM\u00e9rieux). Gram-negative rods (GNRs) were selected for further identification, and the remaining cultures were excluded from the analysis . Urine cE-test strips , and the inoculum size was standardized using a 0.5 McFarland standard. The tested antibacterial drugs included cephalosporin, fluoroquinolones, carbapenems, aminoglycosides, and \u03b2-lactam combined with colistin to determine co-resistance. The established MIC breakpoints were used to interpret the results as resistant and susceptible bacterial strains [The Col-R status of the retained GNRs was detected using SensiTest\u2122 Colistin . Bacteria exhibiting MICs \u22654 \u00b5g/mL were phenotypically reported as Col-R strains. MCRPBSs were tested for MDR and XDR. MICs were determined against several antibacterial drugs using the broth microdilution method and  strains .MCRPBSs were phenotypically characterized to detect the presence of other drug-resistant enzymes . Phenotypically, ESBLs were identified by the hydrolysis of cefotaxime and ceftazidime and the formation of keyhole effect when using the conventional double-disk synergy technique ,38. AmpCmcr-positive bacterial strains (MCRPBSs), and the presence of most frequently isolated mcr-1 to mcr-5 variants was detected. We used previously described primers and well-optimized multiplex polymerase chain reaction (PCR) conditions to detect the presence of mcr genes [mcr-1, 2, 3, 4, and 5), 2 \u00b5L template, 25 \u00b5L master mix, and 1.5 \u00b5L dimethyl sulfoxide (DMSO), and the final reaction mixture was brought to 50 \u00b5L using Milli-Q water. Amplified gene products were detected on agarose gel electrophoresis using 6\u00d7 loading dye at 90 V for 50 min. A 100 bp DNA ladder was used to quantify the gene products, and a gel documentation system was used to visualize the genes.Col-R strains were selected for the analysis of cr genes ,42,43. Mmcr sequencing and used to amplify drug-resistant genes. ESBL, AmpC, carbapenemases, and integron genes were separately amplified separately using previously described primers and optimized PCR conditions [MCRPBS DNA was extracted as described for nditions ,38,44. TE. coli (25922) and Col-R Proteus mirabilis (25933); ESBL-positive K. pneumoniae (700603) and ESBL-negative E. coli (25922); and E. coli (BAA-2469) was used as an NDM-1.The following QC strains were obtained from the American Type Culture Collection (ATCC): colistin-susceptible (Col-S) p-value of <0.05 was considered significant and descriptive statistics were used for the variables.Data analysis was performed using the GraphPad Prism 8.0.2, IBM SPSS v.26, and BioVinci 3.0.0. A mcr-1 and mcr-2 in several clinical isolates, including a high number of isolates that co-expressed blaCTM-1, blaCTM-15, blaCMY-2, blaNDM-1, blaNDM-5, and a few other \u03b2-lactamases. The detection of the mcr-2 gene variant in K. pneumoniae is a rarely reported finding. The co-expression of diverse gene variants among \u03b2-lactamase classes was well-supported by the simultaneous occurrence of Int-1 and Int-2, which can carry several drug-resistant gene cassettes. The molecular epidemiology of the co-expression of mcr and \u03b2-lactamases accentuates the increasing emergence of XDR clinical strains, which are difficult to treat and pose the massive threat of the clonal dissemination of these genes. Although we were able to identify therapeutic alternatives for each of the strains isolated in this study, our findings raise the question of how much time remains before a strain develops resistance against every available antimicrobial option. This situation represents a real danger to human lives and requires implacable surveillance, infection control, and the development of novel therapeutic regimens.The study reports the emergence of"}
+{"text": "Los endopar\u00e1sitos y ectopar\u00e1sitos en perros son de distribuci\u00f3n mundial. La estrecha relaci\u00f3n entre los perros y el hombre implica un riesgo de transmisi\u00f3n de parasitosis zoon\u00f3ticas, por lo cual es necesario conocer las especies que parasitan a los perros de esta zona y determinar los factores asociados.Dipyilidium caninum en pulgas del g\u00e9nero Ctenocephalides spp. Estimar la prevalencia de endopar\u00e1sitos y ectopar\u00e1sitos, identificarlos en perros domiciliados de la zona metropolitana de Toluca, M\u00e9xico, y determinar la prevalencia de D. caninum en pulgas se hizo mediante la reacci\u00f3n en cadena de la polimerasa (PCR). Se recolectaron muestras de 402 perros que fueron llevados a consulta en cuatro hospitales de referencia de Toluca. En el diagn\u00f3stico de endopar\u00e1sitos, se utilizaron las t\u00e9cnicas coproparasitosc\u00f3picas de frotis directo, flotaci\u00f3n y sedimentaci\u00f3n; adem\u00e1s, se recolectaron ectopar\u00e1sitos para su identificaci\u00f3n taxon\u00f3mica. Por \u00faltimo, la detecci\u00f3n de Toxocara spp., Giardia spp., Ancylostoma spp., Cystoisospora spp., D. caninum, Taenia spp. y Trichuris vulpis. Se determin\u00f3 una prevalencia de ectopar\u00e1sitos de 13,13 %. Se identificaron pulgas de las especies Ctenocephalides felis y C. canis, en tanto que solo un animal present\u00f3 parasitosis por Rhipicephalus sanguineus y otro por Trichodectes canis. La prevalencia de D. caninum en pulgas fue del 9,5 %.  El 37,2 % de los perros result\u00f3 positivo para endopar\u00e1sitos. Los g\u00e9neros o especies identificados fueron D. caninum. La prevalencia de endopar\u00e1sitos fue de 37,2 % y, la de ectopar\u00e1sitos, de 13,1 %. Por primera vez en M\u00e9xico se hizo un an\u00e1lisis de endopar\u00e1sitos y ectopar\u00e1sitos en una misma poblaci\u00f3n de perros, as\u00ed como el diagn\u00f3stico molecular de  Giardia spp., Ancylostoma spp., Toxocara canis, Echinococcus spp., Dipylidium caninum, Strongyloides spp., entre otros ,En la actualidad, los perros tienen un papel importante en la sociedad como animales de compa\u00f1\u00eda, para guardia, protecci\u00f3n y rescate, as\u00ed como de apoyo en terapia ocupacional ,Toxocara spp., Giardia spp. y Ancylostoma spp. tienen la mayor distribuci\u00f3n y afectan a perros de distintos pa\u00edses En diversos estudios se han reportado prevalencias variables de endopar\u00e1sitos en perros domiciliados: en Estados Unidos, se encontr\u00f3 una prevalencia nacional del 12,5 % -Ctenocephalides felis y Ct. canisRhipicephalus sanguineus son los ectopar\u00e1sitos que m\u00e1s frecuentemente afectan a perros de \u00e1reas urbanas y rurales ,Entre los ectopar\u00e1sitos que afectan a los perros, las garrapatas y las pulgas ocasionan los principales da\u00f1os y pueden transmitirles agentes pat\u00f3genos Ixodes near affinis, Amblyomma mixtum, A. sabanerae, A. parvum, A. ovale, A. auricularium, A. maculatum, Dermacentor nitens y R. sanguineusEn un estudio reciente en el sureste de M\u00e9xico, se report\u00f3 que los perros pueden estar parasitados con nueve diferentes especies de garrapatas, entre ellas, Dados los serios problemas de salud que los endopar\u00e1sitos y ectopar\u00e1sitos ocasionan a los perros, y que algunos de ellos pueden ser zoon\u00f3ticos, es imperante conocer su diversidad y abundancia en \u00e1reas geogr\u00e1ficas espec\u00edficas, para establecer medidas tendientes a reducir su impacto negativo en los animales y el riesgo de transmisi\u00f3n a la poblaci\u00f3n humana.Por estas razones, el objetivo del presente estudio fue estimar la prevalencia de endopar\u00e1sitos y ectopar\u00e1sitos, identificarlos en perros domiciliados de la zona metropolitana de Toluca, M\u00e9xico, y determinar los factores asociados con la presencia de cada especie parasitaria.2 y la densidad urbana de 67,1 habitantes/ha. Su altitud promedio es de 2.660 msnm, tiene un clima templado  y una humedad relativa promedio de 70 % El estudio se hizo en cuatro hospitales veterinarios de municipios de la zona metropolitana de Toluca, M\u00e9xico, . La poblaci\u00f3n humana estimada en esta zona es de 1,85 millones de habitantes, su superficie es de 1.991 kmMediante la f\u00f3rmula de Cochran En la consulta se les inform\u00f3 a los propietarios sobre los objetivos del estudio y se solicit\u00f3 su consentimiento informado para la toma de muestras a sus mascotas. Las personas proporcionaron la siguiente informaci\u00f3n de los perros: edad, sexo, raza, si ten\u00edan acceso a la calle y si permanec\u00edan dentro o fuera de la casa. En la inspecci\u00f3n general de los animales, se obtuvieron los siguientes datos: condici\u00f3n corporal determinada mediante la escala de Laflamme  A cada perro se le tom\u00f3 un hisopado rectal para el an\u00e1lisis con la t\u00e9cnica directa en fresco y una impresi\u00f3n de la zona perianal con la ayuda de una cinta adhesiva transparente Se recolectaron las garrapatas y los piojos mediante desprendimiento manual con ayuda de pinzas y un guante de inspecci\u00f3n, y las pulgas, con un peine de cepillado y obtenci\u00f3n de espec\u00edmenes ,Las heces de los perros se procesaron en el laboratorio cl\u00ednico del Hospital Veterinario para Peque\u00f1as Especies de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad Aut\u00f3noma del Estado de M\u00e9xico, usando las siguientes t\u00e9cnicas de diagn\u00f3stico de endopar\u00e1sitos: estudio coproparasitosc\u00f3pico directo, t\u00e9cnica de flotaci\u00f3n en soluci\u00f3n de sulfato de cinc y Sheather, t\u00e9cnica de sedimentaci\u00f3n y test de Graham Se consideraron como positivas para endopar\u00e1sitos aquellas muestras con huevos, ooquistes, larvas, adultos o progl\u00f3tidos detectados mediante alguna de las t\u00e9cnicas coproparasitosc\u00f3picas mencionadas. De los animales con ectopar\u00e1sitos, se recolectaron e identificaron espec\u00edmenes de pulgas, garrapatas o piojos.D. caninum en las pulgas obtenidas en los muestreos, siguiendo la siguiente metodolog\u00eda.Adem\u00e1s, en la unidad de diagn\u00f3stico molecular de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad Aut\u00f3noma de Yucat\u00e1n, se hizo el diagn\u00f3stico molecular de Extracci\u00f3n de ADN. Las pulgas obtenidas de cada paciente fueron analizadas de manera individual para identificar su especie; si un perro presentaba m\u00e1s de dos pulgas, se hac\u00eda una mezcla de dos a tres de ellas, de tal manera que se obtuvieran muestras de pulgas individuales y muestras de mezclas de la misma especie. Las pulgas se retiraron del alcohol y se lavaron con agua destilada para luego almacenarlas a -70 \u00b0C durante 12 horas. Posteriormente, con la ayuda de un pistilo de pl\u00e1stico est\u00e9ril, se maceraron y se extrajo el ADN con el estuche Quiagen DNAeasy Blood&Tissue\u00ae siguiendo las instrucciones del fabricante. Las muestras se conservaron a -20 \u00b0C hasta el momento en que se hizo la PCR.Amplificaci\u00f3n de ADN y electroforesis. Para el diagn\u00f3stico de D. caninum en las pulgas, se utiliz\u00f3 la regi\u00f3n 28S rDNA del genoma del par\u00e1sito, cuyo tama\u00f1o esperado era de 653 pb. Se utilizaron los siguientes iniciadores para el diagn\u00f3stico: C28S-1R:5-CACATTCAACGCCCGACTCCTGTAG-3 y DC28S- 1F:5-GCATGCAATCAAAGGGTCCTACG-3 2O y 5 \u03bcl de cada muestra de ADN.Las condiciones del ciclo fueron: 95 \u00b0C por 15 minutos, 40 ciclos a 94 \u00b0C por 30 segundos, 56 \u00b0C por 30 segundos, 72 \u00b0C po 30 segundos y 72 \u00b0C por 10 minutos Toxocara spp., Giardia spp., Ancylostoma spp., D. caninum y Cystoisospora spp., y como variables independientes de cada par\u00e1sito, al municipio , la estacionalidad , la edad (un a\u00f1o o meses y m\u00e1s de un a\u00f1o), el sexo , la raza , el salir a la calle , la convivencia con otros animales , la estancia en exteriores o interiores, la condici\u00f3n corporal (deficiente o no deficiente), las heces , y otros signos cl\u00ednicos asociados con enfermedad intestinal  o presencia de pulgas .Se determin\u00f3 la prevalencia general y por especie de par\u00e1sito. Inicialmente, se realiz\u00f3 la prueba de ji al cuadrado con el programa Prisma Graphpad\u00ae, considerando como variables dependientes a los endopar\u00e1sitos con mayor prevalencia: \u0395l an\u00e1lisis de ji al cuadrado en ectopar\u00e1sitos se hizo unicamente en pulgas porque solo se encontr\u00f3 un animal positivo para garrapatas y otro para piojos. Adem\u00e1s de las variables independientes consideradas para los endopar\u00e1sitos, se consideraron tambi\u00e9n el prurito  y las lesiones en piel .Odds Ratio, OR) e int\u00e9rvalos de confianza de 95 %, y se determinaron los factores asociados con cada especie o g\u00e9nero de endopar\u00e1sitos y ectopar\u00e1sitos  ,El an\u00e1lisis de regresi\u00f3n log\u00edstica se hizo con el programa Sigma Plot.11\u00ae. Para cada especie o g\u00e9nero de par\u00e1sito, se consideraron aquellas variables independientes con una p menor de 0,2 en la prueba de ji al cuadrado. Se calcularon la raz\u00f3n de momios 95% 32,6-42,0) (150/403) result\u00f3 positivo, por lo menos, para un g\u00e9nero o especie de par\u00e1sito gastrointestinal. En el municipio de Metepec, se observ\u00f3 una prevalencia de 32,2 %  (20/62), en San Mateo Atenco, de 41,4 %  (17/41), en Toluca, de 37,6 %  (94/250) y, en Zinacantepec, de 38 %  (19/50), No se observ\u00f3 diferencia estad\u00edstica entre los municipios.Durante los meses de junio de 2016 a mayo de 2017, se evaluaron 403 perros, de los cuales el 37,2 % , seguido por Giardia spp., con 13,4 % (54/403), Ancylostoma spp., con 9,2 % (37/403), D. caninum, con 4,7 % (19/403), Cystoisospora spp., con 4,7 % (19/403), Taenia spp., con 0,7 % (3/403), y T. vulpis, con 0,2 % (1/403). Se detect\u00f3 multiparasitosis en 10,1 % (41/403) de los perros, de los cuales 7,9 % (32/403) present\u00f3 dos par\u00e1sitos y, 2,2 % (9/403), tres par\u00e1sitos. La asociaci\u00f3n m\u00e1s frecuente fue entre un protozoario y un nematodo , (53/403) fueron positivos a ectopar\u00e1sitos. En el municipio de Metepec se observ\u00f3 una prevalencia de 11,2 %  (7/62), en San Mateo Atenco, de 17,1 %  (7/41), en Toluca, de 12 %  (30/250) y, en Zinacantepec, de 18 %  (9/50). No se observaron diferencias estad\u00edsticamente significativas  entre los municipios.De los 403 perros estudiados, el 13,15 % , Ct. canis.La prevalencia general de perros con pulgas fue de 12,9 % (52/403) y se recolectaron entre 1 y 8 pulgas por animal. En estos 52 perros, se recolectaron 145 pulgas, de las cuales el 56,6 % (82/145) era R. sanguineus, y un perro  fue positivo para T. canis; se recolectaron tres espec\u00edmenes de este piojo.Solamente un perro result\u00f3 positivo para garrapatas , con seis espec\u00edmenes de Ct. felis y 19 a Ct. canis. En el D. caninum en la PCR , en tanto que Ct. canis tuvo una prevalencia de 1,9 % (1/52)  para pulicosis en el modelo de regresi\u00f3n log\u00edstica, fueron la condici\u00f3n corporal, el prurito y las lesiones en piel cuadro 7). Se extrajo ADN de 52 muestras de pulgas, de las cuales 33 correspondieron a la especie . Se extrn la PCR . Ct. fel% (1/52) .,Se encontr\u00f3 una prevalencia de endopar\u00e1sitos del 37,2 % en la poblaci\u00f3n de perros domiciliados de la zona metropolitana de Toluca, cifra mayor a la reportada en otros estudios nacionales e internacionales de perros con atenci\u00f3n m\u00e9dica: en Ciudad de M\u00e9xico, las prevalencias registradas han sido de 20 % y 21,3 % ,Toxocara spp. en todos los espacios muestreados Toxocara spp. en los espacios p\u00fablicos en Toluca representa una fuente de reinfecci\u00f3n para los animales y de posible transmisi\u00f3n al humano de la larva migrans visceral La variaci\u00f3n en la prevalencia y la intensidad se podr\u00eda asociar con tres factores. El primero es el uso de cuatro t\u00e9cnicas de diagn\u00f3stico con diferentes propiedades de sensibilidad y especificidad, algunas de ellas m\u00e1s propicias para el diagn\u00f3stico de especies de par\u00e1sitos ,,,,-,,Se identificaron siete g\u00e9neros o especies de par\u00e1sitos, diversidad comparable con el rango reportado en estudios previos, el cual fue de 4 a 16 par\u00e1sitos ,Los resultados muestran un predominio de g\u00e9neros y especies de par\u00e1sitos zoon\u00f3ticos. Seis de las siete especies identificadas tienen potencial zoon\u00f3tico, lo que coincide con otros estudios, como el de Ciudad de M\u00e9xico, donde todas  las especies reportadas fueron zoon\u00f3ticas Toxocara spp., con 16,6 %. En otras ciudades de M\u00e9xico se reportan prevalencias variables, como en M\u00e9rida, 5,7 % y 6,2 % ,El nematodo con mayor prevalencia fue Toxocara spp. Un hallazgo similar se ha reportado en Espa\u00f1a, Rumania y Argentina ,,3) se reactivan y se transmiten a los cachorros por medio de la placenta y la leche En el an\u00e1lisis multivariado de regresi\u00f3n log\u00edstica, los perros menores de un a\u00f1o presentaron la mayor probabilidad de infecci\u00f3n con et al., en pacientes sintom\u00e1ticos comparados con los asintom\u00e1ticos El segundo par\u00e1sito con mayor prevalencia fue Giardia spp., con 13,4 %, la m\u00e1s alta reportada en perros domiciliados de M\u00e9xico. En Villahermosa, Tabasco, se report\u00f3 en el 1 % de los perros Ancylostoma fue el tercero con mayor prevalencia en la poblaci\u00f3n estudiada ; adem\u00e1s, es el par\u00e1sito zoon\u00f3tico con mayor prevalencia en los estudios de Ciudad de M\u00e9xico  El g\u00e9nero Ancylostoma spp. por v\u00eda oral y cut\u00e1nea; llegan a ser parasitosis graves en el intestino delgado, donde producen los principales efectos en su fase adulta ,Los perros menores de un a\u00f1o tienen 2,04 veces m\u00e1s probabilidades de infecci\u00f3n con este nematodo, probablemente asociada con la transmisi\u00f3n lactog\u00e9nica del par\u00e1sito en los primeros d\u00edas de vida Ancylostoma spp. El nematodo se alimenta de la mucosa del intestino delgado y genera da\u00f1o mec\u00e1nico al adherirse a la misma mediante su c\u00e1psula bucal, y la diarrea suele acompa\u00f1arse de sangre La diarrea y las manifestaciones cl\u00ednicas intestinales tambi\u00e9n se asociaron con la infecci\u00f3n de El cestodo con mayor prevalencia fue D. caninum, con 4,7 %. La prevalencia de este par\u00e1sito ha sido menor en estudios similares, como los llevados a cabo en M\u00e9rida, Yucat\u00e1n  D. caninum. El cestodo se adhiere a la pared intestinal por medio del esc\u00f3lex, lo que genera da\u00f1o en la mucosa e inflamaci\u00f3n del intestino D. caninum, ya que las pulgas Ct. felis, Ct. Canis, Pulex irritans y T. canis son hu\u00e9spedes secundarios de este cestodo.La diarrea  y las manifestaciones cl\u00ednicas intestinales  fueron factores asociados con la infecci\u00f3n con Cystoisospora spp. fue el segundo protozoo con mayor prevalencia , y la \u00fanica especie encontrada que no se considera zoon\u00f3tica. Este g\u00e9nero se reporta en la mayor\u00eda de estudios epidemiol\u00f3gicos con prevalencias bajas comparadas con las de los nematodos u otros protozoos como Giardia spp. El 1,9 % de los perros estudiados en M\u00e9rida, Yucat\u00e1n, resultaron positivos para Cystoisospora spp. Los factores asociados con la infecci\u00f3n por este g\u00e9nero fueron la diarrea y las manifestaciones cl\u00ednicas intestinales. El par\u00e1sito destruye la l\u00e1mina propia de todo el intestino delgado del perro hasta producir atrofia de las vellosidades. Se considera un pat\u00f3geno primario de diarrea en animales j\u00f3venes Taenia spp.  y T. vulpis , ambas especies zoon\u00f3ticas; el cestodo es el que posee mayor capacidad pat\u00f3gena en el humano T. vulpis solo se ha reportado como causante de zoonosis de manera excepcional ,Otros par\u00e1sitos identificados cuya prevalencia estuvo por debajo de 1 %, fueron La prevalencia de ectopar\u00e1sitos  fue menor a la reportada en otros estudios; en dos provincias de Brasil fue de 100 % y 89,7 % Ct. felis, lo que coincide con los reportes mencionados, con excepci\u00f3n del de Aguascalientes, donde Ct. canis fue la especie m\u00e1s prevalente ,,,Las pulgas fueron el ectopar\u00e1sito m\u00e1s prevalente, 12,9 %, similar a lo reportado en Italia, 17,6 % Los perros con condiciones corporales deficientes presentaron mayor prevalencia de infecci\u00f3n . Debido a su h\u00e1bito hemat\u00f3fago, los ectopar\u00e1sitos pueden producir anemia y, en consecuencia, un d\u00e9ficit nutricional cr\u00f3nico R. sanguineus, la de mayor distribuci\u00f3n en distintos estados de M\u00e9xico -Ehrlichia canis y Babesia canisSolo un perro present\u00f3 garrapatas de la especie Trichodectes canis fue el \u00fanico piojo identificado en un perro. Este piojo no es com\u00fan en perros; en M\u00e9xico, Brazil y Etiop\u00eda, se reporta Heterodoxus spiniger como el piojo de mayor importancia en perros, con prevalencias del 2 al 67,4 % ,,D. caninum, resultado similar al obtenido en pa\u00edses de Europa  y en Malasia (10 %). La especie de pulga con mayor prevalencia  de D. caninum fue Ct. felis, la m\u00e1s importante en la transmisi\u00f3n de este cestodo en Europa y Malasia ,-En el presente estudio y mediante PCR, se verific\u00f3 que el 9,6 % de las pulgas se encontraban infectadas con En conclusi\u00f3n, la prevalencia de endopar\u00e1sitos en perros domiciliados de Toluca, M\u00e9xico, se considera alta, dado que la poblaci\u00f3n estudiada recibe atenci\u00f3n m\u00e9dica peri\u00f3dica. Se observ\u00f3 un predominio de especies parasitarias con potencial zoon\u00f3tico, lo cual puede representar un riesgo para los due\u00f1os de mascotas de la zona. Seg\u00fan el an\u00e1lisis de regresi\u00f3n log\u00edstica, se debe hacer un diagn\u00f3stico parasitol\u00f3gico exhaustivo en los perros j\u00f3venes, pues es el grupo con la mayor prevalencia de par\u00e1sitos y que m\u00e1s cercan\u00eda tiene con los propietarios. Tambi\u00e9n, se encontraron asociaciones de las parasitosis con la presencia de diarrea o semi\u00f3tica intestinal, el tener acceso a espacios exteriores y la presencia de pulgas.D. caninum en los perros y en las pulgas pone de manifiesto la importancia de un control integral de endopar\u00e1sitos y ectopar\u00e1sitos en la regi\u00f3n, para disminuir las infecciones e infestaciones en los perros y reducir el riesgo de transmisi\u00f3n a los humanosPor el contrario, la prevalencia de ectopar\u00e1sitos en Toluca fue baja, siendo las pulgas las m\u00e1s prevalentes. La condici\u00f3n corporal, el prurito y las lesiones en piel, se asociaron con las infestaciones de ectopar\u00e1sitos. La presencia de"}
+{"text": "With sunitinib treatment of metastatic renal cell carcinoma, most patients end up developing resistance over time. Recent clinical trials have shown that individualizing treatment protocols could delay resistance and result in better outcomes. We developed an in vivo xenograft tumor model and compared tumor growth rate, morphological, and transcriptomic differences between alternative and traditional treatment schedules. Our results show that the alternative treatment regime could delay/postpone cancer progression. Additionally, we identified distinct morphological changes in the tumor with alternative and traditional treatments, likely due to the significantly dysregulated signaling pathways between the protocols. Further investigation of the signaling pathways underlying these morphological changes may lead potential therapeutic targets to be used in a combined treatment with sunitinib, which offers promise in postponing/reversing the resistance of sunitinib. VHL at 3p25 is observed in most cases [VHL, which results in a pro-angiogenic gene expression signature by the destabilization of hypoxia-inducible factors [SETD2 and SWI/SNF chromatin remodeling complex is also characterized in ccRCC [Renal cell carcinoma (RCC) is an epithelial malignancy of the renal tubules . It affeRadical or partial nephrectomy is the treatment for primary ccRCC. For metastatic ccRCC, oral vascular endothelial growth factor receptor TKIs, including \u201csunitinib\u201d, have significantly improved outcomes for patients . TKI monThe prolonged use of sunitinib leads to clinical morbidities such as hypertension, oral mucositis, hand-foot syndrome, diarrhea, hematological toxicity, and fatigue . AdditioA recent single arm phase-II clinical trial has shown that individualized sunitinib therapy may be more effective and safer compared to the traditional treatment regime . In thisIn the present study, we hypothesize that varying treatment schedule and dosage of sunitinib can delay tumor resistance to the drug and prolong progression-free survival compared to the traditional schedule. We gave sunitinib at different dosages and administration schedules in vivo using a xenograft mouse model and examined the morphologic and molecular differences of the resulting tumors between the treatment groups as a tool to examine the effects of altering the schedule of treatment on the development of resistance.5 cells were injected into NOD/SCID (NSG) mice  subcutaneously. A 1:1 ratio of Matrigel  and single-cell suspension were contained in the injection [All animal studies were performed in compliance with the Animal Care Committee of St Michael\u2019s Hospital and the Canadian Council of Animal Care. The 786-0 kidney cancer cell line was obtained from American Type Culture Collection  and was cultured per the distributor\u2019s description. An amount of 5 \u00d7 10njection . Mice wenjection . A totalSunitinib was administered by gavage. Mice were randomized to the following four groups: (1) Control: no treatment, (2) Traditional: Sunitinib for 4 weeks of continuous treatment and 2 weeks of break  AlteTumor size was measured once the tumors become palpable and monitored by manual caliper daily . Tumor vTumor volume was estimated by using the equation above and the average volume per week was calculated for every group.Three mice from every experimental group were sacrificed for histological examination. Tumors and organs  were collected or fixed in 10% formalin. Formalin-fixed paraffin-embedded tissues were sliced at 4\u20136 \u03bcm sections and stained with hematoxylin and eosin. The stained sections were assessed by two pathologists (RS and SK) . Slides Three mice from every experimental group were sacrificed for mRNA expression analysis. Tumors were snap-frozen at \u221280 \u00b0C for RNA isolation. Total RNA was isolated using Qiagen RNeasy Mini Kit , following the manufacturer\u2019s recommendations. RNA quantity and integrity was assessed using the RNA 6000 Nano Assay and Agilent 2100 Bioanalyzer . Samples with RIN greater than 7 were used for RNA-Seq analysis. mRNA sequencing libraries were constructed as per the recommendations of the TruSeq mRNA protocol .RNA-Seq was performed on snap-frozen tumors from traditional and alternative treatment groups. First strand cDNA was synthesized using 1 \u03bcg of total RNA, using the Illumina TruSeq mRNA library prep kit, following the manufacturer\u2019s recommendation. Libraries were sequenced on the Illumina NextSeq 550 system . The targeted read counts were 20\u201335 million total reads per sample. Raw FastQ reads files were assessed and adapter trimming processed using the RNA-Seq Alignment app , and reads with Phred scores > 30 were retained. The resultant quality-trimmed reads were aligned to the hg38 (GrCH38.83) build of the human genome using the STAR aligner app . Transcript abundance quantification was performed using Cufflinks Assembly & DE analysis apps .https://www.genepattern.org/ (accessed on 20 August 2021), https://www.gsea-msigdb.org/gsea/index.jsp (accessed on 20 August 2021)).The differences in tumor sizes between groups were tested using the t-test . The compared groups were control against traditional, alternative 1 against traditional, alternative 2 against traditional and alternative 1 against alternative 2. Gene expression profiles were evaluated by GenePattern RNA Seq modules and GSEA (Gene Set Enrichment Assay) . We selected late treatment cases to evaluate the molecular and gene pathways involved in the changes [To gain a better understanding of the molecular events that led to aggressive behavior and sarcomatoid dedifferentiation, genes with differential falling outside of the inflection point were analyzed using the GSEA. Enrichment gene sets results were visualized by Cytoscape  when compared with no treatment.The mean growth curves of all four groups are summarized in The control group showed the highest growth rate, as expected. Tumors started getting palpable at the second week. The traditional scheduling group (50 mg/day for 4 weeks of continuous treatment and 2 weeks of break) showed resistance around the 6th week and rapid tumor growth by the 9th week. The two alternative scheduling groups (50 mg/day (Alt 1) or 75 mg/day (Alt 2) for 2 weeks of continuous treatment and 1 week of break) showed slower tumor growth rates and did not show signs of resistance till the end of the experiment. There was no significant difference when different alternative schedule dosages were compared . Each graph shows the average of three animals.The slope of traditional treatment (m = 527.61) showed stable disease with minimal tumor growth until about the 6th week. Rapid growth of the tumors occurred at approximately the 9th week and was fully manifested at the 10th week, indicating sunitinib resistance.1 = 218.46 and m2 = 273.46), which indicates the alternative treatment significantly slowed down tumor growth rate, and furthermore, there were no signs of resistance until the end of the experiment (12 weeks). There was, however, no significant difference in tumor growth rate between the two alternative treatment groups (p > 0.05 throughout 12 weeks of the experiment) , and the traditional group, the slopes of the two-alternative scheduling treatments were nearly half (meriment) .Tumors were palpable at the second week and at 6, 9 and 11 weeks. The traditional group was treated with 50 mg sunitinib/day for 4 weeks of continuous treatment and 2 weeks of break). The alternative groups were treated by either 50 mg/day  or 75 mg/day  for 2 weeks of continuous treatment and 1 week of break. Tumor volumes were significantly larger in the traditional group. We observed no significant difference of tumor growth when comparing different dosages in the alternative group.We compared the histomorphology of tumor xenografts subjected to the traditional treatment  and altep < 0.05), significantly less vascularization (p < 0.05), and very minimal component of spindling (a marker of sarcomatoid changes).Histological examination of the alternative treatment scheduling cohort was evaluated after two and three cycles of treatment A. A cyclAdditionally, alternative treatment groups showed a significantly higher proportion of cells with preserved RCC morphology C (roundep < 0.05). When comparing the different dosage of the alternative treatments, the higher dosage (75 mg) clearly produced more confluent areas of necrosis, indicating more effective treatment than the regular classic dosage (50 mg), even at 12 weeks, although, ultimately, this did not translate into a significantly smaller tumor size (as discussed above).In terms of aggressive tumor behavior, lung and liver metastasis were observed in both the traditional and the alternative treatment groups, but tumors with traditional treatment started developing metastasis at a much earlier date (at 6 weeks) and showed significantly higher number and larger size of metastatic deposits. The interrupted treatment protocol resulted in a smaller number of metastatic deposits in the liver and the lung compared to continuous treatment or the control groups after 12 weeks , etc. in the alternative groups as compared to the traditional treatment. It should also be noted that the mice in the alternative group were able to tolerate a higher dosage of the treatment with fewer side effects. Together, these results indicate that the drug \u201cbreaks\u201d  resulted in greater efficiency, with fewer side effects, and enabled the animal to tolerate higher doses, and significantly delayed the development of aggressive features and the development of resistance.Following sequencing, FastQ and sequencing QC were evaluated and samples with a sequencing depth greater than 30 were selected for comparison. There was a significant expression profile difference between the traditional and alternative groups, as shown in p < 0.01, and 12 gene sets were significantly enriched at nominal p < 0.05. The eight highly enriched (significant) pathways were protein secretion, androgen secretion, heme metabolism, mitotic spindle, oxidative phosphorylation, mTORC1 signaling, early estrogen response, Myc targets, bile acid metabolism, UV response DN, G2M checkpoint, and PI3K-AKT-mTOR signaling , the H  collections in MSigDB (Molecular Signature Database). We interrogated the C2 collection to find related pathways, and the H collection (more accurate in reducing noise and redundancy ) for identifying the significantly altered biological processes, as previously completed . We founignaling . Many ofignaling B and cMyignaling D. There Sunitinib and other TKIs remain important treatments for metastatic renal cell carcinoma. The main limitation of its usage is the high prevalence of developing resistance over the time course of treatment. The mechanisms of resistance that develop to TKIs such as sunitinib are poorly understood. A recent clinical trial by Bjarnason et al. showed that an \u201cindividualized\u201d dosing of sunitinib might improve outcomes for patients . The purp < 0.05) throughout the course of the study. It also altered tumor morphology, and the molecular signatures underlying tumor behavior.Our results are consistent with the Bjarnason et al. clinical trial, where shorter sunitinib exposure followed by a \u201cbreak\u201d in treatment, results in improved survival . AlterinWe have previously reported that sunitinib induces early histo-molecular changes in renal cancer cells that can contribute to resistance . Other sThere are currently no clinical biomarkers to predict sunitinib response. Most respondents develop resistance through reversible mechanisms that are poorly understood. We previously identified miRNAs that can predict sunitinib response  and showSunitinib has significant impact on tumor cell programming in addition to its anti-angiogenic role on endothelial cells. In our differential gene expression analysis and GSEA, most enriched genes are involved in tumor aggressiveness and drug resistance including ABHD2, ABCC4, CLN5 intracellular trafficking protein, and insulin like growth factor 2 receptor. ABHD2, an androgen target gene, was reported to promote prostate cancer cell proliferation and migration . ABCC4 iFurthermore, the traditional treatment group showed increased expression of genes involved in pathways that are highly associated with tumor aggression. Remarkably, some cancer stem cell genes were also found in this group, such as PROM1  which is a member of a prominent family of pentaspan transmembrane glycoproteins of murine neuroepithelial origin  . CD133 iA previous study described an upregulation of lipid biosynthesis in the sunitinib-resistant 786-O kidney cancer cell line and was suggested to accelerate membrane construction in both enlarged nuclei and lysosomes . IncreasEMP1) is expressed in high levels in human cancers and was shown in vitro to reduce cell migration and invasion, and was also shown to increase apoptosis and caspase-9 expression in carcinoma of the nasopharynx, stomach, breast and prostate [Our findings are consistent with reports of several other genes that are implicated in progression of cancer. For example, Epithelial Membrane Protein 1 (prostate . Other hprostate , and CYPprostate . Thus, oIn the alternative treatment groups, two gene sets upregulated; however, the differences were not significant compared to the traditional treatment. These two sets are pathways associated with myogenesis and EMT.The current study shows that an alternative treatment scheduling may delay resistance; however, it did not significantly reduce the chance of metastasis. A further study on how to inhibit EMT is warranted."}
+{"text": "Social media offer\u00a0women a space to discuss birth-related fears and experiences. This is particularly the case during the COVID-19 pandemic when measures to contain the spread of the virus and high rates of infection have had an impact on the delivery of care, potentially restricting women\u2019s rights and increasing the risk of experiencing different forms of mistreatment or violence. Through the lens of birth integrity, we focused on the experiences of women giving birth in Germany as shared on social media, and on what may have sheltered or violated their integrity during birth.Using thematic analysis, we identified key themes in 127 comments and associated reactions  posted on a Facebook public page in response to the dissemination of a research survey on maternity care in the first year of the COVID-19 pandemic.Women contributing to the dataset gave\u00a0birth during March and December 2020. They were most negatively affected by own mask-wearing \u2013especially during the active phase of labour, not being allowed a birth companion of choice, lack of supportive care, and exclusion of their partner from the hospital. Those topics generated the most reactions, revealing compassion from other women and mixed feelings about health measures, from acceptation to anger. Many women explicitly formulated how inhumane or disrespectful the care was. While some women felt restricted by the tight visiting rules, those were seen as positive by others, who benefited from the relative quiet of maternity wards and opportunities for postpartum healing and bonding.Exceptional pandemic circumstances have introduced new parameters in maternity care, some of which appear acceptable, necessary, or beneficial to women, and some of which can be considered violations of birth integrity. Our research calls for the investigation of the long-term impact of those violations and the reassessment of the optimal conditions of the delivery of respectful maternity during the pandemic and beyond. Over the past decade, there has been growing evidence that womenEven before the COVID-19 pandemic, research on obstetric violence , on disrIn those conditions, it is even more challenging to preserve a woman\u2019s birth integrity. With the idea of birth integrity, we postulate that every birthing person\u2019s autonomy, self-determination, wholeness, and human rights need to a priori be respected and protected to preserve their integrity. Therefore, we aim to capture how women perceived giving birth as an embodied experience \u2013 and whether their integrity was violated or preserved throughout , 10. An To capture birth integrity, the analysis of maternal voices and expressions outside of (or at least: besides) traditional research settings is essential and offers insights into what matters to women. There is a need to value this experiential knowledge as scientific  and takeDuring pregnancy and motherhood, in particular, social media play a non-negligible role, as women use them to seek out information as well as emotional and social support. Online groups and pages can provide them with a safe place to discuss birth-related questions and intimate topics , 21. AmoOur objective was to understand better the experiences of women giving birth in the context of the COVID-19 pandemic in Germany. To do so, we explored themes discussed by mothers on social media, and through the lens of birth integrity, paying attention to what may help protect birth integrity and, similarly, what has the potential to violate a birthing person\u2019s integrity.We analysed comments posted on a Facebook public page as a reaction to the dissemination campaign of a survey on experiences of maternity care during the COVID-19 pandemic. Indeed, to acquire participants for a study, bloggers and social media parenting pages were asked to disseminate study information on different platforms . The data of this paper is a by-product of this dissemination strategy, composed of comments generated by a single post promoting the research study. The post was hosted by the Facebook page of a well-known motherhood and parenting blog. This blog is not a birth-focussed blog, nor an advocacy blog. The post was short and neutral: it read, \u201cLooking for participants\u201d and shared the link to said study. Users then reacted to this post, either by using a \u201clike\u201d button to show interest, or by commenting under the post.The data comprised three main components suited for analysis: the written comments, the emojis inserted in the comments and aimed at expressing a range of emotions , and theWe took screen-shots of the comments and then copy-pasted them in an Excel document for analysis. We followed the steps of thematic content analysis  as descrAL had no experience of giving birth, SB-Z and CM did. SB-Z and CM discussed with AL collaboratively and challenged the characterisation of codes based on their understanding of pregnancy and birth. In identifying and discussing the attribution and organisation of codes, all authors sought to be aware of how their positions may have impacted their interpretation of the data , 32.Following analysis, quotes were selected based on their representativeness for the findings and were subsequently translated from their original language (German) into English.Questions of consent and privacy are key points of research using social media data . There iElectronic correspondence between the corresponding author and the data protection office of Bielefeld University confirmed the viability of the study: since all the data were publicly available\u00a0and considered secondary data, we were advised that the project did not require ethical review.n\u2009=\u200968). Another set (n\u2009=\u200917) was signifying own participation (e.g. \u201cparticipated!\u201d). One comment was someone using the post as an opportunity to advertise a product. This left 127 written contributions from 69 individual contributors for the content analysis, as well as contributions from further users in the form of reactions, i.e. \u201clikes\u201d and emojis. The majority of comments generated 1 to 5 reactions, 5 comments more than 10 reactions, and one comment 109 reactions. The most mentioned topics and related themes created through the analysis pertain to (i) own mask-wearing, (ii) the presence or absence of a birth partner and supportive care at different stages of the birth process, and (iii) visiting rules, i.e. the (im)possibility to welcome visitors in addition to the birth partner. A fourth, less explicit theme runs through all topics and relates to the way COVID-19 measures are understood and accepted or rejected. Not all women indicated when they had given birth, but for those who did, we mention the birth month after their identifier. For a better understanding of the epidemiological context, Fig.\u00a0The dissemination post went online at the end of the year 2020 (exact date retracted to prevent identification). At the date of data download, a week later, it had been liked 86 times, shared 48 times, and commented 213 times (direct comments to the post and replies to comments). Each comment also generated its own share of engagement or reactions in the form of \u201clike\u201d buttons and emojis. Many of the contributions were tags to point out the study to women who met the requirements or might be interested in participating  and when healthcare professionals entered the patients\u2019 room was obligatory for almost all women. One woman reported having to wear a mask \u201cday and night\u201d, as a healthcare professional could enter the room any time .Some women were not obliged to wear a mask during birth, including women with a planned caesarean section , and others having a vaginal birth (e.g. A120):Fortunately, I didn\u2019t have to wear one [mask] either. The midwife immediately said that the masks can be removed, you cannot give birth with it (A120).Still, many comments disclose that women were requested to wear a mask during the active phase of labour and until either a healthcare professional or themselves got rid of the mask:Mask on, even during the birth. But when it went into full labour, the thing flew through the delivery room once. Nobody said anything. I always wore a mask in the room when someone came in. [\u2026] in the delivery room during CTG [Cardiotocography] and other exams [I was] always wearing a mask. During birth, when things got really serious, I was fortunately allowed to take the mask off. In the beginning the mask had to be on, during birth, it didn\u2019t matter at some point, only the midwife and the doctor had theirs on. We had to put ours back on when we went to the ward. The comments demonstrate a discrepancy between the formal instruction to wear a mask and the actual, more flexible\u00a0handling from the healthcare professionals when women went into full labour.What the above quotations have already indicated (omission of the mask as a relief), is explicitly expressed in the following comments, demonstrating that mask-wearing at any time during birth (including during expulsion) was perceived as an unpleasant and stressful experience:I also had to wear a mask. Quite horrible. (A22)Oh, I\u2019ll take a look at that [survey]. If it helps that women do not have to give birth with a mask, like me, it would be a success. (A111)This last comment by A111 was met with 16 supportive reactions, primarily emojis expressing sadness and shock. It also led to a controversial discussion as one contributor claimed the salutary role of masks in protecting the healthcare professionals from infection in a rather offensive tone, e.g., claiming that women make \u201ca huge drama out of everything and get hysterically worked up about it\u201d (A26). Most of the subsequent commentators solidarised with the women having had negative mask-wearing experience and gave reasons against wearing a mask during active labour, e.g., according to their midwife, \u201coxygen supply is the most important thing\u201d, why mask-wearing is not requested in their hospital (A23) or pointing out that the German midwifery association clearly states \u201cno to mask-wearing\u201d (A30). One contributor held accountable the hospital management and policy for providing midwives with \u201cappropriate masks (FFP2) for their own protection\u201d and:(\u2026) let her [the parturient] damn breathe freely. Not because otherwise, she will suffocate (\u2026). But because she is about to give life to a little human being and breathing is essential. (A24)For many who mentioned mask-wearing without emphasis and without diving deeper into the pros and cons of general mask-wearing, we can assume that they share a general understanding and acceptance of mask-wearing as a measure to contain the spread of SARS-COV-2. However, the discussion specifically about mask-wearing during the active phase of labour reveals that acceptance of the rules comes with limits and that women explicitly articulate the difference between what seems an acceptable public health measure and what is considered an infringement to the physiological process of birth or to their bodily integrity.Whether a companion of choice was allowed to accompany the women throughout labour and birth varied: while some women who had undergone a planned caesarean section had their partners with them throughout the procedure , one woman had to deliver without her partner:Husband was not allowed to attend\u00a0the caesarean section! (was worst part of the [experience] for me) .Many women shared the experience of having to manage the contractions alone and that their partner was only allowed to join when they went into active labour  or, when after going into labour, a caesarean section was performed:My husband was only there for the C-section. During labour, I was alone - and the 3 days afterwards on the ward [I was] also alone [sad emoji and crying emoji] .My husband was not allowed in the delivery room until it started. (\u2026) I could only call him after the water broke. He almost missed the birth [crying emoji] .This woman, whose birth was induced, was alone until the onset of labour as well. Nevertheless, she felt well supported \u201csince everyone at the hospital was really totally sweet\u201d, and her husband was called in time\u00a0to attend the birth . Her positive perception of being well cared for seemed to balance out the absence of her partner, at least partially.In contrast, A122 not only had to cope with labour and birth on her own but in addition was confronted by a lack of supportive care that added to her overall negative birth experience,I gave birth (\u2026) in April alone, without my husband. Even though it was the third child, it was just awful because the support was lacking. Also, the staff was hardly there, so I was alone in the delivery room for 11\u00a0h and had to go through labour alone. It wasn\u2019t until the final spurt that a super lovely midwife came and supported me (\u2026) this [experience] was awful for me, and I struggled with it for a long time .Another woman who also gave birth \"alone\" in April was similarly denied supportive care:[I gave birth] in April, delivered alone, and no visit of my husband or child was allowed afterwards.[\u2026] [I] was also not allowed to be present at any examination of the child. (A126)Her comment generated 109 reactions, with many emojis manifesting the anger, shock, sadness and empathy of the other contributors. The complete isolation of the woman, including from her newborn during examinations, was upsetting to many, with the words \u201chorrible\u201d and \u201cinhuman\u201d being used to describe the situation.The absence of a birth partner and supportive care was generally seen as detrimental to the birth experience and considered as an extreme (somewhat unjustifiable) measure that was going \u201ctoo far\u201d. The women who were allowed to be accompanied throughout their hospital stay showed gratitude and acknowledged how \u201clucky\u201d they had been compared to those who were denied such support.The comments reveal restricted partner visiting regulations for all patients, ranging from a complete ban on visitors, including partners presence during and after birth (A122), to restricted visiting hours (A19):My husband wasn\u2019t allowed to visit us, so he didn\u2019t see his little nugget live until he picked us up from the hospital two days after delivery. (A122)After the birth, there were visiting hours of 3\u00a0h for my husband. He also had to go home two hours after the birth and was allowed to come back at visiting hours\u2026 On the day of discharge, he was also not allowed to pick us up from the room, there haven\u2019t been visiting hours\u2026 .Welcoming other visitors, including the newborn\u2019s siblings, was not possible. Due to those restrictions and sometimes lack of childcare for older siblings, some partners had to refrain from visiting (A84):My husband could have visited from 2 to 8 p.m., but he didn\u2019t because my son was not allowed to come to the hospital. Other visitors were not allowed to come. My husband was there [hospital] once for exactly one hour because he was not allowed to bring our three year old, and we had no one to watch her. I discharged myself on the 3rd day after having many discussions. The clinic had already sealed itself off. Visits for an hour a day and without children. On the third day, I was discharged at my own request. .Those rules negatively affected many women, which sometimes led them to request a shorter length of stay and early discharge from the hospital (as seen in the two last comments above)We didn\u2019t want all these rules. We gave birth at home. Midwife no mask, me none and my husband none. Visits from the first hour the way I wanted it. Thank you, COVID-19 for this indescribable and self-determined birth. (A109)Although the limitations of partner\u2019s visits and the ban for siblings of the newborn was for many women problematic, the limited visiting hours and low number of visitors in the hospital was the most appreciated pandemic-related measure.Much quieter without other visitors compared to my 1st [time at the maternity ward]. (A10)It was quiet and relaxed in the ward. Lovely. No crowds of visitors. Other women shared these feelings and experiences, commenting how the maternity ward felt calm and relaxing, thanks to the absence of visitors .New mothers and healthcare professionals alike saw the relative emptiness and quiet of the maternity wards as an opportunity to rest, heal and recover. It also provided a protective setting for the important developments in the postpartum phase (e.g. breastfeeding) and the nurturing of a bond between the mother and her newborn:My husband was allowed to come daily at visiting time, but other visitors were not, which did not bother me at all. We were able to be in peace and quiet, and the staff on the ward also told us that the women recover so much faster from birth, the milk comes in more quickly .It was wonderfully quiet in the hospital, and we could relax without the stress of visitors, and I could recover. Similar to own mask-wearing, the restrictions put on the number of visitors and visiting hours were, to some extent, understood and accepted by most women. Several contributors even identified in quieter surroundings positive aspects of the pandemic and an opportunity to revel in the postpartum period. But common to all testimonies remain the need to take into account, as much as possible, the personal circumstances, wishes, and expectations of every woman, e.g. the one with other children, the one who prefers to be discharged early, the one who needs quiet.Our findings emphasise deficiencies in maternity care as experienced by birthing women during the pandemic in Germany and how those deficiencies are a threat to the parturients\u2019 birth integrity during labour or birth. In the comments, the most mentioned topics were own mask-wearing, having a companion of choice during birth and supportive care, and restriction on visitors. Those topics also generated the most reactions, revealing compassion from other women and mixed feelings about health measures, from acceptance to shock and anger.Especially at the beginning of the pandemic, some of the measures and changes in the organisation and delivery of maternity care have threatened rights to respectful maternity care. This led civil societies globally and international organizations  to call for less restrictive measures \u201338 with Wearing a mask during delivery is a preventive measure to reduce the risk of infection of both the parturient and healthcare professionals . This stAnother important finding of our study concerns the visiting rules in maternity wards. Despite the fact that some mothers were saddened because their older children were not allowed to visit (and their partners only to a limited extent), many comments reveal that restrictions on visitors had positive effects on the mothers. Many claimed feeling more relaxed, enjoying the quietness of the maternity wards, and having undisturbed time for bonding and breastfeeding. Similar findings emerged from interviews with mothers and healthcare professionals in 2021 in Germany  and fromCommunication about the pandemic-related measures is essential. Our data show that a good understanding of the motivation behind the measures  can\u00a0lead to a better acceptation and fewer negative experiences. It points towards preparedness and the importance of information and communication in healthcare settings . InsecurWith women voicing their concerns and reporting their experiences, social media allow for the emergence of under-explored topics and emphasises what matters to women during and after birth . Similarn\u2009=\u2009127), compared to several thousands in other studies such as Gui et al., 2017 [Since our results are based on comments under a social media post about giving birth during the COVID-19 pandemic, respondents expressed themselves freely and without being guided by researchers . The coml., 2017  for examBy analysing social media comments through the concept of birth integrity, we highlight how own mask-wearing, supportive care, the presence of a birth companion of choice, and visiting rules shape the experiences of birth during the pandemic. Exceptional pandemic circumstances have introduced new parameters in maternity care, some of which appear acceptable, necessary, or beneficial to women, and some of which constitute real threat to birth integrity. Our research calls for the investigation of the long-term impact of those violations of birth integrity and the reassessment of the optimal conditions of the delivery of respectful maternity during the pandemic and beyond."}
+{"text": "Both elevated and low resting heart rates are associated with atrial fibrillation (AF), suggesting a U-shaped relationship. However, evidence for a U-shaped causal association between genetically-determined resting heart rate and incident AF is limited. We investigated potential directional changes of the causal association between genetically-determined resting heart rate and incident AF.Seven cohorts of the AFGen consortium contributed data to this meta-analysis. All participants were of European ancestry with known AF status, genotype information, and a heart rate measurement from a baseline electrocardiogram (ECG). Three strata of instrumental variable-free resting heart rate were used to assess possible non-linear associations between genetically-determined resting heart rate and the logarithm of the incident AF hazard rate: <65; 65\u201375; and >75 beats per minute (bpm). Mendelian randomization analyses using a weighted resting heart rate polygenic risk score were performed for each stratum.We studied 38,981 individuals  with a mean resting heart rate of 67\u00b111 bpm. During a mean follow-up of 13\u00b15 years, 4,779 (12%) individuals developed AF. A U-shaped association between the resting heart rate and the incident AF-hazard ratio was observed. Genetically-determined resting heart rate was inversely associated with incident AF for instrumental variable-free resting heart rates below 65 bpm . Genetically-determined resting heart rate was not associated with incident AF in the other two strata.For resting heart rates below 65 bpm, our results support an inverse causal association between genetically-determined resting heart rate and incident AF. Resting heart rate is a known predictor of several cardiovascular conditions, such as myocardial infarction, heart failure, and stroke \u20134. For sThe pathways underlying the association between resting heart rate and incident AF are not fully understood. Resting heart rate is regulated by complex interactions of biological systems, including the autonomic nervous system. Some of the genetic loci associated with resting heart rate are related to arrhythmia susceptibility ,15. ReceMendelian randomization can be viewed as randomized controlled trials, with genotypes randomly assigned at birth. Therefore, an association between genetic variants that determine resting heart rate and incident AF implies causality, assuming that genetically-determined resting heart rate is not directly associated with possible confounding factors.Evidence for a U-shaped causal association between genetically-determined resting heart rate and incident AF may provide insight into how AF is initiated, and may lead to improved AF risk assessment. We divided resting heart rate into three strata to observe potential directional changes of the linear associations involved in Mendelian randomization analyses. The approach allowed us to investigate evidence for a U-shaped causal association.Fig 1. Detailed cohort descriptions are referenced in the Supplementary Notes inS1 File.The meta-analysis was performed in seven cohorts of the AFGen consortium: the Atherosclerosis Risk in Communities (ARIC) study; the Framingham Heart Study (FHS); the Multi-Ethnic Study of Atherosclerosis (MESA); the Prevention of Renal and Vascular End-stage Disease (PREVEND) study; the PROspective Study of Pravastatin in the Elderly at Risk (PROSPER) study; the Rotterdam Study (RS-I and RS-II); and the Study of Health in Pomerania (SHIP). The selection of the cohorts is visualized in S1 Table in S1 File). Written informed consent by all participants and approval of the ethical review boards of all participating cohorts were provided and specifications can be found in the referenced cohort descriptions in the supplementary data.Participants were of European ancestry, with known AF status and a resting heart rate measured at baseline with a 10-second 12-lead electrocardiogram (ECG). Individuals with prevalent AF at baseline were excluded. We did not exclude individuals with negative dromotropic medication or pacemakers. Additionally, genome-wide genotyping was performed for the common genetic variants used in the resting heart rate polygenic risk score (PRS) ].AF was assessed by each cohort, as referenced in the Supplementary Notes in S1 File.Resting heart rate was measured as a continuous covariate by a resting ECG recorded during baseline evaluations. Information was collected on recognized AF risk factors, such as hypertension, diabetes, heart failure, myocardial infarction and body mass index (BMI). Age was set as age at the time of the baseline ECG. Follow-up duration was defined as the time between the baseline ECG and diagnosis of incident AF or censoring. Detailed information is described for each cohort in the S1 Table in S1 File). The heart rate PRS was used as the genetic instrument in the Mendelian randomization. Pleiotropy was assessed by adjusting for heart rate in the regression analyses of resting heart rate PRS and incident AF.Genotyping methodologies within the AFGen consortium were described previously . A weighMendelian randomization analyses were stratified for instrumental variable-free resting heart rate. The instrumental variable-free heart rate is the heart rate without the effect of the heart rate PRS . First, Heart rate was included in the models of the regressions using linear and quadratic terms together with age, sex, eigen vector, and center if appropriate. From the beta-coefficients of the linear and quadratic terms, the hazard ratio (HR) and resting heart rate were derived for each cohort. Meta-analysis of the beta-coefficients of the linear and quadratic terms were used to derive a meta-analyzed value of the HR and resting heart rate.Fig 2). The standard error of the three causal beta coefficients was calculated by use of Taylor series expansion [The association between genetically-determined resting heart rate and incident AF was investigated by performing Mendelian randomization studies in three strata, with approximately equal numbers of individuals in the three groups of heart rate. The instrumental variable-free heart rate distribution is used to stratify heart rate and avoid an association between heart rate PRS and incident AF based on the association between the heart rate PRS and heart rate . The genxpansion . Bonferr1) and regression analyses of resting heart rate PRS and incident AF (\u03b22) are calculated using the following formula\u2019s; \u03b23) of each stratum indicates the causal association between resting heart rate and incident AF. Abbreviations: PRS = Polygenic risk score, HR = Hazard ratio.First, regression analyses of resting heart rate PRS and instrumental variable-free resting heart rate . The mean resting heart rate was 67\u00b111 bpm on baseline ECGs. A total of 4,779 (12%) individuals developed AF during a mean follow-up period of 13\u00b15 years. Fig 3. The meta-analyzed association between resting heart rate and incident AF showed a U-shaped curve (p = 0.028). Thus, both lower and higher resting heart rates were positively associated with incident AF.Observed associations between resting heart rate and incident AF are plotted in S1 Fig). The association between the heart rate PRS and incident AF was not significant  . Pleiotropy was assessed by performing regression analyses of resting heart rate PRS and incident AF, adjusted for resting heart rate  .The heart rate PRS was associated with resting heart rate in all strata  , showed an inverse relation between resting heart rate and incident AF , 0.73\u20130.95; p = 0.010) for heart rates <65 bpm). The other strata of instrumental variable-free resting heart rates were not causally associated with incident AF  (Table 2).Causal effects, estimated by the ratio method of Mendelian randomization  can distort the resting heart rate.Second, asymptomatic AF may have gone undetected in some individuals, leading to incorrect AF status . Considering the large number of participants, the effect of false-negative classification results may be limited.Third, genetic variants associated with heart rate may have biased the heart rate PRS through (unknown) associations with AF or AF related risk factors. However, pleiotropic effects of heart rate were reduced to a minimum by adjusting the association between the heart rate PRS and incident AF for heart rate.S1 Fig).Fourth, information on negative dromotropic medication or pacemaker rhythm was not available for all participants. Individuals with higher heart rates may be more likely to be treated with heart rate lowering medications, which also reduces the risk of AF. Although participants with negative dromotropic medication or pacemaker rhythm were not excluded, the heart rate was still strongly associated with the constructed heart rate PRS Click here for additional data file.S2 Checklist(DOCX)Click here for additional data file.S1 File(DOCX)Click here for additional data file.S1 Fig2 reflects heterogeneity between studies, higher values reflect greater heterogeneity. Abbreviations: ARIC = Atherosclerosis Risk in Communities study, bpm = beats per minute, FHS = Framingham Heart Study, I2 = heterogeneity, MESA = Multi-Ethnic Study of Atherosclerosis, PREVEND = Prevention of Renal and Vascular End-stage Disease study, PROSPER = PROspective Study of Pravastatin in the Elderly at Risk study, PRS = polygenic risk score, RS = Rotterdam Study, se = standard error of the effect size, SHIP = Study of Health in Pomerania, t2 = between study variance.The results of a regression analyses of the Heart rate PRS and resting Heart rate is shown. (PNG)Click here for additional data file.S2 Fig2 reflects heterogeneity between studies, higher values reflect greater heterogeneity. Abbreviations: ARIC = Atherosclerosis Risk in Communities study, bpm = beats per minute, FHS = Framingham Heart Study, I2 = heterogeneity, MESA = Multi-Ethnic Study of Atherosclerosis, PREVEND = Prevention of Renal and Vascular End-stage Disease study, PROSPER = PROspective Study of Pravastatin in the Elderly at Risk study, PRS = polygenic risk score, RS = Rotterdam Study, se = standard error of the effect size, SHIP = Study of Health in Pomerania, t2 = between study variance.The results of a regression analyses of the Heart rate PRS and incident AF is shown. (PNG)Click here for additional data file.S3 Fig2 reflects heterogeneity between studies, higher values reflect greater heterogeneity. Abbreviations: ARIC = Atherosclerosis Risk in Communities study, bpm = beats per minute, FHS = Framingham Heart Study, I2 = heterogeneity, MESA = Multi-Ethnic Study of Atherosclerosis, PREVEND = Prevention of Renal and Vascular End-stage Disease study, PROSPER = PROspective Study of Pravastatin in the Elderly at Risk study, PRS = polygenic risk score, RS = Rotterdam Study, se = standard error of the effect size, SHIP = Study of Health in Pomerania, t2 = between study variance.The results of a regression analyses of the Heart rate PRS and incident AF adjusted for heart rate is shown. The Heart rate PRS should not be associated with incident AF if adjusted for heart rate; this would be evidence for pleiotropic effects of the Heart rate PRS. (PNG)Click here for additional data file."}
+{"text": "Therefore, we explored the effect of short-term supplementation of hydrogen-rich water (HRW) on the work performance and fatigue recovery of dragon boat athletes after training. (2) Methods: Eighteen dragon boat athletes who trained for 4 h a day (2 h in the morning and 2 h in the afternoon) were divided into an HRW group (n = 9) and a placebo water (PW) group (n = 9), drinking HRW or PW for 7 days. Each participant completed 30 s rowing dynamometer tests, monitoring the heart rate at baseline  and after the intervention (on Day 8). (3) Result: Drinking HRW increased the maximum power and average power of the 30 s rowing test and decreased the maximum heart rate during the period. After the rowing test, the HRW group\u2019s heart rate dropped significantly after 2 min of recovery, while the PW group\u2019s heart rate did not drop. There was no significant difference between the 30 s rowing distance and the predicted duration of rowing 500 m. (4) Conclusions: Drinking HRW in the short term can effectively improve the power performance of dragon boat athletes and is conducive to the recovery of the heart rate after exercise, indicating that HRW may be a suitable means of hydration for athletes.(1) Background: Exercise that exceeds the body\u2019s accustomed load can lead to oxidative stress and increased fatigue during intense training or competition, resulting in decreased athletic performance and an increased risk of injury, and the new medicinal H Dragon boating is one type of exercise with a high intensity of physical load, inducing high physical fatigue. The fatigue oftentimes alters the regulation of human physiological systems by disrupting the redox balance ,2 and diWhen performing low-intensity exercise, reactive oxygen species (ROS) and reactive nitrogen species (RNS) are generated at a low rate and subsequently scavenged by the antioxidant system. However, the performance of high-intensity exercise can lead to an increase in the production of ROS and RNS. When the antioxidant defense capacity is also exceeded, the oxidative stress state appears , which iSince Ohsawa et al. first reported that hydrogen has powerful selective antioxidant properties , the bioTherefore, in this randomized, single-blinded pilot study, we examined the effects of taking HRW for 7 days on the rowing performance and post-exercise recovery in a group of elite dragon boat athletes. We hypothesized that, compared to those who take purified water , participants who take HRW would perform the rowing task better, and their recovery would also be better, and that HRW can be used as a convenient and effective anti-fatigue hydration strategy.Eighteen dragon boat athletes were randomly assigned into a hydrogen-rich water (HRW) group  and a placebo water (PW) group . Each group included 6 male athletes and 3 female athletes; there was also no significant difference in baseline values between the two groups when divided by gender . ParticiTM tank body and an electrolysis generator. The concentration of H2 in the HRW was 1600 ppb. To enable the blinding, the outer packages of the hydrogen and placebo water were the same so that subjects were not aware of which water they were drinking.The HRW was prepared using an electrolysis device  with a transparent TritanAthletes performed 4 h of daily water training (2 h in the morning and 2 h in the afternoon) for 8 days, with an average daily rowing distance of not less than 3000 m. The subjects ate meals that were the same as those they usually ate in everyday life during the experiment and were asked to not take any dietary supplements and drugs. Only 500 mL of purified water was added during the afternoon training. From Day 2 to Day 8, subjects were asked to drink one bottle immediately after the morning training and one bottle immediately after the afternoon training. Each subject thus ingested 1000 mL of HRW or PW per day.Immediately after the afternoon training on Day 1 and Day 8, each subject performed a 30 s rowing test. The researchers recorded the maximum power, average power, stroke distance, and predicted time taken to stroke 500 m at the average speed. The Firstbeat heart rate belt was used to monitor the resting heart rate, the maximum heart rate while performing the task, the heart rate immediately after the test, the heart rate after 1 min of recovery, the heart rate after 2 min of recovery, and the heart rate after 3 min of recovery.All subjects performed a 30 s full-strength rowing test on a rowing dynamometer  after the afternoon training on Day 1 and Day 8. The subjects first performed a 3 min warm-up exercise on a rowing dynamometer , followed by a 30 s full-strength exercise on the dynamometer (with a drag coefficient of 5). During the full-strength exercise, the subjects chose their own physical strength distribution method (pacing strategy) and were verbally encouraged by the testers to perform the longer distance for as long as possible within the specified time (the dynamometer can be displayed).We used the Firstbeat heart rate belt  to monitor the heart rate changes of the athletes during the test. The heart rate belt was worn on the athlete\u2019s chest, and the receiver was positioned to the left of the midline. The elastic band was adjusted so that the position of the receiver did not change during the athlete\u2019s exercise. All subjects wore the heart rate belt before training on Day 1 and Day 8, and their heart rate was recoded after resting for 5 min. After the water training in the afternoon, the participants wore the Firstbeat heart rate belt again for the rowing dynamometer test and rested for 3 min after the test. The researchers monitored the tablet and recorded the subjects\u2019 maximum heart rate during the rowing dynamometer test, the heart rate immediately after the test, the heart rate after 1 min of recovery, the heart rate after 2 min of recovery, and the heart rate after 3 min of recovery. The percent change from baseline in heart rate at each recovery time was then calculated /resting heart rate) for each subject and used to characterize the recovery of the heart rate. The smaller the change, the better the recovery.p < 0.05. Descriptive statistics ) were used to summarize the demographic characteristics of the participants and study outcomes. Shapiro\u2013Wilk tests were used to examine if the data were normally distributed. Independent sample t-tests were used to examine the demographic characteristics of the participants and pre-intervention test results . Two-way (group \u00d7 time) mixed design analyses of variance (ANOVAs) were used to examine the effects of HRW on those outcomes. The independent factor was group , and the repeated measures factor was time ; their interaction effects were examined. Post hoc analyses were performed if there were significant interactions. Secondarily, one-way repeated measures ANOVA was used to examine the effects of the intervention on outcomes within each group, and one-way ANOVA was used to examine the differences between groups after the intervention.Statistical analyses were performed using SPSS 25.0 . The significance level was set at p = 0.090), while no significant interaction in other outcomes of the rowing test was observed , the distance , and the predicted time of rowing 500 m ) (p = 0.015) and average power  were significantly improved after the intervention as compared to baseline, while no significant changes in these two outcomes within the PW group were observed . No significant changes in the distance of the 30 s rowing test and the predicted time of rowing 500 m were observed within either the HRW group  or the PW group . One-way ANOVA showed no significant difference between the HRW and PW groups in each outcome of the rowing test after the intervention.Eighteen participants completed all study tests, and their data were included in the analysis. There were no significant differences in the demographic characteristics of the participants and pre-intervention outcomes . Two-way 0.609)) . Howeverp = 0.029) (p = 0.818), and that the maximum heart rate was significantly decreased in the HRW group after the intervention , but no such significant change was observed in the PW group .Two-way mixed design ANOVA models showed a significant interaction in the maximum heart rate during the rowing test  . Post hop = 0.259), the percent change from baseline in heart rate immediately after the rowing test , the percent change from baseline in heart rate after 1 min of recovery , the percent change from baseline in heart rate after 2 min of recovery , and the percent change from baseline in heart rate after 3 min of recovery . However, in the secondary analyses, the one-way repeated measures ANOVA model showed that within the HRW group, the percent change from baseline in heart rate after 2 min of recovery  and the percent change from baseline in heart rate after 3 min of recovery  were significantly decreased after the intervention as compared to baseline, while no significant changes in these two outcomes within the PW group were observed . No significant changes in the resting heart rate, the percent change from baseline in heart rate immediately after the rowing test, and the percent change from baseline in heart rate after 1 min of recovery were observed within either the HRW group  or the PW group . One-way ANOVA showed no significant difference between the HRW and PW groups in the resting heart rate , the percent change from baseline in heart rate immediately after the rowing test , and the percent change from baseline in heart rate after 1 min of recovery after the intervention , but the percent change from baseline in heart rate after 2 min of recovery of the HRW group was significantly lower than that of the PW group after the intervention , and the percent change from baseline in heart rate after 3 min of recovery of the HRW group tended to be significantly lower than that of the PW group after the intervention  (There were no significant differences in heart rate changes between the two groups before the intervention . We used= 0.050) . In addi= 0.050) .In this pilot study, we observed, for the first time, that consuming HRW for a period of time  after prolonged high-intensity training is of promise to improve power performance and help the recovery of the heart rate in dragon boaters. Greater within-group changes in the maximum and average power of the rowing test were observed in the HRW group as compared to the PW group, indicating the potential benefits of HRW for sprint performance after prolonged exercise. Compared to the PW group, the HRW group had greater within-group changes in the maximum heart rate of the rowing test and the heart rate recovery rate 2\u20133 min after the test, indicating accelerated recovery from the high-intensity exercise.We observed that subjects in the HRW group had a significantly greater increase in the maximum and average power of the 30 s full-strength rowing test and a decrease in the maximum heart rate and faster recovery of the heart rate after the test as compared to the PW group. These results may suggest that HRW can help reduce oxidative stress and metabolic acidosis caused by high-intensity exercise. Studies have demonstrated the relationship between oxidative stress and physical fatigue ,28 and eHowever, the benefits of HRW we observed here are still limited . One of the most significant limitations is the small sample size (n = 9 in each group) and short duration of the test (only 30 s). In addition, although we controlled for the athletes\u2019 diet and energy intake during the experimental period, the athletes\u2019 daily diet may still have a potential impact on exploring the effect of hydrogen-rich water, which should also be carefully controlled and assessed in future studies. Future studies with a larger sample size and implementing longer-term exercises/tests are thus highly demanded to examine and confirm the observations in this study and the effects of HRW on sport performance. Additionally, we only measured the functional performance in this study, and the underlying pathway through which HRW influences recovery and functional performance needs to be explicitly examined in future studies with biophysiological assessments, which will ultimately provide critical knowledge for the optimization of HRW-based strategies  for accelerating recovery and maintaining performance in athletes.This pilot study demonstrated that HRW is of great promise to help accelerate the recovery from high-intensity exercise and to benefit the functional performance of rowing in elite dragon boat athletes, which is beneficial for them to increase power output, gain an advantage in the final sprint stage, and reduce physical damage from accumulated fatigue. Although further studies are absolutely warranted, drinking HRW may be a beneficial hydration strategy for athletes\u2019 recovery."}
+{"text": "After the publication of our article, we detected one unintentional error during the preparation of Fig. S2B in PowerPoint. Western blot bands of GAPDH in MCF-7/WT were run on a same gel with that of MCF-7/ADM, but the images were mistakenly inserted. After carefully checked the original data, a correction was made. This error did not change the data or conclusions of the article in any way.Furthermore, Prof. F Gu was the major supervisor of clinical experiments designing and performing, with the permission of Prof. L Fu. However, we are deeply grieved by the passing of Prof. F Gu. In this situation, Prof. L Fu personally feels she cannot give full advices during the process of corrigendum or in future without detailed experimental information from Prof. F Gu. Therefore, all authors agreed to remove authorship of Prof L Fu and F Gu.We apologize for the inconvenience for these changes."}
+{"text": "Wolbachia species, can manipulate the sexual development and reproduction of their insect hosts. For example, Wolbachia infection induces male-specific death in the Asian corn borer Ostrinia furnacalis by targeting the host factor Masculinizer (Masc), an essential protein for masculinization and dosage compensation in lepidopteran insects. Here we identify a Wolbachia protein, designated Oscar, which interacts with Masc via its ankyrin repeats. Embryonic expression of Oscar inhibits Masc-induced masculinization and leads\u00a0to male killing in two lepidopteran insects, O. furnacalis and the silkworm Bombyx mori. Our study identifies a mechanism by which Wolbachia induce male killing of host progeny.Bacterial symbionts, such as  Wolbachia species, can manipulate the sexual development and reproduction of their insect hosts. Here, the authors identify a Wolbachia protein that interacts with a host masculinization factor and leads to male killing in lepidopteran insects.Bacterial symbionts, such as  Wolbachia are the most widespread intracellular bacteria that alter host insect reproduction. Wolbachia enhance the production of infected female progeny via parthenogenesis, feminization, cytoplasmic incompatibility, or male killing. Each of these manipulations is considered to be adaptive for Wolbachia and facilitates their propagation2. Wolbachia factors resulting in cytoplasmic incompatibility in Drosophila melanogaster have recently been identified4, but the genes underlying the other three manipulations remain largely unknown. Recent comparative genomics approach identified a candidate gene for male killing, which is conserved in several male-killing Wolbachia strains5. The candidate gene, WO-mediated killing (wmk), encodes a putative transcription factor with two helix-turn-helix DNA binding domains and is found within the eukaryotic association module of Wolbachia prophage WO in several Wolbachia strains as are the cytoplasmic incompatibility genes cifA and cifB4. Transgenic expression of codon-optimized wmk in D. melanogaster induces several cytological defects resulting in embryonic death and causes a significant female bias 5. Although the mode of action of wmk is unknown, Perlmutter et al.5. hypothesize that wmk is a strong candidate for the male-killing factor of several Wolbachia strains. Wolbachia-induced male killing is also frequently observed in lepidopteran insects . In Ostrinia scapulalis and its congener O. furnacalis, a unique form of Wolbachia-induced male killing has been reported7. Unlike male killing observed in other butterflies and moths9, Wolbachia depletion from infected strains with antibiotic treatment results in the production of all-male offspring7. This indicates that these Wolbachia possess a factor that induces feminization or inhibits masculinization in Ostrinia moths. Moreover, the Ostrinia feminizing factor itself may have been disrupted or inhibited during a prolonged period of infection by these male-killing Wolbachia.Spiroplasma poulsonii induces male killing in D. melanogaster by targeting the dosage compensation complex10. Similarly, we have shown that a male-killing Wolbachia targets a protein called Masculinizer (Masc), which is required for dosage compensation in lepidopteran insects6. Masc was discovered in the silkworm, Bombyx mori, as a factor required for both masculinization and dosage compensation11. Knockdown of B. mori Masc (BmMasc) inhibits masculinization and induces male-specific death due to failure of dosage compensation in male embryos11. This is likely a phenocopy of male-specific embryonic death observed in Wolbachia-infected Ostrinia moths7. We previously observed inhibition of masculinization and failure of dosage compensation in O. furnacalis embryos infected with the male-killing Wolbachia wFur6. Moreover, injection of artificially synthesized O. furnacalis Masc (OfMasc) cRNA rescues male killing in wFur-infected O. furnacalis embryos6. These findings show that wFur induces male killing in O. furnacalis embryos by targeting OfMasc, but it remains unknown how wFur inhibits the OfMasc-induced signaling cascades. In this study, we identify and characterize a Wolbachia factor for male killing in lepidopteran insects.Since failure of dosage compensation during development likely leads to sex-specific lethality in insects, the factors involved in this process are considered ideal targets for symbiont-induced sexual manipulation. The bacterial symbiont Wolbachia propagate in the cytoplasm, we hypothesized that wFur itself or wFur-derived factor(s) directly interacts with OfMasc in the cytoplasm and inhibits OfMasc function in both the cytoplasm and nucleus. To test this hypothesis, we established a cell-based system for the biochemical identification/analysis of key proteins involved in male killing. We first generated cell lines from O. furnacalis embryos infected with wFur  12, a gene which commonly acts at the downstream end of the sex differentiation cascade in insects13  cDNA induced the expression of male-type Ofdsx variant (OfdsxM)  Fig.\u00a0. Howeverlls Fig.\u00a0. Similarlls Fig.\u00a0. OfT1A-Klls Fig.\u00a0. This deO. furnacalis cultured cells likely mimic the phenotypes of wFur-infected O. furnacalis embryos. We next generated four OfMasc-GFP derivatives  efficiently accumulated in OfT1C cells  in the cytoplasm. We next attempted to identify OfMasc-interacting wFur proteins by comparing immunoprecipitates with anti-GFP nanobody from GFP-, OfMasc-GFP-, and Del1-OfMasc-GFP-transfected OfT1C cells. Liquid chromatography-tandem mass spectrometry (LC-MS/MS) analyses identified 1,045 host- and wFur-derived proteins .Our experiments showed that the newly established lls Fig.\u00a0. These rins Fig.\u00a0. Among tion Fig.\u00a0. This inThe N-terminal region (a.a. 2\u201388) of OfMasc contains two CCCH-type zinc fingers, ZF1 and ZF2 14, suggesting that Oscar possibly possesses Ulp1 activity. The ankyrin repeat is a motif that contains two alpha helices, and its tandem repeats mediate protein\u2013protein interactions16. Ankyrin repeats are most commonly found in eukaryote proteins, but are also present in some bacterial effectors such as the S. poulsonii male-killing protein Spaid15. AlphaFold2 prediction software suggested that the ankyrin repeat region (a.a. 1\u20131370) and the linker/CifB C-terminus-like region (a.a. 1371\u20131830) of Oscar both fold into compact structures  of BmMasc is sufficient for its masculinizing activity and required for dosage compensationOscar homolog only in the draft genome of wBol-1b, a male-killing Wolbachia strain of the butterfly Hypolimnas bolina19. However, only a single ankyrin repeat was identified in this homolog, presumably because the genome assembly of wBol-1b is still incomplete  have maintained Oscar homologs in their genomes and is predicted to use them for male killing. We experimentally detected the full-length amplicons of Oscar from DNAs of wFur-infected O. furnacalis and male-killing Wolbachia-infected O. scapulalis, but not from those of uninfected O. furnacalis and O. scapulalis, all of which are maintained in our laboratory. In addition, we detected Oscar fragments from DNAs of field-collected Ostrinia species that were infected with male-killing Wolbachia , in which 29 copies of ankyrin repeats are missing, affected neither OfMasc-GFP accumulation nor OfMasc-induced masculinization compared to control cells  and detected their expressions using anti-FLAG antibody  as well as B. mori IGF-II mRNA-binding protein (BmIMPM), the product of which is involved in the male-specific splicing of Bmdsx  or Oscar cRNA into uninfected embryos, examined the splicing pattern of dsx in embryos, and sexed the hatched larvae molecularly. Injection of Oscar cRNA in male B. mori embryos inhibited the splicing of BmdsxM as well as BmIMPM expression  and OfdsxM equally, whereas Oscar cRNA injection inhibited OfdsxM splicing , whereas this bias was not observed in GFP cRNA-injected control embryos , which are closely related to wMel wmk  at 25\u2009\u00b0C under a photoperiod of 16L and 8D12. O. furnacalis and O. scapulalis moths used in this study were collected at Nishi-Tokyo, Japan  in early summer of 2020 and 2021. Wolbachia-infected O. furnacalis moths were collected at Matsudo, Japan  in early summer of 2014 and at Nishi-Tokyo, Japan  in early summer of 2021, and Wolbachia-infected O. scapulalis moths were collected at Matsudo, Japan  in early summer of 2020. Larval B. mori (p50T strain) was reared on an artificial diet  or mulberry leaves at 25\u2009\u00b0C under a photoperiod of 18L and 6D.Larval B. mori BmN-4 cells  and S. frugiperda Sf-9 cells  were cultured at 26\u2009\u00b0C in IPL-41 and TC-100 medium  supplemented with 10% fetal bovine serum, respectively. O. furnacalis cell lines, OfT1A, OfT1B, and OfT1C, were established from wFur-infected O. furnacalis embryos (see below) and cultured at 26\u2009\u00b0C in Express FiveTM SFM  supplemented with 18 mM L-Glutamine and 10% fetal bovine serum (FBS) (Gibco). OfT1C/tet and OfT1B/tet cells were cultured in the same medium containing 3\u2009\u00b5g/mL tetracycline.wFur-infected O. furnacalis female was collected into a 1.5\u2009mL microfuge tube at 2\u20133 days post-oviposition and washed twice with 1\u2009mL of phosphate-buffered saline (PBS). The egg surface was sterilized with 1\u2009mL of 3% formaldehyde solution in PBS for 10\u2009min and washed with PBS for 10\u2009min using a tube rotator. After removal of the PBS, the egg mass was crushed gently using an autoclaved pestle in 100\u2009\u00b5L of Express FiveTM SFM supplemented with 18 mM L-Glutamine and 10% FBS. The crushed egg mass was transferred into a 35 mm-diameter culture dish containing 2\u2009mL of Express FiveTM SFM supplemented with 18 mM L-Glutamine and 10% FBS, 2% Penicillin-Streptomycin  (Gibco), and 0.2% Amphotericin B (250\u2009\u00b5g/mL) (Gibco) and cultured at 26\u2009\u00b0C. After some cell clusters attached to the bottom of dish without any contamination, half of the spent medium was replaced with fresh medium at weekly intervals. After the cells showed obvious signs of proliferation, the cells were collected by pipetting, seeded to a new dish or tissue culture flask, and maintained separately in Express FiveTM SFM supplemented with 18 mM L-Glutamine and 10% FBS, 1% Penicillin-Streptomycin, and 0.1% Amphotericin B.An egg mass obtained from Ostrinia species were identified by visual appearance and sex pheromones of the virgin females. Sex pheromone components of O. furnacalis and O. scapulalis are mixtures of (E/Z)\u221212-tetradecenyl acetates (E/Z12-14:OAc) and (E/Z)\u221211-tetradecenyl acetates (E/Z11-14:OAc), respectively25. The hexane extract of a pheromone gland was individually analyzed using a gas chromatograph coupled to a mass spectrometer  equipped with a capillary column . The initial column oven temperature of 80\u2009\u00b0C was held for 2\u2009min, then raised at 8\u2009\u00b0C/min to 240\u2009\u00b0C and held for 2\u2009min. The flow rate of the carrier gas (helium) was 1.0\u2009mL/min. Mass spectra were recorded in the electron ionization mode at 70\u2009eV. Retention time and diagnosis ions  of peak were compared to authentic standard.Ofdsx and Bmdsx cDNA was carried out by 3-step PCR  using KOD FX\u2013neo DNA polymerase  with published primers11. RT-PCR for Sfdsx was performed under same condition using the following primers:Three days after transfection, total RNA was prepared from the transfected cells using TRI REAGENT\u00ae . cDNA synthesis was carried out using 500\u2009ng total RNA and avian myeloblastosis virus reverse transcriptase with an oligo-dT primer . PCR Amplification of Sfdsx_F2: 5\u2032-ACCGCTGCCGCAAGCGATGC-3\u2032Sfdsx_R1: 5\u2032-AATAATCGCCGATCGATATC-3\u2032The uncropped and unprocessed scans used for figures are provided in the Sfdsx cDNAs were sequenced and deposited in GenBank. Quantitative RT-PCR (RT-qPCR) of SfdsxM was performed by StepOne-Plus and StepOne Software v2.3  using a KAPA SYBR FAST qPCR kit  and the following primers:Amplified Sfdsx_qF1M: 5\u2032-GGAAAATAGACGAAGCCCAC-3\u2032Sfdsx_qR2: 5\u2032-CGTACTCCGTGAAGCACATG-3\u2032Sfrp49 and expression values were calculated using the 2-\u0394\u0394Ct method. RT-qPCR of Sfrp49 was performed using the following primers:The mRNA level was normalized to that of Sfrp49_qF1: 5\u2032-CCCAACATTGGTTACGGATC-3\u2032Sfrp49_qR1: 5\u2032-TTCTTTGAGGAGACTCCGTG-3\u2032OfdsxM was performed using a KAPA SYBR FAST qPCR kit (Kapa Biosystems) and the following primers:RT-qPCR of OfdsxM_F2: 5\u2032-GAAGATTGATGAAGCCCACTG-3\u2032OfdsxM_R1: 5\u2032-GCACTGTGTCTATCACACTG-3\u2032Ofrps36 and expression values were calculated using the 2-\u0394\u0394Ct method.The mRNA level was normalized to that of BmIMPM and rp49 was performed using the published primers17.RT-qPCR of O. furnacalis cultured cells using DNeasy Blood & Tissue Kit . Wolbachia density was estimated by qPCR for wsp. qPCR was carried out using a KAPA SYBR FAST qPCR Kit (Kapa Biosystems Inc.) and the values were calculated using the 2\u2212\u0394\u0394Ct method. The amplification values were normalized to those of EF-1\u03b16. The qPCR primers for wsp were as follows:Genomic DNA was prepared from Wsp_F: 5\u2032-GAAACAAATGTTGCAGACAG-3\u2032Wsp_R2: 5\u2032-AACTGTATCAGCTTTTGAAG-3\u2032.Oscar, wmk1, wmk2, and wmk3 fragments were synthesized by Eurofins Genomics (Germany). The DNA fragments of OfMasc-GFP26, wmk1, wmk2, wmk3, Oscar, and their derivatives were cloned into the pIZ/V5-His-g3 vector26. Trilocha varians Masc (TvMasc)27, S. frugiperda Masc (SfMasc), and Papilio machaon Masc (PmMasc) cDNAs fused to EGFP fragment were also cloned into the pIZ/V5-His-g3 vector. The cDNA fragment of SfMasc was cloned from Sf-9 cells and determined by Sanger sequencing. PmMasc cDNA was codon-optimized and synthesized by Eurofins Genomics. The sequences of artificially synthesized cDNA were listed in Supplementary Data\u00a0Mutagenesis and deletion experiments were conducted using the KOD-Plus mutagenesis kit , In-Fusion HD Cloning Kit , or by restriction enzyme digestion. The codon-optimized 5 cells per 35-mm diameter dish) were transfected with 1\u2009\u00b5g of plasmid DNAs using FuGENE HD . Three days after transfection, the expression and localization of EGFP-fused proteins were examined using a FLoidTM cell imaging station 17.Cultured cells ]. After overnight hybridization, the cells were washed using the following buffers: hybridization buffer, 1:1\u2009hybridization buffer and PBS-T (0.1% [v/v] Triton X-100 in PBS), and finally PBS-T. When OfMasc-GFP was transiently expressed in the cells, FISH probe hybridization was performed before ICC staining28. The cells were incubated with anti-GFP antibody  in ICC buffer (0.1% [w/v] BSA/PBS with 0.1% [v/v] Tween 20) for 1 h at room temperature. After 3 washes with ICC buffer, the cells were incubated with Alexa Fluor 488\u2009F(ab\u2019)2 fragment of goat anti-rabbit IgG (H\u2009+\u2009L)  and DAPI  for 1\u2009h at room temperature. After 3 washes with ICC buffer, the cells were mounted with ProLong Gold . The stained cells were analyzed using a FLoid\u2122 cell imaging station (Life Technologies) or a Leica STELLARIS5 confocal microscope  with an HC PL APO CS2 20\u00d7 DRY objective lens (N.A.\u2009=\u20090.75), HC PL APO CS2 63\u00d7 OIL objective lens (N.A.\u2009=\u20091.40), and HyD detectors. The Leica STELLARIS5 microscope was controlled by Leica Application Suite X Version 4.4.0.24861 (Leica), DAPI and Alexa Fluor 488 were excited with a 405\u2009nm DMDO laser and a 488\u2009nm tuned white light laser, respectively.Cells seeded onto poly-lysine-coated coverslips  were placed in the wells of a six-well plate and fixed with 4% [v/v] paraformaldehyde in PBS  for 20\u2009min, followed by permeabilization in 70% [v/v] ethanol for 1\u2009h. For prehybridization, the cells were treated with hybridization buffer  for 1\u2009h. The cells were hybridized overnight with 0.5\u2009\u00b5M Cells were homogenized in RIPA buffer  and 4\u00d7 SDS sample buffer  (3:1). The homogenate was passed more than ten times thorough a 27-gauge needle or sonicated to shear genomic DNAs. After boiling for 5\u2009min, the proteins were separated on 4\u201312% Bis-Tris gels  in MOPS buffer using an XCell SureLock mini-cell . The proteins were transferred to PVDF membranes using an XCell II blot module  according to the manufacturer\u2019s protocol. The membranes were blocked with 4% Block Ace , followed by incubation with primary antibody: anti-GFP antibody , anti-Oscar antibody , anti-FLAG antibody  or anti-actin antibody  in antibody dilution buffer Kiwami Setsuyaku-kun . After incubation with the primary antibody, the membrane was washed three times with TBS-T buffer, and incubated with secondary antibody . After incubation with the secondary antibody, the membrane was washed three times with TBS-T buffer, and stained using a BCIP-NBT Solution kit for Alkaline Phosphatase Stain . Antibody-stained proteins were detected using a ChemiDoc XRS Plus imaging system  and quantified by Image Lab software . The uncropped and unprocessed scans used for figures are provided in the Source Data file.Oscar protein was produced by PUREfrex\u00ae2.0 with DnaK mix  and concentrated using an Amicon Ultra filter unit . Production was verified by Western blotting using anti-Oscar antibody.6 cells) seeded in 10 cm-diameter culture dishes by transfection using FuGene HD (Promega). At 2 days post transfection, OfT1C cells were treated with 100\u2009nM PS-341 (Bortezomib) for 1 day. The OfT1C cells were then fixed with 0.1% formaldehyde for 10\u2009min at room temperature, and the fixation was quenched with 300\u2009mM glycine. The cells were collected by scraping with disposable scrapers and centrifugation at 1,200\u2009g, 4\u2009\u00b0C for 10\u2009min, and washed three times with chilled HEPES-saline . The cells were then lysed on ice for 10\u2009min in 1\u2009mL of RIPA buffer  supplemented with protease inhibitor cocktail cOmplete EDTA-free  and Benzonase . After centrifugation at 17,000\u2009g, 4\u2009\u00b0C for 10\u2009min, the supernatants were incubated with GFP-Trap Magnetic Agarose  for 3\u2009h at 4\u2009\u00b0C under gentle rotation. The magnetic agarose beads were collected using a magnetic stand, washed four times with RIPA buffer, and then twice with 50\u2009mM ammonium bicarbonate buffer. Proteins bound to the beads were digested by adding 200\u2009ng of Trypsin/Lys-C mix (Promega) for 16\u2009h at 37\u2009\u00b0C. The digests were reduced, alkylated, acidified with trifluoroacetic acid (TFA), and desalted using a GL-Tip SDB . The eluates were evaporated in a SpeedVac concentrator and dissolved in 0.1% TFA and 3% acetonitrile (ACN). LC-MS/MS analysis of the resultant peptides was performed using an EASY-nLC 1200 UHPLC connected to an Orbitrap Fusion mass spectrometer equipped with a nanoelectrospray ion source (Thermo Fisher Scientific). The peptides were separated on a 75\u2009\u00b5m inner diameter \u00d7 150\u2009mm C18 reversed-phase column  with a linear 4\u201332% ACN gradient for 0\u2013100\u2009min followed by an increase to 80% ACN for 10\u2009min. The mass spectrometer was operated in a data-dependent acquisition mode with a maximum duty cycle of 3\u2009s. MS1 spectra were measured with a resolution of 120,000, an automatic gain control (AGC) target of 4 \u00d7 105, and a mass range from 375 to 1,500\u2009m/z. Higher-energy collisional dissociation (HCD) MS/MS spectra were acquired in the linear ion trap with an AGC target of 1 \u00d7 104, an isolation window of 1.6\u2009m/z, a maximum injection time of 35\u2009ms, and a normalized collision energy of 30. Dynamic exclusion was set to 20\u2009s. Raw data were directly analyzed against the wFur encoded protein data predicted from an in-house assembled wFur draft genomic sequence and O. furnacalis protein data (GCF_004193835.1_ASM419383v1_protein.faa) downloaded from NCBI supplemented with OfMasc-GFP and GFP-Trap sequences using Proteome Discoverer version 2.4 (Thermo Fisher Scientific) with Sequest HT search engine. The search parameters were as follows: (a) trypsin as an enzyme with up to two missed cleavages; (b) precursor mass tolerance of 10 ppm; (c) fragment mass tolerance of 0.6\u2009Da; (d) carbamidomethylation of cysteine as a fixed modification; and (e) acetylation of protein N-terminus and oxidation of methionine as variable modifications. Peptides and proteins were filtered at a false discovery rate (FDR) of 1% using the percolator node and the protein FDR validator node, respectively. Label-free precursor ion quantification was performed using the precursor ions quantifier node, and normalization was performed such that the total sum of abundance values for each sample over all peptides was the same.OfMasc-GFP derivatives or GFP were transiently expressed in OfT1C cells  were co-transfected with 3\u00d7FLAG-Oscar and GFP, OfMasc-GFP or Del1-OfMasc-GFP using FuGene HD. At 3 days post transfection, the cells were treated with 200\u2009nM PS-341 for 6\u2009h, fixed with 0.1% formaldehyde for 10\u2009min at room temperature, and the fixation was quenched with 300\u2009mM glycine. The cells were collected by scraping with disposable scrapers and centrifugation at 1200\u2009g, 4\u2009\u00b0C for 10\u2009min. The cells were then lysed on ice for 10\u2009min in 1\u2009mL of RIPA-EDTA buffer  supplemented with protease inhibitor cocktail cOmplete EDTA-free and Benzonase. After centrifugation at 17,000\u2009g, 4\u2009\u00b0C for 10\u2009min, the supernatants were collected and protein concentration was determined using PierceTM BCA Protein Assay Kit . The equal amounts of input proteins were incubated with anti-FLAG M2 magnetic beads  for 3\u2009h at 4\u2009\u00b0C under gentle rotation. The magnetic agarose beads were collected using a magnetic stand, washed three times with RIPA-EDTA buffer, and then mixed with 2\u00d7 SDS sample buffer without 0.2\u2009M DTT to elute binding proteins. Immediately before electrophoresis, loading samples were added with 2\u00d7 SDS sample buffer containing 0.2\u2009M DTT. Western blotting was performed as described above with Monoclonal ANTI-FLAG\u00ae M2 antibody produced in mouse  and anti-GFP antibody  as primary antibodies and Goat anti-Mouse IgG (H\u2009+\u2009L) Secondary Antibody, HRP  and Peroxidase AffiniPure Goat Anti-Rabbit IgG (H\u2009+\u2009L) as secondary antibodies. Signals were detected with ECL\u2122 Prime Western Blotting Detection Reagent  using ChemiDoc XRS Plus imaging system. Signal intensities were measured using Image Lab software. The uncropped and unprocessed scans used for figures are provided in the Source Data file.OfT1C/tet cells  platforms for short-read sequencing and PacBio Sequel I for long-read sequencing. The long-reads that were obtained were assembled by Canu v2.130. An estimated genome size of 438.5\u2009Mb was given as a parameter with reference to the existing genome assembly of O. furnacalis (GCA_004193835.1). Every generated contig was subject to BLASTn (v.2.7.1)\u00a0search as a query against Refseq representative prokaryotic genomes database (ref_prok_rep_genomes [https://ftp.ncbi.nlm.nih.gov/blast/db/]). Contigs that were aligned to publicly available Wolbachia sequences were identified as wFur-derived sequences. BWA v0.7.1731 was used to map Illumina short-reads to the candidate wFur draft genome with BWA-MEM mode, and Pilon v1.2332 was utilized to polish the assembly. Stand-alone PGAP v.2021-05-19.build542933 was utilized to annotate the polished wFur genome.To obtain genome sequences of Oscar locus in the wFur genome was compared to that of the wPip genome. BLASTp (v.2.9.0)\u00a0searches were conducted between translated protein sequences of wFur (generated as PGAP output) and wPip (AM999887) in both directions, and genes of reciprocal best hits were regarded as orthologs. In addition, for Oscar, a homologous region in the wPip genome was explored using BLASTn\u00a0(v.2.9.0).The gene arrangement of the wmk in the wFur genome were identified using BLASTn (v.2.12.0)\u00a0and tBLASTn (v.2.12.0)\u00a0with an E-value cutoff of 1e-10. The nucleotide and amino acid sequences of wMel wmk (locus tag WD0626 in the wMel genome sequence AE017196.1) were used as queries for BLASTn (v.2.12.0)\u00a0and tBLASTn\u00a0(v.2.12.0), respectively. The loci annotated as pseudogenes by the PGAP annotation were excluded from the subsequent phylogenetic analysis. The deduced amino acid sequences of wmk and its homologs in the wFur and wMel genomes were aligned using ClustalW v.2.1 with default parameters. A maximum likelihood tree was constructed using IQ-TREE v.2.2.0.334 with 1000 standard bootstrap replicates. The best-fitting substitution model was estimated by ModelFinder, which is implemented in IQ-TREE, and Q.mammal+F\u2009+\u2009G4 was selected according to Bayesian information criterion.Homologs of 35. AlphaFold2 was installed by Docker and CUDA Toolkit 11.1. full_dbs was used as a database and max_template_date was defined as 2021-07-14. For prediction of the protein complex, two protein sequences were connected with a U80 linker and then subjected to AlphaFold2 prediction. Due to limitation of our computer, only a single model was predicted and structure optimization was not performed when the entry data of protein sequences was large. The heatmaps of predicted aligned errors were made using the pae2png.py script (https://github.com/CYP152N1/plddt2csv).Domain architectures of Oscar were analyzed using SMART (a Simple Modular Architecture Research Tool). Protein structures were predicted using an in-house Linux computer in which AlphaFold ver.2.0 was installedOscar fragment (Oscar-pIZ/V5-His-g3) or GFP (control) cDNA6. Primers used for PCR are listed below:The DNA template for cRNA synthesis was amplified by PCR using plasmid DNA containing a codon-optimized pIZ-F-T7: 5\u2032-TAATACGACTCACTATAGGGAGACAGTTGAACAGCATCTGTTC-3\u2032pIZ-R: 5\u2032-GACAATACAAACTAAGATTTAGTCAG-3\u2032Oscar-cRNA-F-T7:5\u2032-TAATACGACTCACTATAGGGAGAATGGAGGATAGACATATCCCGTTCC-3\u2032Oscar-cRNA-R: 5\u2032-TTATCTGCCGCCTTTTCCTTTGGAA-3\u2032Oscar or GFP cRNA solution  was injected into B. mori embryos within 2\u20133\u2009h after oviposition36. The injected embryos were collected at 48\u2009h after injection and total RNA and genomic DNA was prepared from a single embryo36. Total RNA was subjected to RT-PCR experiments for Bmdsx and genomic DNA was used for molecular sexing by PCR using a W chromosome specific primer, Musashi36. The hatched larvae and unhatched developed embryos were also collected and subjected to molecular sexing PCR. Injection of cRNA into O. furnacalis embryos was performed according to the methods in B. mori with some optimization. The egg masses, all embryos of which were injected with GFP or Oscar cRNA, were collected at 1 or 2 days post-injection and subjected to RT-PCR experiments for Ofdsx. The hatched larvae were also collected and subjected to molecular sexing by qPCR using genomic DNA of the Z-linked gene Kettin and autosomal gene EF-1\u03b1 as standards6. The adult O. furnacalis moths emerged from GFP or Oscar cRNA-injected embryos were sexed based on the external morphology.Capped, poly(A)-tailed cRNA was synthesized using an mMESSAGE mMACHINE T7 Ultra Kit according to the manufacturer\u2019s protocol . Statistical analyses were performed using Prism 9 software .Further information on research design is available in the\u00a0Supplementary InformationPeer Review FileDescription of Additional Supplementary FilesSupplementary Data 1SupplementaryData2Reporting Summary"}
+{"text": "Children with cerebral palsy (CP) have motor deficits caused by spasticity, weakness, contractures, diminished selective motor control (SMC), and poor balance. The purpose of the current study was to evaluate the influence of mirror feedback on lower extremity selective motor control and balance in children with hemiplegic cerebral palsy. Understanding the relationship between SMC and balance will help children with hemiplegic CP receive more appropriate therapies.Forty-seven children of both sexes diagnosed with hemiplegic CP participated in the study. Group1 (Gr1 - control group) received conventional physical therapy training while group 2 (Gr2 - intervention group) received conventional physical therapy training in addition to bilateral lower extremity mirror therapy (MT). The primary outcome measure used was Selective Control Assessment of Lower Extremity scale (SCALE), while the secondary outcome measure was the Pediatric Balance Scale (PBS).There were significant differences in Selective Control Assessment of Lower Extremity Scale (SCALE) and Pediatric Balance Scale (PBS) between both groups in favor of Gr2. After treatment, both groups improved significantly, yet Gr2 outperformed Gr1 by a large margin.Mirror therapy may be a useful addition to home-based motor interventions for children with hemiplegic CP due to its relative simplicity, low cost, and high patient adherence. Additionally, it may help children improve their selective motor skills and balance.Current Controlled Trials using African Clinical Trials Registry website with ID number PACTR202105604636415 retrospectively registered on 21/01/202. The most prevalent mobility disorder in children is cerebral palsy (CP), which has an average frequency of three per 1000 live births worldwide and a higher prevalence of 60 to 150 per 1000 among preterm infants who are born weighing less than 1500\u00a0g [The three basic categories of CP are ataxic, dyskinetic, and spastic. Approximately 87% of children with CP are in the spastic category . Selecti\u201cImpaired ability to actively contract individual muscles in a specified pattern in response to demands of a voluntary posture or movement\u201d is the definition of impaired SMC. A pattern of flexor or extensor movement at two or more joints is referred to as a synergistic mass movement pattern. These flexor or extensor synergies prevent isolated joint movements, forcing flexor or extensor muscles to work together (co-activation) during functional activities like walking . The losChildren with cerebral palsy can benefit from a variety of therapeutic approaches, including neurodevelopmental therapies, bilateral therapeutic exercises, constraint-induced movement therapy, sensory integration therapy, and mirror therapy .Modern methods for regaining function of the more affected upper extremity (UE) after a stroke include mirror therapy. Mirror therapy is based on visual stimulation, in contrast to other therapies, which use somatosensory input to aid motor recovery. A mirror is held in the patient\u2019s midsagittal plane during mirror treatment, reflecting the less-affected side as if it were the more affected side. In this configuration, the less affected extremity movements provide the appearance that the more affected extremity is moving normally. The comparatively simple administration and potential for self-administered home therapy, especially for those with severe motor deficiencies, are two benefits of mirror therapy , 8. VisuMirror therapy is simple to use, affordable, and non-invasive. Thus, it can be considered a promising and safe addition to hemiparesis therapy in youngsters . It has Therefore, the purpose of this study was to evaluate the influence of mirror feedback on lower extremity selective motor control and balance in children with hemiplegic cerebral palsy. Understanding the relationship between SMC and balance will support in the delivery of more appropriate therapies to children with hemiplegic CP. Combining easier and more accessible alternative therapies with traditional rehabilitation programs may provide additional benefits for improving LE motor function.A randomized controlled trial was carried out at the outpatient clinics for pediatric rehabilitation \u2013 College of Physical Therapy, Cairo University between the period of December 2018 to October 2021. The study was registered retrospectively on the Pan African Clinical Trials Registry with number of PACTR202105604636415 date 21/01/2021.Procedures of the current study agreed with the ethical code stated in Helsinki Declaration 1975 and was approved by the Ethical Committee Board of the College of Physical Therapy - Cairo University (number: P.T.REC/012/003118). All procedures for assessment and interventions were carried out at the outpatient clinics for pediatric rehabilitation \u2013 College of Physical Therapy, Cairo University.All parents were given a summary of the evaluation and treatment methods, after which they signed an informed consent form stating \u201cthe information in this study has been read and explained to me besides reading it myself. I\u2019ve had the chance to ask questions regarding it, and every one of them has received satisfactory answers. I freely give my child my consent to take part in this study\u201d.(n\u2009=\u200965) children with hemiplegic CP were recruited, eight (n\u2009=\u20098) were excluded for not meeting the criteria, three parents (n\u2009=\u20093) refused to provide their consent and the remaining fifty-four (n\u2009=\u200954) were randomly assigned to two equal groups (Gr1 - control group and Gr2 - intervention group). During rehabilitation, seven children (n\u2009=\u20097) discontinued the intervention; five children (n\u2009=\u20095) travelled with their parents to another city and two children (n\u2009=\u20092) did not participate in the post-treatment evaluation. Inclusion criteria were as follows: (1) diagnosis of hemiplegic CP (2) age range six to nine years, (3) mild to moderate spasticity of the more affected side (score 1\u20132) measured by the Modified Ashworth Scale (MAS) (4) adequate cognitive and linguistic abilities , required for focusing on mirror reflection, for at least ten minutes and follow the therapist\u2019s directions and (5) normal and pain free range of motion (ROM) of the less affected LE. Children who had fixed deformities in the LE that interfered with motor functions, history of epilepsy and/or surgical interference or Botulin toxin injection in the LE within the previous year and un-cooperative were excluded from the study.Sixty-five The sample size was determined using data from prior research published in 2017. Researchers assessed the effect of MT on gross motor skills in children with spastic CP. Based on findings, there were substantial changes between the mirror treatment group and the control group. Using their data and G*Power  were used to compute the sample size . A totalAll hemiplegic CP children were randomly assigned to two equal groups, using a random allocation software. Children were divided to two equal groups using the Graph Pad Quick Calcs website ,  was used to evaluate the ability of patients with spasticity to perform SMC movements in different joints. It was used to evaluate toe, subtalar, ankle, knee, and hip joints range of motions (ROM). Except for hip joint flexion, which was examined in the side-lying position to obtain appropriate joint excursion, other measurements were done in the sitting position. The children were taught to perform the task by counting for three seconds while the examiner passively moved their extremities through the required ROM. After the child completed the required movement in time without moving any untested ipsilateral or contralateral LE joints, a score of 2 points \u201cnormal\u201d was given. A child earned score 1 \u201cimpaired\u201d if he or she performed one of the following errors: just one directional movement, less than 50% of movement achieved, movement of a non-tested joint (including mirror motions), or time beyond a three-second spoken count. The child earned a 0 score \u201cunable\u201d when he/she did not begin the necessary movement or perform a mass extensor or flexor synergistic pattern [ pattern . This waThe Pediatric Balance Scale (PBS) is a widely used instrument for examining children with CP who have a difficulty maintaining standing balance. It is made up of 14 three-dimensional components that include standing, sitting, and postural adjustments. Each item is graded on a scale of 0 to 4, with a higher score indicating greater balance . The PBSChildren in Gr1 (control group) received conventional therapy for 60\u00a0min while children in group 2 (intervention group) received MT and conventional physiotherapy for 60\u00a0min . Both groups received three sessions per week for 12 consecutive weeks. The conventional therapy included stride standing allowing weight shift from one extremity to another, standing on one foot, stoop, and recovery from standing position, standing on balance board, balance training exercises, stretching exercises for hip joint flexors, adductors, hamstrings, and calf muscles and gait training exercises in an open environment , 18.To implement MT, birthmarks and scars on the less affected LE were covered prior to treatment if they impaired the ability to see clearly. During administration of MT, the atmosphere was free of any distractions, to ensure that each child focused and paid attention. A mirror was placed between both LE, with the more affected LE hidden behind a black curtain and the reflection of the less affected LE completely visible. The mirror\u2019s dimensions were large enough at least 35\u2009\u00d7\u200925 inches  to coverThe child was then told to watch the mirror reflection for a minute or two while attempting to imagine the mirror image of the more affected LE. Instructions were given to perform the movement, after the therapist first visually demonstrated it with the less affected LE .In sitting position, each child was asked to perform simultaneous bilateral toe flexion/extension, subtalar joint inversion / eversion, ankle joint dorsiflexion /plantarflexion, knee joint flexion/extension, and in long sitting simultaneous bilateral hip joint adduction/abduction and flexion/extension. If symptoms such as lightheadedness, nausea, or perspiration apperaed, the child was told to focus on the less affected LE or another area of the room instead of the mirror. The child was then told to look at the mirror image for a brief length of time before shifting sight to the less affected LE. This process was repeated several times till any side-effects disappered. The intensity of the mirror illusion was facilitated by moving everything extremely slowly. At the end the treatment session, children were able to move the more affected LE. .Descriptive statistics was used to identify each variable`s mean and standard deviation. Paired t-test was used to compare characteristics of patients between both groups. Chi-square test was used for comparison between two groups in age and gender. The significance level for all the statistical tests was set at p-value\u2009\u2264\u20090.05. IBM statistical software version 21  was used to perform all the statistical analyses.Table\u00a0Gr2 after treatment compared with those before treatment (p\u2009<\u20090.05). Also, effect size was significant in hip and knee joints, total extremity, and PBS score while effect size was medium in the subtalar joint and Toes. On the other hand, there were no significant changes in the toes the ankle joint in Gr1 (p\u2009>\u20090.05) (Table\u00a02).There was a statistically significant improvement in the hip, knee, ankle, and subtalar joints, total extremity, and PBS score in (p\u2009>\u20090.05). There was a significant improvement in the hip, knee, ankle, and subtalar joints, total extremity, and PBS score in Gr2 after treatment compared to Gr1 after treatment (p\u2009<\u20090.05). On the other hand, there was no significant difference in the toes of both groups post-treatment (p\u2009>\u20090.05) (Table\u00a0) and .There was no statistically significant differences pre-treatment between groups 5) Table\u00a0 and .There was a substantial significant positive association at 5% significance level between the PBS score and the SCALE total score Table\u00a0.Children with CP have different muscle magnitudes and recruitment patterns compared to healthy ones. These variations might affect voluntary muscle recruitment, resulting in motor disability. On a functional level, SMC is regarded as one of the most notable deficiencies affecting gross motor tasks in children with CP , 21.Children age in the current study ranged between six and nine as the visual and vestibular systems usually develop in tandem with the somatosensory system. Between the ages of four to six, the highest conceivable sensory integration takes place, with the child exhibiting sensory changes like those seen in adults between the ages of 7 and l0 years , 22.Gr2.This study investigated the effect of mirror feedback on LE SMC and balance in children with hemiplegic CP. Results shown significant improvement of SMC of hip and knee joints within and between groups with favor to the For SMC of the ankle and subtalar joints and toes, there was significant difference within Gr2 and no significant difference within Gr1. The results of our study proved that MT resulted in substantial improvements in SMC and balance in the more affected LE when compared to conventional therapy. Additionally, a substantial positive association between improved balance and improved SMC in the more affected LE was reported.Mohammed et al., (2022) who stated that MT enhance the SMC of the more affected upper extremity (UE) in spastic hemiplegic CP [The results of our study supported the findings of legic CP , 23. Mirlegic CP .Mohan et al., (2013) and Mohan et al., (2013), who showed that MT intervention can restore balance and gait after a stroke [Tae-sung et al., (2016) and Kim, Myoung-Kwon et al., (2016) [Additionally, findings of our study agree with those of a stroke . Signifi, (2016) , 26.In this study, the term more affected and less affected LE were used instead of affected.and non-affected terms commonly used. Each cerebral hemisphere controls function of the.contralateral side of the body. Yet, some nerve fibers carry information to the same side of the body. Therefore, function can be affected in both sides of the body \u201329. ThusThe improvement in SMC for proximal segments of more affected LE may be attributed to anatomical relationship that suggests that distal LE pathways are thought to be more susceptible than proximal LE tracts because of how the LE is organized somatotopically in the sensorimotor cortex , 31. AccWakeling et al. 2007 found that in children with spastic diplegia, aberrant muscle firing occurred more frequently in the distal than the proximal musculature during locomotion. Additionally, the ankle joint has been measured to have higher muscular weakness than more proximal joints [Fowler et al. assessed the proximal to distal distribution of SMC impairment among LE joints. From the hip to the toes, there was a noticeable decline in SCALE ratings [l joints , 35. In  ratings .The disrupted motor command and visual sensory feedback loop are usually repaired by MT . The linWhat happens is the more affected extremity becomes misled by the optical illusion created by the non-affected or less affected extremity movement reflected in the mirror, and the patients believe that the more affected extremity is moving, which improves the motor function of the more affected extremity . WidesprMirror therapy can be considered an effective and simple addition to home-based motor intervention for children with hemiplegic CP due to its relative simplicity, low cost, and high patient adherence. Additionally, it may help spastic children to improve their selective motor skills of the more affected LE and balance.The present study has the following limitations: (1) authors could not apply this rehabilitation programme to other forms of spastic CP since the effect of MT was studied among spastic hemiplegic CP children with sufficient cognitive ability, (2) the children\u2019s SMC and balance were examined three months after the intervention; as a result, we are unable to make any conclusions regarding the brain\u2019s neural activity at the beginning of therapy and three months afterwards. Additionally, the effects of short-term MT usage were not examined in this study, (3) the effect of the MT on the other functional activities for LE, such as gait, running, and coordination, could not be quantified. So, we recommended further studies to investigate the influence of MT on functional activities for LE, such as gait, running, and coordination."}
+{"text": "Heterotopic ossification (HO) is a condition where aberrant bone grows in tissues. This case study presents a rare complication of trauma and laparotomies, where the rapid and extensive occurrence of HO has delayed abdominal incision closure resulting in multiple surgeries and prolonged recovery. A 44-year-old man was retrieved after a truck accident resulting in multi-organ injuries. He required damage control trauma laparotomy followed by several relooks and multiple orthopaedic procedures. Despite several attempts, approximation of the laparostomy wound was not possible due to abdominal rigidity. Computed tomography scans done 20\u00a0days after injury demonstrated advanced HO over the wound edge. Early development of HO may explain why the abdominal incision was difficult to close and highlights the importance of being aware of HO as an early complication after trauma and midline laparotomy. Heterotopic ossification (HO) is a condition, in which ectopic bone is formed in tissues where it does not belong , 2. TrauHere we describe a rare case of a rapidly growing and extensive anterior abdominal wall HO that prohibited the closure of a midline incision after a trauma laparotomy and multiple relooks. This complication resulted in increased morbidities and utilization of an unconventional method to close the abdominal incision months later.Mr. R, 44-year-old male, was a driver in a high-speed collision of two trucks with cabin intrusions and prolonged extrication. His medical and surgical history included psoriatic arthritis, gastro-oesophageal reflux disease, hiatus hernia repair and a Roux-en-Y gastric bypass for weight reduction.Mr R. sustained multiple traumatic abdominal and orthopaedic injuries and was haemodynamically compromised with a systolic blood pressure of 60\u00a0mmHg, haemoglobin of 52\u00a0g/L at arrival, despite 6\u00a0units of packed red blood cell transfusions during the retrieval. Damage control trauma laparotomy found to have two bleeding small bowel mesenteric tears, de-vascularized ileum and caecal perforation resulting in 40\u00a0cm of ileum and ileocaecal resection. After surgery, the patient was transferred to ICU with a temporary abdominal closure. Computed tomography  and X-rays were performed post-surgery and revealed small bilateral pneumothoraces, left 8th and 10th rib fractures and multiple long bone fractures including right wrist distal radius fractures .Two days after the initial trauma laparostomy, the proximal end of the small bowel was anastomosed with the remaining terminal ileum, and an ileostomy was fashioned. Multiple large bowel contusions were further noted and the abdominal wall was closed. Unfortunately, 4 days later, the end ileostomy became ischemic prompting a return to operating theatre to resect the ileostomy and remaining 35\u00a0cm of terminal ileum that had become non-viable. The proximal small bowel end was stapled and a temporary abdominal closure was performed. Another relook was done at Day 5 to create a new ileostomy, but due to the tension of the abdominal wall muscle, the anterior abdominal wound closure was not achievable. Over the following 18\u00a0days, Mr. R underwent multiple orthopaedic surgeries and abdominal wound approximation was re-attempted without success.Approximately 20\u00a0days from the initial accident, the patient developed persistent fever, tachycardia, tachypnoea and swelling on the right wrist, by this time he was not able to flex forward and had limitation to his wrist movement. CT scan of the abdomen revealed advanced calcified HO surrounding the midline incision . In addiThree months later, repeated applications of vacuum dressings promoted sufficient granulation over the open abdominal wound allowing an autologous split thickness skin graft to achieve abdominal closure . A couplSince then, the patient has recovered fully.In this case study, we described a rare complication of extensive and rapidly developed abdominal and wrist HO after trauma. To date, there has not been a case reported in literature, where HO developed earlier than 20\u00a0days. Although advanced HO was detected about 20\u00a0days, subclinical HO would have started to develop just days after trauma and surgeries. The nature of the injuries and the number of surgeries may have contributed to early development of HO. This subclinical HO may have contributed to initial failed attempts of abdominal wound closure. HO can be visualized on plain film X-ray, bone scans, CT or magnetic resonance imaging findings (MRI) , 8. For There is no standardized treatment for HO. Asymptomatic HO is often managed conservatively, but symptomatic HO causing pain and discomfort can be managed prophylactically with non-steroidal anti-inflammatory drugs, localized low dose radiation or combined treatments , 8, 13. In this case report, we presented a rare complication after abdominal trauma. The patient developed early and extensive HO around the abdominal midline incision site, which made the closure of the anterior abdominal wall possible only through utilizing of skin grafts. The current case recognizes HO as a rare early complication after trauma and abdominal incision. It is an important problem to be aware to reduce morbidity after traumatic injuries."}
+{"text": "Known methodological issues such as publication bias, questionable research practices and studies with underpowered designs are known to decrease the replicability of study findings. The presence of such issues has been widely established across different research fields, especially in psychology. Their presence raised the first concerns that the replicability of study findings could be low and led researchers to conduct large replication projects. These replication projects revealed that a significant portion of original study findings could not be replicated, giving rise to the conceptualization of the replication crisis. Although previous research in the field of sports and exercise science has identified the first warning signs, such as an overwhelming proportion of significant findings, small sample sizes and lack of data availability, their possible consequences for the replicability of our field have been overlooked. We discuss the consequences of the above issues on the replicability of our field and offer potential solutions to improve replicability. In the Neyman\u2013Pearson approach to NHST, the observed p-value is compared with a pre-established alpha level rate . If the observed p-value is smaller than the pre-established alpha level, the researcher can claim that statistical significance has been reached and act as if the null hypothesis were false1 with a maximum error rate of the alpha level. Statistical significance (i.e. p < 0.05) should not be confused with practical significance since it only means that the observed data are extreme enough such that an effect as extreme as, or more extreme than, has been observed would occur less than 5% of the time, if the null hypothesis was true  interval should be equally likely in a two-sided hypothesis test regardless of the sample size, yielding a uniform distribution [p-value of 0.01 is just about as likely to be observed as a p-value of 0.9.One way to objectively examine the reliability of a set of findings is to quantify the evidential value of a literature body . Evidention bias \u201344. Fortp-values ,44. For ribution ,44,45  effect size [p-values in literature. Suppose there is a true effect between two populations with a Cohen's d effect size (effect size d) of 0.5 and we perform an unpaired t-test to test this difference in three different sample sizes . As we can see in figure\u00a02a, a sample size of 10 per group and a true effect size d of 0.5 yields a power of 18%, which means that out of 1000 replications, only 180 should be expected to reach statistical significance (in the long run), even though there is a true effect to be found. With a sample size of 60 participants per group, power is as high as 78%, meaning that 780 out of 1000 replications reach statistical significance in the long run (figure\u00a02c). In studies with high power and where a true effect is examined, the likelihood of observing a small p-value (e.g. p = 0.01) is higher compared with a large p-value (e.g. p = 0.4) [p-values are below 0.01, and there are relatively fewer p-values between 0.01 and 0.05  follows a right-skewed distribution, where larger p-values become increasingly less frequent  in unbiased literature\u2014that is, in the absence of p-hacking and publication bias [p-values can be used not only to determine whether a set of homogeneous studies investigates true or false effects, but it can also be used to estimate the average power of the set of studies. Altogether, it should be clear that the small sample sizes observed in sports and exercise science [However, when the alternative hypothesis is true, the distribution of ect size ,46. The p = 0.4) ,46. Moreion bias . For thi science ,39 may bp-value distribution, one explanation for an excess of significant findings in a literature body that has been raised is publication bias and p-hacking [3 In the presence of publication bias (where non-significant findings are less likely to get published), researchers have incentives to explore post hoc analyses to find a significant p-value (i.e. p-hacking). If p-hacking occurs in literature, the distribution of reported significant p-values adopts different shapes [p-values is right-skewed . Therefore, by examining the distribution of p-values, it can be determined whether published findings contain evidential value of a true effect, and the extent to which findings in the literature are affected by publication bias and/or p-hacking [While the above assumes an unbiased -hacking ,48,49.3 t shapes . For ins-hacking ,44.Figu. 2.2In a Neyman\u2013Pearson approach, researchers should use the NHST framework under the assumption of two conditions . First, . 2.2.1Power has direct implications on replicability because, from a frequentist standpoint, power is also described as the long-run probability of obtaining a significant effect when there is a true effect to be found . To daten = 19) reported in the Journal of Sports Sciences [et al. [There is, however, concern that studies in sports and exercise science are not adequately powered for effects of interest. It is again worth highlighting the findings from two recent studies ,36; the Sciences , but thiSciences . This stSciences . The medSciences . It is uSciences \u201358. For  [et al.  for an e [et al.  for metahttps://osf.io/y3482/. There is reason for caution because of the use of small sample sizes in our field [Journal of Sports Sciences (n = 19) [d of 0.43, which has been reported to be the medium effect size benchmark for effects observed in 679 strength and conditioning intervention studies [d of 0.43 with a sample size of 20 for a paired t-test. This within-subject design would yield a power of 45%, implying that if 10 replications were to be conducted, only about five would find a significant effect. It is worth noting that for achieving 80% power, a sample size of 44 would be needed if the true effect size was d = 0.43. Small sample sizes might be appropriate if the true effect size being estimated is large enough to be reliably observed in such samples [To further elaborate, we provide observed power estimates in our field using a typical effect size and sample size reported in previous research ,61. R cour field ,39. Besi(n = 19) , four bi studies . Suppose samples ; for ins samples ,57. Howe samples . This me samples . Given t samples ,39, it m samples . The ext samples . This is. 2.2.2, or both, the consequences of low power should be emphasized here. Firstly, underpowered designs are less likely to find a true effect even if the effect exists at the population level [d of 0.5), two of three of the studies do not find a significant effect and thus commit a type II error.While low power in itself is caused by low sample size or small effect sizeson level ,64. Thispositive predictive value. To see how this plays out, let us assume that 20 sports science studies within the same scope have an average power of 45%, as we have calculated previously assuming a total sample size of 20 and a medium effect size d of 0.43 for a paired t-test. In such a situation, approximately only 9 out of 20 studies (20 \u00d7 0.32) would find a significant effect even if all null hypotheses tested were false. The number of false positives with an alpha level of 0.05 would be 1 (20 \u00d7 0.05). Thus, the number of false positives relative to the total number of published significant findings is 10%  = 1/(1 + 9)). On the other hand, let us consider how things would play out if the average power in a set of 20 studies is 80% instead of 20%. In this case, the number of significant findings when there is a true effect to be found would be 16 (20 \u00d7 0.8). While the number of false positives would be the same (0.05 \u00d7 20 = 1), the proportion of false positives would be approximately 6% (1/(1 + 16)). Comparatively speaking, although an unbiased body of literature can only be achieved by publishing all study findings, irrespective of the p-value, the reliability of a literature body is higher when the power is 80% rather than 20%. In fact, a set of underpowered studies investigating the same effect and all reporting significant findings is so unlikely that the findings become literally improbable [5). Therefore, if the power observed in sports and exercise science studies is as low as hypothesized [Secondly, underpowered designs also increase the proportion of false positives in a literature body where there is publication bias ,64, whicprobable . Supposethesized , we may Thirdly, the effect size provided by a study with an underpowered design in the presence of publication bias is likely to be overestimated ,27,28,65d, which is unknown, is 0.5. The researcher wants to obtain the sample size required to achieve 80% power and uses an overestimated effect size d of 1.34 from a previous underpowered study (a). Thus, the researcher finds out that a sample size of 20 (i.e. 10 participants per group) is needed to achieve 80% power and detect an effect size d of 1.34 for an unpaired t-test. However, although the intended power was 80%, the overestimated effect size (i.e. effect size d = 1.34) yielded a true power of 19% (R code available at https://osf.io/y3482/). Thus, a researcher, who conducts a pre-study power calculation based on the likely overestimated effect size from an original small sample study, may end up designing a study which has less power than intended, and to compound the issue, the use of smaller sample sizes for a given power would ultimately yield overestimated effect sizes. This situation not only occurs when conducting pre-study power calculations based on effect sizes from previous studies with underpowered designs, but also when the effect size of interest is derived from a pilot study  from five psychology journals, 83% of the effect sizes sampled had CI widths that were larger than the reported effect sizes and 26% were twice as large as the reported effect sizes [Lastly, underpowered designs also decrease the precision of parameter estimates ,62; figu. This isct sizes . As a coct sizes ,39, it m. 2.2.3Journal of Science and Medicine in Sport, no study included a pre-study power calculation [et al. [Journal of Sports Sciences included such practice. Although this reflects an increased use of power analysis, it is clearly not a standard practice in our field. This is in marked contrast with the recent findings from Collins & Watt [et al. [Despite the core importance of power in NHST, the use of pre-study power calculations is still scarce in sports and exercise science . In 2000culation . More re [et al.  reporteds & Watt , who obss & Watt ,72\u201374. F [et al.  that inc [et al. ,74. For  [et al. . These p [et al. ,14. This [et al. . However [et al. . Instead [et al. ,70,74. T [et al. ,72, it m [et al. ,23. Furt. 2.3Availability of research data is a core scientific principle, not only because it contributes to cumulative science ,76 and e. 2.3.1et al. [p-value and about 13% contain a grossly inconsistent p-value [p-values in the interval between 0.03 and 0.05 (which are less likely to occur when there is a true effect to be found) were more common in papers that did not share data (16.7%) than in papers that did (9.1%). Thirdly, integrity surveys among researchers have revealed that the prevalence of QRPs was in the range of 33\u201351% [Empirical data show that, in general, sports and exercise researchers are reluctant to engage in data sharing practices . Indeed,et al.  reported p-value ,78. Seco p-value . Interesf 33\u201351% ,81. Moref 33\u201351% ,81. In l. 2.3.2p-value of a significance test is the main statistic used for deciding whether the null hypothesis can be rejected or not. However, researchers' poor understanding of the NHST often leads to the misconception that significance means a large effect, while no significance means a small effect or no effect [p-value along with effect sizes and their CIs [Journal of Science and Medicine in Sport reported effect sizes. Similarly, a more recent study observed that only 39% of studies published in the Journal of Applied Biomechanics in 2014 reported effect sizes [p-values to interpret study findings despite the consequences of small sample sizes on the reliability of statistical results [The o effect ,66,82. Io effect . It has heir CIs . An effeheir CIs . Furtherheir CIs ,76. Despheir CIs ,55. For ct sizes . These f results ,23.Besides the quantitative information, reporting effect sizes and their CI, or at least including sufficient information to calculate them, also contributes to improving the replicability of findings. For instance, researchers attempting to replicate an original study with a higher-power design will need the original effect size estimate to calculate the sample size of the replication study. Similarly, researchers might opt for a more conservative approach, which is to use the lower CI bound of the original effect size. Alternatively, researchers may use the precision-in-parameter-estimation method, which also requires CIs, to identify the minimum sample size that would ensure a precise estimate of the population parameter . Therefoz-curve/p-curve [p-values, studies should also disclose F-ratio or t-statistics, the type of design, and the correlations between dependent observations for within-subjects designs [gav effect size (effect size gav) from such a study [gav  becausen within  to estiming data , one posing data . Howeverp-values and effect sizes not only informs about the statistical significance, direction and magnitude of an effect, but also can be used to answer meta-scientific questions (e.g. how replicable is a particular set of findings?) by performing a z-curve/p-curve analysis, a meta-analysis or a meta-meta-analysis. Addressing meta-scientific questions may require the analysis of large datasets (see [F-ratio or t-statistic and degrees of freedom (in parentheses) followed by the p-value . However, this is not a common standard reporting practice in sports and exercise science. Thus, adopting common reporting practices, such as APA's reporting recommendation, would facilitate machine readability and data usability, enabling the analysis of large sets of data containing p-values, effect sizes or CIs. The reporting of statistical results is key to replicating original studies, assessing the replication success and conducting additional statistical tests. However, the heterogeneity of our reporting practices in sports and exercise science makes a full evaluation of replicability in our field problematic, to say the least.Furthermore, the reporting of exact ets . This c. 2.4As a consequence of the above practices ,23,36,70p-hacking via restricted flexibility in study design and data analysis [et al. [Journal of Experimental Physiology, Human Movement Science, Science and Medicine in Football [and Reports in Sport and Exercise and Journal of Sports Sciences, Psychology of Sport and Exercise,  [One practice is preregistration, which was conceived to mitigate QRPs by preventing HARKing and by reducing the risk of analysis ,94. In panalysis . Howeveranalysis ,97. Alteanalysis ,91,98,99Football , PsycholSciences . AnotherSciences ,74. In aSciences ,91. SharSciences ,102\u2013104.Sciences ,54,105. Sciences . In thisSciences .. 3F-ratios, t-statistics and degrees of freedom, which directly impact the ability to evaluate methodological quality effectively. Altogether, although there is evidence indicating that our field is likely to face a problem with replicability, we acknowledge that the power estimates provided herein  might n"
\ No newline at end of file