diff --git "a/deduped/dedup_0702.jsonl" "b/deduped/dedup_0702.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0702.jsonl"
@@ -0,0 +1,50 @@
+{"text": "The book \"Understanding the Human Machine, A Primer for Bioengineering\" embraces various aspects of biomedical engineering as an essential resource book for physical scientists, engineers and biomedical students. The book interfaces physiologic systems with engineering principles to capture the important concepts from a plethora of facts in field of biomedical sciences. Humors, exercise, history of biomedical discovery and elements of humility continuously emerge throughout the book; thereby, enhancing the self-taught approach for the new comers.The Introduction reflects the author's philosophy and advice for the readers from his accumulated wisdom and experience in teaching bioengineering. In Chapter 2, the author used the system approach to intertwine cardiovascular, renal, respiratory, gastrointestinal, endocrine, nervous and muscular systems. The organization is timely and effective in the era of systems biology and the emerging research towards predictive and preventive medicine.The system approach in Chapter 2 paves the way for detecting signal output from the physiologic systems. Biosensors are illustrated to measure electric signals from the visual, auditory and olfactory systems as well as the heart, brain, and muscle. The integration of electric circuits using the classic examples such as the Wheatstone bridge and operational amplifiers provides the frame work for signal acquisition and processing. Finally, the author completed the book with a touch of bioinformatics in the post genomic era.In general, the book is comprehensive and succinct, readable and interesting. The presented material spans from the fundamental principles to the applications of bioengineering.Certain areas will improve the quality of this book for the readership of undergraduates and new comers to bioengineering. Some figures are difficult to understand as a result of small captions (eg. figs 2.11 and 3.19). Others are old and lack clear labeling . Tissue engineering deserves a paragraph. Analogous to nanotechnology, a link to a tissue engineering website would be helpful for the readers. A paragraph on molecular engineering involving proteins, DNA and RNA molecules would enhance the balance between classic bioengineering and the emerging fields. The readers would be intrigued if the book ends with a paragraph introducing Bio-MEMS , bionanotechnology, molecular imaging, and surface chemistry.Overall, \"Understanding the Human Machine, A Primer for Bioengineering\" is a very useful book that highlights the fusion between organ systems and engineering principles. I would recommend this book as an introduction to bioengineering and a reference for students from physical science, engineering and life science."}
+{"text": "It provides an excellent elementary introduction to this topic.Following an illustrative historical introduction, the author briefly reviews vascular physiology. This is followed by the basics of fluid mechanics as an introduction to the hemodynamics of large arteries. A dedicated chapter illuminating the dynamic consequences of vascular branching follows this chapter. This is the field to which Professor Li has made his substantial contributions.The following chapters cover the venous system and microcirculation. Finally the book reviews measuring techniques used to study hemodynamic behavior.The author suggests this volume to be \"a companion\" to his own treatise \"The Arterial Circulation\" . For thoWhile the new book adds useful information on the venous system and on microcirculation, a topic that has been neglected in classical treatments of hemodynamics, this new volume is substantially less comprehensive in most topics covered in both. Also its index is regretfully, substantially less detailed. Little new has been published in this field since the first book was published in 2000, with the notable exception of Zamir's book \"The Physics of Pulsatile Flow\" [In brief, this book, which is more affordable than its predecessor, should be regarded as a good introduction to the topic, to be used primarily by bioengineering students, rather than an updated authorative text by its erudite author."}
+{"text": "Based on a semester-long seminar on the topic, this book aims to fill a gap in the current engineering curricula by taking a wide-angle view at the process of engineering design rather than focusing on a more narrow and in-depth approach. As part of Artech House Publishers' technology management and professional development library, this is an excellent introduction to the topic and may serve for later reference.The author, Peter. H. Sydenham is the inaugural professor and head of the University of South Australia's School of Electronic Engineering, co-founder of the Australian Centre for Test and Evaluation, and a director of Global Systems Engineering Consulting Pty Ltd. This brief biographical sketch explains his qualification to write a book of such practical value and dimension, and why the book is pedagogically sound.The book, according to the preface, aims at those readers who are engineers \"who have, or aspire to team leadership or want to take on increased team interfacing responsibilities\". As such it builds on and expands what the author perceives to be too little taught in the regular university courses, and covers what is lacking: \"breadth of the knowledge now needed to be an effective engineering designer.\"Twelve chapters offer a step-by-step introduction to the topic. The first chapter, \"Systems Thinking and Systems Engineering\", gives an overview and the \"philosophical\" background, while the last looks at \"Change and Future Trends\". The remaining ten chapters cover the practical aspects of the whole process of systems engineering design with a more hands-on approach, including basics of supporting knowledge such as staff management from planning over recruitment through training to promotion or termination of contract (chapter 3) or information technology support. As such, chapters 2\u20134 cover the more general aspects, while chapters 5\u20139 cover the design process from idea to evaluation. Chapter 10 intersperses legal issues, while chapter 11 covers the prototype build, i.e. the step from abstract design to material product.This is an introductory textbook, and as such, it does a very good job of the task at hand. The language is clear, the case examples are well chosen, and the message is conveyed without fail. Some issues are discussed somewhat at length; for example, the basic IT issues are explained in a very detailed way, but one might assume that the basics would be self-evident for today's user: the target audience will have grown up in the age of the personal computer and the internet and as such, will neither question the computer's usefulness nor be overly na\u00efve with regards to the many IT bugs one has to deal with.The illustrations are about as clear as can be-some, in fact, are not clear at all but as they are meant to demonstrate the complexity of the issue at hand, the message gets conveyed the way it should be.How does this general book relate to the specialist field of biomedical engineering? To quote from p. 12: \"Researchers in the life sciences were driven by a need to better understand how nature works and controls itself. Out of this pioneering work emerged general systems theory cybernetics, self-organizing systems, automation, automaton systems, organizational science, operations research, systems science, and more-topics with which engineers are not usually that familiar\". This lack of familiarity becomes very evident when young engineers join research teams with a focus on applications for the life sciences, such as biomechanical engineering, but also within the broad field of bioinformatics, and they usually take more time to acquire and apply that holistic view of their work than life scientists need to acquire and implement detailed and circumscript engineering knowledge to accomplish their tasks. As such, this book can be recommended to engineers working in biomedicine even at the outset of their careers as it may draw their attention to the importance of this view of things in the new field they enter. Competing recent titles include works by Blanchard . A more One point that a next edition seriously needs to address is the text editing. Using a word processor does not guarantee a perfect text: this one has a lot of extra words, and as many words missing. As faulty as the text editing is the punctuation check. These errors occur as often as once per page, and force the reader to repeat the study of entire paragraphs several times because, more often than not, it is the missing preposition or punctuation that poses a serious threat to understanding. The publishing house would do well in employing an old-fashioned human text editor to spare the reader such nuisance.In summary, this is a basic textbook to project design management for aspiring team leaders, not only in engineering but for any scientific and some business projects as well. Well written, this is a recommended introduction to the matter and may serve as a reference book and reminder even to the experienced team leader.Adrian Mondry is at Bioinformatics Institute, Singapore Mondry@hotmail.com."}
+{"text": "This is the third edition of the already well-known book \"Basic Orthopaedic Biomechanics.\" In addition to restructured chapters, new material reflecting current trends in the field has been included in this new edition, and \"Mechano-Biology\" was added to the title. These most appropriate revisions help to make this a book that is at the same time both \"classic\" and \"up-to-date.\"This book begins with a brief history of science and orthopaedic biomechanics, where the authors discuss how the conflict and inconsistencies of accepted paradigms are challenged by new tools and experiments, leading to new ways of addressing problems in the field. Although there are often \"titanic\" struggles involved in making such paradigm shifts, conflict is often a necessary first step in the advancement of knowledge. This book not only presents the current knowledge in the field, but also has the objective of motivating new questions that could result in future advances.An exceptional team of contributing authors collaborated in writing the various chapters covering different topics in orthopaedic biomechanics and mechano-biology including: analysis of muscle and joint loads, kinematics, biomechanics of musculoskeletal tissues , cartilage and bone tissue engineering, spine and artificial joint biomechanics, etc. There is also an excellent chapter on biomaterials. The chapters are well-written and the figures are informative and of good quality. Each chapter is complemented by an extensive list of references.An important characteristic of this book is that it can be used by any student or researcher in orthopaedic biomechanics, regardless of instructional level or background. Basic concepts are always well explained before they are used. For example, in chapter 1 Newton's laws are reviewed before the forces involved in the analysis of muscle and joint systems are calculated. Being an interdisciplinary subject, many times topics in biomechanics make use of concepts from biology and biochemistry. Whenever such cross-disciplinary ideas present they are well explained; for example, proteoglycans in chapter 5 and intracellular signaling pathways in chapter 6.In summary, this is an excellent book in orthopaedic biomechanics that will greatly benefit all members of the biomechanics community. It can be used as a text for beginning and advanced students, as well as a reference for both students and researchers at all levels, or for those who just want to learn something about biomechanics."}
+{"text": "With the rapid expanding and evolving of biotechnology, new terms are entering the nomenclature at a rapid pace (from the preface), though they are not easily understandable except for a small group of experts. It is important for scientists of other branches to keep abreast of the latest terminology and necessary for non-professionals to understand buzzwords such as \"Apo A-1 Milano\", \"CD95 Protein\", \"FRET\", \"hedgehog signaling pathway\", \"lysophosphatidylethanolamine\". \"Glossary of Biotechnology and Nanobiotechnology Terms, Fourth Edition\", is \"The book provides the definitions of biotechnolgy and nanobiotechnology terminology which includes terms from the fields of biology, biochemistry, chemistry, and nanotechnology. The current book is a result of the author's effort of continuing improvement over a decade since the first edition published in 1993. The current edition contains 402 text pages, more than two and half times of the first edition. In this edition, the author has added \"nanotech\" terms relevant to biotechnology to the glossary (from the preface).anyone working directly or indirectly with those pioneering the frontiers of modern biology\" (from the back cover). The author has written the book for readers without necessarily holding advanced degrees in biochemistry or molecular biology and made certain compromise between absolute scientific rigor and definitions based on analogy, with the inherent possibility of oversimplification (from the preface). The cross reference after each item is extensive and provides the logical connections with other items for readers to explore relevant topics.The book is intended for \"nd edition [th edition. Definitions can be more illustrative with color figures. especially for those items about cell, protein or DNA structures. Moreover, I do not agree with the statement on the back cover that the book \"allows one to follow a reference chain that enhances clarity right down to a high school level.\" Extra efforts and references are required to fully understand the analogies and examples. Finally, let me quote one interesting comment by Eleanor Randall in the review of the same book: \"As I began this review, I needed a clearer definition of nanobiotechnology and its relationship with bionanotechnology. Interestingly, the title term nanobiotechnology was not included in The Glossary and, in the preface, one finds the term bionanotechnology used.\" [Some comments about the book are in the following. The cross-references would be ideal in a hyperlink form such as an online format or in a companying CDROM. I found by Google that an online format is available for its earlier 2 edition . HoweverThe book will help one keep current with the biotechnology and nanotechnology terminology, communicate successfully with those working on the cutting-edge of modern science and enter interdisciplinary collaborations. This book is recommended to scientists, engineers, attorneys, government workers, lobbyists, venture capitalists, and university tech transfer staff, especially for personnel with no advanced training in biological and chemical sciences to understand concepts and buzzwords that are indispensable to their work. Nevertheless, biotechnologist, who is probably only an expert in one of the diverse areas of biotechnology, and advanced students in one of the many biotechnology fields, may find it useful."}
+{"text": "Benoit Mandelbrot has produced a comprehensive, well-presented review of essential topics related to Mandelbrot set theory and applications. The last part of the title \"The Mandelbrot set and beyond\" fully describes its potential allowing the reader to navigate through pictures, hard-to-find early papers and important and effective chapters on the historical background. All chapters are assembled in a way that the overall mix becomes a very well integrated source of know-how and knowledge bringing the readers into the Mandelbrot set world. The spirit of the book is well summarized in a sentence on page 34: \"When seeking new insights, I look, look, look, and play with many pictures. (One picture is never enough).\" It is certainly true that in the last twenty years, mathematics has changed so deeply that to younger persons some chapter's stories might be simply incredible (p.36), as well, one should admit that after Mandelbrot's sets, initially describing trees, coastlines' shapes or allowing measuring the length of the Britain coast, and after the seminal book on \"The Fractal Geometry of Nature\" our way of looking at the world changed. Mandelbrot wrote: \"Why is geometry often described as 'cold' and 'dry'? One reason lies in its inability to describe the shape of a cloud, a mountain, a coastline or a tree. Clouds are not spheres, mountains are not cones, coastlines are not circles, and bark is not smooth, nor does lightning travel in a straight line\". I think our vision of the world, from the atom to the higher length scales, is still changing using those concepts clearly illustrated in the current Mandelbrot's book. Selected notes and papers make this book unique within the several books published on this topic. It is clear the touch of the author under all aspects: a touch of pure genius.There are five main topics dominating the book, namely: Quadratic iteration and its Mandelbrot set \u2013 Quadratic Julia and Mandelbrot sets; Nonquadratic iterations \u2013 Nonquadratic rational dynamics; Kleinian groups' limit set \u2013 Iterated nonlinear function systems and the fractal limit sets of Kleinian groups; Multifractal invariant measures \u2013 Exponentially vanishing multifractal measures; Background and History. Cumulative bibliography is impressive and well done. It is clearly pointed out, following the pathway through the book, how fractal geometry played an important role in offering a quantitative tool in several areas. Circumstances and facts are put together also to bring important lessons for young scientists. The author made a serious and effective effort to realize a book that contains more than history, more than mathematics... it is a sort of ideal book for stimulating new ideas, new concepts, and new discoveries. So far, it is an excellent book also for supporting courses at University, PhD and Post doc level. Moreover, it is indispensable for scientists not only as a lesson of a pathway in science but also as an important source for science of tomorrow. This is a valuable reference source to researchers from these and related areas including bioengineering, biophysics, nanobiosciences and, of course, applied mathematics."}
+{"text": "This book by Leah Edelstein-Keshet, \"Mathematical Models in Biology,\" is a discovery that delighted me at once. It is simple to read and well organized, with basics of mathematics given in chapters separated from applications and examples. At first glance it might be taken more as a book for researchers already involved in the fields of biology, biophysics, and physical medicine rather than a text book for graduate students. To be sure, many of the biologists who are slowly discovering that mathematics is essential to understand modern biology and medicine, will find this book to be a guided tour to many of the mathematical fields connected to the life sciences. However, also students in the mathematical and physical sciences will find in this book a detailed guide to the field of mathematical modeling biological processes.Although some of the newest fields in mathematical modeling of biological systems are only cited in this text, the way the basic ideas in modeling are presented is an essential step for future studies. This major goal of the book is reached by always giving the basic tools of mathematics and calculus in short separate chapters or in boxes in the text. Few mathematical concepts are needed for a reader who is new to this field. Moreover, the author expends much effort in presenting and explaining the methods of mathematical modeling of biological problems. Many examples are discussed in the text, and numerous others are given as guided exercises at the end of each chapter.These features would actually allow the book to be used as an excellent text book in courses for biophysics or biology curriculums. But more than this, the text offers deep insights into higher mathematical concepts and methods that are extremely useful for active researchers.In summary, \"Mathematical Models in Biology\" by Leah Edelstein-Keshet is an essential step for students and researchers active in a wide variety of fields; from cell and molecular biophysics to classical biology."}
+{"text": "Emerging Infections in Asia comprises a selection of scientific and historical review chapters on a variety of infectious diseases and includes contributors from diverse locations ranging from Saudi Arabia to Australia. The book arose from the editors\u2019 experience with the emerging infections described and from their professional associations with the other contributors. The book is divided into 3 disease-specific sections that focus on avian influenza, severe acute respiratory syndrome (SARS), and HIV/AIDS, respectively; a fourth section contains short reviews of other infections. Because of the relatively small size of the book for such a broad topic (250 pages), each section covers only a few specific topics for each selected disease.Escherichia coli and Staphylococcus aureus) that are often overshadowed by more glamorous emerging infections. However, it is disappointing in that the first 2 chapters contradict one another on the occurrence of person-to-person transmission of influenza virus A (H5N1), and the chapter on SARS in China could have been improved with more rigorous editing. Most chapters appear to have been written around 2006, and although they provide good snapshots of the state of knowledge at that time, readers will need to look elsewhere for more recent developments.The book contains some well-written reviews and valuable narrative histories that are important to document . The chapters on SARS in animals and emerging paramyxoviruses are particularly interesting, and the book includes topics (e.g., Emerging Infections in Asia also misses an opportunity to pull together the diverse topics and experiences discussed to provide new insights into the emergence of infectious diseases and into responses to the constantly shifting challenge of emerging infections. Recognizing this drawback, the editors say in their preface, \u201cWe hope that our book can help readers make their own conclusions and ask more questions.\u201d Approached in this context, the book provides an account of the diversity and challenges of emerging infectious diseases in Asia and some informative historical reviews that will be of interest to students exploring this fascinating topic."}
+{"text": "An estimated 70% or more of emerging infectious disease agents have some form of vector. The author of this book, Norman Gratz, a medical entomologist, has written a very valuable resource on vectorborne and rodentborne diseases found in Europe and North America. His book includes information on diseases transmitted by mosquitoes, ticks, rodents, mites, sandflies, fleas, lice, biting midges, diptera, triatomines, and cockroaches. As a text, it is impressive that one man has such a breadth of knowledge of these diseases, although some credit must go to Mike Service, who helped prepare the manuscript for publication after the death of the author.Unlike most books on this subject, which concentrate on describing the agent and its molecular properties, this book focuses on public health aspects of the diseases, and most chapters are divided on the basis of the vector that carries the agents. The chapters describe the history of the agents and details of incidence by country, year, and important ecologic parameters. The details of the number of cases of each disease by year are particularly impressive. Many chapters have a conclusion section with an overview of the public health importance of the disease, interpretation of the risk of the disease, and identification of our knowledge gaps. In addition, some chapters are devoted to the economic effects of vectorborne and rodentborne diseases in Europe and North America.This is a very readable text or reference book for those who want to know about a specific vectorborne or rodentborne disease in Europe or North America through 2003\u20132004. The only weakness I could find is that although the word \u201ccontrol\u201d is used in the title, the book contains relatively little information on this subject. However, the depth of other areas compensates for a lack of information about control.Overall, I recommend this to anyone who needs a reference book on vectorborne and rodentborne diseases. All we need now is an equivalent reference for such diseases in Africa, Asia, Australasia, and South America!"}
+{"text": "Exposure: A Guide to Sources of Infection is a dense reference book suited for health professionals and public health officials working within the realm of infectious diseases. This book does not use the typical format of solely detailing microbes in succession. Instead, it takes the novel approach of organizing microbes by sources of exposure, as stated in the title. Sections include animals, the environment, foods, humans, travel, and nosocomial infections. A listing of microbes is provided in the last section, followed by an exposure checklist in the appendix.By compiling >250 pages of references, the author has tried to give a detailed and current review of the literature. Although some readers may not find this level of detail useful, it is interesting and does propel the reader to think beyond the usual microbes and their common routes of exposure. The author is particularly sensitive to the international nature of infectious diseases and has worked hard to thoroughly discuss cases and outbreaks that have occurred throughout the world. This is particularly evident in the last section of the book, which employs the more familiar format of listing microbes alphabetically. The author cites the effects of many infectious agents by detailing where the microbe is usually found, its prevalence, virulence, and mode of spread.As the author states, the scope of the book is not clinical but rather epidemiologic. Therefore, this publication does not specifically provide suggestions for treatment and management decisions. However, this book stresses the need to be more conscientious of the many modes of infections, which may prompt a diagnosis that otherwise may have been missed."}
+{"text": "Very few studies have evaluated the adverse effect of passive smoking exposure among active smokers, probably due to the unproven assumption that the dose of toxic compounds that a smoker inhales by passive smoke is negligible compared to the dose inhaled by active smoke.In a controlled situation of indoor active smoking, we compared daily benzo(a)pyrene (BaP) dose, estimated to be inhaled by smokers due to the mainstream (MS) of cigarettes they have smoked, to the measured environmental tobacco smoke (ETS) they inhaled in an indoor environment. For this aim, we re-examined our previous study on daily personal exposure to BaP of thirty newsagents, according to their smoking habits.2 = 0.62) with estimated BaP dose from MS of daily smoked cigarettes. In smoker subjects, the percentage of BaP daily dose due to ETS, in comparison to mainstream dose due to smoked cigarettes, was estimated with 95% confidence interval, between 14.6% and 23% for full flavour cigarettes and between 21% and 34% for full flavour light cigarettes.Daily BaP dose due to indoor environmental contamination measured inside newsstands (traffic emission and ETS produced by smoker newsagents) was linearly correlated (p = 0.001 RDuring indoor smoking, ETS contribution to total BaP dose of the same smoker, may be not negligible. Therefore both active and passive smoking exposures should be considered in studies about health of active smokers. Smokers inhale BaP and other toxic compounds present in the MS of their cigarettes , but if Several studies provide evidence of a causal association between passive smoking in non-smokers and lung cancer or ischemic heart disease -5. A preThe low interest in studying the role of ETS on smoker health is probably due to the assumption that the added dose of toxic compounds to smokers from their own passive smoking is negligible, compared to the dose they voluntarily inhale by their cigarettes. According to our bibliographic review, this assumption is not supported by any experimental measures.To evaluate the role of ETS in total daily dose of carcinogens inhaled by smokers, a study regarding the personal exposures to benzo(a)pyrene of newsagents working in Genoa, Italy, was re-examined .2) naturally ventilated newsstands; b) newsstands are completely closed and only with a window to serve clients; c) only electric stoves are used for heating; d) newsstands are occupied by only one person. Therefore ETS pollutants measured inside the newsstand are strictly correlated to the number of cigarettes that each newsagent declared to smoke. Personal sampling was carried out continuously for 24 hours, starting from the opening of newsstand, early in the morning. After their working-day, all the studied newsagents went back home, where they spent the rest of the sampling time.Newsagents were chosen because their personal daily exposures to air and ETS contaminants may be easily monitored, with very few confounders: a) Italian newsagents spend 12 hours a day in small , were chosen for the present investigation. Smokers had a mean daily consumption of fourteen cigarettes  and, according to their statements, none of them, at home was exposed to ETS produced by other smokers.3) [Environmental BaP (Env-BaP) doses (ng/day) were calculated multiplying each measured BaP exposure by the mean air volume, that is estimated to be breathed daily by an adult during moderate activity (20 m3) .Therefore, Env-BaP dose includes BaP from urban sources and BaP from environmental tobacco smoke (ETS-BaP).Daily BaP doses of smokers, inhaled by mainstream smoke (MS-BaP) were estimated by the declared cigarette daily consumption, multiplied by the mean BaP amount measured in the MS of full flavour (FF) and full flavour light (FFL) U.S. cigarettes, sold in 1998: 10.17 ng/cig (range: 7.89 - 12.81) and 6.75 (range: 4.92 - 8.07) respectively [Correlations between measured Env-BaP and estimated MS-BaP daily doses, according to the two \"tar\" categories were studied taking into account variation coefficient of BaP yields in MS, according to Swauger et al.  and accuThe mean and standard deviation of Env-BaP doses of non-smoker and smoker newsagents were 18.2 \u00b1 7.1 and 38.4 \u00b1 12.4 ng/d respectively. Inhalation of the MS of fourteen cigarettes per day , according to the tar cigarette category, increases the BaP dose by an additional 142.4 ng/day (FF) or 94.5 ng/day (FFL).Figure The regression equations for the two cigarette categories (FF and FFL) are the following:Smokers' Env-BaP dose increases linearly with their estimated MS-BaP dose (i.e. number of cigarettes daily smoked), according to equations 1 and 2.Therefore, slopes of the two regression equations permit to evaluate the ratio between the daily BaP dose due to the inhalation of mainstream of smoked cigarettes and the daily dose due to ETS produced by the same cigarettes.The 95% confidence interval for slope of equation 1 is 0.146 - 0.230 and for slope of equation 2, it is 0.210 - 0.340. Since the failure to reject the null hypothesis about similarity of slopes (tested by Fieller's theorem), does not mean equivalence, the two regressions are treated separately to quantify the mean contribution of the doses of ETS, relative to MS, under the two scenarios.If FF cigarettes were smoked, the daily dose of BaP inhaled by our smoker group, due to ETS, might be, with a probability of 95%, between 14.6 and 23.0 percent (mean: 18.5%) of the BaP dose due only to the mainstream smoke. If all smoked cigarettes were FFL, the estimated ETS contribution should be between 21.0 and 34.0 percent (mean: 27.4%).The average smoker of this study (14 FF cigarettes/d) inhales daily 182 ng of BaP, so composed: 142.4 ng (78%) from MS, 26.3 ng (14.4%) from ETS, 13.3 ng (7.3%) from urban pollution.In this example, the contribution to daily BaP dose due to ETS and urban air pollution is equivalent to smoking 2.6 and 1.3 FF cigarettes, respectively.Therefore, this study suggests that to correctly classify smokers, according to their total ambient air BaP exposures, ETS exposures cannot be ignored as well as exposures due to heavy air pollution.There are some uncertainties in these estimations, particularly about the real inhalation rates during the different daily activities and the different personal smoking behaviour . HoweverResults of this study on BaP exposure of newsagents, according to their smoking habits, suggest that exposure to their own environmental smoke cannot be negligible, if smoking occurs in indoor environments. Therefore our conclusions are that both active and passive smoking contributions should always be considered in studies about health of active smokers. We suggest that one of the questions to submit to the participant subjects may be: \"How many hours daily do you smoke in closed environment and together with other smokers?\" This indirect estimation of exposure should be linked with the evaluation of specific markers of tobacco smoke , and/or with biomarkers of exposure (i.e. cotinine), in order to verify the real exposure and prevent misclassification.BaP: Benzo(a)pyrene; MS: mainstream; ETS: environmental tobacco smoke; Env-BaP: BaP derived from urban air pollution and environmental tobacco smoke; ETS-BaP: BaP derived from environmental tobacco smoke; MS-BaP: BaP derived from mainstream of smoked cigarettes; FF: full flavour cigarettes; FFL: full flavour light cigarettes.The authors declare that they have no competing interests.FV have made substantial contribution to conception, design and interpretation of data.MTP contributed to acquisition, analysis and interpretation of data.AS carried out statistical analysis.All authors read and approved the final manuscript."}
+{"text": "OPA1 result in autosomal dominant optic atrophy (DOA). The molecular mechanisms by which link OPA1 mutations and DOA are not fully understood. Recently, we created a Drosophila model to study the pathogenesis of optic atrophy. Heterozygous mutation of Drosophila OPA1 (dOpa1) by P-element insertion dOpa1 causes rough (mispatterning) and glossy (decreased lens deposition) eye phenotypes in adult Drosophila. In humans, heterozygous mutations in OPA1 have been associated with mitochondrial dysfunction, which is predicted to affect multiple organs. In this study, we demonstrated that heterozygous dOpa1 mutation perturbs the visual function and an ERG profile of the Drosophila compound eye. We independently showed that antioxidants delayed the onset of mutant phenotypes in ERG and improved larval vision function in phototaxis assay. Furthermore, heterozygous dOpa1 mutation also caused decreased heart rate, increased heart arrhythmia, and poor tolerance to stress induced by electrical pacing. However, antioxidants had no effects on the dysfunctional heart of heterozygous dOpa1 mutants. Under stress, heterozygous dOpa1 mutations caused reduced escape response, suggesting abnormal function of the skeletal muscles. Our dOpa1 shows organ-specific pathogenesis and is associated with multiple organ abnormalities in an age-dependent and organ-specific manner.Optic Atrophy 1 (OPA1) is a ubiquitously expressed dynamin-like GTPase in the inner mitochondrial membrane. It plays important roles in mitochondrial fusion, apoptosis, reactive oxygen species (ROS) and ATP production. Mutations of  OPA1 gene OPA1 is encoded by a ubiquitously expressed nuclear gene and localized in the inner mitochondrial membrane OPA1 mutation could cause multiple organ abnormalities OPA1 mutations.Previous studies suggest that OPA1 mutations may cause multiple organ anomalies. This is supported by several lines of evidence. First, OPA1 is a ubiquitously expressed protein Drosophila model of optic atrophy Drosophila models for studying eye disorders: 1) significant cost and time savings; 2) eye phenotypes are easier to detect in Drosophila than in other models; 3) the Drosophila eye is non-essential for viability. Versatile technologies exist for generating, identifying and characterizing mutations in the Drosophila retina, making this an unrivaled system for deciphering gene function. In addition, there is a high degree of similarity between Drosophila Opa1 and human OPA1Drosophila knockout model for optic atrophy. Heterozygous mutation of dOpa1 induced by a P-element or transposon insertion caused no structural abnormalities under a light microscope, whereas homozygous mutation resulted in embryonic lethality. In the eye-specific somatic clones, homozygous mutation of dOpa1 caused rough (mispatterning) and glossy (decreased lens deposition) eye phenotypes in adult Drosophila and is associated with increased ROS production Drosophila under a light microscope could still have abnormal function and warrant further analysis.We have developed a dOpa1 mutation affects the function of multiple organs and the underlying mechanisms in Drosophila. Specifically, we examined eye, heart and skeletal muscle in heterozygous dOpa1 Drosophila mutants. Our result showed that heterozygous dOpa1 mutation resulted in abnormal electroretinograms (ERG) in an age-dependent manner. Abnormal visual function was also demonstrated in a phototxis assay. The abnormal ERG and visual dysfunction could be partially rescued by antioxidant treatment. Heterozygous dOpa1 Drosophila mutants also showed reduced heart rate, increased heart arrhythmias, and poor heart function as indicated by decreases in fractional shortening and increased heart failure in response to electrical pacing. Additionally, under heat shock stress, the heterozygous mutants showed reduced escape response suggesting reduced muscle function. Our dOpa1 could cause multiple organ abnormalities and that ROS may play a role in the development of some organs, but not others, suggesting that the pathogenesis could be organ specific.To study OPA1 function and whether the loss of function is linked to the development of multiple organ abnormalities, we determined if heterozygous dOpa1 mutation in Drosophila eyes. Loss of a single copy of dOpa1 did not elicit a gross eye phenotype other than morphologically perturbed mitochondria in transmission electron microscopy (TEM) +/\u2212dOpa1 and +/+dOpa1 control Drosophila were aged and their ERG profiles measured every 7 days for 6 weeks. As shown in dOpa1 resulted in perturbed ERG profiles in an age-dependent manner. The +/\u2212dOpa1 mutants showed an age-dependent progressively worsening reduction in the on-/off-transients beginning at 28 d.o., but no reduction in the peak amplitude for the six weeks tested  and then a sustained corneal-negative photoreceptor response followed by an off-transient when the light stimulus was turned off. ERGs with different intensities of orange light stimuli, Or,-4 (B), Or,-2 (C), and Or (D), are superimposed to show the differences in the on-transient amplitudes. There was a severe reduction in the on-transient amplitude in +/\u2212dOpa1 eyes with brighter Or (D), but not with a dimmer stimulus (B). Our data showed that in +/+dOpa1, there was no significant age-dependent reduction in peak (E) or on-transient amplitudes (G) over the range of light stimuli tested. However, in +/\u2212dOpa1, there was a significant age-dependent reduction in on-transient amplitudes (H) but not in peak amplitudes (F). Since the on-transient has been shown to be originated from the laminar monopolar L1 and L2 neurons +/\u2212dOpa1 mutation has no apparent effect on photoreceptor function but has an effect on laminar neuron function or synaptic transmission between the photoreceptor cells and their target laminar neurons.Previously, we have analyzed the effects of s tested . Since t+/\u2212 DrosophiladOpa1 of different ages. There was an age-dependent progressive reduction of the on-transient amplitudes and the defect could be detected over a wider range of light stimuli in the older +/\u2212 DrosophiladOpa1 (+/\u2212dOpa1 was only seen with the two brightest light stimuli (B). At 35 d.o., +/\u2212dOpa1 showed significantly reduced on-transient amplitudes with Or,-2, Or,-1, and Or light stimuli (C). At 42 d.o., reduction in on-transient amplitudes was manifested in all but the dimmest stimulus in +/\u2212dOpa1 (D).To study the effect of age in detail, on-transient amplitudes were compared among osophila . At 28 dDrosophila that were fed with antioxidant-containing diet. As shown in +/\u2212dOpa1 mutant at all tested ages. Although the differences in on-transient amplitudes between +/\u2212dOpa1 and antioxidant fed +/\u2212dOpa1 (+/\u2212antioxdOpa1) were non-significant, the latter consistently showed larger mean on-transient amplitudes at all light intensities tested and a slower reduction in on-transient amplitude with age when compared with +/+dOpa1. At 35 d.o., a significant reduction in on-transient amplitude was seen only with the brightest light stimulus in +/\u2212antioxdOpa1 (+/\u2212antioxdOpa1 showed significantly reduced on-transient amplitudes at the brightest two Or stimuli (F), while +/\u2212dOpa1 showed a significant reduction over a wider range of Or light stimuli (D). Thus, antioxidant fed +/\u2212dOpa1 delayed the onset of on-transient defect by one to two weeks. These To test if the defect found could be reversed by antioxidant treatment, on-transient amplitudes were determined in 7 to 42 d.o. /\u2212antiox . At 42 ddOpa1 mutation affects visual functions at an earlier stage of fly development, we examined the larval visual system in +/\u2212dOpa1 heterozygous mutants with a phototaxis assay. This assay allowed us to measure larval visual phototactic response to light  , while wild-type +/+dOpa1 exhibited strong negative phototactic behavior   . However p<0.05) . These r+/\u2212dOpa1heterozygous mutants, +/+dOpa1 and +/\u2212 DrosophiladOpa1 were treated with antioxidant. Again, fifty second-instar larvae were collected and the phototaxis assay was repeated three times. In the absence of the light, average RI for +/+dOpa1 and +/\u2212dOpa1 treated with antioxidant were similar  (data not shown). In the presence of light, antioxidant treatment made no difference in wild-type +/+dOpa1 (RI\u200a=\u200a0.667), while mutant +/\u2212dOpa1 showed a significant increase in phototatic response  may affect the rate and rhythm of the heart, we removed the Drosophila head, ventral thorax, ventral abdominal cuticle and all internal organs as described previously Drosophila hearts were then exposed and video recorded for 30 seconds  were tested at week 3. As shown in dOpa1 mutants  and during systole . We calculated the percent fractional shortening (FS) from the heart diameter measurements as an estimate of cardiac contractility (33). These dOpa1 mutations led to a significant reduction in FS  suggesting a loss of myocardial contractility. In order to determine if excess ROS production played a role in these observed cardiac abnormalities, we treated the Drosophila with antioxidant (100 \u00b5M MnTBAP). Our dOpa1mutants. This suggests that changes in ROS production do not mediate the observed effects of OPA mutations on the heart. Instead, heterozygous mutation of dOpa1 leads to a respiratory defect in Complex II and III of the electron transport chain (ETC) as shown in our recent publication There is a sexual dimorphism in overall heart size with female hearts generally being larger than those of males, as has been previously reportedOpa 1 mutants. 80 Drosophila of each genotype  were tested for heart failure in response to electrical pacing for six consecutive weeks starting at one week of age. Fly hearts were paced with external electrical pacing and heart function was observed immediately following and two minutes after pacing. The effect on heart function was defined as \u201cheart failure\u201d if the heart did not resume a normal beating pattern after a two minute rest period following electrical pacing. Our result showed that heart failure in response to electrical pacing increased with age in all flies tested . We then tested if heat-shock stress had an impact on the escape response of +/\u2212dOpa1 and +/+ DrosophiladOpa1. For this experiment, Drosophila in vials were startled by tapping them to the bottom of the vial. The climbing capacity, before and after a 10-min 37\u00b0C heat shock, was determined by calculating the percentage of flies that climbed up>1.0 cm within 15 seconds (locomotive index). The time required for the locomotive index to exceed 50% (recovery time) was also determined To determine the effect of termined . There w minutes . These rOPA1 can lead to DOA and is one of the most common genetic causes of degeneration of retinal ganglion cells, leading to blindness. The main clinical features of DOA include reduced visual acuity, color vision abnormalities, centrocaecal visual field defects and pallor of the optic nerve head. However, the OPA1 gene is ubiquitously expressed and recent studies have suggested that mutation of OPA1 OPA1 may affect the cardiac and skeletal function, which prompted us to analyze function of multiple organs in our Drosophila dOpa1 mutant model. Here we show that heterozygous +/\u2212dOpa1 mutations not only perturb eye function, but also decrease cardiac function and decrease escape responses under stress. These Mutation of +/\u2212 DrosophiladOpa1 suggest that photorecptor function is normal but either laminar neuron function or synaptic transmission between the photoreceptor and the laminar neuron is impaired. Based on the correlation with age and the fact that antioxidants partially rescued the phenotype of ERG and vision loss, our An electroretinogram (ERG) is an extracellular recording of the compound eye and their synaptic targets, the laminar neurons dOpa1 mutations, suggesting that these mutations result in cardiac dysfunction primarily by affecting mitochondrial ATP production rather than by increasing ROS production.A number of studies have implicated mitochondrial defects in cardiac dysfunction. Mitochondrial dysfunction can cause decreased ATP production and/or increased ROS production, and either outcome can lead to cardiac cellular damage. Mutations affecting mitochondrial function have been shown to cause Leber's Hereditary Optic Neuropathy (LHON), MERRF, MELAS, Chronic Progressive External Ophthalmoplegia (CPEO), Kearns-Sayre Syndrome (KSS), and various other pediatric and adult cardiomyopathies. In Friedreich ataxia, mutations occur in the nuclear frataxin gene. Frataxin encodes a mitochondrial inner membrane protein, which transports iron out of the mitochondrial matrix. In the absence of frataxin, iron accumulates in the mitochondria, stimulating the Fenton reaction and ROS production dOpa1 mutation caused reduced escape response, suggesting the possibility of abnormal function of the skeletal muscles.Mitochondrial dysfunction has been associated with many skeletal abnormalities such as MERRF. Recently, two groups reported that several OPA1 mutations cause \u201coptic atrophy plus syndrome\u201d. In addition to optic atrophy, the clinical phenotypes of \u201coptic atrophy plus syndrome\u201d was reported +/\u2212dOpa1 on Drosophila organ systems showed that organ dysfunction developed in an age-dependant manner, consistent with the clinical optic atrophy phenotype. In humans, the onset of most optic atrophies is in childhood and the pathologies typically include progressive bilateral loss of visual acuity, abnormal color vision dOpa1 mutation The analysis of the effect of OPA1 causes mitochondrial dysfunction, including fragmentation, decreased ATP production, increased ROS production and decreased mitochondrial membrane potentials Dominant optic atrophy is one of the most common forms of inherited optic neuropathy ey-FLP.N}2; P{ry[+t7.2]\u200a=\u200aneoFRT}42D PBac{WH}CG8479f02779 (+/\u2212dOpa1) and y[d2] w[1118] P{ry[+t7.2]\u200a=\u200aey-FLP.N}2; P{ry[+t7.2]\u200a=\u200aneoFRT}42D PBac{WH}CG8479f03594 (+/+dOpa1) Drosophila were used in this study. The stocks were established in a previous study +/\u2212dOpa1 mutants and +/+dOpa1 controls were transferred to fresh food every two to three days while aging. +/\u2212dOpa1(antiox)Drosophila and +/+dOpa1(antiox)Drosophila were maintained on 100 \u00b5M MnTBAP antioxidant food.y[d2] w[1118] P{ry[+t7.2]\u200a=\u200aDrosophila. A 300-Watt Halogen lamp (OSRAM) with an unattenuated intensity of 810 \u00b5W/cm2 at the level of the photoreceptors was used for light stimuli. Kodak neutral filters and a Corning orange (Or) filter were used to achieve the desired light intensity and color for the light stimuli. For each stimulus, the Drosophila was first dark-adapted for 3 minutes and then given a 1 second light stimulus. Orange light stimuli were used because they elicit larger on-transient amplitudes than white light stimuli. All recordings were made at 25\u00b0C. Signals were sampled at 2 kHz with an analog-to-digital converter (Digidata 1200A), and the data were acquired and analyzed using a computer with Axoscope (Axon Instruments).ERGs were performed as previously described The phototaxis assay tested larval visual response using methods according to Lilly and Carlson Drosophila were dissected under an oxygenated saline solution that served as artificial hemolymph, composed of NaCl2 (108 mM), KCl (5 mM), CaCl2 (2 mM), MgCl2 (8 mM), NaH2PO4 (1 mM), NaHCO3 (4 mM), HEPES (15 mM), sucrose (10 mM), trehalose (5 mM), pH 7.1,as described previously  A Hamamatsu EM-CCD digital camera  mounted on a Leica DM LFSA microscope with a 10 x water immersion lens  and Simple PCI image capture software  was used to digitally record beating hearts in semi-intact Drosophila preparation www.r-project.org).Drosophila heart function was tested using an electrical pacing assay as previously described[49]. Briefly, Drosophila were anesthetizes by exposing to triethylamine , and were placed on glass microscope slides with their heads and posterior abdomens touching two strips of conductive electrode gel. A square wave stimulator was used to pace the heart at 40V and 6 Hz for 30 s. The assay was done under an inverted microscope and an X25 objective. Each Drosophila was visually checked for cardiac arrest or fibrillation immediately after pacing and then two minutes after pacing. Data were analyzed using a Chi-square test.Drosophila were placed in 9\u00d72 cm tubes with a line drawn horizontally 1 cm from the base. Every 30 seconds, the tubes were tapped until all Drosophila fell to the bottom of the tubes. A baseline locomotive index (number of Drosophila above the 1 cm line after 15 seconds) was established at 22\u00b0C. The Drosophila were then subjected to a 20 minute 37\u00b0C heat treatment and returned to 22\u00b0C. The locomotive indexes were recorded as the samples were allowed to recover Figure S1dOpa1+/\u2212 Drosophila is not associated with major mitochondrial DNA deletions. Total genomic DNA from 3 wk and 6 wk old dOpa1+/\u2212 and dOpa1+/+ flies were fractionated by agarose gel electrophoresis,visualized by ethidium bromide staining and then transferred to nylon membrane. Digoxigenin-tagged DNA probe  were generated by random primer labeling, hybridized to target sequences, bound by anti-digoxigenin-AP, Fab fragments, and then detected with CDP-Star (Roche). Panel B, Southern blot for mitochondrial genome, showing a very similar pattern in dOpa1+/\u2212 and dOpa1+/+ (Panel B).(0.40 MB DOC)Click here for additional data file."}
+{"text": "A nanopore detector has a nanometer-scale trans-membrane channel across which a potential difference is established, resulting in an ionic current through the channel in the pA-nA range. A distinctive channel current blockade signal is created as individually \"captured\" DNA molecules interact with the channel and modulate the channel's ionic current. The nanopore detector is sensitive enough that nearly identical DNA molecules can be classified with very high accuracy using machine learning techniques such as Hidden Markov Models (HMMs) and Support Vector Machines (SVMs).A non-standard implementation of an HMM, emission inversion, is used for improved classification. Additional features are considered for the feature vector employed by the SVM for classification as well: The addition of a single feature representing spike density is shown to notably improve classification results. Another, much larger, feature set expansion was studied , deriving from including all the HMM's transition probabilities. The expanded features can introduce redundant, noisy information (as well as diagnostic information) into the current feature set, and thus degrade classification performance. A hybrid Adaptive Boosting approach was used for feature selection to alleviate this problem.The methods shown here, for more informed feature extraction, improve both classification and provide biologists and chemists with tools for obtaining a better understanding of the kinetic properties of molecules of interest. This current reading is normalized to the baseline \u2013 taken to be the average current reading just before the capture event occurred. An average baseline reading of 120pA and a current reading of 70pA, for example, corresponds to a normalized value of 58.33% baseline. Then, using a bin size of one, the value of 58 is used as the current state.  For most of the data studied in these experiments, almost all capture events take place between 20- and 70% blockade. Thus, only fifty states are used in an effort to help ease computational complexity \u2013 as input scales linearly, computation time scales quadratically. In the implementation of the HMM, the states are chosen with this observation in mind. In the previous example, our state of 58 would correspond to state 38. This process of scaling raw data to actual states is referred to as \"quantization\".After the data is quantized, five rounds of Expectation Maximization are run to obtain accurate estimates of emission and transition probabilities. Initially, emissions for each state 'L', corresponding to a blockade at level 'L', is set to a gaussian with mean at L and unit variance. In addition, all transitions are equally likely. Expectation Maximization serves to obtain a more accurate measure of emissions and transitions based on the observed signal. A standard Viterbi algorithm is then run in order to de-noise the signal \u2013 that is, obtain the most likely path of states that created the observed signal. The process of finding the most likely path of states obtained by the Viterbi algorithm typically reduces the noise in the channel current signal.After the Viterbi algorithm is run, a 150-component feature vector is created for the given signal. Each feature vector consists of three distinct sets of information. The first 50 components come directly from the 50 previously described states of the HMM. These components are level occupation probabilities (a histogram view) for each state calculated after the Viterbit trace back algorithm yields the most likely path. The second set of 50 components is composed of the variances of the emission probabilities. The third and final set of 50 components is composed of a weighted sum of transition probabilities from the dominant levels of a given signal.One refinement to the standard implementation of an HMM, presented here, involves the initial manipulation of the emission probabilities as they are entered in to the HMM. The emission probabilities are the main place where the observed data is brought into the HMM-EM algorithm and can be viewed conceptually as the probability of emitting a hidden or true state given an actual or observed state. By exchanging the roles of the true and actual states, an additional contribution arises that is approximately a locally distributed entropy that is introduced at the cellular level in the standard Viterbi dynamic programming table (see Methods). While the exact theoretical underpinnings of this method are still being researched, it is clear that this \"emission inversion\" improves classification performance.In addition to the 150-component feature vectors and the emission inversion technique already described, additional information can also be extracted. The effects of the addition of a spike density feature are explored, where a spike is defined as an anomalous, deep blockade of channel current from the lower level of a given signal.Another variation on a standard HMM, Emission Variance Amplification is discussed. Here, the goal is to obtain dwell time information for the levels of a given molecule. From this information, the half-life, and thus, the stability of a given level can be determined. However, channel current data is noisy and building a Finite State Automaton to accurately model this noisy data can be difficult. Moreover, this model would not be easily re-usable for other channel current analysis without significant restructuring and re-tuning. Here, an HMM with EVA is used to reduce the gaussian noise bands around a given level while still strictly retaining transitions between levels. This method was first introduced in  and is uAdaptive Boosting (AdaBoosting) is typically used for classification purposes. In general, AdaBoost is an iterative process that uses a collection of weak learners to create a strong classifier. Training data is given a weight, and at each iteration, the weak learners are trained on this weighted data. Weights for these data points are then updated based on the error rate of the weak learner and whether a given data point was classified correctly or not. The consensus vote at each iteration is treated as a hypothesis, and weights are given to a hypothesis based on its accuracy. At the end of the iterative process, final classification is done using all hypotheses and their corresponding weights  are variational-calculus based methods that are constrained to have structural risk minimization (SRM) such that they provide noise tolerant solutions for pattern recognition ,14. SimpThe SVM approach encapsulates a significant amount of model-fitting information in its choice of kernel. In some sense, the SVM kernel provides a notion of distance to the decision hyperplane. Novel, information-theoretic, kernels were successfully employed for notably better performance over standard kernels in prior work,15.Thus, SVMs are fast, easily trained, discriminators ,14, for In what follows, results are described for the proposed extensions and improvements to existing methods in the feature extraction architecture. Improvements in feature extraction and types of features are discussed. Specifically, emission inversion, the addition of a spike density feature, and HMM with EVA are discussed. In addition, a new method of feature selection is shown. The effects of using AdaBoost on a full set of transition probabilities versus a scheme for manually compressing transition probabilities are shown.Observed data is brought into the HMM/EM process chiefly through the emission probabilities. Through running the HMM in debug mode and observing the interactions of various components, an interesting twist on traditional emission probabilities was found \u2013 when the observed states and emitted states share the same alphabet the roles of observed states and emitted states can be reversed for possible improvement to classification performance.Data used from these experiments were the 9bphp data shown in Figure Experimentally, this emission inversion works well with channel current data as shown in Figure In nearly all cases studied, inverting the emissions provides a performance increase in accuracy, stability, or both accuracy and stability. For some molecules, this performance increase was more significant than others and in one case, out of the ten permutations studied, performance was marginally better using a standard HMM without emission inversion .In addition to the level occupation probability, emission probability, and transition probability, the spike density from the lower level of a given molecule has been identified as a possibly significant feature. A spike event \u2013 an anomalous, deep blockade of channel current \u2013 from the lower level is conceptually seen as a fraying of the last few termini of a given molecule. Thus, a measure of spike density can yield information about the stability of the final few base pairings. For this analysis, data obtained from collaborators at NASA/AMES was used . In some sense, however, classification performance is the ultimate judge of the validity of a given method. As described in the Results section, the SVM classification performance is strongest when using emission inversion.There are currently a couple of caveats. Emission inversion only works when the emitted and observed states share the same alphabet \u2013 with the channel current blockade analysis platform this restriction holds. Another caveat is that this method may be strongly data dependent. Only channel current data has been studied using this method for feature extraction, and it is entirely possible that emission inversion does not improve classification on other datasets. In this particular application, the AdaBoost feature selection provides a simple fix to the choice of what features to use. Simply create datasets that include extracted features from both a standard HMM implementation and a HMM implementation with emission inversion and let AdaBoost select the most diagnostic features in an automated way.The results described above clearly show that spike density from the lower level is an important feature. Obtaining the spike density feature (described in Methods) is straightforward. However, adding this feature to the existing 150- or 2600-component feature sets currently requires tuning. Simply adding the spike density feature to an existing feature vector already containing 150 features will obscure the effect of the spike density feature almost completely. Thus, a weight must be added to this new feature. Should the weight be too heavy, though, the effect of the other features will be obscured. Currently, the weighting factor is tuned over in order to arrive at a weighting such that the spike density feature improves classification without obscuring the contribution of other features.A few automated solutions are suggested for future work. One proposed solution is to simply add the un-weighted spike density feature to the existing feature vector and use AdaBoost to select the most diagnostic features. This approach will essentially create a weight for the spike density feature. That is, by removing many components that only add noise to a given feature vector, the remaining features are given more weight. Another solution that is currently being worked on is to fold the definition of a spike into the HMM. This solution requires a non-trivial amount of work as the entire definition of a state has to be entirely reworked. Moreover, the definition of a state must be considered carefully such that a state explosion (as seen in higher order HMMs) does not occur.Preprocessing channel current blockade data using a HMM with EVA significantly reduces the complexity of dwell time analysis. Within a reasonable range of values for EVA factor, the noise bands around levels are significantly reduced while level transitions are retained. However, if too large of an EVA factor is used then transitions can be destroyed and the channel current signal will be mangled beyond use. Although this problem is not significant for a wide range of EVA factor, a HMM with Duration -4 will rAnother aspect of the dwell time analysis that will be explored in future work is the effect of dwell time information on classification. Dwell time distributions for dominant levels should be characteristic for a given signal and thus improve classification performance. However, a significant amount of data is generally necessary to generate accurate dwell time distributions. In the current architecture, 100 ms of channel current blockade are analyzed to create one feature vector. It is unclear as to whether 100 ms will be enough data to overcome this limitation on sparseness of data. A longer signal trace could be analyzed, but computational complexity grows quadratically as signal input increases linearly. Here, the use of a distributed HMM has been developed to allow for the processing of enough data to provide accurate dwell time statistics while still meeting reasonable time constraints (paper in preparation), using a simple distribution analogous to the chunk processing that is employed for the SVM training .Typically AdaBoost is used as a classification method. But due to the limitations discussed in the Background section, SVMs provide a much more robust means of classification for channel current data. However, AdaBoost is still useful in feature selection, and that is the main use we have for AdaBoost in the work presented here. The weighting schemes in the AdaBoost algorithm are a natural fit for feature selection as the weights indicate which features are most diagnostic for a given classification problem.AdaBoost does require some subtle tuning. As can be seen in the algorithm shown in Figure It is also important to note that automated feature selection using AdaBoosting was not able to reproduce results obtained from the \"best-case\" manually designed feature set  {[I] [observed_data[0]] *\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0Forward [0] [I] = emission_probabilities \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0Prior_probability [I];\u00a0\u00a0\u00a0}The data inversion implementation simply exchanges the roles of the actual state and the observed state as follows:\u00a0\u00a0\u00a0For  {[observed_data[0]] [I] *\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0Forward [0] [I] = emission_probabilities \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0Prior_probability [I];\u00a0\u00a0\u00a0}This simple inversion introduces another information factor into the Viterbi algorithm and improves performance as discussed in the Results section. So, with inversion, instead of P(X = b|S = k) we now have P(X = k|S = b). In our analysis we have P(X = k|S = b) \u2248 P(S = k|X = b), so the change with inversion is approximately a factor of [P(S = k)/P(X = b)] introduced at each column position. For the Viterbi calculation, with sums on log contributions from each column, i.e., log [P(S = k)/P(X = b)], the new term sums to the length-weighted relative entropy between the state prior probability and emission posterior probability: - L D(X||S), where L is the length of data parsed and 'D(* || *)' is the Kullback-Leibler Divergence (or relative entropy).As mentioned in the Discussion section, a HMM with EVA is used to significantly reduce the gaussian noise band around levels. In a non-EVA approach, emission probabilities are initialized with a gaussian profile. The initialization is as follows:where \"i\" and \"k\" are each a state with 0 <= {i, k} <= 49 in a 50 state system. To perform EVA, the variance is simply multiplied by a factor that essentially widens the gaussian distribution imposed on possible emissions, and the equation simply becomesEssentially EVA boosts the variance of the distribution and yields the following effect: for states near a dominant level in the blockade signal, the transitions are highly favored to points nearer that dominant level. This is a simple statistical effect having to do with the fact that far more points of departure are seen in the direction of the nearby dominant level than in the opposite direction. When in the local gaussian tail of sample distribution around the dominant level, the effect of transitions towards the dominant level over those away from the dominant level can be very strong. In short, a given point is much more likely to transition towards the dominant level than away from it.1 - Fj are individual feature vectors representing a single capture event. E1 - Ei are the experts or weak learners assigned to an individual component in feature space. In the implementation described in this paper, na\u00efve bayes classifiers were used as weak learners.As introduced in the Backgrounds and Discussion sections, AdaBoost is used in feature selection. In this hybrid implementation, weights are given to the weak learners as well as the training data. The key modifications here are to give each column of features in a training set a weak learner and to update each weak learner every iteration, not just updates the weights on the data. Conceptually, this idea can be seen in the figure shown in Additional File For a given number of iterations T, the process is as follows:\u00a0\u00a0\u00a0Initialize weights on weak learners\u00a0\u00a0\u00a0Initialize weights on training data\u00a0\u00a0\u00a0For i, 1..T\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0Train weak learners\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0Update the weights for each weak learner \u2013 just like the hypothesis\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0update in the standard AdaBoosting method\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0Update the weights for each training point \u2013 just like the original\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0AdaBoosting method\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0Normalize the two weights.\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0Break if the overall composite learner's error rate is 0% or 50%In an example where there is a set of 150-component feature vectors, 150 weak learners would be created. As previously mentioned, each weak learner corresponds to a single component and classifies a given feature vector based solely on that one component. Then, weights for these weak learners are introduced. In each iteration of this modified AdaBoost process, weights for both the input data and the weak learners are updated. The weights for the input data are updated as in the standard AdaBoost implementation while weights on the individual weak learners are updated as if each were a complete hypothesis in the standard AdaBoost implementation  is used for signal acquisition .Click here for fileA blockade level histogram of two DNA hairpin channel blockade signals.Click here for fileThe extrapolated true spike counts for the radiated DNA hairpin blockade.Click here for fileThe extrapolated true spike counts for the non-radiated DNA hairpin blockade.Click here for fileThe 150-component feature vector profiles for the Y-aptamer that binds 6A ssDNA, for signals before and after introduction of that six-adenosine ssDNA.Click here for fileThe dwell time distributions for the three dominant levels of the Y-aptamer (without 6A target).Click here for fileThe key Adaboost modifications are to give each column of features in a training set a weak learner, and to update each weak learner every iteration, not just update the weights on the data.Click here for file"}
+{"text": "Here, we report a significant CapG overexpression in 18/47 (38%) of ovarian carcinomas (OC) analyzed by qRealTime-PCR analyses. Functional analyses in OC cell lines through siRNA mediated CapG knockdown and CapG overexpression showed CapG-dependent cell migration and invasiveness. A single nucleotide polymorphism rs6886 inside the CapG gene was identified, affecting a CapG phosphorylation site and thus potentially modifying CapG function. The minor allele frequency (MAF) of SNP rs6886 (c.1004A/G) was higher and the homozygous  genotype was significantly more prevalent in patients with fallopian tube carcinomas (50%) as in controls (10%). With OC being one of the most lethal cancer diseases, the detection of novel biomarkers such as CapG could reveal new diagnostic and therapeutic targets. Moreover, in-depth analyses of SNP rs6886 related to FTC and OC will contribute to a better understanding of carcinogenesis and progression of OC.The actin binding protein CapG modulates cell motility by interacting with the cytoskeleton. CapG is associated with tumor progression in different nongynecologic tumor entities and overexpression in breast cancer cell lines correlates with a more invasive phenotype  Ovarian cancer globally represents the fifth leading cause of cancer-related death among women . As no e braf and kras genes, which play a crucial role in the cell growth signaling cascade . This results in an amino acid exchange p.Arg335His destroying the PKC-recognition motif and consequently in a loss of Ser337 phosphorylation (unpublished results). This is the first time that a functional effect of rs6886 could be identified. So far, no association studies have been published with respect to oncologic aspects.SNP rs6886 (c.1004G\u2009>\u2009A) is located in exon 10 of the CapG gene (chromosome 2) affecting the first codon within a protein kinase C phosphorylation recognition motif [Rhttp://www.hapmap.org/), where the homozygous A/A genotype (His) accounts for 8%, the homozygous G/G genotype (Arg) for 43%, and the heterozygous G/A genotype for 48% of all in a normal population.Here, we genotyped 263 DNA samples (isolated from EDTA blood samples) of OC patients and 107 DNA samples of healthy controls (age matched) by HRM analyses . ResultsP = 0.153), a marked increase in minor A-allele frequency was detected in OC patients. The frequency of the homozygous A/A genotype was well above the own control sample set (16% versus 10%) and twice as high as in the HapMap dataset (8%) or in BC patients . Looking at the genotype of patients with fallopian tube tumors, half of all cases display the homozygous A/A genotype. Therefore, in this cohort, the homozygous histidine encoding variant (A/A) is significantly associated with fallopian tube carcinomas .Although results in OC and control cases were not significantly different  were less invasive [By capping actin polymers, CapG is a key player in cytoskeletal remodeling and membrane ruffling . While cinvasive .P < 0.027) indicating the putative oncogenic function of CapG in ovarian carcinomas.Our study aims at investigating the effect of differential CapG expression in OC cells hypothesizing that CapG overexpression is involved in OC cell motility and invasiveness. In a sample set of 47 ovarian carcinomas and 21 normal tissue samples, CapG overexpression was determined in 38% of all tumor samples (18/47), which was concordant to previous results based on cancer profiling arrays . The cut in vitro model for further functional characterization of CapG in ovarian carcinomas, four ovarian carcinoma cell lines were analyzed. CapG expression levels were comparable and within the range of the OC samples with a significant CapG overexpression in OvCa-3 and SK-OV-3 cells. The latter has been described as more aggressive with a higher intrinsic metastatic potential [To establish anotential  and thusTo demonstrate the impact of CapG expression on cell migration we investigated the effects of CapG overexpression in Hey transfectants and CapG depletion in SK-OV-3 cells in comparison to the parental cell lines.Transfected Hey cells displayed a significant increase in motility in wound healing assays compared to untreated Hey cells. Concordant to that, the migration rate in CapG knockdown SK-OV-3 cells was reduced by nearly 50% . Results in vitro are thought to transmigrate the basement membrane in vivo. Thus, we analyzed the role of CapG not only with regard to migration properties but also to proinvasive characteristics of an aggressive cell type [However, to further evaluate the impact of CapG depletion on cell migration, we analyzed siRNA treated SK-OV-3 cells in a Matrigel transwell invasion assay. Cells invading a basement membrane extract (BME)ell type . Recent ell type  and possThe even more pronounced reduction (75%) of the invasive phenotype of SK-OV-3 cells after CapG depletion is in good agreement with the results of the scratch assay. It suggests that CapG might play an important role in migration as well as tumor invasion also in OC. Mechanistically, it remains to be explored how CapG influences the invasive behavior of cells. It is conceivable that tumor migration and proliferation rely on increased cancer cell motility through accelerated cytoplasmic actin turnover. On the basis of recent findings by that the nuclear fraction seems to be crucial for invasiveness, a key role of CapG in the nucleus is also possible . By subcSince these results suggest that CapG modulates invasiveness in OC cell lines, we further strived to explore molecular mechanisms that contribute to CapG functioning.http://www.cbs.dtu.dk/services/NetPhosK/) and PhosphoMotif finder (http://www.hprd.org/PhosphoMotif_finder), we identified potential phosphorylation sites of the CapG protein sequence. Amino acid Ser337 was identified as a potential phosphorylation site within a protein kinase C phosphorylation site recognition motif. This motif including Arg335 and consequently phosphorylation of Ser337 is affected by SNP rs6886 (p.Arg335His). For further evaluation of SNP rs6886, we carried out an association study, analyzing allele frequencies in gynecological tumor entities in order to reveal indications for an oncologic impact of this polymorphism. So far, the SNP has been associated with increased intima media thickness in carotid ultrasounds [Phosphorylation of CapG protein was already described as a potential posttranslational modification of functional relevance . Using prasounds  but has P < 0.0001). Interestingly, no differences in allelic frequencies were found in BC samples. Despite the low number of cases/controls investigated in this study, these results suggest a functional relevance of SNP rs6886 in OC and FTC. Because of the rarity of FTC, only 12 samples were available and confirmation of these results in larger probe sets in future studies is needed.Comparing 263 OC cases and 107 controls by genotyping SNP rs6886 performing HRM analyses, the MAF  was higher in OC cases (37.5%) and FTC cases (54%) compared to controls (31%). Even more evident was the genotype distribution with the homozygous A/A genotype expressing the histidine variant in 50% of FTC cases compared to 10.3% in controls  double-knockout mice could be inhibited by removal of the fallopian tube in vivo [Although its relevance is yet not understood, this polymorphism might hint to a possible link between OC and FTC. In case CapG phosphorylation at Ser in vivo . Support in vivo .In this study, CapG overexpression in 38% of OC was found and its functional relevance on cell migration as well as invasiveness has been clearly demonstrated. Although mechanisms are still to explore, the positive correlation of SNP rs6886 as a possible functional relevant CapG variant with FTC may introduce a novel interesting link between ovarian and fallopian tube carcinomas. However, further studies are needed to validate the association of SNP rs6886 with OC and FTC and to evaluate CapG as a prognostic biomarker."}
+{"text": "Increasing robustness via improvement of resistance to pathogens is a major selection objective in livestock breeding. As resistance traits are difficult or impossible to measure directly, potential indirect criteria are measures of immune traits (ITs). Our underlying hypothesis is that levels of ITs with no focus on specific pathogens define an individual's immunocompetence and thus predict response to pathogens in general. Since variation in ITs depends on genetic, environmental and probably epigenetic factors, our aim was to estimate the relative importance of genetics. In this report, we present a large genetic survey of innate and adaptive ITs in pig families bred in the same environment.Mycoplasma hyopneumoniae and analyzed by combining a principal component analysis (PCA) and genetic parameter estimation. ITs include specific and non specific antibodies, seric inflammatory proteins, cell subsets by hemogram and flow cytometry, ex vivo production of cytokines , phagocytosis and lymphocyte proliferation. While six ITs had heritabilities that were weak or not significantly different from zero, 18 and 30 ITs had moderate (0.1<h2\u22640.4) or high (h2>0.4) heritability values, respectively. Phenotypic and genetic correlations between ITs were weak except for a few traits that mostly include cell subsets. PCA revealed no cluster of innate or adaptive ITs.Fifty four ITs were studied on 443 Large White pigs vaccinated against Our results demonstrate that variation in many innate and adaptive ITs is genetically controlled in swine, as already reported for a smaller number of traits by other laboratories. A limited redundancy of the traits was also observed confirming the high degree of complementarity between innate and adaptive ITs. Our data provide a genetic framework for choosing ITs to be included as selection criteria in multitrait selection programmes that aim to improve both production and health traits. Increasing robustness by improving resistance/tolerance to pathogens is an important selection objective in most livestock species, particularly in pigs. In the past 30 years, selection for growth, carcass leanness, meat quality and prolificacy, combined with stringent sanitary rules, vaccination and use of antibiotics, has been highly effective in pigs The choice of relevant ITs is further based on knowledge of the immune system. This highly interactive and cooperative system is classically separated into two arms referred to as innate and adaptive, which produce a combined response. Innate immunity is the first line of defence. Its activation is non pathogen-specific and depends on the recognition of evolutionarily conserved pathogen-associated molecular patterns such as lipopolysaccharides constituting bacterial cell walls + T lymphocyte, CD8\u03b1+ T lymphocyte and B lymphocyte subsets http://www.animalgenome.org/cgi-bin/QTLdb/index), mitogen-induced proliferation In order to include ITs in a breeding plan to improve pig immunocompetence, the genetic and phenotypic parameters of the different ITs need first to be estimated. Several studies in swine, mice, poultry and cattle demonstrated the possibility of selecting animals with high or low immune response (IR) as characterized by one or a few ITs Mycoplasma hyopneumoniae (M. hyopneumoniae).Our global goal is to identify immunocompetence traits for inclusion in selection schemes aiming to improve both zootechnical performances and health traits in pigs. For this purpose, we have launched a genetic and genomic study of numerous ITs covering innate and adaptive IR M. hyopneumoniae  or traits related to total leukocyte and leukocyte subpopulation counts. The various characteristics and descriptive statistics of the traits measured on each animal of the studied population (n\u200a=\u200a383 to 442) are summarized in A set of 54 ITs was measured on a population of 443 pigs three weeks after vaccination against eumoniae . These Iin vitro except for tumour necrosis factor \u03b1 (TNF\u03b1) and mitogen proliferation-related traits. Finally, the CV for seric C reactive protein (CRP) and haptoglobin (HAPT) levels were close to 1.6 and 2, respectively. The highest CV (3.9) was obtained for the specific IgGs directed against M. hyopneumoniae. These data clearly indicate that the seric inflammatory protein levels and the specific IgGs had the greatest phenotypic variance in our study.Ample phenotypic variation was observed for most traits. The coefficient of variation (CV) was equal to 0.8 on average and ranged from 0.07 to 3.9  and 2. L+), \u03b3\u03b4 T lymphocytes (TCR\u03b3\u03b4+), three subsets of \u03b1\u03b2 T lymphocytes , NK cells (CD16+ CD2+) and three monocyte subsets . We excluded from the analysis four haematological traits not directly involved in immunity: red blood cell count (RBC), hematocrit (HT), red blood cell distribution width (RDW) and platelet count (PLT). The percentage of variance (inertia) explained by the first five components was over 50% (+), with a cell response parameter (IL10-PMAIONO) and the seric level of haptoglobin (HAPT). This cluster can be considered as representative of the leukocyte subsets. A third cluster  for which The estimation of phenotypic correlations  counts was highly heritable. Heritability estimates of the three cytokine  levels were moderate to high after PMAIONO and CONA stimulations and weak to moderate after LPS stimulation. For those cytokines induced by CONA or LPS stimulation, confidence interval (95CI) for the heritabilities overlapped zero, except for IL4-CONA. IL2 production after PMAIONO, CONA and LPS stimulations gave high estimates of heritability significantly different from zero for IL2-PMAIONO and IL2-LPS. Proliferation measurements after various stimulations  provided moderate estimates of heritability not significantly different from zero. Among the traits involved in humoral-mediated adaptive immunity, heritabilities for total IgG and IgA antibody levels were higher than for total IgM and specific antibodies, and weak + cells).Among the traits involved in cell-mediated immunity, variation in \u03b1\u03b2 T lymphocyte , iii) cytokine production (IFNA and IL12), and iv) phagocytosis were high and significantly different from zero. In addition, several innate ITs showed weak to moderate heritability, including pro-inflammatory cytokines , MON, CD16- CD2+ cells, CD16+ CD2- cells, MHCII- CD172A+ cells, MHCII+ CD172A- cells, CD16- CD172A+ cells and CD16+ CD172A+ cells. Variation in acute phase proteins was moderately (CRP) to highly (HAPT) heritable. Among the four traits, which measured the total number (MON) or proportions  of monocytes, moderate to high + MHCII+ cells. Other haematological traits  gave high h2 estimates, of which HT and PLT were significant.Heritability for innate ITs such as i) total cell number (EOS and NEU), ii) leukocyte subsets (CD16Pairwise genetic correlations are presented in + CD172A-) and ii) a group of 10 traits with nine hemogram-based cell counts or FACS-characterized leukocyte subpopulations  and two cell activity traits (IgM and IL10-PMAIONO). The second cluster of 18 traits (Cluster B) is also subdivided into two groups of traits: i) a group of three different cell response traits  and one FACS-characterized leukocyte subpopulation (IgM+ cells), and ii) a group of nine cell response traits  and four FACS-characterized leukocyte subpopulations . In cluster A, the first group of 10 traits showed moderately to highly positive genetic correlations with each other. Indeed, - CD8+ and CD16+ CD2+ (NK) cells  TNF, IL8 and PHAG, and ii) CRP and HAPT  CRP and IgA.The unsupervised hierarchical clustering distinguished two main clusters of traits . The firK) cells . In clusand HAPT . Strong in vivo measures on blood such as quantification of cell populations by hemogram, dosage of circulating immunoglobulins and acute phase proteins, as well as ex vivo measures obtained after in vitro tests such as lymphocyte proliferation, phagocytosis capacity and cytokine production after blood stimulation. All these ITs have been widely studied in humans + \u03b1\u03b2 T lymphocytes differentiate into Th1 and Th2 lineages expressing specific cytokines is collapsing. Indeed, recent studies have revealed that cytokine production by the different CD4+ T cell subsets  is highly flexible, providing new insight into the Th cell plasticity The large-scale study reported here allowed us to estimate the genetic and phenotypic parameters of numerous ITs measured on pigs bred in the same environment. Innate immunity is represented by 25 traits, humoral-mediated immunity by five traits and cell-mediated adaptive immunity by 18 traits. We have also considered the total number of white blood cells and lymphocytes, and four other haematological traits . Within cell-mediated immunity, we explored both Th1 and Th2 responses by measuring cytokine production. Streptomyces conglobatus, and CONA, a lectin originally extracted from the jack-bean Canavalia ensiformis, are known to be potent mitogens of blood lymphocytes + and CD8+ T lymphocytes, \u03b3\u03b4 T lymphocytes, CD11R1+, CD11R1+ CD8\u03b1-, CD11R1+ CD8\u03b1+ and CD16+ MHCII+) Our study provides the first heritability estimates for innate and adaptive cytokine production and for lymphocyte proliferation after PMA-ionomycin and LPS stimulations in pig. Pro-inflammatory cytokines appear to show less heritable variation than adaptive system-related cytokines. Among the adaptive system-related cytokines, estimated heritability was weakest for cytokines produced after LPS stimulation, except for IL2 production. Heritability estimates for lymphocyte proliferation after CONA, PMA and LPS stimulations were moderate and that of lymphocyte proliferation after CONA stimulation was comparable to the value obtained by Edfors-Lilja and colleagues + cells) are not significantly heritable contrary to other results 2 for IFN\u03b1 production is moderate to high , mitogen-induced proliferation Overall, we show that variation in both innate and adaptive ITs is under substantial genetic control  and 2. S- CD8+ lymphocytes (which contains \u03b1\u03b2 CD4- CD8+ lymphocytes and NK), and NK cells (CD16+ CD2+ cells). Phagocytosis, production of IL8 and TNF, two pro-inflammatory cytokines produced by monocytes and macrophages, were positively correlated with acute inflammatory phase proteins produced by hepatocytes i.e. CRP and HAPT. A high correlation was also found between CRP and HAPT. Clapperton and colleagues Compared to the previously limited data on genetic correlations between ITs in pigs, our study provides a large-scale estimation of phenotypic and genetic correlations among 32 ITs. PCA results and correlation estimations highlight the weak phenotypic and genetic correlations between the different ITs, except mainly for cell subsets. No cluster of innate and adaptive ITs is revealed. These results illustrate that many of the ITs included in our study provide more or less independent potential clues for selecting for improved immunocompetence. Such complementarity is expected since innate immunity is in place or ready for activation prior to infection or antigenic stimulation and collaborates with adaptive immunity, which is induced by infection or antigenic stimulation. Nevertheless, a few highly positive genetic correlations have been detected between total number of white blood cells and some leukocytes subsets, and between some leukocyte subsets such as total number of lymphocytes, CD4Our results provide a framework for including ITs in multitrait selection for immunocompetence in pigs. Criteria for inclusion should take into account heritability, biological relevance, biological sensitivity and feasibility of measurement Mycoplasma hyorhinisMycoplasma hyorhinis. However, HIR pigs develop more severe arthritis than LIR pigs. Indeed, the levels of humoral and cell-mediated adaptive ITs included in the Wilkie et al index induce the formation of immune complexes and/or the development of inflammatory responses, central to the pathogenesis of Mycoplasma hyorhinis-induced arthritis. Other correlation tests between ITs and response to various infections are needed. However, it is important to remain cautious with high responder animals, which could develop autoimmune pathologies or pathological iummne responses.In order to include immunocompetence in selection for improved health, a major challenge will be to correlate variation in heritable ITs in healthy animals with inter-individual variability in response to various pathogens. Testing this hypothesis will be a key point for further use of ITs as indirect selection criteria in multitrait selection to improve resistance to disease. Some results on genetic and phenotypic relationships between immunocompetence and susceptibility to specific pathogens have already been reported in the literature for pigs. Among pigs selected for eight generations for high (HIR) or low (LIR) response based on an index of four cell and humoral-mediated immunity traits, an increased specific antibody response and lower polyserositis were observed in the HIR pigs compared to the LIR pigs after challenge with a novel pathogen, + cells) and average daily gain All the studies on immunocompetence and resistance to disease will have to be completed by estimation of genetic correlations with economically important traits already under selection. Negative genetic correlations have been reported between some ITs  one day after their arrival in the test station, when 36.3 days old in average. All pigs were apparently healthy with no clinical sign of infection. All animals were sampled three weeks after vaccination. Blood samples were collected via the external jugular vein into tubes with or without anti-coagulants, according to further use.A total of 443 Large White pigs  tested for performance traits in a pig test station  was included in the study. The pigs were distributed in seven contemporary groups and belonged to 307 nuclear families obtained from 106 boars, with an average of 4.1 (+/\u2212 1.7) piglets per boar. Animals were born and weaned in 16 different selection herds and arrived in the test station at five weeks of age with no prior vaccination. They were placed into pens of 30 piglets in a post weaning unit and vaccinated against Blood collected in 10 mL tubes with no anti-coagulant was centrifuged at 3200 g for 15 min at 4\u00b0C. The serum was collected and stored at \u221220\u00b0C until use. Plasma was collected from blood sampled in heparinised tubes and stored at \u221220\u00b0C before use.Hemograms were measured with an MS4-5 counter  with blood sampled in EDTA tubes. Among a set of 18 traits, nine were included in the genetic analyses: total number of leukocytes, lymphocytes, monocytes, neutrophils, eosinophils, erythrocytes, platelets and hematocrit  and 2.M. hyopneumoniae IgG titers were also measured by ELISA using a commercial kit . Absorbance was read at 450 nm using an ELISA plate reader  and the Biolise 2.0 data management software.Total concentrations of immunoglobulin subsets were measured by ELISA as previously described Haptoglobin and C reactive protein levels were measured in pig serum by colorimetric tests  and ELISA assays , respectively. Absorbance was read at 450 nm using an ELISA plate reader .2 and CaCl2 . Cells were then incubated in 2 mL BD Pharmlyse 1X  at room temperature.PBMCs were purified by density gradient centrifugation. A volume of 13 mL heparinised blood was added to Leucosept tubes  pre-filled with 17 mL Ficoll  and centrifuged at 1200 rpm for 35 min. PBMCs were collected at the ficoll interface and washed in 50 mL D-PBS without MgCl2 and CaCl2, incubated with 2 mL pig serum at 4\u00b0C for 20 min, washed again in 50 mL D-PBS without MgCl2 and CaCl2 and then washed in 50 mL S/W buffer  at a final concentration of 5.106 cells/mL. 106 cells were used for each antibody labelling. Single, double or triple staining was performed using monoclonal antibodies (mAbs) directed against i) CD2  and CD16 , ii) CD4  and CD8\u03b1  iii) TCR\u03b3\u03b4 , iv) IgM  and v) MHCII , CD16  and CD172a . Briefly, PBMCs were stained with primary mAbs for 25 min at 4\u00b0C, washed in S/W buffer and stained with allophycocyanin-conjugated anti-mouse IgG1 , phycoerythrin-conjugated anti-mouse IgG2a , FITC-conjugated anti-mouse IgG2b , APC-conjugated anti-mouse IgG1 , phycoerythrin-conjugated anti-rat IgG2a , or phycoerythrin-conjugated anti-mouse IgG2b . After washing in S/W buffer, cells were fixed in BD Cellfix solution . Data acquisition and analysis were carried out with the FACScan and CELLQuest software .Purified PBMCs were washed in 50 mL D-PBS without MgClin vitro by incubating diluted total blood in the presence of pseudorabies virus -infected, glutaraldehyde-fixed, PK15 cell monolayers, according to a protocol previously described for transmissible gastroenteritis virus Synthesis of IFN\u03b1 by leukocytes of pigs was tested Escherichia coli O111:B4  was added to the diluted blood. For mock stimulation, a volume of PBS equal to the volume of stimulation reagents was added to the diluted blood. After incubation at 37\u00b0C for 24 h, culture supernatants were collected by centrifugation at 450 g for 20 min and stored at \u221220\u00b0C before use.Heparinized blood samples (400 \u00b5L) were fivefold diluted in 24-well plates in 1.6 mL RPMI 1640 medium  supplemented with 10% heat-inactivated fetal bovine serum , 2 mmol/L L-glutamine, 100 U/mL penicillin and 100 mg/mL streptomycin. For stimulation, a mixture of 10 ng/mL PMA , 1 \u00b5g/mL ionomycin  and 1 \u00b5g/mL LPS from The cytokines IL1B, IL6, IL8, TNF and IL12 were quantified using commercial ELISA tests . For quantification of basal levels of cytokines in supernatants from mock-stimulated cells, the samples were not diluted for quantification. Supernatants collected from stimulated cells were diluted . All samples were tested in duplicates. Absorbance was read at 450 nm using an ELISA plate reader . Results were expressed as pg of cytokine/mL.Escherichia coli . Cytokine content was measured in supernatants using ELISA tests as already described Heparinized blood diluted 1\u22365 in complete culture medium consisting of DMEM  supplemented with 5% fetal calf serum , 2 mM L-glutamine, 100 U/mL penicillin and 50 \u00b5g/mL streptomycin  was stimulated with 10 \u00b5g/mL CONA , or with 50 ng/mL of PMA  and 1 \u00b5g/mL of ionomycin  or 1 \u00b5g/mL LPS from 3H-methyl-thymidine  was added to each well. After another 24 h incubation period, the cells were harvested through glass-fiber filters  by means of an automatic harvester . Incorporation of tritiated thymidine was measured with a Liquid Scintillation Beta Counter . Results were expressed as a stimulation index of lymphocyte proliferation calculated as mean counts per min (cpm) of the triplicate cultures in stimulated culture/mean cpm in control non-stimulated culture.Lymphocyte proliferation was performed in 96 well plates as already described Preliminary statistical analyses were performed using R software \u03b2, Wa and Wc are known incidence matrix relating observations to fixed and random effects; \u00df \u200a=\u200a a vector of fixed effects and covariates; a \u200a=\u200a the vector of direct genetic effects; c \u200a=\u200a the vector of common litter environmental effects; and e \u200a=\u200a the vector of random residual effects. All random effects were assumed to follow a normal distribution with zero mean. For bivariate analyses, the same effects as for univariate analyses were taken into account in the fixed part of the model and a direct genetic effect was included in the random part of the model. 95% confidence intervals (95CI) were calculated for heritability (h2) estimates .where y \u200a=\u200a the vector of observations; XFigure S1Heatmap of the phenotypic correlations between 32 ITs. The correspondence between colour scale and genetic correlation levels are presented on the right-hand side of the heatmap.(TIF)Click here for additional data file.Table S1Additional details on the measurements of the ITs.(XLS)Click here for additional data file.Table S2Phenotypic and genetic correlations between 32 ITs.(XLS)Click here for additional data file."}
+{"text": "HGF), are associated with an increased susceptibility for developing KC. However HGF protein expression in KC has not been explored. In this initial study, we investigated late-stage KC and control corneas for the expression of HGF and its receptor mesenchymal-epithelial transition factor (c-Met/Met). KC buttons (~8\u2009mm diameter) (n = 10) and whole control corneas (n = 6) were fixed in 10% formalin or 2% paraformaldehyde, paraffin embedded and sectioned. Sections were immunolabelled with HGF and c-Met antibodies, visualised using immunofluorescence, and examined with scanning laser confocal microscopy. Semiquantitative grading was used to compare HGF and c-Met immunostaining in KC and control corneas. Overall, KC corneas showed increased HGF and c-Met immunostaining compared to controls. KC corneal epithelium displayed heterogeneous moderate-to-strong immunoreactivity for HGF and c-Met, particularly in the basal epithelium adjacent to the cone area. Taken together with the recent genetic studies, our results further support a possible role for HGF/c-Met in the pathogenesis of KC.Keratoconus (KC) is a progressive degenerative inflammatory-related disease of the human cornea leading to decreased visual function. The pathogenesis of KC remains to be understood. Recent genetic studies indicate that gene variants of an inflammation-related molecule, hepatocyte growth factor ( Keratoconus (KC) is the most common primary human degenerative corneal disease with a prevalence of around 1 in 2000 worldwide . KC is t\u03b2) [\u03b1), and matrix metalloproteinase 9 (MMP-9) has also been found in tears collected from KC patients compared to controls [The histopathology of KC is well described and includes epithelial and stromal thinning within the apical cone region, breaks in the Bowman's layer, focal fibrosis, and anterior stromal keratocyte apoptosis , 7. Howe\u03b2)  observedcontrols . Furthercontrols .HGF) gene, identifying two single nucleotide polymorphisms  in the promoter region [Single nucleotide polymorphism (SNP) refers to a change in a single nucleotide within a DNA sequence and is the most common type of genetic variation observed in the human genome . SNPs har region . Furtherr region . in vitro [ HGF mRNA expression in keratocytes and c-Met mRNA expression in epithelial cells compared to unwounded corneas, suggesting that the HGF/c-Met pathway plays a role in corneal wound healing [HGF is a pleiotropic growth factor that activates the HGF/c-Met pathway after binding to its receptor, mesenchymal-epithelial transition factor (c-Met/Met). Once activated, downstream pathways such as mitogen-activated protein kinase (MAPK) cascades, PI3K-Akt axis or Janus kinase/signal transducers, and activators of transcription (JAK/STAT) pathways may be activated . HGF hasin vitro , and exoin vitro . In inju healing . Studyin healing .The expression of HGF and c-Met proteins in human KC corneas has not been investigated to date. One study has reported increased serum HGF expression for at least the minor allele of HGF SNP rs3735520, associated with increased potential for developing KC . As a fiKC corneal tissue buttons  and donor corneas  Eye Bank) were obtained with consent and approval from the Sydney Eye Hospital Human Research Ethics Committee (HREC 2013/1041). All procedures were in accordance with the Declaration of Helsinki. Informed consent was obtained from all participants prior to collection of KC buttons. Normal donor corneas were obtained from the Lions NSW Eye Bank following appropriate consent and HREC approval.Ten corneal buttons were collected from KC patients (age range from 18 to 32 years) undergoing corneal transplantation at Vision Eye Institute. All KC patients were diagnosed on the basis of clinical signs and corneal topography and were classified as KC grade 4 (most severe stage) . Six nor\u03bcm. Sections were collected on Super-Frost Plus slides  and dried before use.KC corneal buttons (~8\u2009mm diameter), with the cone apex location marked, were fixed in 10% neutral buffered formalin (NBF). Whole corneas were fixed in 2% paraformaldehyde/PBS (pH 7.4). All specimens were paraffin embedded and cut at 6\u2009Sections were dewaxed and rehydrated through alcohols to water. For antigen retrieval, sections were incubated in 0.01\u2009M citrate buffer (pH 6) at 85\u00b0C for 10 minutes, cooled to 40\u00b0C, and rinsed in Tris-buffered saline  with 0.1% Tween-20 (TBST). Sections were incubated at room temperature (RT) in 5% bovine serum albumin (BSA) in TBST for 30 minutes, followed by incubation overnight at 4\u00b0C in HGF or c-Met primary antibodies, or appropriate negative controls (Mouse or Rabbit IgG) . After oFor co-immunolabelling experiments, a separate series of slides were prepared and HGF visualised with Alexa Fluor 488 and c-Met visualised with Alexa Fluor 594, combined with nuclear Hoechst stain .Immunolabelling was repeated at least twice per specimen for each antibody, and appropriate Ig controls were included for each experiment. All slides were mounted in 20% glycerol/PBS, coverslipped, sealed with nail varnish, and viewed using a Zeiss LSM700 scanning laser confocal microscope and image software . Where more than one colour was to be detected, multichannel excitation bleed-through was minimized using fluorochromes with separated peak excitations. Emission bleed-through was minimized by multitracking, where signal crosstalk between neighbouring channels was corrected by performing a sequential image capture routine.Semiquantitative grading of single-immunolabelled sections was used to assess the intensity and distribution of HGF and c-Met immunoreactivity in the corneal epithelium, stroma, and endothelium. Grading for KC buttons was made in the region adjacent to the cone (Adj) and for control corneas in a similar central corneal region. Immunolabelling of the thinned cone area of KC buttons was examined in each specimen but was not graded for comparison with controls because of the obviously altered morphology . The grading scale used was based on the intensity of the immunofluorescence  and the percentage (%) area immunolabelled  as described previously . A finalAll KC corneas showed a thickened epithelium adjacent to the more central cone region Figures , compareCo-immunolabelling for HGF and c-Met showed that c-Met (red) was primarily localised in the epithelium of both control and KC corneas . HGF gr. Weak an versus control: 16% and 66% resp.)  of this pathway, we examined patterns of HGF and c-Met protein expression in both control and KC corneas. Higher levels of HGF and c-Met immunostaining were detected in the basal epithelium adjacent to the KC cone, compared to the weaker and more uniform epithelial staining pattern seen in control corneas. HGF mRNA expression in the human corneal epithelium compared to keratocytes and endothelium [ c-Met mRNA findings, which showed that human corneal epithelium, keratocytes, and endothelium all expressed c-Met, but with highest mRNA expression in epithelium [In control corneas, we found HGF expression was more intense in the stroma compared to the epithelium. This is consistent with previous studies showing low levelothelium , 20. Theothelium . Our immithelium , 20, 21.ithelium . in vivo, and increased HGF and c-Met mRNA expressions have been detected during corneal wound healing [ HGF mRNA expression was also upregulated in the lacrimal gland when studying injured compared to unwounded rabbit corneas [HGF is reported to be involved in two major processes, cell proliferation and migration, and inflammatory-related signalling cascades. HGF is a potent enhancer for corneal epithelial cell proliferation  and migr healing . Increas healing . HGF mRN corneas . No diff corneas . In seco corneas . This wa corneas . These s corneas , 24. In  Pseudomonas aeruginosa keratitis also worsened the disease progression, with a significantly higher grade of corneal opacity and thinning compared to PBS-treated corneas [ In vitro treatment of corneal stromal keratocytes with proinflammatory interleukin- (IL-) 1\u03b2 increased HGF mRNA and protein production [ Pseudomonas aeruginosa keratitis in mice, most likely under the control of inflammatory cytokines and cell growth kinases [Poorly regulated and overexpressed HGF may be detrimental to tissues, related to the involvement of HGF in inflammation. For example, delayed formation of the epithelium layer and increased formation of stromal myofibroblasts have been detected during rabbit corneal wound healing, for corneas treated with recombinant HGF . Applyin corneas . In vitroduction . Elevate kinases .\u03b1 receptors than controls [ MMP-9 and its inducer proteins IL-6 and TNF-\u03b1 were detected in KC corneal epithelium in an Indian cohort (>100 patients) compared to healthy controls (n = 20), and tear protein levels of MMP-9 and IL-6 were also increased in KC [n = 20) reduced the tear levels of MMP-9 and appeared to halt the progression of KC, consistent with the involvement of inflammation in KC pathogenesis [KC has traditionally been described as a noninflammatory degenerative condition. However, emerging evidence clearly indicates that inflammation-related processes within the epithelium and stroma are involved in the pathogenesis of KC. Significant increases in proinflammatory molecules such as IL-6, IL-4, IL-5, IL-8, and IL-12 \u201329, MMP-controls , and onecontrols . Most reed in KC . Treatmeogenesis . HGF variants and KC susceptibility was first reported by Burdon et al., (2011) and then confirmed in an independent European cohort which replicated the association of SNP rs3735520 and detected a new HGF SNP rs2956540 [n = 830) focused on the HGF locus and detected a different SNP (rs4954218) significantly associated with KC [ HGF SNPs is unclear. However, a study of rs3735520 implicated a possible regulatory effect of this SNP for HGF protein expression in serum from KC patients [ HGF and rs2286194 in the intron between exon 8 and exon 9), it is likely that they will affect gene expression through mechanisms such as RNA splicing, transcription factor binding, and miRNA regulation [The link betweens2956540 . In addipatients . As the gulation . Our res HGF in KC [ HGF consistent with a role for these SNPs in the regulating HGF expression, and increased serum HGF expression associated with the minor SNP allele has been reported [Previous studies showed an independent, repeatable association between certain SNPs andGF in KC , 34, 35.reported . In the"}
+{"text": "The present study investigated the impact of privacy concerns on selfie behaviors across gender and age groups  by use of the structural equation modeling approach. The results suggest that young adults have greater privacy concerns compared to adolescents and adults. Females have greater privacy concerns than males. Greater privacy concerns among female social media users were linked to lower engagement in selfie behavior, but privacy concerns did not influence selfie behavior in the case of male adolescents and young adults. Overall, privacy concerns were more consistently and inversely related to selfie behavior (taking and posting) among females than males. The study results have theoretical as well as practical implications for both researchers and policy makers.Selfies, or self-portraits, are often taken and shared on social media for online self-presentation reasons, which are considered essential for the psychosocial development and well-being of people in today\u2019s culture. Despite the growing popularity and widespread sharing of selfies in the online space, little is known about how privacy concerns moderate selfie behavior. In addition to this, it is also not known whether privacy concerns across age and gender groups influence selfie behavior. To address this timely issue, a survey assessing common selfie behaviors, that is, frequency of taking , editing (cropping and filtering), and posting selfies online, and social media privacy concerns  was conducted. The web-survey was administered to 3,763 Norwegian social media users, ranging from 13 to 50 years, with a preponderance of women ( People turn to online social media for various reasons including communication and self-expression, connecting, observing others, and establishing new and strengthening existing relationships ,b. Most Digital photos are popularly utilized to practice online self-presentation on social media platforms ,b. This The concepts of self-presentation and self-disclosure in online social media are highly relevant, and are also strongly interrelated with each other . The preAccording to the privacy paradox phenomenon, selfie sharing also involves some degree of self-disclosure of current activities, emotions, hobbies, and interests. At the same time, however, it makes those people wary of their actions, and they also have some degree of privacy concern. Furthermore, when private selfies are shared in the computer-mediated space, they turn into public property and generate tensions, which are complex in nature, between privacy concerns, self-presentation goals and social privacy threats. Despite the fact that \u201cprivacy concerns\u201d can possibly affect user experience and different choices pertaining to online self-presentation, surprisingly little is known about the relationship between self-presentation and online privacy concerns. Furthermore, selfie sharing in the computer-mediated space is becoming more and more popular; yet, it is not known how privacy concerns influence selfie-related behavior. It is important to understand this relationship because it informs the researchers and practitioners of how privacy concerns predict online self-presentation-related behavior, which is considered a dominant activity in online social media. Furthermore, better understanding of this relationship can potentially provide new insights into the complex relationship between online privacy concerns and self-disclosure  in computer-mediated systems see . This stThe prior social media literature has been criticized due to its overemphasis on United States (US) based study participants . HoweverRQ1. How do adolescents, young adults, and adults differ in their privacy concerns regarding social media? RQ2. How do males and females differ in their privacy concerns regarding social media? RQ3. How do privacy concerns across genders  and age groups  predict selfie behavior ?The current study has addressed these research gaps by examining the impact of privacy concerns on selfie behavior in the context of three target user groups: adolescent, young-adult, and adult social media users. This study also addresses the pressing need to investigate the selfie behavior of mixed age/gender groups  since thThe prior computer-mediated communication literature suggests significant age differences in privacy behavior. Young-adult social media users possess high levels of privacy concern, and they tend to disclose less information than both older and younger  users . The stuH1: Young-adult social media users possess greater privacy concerns than adult users.H2: Adult social media users possess greater privacy concerns than adolescent users.Similar to age differences, several studies have suggested significant gender differences in privacy behavior. Young-adult men are known to self-disclose relatively more personal information online since they do not foresee associated social privacy concerns , and areH3: Female adolescents possess greater privacy concerns than male adolescents.H4: Female young adults possess greater privacy concerns than male young adults.H5: Female adults possess greater privacy concerns than male adults.Selfies are popular among adolescents  as well Selfies are taken and shared for the identification of gender and self-presentation reasons , and sevScholars have found that selfies are relatively more popular among females, and that they are more likely to take selfies than males . To begiThe prior findings on the empirical linkages between online privacy concerns and self-disclosure are not consistent, as some studies have indicated that there is no significant relationship between them . HoweverH6: Privacy concerns do not play any significant role in influencing the selfie behavior of male adolescents.H7: Privacy concerns play a significant role in influencing the selfie behavior of male young adults.H8: Privacy concerns play a significant role in influencing the selfie behavior of male adults.H9: Privacy concerns do not play any significant role in influencing the selfie behavior of female adolescents.H10: Privacy concerns play a significant role in influencing the selfie behavior of female young adults.H11: Privacy concerns play a significant role in influencing the selfie behavior of female adults.This current study is based on a large-scale national cross-sectional web-survey, which explored several on-/offline behaviors of the general population in Norway. The survey was broadcast  by two nationwide news media delivering news to the general public .The survey featured and focused on the use and overuse of online social media . Respondents could enter the survey by clicking on an open-access web-link providing access to the survey. The first page provided the complete details of the study, that is, study objectives and process, ethical considerations, and anticipated outcomes. In order to participate, the respondents were required to confirm by actively entering \u201cyes\u201d (the other option was \u201cno\u201d which led to a page just thanking them for their interest). At the end of the survey, immediate feedback on scores was used to design engaging obtainer experiences, to which each participant was given informative content of general and specific interest. There were no other incentives for participation. Consent to participate was considered as \u201cgiven\u201d if a participant successfully completed the questionnaire. The responses obtained from the participants were stored in the database of the Internet survey company and were later passed over to our researchers. In conducting the study, we followed the Norwegian Health Research Act and the ethical guidelines of the Helsinki Declaration. According to the guidelines of the Norwegian Health Research Act, if the data collection is anonymous  then approval from the Norwegian Social Science Data Service and the Regional Committee for Medical and Health Related Research Ethics is not required.Mage = 30.45, SDage = 13.00, range 13\u201382 years) participated in the study. Out of the total valid sample, 3,763  social media users represented three groups: adolescents , young adults , and adults . This data-set was also used in another study for investigating the age and gender differences in selfie-related behavior  to 5 .Selfie behavior was assessed using five items. The first two addressed the frequency of selfie-taking: \u201cHow frequently do you take individual selfies\u201d and \u201cHow frequently do you take group selfies.\u201d Both of these items were taken from completely disagree) to 5 (completely agree).Social media privacy concerns were evaluated using four items based on the work of Z-scores were below 3.29 (recommended threshold limit), hence the data were considered free from any potential outliers . In line with previous validation studies, the theoretical model was used as baseline model. To evaluate sources of model misspecification, modification indices  resulted in a poor model fit where \u03c72 = 1585.71, df = 132, \u03c72/df = 12.01, comparative fit index (CFI) = 0.92, Tucker\u2013Lewis Index (TLI) = 0.86, and root mean square error of approximation (RMSEA) = 0.13. The recommended values for goodness of model fit are as follows: \u03c72/df < 3, CFI \u2265 0.92, TLI \u2265 0.92, and RMSEA < 0.08  and \u201cremaining selfie behavior\u201d (p < 0.05) among male adult users. In comparison to this, privacy concerns significantly predicted taking personal selfies, cropping or editing photos, and use of photo-filters among the adolescent, young-adult and adult female social media users. However, privacy concerns significantly predicted posting personal selfies only among young-adult and adult females. Furthermore, privacy concerns significantly predicted taking group selfies only among adult female social media users (see Table 3).The present study investigated the role of online privacy concerns in influencing selfie behavior of social media users across gender and age groups, that is, adolescent, young-adult, and adult social media users. A large self-selected sample of online social media users based in Norway was recruited in order to investigate the three main research questions of the current study. The novelty of this work lies in the focus on two important yet less studied variables: age-gender differences in selfie behavior in the computer-mediated space. The present study further examined the complex, obscure, and rarely studied relationship between privacy concerns and online self-presentation . Such investigation is timely as well as being much needed since it addresses the urgent demand to understand the differences in selfie behavior across gender and broader age groups [see the recent work by RQ1) investigated the differences in the perceptions of privacy concerns among adolescent, young-adult, and adult social media users. The results suggest that young-adult (20\u201330 years of age) social media users have greater privacy concerns compared to the other age groups, and that adult social media users are much more concerned about their privacy compared to adolescent users. Therefore, both hypotheses H1 and H2 were supported. These findings are consistent with the findings reported in the prior literature. For example, scholars have observed that young-adult social media users are more experienced in managing their online privacy  examined the differences in the privacy concerns of male and female social media users. The study results suggest that female users have greater privacy concerns than male users across all three age groups. Therefore, hypotheses H3, H4, and H5 were supported. These findings are consistent with the prior literature, in that male young adults tend to self-disclose more and to have relatively lower privacy concerns  investigated how privacy concerns across the three age groups  and the two gender groups  influence selfie behavior .The third research question  and use of photographic filters among all three age groups, including adolescent, young-adult, and adult female social media users. Therefore, H10 and H11 were supported, but H9 did not receive support from the results. This is consistent with the findings of the prior literature which indicated that female social media users are relatively active in terms of monitoring their privacy settings , and engIn terms of group selfie-taking, the study results suggest that privacy concerns among female adolescent and young-adult social media users were a non-significant predictor, unlike the case of female adult users. A possible explanation for this could be that female adolescents and young-adult social media users actively engage in group selfie-taking as a means of showcasing as well as strengthening peer membership because it is part of their self-identity development, and is considered very important to them see . Due to Regarding personal selfie posting behavior, the study results suggest that privacy concerns were statistically non-significant in the case of female adolescents, but were a statistically significant predictor in the case of female young-adult and adult social media users. One possible reason could be that adolescent females tend to post personal selfies as a means of experimenting with self-identity and self-presentation  due to wComparing the two gender groups across the three age groups, the results for the adolescent social media users suggest that privacy concerns did not influence group selfie taking or personal selfie posting behavior among either male or female users. This suggests that group selfie taking and personal selfie posting are part of the online self-presentation behavior that is considered very important for the well-being and development of adolescents . Due to In the case of young-adult social media users, privacy concerns did not predict group selfie-taking among either male or female young adults. As mentioned before, one possible reason could be that group selfies are associated with peer membership, which is important for young adults. Due to this reason, young adults are less bothered about privacy concerns when it comes to taking group selfies. In comparison, privacy concerns did not influence taking and posting selfies, cropping photos, or using photographic filters among male young adults, whereas they did for female young adults. This is again consistent with the findings of the prior literature, which suggests that females are more concerned about online privacy than male social media users .Finally, in the case of adult social media users, the results suggest that privacy concerns resulted in lower engagement in selfie-taking and selfie-sharing frequency and in photo-editing behavior across both male and female users. The possible reasons could be that older adults are more concerned that selfie taking and posting will affect them negatively in the future .The present study has different theoretical and practical implications for both scholars and practitioners. In terms of its theoretical implications, the current study findings contribute significantly to the interdisciplinary literature on human\u2013computer interaction, new media, computer-mediated communication, as well as developmental psychology. Second, the present findings complement the available qualitative findings e.g.,  on the aThe main limitation of the current study is the self-selected nature of the sample, which was recruited via two leading online news media. Due to this, it is likely that two user groups, namely young adults and adults, were over-represented. This is mainly because online newspapers are particularly popular among young adults and adult Internet users. However, the sample sizes across the three groups were comparable. Of note, the two news entities are nationwide rather than local news media, which increases the possibility of reaching out to a broad range of Norwegian people. Norwegians are also known for being heavy newsreaders, as well as having broad access to the Internet. Nevertheless, we still recommend that other scholars validate the study findings using more representative study samples. Any future investigation with similar research questions should also try to generalize the findings to other age groups, particularly adults older than 50 years. In addition to this, other possible future directions include expanding the study focus to other aspects of selfie behavior such as selfies classified as public, private, and romantic , analysis , interpretation of data , and/or writing and revising the work critically for important intellectual content . All authors read and approved the final version of the work to be published , and agreed to be accountable for all aspects of the work in ensuring that questions to the accuracy of any part of the work are appropriately investigated and resolved .The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "However, an incomplete understanding of the factors that influence binding of \u03b1v\u03b23 integrin-specific radiotracers currently limits their use for assessing response to therapy in cancer patients. This study identifies two fundamental factors that modulate uptake of these radiotracers.Molecular imaging of \u03b1Proceduresv\u03b23 integrin. \u03b1v\u03b23 integrin-specific radiotracers were used to investigate the effect of manipulating \u03b1v\u03b23 integrin expression or activation in cellular binding assays. \u03b23 integrin and \u03b1v\u03b23 integrin expression were measured by western blotting and flow cytometry, respectively. The effect of select pharmacological inhibitors on \u03b1v\u03b23 integrin activation and expression was also determined.Experiments were performed in prostate cancer (PC3) and glioblastoma (U87MG) cells, which differentially express \u03b1v\u03b23 integrin expression when it was decreased (\u03b23 knock-down cells) or increased, either using pharmacological inhibitors of cell signalling or by culturing cells for different times. Studies with both small molecule and arginine\u2013glycine\u2013aspartic acid (RGD)-based radiotracers revealed increased radiotracer binding after activation of \u03b1v\u03b23 integrin with Mn2+ or talin head domain. Moreover, inhibition of fundamental signalling pathways (mitogen-activated protein kinase kinase (MEK), Src and VEGFR2) decreased radiotracer binding, reflecting reduced \u03b1v\u03b23 integrin activity.Radiotracer binding was proportional to \u03b1v\u03b23 integrin. \u03b1v\u03b23 integrin-specific radiotracers can provide otherwise inaccessible information of the effect of signalling pathways on \u03b1v\u03b23 integrin. This has significant implications for assessing response to anti-angiogenic therapies in clinical studies.Binding of small molecule ligands and radiolabelled RGD peptides is modulated by expression and activation status of \u03b1The online version of this article (doi:10.1007/s11307-017-1100-z) contains supplementary material, which is available to authorized users. Unbound radioactivity was removed by rinsing the plates five times with ice-cold PBS. Cells were detached using 0.35\u00a0ml trypsin and neutralised with 0.35\u00a0ml RPMI. The radioactivity present in 0.5\u00a0ml cell suspension was measured in a TRICARB 2100 TR scintillation counter using ultima gold scintillation fluid. The protein content in the remaining 0.2\u00a0ml was measured using the BCA assay. Binding was expressed as a function of radioactivity added per plate and normalised to protein content. Radiotracer binding was performed in the presence and absence of 10\u00a0\u03bcM Cyclo(Arg-Gly-Asp-D-Phe-Lys) peptide (cRGDfK) (a non-radiolabelled cyclic peptide known to bind selectively to \u03b1v\u03b23 integrin) ZMPZAT71 binding. Divalent cations were added to medium just prior to radiotracer, ensuring that cells were not exposed to these stimuli for longer than 30\u00a0min. Indeed, in the presence of Mn2+, radiotracer binding significantly increased in both PC3 and U87MG cell lines . In contrast, Mg2+ did not increase radiotracer binding to either cell line, whereas Ca2+ decreased binding in both cell lines  ZMPZAT71 binds specifically to \u03b1v\u03b23 in cells and the magnitude of binding reflects receptor expression. Firstly, in U87MG cells, [3H]ZMPZAT71 binding increased in a temporal manner in parallel with \u03b1v\u03b23 integrin  on the \u03b2 subunit extracellular domain ZMPZAT71 and [18F]FDR-Aoa-(RGDfK), was enhanced. Taken together, these two datasets provide very strong evidence that radiotracer binding is sensitive to integrin activation status in cells and that these radiotracers can report on \u03b1v\u03b23 integrin activation status. To our knowledge, this is the first study to directly demonstrate this.Significant increases in \u03b1sms Fig. . Mn2+ bir domain , produci ligands . The oppormation . The datv\u03b23 integrin radiotracers that cannot be accounted for by altered \u03b1v\u03b23 integrin expression -DOTA-c(RGDfK) radiotracer uptake was decreased in the absence of any effect on total or cell surface \u03b1v\u03b23 integrin expression [v\u03b23 integrin activation caused by Src inhibitors  binding was observed despite a 50\u00a0% decrease in \u03b1v\u03b23 integrin expression [18F]FPPRGD2 binding and \u03b1v\u03b23 integrin staining both decreased after treatment with ZD4190, a potent inhibitor of VEGFR1 and VEGFR2 inhibitor [in vivo studies have not assessed \u03b1v\u03b23 integrin expression [v\u03b23 integrin activation.Two xenograft studies have also reported changes in binding of \u03b1pression , 18. Theatinib. 6Cu-DOTA-cpression . The autnhibitor , in agrenhibitor , 14, 15.pression , 30, 32 v\u03b23 integrin activation was not clear [v\u03b23 integrin binding radiotracers can report on \u03b1v\u03b23 integrin activation status allows this otherwise inaccessible information to be directly revealed. The results clearly demonstrate that inhibition of MEK1/2, Src and VEGFR2, but not FAK, decreases \u03b1v\u03b23 integrin activation  by providing early guidance on the efficacy of these agents in clinical studies.Binding of radiotracers to cells corresponds with both changes in \u03b1ESM 1(PDF 534\u00a0kb)"}
+{"text": "Primary pulmonary enteric adenocarcinoma (PEAC) is an extremely rare variant of invasive lung cancer. It is highly heterogeneous while shares some common morphologic and immunohistochemical features with usual pulmonary adenocarcinoma (PAC) and colorectal adenocarcinoma (CRAC), making the differential diagnosis difficult. At present there are only limited studies about distinctive features of primary PEAC and the results are often inconsistent.We retrospectively analyzed total 129 primary PEACs and 50 CRACs that were published since 1991 or diagnosed in our centre. Among them eight typical samples of primary PEACs and usual PACs were detected by targeted exome sequencing.+/CDX2+ acquires high sensitivity (71.3%) and specificity (82%) in differential diagnosis of PEACs from CRAC. The primary PEACs harbor a high incidence of KRAS mutation but almost absent of EGFR mutation. Moreover, compared with usual PACs, the primary PEACs have higher nonsynonymous tumor mutation burden and more frequent MMR mutation.The combination of CK7+/CDX2+ immunostaining and the distinctive genetic signatures, including low incidence of sensitivity genes mutations and high tumor mutation burden, is an important supplementary to the clinical differential diagnosis of primary PEACs. Our findings thus have significant implications for development of individualized treatment strategy in these patients.The combination of CK7 Primary pulmonary enteric adenocarcinoma (PEAC) is an extremely rare variant of invasive lung adenocarcinoma. It was firstly described in 1991 by Tsao and Fraser . But thePrimary PEACs were highly heterogeneous and shared some morphologic and immunohistochemical appearances with pulmonary adenocarcinoma (PAC) and colorectal adenocarcinoma (CRAC). It could even present the typical patterns of colorectal cancer. The differential diagnosis between primary PEACs and metastatic CRAC was challenging but of important clinical implications, since it impacted on clinical stage, therapeutic strategy and prognosis seriously.Of course, a circumspect analysis of clinical history, physical examinations  and careful long-term follow-up to exclude the possibility of intestinal cancer metastasis is obviously necessary. Emerging studies analyzed the characteristics of immunohistochemistry and gene mutation profile in primary PEACs to assist the differential diagnosis and to explore new therapeutic targets , 5. It wIn our present study, we collected 18 samples of primary PEACs diagnosed in our centre and retrospectively reviewed 111 cases published since 1991, aimed at comprehensively analyzing the features of clinicopathology, immunohistochemistry and gene mutation profile of primary PEAC. Furthermore, compared with usual PACs, eight classic samples were chose to be analyzed for the genetic signature and tumor mutation burden (TMB) using targeted exome sequencing of 315 oncogenes and tumor suppressor genes.This work obtained each patients\u2019 informed consent and was approved by the Research Ethic Committee in First Affiliated Hospital of Zhejiang University school of Medicine.The cases of lung adenocarcinoma collected from 2008 to 2017 in the First Affiliated Hospital of Zhejiang University school of Medicine were screened according to the WHO 2015 criteria of primary PEAC. Two pathologists reviewed the specimens independently. After excluding possible colorectal cancer metastasis by carefully analyzing the clinical histories and imaging examinations, 18 samples of primary PEACs were enrolled in our study. Also, 50 samples of colorectal adenocarcinoma were collected randomly to analysis the immunohistochemical expression of CK7 and CDX2.The immunohistochemical analysis was conducted as previously described . A panelThe gene mutation profiles in five classic samples of primary PEAC and three usual PAC samples that with no history of smoking were detected by targeted exome sequencing of 315 oncogenes and tumor suppressor genes using Illumina next seq 500 DNA sequencer, USA. The experimental procedure was performed as described previously . SequencA comprehensive search was performed through PubMed using the literature retrieval strategy \u201c(pulmonary enteric adenocarcinoma [Title/Abstract]) OR Pulmonary adenocarcinoma with enteric differentiation [Title/Abstract]) OR Pulmonary intestinal-type adenocarcinoma [Title/Abstract]) OR lung enteric adenocarcinoma [Title/Abstract]) OR enteric-type adenocarcinoma of the lung [Title/Abstract]) OR Intestinal type of Lung Adenocarcinoma [Title/Abstract]) OR Pulmonary Adenocarcinoma With Intestinal Differentiation [Title/Abstract]\u201d in January 2018 . Relevant articles were obtained, and references from each of these articles were further searched for relevant articles. A total of 43 articles were reviewed (of which 22 were case reports or series). There were a total of 129 reported cases from which data were collated and analyzed.+/CDX2+ on primary PEACs. SPSS version 16.0  software and GraphPad Prism 5.0  was used for statistical analysis and graphics, respectively. The statistical significance level was 0.05.Continuous variables were described with mean\u2009\u00b1\u2009standard deviation (SD). Categorical data were described with percentage. For continuous variables, two independent samples t test was used to test the differences between the two groups. And for categorical data, Chi square test was used to test the differences between different groups. Sensitivity, specificity, 95% CI of them, and ROC analysis were performed to evaluate diagnostic value of CK7Eighteen cases of primary PEAC diagnosed in our medical center from 2008 to 2017 were enrolled into this study and representative images of the histopathology for primary PEAC, usual PAC and CRAC is shown in Fig.\u00a0We also analyzed the expression level of serum tumor markers, including CEA, CA199, NSE and CYFRA21-1, which were commonly used in clinic. Interestingly, our results showed that the expression of carcinoembryonic antigen (CEA) and carbohydrate antigen (CA199) was more remarkable than cytokeratin 19 fragment (CYFRA21-1) and neuron-specific enolase (NSE) in primary PEACs. CA199 was the mostly expressed marker while NSE expression was nearly absent.All primary PEACs studies that previously published concerning CDX2, CK20, CK7 and TTF-1 were retrospectively analyzed, and the immunohistochemical results were summarized in Table\u00a0+/CDX2+ acquired high sensitivity  and specificity  in the differential diagnosis of primary PEACs from CRACs, as shown in Table\u00a0+/CDX2+ on Primary PEACs . The representative images of the immunostaining for usual PAC, primary PEAC and CRAC were shown in Fig.\u00a0+, CDX2\u2212; primary PEAC: CK7+, CDX2+; CRAC: TTF-1\u2212, CDX2+; TTF-1 was chosen because of its better specificity than CK7 in the diagnosis for lung adenocarcinoma).Moreover, we also analyzed the expression of CK7 and CDX2 in 50 samples of CRAC that collected randomly in our centre. Our results suggested that the combination of CK7KARS gene mutation in exon 2, 3 and 4. The incidence of EGFR gene, NRAS gene and EML4-ALK fusion mutations was extremely low , and the BRAF gene was wild type in all cases.All studies concerning gene abnormalities in primary PEACs were analyzed , 15\u201322. ERBB2 (HER2) and MMR genes. 2/5 (40%) harbored ERBB2 (HER2) amplification or mutation, while MMR genes showed mutation in 4/5 cases (80%)  and the TMB (muts/Mb) of each case was described in Fig.\u00a0Five classic cases of primary PEAC with no smoking history were chose to be further analyzed for gene mutation by targeted exome sequencing of 315 oncogenes and tumor suppressor genes. Interestingly, we found the abnormalities of nes. 2/5 0% harborPrimary PEAC is a special and rare type of lung adenocarcinoma. To make a definite diagnosis, the distinctive features of immunohistochemistry and gene mutation profile have been attracting more and more attention. By analyzing the cases diagnosed in our medical center, and retrospectively reviewing all published cases, a deeper understanding of primary PEAC is widely expected.As for the clinical features of primary PEAC, we find that primary PEACs are more occurred in elderly women rather than younger patients. Moreover, it is interesting to find that the levels of serum tumor markers CEA and CA199 expression are increased more remarkably than that of CYFRA21-1 and NSE. Of these markers, CA199 is the mostly expressed while NSE expression is nearly absent. Furthermore, the consistent overexpression of CEA and CA199 seems to be closely-related with advanced pathologic stage in primary PEACs. As we known, CEA is nonspecific to diagnose a variety of cancers, such as colon cancer, lung cancer, breast cancer and so on. The high serum expression of CA199 is more predictive for the digestive tract tumors, like colorectal cancer and pancreatic cancer. But CYFRA21-1 and NSE are more specific and sensitive to the diagnosis of lung cancer . Our results reveal that different from usual lung cancer, the serum expression levels of tumor marker CEA and CA199 should be given more attention in the diagnosis, therapeutic monitoring and relapse prediction of primary PEAC, although more studies are needed to validate it.Immunohistochemical marker is significant to the pathological diagnosis, especially in primary PEAC, since it is not enough based solely on its morphologic features. Thus many studies had focused on the immunohistochemical signatures of primary PEACs. The study of Yousem et al.  indicate+/CDX2+ acquired high sensitivity and specificity in the differential diagnosis from colorectal carcinoma, which showed great application value in clinical practice. Considering the high heterogeneity of histomorphology, the combination of CK7+/CDX2+ exhibited much more importance in diagnosis of primary PEAC.As the most typical and clinical routinely detected immunohistochemical markers of pneumocytic and intestinal, CK7, TTF-1, CK20 and CDX2 were chose to be analyzed in the present study. In total 129 cases of primary PEAC, CK7 and CDX-2 were the markers that mostly expressed. It was consistent with the previous study by Nottegar et al. . MoreoveKRAS gene were much more prevalent than EGFR, NRAS genes and EML4-ALK fusion gene in primary PEACs, while the mutation of BRAF gene was total absent. Our results above suggested that using EGFR tyrosine kinase inhibitors in primary PEAC patients might be unreasonable and inefficient, which was different from that in usual lung adenocarcinoma.To validate the molecular profiles, almost all studies concerning mutational information of primary PEAC were retrospectively analyzed. Consistent with the results of the study by Nottegar et al. , we alsoImmunotherapy is considered as a major breakthrough as cancer treatment in recent years, and its efficacy had been confirmed in a variety of tumor types, like advanced NSCLC, melanoma, kidney cancer and so on. In advanced NSCLC, Reck et al.  demonstrFor the first time, using targeted exome sequencing of 315 oncogenes and tumor suppressor genes, we detected the TMB of primary PEACs and compared it with usual pulmonary adenocarcinomas. To our surprise, the nonsynonymous TMB of primary PEACs was significantly higher than that of usual pulmonary adenocarcinomas, which TMB was low in all three cases we detected. Thus we conjectured that checkpoint blockade immunotherapy might be a new light in primary PEAC patients. In view of the possible role absence of tyrosine kinase inhibitors in primary PEACs, the news that these patients might have greater possibility to benefit from checkpoint blockade immunotherapy was exciting, especially for those advanced patients, although further studies were needed to ascertain this. The complications associated with checkpoint blockade in primary PEAC patients, including immune-related adverse events (irAEs), were also worthy of our attention.ERBB2 (HER2) amplification/mutation and MMR genes mutation could also be occurred in primary PEACs. 2/5 primary PEACs harboring the amplification/mutation of ERBB2 (HER2) gene reminded that certain patients with this rare variation of pulmonary adenocarcinoma might be responsive to the therapy targeted at HER2 gene product, like herceptin and pertuzumab, or the inhibitors of HER2 tyrosine kinase, like afatinib. The MMR genes mutation might impair the base mismatch repair system and resulted in the genome instability. Many studies had validated the correlation between MMR deficiency and the response to checkpoint blockade immunotherapy [MMR genes mutation. Furthermore, the mutational status of the core MMR genes, MLH1, PMS2, MSH2 and MSH6, was consistent with the level of TMB in each sample we tested. Similar to the findings in other studies, the loss of DNA MMR enzymes was associated with a high TMB [MMR genes mutation with immunotherapy in primary PEACs still needs to be checked.Interestingly, we found that otherapy , 28, 30.high TMB , 31. But+/CDX2+ immunostaining and the distinctive genetic signatures, including low incidence of sensitivity genes mutations and high tumor mutation burden, provides important supplementary information to clinical differential diagnosis of primary PEACs and has significant implications in individualized treatment strategy in these patients. Our study suggest that, different from it in usual lung adenocarcinoma, EGFR tyrosine kinase inhibitor used in primary PEACs might be unreasonable and inefficient, but these patients might have greater possibility to benefit from checkpoint blockade immunotherapy.The combination of CK7"}
+{"text": "The aim of this paper was to describe the outcome of the therapeutic administration of allogenic mesenchymal stem cells obtained from Wharton's jelly (WJ-MSCs) in children with cerebral palsy (CP) during a medical therapeutic experiment. We retrospectively analyzed the records of 109 patients recruited in daily clinical practice. Each patient received 1\u201310 injections and was examined by the same neurologist (study investigator (SI)) on the day of each infusion. The SI used a 6-point Likert scale to assess the quality of life (QoL) and self-sufficiency of the patients on the basis of the neurological examination. Children with >50% follow-ups after this administration were included into the quantitative analysis. In addition, the assessments of the parents and other health care professionals were obtained for 23 patients and compared with those of the SI. Forty-eight of 54 analyzed patients (88.9%) achieved some improvement in health status. Forty-eight (88.9%) patients experienced an increase in their QoL, and 21 patients (38.9%) achieved an increase in their self-sufficiency level. Improvement was achieved in 17 areas. Adverse events were mild and temporary except one case of epilepsy deterioration leading to treatment discontinuation. Age, body mass, and cell dose were not significant predictors of QoL response, contrary to epilepsy; developmental breakthrough was dose-dependent. Cerebral palsy (CP) is the most common motor disorder in children , decreasThe first therapeutic administration of stem cells for CP happened in 2009. The recipient was a 2.5-year-old boy with CP caused by global hypoxic-ischemic brain damage due to cardiac arrest . After aJournal of Laws of 2008, No. 136, item 857). While the main goal of a research experiment is to expand medical knowledge, the aim of a therapeutic experiment is to improve the patient's health through the use of new\u2014or only partially tested\u2014diagnostic, therapeutic, or prophylactic methods. A therapeutic experiment can be performed when the current treatment options for a disease are ineffective or insufficient. Sometimes, participation in a therapeutic experiment is a patient's only possibility of treatment. Although therapeutic experiments are not so strictly regulated as clinical studies and therefore cannot be matched in terms of data quality, they still possess a scientific value. The aim of our paper was to retrospectively analyze the efficacy and safety of WJ-MSC administration in children with CP participating in a therapeutic experiment.In Poland, doctors may engage in two kinds of medical studies: therapeutic experiments and research experiments   according to the manufacturer's instructions. The tissue explants were cultured in NutriStem\u00ae XF serum-free medium  supplemented with NutriStem\u00aeXF Supplement Mix  and an antibiotic-antimycotic solution (Gibco) and incubated at 37\u00b0C in 5% CO2 in air. After 1-2 hours, the nonadherent cells were washed off, and the attached cells were further expanded. The tissue explants were removed after 2-3 weeks of culture. When the adherent cells reached 90% confluence, they were passaged and reseeded for further expansion at 1.2 \u00d7 104 cells/cm2 in a 75\u2009cm2 tissue culture flask (BD). To evaluate their numbers, the cells were detached using a trypsin solution  and counted in a haemocytometer. When a sufficient number of cells was reached, they were transferred to a freezing bag for cryopreservation. The cells were resuspended in a 10% (v/v) DMSO (WAK-Chemie) solution in human albumin (CSL Behring), frozen in a controlled-rate freezer (Sy-Lab IceCube 14S), and stored in the vapour phase of liquid nitrogen.After harvesting, the umbilical cords (UC) were transported to the laboratory under monitored conditions and processed within 48\u2009h of delivery. First, UC were disinfected by washing in a sterile saline solution supplemented with an antibiotic-antimycotic mixture (Gibco) and were then dissected and stripped of any blood vessels. Using a sterile lancet, Wharton's jelly was minced into 2\u2009cmUC-derived MSCs were characterized by immunophenotyping according to the criteria for defining MSCs described by Dominici et al. . BrieflyThe postthaw MSC viability was determined based on that of a thawed reference sample. The cells were stained with trypan blue, and live cells were counted in a haemocytometer. Neither the proliferation rate nor any other indicators of cellular senescence were monitored. However, only 7 patients received cells after the fifth passage; all other patients received cells that were at passage 4 or lower.Good manufacturing practice was followed throughout the process. The final medicinal product complied with the Chief Pharmaceutical Inspectorate's requirements in terms of the unit volume; number, vitality, and morphology of the cells; microbiological purity; results of serological tests; absence of endotoxins; and immunophenotype of the cells. Before administration, the cells were placed in a water bath and thawed at 37\u00b0C.We performed a retrospective analysis of the medical records of Polish patients with CP who received MSC infusions as part of a therapeutic experiment between 2014 and 23 June 2018. All the data were fully anonymised before we accessed them. Before the beginning of the study, approval was obtained from the Bioethics Committee at the Medical University of Lublin, Lublin, Poland ; the Bioethics Committee at the Regional Chamber of Physicians and Dentists in Lublin, Poland (152/2018/KB/VII); and the Bioethics Committee at Andrzej Frycz Modrzewski Cracow University, Cracow, Poland (24/2016). The study was conducted in accordance with the Declaration of Helsinki. An informed consent form, including consent for the use of the patient's medical data for statistical analysis, was signed by the patients' parents before the MSC administration. All patients were informed about the possibility of publication before the form was signed.6 MSCs/injection were used. The total stem cell count received varied according to the weight of the patient, but the approximate dose per kilogram was 1 \u00d7 106 MSCs. Injections were administered every two months, after patient qualification by the study investigator (SI).The patients were recruited by a neurologist in daily practice. Treatment consisted of 1-5 intravenous stem cell injections per treatment course. Up to two treatment courses were permitted. Four standard stem cell doses of 10, 20, 30, or 40 \u00d7 10All the patients were examined by the same SI, a neurologist, on the day of each infusion. The examinations consisted of a neurologic and paediatric qualitative assessment. The quality of life (QoL) and self-care level of the patients were evaluated based on a physical examination and a medical interview. The results were described using a 6-point Likert scale, in which 0 corresponded to a lack of improvement, and 5 corresponded to an excellent improvement. Scores for QoL and SS level were obtained for each examination and compared to the results of the previous examination. Spontaneous reports by the patients' parents and third-party therapists such as physiotherapists, sensory integration specialists, and pedagogues were obtained from the parents by the Polish Stem Cell Bank and included in this retrospective analysis.As mentioned in the previous section, four standard stem cell counts per injection were used, and the body mass of the patients fluctuated throughout the study. Hence, the real stem cell dose range was calculated using the lowest and highest body masses recorded during therapy, and the highest and lowest stem cell doses used per injection.p \u2264 0.05.Qualitative data were coded as improvement, deterioration, or no change. The following areas were evaluated: muscle tension, muscle strength, gross motor development, fine motor development, nutritional functions, senses, excretion/defecation control, sleeping, circulation, epilepsy attacks, drug dosage, emotions, communication, attention, cognitive functions, engagement (motivation/initiative/cooperation), and social interactions. These results are presented as a number and percentage, calculated using Microsoft Excel. In addition, the nonparametric sign test was performed using the statistical software Statistica 13.0. Statistical significance was considered at U test.The averages for QoL and self-sufficiency were calculated as the sum of individual values divided by number of assessments. The difference between the median QoL score and the median self-service score per administration was assessed using a Kruskal-Wallis rank test with a Bonferroni correction. Subsequently, the results were categorized using a binary system based on the number of past administrations  and compared using the Mann-Whitney The minimum single WJ-MSC dose was calculated as the minimum cell count administered in one injection divided by the maximum body mass during one treatment course. The maximum single WJ-MSC dose was calculated as the maximum cell count administered in one injection divided by the minimum body mass during one treatment course. The minimum total WJ-MSC dose per kilogram of body mass was calculated by multiplying the minimum cell count administered in one injection by the number of administrations and dividing by the maximum body mass during the whole treatment course. The maximum total WJ-MSC dose per kilogram of body mass was calculated by multiplying the maximum cell count administered in one injection by the number of administrations and dividing by the minimum body mass during one treatment course.R coefficients were used to calculate the nonparametric correlation between average improvement in QoL per past administration and age, single dose per kg of body mass, and the minimum total stem cell dose. The nonparametric correlation between QoL after the first cell administration (early response) and average QoL in the following administrations was assessed with the same method. We also calculated these correlations for the average improvement in QoL per collected assessment to minimize the impact of missed follow-ups. After binary categorization, the results were verified using Yates' chi-square test.The age, minimum and maximum single and total doses, and average QoL improvement per administration followed nonnormal distributions. Therefore, Kendall's tau and Spearman 6 to 1.6 \u00d7 106 WJ-MSCs/kg . The maximum single WJ-MSC dose ranged from 0.5 \u00d7 106 to 2.14 \u00d7 106 WJ-MSCs/kg . The minimum total WJ-MSC dose per kilogram of body mass ranged from 0.7 \u00d7 106 to 11.5 \u00d7 106 . The maximum total WJ-MSC dose per kilogram of body mass ranged from 0.71 \u00d7 106 to 13.6 \u00d7 106 . Thirty-one (28.4%) children had epilepsy.We analyzed the data of 107 children aged 17\u2013204 months (17 years)  39\u2013117 months) at baseline. The minimum body mass during the course of therapy ranged from 7.0 to 75.0\u2009kg . The maximum body mass ranged from 7.0 to 86.0\u2009kg . The difference in body mass at the beginning and the end of therapy ranged from 0 to 21\u2009kg . The minimum single WJ-MSC dose ranged from 0.5 \u00d7 10Follow-ups were available for 90 (84.1%) children, but many reports were incomplete. All collected follow-ups were used to assess the safety of the therapy. At least 50% of expected follow-ups were available for 54 children, including 59% of those who received at least two infusions and therefore had at least one assessment. This subpopulation was used to calculate the average improvement in QoL and self-service as well as to assess the number of significantly improved areas with the sign test. Parental assessment and additional documentation were supplied by the parents of 23 children and were used to evaluate treatment efficacy .6 to 1.875 \u00d7 106 . The maximum single MSC dose per kg of body mass ranged from 0.5 \u00d7 106 to 2.14 \u00d7 106 . The minimum total MSC dose, calculated as the minimum cell count administered in one injection divided by the maximum body mass during one treatment course, ranged from 1.2 \u00d7 106 to 11.5 \u00d7 106 WJ-MSCs/kg . The maximum total MSC dose, calculated by dividing the maximum cell count administered in one injection by the minimum body mass during one treatment course, ranged from 1.3 \u00d7 106 to 13.6 \u00d7 106 WJ-MSCs/kg .The subgroup included in the QoL and SS calculations had similar characteristics to the whole study population. The age of the patients was 17\u2013201 months (16 years and 9 months) at baseline  37\u2013123 months). The minimum body mass during therapy ranged from 7.5 to 75.0\u2009kg . The maximum body mass ranged from 10.0 to 86.0\u2009kg . The difference between body mass at the beginning and the end of therapy ranged from 0 to 21\u2009kg . The minimum single MSC dose per kg of body mass ranged from 0.5 \u00d7 10Ninety-eight (91.6%) patients in the study population received only one course of therapy. Nine patients (8.3%) with very good response to the treatment received 1-5 additional injections in the second course.Forty-eight of 54 patients (88.9%) included in the analysis attained some improvement in health status. Forty-eight (88.9%) patients experienced an improvement in QoL. In this subgroup of patients, the median improvement was 1.25, while in the whole population, it was 1.0 per past administration and 1.5 per collected follow-up. Twenty-one patients (38.9%) increased their self-service level. The median increase was 0.8 in this subgroup and 0 when considering the 54 patients. The number and percentage of nonresponders in subgroups categorized by the number of past WJ-MSC administrations are presented in p = 0.06). Statistical significance did not differ after binary categorization  in children who received at least 4 cell infusions compared to children who received 1\u20133 infusions before assessment.According to the Kruskal-Wallis test results, there were no differences in the average self-service score per past administration and per collected follow-up between subgroups categorized by the number of past administrations. However, there was a difference in these variables after categorization by the number of collected follow-ups . The odd6 stem cells per kilogram of body mass  and Spearman methods (0.40) and the chi-square test as well .Out of the ten patients who did not show any improvement after the first administration (early response = 0), five did not continue the treatment, three received two additional injections, four received four additional injections (and completed course one), and two completed course one and received three or five injections in the second course. Six of these patients did not improve their QoL, and eight did not improve their self-service level. In the subgroup of patients who experienced improvement in QoL, it ranged from 0.75 to 1.75 per past administration and from 1.0 to 1.75 per collected follow-up. In two patients who experienced an improvement in their self-service level, the average self-service improvement per administration was 0.8 and 1.0, but the maximum developmental breakthrough was 3.Out of 13 children who had an early response < 2 and received at least five infusions, 12 (92.3%) had a later response < 2. Developmental breakthrough was observed in three children from this subgroup. Two other children improved their SS by 1 point.p = 0.049 in Mann-Whitney U test), but this difference was not clinically relevant.The average improvement in QoL per collected follow-up was better in children without epilepsy  in the following days, with unknown relation to the administration of WJ-MSCs . In thre6 (<quartile 2) and a maximum WJ-MSC dose in the whole therapy of 4.55 \u00d7 106 (<quartile 2). Patient #560 received 1.0 \u00d7 106 (=quartile 2) and 5.0 \u00d7 106 (> quartile 2), patient #592 received 1.17 \u00d7 106 (> quartile 3) and 7.06 \u00d7 106 (>quartile 3), and patient #386 received 1.54 \u00d7 106 (> quartile 3) and 7.69 \u00d7 106 (> quartile 3), respectively. Patients who experienced AEs also achieved the greatest improvement in QoL per past administration and per collected follow-up. QoL scores were as follows: 2.0 and 2.67  for patient #510, 2.8 and 2.8 for patient #592, 1.25 and 1.25 for patient #386, and 0.5 (median level) for patient #560. Regarding their improvement in self-service per past administration, two of these patients achieved a result above quartile 3 equal to 0.6 (1.4 and 0.8); two others did not experience an improvement in their self-service.AEs were not clearly associated with the cell dose. Patient #510 received a maximum WJ-MSC dose in a single administration of 0.9 \u00d7 10This study was a retrospective analysis using medical documentation obtained from a therapeutic experiment. As such, there are some limitations associated with its nature, including the lack of a control group, the lack of blinding in the evaluation, and the fact that the analysis was done retrospectively. There were also violations to the visiting schedule, and the use of concomitant therapies, including physical, pedagogical, and animal therapies. Furthermore, there was no long-term evaluation of the treatment, and a simple 6-point Likert scale was used instead of more specialized neurological scales such as GMFCS, GMFM, Up&Go, CGI, PEDI-CAT, and PedsQL. Although many authors have reported statistically significant changes in these scales after cell therapy , others Other limitations regard technological issues. The procedure currently used to identify MSCs based on the in vitro self-renewal and multipotential evaluation of CFU-F clones only sheds light on the in vitro properties of putative MSCs. The CFU-F assay is not a definitive method for proving the existence of stem cells. In fact, the isolation of MSCs according to the criteria of the International Society for Cell & Gene Therapy produces heterogeneous, nonclonal cultures of stromal cells containing stem cells with different multipotential properties, committed progenitors, and differentiated cells \u201319. The Another limitation of the present study was the need to calculate an approximate stem cell dose, caused by the fluctuation in body mass observed in the patients. It was also partly caused by technical and financial considerations, since every SC administration was funded by the patients' parents, and the cost was dose-dependent. Despite methodological constraints that limit the possibility of drawing categorical conclusions, our preliminary results are valuable for creating new assessment tools dedicated to stem cell therapies. At the top of the hierarchy of evidence-based medicine, and providing the best data, are meta-analyses of controlled and randomized clinical trials. Nonetheless, the results that can be obtained from real-life settings, such as those in this therapeutic experiment, have the advantage of being more similar to daily clinical practice. Furthermore, the inclusion in the present analysis of the spontaneous reports delivered by the patients' parents revealed that the areas in which the patients improved are related to the clinical manifestation of the disease .Another limitation of this study is the high number of missed follow-ups. We were not able to verify if follow-ups were skipped selectively, and therefore, we were not able to assess bias at this stage. The characteristics of the children included in the quantitative analysis were similar to those of the general population. However, even if we assumed that the health status of excluded children did not improve, our results are still encouraging. Some effectiveness was indicated for 48 of 92 (52.2%) patients who had two administrations and therefore at least one expected follow-up.In general, our results are similar to those obtained in clinical trials. Chen et al. observed an improvement in short-term motor functions in two studies involving a total of 111 children with CP. The patients were treated with allogeneic stem cells obtained from the olfactory bulb of aborted human foetuses, as well as autologous bone marrow MSCs. The cells were cultured and propagated in vitro and differentiated into neural stem cells , 22. In In our study, the most frequently observed improvements were psychological. Half of the children with CP have an intellectual disability, which elevates their risk of premature death . Thus, ith administration of MSCs, a reduction in both was observed by the SI, the patient's mother, and the patient's paediatrician, who endorsed the proposal for the second treatment course before the bioethics committee. Although the therapy did not cure the disability, the next course gives hope for the possibility of effective surgery to prevent scoliosis.The partial efficacy observed in our study may be surprisingly positive in some cases, due to synergy between different methods of therapy. For example, one of the patients experienced dislocation of the hip joint caused by involuntary movements and abnormal muscle tension, which voided the effect of surgical treatment. After the 5In our study, we did not notice serious AEs. Novak et al. conducted a meta-analysis of 4 randomized and 1 nonrandomized clinical trials evaluating different stem cell therapies in a total of 328 children and young adults (<32 years) with CP. They found one death (cause unknown) and 3 other serious AEs in the stem cell group, compared to no deaths and 6 serious AEs in the control group . The comIn our study, the only serious AE leading to treatment discontinuation was epilepsy deterioration. Similar AEs were reported by Zali et al. in one patient after bone marrow-MSC administration .The mechanism of action of MSCs in CP remains unknown. Although they are characterized by a high proliferative activity with confirmed in vitro differentiation into osteoblasts, chondroblasts, and adipocytes , their dBecause of the substantial costs of therapy, ethical considerations require the identification of the prognostic factors of success related to the patient. The results from our study suggest that one of them may be epilepsy, which is an expression of severe clinical condition. On the other hand, in 5 out of 20 children with epilepsy, the number of seizures decreased, suggesting that the therapy may be beneficial regardless of improvement in QoL and SS. The second factor that should be analyzed in the future is the type of cerebral palsy. This analysis was impossible for us since the type of disease was frequently missing in the medical documentation available for our study. The third factor worth considering is genetics. In 2015, Wang et al. compared the effect of UC-MSC on the motor functions of identical twins with CP . Eight pThe intravenous administration of WJ-MSCs seems to be a safe and effective procedure that improves gross motor functions, muscle tension, communication, attention, and cognitive functions in children with CP. In our study, this led to an improvement in the QoL of the children according to the parents, third-party therapists, and the SI. However, the clinical response to the treatment varied from patient to patient. In some children, the therapeutic response was remarkable. This, in view of the severe effects of the disease and the poor therapeutic options, makes MSC administration a promising alternative. Nonetheless, further studies using more specific scales are required.Even if several follow-ups indicate no improvement, developmental breakthrough is still possibleLow clinical improvement after the first administration may predict low effectiveness of further therapy, although it does not preclude developmental breakthrough between two consecutive assessments. This suggests that parents should be informed after the first assessment about the limited perspectives for success with further treatmentrd administration. A poor response at this stage should discourage the continuation of therapyThe next crucial checkpoint is the assessment after the 36 MSCs/kg per treatment course. Clinical effects may not be noticeable before this total dose is reachedThe minimal effective dose needed to observe improvement is 4 \u00d7 10The results from our study suggest several practically important conclusions:"}
+{"text": "Pancreatic cancer (PC) has a very poor prognosis and comparatively short survival. Eukaryotic translation initiation factor 5A (EIF5A) promotes cancer metastasis. Here, we exploited the biological role of EIF5A in PC chemoresistance.Expression of EIF5A was analysed in PC cells and tissues by real\u2010time PCR, Western blotting, immunohistochemistry and immunofluorescent. EIF5A expression was specifically suppressed by transfection, and subsequently the alterations of growth behaviour and resistance to anticancer treatment were tested in an orthotopic tumour model.The results showed EIF5A was increased in human PC tissues and PC cells. We found EIF5A knockdown reduced the PC proliferation ability in vivo and in vitro. In addition, sonic hedgehog (sHH) signalling pathway may be a downstream of EIF5A in PC cells. Inhibition of EIF5A and sHH signalling pathway could suppress PC cells proliferation and tumour growth. Importantly, EIF5A played an important role in gemcitabine sensitivity for PC.Taken together, our results revealed that EIF5A regulated the proliferation of PC through the sHH signalling pathway and decreased the Gem sensitivity in PC, which provided a novel therapeutic strategy for PC patients. Vertebrates carry two genes that encode two highly homologous EIF5A isoforms, EIF5A1 and EIF5A2.The sonic hedgehog (sHH) signalling pathway plays an important role in pancreas development and differentiation.Gem, which is a successful compound, frequently is used in PC treatment. Although this drug is effective, its cytotoxic effects and drug resistance limit its application.22.1With the approval and support of the Xi'an Jiaotong University ethics committee, the PC samples from patients (n\u00a0=\u00a030) with the pathological diagnosis were collected at First Affiliated Hospital of Xi'an Jiaotong University. The normal pancreas tissues were obtained from the donor for liver transplantation. All patients were informed and consent was obtained for the research. The nude mice, provided by animal experiment centre of Xi'an Jiaotong University, were used to construct the animal model. All experimental protocols were approved by the Ethical Committee of the First Affiliated Hospital of Xi'an Jiaotong University, Xi'an, China.2.22 atmosphere. Antibodies against sHH (ab53281), SMO (ab5694), PTCH (ab53715), Gli\u20101 (ab49314), GAPDH (ab8245) and EIF5A (ab32443) were purchased from Abcam . Recombinant sHH was obtained from R&D Systems .The human PC cell lines Panc\u20101 and BxPc\u20103 were obtained from the American Type Culture Collection  and cultured in DMEM supplemented with 10% foetal bovine serum (FBS) and 1% antibiotic/antimycotic . The cells were maintained at 37\u00b0C in a humidified 5% CO2.3Pancreas samples from patients or nude mice were collected and labelled by antibodies against EIF5A. Each antibody was diluted at a concentration of 1:1000 in 0.1\u00a0mol/L phosphate\u2010buffered saline (PBS) containing 4% normal serum and 0.3% Triton\u2010X 100 (Sigma). After rinsing with 0.1\u00a0mol/L PBS, sections were reacted with biotinylated goat anti\u2010rabbit IgG  at a dilution of 1:200 in 0.1\u00a0mol/L PBS for 2\u00a0hours at room temperature. After washing with 0.1\u00a0mol/L PBS, they were immersed in a solution of avidin and biotin\u2010peroxidase complex (Vector Laboratories) at a dilution of 1:100 in 0.1\u00a0mol/L PBS for 90\u00a0minutes at room temperature. The sections were then immersed in PBS containing 0.1% diaminobenzidine dihydrochloride (Sigma). Antibody\u2010binding sites were visualized by adding 0.004% hydrogen peroxide. Sections were examined and photographed with a light microscope equipped with digital camera.2.4EIF5A localization in PC cells was examined by immunofluorescence. The prepared cells were washed three times with PBS and then fixed with 100\u00a0mL 4% paraformaldehyde in PBS. The cells were permeabilized in blocking buffer  for 1\u00a0hour at room temperature and then incubated with primary antibody to HO\u20101 overnight at 4\u00b0C. The following day, the cells were washed and incubated with FITC\u2010conjugated goat antimouse IgG  for 1\u00a0hour at room temperature. The cell nucleus was stained with DAPI  for 10\u00a0minutes. After washing with PBS three times, cells were blocked for 5\u00a0minutes. As a negative control, the primary antibody was substituted with antibody diluent.2.5Tumour cells were transfected with EIF5A siRNA. Cells were seeded into small dishes and transfected with 100\u00a0nmol/L ShRNA using Lipofectamine 2000  according to the manufacturer's instructions. The cells were used for further experiments 24\u00a0hours after transfection. Negative control siRNA (Ambion Inc) was used as a negative control.2.6Western blotting and real\u2010time PCR were performed as described previously. Briefly, protein was extracted from the cells using lysis buffer  containing a protease inhibitor cocktail , and protein concentrations were measured by DC Protein Assay . Following separation on 7.5% SDS\u2010polyacrylamide gels, the proteins (20\u00a0\u03bcL) were transferred onto nitrocellulose membranes , which were then incubated with the primary antibodies (1:1000) at 4\u00b0C overnight. After washing three times with TBST, the membranes were incubated with horseradish peroxidase\u2010conjugated secondary antibodies. Quantitative analysis was performed with Image\u2010Pro Plus 6.0 software . The relative protein expression levels were normalized to GAPDH. All experiments were repeated independently three times.\u2212\u0394\u0394Cq method.For real\u2010time PCR, Total RNA was extracted from the cells using TRIzol reagent (Invitrogen), and cDNA was synthesized using a Prime Script RT reagent kit . The real\u2010time PCR experiments were conducted on an iQ5 Multicolor Real\u2010Time PCR Detection System (Bio\u2010Rad Laboratories Inc) using SYBRGreen Real\u2010time PCR Master Mix (Takara). Amplification was carried out as follows: denaturation at 94\u00b0C for 3\u00a0minutes, 35 cycles of 94\u00b0C for 30\u00a0seconds, 58\u00b0C for 30\u00a0seconds and 72\u00b0C for 35\u00a0seconds. The expression of the target gene was calculated using the 22.74 cells per well and incubated overnight in medium containing 10% FBS. The DMSO concentration was adjusted to 0.4%. The cells incubated in serum\u2010free medium were used as the control group. Following incubation for 24, 48 and 72\u00a0hours at 37\u00b0C, 20\u00a0\u03bcL of MTT solution (5\u00a0mg/mL in PBS) was added to each well, and the cells were incubated for an additional 4\u00a0hours at 37\u00b0C. Subsequently, 100\u00a0\u03bcL DMSO was added to each well at 37\u00b0C. The optical density (OD) value was determined using a spectrophotometer (Bio\u2010Rad Laboratories Inc) at 490\u00a0nm. The proliferation rate was defined as OD (cell plate)/OD (blank plate).Cell proliferation rate was measured by MTT assays. Briefly, the cells were seeded in 96\u2010well plates at a density of 1\u00a0\u00d7\u00a0102.86/\u03bcL). After 4\u00a0weeks, the tumour model was highly successful (85%), and drug treatment could be tested. Then, the nude mice were subsequently killed at the indicated time\u2010points to assess the weight of primary tumours.Prepared PC cells were injected into the pancreases of nude mice exposed by midline laparotomy , a sHH pathway inhibitor, was diluted to 18\u00a0\u03bcg/mL and incubated with cells. The neutralizing antibody of sHH  was applied to PC cells at 30\u00a0\u03bcg/mL. Gem was purchased from Sigma\u2010Aldrich and applied according to the PC cell EC50 (100\u00a0\u03bcg/mL). All of above were used to cells for 24\u00a0hours before being processed. In vivo, recombinant sHH, Cyc and Gem were applied to nude mice at 25, 45 and 125\u00a0mg/kg respectively, by intraperitoneal injection.2.10t test. A value of P\u00a0<\u00a00.05 was considered to indicate a statistically significant difference. Data are representative of at least three independent experiments and are reported as means\u00a0\u00b1\u00a0SD.The analyses of the results were carried out using the SPSS statistical software package (version 13.0). The significance of the data was determined using a Student's 33.1P\u00a0<\u00a00.05). In contrast, we found that the protein expression of EIF5A was identified by the immunofluorescence staining in the Panc\u20101 and BxPc\u20103 cell lines . In addition, the reduced proliferation ability kept the consistent results at 24, 48 and 72\u00a0hours. Partially, these findings suggested the importance of EIF5A and it played a role in PC cells proliferation ability.The cell proliferation was measured by MTT assays at 24, 48 and 72 hours following with or without transfection. We found that the proliferation ability was significantly reduced upon EIF5A knockdown compared to control group . The Panc\u20101 cell group formed significantly larger tumour size in vivo compared with Panc\u20101 cells with Si\u2010EIF5A . Taken together, these findings demonstrated that down\u2010regulation of EIF5A prevented proliferation ability in PC progress.We sought to verify the expression of EIF5A in tumours through immunohistochemically stained using EIF5A antibody. The results showed weak expression of EIF5A in the group of Panc\u20101 cells with Si\u2010EIF5A in tumour model Figure B. In conA Figure E (P\u00a0<\u00a00.3.4P\u00a0<\u00a00.05), but we did not observe differential expression of SMO and PTCH in any group (data not shown) (P\u00a0>\u00a00.05). Obviously, these results showed that EIF5A activated the sHH signalling pathway in PC cells. But whether the activation of sHH signalling pathway depends on sHH factor, another experiment was designed, which used recombinant sHH or neutralizing antibody to treat the PC cells with Si\u2010EIF5A. Then, the protein expression of Gli\u20101 was measured by Western blotting. The results showed that Gli\u20101 remained low expression in PC cells containing Si\u2010EIF5A . Altogether, these data indicated that sHH signalling pathway may be a downstream of EIF5A but the sHH factor, independent of sHH canonical stimulation.To determine whether sHH signalling pathway is the downstream effector of EIF5A in PC cell proliferation, firstly, we investigated whether the EIF5A knockdown can decrease the protein expression of sHH signalling factors in different PC cell lines Figure A and B. A Figure E and F (3.5P\u00a0<\u00a00.05). Additionally, the cancer cells with Si\u2010EIF5A combined using recombinant sHH could inhibit the proliferation significantly (P\u00a0<\u00a00.05). Hence, these results demonstrated that EIF5A and sHH signalling pathway may be co\u2010involved in PC cells proliferation.Our above work showed that EIF5A regulated Gli\u20101 protein expression in PC cells. To determine the effect of EIF5A and sHH signalling pathway for PC cells proliferation, the Panc\u20101 and BxPc\u20103 cells with Si\u2010EIF5A were treated with recombinant sHH, or Cyc which is a sHH signalling pathway inhibitor. As shown in Figure P\u00a0<\u00a00.05). Collectively, these results demonstrated that EIF5A and sHH signalling pathway was sufficient and necessary for tumour growth in PC.To determine the effect of EIF5A and sHH signalling on PC tumour growth in vivo, we assessed orthotopic tumour formation of Panc\u20101 cells with Si\u2010EIF5A. After 4\u00a0weeks, the cells were treated with recombinant sHH, or Cyc, then, the average tumour mass of different cell groups was measured . Additionally, we examined the expression of sHH signalling factors in the PC cells treated with Gem. Similarly, Gem increased the expression of Gli\u20101 compared with control . However, Gem up\u2010regulated sHH expression, but did not reach statistical significance (data not shown) (P\u00a0>\u00a00.05). Then, we investigated whether Gem regulate the EIF5A and sHH signalling expression in protein level. Western blotting was used to quantify protein levels, and the results showed that Gem significantly enhanced EIF5A and Gli\u20101 protein expression in Panc\u20101 and BxPc\u20103 cells . Therefore, these data from mRNA and protein analyses indicate that EIF5A may be involved in the sensitivity of Gem in PC cells.To validate whether the EIF5A protein expression and sHH signalling changes is detected by Gem, we treated the PC cells with an EC50 dose of Gem for 24\u00a0hours. The quantification data from real\u2010time PCR revealed that Gem significantly increased the mRNA expression of EIF5A compared with control group in Panc\u20101 and BxPc\u20103 cells Figure A . This phenomenon supported that EIF5A contributed to Gem sensitivity in PC cells. Furthermore, we confirmed the correlation between EIF5A and Gem sensitivity through orthotopic tumour formation of Panc\u20101 cells in vivo . These findings indicated that EIF5A played an important role in Gem sensitivity for PC and suggested that combination therapies involving Gem and EIF5A might benefit PC patients.In our previous work, we found that Gem leaded the up\u2010regulation of EIF5A expression in PC cells. So, we hypothesized that EIF5A could affect the sensitivity of Gem. Then, we examined PC cell proliferation ability when Panc\u20101 and BxPc\u20103 cells, with or without the Si\u2010EIF5A, were treated with different concentrations of Gem for 24\u00a0hours. As shown in Figure o Figure C. Indeedo Figure D (P\u00a0<\u00a00.4Pancreatic cancer remains one of the most aggressive malignancies, because of its poor prognosis, late diagnosis and rapid dissemination, with less than 7% survival at 5\u00a0years.It was known that EIF5A was involved in transcription, mRNA turnover and nucleocytoplasmic transport in cells. Usually, it has two EIF5A isoforms, EIF5A1 and EIF5A2. EIF5A1 is the major isoform which is abundantly expressed in most cells.Sonic hedgehog is abnormally expressed in PC tissue and cells and associated with pathogenesis and progression. sHH is one of the three members family of hedgehog proteins, which includes other two proteins named as Indian Hedgehog and Desert Hedgehog. Binding of hedgehog proteins to the transmembrane receptor Patched activates SMO, leading to nuclear translocation of Gli transcription factors and expression of downstream target genes.The data presented here demonstrated an important role for EIF5A in regulating PC proliferationWe reported that high expression of EIF5A protein was observed in PC. The immunohistochemical analyses demonstrated the up\u2010regulation of EIF5A in PC tissues compared with normal pancreatic tissues. The immunofluorescence staining showed that EIF5A was identified in PC cells. Our found had the consistent aspect with that EIF5A protein was amplified in many neoplastic patient tissues.Then, the Panc\u20101 and BxPc\u20103 cells were transfected for stable knockdown EIF5A using shRNA. MTT results showed that the proliferation ability was significantly reduced upon EIF5A knockdown compared to control group. In fact, the reduced proliferation ability kept similar result at every time\u2010point. Thus, these findings suggested that EIF5A played a role in PC cells proliferation ability, which was consistent with the idea that EIF5A contributes to tumour growth in other cancers.In this work, in order to investigate the tumour growth caused by EIF5A, we built the orthotopic transplantation tumour model in nude mice with PC cells, instead of the subcutaneously implanted tumour model. Mainly because the PC cells were injected into the pancreas of nude mice being more like the tumour microenvironment.Our previous work showed sHH signalling pathway was involved in the PC growth. Here we demonstrated that EIF5A induced the activation of the sHH signalling pathway. The EIF5A knockdown obviously reduced the expressions of sHH and Gli\u20101 in PC cells. To decide whether the activation of sHH signalling pathway depends on sHH factor, we used recombinant sHH or neutralizing antibody to treat PC cells with Si\u2010EIF5A. The results showed low expression of Gli\u20101 in Si\u2010EIF5A group. Altogether, these data indicated sHH factor was unnecessary in activation caused by EIF5A. Possibly the bypass activation or other transcriptional activation ways could be involved. The internal mechanism will be solved in further study.In following experiments, the growth results showed that sHH significantly increased cells proliferation, and the Si\u2010EIF5A obviously decreased the proliferative ability. Together, these results demonstrated that EIF5A and sHH signalling pathway may be involved in and were necessary for tumour growth in PC, which is consistent with our pre\u2010primary work.Gem is frequently used in PC treatment. However, it is only marginally effective because of the less sensibility.In summary, our results revealed that EIF5A regulates the proliferation in PC through the SHH signalling pathway. Modulating the expression level of EIF5A could enhance the Gem sensitivity in PC. Importantly, the target spot to EIF5A and SHH signalling pathway could benefit PC patients in future.The authors declare that there are no conflicts of interest related to this work."}
+{"text": "The cAMP-dependent protein kinase A (PKA) regulates various cellular functions in health and disease. In endothelial cells PKA activity promotes vessel maturation and limits tip cell formation. Here, we used a chemical genetic screen to identify endothelial-specific direct substrates of PKA in human umbilical vein endothelial cells (HUVEC) that may mediate these effects. Amongst several candidates, we identified ATG16L1, a regulator of autophagy, as novel target of PKA. Biochemical validation, mass spectrometry and peptide spot arrays revealed that PKA phosphorylates ATG16L1\u03b1 at Ser268 and ATG16L1\u03b2 at Ser269, driving phosphorylation-dependent degradation of ATG16L1 protein. Reducing PKA activity increased ATG16L1 protein levels and endothelial autophagy. Mouse in vivo genetics and pharmacological experiments demonstrated that autophagy inhibition partially rescues vascular hypersprouting caused by PKA deficiency. Together these results indicate that endothelial PKA activity mediates a critical switch from active sprouting to quiescence in part through phosphorylation of ATG16L1, which in turn reduces endothelial autophagy. Angiogenesis is the process of new blood vessels formation from pre-existing vessels via sprouting and remodeling. Blood vessels are crucial for tissue growth and physiology in vertebrates since they are the pipelines for oxygen and nutrients supply and for immune cell distribution. Inadequate vessel formation and maintenance as well as abnormal vascular remodeling cause, accompany or aggravate many disease processes including myocardial infarction, stroke, cancer, and inflammatory disorders .Sprouting angiogenesis is a multistep process encompassing sprout initiation, elongation, anastomosis and final vascular network formation . MultiplWe identified endothelial cAMP-dependent protein kinase A (PKA) as a critical regulator of angiogenesis during vascular development in vivo. Inhibition of endothelial PKA results in hypersprouting and increased numbers of tip cells, indicating that PKA regulates the transition from sprouting to quiescent vessels . HoweverHere, we established a chemical genetics approach based on the mutation of a \u2018gatekeeper residue\u2019 of the ATP-binding pocket of a protein kinase to identify endothelial-specific substrates of PKA. We verified autophagy-related-protein-16-like 1 (ATG16L1) as a substrate of endothelial PKA and identified that phosphorylation of ATG16L1 facilitates its degradation. in vivo experiments showed that autophagy inhibition partially rescued the hypersprouting and increased tip cell numbers caused by PKA deficiency.6 position with bulky groups as (thio-)phosphodonors. In contrast, WT-kinases poorly use these analogues. Once the substrates are thiophosphorylated by AS-kinases, they can be further alkylated and therefore recognized by a thiophosphate ester-specific antibody  and the thiophosphorylation reaction with 6-cHe-ATP\u03b3S was performed. After alkylation with p-Nitrobenzyl mesylate (PNBM), thiophosphorylated proteins were immunoprecipitated with the thioP antibody coupled to rProtein G Agarose beads . For quaThe ninety-seven proteins identified in both experiments  included1-2-S/T)  out of ninety-seven proteins were tested; four of these five proteins were confirmed to be thiophosphorylated by AS-PKAC\u03b1, indicating that they are indeed direct substrates of AS-PKAC\u03b1 . Only AT1-2-S/T) . Since A1-2-S/T) , it likeATG5 and ATG16L1 are conserved core components of the autophagy process, and PKA activity has been shown to negatively regulate autophagy in S. Cervisiae and mammalian cells through phosphorylation of ATG1/ULK1 . ATG16L1To identify the PKAC\u03b1 phosphorylation sites in ATG16L1, we spot-synthesized 25-mer overlapping peptides that cover the entire ATG16L1 protein. The peptide array was subjected to an in vitro PKA phosphorylation assay. Three peptides of the ATG16L1\u03b1 and 7 peptides of ATG16L1\u03b2 were phosphorylated compared to the negative control . The comWT and the mutant ATG16L1\u03b1S268A in HUVECs. To activate PKA, HUVECs were treated with the PKA specific activator 6-Bnz-cAMP. Using cycloheximide (CHX) to prevent new protein synthesis allowed us to detect the degradation of ATG16L1\u03b1WT and ATG16L1\u03b1S268A over time. Western blot analysis showed that most of the ATG16L1\u03b1WT degraded after 12 hr, whereas ATG16L1\u03b1S268A remained largely stable  crossed with Cdh5-CreERT2 mice expressing tamoxifen inducible Cre recombinase under control of endothelial specific Cdh5 promotor  with dnPKAiEC mice, performed retinal staining for isolectin B4  and the tip cell specific marker ESM1, and quantified the IB4 and ESM1 positive areas. No significant difference were observed between Cdh5-CreERT2 control mice and ATG5ECKO mice on both the vascular plexus and tip cells. However, ATG5ECKO partially rescued both the hyperdense vascular plexus front and the increasing tip cells in dnPKAiEC mice. Retinal stainings demonstrated that ATG5 deletion in endothelial cells in vivo, which shuts down ATG5-dependent autophagy, partially normalizes the hypersprouting phenotype of dnPKAiEC mice , the total number of endothelial cells and proliferating endothelial cells was deceased in dnPKAiEC ATG5ECKO compared to dnPKAiEC mouse retinas  via the phosphorylation of ATG16L1, which accelerates its degradation. In cultured bovine aortic endothelial cells, induction of autophagy by overexpression of ATG5 has been shown to promote in vitro vascular tubulogenesis, whereas ATG5 silencing suppressed this morphogenic behavior . In mice defects , very si embryos . Similar embryos . FurtheriEC phenotype by inhibition of autophagy could lie in additional functions of ATG16L1 itself. Although ATG16L1 plays an essential role in autophagy, and is part of a larger protein complex ATG16L1-ATG5-ATG12 that is necessary for autophagy, ATG16L1 is also involved in the production of inflammatory cytokines IL-1\u03b2 and IL-18 and exerts anti-inflammatory functions during intestinal inflammation  are more stable than ATG16L1WT. Furthermore, PKA deficiency also stabilizes ATG16L1 in endothelial cells in vivo and in vitro. Taken together, it appears that the different phosphorylation sites of ATG16L1 play different roles in fine tuning protein stability under the influence of alternative upstream kinases, and thereby adapt autophagy levels. Given the increasing insights into the role of autophagy in cell and tissue homeostasis and in disease, it will be of great interest to investigate whether the newly identified regulation by PKA extends beyond developmental angiogenesis into pathomechanisms associated with endothelial dysfunction.Interestingly, ATG16L1 can itself be regulated by multiple phosphorylation events by distinct kinases, with opposing effects on protein stability and autophagy. ATG16L1 can be phosphorylated at Ser139 by CSNK2 and this phosphorylation enhances its interaction with the ATG12-ATG5 conjugate . IKK\u03b1 prcleavage . In contFinally, on a technical note, the chemical genetics approach developed by Shokat and colleagues  has succ2 at 37\u00b0C.Human Umbilical Vein Endothelial Cells (HUVECs) were freshly isolated (or purchased from Promocell) and cultured in Endothelial Cell Growth Medium (Ready-to-use) (Promocell), passage 3 to 5 were used for experiments. HEK293T cells were cultured in Dulbecco's Modified Eagle Medium  with 10% Fetal Bovine Serum  and 50 U/ml penicillin and 50 mg/ml streptomycin (Thermo Fisher) in 5% COQ5Site-Directed Mutagenesis Kit (NEB). ATG5, ATG16L1\u03b1, ATG16L1\u03b1 S268D, ATG16L1\u03b2, ATG16L1\u03b2 S269D were cloned into the pRRLsin.PPT.CMV.GFP.MCS vector. pLKO.1-TRC cloning shRNA vector (addgene) was used to clone PKACa shRNA constructs targeting sequence: TAGATCTCACCAAGCGCTTTG and TCAAGGACAACTCAAACTTAT.Lentivirus vector pRRLsin.PPT.CMV.flag.MCS and pRRLsin.PPT.CMV.GFP.MCS were generated by resctrictional cloning of a sequence coding flag-tag/GFP-tag into the pRRLsin.PPT.CMV.MCS vector at XbaI and XmaI restriction sites. PKAC\u03b1 gene from mouse, ANKRD40 and ATG5 were amplified from total RNA extracted from HUVECs and cloned into the pRRLsin.PPT.CMV.flag/GFP.MCS vector. pECE-M2-PPP1R12A wt, EGFPC1-huNFATc1EE-WT, pDESTmycDDX17, pMRX-IP/SECFP-hATG16L1 were purchased from Addgene. pDESTmycDDX17, pMRX-IP/SECFP-hATG16L1 and subcloned to vector pRRLsin.PPT.CMV.flag.MCS. PKAC\u03b1\u00a0M120G, ATG16L1\u03b1 S268A, ATG16L1\u03b2 S269A, ATG16L1\u03b2 S287A, ATG16L1\u03b2 S269A and S287A were generated by site-directed mutagenesis using For lentivirus production, HEK293T cells, seeded in 150 mm dishes, were transfected with flag-tagged or GFP-tagged constructs, psPAX2 and pMD2.G using X-tremeGENE HP (Roche) as transfection reagent. Medium was changed 12\u201316 hr after transfection. Lentivirus-containing medium was collected in 24\u201348 hr afterwards and filtered through 0.45 filters. Lentivius titers were determined with Lenti-X p24 Rapid Titer Kit (Clontech). To infect HUVEC, lentivirus (MOI 20\u201350) and polybrene  was added to cells for 18\u201322 hr, and then the cells were washed with PBS and replaced the medium with fresh EGM2.Cells were lysed in RIPA buffer contained protease inhibitor cocktail and PhosSTOP (Roche). Protein concentrations were measured by Pierce BCA Protein Assay Kit. Samples were further diluted with SDS-loading buffer and SDS-PAGE was performed using NuPAGE 4\u201312% Bis-Tris Protein Gels (Invitrogen). Proteins were tranferred to nitrocellulose membrane with iBlot 2 Dry Blotting System (Thermo Fisher) or to PVDF membranes by wet blotting. Membranes were blocked with 5% nonfat milk in TBST and primary antibodies were incubated overnight at 4\u00b0C or 1.5 hr at room temperature. HRP-conjugated secondary antibodies were diluted and incubated 1 hr at room temperature. SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher) was used for imaging. Following antibodies were used: rabbit anti-thiophosphate ester  was from Abcam, goat anti-\u03b2-actin  antibody, chicken anti-goat IgG-HRP  were from Santa Cruz Biotechnology, rabbit anti-GAPDH , rabbit anti-PKACa , rabbit anti-ATG16L1 , rabbit anti-p62 , rabbit anti-LC3  antibodies and anti-rabbit IgG, HRP-linked antibody  were from Cell Signaling, rabbit anti-flag  and mouse anti-flag  were from Sigma and rabbit anti-GFP  was from Invitrogen. Peroxidase affinipure donkey anti-mouse IgG  was from Jackson Immuno Research.6 cells) were infected with lentivirus encoding either flag-PKAC\u03b1 WT (as negative control) or flag-PKAC\u03b1 M120G. 48 hr after infection, cells were stimulated with Sp-8-CPT-cAMPS (Biolog) for 10 min, then lysed in kinase lysis buffer , 5 mM \u03b2-glycerophosphate, 2 mM dithiothreitol, 0.1 mM Na3VO4, 10 mM MgCl2) with protease inhibitor cocktail on ice for 20 min and spun  to remove cell debries. 3.5 mM GTP and 350 \u03bcM 6-cHe-ATP\u03b3S (Biolog) were added to the lysates. After 30 min incubation at 30\u00b0C, 2.5 mM p-Nitrobenzyl mesylate  was added and the reaction was incubated for additional 2 hr at room temperature. PNBM was removed by Zeba Spin Desalting Columns, 7K MWCO (Thermo Fisher) and samples were washed with IP buffer , 0.5% sodium deoxycholate). The protein fractions were precleared by incubation with Recombinant Protein G Agarose for one hour at 4\u00b0C. The precleared samples were then incubated with anti-thiophosphate ester antibody  coupled to Recombinant Protein G Agarose coupled gently rocking overnight at 4\u00b0C. The agarose beads were washed four times with IP buffer. 1/30 of the washed beads was boiled in SDS sample loading buffer for western blot detection or silver staining. The rest samples were used for mass spectrometry analyze.HUVECs (6 10cm-dishes each containing 1 \u00d7 106 on a 6 cm dish) were transfected with 0.5 \u03bcg pRRL PKAC\u03b1 WT or pRRL PKAC\u03b1\u00a0M120G and 1.5 \u03bcg of indicated candidate substrate using X-tremeGENE HP DNA transfection reagent (Roche). 30 hr after transfection, cells were stimulated with Sp-8-CPT-cAMPS (Biolog) for 10 min, lysated and treated as described above.For validation of the identified substrates, 293 T cells  according to the manufacturer\u2019s protocol. Briefly, the SDS-page gel was washed in ultrapure water and fixed by fixing solution\u00a0 for 30 min. After incubating the gel in sensitizer working solution\u00a0(provided in the kit) for 1 min, silver stain enhancer\u00a0(provided in the kit) was added for another 5 min. Subsequently, the gel was incubated with developer working solution\u00a0(provided in the kit) for 2\u20133 min, before stopping the reaction with stop solution\u00a0(provided in the kit).R was used to calculate fold changes and t-statistics.For mass spectrometric analysis to identify new PKA substrates, samples were prepared by chemical genetical approach as described above, each sample was run on a stacking SDS-PAGE collecting all proteins in a single band. After coomassie blue staining, the minced gel pieces were digested with trypsin based on www.uniprot.org). The mass tolerance for precursor and fragment ions were set to 4.5 and 20 ppm, respectively, during the main search. Enzyme specificity was set as C-terminal to arginine and lysine, also allowing cleavage at proline bonds with a maximum of two missed cleavages. Variable modifications were set to oxidation of methionine residues, acetylation of protein N-termini, phosphorylation and thiophosphorylation of serine, threonine and tyrosine residues. The minimum score for modified peptides was set to 40. The S-lens RF level was set at 50 and we excluded precursor ions with single, unassigned and charge states above five from fragmentation selection.For mass spectrometric analysis to identify phosphorylatin sites of ATG16L1, purified thiophosphorylated ATG16L1 proteins on beads were washed 3 times with 800 \u00b5l IP buffer followed by three times washing with 800 \u00b5l digestion buffer  and dried. The washed beads were resuspended in 150 \u00b5l digestion buffer and incubated for 4 hr with 1 \u00b5g trypsin  at 37 \u00b0C. Beads were removed, another 1 \u00b5g of trypsin was added and proteins were further digested overnight at 37 \u00b0C. Peptides were acidified with 1% TFA and purified on Omix C18 tips , dried and re-dissolved in 20 \u00b5l loading solvent ). Five microliters of the peptide mixture was injected for LC-MS/MS analysis on an Ultimate 3000 RSLC nano LC  in-line connected to a Q Exactive mass spectrometer (Thermo). Trapping was performed at 10 \u03bcl/min for 4 min in loading solvent on a 100 \u03bcm internal diameter (I.D.)\u00d720 mm trapping column  and the sample was loaded on a reverse-phase column ) over 120 min at a constant flow rate of 300 nl/min. The mass spectrometer was operated in data-dependent mode, automatically switching between MS and MS/MS acquisition. Full-scan MS spectra (400\u20132000 m/z) were acquired at a resolution of 70,000 in the orbitrap analyzer after accumulation to a target value of 3,000,000. The five most intense ions above a threshold value of 17,500 were isolated (window of 2.0 Th) for fragmentation at a normalized collision energy of 25% after filling the trap at a target value of 50,000 for maximum 80 ms. MS/MS spectra (200\u20132000 m/z) were acquired at a resolution of 17,500 in the orbitrap analyzer. Raw LC-MS/MS data files were searched against the human proteins in the Uniprot/Swiss-Prot database . His-tagged recombinant catalytic subunits (vector pET46) were purified from E. coli (strain Rosetta D3) as described  was added to visualize whole-retina vasculature by incubating overnight at 4\u00b0C, followed by staining for ESM1 . After mounting, images of retinas were taken using a Leica SPE confocal microscope equipped with a HC PL APO 20X/0.75 IMM CORR CS2 objective or Leica SP8 confocal microscope equipped with a HCX IRAPO L 25X/0.95 W objective. Images were taken at room temperature using Leica LAS X software and processed with image J software.To analyse retinal angiogenesis, the procedures of isolation and staining of the retinas were performed as published . BrieflyTo perform endothlial proliferation and apoptosis assays, mouse eyes were collected at P6 and fixed for 30 min at room temperature with 4% PFA. Retinas were dissected in PBS and blocked/permeabilized in 1% BSA, 50 \u03bcg/ml digitonin in PBS, primary antibodies  were incubated overnight at 4\u00b0C and secondary antibodies (Thermo fisher) were incubated for 2 hr at room temperature. Both antibodies were diluted in1% BSA, 2% donkey serum, 50 \u03bcg/ml digitonin in PBS. The Click-iT Edu cell proliferation kit (C10340) was used to visualize proliferating endothelial cells. After mounting, images of retinas were taken using a Leica SPE confocal microscope equipped with a ACS APO 40X/1.15 oil CS objective or Leica SP8 confocal microscope equipped with a HCX IRAPO L 25X/0.95 W objective. Images were taken at room temperature using Leica LAS X software and processed with image J software.Livers or lung lobes were collected in dry 10 cm dishes and minced finely with blades for one minute, and then incubated in 25 ml of pre-warmed Dulbecco modified Eagle medium (4.5 g/L glucose with L-glutamine) containing 2 mg/mL collagenase (Invitrogen) in 50 ml tubes, gently shaking for 45 min at 37\u00b0C. Suspensions were passed through a 70 \u03bcm cell strainer (VWR) and cells were spun down at 400 g for 8 min at 4\u00b0C. Pellets were resuspended in 10 ml Dulbecco modified Eagle medium containing 10% FBS, 50 U/ml penicillin and 50 \u03bcg/ml streptomycin, passed through 40 \u03bcm Nylon cell strainer  and centrifuged at 400 g for 8 min at 4\u00b0C. Cells were resuspended in cold DPBS (1 ml/lung and 2 ml/liver), added to sheep anti-Rat IgG-coupled Dynabeads (Invitrogen) pre-incubated with purified Rat Anti-Mouse CD31 (BD Pharmingen) and incubated at 4\u00b0C for 20 min. The beads were separated using a magnetic particle concentrator  and washed with cold DPBS with 0.1% BSA. This washing step was repeated five times after which cells were lysed in RIPA buffer for Western Blotting.Statistical analyses were performed using GraphPad Prism 7. The one-way ANOVA was used to compare more than two experimental groups. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.eLife. Your article has been reviewed by three peer reviewers, including Gou Young Koh as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Didier Stainier as the Senior Editor.Thank you for submitting your article \"Endothelial PKA targets ATG16L1 to regulate angiogenesis by limiting autophagy\" for consideration by The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.The comments of all three reviewers are in good agreement. While the reviewers found this work to be of high interest, they raised minor concerns about the strength of the conclusions that can be drawn at this stage. The authors are required to carefully address all comments point-by-point in a data-driven manner or with further analyses. Specifically, the present data fail to fully link the angiogenic morphogenesis with the endothelial cell autophagy. Therefore, additional work to detect the changes in the endothelial cell autophagy by performing immunoblotting and/or immunohistochemical experiments.Reviewer #1:Vascular sprouting is regulated positively and negatively by various signals, including the VEGFA-VEGFR2 and the Dll4-Notch signals. The authors of the present manuscript previously showed that the endothelial PKA negatively regulates vascular sprouting by suppressing tip cell formation, independently of the Notch signal . As a follow-up study of this seminal work, Zhao et al. identified autophagy-related-protein-16-like 1 (ATG16L1) as a substrate of endothelial PKA . Indeed, PKA phosphorylated ATG16L1alpha at S268 and ATGT16L1beta at S269 , and facilitated their protein degradation , which may lead to reduced endothelial autophagy. Accordingly, PKA deficiency stabilized ATG16L1, thereby increasing levels of the positive autophagy marker LC3 II, and reducing the negative autophagy marker p62 in cultured HUVECs . Finally, the authors showed that autophagy inhibition by chloroquine or endothelial ATG5 knockout partially rescued retinal vascular hyper-sprouting caused by PKA deficiency .The overall quality of the chemical genetics screen and biochemical analyses sufficiently supports the notion that PKA mediates phosphorylation and degradation of ATG16L1. On the other hand, additional in vivo data are desirable to more firmly correlate endothelial autophagy with the control of angiogenesis. For example, detection of autophagy markers, such as LC3, in developing retinal vessels of WT and mutant mice shown in Figure 4 will strengthen the authors' claims.Reviewer #2:This is a well written and well organized article that uses an innovative chemical biology screen to identify new protein kinase A substrates including the ATG16L regulator of autophagy. Clear biochemical and cellular evidence is presented showing that phosphorylation of Ser268 on the ATG16La isoform and Ser 269 on the ATG16Lb isoforms drive degradation of the protein. These studies are followed up by some well-reasoned cell based studies on a variety of defined genetic backgrounds. This allows the authors to propose that endothelial PKA activity restricts active sprouting of blood vessels in the retina by reducing phosphorylation dependent role of ATG16L1 isoforms in endothelial autophagy. Overall, this is a nice report that provides a succinct message. I feel that it would be appropriate for the authors to expand on some of their findings as the current work could be considered a minimal publishable unit. Although the data is of high quality and necessary rigor some of the work could be presented in a more complete and convincing manner. Specific criticisms are listed below.1) The authors convincingly show that phosphorylation of Ser268 on the ATG16La isoform and Ser 269 on the ATG16Lb isoforms drive degradation of the protein. All of this phosphorylation is believed to proceed through PKA. However, it seems very likely that other kinases can modify this basophilic site. Experiments should be incorporated that address this issue.2) The workflow for experiments in Figure 1 is excellent, but the data could be more convincingly presented. For example, Figures 1B and 1C should be enlarged to show the data more clearly and molecular weight markers should be indicated on each gel.3) Are their physiological agonists that can be used to recapitulate the experiments in Figure 3?4) What are the additional spots on the peptide arrays in Figure 2A? Focusing in on the relevant information may be advisable.5) The Mass spec traces in Figures 2E and 2F are hard to see. Need to be enlarged and enhanced to emphasize the important data.6) What happens in the experiments in Figure 3 when phosphosite mimics (Asp or Glu) are introduced to positions 268 on ATG16La and Ser 269 on ATG16Lb. Are these forms more labile or are refractory to the process?7) The retina images in Supplementary Figure 3 provide an appreciated context to the study and should be incorporated into the body of the text.Reviewer #3:eLife after addressing following points.The study by Zhao et al. provides mechanistic insights into regulation of angiogenesis by cAMP-dependent protein kinase A (PKA) through inhibition of endothelial autophagy. The authors employed and optimized a chemical genetic screen to find a substrate of PKA in human umbilical vein endothelial cells (HUVECs), and identified ATG16L1 (Autophagy related 16 Like 1) as a novel target of endothelial PKA. They demonstrated that PKA regulates autophagy in ECs through phosphorylation-dependent degradation of ATG16L1. Furthermore, they showed that genetic and pharmacological inhibition of autophagy partially rescue the hyper-sprouting vascular phenotype of PKA-deficient mice. Overall, this study unravels a role of endothelial PKA in regulation of autophagy in ECs and introduces a valuable tool for identifying kinase substrates in ECs. Therefore, I consider this work suitable for publication in 1) The authors should provide explanations on Prkar1a gene and meaning of 'dnPKA' for readers who are not familiar with these molecules, as they did in a previous study .\"To study the role of PKA in vascular development we inhibited PKA in endothelial cells using knock-in mice carrying a single floxed dominant-negative Prkar1a allele  knocked into the genomic Prkar1a locus allowing tissue-specific inhibition of PKA . The regulatory PRKAR1A subunit of PKA is an endogenous inhibitor of PKA, which binds and keeps the catalytic subunits inactive under low cAMP levels .\"2) In Figure 3G, the authors showed that knockdown of PKA results in accumulation of ATG16L1 protein, thereby increasing a positive autophagy marker, LC3II and reducing a negative autophagy marker, p62 in HUVECs. They further showed increased ATG16L1 protein in isolated ECs from dnPKAiEC mice in Figure 3H. However, the authors should provide evidences of changes in vascular autophagy in dnPKAiEC and dnPKAiEC; ATG5ECKO mice, such as results of LC3 or p62 immunoblot or immunostaining.3) In Figure 4, the authors showed vascular hypersprouting in PKA-deficient mice and partial rescue of this phenotype by autophagy inhibition, comparing vascular area and ESM1-positive area of retina from each groups. Detailed analyses and quantitation of vascular features such as radial lengths, number of sprouts, and ratio of proliferating ECs are required.4) In Figure 4, what is an underlying mechanism for normalization of hypersprouting vascular phenotype of PKA-deficient mice by autophagy inhibition? Does inhibition of autophagy decrease proliferation, or induce apoptosis of ECs? Reviewer #2:This is a well written and well organized article that uses an innovative chemical biology screen to identify new protein kinase A substrates including the ATG16L regulator of autophagy. Clear biochemical and cellular evidence is presented showing that phosphorylation of Ser268 on the ATG16La isoform and Ser 269 on the ATG16Lb isoforms drive degradation of the protein. These studies are followed up by some well-reasoned cell based studies on a variety of defined genetic backgrounds. This allows the authors to propose that endothelial PKA activity restricts active sprouting of blood vessels in the retina by reducing phosphorylation dependent role of ATG16L1 isoforms in endothelial autophagy. Overall, this is a nice report that provides a succinct message. I feel that it would be appropriate for the authors to expand on some of their findings as the current work could be considered a minimal publishable unit. Although the data is of high quality and necessary rigor some of the work could be presented in a more complete and convincing manner. Specific criticisms are listed below.We thank this reviewer for appreciating the value of our work and have now provided additional data and improved presentation.1) The authors convincingly show that phosphorylation of Ser268 on the ATG16La isoform and Ser 269 on the ATG16Lb isoforms drive degradation of the protein. All of this phosphorylation is believed to proceed through PKA. However, it seems very likely that other kinases can modify this basophilic site. Experiments should be incorporated that address this issue.This is indeed an interesting point that warrants attention. In Group-based Prediction system v3.0 silico analysis predicted 5 most likely kinases  that may be able to phosphorylate Ser268 on the ATG16La isoform and Ser 269 on the ATG16Lb isoform. We used the peptide SPOT ARRAY ASSAY to test whether the two kinases with highest predicted scores, PAK1 and PRKD2, phosphorylate identified PKA sites on ATG16L1.The peptide TEETAPVRAISRAATRRSVSSFPVP was spot-synthesised in triplets and phosphorylated in vitro by the indicated kinases . As negative controls, the kinases omitted (-). Green spots in the upper lane and black in the lower lane show peptide phosphorylationiEC mice shows dependency on PKA activity, and deficiency of PKA phosphorylation on ATG16L1 could not be compensated by other kinases in endothelial cells, our present work would support the idea that PKA is a major regulator of ATG16L1 in endothelial cells with limited effects of other kinases in the biology investigated.The result shows that PRKD2 but not PAK1 can phosphorylate site Ser268 on the peptide. This result suggests that indeed, as mentioned by the reviewer, other kinases can in principle modify this basophilic site. However, it also demonstrates a degree of specificity already present in the in vitro peptide assay. Whether this site can also be phosphorylated by PRKD2 in intact cells and in importantly in endothelial cells will need to be investigated in the future. Given that ATG16L1 stability in isolated ECs from control and dnPKA2) The workflow for experiments in Figure 1 is excellent, but the data could be more convincingly presented. For example, Figures 1B and 1C should be enlarged to show the data more clearly and molecular weight markers should be indicated on each gel.We agree and have enlarged the pictures and added molecular weight markers.3) Are their physiological agonists that can be used to recapitulate the experiments in Figure 3?This is an interesting point, but complicated by the fact that physiological agonists seem to activate both Epac and PKA. For example, we tested the physiological agonist isoproterenol hydrochloride in HUVECs. As shown in This result is consistent with a previously published paper entitled \u201cExchange protein directly activated by cAMP 1 promotes autophagy during cardiomyocyte hypertrophy\u201d :55-64). The authors demonstrate that isoproterenol increase autophagy in cardiomyocytes through Epac.At least in their assay and cell type, Epac appears to be the dominant effector of isoproterenol. Despite our efforts, we could not find a physiological agonist that would only activate PKA but not Epac. Nevertheless, in our hands, the PKA specific activator 6-Bnz-cAMP, as shown in Figure 3F inhibits autophagy in HUVECs.4) What are the additional spots on the peptide arrays in Figure 2A? Focusing in on the relevant information may be advisable.The red boxed dots correspond to overlapping amino acid sequences that show significant differences in intensity between negative control and PKA catalytic subunit \u03b1. Other single dots cannot be considered reliable as identical core sequences are present in adjacent dots showing no signal. Dots that show equal signal on both arrays must be considered background. We nevertheless choose to present the entire array to allow the reader to appreciate the specificity of the results. Full map details are now provided as Figure 2\u2014figure supplement 1.5) The Mass spec traces in Figures 2E and 2F are hard to see. Need to be enlarged and enhanced to emphasize the important data.We agree and now provide higher resolution to appreciate the details.6) What happens in the experiments in Figure 3 when phosphosite mimics (Asp or Glu) are introduced to positions 268 on ATG16La and Ser 269 on ATG16Lb. Are these forms more labile or are refractory to the process?The results in Figure 3C and 3D show that the GFP tagged phosphomimetic site mutants Ser268D on ATG16La and Ser269D on ATG16Lb are more labile.7) The retina images in Supplementary Figure 3 provide an appreciated context to the study and should be incorporated into the body of the text.We agree and have rearranged the figures and figure legends. Please see Figure 4 and Figure 4\u2014figure supplement 1 in the revised version.Reviewer #3:The study by Zhao et al. provides mechanistic insights into regulation of angiogenesis by cAMP-dependent protein kinase A (PKA) through inhibition of endothelial autophagy. The authors employed and optimized a chemical genetic screen to find a substrate of PKA in human umbilical vein endothelial cells (HUVECs), and identified ATG16L1 (Autophagy related 16 Like 1) as a novel target of endothelial PKA. They demonstrated that PKA regulates autophagy in ECs through phosphorylation-dependent degradation of ATG16L1. Furthermore, they showed that genetic and pharmacological inhibition of autophagy partially rescue the hyper-sprouting vascular phenotype of PKA-deficient mice. Overall, this study unravels a role of endothelial PKA in regulation of autophagy in ECs and introduces a valuable tool for identifying kinase substrates in ECs. Therefore, I consider this work suitable for publication in eLife after addressing following points.1) The authors should provide explanations on Prkar1a gene and meaning of 'dnPKA' for readers who are not familiar with these molecules, as they did in a previous study .\"To study the role of PKA in vascular development we inhibited PKA in endothelial cells using knock-in mice carrying a single floxed dominant-negative Prkar1a allele  knocked into the genomic Prkar1a locus allowing tissue-specific inhibition of PKA . The regulatory PRKAR1A subunit of PKA is an endogenous inhibitor of PKA, which binds and keeps the catalytic subunits inactive under low cAMP levels .\"We greatly appreciate this comment and have now provided more details to explain the meaning of dnPKA in the text as below:iEC is the short denomination for Prkar1aTg/+ mice carrying a single floxed dominant-negative Prkar1a allele, (the regulatory subunit Prkar1a of PKA is an endogenous inhibitor of PKA) crossed with Cdh5-CreERT2 mice expressing tamoxifen inducible Cre recombinase under control of endothelial specific Cdh5 promotor .\u201d\u201cDnPKAiEC mice in Figure 3H. However, the authors should provide evidences of changes in vascular autophagy in dnPKAiEC and dnPKAiEC; ATG5ECKO mice, such as results of LC3 or p62 immunoblot or immunostaining.2) In Figure 3G, the authors showed that knockdown of PKA results in accumulation of ATG16L1 protein, thereby increasing a positive autophagy marker, LC3II and reducing a negative autophagy marker, p62 in HUVECs. They further showed increased ATG16L1 protein in isolated ECs from dnPKAWe appreciate the wish to see evidence for altered endothelial autophagy levels in vivo. Unfortunately, this proved despite all our efforts not to be feasible. Having worked next door to autophagy experts (Sharon Tooze) for many years, I was aware of the tricky nature of the question. Autophagosomes are very small structures and staining for LC3 II as marker for autophagosome processing notoriously difficult in vivo. Reliable and quantifiable results are only achievable on isolated protein. We tested several of the best antibodies and could not achieve reliable staining on retinas. Efforts to isolate the endothelial cells demonstrated that we obtain too little protein from endothelial cells  In Figure 4, the authors showed vascular hypersprouting in PKA-deficient mice and partial rescue of this phenotype by autophagy inhibition, comparing vascular area and ESM1-positive area of retina from each groups. Detailed analyses and quantitation of vascular features such as radial lengths, number of sprouts, and ratio of proliferating ECs are required.We agree and have collected more retinas, performed additional stainings, optimized segmentation and quantification and now provide additional quantification of radial lengths, and number of sprouts/100\u00b5m . We also performed EdU incorporation assay, staining and segmentation to quantify the ratio of proliferating ECs .4) In Figure 4, what is an underlying mechanism for normalization of hypersprouting vascular phenotype of PKA-deficient mice by autophagy inhibition? Does inhibition of autophagy decrease proliferation, or induce apoptosis of ECs?We have now performed the proliferation and apoptosis assay in mouse retinas . The results show that inhibition of autophagy decreases proliferation but has no significant effects on apoptosis. It appears that the combined reduction of tip cells and decrease in total number of proliferating endothelial cells can provide a cellular mechanism for normalization."}
+{"text": "We present expenditure estimates for 106 product categories across Great Britain for the years 2008\u20132016. Estimates are at the Local Authority District level (n\u2009=\u2009380) and the categories cover all food, drink and tobacco commodities. Reliable, local level expenditure estimates are crucial for understanding broader market trends, assessing economic stability and for projections. This is especially important for commodities such as alcohol, tobacco and unhealthy foods due to their role in the prevalence of non-communicable diseases. There has been relatively little research into local area spatial patterns of expenditure, with existing estimates often of insufficient resolution for informing planning decisions. We use spatial microsimulation to create an archive of expenditure datasets. This was achieved by linking socio-demographic foundations with detailed datasets on individual expenditure. Whilst initially developed to aid investigations into sociodemographic trends in the meat industry, the data have reuse potential in a number of disciplines, including public health, economics, retail geography and environmental management. The framework could be applied to other regions with appropriate data.  Further changes may be on the horizon in the context of a UK exit from the European Union2. Against this backdrop of continuous national level change, there is substantial local level variability in food consumption and expenditure patterns, which has been attributed to spatial variations in factors including socio-economic status5 and demographics6. These changes are reflected by individual expenditure patterns as surveyed annually by the Living Costs and Food Survey15, with corresponding results published to the regional level across the UK16 . To help understand the local level variability of expenditure, and to form a baseline for future projections, we present an open access archive of expenditure datasets for Great Britain for the years 2008 to 2016. Each annual dataset consists of an expenditure estimate for 106 food, drink and tobacco categories for every Local Authority District (LAD) (n\u2009=\u2009380).Over the past 50 years, the UK has experienced major shifts in dietary patterns due to changes in agricultural practice, trade policies and food industry marketing17, with emergent higher-level properties giving the best opportunity to understand the entire system at all levels. Reliable and detailed information on the spatial distribution of food, drink and tobacco expenditure is also key for research in the fields of public health, environmental impact and retail geography. This importance is highlighted by the prevalence of non-communicable diseases such as cardiovascular disease, cancer and diabetes which currently account for 70% of all deaths worldwide and 90% in the UK18. As these diseases share key modifiable behavioural risk factors such as tobacco use, unhealthy diet and the harmful use of alcohol, it is clear that understanding expenditure patterns associated with key commodities is of great value for public health research. There is also an increased awareness of the environmental impact of food production, with livestock production responsible for 14.5% of all anthropogenic greenhouse gas emissions in 200419, whilst 71.2% of deforestation in South America between 1990 and 2005 was for conversion to pasture20.Robust estimates of local level spatial patterns of food and drink expenditure are crucial for understanding broader trends, for assessing market stability and for future projections. It has long been argued that the most powerful theoretical models for explaining human behaviour operate at the individual person level16, representative of the population. However, these data are only available at the regional level  and as such are not at a sufficient resolution for informing planning decisions related to public health infrastructure, retail or the environment at the local level. For example, concerns over access to healthy foods21 cannot be assessed using regional level data. Furthermore, there is little information on associated individual level socio-demographics, which have been shown to be strongly linked to expenditure3.There has been relatively little research into local area spatial patterns of food and drink expenditure in the UK. Whilst expenditure data is routinely collected by companies and organisations, these are seldom open-access, often at a coarse spatial resolution and only provide a snapshot of specific products or socio-economic groups. In the UK, comprehensive estimates of food and drink expenditure are published annually by the Department for Environment, Food & Rural Affairs (DEFRA)16 and known drivers of local level variation6 by producing local area level datasets of expenditure using the technique of spatial microsimulation. Increasing computational efficiency and falling costs combined with the improved availability of survey microdata have increased the ability to produce such datasets22. As such, using the code developed by Lovelace and Dumont23, an archive of expenditure datasets has been created. This process used the most recent census and survey microdata available to the authors at the time of writing, alongside a range of geospatial datasets.This study aims to bridge the identified data gap between the published regional level estimates of expenditureWe believe spatial microsimulation techniques of the type described in this paper hold great potential benefits for a range of disciplines including economics, retail geography and public health. Whilst this study focusses on Great Britain, the framework here could be applied to any location with the appropriate data sources.the creation, analysis and modelling of individual level data allocated to geographic zones\u201923, and has been used in the fields of health care demand24, educational attainment25, commuting patterns26, and population projections27 amongst others. For a comprehensive overview of the microsimulation process the reader is directed to Birkin and Clarke28 and a guide to implementation can be found in Lomax and Smith29.This study uses spatial microsimulation to generate expenditure estimates under the framework shown in Fig.\u00a0As with most spatial microsimulation models, the input data for this study consists of microdata \u2013 a non-geographical individual level dataset \u2013 and constraint tables, which provide aggregate counts for each geographical zone (LAD). The framework is split into two separate microsimulation models as shown in Fig.\u00a0https://www.r-project.org). IPF works by adjusting a large array of weights - rows corresponding to individuals and columns corresponding to the geographic zones (e.g. LADs) - iteratively, to maximise the fit between simulated and known (e.g. census/survey) data. The mathematics of IPF are covered by Fienberg30 a guide to implementation is provided in Lomax and Norman31 whilst the code used here for implementing IPF in R was developed by Lovelace and Dumont23.Specifically, this study employs Iterative Proportional Fitting (IPF), implemented within the R programming environment (32.Microdata are taken from the Living Cost and Food Survey (LCF), the most comprehensive survey on household spending in the UK, covering approximately 12,000 respondents from 6,000 households each year. The LCF is carried out by the Office for National Statistics (ONS) and has been running in its current format since 2008. The LCF is designed to be representative of people living in households in the UK, using a multi-stage stratified random sample with clustering approach. The survey is weighted to compensate for non-response and also to ensure the sample distribution matches the population distribution in terms of region, age group and sex. The LCF runs continuously throughout the year to avoid seasonal variationThe LCF comprises an expenditure diary detailing purchases over a two-week period and an interview covering socio-demographic characteristics, income and regular items of household expenditure. Respondents are required to record all expenditure over the two-week period (regardless of outlet), thus providing a comprehensive account of household expenditure. Commodities recorded in the LCF diary (and consequently in this study) are grouped by category, based on The Classification of Individual Consumption by Purpose (COICOP) coding framework. COICOP groups products into homogenous categories for which food, drink and tobacco constitute 106 separate groups. Categories may define a specific product (e.g. 1.1.6.2.1 = Bananas \u2013 fresh) or a homogenous group of products (e.g. 1.1.1.4.1 = Cakes and puddings). The framework structure also allows easy aggregation to higher levels . The full list of 106 food, drink and tobacco expenditure codes used in this study can be found in Supplementary File 1. The 2016\u20132017 LCF survey reported some commodities  only to an aggregate level, resulting in fewer categories for our 2016 dataset (n\u2009=\u200980). These aggregated categories are included in Supplementary File 1. Whilst grouping products in this manner may mean that analysis related to specific products is restricted, the 106 categories provide sufficient detail for most applications. Whilst various other coding frameworks are available, COICOP was specifically developed by the United Nations Statistics Division to analyse individual expenditures, and was therefore adopted by the ONS for use in the LCF. Datasets presented in this study can be directly compared with others which use the COICOP framework, whilst the detailed descriptions provided in Supplementary File 1 allows cross-referencing with alternative frameworks if required.The LCF is geocoded at a coarse level, detailing which of the 12 government regions each individual resides in . As discussed previously, this is insufficient for informing planning decisions related to public health infrastructure, retail or the environment at the local level. Whilst it would be technically possible to constrain the microsimulation model using these data , this would result in a much-reduced sampling pool insufficient for spatial microsimulation. As such, no initial geographical constraints are used in the microsimulation model although the regional information is used to account for relative regional price levels and for model validation purposes, as discussed in due course.It should be noted that whilst the LCF survey includes individuals from Northern Ireland, insufficient constraint variables were available for microsimulation within Northern Ireland (see below). As such, whilst microsimulation outputs presented in this paper are restricted to Great Britain, individuals from Northern Ireland (from the LCF) are included within the sampling pool and may be allocated to any LAD in Great Britain if their socio-demographic characteristics are appropriate.The LCF contains a wealth of information, much of which is not required for the purposes of this study and can thus be discarded. As the microsimulation process requires common variable classes for the microdata and corresponding constraint dataset, re-formatting is required to generate the appropriate classes. Table\u00a0From 2015 onwards the LCF reporting window moved from a calendar year (January to December) to a financial year (April to March). To maintain consistency of our datasets, we use a calendar year throughout (i.e. our 2015 dataset represents LCF data from January 2015 to December 2015). As the LCF details when each survey was completed during the year, we achieve this by removing and appending records from each year as appropriate. The 2015\u20132016 LCF survey also includes additional records from January to March 2015, making it possible to construct a seamless data series.23, based upon relevance to the target variable (expenditure) and data availability. Table\u00a0As with other microsimulation applications, the model presented here is underpinned by the assumption that the target variable (expenditure) is associated with the geographical constraint variables. Constraint variables were chosen following the guidelines of Lovelace and Dumont23. Table\u00a0Microsimulation requires the baseline population of each constraint  to correspond to the population from which the microdata has been sampled. For the LCF, this is all people living in households aged 16 and over (for the adult model) or aged 15 and under (for the child model). The IPF algorithm also requires the baseline population to be identical across all constraint variables. To meet these requirements, our baseline population for each year is taken from the Office for National Statistics mid-year population estimates, with residents living in communal establishments removed to result in only residents living in households. All other constraints are scaled to this baseline population, as described by Lovelace and Dumont33. Furthermore, any deviation from the 2011 counts will have a negligible impact on the model output as communal establishment residents account for a small proportion of the overall population - just 1.7% in 201134.With counts of communal establishment residents only available for the year 2011, we assume that this population is unchanged throughout the study years (2008 to 2016). This is a reasonable assumption, as communal establishment populations are usually fairly stable in terms of their size and demographic structure. For example, an elderly care home will contain a similar group of individuals from year to year. This stability is recognised by the ONS, who treats communal establishment populations as a different and more stable group to the household population when producing the mid-year estimatesAnnual estimates of the number of people aged 16 and over per ethnic group for each LAD are taken from the Annual Population Survey (APS) Table\u00a0. These d35. As such, we assume that the proportion of those unemployed is consistent between the baseline population and the model based estimates.Annual estimates of the number of unemployed people aged 16 and over in each LAD are taken from ONS Model Based Estimates of Unemployment Table\u00a0. These dAnnual estimates of the total number of students aged 16 and over are taken from the Annual Population Survey Table\u00a0. As the Annual estimates of gross weekly pay (pre-tax) for each LAD is taken from the Annual Survey of Hours and Earnings (ASHE) Table\u00a0. This prTo make the ASHE data compatible with the microsimulation model, it is first necessary to estimate the total number of people covered by the sample. This is achieved using employment status estimates from the Annual Population Survey Table\u00a0. This prOnce the number of persons in each category has been estimated, a constraint table is generated containing the income brackets for each LAD (in \u00a3s) and the number of employees within each category Table\u00a0. As with1Data on the household characteristics of each LAD is taken from the 2011 Census Table\u00a0. The dat15. As with the adult model, ONS mid-year population estimates are used in conjunction with 2011 Census estimates of communal residents to create a baseline population. The child model uses an age sex constraint with age categories of 0\u20139 years , 10\u201315 , 0\u20139 years  and 10\u201315 , as shown in Fig.\u00a0For people aged under 16 years of age, a simpler microsimulation model is employed as many of the constraint variables are not applicable or not available (e.g. unemployment). A simpler model is also deemed appropriate as children contribute a negligible amount of total expenditure, accounting for just 0.78% in 2016\u201317 according to the Living Cost and Food SurveyWhilst constraints of age-sex and household type are available for all 380 local authorities across Great Britain, other constraints  are unavailable for a minority of LADs due to small sample sizes or missing data. For example the Isles of Scilly have a total population of just 2,292 people (2014 estimate), meaning that some constraints would be disclosive if published. Whilst this is not deemed an issue in terms of model robustness, the model needs to be able to cope with missing data. This is achieved by dynamically adjusting the final constraint table for each LAD depending on which variables (and categories within) are available. Whilst the student and unemployment variables are binary (either available or not available), the variables of ethnicity and income may be partially complete . In these cases, the constraint (and microdata) is re-categorised to utilise the available data. For example, if an estimate for those of mixed ethnicity is unavailable for a particular LAD, new categories of \u2018black\u2019, \u2018white\u2019 or \u2018other\u2019 will be created.In most circumstances a complete suite of constraints are available allowing for a full microsimulation model. As all LADs have complete age-sex and household type variables the microsimulation model will run on these as a minimum. Table\u00a036. In 2016 food and non-alcoholic beverages in London cost 2.2% more than the UK average whilst in Scotland they cost 0.2% below average36. This is a potential problem for the microsimulation model as the process allows an individual from the LCF microdata to be assigned to any LAD in Great Britain, according to the constraint variables. For example, if an individual from Scotland (from the LCF microdata) is assigned to a London LAD, their expenditure will likely be under-estimated.It is well known that the price of goods and services varies throughout the UK37 are used to adjust expenditure values depending on their source region (from the LCF microdata) and their destination region (as assigned by the microsimulation model). Pre-microsimulation expenditure values are scaled to a \u2018UK average\u2019 price before being adjusted back to regional levels according to the region in which the microsimulation model assigns them to. The ONS provides an aggregate RRCPL value for each of the 12 regions  and provides more detailed category level values for London, Scotland, Northern Ireland and Wales. As such we use the detailed category level values where available and the aggregate value for all categories where not, as shown in Table\u00a037 for 2008 to 2012 and 2016 RRCPLs36 for 2013 onwards.To account for this, ONS Relative Regional Consumer Price Levels (RRCPLs) dataet al.38).Once the model is complete, GIS expenditure datasets may be created by joining the expenditure tables with spatial boundaries. Figure\u00a039.The local level expenditure datasets described in this article are publicly and freely available through Figshare41. Validation of microsimulation models presents a substantial challenge since detailed spatial microdata are seldom available \u2013 in fact it can be argued that if such data were available the microsimulation process would be redundant. There are a variety of methods available for validation, broadly categorised as internal validation  and external validation .The validation of microsimulation models has received much attention in the literature due to the dangers of using incorrect model data to inform policy23. We carried out internal validation in a similar manner to Lovelace, et al.26, by calculating for each LAD the correlation between the aggregate counts from the constraint variables and those generated in our spatial microsimulation. In our models, the results were affirmative; the lowest correlation for a single zone for all years was 0.9876 and in many cases was perfect . The high correlation coefficients throughout give us confidence that the microsimulation process has worked correctly and common issues such as empty cells42 and incorrectly specified constraint variables are not present.Internal validation is the most common form of microsimulation model evaluation and is the process of comparing the model\u2019s output against data that are internal to the model itself42.However, internal validation needs to be viewed in context as IPF microsimulation always converges towards the optimal solution for known constraint variables: it is the unknown cross-tabulations and target variables that we are trying to simulate with spatial microsimulation, so external validation should also be usedIn addition to internal validation, we use two methods for external model validation: a) by comparing the simulation results at the aggregate level with estimates from a dataset external to the model, and b) by aggregating-up the small area estimates provided by the simulation to compare the results with expenditure data that is provided at higher geographies.43 whilst smoking prevalence is often greater in more deprived areas44 and among those of lower socio-economic status45. As such, we explored the relationship between our LAD level estimates of product expenditure and deprivation as measured by an external dataset. We used the Index of Multiple Deprivation (IMD) (https://www.gov.uk/government/statistics/english-indices-of-deprivation-2015), the official measure of relative deprivation for local authorities in England. IMD is based on seven different domains of deprivation: income deprivation; employment deprivation; education, skills and training deprivation; health deprivation and disability; crime; barriers to housing; and services and living environment deprivation. Whilst some of the domains are similar in nature to the constraints used in the microsimulation model (e.g. income deprivation), there are no common datasets between the IMD and the microsimulation, with metrics calculated in different ways. Furthermore, many of the IMD domains are completely absent from the microsimulation  and vice-versa, resulting in a minimal risk of circularity when exploring relationships. As the majority of datasets used in the IMD were collected in 2012 and 2013 we use the 2013 microsimulation results to test for a correlation against the IMD. As the IMD is a ranked dataset, we use the Spearman\u2019s test of rank correlation, with the results shown in Table\u00a0Previous studies have shown that there are relationships between socio-economic status/deprivation and expenditure on certain commodities. Total food expenditure and consumption of fruit and vegetables has been shown to be greater in more affluent households43. Conversely, there is a negative correlation between tobacco and cigarette expenditure and IMD, suggesting expenditure is greater in more deprived areas, in agreement with previous studies44. These results are encouraging, suggesting the model is accurately capturing variation in expenditure for different product categories at small area level.All correlations were significant with a strong positive correlation between IMD and estimates of \u2018all food and drink\u2019 and \u2018fruit and vegetable\u2019 expenditure, suggesting that expenditure on these categories is less in more deprived areas, as found by previous research16. As this regional geographic information is not used in the microsimulation model other than for adjusting for relative regional price levels, this presents a useful form of validation by comparing the aggregated microsimulation results at the regional level to the corresponding values estimated directly from the LCF. Whilst both methods estimate the same parameter (expenditure by region), they are generated in completely different ways. The LCF averaging approach (as used by DEFRA16) takes the average weighted expenditure of surveyed individuals in each region, whilst the microsimulation approach generates a synthetic population with every individual assigned an expenditure profile which is then aggregated to the regional level. Figure\u00a0As noted previously, the LCF is geocoded to a limited extent, with information provided on which of the 12 regions each individual resides. This information is used by the Department for Environment, Food and Rural Affairs (DEFRA) to estimate the expenditure of products at the regional level, as published in the annual Family Food report series37 and 201636 and only at the aggregate level for regions within England  and measurement error32, especially in relation to products consumed away from home47 and alcohol48. Whilst the ONS has a robust sampling, weighting and quality control framework for the LCF32, the end user should be aware of the potential biases and errors, especially when considering specific commodities or socio-demographic categories.The expenditure estimates produced in this study are based on data from the LCF, Census and other official sources. Therefore, the outputs provided are subject to any biases or errors contained in the source datasets. Household surveys such as the LCF have the potential to suffer from issues such as non-response from specific groups (e.g. low income householdsDownload metadata fileSupplementary File 1"}
+{"text": "West Nile fever, as an expanding zoonotic disease, has been reported from different creatures involved in the disease from Iran. In addition to biological mosquito-associated factors, various elements such as their activities, distribution, behavior and vectorial capacity could be affected by environmental factors. We determined the distribution of West Nile virus (WNV) vectors, the environmental factors affecting WNV transmission and the high-risk areas across West Azerbaijan Province (Northwestern Iran), regarding the potential of WNV transmission using Geographical Information System (GIS).Mosquitoes\u2019 larvae and adults were collected from different habitats of the province in 2015 and identified using standard morphological keys. The data regarding the distribution of mosquitoes across the studied area were organized in ArcMap databases. Inverse Distance Weighted (IDW) interpolation analysis was conducted on the data of synoptic stations to find climatic variables in the collection sites of different mosquito species. Layers of transmission-related environmental factors were categorized and weighed based on their effects on disease transmission.Overall, 2813 samples of different mosquito species from different regions of the province were collected and identified. According to the GIS analysis, areas in the northeastern province, which have lower altitudes and slopes with higher temperatures and more water bodies, were found to have better condition for the activity of mosquitoes (as high-risk areas: hot spots).The precision of our results was proven to be in line with previous study results that identified high-risk areas, where WNV-infected vectors were captured from these same areas. Due to notable problems caused by mosquitoes and mosquito-borne diseases (MBDs), the studies of factors influencing the presence, activities, and distribution of mosquitoes and MBDs are important and form absolute parts of the epidemiology of MBDs, in which environmental conditions and their changes are components of this process . In addiMosquitoes\u2019 feeding rates vary expressively with temperature. Moreover, feeding behavior and host availability are affected by climate. Additionally, length of the gonotrophic cycle as an important factor in diseases transmission could be influenced by precipitation patterns . FinallyAmong the different tools used to identify the effects of environmental factors on MBDs and their epidemiology, is Geographical Information System (GIS) . In addiCulex pipiens, Cx. restuans, Cx. salinarius, Cx. tarsalis, Aedes vexans, Ae. albopictus, and Coquillettidia perturbans as biological vectors  in human \u201333, 23.7 caspius  and Culeulex spp .Culex pipiens s.l., Ae. caspius, Anopheles maculipennis s.l., Culiseta longiareolata  the distribution of probable WNV vectors, 2) the environmental factors affecting WNV transmission and 3) the high-risk areas across the province regarding the potential of WNV transmission using GIS.West Azerbaijan Province is located in the northwest of Iran between latitudes 35\u00b0 58\u2032\u201339\u00b0 46\u2032 N and longitudes 44\u00b0 3\u2032\u201347\u00b0 23\u2032 E. This province formally includes 17 counties. It is bordered by Turkey, Iraq, Armenia, and the Republic of Azerbaijan. In addition, it is also bordered by Iranian provinces such as East Azerbaijan, Zanjan and Kurdistan . AccordiMosquitoes were collected during May\u2013Nov 2015 from 24 localities (wetlands) across the province . Adults As distribution of mosquitoes and their transmitted diseases are notably dependent on environmental and climatic factors, the effective climatic data, including maximum monthly temperature, minimum monthly temperature, mean monthly temperature, mean relative humidity and rainfall data of decade (2004\u20132014) were obtained from 16 stations of West Azerbaijan Meteorological Organization . Datasetv\u0302= value to be estimatedvi= known valuei..., dn= distances from the n data points to the point estimated ndFor proper analysis, the data regarding distribution of mosquitoes across West Azerbaijan Province were acquired from previous studies , 33 and Ae. caspius, An. maculipennis, Cs. longiareolata, Cx. pipiens and Cx. theileri) reported from study area, also are known proven and suspected vectors of WNV in different parts of the world, they have been included in final analysis , they are reviewed and endorsed by the Ethics Committee of the UMSU. Sample collection was carried out from private human and animal dwellings. At least one day prior to any sample collection, the owners were informed by the Local Health System officers. The whole process was coordinated, managed and documented by the \u201cLocal Health System officer\u201d in the study areas.Cx. pipiens (22 out of 24 collection sites), while Ae. caspius was found only in 10 localities.Overall, 2813 mosquito specimens from different regions of the province were collected and identified . AnalysiAe. caspius to 1364m for Cs. longiareolata  in the region  and land use should be analyzed and determined in future studies.The present study serves as a preliminary guide that shows the important effects of environmental conditions on one of the important members (mosquitoes) in the transmission cycle of WNV and should be continued with supplementary studies. Taking into account the vector bio-ecologic conditions, other environmental factors and the interaction of the virus and the vectors as well as other important rings in the transmission of disease, the data obtained from this current study will be very useful and effective in knowing the exact nature of the disease transmission pathways and help in designing its control strategies."}
+{"text": "Congenital adrenal hyperplasia (CAH) caused by P450 oxidoreductase deficiency (PORD) in 46, XX patients is characterized by genital ambiguity, primary amenorrhea, absent or incomplete sexual maturation, infertility, skeletal malformations and so on. But few pregnancies have been reported from these female patients with PORD.POR) gene had suffered from primary amenorrhea and infertility. She had one cancelled cycle of ovulation induction due to low serum estradiol(E2), high progesterone(P) levels and thin endometrium, then in vitro fertilization (IVF) was recommended. At the first IVF cycle, 4 oocytes were retrieved and 4 viable embryos were cryopreserved due to thin endometrium associated with low E2 and prematurely elevated P after ovarian stimulation, even though oral dexamethasone were used to control adrenal P overproduction at the same time. When basal P fell to <\u20091.5\u2009ng/ml after the therapy of oral dexamethasone, artificial endometrial preparation and frozen embryo transfer were performed, resulting in a twin pregnancy. She delivered a healthy boy and a healthy girl by caesarean section at 37\u2009weeks and 2\u2009days of gestation. After the literature search in PORD women, no spontaneous pregnancy has been reported and only two previous case reports of 3 successful pregnancies through IVF were summarized.A 29-year-old Chinese woman with PORD due to the compound heterozygous mutation (c.1370G\u2009>\u2009A/c.1196_1204del) in the P450 oxidoreductase (POR mutation, with primary amenorrhea and disorders of steroidogenesis. It seemed that disorders of steroidogenesis caused by PORD didn\u2019t impair the developmental potential of oocytes. IVF and frozen embryo transfer after adequate hormonal control and endometrial preparation should be an effective infertility treatment for PORD women.It is the third report that successful pregnancy was achieved in a CAH woman caused by a compound heterozygous  POR gene on chromosome 7 [The enzyme P450 oxidoreductase (POR) is encoded by the mosome 7 . POR tramosome 7 , 21.POR gene mutations. In 2004, mutations in POR gene disrupting steroid biosynthesis were firstly reported [POR mutations have been reported (7). Patients with PORD occur mostly in neonates and children, and have a range of skeletal malformations, glucocorticoid deficiency and disorders of sexual development (DSD) [POR mutations can impair all microsomal cytochrome P450 enzymes, each enzyme is affected to a different extent (depending on the locations of the POR gene mutations), resulting in high clinical variability of PORD, such as it has been reported that young girls or women only had incomplete pubertal development, primary amenorrhea, oligomenorrhea or infertility with or without skeletal malformations [P450 oxidoreductase deficiency (PORD) is a rare autosomal recessive variant of congenital adrenal hyperplasia (CAH) arising from homozygous or compound heterozygous reported , 15. Up reported . Patientrmations , 25. Thermations .POR mutation.We report a live birth from a Chinese woman who presented with primary amenorrhea and infertility caused by a compound heterozygote To report this case, appropriate written consent and assent had been obtained in accordance with the guidelines of the ethics committee of Sun Yat-sen Memorial Hospital, Sun Yat-sen University (SYSEC-KY-KS-2019-052).2 level remained very low (<\u20095\u2009pg/ml) with P level increasing to 25.1\u2009ng/ml and a thin endometrium (3\u2009mm). Ovulation trigger was cancelled due to the thin endometrium and the abnormal levels of E2 and P.The patient was born at term after a normal pregnancy and delivery. Her parents were nonconsanguineous and she had a healthy and fertile elder brother. At birth, she was healthy and had external female genitalia. At 16\u2009years old, she presented with normal breast development, no pubic or axillary hair, normal blood pressure, but no menses, and she was evaluated for primary amenorrhea by a local gynecologist. Her karyotype was 46, XX and a pelvic ultrasound revealed the presence of 4\u2009\u00d7\u20093\u2009\u00d7\u20094\u2009cm ovarian cyst in the left ovary and an infantile uterus . However the etiology of her amenorrhea remained unknown at that time. After that, she had accepted hormone replacement therapy (HRT) to establish a regular menstrual cycle but her menses didn\u2019t come when she stopped HRT. When she was 29\u2009years old and had suffered from primary infertility for 3 years, she was referred to treat infertility and she had a cancelled cycle of ovulation induction in the local hospital. The follicle growth and sex hormone changes during the ovulation induction were as the following: human menopausal gonadotropin (hMG)(150\u2009IU/d) were administered for 17\u2009days from the cycle 3 of inducing menstruation after two-month oral contraception pills, and two follicles grew to 18\u2009mm and 17\u2009mm in size but serum EThen she was referred to Reproductive Medicine Center of Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University in 2014, willing to have a child. Physical examination revealed the following characteristics: a height of 158\u2009cm and weight of 60\u2009kg; Tanner scores of four for the breasts and two for axillary and pubic hair; female external genitalia; difficulty of bending the metacarpopha-langeal joints from childhood; no other skeletal malformations were founded. No other infertility factor was identified. The evaluations for adrenal, gonadal and pituitary hormones showed that serum levels of P and 17-hydroxyprogesterone (17-OHP) were obvious high, and dehydroepiandrosterone sulfate (DHEA-S), androstenedione, free testosterone were low, as well as the other tests were within the reference ranges. Table\u00a0CYP21A2, CYP19A1, CYP17A1, CYP11A1, HSD3B2, STAR, AR, EDNRA, NR5A1, PDE8B and POR gene.The patient was suspected of having rare forms of CAH according to the clinical manifestations, imaging and laboratory tests. In order to confirm the diagnosis and find the genetic etiology, a panel of CAH candidate genes by targeted exome next-generation sequencing (NGS) were performed, including Genomic DNA were extracted from the peripheral blood leukocytes using the QIAamp DNA Blood Mini Kit . The extracted DNA was segmented by DNA enzyme and purified by magnetic bead , followed by PCR amplification. DNA library was captured and purified twice by a customized Panel probe . The exon, intron-exon boundaries, the 5\u2019and 3\u2032 flanking regions of the panel genes was sequenced by NextSeq500 .http://genome.ucsc.edu)  by the BWA algorithm and annotated using the method reported by Zhang [www.hgvs.org/mutnomen/) guidelines for describing sequence variations and numbering were used, with +\u20091 corresponding to the A of the ATG translation initiation codon of the GenBank cDNA sequence and the amino acid sequences. All variants were classified according to the American College of Medical Genetics and Genomics (ACMG) 2015 classification [Raw data was compared with reference sequence retrieved from the University of California at Santa Cruz Genome Browser : c.1370G\u2009>\u2009A  and c.1196_1204del (p.Pro399_Glu401del)  which supports only 3% of 17-hydroxylase activity, no detectable\u00a017,20 lyase activity [POR gene was firstly reported in two unrelated Turkish PORD patients (HGMD ID:CD117091) and cause a loss of three amino acid p.Pro399_Glu401del (P399_E401del) [The results showed that no mutation and copy number variation were found in activity , and onlactivity . The c.1The elevation of serum basal morning 17OHP concentration is usually used to diagnosis the other types of CAH such as 21-hydroxylase or 11\u03b2-hydroxylase deficiency, while the major clinical presentation in these two types of CAH are atypical genitalia, precocious pubarche, hirsutism, oligomenorrhea/amenorrhea and without sex steroid deficiency and skeletal malformation . Our casShe was given HRT composed of estradiol and progesterone , combined with oral dexamethasone (0.375\u2009mg/d) for 2 months. After the therapy her basal serum P and 17-OHP levels fell to normal levels (0.35\u2009ng/ml and 0.23\u2009ng/ml respectively) with disappearance of the ovarian cyst. According to our several successful cases with atypical CAH caused by 17\u03b1-hydroxylase deficiency through frozen embryo transfer after IVF and the pregnant case with 17\u03b1-hydroxylase deficiency published in 2016  who show2 and P were 33\u2009pg/ml and 2.3\u2009ng/ml respectively with a thin endometrium (4\u2009mm), which showed less disorder comparing with them in the previous cycle of ovulation induction without oral dexamethasone and GnRH agonist down regulation. Then 4 oocytes were retrieved 36\u2009h after HCG triggering and 4 cleavage embryos were available and cryopreserved. The details were shown in Table\u00a0We performed a long gonadotropin releasing hormone agonist (GnRHa) protocol with down regulation using a single dose of 1.3\u2009mg long-acting triptorelin and ovarian stimulation with 225\u2009IU/d of recombinant FSH\u03b1 (rFSH) and 75\u2009IU/d hMG. When four follicles reached to 20\u2009mm, 19\u2009mm,16\u2009mm and 15\u2009mm in diameter, 10,000\u2009IU of human chorionic gonadotropin (HCG) was administered for triggering the maturation of oocytes on Day 21 of stimulation. On the triggering day serum levels of EThe patient\u2019s menses came 17\u2009days after oocyte retrieval. On cycle 3 serum P level was 0.6\u2009ng/ml and artificial endometrial preparation was started with oral estradiol valerate (4\u2009mg/d). When endometrial thickness reached 10.4\u2009mm, progesterone in oil (60\u2009mg/d) was administered by intramuscular injection, and 3\u2009days later, two frozen-thawed embryos were transferred. After embryo transfer, oral dexamethasone wasn\u2019t given any longer considering the patient had never presented with adrenal insufficiency before. A twin pregnancy was attained and estradiol and progesterone was maintained during the first trimester of pregnancy. The pregnancy proceeded uneventfully, with the regular monitor in the department of Endocrinology and Obstetrics. A healthy boy and a healthy girl were delivered by caesarean section after 37\u2009weeks and 2\u2009days of gestation, weighing 2.5\u2009kg and 2.3\u2009kg respectively. No perinatal problems were observed, and the puerperium was uneventful. During the pregnancy and post-partum period, she had not presented with adrenal insufficiency and no need for glucocorticoids replacement. She remained amenorrhea 1 year after delivery and has been accepting HRT until now.POR gene mutations in 46, XX females). Only two papers and three female cases with homozygous or compound heterozygous mutations in POR gene were reported to be successful pregnant [We searched the PubMed database using search terms for Medical Subject Headings and/or text words relating to P450 oxidoreductase deficiency and pregnancy. The retrieved papers were hand-searched for additional relevant articles using our inclusion criteria  and A287P(24%) in 180 individual POR mutations from 90 patients 5% and A2, 25, but2, which means that ovarian stimulation and follicular development increase the P overproduction from ovary. These non-classic PORD female patients who lack the genital and obvious skeletal malformations are usually undiagnosed in their early age, just like these reported cases and our case. These cases remind reproductive gynecologists and endocrinologists to consider the possibility of non-classic PORD when patients present with amenorrhea, oligomenorrhea, unexplained infertility, the presence of ovarian cysts, high basal P or 17OHP and a specific pattern of response to ovarian stimulation. Our case provided additional information of effective infertility treatment in PORD women with different ethnicity, clinical phenotype and POR gene mutation. The impairment of reproductive capacity in non-classic PORD women may be mainly explained by the effects of estradiol deficiency and progesterone excess from both adrenal and gonad, accentuated by ovarian stimulation, on endometrial development.All three reported pregnant cases presented with primary infertility and had accepted IVF treatment. Letrozole combined with hMG protocol in case 1, GnRH agonist and GnRH antagonist protocols in case 2 and 3 were used for IVF (Table 2 on endometrial receptivity by freezing all available embryos. Freeze-all policy have been successfully used in women undergoing IVF under various conditions such as the premature elevation of serum P after conventional ovarian simulation [IVF can be used to segment ovarian stimulation and embryo transfer to avoid the negative effect of high P and low Emulation , 19, lutmulation  and progmulation , 28. Themulation , 20, butmulation . In the mulation . The autmulation , just asmulation , 26. DexPOR mutation with the published three cases who had been reported to obtain successful pregnancies after IVF. For this rare form of CAH, it seemed that disorders of steroidogenesis caused by PORD didn\u2019t impair the developmental potential of oocytes. The successful pregnancy could be obtained through IVF and FET after adequate hormonal control and endometrial preparation. Our report will hopefully improve the timely diagnosis and effective treatment of infertility in PORD women.In conclusion, It is a third report of successful pregnancy in a PORD patient who had primary amenorrhea and different"}
+{"text": "To investigate the differences in plasma metabolomic characteristics between pathological complete response (pCR) and non-pCR patients and identify biomarker candidates for predicting the response to neoadjuvant chemoradiotherapy (nCRT) in esophageal squamous cell carcinoma (ESCC).A total of 46 ESCC patients were included in this study. Gas chromatography time-of- flight mass spectrometry (GC-TOF/MS) technology was applied to detect the plasma samples collected before nCRT via untargeted metabolomics analysis.p\u2009=\u20090.0129), linoleic acid (p\u2009=\u20090.0137), citric acid (p\u2009=\u20090.0473) were upregulated, while L-histidine (p\u2009=\u20090.0155), 3\u20324 dihydroxyhydrocinnamic acid (p\u2009=\u20090.0339) were downregulated in the pCR plasma samples. Pathway analyses unveiled that citrate cycle (TCA cycle), glyoxylate and dicarboxylate metabolic pathway were associated with ESCC chemoradiosensitivity.Five differentially expressed metabolites (out of 109) was found in plasma between pCR and non-pCR groups. Compared with non-pCR group, isocitric acid (The present study provided supporting evidence that GC-TOF/MS based metabolomics approach allowed identification of metabolite differences between pCR and non-pCR patients in plasma levels, and the systemic metabolic status of patients may reflect the response of ESCC patient to neoadjuvant chemoradiotherapy. Esophageal cancer (EC) as an aggressive malignant tumor, is the sixth leading cause of cancer death globally . Over 50Metabolomics have been widely applied in diagnosis and biomarker screening study on various disease, including cancer , 13. SinIn the present study, we aim to investigate the differences in plasma metabolomic characteristics between pCR and non-pCR patients and identify biomarker candidates for predicting the response to neoadjuvant chemoradiotherapy (nCRT) in esophageal squamous cell carcinoma (ESCC). We used gas chromatography time-of-flight mass spectrometry (GC-TOF/MS) technology which is more conducive to the rapid detection of complex samples analysis for untargeted metabolic profiling. The results showed that five metabolites demonstrated differences between pCR and non-pCR patients in the plasma collected before the onset of neoadjuvant therapy. And pathway analyses unveiled that citrate cycle, glyoxylate and dicarboxylate metabolic pathway were associated between pCR and non-pCR groups. This study provided supporting evidence that GC-TOF/MS based metabolomics approach allowed identification of metabolite differences between pCR and non-pCR patients in plasma levels, and the systemic metabolic status of patients may reflect the response of ESCC to neoadjuvant chemoradiotherapy.2) plus cisplatin (50\u201375\u2009mg/m2) every 21\u2009days for two cycles. 4\u20136\u2009weeks after completion of nCRT, patients underwent surgery. Clinical stages and pathological stages were determined according to the eighth edition of the American Joint Committee on Cancer tumor-node-metastasis (TNM) staging criteria [The study included plasma samples from 46 stage II\u2013III esophageal cancer patients who were prospectively selected at the Anyang Cancer Hospital  between June 2017 and April 2019. All patients had been pathologically diagnosed esophageal squamous cell carcinoma. The neoadjuvant chemoradiotherapy (nCRT) consisted of radiotherapy  and concurrent chemotherapy with paclitaxel  after thawing to separate debris or a lipid layer. Metabolites were extracted from plasma samples (50\u2009\u03bcL) with 10\u2009\u03bcL of internal standard  and 175\u2009\u03bcL of pre-chilled methanol: chloroform (3:1) followed by centrifugation at 14, 000\u00d7g for 20\u2009min at 4\u2009\u00b0C. Then each 200\u2009\u03bcL of the supernatant was transferred into an autosampler vial . The resting supernatant from each sample was pooled to prepare quality control samples. Following solvent evaporation and lyophilization, the dried samples were derivatized with 50\u2009\u03bcL of methoxyamine (20\u2009mg/ml in pyridine) for 2\u2009h, followed by silylanization with 50\u2009\u03bcL of MSTFA (1% TMCS) for 1\u2009h prior to injection. Above two steps were performed by a robotic multipurpose sample MPS2 with dual heads .The untargeted metabolomics profiling was implemented on XploreMET platform . The sample preparation was conducted as their published methods with minor modifications , 25. In The GC-TOF/MS analysis was performed using a time-of-flight mass spectrometry (GC-TOF/MS) system ,which consists of an Agilent 7890B gas chromatography and a Gerstel multipurpose sample MPS2 with dual heads . As described previously , DB-5MS XploreMET  was used to process the raw data generated by GC-TOF/MS. The data processing includes baseline denosing and smoothing, peak picking and deconvultion, creating reference database from the pooled QC samples, metabolite signal alignment, missing value correction and imputation, and QC correction as previously reported . Metabolhttp://www.genome.jp/kegg/) and Human Metabolome Database . MetaboAnalyst 4.0  were then applied to analyze the data by R software . The iPath 3.0 (http://pathways.embl.de/) was used to show the metabolic network of the differential metabolites and altered metabolic pathways in KEGG general metabolic pathway.To further investigate the metabolic pathways involved in the chemoradiosensitivity in ESCC, the differential metabolites were annotated with Kyoto Encyclopedia of Genes and Genomes  curve (AUC) was performed to assess the feasibility of using the plasma levels of particular metabolites as predictive biomarkers. The data was randomly split into a training set (data from 36 patients) and a test set (data from 10 patients). Predictions were made on the test set based on the Gaussian Naive Bayes model trained in the training set. n\u2009=\u20094) and III (n\u2009=\u200942), respectively. After nCRT, 23 patients achieved pCR through the examination of surgical pathology specimen, while the remaining 23 patients were identified into non-pCR group. The baseline characteristics of the ESCC patients and treatment outcomes are shown in Table\u00a0A total of 46 patients were included in this study. The age of all subjects ranged from 50 to 84\u2009years, including 30 men and 16 women. According to the American Joint Committee on Cancer tumor-node-metastasis (TNM) staging criteria (the eighth edition), the pre-treatment clinical stages of these 46 subjects were II , and L-histidine, 3\u20324-Dihydroxyhydrocinnamic acid were downregulated  in the pCR plasma samples  were detected in the plasma samples from 46 subjects using untargeted metabolomics analysis  value was 0.76 Fig.\u00a0, which iTo further explore the metabolic pathways related to above ESCC chemoradiosensitivity-associated metabolites, MetaboAnalyst was used to indicate the metabolic pathways connected with these five metabolites. Through pathway analysis based on KEGG database, two pathways namely citrate cycle (TCA cycle), glyoxylate and dicarboxylate metabolism were altered in pCR patients Fig.\u00a0. The oveAlthough the benefit of nCRT has been demonstrated in multiple trials, only approximately 20\u201325% of EC patients showed complete response, and some even developed resistance to currently used therapy . ChemoraMetabolism alterations in cancer are well-documented. Metabolomics as a new high throughput technology provides a broad field for finding metabolites as potential biomarkers in body fluids for diagnosis, treatment and prognosis of cancer. Gas chromatography time-of-flight mass spectrometry (GC-TOF-MS) with its pivotal characteristics, including higher selectivity, resolution, sensitivity and accuracy is well-suited for the identification and quantitation of low molecular weight metabolites , 30. In The major findings of this study were summarized as follows: i) A total of five key metabolites associated with ESCC chemoradiosensitivity were identified; ii) Among the five differential metabolites, isocitric acid, linoleic acid and citric acid were upregulated, while L-histidine, 3\u20324 dihydroxyhydrocinnamic acid were downregulated Fig. b-f; iii)In the previous study, altered metabolic profile was found between the pCR and non-pCR ESCC patients in the serum level detected by gas chromatography mass spectrometry (GC/MS) analysis and liquid chromatography mass spectrometry (LC/MS) analysis . But onlIn the present study, L-histidine was found downregulated in the pCR patients. Previous study showed that increasing serum level of histidine was observed in breast cancer patient and strongly related with disease relapse . MoreoveThere also exist some limitations in this study. The primary limitation is that this is a single\u2013center study with relatively small number of subjects, making the data less conclusive. In addition, due to the restriction of the conditions, we only applied one metabolomics method to identify the potential changed metabolites. Furthermore, the predictive precision of those differential metabolites needed external validation. Larger samples and a combination of research methods may help us better understand the mechanism of ESCC chemoradiotherapy resistance.Overall, we found that significant alteration of metabolites between the responders and non-responders ESCC patients who received neoadjuvant chemoradiotherapy. The pCR group exhibited higher level of isocitric acid, linoleic acid, citric acid, and lower level of L-histidine, 3\u20324 dihydroxyhydrocinnamic acid than the non-pCR group. Changes in plasma metabolic signature may reflect reprogramming of the aforementioned metabolic pathways. Further study is needed to validate these findings using larger samples and to explore the underlying mechanism of ESCC chemoradiotherapy resistance.Additional file 1.Additional file 2: Supplementary Figure 1. Metabolic network of the changed metabolites and altered metabolic pathways in KEGG general metabolic pathway map. Red dots represent the increased metabolites in pCR group; Blue dots represent the specifically decreased metabolites in pCR group."}
+{"text": "Actb, Pgk1, Sdha, Gapdh, Rnu6b) as a function of hypoxia exposure and hypothermic treatment in the neonatal rat cerebral cortex\u2013in order to identify RGs that are stably expressed under these experimental conditions\u2013using several statistical approaches that have been proposed to validate RGs. In doing so, we first analyzed RG ranking stability proposed by several widely used statistical methods and related tools, i.e. the Coefficient of Variation (CV) analysis, GeNorm, NormFinder, BestKeeper, and the \u0394Ct method. Using the Geometric mean rank, Pgk1 was identified as the most stable gene. Subsequently, we compared RG expression patterns between the various experimental groups. We found that these statistical methods, next to producing different rankings per se, all ranked RGs displaying significant differences in expression levels between groups as the most stable RG. As a consequence, when assessing the impact of RG selection on target gene expression quantification, substantial differences in target gene expression profiles were observed. Altogether, by assessing mRNA expression profiles within the neonatal rat brain cortex in hypoxia and hypothermia as a showcase, this study underlines the importance of further validating RGs for each individual experimental paradigm, considering the limitations of the statistical methods used for this aim.Real-time reverse transcription PCR (qPCR) normalized to an internal reference gene (RG), is a frequently used method for quantifying gene expression changes in neuroscience. Although RG expression is assumed to be constant independent of physiological or experimental conditions, several studies have shown that commonly used RGs are not expressed stably. The use of unstable RGs has a profound effect on the conclusions drawn from studies on gene expression, and almost universally results in spurious estimation of target gene expression. Approaches aimed at selecting and validating RGs often make use of different statistical methods, which may lead to conflicting results. Based on published RG validation studies involving hypoxia the present study evaluates the expression of 5 candidate RGs ( In qPCR analysis, reference genes (RGs) with stable expression levels are essential internal controls for relative quantification of mRNA expression. RGs normalize variations of candidate gene expression under different conditions , 2. The RG selection should be performed using the same samples that will be compared when looking at genes of interest. For this purpose, several statistical methods have been proposed, i.e. GeNorm , qBase , BestKeeTo combine these stability rankings, two main approaches have been proposed, i) a weighted rank \u201320 and iIn the present study, we applied this same approach in the evaluation of the stability of five candidate RGs in a murine model of perinatal asphyxia and therapeutic hypothermia. Perinatal asphyxia is a clinical condition defined as oxygen deprivation that occurs around the time of birth and may be caused by perinatal events such as placental abruption, cord prolapse, or tight nuchal cord, limiting the supply of oxygenated blood to the fetus . Recentlin vivo and in vitro studies on hypoxia, making use of qPCR, have been reported [Here, we used a murine model of perinatal hypoxic-ischemic encephalopathy that causes well-described physiological and behavioral impairments and recapitulate several key features of human perinatal hypoxic-ischemic injury \u201331, to areported \u201338, indiRest), a gene that has been shown to be upregulated by hypoxic-ischemic injury in the peri-infarct cortex of adult rats following transient focal ischemia induced by middle cerebral artery occlusion (MCAO) [Bad), a gene that has been shown to be up-regulated by hypoxia in the MCAO rat model, was assessed [We selected five candidate RGs based on published RG validation studies involving hypoxia . Subsequn (MCAO) . Moreoveassessed . This stSprague\u2013Dawley albino rats with genetic quality and sanitary certification from the animal facility of our Institution were used following the international rules and guidelines of the Federation of European Laboratory Animal Science Associations (FELASA). Animals were kept under standard laboratory conditions, with light/dark cycles of 12/12 h. Standard rat chow and water were given ad libitum. During housing, animals were monitored twice daily for health status. No adverse events were observed. All the procedures concerning the animal manipulation and treatment were performed according to the Guide of Animal laboratory Care (revisited in 1996) by the National Institute of Health Guide for the Care and Use of Laboratory Animals (Publications No. 80\u201323). The animal model described below has been approved by the Ethical Committee of CICUAL: \u201cComit\u00e9 Institucional para el Uso y Cuidado de Animales de Laboratorio\u201d (Resolution N\u00b0 2079/07), Facultad de Medicina, Universidad de Buenos Aires, Argentina. All sections of this report adhere to the ARRIVE Guidelines for reporting animal research . A complRattus norvegicus) obtained from the Animal Facility of the Facultad de Medicina, Universidad de Buenos Aires, Argentina were housed in an individual delivery-cage, maintained at controlled temperature (22\u00b11\u00b0C), humidity (50\u201360%), with a fixed 12-h light/dark cycle (light on 7:00 AM to 7:00 PM), and standard rat chow and water present ad libitum.Fifteen pregnant albino Sprague-Dawley rats  following the manufacturer\u2019s instructions. The residual DNA was removed by the TURBO DNA free kit . Yield and purity of RNA were determined by the NanoDrop ND-1000 spectrophotometer . RNA samples with an absorbance ratio OD 260/280 between 1.9\u20132.2 and OD 260/230 greater than 2.0 were used for further analysis. RNA integrity was assessed using agarose gel electrophoresis. One microgram of RNA from each sample was reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer\u2019s instructions. cDNA was stored at \u221220\u00b0C for future use. For qPCR analysis, each cDNA sample was diluted 20 times with nuclease-free water.Real-time PCRs were conducted using the LightCycler 480 Multiwell Plate 96  containing 1\u03bcM of each primer. For each reaction, the 20 \u03bcl mixture contained 1 \u03bcl of diluted cDNA, 5 pmol each of the forward and reverse primers, and 10 \u03bcl 2 \u00d7 SensiMix SYBR No-ROX Kit . The amplification program was as follows: 95\u00b0C for 30 sec, 40 cycles at 95\u00b0C for 15 sec, and 60\u00b0C for 15 sec, and 72\u00b0C for 15 sec. After amplification, a thermal denaturing cycle was conducted to derive the dissociation curve of the PCR product to verify amplification specificity. Reactions for each sample were carried out in triplicate. qPCR efficiencies in the exponential phase were calculated for each primer pair using standard curves . The mean threshold cycle (Ct) values for each serial dilution were plotted against the logarithm of the cDNA dilution factor and calculated according to the equation E = 10(\u22121/slope) \u00d7 100, where the slope is the gradient of the linear regression line.Actb, Pgk1, Gapdh, Sdha, Rnu6b. These genes represent commonly used endogenous control genes chosen from the relevant literature and have been previously validated in rat, mouse and human brain tissues exposed to hypoxia. The selected RGs belong to different molecular pathways to minimize the risk of co-regulation between genes. The primers were designed from nucleotide sequences identified using NCBI BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Rnu6b TaqMan MicroRNA Assay (Rnu6b) was commercially available . All other primers were ordered from Thermo Fisher Scientific with their certificates of analysis. The primer characteristics of nominated RGs are listed in Based on their common usage as endogenous control genes in previous studies , five caRest;\u2014F, AACTCACACAGGAGAACGCC\u2014R, GAGGTTTAGGCCCGTTGTGA.Bad;\u2014F, GCCCTAGGCTTGAGGAAGTC\u2014R, CAAACTCTGGGATCTGGAACA.To assess the stability of candidate RGs, five statistical methods, each with unique characteristics, were used: GeNorm, BestKeeper, NormFinder, Coefficient of Variation analysis, and the comparative \u0394Ct method. Ct values were converted to non-normalized relative quantities according to the formula: 2\u2212\u0394Ct. CV analysis, GeNorm and NormFinder calculations are based on these converted quantities, whereas BestKeeper and the \u0394Ct method make use of raw Cq values. To obtain a integrated ranking, we used the workflows as described in more detail previously , 21.Rest and Bad. The relative expression profiles of Rest and Bad were determined and normalized with all tested RGs. Relative fold changes in gene expression were calculated using the DDCt and Pfaffl methods. Data was expressed as mean \u00b1 standard error of the mean (SEM) from six independent samples/group with triple qPCR reactions. One-way analysis of variance (ANOVA) test was applied to analyze significant differences between conditions for each house-keeping gene. Differences were reported as statistically significant when p<0.05. GraphPad Prism 6  was used for statistical procedures and graph plotting.The impact of RG selection on gene expression quantification was assessed via examining the expression of Pilot assays were performed to optimize cDNA and primer quantities. A total of 0.9 mg of RNA that was previously treated with DNase was used for the reverse transcription reaction in a total volume of 40ml. One microliter of the resulting cDNA was used for the qPCR reaction. Each gene amplification was analyzed, and a melting curve analysis was performed, showing a single peak indicating the temperature of dissociation. Efficiencies are shown in Gapdh as the most stable RG, and Actb as the least stable RG. This method however does not consider potential expression differences between different conditions; hence, a CV analysis alone cannot determine the best set of RGs.We calculated the raw expression profiles of RGs as changes of Ct values across groups and ranked the gene stability according to the CV. The CV estimates the variation of a gene across all samples, therefore, a lower CV value indicates higher stability . This anSdha, Rnu6b, Pgk1, Actb) showed significant variation in mRNA levels when comparing different conditions , the expression stability of candidate RGs was analyzed using four well known statistical methods .Rnu6b, which presented the highest M-value (M = 1.923), all of the other candidate RGs presented M-values lower than 1.5, which is considered to be the cut-off for suitability [Pgk1 and Actb. This is in contrast to the CV analysis, that showed those genes as the least stable ones (higher CV), and to the expression profiles that showed inter-group differences.First, a GeNorm analysis was performed on all five candidate genes. GeNorm calculates a stability value (M) based on pairwise variation of every two genes. In our analysis, except for tability . Based oActb, Sdha and Pgk1 were the most stable RGs, presented stability values lower than 0.3. Gapdh (SV = 1.736) and Rnu6b (SV = 3.17) were the least stable.NormFinder calculates the stability score (S) based on the inter- and intra-group variation. However, it has been reported that including genes with high overall variation can affect the stability ranking of all genes with this method . Actb, SPgk1 (r = 0.825), while Rnu6b was considered the least stable gene (r = 0.106). The ranking obtained from this analysis was the same as the one obtained with GeNorm.BestKeeper uses the cycle threshold (Ct) values to calculate a standard deviation (SD), coefficient of variance (CV), and Pearson correlation coefficient (r) for each gene. Lower SD and CV values indicate more stable gene expression, and genes that exhibit a SD in Ct values above 1.0 should be eliminated and regarded as unreliable controls. Then, the remaining RG are ranked according to r values, with a higher r value indicating more stable gene expression. None of the genes analyzed were excluded for having SD above 1. The most stable RG was Pgk1 (Av. SD = 1.41) and Sdha (Av.SD = 1.45), and the least stable Rnu6b (Av.SD = 3.23). The overall ranking depicted in Pgk1.Using the \u0394-Ct method, the ranking was similar to previous rankings. The most stable RGs were Rest and Bad. These genes have shown to be influenced by hypoxia and hypothermia. Five gene expression normalizing strategies were used to select the least and most stable RGs, and the best combination of two genes, Actb/Pgk1  and the primer efficiency method Click here for additional data file."}
+{"text": "\u24c7 (CAS\u24c7)  developed as a rapid freezer unit supplemented with an OMF generator. The center temperature of tuna blocks was monitored during air blast freezing (ABF) or ABF combined with CAS\u24c7 (ABF-CAS). The time taken to acquire the freezing temperature (-20\u202f\u00b0C) was significantly (p < 0.05) shortened with ABF-CAS compared to ABF. The time taken for ice crystal formation  was slightly shorter in case of the ABF-CAS system relative to ABF (p\u202f=\u202f0.08497).Although freezing is the most popular method for long-term food preservation, the formation of ice crystals during the process often leads to degradation of the product quality. Recently, we demonstrated that the presence of oscillating magnetic fields (OMFs) can hinder ice crystallization (10.1016/j.cryobiol.2020.05.005,  Specifications table\u2022This research represents the first report on the shortening of freezing time (time taken to acquire the freezing temperature) during animal tissue freezing by oscillating magnetic fields using real fish tissues with complex internal structures.\u2022These data provide enhanced understanding of factors contributing to structural damages in frozen food.\u2022These data hint that the suppression of latent heat during tissue freezing is a prominent factor affecting tissue damages induced by ice crystallization.\u2022These observations provide useful insights into safe tissue cryopreservation required in the field of regenerative medicine.1Thunnus albacares) blocks used to data the freezing process are summarized in Details of tuna  were recorded at the center of the frozen sample .Fig. 1ThData obtained from the curves were evaluated for freezing characteristics according to the respective definitions (detailed in p < 0.05) shorter than that in ABF. The time taken for ice crystal formation was also slightly shorter for CAS-ABF compared to ABF (p\u202f=\u202f0.08497). The freezing time  and freezing rate (p\u202f=\u202f0.29294) was similar in tuna blocks frozen by CAS-ABF and ABF methods.The time to freezing temperature (\u221220\u202f\u00b0C) in ABF-CAS was significantly  were cut rectangular. These samples were selected randomly for testing out the different freezing conditions.\u24c7 system. The freezer used in this data had been designed in consultation with ABI , with the OMFs and control system supplied and commissioned by ABI. The basic construction of the freezer consisted of a cooling unit, a freezing cabinet, 2 fans, and 2 control panels. The freezing cabinet contained a rack with 10 equidistant rails that would accommodate up to 10 aluminum trays for freezing food, along with the magnetic field generator. Different freezing conditions, namely air temperature (\u221250\u202f\u00b0C), airflow (0/100%), and \u2018CAS energy\u2019 (0/700), could be set by the control panel The different experimental batches were frozen with an air blast freezer with and without the CAS\u24c7 freezing, the CAS energy was set at 500, as per the recommendation by ABI. The CAS\u24c7 energy was turned off for samples frozen only with ABF. The OMF strength was measured using a gaussmeter . The OMF strength with CAS energy could be controlled in the range of 0.1 to 1.0\u00a0mT. The OMF strength in the ABF-CAS mode recommended by ABI for raw fish was precisely controlled to ensure a working range of 0.1 to 0.5\u00a0mT. The freezing process was considered complete when the temperature at the center of the tuna block reached \u221250\u202f\u00b0C.The freezer was precooled to \u221230\u202f\u00b0C (precooling mode), and the tray with samples was arranged in a single layer in the middle of the cabinet. After the sample was frozen, the air temperature was decreased to \u221250\u202f\u00b0C (rapid freezing mode) with airflow of 50% (corresponding to a flow rate of approximately 0.5\u202fm/s). With CASThe temperature at the center of all samples was monitored in real time during the freezing process using a type K thermocouple  connected to a temperature recorder . An accurate insertion of the thermocouple at the center of all the samples was ensured. In addition, the frozen samples were defrosted and dried after completion of the first freezing step for restoration to the initial state, followed by the second freezing step. The obtained data was output in the CSV format and analyzed for estimating the freezing time.As samples gradually froze in an inward direction from the surface to the center, it was difficult to determine precisely the total freezing time. The temperature at the center was dissipated outside due to the latent heat associated with crystallization of ice during freezing. Consequently, we defined the \u201cfreezing time\u201d as the time taken for the center of the sample to reach the set temperature from the time of initiation of freezing. The \u201ctime to freezing temperature\u201d was considered the time taken for the temperature at the center to reach \u221220\u202f\u00b0C from the initial temperature, because commercially available frozen food has a temperature of \u221218 to \u221220\u202f\u00b0C. In addition, we defined the crystallization time as the time taken for the temperature at the center of the sample blocks to pass through the crystallization temperature zone (\u22121 to \u22127\u202f\u00b0C) t-test was used. Statistical analysis was performed using the Student's t-test, and differences between the groups were considered statistically significant when the P value was less than 0.05.Experimentally acquired data were processed by means of variation statistics, namely mean and standard deviation (SD). To compare the parametric data in the two groups, a The authors declare that they have no known competing financial interests or personal relationships which have, or could be perceived to have, influenced the work reported in this article."}
+{"text": "Staphylococcus aureus (MRSA) in an environment with or without stressor by adding ampicillin at a lower concentration than the minimum inhibitory concentration (MIC). We investigated whether EVs from MRSA under stress condition or normal condition could defend susceptible bacteria in the presence of several \u03b2-lactam antibiotics, and directly degrade the antibiotics. A comparative proteomic approach was carried out in both types of EVs to investigate \u03b2-lactam resistant determinants. The secretion of EVs from MRSA under antibiotic stressed conditions was increased by 22.4-fold compared with that of EVs without stress. Proteins related to the degradation of \u03b2-lactam antibiotics were abundant in EVs released from the stressed condition. Taken together, the present data reveal that EVs from MRSA play a crucial role in the survival of \u03b2-lactam susceptible bacteria by acting as the first line of defense against \u03b2-lactam antibiotics, and antibiotic stress leads to release EVs with high defense activity.Extracellular vesicles (EVs) containing specific cargo molecules from the cell of origin are naturally secreted from bacteria. EVs play significant roles in protecting the bacterium, which can contribute to their survival in the presence of antibiotics. Herein, we isolated EVs from methicillin-resistant  To combat the spread of superbugs globally, it is important to understand all possible bacterial protection mechanisms against antibiotics.Although the discovery of antibiotics has prolonged human life and helped develop a variety of health-related technologies, the overuse of antibiotics has led to the emergence of \"superbugs\" as bacteria have evolved the means of resisting traditional antibiotics. The increase in superbug strains is believed to be a serious threat facing public health around the world. Damage caused by antimicrobial resistance is expected to reach a total gross domestic product (GDP) loss of $ 100 trillion worldwide by 2050, at which point it could kill 10 million people annuallyStaphylococcus aureus (MRSA). Since MRSA was reported in 19612, the incidence of this strain has spread worldwide. MRSA is a major Gram-positive bacterial pathogen that causes a range of illnesses including pneumonia, meningitis, osteomyelitis, endocarditis, and septicemia, which leads to high mortality and is expensive to treat3. Numerous cases of infections due to MRSA have been reported in companion, diverse domesticated, and livestock animals5. The transmission between humans and animals indicated that both directions of humanosis and zoonosis are possible6. Therefore, emerging MRSA infections are no longer primarily a human healthcare-related threat, but a global community-associated problem.The multidrug-resistant (MDR) pathogenic bacterium, as the main cause of recurrent opportunistic infections, is methicillin-resistant 8. Among them, extracellular vesicles (EVs) are known to possess diverse cellular factors and have a variety of functions to aid bacteria survival11. EVs are defined as spherical, and bilayered proteolipids which form lumen-containing spheres with an average diameter of 20\u2013200\u00a0nm, and composed of proteins from various cellular origins, unique lipids, enzymes, toxins and nucleic acids13. Packed within vesicles, the cargo molecules can be transported over long distances away from dilution and degradation, which might explain the effective interaction among bacteria14. These vesicles have been elucidated to play diverse roles15, thus EVs are considered the powerful intercellular and interspecies \u2018communicasomes\u2019 in the microbial ecosystem.Bacteria secret proteins, polysaccharides and diverse molecules to their extracellular milieu to communicate and to coordinate population behaviors16, either through horizontal transfer of antibiotic resistance genes17, or degradation/sequestration of antibiotics19, the mechanism of EVs against antibiotics remain uncharacterized. Previous studies have reported that exposure to some physiological or environmental stressors such as antibiotic treatment, oxidative stress, and temperature influenced the level of vesicles secretion, and stressors could cause alterations in the composition of vesicles21. Based on these studies, we hypothesize that a physiological stressor such as sub-lethal antibiotics can trigger bacteria secreting EVs with significant changes in the proteome to adapt and survive in the antibiotic stressed environment.Although several studies suggested that EVs can defend the bacteria against the effects of several antibiotics by acting as decoysNor) and cultured in the presence of sub-lethal concentrations of ampicillin (EVStrs). The results implicated that EVStrs, which have more proteins that can degrade antibiotics than EVNor, can offer protection to the \u03b2-lactam-susceptible S. aureus against lethal \u03b2-lactam antibiotic concentrations better than EVNor.In the present study, we compared the protein constituents of EVs from MRSA cultured under normal conditions (EVNor and EVStrs with respect to the culture conditions. Transmission electron microscopy (TEM) analysis showed bi-layered spherical EVs  and EVNor (86.84\u2009\u00b1\u20090.25\u00a0nm)  were measured below 0.3, indicating that the arrangements were monodispersed  Fig.\u00a0 online. Strs (64\u00a0\u03bcg/mL of ampicillin treated) increased by 22.4-fold compared to EVNor, the untreated control. Even when only 1\u00a0\u03bcg/mL of ampicillin was added, the yield was 2.5-fold higher than EVNor.To understand further how ampicillin stress affects EVs production, ST692 was exposed to incremental concentrations of ampicillin and each of the respective EVs was purified  (data not shown).Minimum inhibitory concentrations (MICs) of the MRSA strain ST692 and the susceptible bacterium Strs at 25\u00a0\u03bcg/mL in the presence of respective antibiotics showed no loss in viability compared to the culture of susceptible cells without antibiotics. In contrast, the viability of the susceptible cells with EVNor at 25\u00a0\u03bcg/mL in the presence of cefoperazone, cefazolin, cefalexin, and cloxacillin showed no viability, which can be explained by the rapid killing by the respective antibiotic concentrations.To determine the degree of bacterial protection of each EV against antibiotics, we performed quantitative plate assays based on growth kinetics Fig.\u00a0b. NotablS. aureus, but rather from the molecules owned by EVs that protected the bacteria from the \u03b2-lactam antibiotic environment. In addition, colonies grown in TSA agar were identified as S. aureus at the species level using MALDI-TOF MS (data not shown).After the growth curve experiment, all samples were plated on TSA agar with or without respective antibiotics in the same concentration as was used in the growth curve experiment , Edwardsiella tarda (ED45), and Salmonella spp.  were 8\u00a0\u03bcg/mL, 4\u00a0\u03bcg/mL, and 8\u00a0\u03bcg/mL, respectively9. Both EVStrs and EVNor defended RC85, ED45, and Sal26B against ampicillin  or 24\u00a0h  compared with respective antibiotics without EVs. Samples treated with 1\u00a0\u03bcg/mL of EVStrs could hydrolyze six antibiotics, but the capacity appears to be lower than that of 5\u00a0\u03bcg/mL. Moreover, 5\u00a0\u03bcg/mL of EVNor also completely decomposed ampicillin and amoxicillin in 3\u00a0h, but the activity against cefoperazone and cefazolin was very weak, and against cefalexin and cloxacillin was not detected. The extent of the capacity of EVStrs and EVNor to hydrolyze ampicillin for 6\u00a0h was compared by increasing the dose of ampicillin after EVs concentrations were fixed to a certain amount  was the highest, followed by the supernatant from stress condition  in ATCC29213 cells in the respective antibiotic environment Fig.\u00a0d. EVStrsThe MICs of each antibiotic against stressed and normal ST692 cells were compared Table . TreatmeIn this study, the potential function in \u03b2-lactam resistance of EVs released by bacteria in stressed conditions was examined. EVs from MRSA cultured with or without sub-MICs of ampicillin were purified, and their capability to degrade several \u03b2-lactam antibiotics investigated, and their proteomics compared to identified \u03b2-lactam antibiotic resistance-related protein constituents. It was found that the production of MRSA EVs increased dose-dependently by ampicillin treatment, and EVs from cultures treated with ampicillin became more potent in degrading \u03b2-lactam antibiotics.22. In addition, bacterial vesiculation could be triggered more intensely when bacteria were challenged with certain antibiotics at sub-lethal concentrations. A previous study showed that the treatment of \u03b2-lactam antibiotics creates holes in the peptidoglycan layer of Gram-positive bacteria which cause protrusion of cytoplasmic membrane material into the extracellular area and more EVs are generated25. There is no significant difference in the size of EVs isolated from MRSA treated w/ and w/o ampicillin by the analysis of TEM and DLS , interfering them from forming a peptidoglycan layer that produces the cell wall. Due to differences in cell wall organization, Gram-positive bacteria are bounded by a single membrane making them more sensitive to the bactericidal activity of \u03b2-lactam antibiotics than Gram-negative which are surrounded by an outer membrane that can protect exposure to antibiotics28. These bacteria have been exposed to naturally occurring antibiotic compounds for at least one billion years, and the evolutionary advantages they have adapted have led to the rapid development of resistance mechanisms for survival against antibiotics which are currently being used for medical applications29. The major mechanisms by which Gram-positive bacteria have developed to avoid the inhibitory effect of \u03b2-lactam antibiotics are as follows30: (1) \u03b2-lactamases are secreted into the extracellular space to degrade \u03b2-lactam antibiotics before they reach the cell wall; (2) Expression of mutated PBPs that are still capable of synthesizing the cell wall but are incapable of binding to \u03b2-lactam antibiotics. Therefore, EVs that have the ability to resist the bactericidal effect of \u03b2-lactam antibiotics as newly observed in Gram-positive strains are more important than those from the less susceptible Gram-negative strains.\u03b2-lactams are one of the most widely utilized groups of antibiotics available for the treatment of several bacterial infections7 and metallo \u03b2-lactamase superfamily protein31 hydrolytically destroy \u03b2-lactam antibiotics and both proteins were significantly upregulated in EVStrs compared with EVNor  which include imipenem, cefotaxime, and methicillin. These three antibiotics belong in the group of \u03b2-lactam antibiotics but were not degraded by the EVs containing \u03b2-lactamases due to their resistance to \u03b2-lactamasells Fig.\u00a0c, these lls Fig.\u00a0.43 and this phenomenon was confirmed in Fig.\u00a0Ampicillin below concentrations of MICs value intensifies the production of chromosomal \u03b2-lactamaseS. aureus has been identified as one of the microbial infections in many polymicrobial infections44. Studies proving \u2018cooperative interaction\u2019 between different strains of bacteria had been discussed in the past. For example, Candida albicans and S. aureus colonized human mucosal surfaces with commensals and cause enhanced disease severity during biofilm-related coinfections46. Haemophilus influenzae and S. aureus showed cooperative interactions and both colonized in nasopharynx, instances, and genital tract47. S. aureus co-colonized together with Enterococcus faecalis in the intestinal tracts44, and conjugation between the two strains causes a horizontal transfer of the vanA gene, resulting in multidrug-resistant staphylococci49. Schaar et al. also indicated that vesicles including \u03b2-lactamase help to protect producer bacteria as well as co-occurring organisms in the human50. The results of Fig.\u00a0Actually, To summarize, global protein modulation of EVs by ampicillin stress response of MRSA involves processes that are directly related to \u03b2-lactam antibiotic resistance. EVs naturally secreted from MRSA possess\u00a0\u03b2-lactam-resistant proteins, which can help bacteria to survive in the antibiotic environment by hydrolyzing the capacity of antibiotics. Inducing stress on\u00a0MRSA with a sub-lethal dose of ampicillin could stimulate production of EVs enhancing the ability to consume antibiotic compared with EVs released in no-stress condition. Therefore, proper drug treatment is necessary to impede the progeny of MRSA because indiscriminate abuse of \u03b2-lactam antibiotics may create an opportunity for bacteria to be more resistant to \u03b2-lactam antibiotics. Besides, this is a novel mechanism not related to PBP2a-based, the major resistance mechanism of \u03b2-lactam antibiotics of MRSA strains known up to this point. This information equips us with a new perspective on how to lessen (if not eradicate) the impact of multi-drug resistant bacteria which impose a grave threat to global public health.Staphylococcus aureus C-S03-S237 strain of ST69251 isolated from the chicken was provided from Animal and Plant Quarantine Agency, Korea and \u03b2-lactam-sensitive S. aureus ATCC29213 strain was purchased from ATCC. Luria\u2013Bertani  broth or tryptone soya agar  were used to grow both cells at 37\u00a0\u00b0C. Ampicillin-sensitive bacteria, Escherichia coli RC859, and Edwardsiella tarda ED4552 were cultured on TSA and Salmonella spp. Sal26B53 was incubated on brain heart infusion  agar at 37\u00a0\u00b0C.Methicillin-resistant 54 according to Clinical and Laboratory Standards Institute (CLSI) guidelines, except that cation-adjusted Muller Hinton broth was substituted with LB. The MIC values were measured from three independent experiments.Nine \u03b2-lactam antibiotics known to confer bactericidal effects by inhibiting cell wall biosynthesis, namely ampicillin, amoxicillin, cefalexin, cefazolin, cefoperazone, cefotaxime, cloxacillin, imipenem, and methicillin  and five other class antibiotics, such as chloramphenicol, gentamicin, kanamycin, streptomycin, and tetracycline (Sigma-Aldrich) were selected. The minimum inhibitory concentration (MIC) of each antimicrobial agent was determined in ST692 and ATCC29213 cells using the broth-dilution method in 96-well plates7, with some modifications. Briefly, when isolating EVNor, the strain was cultured in nutrient broth  without any antibiotic addition. To determine the change in the production of EVs, the ampicillin dose was treated at 1, 4, 16, or 64\u00a0\u03bcg/mL (EVStrs means EVs treated with 64\u00a0\u03bcg/mL of ampicillin when bacteria are cultured). Each culture medium was centrifuged at 6,000\u00d7g for 15\u00a0min and concentrated by QuixStand Benchtop system . Each supernatant was centrifuged at 150,000\u00d7g at 4\u00a0\u00b0C for 3\u00a0h. Further purification was performed by a continuous sucrose density gradient followed by ultracentrifugation. The final EV pellet was resuspended in 10\u00a0mM Tris\u2013HCl (pH 8.0)  and filtered through a 0.2\u00a0\u03bcm filter . The protein yields of EVs samples were measured using a Pierce BCA protein assay kit . Transmission electron microscopy (TEM) of EVs was performed as previously described9 using a Tecnai G2 Spirit Twin TEM system . Dynamic light scattering (DLS) of EVs for particle size distribution and measurement of zeta potential was performed as described previously9 using a Nano ZS instrument  and the Zetasizer software .EVs from ST692 cells were purified from bacterial culture supernatant as described previously55 and in-gel digestion was performed as previously described9. Each obtained peptide mixture was resuspended in 0.1% (v/v) TFA and passed through an analytical column  via a trap column . The peptides were separated from acetonitrile gradient of buffer A (0.1% (v/v) formic acid in water) and buffer B (0.1% (v/v) formic acid in pure acetonitrile) at a constant flow rate of 0.2\u00a0\u03bcl/min using the Agilent 100 series nano HPLC system coupled on-line to a LTQ ion-trap mass spectrometer (Thermo Fisher Scientific). The gradient started linearly with 5% B and rose linearly to 40% B over 100\u00a0min, increased to 80% B over 1\u00a0min, and then increased to 80% B isocratically over 15\u00a0min. Full-scan mode (m/z 350\u20131600) was enabled and three MS/MS scans were performed with a 30-s dynamic exclusion option set for each survey MS scan.Each of ST692 EVs was mixed with sample buffer and separated by Sodium dodecyl sulfate\u2013polyacrylamide gel electrophoresis (SDS-PAGE) according to Laemmli\u2019s methodStaphylococcus aureus USA300 strain database using Mascot 2.3 . The obtained LC/MS data were analyzed with the DeCyder MS software . For quantitative profiling, proteins identified by multiple peptides with significant Mascot scores were selected (p\u2009<\u20090.05).Peptide peaks were detected with an average peak width of 1\u00a0min and matched with a mass accuracy of at least 0.6\u00a0Da. Differentially expressed proteins were defined to exhibit more than twofold or greater increase/decrease in comparable intensity or the complete appearance/disappearance of the spot. After alignment of the retention times of the chromatogram, normalization was carried out with the measured intensity distribution and the proteome was quantified with the peak intensity ratio. The MS/MS spectra of the peptide peaks were searched against a SwissProt uni_bacteria database or Gene ontology (GO) terms such as biological process, cellular component, and molecular function are derived from differentially expressed proteins obtained using a software tool for researching annotations of proteins (STRAP) version 1.5 .Nor and EVStrs on the cytotoxicity of \u03b2-lactam antibiotics were monitored by assessing the growth curves of EVs-treated Staphylococcus aureus (ATCC29213) cells as previously described with slight modifications9. The following antibiotics were used at the growth-inhibiting concentrations: ampicillin, 40\u00a0\u03bcg/mL; cefoperazone, 8\u00a0\u03bcg/mL; cefazolin, 1.25\u00a0\u03bcg/mL; amoxicillin, 40\u00a0\u03bcg/mL; cefalexin, 4\u00a0\u03bcg/mL; and cloxacillin, 1.25\u00a0\u03bcg/mL. Cultured ATCC29213 cells were separately inoculated in a medium containing each antibiotic and 1, 5, 25\u00a0\u03bcg/mL of EVNor or EVStrs. To test whether EVs can affect different genera of bacteria, Gram-negative bacteria such as RC85, ED45, and Sal26B were cultured in LB, TSB, and BHI, respectively, and same concentrations of EVNor or EVStrs were treated in the medium with respective cultured bacteria in the presence of 30\u00a0\u03bcg/mL of ampicillin. The bacterial growth curves at OD600 were recorded at 2\u00a0h intervals up to 12\u00a0h, and then at 12\u00a0h intervals up to 48\u00a0h or 12\u00a0h intervals for 96\u00a0h using an xMark microplate spectrophotometer (Bio-Rad). The bacterial cultures since the last measurement time were streaked on TSA with or without the respective same concentrations of antibiotics to test whether the EVs could confer resistance to antibiotic-susceptible bacteria. The samples collected at certain time points  and quantitative plate assays were carried out9. The count obtained in the absence of antibiotics was taken as 100%, and the corresponding counts in the presence of different concentrations EVNor or EVStrs plus the respective \u03b2-lactam antibiotics were calculated. Colonies from each cultured sample  were randomly selected and identified by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS)56 to check for contamination.The effects of EVNor and EVStrs on the concentrations of six antibiotics in a cell-free system were analyzed by liquid chromatography/electrospray ionization mass spectrometry  as previously described with slight modifications9. One microgram per milliliter or 5\u00a0\u03bcg/mL of EVStrs or 5\u00a0\u03bcg/mL of EVNor in PBS were mixed with ampicillin (40\u00a0\u03bcg/mL), cefoperazone (8\u00a0\u03bcg/mL), cefazolin (1.25\u00a0\u03bcg/mL), amoxicillin (40\u00a0\u03bcg/mL), cefalexin (4\u00a0\u03bcg/mL) or cloxacillin (1.25\u00a0\u03bcg/mL). Filtered PBS containing the respective antibiotics without EVs was used as a positive control. In addition, to compare the degradability of EVNor and EVStrs against ampicillin, 5\u00a0\u03bcg/mL of each EVs was added to various concentrations of ampicillin. The concentrations of antibiotics were recorded at 3-h intervals for 6\u00a0h or at 24-h intervals for 48\u00a0h in triplicate.To evaluate whether EVs could directly degrade \u03b2-lactam antibiotics, the effects of EV490). A Bradford assay kit (Thermo Fisher Scientific) was used to determine the protein concentrations of samples. Equivalent concentrations of each sample were dispensed to the wells of a clear flat-bottomed 96-well, and the provided nitrocefin and buffer were added. The OD490 was immediately measured in kinetic mode.To test for differences in \u03b2-lactamase activity between whole-cell lysates, supernatants, and EVs from the stressed condition and normal condition, a colorimetric \u03b2-lactamase activity assay kit  was used according to the manufacturer\u2019s instructions. The assay involves the hydrolysis of nitrocefin which produces a colored product that is measured by spectrophotometry  plus sulbactam were determined in the presence of 25\u00a0\u03bcg/mL EVStrs or EVNor.The effects of the \u03b2-lactamase inhibitor, sulbactam , were investigated by growth curve experiments. The \u03b2-lactamase inhibitors were added at the previously reported and fixed concentrationst-test, One-way Analysis of Variance (ANOVA), Two-way ANOVA, or Turkey\u2019s multiple comparison test. All data were expressed as means\u2009\u00b1\u2009standard deviations (SD). Differences were considered statistically significant at P\u2009<\u20090.05.Statistical analyses were carried out using Graphpad Prism, version 8.1.1. . Significant differences were determined by Student\u2019s Supplementary Information 1.Supplementary Information 2.Supplementary Information 3."}
+{"text": "Talaromyces marneffei (T. marneffei) is a growing public health concern. Although Toll-like receptor (TLR) genes play a critical role in the host defense against fungal infection, the influence of polymorphisms in these genes on the susceptibility of acquired immune deficiency syndrome (AIDS) patients to TM remains unknown. This study aims to uncover the associations of single nucleotide polymorphisms (SNPs) in TLR genes with TM susceptibility among patients with AIDS.Talaromycosis (TM) caused by Altogether 200 AIDS patients complicated with TM, 200 matched AIDS patients without TM, and 76 healthy controls (HCs) were enrolled in this case-control study. In total, 23 SNPs in the TLR2, TLR4, and TLR9 genes, which may influence the susceptibility of AIDS patients to TM, were checked by the time of flight mass spectrometry (TOF/MS) method among these Han Chinese subjects.vs. 35.8%, 70.5 vs. 59.7%); the frequency of the GT genotype in TLR2 SNP rs7656411 was markedly higher in severe TM cases compared to controls (57.8 vs. 34.4%).No significant differences in genotype or allele frequencies of selected SNPs were found among the TM group, Non-TM group, and HC group. Haplotype analysis also demonstrated no correlation of these SNPs with TM. However, subgroup analysis showed that the genotype TT and the T allele in TLR2 SNP rs1339 were more frequent in typical TM cases than controls (50.0 Our results demonstrate a genetic connection of TLR2 SNPs rs1339 and rs7656411 with an increased susceptibility and severity of TM among Han Chinese populations. Talaromyces marneffei (T. marneffei), has become increasingly frequent among patients with acquired immune deficiency syndrome (AIDS), accounting for one of the most common invasive fungal diseases (IFDs) in Southeast Asia and southern China , a systemic mycosis caused by rn China . Despitern China . The remToll-like receptors (TLRs) are the first identified and the best-studied family of pattern recognition receptors (PRRs), playing a crucial role in the first line of defense against invading pathogens and promoting adaptive immunity responses . CurrentIn the present study, a case-control model was conducted. The SNPs within the TLR2, TLR4, and TLR9 genes that may contribute to an increased susceptibility of AIDS patients to TM were checked by the time of flight mass spectrometry (TOF/MS) method. The relevance of TLR2 rs1339 and rs7656411 polymorphisms to the susceptibility of AIDS patients to TM provides a new understanding of the role of TLR in fungal infections and lays a theoretical basis for the risk prediction of TM.In this study, a matched case-control design was carried out. A total of 476 Chinese Han adults who had resided in Guangdong Province for more than 1 year, were recruited from Guangzhou Eighth People\u2019s Hospital from 2008 to 2015. Of these, 200 AIDS patients complicated with TM were enrolled as the case group (TM group), including 160 males and 40 females, with an age range of 19\u201369 years and a median age of 37.5 years. Another 200 AIDS patients with comparable gender and age, who did not develop TM, were enrolled in the control group (Non-TM group), including 163 males and 37 females, with an age range of 19\u201377 years and a median age of 39.5 years. In addition, 76 individuals who had a health examination in the same hospital during the same period and had no AIDS or other infectious diseases were enrolled as the healthy control group (HC group), including 53 males and 23 females, with an age range of 21\u201378 years and a median age of 38.6 years. The diagnosis of TM depends on the microscopic identification of the fungus with confirmation by culture as previously described . All pat9/L, mental disorders, septic shock, respiratory failure, and multiple organ damage.A subgroup analysis was performed to account for differences in the severity of TM. Patients with TM were divided into two groups, severe cases and typical cases. Based on the severity of illness, the controls were chosen so that the severe or typical TM cases and their controls were matched by age and sex. The diagnostic criteria of severe TM referred to the Acute Physiology and Chronic Health Evaluation II and sequential organ failure assessment scoring systems , should This project was approved by the ethics committee of the Guangzhou Eighth People\u2019s Hospital (GZ8H20171390), and informed consent was obtained from every subject recruited in the study.Peripheral venous blood (10\u00a0ml) was collected from each subject with an EDTA-K2 anticoagulation vacuum blood collection tube. Genome DNA of peripheral venous blood from all subjects was isolated by using the QIAamp DNA Mini Kit according to the manufacturer\u2019s protocol. The purity and concentration of DNA were detected by an ultraviolet spectrophotometer and then frozen at \u221220\u00b0C until testing.The candidate polymorphisms that have previously been reported to be associated with infectious diseases in the literature, or identified minimal haplotype-tagging SNPs from the NCBI GenBank, dbSNP, and HapMap databases were genotyped after comprehensive evaluation. A total of 23 SNPs in TLR2, TLR4, and TLR9 were identified with the use of a TOF/MS method, with appropriate PCR primers as shown in Pearson\u2019s-chi-square and Fisher\u2019s exact tests were applied to calculate and compare categorical data of clinical variables, and genotype and allele frequencies. All polymorphisms were tested with the Hardy-Weinberg equilibrium (HWE). Plink software was used to analyze linkage disequilibrium (LD) and haplotype analysis. Statistical analyses were conducted using the SPSS 13.0 software package. A P value less than 0.05 was regarded as statistically significant.A total of 200 TM patients, 200 non-TM patients, and 76 healthy controls were included in the study. The clinical characteristics of the patients, including age, sex, CD4+ T cell count, and prevalence of hepatitis or other opportunistic infections, were collected and compared Table 1.In total, 23 candidate polymorphisms, all present in the coding region of the TLRs, were selected for analysis: 9 SNPs in the TLR2 gene , 12 SNPs in the TLR4 gene , and 2 SNPs in the TLR9 gene (rs187084 and rs352140). In detail, 3 of the 9 genotyped TLR2 SNPs  and 4 of the 12 genotyped TLR4 SNPs  showed no polymorphisms in all the subjects, so only 16 SNPs were eligible for the subsequent analysis. All these SNPs were in Hardy-Weinberg equilibrium in controls except for the two TLR4 SNPs rs10116253 and rs7037117.To study associations of TLR2, TLR4, and TLR9 polymorphisms with the risk of TM, the frequency distributions of genotypes and alleles were assessed. Overall, 13 of the 14 SNPs showed no significant differences in genotype or allele frequencies among the TM group, non-TM group, and HC group Table 3.vs. 35.8%, 70.5 vs. 59.7%). In addition, the frequency of the GT genotype in the TLR2 SNP rs7656411 was found to be markedly higher in severe cases than in controls (57.8 vs. 34.4%). Moreover, the genotype and allele frequencies of selected SNPs were similar between patients with typical and severe TM (data not shown). The above results revealed that TLR2 SNPs rs1339 and rs7656411 may contribute to an increased susceptibility of AIDS patients to TM, and the GT genotype of TLR2 SNP rs7656411 may be implicated in the risk of severe TM among AIDS patients.On the other hand, when patients with TM were divided into typical cases and severe cases and compared to matched control patients, significant differences in genotype and allele frequencies of the TLR2 SNPs were observed  rather than all TLR2 SNPs and the first to reveal a noticeable association between the GT genotype of TLR2 SNP rs7656411 and the severity of TM. Our findings suggest that genetic polymorphisms in TLR2 may play a critical role in the occurrence and pathogenesis of TM, and could also serve as a feature underlying the susceptibility and severity of TM among Han Chinese populations.Aspergillus fumigatus, because of the survival difference between TLR2 knockout mice and wild-type mice upon induction of invasive pulmonary aspergillosis  TLR4 and chronic cavitary pulmonary aspergillosis (CCPA) . Bochud Acinetobacter baumannii in a Chinese population (TLR9 is the only TLR in humans that senses unmethylated cytosine-phosphate-guanine (CpG) motifs prevalent in bacterial or viral single stranded DNA . A numbepulation , and thepulation . Moreovepulation . A Japanpulation , indicatpulation . Our stuOverall, this study represented the first analysis evaluating whether TLR2, TLR4, and TLR9 could contribute to regulating the susceptibility or severity of TM among the Chinese Han population. Several limitations could not be ignored. First, the sample size was relatively limited in our cohort. Some genotypes of SNPs have low frequencies, which may restrict statistical power. Second, the studied subjects were all of Chinese Han ethnicities, so the results might not be well applicable to other groups due to ethnic differences. Third, all of the detected TLR SNPs are located in the coding region. Other SNPs present in the non-coding region of these TLRs may also be potential targets. Finally, only the superficial correlation between TLR SNPs and susceptibility to TM was investigated, and the potential mechanisms need further study.In conclusion, the results of this study indicated that TLR2 SNPs such as rs1339 and rs7656411 were associated with an increased susceptibility and severity of TM among Han Chinese populations. Our findings not only imply the importance of TLR2 in natural immunity against fungi but also provide a theoretical basis for the risk and severity prediction of TM.The original contributions presented in the study are included in the article/The studies involving human participants were reviewed and approved by Guangzhou Eighth People\u2019s Hospital (GZ8H20171390). The patients/participants provided their written informed consent to participate in this study.LL and XT designed the research protocol. SX and MW performed the research. WaC, FH, FL, PG, XC, and WeC provided reagents/analytical tools. MW, SX, LL, and XT wrote the manuscript. All authors contributed to the article and approved the submitted version.This work was supported by Guangzhou Basic Research Program on People\u2019s Livelihood Science and Technology [202002020005] and Chinese 13th Five-Year National Science and Technology Major Project [2018ZX10302103-002 and 2018ZX10302104-001-007].The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Few studies have examined associations between neighborhood built environments (BE) and longitudinally measured cognition. We examined whether four BE characteristics were associated with six-year change in global cognition and processing speed. We obtained data on 1816 participants without dementia from the Multi-Ethnic Study of Atherosclerosis. BE measures included social destination density, walking destination density, proportion of land dedicated to retail, and network ratio (street connectivity). Global cognition was measured with the Cognitive Abilities Screening Instrument (CASI) and processing speed with the Digit Symbol Coding test (DSC). Multivariable random intercept logistic models tested associations between neighborhood BE at 2010\u20132012 and maintained/improved cognition (versus decline) from 2010\u20132018, and mediation by minutes of physical activity (PA)/week. The sample was an average of 67 years old (standard deviation = 8.2) (first cognitive measurement) and racially/ethnically diverse . Compared to individuals with no walking destinations in the 1-mile surrounding their residence, those with 716 walking destinations (maximum observed) were 1.24 times more likely to have maintain/improved DSC score . No other associations were observed between BE and cognition, and PA minutes/week did not mediate the association between walking destination density and DSC change. This study provides limited evidence for an association between greater neighborhood walking destinations and maintained/improved processing speed in older age and no evidence for associations between the other BE characteristics and cognition. Future studies with finer grained BE and cognitive measures and longer-term follow up may be required.  Approximately 15% of older adults (\u226565 years) experience mild cognitive impairment . HoweverNeighborhood built environments (BE), including streets, sidewalks, buildings, parks, and other human-made spaces/infrastructure, have been associated with health behaviors such as physical activity (PA) and health outcomes such as depression ,5,6,7. POne potential mechanism to explain these associations is that mixed land uses, green spaces, and greater street connectivity encourage neighborhood walking and thereby increased PA, which has been associated with better cognition and lower dementia risk ,13. In aStudies examining BE, cognitive decline, and dementia risk in older adults are limited ,22,23,24We obtained longitudinal data from the Multi-Ethnic Study of Atherosclerosis (MESA), a population-based cohort study of subclinical cardiovascular disease. This study only used de-identified data . MESA participants were enrolled in 2000\u20132002 from six US cities  and completed six in-person exams to date. At each exam, data are collected on demographics, medical history and health status, medications, anthropometry, self-reported PA, as well as a number of procedures and assessments . Details on MESA are found elsewhere . We restThe validated  CognitivDichotomous measures of cognitive change were of primary interest because we aimed to understand if the BE measures were associated with maintained or improved cognition over time specifically. Simply the maintenance of cognition over time may be of clinical significance among older adults because they often experience cognitive decline due to normal aging. The dichotomous measures of longitudinal change in CASI and DSC scores were calculated from continuous measures of annual change in scores from Exam 5 to 6. We ran unadjusted linear regression for each participant with cognitive score as the outcome and time as the predictor . Then, the dichotomous outcomes were derived by categorizing the resulting continuous measures as maintained/improved score  versus decline in score from Exam 5 to 6. Regression analyses focused on continuous cognitive outcomes were based on z-scores. Raw CASI and DSC scores were transformed into z-scores by subtracting from each participant\u2019s score the mean score of the sample and dividing the result by the standard deviation of the sample.Measures of social destination density, walking destination density, network ratio, and proportion of land dedicated to zoned retail (hereafter termed proportion retail), were previously developed in the MESA Neighborhood Study ,35. Part2 was calculated for each radial buffer. Measures based on \u00bd-mile radial buffers were used in this study. Appraisals of neighborhood safety walking and safety from crime were reported by participants on a 5-point scale (strongly agree to strongly disagree).We used a single measure of neighborhood socioeconomic status (SES) (by US Census tract) that was previously derived from a principal components analysis of seven US Census American Community Survey (2007\u20132011) variables: neighborhood median home value, percentage rental income, and median household income, as well as percentage of neighborhood residents with high school degrees, bachelor\u2019s degrees, annual household incomes >$50,000, and managerial occupations. Neighborhood population density was calculated for the radial buffers surrounding the participants\u2019 homes based on the 2010 Census block-level population density. Assuming an equal distribution of the population per block, the population/km2) calculations were based on height and weight measurements, and apolipoprotein E (APOE) genotype (genetic risk factor for Alzheimer\u2019s disease) was dichotomized into APOE \u03b54 carriers  and non-carriers.Participant demographics included age, sex, race/ethnicity, education, car ownership, and income. Self-reported health status/behaviors from Exam 5 included depressive symptoms , current smoker, diabetes mellitus, arthritis (any type), cardiovascular disease, cerebrovascular disease, and self-reported PA . Number of residential moves was available for the MESA follow-up period. Body mass index  for the demographics, health status/behaviors, cognitive test scores, and neighborhood/BE characteristics. Unadjusted and adjusted random intercept logistic regression models (accounting for clustering by US Census tract) determined associations between the BE variables and CASI and DSC score changes from Exam 5 to Exam 6. Separate regression models were run for each BE-cognitive test combination. We controlled for covariates known a priori or hypothesized to be associated with BE and/or cognition: age (Exam 5), sex, education, race/ethnicity, income, neighborhood SES, site, APOE \u03b54 carriers, appraisal of neighborhood safety and crime, arthritis, cardiovascular and cerebrovascular disease, diabetes, and number of residential moves.In sensitivity analyses, we re-ran the adjusted regression models described above while: (1) additionally controlling for car ownership, (2) replacing the dichotomous outcomes with continuous measures of cognitive change (z-scores) and employing adjusted random intercept linear regression (accounted for clustering by participant and US Census tract), and (3) replacing the dichotomous outcomes with measures of cognitive change based on three categories . The latter sensitivity analysis was performed to account for potential learning effects in repeating the same test after six years, which might result in maintained/improved scores over time for some individuals. In the final sensitivity analysis, we calculated propensity scores for the probability of inclusion in our analytic sample based on age, education, sex, income, race/ethnicity, marital status, site, and comorbidities . The propensity scores were incorporated into inverse probability weights that were applied to the logistic regression models to address potential selection/attrition bias.p < 0.05, the multivariable regression analyses were repeated in an exploratory analysis to assess mediation by total MET-minutes of PA/week using a causal steps approach [For BE-cognition associations with approach . We examRegression analyses were conducted using the \u201clme4\u201d package (\u201clm\u201d function) in R version 4.0.2.  No adjustments were made for multiple comparisons.2), 13% had possible depression, 29% had arthritis, and 8% had cardiovascular and/or cerebrovascular disease. Twenty-nine percent reported frequently walking places (\u22657 h/week). Seventy percent had no residential moves during MESA follow-up, 20% moved once, and 10% moved at least twice.The sample included 1816 participants . Mean agAt Exam 5, mean CASI scores were 90.0 (SD = 6.8) and DSC scores were 55.4 (SD = 16.8) . Maintaip < 0.10) were observed for greater walking destination density (per 100)  and greater proportion retail  and maintained/improved DSC score. Using the 1-mile buffers, greater walking destination density (per 100) was associated with maintained/improved DSC score   . Thus, cIn the first sensitivity analysis, additionally controlling for car ownership resulted in similar estimates to Total MET-minutes of PA/week was not a mediator of the association between walking destination density (1-mile buffer) and DSC score and was not associated with either measure (data not shown). Lastly, measures of average annual change in the BE characteristics from Exam 1 to 5 were not associated with the dichotomous measure of change in CASI or DSC scores from Exam 5 to 6 .Overall, this study provided little evidence for an association between the neighborhood BE and cognitive changes over time during late life see . The maiWe did not find associations for social destination density, network ratio, or proportion retail. Although preliminary, these results may suggest that destinations for conducting day-to-day transactions  and shopping may encourage visiting neighborhood destinations and help to maintain late-life cognition. Despite finding that PA was not a mediator, other studies found that it was associated with processing speed and mediated BE-cognition associations ,41. ObjeA cross-sectional study of older adults in Singapore found that land use mix and greater street connectivity were associated with better global cognition scores (Repeatable Battery for the Assessment of Neurocognitive Status) . AnotherTwo longitudinal studies examined associations between similar BE measures and cognitive decline. A study of cognitively normal older adults in Kansas (US) found associations between greater neighborhood street connectivity and slower two-year decline in attention and between greater street integration (fewer turns to get to destinations) and greater two-year decline in attention and verbal memory . Street The other longitudinal study of older adults in Chicago, Illinois (US), found presence of neighborhood community centers associated with slower decline in global cognition . PresencWe found that annual changes in BE exposures in the ten years preceding the cognitive assessments were not associated with longitudinal cognitive changes. This is possibly explained by the relative invariance of the BE measures over time. Larger changes over time would generally be expected for individuals moving to dramatically different neighborhoods . Over the MESA follow-up period, 70% of the sample did not move residences, and among the movers, the majority did not experience dramatic changes in their BEs following moves. This study was not designed to focus on the effects of residential moves on cognition, but instead on how differences and changes in BE exposures may affect cognition after controlling for the number of residential moves. However, future studies of individuals who move to dramatically different BEs, compared to those who do not move, may provide fruitful insights into BE-cognition associations. More refined measures of BE changes or more complex modeling of BE-cognition relationships may be warranted in future studies, particularly those including life course BE exposures. Comparisons of BE typologies  may help elucidate causal mechanisms and increase specificity of BE exposures associated with maintained/improved cognition. In addition, measures such as proportion retail will need refinement to include quantification of density and/or quality of retail establishments. Prior findings of moderate to high correlation between the BE measures and population density  precludeStudy strengths include a racially/ethnically-diverse, population-based cohort enrolled from six US cities. We examined longitudinal change in exposures and outcomes. The availability of extensive phenotyping in MESA allowed for consideration of PA as a mediator and important confounders such as neighborhood SES. In addition, we tested associations with \u00bd-mile and 1-mile neighborhood measures, to evaluate if associations remained consistent across varying neighborhood boundaries.Study limitations include lack of early- and mid-life BE measures and early-life SES measures beyond educational attainment, factors that may demonstrate stronger associations with cognition than late-life measures. Data were not available on other cognitive domains that may be associated with BE exposures, such as attention and visuospatial function. The self-reported PA measures may not adequately reflect actual PA, and objective measures obtained through devices such as accelerometers may result in different mediation findings. The association between walking destination density and processing speed may have resulted from multiple testing, and the observed association only applied to the dichotomous processing speed measure, not the continuous or three-category measures. Thus, the study findings are tentative and need replication in other cohorts. Time spent in the neighborhood environment was not available, and we were not able to account for self-selection into neighborhoods that may affect associations, such that individuals with lower risk for cognitive decline move to neighborhoods with more walking/retail destinations. Additionally, we did not capture BE exposure outside of the neighborhood, therefore, the BE measures do not represent overall BE exposures. Lastly, study findings may not be generalizable to other US regions or groups.In this study, we investigated associations between neighborhood measures of land use mix and destination accessibility and late-life changes in global cognition and processing speed. Greater walking destination density was associated with maintained/improved processing speed over time, but no other BE measures were associated with cognitive change. Based on our findings and the extant literature, evidence is not yet conclusive to support community interventions for increased land use mix/destination accessibility to help maintain cognitive health in older age. Future studies with finer grained BE and cognitive measures and longer-term follow up may be required."}
+{"text": "The incidence of endometrial cancer is rising in parallel with the obesity epidemic. Obesity increases endometrial cancer risk and weight loss is protective, but the underlying mechanisms are incompletely understood. We hypothesise that the immune microenvironment may influence susceptibility to malignant transformation in the endometrium. The aim of this study was to measure the impact of obesity and weight loss on the immunological landscape of the endometrium.2) undergoing bariatric surgery or medically-supervised low-calorie diet. We collected blood and endometrial samples at baseline, and two and 12 months after weight loss intervention. Serum was analysed for inflammatory markers CRP, IL-6 and TNF-\u03b1. Multiplex immunofluorescence was used to simultaneously identify cells positive for immune markers CD68, CD56, CD3, CD8, FOXP3 and PD-1 in formalin-fixed paraffin-embedded endometrial tissue sections. Kruskal\u2013Wallis tests were used to determine whether changes in inflammatory and immune biomarkers were associated with weight loss.We conducted a prospective cohort study of women with class III obesity  than low-calorie diet . There were significant reductions in serum CRP  and IL-6 , but not TNF-\u03b1 levels, with weight loss. Tissue immune cell densities were unchanged except for CD8+\u2009cells, which increased significantly with weight loss . Tissue CD3+\u2009cell density correlated negatively with systemic IL-6 levels .Forty-three women with matched serum and tissue samples at all three time points were included in the analysis. Their median age and BMI were 44 years and 52\u2009kg/mWeight loss is associated with reduced systemic inflammation and a recruitment of protective immune cell types to the endometrium, supporting the concept that immune surveillance may play a role in endometrial cancer prevention. Median BMI was 53\u2009kg/m2 and 47.1\u2009kg/m2 at baseline, 45\u2009kg/m2 (p\u2009=\u20090.0002) and 46.7\u2009kg/m2 (p\u2009=\u20090.936) at 2 months and 35\u2009kg/m2 (p\u2009<\u20090.0001) and 43.6\u2009kg/m2 (p\u2009=\u20090.201) at 12 months in women undergoing bariatric surgery and low-calorie diet, respectively.From a total cohort of 80 participants, 43 had matched serum and tissue samples at baseline, and 2 months and 12 months after weight loss intervention and were included in this study. Their median age and BMI at baseline were 44 years (range 24\u201360 years) and 52\u2009kg/mescribed . Median p\u2009=\u20090.0086) compared to baseline  and BMI reduction   and 12 months (p\u2009<\u20090.00001) compared to baseline  and BMI reduction   and BMI    Table . No signObesity increases endometrial cancer risk and weight loss is protective, but the underlying mechanisms are incompletely understood. Here, multiplex fluorescence immunohistochemistry was used to quantify and phenotype immune cells in the endometrium before and after weight loss in women with class III obesity. There was a significant rise in CD8+\u2009immune cell density at 2 and 12 months that correlated with weight loss. We also found significant reductions in systemic inflammatory markers CRP and IL-6 with weight loss, the latter inversely correlated with CD3+\u2009immune cell density in the endometrium. Taken together, these findings indicate that the immunological landscape of the endometrium may be affected by obesity and weight loss, and by extension, that the immune microenvironment may influence susceptibility to neoplastic change.Previous work has shown a strong positive correlation between serum levels of pro-inflammatory cytokines and adipokines and endometrial cancer risk . In a prHere, we show convincing evidence of a change in the immunological landscape of morphologically normal endometrium in women with class III obesity who undergo significant weight loss. The reduction in systemic inflammation that accompanies weight loss is associated with a recruitment of protective immune cell types to the endometrium, in particular CD8+\u2009cytotoxic T cells. This is consistent with previous work comparing circulating immune cell populations in obese and lean study participants that found higher CD8+\u2009T cell counts in lean individuals . CD8+\u2009T-This is the first study, to our knowledge, that compares immune biomarkers in serum and endometrial tissue before and after weight loss in women with class III obesity. Serial measurements across three time points add to the strength of the findings and distinguish short- and long-term effects of weight loss. It is interesting that changes to blood and tissue immune biomarkers were observed as early as 2 months after weight loss intervention, before the majority of excess body weight had been shed. Changes to the immune microenvironment coincided with the natural clearance of atypical hyperplasia in 3/6 women with occult endometrial abnormalities at baseline, indicating their potential role in the restoration of endometrial health. Indeed, resolution of 5/6 endometrial abnormalities occurred by 6 months post-bariatric surgery, before women had achieved a healthy body weight. Immune cell infiltrates vary with menstrual cycle phase and menopausal status , and thiA limitation of our work is the relatively small sample set; however, it derives from a larger cohort of 80 participants and highlights the challenge of longitudinal studies involving sequential invasive sampling. We were unable to control for potential confounding factors, particularly age and menopausal status, and the numbers were too small to allow subgroup analysis by weight loss intervention. Although interesting, our findings are correlative and their significance is uncertain. We were limited by the number of fluorophores we could multiplex in one experiment, precluding the detailed phenotyping of immune cell sub-populations, for example M1 and M2 macrophages. Endometrial recruitment of protective M2 macrophages with weight loss may have been masked by the simultaneous loss of pro-inflammatory M1 macrophages, for instance, and our study design did not allow these cellular sub-populations to be differentiated from each other. Other immune cells may also be important in regulating endometrial health and more research is needed.If validated in larger studies, the insights provided here could have important clinical implications. Immune biomarkers could enable individualised endometrial cancer risk prediction and also measure the success of risk-reducing interventions. Research could be directed towards encouraging recruitment of protective immune cells to the endometrium to boost the natural clearance of precursor and precancerous lesions. We urgently need innovative solutions to avert the impending surge of endometrial cancer diagnoses predicted by the escalating global obesity problem.Supplemental Material"}
+{"text": "Pet ownership has been associated with positive outcomes in many populations, yetthe associations with physical and psychological wellbeing in people withdementia remain unclear. The current study used baseline data from 1,542 peopleliving at home with mild-to-moderate dementia from the Improving the experienceof Dementia and Enhancing Active Life (IDEAL) programme. Regression analysesinvestigated associations of pet ownership and pet care with self-reports ofwalking, loneliness, depression, and quality of life (QoL). After adjusting forcovariates, having any pet was associated with higher likelihood of walking over3 hr in the last week. Those with a dog and who were involved in its care wereless likely to be lonely than those with no dog. Having any pet but noinvolvement in its care was associated with increased depression and decreasedQoL compared with those without a pet. The key factor in the associations wasinvolvement in the care of the pet by the person with dementia. In the United Kingdom there are approximately 850,000 people living with dementia,around two thirds of whom reside at home . In the Within the general U.K. adult population, 49% of people own a pet . It has It is unclear from existing research how pet ownership may affect those living withdementia. For those with cognitive impairments, pets may provide nonjudgementalinteractions that are reassuring, but pet ownership or pet care may also place aburden on the person with dementia. Identifying the benefits and difficulties of petownership in people living with dementia could help when making difficult decisionsaround pet ownership and inform future interventions. The majority of research inthis area involving people with dementia has examined Animal-Assisted Interventions(AAI). AAI are interventions that are characterized by an interaction with a trainedanimal, generally in a controlled environment .For exaWe identified only one published study that sought to investigate the role of pets inthe lives of people living with dementia as part of a larger American interventionstudy for female spouses of men with dementia. To summarize, previous research with wider society has shown that having a pet andbeing involved in caring for it is associated with greater physical activity, bettercardiovascular health, less depression and loneliness, and better QoL . MeanwhiThe current study utilized baseline data from the IDEAL programme; a longitudinalcohort study of people with dementia and carers. Details of the aims andprocedures can be found in the programme protocols .The IDEAt baseline the IDEAL cohort comprised 1,547 people with dementia and 1,283carers. Our article focuses on the views of people with dementia. Inclusioncriteria were a clinical diagnosis of dementia (any subtype) and a Mini-MentalState Examination MMSE;  score ofPet ownership was assessed through several questions. Participants were asked ifthey had no pets, one pet, or more than one pet. If they had a pet, they wereasked to specify the type of animal(s); questions were adapted from Physical activity was assessed with a single question about how much walking theparticipant had done in the previous week, taken from the General PracticePhysical Activity Questionnaire GPPAQ; . Tomatcn = 75) in the IDEAL cohort  and incorporatesmultiple aspects of life including financial situation, relationships, healthstatus, and mood. Scores were summed to provide a total ranging from 13 to 52with higher scores indicating more positive ratings of QoL. The scale has goodreliability (Cronbach\u2019s \u03b1 = .84 to .88) and good test\u2013retest reliability versus non-Alzheimer\u2019s dementia(non-AD), functional ability, living situation .t tests, chi-square, Spearman\u2019s rho correlations oranalysis of variance (ANOVA) as appropriate to the type of data, conditionalupon test assumptions being met. As previous AAI research has focused on dogs,this study considered first pet ownership in general , andsecond dog ownership specifically, before considering the interactions of petand dog ownership with involvement in the care of the pet as potentialpredictors. Multiple generalized linear and binary regressions were thenconducted, adjusting for key characteristics that were significantly associatedwith each outcome. Separate regressions were conducted for each key predictor:pet versus no pet, dog versus no dog, having a pet and involvement in its careor having a pet and no involvement in its care versus no pet, and finally havinga dog and involvement in its care or having a dog and no involvement in its careversus no dog. Holm\u2013Bonferroni corrections for multiple comparisons were appliedto all analyses.Data were analyzed using IBM SPSS v25. The number of participants varies byanalyses due to variations in the level of missing data, with sample sizenumbers indicated for each analysis in the results. Associations between keycharacteristics  and the outcomes of interest were assessed withn = 1,075; 69.7%) responded thatthey did not have any pets, while the remaining 467 (30.3%) participants respondedthat they had at least one pet. The most prevalent type of animal was a dog followed by a cat , with 80 participants (5.2%) having a different type of animal, as well as orinstead of a dog or cat. Other kinds of animal were horses (n = 5),fish (n = 22), birds (n = 39), guinea pigs(n = 4), tortoises (n = 4), hamsters(n = 1), rabbits (n = 3), ferrets(n = 1), and various reptiles (n = 6). Ofthose with pets, 330 (70.7% of those with pets) were involved in the care of theiranimal, with 195 participants (41.8% of those with pets) involved in the care of adog specifically. Of the 1,547 people with dementia in the baseline IDEAL cohort 1,542 answered the petquestions; however, not all participants had data for all other included variables.The majority of the participants . Those with a dogwere 1.8 times more likely to walk for over 3 hr per week compared with thosewithout a dog . Thosewith a pet who were involved in its care were 1.8 times more likely to walk forover 3 hr per week compared with those without a pet . Those with a dog who were involved in itscare were 2.5 times more likely to walk for over 3 hr per week in comparisonwith those without a dog . There was no difference in the amount of walking between those with a petor dog with no involvement in the animal\u2019s care and those with no pet ordog.Age, gender, type of dementia, functional ability, living situation, andcognitive function were significantly associated with physical activity and wereadjusted for in the following analyses. Those with pets were 1.4 times morelikely to walk for over 3 hr per week compared with those without a pet. There was nodifference in loneliness in the adjusted models between those with and without apet, those with a dog, or those with no involvement in the pet\u2019s care.Age, living situation, and functional ability were significantly associated withloneliness and were adjusted for in the following analyses. Those who had a dogand were involved in its care were 35% less likely to be lonely than those whohad no dog .Similarly, those with a dog who were not involved in the dog\u2019s care were 2.2times more likely to be depressed than those with no dog . There was no difference in depression levelsin the adjusted models between those with and without a pet, those with a dog,or those involved in the pet\u2019s care.Type of dementia and functional ability were significantly associated withdepression and were adjusted for in the following analyses. Those with a pet whowere not involved in its care were 1.8 times more likely to be depressed thanthose with no pet . Similarly, having a dog but with no involvement in the dog\u2019s care wasassociated with a 2.13 point decrease in QoL score in comparison with having nodog . There was nosignificant difference in QoL scores in the adjusted models for those with orwithout a pet, those with a dog, or those involved in the pet\u2019s care.Age, type of dementia, and functional ability were significantly associated withQoL and were adjusted for in the following analyses. Having a pet but noinvolvement in its care was associated with a 1.58 point decrease in QoL scorein comparison with having no pet (This is the first study to our knowledge that has quantitatively investigatedassociations of self-reported pet ownership and pet care with loneliness, physicalactivity, depression, and QoL in a large cohort of people living with dementia. Theresults indicate that the associations are complex and are likely to be influencedby more than just pet ownership; the involvement of the person with dementia in thecare of the animal was a key factor in the associations. After adjustment forcovariates, physical activity was the only outcome associated with pet ownershipwithout considering involvement in care for the pet. Those who had a pet of any kindand specifically a dog were significantly more likely to walk over 3 hr per weekthan those with no animal; the associations were stronger when care for the animalwas included, suggesting that being actively involved in caring for an animal is animportant aspect of the benefits of pet ownership for people living with dementia.In regards to loneliness, the only significant association was for those with a dogand who were involved in its care; this group were significantly less likely to belonely than those with no pet. In contrast, the only significant associations fordepression and QoL were in those with a pet, or specifically a dog, and were notinvolved in its care; this group were significantly more likely to have depressionand lower QoL scores than those with no pet. This finding and the lack of directassociations between pet ownership on its own and depression or QoL suggests theremay be something specific about having involvement in the care of the animal.Previous research conducted with the wider population has generally found morepositive and direct physical and psychological outcomes associated with petownership than were found here e.g., .This isThere may be a number of other variables not considered here that explain theassociation between having a pet but no involvement in its care and a significantlyhigher likelihood of having depression or reduced QoL. The analyses for theseoutcomes were adjusted for functional ability so there may be more to theassociation than whether or not the person is able to help with the care of a pet.It is possible that \u201cdepressive realism\u201d  may be aThere may be a complex interplay between the positive and negative aspects of petownership described above, which could result in minimal associations in such alarge sample as this cohort study. In addition, there are some limitations to thisstudy that should be considered. As the IDEAL programme has a wide scope, to avoidover-burdening participants and due to practical constraints, only a limited numberof questions relating to pet ownership were included. For example, the physicalactivity question was limited to walking, whereas pets may also reduce othernonsedentary activity. There are also other aspects of pet ownership that are likelyto be important, such as the amount of time the person with dementia spendsinteracting with the pet, which were not investigated as part of this study; itshould be noted that caring for a pet is different from the bond that a person haswith his or her pet, a person with dementia may have a strong bond with his or herpet but be unable to care for it. Moreover, we cannot infer the direction of anyassociations. It is possible that those who walk more are more likely to get a petand specifically a dog, or people may get a pet in response to their depression orloneliness e.g., . Future Despite some limitations, this study represents an important first step in providinggeneralizable evidence as to the associations between pet ownership and physicalactivity, loneliness, depression, and QoL in people with dementia. Pet ownership,and specifically dog ownership, is associated with higher levels of walking, withstronger associations when the person is also involved in the care of the animal.Having a dog and being involved in its care is associated with lower likelihood ofbeing lonely, while having a pet and not being involved in its care is associatedwith higher depression and lower QoL. This may indicate something distinctive aboutthe characteristics or environments of those who have a pet but have no involvementin its care. The IDEAL programme will allow for continued follow-up of the cohort,making it possible to identify those who may most benefit from pet ownership, andany longer-term positive and negative outcomes for pet owners. Focused qualitativeresearch is also needed to help specify the potential benefits and difficulties ofhaving a pet for community-dwelling people with mild-to-moderate dementia."}
+{"text": "The daily practice of physical exercise and a balanced diet are recommended to prevent metabolic syndrome (MetS). As MetS is a multifactorial disorder associated with the development of serious diseases, the advancement of comprehensive biomarkers could aid in an accurate diagnosis. In this regard, it is known that gut microbiota is altered in MetS, and especially, lipid metabolites species are highly modified, thus emerging as potential biomarkers. In preliminary studies, we observed that alterations in serum lysoglycerophospholipids (Lyso-PLs) were shared between animals with diet-induced MetS and those performing resistance exercises assiduously. Therefore, our objective was the targeted determination of the lysophospholipidome in young rats fed a standard (ST) or a cafeteria diet (CAF) and submitted to different training intensities to evaluate its potential as a biomarker of a detrimental lifestyle. Targeted metabolomics focused on lysophosphatidylcholines (Lyso-PCs) and lysophosphatidylethanolamines (Lyso-PEs) and multivariate statistics were used to achieve an integral understanding. Chronic intake of CAF altered the serological levels of both lipid subclasses. Twenty-two Lyso-PLs were significantly altered by CAF, from which we selected Lyso-PCs (14:0), (17:1) and (20:2) and Lyso-PEs (18:2) and (18:3) as they were enough to achieve an optimal prediction. The main effect of physical training was decreased Lyso-PEs levels with disparities among training intensities for each diet. We concluded that an examination of the lysophospholipidome reveals the general state of the metabolome in young female rats, especially due to intake of an MetS-inducing diet, thus highlighting the importance of this family of compounds in lipid disorders. Metabolic syndrome (MetS) represents a serious public health problem due to its increasing prevalence, which can reach around 80% in some regions . The incIn previous studies, we have observed that feeding with a highly palatable cafeteria diet (CAF) induces a profound impact on the gut microbiota profile ,9 as welTherefore, the main objective of the present investigation was the detailed evaluation of Lyso-PL levels in the serum of young rats fed standard chow (ST) or CAF and submitted to different intensities of aerobic training performed voluntarily on a treadmill without inclination. Thus, we aimed to assess the potential of Lyso-PLs as circulating biomarkers of lipid disorders in youth by using a targeted metabolomics analysis.As we have previously published, a CAF diet for 8 weeks triggered the development of MetS in animals . In partBased on the comparison of the six groups by two-way ANOVA, the lifestyle intervention induced significant modifications in the levels of the majority of Lyso-PLs , specifip < 0.050, two-way ANOVA). Along with diet, the levels of Lyso-PEs (18:1) and (20:4) were affected by exercise. The use of the treadmill counteracted the high levels induced by CAF intake, mainly in the group that was running at low speed (TML-CAF), in which significant differences in the levels of both metabolites were observed compared to the CON-CAF group . No significant changes in these Lyso-PEs were found among ST-fed groups. In fact, Lyso-PEs (16:1) and (20:4) were also significantly affected by the interaction of the two experimental factors. Instead, Lyso-PC (16:0) was exclusively influenced by exercise, which led to a general decrease in the circulating levels of animals fed both diets. According to the post hoc analysis, other decreases in Lyso-PL levels as a consequence of exercise were detected in Lyso-PEs (16:0), (18:0) and (22:6) and, curiously, were also found between CON-CAF and TML-CAF groups.On the other hand, the effect of physical training was prevalent in Lyso-PEs, influencing the levels of almost half of the molecular species, while only 10% of the Lyso-PCs were altered  > Lyso-PC (20:2) > Lyso-PC (14:0) > Lyso-PC (17:1) > Lyso-PE (18:2) D. The seOnce the prevalent effect of diet was determined, we proceeded to examine the influence of physical exercise on the Lyso-PL-related metabolome .p = 0.001, two-way ANOVA) with general behavior similar to that described above for individual Lyso-PEs . Based on the individual scores plot of ST , (17:1) and (20:2) and the Lyso-PEs (18:2) and (18:3) may have great potential as key biomarkers of metabolic disorders.The animal protocol was approved by the Generalitat de Catalunya. All of the procedures were performed following the \u201cPrinciples of Laboratory Animal Care\u201d and according to the European Communities Council Directive regarding the protection of experimental animals (86/609/EEC).n = 9\u201312 per group) with comparable body weights. The selection of female animals was based on our previous studies in which female animals were more active in the voluntary wheel running and presented higher tolerance to physical training intensities compared to males [g, 15 min, 4 \u00b0C). Samples were conserved at \u221280 \u00b0C until metabolite extraction and LC-MS/MS analysis. Body weight, food intake and biometric parameters of these animals can be seen in our previous publications [The experimental animals were the same as those used in our previous work . Brieflyto males . An outlications ,11.The mobile phases used for the chromatographic separation of Lyso-PLs were prepared with methanol (MeOH) , acetonitrile , isopropanol and 7.5 M ammonium acetate solution . All of these were of the highest grade commercially available. Ultrapure water was obtained from a Milli-Q advantage A10 system .The standards using in the LC-MS/MS analysis of Lyso-PLs were 1-tridecanoyl-sn-glycero-3-phosphocoline, Lyso-PC (13:0); 1-palmitoyl-sn-glycero-3-phosphocoline, Lyso-PC (16:0); 1-stearoyl-sn-glycero-3-phosphocoline, Lyso-PC (18:0); 1-arachidoyl-sn-glycero-3-phosphocoline, Lyso-PC (20:0); 1-palmitoyl-sn-glycero-3-phosphoethanolamine, Lyso-PE (16:0); 1-stearoyl-sn-glycero-3-phosphoethanolamine, Lyso-PE (18:0); and 1-oleoyl-sn-glycero-3-phosphoethanolamine, Lyso-PE (18:1). All of these were over 99% purity and were purchased from Avanti Polar Lipids . A solution containing chloroform  was used for the dilution of standards.Butylated hydroxytoluene  was added to MeOH to avoid metabolite oxidation during sample extraction.v/v/v) at 2 mg/mL and preserved in dark-glass vials at \u221220 \u00b0C. The day of the LC-MS/MS analysis, mixed standard solutions with concentrations of 1, 10 and 100 mg/L were prepared using MeOH. Similar to the calibrators, Lyso-PC (13:0) was handled separately to be used as internal standard (IS).Lyso-PLs were individually dissolved in MeOH/chloroform/water (65:35:8 v/v/v) in the presence of the IS. The concentration of the calibrators ranged from 0 to 5 mg/L, whereas the IS was added at a final concentration of 500 or 360 \u00b5g/L depending on the procedure of extraction. The preparations were extracted and subsequently analyzed by using the same procedure as the serum samples. The calibration curves were finally generated for each standard by plotting the peak abundance ratios  versus the concentration ratios  and fitting to a linear regression. The calibration curves were prepared by the addition of increasing amounts of the standard mixtures to constant final volumes of water/isopropanol/acetonitrile  extraction. The second procedure assisted in the determination of serum Lyso-PEs and starts with a greater volume (50 \u00b5L) of sample, so it was called the \u201cHigh sample volume\u201d (HSV) method. v/v/v/v) as solvent A and isopropanol/acetonitrile/500 mM ammonium acetate (50:49:1 v/v/v) as solvent B. Each sample (2 \u00b5L) was loaded into a 0.3 mL/min flow of 30% B passing through a reversed-phase column (Acquity UPLC BEH C8) with a particle size of 1.7 \u00b5m and 2.1 mm internal diameter \u00d7150 mm length . After that, the analytes eluted along a continuous gradient to 75% B over 20 min. A pool of samples was used as quality control in order to monitor and control the analysis.In order to cover all the Lyso-PLs contained in the samples, a specific UHPLC- + ESI-MS/MS analysis was developed and validated using a set of samples from this study. Details and results from this validation are shown in our previous publication . The chrThe tandem mass spectrometer analysis was achieved through positive electrospray ionization (+ESI) performed within a QqQ 6490, also from Agilent Technologies. The ionization source parameters were as follows: nebulizer gas (nitrogen) pressure, 25 psi; gas flow, 12 L/min at 240 \u00b0C; sheath gas flow, 12 L/min at 350 \u00b0C; capillary and nozzle voltages, 4.5 kV and 500 V, respectively; and fragmentor and cell accelerator voltages, 380 and 5 V, respectively. The selected scan mode was dynamic multiple reaction monitoring (MRM). Information about the transitions and optimal collision energies used for UHPLC- + ESI-MS/MS analysis is provided in p < 0.05 was considered statistically significant. The univariate statistical analysis was performed with the Statistical Package for Social Sciences IBM Corp. Released 2010. IBM SPSS Statistics for Windows, Version 19.0. Armonk, NY, USA: IBM Corp.The results are presented as the means \u00b1 standard errors (SEM) based on the indicated number of rats. The Shapiro\u2013Wilk test was used for the assessment of the normality of the data. After that, differences among the six groups of rats were determined using two and one-way ANOVA. First, analysis based on two-way ANOVA was used to evaluate the main effects of the diet and the physical exercise and their interaction. When any of the effects was statistically significant, one-way ANOVA was used to determine the differences among means. The homoscedasticity between groups was assessed using Levene\u2019s test. Tukey\u2019s post hoc contrast was applied when the variances were similar, whereas Dunnett\u2019s T3 post hoc contrast was applied if this assumption was not fulfilled. A two-tailed value of A multivariate statistical evaluation based on a combination of principal components analysis (PCA), partial least squares discriminant analysis (PLS-DA) and hierarchical clustering analysis was performed to determine the influence of diet and physical exercise on the Lyso-PL-related metabolome. Receiver operating characteristic (ROC) curves by the \u201cleave one out\u201d approach, permutation tests and random forest classification were also conducted to validate the multivariate biomarker. All analyses were performed after range scaling with the use of the software MetaboAnalyst (version 3.0) available online ."}
+{"text": "Lmna deletion develop cardiac failure and die within 3\u20134 weeks after inducing the mutation. When the same Lmna mutations are induced in mice genetically deficient in the LINC complex protein SUN1, life is extended to more than one year. Disruption of SUN1\u2019s function is also accomplished by transducing and expressing a dominant-negative SUN1 miniprotein in Lmna deficient cardiomyocytes, using the cardiotrophic Adeno Associated Viral Vector 9. The SUN1 miniprotein disrupts binding between the endogenous LINC complex SUN and KASH domains, displacing the cardiomyocyte KASH complexes from the nuclear periphery, resulting in at least a fivefold extension in lifespan. Cardiomyocyte-specific expression of the SUN1 miniprotein prevents cardiomyopathy progression, potentially avoiding the necessity of developing a specific therapeutic tailored to treating each different LMNA cardiomyopathy-inducing mutation of which there are more than 450.Mutations in the LaminA gene are a common cause of monogenic dilated cardiomyopathy. Here we show that mice with a cardiomyocyte-specific  Mutations in the LaminA gene are the second most common inherited cause of Dilated Cardiomyopathy, a major form of heart failure. Here the authors show that disruption of the nuclear protein SUN1 in cardiomyocytes, by AAV mediated transduction of a SUN1 inhibitor, significantly suppress cardiomyopathy progression, providing a potential therapeutic route to treat this disease. The causes of DCM are varied but include various extrinsic factors . However, 30\u201340% of all cases have a monogenic basis, with mutations in some 40 genes being linked to DCM. The most frequently mutated gene in DCM is TTN, which encodes the giant sarcomeric protein titin, with truncating variants in TTN resulting in almost 15\u201325% of all congenital forms of DCM4. The second most frequently mutated gene is Lamin A (LMNA) and accounts for as many as 6\u20138% of congenital DCM patients4.Dilated Cardiomyopathy (DCM) is the most common disease affecting heart muscle, accounting for ~60% of all cardiomyopathies. It is characterized by reduced systolic (contractile) function due to enlargement and thinning of the left ventricular wall. In some cases, both ventricles are affected. DCM often results in sudden heart failure and cardiac death, resulting in high hospital admission rates, the need for heart transplantation, and consequently a high-cost burdenLMNA-induced DCM is characterized by cardiac conduction defects, manifested by electrophysiological abnormalities, including atrioventricular block, ventricular arrhythmias, and fibrillation. The risk of sudden cardiac death is more significant in patients with LMNA-cardiomyopathy than patients with other forms of DCM5. Some 450 different dominant missense mutations have been identified in the LMNA gene that are linked to DCM. This diversity of mutations complicates genetic approaches to treating LMNA-induced DCM. To a limited extent, LMNA-linked DCM can be treated by fitting a pacemaker. Ultimately, effective treatment is accomplished by heart transplantation7.Lmna mutations die within a few weeks after birth11. The cause of their early death is uncertain due to multiple tissues being affected. However, cardiac myopathy is considered to be a significant factor, as many Lmna mutant mice develop DCM with conduction abnormalities with focal myocyte degeneration12. Mice, therefore, provide a valuable model to determine the underlying molecular pathology of DCM.Mice carrying LMNA. In addition, two B-type lamins (LMNB 1 and 2) are encoded by separate genes, LMNB1 and LMNB213. The lamina provides structural and mechanical integrity to the nucleus, maintains nuclear shape, and contributes to nuclear positioning within the cell. In addition, the lamina is a critical determinant of chromatin organization14, through the provision of binding sites at the nuclear periphery for higher-order chromatin domains. The lamins interact with numerous INM proteins, including Emerin, the Lamina-Associated Polypeptides (LAPs), and the SUN domain proteins15, many of which are either mutated or present as a variant linked to heart disease17. Together these proteins comprise an integrated protein network, centered on the lamina, where loss or mutation of the lamins can result in either the mislocalization or a change in their expression levels 20. Among the proteins, whose expression is altered by the loss or mutation of Lmna are SUN1 and LAP2\u03b1, whose levels increase. Genetic reduction of the levels of either protein, particularly SUN1, significantly ameliorates much of the pathology observed in mice with Lmna mutations, so increasing longevity19. Whether this is a consequence of SUN1 toxicity due to elevated expression levels versus elimination of a SUN1 function that exacerbates the effects of Lmna deficiency is uncertain.The lamins are nuclear intermediate filament proteins and are the principal constituents of the nuclear lamina, the proteinaceous matrix underlying the inner nuclear membrane (INM). The lamina is composed of the A-type lamins, consisting of 2 predominant forms, lamins A and lamin C, derived by alternate splicing of 21. In mammals, SUN1 and SUN2 are the two principal SUN proteins widely expressed in virtually all tissues. In the perinuclear space, between the INM and outer nuclear membrane (ONM), the C-termini of either SUN1 or 2 binds to the C-termini (KASH domains) of the different Nesprins/SYNE/KASH proteins that traverse the ONM. Together, these two families of proteins comprise the LINC complexes, which physically couple interphase nuclei to the cytoskeleton23. The N-termini of the SUN domain proteins protrude into the nucleoplasm. With SUN1, this region interacts with pre-laminA and nuclear pore complexes, as well as other nucleoplasmic/NE proteins such as DROSHA24. With the Nesprins/KASH-domain proteins, their large N-terminal domains extend into the cytoplasm adjacent to the ONM. Depending on the particular Nesprin/KASH protein, the Nesprins interact directly or indirectly with the three cytoskeletal protein networks 25. Consequently, the LINC complex establishes a direct physical connection between the cytoplasmic cytoskeletal networks  and the interphase nuclear interior or nucleoplasm. The LINC complex mediates force transmission between the nucleus and cytoskeleton, resulting in changes in gene expression/chromatin organization in response to mechanical/physical stimuli28. Although the loss of either SUN1 or SUN2 alone has no overt effect on postnatal growth and longevity, SUN1 null mice are both infertile and deaf. However, simultaneous loss of SUN1 and SUN2 results in perinatal lethality, indicating some degree of redundancy29, at least during embryogenesis.The SUN  proteins share a conserved C-terminal SUN domain and localize to the INMLMNA mutations, AAV mediated delivery of a DN-SUN1 to CMs may be of therapeutic benefit to patients with LMNA associated DCM.Here we show that in mice that develop Lmna-induced DCM, disruption of the LINC complex, by either genetic ablation or by delivery of a Dominantly Negative acting Sun1 miniprotein (DNSUN1) that destabilizes the LINC complex, significantly ameliorates DCM progression, and leads to at least a fivefold increase in longevity. We demonstrate that disruption of the LINC complex in individuals carrying Lmna loss to postnatal pathology in mice, we specifically ablated the Lmna gene in specific tissues by using a floxed conditional LmnaF/F line of mice that, when recombined by Cre activation, results in the complete loss of LaminA/C protein as previously described14. If the LmnaF/F is constitutively deleted in all tissues by crossing the LmnaF/F mice with Zp3-Cre mice30, the mean postnatal lifespan is 17.5 days , contributes to the early postnatal death of Lmna\u2206/\u2206 mice and what consequences the same tissue-specific loss of Lmna would have on a Sun1 null background. We crossed the LmnaF/F to \u03b1Myh6-Cre31 mice, in which constitutive Cre expression commences during embryogenesis but is restricted to CMs. These mice survived slightly longer than the Lmna\u2206/\u2206 for an average of 26.5 days postnatally  (abbreviated to mcm) in which Cre is induced in CMs by a single injection of tamoxifen (Tmx)32. The average lifespan of 1\u20135 month-old LmnaF/F:mcm mice, following Cre induction, was 27 days .To further define the consequences of ays Fig.\u00a0. When thity Fig.\u00a0. Performlly Fig.\u00a0. The samrth Fig.\u00a0, revealiys Figs.\u00a0, 2A. LmnLMNA-induced DCM result from missense mutations, we determined what effect loss of SUN1 had on the longevity and cardiac function of a previously described Lmna mutant mouse line, carrying the N195K missense mutation, in which early death is a consequence of heart failure12. This mutation has been identified in at least two unrelated patients diagnosed with DCM34. Here too, we found that the absence of SUN1 significantly increased the lifespan of this mutant line and improved cardiac function  resulted in the cardiomyocyte-specific deletion of the WT floxed Lmna allele rendering the CMs hemizygous for the N195K mutation, i.e., LmnaN195K/\u2013. These mice had a mean lifespan of fewer than 50 days, a lifespan half that of the original LmnaN195K/N195K homozygotes    Fig.\u00a0. Histolorts Fig.\u00a0. Signifiols Fig.\u00a0, with maols Fig.\u00a0. The lefged Fig.\u00a0. There wols Fig.\u00a0, togethe98) Fig.\u00a0. Increasols Fig.\u00a0. HoweverLmnaN195K/F:mcm mice, echocardiograms after Cre induction revealed progressive worsening of cardiac contractility in the LmnaN195K/F:mcmSun1+/+ mice compared to LmnaN195K/F:mcmSun1\u2212/\u2212 mice  compared to LmnaF/F:mcm/Sun1+/+ controls  compared to controls, whereas slight fibrosis was evident in the LmnaF/F:mcm/Sun1\u2212/\u2212 hearts  was evident in the rts Fig.\u00a0. The LmnLmnaF/F:mcm/Sun1+/++Tmx papillary muscle (P\u2009=\u20090.0028) when compared with LmnaF/F:mcm/Sun1+/+ controls. In the absence of SUN1, LmnaF/F:mcm/Sun1\u2212/\u2212\u2009+\u2009Tmx cardiac papillary active force was maintained at levels that did not differ significantly from those of controls  and LmnaF/F:mcm/Sun1\u2212/\u2212 +Tmx mice  to transduce and specifically express in CMs, a dominant-negative SUN1 minigene whose protein product would compete with SUN1-KASH binding in the CM perinuclear space22  epitope. To localize the resulting protein product to both the lumen of the endoplasmic reticulum (ER) and perinuclear space (between the INM and ONM-PNS), the signal sequence, and signal peptidase cleavage site of human serum albumin was fused to the N terminus of HA-Sun1L to yield SS\u2013HA-SUN1L. To prevent the secretion of the miniprotein from the ER-PNS, a KDEL tetrapeptide was linked to the C- terminus of SS\u2013HA-Sun1L, forming SS\u2013HA-SUN1L\u2013KDEL22  competes with endogenous SUN1, thereby displacing KASH-domain proteins from NE-associated LINC complexes, is presented in Fig.\u00a0These results demonstrate that genetic ablation of SUN1 functionality or reduced possibly toxic SUN1 levels could be of therapeutic value in treating DCM. Consequently, our next goal was to determine whether the beneficiary effects of SUN1 loss were due to the complete elimination of SUN1\u2019s functions, including interactions involving its nucleoplasmic domain, versus specific disruption of its LINC complex-associated role. In the latter, SUN1 functions as an anchor for KASH-domain proteins in the ONM, and mediate the tethering of the nucleus to components of the cytoskeleton, with the microtubular network, preferentially interacting with SUN1-KASH LINC complexese22 Fig.\u00a0. InitialL22 Fig.\u00a0. The sigTo verify that the DNmSUN1 functioned in CMs, we initially transduced human CMs derived from iPS stem cells using the AVV-DJ system to provide a higher infectivity rate in cultured cells than the AAV9 serotype Fig.\u00a0. The DNm10\u2009vg/g per mouse. The injected mice were sacrificed for analysis at 99 days after Tmx-induced deletion of Lmna. Detection by PCR of the Lmna deletion in the hearts confirmed Cre induction following Tmx injection as expected  to transduce and express the DNmSUN1 minigene in the hearts of postnatal mice, initially by intrathoracic injection at a dose of 5\u2009\u00d7\u200910ted Fig.\u00a0. The locted Fig.\u00a0.t test ****P\u2009<\u20090.0001).To further verify that the DNmSUN1 was disrupting the LINC complex, displacing Nesprin1 in CMs, CMs were isolated from mice transduced with AAV9 delivering DNmSUN1 or controls injected with PBS only. The CMs were immunostained with anti-Nesprin1 and anti-SUN1. The intensity or levels of Nesprin1 at the NE were reduced, revealing displacement of Nesprin1 protein. Fig.\u00a0. NesprinLmnaF/F:mcm mice injected with the AAV9-GFP control lived an average of 34.5 days after Cre induction  lived significantly longer, with the majority surviving at least 99 days after Tmx induction, before being sacrificed for analysis (P\u2009=\u20090.0002)   lived significantly longer, with the majority surviving at least 66 days after Tmx induction before they sacrifice for analysis (P\u2009=\u20090.0002)  and high (4\u2009\u00d7\u20091010\u2009VG/g) doses of DNhSUN1 are presented and show that doubling the concentration of the injected DNhSUN1 extends longevity even further to at least 300 days after Tmx injection. The results further suggested that females may survive longer than males; a divergence also noted in mice where Lmna deletion in the liver38. Injection of the DNhSUN1 into wild-type mice revealed the DNhSUN1 had no overt detrimental effects on the longevity of normal mice with the mice living for over 1 year with DNhSUN1 protein expression still being detectable in heart extracts after 1 year  Fig.\u00a0. In Fig.ear Fig.\u00a0. Histoloear Fig.\u00a0 with conear Fig.\u00a0. ECG anaTmx Fig.\u00a0, with heTmx Fig.\u00a0. Althougice Fig.\u00a0. ImportaLMNA mutations. LMNA associated DCM is regarded as a particularly aggressive form of heart failure, frequently leading to premature death or cardiac transplantation40. By 60 years, 55% of LMNA mutation patients die of cardiovascular failure or receive a heart transplant, compared with 11% with idiopathic cardiomyopathy. Attempts to ameliorate DCM by fitting a pacemaker have been, at best, of transient benefit. Consequently, it is necessary to develop new therapeutic avenues to treat DCM caused by LMNA mutations.Here we show that disrupting the LINC complex protein, SUN1, suppresses DCM progression caused by LMNA mutations causing DCM are dominant missense, primarily due to a single base change. Treatment by gene therapy to repair each mutation would be a daunting task. Moreover, simply eliminating the mutated allele, leaving the patient haplo-insufficient for the remaining WT allele would almost certainly be ineffective at preventing heart failure as a patient, who was effectively heterozygous for LMNA, developed DCM41. Various other routes downstream of the LMNA gene have been explored as potential therapeutic pathways. These have included inhibiting mTOR with rapamycin/rapalogues43, MEK1/2 kinase pathway inhibitors44, upregulation of YY145, and most recently inhibiting the transcription factor bromodomain-containing protein 4 (BRD4)46. Many of these procedures necessitated repeated injections (often daily) of the compounds, some of which were associated with significant side effects.The majority of In contrast, the AAV delivery system requires a single injection. Our data revealed that following a single injection of the vector expression of the DNSUN1 constructs is still detectable 1 year after injection. In all studies, as here, the primary endpoint was lifespan extension, with fibrosis reduction and cardiac function being the secondary endpoints. All approaches resulted in increased longevity, improved ventricular function, and reduced fibrosis (10\u201340%), but the lifespan extension and long-term efficacy were less than that observed by depletion and genetic disruption of SUN1. However, longevity is extended to close to 1 year after administering and persistent expression of the DNhSUN1 protein for at least 1 year.28. The first \u201cgene regulation hypothesis\u201d proposes that LMNA mutations/loss disrupt the equilibrium of various molecular pathways due to the mutations altering interactions with NE proteins and chromatin, altering gene expression. Evidence supporting this hypothesis comes from studies reporting changes in signaling pathways including the AKT-mTOR42, WNT/\u03b2-catenin48, TGF-\u03b2/Smad19, MAP Kinase49 and the ERK1/2\u2013CTGF/CCN2 pathways50. While all these changes have been documented, it is not established whether these changes are merely a secondary compensatory effect in diseased tissue.The molecular mechanisms underlying the varied phenotypes of the laminopathies are still not understood, though two alternative hypotheses have been proposed to explain the tissue-specific pathologiesLMNA loss or mutation that leads to increased nuclear fragility. As a result, mechanical stress and tension forces transmitted via the LINC complex from the cytoplasm to the NE causes damage to the NE51. This hypothesis is similar to that proposed for Duchenne muscular dystrophy (DMD), where the loss of dystrophin increases the fragility of the muscle cell membrane, making them susceptible to tension-stress forces during muscle contraction and results in muscle cell rupture and death52. LMNA mutant fibroblasts show nuclear deformation, defective mechanotransduction, reduced viability when subjected to mechanical strain, and increased nuclear rupture at low and moderate pressures compared to WT nuclei54. Within the context of contracting murine CMs, mechanical stress and tension forces caused by 500\u2013600 contractions per minute are exerted on the NE via the LINC complex, resulting in nuclear distortion, damage, and eventual death/loss as presented in Figs.\u00a0Lmna-null CMs, resulting in CM death. Whether such forces also induce DNA damage in the CMs, as reported for myoblasts derived from Lmna mutant mice, is still unclear55 as we could not detect any convincing evidence for DNA damage in the LaminA depleted CMs. If this tension-stress hypothesis is correct and that the cytoskeleton itself promotes damage to the NE, then unlinking the LINC complex by interfering with SUN1 function should reduce the stress on the CM nuclei. Such uncoupling would predict the prevention of CM cell death in the mutant CMs. To test this tension-stress hypothesis, a DNhSUN1 construct22 was used to compete with endogenous SUN1 for KASH-domain-binding to decouple CM LINC complexes  networks, whereas SUN2 preferentially interacts with the cytoplasmic microfilament-actin network35. In addition, SUN1 interacts directly with Lamin A whereas SUN2 does not or shows reduced interaction58. In CMs, the MTs ramify throughout the cell, but cluster as a dense network around the CM nuclei and, therefore, may be the principal cytoskeletal network the LINC complex/Nesprin-1/SUN1 interacts.These results indicate that loss or mutation of nts Fig.\u00a0. In the na Figs.\u00a0, 7D. Int59. Intermediate filaments, in particular Desmin, and its interaction with the KASH-domain protein Nesprin 3, has also been implicated in maintaining CM nuclear organization. However, in our hands, Nesprin3 null mice are overtly normal, and we did not detect any cardiovascular defect either histologically or by changes in blood pressure. These findings suggest that disruption of the SUN1/Nesprin1 LINC complex specifically uncouples the CM nuclei from mechanical stresses transmitted through the CM MT network60.In contrast, actin microfilament networks i.e., stress fibers or transmembrane TAN lines, are absent, as actin predominantly localizes to the sarcomeres62. However, even though tension-stress may be the primary cause for LMNA deficient CM death, disrupting SUN1 may not be so effective in preventing Lmna mutation-induced cell death in murine skeletal muscle, as Lmna\u0394/\u0394:Sun\u2013/\u2013 mice die at an earlier age than those mice where Lmna was specifically deleted in the CMs. Which muscle groups (or even other tissues lacking Lmna) result in the earlier murine lethality remain to be identified. However, in the LMNA DCM patients, heart failure is the primary cause of death, and our results show that disrupting the LINC complex in CMs could be effective at retarding heart failure.Our results provide an opportunity to use the AAV-DNSUN as a potential therapeutic for preventing DCM progression in laminopathy patients. An attractive feature to using the DNSUN1 as a therapeutic is its potential long perdurance, which may avoid the necessity for repeat AAV injections, resulting in immune responses to the AAV, potentially compromising the efficacy of the vector. As a delivery route for patients, the AAV system is established and approved by regulatory authorities to treat an increasing number of diseases. It is becoming more widely used with multiple ongoing clinical trials, including its introduction into patients with heart diseasead libitum. Ethical oversight and approval were granted by the Institutional Animal Care and Use Committees, for both the ASTAR Biological Resource Center (BRC) and the NUS AICUC and the animal facility/committee (Comparative Medicine protocol R16-213) and is governed by the association of AAALAC (USA) providing guidelines to both AALAS (USA) and AVS (Singapore) to which NUS adheres.Mouse (C57Bl6/J and 129\u2009Sv/J) strains were maintained at the A*STAR Biological Resource Center facility and the NUS Animal Facility on a 12\u2009h light/dark cycle in ventilated animal barrier facilities with the temperature set to 21\u2009\u00b1\u20091\u2009\u00b0C, humidity at 55\u201370% and with food and water provided LmnaF/F mice were generated and characterized as previously described63. To derive mice with a global deletion Lmna (Lmna\u2206/\u2206), we crossed the floxed allele (LmnaF/F) to mice in which Cre recombinase is driven by the regulatory sequences of the mouse zone pellucida 3 gene 93Knw, JAX stock 003651)30. Cardiomyocyte (CM)-specific deletion of Lmna (LmnaF/F \u03b1IMhc), was performed using 2 lines where Cre recombinase is expressed specifically in CMs. We first crossed the LmnaF/F mice to mice where Cre expression was driven by the CM-specific murine alpha myosin-heavy chain  promoter 2182Mds, JAX stock 011038). In addition, we derived a tamoxifen-inducible CM-specific deletion of Lmna (LmnaF/F:mcm), by crossing the LmnaF/F with a line where Cre expression was driven by the mouse CM-specific alpha-myosin heavy chain promoter  that expresses a tamoxifen-inducible Cre recombinase (MerCreMer) specifically in juvenile (14d) and adult (3\u201336 month) cardiac myocytes 1Jmk, JAX stock 005657). The specificity of mcm Cre expression to CMs was confirmed by crossing Cre lines to the mT/mG reporter mice64. Generation of the Sun1\u2212/\u2212mice was previously described65, as was the LmnaN195K/N195K12 line that carries a Lmna N195K missense mutation that also results in death associated with heart failure. The Lmna\u2206/\u2206:Sun1\u2212/\u2212 and LmnaF/F mcm:Sun1\u2212/\u2212 mice were obtained by crossing the respective Lamin-Cre mice strains with Sun1+/- mice as Sun1\u2212/\u2212 mice are infertile.The To test for the insertion of loxP sites and the conditional deleted allele, genotyping was performed with a duplex PCR protocol. The primer sequences are in Supplementary Table\u00a02 euthanasia or anaesthetized with a gaseous mixture of 1.5% Isoflurane (BioMac) and 1.5\u2009L O2 at various time points after tamoxifen injection. Cardiac arrest was induced by injection of 15% KCl, followed by flushing with PBS to remove blood. Hearts for paraffin embedding were flushed with 4% paraformaldehyde (PFA), left in 4% paraformaldehyde (PFA) overnight, dehydrated in 70% ethanol for at least 24\u2009h and embedded in paraffin. Hearts for cryosection were embedded in tragacanth gum (Sigma), frozen in isopentane  cooled in liquid N2, cut at 9\u2009\u03bcm sections using a cryostat (Leica CM3050), collected onto charged slides, and stored at \u221220\u2009\u00b0C for histological and immunofluorescence staining. Hearts for protein and RNA extraction were snap-frozen in liquid N2 and stored for further processing.Mice (14 days old) and adults (3\u20135 months old) were injected once with 40\u2009mg/kg of Tamoxifen (Sigma) dissolved in corn oil (Sigma). Mice were sacrificed by CO66. Briefly, mice were anaesthetized with isoflurane . Hearts were stopped with 15% KCl, the descending aorta was cut, and hearts flushed with 7\u2009mL of EDTA buffer through the right ventricle. The ascending aorta was clamped using Reynolds forceps, and the entire heart removed and placed in a 60\u2009mm dish containing fresh EDTA buffer. Hearts were digested by sequential injection of 10\u2009mL EDTA buffer, 3\u2009mL perfusion buffer, and 30\u201350\u2009mL collagenase buffer into the left ventricle. Forceps were used to gently pull the digested heart into smaller pieces ~1\u2009mm and gentle trituration. Enzymatic activity was inhibited by the addition of 5\u2009ml of Stop buffer. The cell suspension was passed through a 100\u2009\u00b5m filter, and four sequential rounds of gravity settling to enrich for myocytes, ultimately resulting in a highly pure myocyte fraction. CMs were plated on laminin-coated coverslips and cultured for 24\u2009h before fixation with ice-cold Methanol for further processing.Cardiomyocyte isolation was performed as per standard protocolFor histological studies, sections (9\u2009\u00b5m) were stained with standard Haematoxylin and Eosin for cell morphology, Masson\u2019s trichrome stain to detect collagen, and TUNEL assay (Abcam) to detect apoptotic nuclei. Images were obtained with a Zeiss Axio Imager Microscope. For immunofluorescence of frozen hearts, sections were warmed to room temperature, rehydrated with PBS, blocked with M.O.M block (Vector Shields) and donkey serum (Sigma-Aldrich), incubated with primary antibodies overnight at 4\u2009\u00b0C. The slides were then washed in PBS and incubated with secondary antibodies and Hoechst dye (Sigma-Aldrich) for 60\u2009min, washed with PBS, and mounted in Prolong-Gold Antifade reagent (Invitrogen). Primary antibodies are listed in Supplementary Table\u00a0Whole hearts were homogenized in RIPA lysis buffer and the extract spun at 13200\u2009g, 10\u2009min, 4\u2009\u00b0C. Total cell lysates were electrophoresed and transferred to PVDF membrane and blocked with Odyssey Blocking Buffer (Li-Cor Biosciences). The membrane was incubated with primary antibodies for 2\u2009h at room temperature or overnight at 4\u02daC, washed in TBST washing solution, and incubated in Odyssey IRDye secondary antibodies (1:5000) for 1\u2009h before visualization with the Odyssey Infrared Imaging System (Li-Cor Biosciences). The primary antibodies used: for detection of LaminA/C  that is specific to an epitope in the first 50 amino acids in LMNA, mSun1 , GFP , LaminB1 , anti-HA epitope , GAPDH , and control \u03b2-tubulin . For detection of the AAV9-DNhSun1 transgene, a mouse mAB specific to the C-terminus of human Sun1  was used in combination with protein A conjugated to HRP . GAPDH  was used with anti-rabbit Immunoglobulins/HRP  as a loading control. Uncropped and unprocessed scans of blots are in the Source Data file.Cardiac function was measured by echocardiography using the Vevo2100 and Vevo3100 . Mice were shaved 1 day before ultrasound examination. The animals were anaesthetized with 1.5% isoflurane mixed with oxygen. Readings of B-mode and M-mode were taken at heart rates between 450 bpm and 350 bpm. FS, EF, and GLS were calculated from the parasternal long axis using the Vevostrain feature of the VevoLab software . Cardiac measurements of the left ventricular interior diameter, interventricular septum, and left ventricular posterior wall were taken from the parasternal short-axis for the diastolic and systolic state.67. Briefly, the explanted mouse heart was immediately rinsed with oxygenated ice-cold Krebs\u2013Henseleit solution with 12\u2009U/mL heparin sodium (EDQM) and 30\u2009mM 2,3-Butanedione monoxime BDM (Sigma) and excess blood removed. Hearts were then transferred to ice-cold Krebs\u2013Henseleit solution in a glass petri-dish under a dissection microscope with a cooling stage. Cylindrical papillary muscle (200\u2013300\u2009\u00b5m in diameter and 1.5\u20132\u2009mm in length) were excised from the left ventricle. T-shaped aluminum clips with a hole were crimped onto the ends of a papillary preparation and the prepared papillary chunks fixed using pins onto a glass petri-dish with a layer of PDMS sylgard 184 (Dow Corning). Papillary preparations were immersed in a 2% Triton X-100 solution at 4\u2009\u00b0C overnight. Force measurements were performed as previously described68. The T-shaped aluminum clips at the ends of the papillary preparations were attached to the hooks of a force transducer  and servo-motor in the experimental rig was glued with shellac in ethanol (Sigma) to minimize the movement during the experiment. Papillary contraction force was measured at 20\u2009\u00b0C. The maximum contraction force was measured inactivating solution  with 32 \u00b5mol/L free Ca2+. Data were collected and processed from the force transducer and DAQ data acquisition device  using a customized software programmed by LabVIEW 2013 . At least 5 fibers were tested from each mouse, and at least 3 mice were tested for each experimental group.Mouse papillary muscle from the left ventricle was prepared according to the methods described before69 using the episomal reprogramming method70. Informed consent was obtained for this procedure with UCSF Committee on human research #10-02521, which approved the study protocol. The human iPS cell lines used in this study were generated from a healthy male patient, WTC10 and WTC11. Pluripotent stem cells were maintained on Matrigel (BD Biosciences) coated polystyrene culture plates in StemFlex medium (Thermo Fisher Scientific). Cells were supplemented with Y-27632 (10\u2009\u03bcM) (StemCell Technologies), a Rho-associated kinase (ROCK) inhibitor after passaging to promote cell survival.Human iPSCs were generated from a healthy male patient71. Human pluripotent stem cells were seeded at 5\u2009\u00d7\u2009104\u2009cells/cm2 onto 12-well plates coated with Matrigel (BD Biosciences) in StemFlex medium for 3 days. On the day of differentiation, the medium was switched to RPMI medium supplemented with B27 without insulin (RPMI/B27\u2212) (Life Technologies) and CHIR99021 (12\u2009\u03bcM) (Tocris) for exactly 24\u2009hr before replacing with fresh RPMI/B27\u2212 medium. After 48\u2009h, cells were treated with IWP2 (5\u2009\u03bcM) (Tocris) in RPMI/B27\u2212 for 2 days before replacing with fresh RPMI/B27\u2212 medium. After 2 days, the medium was then switched and maintained in RPMI/B27 with insulin (RPMI/B27+) for 8\u201311 days before using a metabolic selection protocol to purify iPSC-CMs72. Cells were re-plated and maintained on RPMI/B27+ medium for 4 days and then replaced with lactate medium (glucose-free DMEM containing sodium pyruvate and buffered lactate (4\u2009mM) supplemented with Glutamax and nonessential amino acids). Cells were treated with lactate medium twice, with each treatment lasting for 2 days. The purified iPSC-CMs were then maintained in RPMI/B27+ medium for 1 week before harvesting for further analyses.Differentiation of human iPSCs to cardiomyocytes (iPSC-CMs) was performed by modulating WNT/\u03b2-catenin signaling as described (the GiWi protocol)22. Briefly, almost the entire luminal domain of Sun1 was tagged at its NH2 terminus with HA (HA-Sun1L). To introduce the HA-Sun1L as a soluble form into the lumen of the ER and PNS, signal sequence and signal peptidase cleavage sites of human serum albumin was fused to the NH2 terminus of HA-Sun1L to yield SS\u2013HA-Sun1L. To prevent its secretion, a KDEL tetrapeptide was fused to the COOH terminus of SS\u2013HA-Sun1L to form the final SS\u2013HA-Sun1L\u2013KDEL. The HA-Sun1L region was replaced with a GFP sequence to generate the SS-GFP\u2013KDEL. The DN-Sun1 and GFP fragments were amplified with the primers listed below . Ligations were performed using isothermal assembly with NEBuilder\u00ae HiFi DNA Assembly Master Mix . Primers used for constructing the plasmids were ordered from IDT.The DNSUN1 (SS\u2013HA-Sun1L\u2013KDEL) and GFP (SS-GFP\u2013KDEL) vectors as described73. 293T cells were expanded in 15\u2009cm dishes or T-flasks before being seeded into a 10-chamber CellSTACK . pAAV2/9 , pHelper , and plasmids containing the transgenes (Penn-AAV-cTnT-EGFP-RBG and pAAV-cTnT-Myc-SUN1DN) were transfected using PEI Max . 4 days after transfection, the cell pellet and supernatant were harvested. The supernatant was clarified by filtration and applied by gravity flow to ~1\u2009ml POROS\u2122 CaptureSelect\u2122 AAV9 Affinity Resin . Cells were resuspended in lysis buffer , lysed by 4\u20135 rounds of freeze/thaw, sonicated, and treated with benzonase to shear and digest DNA. Cell debris was pelleted by centrifugation, and cell lysates were collected and filtered through 0.45\u2009\u03bcm syringe filters. Filtered lysates were then applied to AAV9 affinity resin by gravity flow. Following washing in wash buffer , AAV9 virions were eluted using 100\u2009mM glycine, pH 2.5, and collected in microfuge tubes containing 1/10th volume of 1\u2009M Tris, pH8. Following 2 rounds of buffer exchange into PBS containing 0.01% Pluronic F-68 and concentration via Amicon\u00ae Ultra 100 KDA concentrators , ~1\u2009ml solution containing AAV virions was filtered through 0.22\u2009\u03bcm 4\u2009mm Millex syringe filter units  and stored in 4\u2009\u00b0C or \u221280\u2009\u00b0C. To quantify viral genomes, dye-based quantitative real-time PCR was performed using primers 5\u2032-acagtctcgaacttaagctgca-3\u2032 and 5\u2032-gtctcgacaagcccagtttcta-3\u2032, PacI-digested and PCR-purified PENN-AAV-cTnT-EGFP-RBG to generate a standard curve, and PerfeCTa SYBR Green FastMix Low ROX qPCR master mix .AAV Virus was produced as per standard protocol10\u2009VG/g AAV9-DNmSun1 or AAV9-GFP virus into the thoracic cavity at 15 days postnatally. Adult mice (3\u20135 months old) were injected IP with a single dose of Tmx (40\u2009mg/kg), followed by injection of AAV9 at a concentration of 5\u2009\u00d7\u20091010\u2009VG/g AAV9-DNmSun1 or AAV9-GFP virus into the thoracic cavity. Young and adult mice were anesthetized with a gaseous mixture of 1.5% Isoflurane (BioMac) and 1.5\u2009L O2 before injections.Initially, the following protocol was used for AAV transduction into the mouse hearts. Mice were genotyped 10 days postnatally. They were then subjected to one IP injection of Tmx (40\u2009mg/kg) at 14 days postnatally, followed by a single injection at a concentration of 5\u2009\u00d7\u20091037. For evaluation of the cardiac function, only male animals were used. On postnatal day 10 mice were genotyped. To induce deletion of the Lmna gene in CMs, a single IP injection of tamoxifen (40\u2009mg/kg) was administered on postnatal day 14 to all animals. On postnatal day 15, animals were injected retro-orbitally with AAV9 DNhSUN1 or AAV9 GFP  into the retro-orbital sinus using an insulin syringe. For the dose\u2013response experiments, 5\u2009\u00d7\u20091010\u2009VG/g was used for the high dose. Animals were selected randomly. TMX and AAV9 injections were performed under anesthesia using 1.5% Isoflurane mixed with oxygen. The AAV9 working solution was prepared freshly before administration. Depending on the concentration of viral genomes, the respective AAV9 stock solutions were diluted with PBS containing 0.001% Pluronic F-68.In the subsequent set of AAV transductions, the route of administration was changed from intrathoracic to retro-orbital injectionT-test as indicated. For lifespan analysis, significance was tested with Log-rank test. To calculate the significance of cardiac data Tukey\u2019s post hoc test was used for multiple groups.All statistical analyses were performed using Excel 2016 and Graphpad Prism 9.1.0. Results are shown as mean with \u00b1SD. Data were analyzed using One-way ANOVA or unpaired Further information on research design is available in the\u00a0Supplementary InformationReporting Summary"}
+{"text": "The acceleration of parallel high-throughput first-principle calculations in the context of 3D  periodic boundary conditions for low-dimensional systems, and particularly 2D materials, is an important issue for new material design. Where the scalability rapidly deflated due to the use of large void unit cells along with a significant number of atoms, which should mimic layered structures in the vacuum space. In this report, we explored the scalability and performance of the Quantum ESPRESSO package in the hybrid central processing unit - graphics processing unit (CPU-GPU) environment. The study carried out in the comparison to CPU-based systems for simulations of 2D magnets where significant improvement of computational speed was achieved based on the IBM ESSL SMP CUDA library. As an example of physics-related results, we have computed and discussed the ionicity-covalency and related ferro- (FM) and antiferro-magnetic (AFM) exchange competitions computed for some CrX Since the first discovery of graphene, 2D materials have been proposed as a designing basis of novel quantum systems and devices for applications in energy harvesting and microelectronics. Recently, for the first time, the monolayer 2D CrIbricated\u00a0, followebricated\u00a0, with a operties\u00a0. ThereinIn the last decade GPUs have been actively developing the direction of high-performance computing systems, where classical CPU-based systems reached their limits. They have shown high computational efficiency and, therefore, have been increasingly used for a simulation purpose in the various fields of physics\u00a0,7,8, wheThe hybrid computing cluster used consists of one control and four computing nodes. They are Sitonica PW22LC servers (IBM Power System S822LC 8335-GTB). Where each node includes two IBM POWER8 processors with a maximum frequency of 4.023 GHz, two NVIDIA Tesla P100 GPU co-processors , 256 GB DDR4 RAM, an EDR InfiniBand controller, and two Seagate ST1000NX0313 1 TB 7200RPM hard drives . In order to store data, a storage area network with 50 TB capacity was used. A management network based on Gigabit Ethernet technology was used. While for the data network, the EDR InfiniBand network with a capacity of 100 Gb/s was employed.QE-GPU-Plugin\u00a0[For comparison purposes, three different builds of Quantum ESPRESSO (QE) version 6.2 open-source package were used. The first one (CPU) is a simple CPU-version without GPU-support, in which as a mathematical library, the serial version of the IBM ESSL version 6.2.1 (Engineering and Scientific Subroutine Library) library was used. The second one (GPU) is the Quantum ESPRESSO version 6.2 with GPU-support activated with a special open-source extension U-Plugin\u00a0.The serial version of the IBM ESSL version 6.2.1 library was also used as a mathematical library in this build. The third one (ESSLCUDA) is the standard CPU-version compiled along with the GPU-enabled version of the ESSL library, which supports the offloading part of the calculations into co-processors. All versions were compiled by IBM compilers  with the activated support of the parallel execution in the frame of IBM spectrum Message Passing Interface (MPI) version 10.1.0.CUDA_VISIBLE_DEVICES environment variable so that MPI processes running on the first processor cores would be linked to the first co-processor, and processes of the second processor cores would be linked to the second co-processor. Calculations were terminated after performing the full self-consistent loop for each case.Calculations have been performed with the use of 1\u20133 computational nodes  where each MPI-process corresponds to one processor core. Their binding to co-processors was performed by the setup of the The CPU machine has been used for the comparison is the Cray XC30  where each compute-node contains two Intel 2.7 GHz 12-core E5-2697 v2 (Ivy Bridge) series processors with the supported two hardware threads per core. The two processors are connected by two QuickPath Interconnect  links with local memory of 32 GB. For the sake of consistency in the second CrIk-point meshes\u00a0[The ground states calculations were performed using a computational implementation of the density-functional theory (DFT) package Quantum ESPRESSO\u00a0. We usedt meshes\u00a0 were useg method\u00a0. Thus, tpackage \u00a0. For thed-electrons in chromium compounds one has to take into account correlation effects in order to describe their electronic and magnetic properties correctly\u00a0[It is well-known that for orrectly\u00a0,17. A deorrectly\u00a0. In thisorrectly\u00a0. We usede method\u00a0\u2014for 2D Ce 1.6 eV\u00a0 for UeffS as a function of processors number N are presented on the Figure. Where the three abovementioned builds of the code were employed. The acceleration has been computed as follow npool = 1). This clearly indicates the performance degradation against the k-grid distribution over 4-nodes (npool = 4), where computational enhancements can be achieved by increasing the number of MPI-processors in use.In the first instance, we performed a standard QE PSIWAT test\u00a0, which aThe next step was with the use of the best performed QE build to compare its performance with other nation-wide top-ranking supercomputer facilities. The Cray XC30 MPP supercomputer equipped with a high-performance Lustre storage system was chosen as its counterpart. To emphasize the role of the unit cell size and k-points mesh for a purer 2D system, there are two test cases that have been considered.Case 1 is the mono-layered system containing 4 Cr atoms and 12 I atoms with a relatively dense k-points mesh 18 \u00d7 18 \u00d7 1  and extremely large vacuum space 43 \u00c5 where PAW pseudopotentials have been used. The second case is a single layer of CrI-npool option for k-points distribution over separate nodes. At the same time, what can be clearly seen in this figure is the constant dominance of the hybrid system performance. Obtained results for a double-layered system of CrIThe results of the scaling analysis are presented in I with the biggest ionic radius up to the F, where the ferromagnetic exchange gets weaker and is less preferable than the anti-ferromagnetic H=\u2212\u2211\u2329U and d-orbitals. Hence, by substituting halide atoms X, one can control AFM/FM contributions to the total exchange due to By keeping a metallic ion M unchanged in MXractions . Since f/(U+JH)3  can be a/(U+JH)3  the prop/(U+JH)3 ,36. The ositions .In order to demonstrate the importance of higher-order exchanges, we performed GPU-enhanced non-collinear calculations for rotation spins in the RuClv et al. . It is cJeff=3/2 . While fIn summary, the results observed indicate the efficiency of hybrid computer clusters for collinear and noncollinear first-principle calculations where we employed the IBM ESSL mathematical library with automatic partial offloading of calculations into co-processors. This approach allowed us to increase the computational speed of the application based on the BLAS library, which originally was not designed for use on graphical processors. The proposed setup of a computing environment has been effectively applied for computing the magnetic and electronic characteristics of 2D magnets demonstrating the peculiar ferro- and antiferromagnetic exchange interplay and related high-order effects. Therefore, the proposed methodology will speed up computational schemes for low-dimensional materials design using the premier GPU-accelerated platforms. Accordingly, it paves the way to improve the performance of the accelerated materials design based on high-throughput computational schemes."}
+{"text": "Young children do not always consider alternative possibilities when planning. Suppose a prize is hidden in a single occluded container and another prize is hidden in an occluded pair. If given a chance to choose one container and receive its contents, choosing the singleton maximizes expected reward because each member of the pair might be empty. Yet, 3-y-olds choose a member of the pair almost half the time. Why don\u2019t they maximize expected reward? Three studies provide evidence that 3-y-olds do not deploy possibility concepts like MIGHT, which would let them represent that each container in the pair might and might not contain a prize. Rather, they build an overly specific model of the situation that correctly specifies that the singleton holds a prize while inappropriately specifying which member of the pair holds a prize and which is empty. So, when asked to choose a container, they see two equally good options. This predicts approximately 50% choice of the singleton, observed in studies 1 and 3. But when asked to throw away a container so that they can receive the remaining contents (study 2), they mostly throw away a member of the pair. The full pattern of data is expected if children construct overly specific models. We discuss whether 3-year-olds lack possibility concepts or whether performance demands prevent deployment of them in our tasks. Young children make surprisingly unwise decisions in the face of multiple possibilities . Conside2What computational process yields this highly replicable behavior\u2014better than chance, but far from maximizing? One proposal is that chimpanzees, older 2-y-olds, and most 3-y-olds deploy minimal representations of possibility . They inHowever, 50% choice of a member of the pair could arise in many ways. Children might have a side bias, might focus on only one prize during the setup phase, or may be choosing between the two sides at random. These low-level strategies engage neither minimal representations of possibility nor possibility concepts; they do not even require working memory models of one prize on each side. Here, we report three studies , estimated probability of choosing wisely .62, 95% CI .48, .73], probability > .33 \u2248 1. This replicated published three-container tasks: .61 in ref. , probabiSI Appendix). Moreover, if children are choosing a side or a coin at random, there should be no difference between the Throw Away task and the Pick 1 of 3 task. If children deploy minimal representations of possibility, performance on the Throw Away task should be better than Pick 1 of 3: They throw away the chest they take to be empty, which is always a member of the pair. This was observed (log odds ratio (log OR) 1.60, 95% CI ; SI Appendix). These results rule out the low-level strategy hypothesis. They are as expected if children deploy minimal representations of possibility. They are also expected if prompting 3-y-olds to think about which container is empty somehow elicited the deployment of possibility concepts. Study 3 adjudicated between these hypotheses.In study 2, we taught twenty-four 3-y-olds  that when they threw a chest away, they received the contents of all remaining chests. In each of the eight test trials, they were reminded to try to get two coins and then asked which chest they wanted to throw away. Children deploying possibility concepts or minimal representations of possibility should reliably throw away a chest from the pair: a chest that merely might hold a coin or the chest that they believe is empty, respectively A. ChildrSI Appendix. Moreover, participants who deploy minimal representations of possibility should choose wisely less often on Pick 1 of 2 than on Throw Away  eight trials in which they were asked to throw away a chest that they do not want and then to choose one of the two remaining chests. Children threw away from the pair more often than expected by chance  and made wise decisions on Throw Away more often than in Pick 1 of 3 in study 1 , replicating study 2. These results are expected if children deploy minimal representations of possibility and also if they deploy possibility concepts. The Pick 1 of 2 question tested these hypotheses A. Particrow Away A. IndeedThe full pattern of responses B fits beSI Appendix, section II for discussion of the deviation from 100% wise decisions on the Throw Away trials.The hypothesis that children deploy minimal representations of possibility makes quantitative predictions in each trial type, several of which are not met. See P = .90). Small dots in SI Appendix, section III for statistical details.In Pick 1 of 3, 3-y-olds choose wisely 60% of the time, not 50%. The expected 50% performance is observed in older 2-y-olds (46% in ref. (P = .001). See SI Appendix, section III for statistical details.This analysis strategy allows us to test an additional hypothesis that could yield the observed mean. We have already rejected the hypothesis that all 3-y-olds choose at random since participants choose wisely on the Pick 1 of 3 measure much more than a third of the time. But if the population were a 60%/40% mixture of children who choose one of three chests at random and children who always choose wisely, we would expect the observed 60% wise decisions (.6 * .33 + .4 * 1 = .60). However, the observed distribution of proportions , and a coin went in this one (one of the pair), so throw away that one (the remaining chest from the pair).\u201d These three studies, and this explicit explanation, provide strong evidence that 3-y-olds deploy minimal representations of possibility in these tasks.The failure of 3-y-olds to deploy possibility concepts on three-container tasks coincides with failures at this age to deploy possibility concepts in other action planning tasks and in the comprehension of the language of possibility.When a reward is dropped into a tube that forks at the bottom, 2.5-y-olds who want to catch the reward almost always cover just one exit, missing the reward about half of the time .The \u201cthree-exit task\u201d eliminated working memory demands of the three-container task by making everything the child needs to know visible and salient while they plan their action . ParticiBy age 2 or 3, children use words like \u201cmaybe,\u201d \u201ccan,\u201d and \u201chave to\u201d that express possibility and necessity in adult language . But sysJointly, all the above failures raise the possibility that children do not deploy possibility concepts\u2014symbolic markers that mark propositions as merely possible\u2014because they do not have them to deploy. This hypothesis has not been ruled out by existing research .Taking this hypothesis seriously raises questions for further research. It is possible that 3-y-olds do have possibility concepts, but diverse performance issues prevent deployment of possibility concepts in each of these tasks. If so, we should be able to develop novel tasks that reveal possibility concepts in 3-y-olds and characterize the performance demands that prevent 3-y-olds from deploying possibility concepts. Indeed, the three-exit task was an attempted step in this line of research but instead established that working memory demands were not masking children\u2019s possibility concepts. Further research should continue exploring parallels in the developmental course of possibility concepts across tasks with diverse performance demands, including seeking within-child correlations and controlling for age and executive function.If the evidence were to favor the hypothesis that most 3-y-olds lack possibility concepts, this would raise a daunting challenge: specifying a mechanism that supports the development of possibility concepts out of available representational and computational capacities that lack symbols for possibility. Are minimal representations of possibilities precursors to possibility concepts, in the sense of playing a causal role in their acquisition? If children initially analyze words like \u201cmaybe\u201d and \u201ccan\u201d in terms of minimal representations of possibility, perhaps the full pattern of use of modal words plays a role in acquiring the concept of possibility. Further research should explore the details of how children learn modal language as well as the relations between its acquisition and performance on action planning tasks that probe possibility concepts.SI Appendix for complete participant information, procedure, and counterbalancing. Ethical approval for all studies was granted by the Harvard Institutional Review Board. Caregivers provided informed consent prior to each study. Children gave verbal assent.Tasks were presented via Zoom. Children indicated their choices by pointing; caregivers communicated the child\u2019s choice. In training, children learned to make wise decisions\u2014whether picking a chest, throwing away a chest, or throwing away a chest and then picking one\u2014in full knowledge of which chests held coins and which were empty. Test trials are described in SI Appendix.Data were analyzed with a Bayesian GLMM with a random intercept for participant id. We used default priors. The DV was the participant\u2019s choice: Did they choose wisely (1) or not (0)? The IV was trial type . Statistical methods and additional models are detailed in https://aspredicated.org/aq2ct.pdf.Pregistration for study 3 is at Appendix 01 (PDF)Click here for additional data file."}
+{"text": "Gastrointestinal stromal tumors are considered to be insensitive to radiotherapy. However, with the development of radiation techniques and the accumulation of cases, some studies have indicated that radiotherapy could help achieve objective response in advanced or metastatic gastrointestinal stromal tumors. Therefore, it is necessary to conduct a systematic review to reassess the role of radiotherapy in gastrointestinal stromal tumors. The purpose of this study was to draw the attention of scholars and clinicians to radiotherapy and promote further research on radiotherapy in gastrointestinal stromal tumors.Gastrointestinal stromal tumors (GISTs) are considered insensitive to radiotherapy. However, a growing number of case reports and case series have shown that some lesions treated by radiotherapy achieved an objective response. The aim of the study was to perform a systematic review of all reported cases, case series, and clinical studies of GISTs treated with radiotherapy to reevaluate the role of radiotherapy in GISTs. A systematic search of the English-written literature was conducted using PubMed, Web of Science, and Embase databases. Overall, 41 articles describing 112 patients were retrieved. The included articles were of low to moderate quality. Bone was the most common site treated by radiotherapy, followed by the abdomen. In order to exclude the influence of effective tyrosine kinase inhibitors (TKIs), a subgroup analysis was conducted on whether and which TKIs were concurrently applied with radiotherapy. Results showed that radiotherapy alone or combined with resistant TKIs could help achieve objective response in selected patients with advanced or metastatic GISTs; however, survival benefits were not observed in the included studies. Pain was the most common symptom in symptomatic GISTs, followed by neurological dysfunction and bleeding. The symptom palliation rate was 78.6% after excluding the influence of effective TKIs. The adverse reactions were mainly graded 1\u20132. Radiotherapy was generally well-tolerated. Overall, radiotherapy may relieve symptoms for GIST patients with advanced or metastatic lesions and even help achieve objective response in selected patients without significantly reducing the quality of life. In addition to bone metastases, fixed abdominal lesions may be treated by radiotherapy. Publication bias and insufficient quality of included studies were the main limitations in this review. Further clinical studies are needed and justified. KIT gene and PDGFRA gene drive approximately 90% of GISTs [Gastrointestinal stromal tumor (GIST) is the most common mesenchymal tumor in the gastrointestinal tract , with siof GISTs . At presof GISTs . Althougof GISTs ,7, localof GISTs . In the of GISTs . Howeverof GISTs ,11. Radihttps://osf.io/qba6j, accessed on 22 June 2022).This systematic review was reported according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) checklist  Table S. This prA systematic review was performed that analyzed radiotherapy in the management of GISTs to answer the following question: \u201cWhat is the potential value of radiotherapy in GISTs\u201d?Articles in which patients with confirmed GISTs were treated with radiotherapy combined with/without TKIs and/or surgery were included, irrespective of what type of treatment the patients previously had. Case series were defined as reports on treatment outcomes in more than 2 patients. In addition, at least one of the following was obtained from the included articles: (1) patient response to radiotherapy; (2) duration of disease control ; (3) symptom palliation; (4) adverse events.Studies written in non-English languages, cases with synchronous or heterochronous tumors, case series with other types of tumors and reviews, and unavailable full texts were excluded.A systematic review of the English-written literature was conducted using PubMed, Web of Science, and Embase databases, with individual search strategies for each database. A comprehensive search was undertaken to retrieve original studies using the keywords gastrointestinal stromal tumor, GIST, radiotherapy, and their variations. No time limit was imposed on publication dates. The last search was performed on 18 May 2022. The reference lists of all relevant articles were scanned to identify any possible related studies to be included .The selection was completed in two phases. In phase one, all retrieved abstracts were screened by two authors (H.Z. and T.J.). For each one that met the inclusion criteria, the full text was obtained. In phase two, full-text reading was performed independently by the same two authors. They had discussions to reach a consensus when disagreements arose. When a consensus was not reached, a third author (Y.Y.) was involved in making a final decision.The Joanna Briggs Institute (JBI) Critical Appraisal Checklist for Case Reports and Case series and the CARE Checklist were adapted and applied for the methodological quality assessment ,15. RegaAge, sex, sites treated by radiotherapy, dose and fractions, previous and concomitant TKIs, symptom palliation, adverse events, disease response, time to progression, time to recurrence, and survival time were recorded by one author (H.Z.). A second author (T.J.) cross-checked all the collected information. Again, any disagreement was resolved by consensus or the decision of a third author (Y.Y.). The results of response to radiotherapy and recurrence should be supported by objective images (pre- and post-treatment images) or based on definite criteria that were presented in articles. Regarding response, we defined articles in which definite criteria and objective images were not presented as \u201cnot available\u201d. When the authors evaluated a response according to specific criteria or images presented in studies, we accepted it. When the articles presented images and did not evaluate responses to radiotherapy, we evaluated the responses based on the images according to Response Evaluation Criteria in Solid Tumors (RECIST criteria).The included studies were synthesized in qualitative and quantitative descriptions. Response and symptom palliation after radiotherapy were the primary outcomes. In addition, we defined the initiation of radiotherapy as the starting point for follow-up. Overall survival (OS) was calculated from the date of radiotherapy initiation to the date of death. Time to progression and recurrence were calculated from radiotherapy initiation to progression and recurrence, respectively. Local progression and recurrence were defined as any clinical or radiographic evidence of tumor growth. Local progression-free survival (PFS), local recurrence-free survival (RFS), and OS were estimated using the Kaplan\u2013Meier method. OS, PFS, RFS, and adverse events related to radiotherapy were the secondary outcomes.Finally, 412 studies were retrieved from the 3 electronic databases, and 2 were obtained from reference lists. Then, duplicate articles were removed, resulting in 315 remaining studies. Then, a comprehensive evaluation of the abstracts was conducted, and 265 articles were excluded. Therefore, 50 manuscripts were selected for full-text review. Later, four case reports were excluded due to reporting GISTs with synchronous or heterochronous tumors, and five case series were excluded due to reporting GISTs with other types of tumors. There were a total of 41 retrieved articles describing 112 patients ,52,53,54There were 34 case reports and 2 case series, covering 70 lesions in 55 patients, which clearly described the patients\u2019 responses to radiotherapy and the specific scenarios of radiotherapy combined with TKIs ,50,51,52We divided the 53 defined irradiated lesions into 4 groups according to radiotherapy with/without concomitant TKIs: radiotherapy (R), radiotherapy with new TKIs , radiotherapy with resistant TKIs , and radiotherapy with sensitive TKIs . The responses of the lesions are presented in Among the 41 patients who had defined lesions treated by radiotherapy, Cuaron et al. reported 15 patients with locally advanced or metastatic GISTs . There wRegarding the 17 undefined irradiated lesions in 17 patients, 13 patients were from 13 case reports ,40,42,44In addition, there were three other case series, which did not clearly describe the specific scenarios of radiotherapy combined with TKIs ,48,49. JBoth interstitial brachytherapy (iBT) and radioembolization are internal irradiation. Omari et al. reported that among 10 imatinib-resistant metastatic GISTs treated with iBT (TKIs continued in 7 patients), 1 recurred, and 6 died during follow-up , with a median PFS of 6.8 months  and a median OS of 37.3 months ; local tumor control was 97.5% . RathmanWe considered symptom palliation in defined lesions treated by radiotherapy alone or radiotherapy with previously resistant TKIs. Among the 41 patients who had defined lesions, 30 patients received radiotherapy alone or radiotherapy with previously resistant TKIs. There were 28 patients with symptomatic GISTs. Local pain, which occurred in 17 patients, was the most common symptom, followed by neurological dysfunction (4) and bleeding (3). There were 22 patients achieving partial or complete palliation. Two patients did not achieve palliation, and the other four patients were not available. The symptom palliation rate was 78.6% (22/28).In addition, the other case series reported symptom palliation in 12 patients with advanced or metastatic GISTs treated by radiotherapy with concomitant TKIs . Pain, sThere were five case reports and four case series reporting adverse events ,49,52,54KIT/PDGFRA and some special mutation sites in GISTs such as PDGFRA D842 V result in a limited response to imatinib [In the era of TKIs, the management of GISTs has undergone revolutionary changes ,56. The imatinib ,62,63. Aimatinib ,64,65,66imatinib . HoweverAccording to the current systematic review, the quality of most case reports and case series included was low. High-quality research on radiotherapy in GISTs is needed in the future. Compared with many other malignant tumors, GISTs have a better prognosis, and patients are expected to live longer. In many published clinical studies, outcome events often require an extended follow-up ,68, but We analyzed the defined irradiated lesions, which are presented in The latest NCCN guidelines recommend radiotherapy for the palliative treatment of bone metastases . We furtAccording to our study, there were six patients (four patients not resistant to TKIs) with advanced or metastatic GISTs treated by radiotherapy alone. PR was seen in three patients, with an estimated median PFS of 9 months in the six patients. Compared with patients with advanced GISTs treated initially with imatinib , radiothThere were seven patients with undefined irradiated lesions mainly located in the brain treated by radiotherapy alone. The estimated median RFS was 20 months. Sym et al. reported that compared with imatinib-resistant patients after surgery, patients responsive to imatinib had better survival after surgery . The resIn addition, relatively high disease control has been achieved in radioembolization and iBT ,49, whicThrough the analysis of symptomatic GISTs, we found that the symptom palliation rate of radiotherapy alone and radiotherapy with concomitant previously resistant TKIs reached 78.6% 22/28), which supports the application of radiotherapy in GISTs for palliative purposes recommended by the guidelines 2/28, whi,53. PattVEGF receptors may be associated with local dermal toxicity and hepatotoxicity at irradiated sites [Radiotherapy with concomitant TKIs was well-tolerated. Most adverse events were grade 1\u20132. However, some adverse reactions suggested that we need to be cautious in simultaneous treatment. TKIs that inhibit ed sites ,83,84,85Regarding the modes of radiotherapy, Joensuu et al. reported radiotherapy for liver and abdominal tumors, for which three-dimensional (3D) conformational radiotherapy and intensity-modulated radiotherapy (IMRT) were mainly used . These mWe must acknowledge that this study has several limitations.Most importantly, publication bias was present in the current study. Because GISTs were considered insensitive to radiotherapy in the past, positive results of radiotherapy treatment had a tendency to be published, which may overstate our findings. Furthermore, with the wide application of TKIs, radiotherapy was rarely considered in GISTs, resulting in few publications reporting radiotherapy in GISTs. However, to discuss the application of radiotherapy in GISTs more comprehensively, we conducted an extensive literature search and included almost all the positive and negative cases of radiotherapy that could be retrieved. A considerable number of patients were not responsive to radiotherapy in our study. However, there were still many negative cases that could not be obtained through the literature search. Further research is, therefore, necessary on radiotherapy in GISTs.Second, the articles included were low- to moderate-quality case reports and case series. In addition, there was data heterogeneity in these studies. Thus, in the future, we need to design high-quality randomized controlled studies to evaluate the efficacy and safety of radiotherapy in GISTs.Third, in the era of TKIs, radiotherapy with concomitant TKIs has been more common, which may mean that the effects of radiotherapy cannot be effectively evaluated. Thus, it is necessary to strictly design research to assess the value of radiotherapy in GISTs from an ethical point of view.Overall, radiotherapy may relieve symptoms for some GIST patients with advanced or metastatic lesions and even help achieve objective response in selected patients without significantly reducing the quality of life. In addition to bone metastases, fixed abdominal lesions may be treated by radiotherapy.Nevertheless, the efficacy and safety of radiotherapy in GIST patients warrant further investigation."}
+{"text": "We tested swab specimens from pets in households in Ontario, Canada, with human COVID-19 cases by quantitative PCR for SARS-CoV-2 and surveyed pet owners for risk factors associated with infection and seropositivity. We tested serum samples for spike protein IgG and IgM in household pets and also in animals from shelters and low-cost neuter clinics. Among household pets, 2% (1/49) of swab specimens from dogs and 7.7% (5/65) from cats were PCR positive, but 41% of dog serum samples and 52% of cat serum samples were positive for SARS-CoV-2 IgG or IgM. The likelihood of SARS-CoV-2 seropositivity in pet samples was higher for cats but not dogs that slept on owners\u2019 beds and for dogs and cats that contracted a new illness. Seropositivity in neuter-clinic samples was 16% (35/221); in shelter samples, 9.3% (7/75). Our findings indicate a high likelihood for pets in households of humans with COVID-19 to seroconvert and become ill. SARS-CoV-2 originated in horseshoe bats and probably reached humans through an unidentified intermediary host  approved the studies by Animal Utilization Protocol 4411 and Research Ethics Board Protocol 20-04-002.https://lhnvd.com) for a minimum of 12 hours, extracted RNA using Galvens Viral RNA Extraction , and eluted into water.Pet owners who had a diagnosis of SARS-CoV-2 infection or symptoms compatible with COVID-19 in the previous 3 weeks were invited to have their pet swabbed by study veterinarians during April 24, 2020\u2013August 31, 2021. Dogs, cats, and ferrets of any age and clinical status were eligible for testing; the only exclusion criterion was medical or behavioral issues that precluded safe sampling. We obtained swab samples from the distal nares, oropharynx, and rectum, whenever possible. We placed swabs in inactivating media  collected blood samples from cats and dogs admitted to the shelter during June 18\u2013November 28, 2020. Any animal that did not have health and behavioral reasons for exclusion was eligible for the study, regardless of origin  or known history of SARS-CoV-2 exposure. Similarly, we collected samples through Toronto Animal Services (TAS) from unowned and owned cats admitted to a low-cost neuter clinic during January 21\u2013July 6, 2021. We centrifuged all blood samples on site and shipped serum samples to Ontario Veterinary College . Serum samples were frozen in aliquots until batch analysis.We constructed ELISA assays for the detection of cat and dog IgG and IgM to SARS-CoV-2 S protein . Positivhttps://www.genscript.com) to determine blocking of the interaction of the receptor-binding domain (RBD) of SARS-CoV-2 with the ACE2 receptor. Following manufacturer instructions, we interpreted inhibition >20% relative to the kit positive control as indicating the presence of neutralizing antibodies.We tested the initial 42 serum samples and a subsequent 70 samples with IgG optical density (OD) >1.4 with the surrogate virus neutralization test ; p<0.05 was considered significant.We compared differences in seropositivity among different pet cohorts with Mann-Whitney tests. We calculated correlation of ELISA OD with sVNT results using Prism version 9.3.1  samples. Samples from 5 (7.7%) cats and 1 (2.0%) dog had positive PCR results. Each N1 PCR positive result (Ct <35.99) was confirmed by amplification with E, R, or RdRp primers. For all 6 animals testing positive, the nasal swab samples were positive; oral swab samples were positive from 2 of 3 tested, and rectal swab samples were positive from 1 of 3 tested. Swab samples from an additional 10 (15%) cats, 3 (6.1%) dogs, and 3 (50%) ferrets had nonnegative results. N1 PCR Ct values for those 16 samples were 36.00\u201339.00. Testing of other targeted regions at additional laboratories yielded similar nonnegative results.One cat with an initial Ct of 21.56 was retested weekly 5 times after the first positive result and had positive results during the first 3 weeks. Another cat with an initial Ct of 24.11 tested positive again 1 week later (Ct 36.19) and negative thereafter.We derived whole-genome sequences (>99.3% coverage) from 2 positive cats. Phylogenetic analysis assigned the sequences to Pangolin lineage A.23.1 and B.1.2, which had the highest similarity to human SARS-CoV-2 sequences derived in that time period from the corresponding geographic region.We collected serum samples from 59 dogs and 48 cats from 77 households and 1 animal shelter (from recently surrendered cats). Median number of samples per household was 1 (range 1\u20134). We collected 7 samples from the humane society; those 7 samples were excluded from risk factor analysis because of the potential clustering effect and the lack of metadata about these animals. Dogs were a median of 5 years of age (range 5 months\u201314 years of age), and cats were a median of 6 years of age (range 1\u201319 years of age).Seropositivity for IgG and IgM was 42%\u201362% using >3 SD above the mean of the negative control samples as a cutoff and 25%\u201348% at >6 SD . At >6 SFor statistical analysis, we defined seropositivity as >3 SD for IgG, IgM, or both. We observed a significant association between seropositivity and owner-reported onset of new respiratory disease in dogs at the time of the owner\u2019s infection (p = 0.04), but not in cats . AssociaNot all risk factor data were available for all animals. Univariable risk factor analysis did not identify risk factors for dogs, but sleeping in the owner\u2019s bed was a risk factor for seropositivity in cats  We determined no effect from the presence of multiple pets in the household  or the number of persons with confirmed  or confirmed and suspected  COVID-19. We did not see an association between time the animal typically spent per day with the infected owner for either dogs (p = 0.71) or cats (p = 0.53).When we defined seropositivity as >6 SD above the mean of negative controls, we saw no significant association between seropositivity and owner-reported onset of new respiratory disease in the pet at the time of the owner\u2019s infection for dogs . However>1 animal was seropositive in 3 (16%) of the 19 households where >1 animal was sampled: 2 households in which 2 dogs were seropositive and 1 in which a dog and cat were seropositive.Univariable risk factor analysis did not identify an association of seropositivity with risk factors . We saw We performed sVNT on 53 samples from household pets. Of those, 30/41 (76%) that were positive for IgG and/or IgM (6 SD) were also positive on sVNT compared with 0/12 IgG/IgM negative samples (p<0.0001). Despite the smaller sample size, we repeated risk factor analysis using the samples tested by sVNT. For dogs, licking hands or face of owners was associated with seropositivity . In addition, we noticed an association between positivity and dogs spending 19\u201324 hours with owners . For cats, the association between positivity and being kissed by owners was significant .We collected serum samples from 221 cats during January\u2013June 2021. Full animal information and history were not available for all cats. The median age of the 184 (83%) cats for which age was reported or estimated was 1.5 years (interquartile range 3.25 years). We classified 32/184 (17%) cats as kittens and 152 (83%) as adults . COVID cUnivariable analyses were performed excluding animals whose exposure to persons with COVID-19 was unknown . We idenOf 67 cat and 8 dog samples from THS, 7/75 (9.3%) overall and 7/67 (10%) of cat samples were seropositive (>6 SD). We did not perform risk factor analysis because limited metadata were available.We identified a significant difference in the mean OD between household samples and those from both THS and TAS. Differences between THS and TAS were not significant .In addition to ELISA testing, we also assessed a subset of 112 serum samples (53 household and 59 from shelter and spay/neuter clinic) with the sVNT. We found a significant correlation between the ELISA OD and neutralization of virus binding  , panel A6 TCID50 of SARS-CoV-2 intranasally and orally had detectable viral RNA for 10 days in nasopharyngeal swabs, 7 days in oropharyngeal swabs, and 14 days in rectal swabs, but such high viral challenge may not simulate typical human\u2013cat household interactions .These data indicate relatively common transmission of SARS-CoV-2 from humans to animals and that certain human\u2013animal contacts  appear to increase the risk. We inferred that infections in dogs and cats reflect direct transmission from humans to animals, given the pandemic nature of this virus in humans and limited contact of most household pets with other animals (The relevance of human\u2013pet transmission of SARS-CoV-2 needs further study. We observed an association between infection and clinical disease in both dogs and cats; in most cases, disease was very mild and self-limiting. Clinical data from this study are consistent with other studies indicating limited overall health risk to otherwise healthy dogs and cats (Additional information about SARS-CoV-2 infection, seropositivity, and illness in cats and dogs. Questionnaire used in surveillance of SARS-CoV-2 infection, seropositivity, and illness in household pets. Questionnaire used in surveillance of SARS-CoV-2 infection, seropositivity, and illness in cats and dogs in an animal shelter."}
+{"text": "We analyze a binary classification problem by using a support vector machine based on variational quantum-circuit model. We propose to solve a linear equation of the support vector machine by using a  An efficient application of quantum computations is machine learning, which is called quantum machine learning17 . A support vector machine is one of the most fundamental algorithms for machine learning23, which classifies data into two classes by a hyperplane. A support vector machine (SVM) is a computer algorithm that learns by examples to assign labels to objects. It is a typical method to solve a binary-classification problem18. The optimal hyperplane is determined by an associated linear equation F and 24. Usually, the linear equation is solved by the Harrow-Hassidim-Lloyd (HHL) algorithm25. However, this algorithm requires many quantum gates. Thus, the HHL algorithm is hard to be executed by using a near-term quantum computer. Actually, this algorithm has experimentally been verified only for two and three qubits28. In addition, it requires a unitary operator to execute 21.Quantum computation is a hottest topic in contemporary physics29, variational eigenvalue solver30, quantum circuit learning31 and quantum linear solver33. We use wave functions with variational parameters in QAOA, which are optimized by minimizing the expectation value of the Hamiltonian. A quantum circuit has variational parameters in quantum circuit learning31, which are optimized by minimizing a certain cost function. A quantum linear solver solves a linear equation by variational ansatz33. The simplest method of the optimization is a steepest-descent method.The number of qubits in current quantum computers is restricted. Variational quantum algorithms are appropriate for these small-qubit quantum computers, which use both quantum computers and classical computers. Various methods have been proposed such as Quantum Approximate Optimization Algorithm (QAOA)F by the U satisfying In this paper, we present a variational method for a quantum support vector machine by solving an associated linear equation based on variational quantum circuit learning. We propose a method to expand the matrix A simplest example of the SVM reads as follows. Suppose that there are red and blue points whose distributions are almost separated into two dimensions. We classify these data points into two classes by a line, as illustrated in Fig. M data points are spattered in D dimensions, which we denote F is a In general, F and an arbitrary given state c is introduced to preserve the norm of the state, and it is given by25 is a most famous algorithm to solve this linear equation by a quantum computer. We first construct a Hermitian matrix byF is uniquely obtained by We solve the linear equation  by a qua32 to solve the linear equation (F is expanded in terms of some unitary matrices Recently, variational methods have been proposedequation . In one 32We start with a trial state F be N satisfying F by the gamma matrices z.Let the dimension of the matrix F by column vectors asp denotes the p-th component of q denotes the (q is the decimal representation of the binary number The merit of our method is that it is straightforward to determine i-th qubit if The state  See Eq. . By usinentclass1pt{minimaj, which leads toOnce we have entclass1pt{minima34. We may use this method to find an optimal trial state t by the amount of One of the most common approaches to optimization is the steepest-descent method, where we make iterative steps in directions indicated by the gradient See Eq. . Then, wmentclass2pt{minimp-th component of the trial state n stepp component is 1 and the other components are zero. Then, we calculate the costfunctionp from 1 to p-th component is In the numerical simulation, we discretize the time stepWe denote the saturated cost function 2 in Eq. . We showmentclass2pt{minimA comment is in order. The cost function does not become zero although it becomes very small. It means that the solution is trapped by a local minimum and does not reach the exact solution. It is a general feature of variational algorithms, where we cannot obtain the exact solution. However, the exact solution is unnecessary in many cases including machine learnings. Actually, the classification shown in Fig. U that36. Indeed, an arbitrary unitary matrix is decomposable into a sequential application of quantum gates36, each of which is constructed as a universal quantum circuit systematically42. Universal quantum circuits have so far been demonstrated experimentally for two and three qubits46.In order to construct the trial state U satisfying Eq. (31, where angle variables U, and the cost function is optimized by tuning We may use a variational method to construct ying Eq. . QuantumWe next consider a problem to find a unitary transformation s in Eq. , it is p50, which can be programmable by a customer or a designer after manufacturing in a factory. An FPGA executes any classical algorithms. On the other hand, our variational universal quantum-state generator creates an arbitrary quantum state. We program by using the variational parameters An FPGA is a classical integrated circuitWe show explicitly how the cost function is renewed for each variational step in the case of two- and three-qubit universal quantum circuits in Fig. r, while blue points have a distribution around r. We assume the Gaussian normal distribution. We choose We demonstrate a binary classification problem in two dimensions based on the support vector machine. We prepare a data set, where red points have a distribution around As an example, we show the distribution of red and blue points and the lines obtained by the variational method marked in cyan and by the direct solution of  marked i10 requires M is the number of training data points. It has an advantage over the classical protocol which requires 51, which requires polynomial runtime as a function of the number of data points M and dimension of the feature space The original proposalN qubit can represent N quantum gates54. We need N quantum gates for the execution of N for approximate preparation. In machine learning, the exact solution is unnecessary. Thus, 6N quantum gates are enough.On the other hand, the accuracy is independent of the number of required quantum gates. It is determined by mentclass2pt{minim56 is given by57. It is known59 that the depth of a quantum is linear to the dimension of the feature space N.In this paper, we have used the linear Kernel function , which iF is efficiently inputted into a quantum computer by using the We have proposed that the matrix Although it is possible to obtain the exact solution for the linear equation by the HHL algorithm, it requires many gates. On the other hand, it is often hard to obtain the exact solution by variational methods since trial functions may be trapped to a local minimum. However, this problem is not serious for the machine learning problem because it is more important to obtain an approximate solution efficiently rather than an exact solution by using many gates. Indeed, our optimized hyperplane also well separates red and blue points as shown in Fig. M data, we need to prepare 62 based on the fact that the Kirchhoff law is rewritten in the form of the Schr\u00f6dinger equation63. Our variational algorithm will be simulated by using them.In order to classify 23. We first prepare a set of training data, where each point is marked either in red or blue. Then, we determine a hyperplane separating red and blue points. After learning, input data are classified into red or blue by comparing the input data with the hyperplane. The support vector machine maximizes a margin, which is a distance between the hyperplane and data points. If red and blue points are perfectly separated by the hyperplane, it is called a hard margin problem (Fig.A support vector machine is an algorithm for supervised learningblem Fig.a. Otherwblem Fig.b.We minimize the distance j. The problem is reduced to find the minimum of 64. It is expressed in terms of the Lagrangian asFirst, we consider the hard margin problem, where red and blue points are perfectly separable. All red points satisfy For the soft margin case, we cannot separate two classes exactly. In order to treat this case, we introduce slack variables We explicitly show how to calculate nt}cj in  based onWe show an explicit example of the nt}cj in  is calcuNext, we show an explicit example of the nt}cj in  is calcuAngle variables are used as variational parameters in a universal quantum circuit learning. We present examples for one, two and three qubits.The single-qubit rotation gates are defined byIt is obvious that an arbitrary state is realized starting from the state 4343The two-qubit universal quantum circuit is constructed as42. The three-qubits universal quantum circuit contains 82 variational parameters. We show a quantum circuit in Fig. The three-qubit universal quantum circuit is constructed as39. The minimum numbers of variational parameters are N-qubit unicersal quantum circuits. However, we need more variational parameters in the currently known algorithm for General multi-qubit universal quantum circuit is constructed in Ref.54. They are constructed asn and the target qubit being N quantum gates for N-qubit universal quantum circuits. We show an example of the hardware-efficient quantum circuit with Actually, multi-qubit universal quantum circuits are well approximated by the hardware-efficient quantum circuit34.In addition, an ansatz based on the restricted Boltzmann machine requires All of the numerical calculations are carried out by Mathematica."}
+{"text": "Lytechinus pictus and the sea stars Patiria miniata and Patiriella regularis. We outline procedures to successfully label, mount and image early embryos for 10\u201316\u00a0h, from cleavage stages to early blastula. We show that data obtained with these methods allows 3D segmentation and tracking of individual cells over time, the first step to analyze how cell shape and cell contact differ among species. The methods presented here can be easily adopted by most cell and developmental biology laboratories and adapted to successfully image early embryos of additional species, therefore broadening our understanding of the evolution of morphogenesis.Echinoderm embryos have been model systems for cell and developmental biology for over 150\u00a0years, in good part because of their optical clarity. Discoveries that shaped our understanding of fertilization, cell division and cell differentiation were only possible because of the transparency of sea urchin eggs and embryos, which allowed direct observations of intracellular structures. More recently, live imaging of sea urchin embryos, coupled with fluorescence microscopy, has proven pivotal to uncovering mechanisms of epithelial to mesenchymal transition, cell migration and gastrulation. However, live imaging has mainly been performed on sea urchin embryos, while echinoderms include numerous experimentally tractable species that present interesting variation in key aspects of morphogenesis, including differences in embryo compaction and mechanisms of blastula formation. The study of such variation would allow us not only to understand how tissues are formed in echinoderms, but also to identify which changes in cell shape, cell-matrix and cell-cell contact formation are more likely to result in evolution of new embryonic shapes. Here we argue that adapting live imaging techniques to more echinoderm species will be fundamental to exploit such an evolutionary approach to the study of morphogenesis, as it will allow measuring differences in dynamic cellular behaviors - such as changes in cell shape and cell adhesion - between species. We briefly review existing methods for live imaging of echinoderm embryos and describe in detail how we adapted those methods to allow long-term live imaging of several species, namely the sea urchin  Echinoderm embryos, and the sea urchin in particular, have been models for cell and developmental biology for over a century , leadingAmong the echinoderms, there are numerous experimentally tractable species that share a common developmental program while presenting differences in key aspects of embryonic development, e.g., asymmetry of cell divisions , mode ofAstropecten scoparius, the blastomeres of the early embryo do not adhere to each other at all, but rather to the fertilization envelope , cytoplasm , acto-myosin cortex , mitochondria , lysosomes , nuclei . Ease of use is the strong suit of vital dyes: they can simply be added to the culture medium (sea water for echinoderms) and staining is achieved in a matter of minutes . We havevia live imaging .An effective method to drive the expression of a protein of interest in the whole embryo is the injection of synthetic mRNAs before the first cell division has occurred . The mRNTherefore, injection of mRNAs coding for fluorescent proteins has been used extensively to uniformly label embryos, including echinoderm embryos . The catvia the addition of a poly-adenine tail will solve the problem .within the embryo. In other words, the ideal mounting does not damage nor deform the embryo to be imaged. Especially when aiming at the study of epithelial morphogenesis, avoiding deformation of the embryo is important. Several techniques have been employed for live imaging of echinoderm embryos, foremostly applied to the sea urchin. Among these, the use of a Kiehart chamber . The Ki chamber . The cha chamber . Wet cha chamber . This meEmbedding in agarose requires placing and orienting embryos into 1% ultra-low melting agarose in filtered sea water: this solution will be liquid when kept at 20\u00b0C\u201325\u00b0C and solidify into a soft gel when the temperature is lowered to 16\u00b0C\u201312\u00b0C. The use of PEG-DA gels is a handy alternative that has recently been developed and tested for marine embryos : in thisLytechinus pictus.Coating a glass-bottom dish with protamine is a valid alternative: a 1% protamine sulfate solution is placed on the glass for a few minutes and then washed with filtered sea water. The glass-bottom dish is then filled with water and the embryos are placed onto the glass, to which they will stick. Protamine coating is best used on embryos that are still within their fertilization envelope: in this case the fertilization envelope will remain attached to the glass, effectively immobilizing the embryo within the envelope without damage or deformation. Note that if the naked  embryo is placed directly onto the protamine, the cell-membranes in contact with it will be spreading onto the glass, which is not ideal. We have successfully used this method for long term live imaging of the sea urchin Patiria miniata, Patiriella regularis, Astropecten scoparius, Parastichopus parvimensis - are not compact and fill the fertilization envelope from early on. In these species, even slight deformations of the fertilization envelope following adhesion onto a protamine substrate may alter the embryo morphology. Therefore, we use an adaptation of the Kiehart chamber that allows immobilizing of such embryos. This method consists in using a glass-bottom dish to create a sealed chamber , are regular Petri dishes that have been perforated and resealed by the addition of a coverslip on the bottom of the dish, therefore allowing imaging of the specimen cultured in the dish with an inverted microscope. When mounted on such dishes, the sample is therefore located in what is practically a well within the glass-bottom dish, with diameter equivalent to the perforation and height equivalent to the thickness of the plastic. For MatTek dishes, the height is about 600 microns, which is large enough to fit most echinoderm early embryos: sealing this well with a second coverslip on the top creates a chamber in which embryos can be cultured with no damage or developmental delay for at least 20\u00a0h . Importaea water . We findFor embryos to develop properly within such a chamber, it is paramount that there is no air within the chamber and that the sealant is not toxic and does not allow any evaporation. To achieve this we use vaseline. Specifically, we brush a thin layer of vaseline on the plastic bottom of the dish, around the bottom coverslip. We then add filtered sea water to cover the bottom coverslip and place the embryos in the middle of the well. Finally, we place a second coverslip on top of the well and press it down until all excess water is pushed out of the chamber and the vaseline is uniformly adhering to all sides of the top coverslip. At this point the embryos are immobilized by means of capillarity . More waInterestingly, the same principle can be used to mount live echinoderm embryos into transparent plastic tubes, FEP tubes, which allows imaging on vertical light-sheet microscopes, such as the Zeiss Z1 . In thisOne caveat of this method is that the chamber is completely sealed and therefore does not allow for gas exchange, which could result in hypoxia. In our hands, this is not a problem for sea star embryos, as long as the number of embryos mounted in the chamber is small . It is possible that hypoxia becomes a concern for species that have larger embryos or higher metabolic rates, and so viability within the chamber should be tested before imaging a new species.Lytechinus pictus can be raised between 12\u00b0C and 23\u00b0C, , which consists of a small chamber to be mounted directly on the stage and can be used also for weight-sensitive setups, such as piezo stages. It is important to note that 1) these types of stages do not allow very uniform temperature control, as heat exchange between the stage and warmer air in the room creates temperature gradients within the sample and 2) there are considerable differences between the temperature of the stage and inside the dish. Therefore, it is important to check that the temperature settings allow maintaining the embryos at the desired temperature: for instance, we have found that setting our OKO stage at a temperature of 12\u00b0C results in 16\u00b0C\u201317\u00b0C inside the dish.Temperature control is paramount not only to ensure proper development of embryos, but also to obtain reproducible results when performing live imaging. The optimal temperature for echinoderm embryos depends on the species, with some needing precise temperature control  and othend 23\u00b0C, ). The thPatiriella regularis embryos on a confocal microscope equipped for live-imaging of mammalian cells, i.e., with a temperature control chamber to be set at 37\u00b0C. We repurposed the chamber by connecting it to a portable AC system and testing optimal settings to maintain 18\u00b0C\u201320\u00b0C temperature inside our Petri dish.Devices for temperature exchange and temperature controlled stages, however, can be rather expensive, and not available to labs that may want to get started with live imaging of echinoderm embryos. An alternative is ambient temperature control: either the room in which the microscope is located or a chamber built around the microscope can be cooled to the required temperature. In some cases, a bit of creative problem solving goes a long way. For instance, we have successfully performed live imaging of Lytechinus pictus, Patiria miniata, and Patiriella regularis, on laser scanning confocal microscopes with very good results  and a little more than that for sea urchin embryos (embryo diameter of 100 microns. ca).The use of multi-view light-sheet microscopy is recommended to obtain accurate 3D data of entire embryos . It is iIndependently of the microscope to be used, tuning of imaging settings will be necessary to obtain high quality images of developing embryos. Perhaps the most important parameter is the laser power used for excitation: it should be minimal. Second only to temperature, phototoxicity is the primary cause of abnormal development in embryos that are being live imaged . It is hL. pictus  or South Coast Bio-Marine LLC  and held in free flowing seawater aquaria at a temperature of 12\u00b0C\u201316\u00b0C. Adult Patiriella regularis were collected off the coast of Tasmania  and held in aquaria at a temperature of 20\u00b0C. Sea star gametes were obtained as previously described . All embryos were raised in 0.22\u00a0\u03bcm filtered sea water (FSW) with the addition of 0.6\u00a0\u03bcg/ml Penicillin G sodium salt  and 2\u00a0\u03bcg/ml Streptomycin sulfate salt .Adult escribed . BrieflyPatiria miniata and Patiriella regularis immature oocytes were injected with mRNAs to label membranes  and nuclei . Injected oocytes were incubated at 16\u00b0C overnight, activated and fertilized.mRNAs were synthesized with the mMessage mMachine SP6 Transcription Kit  and additionally polyadenylated with a PolyA Kit . Patiria miniata) or Zeiss LSM 800 confocal microscope . Datasets were 3D rendered using Imaris 6.4 (Bitplane), and segmentation and tracking was achieved using the Fiji plugin Limeseg . Transmitted light inverted cell culture microscope . Micromanipulator .- Needles: Pull needles, using a borosilicate capillary with filament and 1\u00a0mm external diameter (MPI TW-100). Using a Sutter Instrument P-1000 needle puller we use the following settings: Heat = Ramp +10; Pull = 90; Velocity = 80; Delay = 90; Pressure 200; Delay mode: active. If possible, pull needles shortly before injection, to avoid dust or other particles from depositing inside the needle and possibly causing clogging during injection.- Injection chamber: place a stripe of electrical tape to one side of a microscopy slide. Make sure there are no folds or bumps. Placing a coverslip on top of the slide with electrical tape will create a chamber to line up the sea star oocytes up against for injection.- mRNA: Synthesize the mRNA for injection, in this case mRNA coding for membrane bound mCitrine and H2B-RFP. Linearize pCS2-lck-mCitrine and pCS2-H2BRFP plasmids by digesting with NotI clean up the digest using the Qiagen PCR clean up kit. For best results, digest 10\u00a0\u03bcg plasmid overnight and then elute the linearized plasmid in 20\u00a0\u03bcl of nuclease free water. Run the linearized plasmid on a gel to make sure the plasmids are fully linearized. Use mMessage machine mRNA synthesis kit with the linearized plasmid as template, followed by addition of polyA tail with a polyA tailing kit. For mRNA synthesis with mMessage machine SP6 kit, we have best results incubating the reaction overnight at 30\u00b0C, instead of the recommended 2\u00a0h at 37\u00b0C. Precipitate mRNA with Phenol/Chloroform. Dilute mRNA in 15\u00a0\u03bcl of nuclease free water for a 20\u00a0\u03bcl mMessage machine reaction. Quantify mRNA concentration, e.g., with a Nanodrop, and run a gel to check for integrity. Preserve mRNA stock at a concentration of 1\u20132\u00a0\u03bcg at \u221220\u00b0C.- Injection mix: Immediately prior to injecting, prepare 2\u00a0\u03bcl of lck-mCitrine mRNA at a concentration of 50\u2013100\u00a0ng/\u03bcl and H2B-RFP mRNA at a concentration of 200\u2013400\u00a0ng/\u03bcl. Addition of a dye, such as phenol red or fluorescent dextran, to the injection mix is helpful to monitor the success of injection but is not necessary. Spin the injection mix for 2min at 16\u00a0Kg.- Gametes: Gametes are obtained by dissection of the ovaries and spermogonia from adult animals. Make a small incision on the ventral side of an adult sea star at the base of one arm. Use tweezers to extract a piece of gonad. Store sperm dry in an Eppendorf tube at 4\u00b0C for up to 2\u00a0days. Place ovaries in PS-FSW and cut them open: individual oocytes will be released. Remove the remaining pieces of ovary. Wash the oocytes with PS-FSW twice. Shortly before injection, transfer oocytes to a Petri dish.- 1-Methyladenine: Dissolve 1-MA in nuclease free water at a concentration of 10\u00a0mM. Dissolving requires heating the solution at 60\u00b0C. Aliquot this stock solution and store at \u221220\u00b0C. We have successfully used frozen aliquots for up to 2\u00a0years after preparation.- MatTek dish (P35G-1.5-14-C).- Vaseline.- Load needles: Place 0.5\u00a0\u03bcl of injection mix on the back of a needle that is held vertically. Wait 2\u20135\u00a0min for the injection mix to descend the needle.- Prepare the injection chamber: Place a clean coverslip over the slide with the electrical tape. Pipette 4\u00a0\u03bcl of PS-FSW between the coverslip and the slide. Press the coverslip against the electrical tape so that the water is sucked in between the coverslip and the tape.- Position needle: Insert the loaded needle in the microinjector holder. Adjust the injector so that a small positive pressure is applied to the needle. Using a Narishige IM-400 we set balance pressure to 60\u201380\u00a0KPa. Position the needle in the middle of the microscope field of view. Check that the tip is not broken.- Load injection chamber: Use a p20 pipette to transfer oocytes to the injection chamber. Pipette up to 7\u00a0\u03bcl of PS-FSW with oocytes on one side of the injection chamber, between the coverslip and slide: the oocytes will move into the chamber by capillarity. Adjust the position of the coverslip so that the oocytes are positioned in one line along the tape.- Inject! Break the tip of the needle by gently pressing again the slide. Adjust the injector settings so that liquid flows out of the needle slowly and constantly. Insert the needle in each oocyte by pressing it against the tape. Remove the needle once a drop of liquid with diameter no bigger than \u00bc of the oocyte diameter has been injected.- Recover injected oocytes: Dip the injection chamber into a Petri dish with PS-FSW. Slide the coverslip upwards. The oocytes will fall to the bottom of the dish. Clean the chamber with lens cleaning paper.This injection method requires some speed, as the volume of PS-FSW in the chamber is rather small and will start to dry up in 5\u201310\u00a0min. It is best to start with loading a small number of oocytes in the chamber and repeat the process as needed. Once mastered the injections, one can easily inject over 100 embryos each round.- mRNA translation: Incubate the injected oocytes at 16\u00b0C overnight to allow for translation of the injected mRNA. Check for fluorescence: if the injection was successful, both membranes and germinal vesicle will be fluorescent, with mCitrine and RFP, respectively.To inject inside the chamber, it is best to position the needle horizontally, as perfectly as possible. In this way it will be easier to insert the needle between slide and coverslip.- Oocyte activation: Add 1-MA to the injected oocytes to a final concentration of 3\u00a0\u03bcM. Incubate for 1\u00a0h at 16\u00b0C. Check that the germinal vesicle is disrupted.- Sperm activation: When the oocytes are activated , dilute sperm into PS-FSW 1:1000. This will activate the sperm that will be actively swimming for about 20\u00a0min.- Fertilize! Add a few drops of activated sperm to the activated oocytes (approx dilution of 1:1000). Check that the sperm is motile under a microscope. After 10\u00a0min the fertilization envelope will be clearly elevated, a hallmark of successful fertilization. Wash with PS-FSW twice to remove excess sperm.If the injected oocytes are not mature they will not be activated and will retain an intact germinal vesicle after activation with 1-MA. Often both mature and immature oocytes are present in an ovary: in this case only the mature ones will be activated and fertilized, effectively removing the need for selecting mature oocytes prior to injection.- Once the embryos have reached the desired developmental stage, prepare a MatTek dish chamber by brushing a thin layer of vaseline on the plastic portion of the MatTek dish, just around the base coverslip.- Fill the inner chamber of the MatTek dish with 250\u00a0\u03bcl of PS-FSW.- Transfer a maximum of 20\u201330 embryos to the MatTek dish, placing them in the center of the base coverslip.- Gently place a 22X22 coverslip on top of the PS-FSW containing the embryos and push it down slowly so that excess water is pushed out of the chamber while the embryos remain somewhat centered in the dish.- Fill the MatTek dish with 2\u00a0ml of PS-FSW.1. When pushing the top coverslip down, make sure that a uniform layer of vaseline has sealed the coverslip in place. If in doubt, add a thick layer of vaseline all around the top coverslip.2. This method does not allow orienting of the mounted embryos: the ease of obtaining high numbers of injected and mounted embryos means that one can rely on the chances of finding a certain number of embryos in the desired orientation.3. Adding water to the MatTek dish after mounting helps maintain the desired temperature in the dish.- Prepare temperature controlled stage: 1\u00a0h before imaging, start the cooling of the temperature controlled stage. This allows the stage to be at the desired temperature when starting imaging, thereby reducing drift during the acquisition.- Adjust imaging settings: Set-up the imaging software as needed. In this case we used a Leica Sp8 inverted confocal with settings:- time-lapse- multi-positioning- z-stacks- two channels: mCitrine  and RFP - Bidirectional scanning- Resonant scanner 8000\u00a0Hz- Line average 3- Frame average 2- 20X objective, 0.70 NA- Pinhole at 1.20 AU- Z-step: 0.91\u00a0\u03bcm- Set up imaging: Once the MatTek dish is placed on the microscope stage, find the embryos to image and mark their position in the software. Set an appropriate z-stack for each position. Set duration of acquisition  and timeframe . Hit the start button!The mounted embryos are now ready to be imaged. Settings will vary depending on the scope of imaging. Here we will refer to the settings we used to image multiple embryos for up to 16\u00a0h.Make sure the z-stack starts from below the coverslip and to set the z-stack a bit bigger than what seems necessary. This helps avoid the sample moving out of the set z-stack because of morphogenesis or stage drift.Lytechinus pictus were collected at La Jolla, CA, United States and held in free flowing seawater aquaria at a temperature of 16\u00b0C. Spawning was induced by injection of 0.5\u00a0M KCl, as previously described  on a glass bottom dish  coated with protamine, incubated at 16\u00b0C until the 2-cell stage and then imaged on an inverted Leica Sp8 confocal microscope  until the 16-cell stage. Datasets were 3D rendered using Imaris 6.4 (Bitplane), segmentation and tracking was performed using the Fiji plugin Limeseg .  Limeseg .- Injection set up: Microinjector . Transmitted light inverted cell culture microscope . Micromanipulator .- Needles: Pull needles, using a borosilicate capillary with filament and 1\u00a0mm external diameter (MPI TW-100). Using a Sutter Instrument P-1000 needle puller we use the following settings: Heat = Ramp +10; Pull = 90; Velocity = 80; Delay = 90; Pressure 200; Delay mode: active. If possible, pull needles shortly before injection, to avoid dust or other particles from depositing inside the needle and possibly causing clogging during injection.- Protamine MatTek dishes: Using tweezers, mark a line on the plastic of the MatTek dish, close to the cover: this will help break the needle for injection. Cover the MatTek dish coverslip with 200\u00a0\u03bcl of 1% protamine sulfate solution. Incubate for 5\u201310\u00a0min. Remove most of the 1% protamine solution and let dry.- mRNA: Synthesize the mRNA for injection, in this case mRNA coding for membrane bound mCitrine and H2B-RFP. Linearize pCS2-lck-mCitrine and pCS2-H2BRFP plasmids by digesting with NotI. Clean up the digest using the Qiagen PCR clean up kit. For best results, digest 10\u00a0\u03bcg plasmid overnight and then elute the linearized plasmid in 20\u00a0\u03bcl of nuclease free water. Run the linearized plasmid on a gel to make sure the plasmids are fully linearized. Use mMessage machine mRNA synthesis kit with the linearized plasmid as template. For mRNA synthesis with mMessage machine SP6 kit, we have best results incubating the reaction overnight at 30\u00b0C, instead of the recommended 2\u00a0h at 37\u00b0C. Precipitate mRNA with Phenol Chloroform. Dilute mRNA in 15\u00a0\u03bcl of nuclease free water for a 20\u00a0\u03bcl mMessage machine reaction. Quantify mRNA concentration, e.g., with a Nanodrop, and run a gel to check for integrity. Preserve mRNA stock at a concentration of 1\u20132\u00a0\u03bcg\u00a0at \u221220\u00b0C.- Injection mix: Immediately prior to injecting, prepare 2\u00a0\u03bcl of lck-mCitrine mRNA at a concentration of 25\u201375\u00a0ng/\u03bcl and H2B-RFP mRNA at a concentration of 50\u2013100\u00a0ng/\u03bcl. Addition of a dye, such as phenol red or fluorescent dextran, to the injection mix is helpful to monitor the success of injection but is not necessary. Spin the injection mix for 2\u00a0min at 16\u00a0Kg.- Gametes: Gametes are obtained by injecting adult animals with 200\u2013500\u00a0\u03bcl of 0.5\u00a0M KCl, which induces spawning. Once spawning has begun, place females upside down in a small beaker containing PS-FSW and males on an empty Petri dish. Transfer the released sperm to an Eppendorf tube and store dry at 4\u00b0C, for up to 2\u00a0days. Wash oocytes 3 times in PS-FSW. Shortly before injection, transfer oocytes to a glass bottom dish.Sperm can be stored dry at 4\u00b0C for up to 2\u00a0days and oocytes can be kept in PS-FSW at 16\u00b0C for a few hours. However, fertilization rates will decrease the longer oocytes are stored: it is best to fertilize and inject immediately after spawning.L. pictus, by which females have larger gonopores than males   , the loc- Load needles: Place 0.5\u00a0\u03bcl of injection mix on the back of a needle that is held vertically. Wait 2\u20135\u00a0min for the injection mix to descend the needle.- Position needle: Insert the loaded needle in the microinjector holder. Adjust the injector so that a small positive pressure is applied to the needle. Using a Narishige IM-400 we set balance pressure to 60\u201380\u00a0KPa. Position the needle in the middle of the microscope field of view. Check that the tip is not broken.- Activate sperm: Dilute sperm into PS-FSW 1:1000. This will activate the sperm that will be actively swimming for about 20\u00a0min.- Row oocytes: Wash the protamine MatTek dish twice with PS-FSW and then fill it with PS-FSW. Using a small glass pipette, transfer oocytes to the MatTek dish and place them in rows, for ease of injection.To inject inside the MatTek dish, it is best to position the needle at a 45\u00b0 angle with the bottom of the dish.- Fertilize: Add a few drops of activated sperm to the activated oocytes (approx dilution of 1:1000).- Inject! Place the MatTek dish on the microscope. Break the tip of the needle by gently pressing against the mark on the plastic. Adjust the injector settings so that liquid flows out of the needle slowly and constantly. Insert the needle in each zygote. Remove the needle once a drop of liquid with diameter no bigger than \u00bc of the oocyte diameter has been injected.- Wash out excess sperm: Exchange as much of the PS-FWS in the dish as possible, working gently to avoid dislodging the injected embryos.Conventionally, oocytes are rowed tightly, which helps keep them still for injection. However, if the embryos are left to develop in place they will press against each other, thereby altering their shape. Therefore, if embryonic shape is of interest, it is necessary to row embryos sparsely, so that they don\u2019t touch each other once the fertilization envelopes are raised.1. Reduce protamine concentration to 0.5%, so the glass bottom is less adhesive2. Wash the oocytes twice instead of three times, so some jelly is left on the oocytes, thereby reducing adhesion to protamine.3. Quickly fertilize after rowing, in that way the oocytes do not have time to spread over the protamine as that is prevented once the fertilization envelope is lifted.With this method, the embryos are pinned to the glass bottom of the dish because their fertilization envelopes adhere to the protamine coating: the embryos stay in place but are not deformed. However, adhesion to protamine is variable and changes from female to female: sometimes the oocytes spread dramatically on the protamine dish and that results in poor fertilization and/or deformed embryos. This effect can be avoided in three ways:- Prepare temperature controlled stage: 1\u00a0h before imaging, start the cooling of the temperature controlled stage. This allows the stage to be at the desired temperature when starting imaging, thereby reducing drift during the acquisition.- Adjust imaging settings: Set-up the imaging software as needed. In this case we used a Leica Sp8 inverted confocal with settings:- time-lapse- multi-positioning- z-stacks- two channels: mCitrine  and RFP - Bidirectional scanning- Resonant scanner 8000\u00a0Hz- Line average 3- Frame average 2- 20X objective, 0.70 NA- Pinhole at 1.20 AU- Z-step: 0.91\u00a0\u03bcm- Set up imaging: Once the MatTek dish is placed on the microscope stage, find the embryos to image and mark their position in the software. Set an appropriate z-stack for each position. Set duration of acquisition (e.g. 16\u00a0h) and timeframe . Hit the start button!The injected embryos will start expressing lck-mCitrine and H2B-RFP at around 8\u201316 cells stage, depending on the amount of mRNA injected. Since they have been injected and positioned on a glass bottom dish, they can be imaged directly, without the need for further mounting. Settings will vary depending on the scope of imaging. Here we will refer to the settings we used to image multiple embryos for up to 16\u00a0h.Make sure the z-stack starts from below the coverslip and to set the z-stack a bit bigger than what seems necessary. This helps avoid the sample moving out of the set z-stack because of morphogenesis or stage drift.L. pictus) and two asteroid sea stars (P. miniata and P. regularis). To this aim, we injected 1-cell stage sea urchin embryos with mRNAs coding for a membrane bound mCitrine (lck-mCitrine) and a nuclear CFP (H2B-CFP). Injections were performed directly on glass bottomed Petri dishes, so that successfully injected embryos could be imaged directly without further manipulations. Injected embryos were imaged on a confocal microscope starting at the 2-cell stage and until hatching  and incubated them overnight at 16\u00b0C. This results in the oocytes translating the mRNAs and expressing the fluorescently tagged proteins . We thenImaged embryos developed normally as they showed no phenotypes when compared to untreated siblings . MoreoveDrosophila (C. elegans (The methods described here allow long term live imaging of several echinoderm embryos, and can be easily adapted by most cell and developmental biology labs that wish to expand their work to new model systems. Live imaging of early embryos at subcellular resolution in multiple species will deliver exciting new insight on the evolution of development. A particularly interesting avenue will be that of coupling live imaging with both biophysics and molecular approaches, which has already proven very effective in uncovering mechanisms of morphogenesis in the zebrafish , mouse , Drosophosophila , C. eleg elegans  and asci elegans . Applyinvia a quick osmotic shock\u2014or incubating the larvae with drugs inhibiting ciliary movement (Echinoderms also have variation in key aspects of embryonic development at later stages, including gastrulation, with variation in the modes of tissue invagination and cell ingression  and orgamovement . Howevermovement .The challenge ahead is therefore to develop mounting and imaging techniques amenable to imaging of echinoderm and other marine embryos at all stages of development. Possible avenues include screening for compounds that inhibit ciliary movement without affecting embryogenesis , the dev"}
+{"text": "As noise-induced hearing loss (NIHL) is a leading cause of occupational diseases, there is an urgent need for the development of preventive and therapeutic interventions. To avoid user-compliance-based problems occurring with conventional protection devices, the pharmacological prevention is currently in the focus of hearing research. Noise exposure leads to an increase in reactive oxygen species (ROS) in the cochlea. This way antioxidant agents are a promising option for pharmacological interventions. Previous animal studies reported preventive as well as therapeutic effects of Insulin-like growth factor 1 (IGF-1) in the context of NIHL. Unfortunately, in patients the time point of the noise trauma cannot always be predicted, and additive effects may occur. Therefore, continuous prevention seems to be beneficial. The present study aimed to investigate the preventive potential of continuous administration of low concentrations of IGF-1 to the inner ear in an animal model of NIHL. Guinea pigs were unilaterally implanted with an osmotic minipump. One week after surgery they received noise trauma, inducing a temporary threshold shift. Continuous IGF-1 delivery lasted for seven more days. It did not lead to significantly improved hearing thresholds compared to control animals. Quite the contrary, there is a hint for a higher noise susceptibility. Nevertheless, changes in the perilymph proteome indicate a reduced damage and better repair mechanisms through the IGF-1 treatment. Thus, future studies should investigate delivery methods enabling continuous prevention but reducing the risk of an overdosage. With a global proportion of 16% noise-induced hearing loss (NIHL), a form of sensorineural hearing loss (SNHL), is one of the leading causes of occupational diseases amongst adults. It is caused by either one-time exposure to high level noise or by continuous ambient exposure , firefigSince up to now there are no reliable treatment strategies for NIHL, prevention is the method of choice\u2014conventionally with earplugs or other hearing protection devices. The outcome of such devices varies dependent on the user\u2019s compliance and in some work situations, e.g., in the kindergarten, the use is impossible. As a concept to circumvent this problem, pharmacological prevention is investigated in several animal and some human studies ,20,21. MInsulin-like growth factor 1 (IGF-1) is a polypeptide with 70 amino acids and is synthetized in the liver. For IGF-1, antioxidant effects have been described in various disease models such as liver cirrhosis ,32 or caHowever, regarding NIHL, all up to now published studies have one limitation: they all investigated temporary delivery. Unfortunately, in many situations, the timing of acoustic trauma cannot be accurately predicted, or cumulative effects of noise  occur. Tn = 7). The control group (n = 6) received an osmotic pump containing artificial perilymph (AP). On day 0 an additional AABR was performed followed by 4 h noise exposure and a second AABR measurement 30 min after the noise insult. After 1 day (day 1) an AABR measurement and a \u00b5CT to analyze to implant\u2019s position were performed. One week after noise insult, on day 7, a final AABR was followed by \u00b5CT imaging, apical perilymph sampling and euthanasia. For a detailed overview over the experimental timeline and performed AABR measurements see Guinea pigs were used as animal model. One week before noise insult (d -7) the animal\u2019s normal hearing was verified by acoustically evoked auditory brainstem response (AABR) measurement and subsequently an IGF-1-delivering device . One day after noise trauma the hearing threshold in both groups recovered, resulting in a decreased threshold shift (p \u2264 0.05) and 4 kHz . One week after noise trauma the recovery proceeded and partially no noise-induced threshold shift was detectable anymore . Since the total volume of the guinea pig perilymphatic space is ~8.87 \u00b5L and ~4.66 \u00b5L for the scala tympani , we collTo better understand the impact of IGF-1 delivery, the altered proteins in the comparison of the perilymph proteomes of the two implant conditions as well as the two contralateral conditions were further characterized concerning their name and their regulation. In the perilymph of IGF-1-treated ears the three altered proteins in comparison to the AP-treated ears were increased .The perilymph of the contralateral ears shows more variation in the comparison IGF-1- vs. AP-treated animals. Five proteins were increased and four proteins were decreased in the contralateral ears of the IGF-1 group .All groups showed a variance in the ribbon number per inner hair cell (IHC) according to the corresponding frequency with the highest number in the middle-frequencies . This isTwo-way ANOVA revealed no statistically significant difference between all four groups , but a tendency was apparent: In group comparison across all frequencies, AP ipsilateral had most frequently the highest absolute CtBP2 counts. The fewest CtBP2 puncta were counted most frequently in the IGF-1 ipsilateral group as well as the IGF-1 contralateral group.It was similar when looking at the PSD95 counts. AP ipsilateral had most frequently the highest counts. The fewest PSD 95 counts were most frequently counted in the IGF-1 contralateral group. However, the most frequent highest colocalized counts were not seen in the AP ipsilateral but in the AP contralateral group.The two IGF-1 groups had the fewest colocalized counts with equal frequency.Since some noticeable differences in the absolute counts were seen between the groups, the ratio of the mean values of the PSD95 and colocalized points in relation to the mean number of CtBP2 puncta of the respective condition were also considered for further analysis . As a raNIHL is a disorder with global importance , but unfAs already known, IGF-1 has antioxidant effects ,49,50,51As other studies have already shown that a local IGF-1 application to the round window membrane shortly before or directly after the noise trauma has a positive effect, we aimed to determine the effect of a long-term administration. The diffusion of IGF-1 through the membrane is challenging . TherefoOne week after starting the IGF-1 delivery, the surgery related threshold shifts of IGF-1 and AP implanted animals did not differ significantly . NeverthIn order to validate this tendency, histological evaluation of the inner hair cell synapses was performed. No significant differences were observed between the four groups  . All groTo understand the consequences of the IGF-1 application on the cochlear function, a proteome analysis of the perilymph was performed. Nowadays, human perilymph can be obtained from patients undergoing surgical procedures such as cochlear implantation , its anaNevertheless, the IGF-1 treated animals showed higher levels of Collagen type VI alpha 3 (COL6A3) chain in both implanted and contralateral ears. Normally, various collagens are decreased in noise exposed mice ,80. As tConsidering all the above-mentioned points, there are both positive and negative effects of the IGF-1 application. As Gao et al. reported for the maintenance of ribbon synapses, there is a belly-shaped dose\u2013response curve . It can The experimental setup was previously published in detail by Malfeld et al. . Therefo\u00ae 2006, DURECT Corporation, Cupertino, CA, USA; pumping rate 0.15 \u00b5L/h) were filled and connected to a hook-delivery device (HDD) consisting of a commercially available silicone catheter  and a small hook-shaped stainless-steel tip  with an outer diameter of 0.31 mm [\u00ae Germany, Hamburg, Germany) in a concentration of 2 \u03bcg/mL diluted in AP. The pumping rate of the osmotic pump results in a release of 0.3 ng IGF-1 per hour. During the priming time of 60 h each pumps\u2019 function was macroscopic controlled by fluid drain out of the catheters\u2019 tip [Osmotic minipumps (ALZET 0.31 mm . The pumThirteen (seven in the IGF-1 group and six in the control group) male Dunkin Hartley guinea pigs  weighting between 350 g and 426 g were included in the study. Animals were housed in a temperature- and humidity-controlled room, exposed to a 24 h light-dark cycle (14 h/10 h) with free access to food and water. All experimental procedures were conducted in accordance with the German \u201cLaw on Protecting Animals\u201d and with the European Communities Council Directive 2010/63/EU for the protection of animals used for experimental purposes. The use of animals for scientific purposes was permitted by the local authorities (Lower Saxony State Office for Consumer Protection and Food Safety (LAVES), Oldenburg, Germany, registration number 19/3145).All procedures were performed under general anesthesia  with previous sedation . During every anesthesia, the animals were placed on a heating pad. Areas to be incised were locally infiltrated with prilocaine. To reduce pain and to prevent infections the animals received subcutaneously 0.2 mg/kg meloxicam and 10 mg/kg enrofloxacin. Euthanasia was performed via intracardiac injection of not less than 300 mg/kg pentobarbital.Acoustic stimulation and recording of the auditory brainstem signals were performed using a Pilot Blankenfeld system that was modified for the use in guinea pigs  in a soundproof booth. Acoustic clicks were used to detect general auditory system thresholds. Frequency-specific acoustic thresholds were detected using tone bursts of 500 Hz, 1 kHz, 2 kHz, 4 kHz, 8 kHz, 16 kHz, 32 kHz and 40 kHz. Stimuli were presented by calibrated loudspeakers via a plastic cone placed in the outer ear canal. The contralateral ear was masked using white noise 30 dB lower than the stimulus. Determination of the hearing thresholds was done by visual inspection of AABR signals in the system\u2019s analyze function at a maximum magnification of 700 nV/Div. The lowest stimulus intensity at which AABR signals could be detected was defined as the hearing threshold. Where it could not be defined up to the maximum sound stimulus level of 100 dB sound pressure level (SPL) peak (85 dB SPL peak for 40 kHz), the threshold was defined as 110 dB SPL peak or 95 dB SPL peak for 40 kHz. All animals fulfilled the criterion of initial normal hearing (click thresholds \u2264 40 dB SPL peak) .The hearing threshold shift due to implantation was set as the difference between the measured thresholds of day \u22127 and day 0 pre noise exposure. The threshold shifts due to noise at different time points after exposure were set as the difference between the hearing thresholds of day 0 30 min post noise, day 1, and day 7 in comparison to the day 0 pre noise threshold.Following general anesthesia and additional local anesthesia of the areas to be incised, the scull was exposed. The left bulla was exposed using a retroauricular approach. A subcutaneous tunnel was built connecting the skin incision at the skull and the postauricular incision, in which the catheter was guided to the middle ear cavity. After opening the round window membrane using a micro-hook, the tip was inserted in the round window and the bulla was closed using UV cement . The osmotic pump was placed in a subcutaneous pocket between the scapulae and the catheter placed on the head. To avoid tractive forces reaching the implant, a small, halved silicon tube was fixed at the skull guiding the catheter. The postauricular wound was closed in two layers and the wound at the skull was closed with u-sutures.The anesthetized animal was placed in a sound-insulated box. Calibrated loudspeaker  were bilaterally placed directly in front of the animal\u2019s outer ear. Beethoven -5th Symphony, 4th movement: Allegro; Presto played by the Ensemble Reflector and recorded by PASCHENRecords was used as noise stimulus. The original audio was modified to generate a flat power spectrum between 200 Hz and 40 kHz (max. range 30 dB between frequencies), presented at a peak SPL of 120 dB. An exposure time of 4 h was chosen, which is known to cause a moderate temporary threshold shift in HDD implanted guinea pigs .g the supernatant containing the peptides samples was analyzed with LC-MS using a DDA method with a RSLC and reversed phase chromatography and an Orbitrap Fusion Lumos , as described recently [14 days after starting the IGF-1 treatment, i.e., 7 days after TTS insult, animals were anaesthetized and following AABR measurement and \u00b5CT they received an additional local anesthetic nerve block. The bullae were exposed using a ventral approach. Perilymph was obtained by a cochleostomy in the apical region of the cochlea using the capillary forces of modified micro glass capillaries . Each sarecently . Raw MS recently  and Persrecently  and guinrecently . Proteint-test. p-values < 0.05 were considered to be statistically significant. Proteins were mapped to the categories molecular function, biological process and cellular compartment by Gene Ontology (GO). GO offers the mapping of proteins at the UniProt Website http:/www.uniprot.org (accessed on 13 June 2022) based on the protein\u2019s information in the UniProt Knowledgebase. Uncharacterized proteins were identified using Basic Local Alignment Search Tool (BLAST), which compares the identified protein sequence with sequences already included in a database. The perilymph data set is available publicly through this link: https://github.com/vianna-research/guinea-pig-perilymph-proteome-publication (accessed on 10 October 2022).After normalization on median intensity values, the data were tested for significant differences between groups using student\u2019s After euthanasia, the bullae were harvested and the HDD\u2019s position in the round window was checked. The HDD was explanted and the pumping of the osmotic pumps was rechecked. Both oval and round windows were opened and the cochlea was slowly perfused with 4% paraformaldehyde (PFA) via the round window followed by 1 h fixation in 4% PFA on ice. All following decalcification steps were performed with gentle agitation at room temperature (RT). After rinsing 3 \u00d7 10 min with phosphate-buffered saline (PBS), the specimens were decalcified in 10% ethylenediamine tetraacetic acid-disodium salt  in PBS, pH 7.4, with EDTA changes every 1\u20133 days. After 21 days in EDTA, the cochleae were washed 3 \u00d7 10 min with PBS. The basilar membrane was dissected in 8\u20139 pieces under a dissecting microscope and all pieces were transferred in PBS on glass slices to a humidity chamber for staining against the hair cells and the ribbon synapses. As the preparation was performed from apical to basal, the order of the pieces was noted. The staining protocol was modified from Wang et al.  and Shi Permeabilization was achieved by 1% Triton-X (Sigma-Aldrich) in PBS for 1.5 h at room temperature. Subsequently the samples were blocked for not less than 4 h with blocking solution /1% Triton-X/PBS). The incubation time of 36 h at 4 \u00b0C for the primary antibodies  was followed by 3 \u00d7 10 min washing steps with PBS at RT. Secondary antibodies  for 4 h at RT followed by three washing steps. Subsequently after removing the PBS, a drop of mounting medium  was added and the specimen was covered with a cover slip.https://www.masseyeandear.org/research/otolaryngology/eaton-peabody-laboratories/histology-core, accessed on 17 March 2021). Afterwards, detailed images of the inner hair cells at regions corresponding to all tested frequencies via AABR measurements were created. For this purpose, a 63-objective  with immersion oil was used and an additional optical zoom of about 1.5 (1.25 to 1.8) was added. The z-stacks with a final size of 6.5 to 19.5 \u00b5m were generated in 0.5 \u00b5m steps with a pinhole size of 95.5 \u00b5m. To investigate the condition of the inner ear ribbon synapses, the presynaptic (CtBP2), postsynaptic (PSD95) and colocalized puncta, which indicate an intact synapse [Confocal Laser Scanning Microscopy (CLSM) of the cochlear whole mounts was performed using a Leica TCS SP8. To generate overview images of each fragment a 20-objective  with immersion oil (Leica Microsystems #11513859) was used. Excitation was carried out using an argon-laser with 488 nm (Alexa 488), 568 nm (Alexa 568), and 650 nm (Cy5) emission maxima and the photomultiplier gates were adjusted to 504\u2013572 nm, 582\u2013644 nm, and 654\u2013783 nm, respectively. Stacks were generated with a step size of 3 \u00b5m, resulting in a final size of 18 to 48 \u00b5m. The pinhole size was 56.7 \u00b5m and the zoom factor was 0.75. Frequency-mapping of each cochlea was conducted using a custom-made ImageJ plugin  and p \u2264 0.01 (**). For information about the statistical analysis of the perilymph data see The statistical analysis of ABR and histological data was performed using GraphPad Prism\u00a9 version 8.4.3. Data were checked for normal distribution using the Kolmogorov\u2013Smirnov test. Hearing threshold or threshold shifts at different time points between groups were analyzed using an unpaired t-test. Synapse counts were compared across all groups using a 2-way ANOVA. The data are reported as mean \u00b1 standard deviation (SD). Statistical significance was considered and depicted at Contrary to the literature, the present study did not show any significant improvement in NIHL with preventive administration of IGF-1 via osmotic pumps. There were indications of increased sensitivity to noise after IGF-1 application. Nevertheless, changes in the perilymph proteome were also shown, which could indicate reduced damage and better repair mechanisms. Future studies using IGF-1 should consider investigating other continuous delivery methods for prevention of NIHL but should avoid overdosage."}
+{"text": "Noise-induced hearing loss (NIHL) is one of the leading causes of sensorineural hearing loss with global importance. The current treatment of choice for patients with hearing problems is a hearing aid or a cochlear implant. However, there is currently no treatment to restore physiological hearing. The development of preventive drugs is currently the focus of hearing research. In order to test the efficacy of a drug, the active ingredient has to be applied at reliable concentrations over a period of time. Osmotic minipumps can provide local drug delivery into the perilymph. Combined with a cochlear implant or a tube, the implantation of the pumps may lead to increased hearing thresholds. Such surgery-related threshold shifts complicate the examination of other factors, such as noise. The aim of the present study was to develop an animal model for the examination of substances that potentially prevent NIHL. For this purpose, six male guinea pigs were unilaterally implanted with a silicon catheter with a hook-shaped microcannula at its tip, attached to an artificial perilymph containing osmotic minipump. One week after surgery, the animals were exposed to four hours of a musical piece, presented at 120 dB SPL, to induce a threshold shift. The implantation of the hook-delivery device caused a moderate threshold shift that allows to detect an additional noise-induced temporary threshold shift. This method enables to investigate drug effects delivered prior to the noise insult in order to establish a preventive strategy against noise-induced temporary threshold shifts. The established drug delivery approach allows the release of drugs into the inner ear in a known concentration and for a known duration. This provides a scientific tool for basic research on drug effects in normal hearing animals. Excessive overexposure to noise due to occupational or recreational activities can lead to noise-induced hearing loss (NIHL), one of the leading causes of sensorineural hearing loss (SNHL) in people. SNHL is characterized by hearing threshold elevation, caused by a loss of cochlear sensory cells and a subsequent degeneration of the spiral ganglion neurons (SGN) and their central projections ,4,5,6,7.Guinea pigs are a commonly used animal model in hearing research. They are used to assess the normal structure and function of the cochlea and auditory pathways, as well as for studies on therapy development for the pathological auditory system, after damage induced by noise exposure, ototoxic drug treatment, or other insults . DevelopThe aim of the present study was to develop a pump-catheter system for chronic drug delivery in an animal model with low surgery-related threshold shifts, which allows the investigation of the effect of subsequent noise trauma and the future treatment strategies against NIHL.\u00ae rat jugular catheter, DURECT Corporation, Cupertino, CA, USA; 0.94 mm OD; 0.51 mm ID) was combined with a small stainless-steel tip , with an outer diameter of 0.31 mm. For this purpose, the cone was removed and the cannula was bent to an angle around 90\u00b0. The shorter shank had a maximum length of 1.5 mm. The longer shank was shortened to a maximum length of 8 mm and inserted in the catheter. The catheter and tip were connected using tissue glue , paying attention to not block the lumen  [\u00ae 2006, DURECT Corporation, Cupertino, CA, USA; pumping rate 0.15 \u00b5L/h) and catheters was conducted under sterile conditions, with a flow based on the guidelines of the manufacturer. The self-made hook-delivery device (HDD) was attached to the pump flow moderator by insertion. To avoid disconnection of the catheter and flow moderator, a small drop of UV cement  was used. Since a catheter was used, additional priming of 60 h was needed, as required by the manufacturer. During this time, the pumps were placed in a 6-well-plate , with every tip of the catheters positioned in a 0.5 mL Eppendorf\u00ae tube    as the mGermany) C. This eAfter the in vivo tests (see below), the pumping of the explanted pumps was re-checked using the same procedure.Six adult male Dunkin-Hartley guinea pigs , weighing between 374 g and 426 g, were used. All animals received an osmotic pump implanted unilaterally in the left ear  and all ears were exposed to noise trauma (n = 12 implanted and not implanted ears exposed to noise). They were kept in a temperature- and humidity- controlled room, exposed to a 24-h light\u2013dark cycle (14 h/10 h), with free access to food and water. All experimental procedures were conducted in accordance with the German \u201cLaw on Protecting Animals\u201d and with the European Communities Council Directive 2010/63/EU for the protection of animals used for experimental purposes. The use of animals for scientific purposes was permitted by the local authorities (Lower Saxony State Office for Consumer Protection and Food Safety (LAVES), Oldenburg, Germany, registration number 19/3145).Initially, the animals\u2019 normal hearing was verified by ABR measurement on day \u22127. Subsequently, the animals were implanted with the HDD. After 1 week, on day 0, an additional ABR was performed, followed by four hours of noise exposure. In addition, 30 min after noise application, the hearing status was measured again. One day after noise insult (day 1), an ABR measurement, followed by imaging of the drug delivering device in situ using \u00b5CT, was performed. On day 7 after noise insult, a final ABR was performed, followed by \u00b5CT imaging and euthanasia. This timeline is illustrated in ABR measurement, HDD implantation, noise trauma, \u00b5CT and euthanasia were performed under general anesthesia , following pre-anesthetic sedation . Areas to be incised were locally infiltrated with prilocaine. To reduce pain and to prevent infections, the animals subcutaneously received 0.2 mg/kg meloxicam and 10 mg/kg enrofloxacin. Euthanasia was performed via intracardiac injection of no less than 300 mg/kg pentobarbital. For details concerning the medical treatment, one can refer to Acoustic stimulation and recording of the auditory brainstem signals were performed using a Pilot Blankenfelde system modified for use in guinea pigs . The ABR signals were recorded using four subdermal needle electrodes. They were placed at the vertex (common positive), left and right mastoid (references) and in the neck (ground). Due to the implants\u2019 position and the head suture, the vertex and neck electrodes\u2019 position had to be changed from day 0. The positive electrode was placed rostral to the head suture and the ground electrode caudal to the osmotic pump. Experiments were conducted in a soundproof booth. To detect general auditory thresholds, acoustic clicks (duration 150 \u00b5s) were used. For detection of frequency-specific acoustic thresholds tone bursts of 500 Hz, 1 kHz, 2 kHz, 4 kHz, 8 kHz, 16 kHz, 32 kHz and 40 kHz were used. Acoustic stimuli were presented by loudspeakers  via a plastic cone placed in the outer ear canal. The EC1 gained electrical supply via an electrostatic speaker driver . All loudspeaker-cone compositions were calibrated at the beginning of the project. For this purpose, the system\u2019s output was adjusted in the service menu of the software at 80 dB for each stimulus. The output was recorded using a \u00bc-inch condenser microphone  connected to a preamplifier  and a conditioning amplifier . Before the end of the study, the output was tested again and was 82.06 \u00b1 5.73 dB SPL. Starting at 80 dB SPL , each stimulus was presented 200 times and responses from the contralateral ear were masked by white noise 30 dB below the stimulus level. Dependent on the response, the hearing threshold was searched down- or upwards in 20 dB to 5 dB steps. The hearing thresholds were determined by visual inspection of ABR signals in the analyze function of the system, with a maximum magnification of 700 nV/Div. The lowest stimulus intensity at which ABR signals could be detected was taken to be the hearing threshold for the relevant stimulus configuration . Where tThe hearing threshold shift due to implantation was set as the difference between the measured thresholds of day \u22127 and day 0 pre noise exposure. The threshold shifts due to noise at different time points after exposure were set as the differences between the hearing thresholds of day 0, 30 min post noise, day 1, and day 7 in comparison to the day 0 pre noise threshold.\u00a9. The osmotic pump was placed in the subcutaneous pocket in the neck and the rest of the catheter was looped and placed on the animal\u2019s head. To avoid tension stress on the implant tip, e.g., by head movement, a small piece (maximum length 7 mm) of a halved silicon tube (OD 4 mm) was fixed at the head using Tetric EvoFlow\u00a9 to guide the catheter. Additionally, a small drop of Tetric EvoFlow\u00a9 secured the catheter at the skull directly behind the subcutaneous tunnel. The postauricular wound was closed in two layers and the wound at the skull was closed with u-sutures.The anesthetized animal was placed on a heating pad and the skin over the skull was incised after local anesthesia with prilocaine. The periosteum was removed and a subcutaneous pocket between the scapulae was formed. Access to the middle ear cavity was obtained using a retroauricular approach. After visualizing the round window, the bony overhang of the round window niche was removed using a micro hook, without hurting the facial nerve. A subcutaneous tunnel that connected the skin incision at the skull and the postauricular incision was built, in which the catheter was guided to the middle ear cavity. The catheter tip was inserted in the round window after opening the membrane and the bulla was closed using Tetric EvoFlow\u00ae (version 2.1.1) on a notebook (Windows 10 pro). Audacity\u00ae software is copyrighted ). It is a free software distributed under the terms of the GNU General Public License. The name Audacity\u00ae is a registered trademark of Dominic Mazzoni. A stereo power amplifier  was interconnected between the computer and loudspeaker. The presented sound file was engineered for an overall broad, noise-like frequency spectrum beyond 40 kHz. To mimic naturally occurring fluctuations of the temporal envelope in noisy environments, the modified file was based on a recording of Beethoven 5th Symphony, 4th movement, Allegro; Presto, played by the Ensemble Reflector by PASCHENRecords. In order to create a broadband noise trauma, the audio file was limited in its dynamics, so that it had a constant digital level. In a second step, self-learning filters were used to generate a flat power spectrum between 200Hz and 40 kHz (maximum range was 30 dB between frequencies). The recording had a sampling frequency of 96 kHz and the sound file included all frequencies played by the instruments and inserted frequency content up to the Nyquist frequency of 48 kHz. Thus, a large part of the frequency range of the guinea pigs that extended above 50 kHz was excited by the stimulus [The anesthetized animal was placed on a heating pad in a sound-insulated box. Calibrated loudspeakers  were placed directly in front of the animal\u2019s outer ears. The noise insult was presented via the software Audacitystimulus . The souFor evaluation of the implants\u2019 position, the cochlea of each guinea pig was scanned at day 1 and day 7 immediately after the ABR measurement under the same anesthesia using a \u00b5CT scanner . Scans were performed using 1470 \u00b5A, 100 W, at an integration time of 90 ms, resulting in a resolution of 17 \u00b5m. The data were converted to DICOM and reconstructed with COMET  and the \u00ae version 8.4.3.) and the Shapiro\u2013Wilk test (at statskingdom.com) [\u00ae. For comparison of the groups with significant departure from normality, a Wilcoxon signed-rank test was used. If both data sets were normally distributed, a paired t-test was performed. For details concerning the statistical analysis, one can refer to p \u2264 0.05 (*); p \u2264 0.01 (**) and p \u2264 0.001 (***). Data that did not significantly differ are indicated using ns = not significant.Due to the small number of animals, data were double checked for normal distribution using the Kolmogorov\u2013Smirnov test (in GraphPad Prismdom.com) . The KolThe main objective of the present study was to establish an animal model to test intracochlear preventive pharmacotherapy of temporary threshold shifts (TTS). A custom-made catheter-pump-based delivery system, allowing chronic drug delivery and imaging of the intracochlear part for quality control, was built, a TTS was established and the combination of both was tested in vivo.The self-built HDD was implantable into the guinea pig inner ear via the round window and remained in situ throughout the observation period. This was determined macroscopically after euthanasia of the animals , as wellBefore and after implantation, the fluid-filled delivery device was placed in a well plate to check pumping activity. This quality control method is an easy and inexpensive method to determine the functionality of each self-made HDD system. Before and after explantation, all pumps delivered fluid into the Eppendorf tubes, indicating proper function.The study aims to determine both the effect of the HDD implantation and the effect of the noise trauma on the hearing threshold. To obtain an overview, first, the click hearing thresholds are reported, followed by the effects of the HDD implantation on frequency-specific ABR thresholds. Afterwards, the effect of noise exposure on frequency-specific ABR thresholds of the right (not implanted) ears was examined, followed by the effect of implantation and noise exposure on frequency-specific ABR thresholds of the left (implanted) ears. Finally, the effect of the implantation on the extent of the noise trauma was evaluated.p \u2264 0.05; paired t-test) for the left (implanted) ears, respectively, and 30 \u00b1 4.4 dB SPL vs. 55 \u00b1 6.3 dB SPL  for the right (not implanted) ears, respectively   (t-test).The initial na\u00efve click-evoked hearing thresholds of left (pre-implantation) and right (not implanted) ears did not differ A. The clectively A. The co t-test) B. Additi t-test) B. The thp \u2264 0.05; paired t-test). This difference could no longer be observed directly after noise trauma nor up to 7 days after noise trauma (As the threshold increase during the whole experiment is more pronounced in the right (not implanted) ears than in the left (implanted) ears, the click hearing thresholds between the groups over time were compared  to elucie trauma .As the implantation appears to have an effect on the click-evoked hearing threshold that is neutralized after noise exposure, an analysis of the frequency-specific hearing thresholds was performed to look into the effect of implantation on the hearing function.p < 0.05; Wilcoxon signed-rank test) and 1 kHz  and at 500 Hz  and in the click condition , the thresholds of left (implanted) ears were significantly increased compared to the right (not implanted) ones , 32 kHz  and 40 kHz  with higher thresholds in the right (not implanted) ears  ears before noise trauma (day 0 pre noise) were significantly higher at frequencies above 8 kHz than na\u00efve ears (day \u22127) A. Compared) ones B. In added) ears C.The effect of the noise trauma is reflected in the difference in hearing thresholds before and 7 days after noise trauma in right (not implanted) ears. Compared to day 0 pre noise, there was a significant increase in frequency-specific thresholds 30 min after noise exposure (day 0 post noise), except for 500 Hz and 1 kHz (The frequency-specific hearing thresholds over time of the left (implanted) and noise affected ears are descriptively illustrated in The combination of implantation and noise insult led to significantly increased thresholds over all frequencies, which were still detectable 7 days after noise trauma . The insp \u2264 0.05; paired t-test}. However, 7 days after noise application, the threshold shift in left (implanted) and right (not implanted) ears differed significantly . At 8 kHz, the mean threshold shift from day 0 before noise insult to day 7 after noise was 2 \u00b1 11.7 dB in left (implanted) ears, and therefore significantly lower than in right (not implanted) ears, where the shift was 33 \u00b1 13.6 dB . At 2 kHz, there was still a difference in threshold shifts between left (implanted) and right (not implanted) ears , but at lower frequencies (1 kHz and 500 Hz), no differences were observed. In these frequency regions, the threshold shift of both groups was close to 0 with 3 \u00b1 13 dB at 1kHz and \u22121 \u00b1 9.8 dB at 500 Hz for left (implanted) ears and 9 \u00b1\u22125.8 dB at 1 kHz and 0 \u00b1\u22127.7 dB at 500 Hz for right (not implanted) ears, respectively.The threshold shifts from the period before noise insult to directly after noise insult did not differ between the left (implanted) and right (not implanted) ears A, exceptficantly B, with iThe microneedle can be visualized by \u00b5CT, allowing determination of the correct location of the hook . The anaNumerous diseases cause cochlear dysfunction. Local pharmacotherapy could be a treatment option in the future. Prevention is always better than therapy; therefore, preventive drug treatment strategies should be applied before an insult affects cochlear health. To measure the biological effectiveness of a preventive local drug therapy, the application per se needs to be as less traumatic as possible. We are interested in identifying preventive substances against NIHL. For this purpose, we developed a model for pump-based drug delivery in normal hearing guinea pigs that received TTS-inducing noise trauma. Since drug delivery to the inner ear is challenging due to the blood\u2013labyrinth-barrier and round window membrane permeability, delivery directly in the perilymphatic space using a pump-based system is the best way to investigate a drug\u2019s effect in basic research. As soon as an effect is shown and the therapeutic dose is determined, the delivery method needs to be optimized for patients, as it would be too traumatic for the current pump-based delivery system to be applied for the treatment of inner ear pathologies. The application in human patients requires drug delivery in the form of systemic delivery or local delivery without opening the perilymphatic space. Therefore, the presented study aims to establish a drug delivery approach to release drugs in a known concentration and for a known duration into the inner ear for a basic research set-up.A well-established method for chronic drug delivery to the inner ear is the use of osmotic minipumps ,36,44. THowever, it is also possible that there is no significant difference between left (implanted) and right (not implanted) ears in the higher frequencies, since a spread of inflammatory cells, for example, into the contralateral ear cannot be excluded. Unlike humans, guinea pigs have a large cochlear aqueduct that connects the perilymph spaces of both ears . AdditioWe used a small microneedle that was shortened, bent and inserted 1.5 mm in the scala tympani. As the microneedle can be visualized using \u00b5CT, it is possible to perform a second surgery, if an animals\u2019 implant is in an incorrect position. This follows the principle of the animal welfare law to reduce the number of animals used for scientific purposes. Care should be taken to ensure that the microcannula part of the implant ends in the middle ear cavity or can be completely covered with dental cement, while closing the osteotomy of the cavum tympani. Otherwise, it may lead to skin irritation or development of pressure, strain, or tension forces, changing the implant\u2019s position.As the study\u2019s aim was to develop a NIHL animal model for preventive chronic drug delivery, the next step was to expose the animals to a noise insult. Many studies concerning noise trauma use an artificial noise trauma, such as a pure tone ,53,54,55The shown tendency towards a beneficial effect of AP infusion, improving the recovery from noise, needs to be considered in future studies that investigate the beneficial effects of drugs on inner ear trauma in normal hearing animals. The potential protective effects of agents should lead to faster recovery compared with control ears implanted with an AP delivering pump or maybe an additive, or even synergistic effect, of drug and AP infusion. To elucidate which intervention, drug delivery approach and molecule cause which effect in the inner ear, the evaluation should include the not implanted  ears and maybe other fluids, e.g., saline or AP without albumin, should be considered as control substances. However, as aforementioned, omitting the albumin may influence the osmolarity of the perilymph, and therefore may affect the endocochlear potential. Depending on which drug to be tested, albumin may be necessary as a carrier protein.NIHL is a complex disease and many factors have to be considered when establishing a new animal model. For example, both the melatonin of pigmented animals  and the Even though the focus of the present study was on the development of an animal model for long-term application of preventive substances for NIHL, the presented HDD can also be used in other areas of hearing research. This includes all areas in which cochlear pharmacotherapy is investigated, such as the prevention of ototoxic drug effects, such as aminoglycosides or cisplatin, or the development of virus-mediated gene therapies.The implantation of the HDD attached to an osmotic pump caused a moderate threshold shift that enabled us to further induce and detect a temporary noise-induced threshold shift. An exposure of 4 h to the audio file of the orchestral piece caused an increase in hearing threshold for all tested frequencies with a frequency-specific intensity. The threshold shift partially recovers within one week, with more pronounced recovery at the left (implanted) ear. This facilitates the investigation of the effect of drugs delivered prior to the noise insult via osmotic pumps to establish a preventive therapy against noise-induced TTS, an ailment with global importance."}
+{"text": "Objective: Prolonged laryngoscopy and failure to intubate are associated with increased morbidity and mortality. Need to improve glottic visualisation and ease of intubation has led to the introduction of various types of laryngoscopes. This study compares the effectiveness of C-MAC video laryngoscope (VL) with McCoy laryngoscope in patients with an anticipated difficult airway.Methods: This prospective randomised single-blinded single-centre study included patients with modified Mallampati grades 3 and 4, divided into two groups I and\u00a0II of 65 patients each. Group I was intubated using C-MAC and group II with McCoy Laryngoscope. Modified Cormack Lehane grade of visualisation, time to intubate, intubation difficulty scale score and complications were recorded.Results: C-MAC VL provides a higher proportion of modified Cormack Lehane grade I visualisation , the lesser median time of intubation in seconds  and significantly lesser median intubation difficulty score (0 vs 3) when compared to McCoy.Conclusions: C-MAC VL provided better visualisation of glottis and easier tracheal intubation that too in a significantly lesser time. We conclude and recommend the use of C-MAC VL over McCoy for endotracheal intubation in patients with predicted difficult airways, especially in modified Mallampati grades 3 and 4. Securing the airway by tracheal intubation is a very essential life-saving skill.\u00a0Complications during tracheal intubation include hypoxia, airway trauma, oesophageal intubation and even cardiorespiratory arrest .\u00a0Proper The most popular laryngoscope in the world was developed by Sir Robert Macintosh in 1943. The Macintosh blade is the most commonly used laryngoscope blade, which is curved. Since then, different types of laryngoscopes have been devised to decrease the incidence of failed intubations ,6. McCoyA prospective randomised single centre study was performed following\u00a0approval from the institute's ethical committee.\u00a0The inclusion criteria were the age of 18 to 60 years, receiving general anaesthesia and endotracheal intubation for\u00a0elective surgery,\u00a0American Society of Anesthesiologists (ASA) grades I and II, body mass index (BMI) 18.5 to 24.9 and modified Mallampati grades (MMG) 3 and 4. Those patients with pregnancy, BMI > 24.9, inadequate mouth opening (<4 cm), thyromental distance <6 cm, restricted neck movement or any diseases involving the neck, upper respiratory tract and upper alimentary tract were excluded from the study. The following selection and written informed consent taken during preoperative assessment, we randomised patients into two groups based on the sealed envelope technique. Group I was intubated using C-MAC VL and group II with McCoy laryngoscope. Laryngoscopy and intubations were performed by an anesthesiologist who was familiar and trained with intubation using McCoy and C-MAC VL. Patient randomization was stopped when we had data of 65 patients for each group available for final analysis.We followed the institutional practice guidelines for preop fasting and pre-medications.\u00a0After explaining the procedure to the patient, standard monitoring  and good intravenous access were confirmed.\u00a0The patient's head was kept at the\u00a0level of the xiphisternum of the anaesthesiologist responsible for airway management.Preoxygenation was done with 100% oxygen for at least three minutes. Induction was done using intravenous Fentanyl (2 mcg/kg) and Propofol (2 mg/kg or more) followed by the neuromuscular blockade, achieved by intravenous succinylcholine 2 mg/kg. Resolution of fasciculations or end of\u00a090 seconds after succinylcholine injection was considered as the time to do laryngoscopy. Intubation was done in the \u201csniffing morning air\u201d position, that is extension at the atlanto-occipital joint and flexion of the neck at the lower part of the cervical spine.Successful intubation was confirmed by bilateral equal air entry, misting of the tube, equal chest rise and continuous quantitative capnography. Intubation difficulty scale score (IDS) was the primary outcome, which included modified Cormack and Lehane (MCL) grading, number of attempts, number of operators, number of alternative techniques, need of lifting force, external laryngeal pressure and mobility of vocal cords. Time for intubation was the time between insertion of the blade into the mouth until detection of end-tidal carbon dioxide on the monitor.\u00a0In case of failure to intubate after two attempts and or any change in the physiological parameters such as bradycardia (<60 per minute) or oxygen saturation < 90%, during induction and intubation, then the patient was dropped out of\u00a0the study and was managed according to the standard protocol. Complications such as sore throat, desaturation, dental injuries, mucosal injuries and oesophageal intubation, bronchospasm were also noted and treated accordingly.\u00a0Statistical analysisBased on earlier findings, a change in mean IDS score of 1 with a standard deviation (SD) of 2.00 between two groups was considered clinically important . ConsideFollowing exclusion as explained under methods, data of 130 patients were available for final analysis. There was no significant difference between the two groups with respect to the baseline characteristics such as age, gender, actual body weight, ASA status (I and II) and MMG ( 3 and 4) (Table Difficult airway management remains a\u00a0challenge despite the invention of many novel airway devices, even in the hands of experienced anaesthesiologists. Endotracheal intubation has two basic steps, exposure of the glottic opening and passage of the tip of the endotracheal tube between the vocal cords. During laryngoscopy, optimum head extension and neck flexion are paramount for adequate alignment of the oro-pharyngeal-laryngeal axis which ascertains visualisation of the glottic opening.The distal levering tip of the McCoy blade allows an elevation of the larynx from the area of the teeth towards the vallecula leading to better alignment of axes and glottic visualisation . VariousThere have been multiple studies comparing standard Macintosh blades, McCoy blades and various VLs. One of the studies, in which they compared tracheal intubation with Macintosh, McCoy and TruViewTM in patients with the immobilised cervical spine, reported better glottic visualisation, a higher rate of successful intubation during the first attempt and easier tracheal intubation, and with TruView as compared to Macintosh and McCoy laryngoscopes . This isA meta-analysis published in 2011 compared VLs with direct laryngoscopes in patients scheduled for elective procedures. It showed that the VL exhibited a significantly shorter duration of endotracheal intubation in patients with difficult airways . SimilarThere are many limitations of the present study. First, the intubating anaesthesiologist could not be blinded to the type of device used, thus the observer's bias could not be completely eliminated. However, the observer recording the data for the time taken to intubate, number of attempts and complications was blinded from the device type and MMP grading. Observations such as\u00a0MCL grading and lifting force applied are subjective in nature and not known to the observer. Second, the results of the study may vary with the level of experience of the anaesthetist. Third, the hemodynamic parameters during intubation could not be recorded, which could have been a great supplement to the laryngoscopy outcome. Third, the use of style to alter the shape of the endotracheal tube was not taken into account.C-MAC VL was found to improve the view of the glottis, take lesser time for intubation\u00a0and improve IDS score in comparison to the McCoy laryngoscope. Therefore, this study concludes and\u00a0recommends the use of C-MAC VL in the airway management of patients with predicted difficult airways, especially with MMG 3 and 4. Further studies taking into account the hemodynamic parameters during intubation, the use of stylet and external laryngeal manipulation and the user learning curves will strengthen the evidence for the use of video laryngoscope in all elective and emergency intubations including the anticipated difficult ones."}
+{"text": "Undernutrition in children seems to be one of the major health issues in developing nations including India. Stunting, underweight, and wasting are the three most often used anthropometric indicators to evaluate childhood undernutrition. Children who exhibit one or more indicators of undernutrition are considered as anthropometric failure (AF). The present study aims to determine the distribution and determinants of anthropometric failure in children under the age of five in different regions of India.2) test was used to look into the association between categorical variables. Binary logistic regression was used to find the explanatory factors that influence anthropometric failure.NFHS-5 data, collected between 2019 and 2021, were utilized for the study. Pearson's chi-square  in India are suffering from anthropometric failure, out of these West (57.88%), East (56.58%), and Central (53.94%) regions have covered half of the total occurrence. State-wise, Bihar (61.66%), followed by Gujarat (60.26%), and Jharkhand (58.05%) have recorded the highest rates of anthropometric failure. Anthropometric failure is higher among anemic children, boys, parent not alives, the higher number of birth order, lower educated mothers, rural dwellers, belonging to scheduled tribes and scheduled castes communities, living in nuclear families, and having lower household wealth indexes than their other counterparts.These aspects imply that regional determinants should be taken into consideration when implementing child nutrition development programs. India is a developing nation with more than 119.84 million under-five children, or 9.90 percent of the total population according to of the 2011 census. By 2021, that number was projected to be over 114.27 million, constituting 8.38 percent of the total population , underweight (low weight-for-age), and wasting (low weight-for-height) are the three most often used anthropometric indicators that are universally accepted for undernutrition assessment. Poor nutrition during pregnancy and early childhood may have devastating effects like stunting and wasting. The key finding reports for the 2021 edition of the Joint Child Malnutrition Estimates mentioned that in 2020, globally, 149.2 million (22.0%) and 45.5 million (6.7%) children under five years were suffering from stunting and wasting, respectively .Svedberg (2000) proposed an elaborate Composite Index of Anthropometric Failure (CIAF) for assessing malnutrition and noted that the conventional indices were insufficient to measure the overall prevalence of child undernutrition. According to Svedberg, children who exhibit stunting, wasting and underweight are all regarded as being undernourished or being in a state of anthropometric failure . Nandy eUsing the composite index of anthropometric failure, a few studies have evaluated the prevalence of undernutrition in Indian children. Most of the studies are found to be conducted on community-based and geography-specific. A few of these studies have also examined confounding factors regionally, like child age and sex, socioeconomic status, maternal education, birth order, birth intervals, exclusive breastfeeding, childhood morbidities, and the number of siblings. In this regard, a mention may be made of some of the studies conducted in India.Shit and others studied among slum children in the Bankura district of West Bengal ; BoregowThe present study aims to estimate the distribution of anthropometric failure among under-five children and its determinants across the regions in India.Data source: The data was derived from the Fifth National Family Health Survey (NFHS-5), which was carried out between 2019 and 2021 in India. Anthropometric failure among children under the age of five was studied using the NFHS-5 data. Out of the 2834297 reported household members, 197,090 children under the age of five were included in the study. The criteria for data inclusion and exclusion were provided in the flow chart below (rt below . The comOutcome variables- Anthropometric failure: An indicator of child undernutrition is anthropometric failure (AF), which was used as the outcome variable and was derived from the composite index of anthropometric failure (CIAF). The anthropometric failure indicates insufficient and poor nutrition, which was determined by using nutritional indicators of stunting, wasting, and underweight (erweight  20). St. StOutcoerweight , 29. AntExplanatory variables - child, maternal, and socio-demographic determinants: Studies on potential determinants of anthropometric failure in children focused on child health and demographics, maternal factors, and socio-demographic factors. Explanatory factors were explicitly classified while retaining their meaning by utilizing information from existing studies.Anemia in children , gender of the children , and parents alive  have been shown as child health-and-demographic variables , 31. BirRegional divisions in India: India consists of 28 States and 8 Union Territories (UTs), which were grouped into 6 geographic regions by NFHS-5: Central, East, North, Northeast, South, and West  test was used to look at the association between categorical variables. Binary logistic regression was used to find the explanatory factors that influence AF, where AF was coded as \u201c1\u201d and its counterpart, NF, as \u201c0\u201d. The independent variables were chosen following a multicollinearity test and a VIF of less than 5 was selected for analysis. Using a 95% confidence interval and a p-value of \u22640.05, statistical significance was determined. The Omnibus chi-square was used to confirm whether the data fit the logistic regression model  provided the NFHS-5 data that were used in this study. The survey protocols and participant confidentiality have been evaluated and approved by the ICF Institutional Review Board (IRB) and the International Institute for Population Sciences (IIPS) in India, a nodal organization of the host country. The ICF IRB adheres to the guidelines established by the US Department of Health and Human Services concerning participant confidentiality and the protection of human subjects. As a result, the DHS data did not require further ethical approval because it was ethically appropriate.The prevalence of anthropometric failure among children under the age of five in the Indian populations on state-wise and regional basis are displayed through the maps in In India, it is found that the group E (stunting and underweight) and group F (stunting only) predominately affect about 30.66 percent of children, while the group Y (underweight only) and group D  comprises only 7.51 percent of children . MaximumRegion-wise factor distribution:Effect of the explanatory factor on anthropometric failure (AF): Binary logistic regression is used in 2 8191.90), Central (\u03c72 1838.76), East (\u03c72 2529.44), North (\u03c72 798.80), Northeast (\u03c72 209.52), South (\u03c72 1146.42), and West (\u03c72 960.85) all have a significant level at p<0.001. These facts show that the models for India and each regional division fit the data well. Each regression model is significant (p <0.01), with the correct percentage of prediction for India, Central, East, North, Northeast, South, and West, being 59.50 percent, 59.13 percent, 62.28 percent, 59.40 percent, 58.35 percent, 59.24 percent, and 60.87 percent, respectively. The model reveals the following facts.All regions have shared a common predictor, child anemia, but the effect of anemia on AF is strongest in East and South regions, where it is 1.37 times more common than in children who are not anemic, followed by the West at 1.35 times and the Northeast at 1.31 times more prevalent. Boys are more likely than girls to have AF, with prevalence rates in the North and West regions being 1.15 and 1.08 times higher, respectively. Only in the Central region the children who lost their parents are 1.36 times more likely to have AF than their counterparts. Birth order has a maximum significant impact in the East and South, where it is 1.22 times and 1.20 times more prevalent in the third and more children compared to the first and second. Lower maternal education is found to be a common factor and to be positively associated with AF, with lower or non-educated mothers have a higher probability of having an AF child than a higher educated mothers.Except for the Northeast, the social category is shown to be a prevalent factor across all regions. Children from the Scheduled Caste community are more likely than children from general castes suffer from AF in the Central, East, and North, but Scheduled Tribe children are more affected in the South and West regions. Children from nuclear families were more likely to suffer from AF in the Central, North, and West regions, but in the South, it was 7 percent more prevalent in the non-nuclear family . The prevalence of AF found to be higher in children from poor- and middle-wealth-indexed families than from wealthier ones. In the East, there is a maximum prevalence of AF found among poor families-about 1.85 times.More than half of the under-five children 52.18%) in India are suffering from AF, out of which West (57.88%), East (56.58%), and Central (53.94%) regions have covered half of the total occurrences. State-wise, Bihar (61.66%), followed by Gujarat (60.26%), and Jharkhand (58.05%) have recorded the highest rates of AF and it is the West (57.88%), and the East (56.59%) areas in terms of regional basis. The prevalence of AF in India shows consistency with the Ethiopian administrative zones (53.78%) . However% in IndiIn the case of CIAF, group E (stunting and underweight) and group F (stunting only) are found to predominately affect more than 30.0 percent of children, while group Y (underweight only) and group D  comprise only 7.51 percent. Children in group E (stunting and underweight), group B (only wasting), group D , and group Y (only underweight) are more common in the West region, at 15.85 percent, 8.05 percent, 7.48 percent, and 2.81 percent respectively. The East region is mostly affected by group D , and group E (stunting and underweight), the percentage is 6.40 percent and 18.10 percent, respectively. Children from the Central (17.33%), Northeast (17.13%), North (14.69%), and South (13.40%) are more were affected by group F (only stunting). The regional differences in CIAF may be due to climatic variation in geographical, political, and socio-cultural norms, and due to dietary-related factors in different zones  in Bangladesh also recorded the higher odds of AF among the mothers having a higher order of birth, living in rural areas, and poorest socio-economic statuses . The finIn conclusion, the higher prevalence of anthropometric failure in India embodies a major area of concern to study for getting a healthier society. The regional variation in the occurrence of anthropometric failure represents the influence of various factors in different areas. Some factors influence anthropometric failures uniformly across all regions, whereas others have regionally specific impacts. These aspects imply that regional determinants should be taken into considerations when implementing child nutrition development programs.To reduce the demographic failure of Indian children, it is pressingly necessary to prioritize steps to reduce childhood anemia, improve maternal education, raise the wealth index per family, and take special care of children from Scheduled Tribes and Scheduled Castes. Understanding the taxing factors by the researchers will be helping the policymakers to plan and execute a required strategy to mitigate those problems.India, a developing nation, has a very high prevalence of undernutrition in children under the age of five. The effects of undernutrition on the child nutrition are assessed by AF by combining three indices of child malnutrition, i.e. wasting, stunting, and underweight. In the current context, it appears more reasonable to include these indications together in AF in order to determine factors that are responsible. Although AF has been separately studied in various communities or regions, there hasn't been a regional distribution of the entire nation; for this reason, the regional distribution has been shown in this study. This study will aid governments and non-governmental organisations in the implementation of future nutritional development initiatives for children, allowing India to easily reach Sustainable Development Goals (SDGs) targets. As the present study is based on secondary data source, the analysis is limited to the available data set only. More primary studies in broader perspectives would be helpful to get vast information of Indian population regarding malnutrition."}
+{"text": "In Denmark, chiropractors have a statutory right to use radiography and the government-funded national Health Insurance provides partial reimbursement. Danish National Clinical Guidelines recommends against routine use of imaging for uncomplicated spinal pain; however, it is not clear if clinical imaging guidelines recommendations have had an effect on the utilisation of spinal radiography. This study aimed to describe the utilisation rate of radiographs in Danish chiropractic clinics in the period from 2010 to 2020 and to assess the impact of clinical guidelines and policy changes on the utilisation of radiographs in Danish chiropractic clinics.Anonymised data from January 1st, 2010, to December 31st, 2020, were extracted from the Danish Regions register on health contacts in primary care. Data consisted of the total number of patients consulting one of 254 chiropractic clinics and the total number of patients having or being referred for radiography. Data were used to investigate the radiography utilisation per month from 2010 to 2020. An \u2018interrupted time series\u2019 analysis was conducted to determine if two interventions, the dissemination of 1) Danish clinical imaging guidelines recommendations and policy changes related to referral for advanced imaging for chiropractors in 2013 and 2) four Danish clinical guidelines recommendations in 2016, were associated with an immediate change in the level and/or slope of radiography utilisation.In total, 336,128 unique patients consulted a chiropractor in 2010 of which 55,449 (15.4%) had radiography. In 2020, the number of patients consulting a chiropractor had increased to 366,732 of which 29,244 (8.0%) had radiography. The pre-intervention utilisation decreased by two radiographs per 10,000 patients per month. Little absolute change, but still statistically significant for Intervention 1, in the utilisation was found after the dissemination of the clinical guidelines and policy changes in 2013 or 2016.The proportion of Danish chiropractic patients undergoing radiography was halved in the period from 2010 to 2020. However, the dissemination of clinical imaging guidelines recommendations and policy changes related to referrals for advanced imaging showed little meaningful change in the monthly utilisation of radiographs in the same period. Radiography has been used as a diagnostic tool amongst chiropractors since its incorporation in chiropractic clinical examinations in the early 1900s . DespiteTo improve appropriate utilisation of radiography, clinical guidelines have been developed in recent years , 4. In DClinical guidelines are designed to improve quality and reduce variation in the management of patients by changing the clinicians\u2019 behaviour . HoweverTo our knowledge, no existing articles have reported on the effect of the guidelines on the utilisation of radiographs in a Danish chiropractic setting. The objectives of this study were therefore to: (1) describe the utilisation rate of radiographs in Danish chiropractic clinics from 2010 to 2020; and, (2) assess the impact of disseminating Danish clinical guidelines in 2013 and 2016 on the utilisation of radiographs in Danish chiropractic clinics.This study is a retrospective quasi-experimental design using interrupted time series analysis to assess the potential impact of implementation of clinical guidelines in 2013 and 2016.The Danish healthcare system is primarily publicly funded . Taxes fAnonymised data from January 1st, 2010, to December 31st, 2020, were extracted from a register at the Danish Regions. Data comprised the monthly and yearly number of all unique patients who consulted a chiropractor and the number of unique patients who had radiography. Data on all billing codes for radiography per month and year were identified and extracted.To receive reimbursement, and thereby be registered in the billing code registry, a chiropractic clinic must be a part of the Danish collective agreement for chiropractors. In September 2014 there were 264 clinics in Denmark whereof 228 clinics (86.4%) were a part of the Danish collective agreement for chiropractors . The DanData were categorised by age groups and sex. As a unique patient can occur once every month over a calendar year, the monthly rates of unique chiropractic patients would be lower than compared to yearly rates. The number of radiographs were extracted and summarized from the following billing codes: Primary radiographic examination of the clinician\u2019s own patient (billing code 2014); Primary radiographic examination by referral from other chiropractor (billing code 2015); and, Supplementary radiographic examination (billing code 2020) .In this study we chose to analyse the impact of two periods of dissemination and implementation of the clinical guidelines and collective agreements in the study period 2010\u20132020) that may have had an impact on chiropractors utilisation of radiographs: (1) The Danish clinical guidelines for diagnostic imaging of the musculoskeletal system from 2013 \u20132020 tha; and (2)The clinical guidelines for diagnostic imaging of the musculoskeletal system were published and made available online in May 2013 (revised in 2014 online only) . All memThe four national clinical guidelines for managing neck and low back pain were published in the period from May 2015 to November 2016: (1) National clinical guidelines for non-surgical treatment of cervical radiculopathy (May 2015) , 24 specJanuary 2014 for the implementation of the imaging guidelines and the 2014 collective agreement and December 2016 for the clinical guidelines on neck and low back pain.Considering that passive diffusion, such as printed educational material and online publications of guidelines, is associated with a small change in clinical behaviour only , a more To describe the utilisation rate of radiographs in Danish chiropractic clinics, yearly data on unique patients having radiography was used as the numerator and the number of unique annual chiropractic patients as the denominator to calculate a percentage. The use of proportions eliminates the impact of a change in numbers of chiropractic clinics, chiropractic patients and seasonal trends.To assess the impact of the two interventions in January 2014 and December 2016, respectively, on the utilisation of radiographs in Danish chiropractic clinics, an interrupted time-series (ITS) analysis was performed using monthly data. The monthly proportion of patients having radiography was calculated using the number of unique patients having radiography as the numerator and the total number of unique chiropractic patients as the denominator. For interpretation purposes, we multiplied the proportion by 10,000. The significance of a change in slope and immediate level change of the slope before and after the two interventions were calculated using segmented regression analysis. The model requires a minimum of eight time points before and after an intervention  and therGiven that the interventions were implemented over a period of time rather than at a single time point, we conducted a sensitivity analysis. To account for the time lag between guideline publication and implementation in practice, we defined a \u2018phase-in\u2019 period for each of the two interventions and the data points for these periods were excluded from the sensitivity analysis. For Intervention 1, we censored the data between May 2013 and January 2014, and for Intervention 2, we censored the data between May 2015 and November 2016. In addition, the time period used in this analysis overlaps with the COVID-19 pandemic, which could act as a concurrent event and potentially affect the outcome. Therefore, we performed a sensitivity analysis censoring the period from March 2020 onwards to account for potential confounding effects. Finally, the post-analysis autocorrelation function (ACF) and partial autocorrelation function (PACF) plots indicated risk of seasonality and we therefore performed a sensitivity analysis controlled for seasonality using seasonal differencing adjustments and testing for stationarity using Dickey-Fuller test.In total, 336,128 unique patients consulted a chiropractor in 2010 of which 55,449 (15.4%) had radiography. In 2020, the number of patients consulting a chiropractor had increased to 366,732 and of these 29,244 (8.0%) had radiography.Data from 2010 to 2020 of patients having radiography were divided into age groups of which the largest in 2010 was 40\u201349 years and 50\u201359 years in 2020. The percentage of each age group in 2010 and 2020 is shown in Fig.\u00a0More than half of those who consulted a chiropractor in 2010 were women (55.7% in 2010 and 54.5% in 2020). Of patients undergoing radiography, the proportion of women was 51.1% in 2010 and 48.6% in 2020.There was an overall decrease in the utilisation of radiographs in Danish chiropractic practice from 15.4% to 2010 to 8.0% in 2020, corresponding to a yearly decrease of 0.8% (95% CI 0.68\u20130.85). , corresponding to a decrease of two radiographs per 10,000 patients per month.From 2010 to 2013 (pre-intervention) there was a monthly decrease of 2.2 radiographs per 10,000 patients (p\u2009<\u20090.001). After the first intervention there was a statistically significant level change of 28.4 fewer radiographs per 10,000 patients (p\u2009=\u20090.04) and a statistically significantly increase in the monthly utilisation (slope) of 1.3 radiographs per 10,000 patients (p\u2009=\u20090.006). of 0.78 radiographs per 10,000 patients, although both estimates were not statistically significant  as compared to the time period between the two interventions. Fig.\u00a0; Table\u00a01Sensitivity analyses were performed to account for (1) seasonality, (2) pandemic period, and (3) interventions as time periods instead of single time points.Seasonality: As the post analysis autocorrelation function (ACF) and partial autocorrelation function (PACF) plots indicated seasonality, we adjusted the dataset for this. The analysis of the adjusted dataset resulted in only minor changes of all the estimates. However, these changes were not significant (overlapping 95% CIs) and the new analysis did not change the overall results as compared to the original analysis, data not shown.COVID-19 pandemic period: Censoring data points for the period of the pandemic (March 2020 to December 2020) did not change the estimates significantly (overlapping 95% CIs) as compared to the original analysis, data not shown.Interventions as periods instead of time points: As the interventions were implemented over a period rather than at a single time point, we also analysed the data consoring between the start of the interventions to when they were fully implemented, e.g. between May 2013 and January 2014 for Intervention 1 and between May 2015 to November 2016 for Intervention 2). The new analysis did not change the estimates significantly (overlapping 95% CIs) as compared to the original analysis, data not shown.The yearly utilisation rate of radiographs in Danish chiropractic clinics decreased significantly from 15.4% to 2010 to 8% in 2020. However, the dissemination of Danish clinical guidelines and the collective agreement that gave Danish chiropractors the option to refer patients for advanced diagnostic imaging did not change the utilisation of radiography considerably. The first intervention showed a statistically significant level change and slope change; these changes corresponded to 28 fewer radiographs per 10,000 patients per month and an increase of 1.3 radiographs per 10,000.Using the results from the analysis Fig.\u00a0 we estimThe reduction of about 50% in the rate of radiography usage among Danish chiropractors from 2010 to 2020 should be viewed by considering that a substantial decrease was also present in Denmark in the years prior to 2010. In a study from 2002 to 1,595 chiropractic patients, 27% had radiography taken on the day of their visit with more radiographs taken with increasing age and longer duration of symptoms .With the current decrease in utilisation presented in this study, it is possible that radiographs will no longer be used in Danish chiropractic practice within a decade or two. Although the \u2019optimal\u2019 imaging rate of patients seen in chiropractic practice is unknown, the decreasing usage of diagnostic imaging would potentially level out at some point as there are absolute indications of imaging, including radiography. For low back pain, the prevalence of serious pathology has been suggested to range between 0.9 and 4.5% , 30. If The decreasing use of radiographs in Denmark could potentially be caused by factors other than the publication and implementation of clinical guidelines. The change in the undergraduate training of Danish chiropractors, as well as increased knowledge about and access to other diagnostic imaging modalities, such as MRI, could have influenced the utilisation of radiography. The Danish chiropractic education was established in 1994 as a university based five-year education at the Faculty of Health Sciences, University of Southern Denmark (SDU), and the majority of Danish chiropractors (60% in 2020) are now graduates from SDU . SDU eduWhen analysing the study sample, we found an increase in age for chiropractic patients having radiography from 2010 to 2020. First, it is notable that the study period is 11 years. Therefore, the same group of patients most commonly receiving radiography is the same in 2010 (40\u201349 years of age) and 10 years later, in 2020, (50\u201359 years of age). This is in accordance with Kiel et al.  who founThe implementation of Danish guidelines and policy changes investigated in the present study was shown to be less effective when compared to similar interventions. Bussi\u00e8res et al. reported a statistically significant drop after publication of web-based guidelines known among clinicians known to have high radiography imaging rates . HoweverThe primary aims of the Danish national clinical guidelines on neck and low back pain were to promote more evidence-based management of patients with spinal pain, including imaging. The present study found that, although there was a large and significant decrease in the proportion of patients with radiographs over the study period, the interventions themselves did not seem to have an important effect on the change of the use of radiography in chiropractic practice. The effect of interventions in relation to behaviour change depend on its dissemination and implementation. Therefore, it can be helpful to evaluate facilitators and barriers. The publishing of the guidelines was facilitated by sending out printed versions to members of the DCA and the guidelines were presented at two annual meetings and made easily accessible online. Moreover, the Chiropractic Knowledge Hub (former NIKKB) engaged the members of DCA in a more active manner by setting up regional workshops which had a considerable reach. Potential barriers could include misalignment with patient expectations or the chiropractors\u2019 habits, experience or diagnostic confidence . Also, tBased on the considerations above, one may argue, that the decrease in the utilisation is a continuation of the focus from Danish chiropractors on both technical and clinical aspects of imaging and that the guidelines messages were consistent with other initiatives and therefore could have made a collective contribution to the decreased imaging rates overall. This is a process that started before the turn of the century with the focus of integrating chiropractors in the public health care system. With regards to imaging, national and international publications, such as a Danish quality assurance report on low back pain and chiropractic , which hOne major limitation of the study is that the interventions were not well-defined in time and were not defined before data collection (pre-hoc). Also, the data available were limited to the utilisation of radiography with no knowledge of the patients\u2019 signs and symptoms or the chiropractors\u2019 attitudes and beliefs towards diagnostic imaging. Hence, factors beyond what is described in the interventions may have influenced chiropractic use of diagnostic imaging.This study includes data from patients of all ages, including infants and children, although the clinical guidelines only apply to adult patients. However, as the increase of patients aged 0 to 17 years, increased by less than 1%, from 8.7% to 2010 to 9.4% in 2020 (data not shown), we do not consider this to have had an effect on the interpretation of the results.The included data does not distinguish between radiographs of different regions of the spine or extremities. The clinical guidelines from 2015 to 2016 only concern radiography of the cervical and lumbar spine regions. Therefore, conclusions of the effects of the interventions for different anatomical regions cannot be drawn from this study.This study does not include data from all Danish chiropractic clinics as a smaller proportion of clinics are not part of the Mutual Agreement with Danish Regions. Nevertheless, since the vast majority (>\u200990%) of the Danish chiropractic clinics are included, the study\u2019s representativeness is considered acceptable , 21, 31.Furthermore, not all chiropractic clinics have their own radiographic equipment and therefore refer to other clinics or hospitals . The radThis study also has several strengths. ITS analysis is one of the strongest quasi-experimental methods which considers secular trends and the ability to evaluate both wanted and unwanted effects of interventions . To perfIn 2020, radiographic usage amongst Danish chiropractors was 8%, which can be considered fairly low when the prevalence of serious pathology is taken into account. Future research is needed to investigate if patients seen in chiropractic practice have clinical signs and symptoms that are in accordance with indications for imaging in cross-sectional studies and if these signs and symptoms really are predictors for serious pathology in longitudinal studies. Also, future research should investigate and identify patient and clinician factors that may be related to inappropriate utilisation, both over- and underuse, with regards to clinical guidelines.This study found a continued significant decrease in Danish chiropractors\u2019 utilisation of radiography which were reduced by half from 2010 to 2020. However, the implementation of clinical guidelines and policy changes relevant for diagnostic imaging within the same period showed little meaningful change on the utilisation. Future research should investigate and identify patient and clinician factors that are related to inappropriate utilisation of imaging, both over- and underuse, with regards to clinical guidelines."}
+{"text": "Ferula communis root bark.Plants are widely used in traditional medicine because they contain a high concentration of antimicrobial agents, serving as the foundation for medicines. The aim of this study was preliminary identification of phytochemicals and assesses the antimicrobial activity of extracts of Plant was collected, and standard qualitative procedures were conducted. The plant samples were extracted with 99.9% methanol and 80% ethanol. To identify phytochemicals found in plants, a preliminary phytochemical analysis was performed. Agar diffusion tests, minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) were performed to evaluate antibacterial activity.Ferula communis showed an antibacterial effect on both gram\u2010negative and gram\u2010positive bacteria in a concentration\u2010dependent manner. The average zone of inhibition for gram\u2010positive bacteria was 11\u00a0mm, whereas for gram\u2010negative bacteria, it was 9\u00a0mm. The MIC and MBC values also varied with the type of bacteria. In all bacterial species tested, the mean MBC value was similar to the MIC.The preliminary phytochemical analysis of the ethanol and methanol extract revealed positive results for flavonoids, coumarins and tannins. Terpenoids and anthraquinones were detected only in the methanol extract. The extract of F. communis and extracts showed antibacterial effects in a concentration\u2010dependent manner. Therefore, further purification and evaluation of the extracts and antioxidant activity of the plant should be investigated.Different phytochemicals were detected in extracts of the root bark of  Ferula communis (Apiaceae) were positive for flavonoids, tannins and coumarins, whereas the methanol extract was positive for the presence of tannins, flavonoids, coumarins and terpenoids. The extract of F. communis showed an antibacterial effect on both gram\u2010negative and gram\u2010positive bacteria in a concentration\u2010dependent manner.Ethanol extracts of root bark of  Despite this, it has one of the world's lowest unit outputs. This is primarily due to livestock diseases, which have disastrous health consequences Teklay, . DespiteIn Ethiopia, nearly 90% of livestock owners use traditional methods to treat animal diseases. A number of plant species have been identified as having pharmacological activities, and the active ingredients are primarily extracted from different parts of the plant, which are then processed and administered via appropriate routes  was heated in a water bath with 10\u00a0mL of distilled water. Three drops of 0.1% ferric chloride were added to the filtrate after the mixture was filtered. The presence of tannins in distilled water was indicated by a blue, blue black, green or blue green solution or precipitates   was mixed with 2\u00a0mL of chloroform, and 3\u00a0mL of concentrated H2SO4 was carefully added to form a layer. A reddish\u2010brown interface was formed which indicated the presence of terpenoid on both extract. Test for flavonoids: About 0.2\u00a0g of the extract was dissolved with ferric chloride. Formation of blackish red colour indicated the presence of flavonoids  was added to 0.5\u00a0g of the 2.3.5One gram of extract was kept with water. Then it was divided into two test tubes. One with 10% ammonium hydroxide added and another as a control. If fluorescence colour indicted positive for coumarin  was added to the filtrate, and the mixture was shaken. The presence of a pink, red, or violet colour was taken as an indication of the presence of anthraquinone  used as positive control. Diameter of the zone of inhibition (in mm) surrounding each well was recorded  for different extracts were performed by Mueller Hinton agar plate diffusion method and macro\u2010broth dilution method, respectively  was mixed up to 10 well. The plates were wrapped loosely with cling film to ensure that the bacteria did not get dehydrated and then they were placed in an incubator at 37\u00b0C for 24\u00a0h. After 24\u00a0h of incubation, the plats were removed from incubator and adding of tetrazolium chloride by preparing as liquid and again incubated and was kept for 30\u00a0min then observe the colour change visually or subculture with plate count agar and observe growth.2.6The minimum bactericidal concentration (MBC) corresponded to the lowest concentration that yields negative subcultures after incubation at appropriate temperature of 37\u00b0C for 24\u00a0h. This was taken from last growth in MIC subculture with plate counter agar (PCA), that means determined in broth dilution tests by subculturing 10\u00a0\u03bcL from negative wells cultured on PCA medium. Dividing the medium into four parts from the Petridis opposite side with marker , version 22.0 software. The statistical differences of the mean zone of inhibition of crude extract and solvent fractions for individual bacterium were carried out by one\u2010way analysis of variance followed by Tukey post hoc multiple comparison test at a significance level of 33.1F communis highly positive for tannin.The result of preliminary phytochemical screening test is shown in Table\u00a03.2Salmonella typhus was more susceptible than any other gram\u2010negative bacteria in methanol extract, with a concentration of 500\u00a0mg/mL, followed by E. coli, Klebsiella pneumonia and Pseudomonas erogenous. Citrobacter had a minimum zone of inhibition of 2.67\u00a0mm, whereas ethanol extract of F. communis had a slightly similar antimicrobial effect on gram\u2010negative bacteria except P. aeruginosa, with a minimum zone of inhibition of around 2.67\u00a0mm. Gram\u2010positive bacteria, S. aureus, were also inhibited slightly better by methanol extract than by ethanol extract. The inhibition zones in methanol were 11 and 10.7\u00a0mm in ethanol extract. In general, the F. communis plant extract in both fractions was more effective against gram positive bacteria than gram\u2010negative bacteria. The antibacterial activity pattern of the methanol extract on S. aureus was significant (p\u00a0<\u00a00.05) at 500\u00a0mg/mL within a group. The antimicrobial effect in ethanol extract was similar with methanol extract both in gram negative and gram positive except slightly variation within concentration difference and ethanol extract showed low inhibition on P. aeruginosa. Except for K. pneumonia and S. aureus, there was no difference in inhibition zone between positive control and 500\u00a0mg/mL concentration  has almost similar amount (Figures\u00a0The MIC and MBC of methanol extract were lower in concentration than ethanol extract except  Figures\u00a0 and\u00a02. T4F. communis is a medicinal plant that is used to treat a variety of diseases. In this study, the methanol and ethanol extracts of F. communis root bark were positive for flavonoid, tannin and coumarin in this study, whereas the methanol solvent fraction was positive for tannins, flavonoids, coumarin, terpenoid and anthraquinone but negative for saponins, steroid and cardiac glycosides. According to other reports, the phytochemical analysis of F. communis Ethyl acetate extract and n\u2010butanol extract revealed the presence of flavonoids, alkaloids, terpenoid, diterpenes, glycosides, terpenoid, phlobatannins and tannins (Gamal & Atraiki, Plants have been found to contain over 2000 phytochemicals. The medicinal value of plants is determined by the chemicals found in them Nn, . F. commF. communis responsible for its antibacterial activity. The antibacterial activities of F. communis plant extracts had inhibitory effect against S. aureus and gram\u2010negative bacteria. According to (Akaberi et\u00a0al., F. communis had antibacterial and cytotoxic activities. The n\u2010butanol and ethyl acetate root bark of extract exhibited more interesting antimicrobial activities. This difference may be due to geographical areas of plant collection, extraction method and the parts of the plant used for extraction. According to (Mahendra & Bisht, F. communis in Egypt with a concentration of 200\u2013300\u00a0mg/mL had an antibacterial effect similar to the current study with a concentration of 250\u2013500\u00a0mg/mL, but there is a minor difference. This variation may be due to geographical areas of plant collection, extraction method and plant parts used for extraction.The present study was undertaken to determine on which extract do the constituents of the root bark of F. communis plant extracts had positive effect against S. aureus and gram\u2010negative bacteria with a concentration of about 125\u00a0mg/mL. At a concentration of 62.5\u00a0mg/mL, both gram\u2010negative and gram\u2010positive bacteria had a very rare effect. P. aeruginosa was more susceptible in methanol extract than ethanol extract and had a lower effective than other gram\u2010negative bacteria in the current study. This could be due to the extract's mechanism of action on bacteria. In this study, F. communis was more potent against gram positive bacteria than that of gram\u2010negative bacteria.The antibacterial activities of S. aureus but in gram\u2010negative bacteria average MIC above 30\u00a0mg/mL. In other study better antibacterial effect of 12\u00a0mg/mL and antimycobacterial effect of 8\u00a0mg/mL with ethyl acetate and n\u2010butanol extract (Gamal & Atraiki, n\u2010butanol extracts of Ferula asafoetida had substantial antibacterial activity that is MIC and MBC against S. aureus was 1.25\u00a0mg/mL (Shubha & Hiremath, F. communis. The difference may be due to specious of plant, solvent extraction or type of soil.MIC was 16.67\u00a0mg/mL in ethanol extract and 18.66\u00a0mg/mL in methanol extract of minimum inhibition in 5F. communis plant, which offer a scientific basis for traditional use of medicine in both ethanol and methanol extracts for in vitro antimicrobial effect. The test plants showed antibacterial activity as evidenced by moderate zone of inhibition on both gram\u2010negative and gram\u2010positive bacteria except Citrobacter. This finding gives hints that potential lead molecule can be isolated from this medicinal plant that can be a base for synthesis of effective antibacterial drugs. Phytochemical screening of the F. communis showed the presence of secondary metabolites that are responsible for their antibacterial activity and effectiveness. Based on the findings, further research on plant fractions and isolates for antibacterial activity and toxicities should be made. The plant F. communis has many advantages, so it has to be cultivated well and preserved. Awareness creation among the community regarding this plant has paramount importance and should be practice well. Study should be done to understand mode of action of the phytochemicals found in this plant against bacteria and other microbes.Medicinal plant species are used to treat diseases of infectious origin. Phytochemicals are chemical compounds produced by plants. So it can be considered a factory of many chemical products. The genus Ferula is one of the plants used in traditional foods as well as in traditional medicine. In this study, In this research paper, Dr. Betelihem Yirdaw participated in conceptualization, data collection, laboratory work and manuscript write\u2010up, whereas Dr. Temesgen Kassa contribute to data analysis, edition and validation.No conflict of interest between the authorsThis research did not receive a specific fundhttps://publons.com/publon/10.1002/vms3.1170.The peer review history for this article is available at"}
+{"text": "The purpose of this paper was to identify and evaluate differences in the attitudes to using FinTech products and services in Poland adopted by two study cohorts\u2013one comprised of young customers, born no earlier than in 1990, and the other comprised of other adults. The main motivation for our research was to answer the question if young people growing up in the market economy will behave differently in the use of FinTech than older generations living in the former political and economic system. We also wanted to find the factors that determine the perception and willingness to use FinTech in the mentioned age groups. The data discussed in the paper were provided by the CAWI survey that was conducted in 2020 and covered a sample of 1,153 adult Poles. To achieve our goal, we used nonparametric statistical testing and the backward stepwise logistic regression models. The research demonstrated that young customers showed considerably more interest in all the aspects of the use of FinTech within the framework of our study than the other adults. Regarding the experience of using FinTech, such determinants as the male gender, the larger household in which a given respondent lives, and the possibility of making financial decisions independently exerted more impact on the young customers cohort than on the other adults. Irrespective of their opinion about FinTech, the persons under 30 years of age are more likely to use FinTech beyond average than the other adults whereas the persons over 30 years of age will do so only if they evaluate FinTech very well. Technological progress and the digitisation of business processes in the financial services industry as well as the restrictions imposed due to the COVID-19 pandemic prompt more and more clients to depart from traditional offers of financial products and services. Not only has the ongoing transformation of the financial sector already led to the creation of increasingly digitised business processes and models . It is cThe emergence of FinTech has its roots in the rapid growth and widespread adoption of internet, mobile and communications technologies . Both technology and the internet have the significant impact on the way people behave, interact and communicate with each other . ClearlyOne of the cohorts which is especially susceptible to the use of technology and the Internet is young persons, including children, youths, and young adults. They can be identified as a group that is particularly open to various innovations . When coDue to the assumed higher absorptive capacity of young people (young adults) for innovative solutions compared to other adults, our study will include the comparison of the two cohorts mentioned in use of Fintech solutions . The purIn our work we test the hypothesis that young adults are more likely to use FinTech products and services than the customers from the other age cohort.To verify the hypothesis and realize the purpose of the paper, we examine:the susceptibility to use FinTech in two age cohorts,the factors that determine the use of FinTech offers in each age cohort (the experience with FinTech products and services),he factors that determine a high susceptibility to use the FinTech, i.e., the above-average use.Our study is based on the background of the Polish market. The choice of Poland was motivated by two main factors. The first, was the opportunity to obtain data from a large and at the same time representative research sample thanks to the cooperation with an appropriate opinion research center in Poland. The second reason for choosing the Polish market as the country of study was the specificity of the market itself. Poland belongs to the region of Central and Eastern Europe (CEE), i.e., countries that changed their political and economic systems in the late 80s and early 90s of the twentieth century ,11. ThisApart from the motivation presented above one may add that that the Polish FinTech sector itself is developing very rapidly. In the years 2018\u20132023, the number of FinTech entities registered in Poland increased from 167 to 360, and including foreign entities and entities operating for FinTech, to 417. This represents an increase of around 115% and 150% respectively. The largest group of FinTechs are entities offering payments. More than half of the FinTech in Poland was created after 2016, which proves the dynamic growth of the sector, reflected in the emergence of the 30 new entities per year .The rest part of the paper is structured as follows: we present the theoretical background and literature review, describe the materials and statistical methods used, and characterize data and research process. The next section presents the results divided into the general susceptibility to use FinTech in various age cohorts, experience with FinTech products and services, and determinants of the susceptibility to use the FinTech offer beyond average. The paper ends with the discussion and conclusions, including the practical implications and limitations of the research.The theoretical background for the operation and development of FinTech can be associated with the TAM (Technology Acceptance Model). According to the original Technology Acceptance Model (TAM), the customer\u2019s intention to adopt a new technology depends on its perceived suitability and the ease of use ,14. The The results of research into FinTech customers are also available. They indicate that the lack of trust to others and the dissatisfaction with the relations between the customer and the financial institution are the major reasons why individuals decide to change the financial institution or recognise FinTech as the main service provider . ConductFrom the point of view of the subject of this article, is the issue of intergenerational differences in the FinTech research is important. The works on human capital theory published in the 1960s by Schultz ,40 and BUsed throughout this paper, the term \u2018young adults\u2019 should be referred to the generational identity discussed in the expert literature. The very term \u2018generation\u2019 is ambiguous and can be understood differently in social sciences \u201354. A \u2018gTraditionalists (born in or before 1945),Baby Boomers (born between 1946 and 1964),Generation X (born between 1965 and1981),Generation Y\u2013Millennials (born between 1982 and 2000),Generation Z (born after 2000).This division is conventional, which means that while reviewing the research of various authors, particularly those representing different academic disciplines, one may come across slightly different age bracket definitions as well as different names of individual generations, especially the youngest ones \u201361. CharIt must be emphasised that 1989 was the breakthrough year of political transition in Poland . The perThe review of the literature definitively shows a relatively small number of works related to the use of FinTech by different generations of the society both in the Western cultures as well as CEE countries, where the living conditions of people of different age groups have been different. Despite the growing number of the papers dedicated to the FinTech in general and to different aspects of their functioning ,38,65, tAs most of the financial products and services currently available on the market are becoming FinTech, and as traditional financial institutions  more and more frequently takes over the FinTech outlook, the knowledge related to FinTech functioning in inter-generation aspects turns out particularly important. The knowledge that is developing in this field may help to support effective inclusion in the financial market not only young people but also other adults in terms of fast changes in the information and communication technologies. Moreover, it may also prevent exclusion of older people from the financial market in the emergence of the FinTech era. The knowledge in the inter-generation use of FinTech may identify determinants of acceptance and willingness to use on a daily basis FinTech by the young and other adults.In this paper the term \u2018young adults\u2019 will denote the persons who were born no sooner than in 1990 and were not older than 30 in the year the survey was conducted (2020). Consequently, the young adults\u2019 cohort includes Generation Z and younger Millennials. The term other adults refer to people over 30 years of age.The paper relies on a survey conducted by a professional opinion poll organisation in October and November 2020 among a sample of 1,153 Poles over 18 years of age. The sample was a quota sample, which ensured the compliance of its structure with the population structure. The CAWI (Computer-Assisted Web Interview) method was used to conduct the survey and the research results were processed with the use of the IBM SPSS Statistics 26 software. The basic characteristics of the respondents participating in the survey are presented in For the purposes of statistical data analysis, we conducted a study of the normality of the distribution of random variables for two cohorts studied (up to and including 30 years\u2013young adults and over 30 years\u2013other adults). As the Kolomogarov-Smirnov test showed a lack of normality of the distributions, we decided to use non-parametric statistical tests and modelling methods to disregard the assumption of normality of the distribution. Due to the ordinal nature of the variables, we used the nonparametric Mann-Whitney U test and logistic regression. We performed the Mann-Whitney U test at \u03b1 = 0.05 to determine the general susceptibility to use FinTech products and services by young customers (born in 1990 or later and not older than 30 in 2020) and the other adults (over 30 years old) and we used two backward stepwise logistic regression models at \u03b1 = 0.1 to evaluate the experience of using FinTech and to identify the determinants of the high susceptibility to use the FinTech offers (above-average use).At the first stage of the study, we intended to compare:the experience in using FinTech products and services,the general susceptibility to use a variety of products , lending platforms, insurance, cryptocurrencies, stock investment) offered by FinTech entities,general evaluation of FinTech,the possibility of exclusive use of FinTechs.The FinTech products and services analysed in our study were selected based on observations of the Polish market and their availability among FinTech entities in Poland. The selection we also based on FinTech types commonly described in the literature presented in the Introduction section of this paper. The comparison concerned young customers was contrasted with that of the other adults (over 30 years old). The cohort of young adults (young customers) comprised of 230 persons and the cohort of the other adults (other customers) that comprised of 923 persons.The comparison based on nonparametric Mann-Whitney U test  and presAll the differences between the young customers and the other adults surveyed in the study occurred to be statistically significant except for the loans granted through lending platforms. In all cases the mean rank value for the persons up to 30 years of age turned out to be higher than in the other adults\u2019 cohort.In the next step, we decided to find factors that influence decisions about using FinTech offers in each age cohort. In the group of young customers 163 persons admitted that they had experience of using FinTech, which accounted for 72.6% of the cohort, while in the group of persons older than 30 years of age 565 respondents had experience of using FinTech products or services (61.2% of the other adults\u2019 cohort). The comparison of the factors influencing using/not using FinTech was conducted by means of a binary choice model, i.e., logistic regression (the logit model), used to monitor the choices made by individuals .In our case, we used the backward stepwise estimate and the model described with In the model, the dependent variable assumed as 1 was the possession of experience of using FinTech products and services by the respondents, whereas lack of such experience was assumed as 0. Moreover, we selected 20 explanatory variables (factors) characterising the respondents in respect of gender (X1), place of residence (X2), type and level of education (X3), marital status (X4), household size (X5), use of selected banking products (X6-X12), evaluation of FinTech (X13), independence in making financial decisions (X14), professional status (X15), being a farmer (X16), being retired or pensioner (X17), being a business owner (X18), being employed (X19), being a student of primary or other school (X20).The description of the model parameters for the young customers cohort is presented in Among the variables five of them were statistically significant. Two variables were related to socio-demographic aspects while the remaining concerned economic and financial issues.The estimate of the model parameters for the other adults (over 30 years of age) is presented in In case of the modelling of the experience in use of FinTech products and services among adults over 30 years of age, seven independent variables turned out to be statistically significant with three concerning socio-demographic aspects and the remaining four pertaining to economic and financial issues.The study concerning the use of FinTech products and services by young customers and the other adults was expanded to include the modelling of high susceptibility to use the FinTech or, in other words, the susceptibility to use FinTech offer beyond average. We decided that the above-average interest in the FinTech offer should be defined as more than a half of the value of the score obtained evaluations of declarations of using FinTech regarding seven aspects , lending platforms, insurance, cryptocurrencies, and stock investment). The respondent could evaluate each aspect of the declaration of using FinTech on the scale from 1 (definitely not) to 5 (definitely yes), which\u2013with seven aspects evaluated\u2013gave a minimum score of 7 and a maximum score of 35. The mean score for the seven segments was 21 and set the threshold for another division within the framework of which the persons from both the young customers cohort and the other adults\u2019 cohort were divided into two sub-cohorts:showing above-average (high) interest in FinTech offers\u2013this sub-cohort included the persons who scored over 21 points;showing average or less-than-average (low) interest in FinTech offers\u2013this sub-cohort included the persons who scored 21 points or fewer.Out of 163 young customers, 62 persons  scored over 21 points, whereas 101 persons (62%) scored below that number (sub-cohort B). In the group of 558 other adults, 147 persons (26%) were included into sub-cohort A, while sub-cohort B comprised of 411 persons (74%). In order to determine the factors that influenced the declaration of having above-average interest in FinTech in both cohorts, we applied the backward stepwise logistic regression model again with the dependent variable assumed as 1 when the total score for the susceptibility to use FinTech exceeded 21 (for sub-cohort A) and assumed as 0 when the score was equal to or lower than 21 (sub-cohort B). We used explanatory variables (factors) that were described in the point 2.2. of this article, i. e. which were characterising the respondents according to socio-economic features, the use of selected banking products as well as general evaluation of FinTech. The results of the estimates conducted for young customers are presented in In the case of young customers, the high willingness of using FinTech was determined with three statistically significant variables. All of them concerned financial products and general evaluation of the FinTech (attitude toward FinTech).Relevant calculations for the other adults\u2019 cohort are presented in In the case of the other adults\u2019 cohort, six statistically significant variables influencing the willingness to use FinTechs beyond average were recorded. Their scope was larger than for young generation and included education, social, family, and professional situation, as well as general evaluation of the FinTech (attitude toward FinTech).Our research into the susceptibility to use FinTech, the experience of FinTech, and the willingness of above-average use of FinTech offers demonstrates the existence of major differences between young customers and the other adults.Regarding the study of the susceptibility (willingness) to use the most popular FinTech products and services , all difThe interest of young customers in FinTech can be explained primarily with an attractive and very modern profile of FinTechs\u2019 operation and philosophy that\u2013in major part\u2013relies on mobile or online channels, which constitute an inherent part of a young person\u2019s lifestyle, communication style, and manner of dealing with everyday matters. Thus, it is not without reason that the generations of young people are referred to as \u2018digital natives\u2019 ,62,72. AUsing the trend of widespread development of the digital environment FinTech may relatively easily create a broad range of products and solutions. When evaluating possibilities of FinTech development in Poland we may find that terms for digitalization and FinTech proliferation are very favourable. Such statement can be confirmed by the fact that among the 50 fastest growing technology entities classified in the Deloitte Technology Fast 50 Central Europe 2022 ranking, as many as 17 came from Poland (in 2021 it was 16) ,74. PolaThe phenomenon of higher susceptibility to use FinTech by young adults than other adults may result also from the fact that the use of many FinTech products or services is free of charge or costs very little. For these young persons\u2013who have a relatively low income\u2013this is a desired situation which frequently might not happen if they wanted to use the products and services offered by traditional financial institutions that maintain physical branches.The phenomenon of inclination of young adults toward FinTech can also be explained by the fact that in Poland there have been no spectacular bankruptcies or other types of crises related to FinTech institutions or the entire FinTech sector. Due to this reason, trust, and perception of safety of FinTech are relatively high. Moreover, young people may not necessarily familiar with the offers of banks or other financial market companies, their innovative functionalities, or digital solutions, what can result from the perception of e.g., banks, as traditional institutions associated with older generations. It should be emphasised that as young people generally do not have negative experiences with traditional financial institutions, their attitude towards FinTech is a direct result of the subjectively perceived usefulness and the ease of use, combined with benefits (low or no fees) and low risk perception. Such characteristics support the validity of the TAM theory and its variants when describing the development of the FinTech sector. Against this background, in the subgroup of other adults, less willingness in use FinTech products and solutions may be part of both their perceived lower usefulness, but also greater difficulty of use. Rapid progress in FinTech means that often other adults  are to lesser extent able to follow change trends or learn novelties. They will be more sceptical about the usefulness and ease of use FinTech solutions. Their lower willingness to use the FinTech sector may also be influenced by the historically accumulated negative experiences in finance provided by traditional financial institutions . Bad former experiences may distract them from searching financial innovations, that can turn harmful for them in the future. On the other hand, the lower willingness of other adults to use FinTech can be explained by the sufficient and reliable solutions provided by the traditional financial institutions.While considering the experience of using FinTech products or services by both age cohorts that participated in the study, it must be noticed that it was possible to identify the determinants of using FinTech in respect of the respondents\u2019 characteristics. It was observed in both cohorts that men were considerably more experienced in FinTech than women, especially in the young customers\u2019 group. This may result from a different approach to risk adopted by men and women . A similOur investigation allowed also to indicate the factors determining the use and having experience in FinTech but differentiating the two study cohorts. The possession of a traditional bank account by respondents from the younger cohort cannot be overlooked as it decreases the likelihood of using FinTech. This phenomenon can be justified with the positive image, good reputation, and trust in safety of bank deposits among young people \u201381 and tWhen evaluating the high willingness to use FinTech products and services, i.e., the willingness to use it beyond average, it is important to point to the overall evaluation of FinTech operation as a statistically significant parameter characterising both age cohorts. In this case, a positive evaluation of operation influences the high willingness to use FinTech beyond average. It is worth remarking that the regression coefficient is higher for those evaluating FinTechs neutrally and lower than for those evaluating them positively in the cohort of young customers when compared to the other adults. This phenomenon implies that, regardless of how they evaluate FinTech, the persons below 30 years of age are more likely to use a FinTech beyond average than the other adults. The respondents over 30 years of age will do so on the condition that they very well evaluate FinTechs.Regarding the determinants of the above-average use of FinTechs, which can be identified only among the young customers or only among other adults, it is important to notice among the young adults the positive impact of prepaid and credit card possession. As to the other adults, the above-average use of FinTech depends on more variables, especially those concerning being in a relationship and being able to make financial decisions independently. In this case, both parameters have a stimulating effect and may, by virtue of the respondents\u2019 age, indicate that FinTech solutions are primarily used by the persons forming a household. Other factors influencing the widespread use of FinTech by respondents over 30 years of age include the level of education, the type of education, and the status of a retiree or a pensioner. In respect of the former, a higher level of education generally decreases the likelihood of using FinTech; however, this relationship is not linear and requires in-depth research embracing a comparison of the will of using FinTech between persons with various levels of education. We can refer here to a study by Cwynar  that doeThe purpose of the paper was to identify and evaluate the differences in the attitudes to using FinTech products and services between young adults and the other customers (other adults). Due to the fact that Poland is a post-communist country, it was assumed that the persons born no sooner than in 1990 should be recognised as young customers. The remaining adults were classified into the other cohort. The two study cohorts were born at a different time in history and were raised and came of age in a different socio-economic context.When compared to the other adults, young customers expressed significantly more interest (higher willingness) in using non-banking FinTech in respect of all categories tested in the study, that is the susceptibility to avail oneself of seven different product areas , lending platforms, insurance, cryptocurrencies, stock investment), the general evaluation of the operation of FinTech, and the susceptibility to use exclusively FinTech products and services. Thus, the hypothesis proposed in the paper can be confirmed.In our research we find that majority of both age groups, i.e., young persons and other adults had experience in using non-banking FinTech solutions, with the higher rate observed among the younger generation. Such a result signifies that FinTech solutions are widespread in the economy and can be effectively used by young and older people.Among the two groups of age there are as a rule different determinants of the use of FinTech. We found just gender, using of prepaid card, being independent in taking financial decisions and household size as the factors that turned out to be commonly stimulating to use the Fintech.Similarly, we find different determinants of the high susceptibility (above-overage) to use FinTech products and services for both age groups studied. The determinant that turned out common for the two cohorts is the respondents\u2019 evaluation of the FinTech. If the evaluation of the FinTech is positive, the odd of willingness to use of Fintech is clearly visible. As the other adults evaluate FinTech less positively than the young generation, this means that they are highly willing (above-overage) only if they have a positive opinion of the FinTech. This relationship is weaker for the young adults.The influence of an age on financial behaviour and decisions should be recognised as one of the key research areas in modern finance. This conclusion stems from the observation of significant socio-demographic changes happening in the societies concurrently with rapid transformation taking place in information technology and finance.The findings of our research undoubtedly provide practical implications which can be valuable for various commercial units. For example, thanks to our investigation, it is possible to identify the characteristics determining the use of FinTech products and services by both young and other adult customers. Financial institutions or FinTech companies might use it to increase the effectiveness of their sales. For example, the negative impact of having a bank account by young people on the willingness to use FinTech may encourage FinTechs to offer products and services to young customers before they start cooperation with traditional banks. The results of our study can be used to evaluate the possibilities of combining banking  and non-banking offers with FinTech solutions as well as to develop FinTech oriented offers for customers who are actually interested in this financial segment , profiled according to their age. Such an application can led to better management of customer acquisition costs, more effective support for FinTech development, as well as keeping customers loyal in terms of the increased competition that accompanies the digitalisation process.We are conscious that our paper has a few limitations. For example, the research was conducted using the CAWI technique. Therefore, it can be assumed that the participants were the people who have free access to the Internet or mobile communication channels. The use of the CATI technique of obtaining opinions would allow to obtain opinions from people who use mobile and Internet technologies daily to the lesser extent. In addition, our study concerned the CEE market, i.e., the market where it was much easier to disseminate new financial solutions due to the lack or very low effectiveness of traditional financial solutions developed by institutions in the 90s of the twentieth century. In the Western countries, where traditional financial systems were built much earlier, the susceptibility to FinTech products and services might be different as generations of young people and adults in the Western countries did not live in such diverse (different) economic and political conditions as the societies in CEE.The limitation of our paper was also the fact that we did not investigate the behavioural factors describing two selected age cohorts, which could be crucial from the perspective of TAM theory development. Due to the limited size of the opinion survey, we have focused mainly on socio-economic determinants.We think that further research in intergenerational evaluation of FinTech should focus on aspects of cybersecurity and legal protection of the use of FinTech as well as aspects of the response of traditional financial institutions to FinTech activities, i.e., improving the quality of products and services, further digitisation, entering FinTech competencies. It may also be interesting to examine the impact of extraordinary situations, such as restrictions related to the COVID-19 pandemic, on the acceptance of specific technologies used in the FinTech segment."}
+{"text": "The digital revolution has brought rapid developments to the health sector. People were taking advantage of telemedicine technology during the COVID-19 pandemic. Telemedicine is highly recommended during a pandemic because it will reduce the transmission rate of viruses, and it is considered adequate and low-cost. However, a fundamental challenge still occurs; most people need to be used to telemedicine technology. Presumably, inadequate education and lack of experience regarding the use of telemedicine are obstacles for society in utilizing telemedicine.  This study is aimed at determining the factors that influence the use of telemedicine. It focused on variables such as data confidentiality, administration, and knowledge to measure potential factors that pushed people to utilize telemedicine. We used a quantitative approach, using multivariate analysis, namely, simple linear regression. Most of our respondents are people aged 18-30 years young. p value =0.090 or >0.05) on telemedicine implementation, while the knowledge factor has a significant effect on telemedicine implementation with a p value =0.043 (<0.005). The multivariate analysis explained that the knowledge variable influenced telemedicine use with a p value =0.033 (<0.05), meaning it contributed 1.624 times to telemedicine.  All respondents stated that administration factors in the implementation of telemedicine were good. Through the Chi-square test, the data safety factor has no effect (Knowledge is an intellectual property that everyone must have to capitalize on with telemedicine. A lack of knowledge will become an information gap and a barrier for someone to reach new tools/technologies. This study discusses the factors that influence the use of telemedicine. The study's results explain that the knowledge variable is the most significant factor influencing telemedicine use.  Advances in technology bring increasingly sophisticated aspects to the health sector. Telemedicine is an evidence-based practice resulting from technological developments . Three pTelemedicine is increasing, especially during the COVID-19 pandemic, and there is great hope for the public to continue to consult with health workers . ContactThe current debate is centered on the issue of the lack of information and education that hinders people from accessing telemedicine technology. Telemedicine is used to increase digital literacy and technological resources . IncreasAt the same time, education level is a telemedicine obstacle because research also finds that the lower a person's education, the lower that person's knowledge, which is called a digital literacy deficit. Another weakness of telemedicine is that health workers cannot carry out physical examinations in person, so they are limited in providing emergency services. In addition, users need stable connectivity to access telemedicine services , 17. HowThis study was conducted in Surabaya City, East Java Province, Indonesia. This study uses a quantitative approach with a cross-sectional design. Surabaya, the capital city of East Java, is home to people of various ethnicities. The locals are joined by foreigners who came from other areas and settled in the area, which has resulted in the area being densely populated. Consequently, the spread of the COVID-19 virus is rapidly happening in this city.Previous research has been conducted on telemedicine using a retrospective observational study method because of doubts arising during diagnosis and therapeutic management . MeanwhiPerception of data security influences the perceptions of telemedicine implementation.Perception of administration influences the perceptions of telemedicine implementation.The knowledge factor influences the perception of telemedicine implementation.We used a simple random sampling method and selected respondents based on several inclusion criteria: telemedicine service users and smartphone users. We adjusted the inclusion criteria to the research objective, namely, the determining factors for the use of telemedicine, where people generally access telemedicine via smartphones. The number of respondents in this study was 400 respondents. The entire research process was carried out for one year in 2022 after COVID-19 hit.Based on previous research on the use of telemedicine in the community, it is still necessary to adjust preferences based on age, knowledge, and practice of implementing telemedicine. Therefore, our study contributes to exploring and estimating the variables related to continued telemedicine adoption. In addition, we also explore knowledge, administration, and data confidentiality factors in the performance of telemedicine services. On the knowledge factor, the questionnaire questions included the types of services available on telemedicine, how to use these services, and the reasons for using telemedicine applications. The knowledge factor questions are six questions. Meanwhile, regarding health administration factors, we asked three questions related to perceptions of the importance of ease of administration, the importance of recording service access history, and the importance of minimizing document requirements for telemedicine services through yes or no statements. Finally, on the data confidentiality factor, three questionnaire questions cover the responsibility for data confidentiality and perceptions of personal data security when using telemedicine services.p > 0.05 = normal). Thus, we found that the dependent and independent variable scores were not normally distributed . Therefore, we used medians for cut-offs for all variables. The median value for the variable knowledge is 6, administration and data confidentiality is 3, and for the use of telemedicine is 24. This study only focused on a few independent variables, which are crucial in discussing telemedicine usage.Before conducting an in-depth analysis, researchers coded the answers to classify the data and simplify the data entry process. The data then goes through a data entry process. All data underwent a normality test with the Kolmogorov-Smirnov test (The data in the questionnaire is inputted into the Microsoft Excel Worksheet (.xlsx) and then inputted into the SPSS 26.0 application to assess the findings. We utilized univariate analysis to explain the characteristics of respondents . It is necessary to describe certain patterns and tendencies among telemedicine users. Bivariate analysis was used to determine the relationship between the dependent and independent variables, and the analysis used was Chi-square analysis. It could give a proper explanation regarding factors that pushed people to utilize telemedicine. Furthermore, to see the most dominant factors influencing the use of telemedicine, the researchers also used regression analysis.Based on the data we collected through questionnaires, most of our respondents were women, namely, 251 respondents or around 62.8%, while the rest were men, 149 respondents (37.3%). While on the age factor, generally, 18-30, namely, 321 respondents (80.3%), and respondents aged <18 years, 31-40 years, and >40 years, each less than 10%. Students dominate the respondents. We define a student as someone who goes through a learning process at all levels of formal education. A total of 340 respondents (85%) were students, 20 respondents (5%) were private employees, five respondents (1.3%) were self-employed, two housewives (0.5%), and two government officials (0.5%). Thirty-one respondents (7.8%) are not included in the previously mentioned occupational groups. Respondents in general (365 respondents or 91.3%) had a high school education, 8.3% (33 respondents) had a bachelor's degree, and the remaining 0.5% (2 respondents) had a master's degree .One of the platforms in telemedicine services still being used by the public is Halodoc (39.8%), a franchise provided by the private sector. Meanwhile, the services provided by the government, namely, mobile JKN, still need to be used by the public in this study, namely, only 0.3% of the total respondents. Respondents also use Alodokter (5.3%), KlikDokter (1%), and other franchises that require explicit identification (2.5%). The majority of respondents stated that they no longer used telemedicine (51.3%), while 10% of respondents stated that they still used it once a month, and the frequency was more than once a month and less than or equal to three times a year, each less than 10%. They all have experience using telemedicine, primarily for consulting doctors (30%), while their other activities are reading health articles (26.5%), buying medicine (9.5%), laboratory testing (2%), getting COVID-19 medicine for free (1.6%), and other telemedicine activities (30.5%) .p value of 0.09 . Thus, the two variables do not have a significant relationship.We also performed the 2 \u00d7 2 table relationship analysis in p value of 0.043  or is significantly related. Dominant respondents had good knowledge (290 respondents), where 49% considered the implementation of telemedicine to be good, and 51% stated that the implementation of telemedicine was poor. Meanwhile, 110 respondents had poor knowledge, of which 60.69% of respondents considered the implementation of telemedicine to be good, and 39.1% of respondents stated that the implementation of telemedicine was poor. The next step is to select significant variables  based on the Chi-square test results and enter them into the regression test. Thus, the regression test can only be carried out on one variable that meets the significant requirements, namely, the knowledge variable.Researchers could not conduct a Chi-square statistical test on administrative factors because all respondents (100%) stated that administration was good. However, the percentage of respondents' opinions regarding the implementation of telemedicine is slightly different. Namely, 52.3% said it was good, and 47.8% said it was poor. Meanwhile, the knowledge variable related to the application of telemedicine has a p value of 0.03 . In other words, knowledge has a significant relationship with perceptions regarding the application of telemedicine. The odds ratio value indicates that people with better knowledge will have the opportunity to utilize telemedicine services by 1.624 times . At the same time, the value of B indicates that knowledge has a positive correlation with the use of telemedicine.The regression analysis results in Telemedicine is one of the targets of world technological progress , 29 in aThe application of telemedicine involves a complex integration between information technology and healthcare services that enables service providers to diagnose, consult, and treat patients without geographic boundaries. By leveraging online platforms and dedicated applications, telemedicine revolutionizes traditional healthcare delivery while maintaining high medical standards. In the context of a global pandemic and increasing demand for medical services, telemedicine is increasingly becoming an essential solution in overcoming barriers to access and improving the quality of medical services in general , 35, 36.Specifically in Indonesia, this study's results indicate that telemedicine use still needs to be increased. Currently, there is only one telemedicine franchise that dominates the Indonesian market, namely, Halodoc. This finding implies that telemedicine, the style of today's digital devices, is not yet as prevalent among the public. Services of telemedicine include administration, information, and treatment. Our research results also show that most respondents were women, and most came from the younger generation, especially those aged 18-30. This finding is similar to other studies, with the average age of research respondents being 29 years  and otheThis condition is different in people with old age. Our findings align with Jaron in Poland, who found that the age group 60 years and over showed reluctance to access teleconsultation . TelemedHealth services that use more than one service modality, such as distance medicine, have the potential to report higher utilization rates of health services compared to those that only have one service modality . HoweverOne study stated that telehealth investments could increase the utilization of youth health services and help maintain relationships with adolescents during shocks, including during a pandemic or other conditions that can limit physical access to health services . The sucPrevious research found that there is avoidance of using relatively new services because people do not trust and benefit from these services \u201346. On tp value was 0.015, which means that education affects the level of knowledge. Adequate knowledge is essential to encourage someone to try something new. Therefore, people must find ways to increase digital literacy to keep up with the increasingly sophisticated times [According to another study, the number of respondents with good knowledge as much as 67.4% of respondents had also received health information from the Internet as much as 23.6%, and 60.59% of respondents had visited telemedicine platforms. Respondents stated that they often exchange information about the COVID-19 virus via telemedicine as much as 75.3% and usually use communication services via telephone as much as 30.6% . This fied times , 51.Due to our findings, we suggest increasing capacity building for citizens, positive medical or academic training, and continuing medical education for more complex diagnoses, which also play a small but integral role in video and web conferencing. This training can become a global learning forum by recording and broadcasting the learning sessions so that other doctors or students can access them for free. Additionally, facilitating the transfer of medical knowledge from sources in research centers using audiovisual and digital tools reduces the information gap for healthcare providers in underserved hospitals . In othep value of 0.090 (>0.05), which means it does not affect the use of telemedicine. However, data security is an essential variable in telemedicine technology. In order for users to feel comfortable and continue to use the telemedicine platform, service providers must provide data security that is confidential and accurate [Based on the results of our study, the data security variable has a accurate , 49, 52.accurate .Indeed, telemedicine has many advantages but can only partially replace the primary doctor-patient relationship. Some treatments would be more optimal in person, not just virtually. However, telemedicine is aimed at providing online counseling  and geneThe use of telemedicine has increased significantly during the COVID-19 pandemic. Our findings highlight knowledge as the most crucial variable. Good knowledge does not necessarily have implications for good perceptions of telemedicine implementation. In other words, telemedicine technology needs to be updated to attract its users' interest. Meanwhile, we also found telemedicine users with poor knowledge. Thus, education regarding this technology must be increased so that users are accustomed to using it. Knowledge of telemedicine will enable them to use it wisely. In addition, our research implies that health awareness fundamentally extends beyond knowledge of technology. With a proper understanding of the importance of health, society will look for ways to direct it toward it. In addition, social barriers in society cause their reluctance or inability to access valuable technologies such as telemedicine. Further research on telemedicine may explore these barriers. In addition, it is also essential for future researchers to focus on the effectiveness of telemedicine as a technology that functions to increase public health awareness and not only focus on the ability or effectiveness of telemedicine as a technology to cure disease."}
+{"text": "Citrus limon) industry worldwide. However, the pathogenesis of CYVCV remains poorly understood. In this study, direct interaction between the coat protein (CP) of CYVCV and the ascorbate peroxidase 1 of lemon (ClAPX1) was confirmed for the first time by yeast two-hybrid, Bimolecular Fluorescence Complementation, and Co-immunoprecipitation assays. Transient expression of CP in lemon and Nicotiana benthamiana significantly enhanced the enzyme activity of the ClAPX1, and then inhibited the accumulation of H2O2. In addition, overexpression of ClAPX1 in lemon by transgene significantly promoted CYVCV accumulation and depressed the expression of most genes involved in jasmonic acid (JA) signaling pathway. Correspondingly, ClAPX1 silencing by RNA interference inhibited CYVCV accumulation and increased the expression of most genes involved in JA signaling pathway. To our knowledge, this is the first report that viruses regulate ROS by targeting APX directly, thereby suppressing host immune response and promoting viral accumulation, which may be mediated by JA signaling pathway.Reactive oxygen species (ROS) are closely related to the antiviral immune response of plants, while virus can regulate ROS through various pathways to facilitate their own infection or replication. Citrus yellow vein clearing virus (CYVCV) is one of the most devastating viruses affecting lemon ( Studies have shown that a local ROS burst can directly limit virus spread and ROS also act as signaling molecules to induce or trigger antivital immune responses, including pathogen-associated molecular pattern-triggered immunity (PTI), effector-triggered immunity (ETI), and systemic acquired resistance (SAR) (Nicotiana benthamiana (N. benthamiana) to induce an intracellular ROS burst, which promoting viral RNA replication -responsive pathogenesis-related (PR) genes by inhibiting CAT activity during MCMV infection (Reactive oxygen species (ROS), including superoxide (Oce (SAR) . On the lication . The intnfection . In addinfection . The P31nfection . Barley nfection .Arabidopsis (OsAPX7 modulates drought stress tolerance in rice (Oryza sativa) (Zea mays APX1 overexpression resulted in lower H2O2 accumulation and enhanced resistance against B. maydis (Xanthomonas perforans (2O2 accumulation and inducing an immune response in tobacco (Ascorbate peroxidase (APX) is a key enzyme in ROS-scavenging system and plays a significant role in plant responding to abiotic and biotic stresses. APX distributed in various cellular compartment as cytoplasm, chloroplast and microbody, can be divided into four isoforms, such as: thylakoid membrane-bound APX (tAPX), microbody (including glyoxysome and peroxisome) membrane-bound APX (mAPX), stromal APX (sAPX), and cytosolic APX (cAPX) . In abiobidopsis . Overexpbidopsis . Overexpbidopsis . Stromal sativa) . In biot sativa) . Zea may. maydis . Tomato erforans . Studieserforans . Mittler tobacco . To dateCitrus yellow vein clearing virus (CYVCV) is an emerging virus that causes serious economic damage to the lemon industry worldwide. The virus was first identified in Pakistan in 1988 , and latMandarivirus in the family Alphafexiviridae  Osbeck) seeds were maintained in a greenhouse at 25\u00b0C under a 16 h/8\u00a0h light/dark cycle.A CYVCV infectious cDNA clone, pCY-AY221, was constructed by Cui et\u00a0al. . N. bent2.2The cDNA library was constructed by the Genecreate company using Eureka lemon leaves infected with CYVCV. The coding sequence (CDS) of the CP was cloned into the pGBKT7 vector to generate the pGBKT7-CP vector. Subsequently, The CDS of ClAPX1 was cloned and fused with the pGADT7 vector to generate the pGADT7-ClAPX1 vector. The generated bait and prey plasmids were co-transformed into yeast cells (Y2H Gold) and cultured on SD-Leu/-Trp medium for 2-3 days post inoculation (dpi). Then, they were plated onto SD-Leu/-Trp/-His medium to analyze the interaction. The primers used for vector construction are listed in 2.3A. tumefaciens strain GV3101 and cultured overnight. The cultures were collected and resuspended with infiltration buffer  with OD600\u00a0=\u00a01.0. Agrobacterium strain GV3101 with pSPYNE-CP and pSPYCE-ClAPX1 were mixed (1:1 ratio), followed by incubation at 25\u00b0C for 3\u00a0h. Subsequently, the mixture was infiltrated into N. benthamiana leaves. The infiltrated leaves were collected using a 5\u00a0mm diameter punch and observed under an Olympus FV3000 confocal microscope at 2-3\u2009dpi. The primers used for vector construction are listed in The CDS of CP and ClAPX1 were inserted into the pSPYNE and pSPYCE vectors, respectively, to generate the pSPYNE-CP and pSPYCE-ClAPX1 constructs. The obtained vectors were transformed into 2.4A. tumefaciens harboring pBI121-CP-RFP and pBI121-ClAPX1-CFP were co-agroinfiltrated in N. benthamiana leaves. The infiltrated leaves were harvested at 2 dpi, frozen with liquid nitrogen, and subsequently ground into a powder. Total protein was then extracted using IP buffer  Triton X-100, 10% (v/v) glycerol, 1\u00d7protease inhibitor cocktail and 1 mM phenylmethylsulfonyl fluoride (PMSF)). After being incubated for 20\u00a0min, the mixture was centrifuged at 12000\u00a0g, 4\u00b0C for 20\u00a0min. The supernatant was then incubated with anti-GFP beads. The immunoprecipitated proteins were separated by 12.5% SDS-PAGE and analyzed using the corresponding antibodies. The primers used for vector construction are listed in The CDS of CP and ClAPX1 were cloned into the pBI121 vector to generate pBI121-CP-RFP and pBI121-ClAPX1-CFP, respectively. 2.5N. benthamiana along with agrobacterial cells harboring the plasma membrane marker PM-GFP and the nuclear marker H2B-GFP. pBI121-CP-RFP and pBI121-ClAPX1-CFP were also co-infiltrated into N. benthamiana leaves. Green fluorescence protein (GFP), blue fluorescent protein (BFP) and red fluorescence (RFP) were observed using confocal laser scanning microscope FV3000 at 2-3 dpi.The pBI121-CP-RFP and pBI121-ClAPX1-CFP vectors were used for the subcellular localization assay, and pBI121-CFP was used for control. The pBI121-ClAPX1-CFP construct was subsequently co-infiltrated into the leaves of 2.6A. tumefaciens GV3101, which harbors the pBI121-CP-RFP and pBI121-ClAPX1-CFP plasmids, were mixed in a 1:1 ratio for co-infiltration into N.\u2009benthamiana and one-year-old virus-free Eureka lemon seedlings, respectively. At 2-3 dpi, the infiltrated leaves of N.\u2009benthamiana were collected for CYVCV accumulation and additional analysis. \u200bAt 10 and 20 dpi, the infiltrated lemon leaves were collected for observation of CYVCV accumulation and further analysis.2.7A. rhizogenes strain K599 and cultured overnight at 28\u00b0C using TY liquid medium. The resuspended cell at final concentration (OD600\u00a0=\u00a00.6-0.8) with the MES buffer  followed by incubated at 28\u00b0C for 3\u00a0h. Subsequently, Eureka lemon branches were soaked in the resuspended A. rhizogenes strains K599 and subjected to vacuum in\ufb01ltration for approximately 25\u00a0min using a standard vacuum. The stem sections were cultured in a dome tray filled with vermiculite-mixed soil in the greenhouse at 26\u00b0C, with 90% relative humidity and a 16 h/8\u00a0h (light/dark) photoperiod. To identify the transgenic roots, GUS histochemical staining and reverse transcription-PCR (RT-PCR) assays were used. The obtained transgenic roots were used for gene expression analysis and subsequent evaluation. The primers used for vector construction are listed in Citrus hairy root transformation was performed according to the methods reported by 2.8Transgene and silencing citrus were graft inoculated with CYVCV positive bark by RT-qPCR detection. Subsequently, root samples were collected one month after virus inoculation for gene expression and CYVCV accumulation analysis. The primers used for vector construction are listed in 2.9N.\u2009benthamiana leaves, Eureka lemon leaves and roots were extracted according to Plant Total Protein Extraction Kit (Solarbio Life Sciences). The extracted proteins were then separated using 10% SDS-PAGE and then transferred to the PVDF membrane. The PVDF membranes were incubated with monoclonal anti-CP of CYVCV, monoclonal anti-GFP (Sigma), followed by a horseradish peroxidase (HRP)-conjugated secondary antibody (Proteintech). Blots were visualized using a chemiluminescence detection kit (Everbright Inc.).The total protein of 2.102O2) contents were measured using the micro method kit following the manufacturer\u2019s instructions . Three biological replicates were maintained in each group. The ClAPX1 activity was measured using a micro method kit following the manufacturer\u2019s instructions .The hydrogen peroxide  was used to generate the first-strand cDNA. RT-qPCR was conducted using BlasTaq\u2122 2 \u00d7 qPCR mixes, N.\u2009benthamiana and citrus actin gene were used as an internal reference. The results were analyzed by the 2-\u0394\u0394Ct method and shown as means \u00b1 SD (n = 3). At least three biological repeats were conducted for all experiments. Different letters indicate significant differences at P \u2264 0.05.The total RNA was isolated from 2.12Each experiment was repeated at least three times, and data are represented as the mean. Values are presented as means \u00b1 SD. Statistical significance was determined using Student\u2019s t-test, *\u00a0P\u00a0<\u00a00.05; ** P<0.01, *** P<0.001. All analyses were performed with the GraphPad Prism 8.0 software.33.1N. benthamiana co-infiltrated with Agrobacterium carrying pSPYNE-CP and pSPYCE-ClAPX1 plasmids, but not in those co-infiltrated with pSPYNE-CP and pSPYNE or pSPYCE-ClAPX1 and pSPYCE plasmids  medium, while the negative control did not show any growth , allene oxide cyclase (CsAOC), coronatine insensitive 1 (CsCOI1), lipoxygenase 3 (CsLOX3), lipoxygenase 1 (CsLOX1), jasmonic acid-amido synthetase 1 (CsJAR1), myelocytomatosis proteins 2 (CsMYC2), mitogen-activated protein kinase (CsMAPKs), plant defensin 1.2 (CsPDF1.2), and pathogenesis-related protein 3 (CsPR3) in transgenic lemon roots.To elucidate the mechanism underlying ClAPX1-mediated facilitation of CYVCV accumulation, we examined the relative expression levels of ten genes involved in jasmonic acid (JA) biosynthesis and immune response, including allene oxide synthase  of Pepino mosaic virus (PepMV) and tomato CAT1 increases its activity and promotes virus accumulation . In thisn citrus , suggest2O2 accumulation and activating a JA-mediated defense signaling pathway  were decreased in the transgenic roots, while the expression levels of seven genes  were increased in the silenced roots. These results suggest that the interaction of CP with ClAPX1 may affect the JA signaling pathway, while further studies are needed to elucidate the mechanism by which APX promotes CYVCV accumulation.The role of APX in pathogen infection has been extensively studied; however, the underlying mechanism by which APX responds to biological stress remains elusive. One study revealed that the cytosolic localized protein ZmAPX1 induces resistance to SCLB in maize by reducing H pathway . CAT, wh pathway . In this pathway . In ordeIn summary, our study confirmed that the CP of CYVCV can directly interact with the host protein ClAPX1, thereby promoting its activity and reducing ROS accumulation. Furthermore, the interaction between CP and ClAPX1 suppresses plant immunity, thereby facilitating CYVCV accumulation, which may be involved with JA signaling pathway. The present study represents the first report to clarify the direct interaction of CP with ClAPX1 via regulating ROS. This finding lays a foundation for future investigations aimed at unraveling the functional role of APX in plant-pathogen interactions and exploring potential resistant varieties.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.CW: Investigation, Validation, Writing \u2013 original draft, Writing \u2013 review & editing. QZ: Investigation, Writing \u2013 review & editing. JL: Writing \u2013 review & editing. XW: Writing \u2013 review & editing. CL: Writing \u2013 review & editing. YB: Writing \u2013 review & editing. ZS: Supervision, Writing \u2013 review & editing."
\ No newline at end of file