{"text": "Many properties of organisms show great robustness against genetic and environmental perturbations. The terms canalization and developmental stability were originally proposed to describe the ability of an organism to resist perturbations and to produce a predictable target phenotype regardless of random developmental noise. However, the extent to which canalization and developmental stability are controlled by the same set of genes and share underlying regulatory mechanisms is largely unresolved.Drosophila subobscura. For the analysis of overall size, developmental stability was positively correlated with levels of heterozygosity and development at the optimal temperature. For analyses of shape, the overall comparisons by matrix correlations indicate that inter- and intraindividual variation levels were poorly correlated, a result also supported when comparing the vectors describing patterns of variation of landmark position. The lack of similarity was basically due to the discrepancy between the genetic and environmental components of the interindividual variation. Finally, the analyses have also underscored the presence of genetic variation for directional asymmetry.We have analyzed the effects of clinal genetic variation (inversion polymorphism) on wing asymmetry by applying the methods of geometric morphometrics in the context of quantitative genetics using isochromosomal lines of Drosophila populations is loosely related to individual fitness.The results strongly support the hypothesis that environmental canalization and developmental stability share underlying regulatory mechanisms, but environmental and genetic canalization are not functionally the same. A likely explanation for this lack of association is that natural wing shape variation in  Phenotypic robustness refers to the invariance of the specified target phenotype given the genetic makeup and environmental conditions. Whereas the presence of naturally occurring phenotypic variation is at the core of evolutionary biology, developmental geneticists have traditionally considered it as a nuisance. Instead, they have relied on the study of single or multiple mutant combinations to reveal the generation of phenotypic patterns (e.g. ). A resuThree major processes are involved in the control of phenotypic variability : canali) and special (micro) environmental effects : the first refer to influential factors (e.g. temperature) that are shared by groups of individuals, whereas the latter are residual deviations from the phenotype that would be specified on the basis of genotype and general environmental effects. Such deviations are unique to individuals and are largely unpredictable. The variance associated with special environmental effects can be estimated when experiments are performed on completely inbred lines . In bilaterally symmetrical organisms it is also feasible to estimate the two sources that contribute to those special environmental effects: among-individual  and within-individual variance . If the only real cause of asymmetry is variation due to stochasticity in development, then FA can be taken as an estimated of . Therefore, FA is only one source of the phenotypic variation within environments , contrarily to the arguments in Nijhout and Davidovitz  have a mean of zero, the interaction term is a measure of fluctuating asymmetry  provided that there is no genetic variation for DA [To first partition the total phenotypic variation into interindividual, intraindividual and measurement error components, we used the conventional mixed model, two-way ANOVA  for the study of left-right asymmetries . In thisn for DA , and the; there is no genetic variance within crosses). An estimated of the among-fly special environmental effects variance (i.e. ) is therefore obtained by subtracting the individual \u00d7 side interaction effect (which includes  plus measurement error) as the appropriate error term. However, when genetic variation for DA is present the unbiased within-fly special environmental effects variance (i.e. FA) is estimated after partitioning the individual \u00d7 side interaction effect into its causal components [We now digress slightly to point out some inconsistencies in the literature on what is the appropriate error term to test for the \"interindividual\" effect in the mixed model, two-way ANOVA  outbred crosses the karyotype covariance components were calculated as  , the cross covariance components as , and the among-fly special environmental effects covariance components as .The SSCPIS matrix into their causal components [Similarly, genetic effects for DA can be investigated after partitioning the SSCPmponents . for i \u2260 j,  for i = j; superscript 'denotes transposition) in an n-dimensional space.Within each sex and temperature, principal component analyses  of the Vx- and y-coordinates  since covariance matrices are symmetrical, and statistical significance was assessed using permutation tests designed to maintain the associations between pairs of  columns ,15); othA second test examined the congruence of the landmark displacements corresponding to each emergent PC for the different effects within groups. Because the PCs correspond to directions in the multivariate shape space, correlations can be obtained by angular comparisons of component vectors. Statistical significance of these correlations was then assessed by comparing those observed values to a null distribution of absolute angles between 100,000 pairs of 22-dimensional random vectors . The 0.1) [) against mean centroid size .The occurrence of antisymmetry  for cen) . The indP-values > 0.10) and, therefore, no size corrections were necessary.Scatter plots of left-right differences for each landmark after Procrustes superimposition were visually checked to see whether or not there was evidence for clustering of these vectors that would have argue for the occurrence of AS ,15. No iThe computer programs used for statistical data analyses were MATLAB (V.6. ) togetheMS conceived the study, carried out extraction of O chromosomes, experimental crosses, egg collections, statistical analyses, and drafted the final manuscript. PFI carried out extraction of O chromosomes, experimental crosses, egg collections, wing measurements, and preliminary statistical analyses and drafts of results. WC read all salivary gland squashes for gene arrangement identification and mounted the wings on microscope slides. All authors read and approved the final manuscript."}
{"text": "Wolbachia infection in D. bifasciata in Hokkaido island of Japan, in contrast to the presence of infection on the proximal island of Honshu, was associated with failure of the infection to function properly on the Hokkaido genetic background.Selfish genetic elements that distort the sex ratio are found widely. Notwithstanding the number of records of sex ratio distorters, their incidence is poorly understood. Two factors can prevent a sex ratio distorter from invading: inability of the sex ratio distorter to function (failure of mechanism or transmission), and lack of drive if they do function (inappropriate ecology for invasion). There has been no test to date on factors causing variation in the incidence of sex ratio distorting cytoplasmic bacteria. We therefore examined whether absence of the male-killing D. bifasciata may occur at different densities in Hokkaido and Honshu populations, giving some credence to the idea that ecological differentiation could be important.The male-killer both transmitted and functioned well following introgression to each of 24 independent isofemale inbred lines carrying Hokkaido genetic backgrounds. This was maintained even under stringent conditions of temperature. We therefore reject the hypothesis that absence of infection is due to its inability to kill males and transmit on the Hokkaido genetic background. Further trap data indicates that The absence of the infection from the Hokkaido population is not caused by failure of the male-killer to function on the Hokkaido genetic background. Selfish genetic elements that distort the sex ratio of their host are known widely in arthropods . DespiteDrosophila pseudoobscura, frequency declines at both high latitude and high altitude. This is not associated with resistance to the action of the driver (no resistance is known), and variation in rates of multiple mating is suspected as a cause [D. subobscura, X drive is present in North Africa and absent in Europe. Here, absence of X drive is associated with the less efficient function of X drive on the European genetic background [Factors causing variation in prevalence/incidence over space may be either ecological or associated with differences in host genetic constitution. For instance, in the case of X chromosome meiotic drive in  a cause . In contckground .Drosophila prosaltans, for instance, there is intra-population host genetic variation in refractoriness to male-killer action/transmission [et al. [This study pertains to the factors affecting the incidence of male-killing bacteria. These bacteria pass from a female to her progeny, and kill any males they enter. Male-killers are common in insects, but an appreciation of the factors underlying their incidence is lacking . In the smission . Thus, ismission . For ins [et al.  have demWolbachia in Drosophila bifasciata in Japan. Drosophila bifasciata feeds on sap fluxes in deciduous forests, and sampling across 10 populations within Honshu island in Japan revealed a relatively constant frequency of infection, with between 5 and 7% of females infected with the male-killer [Wolbachia still present on Honshu to this day [In this paper, we examine the factors that could cause incidence variation for the male-killing e-killer . The malthis day .D. bifasciata populations [In contrast to collections from Honshu, past surveys across Hokkaido, the North island of Japan, indicated flies in this area are not infected with the male-killer, despite the relative proximity of the sites to the infected populations in the Northern most sites in Honshu. In total, 559 flies from six locations within Hokkaido were tested, with no evidence of sex ratio distortion in any case . We can ulations . Second,D. bifasciata ecology between Hokkaido and Honshu islands. Our results indicated that the Hokkaido genetic background supported the transmission and action of the male-killer even under stringent conditions, ruling out genetic differentiation as a cause of the absence of the male-killer from Hokkaido. We did observe higher capture rates of D. bifasciata in the island of Hokkaido, and future work should therefore be focussed on the degree to which ecological differences affecting the drive of the infection dictates incidence in this species.We tested whether the absence of infection in Hokkaido was associated with an effect of host genotype on the efficiency of male-killer transmission or strength of male-killing ability. Beyond this, we examined whether trap collection data were consistent with difference in Twenty-eight female flies were collected from the field in Hokkaido. Of these, 4 failed to produce progeny. The remaining 24 all produced a normal sex ratio, consistent with continued absence of the male-killing trait in Hokkaido.Wolbachia from Honshu by introgression of the infection onto the Hokkaido genetic background. The progeny from the 24 Hokkaido females were maintained as isofemale inbred lines for three generations to capture genetic variation within them. The male-killing Wolbachia from Honshu was then placed onto each inbred background via crossing infected females from Honshu to males from each of the Hokkaido lines, with subsequent generations being maintained through further crossing to males from the appropriate Hokkaido line.We tested whether the Hokkaido genetic background supported the male-killing The sex ratio produced following introgression of the infection to the Hokkaido genetic background was female biased and penetrance of the male-killing phenotype was perfect in the first generation. A few males appeared sporadically in six of the 24 lines in one or more subsequent generations, with highest frequency in lines 15 and 25  than in the two samples from the Northern Honshu populations  and the population from Mid Honshu (Kiyosumi). Increased capture rate in Hokkaido was also reflected in an increase in the proportion of all drosophilids sampled that were bifasciata . This high efficiency was maintained even at the threshold for complete male-killing in Honshu, 23.5 C . Thus, the male-killer is proficient at being transmitted and killing males on the Hokkaido background even under relatively stressful environmental conditions. Further, we continue to maintain the infection on the Hokkaido background (we are now at generation 15) without any loss of the infection and without appearance of males. Thus, it is not tenable to argue that the hosts themselves are not genetically suitable for the function of male-killer, at least on an ecological timescale. This situation contrasts with the case of meiotic drive in the related fly D. subobscura, where absence of drive in Europe was associated with refractoriness to the action of the sex ratio distorting element.Previous study has shown that male-killing bifasciata captured at lower rate in the populations from Honshu than in Hokkaido. Thus, ecological heterogeneity is a possible source of the incidence pattern. There are three parameters in male-killer dynamics that may be environmentally influenced. First, the advantage to male-killing may not be as strong in Hokkaido populations. Second, the cost of infection to female flies may be higher in Hokkaido than in Honshu. Third, the transmission efficiency may alter, mediated via elevated temperature, or possibly by reduced overwinter temperature.In the absence of variation in the ability of the male-killer to function on the different genetic backgrounds, the question arises as to the features that cause infection to be absent from the Hokkaido population. Our study did reveal differences in trap collection rates between the populations of Hokkaido and those of Northern Honshu, with In our view, the latter factor is unlikely to be driving the observed pattern. It is notable that the survey of Ikeda revealed the infection to be present in Northern Honshu, but not in Southern Hokkaido. Given these two areas are geographically and climatically very close, temperature differences have poor explanatory power. Explanations based on temperature are also weak because this species exhibits a degree of homeostasis in temperature, moving to elevated altitudes to avoid excess temperature.bifasciata observed in Hokkaido translates into many females laying eggs in a single sap flux, male death will not greatly increase the survival of infected females over uninfected, and infection will decline in frequency. The second factor that may cause infection to decline in frequency is if costs of infection are higher in Hokkaido than in Honshu. This factor can be ecologically contingent. Ikeda demonstrated that the relative fitness of infected flies compared to uninfected flies was lower under high densities in the laboratory [This leaves us with two hypotheses to explain absence of infection in Hokkaido. The first is that there is a weaker advantage to male-killing in Hokkaido than on Honshu, such that there is insufficient drive to maintain the bacterium or permit its spread. The advantage of male-killing to the bacterium depends upon the number of females ovipositing in a single patch . If the boratory . Thus, iWolbachia from Hokkaido.Aside from these possibilities, which we consider most likely, other ecological discontinuities between Hokkaido and Honshu deserve investigation. Some symbionts, for instance, give the host protection against parasitoids , and thuWolbachia to function on different host genetic backgrounds that drives presence or absence of infection in the D. bifasciata- male-killing Wolbachia system. We have demonstrated that despite being absent from Hokkaido, Wolbachia can both be maintained and express male-killing on the Hokkaido host genetic background. We observe that the two populations show differences in trap capture rates, and argue that either ecologically contingent benefits or ecologically contingent costs of infection may explain presence and absence of infection in this species, and that future research be focussed at this level.It is not variation in the ability of D. bifasciata were collected on the campus of Hokkaido University, Sapporo , Japan, in May 2003. These were then brought into the laboratory, where they were maintained individually in vials at 21\u00b0C on a modified cornmeal-agar diet . These female were checked for the presence of the male-killing trait through scoring of the sex ratio, and maintained by sib-sib inbreeding  for three generations to make inbred isofemale lines. In total, 24 isofemale inbred lines were created (4 lines went extinct), which were maintained thenceforth by simple tossing every three weeks.Twenty eight wild female Wolbachia infected virgin females extracted from a culture derived from Honshu island, Japan . This pished in ) with liTemperature is known to affect the stability of the male-killing trait, and previous study demonstrated that an upper threshold of 23.5 C existed for stable maintenance of the infection on the Honshu genetic background . We testDrosophila communities. Drosophila communities were sampled in 4 deciduous forests in Southern Hokkaido, 2 sites in Northern Honshu, and one site in Mid Honshu, in early-mid October over a number of years between 1973 and 1984 (Figure D. bifasciata is a typical forest-canopy dweller, sampling from the forest canopy is essential for estimating its population density. These traps were cleared 7 or 10 days after setting, and the capture rate of bifasciata per trap per day calculated at each locality to represent the density of this fly in this region. All drosophilid flies were identified, and the proportion of flies caught that were bifasciata recorded.Evidence of differences in fly density can be derived from sampling the ZV helped with the design of the crossing scheme, conducted the crosses involved, and performed the analysis of these crosses. MT designed and conducted the field sampling and scored trap collections. GH conceived the project, organised collection, helped with design of the crossing scheme, and wrote the paper. All authors read and commented on drafts of the manuscript, and approved the final manuscript."}
{"text": "Yield of hybrids parented by the pyramided genotypes was more than 50% higher than that of a control market leader variety under both wet and dry field conditions that received 10% of the irrigation water. This demonstration of the breaking of agricultural yield barriers provides the rationale for implementing similar strategies for other agricultural organisms that are important for global food security.Natural biodiversity is an underexploited sustainable resource that can enrich the genetic basis of cultivated plants with novel alleles that improve productivity and adaptation. We evaluated the progress in breeding for increased tomato  Dramatic improvements in crop yield  can be achieved by breeding selected genetic regions from wild species into domesticated varieties Plant evolution under domestication has led to increased productivity, but at the same time it has narrowed the genetic basis of crop species . A majorSolanum pennellii and introduced (through genetic crosses) onto the genetic background of the elite inbred variety M82 (Solanum). The ILs constitute an \u201cexotic library\u201d where the entire wild-species genome was partitioned among 76 lines each carrying a single homozygous introgressed segment. Implementation of this resource for QTL mapping is based on the nearly isogenic nature of the lines such that any phenotypic difference between M82 and an IL, or the hybrid of M82 with an IL (ILH), is attributable to the S. pennellii genomic segments . The ILs comprised marker-defined genomic regions taken from the drought-tolerant wild species segments . Similarsegments .in silico, in a search engine that displays a range of statistical and graphical outputs that describe the components of the genetic variation  and their soluble-solids content (mainly the sugars glucose and fructose), which is measured in refractometer brix (B) units (expressed as a percentage). Therefore, agricultural yield of processing tomatoes is the total sugar output per unit area ; the industry is searching for varieties that excel in BY. Our experiments were conducted in wet and dry fields, where the BY of the control variety M82 in the dry conditions was only 50% of that produced in the wet treatment, which received 10-fold greater irrigation .In \u201cketchup tomatoes,\u201d which are used to produce various concentrated products, agricultural yield is made up of the total weight of the fruits harvested per unit area  in the dry fields. IL7-5-5 did not affect B, while for BY it was dominant. IL8-3 was greatly inferior to M82 for Y , but the ILH increased Y by 45% and 25% . This result indicates a strong overdominant effect for the introgression . The homozygous IL had double the effect on B relative to the ILH; this resulted in a strong overdominant effect on BY in both environments . The reduced Y of IL8-3 was caused by a pleiotropic effect of a leaf necrosis gene that was observed in all lines that were homozygous for this introgression; the necrosis was particularly severe in the dry treatment. IL9-2-5 significantly increased Y only in the homozygous condition in the wet treatment. For B and BY, ILH9-2-5 was intermediate between M82 and the homozygous IL, showing an additive mode of inheritance. The nature of the genes that improve BY in the above introgressions is unknown, with the exception of IL9-2-5, which harbors at least two QTL that affect the components of BY  that increases sugar content of the fruit as a result of a modification of enzyme functions , Chromosome 8 (IL8-3), and Chromosome 9 (IL9-2-5) that affect the components of BY. ts of BY . One of mponents .S. pennellii segments were pooled, using marker-assisted selection, into a single M82 line designated IL789 . IL789 showed a strong interaction with the environment: In the wet treatment it produced a Y similar to that produced by M82, while in the dry fields Y was reduced by 36% as a result of the pleiotropic effect of the recessive leaf necrosis gene on IL8-3. In the heterozygous condition IL789 dramatically increased Y in both field environments, and combined with the increases in B, ILH789 improved BY by 109% in the wet field and 58% in the dry fields. As described in earlier studies . BY of BOS3155 was in a range similar to that of our experimental hybrids, indicating that the experiment was conducted in elite genetic backgrounds.Our breeding program within the ermplasm A. The BYermplasm B. This iermplasm . As a reS. pennellii pyramid as the mean difference between the nearly isogenic hybrid groups: 100% (wet) and 65% (dry). These estimates for the exotic effects on BY are very close to those obtained in the uniform M82 background, indicating additivity of the exotic and cultivated effects  interactions and the stability of BY improvement associated with the heterozygous ressions . Generalressions . In the ressions . In the We have demonstrated that an IL population derived from a wild tomato species, with no yield potential, can make a wide array of previously unexplored genetic variation rapidly available to plant breeders to improve crop productivity. The effectiveness of the introgressions in diverse genetic backgrounds indicates that alleles similar to those of the wild species are not present in the cultivated tomato gene pool. The results presented here using the tomato ILs establish a genetic infrastructure to explore the molecular basis underlying yield heterosis. With the coming sequence of the tomato genome it will be easier to isolate those factors that are responsible for the strong overdominant effects, such as those observed for IL8-3 and some additional lines that are described in the IL phenotypic database Real Time QTL . Finally2. In 2003, trials were conducted in two locations: Akko and Mevo-Hama, in the Golan Heights. In Akko, experiments were both at wide-spacing planting density and in plots of 14 plants per 4 m2 (3.5 plants/m2). In Mevo-Hama all experiments were at the wide-spacing density. The seedlings were grown in a greenhouse for 35\u201340 d and then transplanted in the field, at the beginning of April in Akko, and at the beginning of May in Mevo-Hama. In all seasons and locations both wet and dry trials were conducted. Both the wet and dry fields started the growing season at \u201cfield capacity,\u201d which represents the maximum amount of water that the soil could hold. For the dry treatment only 30 m3 of water was applied per 1,000 m2 of field immediately after transplanting. In the wet treatment 320 m3 of water was applied per 1,000 m2 of field throughout the growing season according to the irrigation protocols in the area. All experiments were transplanted in a randomized block design.The results presented are from three growing seasons. In 2001 and 2002 all field trials were conducted at the Western Galilee Experimental Station in Akko, Israel, at a wide-spacing planting density of 1 plant per mS. pennellii genomic segments . Lines homozygous for each of the segments and IL789 homozygous for all three introgressions were selected and verified with RFLP markers that flanked the introgressed segments from both ends (http://www.sgn.cornell.edu/). Phenotyping of the plants for Y, B, and BY was performed according to published protocols  was half of the difference between each IL and M82, and its significance level was determined by the comparison between the IL and M82. The dominance deviation (d) is the difference between ILH and the mid-value of its parents. Its significance level was calculated by contrasting the ILH (+1) with M82 (\u22120.5) and the appropriate IL (\u22120.5). The degree of dominance for each introgression (d/[a]) was calculated by dividing the mean dominance deviation by the mean additive effect. Deviation of the observed yield component values of the pyramided genotypes (IL789 and ILH789) from the expected values based on the assumption of additivity of the effects of the individual introgressions was tested using a t test at p < 0.05. G \u00d7 E interaction was tested using a two-way ANOVA.Statistical analyses were performed using the JMP V.5 software package . Mean values for the parameters measured for the tested genotypes were compared using the \u201cFit Y by X\u201d function and \u201cCompare all pairs\u201d (Tukey-Kramer). All calculations were performed with the phenotypic values, while some of the results are presented as the percent difference from M82. The additive effect"}
{"text": "Little is known about the history and population structure of our closest living relatives, the chimpanzees, in part because of an extremely poor fossil record. To address this, we report the largest genetic study of the chimpanzees to date, examining 310 microsatellites in 84 common chimpanzees and bonobos. We infer three common chimpanzee populations, which correspond to the previously defined labels of \u201cwestern,\u201d \u201ccentral,\u201d and \u201ceastern,\u201d and find little evidence of gene flow between them. There is tentative evidence for structure within western chimpanzees, but we do not detect distinct additional populations. The data also provide historical insights, demonstrating that the western chimpanzee population diverged first, and that the eastern and central populations are more closely related in time. Common chimpanzees have been traditionally classified into three populations: western, central, and eastern. While the morphological or behavioral differences are very small, genetic studies of mitochondrial DNA and the Y chromosome have supported the geography-based designations. To obtain a crisp picture of chimpanzee population structure, we gather far more data than previously available: 310 microsatellite markers genotyped in 78 common chimpanzees and six bonobos, allowing a high resolution genetic analysis of chimpanzee population structure analogous to recent studies that have elucidated human structure. We show that the traditional chimpanzee population designations\u2014western, central, and eastern\u2014accurately label groups of individuals that can be defined from the genetic data without any prior knowledge about where the samples were collected. The populations appear to be discontinuous, and we find little evidence for gradients of variation reflecting hybridization among chimpanzee populations. Regarding chimpanzee history, we demonstrate that central and eastern chimpanzees are more closely related to each other in time than either is to western chimpanzees. Common chimpanzees have been classified further into three populations or subspecies based on their separation by geographic barriers : western (P. troglodytes verus), central (P. t. troglodytes), and eastern (P. t. schweinfurthii) . Ea. Ea20]. The multilocus dataset also provides power to identify individuals with multiple ancestries and to assess their ancestry proportions. This cannot be done reliably using studies of single loci such as the Y chromosome or mtDNA, because individuals can in fact be descendants of multiple ancestral populations without carrying DNA from some of the populations at the locus being studied. The STRUCTURE analysis identified nine individuals as having more than 5% genetic ancestry from two clusters .P. t. vellorosus . In. In17]. llorosus . The twoWe also used STRUCTURE to validate a minimal set of markers that could be useful for classifying chimpanzees in conservation studies . The topp < 10\u221212) and nearly perfectly separate western, central, and eastern chimpanzees, and bonobos (p = 0.011) is also significant, and the fifth is not significant (p = 0.44).We next carried out principal components analysis (PCA). This approach has been shown to have similar power to capture population structure as STRUCTURE, but also provides a formal way of assigning statistical significance to population subdivision . When th bonobos . Only si bonobos . The foup < 10\u221210) for the first three eigenvectors but insignificant for the fourth (p = 0.97), indicating that this eigenvector is capturing population subdivision that is different from the traditional western/central/eastern/bonobo designations.The eigenvectors are strongly correlated to the population labels. We used nonparametric analysis  to explore whether the values of each sample along the four significant eigenvectors were significantly correlated to the four pre-existing population labels. The overall statistic is highly significant (n = 49), central chimpanzee (n = 16), eastern chimpanzee (n = 6), and bonobo (n = 6) samples . Western chimpanzees are the only population with evidence for internal substructure (p = 5.5 \u00d7 10\u22125). The first eigenvector obtained when western chimpanzees are analyzed by themselves strongly correlates to the fourth eigenvector in the main analysis   , indicatAlthough the fourth eigenvector seems to be detecting real structure, it does not mark out discontinuous subpopulations of western chimpanzees . The faiCould there be additional population structure  among thp < 0.05). This allowed us to assess power to detect an additional population as diverged as the eastern chimpanzees.To place an upper bound on further structure especially among the central chimpanzees, we considered the possibility that, among the 16 central chimpanzees, a subset is from a different population. We performed PCA on 10 central/6 eastern, 11 central/5 eastern, 12 central/4 eastern, 13 central/3 eastern and 14 central/2 eastern chimpanzees and assessed what fraction of 1,000 random resamplings of central and eastern chimpanzees showed evidence of structure     as an F1, with a likelihood ratio (LR) of \u223c24,000,000:1. The F2/backcross test identifies the captive-born individual number 68  as an F2/backcross, with an LR of \u223c37:1 . There are no other hybrids identified by either the F1 or F2/backcross test, suggesting that the other animals in Of the nine putative hybrids identified by STRUCTURE, the F1 test produced a particularly intriguing pattern in number 54, a wild-caught individual with mtDNA that has been hypothesized to be diagnostic of P. t. vellorosus origin [F1 hybrid. However, a careful examination shows that the pattern of variation at number 54 fits neither the hypothesis of a first generation hybrid or an older mixture. To demonstrate this, we simulated 100 different western-central F1 hybrids and 100 older western-central mixtures by random sampling from the population allele frequencies. Simulated older mixtures always generated an LR of >100,000:1 relative to the alternative hypothesis of an F1. Simulated F1 hybrids always gave an LR < 1:2. The LR for individual number 54 of 7:1 falls outside of either expectation. This individual fits neither model, suggesting ancestry from an as-yet undetermined population.The s origin ,10. IndiRST statistic, a microsatellite-based estimator of FST [RST assumes the stepwise mutation model (SMM), in which the number of repeats changes by one or two or more units with an equal probability of increasing or decreasing. A goodness of fit test suggests that this simple model provides a reasonable match to our data  western-central and bonobo-eastern forming clades, (2) western-eastern and bonobo-central forming clades, and (3) eastern-central and bonobo-western forming clades. If a tree provides a good description of the history of the population, then the allele frequency differences between two populations should only reflect changes since they split. For example, the difference in allele frequency between central and eastern chimpanzees should have arisen entirely since their divergence from a common ancestral population and so should be uncorrelated to the allele frequency differences between western chimpanzees and bonobos.p = 0.00025 and p = 0.0027, respectively (p = 0.37). Thus, our analysis does not find any evidence for gene flow between western and central chimpanzees since their initial split, as has previously been hypothesized [To implement this idea, we calculated the difference in frequency within clades for all alleles and then tested for a correlation across clades. When we carry out this analysis for the first and second hypothesized trees, a correlation is observed, rejecting these trees at a significance of ectively . The hypthesized . If genetMRCA) of two chromosomes is expected to be ASD/2\u03bc, where \u03bc is the average mutation rate per year per locus, averaged across loci. Because allele lengths change according to a random walk, the ASD between allele lengths in two chromosomes is expected to increase linearly with time and is thus expected to act like heterozygosity in sequence comparisons. By averaging ASD over pairs of chromosomes within and across populations, we can estimate the average tMRCA within and across populations.To estimate the times of genetic divergence among chimpanzees, we used the average squared distance (ASD) statistic . For mictMRCA within and across populations, we used two estimates of the microsatellite mutation rate. The first, \u03bc = 6.57 \u00d7 10\u22123 per year, relies on a 7 Mya estimated average tMRCA between humans and chimpanzees and the observation that two western chimpanzees are \u223c14.8 times less genetically diverged than humans and chimpanzees [\u22125 per year, based on estimated rates of microsatellite mutation in humans, and assuming 15 years per generation (The results confirm that genetic diversity (heterozygosity) is least for western chimpanzees and bonobos, higher for eastern chimpanzees, and highest for central chimpanzees, consistent with results obtained from a nucleotide resequencing dataset . To estimpanzees . We alsoneration .tMRCAs should be treated with caution because of uncertainty about the microsatellite mutation rate process and the calibrations used to obtain absolute dates. Nevertheless, the tMRCA estimates are consistent with previous results from smaller resequencing based datasets [tMRCAs are all similar, which appears at first to contradict the claim that the populations split at different times. However, most of the genetic divergence reflects ancestral diversity, which is shared among all the chimpanzees . MorWe have carried out the largest analysis of chimpanzee genetic variation to date, which shows that the western, central, and eastern chimpanzee subspecies designations correspond to clusters of individuals with similar allele frequencies that can be defined from the genetic data without regard to the population labels. Moreover, we find little evidence for admixture between groups in the wild. Our analysis also provides the first formal test showing that the central and eastern chimpanzee populations are more closely related to each other in time than either is to western chimpanzees.P. t. vellerosus. However, the failure to detect a distinct population cluster for these individuals could simply reflect a lack of power. Our analysis does allow us to state that even if P. t. vellorosus is a distinct population, its level of allele differentiation from either western, central, or eastern chimpanzees is not likely to exceed FST = 0.09.PCA also further suggests population structure within western chimpanzees. However, more data\u2014more samples, genetic markers, and information about geographic origin\u2014would be needed to understand this structure. We find no support for the proposed fourth population of common chimpanzees We finally emphasize that although we attempted to include chimpanzees from as wide a range of sites in Africa as possible, the geographic sampling of the chimpanzees that we studied was likely nonrandom. The fact that our study did not include chimpanzees from some regions\u2014including where chimpanzees are now extinct\u2014could create the appearance of too much discontinuity . Future The samples for this study were assembled from four sources: DNA collections at the Max Planck Institute , Anne Stone's laboratory at Arizona State University , the Corhttp://www.preventiongenetics.com). The microsatellite markers all contain tandem repeats of two, three, or four nucleotides that vary in repeat number across individuals. For example, at a single marker, different individuals might have between three and 11 contiguous repeats of a GATA sequence. The assays used for genotyping were designed for humans. However, we hypothesized that many of them would work for chimpanzees because of the \u223c98.8% sequence similarity [We assembled all the DNA samples at a single site (the Broad Institute) and carried out whole-genome DNA amplification (WGA) for all samples to generate a quantity sufficient for analysis . The WGAmilarity .F1/F2 hybrid analyses. Genotypes for all markers are available in Assays were attempted for 470 microsatellites. Most came from the Marshfield Screening Set 13  and A subset of 84 of the 91 genotyped samples were chosen for further study after removing two due to a high missing data rate, one due to evidence for contamination (more than two genotypes at many loci), and four due to evidence of genetic relatedness: two accidental duplicates, and two apparent first degree relatives. For each pair of related individuals, we dropped the one with the lower success rate. The duplicate individuals allowed us to assess genotyping quality. For the two individuals studied in duplicate, 1.18% of genotyping calls differed, suggesting an error rate per genotype of \u223c0.59% .We applied two complementary methods to characterize population structure in chimpanzees. First, we used the software STRUCTURE in the \u201cadmixture\u201d mode, so that individuals were allowed to have ancestry from multiple populations. We used a model of correlated allele frequencies, a \u201cburn-in\u201d of 100,000 Markov Chain Monte Carlo (MCMC) iterations, and 1,000,000 follow-on MCMC iterations.We also analyzed the data using a new implementation of PCA  availablHw, the average heterozygosity within an individual's two chromosomes, and Rw, calculated as m1 and m2 are the alleles' number of repeat units at marker m within an individual, and M is the total number of markers considered. We used the average value of Hw and Rw over individuals in a population to test the hypothesis of random mating and assessed significance by a permutation test. Specifically, we generated 1,000 samples of n individuals, randomly assigning to each of them two alleles from the pool, then counted how often Hw or Rw was as small or smaller than observed. Hw was significantly lower than expected for all samples considered (at the p < 0.05 level), while Rw was significantly lower in wild-caught western chimpanzees . Thus, we analyzed 48 western chimpanzees, including 34 wild-caught and 14 captive-born individuals. We also analyzed 13 wild-caught central chimpanzees . We consmpanzees .For other analyses in which we were interested in studying only individuals identified unambiguously as being from one population, we excluded the captive-born individuals defined as putative hybrids by STRUCTURE.i repeats, is an estimator of 2N\u03bc, the population mutation parameter [N\u03bc for the 221 tetra-, 62 tri-, and 11 dinucleotides included in other analyses. Averaging this estimate over all markers of the same type and dividing by N = 10,000 [\u03bc for each type of marker, \u22123, 1.91 \u00d7 10\u22123, and 2.17 \u00d7 10\u22123, respectively. These estimates are roughly similar to independent estimates [\u22124, 7.10 \u00d7 10\u22124, and 1.51 \u00d7 10\u22123, respectively.We examined whether our data fit the SMM in the 49 individuals that are identified as western chimpanzees by both STRUCTURE and PCA. We focused on western chimpanzees because they have the largest sample size and hence provide us with the most power to detect a departure from the SMM. Under the one-step SMM, arameter . For eac= 10,000 , we obtastimates  based onTo assess the goodness of fit of the SMM, we compared the observed distribution of SIMCOAL2 . We geneSIMCOAL2  of 10,00 the SMM .F1 hybrid of two known populations versus the alternative that it is a 50%\u201350% mixture . For a given autosomal marker, one can compute a log-factor under the assumption that the allele frequencies are known; these log-factors can then be summed across all markers. In practice, our population samples are small, and so allele frequency estimates are imprecise. To account for uncertainty in the allele frequencies, we used a hierarchical Bayesian model for the unknown frequencies, with a Dirichlet prior distribution for the frequencies . We verDataset S1(305 KB TXT)Click here for additional data file.Figure S1Here, we present the correlation for the 49 individuals that are clearly identified as western chimpanzees by both STRUCTURE and PCA, demonstrating that these eigenvectors are revealing the same population structure.(11 KB PDF)Click here for additional data file.Figure S2Distributions of the expected (51 KB PDF)Click here for additional data file.Protocol S1(51 KB PDF)Click here for additional data file.Table S1(22 KB PDF)Click here for additional data file."}
{"text": "Drosophila wing shape has emerged as an attractive system for genetic dissection of multi-dimensional traits. We utilize several experimental genetic methods to validation of the contribution of several polymorphisms in the Epidermal growth factor receptor (Egfr) gene to wing shape and size, that were previously mapped in populations of Drosophila melanogaster from North Carolina (NC) and California (CA). This re-evaluation utilized different genetic testcrosses to generate heterozygous individuals with a variety of genetic backgrounds as well as sampling of new alleles from Kenyan stocks.Quantitative differences between individuals stem from a combination of genetic and environmental factors, with the heritable variation being shaped by evolutionary forces. Egfr promoter, had replicable effects in all new experiments. However, expanded genotyping of the initial sample of inbred lines rendered the association non-significant in the CA population, while it persisted in the NC sample, suggesting population specific modification of the quantitative trait nucleotide QTN effect.Only one variant, in the Dissection of quantitative trait variation to the nucleotide level can identify sites with replicable effects as small as one percent of the segregating genetic variation. However, the testcross approach to validate QTNs is both labor intensive and time-consuming, and is probably less useful than resampling of large independent sets of outbred individuals. Elucidation of the specific genetic variants that underlie natural phenotypic variation constitutes a major challenge for evolutionary geneticists. Our understanding of evolution will remain incomplete until the relative proportions of deleterious, (nearly) neutral and adaptive factors are documented, in terms of number of loci, their individual and joint effects as well as mode of expression . SeveralD. melanogaster, QTL loci have also been dissected with quantitative complementation tests [Most common implementations of quantitative trait locus (QTL) mapping have low bias with respect to genomic coverage, but only identify allelic variation between two strains. In model organisms, these approaches allow assessment of marginal and epistatic effects, since the experiments are conducted with a large number of offspring, often in laboratory settings that reduce environmental variance. In practice, QTL are rarely resolved to individual loci or exact causal genetic variants -5, althoon tests ,10 and/oon tests ,11-20 anon tests -23.D. melanogaster can be implemented with varying degrees of control over genetic and environmental variance from wild caught individuals, laboratory reared iso-female lines, inbred strains, chromosome extraction lines and strains with introgressed chromosome regions. It is now clear that the power and resolution of association studies varies among organisms according to the extent of haplotype structure, and that different experimental approaches must be taken to verify associations in each organism. Despite the lesson from LD mapping in humans that extensive repetition, across cohorts and populations, is crucial to verify allelic contributions [Successful implication of allelic and nucleotide variation in candidate genes in the production of phenotypic variation is aided by low amounts of LD, due to substantial historical recombination, in the fly genome. LD mapping in ibutions ,25, replDrosophila wing shape has been used extensively as a model for the study of integration of developmental and quantitative genetics ,27 and fEgfr locus and shape, by sequencing ~11 kb of the locus in 210 inbred lines from two North American localities, NC and CA [Egfr with aspects of wing shape and size, either as main effects or by interaction with population or sex, were reported. A follow-up with wild caught flies confirmed one of the associations, suggesting that QTN effects responsible for less than one percent of the variation for a complex trait can be isolated [QTL mapping and quantitative complementation tests support the involvement of venation loci, including components of the EGFR/Ras pathway, in naturally occurring wing shape variation ,41. ThesC and CA ,48. Signisolated .Egfr polymorphisms to naturally occurring variation for wing shape and size. Three schemes were employed, two involving crosses among a subset of the NC lines , and a third involving test crosses between an independent set of Kenyan second chromosomes and the Samarkand wild-type and EgfrE1 and blistered1 mutant alleles  descriptors of shape, and although these are modified subtly by inclusion of more wing data  overall eference ). Furthesize and Egfr polymorphisms, recrossing of inbred lines used earlier and testcrosses of additional African chromosomes was carried out. Neither of the two variants affecting size of the wing (C31656T and T40722C) in the initial study gave a significant association in any of the three new datasets (Table p = 0.000002) that also exhibited a possible three way interaction of Population, Sex and Genotype (p = 0.001). As the three-way interaction was primarily caused by larger difference in the CA than the NC sample [Egfr with wing size was likely a false positive even though it was significant after adjustment for the number of multiple comparisons experiment-wide.In order to re-evaluate our previously published associations between wing C sample , the lacEgfr variants to aspects of wing shape. Only one polymorphism T30200C, was significant and had consistent effects in all of these experiments. This variant resides in the second alternate promoter in a putative GAGA factor binding site, and contributes to the first principal component of the central region of the wing  and also each of the two site haplotypes had given highly significant association in the original panel of inbred lines. Due to smaller sample size in our recrossing datasets, testing of this pattern could only be conducted with the BC dataset, but the previous epistatic interactions were not confirmed (data not shown). In summary, only one of the Egfr polymorphisms previously implicated to impact wing shape was corroborated by the new data.Neither of two other previously reported putative associations , the sexp = 0.00002) but only marginal association in the west coast sample (p = 0.04) (see p = 0.002). More dramatically, the addition of 30 more alleles to the CA lines (N = 76) rendered the originally marginal association non-significant (p = 0.9) (p > 0.05).Previously, due to incomplete genotyping around exon 2, the contribution of T30200C to the central region of the wing was only evaluated with 79 NC and 43 CA lines . Analyse.04) see . In ordep = 0.9) . Inspectp = 0.9) , as the bs1 carrying chromosomes).Estimates of the genotypic effects of T30200C on wing shape are comparable across all of the datasets. There was a slight reduction in observed contribution after the extra genotyping , and theEgfr locus is plotted for the three experiments in Figure p = 0.05 and p = 0.0001 as before [Egfr.In order to compare the gene-wide patterns of association for each design, the association statistic for the Genotype effect of each site along the s before . The anap = 0.05. The observed jaggedness of the association profiles likely reflects stochastic fluctuations in the p-values in experiments with relatively small sample size. One interpretation of the data is that the inbred and backcross designs provide better dampening of this stochastic fluctuation then do studies with round robin crossed inbred lines.The first general result is that the small sample of Kenyan introgressions provides more highly significant sites than the total NC sample (with the exception of T30200C there are no significant associations in common between these two populations). Similarly the RR design yielded more significant test statistics (three sites in the first exon) then the BC or inbred panels and had 55 sites exceeding the test-wise significance threshold of The second result is that, in both the RR and BC experiments, the shape of the association profile tracks quite closely with that of the corresponding profile for the set of nearly isogenic lines used to set up the testcrosses. This was not anticipated, since NC025 and NC144 lines have very different wing shapes and each contribute 25% of the genetic variation in the BC, while the RR combines the genetic variation of the 71 inbred lines in equal proportions. Evidently genetic correlations between the different testcrosses are sufficient to produce similar association profiles, whether or not these accurately report QTN effects.Egfr affect the cross-vein placement we performed a combined Mixed model ANOVA on the three NC datasets . Eleven independent polymorphisms summarized in Table p < 0.0001, including site T30200C. Most of these sites are not significant in the CA and Kenyan datasets, but the direction of the genotypic effects generally correspond with the NC panels . Only one of these new candidate variants, C6085G in the less conserved of the two alternate first N-terminal exon, alters the protein, while the remaining are non-coding or silent. Interestingly, one of these silent polymorphisms is C40620T, which also associates with cryptic variation for eye-roughness in inbred lines and wild flies [Egfr variants are tested against other principal component measures of wing shape, similar number of sites emerge at the level of p < 0.0001 (data not shown) suggesting the caveat that this approach may be inherently noisy.Finally, in order to test whether other sites in ld flies . Note hoEgfr and wing shape and size in D. melanogaster in 210 inbred lines from two North American populations [Egfr variants or linked polymorphisms as causal variants. In this study we aimed to re-evaluate their involvement through further genetic analysis by generating heterozygous lines derived from crosses of a subset of the original lines and by test crosses with a small sample of African chromosomes. Only one of the retested variants was significant in all datasets and gave consistent effects: the T30200C polymorphism that affects a principal component capturing variation in relative distance between the two cross-veins. However, even the estimated absolute magnitude of this effect is dependent on the survey population and crossing scheme. These results highlight the difficulties in validating weak quantitative effects through experimental genetic approaches and suggest that resampling of outbred populations may be the more conclusive approach to dissection of QTL to the nucleotide level.Previously, fine mapping of the association between polymorphisms in the candidate locus ulations  implicatEgfr do not contribute to shape of the central region of the wing. This seems unlikely, since significant association was also observed in a large sample of outbred NC flies [There are at least three possible explanations for the observed restriction of statistical support for the association of T30200C with wing shape to just two of the three populations sampled. The first is that the observed associations in NC and Kenyan samples are false positives, namely that T30200C or linked variants in NC flies  and the Egfr polymorphisms to wing shape in NC. One is that the effect of T30200C is masked by genetic variation that is unique to the CA population. Another possibility is that T30200C is not the real causative variant, but exhibits high LD with the causative site in the NC and Kenyan populations but weak LD in the CA population. Since LD in the Egfr decays to background levels over several hundred bases and no differences were observed between NC and CA in their patterns of LD or allele frequencies, while both North American populations diverge considerably from the Kenyan sample [p = 0.88), but it does lie adjacent to a 23 kb intron that has not been sequenced in the population sample and could conceivably harbor the true causative variant. However, we favor the hypothesis that one or more modifier loci that differentiate the two North American populations mask the expression of variation due to the Egfr in the CA sample.Two alternative explanations are consistent with the statistical significance being indicative of a true contribution of n sample , this laEgfr promoter, is supported by genetic interaction between the two loci [Egfr and cross vein placement is in accord with developmental genetic evidence. Specifically, flies heterozygous for different Egfr alleles lack the majority of the L4 vein and the entire proximal cross-vein [Two developmental genetic arguments also lend support to the hypothesis that the T30200C variant is the causal site. First, our prediction that this site affects a GAGA factor binding element in the two loci ,54. Secooss-vein ,55,56. RD. melanogaster are now being dissected with QTL mapping, quantitative complementation tests and by testing specific allelic variants by LD mapping. While several studies have found significant association between markers in candidate gene regions and continuous phenotypes [achaete-scute locus influence bristle number, and this inference was corroborated in a second sample [Delta polymorphisms [Egfr polymorphisms affect cryptic variation in eye roughness in inbred lines, and then confirmed the finding in an independent sample of wild caught flies [hairy on bristle number that was previously observed [scabrous in variation for bristle number, these two studies differed in which markers were typed and by criteria for evaluation of significance  are forthcoming since the different approaches only produce broadly comparable results.The round robin and backcross approaches were designed to evaluate the degree to which effects observed in inbred lines are also seen in mixed genetic backgrounds. If the effects of the SNP are additive and there is no epistasis, then they should be just as strong in the testcrosses as in the nearly isogenic lines, with the caveat that there are three genotypes at each SNP to compare instead of just two. The BC design differs in two distinct ways from the RR design, namely the reduced genetic variation  and the capacity to detect epistatic effects. This latter could occur by interaction between the QTN and other loci, either due to de-canalization as these other loci perturb the phenotype away from the population mean, or simply because QTN effects may generally be so modified by the background that they are only observed in certain backgrounds. The similarity of the estimated genotypic mean differences over the two BC backgrounds and the close tracking of means in the KI experiment Figure , suggestEgfr may affect cross-vein placement, a considerably larger sample than explored here would be required to validate these sites. The testcross results strongly suggest that we can eliminate highly significant results from the first experiment as false positives, but can not conclusively resolve the question of whether the Egfr QTL resolves to a single or several QTN.While the ten new highly significant sites in the combined model may be false negatives in the initial lines, more data would be required to confirm that they are true positives. These results indicate that recrossing and deeper population sampling has at best low power to detect novel candidate sites with subtle effects on the phenotype. Consequently, the testcrosses do not obviously outperform the inbred line analysis or bring us any closer to resolving true positive QTN from false positives. Even with a relatively large experiment such as this, the amount of labor and time spent on setting up several hundred crosses and phenotyping several thousand wings does not overcome sampling biases. Even if our analyses suggest that other sites in Egfr contribution to shape variation in D. melanogaster wings reported in Palsson and Gibson [Egfr variants failed to validate in testcrosses is that stochastic factors have a substantial impact on analysis of the genetic basis of continuous phenotypes in studies involving fewer than 200 inbred lines. Apparent conditional polymorphisms may be especially sensitive to these effects of chance, and all unreplicated association studies in Drosophila should be considered with this caveat in mind. We suggest that measurement of a very large number of offspring is essential for replication and validation in association studies, and that these are better sampled in outbred wild individuals than in laboratory lines. The declining cost of genotyping will facilitate this transition to large scale mapping of quantitative traits to single nucleotides in ecological settings.The d Gibson , and repd Gibson , represeEgfr on wing shape , and a blistered allele (bs1) were substituted into Sam. The wild-type chromosomes were tested over these two mutations and the wild-type Samarkand second chromosomes in three replicate crosses arranged in random blocks. All crosses involved three males crossed to three females, and where conducted in two (RR and BC) or three replicates (KI).Three separate experiments were conducted to re-evaluate the contribution of e Figure . Two invnd or 4th day depending on visual assessment of egg density. The right wing of eight to ten randomly selected individuals per sex  from each vial was scored. In the Kenyan introgression experiment the visible marker Cy on the balancer chromosome distinguished genotypes of lines inviable as 2nd chromosome homozygotes. Handling of specimens and data processing was identical to previous experiments [Flies were reared at 25\u00b0C in standard cornmeal medium with a constant light/dark cycle. Density was controlled by placing two virgin females and two males in a vial and discarding parents on the 2eriments . In shoreriments ). The niShape variation was summarized with the TPSrelw software version 1.39 (freeware available ) by calcEgfr haplotypes are highly similar, as 167 out the 232 common Egfr sites genotyped in both lines differ, with several recombination events evident. F1 lines that were missing a genotype of one parent where omitted from the analysis for that particular genotype. In the Kenyan sample, only the variant T40722C was not tested, as it was only available in one Kenyan line. The Egfr alleles were not sequenced in the three tester chromosomes, leading to tests on haploid data.Genotypes used for the association tests were derived from our earlier sequence data . The BC The T30200C polymorphism in the non-coding region upstream of alternative exon one  was re-gAll statistical analysis used SAS version 8.2 . The estimation of line effects and extraction of line means was implemented with the LSMEANS option in Proc GLM. The model for the RR dataset was:\u03bc + Line + Rep(Line) + \u03b5Y = bs), Sex or Line.where Line represents each of the F1 lines generated by the round-robin crosses, and Rep the replicate vial. For the Back-cross and the Kenyan introgression, a more complicated model was used, accounting for the effects of Cross  + S \u00d7 R(C \u00d7 L) + \u03b5Y = In both models terms including Line and Rep are considered random. We also performed the analysis without Rep as a term, with the same results.The main aim of these experiments was to re-evaluate the six sites which gave significant signals for wing size and shape in . The RR \u03bc + Gtyp + Rep(Gtyp) + \u03b5Y = Gtyp is the fixed effect of Genotype, and Rep is a random term, again the replicate vials. For the back-cross and the Kenyan test cross, the model accounted for the contribution of sex and cross:\u03bc + Gtyp + Sex + Cross + G \u00d7 S + G \u00d7 C + G \u00d7 S \u00d7 C + Line(G \u00d7 C) + \u03b5Y = The mean effects of polymorphisms were estimated by the LSMEANS option. Reduced models, by crosses, and extended, by including replicates were also studied and were in accord.Egfr on the C1 we utilized a related model, substituting the Cross term with a fixed experiment (Exp) term to demarcate the NC, BC and RR datasets, and restricting the analysis to females as the RR panel had no males. The sire and dam are random effects nested within the fixed effects:In order to gauge the effects of additional sites in \u03bc + Gtyp + Exp + G \u00d7 E + dam \u00d7 sire(G \u00d7 C) + Rep(dam \u00d7 sire \u00d7 G \u00d7 C) + \u03b5Y = Sites with probability of genotype term below 0.0001, where then investigated for consistency in genotypic effects and their significance in the CA and KI dataset.AP, GG and JD designed experiments. JD crossed and scored RR and BC experiments, AP crossed and scored KI, Inbreds and parts of RR dataset. AP conducted statistical analysis. ID regenotyped the T30200C variant. AP, ID and GG wrote the manuscript and all authors approved the final version.Egfr promoter and the first principle component for the shape of the central region of the wing.ANOVA tables for site T30200C and wing shape. The file shows the results of Analysis of Variance for the T30200C variant in the Click here for fileGenotypic effects of T30200C on the first PC of the central region of the wing. This table illustrates the genotypic effects (and standard errors) for the T30200C association to wing shape of the central region.Click here for file"}
{"text": "What makes some people neurotic or schizophrenic or right-handed or fearless? The challenge in answering this is to map from genotype to anatomical and physiological phenotypes and beyond to behavior and cognition. What makes some people neurotic or schizophrenic or right-handed or fearless? Are these behavioural differences caused by literal differences in how individuals' brains are wired? If so, what causes those differences? This age-old question of nature versus nurture can be recast in more realistic terms based on our modern understanding of genetics, development, and neuroscience. The challenge in this area is to understand how genotype is mapped to phenotype, not just in terms of the average effects of single genes across populations but also in terms of their combined effects in shaping the phenotypes of individuals.\u201cThings are the way they are because they got that way.\u201d\u2014Gerald WeinbergThere is compelling evidence that many psychiatric disorders have their origins in disturbed neurodevelopment, resulting in altered connectivity ,2. SimilThe establishment of the circuitry of the brain follows an intricate developmental programme involving cell fate specification, cell migration, axon pathfinding, target selection, and synaptogenesis . The lasThese effects can be directly observed in model organisms. In Drosophila, the projection of motor axons to the embryonic body wall muscles has been very well characterised. In this system, many genes show no effect when removed on their own but do show an effect when ectopically expressed , a prediSimilar effects are seen for behavioural phenotypes, including the well-known large effects of genetic background in mice. Greenspan and colleagues discovered complex and shifting epistatic interactions between 16 genes for a behavioural trait in flies . These fHow this kind of epistasis observed at the biological level in model organisms relates to statistical epistasis in human populations is an open and critical question . The impResearchers in psychiatric genetics are beginning to come to grips with the issue of epistasis. This will be especially important as data from large-scale whole-genome association studies emerge in the near future. Some of the methods of these studies look for epistasis between pairs of candidate genes, identified through suggestive single-gene associations with disease  or by inDrosophila embryo [Another level of complexity arises in mapping from genotype to phenotype, even in the hypothetical case where whole-genome sequence is available and all single-gene and epistatic effects are known. Monozygotic twins in humans, and genetically identical organisms in other species, show considerable phenotypic variability. This phenotypic variability can be continuous or dichotomous and is observed for behavioural traits and psychiatric disorders  and alsoa embryo .Epigenetic differences have been proposed as a mechanism to explain this intrinsic phenotypic variability . Random Waddington's \u201cepigenetic landscape\u201d  providesWaddington referred to the buffering of developmental systems to produce a \u201cwild-type\u201d phenotype in the face of various mutations or environmental insults as \u201ccanalization\u201d . Increasing mutational load should reduce the capacity for such buffering, leading to the prediction that individuals with greater developmental \u201cnoise\u201d should be more susceptible to disease. Such noise can be indirectly measured by examining markers of \u201cfluctuating asymmetry\u201d, including fingerprint asymmetry, for example, which has indeed been found to be higher in individuals with schizophrenia .The challenge for the fields of neurodevelopmental and psychiatric genetics is to develop methods to take these factors into account in attempting to map from genotype to anatomical and physiological phenotypes and beyond to behaviour and cognition. Modelling this complexity may require both new mathematical methods and more detailed empirical data derived from studies of model organisms . Whichev"}
{"text": "Condition-dependence is a ubiquitous feature of animal life histories and has important implications for both natural and sexual selection. Mate choice, for instance, is typically based on condition-dependent signals. Theory predicts that one reason why condition-dependent signals may be special is that they allow females to scan for genes that confer high parasite resistance. Such explanations require a genetic link between immunocompetence and body condition, but existing evidence is limited to phenotypic associations. It remains unknown, therefore, whether females selecting males with good body condition simply obtain a healthy mate, or if they acquire genes for their offspring that confer high immunocompetence.Taeniopygia guttata. We show that there is significant positive additive genetic covariance between an index of body condition and an index of cell-mediated immune response. In this case, genetic variance in the index of immune response explained 56% of the additive genetic variance in the index of body condition.Here we use a cross-foster experimental design to partition the phenotypic covariance in indices of body condition and immunocompetence into genetic, maternal and environmental effects in a passerine bird, the zebra finch Our results suggest that, in the context of sexual selection, females that assess males on the basis of condition-dependent signals may gain genes that confer high immunocompetence for their offspring. More generally, a genetic correlation between indices of body condition and imuunocompetence supports the hypothesis that parasite resistance may be an important target of natural selection. Additional work is now required to test whether genetic covariance exists among other aspects of both condition and immunocompetence. Body condition is central to animal life histories because the expression of many traits critical to survival and reproductive success is condition-dependent ,2. CondiA key requirement of the CMIH hypothesis, and other related life history hypotheses -19, is tTaeniopygia guttata. Zebra finches provide an ideal opportunity to determine if this critical genetic association exists for two reasons. First, this species is a model system for the study of sexual selection, in which female choice is based on a number of condition-dependent male signals that include song rate and bill colour [The overall aim of this study was to test directly for genetic covariance between indices of body condition and immunocompetence in a small passerine bird, the zebra finch l colour -40. Secol colour . We therl colour  to estimIijk) testing for a genotype-environmental interaction for Equation (1) was not significant for our indices of either immune response  or body condition . This showed that chicks from the two sampling sites did not respond differently to nest environments from the other population. Similarly, there were no significant differences between the sites for the phenotypic means of our indices of either immunocompetence  or body condition , or the breeding values of broods for either trait  between our indices of immune response level and body condition was 0.75 \u00b1 + 0.41 Pi = average effect of the ith cross-fostered block of nests, Mij = direct effect of the jth (genetic) mother within the ith block (j = 1 or 2), Nik = kth (unrelated) nurse within the ith block (k = 1 or 2), Iijk = M \u00d7 N interaction within the ith block, and eijkl = residual error for the ith offspring of the jth mother raised by the kth nurse within the lth block of nests.where, Iijk term of Eq. 1 tested for the presence of a genotype-environment interaction in this experiment as nest of origin also represented genetic population of origin and nest of rearing also represented the population of rearing. Significance of nest of origin (Mij) and nest of rearing (Nik) was tested using the interaction term (Iijk) as the error, type III sums of squares for unbalanced designs. In all genetic models genetic relationships were inferred on the basis of the male and female providing care at the nest in question, as extra-pair paternity in zebra finch colonies is low (2.4% of chicks) [The  chicks) .When using individuals from two different populations there is also the risk that such populations could differ with respect to the parameters under study. Specifically, if the populations differed with respect to both traits then pooling individuals from the two populations might generate spurious covariance between the traits. It is important to note here that the populations need to differ for both traits and not just one of them. This is because, if populations only differ with respect to in one variable, this would just increase variation along a single axis. To assess these possibilities we therefore tested for differences between the source populations in both the phenotypic means and breeding values of our indices of both immune response and body condition.We used two related methods to test for a genetic correlation between our indices of immunocompetence and body condition. To facilitate comparisons with other studies, we first used the standard method for analysing cross-foster experiments, which is based on using offspring values alone . We usedX  that were estimated by the various methods listed in Table 9. The estimation of the direct-maternal additive genetic covariance which is isolated by observational component 9 has been the source of some confusion in the literature. Rutledge et al [AOAM could be estimated using the interaction term in (1), which more recently was also advocated as an appropriate way of estimation in Lynch and Walsh (1998). However, this method of estimation was subsequently shown to be incorrect [V matrix are set to zero, see below). By using the estimation method of component 9 employed here, this potential problem is likely to be exacerbated as the estimate of component 9 is a linear combination of the mean squares used in other observational components (5 and 6). Nevertheless, component 9 as estimated here has an established interpretation, and facilitated the isolation of the important \u03c3AOAM causal component.The observation vector ge et al  first prncorrect ,56. Riskncorrect  outlinedncorrect ,57, whicncorrect  approachncorrect ,55 or heV, with off-diagonal elements all zero. To obtain variances for each observational component [Variances of the observational components were used as the diagonal elements of the square matrix omponent  for compVAR(\u03c32) = (VAR(A) VAR(B) + COV2) / (N) \u00a0\u00a0\u00a0 (2)A and B represented the two kinds of individuals whose covariance is being estimated and N is the number of bivariate observations. The variance of components 5\u201310 were estimated as weighted sums of the variances of the appropriate mean squares, where the variance of a mean square is given by  = (2MS2) / (N + 2) \u00a0\u00a0\u00a0 (3)MS represents the mean square of the term of interest and N is the number of blocks. The causal components of variance were estimated as elements of the vector:in which b = (X'V-1X)-1X'V-1y \u00a0\u00a0\u00a0 (4)with covariance matrix:S = (X'V-1X)-1. \u00a0\u00a0\u00a0 (5)S was used to estimate the standard error of b. Phenotypic variance was estimated as the sum of the elements of b and its corresponding standard error approximated by the square root of the summed diagonal elements of S.where the square root of the corresponding diagonal element of V) were determined by calculating separate variances of cross-covariances for (i) our index of body condition in parents and our index of immune response in offspring, and (ii) our index of immune response in parents and our index of body condition in offspring. The mean was then taken of these two variances of cross-covariances. The additive genetic correlation (rA) and an estimate of its standard deviation were calculated using equations 19.2 and 19.4 in Falconer [Estimation of the genetic correlation between our indices of body condition and cell-mediated immune response level required all observational components to be estimated as cross-covariances . Cross-cFalconer , respectFalconer .DJG helped to design the project, collected animals from the wild, conducted all crosses and measurements, performed statistical analyses, and helped to write the paper. MWB helped with the statistical analyses and the writing of the paper. IPFO helped to design the project, collect animals, and write the paper. All authors read and commented on drafts of the manuscript, and approved the final manuscript."}
{"text": "There has recently been great interest in applying theoretical quantitative genetic models to empirical studies of evolution in wild populations. However, while classical models assume environmental constancy, most natural populations exist in variable environments. Here, we applied a novel analytical technique to a long-term study of birthweight in wild sheep and examined, for the first time, how variation in environmental quality simultaneously influences the strength of natural selection and the genetic basis of trait variability. In addition to demonstrating that selection and genetic variance vary dramatically across environments, our results show that environmental heterogeneity induces a negative correlation between these two parameters. Harsh environmental conditions were associated with strong selection for increased birthweight but low genetic variance, and vice versa. Consequently, the potential for microevolution in this population is constrained by either a lack of heritable variation (in poor environments) or by a reduced strength of selection (in good environments). More generally, environmental dependence of this nature may act to limit rates of evolution, maintain genetic variance, and favour phenotypic stasis in many natural systems. Assumptions of environmental constancy are likely to be violated in natural systems, and failure to acknowledge this may generate highly misleading expectations for phenotypic microevolution. An analysis of birth weight in Soay sheep reveals that environmental heterogeneity can constrain evolution and suggests that rates of evolutionary change may be lower in natural populations than expected from theory. Quantitative genetic models allow an evolutionary trajectory to be predicted from the strength of selection and the amount of genetic variance, usually expressed as the heritability,h2 . Howeverh2 ,4, and h2 ,6. Alth(Ovis aries) on the Scottish island of Hirta, St. Kilda [Here we examine the simultaneous effects of environmental variation on selection and heritability, using data from a long-term study of Soay sheep. Kilda . This sy. Kilda ,9. By s. Kilda . While sHere, we employ the analytical technique of \u201crandom regression\u201d to model genetic variance as a function of a continuously varying environment. This not only allows a more realistic model of environmental variation, but can also provide statistical benefits . In partBWT) and its association with juvenile mortality in the Soay sheep population. Of the total mortality of sheep, 24% occurs during the neonatal period (from birth in April or May until October 1 of the same year), making it a critical episode for viability selection [We focused on the trait of lamb birthweight  is relatively low [Birthweight is also heritable, as a consequence of strong maternal genetic effects, even though additive genetic variance , thely low .p = 0.15,n = 19). We therefore tested the hypothesis that environmental heterogeneity limits phenotypic evolution through effects on heritability or selection, or both simultaneously. To do this, we first examined the impact of environmental variation on the heritable basis of birthweight by modelling levels of genetic variance across a variable environment. Secondly, we tested for systematic variation between years of differing environmental conditions in the strength of selection acting over the neonatal period.Despite both positive directional selection and heritable variation ,18, annWe estimated heritable variation in Soay sheep birthweight using an animal model approach , which a(E) based on the level of neonatal mortality in each year  is used, then an individual's maternal genetic effect cannot change withE and, consequently, variance in these effects  is also constant across environments. In contrast, fitting higher-order polynomial functions allows systematic variation in the amount of maternal genetic variance across environments to be explicitly tested for.To model genetic variation for birthweight, we defined a measure of environmental qualityyear see. An enviVM) showed a general increase withE (VA = 0.020 (0.009),VC = 0.015 (0.008), andVR = 0.116 (0.008), respectively. As a consequence of increasingVM, the evolutionary potential of birthweight, as indicated by the total heritabilityh2T . Analysis with 1987 data excluded confirmed a strong trend of increasingVM withE, as did simpler models where we used first- or second-order functions of environmental quality , also ieffects ,23. Givs years , it is aE changes. Nevertheless, maternal genotype-by-environment interaction is shown by the environmental dependence ofVM.Maternal genetic covariances between environments were also estimated under Model IV, and were found to be uniformly positive . RescalisBWT), as well as with environmental qualityE  are useful for comparison with other studies, and ranged from +0.038 (\u00b1 0.019) to a maximum of +0.529 (\u00b1 0.064). This confirms that, in some years, directional selection was considerably stronger than the median value of 0.16 reported in the literature [Our finding of environmental variation in the heritable variance for birthweight was complemented by similar systematic variation in strength of selection. The relationship between phenotype and fitness  was investigated using generalised linear mixed modelling and standard regression-based methods , and conalityE . Howeverr = \u22120.919, df = 17,p < 0.001), confirming that positive directional selection on birthweight is weaker in good environments , suggesting a slight upward bias in the overall selection estimate through environmentally induced positive covariance between phenotype and fitness [Annual selection differentials were also strongly negatively correlated with environmental quality (Pearson's correlationonments . Poolingfitness .h2T), obtained under Model IV, were strongly negatively correlated with annual selection differentialsS .Thus, maternal genetic variance for birthweight increases with environmental quality, while the strength of selection decreases. This shared dependence on environmental quality results in a negative correlation between the strength of selection on birthweight and the amount of heritable variation. Accordingly, annual estimates of the total heritability ((R) to selection through neonatal mortality, determined using the breeder's equation [h2T andS, were small but showed a 10-fold range in magnitude (from 0.004 to 0.046 kg per generation). The weighted geometric mean response . Predicted responses should be interpreted with some caution since many assumptions of the breeder's equation will likely be violated in this case. For example, these predictions reflect selection through neonatal mortality only, while birthweight may co-vary with multiple fitness components [Evolution of increased birthweight in response to differential neonatal mortality is therefore limited by either a lack of heritable variation in poor environments or by a reduced strength of selection in good environments. Annual phenotypic responsesquation  as the ponse see was 0.01ponents  and withponents ,28. Nevponents ,29.Our findings thus highlight the differences between populations in natural environments and those in the controlled, constant environments for which quantitative genetic theory has been developed. While suitable long-term data will not always be available, increased efforts should be made, wherever possible, to fully consider the implications of environmental heterogeneity for both selection and the genetic variation on which it acts. In particular, if favourable environmental conditions are generally associated with low levels of selection but with high levels of heritability, and vice versa, then rates of evolutionary change may be much lower than those expected from values averaged across environments, providing an explanation for the frequently-observed stasis .Soay sheep were introduced to the Scottish archipelago of St. Kilda in the Bronze Age, and to the main island of Hirta  in 1932 shortly after the human evacuation of St. Kilda. Data relating to birth, death, reproduction, and phenotype have been collected for individually tagged animals resident in the Village Bay area since 1985 . The pedj), as well as additive (ai) and maternal genetic (mj) effects on birthweight. This random-effects structure results in the total phenotypic variance (VP) being split into four components: additive genetic variance (VA), maternal genetic variance (VM), maternal permanent environment variance (VC), and the residual (or temporary environment) variance (VR). Importantly, rather than using a conventional animal model, we fitted the maternal genetic effect mj as a polynomial function of environmental qualityE using random regression. Here, environmental qualityE is defined as the proportion of lambs surviving until October 1 in the year of birth . Thus, the birthweight of any animali having motherj is given as:Quantitative genetic parameters were estimated using animal models to partition variance into genetic and environmental components. Animal models are able to accommodate unbalanced datasets and complex pedigrees typical of natural populations , and alsBWT is birthweight, ei is a residual error term (having mean zero and varianceVR), andf is the random-regression function of maternal genetic value on orthoganol (Legendre) polynomials ofE with orderx. The model structure was fitted using different orders of the polynomial function (0 \u2264x \u2264 3) using restricted maximum likelihood implemented in ASReml . These alternative formulations of the model were then compared statistically using likelihood ratio tests. Model convergence was not achieved forx > 3 (unpublished data). As in a conventional animal model, an implicit assumption here is thatVA andVR are constant across environments. Univariate animal models in data subsets corresponding to good and bad environments (based on upper and lower 50 percentiles ofE) provided support for this assumption, with no significant differences in estimated additive or residual variances.WhereQ) was used to determine the maternal genetic variance\u2013covariance matrix (M) as:The estimated variance\u2013covariance matrix of random-regression parameters for the maternal genetic effect . Approximate standard errors for each element ofM were determined following Fischer et al. [h2T = (VA +VM/2)/VP . Note t(W) and was defined as 0 for animals that died before October 1 in the year of birth and as 1 for those that survived. Note that since offspring share common mothers, individual birthweights cannot be considered as independent data points. To account for this non-independence, we used a linear mixed model , with maternal identity fitted as a random effect such that:Neonatal survival was used as the fitness componentE is environmental quality;sBWT is birthweight standardized to mean 0 and variance 1,b0 tob3 are constants, andMOTHER is the maternal identity. AsE is determined from the average neonatal survival in each year, a statistical association between fitness and environment is inevitable . However, it is the effect ofE on selection, assessed fromb3, the interaction betweensBWT andE, that is of primary interest. Selection differentials(S) and standardized selection gradients (\u03b2) [BWT. Annual phenotypic responses(R) to selection were determined as the product ofh2T andS, and the weighted geometric mean response was calculated. Annual responses were weighted by surviving cohort size on October 1 .wherents (\u03b2)  were det"}
{"text": "Drosophila buzzatii and D. koepferae. Genital morphology in interspecific hybrids was examined and compared to the corresponding parental lines.The rapid evolution of genital morphology is a fascinating feature that accompanies many speciation events. However, the underlying patterns and explanatory processes remain to be settled. In this work we investigate the patterns of intraspecific variation and interspecific divergence in male genitalic morphology (size and shape) in the cactophilic sibling species D. buzzatii and D. koepferae showed contrasting patterns of genital morphological variation. Though genitalic size and shape variation have a significant genetic component in both species, shape varied across host cacti only in D. buzzatii. Such plastic expression of genital shape is the first evidence of the effect of rearing substrate on genitalic morphology in Drosophila. Hybrid genital morphology was not intermediate between parental species and the morphological resemblance to parental strains was cross-dependent.Despite of being siblings, Our results suggest the evolution of different developmental networks after interspecific divergence and the existence of a complex genetic architecture, involving genetic factors with major effects affecting genital morphology. The evolutionary processes governing the divergence of animal genitalia are mostly unknown and constitute one of the most intriguing pieces of a mayor puzzle that is speciation -5. In maThree main hypotheses have been proposed to explain the evolution of genital morphology: the lock and key, the pleiotropy and the sexual selection hypotheses. The lock and key hypothesis  states tThe pleiotropy hypothesis assumes that genital variation is largely neutral. Since genital and non-genital morphological traits are implicitly genetically correlated, changes of allele frequencies at loci pleiotropically affecting general morphology and genitalia may lead to rapid and arbitrary evolution of genitalic traits ,10,11. TDrosophila and their hybrids [The study of the evolution of male genitalia may be even more complicated not only because it may be influenced by both natural and sexual selection, but also because it's phenotypic expression might be influenced by environmental factors  as occur hybrids . TherefoDrosophila repleta group [D. buzzatii and D. koepferae [D. buzzatii is mainly adapted to breed on decaying tunas (genus Opuntia), while D. koepferae prefers the necrotic stems of columnar cacti of the genera Cereus and Trichocereus [D. buzzatii males can inseminate D. koepferae females and female hybrid offspring can be successfully backcrossed to D. buzzatii males [The aedeagus, which is the intromittent organ of male genitalia , is consta group . To thisoepferae ,20, whicoepferae , sexual oepferae . Both spoepferae ,24, howehocereus . Though ii males . Furtherii males ,27.Drosophila [The knowledge of the ecology of these cactophilic osophila ,24,28,29In this work we investigate the sources of phenotypic variation, genetic and environmental, by examining genitalic size and shape in flies of several isofemale lines of both species and interspecific hybrids raised in two different species of host cacti.D. buzzatii, 294 D. koepferae and 60 interspecific hybrids).A total of 606 males were analyzed in this study (252 D. koepferae and 12 in D buzzatii (results not shown). The cumulative contribution of the first 5 principal components of the elliptic Fourier descriptors (EFDs) of the genital outlines accounted for over 74% and 77% of total shape variance in D. koepferae and D. buzzatii, respectively and nearly 84% of shape variation in the interspecific analysis  while in D. koepferae differences between flies grown in different cactus media were not significant . As visually observed, D. buzzatii and D. koepferae significantly differed in their genitalic shape and presented morphological variation not only among lines within species but also interacting with the breeding substrate (Table We detected significant differences in aedeagus size between species but more notably between flies reared in different cacti Table . Howeverte Table .D. buzzatii the Cactus by Line interaction was significant and accounted for a relatively high percentage (12.1%) of phenotypic variance in aedeagus size. However, only the Line factor was significant in D. koepferae, neither the Cactus effect nor the Cactus by Line interaction were significant.The results of intraspecific ANOVAs also revealed important differences Table . In D. bD. buzzatii. In D. koepferae, in contrast, our results show that variation in aedeagus size has a genetic component, devoid of any plastic response in relation to the breeding substrate. According to the results of the MANOVAs, variability among lines in aedeagus shape was significant in both species , whereas in D. buzzatii, we detected a significant allometric relationship . Furthermore, aedeagus size and wing length varied isometrically in D. buzzatii as suggested by a coefficient of allometry not significantly different from 1 .We also studied the relationship between variables describing size of male genitalia and wing length. These variables were not significantly correlated in D. buzzatii and D. koepferae [D. buzzatii or D. koepferae. In all cases hybrid males failed to produce offspring even though copulation attempts were observed in the vials. Hybrid progeny obtained in crosses 4853 and 8832 could only be tested in vials prepared with the medium prepared with fermenting Opuntia due to low numbers of hybrid larvae, while in the other crosses the yield of hybrid progeny was high enough to be reared in both cactus media.Four interspecific crosses, out of 25 attempted,  yielded enough hybrid progeny as to perform the present study. These results are in agreement with previous studies reporting strong premating isolation between oepferae . In ordeOpuntia, the rearing substrate where all crosses were able to be tested. F1 hybrid males from crosses 4853 and 8832 reared in Opuntia vials presented intermediate values that differed significantly from both parental strains . In the other crosses, in which hybrids could be reared in both cacti, a significant Genotype by Cactus interaction  was only detected in cross 4855. Hybrids male progeny in this cross presented larger aedeagi than males of the parental D. buzzatii line in Opuntia, while differences between hybrids and the D. buzzatii parent were not significant in Trichocereus. In all cases, D. koepferae presented the largest genitalia in both cacti. In one cross (3512) mean genitalic size in hybrids was significantly lower than the male parental D. buzzatii line . Based on the correlation matrix, only PC1 scores were correlated with organ size in hybrids accounting for 50.4% of shape variation  were significant in all crosses Table . In Figup < 0.001 in all cases). However, neither the Cactus factor nor the Cactus by Genotype interaction were significant in the crosses in which hybrids were raised in the two cactus media (4855 and 3512).Significant shape differences among genotypes were detected in all crosses Table . Post hoD. buzzatii lines involved in successful interspecific crosses tended to be negative and those of D. koepferae positive. However, hybrids failed to present intermediate values for both shape variables simultaneously. For instance, hybrids of cross 8832 had shape scores for both PC1 and PC2 that placed them in the morphological space closer to the D. koepferae parent (Line 88) than to D. buzzatii (Line 32). On the contrary, in cross 3512 a hybrid genital morphology was more similar to D. buzzatii for PC1 (Line12) but the mean for PC2 was more extreme than any of the parental lines. Suggestively, as explained above, hybrids in 3512 also presented smaller genitalia than both parental lines.In figure F3,110=17.59; p < 0.0001; Figure In order to evaluate the degree of resemblance of the morphology of hybrids to each parental line, we calculated the Euclidean distance to the morphological centroid of each parental strain using the shape (PCs) scores of each individual hybrid. As a rough index of morphological dissimilarity, hybrids would show equal mean distances to the centroids of both parental clouds of points if they have intermediate aedeagus morphology. Expression dominance of one genome over the other would produce phenotypes resembling more closely one parental strain or the other. Morphological dominant expression was tested with an ANOVA in which the variable was the Euclidean distance of each hybrid male to the centroid of each parental species  with Cross and Parents as fixed factors. The ANOVA revealed significant differences among crosses though it should be noted that hybrid resemblance to parental strains were not independent of the cross  development of male genitalia.The first issue raised by our study is that aedeagus size and shape vary substantially in both species, and, that a significant portion of variation is genetically determined. Moreover, the inclusion, in our experimental design, of semi-natural rearing media prepared with different cactus hosts permitted the characterization of morphological variation in terms of phenotypic plasticity in both species. In this sense, phenotypic plasticity in genital morphology was evident in ic basis . Such a punctata . In contD. buzzatii and D. koepferae. In the latter, shape and size of male genitalia, as well as aedeagus size and wing length, appeared to be largely uncoupled as suggested by the low level of within and between organ allometries. These results suggest that differences among flies in wing length are not expected to be accompanied by changes in the size of the genitalia, indicating that the factors involved in development of wings and male genitalia are largely independent in D. koepferae. In contrast, aedeagus shape and size were significantly correlated in D. buzzatii, suggesting that factors affecting size (for instance the type of cactus host) may also indirectly affect the shape of the organ.Another relevant point is that patterns of allometry within (aedeagus size and shape) and between organs (aedeagus and wing size) also differed between D. buzzatii, body size related traits (such as wing length), known to be under natural selection [In election -38, are election ,39-41. Felection -44. If tD. buzzatii [Several features of the mating system, such as female remating frequency, premating time, copulation duration, interval between successive matings, and progeny numbers, have been shown to be genetically variable in buzzatii . Howeverbuzzatii  and Colebuzzatii .D. buzzatii and D. koepferae, now, we would like to examine whether our data allow a critical evaluation of the plausibility of the three main hypotheses proposed to explain genital evolution. Though our results are not entirely conclusive in this respect, the extensive phenotypic and genetic variation in aedeagus morphology are strong evidence against the \"lock and key\" hypothesis, that predicts low levels of variation (both phenotypic and genetic) in genital structures. However, the correlation between aedeagus morphology and wing length, along with the condition dependence (phenotypic plasticity in relation to cactus hosts) are in agreement, at least in D. buzzatii, with predictions of the hypothesis of pleiotropy. Concerning the third hypothesis, sexual selection, we must await for the results of experiments testing the relationship, if any, between genital morphology and reproductive performance.To this point we have presented basic features of the patterns of variation of aedeagus morphology in D. buzzatii and D. koepferae. In this sense, our results seem in conflict with the single available work comparing genital morphology in hybrids and parental species [D. buzzatii or D. koepferae varied among crosses. In fact, hybrid's morphological distance to D. buzzatii and D. koepferae depended on the parental strains employed in the crosses. In none of the 4 crosses hybrid morphology was phenotypically intermediate . Another non trivial point, that may complicate our interpretation is the difference in the time of divergence between the members of the two pairs of species, since development in interspecific hybrids is a result of a balance between the effects of the degree of heterozygosity and the degree of genomic coadaptation  and the outcome of the past selection pressures on the species studied . In this context, the idea that morphology (size and shape) of an organ potentially involved in species recognition (such as aedeagus morphology), might be associated to polymorphic inversions is consistent with recent theories linking chromosomal rearrangements and reproductive isolation [However, there are certain differences between our study and Liu et al's  that areer group ) in D. spulation  and therpulation , and tesied (see ). D. simears ago , while Dears ago . Finallydentical , whereas species ,23. Our its . The advantages of the use of the isofemale line technique in quantitative evolutionary genetics have been thoroughly described in [Fifteen isofemale lines (lines hereafter) of each species, derived from collections in the locality of Suyuque , were employed in the experiments outlined below. In this area both species coexist in nearly equal proportions  preceding the number of the male parental (D. buzzatii) line (e.g. the cross between D. koepferae line 48 and D. buzzatii line 55 was designated as 4855). Batches of 30 first-instar hybrid larvae were transferred to culture vials containing one of the two 'semi-natural' media. Four replicated vials were run per every combination of cactus and cross when the number of hatched larvae allowed it. The hybrid status of the descendants was ascertained by the cytological analysis of the polytene chromosomes of progeny larvae grown in vials run in parallel.Five lines of each species were randomly chosen to generate interspecific hybrids. All possible combinations were attempted . F1 hybrids were produced by crossing 25 virgin females of a 2 anesthesia.All cultures were maintained at 25 +/- 1\u00b0C with a 12:12 light/dark photoperiod until the emergence of adults. Adult flies were simultaneously collected and sexed under light COThe aedeagus and both wings were dissected from 2 to 5 males emerged in each replicate. Aedeagi were mounted on slides and photographed with a digital camera mounted on a microscope at 400 \u00d7 magnification. Wings were also mounted and ventral views of wing images were captured with a digital camera attached to a binocular microscope (25 \u00d7) connected to a computer. In each image, we scored total wing length (WL) using TpsDig .D. buzzatii and D. koepferae that preclude the possibility of determining an adequate number of reliable homologous landmarks. However, the aedeagus is a flat quitinous organ that can be effectively described in shape and size in two dimensions when flattened under a cover slip. Consequently, we decided to employ an approach based on elliptic Fourier descriptors (EFDs) [x and y coordinates of the outline of the studied organ are fit separately as functions of arc length by Fourier analysis, so that the outline can be decomposed into a weighted sum of sine and cosine functions designated as harmonics. Outlines from digital images were used to obtain Fourier coefficients for a polynomial function of 30th degree which were computed with SHAPE v1.2 package, [As shown in Figure s (EFDs)  as a pros (EFDs) . This ispackage,  using Elpackage, ,58,59. FThe area of each aedeagus (in pixels) was calculated from the digital images and considered as an estimator of the size of the organ. We performed a normalization of the descriptors based on the first harmonic ellipse that corresponds to the first Fourier approximation to the contour information (reviewed in ). Thus, The variance-covariance matrix of the 120 (4 per harmonic) estimated EFDs coefficients was used as input in a principal components analysis. This procedure allowed us to summarize the information assessed in the coefficients and reduce the dimensionality of the variables  in a lowWe worked with two sets of PC scores. The first set of principal components were calculated from the matrix of coefficients derived form the analysis of the outlines of the genitalia of males of the parental lines employed in successful interspecific crosses and the hybrids. The second set was obtained separately for each species improving the assessment of intraspecific variation in aedeagus morphology by avoiding the noise resulting from conspicuous interspecific morphological differences in the estimation of the PCs. This set was used in the evaluation of intraspecific sources of shape variation. Preliminary analyses with this technique showed that it is repeatable and reliable in species discrimination .C) may be interpreted as phenotypic plasticity, while significant differences among isofemale lines as due to genetic differences . Finally, a significant L \u00d7 C interaction may be construed as an estimation of genotype by environment interaction (GEI) or more explicitly, that the response of isofemale lines is not independent of the rearing cactus.Both interspecific and intraspecific size differences were investigated by means of ANOVAs, with Species , Cactus  and Line (nested in Species random factor) as main sources of variation. The variable was log-transformed to ensure homoscedasticity. According to our experimental design, in the ANOVAs for species, a significant cactus effect .We also evaluated the allometric relationship between aedeagus size and wing length, a trait correlated with overall body size, which in the studied species are known to be affected by the rearing substrate . Size daThe principal components scores obtained by means of the general assessment of interspecific shape variation of parental lines and F1 hybrids were used in the examination of morphological patterns of variation in the offspring of interspecific crosses. Size was analyzed by means of an ANOVA and shape with a MANOVA. In both cases the principal factor was Genotype (both parents and the hybrids) and in those crosses in which hybrid larvae could be reared in both cactus hosts, Cactus was also considered as a fixed factor.Statistica 6.0  was usedIS and EH conceived the study and read the salivary gland squashes. IS and VC carried out the experimental crosses, egg collections, larval seeding, rearing and adult collection. IS dissected the male genitalia, performed the morphological quantification, statistical analyses, and wrote the first draft of this manuscript. IS and EH wrote the final version of this manuscript. VC mounted the wings on microscope slides and provided the wing measurements. VC and JF helped to draft the final version of this manuscript. All authors read and approved the final manuscript."}
{"text": "Drosophila melanogaster wings in an experimental design with extensively replicated and fully controlled genotypes. The amounts of variation among individuals and of fluctuating asymmetry differ markedly among genotypes, demonstrating a clear genetic basis for size and shape variability. For wing shape, there is a high correlation between the amounts of variation among individuals and fluctuating asymmetry, which indicates a correspondence between the two types of buffering. Likewise, the multivariate patterns of shape variation among individuals and of fluctuating asymmetry show a close association. For wing size, however, the amounts of individual variation and fluctuating asymmetry are not correlated. There was a significant link between the amounts of variation between wing size and shape, more so for fluctuating asymmetry than for variation among individuals. Overall, these experiments indicate a considerable degree of shared control of individual variation and fluctuating asymmetry, although it appears to differ between traits.The nature of developmental buffering processes has been debated extensively, based on both theoretical reasoning and empirical studies. In particular, controversy has focused on the question of whether distinct processes are responsible for canalization, the buffering against environmental or genetic variation, and for developmental stability, the buffering against random variation intrinsic in developmental processes. Here, we address this question for the size and shape of  Developmental buffering is an important factor in evolutionary processes, because it can maintain adaptive phenotypic traits in the presence of genetic and environmental variation and it can conceal genetic variation from selection Empirical studies have tackled the question of whether canalization and developmental stability are distinct processes by comparing variation among individuals and the left-right asymmetries within individuals. Two main approaches have been used, which focus either on the amounts of variation or on covariance structures of multivariate features such as shape. Some studies have indicated that the amounts of individual variation and fluctuating asymmetry (FA) are correlated among genotypes Drosophila melanogasterThis study used both these approaches simultaneously in the context of an experimental design with complete control of genetic variation, replicated for 115 distinct genotypes from the Exelixis deficiency stocks of We digitized 15 landmarks on the left and right wings of each fly . To estir\u200a=\u200a0.81, P<0.0001) and for FA . Although the two measures are computed from different aspects of variation, they both convey similar information in the context of this study and therefore can be interpreted as nearly equivalent measures of shape variation.We used two different methods to quantify the amounts of shape variation among individuals and FA F114, 259\u200a=\u200a2.08, P<0.0001) and for FA . Similarly, the ANOVAs for both measures of shape variation indicated significant effects of the genotypes on variation among individuals  and on FA . These results show that the chromosomal deficiencies have clear effects on the amounts of variation among individuals and on FA, which in turn indicates a genetic basis for the amounts of variation.The amounts of variation differed markedly among the different genotypes, although there was also a consistent effect of the vials in which the flies had been reared. For centroid size, the ANOVAs indicated that the variation among genotypes exceeded the variation among vials both for variation among individuals (P<0.0001), and in the analysis using Mahalanobis distance, it was 0.67 (P<0.0001). Overall, there is a clear trend for genotypes with greater amounts of individual variation to have greater amounts of shape FA as well.For both measures of shape variability, the amounts of shape variation among individuals and of shape FA were significantly correlated across genotypes . In the r\u200a=\u200a0.074, P\u200a=\u200a0.22; In contrast, the correlation between individual variation and FA of centroid size was low and not statistically significant (P<0.0001 in permutation tests). Accordingly, genotypes that are more asymmetric for size also tend to be more asymmetric for shape. The correlations between amounts of individual variation of size and shape were 0.25 (P\u200a=\u200a0.0059) and 0.19 (P\u200a=\u200a0.022) for the measures using Procrustes and Mahalanobis distances, respectively  and size accounted for an average of 8.18% of shape variation among individuals. The asymmetry of size accounted for an average of 4.61% of the asymmetry of shape . Accordingly, size accounts for only relatively minor proportions of shape variation and asymmetry under the conditions of our experiment. It therefore appears that the correlation between size and shape in the amounts asymmetry and individual variation is not simply the result from a direct allometric link between size and shape, but is based at least to a considerable part on linkages in the processes that produce or buffer against the variation.To assess the possibility that this association was caused by a direct developmental link between size and shape, we tested for allometry within genotypes by multivariate regression of shape on centroid size P \u2264 0.0001).To examine whether among-individual variation and FA primarily concern the same or different features of shape, we quantified the degree of congruence between the respective patterns of covariation in landmark shifts. For this purpose, we computed matrix correlations between the respective covariance matrices for those 95 genotypes for which there were at least 50 specimens. Matrix correlations were computed both with the diagonal blocks included and excluded to examine whether the total patterns of landmark variation differ from the patterns of covariation among different landmarks This study shows a significant genetic effect on the amounts of individual variation and FA as well as a clear association in both the amounts and patterns of variation between individual variation and FA for wing shape. This is consistent with the idea of a common genetic and developmental basis for buffering of wing patterning processes against variation from different sources. The correlations between size and shape in the amounts of FA and individual variation provide further evidence in favor of a common basis for buffering. In contrast, the lack of association between the amounts of individual variation and FA for centroid size indicates that these relationships depend on the specific traits under study and the processes involved in their development. Here we discuss these findings and their implications for interpreting the mixed results of published empirical studies on canalization and developmental stability.Drosophila melanogasterDrosophila wing found an association between the severity of effects and levels of FA Our data indicate a clear association of the amounts of individual variation and FA of wing shape across genotypes . This fiIn stark contrast to the shape data, the association between individual variation and FA did not hold in the analysis for centroid size . This diThe discrepancy between these findings for size and shape highlights a methodological problem inherent in studies of developmental buffering: how can the effects of buffering be distinguished from differences in the initial input of developmental variation? Buffering is only observable if there is variation, and the resulting phenotypic variation is the joint expression of both the input of variation and the buffering of that variation by the developmental system. The original amount of variation, however, which is the input for the buffering processes in the developmental system, is unknown. The input of variation and buffering are therefore almost inextricably linked and cannot be separated without specifically designed experiments. Here we used samples of flies with controlled genotypes, so that genetic variation within samples can be ruled out. However, non-genetic effects cannot be controlled in this manner. The theoretical limit is a situation in which the environment is held constant so that the conditions under which the wings of two different flies develop are no more different than the conditions encountered by the two wings of the same fly. In this case, the left and right wings of individual flies would not be correlated, and the variance for individuals, var(0.5(right+left)), would be one-quarter of the variance for asymmetry, var(right\u2212left). For shape, individual variation (quantified using Procrustes distance) exceeded this theoretical limit consistently, but only by relatively small amounts , indicatThe correlation between the amounts of FA for centroid size and shape across the 115 genotypes exceeds the within-sample correlations of size and shape asymmetry for all but a few samples. Therefore, the direct developmental association of size and shape is not sufficient to account for the agreement of amounts of FA of size and shape. This is further evidence for a common genetic control of developmental variation of size and shape, although the data do not permit one to distinguish whether this control affects the origin of developmental noise or the developmental stability buffering against it. The association across many deficiency genotypes affecting different genomic regions may also be taken as evidence that a range of different genes contribute to the control of developmental stability, rather than just a few specialized genes Drosophila melanogasterDrosophila species Drosophila subobscura found considerable differences We not only compared the amounts of variation, but also the patterns of landmark shifts associated with individual variation and FA. There is a close and consistent correspondence between the patterns of individual variation and FA. A similar correspondence of patterns of shape integration for individual variation and FA has been found previously in the wings of Because each of our samples was genetically uniform, we can rule out a contribution from allelic differences to the variation among individuals, which would produce effects that depend on the genetic composition of the sample and usually would differ from the within-individual effects. Imagine a population in which one locus with two alleles affects shape, so that the allelic differences will cause variation along a single line (with additive effect only) or in a plane (with additive and dominance effect). Unless the non-genetic components of variation also happen to be concentrated in the direction of this particular line or plane, the two components of variation will therefore be different. Even when more complex genetic models are used, the covariance structure among individuals will depend on the particular mix of genotypes, and may not reflect the inherent patterns of canalization. This reasoning can explain the closer resemblance of the patterns of FA to those of environmental rather than of genetic variation that has been found in empirical studies that specifically examined this effect Overall, the results of this study clearly indicate that both the amounts and the patterns of individual variation and FA of shape are associated consistently across a broad spectrum of distinct genotypes. This suggests that canalization and developmental stability for wing shape share a common basis The flies used here were offspring from crosses between the Exelixis deficiency stocks A set of 15 landmarks was digitized on each image . To asseThe shape information was extracted from the landmark coordinates with a generalized least-squares Procrustes fit To quantify individual variation and FA of wing size, we used the within-sample variance of the centroid size We used two different methods to quantify variation, which are based on different measures of morphological distance: Procrustes distance and Mahalanobis distance To test whether the amounts of variation differed among genotypes, we used an extension of Levene's test To examine the correspondence between the amounts of individual variation and FA, we computed the variances based on the two distance measures for data sets with either the mean shapes of both wings or the signed (right\u2212left) differences of wing shape. Product-moment correlations were then computed across genotypes. The statistical significance of correlations was assessed with permutation tests Allometry within genotypes was tested by multivariate regression of shape on centroid size x and y coordinates of each landmark were kept together) x and y coordinates of each landmark) For the strains for which at least 50 specimens were available, we also compared the patterns of shape variation between individual variation and FA Table S1Strains used in this study and various sample statistics.(0.36 MB DOC)Click here for additional data file."}
{"text": "In this paper we present a novel approach to quantifying genetic architecture that combines recombinant inbred lines (RIL) with line cross analysis (LCA). LCA is a method of quantifying directional genetic effects  that differentiate two parental lines. Directional genetic effects are thought to be critical components of genetic architecture for the long term response to selection and as a cause of inbreeding depression. LCA typically begins with two inbred parental lines that are crossed to produce several generations such as F1, F2, and backcrosses to each parent. When a RIL population (founded from the same P1 and P2 as was used to found the line cross population) is added to the LCA, the sampling variance of several nonadditive genetic effect estimates is greatly reduced. Specifically, estimates of directional dominance, additive x additive, and dominance x dominance epistatic effects are reduced by 92%, 94%, and 56% respectively. The RIL population can be simultaneously used for QTL identification, thus uncovering the effects of specific loci or genomic regions as elements of genetic architecture. LCA and QTL mapping with RIL provide two qualitatively different measures of genetic architecture with the potential to overcome weaknesses of each approach alone. This approach provides cross-validation of the estimates of additive and additive x additive effects, much smaller confidence intervals on dominance, additive x additive and dominance x dominance estimates, qualitatively different measures of genetic architecture, and the potential when used together to balance the weaknesses of LCA or RIL QTL analyses when used alone. Genetic architecture is a broad term for all factors that influence the determination of phenotype from genotype. It includes all genetic effects on traits: the number of genes, allelic effects, epistasis, pleiotropy, and genotype x environment interactions Studies of genetic architecture have revealed that epistasis, i.e. interactions between loci, is a common component of most quantitative traits. For example, biomedical studies have shown an epistatic genetic basis for many human diseases directional, effects of all loci contributing to a trait. Line crosses have become more popular in recent years as interest in quantifying epistasis in quantitative traits has increased; this method offers far greater statistical power than variance component analyses previously used to measure epistasis Line cross analysis (LCA) is a well established method of quantifying genetic architecture with a long history of use in agriculture. Because of its utility for gene discovery, much recent work has focused on understanding genetic architecture at the level of individual loci or QTL. LCA in contrast measures the summed, i.e. In this paper we present a novel approach to quantifying genetic architecture that combines recombinant inbred lines (RIL) with line cross analysis. When RIL are used in line cross analyses, scaling tests can be constructed for non-additive genetic effects with far more precision than traditional methods of estimation. The RIL can be simultaneously used for QTL identification. These two uses of a RIL population yield qualitatively different information about genetic architecture and can be used in a powerful and complementary manner.Line cross analyses typically begin with two inbred parental lines that are crossed to produce an F1 generation. F2s, backcrosses, and other generations can be produced as well; the directional genetic effects  to be estimated are limited by the number of generation means measured. For example, estimating the mean, additive, dominance, and 3 pairwise epistatic effects requires at least 6 generation means for estimation and 7 for hypothesis testing.S) and the hybridity index (\u03b8H), multiplied by the additive (A), dominance (D) or epistatic interaction effects  that potentially differentiate the parental lines (equation 1).S determines the coefficients of the additive effects' contribution to each generation's phenotypic mean. The source index is scaled from one to negative one and indicates the proportion of genes in the generation that came from parent one (P1), with +1 indicating 100% and \u22121 indicating 0%. P1's \u03b8S\u200a=\u200a+1 while for F1s, F2s, and RILs \u03b8S\u200a=\u200a0.Line cross analyses are primarily carried out using frameworks based on the F2 model of Cockerham H\u200a=\u200a+1, while parents have \u03b8H\u200a=\u200a\u22121. The hybridity index determines the contribution of the dominance effects to each generation mean. The hybridity index is also scaled from +1 to \u22121, with +1 indicating that every locus is heterozygous and \u22121 indicating that every locus is homozygous. F1s thus have \u03b8To this traditional set of line cross generation means, the mean of a RIL generation can be added. In this context, \u2018RILs\u2019 or a \u2018RIL population\u2019 is a set of genotypes of highly inbred F2 lines. If these genotypes were replicated, the means of each genotype can be used as individuals for calculating the overall RIL generation mean. RILs asymptotically approach complete homozygosity for all loci as the number of generations of inbreeding approaches infinity. In practice, the convention is to use six to eight generations of inbreeding, resulting in \u223c99.84 to 99.96% homozygosity respectively. A major advantage of RILs is that the descendents of any one RIL are genetically identical, hence \u201cimmortal\u201d (ignoring mutation accumulation), allowing RILs to be marker-genotyped once and phenotyped repeatedly in multiple labs and experiments. In the framework of LCA, RIL can be used to greatly improve power in estimating non-additive genetic effects.The F2 generation has a value of zero on both the source and hybridity indices. All genetic effects are scaled relative to this F2 generation mean, thus the linear contrasts used to estimate the genetic effects are sometimes called F2 scaling tests. The expected mean of the F2 and RIL generations are identical and their source indices are both zero -1, assuming equal spacing of markers throughout the genome. In the absence of segregation distortion, this will be very close to zero). However the F2 hybridity index has zero value, while the RIL hybridity index is in contrast approximately negative one. .Products of the source and hybridity indices determine the coefficients for interactions between additive and dominance effects (i.e. epistasis). For example, the product of the additive coefficient (source index) and the dominance coefficient (hybridity index) is the coefficient for the additive x dominance epistatic effect. The coefficients for additive, dominance and pairwise epistatic effects for 7 commonly used generation means are given in Xiz indicates the phenotypic mean of the iXth generation :Using equation (1) and the first six generations in Note the equations for D and AD in Lynch & Walsh (By incorporating the RIL generation's equation (for the contributions of the various genetic effects to the RIL generation mean) in the F2 scaling tests, we can construct tests for non-additive genetic effects with fewer terms than traditional tests, shown by contrasting equations (2) and (3). Incorporating the RIL means equalizes the number of generation means necessary to estimate the additive and dominance effects, and the number of generation means necessary to estimate the AA, and DD epistatic effects. This is important in providing equanimity in the power of tests for both intra- and interlocus additive vs. dominance effects; estimates of A and D both require two generation means while AA and DD both require three generation means. AD is the sole equation which retains four generation means in its estimator because the RIL mean cannot be used to simplify the equation.D follows a t distribution with 1 df. Similar test statistics can be constructed for each genetic effect following the same format.T-tests can be used to test the null hypothesis that a genetic effect equals zero, assuming that the test statistic is normally distributed under the null hypothesis. The test statistic is simply the estimated genetic effect estimate divided by the standard error of the estimate. For example, the test statistic for the composite dominance effect (using eq. (2)) isThe effect of reducing the number of terms becomes clear when we look at the new RIL-based test statistic for the composite dominance effect:2 * Var (A) + d2 * Var (B), provided that the terms being summed are independent. We can compare the variances associated with the traditional formulae for D, AA, and DD from equations (2) with the corresponding RIL equations (3). For these comparisons, we assume that all generation means have equal variance (i.e. \u03c32\u200a=\u200aVar (P1)\u200a=\u200aVar (P2)\u200a=\u200aVar (F1)\u200a=\u200aVar (F2)\u200a=\u200aVar (B1)\u200a=\u200aVar (B2)\u200a=\u200aVar (RIL)).Recall that the variance of a sum equals the sum of the variances multiplied by the square of the coefficients, i.e. Var (cA + dB)\u200a=\u200acBased on this assumption, the RIL-based equation for D, AA, and DD have 92%, 94%, and 56% reductions in variance respectively relative to the traditional equations . The varY), a design matrix (X) of coefficients derived from the source and hybridity indices, and a vector of composite genetic effects (\u03b2) to be estimated. Initially, \u03b2 contains the mean and the composite additive effect and X contains two corresponding columns. An estimate of \u03b2 is calculated using (XTX)\u22121XTy (or (TV\u22121XX)1\u2212TV\u22121yX, where \u22121V is a diagonal matrix of squared standard errors for generation means if sample sizes are unequal). This estimate of \u03b2 is premultiplied by X to produce a vector of predicted generation means \u0176, given an additive genetic architecture. \u0176 is then compared with the observed Y using a chi-squared test. If the observed and predicted Y's are significantly different, then the additive model is rejected and an additive and dominance model is tested next. A new \u03b2 vector containing the mean, the composite additive effect, and the composite dominance effect is estimated and multiplied by an X matrix with 3 columns to produce a new \u0176. Increasingly complex models of genetic architecture are tested until the predicted and observed vector of generation means is not significantly different.Frequently, line cross experiments are analyzed using joint scaling tests e.g. . The joiTo illustrate the advantages of using RIL in a joint scaling context, we used seven generation means to estimate a model of additive, dominance and pairwise epistatic effects:Y\u200a=\u200aX\u03b2, where\u03b2\u200a=\u200a(XTX)\u22121XTy. When we used Mathematica \u03b2 in terms of the generation means, the solution is:The general formula for solving linear equations is As in the individual scaling tests, the variance of the dominance effect and the additive x additive effect in RIL models are reduced by 92% and 94% respectively relative to the traditional equations. When the genetic effects are estimated simultaneously using RILs in the model above, the variance of DD is now reduced by 79%  and the variance of the estimate of the mean is reduced by 63%.More precise estimation of non-additive genetic effects will help distinguish whether these non-additive effects are rarely detected within micro-evolutionary studies because they are uncommon or because experimental designs have lacked sufficient statistical power to detect them.Phylogenetically broad crosses have gained increasing importance in both plant breeding and evolutionary genetic studies e.g. . DirectiWe show in this paper that the inclusion of a RIL generation in line cross analysis can greatly increase the accuracy with which D, AA, and DD interactions are estimated. The accurate estimation of gene interaction effects can be of substantial value for those interested in describing genetic architecture and its role in a variety of evolutionary processes Arabidopsis thaliana C24 and Col-0 genotypes to produce F7 recombinant inbred lines, then crossed these RIL to both parents and F1 in what is known as a triple test cross (TTC) design. RIL, RIL X C24, RIL X Col-0, and RIL X F1 generations were all used in line cross analysis and their results suggested that pairwise and higher order epistasis are important components of the genetic architecture of heterosis for biomass in C24 X Col-0 Arabidopsis lines. While the TTC design allows one to estimate non-additive genetic variance components, these additional crosses are not necessary to reap benefits of using RIL in LCA. We suggest purchasing RIL from stock centers to reduce the time consuming crosses necessary for more complex breeding designs.A reviewer has pointed out that one research group has previously incorporated RIL into line cross analysis. Kusterer et al. The reductions in variance used as an illustration in this paper are predicated on the assumption of equal variances in the estimate of every generation line mean. This is not necessarily a realistic assumption, particularly for the RIL generation. First, RIL populations are perforce large. The best RIL populations in many species contain 200\u2013400 RILs and these are often grown and measured in multiple replicates for the purpose of QTL analysis. Line cross generation means are typically calculated with far fewer measures and hence degrees of freedom. Thus we might expect the variance of the mean to be substantially smaller for the RIL mean than for other generations. However, RIL populations very often show transgressive segregation, even when the parents are phenotypically similar. In fact Rieseberg et al. If a RIL population is used within a line cross analysis, little extra work is required for QTL mapping. The QTL mapping results will give qualitatively different information on genetic architecture, information that compliments the results of the line cross analysis. QTL mapping can potentially find the number of regions with additive effects (QTL) and the magnitude of those effects, as well as additive x additive epistatic regions responsible for the composite effects detected in line cross analysis. Additionally, QTL mapping may detect loci with equal and opposite effect that are invisible to LCA. For example, if the P1 allele at locus A adds 5 units to the phenotype but the P1 allele at locus B reduces the phenotype by 5 units, LCA will not detect this zero net additive difference between parents. Such canceling effects are clearly often present, evidenced by RIL population parents having very similar phenotypes but widely transgressive segregation in the inbred F2 descendents  of opposite sign invisible to line cross analysis. It can also detect additive and additive by additive epistatic QTL. It can be used to find the location of QTL for effects detected in line cross analysis. Recombinant inbred lines can be purchased from stock centers so that the time and work required to produce them is avoided. QTL studies that wish to incorporate additional line crosses will only require small increase in sample size on the order of 20%. On the other hand, line cross studies will require adding a much larger sample size to add a set of RIL lines large enough for QTL mapping. But these additional organisms phenotyped will not require the time-consuming crosses. Adding line crosses to a QTL experiment or a RIL population to a line cross experiment results in a large increase in ability to measure genetic architecture that will more than justify the modest increase in research effort and cost. Increased statistical power, qualitatively different measures, cross-validation of results, and potential to overcome weaknesses of each approach alone makes this a very powerful approach to gaining a fuller understanding of genetic architecture."}
{"text": "The accuracy by which phenotype can be reproduced by genotype potentially is important in determining the stability, environmental sensitivity, and evolvability of morphology and other phenotypic traits. Because two sides of an individual represent independent development of the phenotype under identical genetic and environmental conditions, average body asymmetry (or \"fluctuating asymmetry\") can estimate the developmental instability of the population. The component of developmental instability not explained by intrapopulational differences in gene or environment (or their interaction) can be further defined as internal developmental noise. Surprisingly, developmental noise remains largely unexplored despite its potential influence on our interpretations of developmental stability, canalization, and evolvability. Proponents of fluctuating asymmetry as a bioindicator of environmental or genetic stress, often make the assumption that developmental noise is minimal and, therefore, that phenotype can respond sensitively to the environment. However, biologists still have not measured whether developmental noise actually comprises a significant fraction of the overall environmental response of fluctuating asymmetry observed within a population.Aphis gossipyii, it was discovered that fluctuating asymmetry in the aphid wing was nearly four times higher than in other insect species. Also, developmental noise comprised a surprisingly large fraction (\u2248 50%) of the overall response of fluctuating asymmetry to a controlled graded temperature environment. Fluctuating asymmetry also correlated negatively with temperature, indicating that environmentally-stimulated changes in developmental instability are mediated mostly by changes in the development time of individuals.In a morphometric study designed to partition developmental noise from fluctuating asymmetry in the wing morphology of a monoclonal culture of cotton aphid, The amount of developmental noise revealed in this trait potentially does interfere with a substantial amount of the sensitivity of fluctuating asymmetry to change in temperature. Assuming that some genetic-based variation in individual buffering of developmental instability exists in natural aphid populations, the amount of internal developmental noise determined in this study could also substantially reduce evolvability of the aphid wing. The overall findings here suggest that individual response to the seemingly high cost of stabilizing some aspects of the phenotype may account for the frequent observation of trait and species specificity in levels of fluctuating asymmetry. Phenotype is determined partly by the interaction of genotype and environment and partly by random internal noise during development. The phenotype is also generally robust to the combined effects of mutation, environmental change, and internal noise . This roDevelopmental instability most often is estimated by fluctuating asymmetry (FA), the right and left side difference in size or shape in a single trait across the population ,11-13. GBiologists have often assumed either that FA is driven mostly by uniform individual responses to a variety of stessors encountered by a natural population in a heterogeneous environment or that FA is driven mostly by variability among individual capacities to buffer against a relatively uniform level of stress presented by a homogenous environment. This difference of opinion as to whether FA is mostly environmentally-based or has a significant genetic component is debated ,15, and Drosophila imaginal wing disc over an average distance of only 2\u201310 cells (2\u20134 doublings) regardless of the stage of development. This large difference between adult body size and the comparatively small extent of synchronized cell behavior implies a large potential for the accumulation of errors caused by random differences in the timing of cell cycles within expanding cell populations during growth and development. This source of developmental noise is amplified strongly by expanding populations of growing cells during the exponential growth phase, causing the multiplicative accumulation of developmental error. Without mechanisms to regulate this kind of noise, the ascertainment of an accurate and symmetric phenotype would be nearly impossible. However, empirical observations of the symmetry of various morphologies demonstrates that most organisms actually exhibit low levels of developmental instability, as estimated by FA. Clearly, while the potential for error that leads to developmental noise must be regulated dynamically during the growth process . Milan et al.  has demoess (see ), it is Despite the likely contribution of multiplicative error to FA, it has traditionally been assumed, that developmental instability somehow originates at a subcellular molecular level and that these effects are independent and additive in their contribution to overall body asymmetry [,12 and  but alsohe \"law\" . Hence, he \"law\"  rationalhe \"law\" ,29. Babbhe \"law\"  has alsoDespite the potential for individual differences in gene and environment to influence the developmental stability of the phenotype, almost nothing is known about the overall level of internal developmental noise in a typical phenotypic trait. More importantly, how does this level of noise compare to the response of fluctuating asymmetry observed when an organism's environment changes? This is the central question in this investigation, which reports the percentage of variation in FA due to noise compared to the environmental response of FA along a temperature gradient in a genetically homogeneous population of organisms with complex morphology.Aphis gossipyii, is characterized. This species can reproduce parthenogenetically (apomictic) and often produces wings that are easily measured using multiple landmarks. Cotton aphids demonstrate large visible variation in body size, wing size, and wing FA, even within monoclonal cultures and are one of the few insects that demonstrate quite visible wing asymmetry within many individuals. Cotton aphids are also phenotypically plastic in response to temperature, producing smaller lighter morphs at high temperatures and larger, darker morphs at low temperatures. This unique feature allows observation of two genetically homogeneous groups in which differences in gene expression exist (causing the two color/size morphs). Therefore, this model system can allow for partitioning of the effect of variation in gene expression from variation in genotype on developmental stability.In this study, both the noise component of FA and its response to environment (temperature response) in the cotton aphid, Aphis gossipyii Glover) was obtained from Dr. J.P. Michaud in Lake Alfred, Florida and was brought to the Department of Entomology and Nematology at the University of Florida. The culture was maintained on cotton seedlings (Gossipium) grown at different temperatures  under artificial grow lights (14L:10D cycle). Because of potential under-sampling caused by a non-normal distribution of FA , a secoDevelopment time for individual apterous cotton aphids (Lake Alfred clone) were determined on excised cotton leaf discs using the method of Kersting et al. . Twenty In each temperature treatment, single clonal populations were allowed to increase on plants until crowded, in order to stimulate alate  production. Temperature treatments above 17\u00b0C produced small light colored and tended to feed on the undersides of leaves of cotton seedlings. Temperature treatments below 17\u00b0C produced larger, dark morphs that tended to feed on the stems of cotton seedlings. Alatae were collected using small brushes dipped in alcohol and were stored in 80% ethanol. Wings were dissected using fine insect mounting pins and dry mounted as pairs on microscope slides. Dr. Susan Halbert at the State of Florida Department of Plant Industry in Gainesville, FL performed species identification.Specimens were dried in 85% ethanol, and pairs of wings were dissected (in ethanol) and air-dried to the glass slides while ethanol evaporated. Permount was used to attach cover slips. This technique prevented wings from floating up during mounting, which might slightly distort the landmark configuration. Dry mounts were digitally photographed. Six landmarks were identified as the two wing vein intersections and four termination points for the third subcostal.Wing vein intersections were digitized using TPSDIG version 1.31 . SpecimeFA1, FA2 and FA3) of the total sample. All subsequent statistical analyses were performed using SPSS Base 8.0 statistical software [in a smaller subset , and \"response\" refers to the overall variance of FA between temperature treatments . The fraction of FA due to noise was calculated as the intra-individual variance of FA within each treatment divided by the total variance of FA among all individuals in the study.The overall fraction of FA due to developmental noise was 49.7% and 50.1% for size and shape FA, respectively, and the overall noise-to-response ratio was 1.00 and 1.02 for size and shape FA, respectively. There were no significant differences in the levels of developmental noise between light and dark morphs regardless of whether FA was measured using multivariate size or shape , and mean isogenic FA (both size and shape) was highly significantly different across temperatures  in the Gainesville FL clone  but this difference is due mostly to elevated FA in the 12.5\u00b0C group  morphs. Temperature trends in mean FA, which are sloped differently in the two color/size morphs Figure , were alBoth environmental temperature and FA potentially interact with growth rate and size in ectothermic species and, therefore, they should indirectly influence each other. There are several ways that FA might respond to temperature. First, increased temperature may increase molecular perturbation, which may further act to increase overall levels of developmental noise during development. This should predictably increase FA with temperature. Second, increased temperature may act as a behavioral cue to shorten development time , therebyOnly a few studies have directly investigated the relationship between FA and temperature. The results are conflicting. FA is found to increase on both sides of an \"optimal\" temperature -44, to bIn this study, there is a clear overall decrease in FA with increasing temperature. This strongly supports that developmental instability is a function of developmental time rather than growth rate. Thus, the longer time spent in development and therefore, the more interrupted the growth process becomes, the larger the accumulation of multiplicative developmental errors. This was especially evident in the curve of centroid size-based FA, which closely follows the curve of development time. The slope of the temperature trend in mean FA is much steeper in dark morphotypes, which also have significantly higher FA, further indicating that environmental influences on FA are primarily related to individual developmental time. This result is consistent with the explanation of the basis of FA by Emlen et al.  and counThis research indicates that within at least one morphological trait, the aphid wing, moderate levels of internal stochastic developmental noise do exist and potentially could impart some degree of insensitivity of FA to the environment. It perhaps also suggests that developmental accuracy may come at some significant cost that some organisms are unwilling to allocate towards certain aspects of their morphologies. Variation imposed by differences in this cost may account for the trait and species specificity of FA often observed among studies. Recently, it has been demonstrated that stochastic events occurring during the rapid growth phase of development can have profound effects on statistical qualities of fluctuating asymmetry, such as tail size and variance . This al"}
{"text": "In this essay, Abigail Shearin and Elaine Ostrander discuss the proposed genomic mechanisms for the extraordinary level of phenotypic variation observed in the domestic dog and the evidence detailing the variants responsible for the many shapes, sizes, textures, and colors of man's best friend. As a result of domestication, selection for desirable phenotypes, and breed propagation, the domestic dog is unmatched in its diversity as a land mammal. Exhibiting extraordinary levels of both interbreed heterogeneity and intrabreed homogeneity, evidenced in part by the extensive linkage disequilibrium observed in many breeds, the dog provides an as-yet unrealized opportunity to uncover the molecular mechanisms that govern natural variation across mammalian species. We herein discuss recent advances in canine genomics that have made exploration of genetic mechanisms controlling breed-specific differences possible. We consider some examples where molecular mechanisms controlling simple traits have been uncovered. Finally, we reveal how combinations of genes produce complex phenotypes that can be revealed through studies of dog breeds featuring specific traits.As Darwin himself noted, the domestic dog displays a remarkable level of phenotypic diversity Canis familiaris, and possess a 2.8 Gb genome featuring 38 autosomes and the sex chromosomes, similar in size to the 3 Gb human genome. Dogs of any breed can, for the most part, be crossed to produce fertile offspring. Breeds were developed largely during the Victorian era, with special selection for both morphologic traits based on size, proportion, coat, etc., as well as behavior. To be a registered member of a breed, both of a dog's parents have to be registered members of the same breed, and their parents in turn must be registered members of the breed. Thus, each breed is effectively a closed breeding population that offers many statistical advantages for doing genetics beyond what can be done in studies of human populations There are over 300 dog breeds identified worldwide, with nearly 170 recognized in the United States by the American Kennel Club (AKC) In this essay we consider some of the features of the canine genome relevant for successful studies of selected traits. We discuss current hypotheses regarding the development and maintenance of genetic variation in dogs today. We consider examples in which identified genes account for unique, and sometimes complex, phenotypes. Finally, we consider the implications of these findings for studies of true complex traits, such as those associated with behavioral genetics.\u22124, which is essentially the same high level of nucleotide diversity reported in the human population. As expected, however, the level of genetic diversity within any single breed is considerably less than the species as a whole The canine genome was sequenced to both 2\u00d7 The loss of diversity reported by Gray et al. The extensive LD that characterizes dogs means that genome-wide association studies (GWAS) can be done in the dog with as few as 20,000\u201330,000 single nucleotide polymorphisms (SNPs), compared to the million needed for the more outbred human population To aid in the selection of breeds for any given study we recently did a cluster analysis of 132 dog breeds and showed that breeds divide into five major groups: Asian and ancient dogs; hunting and gun; mastiff and terrier; herding and sight hound; and a mountain group The closest relative to the domestic dog is undeniably the gray wolf, from which the dog differs by only 0.04% in nuclear coding-DNA sequence Alx-4 gene, which is postulated to be responsible for their characteristic rear digit polydactyly Alx-4 allele, while one Great Pyrenees who lacked rear digit polydactyly did not carry the variant allele The degree to which new mutations have played a role in the development of the modern dog still requires intense scrutiny, but three major sources of genomic variation have been proposed as contributors to the high levels of phenotypic variation observed in today's domestic dogs. The first is variability associated with microsatellites or simple sequence repeats (SSRs). Fondon and Gardner hypothesized that repeat length polymorphisms, particularly those occurring in regulatory regions, were an important source of morphologic variation, in part because they occur at a mutation rate 100,000\u00d7 greater than SNPs Elaborating on this theme, the same investigators found that members of the Canidae family possessed elevated genome-wide basal slippage rates, the rate at which DNA replication machinery creates new alleles due to errors in replicating repeat elements, compared to humans, non-human primates, and other members of the Carnivora order  Another mechanism that clearly accounts for a subset of diversity between breeds is carnivore-specific short-interspersed nuclear elements (SINEs) fibroblast growth factor-4 (fgf4) retrogene, a gene copied by reverse transcriptase from processed mRNA and inserted into the genome, which we demonstrated is associated with chondrodysplastic breeds displaying disproportionately short limbs FGF4 but none of the introns or regulatory machinery. Expression studies revealed that the adjacent genes were expressed in neonatal chondrocytes, as was the retrogene. However, the retrogene was not expressed in the cartilage of mature dogs. Although expressed retrogenes are common in insects, this is the first example we are aware of in which alleles of a retrogene segregate in a mammalian species such that they are a major source of morphological variation Other possible mechanisms of variation in the dog are common to many species and include mutational hotspots, chromosomal fission, and gene duplications. The latter are particularly interesting. For instance, duplication of a 133-Kb region spanning three fibroblast growth factor genes was shown to be associated with the appearance of a characteristic ridge on the back of the Rhodesian ridgeback breed The first large-scale genetic studies of canine skeletal morphology were done by Chase et al., in the Portuguese Water Dog (PWD) insulin like growth factor-1 (IGF-1) gene IGF-1 haplotype was shared among all small dogs, suggesting that a single ancestral mutation had been selected for in the development of all small dog breeds studied. Two distinct IGF-1 haplotypes segregated in large dogs, suggesting a more complicated scenario for enlarging breed size We showed that the primary signal for body size (PC1) was a four million base pair (bp) locus spanning several genes on CFA15 cis-acting mechanisms, although the critical mutation remains to be found.Additional skeletal traits studied include PC2, which defines leg length versus width in the original study of Chase et al., R-spondin-2 (RSPO2) gene is strongly associated with wire hair and \u201cfurnishings\u201d, the latter being the moustache and eyebrows characteristically seen, for instance, in the schnauzer fibroblast growth factor-5 (FGF5) gene. Curly versus straight fur is associated with a coding SNP within the keratin71 (KRT71) gene Some of the most exciting progress in understanding the genetics of variation in dogs relates to the complex traits of coat texture and color. We recently showed that variation in canine pelage, including pattern, length, curl, and texture (smooth versus wire), are controlled by combinations of alleles at only three genes RSPO2, FGF5, and KRT71 and thus possesses long, curly hair with furnishings  pathway. Variants result from mutations in the microphthalmia-associated transcription factor (MITF), which is crucial for melanocyte migration Several dog breeds exhibit complete or partial absence of pigmentation. For instance, Karlsson et al. mapped a locus for white-spotting to a 102-kb haplotype on CFA 20 in a region that spans a single gene; The identification of genetic variants controlling morphology in the dog population has reached an exciting juncture. The current set of available molecular tools allows us to finally address the critical questions. For instance, the striking morphological variation observed between breeds of dogs provides us with unique opportunities to study the genetic basis of both evolution and domestication. A deeper understanding of the genomics and variation in wild canids would enhance our ability to pursue these questions.Several hypotheses have been proposed as to why the dog, as opposed to any other domestic land mammal or any other domesticated creature, displays such extremes of morphologic variation (Box 1). Each theory has its champions, and most likely a combination of mechanisms contribute with the strong artificial selection imposed by man being the most important. The question remains: if under the same intense artificial selection for novel morphological traits, would other domestic creatures exhibit equivalent variation? As scientists continue hunting for the genes and tracking the mutations that control morphologic variation in the domestic dog, we expect still more secrets will be revealed regarding the genetic basis of man's extraordinary best friend.Microsatellites or simple sequence repeatsHigh levels of repeat purityThe abundance and location of SINEC_Cf elements in the canine genomeCommon sources of variation: mutational hotspots, chromosomal fissions, and gene duplicationsIntense artificial selectionRapid perpetuation of new mutations"}
{"text": "Heritability in mate preferences is assumed by models of sexual selection, and preference evolution may contribute to adaptation to changing environments. However, mate preference is difficult to measure in natural populations as detailed data on mate availability and mate sampling are usually missing. Often the only available information is the ornamentation of the actual mate. The single long-term quantitative genetic study of a wild population found low heritability in female mate ornamentation in Swedish collared flycatchers. One potentially important cause of low heritability in mate ornamentation at the population level is reduced mate preference expression among inexperienced individuals.Applying animal model analyses to 21 years of data from a Hungarian collared flycatcher population, we found that additive genetic variance was 50 percent and significant for ornament expression in males, but less than 5 percent and non-significant for mate ornamentation treated as a female trait. Female breeding experience predicted breeding date and clutch size, but mate ornamentation and its variance components were unrelated to experience. Although we detected significant area and year effects on mate ornamentation, more than 85 percent of variance in this trait remained unexplained. Moreover, the effects of area and year on mate ornamentation were also highly positively correlated between inexperienced and experienced females, thereby acting to remove difference between the two groups.The low heritability of mate ornamentation was apparently not explained by the presence of inexperienced individuals. Our results further indicate that the expression of mate ornamentation is dominated by temporal and spatial constraints and unmeasured background factors. Future studies should reduce unexplained variance or use alternative measures of mate preference. The heritability of mate preference in the wild remains a principal but unresolved question in evolutionary ecology. High genetic variability is common in sexually selected traits However, directional mate choice also shows variation within a single population. For example, females that are unattractive or in poor condition may need to be less choosy due to the risk of rejection by males Theoretical models that laid the foundation of contemporary sexual selection research examined the evolution of mating preferences, which means that they assumed heritable variation in preferences  fathers and sons were found to positively correlate in the ornamentation of females they mated with, and mate ornamentation was also repeatable within males. In this study, additive genetic and other individual-specific (i.e. permanent environment) effects on mate attractiveness could not be distinguished. The second study was conducted in a Swedish population of collared flycatchers  on the island of Gotland, using an extensive, long-term pedigree To the best of our knowledge, there are only two studies of the inheritance of mating patterns in the wild. Both studies used the ornamentation of the mate as a measure of an individual's mate preference. In the first study Studies in many species have suggested that mate choice is age-dependent Here we concentrate on the effect of breeding experience on the heritability of mate ornamentation. As a first step, we look for effects of breeding experience on breeding date and clutch size when controlling for female age, to see whether our coding of experience is meaningful. As a second step, we repeat the population-level heritability analyses conducted in the Swedish population to see whether the apparent additive genetic background of mate FPS is similar in our population. For comparison, we also estimate the variance components of FPS in males  We ignore other sexual traits such as wing patch size and song throughout, due to the lack of adequate data from those traits for this analysis. However, the independent treatment of FPS is justified by the fact that this ornament, with its low phenotypic plasticity, occupies a special, disjunct position among male sexual traits in our population 1,4078\u200a=\u200a86.57, p<0.001), but less strongly affected by age . Inexperienced females laid eggs much later than experienced ones  and age . The same was true for date-corrected clutch size .Breeding date (n\u200a=\u200a5651 observations) was strongly influenced by experience (Fced ones . Clutch A), while variances due to year (VYEAR) and nestbox plot (VPLOT) were also significant and together explained another ten percent of variation. VPE was not significant. When analyzing female mate FPS , but it had a broad error range and therefore did not differ significantly from zero either . In this bivariate model, VA seemed slightly higher in the inexperienced group, but it was not significantly different from zero in either category . Simultaneously constraining rG as 1.0 and VA in the two experience categories as equal did not lead to a significantly different model likelihood compared to the unconstrained model . In sum, there was no evidence that experience affected the additive genetic background of mate FPS. However, the correlation of nestbox plot effects on mate FPS between experience categories (rPLOT) was bound to 1.0 while the correlation of year effects (rYEAR) was 0.921\u00b10.098. Both rPLOT and rYEAR were significantly different from zero .Our final analysis was a bivariate animal model of mate FPS among inexperienced and experienced females. Similar to the univariate results, VA) for ornamentation (FPS) as a male trait (fifty percent). For mate FPS as a female trait, however, VA was very low (less than five percent), and breeding experience had no demonstrable effect of on the expression of additive genetic variation. We also found significant spatial and temporal constraints on both the expression of mate FPS and its pattern with experience, and a large percentage of unexplained variance in mate FPS. These results raise questions about the adequate quantification of mate preferences in wild populations.We detected ample additive genetic variation . Therefore, if an inexperienced and an experienced female shared breeding area or year, this made their mate FPS similar. At the population level, the numbers of available data varied vastly among combinations of year and nestbox plot, so the high rPLOT and rYEAR we found also imply that temporal and spatial heterogeneity tended to blur any existing experience effect on mate FPS. In other words, temporal and spatial constraints not only affect the distribution of mate FPS, but may also limit the detectability of other, functionally independent, biologically meaningful effects on this trait.These limiting factors include temporal changes in the ornamentation of available males Therefore, mate ornamentation seems to be a poor measure of mate preferences in our population, and this makes its heritability and patterns with experience difficult to interpret. In response to a similar critique To summarize, it seems that the limiting factor in the correlative approach introduced by Ref. All work was conducted with ringing license from the Hungarian Ornithological and Nature Conservation Society , long-term research agreements with the Pilis Park Forestry (December 1988 and March 2007) and research permits from Duna-Ipoly National Park and the regional nature conservation authority .The fieldwork was conducted in the Pilis Mountains, near Szentendre, Hungary, where a nestbox breeding population  of collared flycatchers has been intensively monitored since 1982. More details on the population and the study site have been presented elsewhere In our population, extrapair paternity does not seem to be consistently related to any male trait, including FPS The comprehensive 21-year phenotypic dataset from which we drew our data contained n\u200a=\u200a4233 male FPS records and n\u200a=\u200a3726 female mate FPS records. Repeated records of individuals within years and all broods where brood size had been manipulated or the nestlings had been cross-fostered without individual identification were deleted from the analyses. Of the remaining data, those that could be used for the pedigree analyses (recruits and their parents) consisted of n\u200a=\u200a2138 male FPS records and n\u200a=\u200a1971 female mate FPS records from n\u200a=\u200a1380 recruits and their parents .F statistics. Importantly, estimates of additive genetic variance and covariance in an animal model depend on the other random and fixed effects in the model Data were analyzed using ASReml2  to fit a series of animal models. An animal model is a linear mixed effect model that includes individual genetic merit as a random effect such that, in the presence of pedigree data, phenotypic variance can be partitioned into (additive) genetic and environmental components Firstly, we looked for effects of female breeding experience on breeding date (log-transformed first egg date relative to yearly median) and clutch size using general linear mixed models in PROC MIXED of SAS 9.1 (SAS Institute). The effect of breeding experience is confounded by age, so we tested experience effects in two ways: with binary age as a simultaneous predictor, and in the subset of after-second-year (i.e. old) females. The two approaches always gave the same results, so we report results of the former, which relies on all available data and is therefore more powerful. All models contained female identity, nestbox plot (i.e. breeding area) and year as random effects, and female age and experience as fixed factors. For clutch size, we also ran a model with breeding date as a covariate to see whether experience affects primary reproductive output when controlling for differences in breeding date.A), permanent environment (VPE), breeding area (VPLOT), year of breeding (VYEAR), and residual (VR) components. Plot and year effects were included to account for expected spatial and temporal heterogeneity in the environment. The permanent environment effect makes use of repeated measures available from individuals to account for fixed non-genetic differences between individuals that can otherwise bias the estimation of VA. Phenotypic variance VP was determined as the sum of the variance components and heritability estimated as the ratio of VA to VP. Note that this model is similar to that used by Ref. Secondly, we estimated variance components for female mate FPS and male FPS. For female mate FPS, the model included binary mate age  and binary breeding experience  as fixed factors. For male FPS, the only fixed factor was the binary age of the male. Male age as a fixed effect was included because FPS is weakly but significantly age-dependent G. The area- and year-generated covariances between the experience categories were modeled as well . As an explicit test for a genotype by-breeding experience interaction we compared the likelihood of this model to one in which rG was set to unity and VA was constrained to be constant across experience classes.Thirdly, to test the null hypothesis that the heritability of mate ornamentation does not change with female experience, we ran a bivariate animal model in which the mate FPS of inexperienced and experienced females were modeled as two separate traits. We used the above model structure except that the permanent environment component was fit only in the experienced group. This is because inexperienced birds were defined as those in their first breeding attempt and therefore there can be no repeated measures of this trait. Heritabilities for each trait were estimated as well as the genetic covariance between them which was rescaled to estimate the genetic correlation r"}
{"text": "Quantitative genetics, or the genetics of complex traits, is the study of those characters which are not affected by the action of just a few major genes. Its basis is in statistical models and methodology, albeit based on many strong assumptions. While these are formally unrealistic, methods work. Analyses using dense molecular markers are greatly increasing information about the architecture of these traits, but while some genes of large effect are found, even many dozens of genes do not explain all the variation. Hence, new methods of prediction of merit in breeding programmes are again based on essentially numerical methods, but incorporating genomic information. Long-term selection responses are revealed in laboratory selection experiments, and prospects for continued genetic improvement are high. There is extensive genetic variation in natural populations, but better estimates of covariances among multiple traits and their relation to fitness are needed. Methods based on summary statistics and predictions rather than at the individual gene level seem likely to prevail for some time yet. The framework can also be used for the analysis of traits such as litter size that take a few discrete values, and of binary characters such as survival to adulthood that have a polygenic basis. The quantitative genetics approach has diverse applications: it is fundamental to an understanding of variation and covariation among relatives in natural and managed populations, of the dynamics of evolutionary change, and of methods for animal and plant improvement and alleviation of complex disease.On the premise that many genes and the environment act and interact to determine the trait, founders recognized that it would be difficult if not impossible to determine the action of individual trait genes. Statistical methods were invented by A), which is the expected performance of offspring, and heritability . In view of the assumed complexity of the underlying gene action, involving many loci with unknown effects and interactions, much quantitative genetic analysis has, unashamedly, been at a level of the \u2018black box\u2019.The models and summary quantities defined by Fisher and Wright have remained at the heart of the subject not least because they provide ways to make predictions of quantities such as the response to artificial and natural selection. Useful parameters include, for example, breeding value , many identified to genes, segregating for human height (see later); but these QTL, likely to be individually among the most important, contribute only about 5 per cent of the genetic variation. In view of its complexity, it therefore seems likely that the black box will remain cloudy for a while, even though fed information on, inter alia, myriads of genetic markers, levels of gene expressions and trait phenotypes. Statistical methodology which works and is continually developed to incorporate extensive marker and other new data seems likely to remain important for some time yet: better to work with the whole beast rather than try to assemble its parts from inadequate instructions.Genetica 136, 211\u2013386), and in a Nature Insight series .I will address some of the background and some of these questions in this personal perspective, which is inevitably uneven in coverage and references, and reflects my interests, biases, knowledge and lacunae. It will focus particularly on animal improvement, an area which has both stimulated many developments in quantitative genetics, and is relevant to the welfare of man. Other recent perspectives and summaries from different viewpoints can be found in, for example, papers by 2.Let us review the standard assumptions in quantitative genetic analysis, address whether they stand up, and if not how much it matters.(a)VA, interactions of effects between alleles within loci  and among loci   of individuals, D defines dominance relationships and VE the environmental variance. For the epistatic terms, # denotes element-by-element multiplication, but applies only for unlinked loci. Many more terms may be included, such as maternal genetic effects, and genotype \u00d7 environment interaction. The model has unlimited opportunities for complexity. This is a strength, in that it is all-accommodating, and a weakness, in that datasets may be adequate to allow partitioning into only very few components.In the model proposed by  VAD, \u2026) . These p(b)The regression of offspring phenotype on that of parent for the same or different traits is usually assumed to be linear and, equivalently, so is the regression of response on selection differential. This important assumption holds under multivariate normality of phenotypic and genotypic values and thus the central limit theorem assuming multifactorial inheritance. Some traits, such as litter size or lifespan, are clearly not normally distributed, but adequate transformations can be invoked or departures ignored.(c)Response = h2 \u00d7 selection differential. Selection changes gene frequencies and hence the genetic variance, so predictions of response in subsequent generations formally require knowing individual gene effects and frequencies. Fisher's \u2018infinitesimal model\u2019, formalized by Response to the first generation of selection can be predicted from the breeder's equation 3.(a)X and Z are design matrices, \u03b2 is a vector of fixed effects (e.g. years), a is a vector of random effects  and e is a vector of random errors; and var(y) = ZAZ\u2019VA+IVE where A is the additive relationship matrix (equation (2.1)). The model is general and flexible: it can incorporate, albeit with increasing computing needs, other covariance terms such as common environment among full sibs, repeat observations, maternal genetic effects  and multiple traits.Estimates of genetic parameters such as heritability are needed as a basis for description and prediction. Traditional methods such as analysis of variance or regression cannot cope adequately with unbalanced data and the complex pedigrees found outside the laboratory. They have been superseded by more sophisticated methods, often in the context of livestock data , which hIn retrospect, a surprisingly recent development has been in the modelling and analysis of longitudinal traits such as body weight which changes over time. The variances and covariances can be described directly by continuous covariance functions  or, equiThe generality of the animal model and the fact that most field data  are highly unbalanced have created a need for sophisticated and general analytical methods. These use restricted maximum likelihood (REML) or Bayesian principles, facilitated by the availability of specialized computer packages . Indeed, as genotyping costs fall there are increasing opportunities to expand pedigrees. While relatively simple objectives are to estimate genetic variances and covariances, a broader aim is to use data on breeding success to obtain estimates of the genetic parameters of fitness per se . The animal model can cope with selection and assortative mating, but only if the data on which decisions are based is included . Animal breeders encounter many such problems, but they are typically more serious for data from natural populations where datasets may be small, poorly structured and include multiple traits. Some traits associated with fitness, i.e. the selection \u2018criterion\u2019, may not be recorded, and some individuals may die or leave the population before recording. (b)within families from the regression of phenotypic similarity of sibs for a trait on the actual proportion of genome shared as determined by SNP identity, and is free of confounding by environmental differences between families or maternal genetic effects  chips provides a different method to estimate genetic variances. Pairs of full sibs share 50 per cent of alleles on average, but because linked genomic regions are transmitted, the actual proportion shared varies about expectation, with a s.d. of approximately 4 per cent for humans ((c)Prediction of breeding values is a fundamental component of modern breeding programmes, as those with the highest values should be selected. The major unifying development, Best Linear Unbiased Prediction (BLUP), is due to Henderson , 1984 anall information on all traits on which selection is practised is included in the data. Further, if any selection is practised, the infinitesimal model assumption is implicit (but often forgotten) in the use of the relationship matrix A to quantify variances and covariances across generations.BLUP is best in the sense of minimum variance among linear predictors, but only if population parameters are well estimated. It is unbiased in that, as more data are accumulated, the predicted breeding values approach the true values; and while it allows for selection, requires the important but often unachievable proviso that 4.Many major assumptions are made in the applications of quantitative genetics, but the issue is not the formal correctness of models used, rather the extent to which they work reasonably well. There is not space for a full review, but more discussion and examples are given elsewhere e.g. . We firsA and A#A matrices in equation (2.1)). These in turn may be confounded with other parameters, such as genetic maternal effects to explain why, say, a daughter-dam correlation exceeds twice that of half sibs in the absence of epistasis. Linkage disequilibrium (LD) is patently present, but that owing to close linkage is assumed absent in the infinitesimal model. The orthogonality assumptions in equation (2.1) may not hold, but how should that be tested? Hence, much of the evidence based on quantitative information is unsatisfactory in being so inconclusive, for example in failing to reject even the infinitesimal model as the following examples show.A major problem is to obtain data of adequate structure and quantity. For example, in the infinitesimal model all genetic variation is assumed to be additive. In random mating populations it is, however, usually impossible to estimate epistatic variances with any precision because the coefficients are very small and highly correlated with those of non-epistatic components . Indeed, this has been the big quantitative genetics industry of the last two decades. The basic methods are to use associations generated by linkage or LD between marker genes and the trait to locate QTL or to identify and locate mutations having a phenotypic effect and a molecular signal, such as transposable elements. Linkage studies  have beeThere is an extensive literature on the basic methodology of QTL mapping e.g.  and, for(a)Rather than attempt to review or even summarize the field, I shall just give some examples of the results from the use of different techniques, roughly in descending order of precision, that both provide information and generate questions.Drosophila melanogaster, a method permitting precise location, Drosophila have an excuse) and 34 per cent affected locomotor behaviour to a stimulus; and she noted that similar screens have found 22 per cent of insertions affecting abdominal and 23 per cent affecting sternopleural bristle number. Some have large effects, however. In view of the fact that such a high proportion of sites are targets, it is not surprising that there is extensive pleiotropy. Mackay also notes that many show epistatic effects. Similarly, for a range of behavioural traits in mice, in a study of over 200 gene knockout lines, 19 per cent showed abnormal open-field activity , and likely others were discovered by companies but not entered. These were from 83 publications and represented 109 different traits (but many have pleiotropic effect), representing a major effort and expenditure. The number of animals involved in each analysis are far smaller than in the association studies in humans, although data are used from segregation within individual sires who have progeny-tested sons with accurate estimates of breeding value. As only few of the QTL have been finely mapped, there is uncertainty about which of those mapped in different studies to similar genomic regions are the same or different genetic lesions, and how many are false-positives. In a few cases in livestock the actual genes, all having large effect, have been identified and sequenced. Some were already known as major genes, such as double muscling in cattle, for which the myostatin gene has been identified as causative, and others were initially discovered in mapping studies, for example DGAT, which influences milk composition of dairy cattle \u221d[p(1 \u2212 p)]\u22121, under rare mutation drift balance (r2) with a rare QTL. The hypothesis that most of the missing variation is associated with extreme frequencies is not, however, supported by the schizophrenia study  tend to be highest for conformation traits and mature size, typically 50 per cent or more, and lowest for fitness-associated traits such as fertility (e.g. A = h \u00d7 CV), is typically higher for fitness-associated than conformation traits Vm/VE, show a surprisingly narrow range over many traits and species, centred about 0.1 per cent . If few loci are assumed to affect the trait and typical estimates of the strength of selection are assumed, the predicted variance is much lower than that observed . But eveVG on population size, nor explain the constancy of trait means. Various aspects of the fit to the data are enhanced both by assuming that the mutants are (nearly) additive for the trait but  recessive for fitness, and worsened by assuming that there are substantial pleiotropic effects on other traits and overall fitness  heterozygote superiority, but none are clear winners. h2 are determined has been less studied and is even less well-understood than that of VG. Evolution of VE requires genetic variation of phenotype given genotype, for which there is strong evidence in Drosophila There has been extensive theoretical analysis and simulation to develop methods for using individual QTL in plant and livestock breeding programmes by marker-assisted introgression of a QTL from another population or by marker-assisted selection to increase frequency of a segregating gene in the population e.g. . ClearlyMuch effort has been expended on QTL detection and on theoretical analysis of how best to incorporate them in improvement programmes. We have much less information on actual effectiveness because much is within commercial companies and conventional selection on continuous traits has continued alongside. In two recent reviews on applications in plant breeding, (b)The availability of marker panels of thousands of SNPs does, in contrast, appear to be bringing in a real paradigm shift following the pioneering study of A (equation (2.1)) by the realized relationship matrix as assessed using high-density markers We see the striking changes that have been produced in quantitative traits by selection, for example among breeds of dogs in body weight and behaviour, and in the productivity of modern livestock and crops. Can we expect continued change?The Illinois maize selection for high and low content of oil in the kernel has been continued since 1896. The low lines have reached a plateau , but the upward lines have continued responding for 100 generations (i.e. years, et al. Results for a limited number of generations are shown for cattle in Ne times the response in each early generation (It is not surprising that such continued responses are found, as in many other experiments . If manyneration . The newneration , althougneration . Taken tNe and likely long-term progress (Modern breeding programmes inevitably involve a concentration of improvement in populations of limited size so that effective multi-trait recording can be undertaken and intense selection practised. There is a multiplication pyramid from nucleus populations in poultry and pigs, and in dairy cattle a concentration through use of sires through artificial insemination worldwide. Breeding programmes can be designed to optimize the trade-off between high selection intensity with the use of relatives' information to increase short-term gain and the decrease in 9 chickens are raised so, with a mutation rate of 1.8 \u00d7 10\u22129, there are over 50 mutants at each DNA site. The problem is not that there is no new variation, but to identify the useful new variants. Although it would be impossible to identify a mutant for a quantitative trait such as body weight in birds down the multiplication pyramid, it might be possible for a disease-resistant mutant.For cattle there is evidence that population sizes were large following domestication, of the order of tens of thousands or more, but those in some modern breeds are of the order of 100. Even so the levels of molecular genetic diversity within breeds are at least as great as in human populations (We can be optimistic about the prospects for future improvement, not least because the input of molecular and high-throughput technologies to livestock improvement has so far been tiny. Clearly, there are limits imposed by the laws of thermodynamics, but by simply increasing the rate of live-weight gain of a bird, the efficiency of feed use is increased and also, a new consideration, greenhouse gas emissions per unit product is reduced. There are undoubtedly challenges, for example in the availability of water and climate change influences more generally, but new opportunities will come from new technology. Some, for example genomic selection, are really just extensions of classical quantitative genetic methods of increasing accuracy of selection. Others, for example changing or inserting new genes, provide radical ways of introducing new variation, but only if the public accepts them. Although conserved animal germ plasm far behind the commercial norm may harbour useful variants, I expect their contribution to genetic improvement to be small.Drosophila, the effectiveness is illustrated by the results of many selection experiments (e.g. Similarly, the large amounts of genetic variation found in natural populations show that traits can be changed rapidly and substantially as a consequence of natural selection. With fitness defined as some simple measure, like bristle number in nts e.g. . There aif these coincide with fitness \u2018objectives\u2019, implies adaptive evolution is not possible. Although these analyses indicate there are, indeed, trajectories that cannot be followed, sampling errors alone can lead to such inferences. To understand and predict changes or lack thereof, we greatly need more reliable information on the genetic covariances among multiple traits and on fitness profiles on many environments, but this is a massive task. In the presence of a major change of environment where fitness profiles change, the risk to a species seems more likely to come from other species-filling niches or evolving more rapidly rather than from its total inability to adapt.The ability to evolve depends on the additive genetic covariance structure of all the relevant traits, and whether the relevant combination actually expresses genetic variation. Recent analyses on genetic covariance matrices typically find that many of their eigenvalues are zero, such that the corresponding eigenvectors indicate directions of no variance e.g. , ch. 30,9.Our level of understanding of many features of quantitative traits is quite rudimentary: what the genes do and how they interact, how their effects are distributed, the extent and magnitude of pleiotropic effects, the relations to overall fitness, and how and why is so much variation maintained? At this stage, however, we find that the many classical genes of small effect model explains many of the phenomena we observe and provides a basis for predictions of change. We can and are using the new information we get, however. But we should bear in mind that, as Darwin perceived, evolution succeeds through simple selection."}
{"text": "Drosophila melanogaster. Further, we also have identified mutations in genes involved in metabolic and neurogenic pathways that affect development time (heterochronic genes). However, we do not know whether these loci affect variation in developmental time in natural populations.Previously, we have shown there is clinal variation for egg-to-adult developmental time along geographic gradients in Drosophila melanogaster from an altitudinal cline, and measured egg-adult development time for each line. We found not only a large amount of genetic variation for developmental time, but also positive associations of the development time with thermal amplitude and altitude. We performed genetic complementation tests using substitution lines with the longest and shortest developmental times and heterochronic mutations. We identified segregating variation for neurogenic and metabolic genes that largely affected the duration of the larval stages but had no impact on the timing of metamorphosis.Here, we constructed second chromosome substitution lines from natural populations of invected, mastermind, cricklet and CG14591 may affect natural variation in development time and thermal evolution.Altitudinal clinal variation in developmental time for natural chromosome substitution lines provides a unique opportunity to dissect the response of heterochronic genes to environmental gradients. Ontogenetic stage-specific variation in  Understanding the ontogenetic trajectories of life-history traits is necessary to explain and predict constraints and variation in the evolution of characters. In this context, any variation in the state of individuals prior to reproduction will be preserved to some degree at the reproductive stage. In this sense, the time elapsed from the embryo to the reproductive phase, commonly known as developmental time (DT), is directly related to an individual's reproductive success D. melanogaster.In holometabolous insects like fruit flies, which occupy ephemeral habitats, the impact of DT on fitness is further exaggerated Drosophila melanogaster populations of Australia et al.Changes in the timing of developmental processes \u2013 heterochrony \u2013 could account for many evolutionary changes among populations and species. However, the first criterion for heterochonic evolution is the existence of natural variation for developmental time. Several studies have shown latitudinal clinal variation for DT in Hippo, Notch and insulin signaling pathwayIn(2L)t and In(2R)R, two cosmopolitan polymorphic inversions of the second chromosome, affect DT invected and mastermind are involved in the development of the nervous system cricklet is a gene encoding a carboxylesterase involved in the metabolism of the juvenile hormone CG14591 has no clear association with any biological process.DT is a quantitative trait determined by multiple segregating genes that are sensitive to temperature variation Drosophila brings an impressive toolkit for dissecting multiple interacting loci with individually small effects that affect quantitative developmental traits Genetic complementation testing is a potent tool to investigate the contribution of individual genes to natural variation in quantitative complex traits Drosophila melanogaster of western Argentina. We show that variation in DT among populations is not only correlated with altitude but also with certain features of the thermal regime. Clinal variation in DT over short geographic distances and its association with climatic variables suggests that among-population differentiation is the consequence of different selective pressures along the altitudinal gradient. Also we show that allelic variants at candidate heterochronic genes invected, mastermind, criclket and CG14591 contribute to altitudinal variation in DT with stage-specific effects.We report the results of a survey of variation in DT using second chromosome substitution lines derived from sampling localities that lay along latitudinal and altitudinal gradients from several populations of Drosophila melanogaster females collected in six localities along latitudinal and altitudinal gradients in Western Argentina (February 2004 and February 2005). The geographical location, latitude, longitude, altitude and climatic information for each population are given in Canton-S B strain by standard techniques using balancer chromosomes ]. A single w; Cy/+ 2; Sb/+ 3 male from the progeny of each cross was crossed to w; Cy/Sp; Canton-S B females. Next, w; Cy/+ 2; Sb/Canton-S B males were crossed to w; Cy/Sp; Canton-S B females (G3). Females and males of genotype w; Cy/+ 2; Sb/Canton-S B were intercrossed at G4, and the Cy and the Sb balancers were eliminated in the next generation (G5), obtaining an isogenic second chromosome substitution line with genotype w; +2; Canton S B. By means of this protocol we generated 50 second chromosome substitution lines isogenic for one wild derived chromosome in an otherwise isogenic background common to all lines. An average of 9 lines per population was obtained.Isofemale lines were founded by rearing the progeny of gravid omosomes . To consFor each substitution line, 300 pairs of sexually mature flies were placed in egg collecting chambers for 8 hours. Eggs were allowed to hatch and batches of 30 first-instar larvae were transferred to culture vials containing 10 ml of cornmeal-agar-molasses medium . Emerged flies from each vial were collected every 12 hours and sorted by sex. We estimated DT as the time elapsed since the transfer of first-instar larvae to the vials until adult emergence. All vials were kept in an incubator at 25\u00b11\u00b0C, under a 12-h light\u2236 12-h dark cycle and at 70% humidity.Forward stepwise multiple regression analyses were performed using geographic and climatic variables separately to test for clinal variation in developmental time. The geographic variables considered were altitude and latitude; and the climatic variables were minimal mean temperature, maximal mean temperature, mean temperature and thermal amplitude.invected, cricklet, CG14591 and mastermind to natural variation in DT among the most divergent second chromosome substitution lines. Thus, from our set of isogenic lines we selected those exhibiting the most extreme phenotypes for DT (the fast and slow developing lines). These lines were crossed individually with lines carrying P [GT1] element mutated alleles in one of the four candidate genes identified by Mensch et al. (2008) P [GT1] element-free insertion line with the same genetic background (Canton-S B). The genotypes of the F1 progeny of the crosses were m/+i and Canton-S B/+i, respectively, where m is a mutant allele in one of the candidate genes derived from a P [GT1] element insertion line and +i represents a wild derived allele of the candidate gene. We used P [GT1] insertion lines BG00846, BG01339, BG01672 and BG01902 that carry mutant alleles for invected, cricklet, CG14591 and mastermind, respectively Quantitative complementation tests were performed to examine the contribution of We evaluated variation in developmental time among genotypes by means of a four-way analysis of variance (ANOVA) according to the mixed model:Y\u200a=\u200a\u03bc + L + S + G+ R (L \u00d7S\u00d7 G) + L \u00d7 G + L \u00d7 S + G \u00d7 S + L \u00d7 G \u00d7 S + E,Canton-S B or m) and sex, respectively. R stands for the among replicate effect (random), and E is the error . The first criterion that must be met for quantitative failure of complementation is a significant Line by Genotype interaction. However, quantitative failure of complementation can be explained either as due to allelism or epistatic interactions Canton-S B background is not greater than variance among lines in the mutant background where L, G and S are the fixed cross-classified effects of line (second chromosome substitution line), genotype  and pupal developmental time (PDT), involving the duration of all events that occurred before and after pupation, respectively. All statistical tests were performed using the STATISTICA package .D. melanogaster second chromosome harbors genetic variation in natural populations for this fitness related trait  and Lavalle fast , whereas the lines that took more time to reach the adult stage were San Blas slow  and Uspallata slow .A large amount of variation in DT was found among natural substitution lines, indicating that ed trait . Among tF1,185\u200a=\u200a6.59; p\u200a=\u200a0.01) and females . Indeed, DT substitution lines derived from highland and lowland sampling sites differed, on average, by 12 hours in both sexes.Regression of DT on geographic variables revealed a significant and positive association between developmental time and altitude   and noneIn order to quantify within population genetic variation, we performed an ANOVA for each sampling locality . In all mastermind, invected, cricklet and CG14591, that mapped in the second chromosome. Thus, natural genotypes that differed in DT by more than five days were used in four independent QCTs. Our results showed a significant line by genotype interaction in each QCT suggesting a failure of complementation in all four candidate genes  with a DT ratio close to zero, suggesting that this chromosome did not contribute to natural genetic variation for this gene. All in all, our results not only confirm that mastermind, invected, cricklet and CG14591 are quantitative candidate genes for developmental time expression, but also that these genes exhibit natural allelic variants that contribute to natural variation in DT.Genetic variation in candidate genes was revealed by the different responses of natural chromosomes when combined with mutant alleles or the functional each QCT . Most raCanton-S B backgrounds  and pupal (PDT) stages. For all candidate genes, we found that the L \u00d7 G interaction was significant for LDT but not for PDT  et al.(1999) drosophilids as well Also interesting is that the line by sex interaction did not contribute to variation in DT in any of the localities, suggesting the lack of genetic variation for sexual dimorphism of DT. Interestingly, Mensch et al. (2008) Regression analyses of DT on geographic and climatic variables indicated that altitudinal clines and the association with thermal amplitude reported in Folguera P element insertion lines that we used to characterize heterochronic candidate genes invected, mastermind, cricklet and CG14591 have natural allelic variants that affect DT. To our knowledge this the first time that natural allelic variation is described for these genes as well as the  characterization of the genetic basis of DT variation in natural populations. Moreover, the similar variances of natural allelic variants when combined with mutant and Canton S B alleles, in all QCTs, suggest an additive effect of allelic variants of mastermind, cricklet, CG14591 and invected on DT. However, non additive effects due to interactions with other second chromosome loci affecting DT cannot be ruled out. Notice, for instance, that the genotype Lavalle/mutant, exhibited faster larval developmental time than the Uspallata/mutant genotype, when the mutant allele is contributed by the P-element insertion line for invected  has been the difficulty in mapping individual genes affecting natural genetic variation because differences in genetic background can profoundly affect complex phenotypes invected . On the  CG14591 . These rinvected and mastermind are expressed early in development and also during the larval and pupal stages engrailed, is a transcription factor that is expressed in neuroectodermic cells mastermind is a key component of the Notch signaling pathway, which determines cell fate and regulates pattern formation. Likewise, cricklet  encodes a carboxylesterase that has been proposed to be associated with Juvenile hormone (JH) functions CG14591. Our study provides, therefore, the first record concerning functional significance of CG14591 in D. melanogaster.Noteworthy, two of the genes, invected alleles that not only affected larval developmental time but also influenced various adult body size traits As a complex trait, DT displays considerable genetic correlations with other life history and morphological characters. Particularly, it has been suggested that DT may be involved in a trade-off with body size, since attaining a large size may imply a longer feeding period, and thus a longer DT. Thus, variation in growth patterns, growth rate and the duration of the growth period, affect the age and size at maturity, implying that the study of juvenile growth may be crucial to understand life history evolution Drosophilaet al., unpublished results). Noteworthy, mastermind, cricklet and CG14591 were also shown to be candidates for the plastic responses of DT to temperature variation D. melanogaster and allied species The recognition that a single trait, DT, may be subdivided in \u201csubtraits\u201d that are not under the control of the same genes imply that the duration of larval and pupal stages responded to different selective pressures; a matter that may have broad implications in evolutionary genetics, since responses to selection may crucially depend on the genetic variance/covariance of individual \u201csub-traits\u201d"}
{"text": "Genetics contributes importantly to learning abilities and disabilities\u2014not just to reading, the target of most genetic research, but also to mathematics and other academic areas as well. One of the most important recent findings from quantitative genetic research such as twin studies is that the same set of genes is largely responsible for genetic influence across these domains. We call these \u201cgeneralist genes\u201d to highlight their pervasive influence. In other words, most genes found to be associated with a particular learning ability or disability (such as reading) will also be associated with other learning abilities and disabilities (such as mathematics). Moreover, some generalist genes for learning abilities and disabilities are even more general in their effect, encompassing other cognitive abilities such as memory and spatial ability. When these generalist genes are identified, they will greatly accelerate research on general mechanisms at all levels of analysis from genes to brain to behavior. Genetic research has moved beyond merely demonstrating the importance of genetic influence. Most notably, intense research efforts are focused on attempts to identify the DNA responsible for this genetic influence, especially for reading disability, and we mention this work briefly. Nonetheless, quantitative genetic research such as twin studies that compare identical and fraternal twins continues to be important in charting the course for molecular genetic explorations. The most important example is multivariate genetic analysis, which makes it possible to investigate genetic links between variables rather than focusing on one variable at a time. The major goal of this article is to provide an overview of multivariate genetic research on learning abilities and disabilities, which consistently points to \u201cgeneralist genes\u201d that have pervasive effects. We also consider the implications of generalist genes for education and for cognitive neuroscience. In order to focus on this topic of generalist genes, we need to forgo presenting other topics important to the field of mind, brain, and education, such as the developmental interface between genes and environment . HoweverMore than 90% of teachers and parents say that they believe genetics to be at least as important as the environment for learning abilities and disabilities . In the Two decades of research make it clear that genetics is a surprisingly large part of the answer to why children differ in their ability to learn in school. Most research uses the twin method that compares resemblance for genetically identical twins  and for twins who are only 50% similar genetically . Genetic influence is suggested to the extent that MZ twins are more similar than DZ twins, reflecting the twofold greater genetic similarity of MZ as compared with DZ twins. For example, a review of twin studies of language disability reported concordance (the likelihood that one twin will be affected if the other twin is affected) of 75% for MZ twins and 43% for DZ twins . For reaMoreover, genetics is not only involved in disability. Twin studies also consistently point to substantial genetic influence for learning abilities throughout the normal distribution of individual differences. A review of twin studies that reported results for both learning disabilities and abilities found that the average weighted heritability (proportion of phenotypic variance that is attributed to genetic variance) was 0.43 for language disabilities and 0.25 for language abilities; 0.52 and 0.63 for reading disabilities and abilities, respectively; and 0.61 and 0.63 for mathematics disabilities and abilities, respectively .The case for substantial genetic influence on learning disabilities is so clear that most genetic research, especially in the area of reading disabilities, now focuses on using molecular genetics to identify the specific genes responsible for this genetic influence. Although progress has been slow, recent developments in molecular genetics are promising ;. For reUnivariate genetic analysis uses methods such as the twin method to estimate genetic and environmental contributions to individual differences (variance) on a single variable (univariate). If MZ twins are more similar than DZ twins for a trait, this suggests that genetic differences account for some of the observed (phenotypic) differences on the trait. Heritability estimates the extent to which genetic variance accounts for phenotypic variance. In contrast, multivariate genetic analysis focuses on the covariance (correlation) between two traits (bivariate) or multiple traits (multivariate) and uses the twin method to estimate genetic and environmental contributions to their covariance as well as the variance of each trait. In other words, multivariate genetic analysis estimates the extent to which genetic and environmental factors that affect one trait also affect another trait.The gist of multivariate genetic analysis lies in cross-trait twin correlations. Just as univariate genetic analysis compares MZ and DZ correlations for a single trait, multivariate genetic analysis compares MZ and DZ correlations across traits, called cross-trait twin correlations. To the extent that MZ cross-trait correlations are greater than DZ cross-trait correlations, this suggests that genetic differences mediate the phenotypic correlation between the traits.In practice, multivariate genetic analysis is conducted using structural equation model-fitting techniques based on the model shown in rA), which represents the extent to which genetic effects on trait X correlate with genetic effects on trait Y independent of the heritability of the two traits. A genetic correlation of 0.0 indicates that completely different genes affect the traits and a genetic correlation of 1.0 signifies that the same genes affect both traits. In other words, the genetic correlation is the probability that a gene found to be associated with one trait will also be associated with the other trait. An important feature of the genetic correlation is that it is independent of the heritability of the traits. That is, the genetic correlation can be high even if the heritabilities of the two traits are low and vice versa. In the interest of streamlining this article, we will not discuss a second multivariate genetic concept, the genetic contribution to the phenotypic correlation, which is represented in the model as the product of the genetic paths connecting trait X and trait Y . We will also not discuss the C and E correlations even though they also tell an interesting story  are substantial but somewhat lower than the genetic correlations among learning abilities  and NC ratings for English, mathematics, and science, we conducted separate Cholesky analyses at 7, 9, and 10 years. The genetic results are presented in 1 latent variable extracts genetic variance that is in common between g and academic performance in English and mathematics. The heritability of g at 7 years is shown as 0.37. The A1 loadings of 0.23 for English and 0.19 for mathematics indicate that a significant and substantial amount of the genetic variance on English and mathematics is shared in common with g. However, English and mathematics are more highly heritable than g: The heritability estimates from g (0.23/0.65 = 0.35). Similarly, only a third of the genetic variance on mathematics is shared in common with g (0.19/.065 = 0.29).Using TEDS data on g. This analysis is captured by the A2 latent variable. The significant and substantial loadings of English and mathematics on the A2 latent variable indicate that English and mathematics share genetic variance independent of g. For mathematics, about a third of its genetic variance is shared with English independent of g (0.21/0.65 = 0.32). The A3 latent variable indexes genetic variance that is unique to mathematics, that is, not shared with either g or English. Focusing on mathematics, the results suggest that about a third of its genetic variance is in common with both g and English, about a third is in common with English independent of g, and the remaining third is unique to mathematics. A similar conclusion would be reached for English if it were the last variable in the Cholesky analysis.An important feature of the Cholesky model is that it estimates genetic variance shared by English and mathematics that is independent of g, English, and mathematics (0.15/0.61 = 0.25); 34% is independent of g but in common with English and mathematics (0.21/0.61 = 0.34); 11% is independent of g and English but in common with mathematics; and 30% is unique to science.Similar results were obtained at 9 and 10 years, as shown in the second and third panels of g, English, and mathematics; 17% is independent of g but in common with English and mathematics; 6% is independent of g and English but in common with mathematics; and 29% is unique to science. This suggests that science at 10 years may have more to do with g genetically. However, the results for English and mathematics are similar at 10 years in suggesting that only about a third of their genetic variance is shared in common with g.At 10 years  genes found to be associated with a particular learning ability or disability (such as reading) will also be associated with other learning abilities and disabilities (such as mathematics). In addition, most  of these generalist genes for learning abilities (such as reading and mathematics) will also be associated with other cognitive abilities .Although finding generalist genes associated with learning disabilities is unlikely to have much direct impact on teachers in the classroom confronted with a particular child with a learning disability, such findings will have far-reaching ramifications in terms of educational research and, more practically, in terms of diagnosis, treatment, and prevention. At the most general level, identifying generalist and specialist genes will increase acceptance of genetic influence in education because DNA provides evidence for genetic influence that is much more direct than the evidence provided by quantitative genetic research such as twin studies.In terms of research, few educational researchers are likely to become involved in the quest to find genes associated with learning abilities and disabilities, but when the genes are found, they will be widely used in research as DNA risk indicators in much the same way that demographic risk indicators are currently used . MoreoveThe most immediate implication for education is the realization that genetic diagnoses of learning disabilities differ from traditional diagnoses, which are based on symptoms rather than causes. From a genetic perspective, learning disabilities are not distinct diagnostic entities: the same set of generalist genes affects learning abilities and disabilities. Finding generalist genes associated with learning disabilities will lead to new diagnostic classifications that are based on etiology rather than symptomatology.In terms of treatment, genes will be used clinically or educationally to the extent that response to treatment depends on genetic risk. This goal is part of a \u201cpersonalized medicine\u201d movement toward individually tailored treatments rather than treatments that are \u201cone size fits all\u201d .The most important benefit of identifying genes that put children at risk for developing learning disabilities is that the causal nature of genes means that they can serve as an early-warning system. This should facilitate research on interventions that prevent learning disabilities, rather than waiting until problems are so severe that they can no longer be ignored. The goal of early intervention fits with a general trend toward preventative medicine. Because vulnerability to learning disabilities involves many genes of small effect, genetic engineering is unimaginable for learning disabilities; interventions will rely on environmental engineering, primarily educational interventions.Acceptance of generalist genes will change the way we think about the brain and mind. In this final section, we discuss two genetic concepts\u2014pleiotropy and polygenicity\u2014that provide a foundation for understanding the effects of generalist genes on the brain and mind.Pleiotropy means that a gene has multiple effects. In terms of individual differences\u2014which is the focus of genetic studies on learning abilities and disabilities\u2014polymorphisms in these genes will also have pleiotropic effects. Pleiotropy is common in complex organisms and can be expressed at various biological levels, from a gene that mediates several intracellular signal transduction pathways to a gene that is expressed in different tissues . As one A powerful new tool for seeing pleiotropy in the brain is gene expression mapping. Gene expression can be indexed by the presence of RNA that is transcribed from DNA. A critical development in gene-expression mapping throughout the brain is the microarray that can detect the expression of all the genes in the genome simultaneously , which iO-methyltransferase (COMT) and brain-derived neurotrophic factor (BDNF)   . COMT islas.org) .www.genes2cognition.org). The generalist genes hypothesis predicts that functional genetic neuroimaging will also show general effects of allelic variation across brain regions and across tasks.Similar to early neuroimaging research, genetic neuroimaging work has focused on structural localization at the normative level of analysis, for example, in the transcriptome-mapping project in humans . StructuThe effects of pleiotropy (each gene affects multiple traits) are amplified by polygenicity (each trait is affected by multiple genes). Again, much of the discussion of pleiotropy is at a normal level rather than the individual-differences level, which is the critical level of analysis for learning abilities and disabilities. For common disorders and complex traits, genetic research on individual differences has undergone a revolution that has radically altered molecular genetic strategies. Instead of thinking about rare genetic disorders caused by a single-gene mutation of the sort that Mendel investigated in the pea plant, it is now generally accepted that common disorders are caused by many genes (polygenicity), which implies that each of these genes will have only a small effect. Single-gene disorders are usually extremely rare, with a frequency of one in tens of thousands, whereas the frequency of learning disabilities such as reading and mathematics disability is often considered to be as great as 5%. It is likely that a few cases of learning disability are due to single-gene disorders that contribute little to normal variation in learning ability. However, most researchers now believe that common disorders are caused by common genetic variants\u2014the common disorder/common variant hypothesis \u2014rather tPolygenicity is thought to be the reason why progress has been so slow in identifying genes associated with common disabilities and complex traits\u2014very large samples are needed to attain the statistical power needed to detect very small effect sizes . In the In our opinion, pleiotropy and polygenicity make it likely that generalist genes result in \u201cgeneralist brains\u201d at the individual differences level of analysis. That is, polymorphisms in genetic input into brain structure and function have general effects, not modular effects . In othePleiotropy and polygenicity will make it difficult to investigate links between genes, brain, and behavior. Despite these challenges and complexities, when generalist genes are identified, they will provide three opportunities for empirical research on brain pathways between genes and learning abilities and disabilities. First, these genes will be identified on the basis of their prediction of learning disability. In other words, no matter how complex the brain pathways are between genes and learning abilities and disabilities, these genes will be anchored to a functional effect at the level of individual differences in learning abilities and disabilities. Second, each of these generalist genes will provide a window through which we can view brain mechanisms that are functionally related to learning disabilities . Third,"}
{"text": "Understanding the genetic architecture of ecologically relevant adaptive traits requires the contribution of developmental and evolutionary biology. The time to reach the age of reproduction is a complex life history trait commonly known as developmental time. In particular, in holometabolous insects that occupy ephemeral habitats, like fruit flies, the impact of developmental time on fitness is further exaggerated. The present work is one of the first systematic studies of the genetic basis of developmental time, in which we also evaluate the impact of environmental variation on the expression of the trait.P[GT1]-element insertion lines of Drosophila melanogaster to identify novel genes affecting developmental time in flies reared at 25\u00b0C. Sixty percent of the lines showed a heterochronic phenotype, suggesting that a large number of genes affect this trait. Mutant lines for the genes Merlin and Karl showed the most extreme phenotypes exhibiting a developmental time reduction and increase, respectively, of over 2 days and 4 days relative to the control (a co-isogenic P-element insertion free line). In addition, a subset of 42 lines selected at random from the initial set of 179 lines was screened at 17\u00b0C. Interestingly, the gene-by-environment interaction accounted for 52% of total phenotypic variance. Plastic reaction norms were found for a large number of developmental time candidate genes.We analyzed 179 co-isogenic single Drosophila. At the same time, we also show that many heterochronic phenotypes may arise from changes in genes involved in several developmental mechanisms that do not explicitly control the timing of specific events. We also demonstrate that many developmental time genes have pleiotropic effects on several adult traits and that the action of most of them is sensitive to temperature during development. Taken together, our results stress the need to take into account the effect of environmental variation and the dynamics of gene interactions on the genetic architecture of this complex life-history trait.We identified components of several integrated time-dependent pathways affecting egg-to-adult developmental time in  Drosophila species occupy ephemeral habitats, such as rotting fruits that may result in selection for rapid development. Quoting Gould's Ontogeny and Phylogeny: \"The timing of maturation is a primary variable in setting life history strategies. We have a prima facie case for ascribing direct significance to the change in developmental timing itself, not only to its morphological consequences\" insertion lines can not be explain as a consequence of unfit flies. The most extreme phenotypes were exhibited by lines BG01543 and BG01412. The former developed 60 and 50 hours  faster and the latter 119 and 146 hours  slower than the control. We observed a significant line effect indicating mutational variance among single P-element insertion lines  differed significantly from the control. Mean values of all significant P[GT1] insertion lines tested at 25\u00b0C are shown in Additional file P-element caused an increase in DT, while in the rest of the significant lines DT was shortened as compared to the control (20%) , a gene encoding a glutamine-rich nuclear protein  insertion in exon 1 caused a reduction in the RNA expression levels in embryos, third instar larvae and adults but not in the pupal stage compared to the control  insertions. We also estimated the relative contribution of all random sources of variation  to the total variance.Analysis of variance (ANOVA) was utilized to assess the magnitude of mutational variance for DT at each temperature. In order to include all lines tested in different batches, individual DT scores were expressed as deviations from the mean of their contemporaneous co-isogenic controls, separately for males and females. Three-way ANOVA was computed for each thermal treatment, following the mixed model: Y = \u03bc + L + S + L \u00d7 S + E, where \u03bc is the overall mean, L is the random effect of line, S is the fixed effect of sex and E represents the error term. An ANOVA was used to assess the magnitude of mutational variance for DT induced by P-element insertion lines and the control were tested using Dunnett contrasts for each temperature and batch. Those lines that exhibited significant DT differences relative to the control (heterochronic mutants) were considered as lines bearing an insertion in a candidate DT gene.To identify which lines were responsible of the significant line or line-by-sex interaction, phenotypic differences between rG \u00d7 E < 1, see below) (changes in rank order), the contribution of these two sources of variation was analyzed by means of the equation derived by Robertson [VG \u00d7 E = [(\u03c3E1 - \u03c3E2)2 + 2\u03c3E1\u03c3E2(1 - rG \u00d7 E)]/2, where VG \u00d7 E is the G \u00d7 E variance component, rG \u00d7 E is the cross-environment genetic correlation and, \u03c3E1 and \u03c3E2 are the square roots of the among-line variance components of the two thermal environments studied  insertion lines analyzed. VT is presented in angular transformation  and DT expressed in hours. Solid line represents the correlation plot and dashed lines the 95% confidence intervals (r = 0.305).Correlation between viability (VT) and developmental time (DT) for all Click here for fileP[GT1] insertion lines on DT (25\u00b0C). Values are shown as the deviation of the insertion line mean from contemporaneous control for each sex separately.Mean values of significant Click here for fileP[GT1] insertion sites, cytologial positions, biological process gene-ontologies and pleiotropy.Genetic information of candidate DT genes including gene names, Click here for file"}
{"text": "Utilising data derived from twins and their families, different approaches can be applied to study genetic and environmental influences on human dental variation. The different methods have advantages and limitations and special features of the twinning process are important to consider. Model-fitting approaches have shown that different combinations of additive genetic variance (A), non-additive genetic variance (D), common environmental variance (C), and unique environmental variance (E) contribute to phenotypic variation within the dentition, reflecting different ontogenetic and phylogenetic influences. Epigenetic factors are also proposed as important in explaining differences in the dentitions of monozygotic co-twins. Heritability estimates are high for most tooth size variables, for Carabelli trait and for dental arch dimensions, moderate for intercuspal distances, and low for some occlusal traits. In addition to estimating the contributions of unmeasured genetic and environmental influences to phenotypic variation, structural equation models can also be used to test the effects of measured genetic and environmental factors. Whole-genome linkage analysis, association analysis of putative candidate genes, and whole genome association approaches, now offer exciting opportunities to locate key genes involved in human dental development. Therefore, by assuming that both types of twins have been sampled from the same gene pool and that similar environmental factors act upon them, one can estimate the relative contributions of genetic and environmental influences to observed variation in different features or traits. The calculation of heritability estimates provides a means of quantifying the extent of the genetic contribution to phenotypic variation, with proportions ranging theoretically from 0 to 1. Various formulae can be utilised to calculate estimates of heritability for both quantitative and categorical data, and their standard errors, although few early twin studies provided such estimates. Two types of heritability can be distinguished: \u2018narrow-sense\u2019 heritability refers to the contribution of additive genetic variance to observed phenotypic variance, whereas \u2018broad-sense\u2019 heritability refers to the total contribution of genetic factors (additive and non-additive) to the observed variation. Additive effects represent the sum of parental genes influencing the offspring's trait, whereas non-additive effects encompass the effects of genetic dominance and gene\u2013gene interaction.There are several assumptions that underlie the classical twin approach and these were not tested fully in many of the early studies. Furthermore, it has often been overlooked that heritability is a population concept, referring to the proportion of genetic variation within a given population at a particular time. The concept should not be applied to a single individual but, rather, to a group of individuals.Kang et al.2A major issue of concern in many previous studies of twins has been the accuracy of zygosity determination. Although comparisons of physical appearance can provide a reasonably reliable means of determining zygosity, errors can occur and these may influence subsequent analyses. The use of blood groups, as well as serum and enzyme polymorphisms, improved the ability to assign zygosities to twins. More recently, the use of highly polymorphic regions of DNA derived from blood or buccal cells has proved to be accurate and reliable.One of the main criticisms of the classical twin model has been based on the assertion that MZ co-twins are likely to share more similar environments post-natally than DZ co-twins, so greater similarities between them compared with DZ co-twins may partly reflect more similar environments rather than more similar genetic constitutions. While this can be an important issue with some behavioural phenotypes, it is less likely to be a major factor in studies of dental morphology, although nutritional similarities could possibly affect dental development.Another consideration is the possibility of an interaction between genetic and environmental influences. The classical twin model tends to assume that these two influences operate independently, hence the often-used phrase \u2018nature versus nurture\u2019. This is seldom the situation and there is frequent interaction between genetic and environmental factors.A further criticism of the classical twin model has been whether it is reasonable to extrapolate the findings from twin studies to a general population containing many singletons, given the special nature of the twinning event, twin pregnancies and births, and the upbringing of twins. The nature of the phenotype under investigation is important when attempting to assess the importance of these factors. However, there are some who question whether this is an appropriate assumption, even for dental variables.3The twinning process itself and the circumstances surrounding the birth of twins and their peri-natal development is special. Twinning has been associated with a high peri-natal mortality rateApart from an apparently higher prevalence of peri-natal mortality and morbidity amongst twins, there is another special feature of the twinning process that frequently has been overlooked. MZ twin pairs most often share a common placenta and chorion (around 60\u201370%), but there are around 20\u201330% of MZ co-twins who have separate placentas and chorions. Di-chorionic twins are thought to have separated at an early stage of development, probably in the first 5 days post-conception whereas mono-chorionic twins are thought to have separated at a later stage, around six to 9 days post-conception. In around 30% of mono-chorionic MZ twins, there can be arterio\u2013venous anastomoses that can lead to marked differences in physical development. Few studies of dental features in twins have taken account of chorion type, although Burris and HarrisThe fascinating phenomenon of mirror-imaging, where one member of a twin pair \u2018mirrors\u2019 the other for one or more features, is well known to most people. However, most of the studies of mirror-imaging in twins have been retrospective reports based on small sample sizes rather than being well-planned prospective studies. To ensure that findings are not purely due to chance, a suite of study variables needs to be defined, measurements and observations made, error studies performed, and comparisons of the frequencies of mirrored features made between MZ twins, DZ twins and singletons. Given that there is some preliminary evidence that mirror-imaging may be related to the timing of the division and therefore the type of placentation,4Apart from the classical twin model, there are several other research methods that can be used when studying twins. One approach that overcomes the problem of possible confounding effects due to common family environment is to study MZ twins who were separated shortly after birth and subsequently reared in separate homes. Assuming that their adoption placement is not influenced by trait-related environmental factors, the similarity of reared apart MZ co-twins can be attributed to shared genes alone.A further design is the MZ co-twin model, which involves comparison of MZ twins where each member of a pair has been exposed to different environmental effects. For example, MZ co-twins may be treated with different orthodontic appliances and the outcomes compared, or the severity of periodontal disease might be compared between MZ co-twins where one is a smoker and the other is not. The MZ co-twin model can also be used to make inferences about the relative contributions of genetic and environmental factors to phenotypes for which the twins are discordant. Differences in the number and position of missing teeth between MZ co-twins raise the likelihood that environmental and/or epigenetic influences during development can lead to quite distinct differences in dental development.Another research design involving twins is the so-called twin half-sib model.Another model that can be used is the opposite-sexed DZ model. This approach focuses on male\u2013female twin pairs and tests whether there are differences in mean values and variances for selected features between these twins compared with other twin types and singletons. Since each member of a male\u2013female twin pair may be exposed to elevated levels of hormones from their co-twin in utero, it is possible that this may lead to observable effects post-natally. Indeed, there is some evidence that tooth size is increased in females belonging to opposite-sexed twin pairs compared with females from same-sexed MZ or DZ groups.52) can be derived according to the formula: h2\u00a0=\u00a02(rmz\u00a0\u2212\u00a0rdz), where rmz and rdz are the values of correlation coefficients between samples of MZ and DZ co-twins for the feature under investigation.There have been two main quantitative genetic approaches used to clarify causes of observed variation in the human dentition: classical correlation analysis and multiple abstract variance analysis.The development of more sophisticated model-fitting methods to analyse twin data made it possible to estimate the strength of genetic and environmental contributions within calculable confidence intervals.Three additional sources of variation and covariation between twins that need to be considered are assortative mating, genotype-by-environment interaction (GxE) and genotype\u2013environment correlation (CorGE). The presence of assortative mating, if unmeasured, will lower the estimated genetic contribution to variation. To test for assortative mating, data from parents of twins are needed, as described previously in the twin half-sib model. It is unlikely that there is strong positive or negative assortative mating with respect to dental features, and the few attempts to explore this source of variation have failed to find evidence for its presence.Computer programs, such as Mx developed by Neale,A summary of findings relating to genetic and environmental contributions to human dental variation based on the Adelaide twin studies is provided in 6Our previous studies support the view that, even though there is a relatively strong genetic basis to missing or extra teeth, the number or position of affected teeth can be influenced by epigenetic factors.We consider that a multifactorial modelGiven that there is a link between the size and shape of teeth, and hypodontia or supernumerary teeth, we propose that there is likely to be a group of genes that exert pleiotropic effects on all of these dental phenotypes, accounting for their observed co-variation. How many genes are involved remains to be determined and it is possible that it may be a relatively small number. Support for this view is provided by Kangas et al.7In addition to estimating the effects of unmeasured genes and environmental influences, structural equation models can also be used to test the effects of measured genetic and environmental factors. Until recently, the analysis of molecular genetic data focussed on two different approaches, namely whole-genome linkage analysis or association analysis of putative candidate genes, or a combination of the two. More recently the Wellcome Trust Case Control Consortium7.1Linkage analysis establishes relationships between the level of similarity in a phenotype in genetically related individuals and their levels of similarity in regions of the genome. If such a relationship can be established with sufficient statistical confidence, then one or more genes in those regions are possibly involved in phenotype similarity among individuals.Linkage analysis depends on the co-segregation of alleles at a trait locus and a marker (i.e. on the same chromosome and thus violating Mendel's law of independent assortment). Markers are most commonly variable number tandem repeats \u2013 short segments of DNA with a repeated sequence, also called \u2018microsatellites\u2019. If a pair of offspring has received the same haplotype from a parent in a certain region of the genome, the pair is said to share that parent's alleles in that region identical by descent (IBD). Since offspring receive their haplotypes from two parents, the pair can share 0, 1 or 2 alleles IBD at a certain locus in the region. The IBD status is usually estimated for a number of markers with (approximately) known location along the genome  or 8\u00a0cM  intervals) and is used as the measure of genetic similarity at the marker. The IBD status at a marker is informative for the IBD status at any other locus on the chromosome as long as the population recombination fraction is less than 0.5. The IBD status at the marker and the locus are then correlated in the population and hence similarity at the marker is informative for similarity at the locus. The informative locus may be a gene or located near a gene. If variation in the gene and variation in the phenotype are related, then variation in the IBD status at the locus and thus also at the marker will be related to variation in phenotype similarity. It is possible to estimate the variance contributed by a genetic marker to a trait using structural equation modelling or other regression-based approaches.7.2Ultimately, we aim to quantify the specific effects of genes in terms of their trait contributions from additivity and dominance. Linkage analysis may identify a narrow chromosomal region (i.e. quantitative trait locus) containing a gene influencing the trait. Genes with putative function (i.e. \u2018candidate\u2019 genes) can then be selected to test for their association with the trait. Known as association analysis, regression-based methods can be used to test whether variation within the gene is related to variation within the trait.Traditional association studies such as case\u2013control designs may provide spurious associations, the result of stratified samples.7.3p\u00a0<\u00a05\u00a0\u00d7\u00a010\u22127), almost all of which were supported by prior findings and/or replication studies. A further 58 loci were identified with p values\u00a0<\u00a010\u22125.Technological advances have now made association analysis possible on a genome-wide (GWA) level. Single nucleotide polymorphisms  are the preferred markers, with sets of up to 500\u00a0K SNPs on a single chip (e.g. affymetrix). The first successfully documented GWA reported the findings of The Wellcome Trust Case Control Consortium Study.Family studies are not preferred for GWA because it requires very large samples for sufficient statistical power. However, family studies offer several advantages: they enable investigation of parent of origin effects, as maternal and paternal genes can be dissociated; gene x environment interaction effects can be studied, for instance, by measuring affected twins with known environmental exposures; and they are free from population stratification bias because the test of association can be tested within families as well as between families.Once causal genetic polymorphisms are identified the next step is to describe gene (and protein) functions and interactions. Such studies will most likely target gene expression, protein analysis and structure .8With recent advances in molecular biology and genome-scanning techniques, innovative approaches involving the study of twins have much to offer in complementing molecular studies and helping to unravel how genes and the environment contribute to both normal and abnormal phenotypic variation. As Martin et al.Although the identification of key genes for dental development in humans will represent a major step forward, merely identifying genes will not explain fully how various dental anomalies arise in individuals. This is where further exploration of epigenetic factors, using the MZ co-twin model, is likely to be a fruitful area for future study. Already researchers are beginning to study epigenetic biomarkers in an attempt to explain the reasons for observed differences between MZ twin pairs.Competing interests: None declared.Funding:: National Health and Medical Research Council of Australia, Australian Dental Research Foundation, Wellcome Trust, UK."}
{"text": "The evolution of disease resistance and immune function may be limited if increased immunocompetence comes at the expense of other fitness-determining traits. Both the maintenance of an immune system and the deployment of an immune response can be costly, and the observed costs may be evaluated as either physiological or evolutionary in origin. Evolutionary costs of immunological maintenance are revealed as negative genetic correlations between immunocompetence and fitness in the absence of infection. Costs of deployment are most often studied as physiological costs associated with immune system induction, however, evolutionary costs of deployment may also be present if genotypes vary in the extent of the physiological cost experienced.D. melanogaster. Phenotypes evaluated included fecundity, weight measures at different time periods and resistance to Providencia rettgeri, a naturally occurring Gram-negative pathogen of D. melanogaster. In the food-limited environment we found a negative genetic correlation between fecundity in the absence of infection and resistance, indicative of an evolutionary cost of maintenance. No such correlation was observed in the food-unlimited environment, and the slopes of these correlations significantly differed, demonstrating a genotype-by-environment interaction for the cost of maintenance. Physiological costs of deployment were also observed, but costs were primarily due to wounding. Deployment costs were slightly exaggerated in the food-limited environment. Evolutionary costs of immunological deployment on fecundity were not observed, and there was only marginally significant genetic variation in the cost expressed by changes in dry weight.In this study we analyzed evolutionary and physiological costs of immunity in two environments representing food-limited and food-unlimited conditions. Patterns of genetic variation were estimated in females from 40 'hemiclone families' isolated from a population of Our results suggest that the costs of immunity may be an important factor limiting the evolution of resistance in food-limited environments. However, the significant genotype-by-environment interaction for maintenance costs, combined with the observation that deployment costs were partially mitigated in the food-unlimited environment, emphasizes the importance of considering environmental variation when estimating patterns of genetic variance and covariance, and the dubious nature of predicting evolutionary responses to selection from quantitative genetic estimates carried out in a single environment. Understanding factors affecting susceptibility to infectious disease is the goal of many branches of the biological sciences. For the evolutionary biologist, these factors include the forces of mutation, gene flow, recombination, drift and selection and how these processes have shaped, and are currently shaping, genetic variation contributing to susceptibility to parasites and pathogens. The continued maintenance of genetic variation for disease resistance present in most populations -6 poses One hypothetical solution to this problem is that the rapid generation times of pathogens may provide them an evolutionary advantage over the host. Furthermore, for longstanding pathogen-host interactions, cycles of pathogen adaptation and host counter-adaptation may promote the rapid evolution of genes involved in defense and the maintenance of host polymorphisms through frequency dependent selection -9.In addition to the assumed advantage of pathogens over their hosts, and potential pathogen-host coevolution, evolutionary and ecological immunologists have more recently begun to consider the consequences of the host life history on patterns of disease susceptibility -15. The Pathogen defense is a multifaceted trait, including behavioral, morphological and physiological components ,19. HoweDrosophila melanogaster is a model system for much of our understanding of both constitutively expressed and inducible immune mechanisms including antimicrobial peptide production, phagocytosis of potential pathogens by insect hemocytes, the melanization reaction and encapsulation [The immune system of insects, while lacking the combinatorial specificity and antigenic memory characteristic of vertebrate immune function, is an effective mechanism of immunological defense providing protection against a wide variety of potential pathogens of bacterial, fungal, viral and multicellular parasitic origins. sulation ,20,21.But what are the costs of immunity? First, we must distinguish between maintenance costs and deployment costs, and second, whether these costs are physiological or evolutionary . MaintenA second distinction must be made between physiological costs and evolutionary costs. Physiological costs are evaluated either by examining the phenotypic correlation between fitness traits or through experimental manipulation. For example, the experimental manipulation of male sexual activity results in a decline in their immune function, consistent with the hypothesis that the maintenance of an immune system carries some physiological cost . PhysiolD. melanogaster, for example, experimental evolution of resistance to the parasitoid wasps Leptopilina boulardi and Asobara tabida revealed a genetic trade-off with larval competitive ability in crowded larval conditions [Evolutionary costs imply an underlying genetic basis to the observed cost and are evolutionary in the sense that they may act as brakes retarding the response to selection for immune efficacy. Evolutionary costs of immunological maintenance are revealed as negative genetic correlations between immunocompetence and the expression of other fitness components in the absence of infection ,14. In Dnditions ,4.D. melanogaster immunological defense against the parasitoid Asobara tabida caused declines in desiccation and starvation resistance and the magnitude of this cost varied among iso-female lines [Evolutionary costs of deployment indicate that genotypes vary in cost of immune system induction. Such costs would be revealed either as a significant genotype-by-immune challenge interaction when comparing fitness traits in immune challenged versus unchallenged individuals or by demonstrating that costs of deployment are exaggerated as a consequence of selection on immune system function. There are no previous attempts to evaluate evolutionary costs of immunological deployment. In le lines , howeverD. melanogaster was only revealed in a highly competitive environment [Environmental variation is known to affect the appearance and magnitude of both physiological and evolutionary costs of immunity. For example, reduced larval competitiveness in parasitoid-resistant ironment ,4, whileironment . In geneironment ,28. Furtironment ,30. In pironment .D. melanogaster and used them to estimate the evolutionary costs of immunological maintenance and deployment under both food-limited and food-unlimited environmental conditions. We evaluated maintenance costs as the genetic correlation between fecundity in the absence of infection and resistance to an experimental infection with the bacterium Providencia rettgeri. We estimated deployment costs as the change in fecundity following infection with live bacteria or heat-killed bacteria in comparison with both sterile wounding and uninjected controls. Our results indicate the presence of maintenance costs, but that these costs can be wholly mitigated in an environment in which food resources are not limiting. We also detected deployment costs, but as with maintenance costs, the decline in fecundity due to immune challenge was condition dependent.In this experiment we isolated 40 hemiclones from a natural population of P. rettgeri from 605 plates, and the dry weight of 5,248 females. Because of a labeling error, data for 2 of the hemiclone lines is missing from the fourth block of the experiment. Otherwise, sources of departure from the balanced design were random with respect to hemiclone line.The final data set included counts of 6,425 vials totaling 892,682 emerging offspring, colony counts of P. rettgeri, dry weight at emergence, dry weight at day 9, and the change in dry weight from emergence to day 9 are included in the analysis of maintenance costs. Hemiclone lines varied for all of these traits in both environments , resistance to ts Table  and 2.h2 = 0.06) was just less than half that seen in the yeast-unlimited environment (h2 = 0.15). Estimates of the coefficient of additive variation for fecundity in each environment were very similar, while the residual variation (CVR) in the yeast-limited environment was almost twice that observed in the yeast-unlimited environment  interaction . As with fecundity, there was evidence of a strong GxE interaction for female weight at day 9 post eclosion  were based on uninjected females. The heritabilities of dry weight at emergence and dry weight at day 9 (in either food environment) were all very similar, ranging from 0.21 to 0.27 . This correlation was absent in the yeast-unlimited environment . Using Fisher's z' transformation  we foundNo weight measure was significantly correlated with resistance Table . Dry weiWeight at emergence did not correlate with subsequent fecundity in either environment  and a marginally significant interaction between diet and injection . We therefore split the analysis between the two dietary manipulations  for the contrast repeated measures ANOVA compares the natural-log transformed fecundity in vial 3, prior to injections, with natural-log transformed fecundity in vials 4, 5, 6 and 7 separately. An initial analysis revealed significant interactions between diet and hemiclone line . This was mainly due to an approximate 10% decline in the fecundity of females in the first 28 hours after receiving an injection with either heat-killed bacteria or a sterile wound compared to the uninjected controls. In subsequent time periods the fecundity of females in the different injection treatments no longer differed , between bacteria injected females and females injected with a sterile needle (C2) and between females receiving an injection of any sort and uninjected females (C3). In the yeast-limited environment, only C3 showed a decline in the fecundity of injected females compared to uninjected females . However, in the first 28 hours after injection, when the cost was realized, the interaction was not significant .As previously discussed, evolutionary costs of immunological deployment are revealed as a genotype-by-challenge interaction, indicating genetic variation for the physiological cost experienced. In the yeast-limited environment, this interaction was marginally significant , although much less pronounced than that seen in the yeast-limited environment. However, unlike the situation in the yeast-limited environment, the effect was due primarily to the decline in fecundity in females receiving an injection with heat-killed bacteria, who showed a marginally significant decline compared to sterile-needle injected females  and a trend toward a significant decline compared to the uninjected females . There was no difference between sterile wounded females and uninjected females . Once again, the source of this effect was a difference apparent in the first day after injection, where females receiving an injection with heat-killed bacteria showed a strong decline in fecundity compared to both sterile wounded and uninjected females while sterile wounded and uninjected females were statistically indistinguishable . Examination of the a priori orthogonal contrasts showed no difference in the fecundity of females receiving injections with heat-killed bacteria versus injections with live bacteria . However, there was a decline in the fecundity of bacteria-injected females compared to sterile-needle injected controls . The effect seen in C2 makes the interpretation of the significance of the C3 comparison dubious. Post-hoc examination of the means for the different injection groups indicated that change in fecundity of females receiving an injection of bacteria (live or heat-killed) was lower than for uninjected females  and that there was no difference between uninjected and sterile needle injected females .Fecundity in the yeast-unlimited environment in the first 28 hours after injection was analyzed in the same manner as described for the yeast-limited environment .Once again, the line by injection interaction was marginally significant for the full model, but was not significant for the analysis of changes in fecundity in the first 28 hours after injection Table . To examIn terms of female dry weight at the end of the experiment, females receiving an injection (either with heat-killed bacteria or a sterile wound) had a lower weight than the uninjected controls in both environments Fig. , Table 7The experimental manipulation of yeast availability had a predictably large effect on female fecundity, with females in the yeast-unlimited environment . It is surprising that diet did not affect immune function given that a previous study, with a similar manipulation of food availability, found that females with ad libitum access to dietary yeast had dramatically improved immunity compared to females on a yeast-limited diet [Unlike fecundity and adult dry weight, there was no discernable effect of the environmental manipulation on immune function. Estimates of the number of bacteria recovered were nearly identical Table  and therted diet .D. melanogaster [E. coli, rather than the ability to slow the growth of a pathogenic bacterium. This also seems wanting as an explanation as the slower clearance of E. coli for females on the yeast-limited diet was mirrored by a more rapid death from an experimental infection with pathogenic Pseudomonas aeruginosa [This study differed in 3 ways that could potentially cause the disparity in outcomes. First, the studies used flies from different populations. However, given that there is little genetic differentiation among North American populations of nogaster  this doeruginosa .ad lib food conditions. However, it appears that the low food environment in the study of McKean and Nunney (2005) may have represented a greater limitation for females than in the present study. In support of this hypothesis, the fecundity of females in yeast-unlimited condition in McKean and Nunney (2005) was 6.7 times that of the yeast-limiting condition, compared to only a 2.5 fold increase seen in the present study. The results of McKean and Nunney (2005), utilizing the agar-cornmeal-molasses food, have recently been replicated  suggesting that the effect of food availability on patterns of immune function is a threshold trait, and that past a certain level of food availability further improvements in immune function do not occur.A third explanation, and the one that seems most likely, is that there are differences in the conditions actually represented by the environmental manipulation performed. The 'standard' yeast-limiting vials used in this study were made with agar-dextrose-yeast media while in the study of McKean and Nunney (2005) standard, yeast-limiting vials were made with agar-cornmeal-molasses. In both studies it seems likely that the yeast-supplemented vials represented Our analysis revealed heritable variation for each of the phenotypes assayed. These heritability estimates represent the upper bound of estimates of the narrow sense heritability . There aDue to the very large number of flies needed for this experiment , we did not attempt to precisely control the larval density or to keep track of the source of maternal chromosomes. It seems unlikely that variation in larval density would inflate our estimate of the additive variance. The numbers of females laying eggs in the collection vials was quite low and because the females in these vials were fully wild-type, variation among vials in the density of eggs laid is expected to be random with respect to hemiclone genotype. It also seems unlikely that our estimate of the additive variance is inflated by the confounding of non-additive genetic variance arising from a pervasive sampling of full sibs, in violation of our assumption that test females were almost exclusively composed of half-sibs. The test females used within each block of the experiment are the offspring of 75 randomly sampled females from our base population . Assuming an equal contribution of daughters from each female, the probability that two randomly sampled test females within a particular test vial of 5 females are not full sibs is 0.998. Therefore, it is not likely that estimates of the additive variance are inflated due to violation of the half-sib assumption.breeding value of a gamete, while a half-sib design provides estimates based on the breeding value of an individual [D. melanogaster, where there is no recombination in males, the breeding value of a gamete could differ from the breeding value of an individual male if there are strong epistatic interactions between allelic variants at loci on different chromosomes [D. melanogaster, it is unlikely that such non-additive effects would inflate the additive variance. Furthermore, the present design is very similar to other quantitative genetic designs in D. melanogaster utilizing balancer chromosomes [i.e., the North Carolina II breeding design; [A third source of deviation from more standard quantitative genetic designs is unique to the clone-generator system itself . The expdividual ,40. For omosomes . HoweverOur estimates for the heritability of fecundity, immunity and dry weight in the two environmental conditions Table  are consA, rather than the heritability. In general, the low heritability of life history traits, such as fecundity, appears to arise from a greater residual variation rather than an absolute reduction in the additive genetic variance. Such an effect seems to explain why we see such a low estimate for the heritability of fecundity in the yeast-limited environment (h2 = 0.06) compared to the yeast-unlimited environment (h2 = 0.15); a comparison of CVA shows they are similar in the two environments, however, the CVR in the yeast-limited environment is twice that seen in the yeast-unlimited environment  and hemocyte load (h2 = 0.74 \u00b1 0.06) are more than three times as high as our estimates of resistance to P. rettgeri in the yeast-limited (h2 = 0.12) and yeast-unlimited environment (h2 = 0.14). Similar observations of very high levels of heritability have been reported for the caterpillar Spodoptera littoralis (phenoloxidase (PO) activity: h2 = 0.69 \u00b1 0.07; encapsulation: h2 = 0.62 \u00b1 0.14 [h2 = 0.36 \u00b1 0.08; PO activity: h2 = 0.65 \u00b1 0.11; antibacterial activity: h2 = 0.63 \u00b1 0.11; haemocyte density: h2 = 0.36 \u00b1 0.08; [h2 = 0.69 \u00b1 0.48 [Our estimates for the heritability of the ability to slow the growth of ri Table  are much2 \u00b1 0.14 ), in the \u00b1 0.08; ), and ine h2 = 0. \u00b1 0.06 aAnopholes gambiae was much greater than observed for resistance to E. coli [The exact origin of such profound differences in the magnitude of the heritability estimates is unclear. One possibility is that functional measures of the effectiveness of an immune response may be quite different than measures of single effectors or components of the immune response . For exa E. coli .Evolutionary costs of immunological maintenance are revealed as negative genetic correlations between fitness components in the absence of infection and immune system function ,51. Our D. melanogaster selected for increased resistance to the larval parasitoids Asobara tabida or Leptipolina boulardi [The effect of environmental variation on evolutionary costs of immunological maintenance has also been observed in lines of boulardi ,4. Theseboulardi -31,52.An immunological cost of deployment is recognized as a reduction in fitness as a consequence of immune system activation ,15,53. TThe experimental design used here allows us to examine both the physiological and evolutionary costs of immunological deployment. Our results suggest the presence of short-term physiological costs of deployment Fig. , 6, 7. TD. melanogaster involves the production of antimicrobial peptides and the activation of enzyme cascades involved in wound repair. These induced responses to wounding could contribute to the observed fecundity cost. The cost could also arise as a consequence of physical damage. However, it would seem that physical damage would have longer-lasting effects on fecundity instead of the transitory effect observed here.Females in the yeast-limited environment were less fecund in the first 28 hours after injection, but fecundity returned to uninjected levels by 48 hours after infection Fig. . The decMicrococcus luteus (a Gram-positive bacterium) and Escherichia coli (a Gram-negative bacterium). The fecundity of these females was compared to sterile media injected controls. Wild-type, immune intact, females experienced a significant and long lasting decline in fecundity [Our results differ dramatically from those reported by Zerofsky et al. . In theiecundity .M. luteus and E. coli were mixed, heat-killed, centrifuged and then the needle dipped into this highly concentrated pellet. We used solutions containing heat-killed bacteria diluted to an OD610 \u2248 0.6, or live bacteria at a slightly lower concentration (OD610 \u2248 0.2). The apparent active and rapid down-regulation of immune responses [M. luteus and Gram-negative E. coli) could produce longer-lasting costs. Consistent with this is the observation that the E38, relish mutants  did not experience a cost of deployment [M. luteus, was intact.We suggest two hypotheses to explain the disparity in 1) distinguishing changes in fecundity in sterile-wound and bacteria injected females and 2) the lack of a long-term fecundity cost in this experiment. First, there was a tremendous difference in the amount of bacteria introduced to females in the 2 experiments. In the study of Zerofsky et al. , overnigesponses ,56 may mployment  even thoWe also observed a deployment cost in the yeast-unlimited environment, and as with the yeast-limited environment, this cost was short term, with fecundity returning to the level of uninjected controls within 48 hours. The unlimited access to dietary yeast affected both the magnitude and the type of cost experienced. First, the 5% decline in fecundity of bacteria-injected (either live or heat-killed) females in the first 28 hours after infection was less than the 11% decline observed for similarly challenged females on the yeast-limited diet. Second, in the yeast-unlimited environment a cost of immune system activation could be distinguished from a simple cost of wounding Tables , Fig. 3.Bombus terrestris, the acceleration of mortality following challenges with LPS and synthetic beads was only seen when bees were starved subsequent to the challenge and not in bees kept on a normal diet [Spodoptera littoralis caterpillars immune function declined, but the cost of nucleopolyhedrovirus increased, as a consequence of manipulations of dietary protein levels [ad libitum access to food does not appear to allow for complete mitigation of deployment costs as this and another study [There are other examples of food availability affecting deployment costs and also the cost of parasitism itself. For example, in the bumble bee, mal diet . Likewisn levels . Howeverer study  have demMycobacterium marinum [A physiological cost of deployment was also reflected in the decline in dry weight of females injected with heat-killed bacteria or given a sterile wound. This decline in weight was seen in both the yeast-limited environment, where there was a 3.7% decline in dry weight, and in the yeast-unlimited environment where females exhibited a 2.3% decline in weight compared to uninjected controls Table . This ob marinum . In that marinum  argued t marinum . Our resLastly, we did not find overwhelming evidence of evolutionary costs of immunological deployment. For fecundity, there were marginally significant hemiclone line by injection interactions for the full model in the contrast MANOVA  in the summer of 2004. The population was maintained as isofemale lines until August 2005, when we created a large outbred population from equal numbers of mated females from each of the lines. We maintained this population for 6 generations prior to isolating the hemiclones used in the experiment. In general, adaptation to laboratory conditions occurs very rapidly [We established the population of  rapidly -64. ThusDuring the first 5 generations of outbreeding, we placed 15 females and 15 males in each of 250 vials (N = 7500). After 24 hours we removed the adults from the vials leaving only the eggs. Twelve days later, we collected the next generation of adults and mixed evenly among vials. In the generation prior to establishing the hemiclones, we randomly assigned 6 males and 6 females from each of the 250 vials to one of 100 vials . We maintained the population in a similar manner  during cytogenetic cloning and amplification.D. melanogaster genome). Cytogenetic cloning relies on the absence of recombination in males and the use of so-called 'clone generator' (CG) females. The process of hemiclone isolation, amplification, and the creation of hemiclone families for quantitative genetic analysis is described in Figure We isolated a total of 100 hemiclones from our sample population and from this sample randomly chose 40 for use in this study. The sampling of hemiclones (cytogenetic cloning) has been previously described ,65. The In this study we examined immunological costs in females only. Experimental females were founded by crossing hemiclone males randomly to females from the base population. For each of the 40 hemiclone lines used in the study, 5 replicate vials of 10 hemiclone males combined with 15 virgin females from the base population were established and transferred every 24 hours for 2 days. In this crossing design it is expected that 1/2 of fertilized eggs will be inviable, thus these conditions will result in relatively low larval densities. Furthermore, variation in larval density among collection vials due to variation in female fecundity should be random with respect to the hemiclones and thus should not act to confound subsequent phenotypic assays.VA [We mixed the newly emerged virgin females from all 10 vials before placing them randomly in experimental vials (see below). These fully wild-type females share the same set of paternal chromosomes  and a random set of maternal chromosomes and mitochondria. Assuming that most of the sampled offspring are not full sibs, these 'hemiclone-families' are composed of half-sisters that, because they share the same paternal set of chromosomes, have a coefficient of relatedness of 0.5. For any phenotype of interest, the deviation of the hemiclone family mean from the population mean phenotype gives a direct estimate of the breeding value of a gamete. The correlation of breeding values for different traits, or for the same trait expressed in different environments, is the broad-sense genetic correlation and the heritability can be estimated from the among family variance, which provides an upper bound to the additive genetic variance, VA .Providencia rettgeri and fecundity in the absence of infection. Deployment costs were evaluated as the decline in female fecundity following injections with either live or heat killed P. rettgeri compared with both sterile needle injected and uninjected controls. The design described below, and shown in Figure Our goals were to measure the evolutionary costs of immunological maintenance and deployment in food-limited and food-unlimited environments. An outline of the experimental design is shown in Figure \u03bcl of water onto the surface of the food in standard vials. The vials were then allowed to dry for 2 \u2013 3 days prior to use in the experiment. This amount of yeast was not exhausted during the 24 hours the females were in vials, thus this manipulation represents an ad libitum amount of food.We manipulated adult food availability by adding dietary yeast to 'standard' vials. Standard vials were made with equal amounts, by weight, of glucose and yeast and these represent yeast-limited, but not starvation conditions. Yeast-supplemented vials were made by placing 40 mg of yeast suspended in 50 \u03bcg using a Sartorius CP2P microbalance .We collected experimental, virgin females as described above and placed 5 per vial in 8 standard and 5 yeast-supplemented vials . We froze females from the 3 extra standard vials on the day of injections to examine patterns of variation in immune system gene expression, the results of which will be published elsewhere. We collected an additional 6 experimental females and froze them for subsequent analysis of female dry weight at emergence. On day 2, we transferred the females to a new vial containing 5 males randomly sampled from the base population. On day 4, we transferred the flies to a new vial  and discarded vial 2. On the afternoon of day 5, we injected the flies (see below) and placed them in vial 4. We then transferred the flies every 24 hours for 3 more days . On day 9, we transferred the flies out of vial 7 and into microcentrifuge tubes and flash-froze them for subsequent analysis of female dry weight at the end of the experiment. We counted the number of emerging offspring for each of vials 3 \u2013 7 representing our estimate of female fecundity. We determined the dry weight of females at emergence and on day 9 by drying the flies in a drying oven for 24 hours, and then weighing each individual to the nearest 0.001 Providencia rettgeri, or heat-killed P. rettgeri. Controls for the analysis of deployment costs included both sterile-wounded and uninjected females. P. rettgeri is a Gram-negative bacterium in the family Enterobacteriaceae. Providencia species have been isolated from a number of different insects, including Drosophila [P. rettgeri strain used in this experiment from the hemolymph of a wild-caught D. melanogaster collected near State College, Pennsylvania, USA. This strain is pathogenic to Drosophila, meaning that it is able to grow rapidly and cause fly death when introduced into the hemocoel.On the day of infections, we injected the females with either live osophila . B. Lazz610 = 0.6 (for injections with heat-killed bacteria) or A610 = 0.2 (for injections with live bacteria). We heat-killed the bacteria by placing a culture at 65 C for 45 minutes prior to injections. To test the effectiveness of the heat killing process, we plated a 50 \u03bcl sample of each of these cultures and in no case were live bacteria observed. We injected the flies by piercing their thorax with a 0.1 mm minutien pin  dipped into either 1) a liquid culture of live P. rettgeri, 2) a liquid culture of heat-killed P. rettgeri or 3) sterile LB. We used separate needles for each injection treatment. Uninjected and injected females were handled in a similar manner with respect to the timing of CO2 anesthetization.On the evening prior to infections, bacterial cultures were initiated in sterile LB and allowed to grow overnight at 30 C. We diluted the resulting cultures to an optical density of A\u03bcl of sterile LB and plating 50 \u03bcl of this homogenate on LB plates with an Autoplate 4000 spiral plater . The plates grew overnight at room temperature and we then counted the number of colony forming units (CFU) using the Q-Count detection system . We plated a total of 8 plates for each hemiclone line in each environment.For females receiving an infection of live bacteria, we estimated the bacterial load 28 hours after infection by homogenizing 3 females in 500 P. rettgeri, and fecundity in the absence of infection is indicative of an evolutionary cost of immunological maintenance. We estimated genetic correlations as the parametric (Pearson product-moment) correlations of least-square hemiclone line means for our phenotypes from mixed-model ANOVAs outlined below. The analysis of fecundity in the absence of an immune response is based on counts of emerging offspring from vial 3. This represents counts of emerging offspring from 8 vials in the yeast-limited diet and 5 vials in the yeast-unlimited diet within each of the 4 replicate blocks (n = 32 for the yeast-limited diet and n = 20 for the yeast-unlimited diet). Counts of emerging offspring were natural-log transformed in order to improve the fit to normality. We performed a mixed-model analysis of variance (ANOVA) on the natural log transformed counts of emerging offspring using the following model:As discussed above, a negative genetic correlation between immunological performance, assayed as the ability to slow the growth of pathogenic \u03bc is the grand mean, Li is the fixed effect of the ith hemiclone LINE , Dj is the fixed effect of the jth DIET (j = yeast-limited or yeast-unlimited), (LD)ij is the LINE \u00d7 DIET (genotype-by-environment) interaction, bk is the random effect of the kth BLOCK  and \u03b5ijkl is the residual variance. Estimation of the LINE least-square means and measures of variation  for fecundity in the absence of infection were estimated for each environment separately by entering the effect of LINE as a random factor into the model. Breeding values, used to establish genetic correlations among traits, were calculated as the deviation of the LINE least-square means from the population mean.where P. rettgeri infection using a mixed-model analysis of variance (ANOVA) on the natural log transformed counts of P. rettgeri colonies with the following model:We analyzed resistance to Li is the fixed effect of the ith hemiclone LINE , Dj is the fixed effect of the jth DIET (yeast-limited or yeast-unlimited), (LD)ij is the LINE \u00d7 DIET (genotype-by-environment) interaction, ik is the random effect of the kth INJECTOR , bl is the random effect of the lth BLOCK  and \u03b5ijklm is the residual variance. Colony counts were natural-log transformed in order to improve the fit to normality. Again, we calculated the hemiclone LINE least-square means and measures of variation separately for each environment. For the analysis of genetic correlations, we calculated the breeding value for resistance by subtracting the LINE least-square mean from the population mean. Thus positive values indicate hemiclone lines in which fewer bacteria were recovered .where We also collected data on female weight. Weight data included weight at emergence, weight at day 9, and from these two measures we could also calculate the change in weight. We evaluated among hemiclone line variation in emergence weight using the following mixed ANOVA model:\u03bc is the grand mean, Li is the fixed effect of the ith hemiclone LINE , bj is the random effect of the jth BLOCK  and \u03b5ijkl is the residual variance.Where At the end of the experiment we weighed uninjected females along with females that had received either heat-killed bacteria or a sterile wound. We analyzed day 9 dry weights using the following model:\u03bc is the grand mean, Li is the fixed effect of the ith hemiclone LINE , Dj is the fixed effect of the jth DIET (j = yeast-limited or yeast-unlimited), Ck is the fixed effect of the kth immune CHALLENGE , bk is the random effect of the kth BLOCK , il is the random effect of the lth INFECTOR  and \u03b5ijkl is the residual variance. We included all 2-way interactions and the 3-way interaction in the model. We used a reduced model to estimate the heritability of dry weight at day 9, including only females in the uninjected group, split between the two diets. We analyzed weight gain during the experiment by first subtracting the emergence weight from the weight at day 9 of uninjected individuals within each diet and then applying the following ANOVA model:where Li is the fixed effect of the ith hemiclone line , Dj is the fixed effect of the jth DIET (yeast-limited or yeast-unlimited), (LD)ij is the hemiclone LINE \u00d7 DIET (genotype-by-environment) interaction, and \u03b5ijk is the residual variance.where Physiological costs of immunological deployment are recognized as a decline in fitness trait values as a consequence of immune system activation. Evolutionary costs of deployment are present if genotypes vary in the physiological cost experienced. We evaluated both of these costs using multivariate, repeated measures analyses. We first compared the natural-log transformed counts of emerging offspring of females receiving an injection of heat-killed bacteria and sterile needle injected and uninjected controls. The multivariate analysis of variance (MANOVA) was carried out by implementing the contrast function in JMP. The contrast response design creates an M-matrix comparing post-injection fecundity  to pre-injection fecundity  for each of the four days post injection. Independent variables in the model included the main effects of hemiclone line, diet and injection in addition to all of their two- and three-way interactions. We also included the effects of block, injector and the number of females in the vial. This last effect was included due to the attrition of flies during the experiment due primarily to escape during transfer but also due to death. In addition to examining results from the full model, tests of each column of the M-matrix compared pre-injection fecundity with fecundity 28, 48, 72 and 96 hours post-injection.a priori orthogonal contrasts designed to test specific hypotheses concerning the effects on fecundity of the different injections. The first contrast (C1) compared pre-injection and post-injection fecundity between females receiving an injection with live bacteria versus females that received an injection with heat-killed bacteria. This contrast tests whether changes in fecundity following injection differ depending on whether the flies received living or dead bacteria. The second contrast (C2) compares the combined means of females receiving bacteria (either living or dead) with females that received a sterile wound. This contrast tests whether costs associated with a response to bacteria can be distinguished from costs associated with wounding. Results from this analysis are only meaningful if the comparison in C1 was not significant. The third contrast (C3) compares the combined means of females that received an injection of any type  to uninjected females. Provided that the previous contrasts were not significant, C3 tests the effect of wounding on changes in fecundity following injection.We also had fecundity estimates for the first 28-hours post injection for females receiving an injection of live bacteria. We examined the potential deployment costs associated with the response to live bacteria restricted to a single day post-injection using the same contrast design within the MANOVA platform described above. In this analysis, the response design matrix is a vector of pre-challenge fecundity  contrasted with fecundity in the first 28 hours after challenge . The independent variables in this analysis are the same as described above for the full analysis across all time periods post-injection. However, in this analysis we constructed a set of KAM and CPY coordinated and carried out the experiment. KAM analyzed the results and drafted the manuscript. All authors participated in outlining the experimental design and read and approved the final manuscript."}
{"text": "Despite the fact that genetic imprinting, i.e., differential expression of the same allele due to its different parental origins, plays a pivotal role in controlling complex traits or diseases, the origin, action and transmission mode of imprinted genes have still remained largely unexplored. We present a new strategy for studying these properties of genetic imprinting with a two-stage reciprocal F Many traits important to agriculture, biology, and human health are complex in terms of the genetic machineries that determine trait formation and development. Broadly speaking, these machineries are equipped with a web of actions and interactions of numerous DNA sequence polymorphisms, modified or altered by environmental factors. To elucidate a detailed picture of the genetic architecture of complex traits, various molecular, statistical, and computational tools have been developed and used in the mapping and identification of specific genes underlying the traits Arabidopsis thaliana to identify the genetic variation due to epiallelic variants in flowering time and plant height. Epiallelic variation can also be studied by tracing parent-dependent differences of the same allele. If the same allele functions differently, depending on which parent the allele is derived from, a phenomenon known as genetic imprinting or parent-of-origin effect, this allele may be epigenetic. Previous studies have suggested that genetic imprinting results from an epigenetic mark of differential methylation set during gametogenesis To describe variation among individuals in the number or distribution of methylated nucleotides at specific gene sequences, a new term, called epialleles, has been coined The past several years have witnessed an intense interest in mapping and identifying the regions of the genome that contain imprinted sequence variants with genome-wide linkage and association studies. Cheverud et al. In this article, we develop a novel strategy for identifying imprinted genes and understanding the transgenerational changes of their effects with a three-generation pedigree. This pedigree is initiated by reciprocally crossing two contrasting inbred lines, leading to two different FSuppose there are two inbred lines that are sharply contrasting in a complex trait. Each line can serve as a maternal and paternal parent, thus allowing a reciprocal cross. An FAssume that each FUsing the iQTL demonstrated in The same QTL genotype is different from different mating types due to the genetic imprinting of the FFThus, a final genotypic value of an FThe four epigenetically different Ffamilies  are obseTo determine whether there is an iQTL for the complex trait can be tested with log-likelihood ratio approaches. We first tested whether a significant QTL exists in the four FAfter a significant QTL is determined, then the imprinting effect of the QTL can be tested using the following null hypothesis,The newly developed model was used to analyze a data set from a large-scale QTL analysis project in which mice serve as a model system to study survival time to hyperoxic acute lung injury (HALI) Phenotype differences between the Fdetected , which idetected . All therom  to  . TherefoThe second test concerns the imprinting effects expressed in the F to zero . Except ceptions . One is In sum, all the detected iQTLs show a similar pattern of genetic effect on HALI in the Fositive) . PronounTo examine the statistical behavior of the new model, we performed Monte Carlo simulation studies by mimicking the example of the Ffamilies , initiatew model . At the ple size . To bettIn part 2, the simulation was used to test the power of the new model and its false positive rates. The conditions used for power calculation were the same as described above. According to traditional Mendelian genetic theory, the maternally and paternally derived alleles of a gene should have a similar amount of expression because they carry the same DNA sequence. However, a growing number of studies suggest that alleles may be expressed from only one of the two parental chromosomes The attempts to characterize imprinting effects are affected by our incapacity to discern the effect of DNA methylation variants from that of DNA sequence variants using a mapping study. This issue was, however, resolved by comparing two reciprocal crosses in which the maternally- or paternally-derived version of the same allele at a gene can be identified However, to study the precise genetic mechanisms through which chromatin dynamics alter quantitative variation, a simple test of imprinting effects of iQTLs is not adequate. Rather, a detailed understanding of whether and how imprinting effects are transmitted across generations is crucial for determining the contribution of epigenetic modification to heritable phenotypic variation for a complex trait. In this article, we present a new strategy for estimating and testing imprinting effects of iQTLs and their transgenerational transmission through two-generation reciprocal crosses leading to four epigenetically different Ffamilies . The newWe formulated a mixture model-based likelihood for the imprinting effects of iQTLs flanked by markers in four epigenetically different Fdetected  when theThe model developed in this article will provide a useful tool for studying transgenerational imprinting inheritance and its impact on the variation in complex traits and diseases. As a first attempt of its kind, the model will need to be modified so as to broaden the scope of its application. Given its ubiquitousness in trait control, epistasis between different genes should be incorporated into the current model, helping to draw a comprehensive atlas of the genetic architecture for complex traits. Also, the expression of any genetic effects cannot be isolated from the environment in which organisms are reared Figure S12 families, initiated with two inbred lines AA and aa. The two inbred lines that serve as female (red) and male parents (blue) are crossed reciprocally to generate two F1 families. From each of these two families, two progeny, one being a female (red) and the other being a male (blue), are selected to make all possible crosses, leading to four different F2 families .A mating design generating four reciprocal F(0.04 MB EPS)Click here for additional data file.Figure S2The plot of log-likelihood ratio across the mouse genome composed of 19 autosomes and one sex chromosome. Ticks on the x-axis are molecular markers. The peaks of the profile, at which significant QTLs on chromosomes 1, 4, 9, and 15 are detected by the new model, are indicated by arrowed vertical lines. The critical threshold for claiming the existence of significant QTLs is indicated by a horizontal line.(0.03 MB EPS)Click here for additional data file.Methods S1Supporting Methods.(0.04 MB PDF)Click here for additional data file."}
{"text": "Finally, for the first time from real data, we provide estimates of functional genetic effects as sets of effects of natural allele substitutions in a particular genotype, which enriches the debate on the interpretation of genetic effects as implemented both in functional and in statistical models. We also discuss further implementations leading to a completely general genotype-phenotype map.Although the genotype-phenotype map plays a central role both in Quantitative and Evolutionary Genetics, the formalization of a completely general and satisfactory model of genetic effects, particularly accounting for epistasis, remains a theoretical challenge. Here, we use a two-locus genetic system in simulated populations with epistasis to show the convenience of using a recently developed model, NOIA, to perform estimates of genetic effects and the decomposition of the genetic variance that are orthogonal even under deviations from the Hardy-Weinberg proportions. We develop the theory for how to use this model in interval mapping of quantitative trait loci using Halley-Knott regressions, and we analyze a real data set to illustrate the advantage of using this approach in practice. In this example, we show that departures from the Hardy-Weinberg proportions that are expected by sampling alone substantially alter the orthogonal estimates of genetic effects when other statistical models, like F The rediscovery of Mendel's laws of inheritance of genetic factors gave rise to the research field of Genetics at the very beginning of the last century. The idea of traits being determined by the effects of inherited genes is thus the conceptual core of Genetics. After more than one century, however, we still lack a completely general mathematical description of how genes can control traits. Such descriptions are called genotype-phenotype maps, or models of genetic effects, and they become particularly cumbersome in the presence of interaction among genes, also referred to as epistasis. The models of genetic effects are necessary for unraveling the genetic architecture of traits\u2014finding the genes underlying them and obtaining estimates of their individual effects and interactions\u2014and for meaningfully using that information to investigate their evolution and to improve response to selection in traits of economical importance. Here, we illustrate the convenience of using a recently developed model of genetic effects with arbitrary epistasis, NOIA, to inspect the genetic architecture of traits. We implement NOIA for practical use with a regression method and exemplify that theory with a real dataset. Further, we discuss the state of the art of genetic modeling and the future perspectives of this subject. There is an increasing interest in Quantitative Genetics and Evolutionary Biology to identify genetic effects, and more particularly gene interactions, on a genome-wide scale and to understand its role in the genetic architecture of complex traits \u221e model Regarding now the first issue mentioned above\u2014the models of genetic effects\u2014the definition of the genetic effects in Haley and Knott's 2 population or into an outbred population of interest. Second, using the functional formulation of NOIA, it is possible also to express the genetic effects as effects of allele substitutions from reference individual genotypes\u2014instead of from population means like in the statistical formulation. In other words, starting from the orthogonal genetic effects of a population or sample under study, which are the ideal ones for performing model selection and have a particular meaning, NOIA enables us to obtain the values of the genetic effects that are associated to other desired meanings and are useful, therefore, to inspect different aspects of the evolution of a population, or selective breeding for increasing or decreasing a trait values.The statistical formulation of the recently developed NOIA  model of genetic effects is orthogonal in situations where previous models are not\u2014for departures from the Hardy-Weinberg proportions (HWP) at any number of loci\u2014and it is therefore more appropriate choice for estimating genetic effects from data in genetic mapping 2 populations, to compute genetic effects in a non-ideal situation, under departures from the HWP. We address this issue by generating simulated populations that depart from the HWP in several degrees and analyzing them with NOIA and other models. We quantify the deviances from orthogonal estimates due to using models that assume ideal conditions in the populations under study, thus showing the practical convenience of using the NOIA model for performing real estimates of genetic effects in QTL experiments. Second, we develop an implementation of NOIA with HKR, allowing it for immediate practical use and illustrate its performance using an example with real data. By this example we provide estimates of genetic effects with different meanings and, for the first time, functional estimates of genetic effects\u2014using an individual genotype as reference\u2014from a real data set. We discuss on how this feature opens new possibilities of using real data to analyze important topics in Evolutionary Genetics.Our motivation for this communication is to show how to use models of genetic effects to obtain estimates of genetic effects from data that have the desired meaning of any particular scientific purpose. To this end we first inspect how much of a difference it makes to use the classical models for ideal populations, such as ideal F2), the genetic effects of a two-locus and two-allele genetic system , \u03b1B and \u03b4B. The estimates in this group decreased with increasing departures from HWP. The third group contains the remaining three genetic effects, \u03b4A, \u03b4\u03b1 and \u03b4\u03b4, whose estimates are not affected by departures from HWP at locus B. The genetic effects measured by the G2A model show the same qualitative behavior described above for NOIA , but are quantitatively different. The reason for this is that G2A can adapt the measurements to the changes in the allele frequencies of the population, but not to the precise departures of the genotype frequencies from the HWP. The genetic estimates obtained using the F2 model always give the same values independently of the genetic constitution of the population. The F2 thus fails to capture the effects of departures from HWP at all. Thus, unless when the studied population is an ideal F2 . For orthogonal models, the sum of the three components of variance gives the total genetic variance\u2014which in this case equals the phenotypic variance, since there is no environmental variance in the simulated populations. Here, this is only observed for the variances computed using NOIA. The other two models are not orthogonal in the populations under study , and thus there exist covariances between the genetic effects that would need to be accounted for to obtain the true genetic variance of the population 2 models is, thus, non-orthogonal. The G2A leads to a greater departure form an orthogonal decomposition of variance than the F2 model by the particular kind of departures from HWP simulated here. Both the G2A and F2 models underestimate the additive variance and therefore also the heritability of the trait in the simulated populations.A and B) genetic system with epistasis affecting growth rate in an F2 cross between Red junglefowl and White leghorn layer chickens A departs significantly from the HWP when considered alone, but not when correcting for multiple testing . 2 and G2A differ substantially from these of NOIA . This example with real data, thus, shows that it makes a substantial improvement to use NOIA to compute genetic effects and variance decomposition in QTL mapping experiments over the classical models of genetic effects designed to fit ideal experimental situations.For illustrating the advantage of using NOIA for analyzing experimental data, we reanalyze a two-locus , relative to the expected value without epistasis, which is a decrease in roughly 20 grams from the Red junglefowl. In total, this makes the phenotype of the White leghorn layer 20 grams higher than the Red junglefowl. However, for inspecting if this results support the White leghorn layer alleles being likely to reach fixation we also need to consider the phenotypes of the heterozygotes. Interactions involving dominance in locus B are all negative, thus favoring the fixation of the White leghorn layer allele, B2. The role of allele A2 is not as obvious, since da is positive. The genotypic value of \u201cA1A2B2B2\u201d is roughly 30 grams higher than the Red junglefowl (computed again from G\u200a=\u200aS\u22c5E) and ten grams higher than the pure White leghorn layer. The expected, therefore, would be that the two alleles segregate at locus A. The standard deviations of the estimates are however rather large and thus do not rule out the possibility of fixation of the White leghorn layer allele at locus A.For analyzing what would happen if eventually the two mutations were present at the same time in the population, we have to consider also the interaction effects. The double homozygote for White leghorn layer allele increases the phenotype with roughly forty grams  the ones with the reference of the mean of an ideal F2 population. Further, as illustrated in the example with real data, it is possible to transform statistical estimates of genetic effects into functional ones, using a particular reference genotype. Another situation in which these transformations are valuable is, for instance, in a three-locus genetic system with pairwise epistasis. In this case, NOIA would easily permit to consider only the significant genetic effects and to re-compute the genotypic values only from the significant genetic effects (assuming the non-significant third-order interactions to be zero).One example of the previous is removing the characteristics of the data that are not supposed to be properties of a target population from the estimates. The departures from HWP of the experimental data we dealt with in this article are in fact supposed to be only due to sampling, instead of being caused by real Hardy-Weinberg disequilibrium in the Fe.g.e.g.2 experimental population, into functional genetic effects as allele substitutions performed from a reference individual. Concerning these functional estimates of genetic effects, we have shown in the previous section how they can improve the understanding of the genetic system by inspecting a two-locus model obtained from real data. Notice that when changing the reference of the model, the genetic effects can change their magnitudes and even their signs . When performing IM for searching for the positions and estimates of genetic effects in QTL mapping experiments, missing data occurs at two levels. First, the genotype of the QTL located in a marker interval is not known and needs to be estimated from the observed flanking marker genotypes. Second, in most experimental datasets there are missing genotypes for many genetic markers that can be imputed from genotypes at closely linked informative markers. Thus, the implementation of HKR with NOIA enables us to perform IM with a regression method and using a model of genetic effects that is orthogonal regardless of how far the available data is from the HWP.et al.The HKR has been assessed as a good approximation of IM when dense marker maps are available and missing data are few and random et al.Models of genetic effects need to be further generalized. Two important cases that need to be accounted for are multiple-alleles and LD, which have been addressed in several recent publications dealing with statistical models of genetic effects. Yang A and B, generating several populations with the second locus affected by departures from the HWP in several degrees. The genotype-phenotype map corresponds to the phenotype mean of the population and all the genetic effects being equal to one in an ideal F2 population .We analyzed the simulated data by computing the genetic effects of the system using three models: NOIA, G2A and FSS (S5), in the HKR method, as we do with the F2 model in p11, p12 and p22 in the NOIA statistical formulation (S5) are the exact genotype frequencies at the considered loci. In the HKR, the genotype frequencies are not known, but can be estimated as:N is the number of individuals in the population under study. We implement this model in the general expression of the HKR (S4), in G* be the column-vector of observed phenotypes, G*k, k\u200a=\u200a1,\u2026,N, \u03b5 the corresponding vector of errors, and Z, which is an N\u00d73-matrix whose rows are the vectors \u03c9k (S4). With this notation, the general expression of regression (S4) is:SS matrix and the E vector can be extended as in \u00c1lvarez-Castro and Carlborg Z matrix can be extended as the row-wise Kronecker product of the matrices of the single loci, also as in \u00c1lvarez-Castro and Carlborg A and B) case, the ZAB matrix is an N\u00d79-matrix that is built as:We recall the required theory behind the HKR and NOIA in et al.2 intercross of roughly 800 individuals between one Red junglefowl male and three White leghorn females. A simultaneous two-dimensional genome scan was performed to identify pairs of interacting loci regardless of whether their marginal effects were significant or not. We have studied in more detail one of the detected pairs involving QTL on chromosome 2 (486 cM) and 3 (117 cM), hereafter loci A and B respectively. This pair was selected for a number of reasons. First, these loci interact epistatically, in spite of showing no significant marginal effects in the studied population. Second, since they are located in different chromosomes, there is no physical linkage between them. Third, the genotype frequencies at locus A depart significantly from the HWP (p<0.05) when considered independently, but the departure is not significant after applying multiple testing correction accounting for the rest of the detected QTL. Thus, locus A is an example of the departure of the HWP that is expected in QTL experiments just due to sampling. The level of departure from the HWP for the evaluated pair roughly equals the 30% deviation in Carlborg A and B, using several models of genetic effects. First we used the F\u221e model, which was the one also used by Carlborg et al.2 model, which was designed for F2 populations. Third, the G2A model, which can account for departures of the gene frequencies from \u00bd, and finally the statistical formulation of NOIA, which can adapt to the genotype frequencies of the sample used for the estimation of QTL effects. In these analysis we have made use of the theory developed in this article: the implementation of HKR with NOIA. These developments enable us to deal both with missing data and with the estimation of genetic effects of positions inside the marker intervals.We have computed the genetic effects of the epistatic pair involving loci S matrix\u2014the genetic-effect design matrix\u2014of the orthogonal system, G\u200a=\u200aS1\u22c5E1, and the inverse of the S matrix in the new system, G\u200a=\u200aS2\u22c5E2:E1 can be expressed as functions of the estimates in E2 as:E2, can be computed from the ones in E1 as:E2, V2, from the vector of variances of the estimates E1, V1, we just rewrite (3) in algebraic notation as:\u00c1lvarez-Castro and Carlborg Text S1Background information on the HKR and NOIA. Concepts and equations related to the original formulation of the HKR and to the NOIA statistical formulation that will help the reader to deeper understand some details of the methods used in the article.(0.09 MB DOC)Click here for additional data file."}
{"text": "The authors analyze developmental, genetic, and demographic mechanisms by which populations tolerate changing environments and discuss empirical methods for determining the critical rate of sustained environmental change that causes population extinction. Many species are experiencing sustained environmental change mainly due to human activities. The unusual rate and extent of anthropogenic alterations of the environment may exceed the capacity of developmental, genetic, and demographic mechanisms that populations have evolved to deal with environmental change. To begin to understand the limits to population persistence, we present a simple evolutionary model for the critical rate of environmental change beyond which a population must decline and go extinct. We use this model to highlight the major determinants of extinction risk in a changing environment, and identify research needs for improved predictions based on projected changes in environmental variables. Two key parameters relating the environment to population biology have not yet received sufficient attention. Phenotypic plasticity, the direct influence of environment on the development of individual phenotypes, is increasingly considered an important component of phenotypic change in the wild and should be incorporated in models of population persistence. Environmental sensitivity of selection, the change in the optimum phenotype with the environment, still crucially needs empirical assessment. We use environmental tolerance curves and other examples of ecological and evolutionary responses to climate change to illustrate how these mechanistic approaches can be developed for predictive purposes.Global climate change, over-exploitation, and habitat alteration are causing sustained and consistent pressures on wild populations Two main approaches exist for studying the impact of environmental change on species persistence\u2014niche modelling and mechanistic population modelling. On the one hand, \u201cclimate envelope models\u201d (or \u201cniche models\u201d) are correlative and focused on the environment. Their conceptual background traces to Hutchinson's multidimensional representation of the niche On the other hand, mechanistic population modelling focuses on the biological processes that underlie population persistence. By combining evolutionary genetics and demography, the conditions that allow a population to maintain a positive intrinsic growth rate in the face of environmental change can be predicted theoretically Here, we propose a model of evolution and population growth to address how demographic and evolutionary constraints limit the persistence of a geographically isolated population under sustained environmental change. This model generalizes an earlier one by Lynch and Lande critical rate of environmental change: maximum rate of sustained environmental change that allows long-term persistence of a population, denoted as c\u03b7.environmental sensitivity of selection: change in the optimum phenotype with the environment. For a linear relationship, it is measured by the slope B.generation time: the average age of parents of a cohort of newborn individuals, denoted as T. With discrete non-overlapping generations, T is the mean time between successive reproductive episodes in the population.genetic variance: the genetic component of phenotypic variance \u03c32, or more precisely, \u201cadditive genetic variance\u201d h2\u03c32, the statistically additive component of phenotypic variance determining the resemblance between offspring and parents, and the genetic response to selection.heritability: the proportion of phenotypic variance in a trait due to additive genetic effects, denoted as h2.intrinsic rate of increase: population growth rate in the absence of intra- or inter-specific competition. For a perfectly adapted population with mean phenotype at the optimum, the intrinsic rate of increase is denoted as maxr.norm of reaction: the expected phenotype of a given genotype as a function of the environment.phenotypic plasticity: direct influence of the environment on individual phenotypes through developmental mechanisms. For a linear norm of reaction plasticity is measured by the slope b.quantitative trait: continuously distributed phenotypic character, with phenotypic variance in a population determined by multiple polymorphic genes and environmental effects.stabilizing selection: natural selection such that individual fitness decreases with increasing phenotypic deviation from an optimum. Its strength is measured by \u03b3.tolerance curve: fitness or performance as a function of the environment.There are three mechanisms by which a population can persist when its local environment changes: dispersal to track its preferred environment in space, genetic evolution to the new local conditions, or phenotypic plasticity \u03b5  changes at a constant rate \u03b7 in time. Adaptation to this changing environment is mediated by a quantitative trait z that determines fitness. Selection on multiple correlated traits also can be incorporated z, such that a given change in the environment directly modifies the phenotype of each individual by a constant amount. The rate of environmental change is expressed per unit time  instead of per generation.We assume that a continuous environmental parameter Under sustained environmental change, assuming constant genetic and phenotypic variance and strength of stabilizing selection, the rate of phenotypic evolution eventually reaches a steady state where the mean phenotype lags a constant distance behind the changing optimum phenotype . If this\u03c32 and heritability h2 of the trait, the strength of stabilizing selection \u03b3, and the maximum intrinsic rate of population growth maxr determined the critical rate of environmental change in the absence of phenotypic plasticity.The original model T. The remaining two parameters are the environmental sensitivity of selection B, which measures how changes in the environment influence the optimum phenotype, and phenotypic plasticity b, which quantifies the direct impact of the environment on development of individual phenotypes. The critical rate of environmental change for long-term persistence increases with decreasing absolute difference between the environmental sensitivity of selection and phenotypic plasticity. Although plasticity causes weaker natural selection on the trait and smaller genetic response to selection, this is more than compensated by the plastic phenotypic change that brings the mean phenotype closer to the optimum  of a population with optimum mean phenotype. Even if these parameters are not affected by the environmental change, they do constrain the rate of adaptation. Populations with longer generations must evolve faster per generation to adapt to a given rate of environmental change, and populations with a low maxr will reach extinction before they can adapt to rapid environmental change maxr per unit time is roughly inversely proportional to the generation time (1) Evolutionary potential. This measures how fast genetic evolution occurs for a given deviation of the mean phenotype from the optimum. The strength of stabilizing selection \u03b3 measures how the mean fitness decreases with the squared deviation from the optimum and also determines the strength of directional selection for a given deviation from the optimum. Stronger stabilizing selection (larger \u03b3), although causing increased mortality, allows faster environmental change to be tolerated by causing faster evolution \u03c32 and heritability h2, determines how much genetic evolution is caused by a given strength of selection. Higher genetic variance allows persistence under stronger environmental change, because it allows the population to track its phenotypic optimum more closely. Although we focus on a single trait for simplicity, this may actually be a linear combination of measurable traits. In this case, the genetic variances of the original traits and their genetic covariances affect the magnitude of the genetic response to selection in any phenotypic direction (2) Biological impact of the environment. This links the environment to the biology of individuals in the species. Phenotypic plasticity describes the direct impact of the environment on the development of individual phenotypes. It may involve morphological, physiological or behavioural responses, which can occur on different time scales. For continuous environmental variables, plasticity usually is modelled using reaction norms, where the phenotype of a given genotype is plotted as a function of the environment b quantifies the degree of plasticity. The environmental sensitivity of selection, B, measures how the optimum phenotype changes with the environment, which for simplicity we also assume is a linear relationship. With no cost of plasticity, populations with b closer to B are likely to persist under higher rates of environmental change.(3) This model can be combined with environmental projections to ask whether future rates of environmental change will threaten the persistence of particular populations or species. Application of the model requires multiple steps, which previously have been undertaken in isolation or in combination, although all have rarely been completed together.Ecological investigation in the field is needed to identify traits that potentially determine adaptation to a specific environment. For instance, for ectotherms such as insects and reptiles, thermal adaptation may occur not only through physiological traits governing energy metabolism, but also through behavioural and morphological traits involved in movement between shaded and sunny patches \u03b3 has been estimated in many plant and animal taxa by regressing the fitness of individuals on their phenotypes maxr are needed to understand how phenotypic traits influence population dynamics. Analysis of natural selection has been extended to age- or stage-structured populations, allowing identification of parts of the life cycle where phenotypes most strongly influence demography The strength (and direction) of natural selection h2\u03c32) along the direction of natural selection limits the rate of evolution has motivated many studies. For instance, in the North American prairie plant Chamaecrista fasciculate, small genetic variance for a linear combination of traits has been predicted to limit the response to selection caused by climate change Drosophila species The question of whether genetic variation  directly to the environment, which makes it difficult to produce evolutionary predictions and to test them experimentally Environmental tolerance curves relating fitness (or performance) to abiotic environmental variables such as temperature We propose that incorporating phenotypically plastic traits, which are under stabilizing selection through their influence on lifetime fitness Thermal tolerance curves generally are strongly skewed, with fitness decreasing steeply as temperature approaches the critical thermal maximum The model in Box 2 assumes a linear reaction norm, implying that a given amount of environmental change always produces the same plastic phenotypic change. Plasticity is generally studied in the context of environments that vary in space or fluctuate in time with a stationary distribution, but little is known about plastic responses outside the usual range of variation. Extreme environments may disrupt the plastic response, such that the reaction norm may take any shape in environments that were rarely encountered before Phenotypic plasticity may entail several types of fitness costs to the organism independent of the expressed phenotype In the literature on tolerance curves, the cost of plasticity is generally expressed as a trade-off between tolerance breadth and fitness in the optimum environment, corresponding to the intuitive idea that the \u201cJack-of-all-trades is a master of none.\u201d This has been modelled In the model of Box 2 and \u03b3 may depend on the environment  can cause the genetic variance (h2\u03c32) to depend on the environment Our model includes a number of simplifying assumptions. We assume a constant shape of the fitness function across environments, allowing only the optimum phenotype to change with the environment. However, the strength of stabilizing selection around the optimum phenotype Plasticity itself may evolve if it varies genetically, and new environments can cause directional selection on plasticity Finally, we considered a population that cannot disperse nor receive migrants from other populations experiencing different environments. We focused on this situation because it is one that is most commonly overlooked in niche modelling studies. Our model thus applies best to species with habitats restricted by dispersal barriers or species which disperse slowly relative to the rate of environmental change Our aim was to describe an approach based on evolutionary and demographic mechanisms that can be used to make predictions on population persistence in a changing environment and to highlight the most important variables to measure. While this approach is obviously more costly and time-consuming than niche modelling, its results are also likely to be more useful for specific purposes because it explicitly incorporates the factors that limit population response to environmental change.Aedes aegiptii in Australia. Egg desiccation was treated as a threshold trait, but the possibility of phenotypic plasticity or evolution of the threshold was not considered. These encouraging efforts call for more empirical studies where genetic evolution and phenotypic plasticity are combined with demography to make predictions about population persistence in a changing environment. The simple approach we have outlined is a necessary step towards a more specific and comprehensive understanding of the influence of environmental change on population extinction.The feasibility of such a mechanistic approach has been demonstrated by a few recent studies. Deutsch et al. Text S1A model of plasticity, evolution, and extinction in a changing environment.(0.48 MB PDF)Click here for additional data file."}
{"text": "In vitro experimentation provides a convenient controlled environment for testing biological hypotheses of functional genomics in cancer induction and progression. However, it is necessary to validate resulting gene signatures from these in vitro experiments in human tumor samples (i.e. in vivo). We discuss the several methods for integrating data from these two sources paying particular attention to formulating statistical tests and corresponding null hypotheses. We propose a classification null hypothesis that can be simply modeled via permutation testing. A classification method is proposed based upon the Tissue Similarity Index of Sandberg and Ernberg  that uses the classification null hypothesis. This method is demonstrated using the in vitro signature of Core Serum Response developed by  Integration of in vitro studies, i.e. experimental studies, with human \u201cin vivo\u201d gene expression studies is an area that is being considered more frequently in the functional genomic analysis of cancer. Hypotheses about cancer development, progression, and risk factors are difficult to test directly in a patient population. However, in experimental studies on cell cultures and model organisms, conditions can be specifically controlled to allow biological hypotheses to be tested. Integrating the results from such experiments with in vivo cancer signatures holds the potential to both infer activity of specific oncogenic pathways in vivo and to identify relevant effectors of oncogenic pathways.To begin to understand the mechanisms by which oncogenes cause cancer, studies have used gene-expression profiling to identify downstream targets of oncogenic pathways in cell-culture systems. Conceptually, this involves manipulating a gene in an in vitro system, measuring the global profile using gene expression technology and then trying to relate the in vitro gene expression profile to an in vivo gene expression profile. Such an approach was taken by Additionally, studies have used gene-expression profiling of cancerous growths induced in model organisms to examine tumor development or progression. Though model organism studies have the added difficulty of mapping orthologous genes between organisms, a difficulty not shared with tissue and cell cultures of human origin, there have been promising applications. For example, It is expected that in vitro/in vivo experiments such as those described in the previous two paragraphs will become much more commonplace in the future. Thus, it is critical to address statistical issues and to develop methods for integrating in vivo and in vitro genomic data so that inferences regarding transcriptional regulatory pathways in cancer can be generated. In this article, we discuss the statistical issues of the integration of these two types of datasets. We review various existing approaches and discuss their statistical advantages and disadvantages. In addition, we outline an approach for quantifying the predictive ability of a gene expression profile determined from an in vitro experiment based on the tissue similarity approach of One class of methods that has been popular in the literature for in vitro/in vivo genomic data analysis is the following. First, one generates ordered lists of genes using the in vivo expression data. One then generates a differentially expressed gene list using the in vitro data and studies the overlap between the two lists. The seminal examples of this are in There are some desirable features of the GSEA method. First, it utilizes all the information available in the in vivo gene expression data; no thresholding is done in that dataset. Second, a Kolmogorov-Smirnov statistic is used for the analysis, which is a non-parametric method and thus provides some robustness. However, there are several disadvantages to GSEA as well. For instance, note that there is thresholding done in the in vitro gene expression dataset to select the differentially expressed gene set. A potential improvement to the GSEA method, to avoid this thresholding, would be the following. First, one determines the common genes in the in vivo and in vitro datasets. One then takes the scores of differential expression from the in vitro data, finds the corresponding correlation scores (correlation with Cyclin D1) in the in vivo data and examines a scatterplot of the two variables. If the association is linear, then one tests for association using the Pearson correlation coefficient between the two variables. If instead the association appears nonlinear, then one could use a smoothing-spline based test . Such anBefore going further, let us consider the null hypothesis under consideration in the GSEA method, or the variants proposed above. Specifically, in the 0 is true; however, the two permutation schemes developed in the GSEA method do not do this. Permutation of the sample labels fails because the null hypothesis pertains to the population of genes in the two studies and not the relation of samples within a study. Additionally, The alternative hypothesis is that there is an association. In specifying the null hypothesis we uncover a more subtle disadvantage of the GSEA method\u2014the determination of the distribution of the KS test statistic under the null hypothesis. Two variants of permutation testing have been proposed by There is an alternative approach to the GSEA method for integrative analysis of in vitro and in vivo data, which is what we focus on in the rest of the paper. It is based on ideas of classification and clustering since the goal in many genomic studies utilizing high-throughput expression technologies is to develop a signature that can discriminate between relevant classes or groups of samples. In general, demonstration of the predictive or prognostic ability of a classification signature on independent data sets is a crucial step in the validation of that signature . Thus, d0 class as the classification null hypothesis.The alternative is that at least one set of genes derived from the in vitro data is predictive. Notice that this null hypothesis is different from the null hypothesis described for the GSEA method. For clarity, we will refer to H0 class is true, then any set of genes derived from the in vitro expression profile data will have no ability to separate samples in the in vivo expression dataset with regard to a clinical outcome. Thus, we can take random sets of genes from the in vitro data and apply the classification algorithm of interest. If the classification null hypothesis is true, then all sets of genes, including the derived signature, should provide equal prediction performance.An advantage of the classification null hypothesis is that permutation testing becomes possible here. In particular if HThe classification null hypothesis has motivated the following algorithm that we have used in our previous work . Here weDerive a gene signature from the in vitro gene expression data;Select those genes from the in vivo expression data that are included in the in vitro signature and cluster the samples from the in vivo expression data into two groups using hierarchical clustering with average linkage clustering and Euclidean distance;Calculate the log-rank statistic for survival between the two groups of patients;Let L denote the size of the gene list in 1. Randomly choose L genes from the in vitro data as the gene signature. Continue with steps 2 and 3 above.Repeat steps 2\u20134 1000 times. Calculate the proportion of datasets in which the log-rank statistic is greater than the one calculated initially from the signature in step 1.The proportion calculated in step 5 will be the permutation p-value under the classification null hypothesis. This permutation scheme will form the basis of assessing significance for our proposed analytical scheme described in the next section. We note that one could also modify the GSEA procedure in a similar way, as shown in Notice that a limitation of the classification null hypothesis is that the alternative hypothesis states that there exists at least one signature from the in vitro expression data that is predictive in the in vivo expression data. In fact the experimentally derived gene list need not be a unique classifier. It has been recently noted that there are likely many gene signatures that have similar predictive power . It may The paper of The algorithm of To integrate the in vivo data, first map the in vivo samples into the same reduced space of the in vitro samples by again calculating the correlation between each eigenarray and in vivo sample array. To maintain scale in this correlation, the tumor samples are also standardized so that each gene has a mean expression of zero and a unit standard deviation. The distance between the in vivo tumor sample and each of the two consensus signatures, i.e. centroids, is calculated using Pearson correlation. Samples are classified with the experimental condition with whose centroid they correlate best.There are several differences between their and our implementations of TSI. First, in contrast to Since the gene signature on which the classification is based is determined from the in vitro data, and does not use the in vivo data, the statistical significance of any tests on the in vivo data can be accepted without bias. This is an example of using the in vitro data for the training dataset and the in vivo data for the testing dataset. Indeed, if this in vivo validation is not at least marginally significant it is not of interest to proceed further to test the classification null hypothesis.Using the TSI method, we develop a classification scheme from the in vitro signature. The null hypothesis of interest is again the classification null hypothesis as presented above. We thus propose the use of a permutation test to determine the utility of the gene signature in its classification ability. In the following we slightly modify the permutation test procedure described in the previous section to account for gene-gene correlation within the in vitro gene signature. Specifically, as it is likely that genes within a pathway are correlated, it is reasonable to assume that the significantly differentially expressed genes that comprise the in vitro signature are correlated. Finally, the permutation test for the TSI analysis has two interesting attributes against which the classification signature is compared. Specifically, in permuting the data, the TSI scores are recalculated using the randomly selected gene list and with each randomly selected set of genes there is a possibility of unclassified samples. Thus the classification is compared to: (1) the measure of association with predictive factors in vivo, and (2) the percentage of unclassified samples in vivo.For the purpose of demonstration we use, as the in vitro derived signature, the wound healing signature of http://smd.stanford.edu/cgi-bin/publication/viewPublication.pl?pub_no=293) . The data were normalized using loess normalization by print block within array . Sporadic breast cancer expression data and recurrence free survival information . Each of these experiments was normalized by global scaling per array. No imputation was done for missing data in the tumor sample data sets.Localized prostate tumor probe-set level expression measures and recurrence free survival information  were obton van\u2019t  were obtUnigene Cluster ID number was used to map genes between platforms. Annotation information was acquired from SOURCE . If, forThe classifier was built using the CSR in vitro signature and the TSI algorithm, described in the previous section and in 0 class, we wish to see if the in vitro derived CSR signature has prognostic ability in vivo. Thus the prognostic ability of the CSR signature as a classifier was tested using univariate Cox regression; see According to HAccepting the above significant separation of the Kaplan-Meier curves as validation of the CSR signature in vivo, we proceed to test the classification null hypothesis using 1000 random samples from the genes in common between the in vivo and in vitro samples, see As depicted in The breast cancer samples appear to have a more well defined subset of unclassified samples, see One problem encountered in this analysis was the integration of gene expression data across microarray platforms. We attempted to compensate for this numerically by global standardization that centered the array-wise median values at zero. Furthermore, in the TSI algorithm genes were standardized to zero mean and unit standard deviation before being mapped into the reduced space. An additional complication, beyond numerical scaling, is that the differing array configurations between the in vitro and in vivo experiments mean that only those genes with Unigene ID numbers common to both data sets can be considered. This initially excludes ESTs from the in vitro signature as well as other features that do not have Unigene ID numbers. The signature is further reduced by focusing on only the common genes between data sets as determined by Unigene ID. We expect that there is correlation between the genes within the CSR signature and thus the loss of some genes from this signature will be tolerable.The most dramatic decrease in CSR genes available for the analysis was for the Finally, we turn our attention to the permutation testing depicted in 0 class. In the prostate samples, Next, consider the empirical p-value for testing HHere we have discussed the nature of hypothesis testing when integrating gene expression signatures derived from hypothesis driven in vitro studies with gene expression profiles of in vivo tumor samples. Assigning significance to classification results and associations is necessary to evaluate the utility of the in vitro signature in cancer development and progression as found in vivo. However, for accurate assessment of significance it is necessary to consider the underlying null hypothesis that is being tested. Though the permutation test has been widely accepted as a panacea for significance testing we discussed how the permutation must be done with care so that the underlying null distribution is appropriately reconstructed. We provide a method of assessing the classification potential of an in vitro signature using the TSI classifier of Although we have discussed the value of a well defined null hypothesis, the interpretation of the alternative hypothesis comes into play when the null is rejected. In particular, the alternative hypothesis for the classification null hypothesis is that at least one predictive signature exists. The number of such signatures is not known and thus the signature being tested need not be unique. We know from We have remarked at several points about the use of thresholding in the algorithms. Arbitrary thresholds used to select genes that are interesting biologically or signatures that are significant statistically may not always be satisfying. We briefly discussed how the concept of GSEA could be adapted to a regression model that would not require a strict definition of the in vitro gene set of interest. Yet, the TSI-type algorithm that we proposed still used thresholding of the in vitro data to produce a signature. This is not necessary for the sake of the algorithm and classification should still be possible using the entire gene signature of the in vitro samples. Ultimately the classifier is built on the correlation of the in vivo samples to composite signatures for each experimental condition in the reduced space.We again used thresholding in the classification of the in vivo samples by requiring a significant correlation with one of the experimental centroids. The threshold for significance was left at the typical level of p < 0.05, although this could be adjusted to achieve desired specificity and sensitivity in the classifier by dividing the in vivo samples into training and test sets and examining various thresholds. Alternatively, the correlation score could be used as a continuous variable in the Cox regression models. In this way those samples that were not classified in the dichotomous classification would contribute to the model."}
{"text": "P. berghei malaria can successfully be induced in mice by immunization with both radiation attenuated sporozoites (RAS) arresting early during liver stage development, or sporozoites combined with chloroquine chemoprophylaxis (CPS), resulting in complete intra-hepatic parasite development before killing of blood-stages by chloroquine takes place. We assessed the longevity of protective cellular immune responses by RAS and CPS P. berghei immunization of C57BL/6j mice. Strong effector and memory (TEM) CD8+ T cell responses were induced predominantly in the liver of both RAS and CPS immunized mice while CD4+ T cells with memory phenotype remained at base line levels. Compared to unprotected na\u00efve mice, we found high sporozoite-specific IFN\u03b3 ex vivo responses that associated with induced levels of in vivo CD8+ TEM cells in the liver but not spleen. Long term evaluation over a period of 9 months showed a decline of malaria-specific IFN\u03b3 responses in RAS and CPS mice that significantly correlated with loss of protection . The reducing IFN\u03b3 response by hepatic memory CD8+ T cells could be boosted by re-exposure to wild-type sporozoites. Our data show that sustainable protection against malaria associates with distinct intra-hepatic immune responses characterized by strong IFN\u03b3 producing CD8+ memory T cells.Protection against  Plasmodium infected mosquitoes that inject sporozoites into the skin. These sporozoites travel to the liver for further development and released as blood-stage parasites that are responsible for clinical malaria Malaria is transmitted to the host through bites of P. berghei sporozoites.Sterile protection against malaria by whole sporozoites is thought to be mediated by hepatic CD8+ T cell responses. The expansion of CD8+ T cells with memory phenotype, identified by the high expression of CD44, as well as high production of IFN\u03b3 have been shown to associate with protection by RAS P. berghei ANKA sporozoites (Pbspz) according to RAS or CPS protocols (EM: CD44hiCD62L\u2212) and without obvious alterations in the central memory (TCM: CD44hiCD62L+) pool  or low (10 K/10 K/10 K) dose of rotocols . Inducedrotocols . Both RAL+) pool . In spleBoth high (50 K/20 K/20 K) and low (10 K/10 K/10 K) immunization doses with either RAS or CPS regimes induced complete protection in 100% of the mice . All na\u00efEM cells. Prior to challenge (C-1) the proportion of CD8+ TEM cells was higher in PBMC, HMC and splenocytes of RAS-compared to CPS immunized mice  while the post-immunization profile remained stable in CPS immunized mice. Overall, CD8+ but not CD4+ TEM cells, only from liver but not spleen or peripheral blood remained significantly higher in immunized versus na\u00efve mice. Interestingly, CD8+ TEM cells from na\u00efve mice significantly increased during fatal infection up to day 6 post-challenge (p\u200a=\u200a0.008), most strikingly in the liver but also in spleen and peripheral blood. All data combined indicate the strongest memory T cell responses to be generated intra-hepatically.We next studied the effect of challenge infections on the dynamics of CD4+ and CD8+ Tzed mice . There wex vivo stimulated with cryo-conserved P. berghei sporozoites. CD8+CD44hi T cells of RAS and CPS mice show similar IFN\u03b3 responses albeit somewhat higher in the liver than in the spleen (ex vivo IFN\u03b3 response to Pbspz while the positive control stimulation with PMA and ionomycin resulted in percentage of responding cells similar to immune mice (data not shown).IFN\u03b3 responses of CD8+ T cells with memory phenotype (CD44hi) induced by RAS or CPS immunization was assessed 21 days following challenge at day 41 (C+21). Freshly isolated HMC and splenocytes were e spleen . Liver aEM were assessed 3, 6 or 9 months following the last immunization by three doses of 10 K sporozoites. Analysis of the memory pool showed compared to na\u00efve mice, sustained and significantly high levels of CD8+ T cells with effector memory phenotype up to 9 months post- immunization  or infected red blood cells (PbiRBC) were significantly increased, with the highest responses in RAS immunized mice(Pbspz specific IFN\u03b3 response was observed over a 3 to 9 months post-immunization period (We further explored the differences in antigen exposure of RAS and CPS protocols (tested by serology) and assessed the longevity of IFN\u03b3 response by hepatic CD8+ T cells. While concentrations of anti-sporozoite specific IgG antibodies were equal in all immunized mice, only the CPS protocol as expected induced anti-blood-stage specific IgG antibodies . Challenized mice. Howevern period . In cont2\u200a=\u200a0.60, p<0.0001).Long-term protection was evaluated by challenge at 3, 6 or 9 months post immunization. While RAS protocol induced 100% protection at all time points, CPS-induced protection was reduced from 100% (t\u200a=\u200a3 and 6 months) to 50% (t\u200a=\u200a9 months) . InteresEM cell response could be boosted by re-exposure. In protected mice challenged 3, 6 or 9 months after immunization, levels of liver CD8+ TEM showed at day 21 after individual challenge infections a significant increase in proportion of CD8+ TEM .We finally investigated whether decreased liver CD8+ TCD8+ TEM . MoreoveCD8+ TEM . AlthougP. berghei RAS and CPS immunization, similar T cell responses are induced with increase of predominantly the CD8+ T cell pool with memory phenotype in liver, and to a lesser extent in spleen and PBMC. The composition of the CD4+CD44hi T cell pool remains relatively unaffected. The observed changes after RAS immunization corroborate data from previous studies showing clear liver CD8+ TEM cells responses with modest expansion of spleen cells and PBMC EM cells with IFN\u03b3 as one of the main actors. Further long term evaluation of RAS or CPS induced immune responses and protection clearly shows that up to 9 months after immunization, malaria specific IFN\u03b3 response declines despite sustained high levels of liver CD8+ TEM cells. This waning IFN\u03b3 response significantly correlates with loss of protection observed in CPS mice 9 months after immunization . In a previous study by Jobe et al P. berghei RAS immunization was shown to induce liver IFN\u03b3-secreting CD8+ T cells still measurable at high levels upon re-challenge 6 months after the first challenge infection. While these findings are in line with our post-challenge observations, our pre-challenge data show that in its natural course, CD8+ T-cell mediated protective immune response declines over time yet remains detectable months after immunization prior to boost by re-exposure.The present study highlights the essential role of IFN\u03b3 response by liver memory CD8+ T cell for the longevity of protection against malaria. After both loCD11ahi T cells in peripheral blood loCD11ahi T cells were however not sufficient to induce protection. Similar findings were reported by Friesen et al, showing equally high levels of PBMC CD8aloCD11ahi T cells in mice immunized by P. berghei RAS or under azythromycin chemoprophylaxis despite protection levels of 40 and 80% respectively loCD11ahi T cells (as shown by others) or CD8+ T cells with classical effector memory phenotype (CD44hiCD62L\u2212) are sufficient to predict protection. On top of quantitative analysis of CD8+ memory T cell responses, the present study supports the predictive value of malaria specific IFN\u03b3 response for longevity of protective immunity.Several studies have addressed protection in murine malaria models with parallel immune responses. Schmidt et al have shown induced and sustained (up to 5 months) CD8+ memory T cell response defined by presence of CD8aP. yoelii parasites induce a more robust protective immune response in mice compared to RAS P. berghei and P. yoeliiOur findings of a more sustained protective immunity induced by RAS compared to CPS are somewhat surprising. As shown by Butler et al., late arresting genetically attenuated \u2018central mediator of protective immune response against malaria\u2019Finally, encouraging long term protection up to 42 ad libitum. All animal studies and procedures were approved by the Ethical Committee on Animal Research of the Radboud University Nijmegen .C57BL/6j mice (6 to 8 weeks old) were purchased from Elevage-Janvier . Mice were housed at the Central Animal Facility in Nijmegen and received a standard diet and water P. berghei (ANKA) sporozoites (Pbspz) were obtained by dissection of the salivary glands of infected female Anopheles stephensi mosquitoes 21\u201329 days after blood meal on infected mice. To obtain radiation attenuated sporozoites (RAS), infected mosquitoes were irradiated at 16,000 rad (Gammacell 1000 137Cs) prior to dissection.Pbspz doses: 50.000-20.000-20.000 or 10.000-10.000-10.000. During CPS immunization, mice received a daily i.p. injection of 800 \u00b5g of chloroquine base starting simultaneously with the first inoculation up to two weeks after the last sporozoite inoculation. Chloroquine disphosphate  was diluted in PBS and administered to both immunized and na\u00efve mice. At the end of the chloroquine treatment and approximately a day before challenge, absence of parasitemia was confirmed by examination of Giemsa-stained slides of tail blood.Mice received three intravenous injections with weekly intervals of two Pbspz. In one experiment, mice were challenged by bites of 5\u201311 infected mosquitoes. Presence of sporozoites in mosquitoes after feeding was confirmed by examination of the dissected salivary glands.Absence of blood-stage parasites prior to challenge was confirmed at the end of the rested phase in all groups. CPS or RAS immunized and na\u00efve mice were simultaneously challenged at day 41 or 3 to 9 months after the last immunization by i.v. injection of 10,000 WT Parasitized red blood cells were identified by Giemsa-stained blood smears on other days from day 3\u201314 and finally on day 21 after challenge. Protection was defined as the absence of blood-stage parasites by day 21 post-challenge. A schematic representation of the experimental design is presented in P. berghei sporozoites or infected red blood cells (iRBC) was performed as described by Bousema et al g RT)and overnight coating of Sterilin ELISA plates  was performed with the equivalent of 40.000 iRBC or 4.000 sporozoites per well. After blocking with 5% milk/PBS, plasma samples were incubated for three hours at room temperature . Rabbit anti-mouse IgG HRP  was used for the detection of IgG antibodies to sporozoites or blood-stage antigens.Antigen extraction from whole Before and after challenge, mice were euthanized by isoflurane inhalation after i.v. injection of 50 IU of heparin. Blood, spleen and liver were collected after perfusion of the liver with 10 ml of PBS. Cell suspensions of liver and spleen were made by passage of the organs through a 70-\u00b5m nylon cell strainer (BD Labware). Liver cells were resuspended in 35% Percoll  and centrifuged at 800 g for 20 min. Liver and spleen erythrocytes were lysed by 5 min incubation on ice in ACK lysing solution. After erythrocyte lysis, HMC and splenocytes were resuspended in PRMI 1640 medium. Isolation of peripheral blood mononuclear cells (PBMC) was performed using Histopaque-1077 (Sigma-Aldrich) according to the manufacturer's recommendation.6 cells were resuspended in cold assay buffer  and incubated for 30 min at 4\u00b0C with the monoclonal antibodies. Cells were fixed with Fix & Perm medium A (Invitrogen) and resuspended in assay buffer for measurement.Five-color staining of PBMC, HMC and splenocytes was performed using monoclonal antibodies purchased by Biolegend: Pacific blue-conjugated anti CD3 (17A2), Peridinin Chlorophyll Protein (PerCP)-conjugated anti CD4 (RM4.5), Alexa fluor 700-conjugated anti CD8a (53\u20136.7), fluorescein isothiocyanate (FITC)\u2013conjugated anti-CD44, allophycocyanin (APC)\u2013 or phycoerythrin-Cy7 (PE-Cy7)-conjugated anti-CD62L (MEL-14). Briefly, 105 cells/well) were co-cultured in complete RPMI 1640 culture medium 4/ml), P. berghei infected red blood cells (iRBC - 5\u00d7106/ml), salivary gland preparations from uninfected mosquitoes or uninfected red blood cells (uRBC - 5\u00d7106/ml). Cells were stimulated at 37\u00b0C/5%CO2 for 24 hours and Brefeldin A (Sigma) was added during the last four hours . As positive control, PMA (100 ng/ml) and Ionomycin (1.25 \u00b5g/ml) (Sigma) were added simultaneously with Brefeldin A. Cells were harvested after 24-hours in vitro stimulation and stained with monoclonal antibodies against CD3, CD4, CD8a and CD44 as indicated above. Fixed cells were stained with APC-conjugated anti-IFN\u03b3 with Fix & Perm medium B (Invitrogen) at 4\u00b0C for 30 min.HMC and splenocytes . p<0.05 was considered statistically significant.Flow cytometry was performed on a 9-color Cyan ADP (Beckman Coulter) and data analysis using FlowJo software . For the analysis of cytokine production, background response to salivary glands or uRBC was subtracted from"}
{"text": "The proportion of mothers who exclusively breastfeed their babies up to 6 months remains low. Determinants of breastfeeding practices have been largely documented in high-income countries. Little evidence exists on possible predictors of breastfeeding behaviors in the Middle East. Our aim was to assess the prevalence of breastfeeding in Beirut and determine the factors that impact breastfeeding behavior in this population.Data for this longitudinal study is nested within a randomized controlled trial (RCT) assessing the impact of a 24-hour hotline and postpartum support film on postpartum stress. Healthy first-time mothers delivering in the capital Beirut between March and July 2009, were interviewed at 1\u20133 days and 8\u201312 weeks post delivery. A multiple logistic regression analysis was used to determine the factors associated with exclusive breastfeeding at 8\u201312 weeks postpartum.The overall breastfeeding rate at 8\u201312 weeks postpartum was 67%. The exclusive breastfeeding rate was 27.4%. Factors associated with exclusive breastfeeding included maternal work , planned pregnancy , intention to breastfeed , source of maternal emotional support  and the use the postpartum support video, the hotline service or both .The proportion of healthy first-time mothers who exclusively breastfeed in Beirut is extremely low. Factors associated with breastfeeding behavior are diverse. Future research and interventions should target different levels of the maternal-child pair\u2019s ecosystem.NCT00857051ClinicalTrials.gov,  The health benefits of breastfeeding have been widely cited. Breastfeeding has been shown to protect infants against common acute childhood infections, enhance the immune system, decrease rates of Sudden Infant Death Syndrome (SIDS), promote cognitive development and prevent chronic diseases such as obesity, diabetes mellitus type 1 and 2), asthma and certain pediatric malignancies  and 2, a, notwithFor optimal growth and development, the World Health Organization (WHO) recommends exclusive breastfeeding for the first six months of life, starting in the first half hour after delivery . HoweverUnderstanding the context-specific patterns and determinants of breastfeeding practices is necessary to ensure successful breastfeeding promotion strategies . As suchAlthough various breastfeeding promotion initiatives have been established in Lebanon, breastfeeding rates remain low. According to the 2006 Pan Arab Family Health Survey (PAPFAM), while up to 89% of infants are ever breastfed, only 24% of infants below 4 months are exclusively breastfed. The average duration of breastfeeding is 9 months . One stuTo date, studies that have addressed possible predictors of breastfeeding behavior in Lebanon remain scarce. This paper aims to assess the prevalence of breastfeeding in Beirut and determine the factors that impact breastfeeding behavior in this population. A better understanding of these factors would contribute to a larger academic understanding of the breastfeeding ecosystem in Lebanon, assist breastfeeding promotion agencies and practitioners to implement successful strategies, and catalyze the development of effective breastfeeding-friendly policies.Lebanon is a small middle-income country on the Eastern Mediterranean, with an estimated population of 4 million and a fertility rate of 1.7 . Its popThis was a secondary analysis of data from a randomized control trial (RCT) assessing the impact of a 24-hour hotline service and postpartum support film on postpartum stress among first-time mothers [unpublished data - Osman]. First-time mothers were randomized according to a computer-generated random list into one of four groups . A randomized controlled single-blind design was used. The postpartum support film was recorded on a DVD, the hotline service number was marked on a card and the control group entailed a music CD. All materials were placed in a hard DVD cover and in consecutively-numbered opaque envelopes that looked and felt the same. These were handed to every mother by recruiters who were blinded to their contents.Based on power calculations for the original RCT (see below), a total of 751 primiparous women were contacted: 119 were excluded and 80 refused to participate. 552 women received the baseline interview.The study was conducted between March and July 2009. Trained interviewers conducted a baseline and postpartum assessment of healthy first-time mothers at 1\u20133 days and 8\u201312 weeks post-delivery respectively.Baseline data was collected daily over a 7-week period by 8 recruiters who included midwives and public health graduate students. Recruiters visited participating hospitals daily at same time (8-10am) to include all primipara deliveries that met study inclusion criteria. At each hospital visit, the recruiter reviewed the list of deliveries in the last 24 hours and visited every woman who met the inclusion criteria in her room. Written informed consent was obtained from each prospective participant. A 3-minute baseline interview was conducted to gather information about the woman\u2019s socio-demographic status, her health and that of her baby as well as her pregnancy, delivery experience and intent to breastfeed.Fourteen assessors were trained to conduct the postpartum interview. Interviews were conducted face to face at women\u2019s homes when possible. Telephone assessments were conducted when assessors were unable to visit women at home. The postpartum interview lasted between 30 to 50 minutes. It included questions about general health, infant health and care, breastfeeding attitude and behavior, marital life, employment and perceptions of self-efficacy and social support. In addition, screening tests for postpartum anxiety and stress as well as postpartum depression were conducted.All first time mothers delivering within participating hospitals were eligible for inclusion in the study. They were excluded if they had any of the following characteristics: 1) multiple or complicated gestations, 2) chronic diseases requiring daily management such as cardiovascular diseases, hypertension, diabetes, or thyroid diseases, 3) infant in the neonatal intensive care unit, or 4) they were planning on leaving Lebanon before the time of assessment.The outcome of this study was exclusive breastfeeding at 8 to 12 weeks postpartum. It was categorized into exclusive breastfeeding and non-exclusive breastfeeding (consisting of complementary feeding and infant milk formula). As per the WHO definition, exclusive breastfeeding was defined as giving no other food or drink, not even water, except breast milk (including milk expressed or from a wet nurse) but allows the infant to receive oral rehydration solution (ORS), drops and syrups .Based on a thorough literature review, a set of factors was selected to assess their associations with the outcome Table\u00a0. These iSample size was calculated based on the aim of reducing the PSS-10 mean by 4 points in the original RCT. The mean score for the PSS-10 was found to be 18.3, with a standard deviation of 4.9 in the validation study among postpartum women in Lebanon. Based on the assumption that 50% would watch the film, the mean for the intervention group was considered to be 16.3. Therefore, 126 women were needed in each arm with an alpha of 0.05 and a power of 90%. Accounting for 10% loss to follow-up, 140 women were needed for each arm. Although these power calculations were conducted for the original RCT, they are similarly adequate for this cross-sectional study given the multiple outcomes tested and allowed for.The statistical package for social sciences (SPSS) version 16 was used. Descriptive statistics were done to examine variability of all chosen factors and to decide on bracketing  on March 5, 2009. Applications were also submitted and approved by ethical review boards of participating hospitals when required.A total of 751 primiparous women were approached to participate with a 74% enrollment rate (119 were excluded and 80 refused to participate). There were no significant differences between the socio-demographic characteristics of women who participated and those who refused (data not shown). Of the 552 women who received the baseline assessment, 452 (82%) completed the postpartum questionnaire and 100 (18%) were lost to follow-up. Of the 452 who completed the postpartum assessment, 325 (72%) had a face-to-face interview and 127 (28%) completed it over the telephone. There were no significant differences between the socio-demographic characteristics of women who were assessed and those who were lost to follow up.The majority of women had secondary education and above (70.8%), with slightly over half of them 51.2%) having reached university. Around sixty percent were unemployed and reported a household monthly income of over 1 million Lebanese pounds . Most women did not report any health problem in the postpartum period. However, the prevalence of stress, anxiety and depression symptoms was relatively high . The large majority of newborns was term (91.4%) and close to half (46.3%) was delivered by C-section. The largest percent of mothers intended to exclusively breastfeed (87.1%) (Table\u00a0% having Most (67%) mothers were breastfeeding at 8\u201312 weeks postpartum. Only 27.4% of mothers were exclusively breastfeeding at that time, 39.6% were giving both breast milk and infant formula while 33% were giving infant formula only.p-value= 0.092 and 0.068, respectively). Factors significantly associated with exclusive breastfeeding included maternal age, employment and monthly household income, gestational age and mode of delivery, intention to breastfeed at the time of delivery, baby\u2019s health and main source of emotional support for the new mother.Various factors were tested for their association with exclusive breastfeeding Table\u00a0. These wp-value= 0.003) compared with 30.4% of younger mothers. Only 13.8% of working mothers exclusively breastfed compared with 35.8% of non-working mothers . Interestingly, 18.2% of those whose monthly household income was more than 2 million Lebanese Pounds  exclusively breastfed their infant compared with 33.3% of those whose monthly income was below 1 million Lebanese Pounds (around 600 US Dollars) . Only 11.1% of mothers of preterm infants exclusively breastfed compared with 27.1% of mothers of term infants . 22.2% of those who underwent a C-section exclusively breastfed compared with 32.5% of those who underwent a vaginal delivery .41.2% of mothers whose ages were between 20 and 24 exclusively breastfed their infant . 30% of women who intended to exclusively breastfeed at the time of delivery were doing so, compared to 6.9% of those who did not intend to. A significantly higher proportion of mothers who did not report any health problems in their newborn breastfed exclusively compared to those who reported that their babies had health problems .Intention to exclusively breastfeed was strongly associated with exclusive breastfeeding .21.1% of women who identified their mothers as their main source of emotional support exclusively breastfed compared with 31.8% of women who reported their husbands or others as their primary source of emotional support (Maternal work, intention to breastfeed, pregnancy planning, source of emotional support and the intervention arms were significantly associated with exclusive breastfeeding Table\u00a0. Non-worThis study confirms the low prevalence of exclusive breastfeeding at 8\u201312 weeks postpartum in a representative sample of women in Beirut. The large majority of the mothers in this study were not exclusively breastfeeding at 8\u201312 weeks postpartum. Prevalence of exclusive breastfeeding at 6 months postpartum is likely to be even lower. This finding is similar to findings from other developing countries demonstrating the low adherence to the WHO breastfeeding guidelines ,27. In LIn this study, almost all mothers intended to exclusively breastfeed, similar to observations in neighboring countries such as Syria and Jordan . The facThe large C-section rate found in this study was similar to C-section rates in Beirut reported in other studies -33. AlthThe hotline service instituted as part of the original RCT also had a significant impact on exclusive breastfeeding. Women who used the hotline were almost four times as likely to exclusively breastfeed. This may indicate the need for more awareness and/or support to breastfeeding mothers. In today\u2019s ever-growing time constraints, our result emphasizes the value, for women\u2019s health practitioners, of simply taking the time to answer a question. Given that the hotline issues addressed were not restricted to breastfeeding, it would be interesting to investigate whether the impact of a \u201cbreastfeeding hotline\u201d would be greater. If so, a national hotline could prove to be a cheap and feasible way to raise breastfeeding rates.The restriction of participants to healthy first-time mothers delivering in Beirut is one limitation of this study. The conclusions reached may not be applicable to the larger Lebanese population, especially given the likely differences in breastfeeding practices among urban and rural mothers . FurtherThe proportion of healthy first-time mothers who exclusively breastfeed in Beirut is extremely low. This evidence is a timely reminder that much has yet to be done to promote breastfeeding in Lebanon. Understanding its determinants is a first step towards developing successful interventions and policies. This study has found that maternal employment status, intent to breastfeed and baby\u2019s gestational age and physical health are significantly associated with exclusive breastfeeding. The diversity of these factors dictates an ecological approach to breastfeeding promotion. Multi-faceted interventions across different levels of the maternal-child pair\u2019s ecosystem are likely to be the most effective. Beyond the epidemiology of breastfeeding, further research is needed to assess which multi-level strategies most effectively raise breastfeeding outcomes.The authors declare that they have no competing interests.HH contributed to the literature review and interpretation of data. MC contributed to the design, analysis and interpretation of data. MS contributed to data collection, management and analysis. RC contributed to the literature review and data analysis. HO contributed to the conceptualization of the study design, analysis and interpretation of data. All authors contributed to the writing of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/13/702/prepub"}
{"text": "The past two years have witnessed unprecedentedly rapid development of organic\u2013inorganic halide perovskite\u2013based solar cells. The solution\u2013processability and high efficiency make this technology extraordinarily attractive. The intensive investigations have accumulated rich experiences in the perovskite fabrication; while the mechanism of the chemical synthesis still remains unresolved. Here, we set up the chemical equation of the synthesis and elucidate the reactions from both thermodynamic and kinetic perspectives. Our study shows that gaseous products thermodynamically favour the reaction, while the activation energy and \u201ccollision\u201d probability synergistically determine the reaction rate. These understandings enable us to finely tune the crystal size for high-quality perovskite film, leading to a record fill factor among similar device structures in the literature. This investigation provides a general strategy to explore the mechanism of perovskite synthesis and benefits the fabrication of high\u2013efficiency perovskite photoactive layer. The recent exploitation of organic\u2013inorganic hybrid perovskite in solar energy conversion arouses new academic curiosity1358AMX3, where A is methylamine, M is metal element and X represents halide element1112132 (M\u2009=\u2009Pb or Sn) and CH3NH3X (X\u2009=\u2009Br or I) with a molar ratio of 1:3. The preparation of CH3NH3PbIx3-Clx film through reaction (1) is a typical example2  and CH3NH3X (X\u2009=\u2009Br or I) with a molar ratio of 1:1, such as the reaction between PbI2 and CH3NH3I for the synthesis of CH3NH3PbI3 (reaction 2)Typically, the perovskite adopts a chemical formula denoted by The reported high\u2013efficiency devices are mostly based on these two reactions163NH3PbIx3\u2212Clx, a precursor solution containing PbCl2 and CH3NH3I with a molar ratio of 1:3 in dimethylformamide (DMF) was prepared (donated as \u201cPbCl2\u2009+\u20093CH3NH3I system\u201d). The mixed solution was then spin\u2013coated on TiO2 compact layer on an FTO\u2013coated glass. The formation of final perovskite film was achieved by annealing at 100\u2009oC for 45\u2009min. X-ray diffraction (XRD) pattern shows typical (110) and (220) peaks centered at 14.1o and 28.4o  of CH3NH3Cl in the film accounts for negligible chlorine left in the final perovskite193, CH3NH2 or neutral CH3Cl, etc. To obtain a definite answer, we managed to separately collect the acidic or basic gases by filtering through acidic or basic media. Fourier transform infrared spectroscopy (FTIR) is used to characterize the vibrational modes of the collected gases in a gas cell. When the gas product was purged through NaOH powder, the spectrum  and 2 peaks cespectrum  shows pe145\u2009cm\u22121 . To confin 2\u2009min . It is aCH3NH3Cl . HoweverCH3NH3Cl  and lite10) and 2 peaks ceoC. The rationality behind this experiment is that HCl and CH3NH2 generated from the precursor film are able to enter into the upper pre-formed perovskite film and react with it. As a consequence, the surface of the perovskite film was observed to turn back to yellow. Furthermore, annealing of the yellow sample can again lead to the formation of the perovskite, indicating that the reaction between PbCl2 and CH3NH3I is reversible. In this case, the reaction depicted by (1) can be more precisely described by equation (3):Because of the generation of gaseous products, we also observed that if the reaction was conducted at a reduced pressure, the reaction would speed up because of the fast removal of the gaseous products. This is a typical characteristic of the solid-state reaction involving gaseous product generation. On the other hand, the reaction rate is greatly decreased when the reaction was performed in an enclosed system where the generated gas is retained in the system, indicating that the escape of gaseous product is a driving force for the reaction. To examine the reversibility of the reaction, we place a perovskite film facing a precursor film. The bottom precursor film was then heated up to 100\u20093NH2 favours the entropy increase and high temperature promotes the forward reaction.Since \u0394G\u2009=\u2009\u0394H\u2009\u2212\u2009T \u00b7\u0394S , the reduction of Gibbs free energy induced by the entropy increase becomes increasingly significant as the temperature increases. Apparently, the release of HCl and CHin situ XRD to probe the crystal structure evolution\u2013associated intermediate chemical reactions. The precursor film was firstly pre-dried at 60\u2009oC. XRD measurement displays several sets of diffraction patterns .To explore the reaction pathways, we apply patterns . First, o and 31.37o can be assigned to the diffractions of CH3NH3PbCl3,2 and CH3NH3Cl has also happened along with the ion exchange as in reaction (5). There is also XRD diffraction peak at 14.02o corresponding to CH3NH3PbI3 observed at this stage, indicating the reaction (6).Second, the peaks at 15.53o, 16.64o, 28.42o and 18.03o cannot be assigned to any perovskite or lead halide; these peaks are presumably associated with the complex intermediate phase that composed of Pb halide and the organic species (Pb-complex)The diffractions at 11.38oC, the typical XRD diffraction pattern , (200), (210) and (300) plane with a cubic structure2 and CH3NH3PbCl3, accompanied by the growth of the diffraction peaks of CH3NH3PbI3  and (8) as indicated in o, 16.64o, and 18.03o gradually disappears as a result of the consumption of Pb for the formation of perovskite at elevated temperature (Another notable observation from the XRD pattern is that the (100) and (200) diffraction peaks downshift continuously during the annealing at 100\u2009oC , which cperature .Ea) of the reaction. To obtain Ea, we first of all explore a parameter that can quantify the reaction rate. Considering the nature of the solid-state reaction, the gas release speed is associated with the reaction rate. If we assume that the overall reaction is described by reaction (9) below, a complete transformation to the perovskite leads to a weight loss of 17.9% as the gaseous products escape. This complete transformation to a pure-iodide based perovskite is reasonable since prolonged heating often results in undetectable chlorine content, both observed in our investigations and in the literatureThe kinetic factor that influences the reaction rate is usually reflected by the activation energy  of reaction (9), the precursor solution was pre-dried at 80\u2009 mixture . Subseques 15.2% , which iRr) against time (t) to determine the order of the reaction. The constant reaction rate as a function of time (Rr\u2009=\u2009k (k is the rate constant of the forward reaction). The natural logarithm form of Arrhenius equation can be expressed by formula (10).We thus plot the reaction rate  \u22121/T plot , (5) and (6) are nearly instantaneously occurred after drying at 60\u2009oC. The calculated Ea represents required energy for the conversion of Pb-complex, CH3NH3PbCl3 (reaction d), CH3NH3PbI3\u2212xClx (reaction e), to CH3NH3PbI3.where 1/T plot  we can c3NH3PbI3 displays zero-order reaction characteristics.Since the conversion towards final all-iodide perovskite is reversible and involves gaseous products generation, the increase in reactant would increase the distance for the gases diffusion out of the film. Furthermore, the increased diffusion length would increase the back reaction. An overall result is that the reaction rate did not show increment along with the increase of reactant amount. This is the reason why the formation of CH2 and CH3NH3I as the precursors, the reaction between PbI2 and CH3NH3I is conducted in a 1:1 ratio to generate CH3NH3PbI3 without chlorine doping (denoted as \u201cPbI2\u2009+\u2009CH3NH3I system\u201d). The electronic properties of the two kinds of perovskites and their film formability are quite different2622 and CH3NH3I at 60\u2009oC, the yielded light yellow powder was heated at elevated temperature to facilitate the reaction. The weight loss of the reaction was found to be 10.2% (Different from the perovskite synthesis using PbClbe 10.2% . From thRr (at constant temperature of 110\u2009oC) against t to determine the order of the reaction \u2009\u2013\u20091/T plot (2\u2009+\u20093CH3NH3I system (69\u2009kJ mol\u22121). For the analysis of Ea, we characterized the dried mixtures of the two systems. It was found that the \u201cPbCl2\u2009+\u20093CH3NH3I\u201d system forms poor crystallized product while the \u201cPbI2\u2009+\u2009CH3NH3I\u201d system forms better crystallized material according the XRD characterization , the PCE can reach 12.26%, with a short-circuit current density (Jsc) of 19.66\u2009mA cm\u22122, an open-circuit voltage (Voc) of 1.00\u2009V, and a fill factor (FF) of 0.62. The average PCEs and standard deviations based on over twenty devices of each set are summarized in 2 and CH3NH3I as the precursors (device 2) leads to a PCE of 4.29%, with Jsc of 13.14 mA cm\u22122, Voc of 0.82 V and FF of 0.40. When using the mixture of lead precursors with CH3NH3I:PbCl2:PbI2 of 1.5:0.25:0.75 (device 3), 2.0:0.5:0.5 (device 4) and 2.5:0.75:0.25 (device 5), the PCEs are 13.78%, 15.00% and 13.05%, respectively. In the device fabrication, we found that to maintain 1:3 ratio between PbCl2 and CH3NH3I and 1:1 ratio between PbI2 and CH3NH3I in the precursor is crucial for the high\u2013quality photoactive films.The photocurrent density-voltage responses of the devices  and the 3, 4, 5) with films prepared by using mixed PbCl2 and PbI2 sources are larger than that of the two devices fabricated using only PbCl2 or PbI2 as the lead precursor. The FF for the optimal device reaches 0.72 (device 4). FF is a parameter that reflects the quality of the device and is associated with the total resistance of the devices. The FFs of the devices based on the planar heterojunction , 1:0:1 , 1.5:0.25:0.75 (device 3), 2:0.5:0.5 (device 4) and 2.5:0.75:0.25 (device 5). The total concentration of lead salt in each solution was kept at 0.88\u2009M.All materials were purchased from commercial suppliers and used as received unless stated otherwise. CH\u22121 was washed by sonication with deionized water, ethanol and acetone and then treated with oxygen plasma for two minutes. A compact layer of TiO2 was deposited on the FTO substrate by spin-coating the titanium precursor (0.24\u2009M titanium isopropoxide and 0.12\u2009M HCl in ethanol) at 5000\u2009r.p.m. for 60\u2009s following by calcination on a hotplate at 500\u2009oC for 40\u2009min. Subsequently, the perovskite solution was spin-coated on the cooled TiO2/FTO substrate in a nitrogen-filled glovebox at 3000\u2009r.p.m. for 60\u2009s. It was annealed on a hotplate at 100\u2009oC for the reaction and crystallization of the perovskite. The optimized annealing time for the above-mentioned five precursors is 45\u2009min, 10\u2009min, 15\u2009min, 23\u2009min and 33\u2009min, respectively. Then, the HTM, spiro-OMeTAD, was deposited by spin coating a solution  and 26.3\u2009\u03bcL lithium-bis(trifluoromethanesulfonyl)imide (Li-TSFI) stock solution (520\u2009mg mL-1 in acetonitrile) in 1\u2009mL chlorobenzene) at 5000\u2009r.p.m. for 60 s. After oxidizing the HTM layer in air for 15\u2009h, the cell was completed by thermally evaporating a 100\u2009nm-thick silver layer.FTO-coated glass with sheet resistance of 14 \u03a9 sq\u22121. 25\u2009\u03bcL perovksite solution containing CH3NH3I and PbCl2 of a molar concentration of 2.64\u2009M and 0.88\u2009M (mass percentage 42%) was held at 80\u2009oC in a ceramic crucible for 150\u2009min until the weight kept unchanged. A weight loss of 56% meant that DMF nearly totally evaporated. Then the remaining solid was heated from 80\u2009oC to 180\u2009oC at a rate of 5\u2009oC min\u22121 during which CH3NH3PbIx3-Clx formed in the reaction  solution was held at 60\u2009oC until the solvent DMF was totally evaporated. Mass loss of 60% meant that one DMF molecule is possibly binding with one Pb atom in the remaining solid. Then the yielded light yellow solid was heated from 60\u2009oC to 110\u2009oC and held at 110\u2009oC till the complete reaction , the readily spin-coated perovskite film on TiO2/FTO substrate was transferred from a glovebox into an XRD characterization cell which was filled with nitrogen. The temperature of the characterization cell was held at 60\u2009oC at first and then increased to 100\u2009oC and kept for 50\u2009min until the complete formation of CH3NH3PbI3. During this annealing stage, in situ XRD characterization  was performed from 10 degree to 50 degree (2\u03b8) at a speed of 5 degree/min at a condition of 40\u2009kV and 80\u2009mA. The characterization process was repeated every ten minutes to monitor the phase change during the annealing stage.For the \u22121 from 10 degree to 70 degree (2\u03b8)  .\u22121. Two probes mounted on the micropositioners were put in touch with the FTO and the silver electrodes, respectively. A scanning voltage from \u22120.2\u2009V to 1.2\u2009V was applied across the two electrodes at a step of 0.05\u2009V and the corresponding current was recorded. All the cells had an active area of 0.12\u2009cm2 defined by the silver electrode.The J-V characterization of the solar cells was conducted in a nitrogen-filled glovebox under the luminescence of AM 1.5\u2009G solar-simulated light with an intensity of 100\u2009mW cmThe incident photon current efficiency (IPCE) of the cells was characterized in air under the luminescence of monochromatic light from 300\u2009nm to 800\u2009nm in a DC mode without bias light. The output current of the cell was record at each wavelength. With the incident light powder known, the conversion efficiency from incident photons to the output charges was thus calculated for the whole spectrum.Rr) of the PbCl2\u2009+\u20093CH3NH3I system was derived by taking a derivative on the weight of the reactant as a function of time at an isothermal temperature of 150\u2009oC. The calculated reaction rate was 0.004\u2009mg min\u22121 and gradually decreased to 0.003\u2009mg min\u22121 after 150\u2009min which could be considered as constant. It should be noted that the amount of the reactant is significantly larger than that in the device fabrication, so the required time for completing the reaction becomes much longer. On the other hand, with the generation of product in a solid-state reaction, the diffusion time of reactants becomes longer and longer, the apparent reaction rate thus becomes slower and slower.The reaction rate \u2009\u2013\u20091/T plot (k represents the reaction rate constant and T is thermodynamic temperature). Since the reaction between CH3NH3I and PbCl2 is a zero order one, then we can write A is the pre-exponential factor and R is the universal gas constant) based on Arrhenius equation. The reaction rate was calculated within a temperature range from 120\u2009oC to 150\u2009oC. For the reaction of the PbI2\u2009+\u2009CH3NH3I system, we can write that W respresents the weight of the reactant since this is a first-order reaction. The data for plotting ln(k)\u2009\u2013\u20091/T is in the temperature range between 70\u2009oC and 100\u2009oC.The activation energy of the above two reaction systems was calculated from the fitted slope of ln."}
{"text": "This approach was applied to DW samples collected from 15 households serviced by a chloraminated distribution system, with homes located in areas representing short (<24\u00a0h) and long (>24\u00a0h) distribution system residence times. Multivariate statistical analysis revealed that greater water age  was associated with a greater relative abundance of Mycobacterium avium subsp. avium, one of the most prevalent NTM causing infections in humans. DW from homes closer to the treatment plant (with a shorter water age) contained more diverse NTM species, including Mycobacterium abscessus and Mycobacterium chelonae. Overall, our approach allows NTM identification to the species and subspecies levels and can be used in future studies to assess the risk of waterborne infection by providing insight into the similarity between environmental and infection-associated NTM.Nontuberculous mycobacteria (NTM) frequently detected in drinking water (DW) include species associated with human infections, as well as species rarely linked to disease. Methods for improved the recovery of NTM DNA and high-throughput identification of NTM are needed for risk assessment of NTM infection through DW exposure. In this study, different methods of recovering bacterial DNA from DW were compared, revealing that a phenol-chloroform DNA extraction method yielded two to four times as much total DNA and eight times as much NTM DNA as two commercial DNA extraction kits. This method, combined with high-throughput, single-molecule real-time sequencing of NTM  rpoB genes, was used for high-throughput characterization of NTM species and in some cases strains in drinking water (DW). The extraction procedure recovered, on average, eight times as much NTM DNA and three times as much total DNA from DW as two widely used commercial DNA extraction kits. The combined DNA extraction and sequencing approach allowed high-throughput screening of DW samples to identify NTM, revealing that the relative abundance of Mycobacterium avium subsp. avium increased with water age. Furthermore, the two-step barcoding approach developed as part of the PacBio sequencing method makes this procedure highly adaptable, allowing it to be used for other target genes and species.An extraction method for improved recovery of DNA from nontuberculous mycobacteria (NTM), combined with single-molecule real-time sequencing (PacBio) of NTM  Management of the microbial quality of drinking water (DW) is aimed primarily at minimizing illness caused by waterborne pathogens. The increasing prevalence of infections due to nontuberculous mycobacteria (NTM) \u20134, combi\u20135\u2013Mycobacterium avium and Mycobacterium abscessus) (Mycobacterium frederiksbergense and Mycobacterium aurum) (Only a few of the >150 NTM species that have been described  cause inscessus) , 10, 13,m aurum) , 15. MolrpoB and hsp65, is required to differentiate NTM species, as even full-length 16S rRNA gene sequences do not provide the resolution needed for discrimination to the species and subspecies levels  with low error rates. The high guanine-cytosine content of NTM genomes  providesIn this study, we sought to determine if single-molecule real-time sequencing with the PacBio platform  could overcome these obstacles. This platform achieves long read lengths  with low error rates when used in conjunction with the circular consensus sequencing (CCS) approach, making it possible to distinguish single nucleotide polymorphisms (SNPs) and allowing, in some cases, strain level differentiation \u201329. Comb\u2013P < 0.001), as determined by measuring NTM abundances by quantitative PCR (qPCR) targeting the atpE gene  and NTM abundances (P = 0.045) . Likewise, there was no significant difference in the total bacterial, NTM, and Pseudomonas abundances obtained with increased bead-beating times (from 45\u00a0s to 2\u00a0min to 5\u00a0min) by either PC1 or PC2 (Two phenol-chloroform methods (designated PC1 and PC2) and two commercially available DNA extraction spin kits (FastDNA and Maxwell)  were comtpE gene . Howevermparable . PC2 emp= 0.045)  than the= 0.045)   with 10.1128/mBio.02354-17.1TEXT\u00a0S1\u00a0TEXT\u00a0S1, PDF file, 0.04 MB.Extraction efficiency calculation. Download Copyright \u00a9 2018 Haig et al.2018Haig et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the rpoB primers  and subspecies of Mycobacterium fortuitum and Mycobacterium mucogenicum , were correctly identified as M.\u00a0avium subsp. avium and M.\u00a0chelonae . The DS water residence times of these homes varied from 11 to 113\u00a0h according to the city\u2019s hydraulic model. Homes were divided into groups near (<24-h DS residence time) and far from (>24-h DS residence time) the DW treatment plant, corresponding to low and high water ages , respectively.rpoB gene sequences per sample. The number of NTM OTUs present in DW samples ranged from 4 to 10 (see M.\u00a0abscessus) and slowly  growing species and including three distinct strains of M.\u00a0chelonae and two strains of M.\u00a0mucogenicum (P = 0.057), as measured by using the Shannon index   NTM o 10 see . Overallogenicum . There wndex see . DW samp \u00b1 0.09) . M.\u00a0aviu10.1128/mBio.02354-17.3TEXT\u00a0S3\u00a0TEXT\u00a0S3, PDF file, 0.05 MB.Combined qPCR and PacBio data. Download Copyright \u00a9 2018 Haig et al.2018Haig et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the P = 0.001), with water age explaining 81% of the difference (P = 0.03). The residual monochloramine concentration (C) multiplied by water age , referred to collectively as Ct, was not a significant parameter in the multivariate model explaining NTM community structure. However, a greater Ct was significantly associated with a greater NTM qPCR abundance (P < 0.001), with the average concentration across all samples corresponding to 6.47 \u00d7 106 \u00b1 1.03 \u00d7 106 NTM atpE gene copies/liter. Further, additional multivariate analysis using estimated M.\u00a0avium subsp. avium concentrations, obtained by combining M.\u00a0avium subsp. avium relative abundances determined by the PacBio sequencing method with NTM qPCR concentrations .Permutational multivariate analysis of variance revealed that the NTM community structures of the two water age groups were significantly different from each other  of NTM species and strains in biomass from 15 DW samples collected from premise plumbing. Concentrations were calculated by combining qPCR and PacBio data. Water age represents the total of water residence time in the DS and the stagnation time in premise plumbing. Download Copyright \u00a9 2018 Haig et al.2018Haig et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the DNA extraction methods impact the abundance and types of microorganisms recovered from complex environmental and biological samples owing to physiological differences among microorganisms and differing extraction efficiencies , 32. GivEukarya, which have complex cell walls, making them difficult to lyse  by the PC2 method was 78.6%, considerably higher than values reported in another study, in which the extraction efficiency did not exceed 43.3% . Hence, fewer sequences needed to be discarded, making this new methodology more economical and effective. Application of the sequencing approach to DW samples revealed 13 NTM species, 5 of which are considered clinically relevant  than in this study  may have been sufficient to result in NTM infections, as previously demonstrated through dose-response models  (Combining relative abundances of NTM determined by the PacBio sequencing method with NTM qPCR concentrations see  suggests102\u00a0CFU) . Since t102\u00a0CFU) .M.\u00a0avium subsp. avium than DW from homes closer to the treatment plant. If supported by future, larger-scale studies, the factors contributing to this intriguing finding can be elucidated. This will, in turn, allow for better estimates of the health risks posed by NTM in DW and will provide a foundation for studies to mitigate this risk.Methods are needed that yield high NTM DNA levels during extraction from low-biomass samples and recover relatively large, phylogenetically informative segments of NTM DNA to advance our understanding of the potential health risks posed by NTM in DW systems. Our use of a DNA extraction method that employs enhanced physical disruption and chemical lysis of NTM cells resulted in considerably greater yields of NTM DNA from DW samples than those obtained with commonly used commercial DNA extraction kits. The development of a two-step barcoding procedure with PacBio sequencing provided a high-throughput method to detect and differentiate NTM present in DW. Applying these methods to DW samples collected from homes receiving municipally treated DW suggests that water age impacts NTM distribution in DW. Most notably, our findings indicate that DW from homes with DS residence times of >24\u00a0h had higher concentrations of From October 2015 to February 2016, 1-liter cold water samples were collected from kitchen faucets after at least 6\u00a0h of stagnation from 15 homes serviced by the Ann Arbor, MI, DW treatment plant. This first 1-liter sample represents the cold water in each home\u2019s plumbing; the minimum premise plumbing volume for the homes sampled was 3.5\u00a0liters. The DW treatment plant obtains raw water from the Huron River (80 to 85%) and from groundwater wells (15 to 20%) and provides lime softening, coagulation, flocculation, sedimentation, ozonation, filtration, and chloramination . The homC) multiplied by water age , referred to collectively as Ct, was calculated for each sample.The temperature, pH, and total and free chlorine concentrations of all samples were measured on site. The average (\u00b1SD) water temperature and pH of the 15 samples were 20.4\u00b0C \u00b1 1.9\u00b0C and 8.6 \u00b1 0.6, respectively. Total and free chlorine concentrations were measured with a DR900 spectrophotometer . The combined chlorine (monochloramine) concentration was estimated by subtracting the free chlorine concentration from the total chlorine concentration. DS residence times for each home sampled were estimated by performing 168\u00a0h (7\u00a0days) of simulations in EPANET  for eachBiomass was filtered from each sample with a 0.2-\u03bcm polycarbonate filter  and stored at \u221280\u00b0C.Pseudomonas, and total bacteria as described below. Subsequently, DNA was extracted from 15 DW samples collected from homes and one mock community by PC2, the phenol-chloroform-based extraction method with 0.09% SDS and 5 min of bead beating.Four DNA extraction methods were tested in triplicate with 1-liter samples of DW from a composite sample of 30 liters of cold water collected from the Environmental and Water Resources Engineering Building at the University of Michigan (Ann Arbor). The four methods tested included the commercially available FastSpin kit for soil  and Maxwell LEV Blood DNA kit  and two variations of a standard phenol-chloroform method (PC1 and PC2) with a modified version of the universal nucleic acid extraction buffer  Table\u00a01Table\u00a01. 10.1128/mBio.02354-17.5TEXT\u00a0S5\u00a0TEXT\u00a0S5, PDF file, 0.1 MB.Detailed extraction procedure used in this study. Download Copyright \u00a9 2018 Haig et al.2018Haig et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the E.\u00a0coli ATCC 15597 at 1.6 \u00d7 107 \u00b1 7.1 \u00d7 106\u00a0CFU/liter or M.\u00a0abscessus ATCC 19977 at 1.4 \u00d7 107 \u00b1 1.1 \u00d7 107\u00a0CFU/liter. The cultures were grown in accordance with ATCC standard procedures. Resulting DNA yields were measured with the Qubit Fluorometer . Final extraction efficiencies were calculated by comparing the measured results to the extraction-independent total cell counts determined by staining with 4\u2032,6-diamidino-2-phenylindole  and visualization with a Zeiss Axio Observer D1 fluorescence microscope . Theoretical DNA yields from E.\u00a0coli and M.\u00a0abscessus cells were calculated as outlined by Dolezel et al. . PCR conditions for NTM and total 16S rRNA gene assays consisted of 40 cycles, whereas the Pseudomonas assay was performed with 35 cycles. Melting curve analysis of the PCR products was conducted following each assay to confirm that the fluorescence signal originated from specific PCR products and not from primer dimers or other artifacts. For all qPCR assays, a linear relationship between the log of the standards\u2019 DNA copy number and the calculated threshold cycle value across the specified concentration range was confirmed . Amplification efficiencies, calculated by the method described by Pfaffl . A phylogenetic tree was plotted with FigTree v1.4.2.MrBayes version 3.2  was usedM.\u00a0avium subsp. avium (DJO-44271) and 5% M.\u00a0chelonae (19237) by a two-step PCR procedure similar to that described in reference rpoB genes were amplified with the newly designed rpoB primers , we employed BLAST (Phylogeny of OTUs in the noncontrol samples was established on the basis of parameters obtained by testing a UPARSE analysis workflow  with theed BLAST  to identrpoB database was generated by downloading all 70,507 currently available bacterial rpoB sequences from GenBank (rpoB sequences. By using the aforementioned workflow, classifications were assigned to OTUs from the experimental samples by using global alignments with USEARCH and an identity threshold of >99.8%.The custom-made  GenBank , identif GenBank . Five yeMycobacterium, Pseudomonas, and total bacterial gene copy numbers obtained by different extraction methods were identified by Wilcoxon tests. Significant differences in the NTM community structure were determined by nonparametric multiple analysis of variance. All statistical analyses were performed with the R statistical software (P\u00a0values of <0.05.Significant differences between the total DNA yields and software , with st"}
{"text": "Mage = 13.7, SD = 0.53; 53.9% girls) and 845 9th grade students at T2  from the initial sample]. Besides direct effects, three cross-lagged over-time paths were found to be significant: students\u2019 perception of peers as positive motivators (PPMs) at the beginning of 8th grade (T1) positively predicts their behavioral school engagement at the end of 9th grade (T2), as well as emotional school engagement at the beginning of 8th grade positively predicts students\u2019 perception of PPMs 1.5 years later. Furthermore, behavioral school engagement at T1 functions as a predictor of a student\u2019s school self-concept at T2.Existing literature evidences the association between adolescents\u2019 school self-concept and engagement, both concepts being related to students\u2019 perception of teachers and peers as motivators. However, few longitudinal studies explore the interplay of these factors. The present study aims to close this gap, applying latent cross-lagged panel design to two-wave data from German adolescent students [1088 8th grade students at T1 ( Figure 1).School engagement is an important factor in a student\u2019s school career, as high engagement levels can enhance academic motivation and achievement , whereasHowever, until today it is not clear whether these relations are in fact reciprocal within and over time through adolescence, or whether there is another clear  order. This study aims to close this research gap and examine the within- and over-time associations of these variables from early to middle adolescence to gain a better understanding of the processes that accompany the trend of adolescents\u2019 decline of engagement in school context. The findings might indicate potential starting points for prevention or intervention strategies to protect students from this downward trend.School engagement is defined as a complex and multidimensional construct , comprisThe self-system model of motivational development  suggestsAs mentioned-above, the Bioecological Theory , 1979, LPositive and motivating relations to peers are associated with an increase in both emotional and behavioral engagement at school . LongituAccording to the Bioecological Model of In sum, the existing body of research suggests that (a) school self-concept, emotional and behavioral school engagement and teachers and peers as positive motivators might associate with one another and (b) that these associations might be bidirectional according to the ideas of the Bioecological Theory and Developmental Contextualism and (c) that they might exist not only within-time but also over-time e.g., .Accordingly, this study follows a cross-lagged panel research design to evaluate the interplay of school self-concept, socio-motivational relations with teachers and peers, and emotional and behavioral school engagement within- and over-time from the beginning of 8th grade to the end of 9th grade in secondary school context. Specifically, it was hypothesized that higher levels of school self-concept and a more positive perception of peers and TPMs would be concurrently and longitudinally related to higher levels of emotional and behavioral school engagement.Mage = 13.7, SD = 0.53; 53.9% girls)] at Time 1 and remaining 845 students  from the initial sample at Time 2 (1.5 years later at the end of 9th grade). This age group was chosen for two reasons: (1) As the school transition to secondary school occurs in Germany in 7th grade, students tend to struggle with the associated intra- and interindividual changes still at the beginning of 8th grade  Furth grade  reachingth grade . The parSchool Engagement measures are based on the Engagement/ Disaffection Scales developed by 1) and the ESE Scale   were comprised of six items each. Although the Cronbach alpha value for the ESE items at T2 was not as high as for the other subscales, parcels can be built according to School Self-Concept (SSC) was addressed by a subscale of SESSKO scales developed by Teachers and Peers as Positive Motivators was assessed using Relationship and Motivation (REMO) Scales (The perception of ) Scales ; (1) TPM2-difference test was estimated using the Satorra\u2013Bentler scaling correction factor , Root Mean Square Error of Approximation (RMSEA), Comparative Fit Index (CFI), Tucker-Lewis Index (TLI) and Standardized Root Mean Square Residuals (SRMR). Respective CFI and TLI values above 0.95 and RMSEA and SRMR values up to 0.08 indicating an acceptable fit of the model. Due to the fact that missing data was completely at random (MCAR) as shown in 2 = 117.35; df = 101; p > 0.05), missing data were handled using full-information maximum likelihood estimation (FIML).We used the TYPE = COMPLEX function in Mplus to consider the classroom nesting of the data, because it supplies corrected standard errors and chi-square values regarding the nested structure of the data (1088 students in 71 school classes) . Model fTable 1. Results from an unconditional latent change model (LCM) , ESE  and PPM . In turn, there was neither a significant mean decrease/increase in TPM  nor in SSC .Bivariate correlations and descriptive statistics are reported in el (LCM)  that inc2(125) = 358.57, p < 0.001; CFI = 0.96, TLI = 0.95, RMSEA = 0.04 (0.04\u20130.05); SRMR = 0.03].Before conducting the cross-lagged panel design, a confirmatory factor analysis (CFA) was run. The CFA showed a good model fit [\u03c7Table 2). Strong measurement invariance over time has been found, supporting the assumption that the constructs remained stable over time and therefore, flavoring the use of cross-lagged panel design  specified an unconditional model  without equality constrains; (2) specified factor loadings as invariant over time ; and (3) set loadings and item intercepts invariant over time   showed a good fit \u03c72(123) = 308.842, p < 0.001, CFI = 0.97, TLI = 0.96, RMSEA = 0.04 (0.03\u20130.05), SRMR = 0.03.The final cross-lagged panel design model  as well as the within-time associations between BSE and ESE  Furthermore, TPM is positively associated with BSE  and ESE . In turn, the association between PPM and BSE  and between PPM and ESE  was significant solely at T1. In addition, the association between SSC and BSE  as well as the association between SSC and ESE  was found to be positively significant. In contrast, there was no significant relation between SSC and PPM neither at T1 nor at T2. In turn, a positive significant association between SSC and TPM was found .The within-time associations between TPM and PPM are positively significant , ESE , TPM , PPM , SSC .The model evidenced positive direct effects of each variable from T1 to T2 supporting the stability of the constructs: BSE . Furthermore, ESE at T1 positively predicted PPM at T2 . In turn, SSC at T1 negatively predicted both ESE  and PPM at T2 .Students\u2019 perception of PPM in early adolescence predicted BSE in middle adolescence  school engagement, whereas this role generally decreases in importance during middle adolescence. This finding is in accordance with research that showed that peers as secondary socialization instance are particularly important in early adolescence, when students turn away from family  and haveIn addition, there was neither a significant within-time association between PPMs and school self-concept at T1 nor at T2. This means that adolescents\u2019 school self-concept is less sensitive to motivational support from peers compared to motivational support from teachers (see above). This may be due to the fact that teachers in their institutional role possess more opportunities to promote a student\u2019s academic self-concept: TPMs may not only satisfy students\u2019 affiliative needs, but also support the needs of competence and autonomy by clear set goals, well-articulated expectations, meaningful instructions and empowerment . In turnOverall, our two-wave cross-lagged panel design study showed that the within-time interplay between school self-concept, behavioral and emotional school engagement as well as students\u2019 perception of peers and TPMs tend to be stronger in early adolescence at the beginning of 8th grade than in middle adolescence at the end of 9th grade. This might be explained by a growing need for autonomy from adults during middle adolescence  and incrIn particular, the role of PPMs seems to loose impact from early to middle adolescence: while PPMs were positively associated with both behavioral and emotional school engagement at T1 and positively associated over time with behavioral school engagement, there was no significant association of PPMs and behavioral school engagement at T2. However, there was a positive over-time association between emotional school engagement at 8th grade and students\u2019 perceptions of PPMs at the end of 9th grade, not only supporting the existing findings that these two factors positively associate , but alsIn sum, our findings underline the relevance of Bronfenbrenner\u2019s Bioecological Theory and Lerner\u2019s Developmental Contextualism in the explored interplay in a short-term perspective, such as peers and teachers play differentiated roles for different aspects  at different times during adolescence and vice versa. In other words, the development of adolescent students\u2019 school engagement is embedded in complex dynamics between a student\u2019s sense of their own abilities in school and their motivational relationships with peers and teachers within-time, although no relation between the variables is bidirectional over-time. Therefore, fostering both students\u2019 school self-concepts as well as their motivational relations with peers and teachers might benefit their emotional and behavioral school engagement and vice versa in the course of adolescence, whereas the beneficial effect is greater the earlier it starts.The current research evidences several theoretical and methodological limitations. First, although students\u2019 subjective perceptions were at the heart of the study, self-report is often subject to criticism. However, some authors  claim thAt the same time, the current study evidences a number of strengths. Firstly, it focuses on absolute school self-concept, allowing practical interventions through school psychologists, as impact on only one aspect of school self-concept within school environment  might induce negative changes in the counterpart e.g., . Secondlhttp://bravors.brandenburg.de/verordnungen/wissuv_1998) with written informed consent from all subjects. All subjects gave written informed consent in accordance with the Declaration of Helsinki. The protocol was approved by the Ministry of Education, Youth and Sports of Brandenburg.This study was carried out in accordance with the recommendations of the guidelines of the Ministry of Education, Youth and Sports of Brandenburg (All authors agree to be accountable for the content of the work. OB did the statistical analyses and wrote the main part of the paper. DR assisted with the statistical analyses and reviewed the paper, contributed decisively to the discussion part and added comments on the manuscript throughout the process of manuscript development.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "MATa and MAT\u03b1), the protein kinase A (PKA) and target of rapamycin complex I (TORC1) signalling pathways integrate at the promoter of the master regulatory transcription factor IME1 to control sporulation via nutrient availability , however, IME1 is repressed by transcription through the IME1 promoter of a long non-coding RNA called IRT1, which prevents this cell type from undergoing sporulation. Here, we investigated the role of nutrient signalling in mating-type control of IME1. We find that expression of IRT1, like IME1 itself, depends on nutrient availability and the activities of PKA and TORC1. IRT1 transcription is repressed when nutrients are ample and TORC1 and PKA are active. In contrast, inhibition of PKA and TORC1 is sufficient to recruit Rme1 to the IRT1 promoter and induce IRT1-mediated repression of IME1. Finally, we provide evidence that IRT1 and IME1 are co-repressed by the Tup1\u2013Cyc8 complex when nutrients are ample. Thus, in cells with a single mating-type nutrient availability regulates mating-type repression of IME1 and sporulation. Our results indicate that there is a hierarchy between nutrient and mating-type signals in controlling the decision to enter sporulation.Cell fate decisions are controlled by multiple cell-intrinsic and -extrinsic factors. In budding yeast, the decision to enter gametogenesis or sporulation is dictated by nutrient availability and mating type. Recently, we showed that in diploid cells harbouring opposite mating types ( Cell fate decisions are regulated by a multitude of intrinsic and extrinsic signals. How multiple signals are integrated to make a binary cell fate choice is often not well understood.Budding yeast gametogenesis or sporulation is an ideal model system to study this problem. When the signal requirements to enter sporulation are met, cells induce a gene expression cascade to generate four haploid spores from a diploid cell , are active , represses the transcription of RME1 (Mitchell and Herskowitz MATa or MAT\u03b1), however, exhibit high levels of Rme1 which in turn represses IME1 via an unusual mechanism . The mating-type locus (HMR) was used as a non-binding negative control. Primer sequences are available on request.Chromatin immunoprecipitation experiments were executed as described previously  that was described previously and the TORC1 inhibitor rapamycin  . Interestingly, the levels of IRT1 were significantly higher when tup1\u0394 cells were grown to high density (OD600\u00a0~\u00a010). We conclude that Tup1\u2013Cyc8 contributes to IRT1 repression.Having established that TORC1 and PKA control IME1, IRT1 (at least in part) is regulated by Tup1\u2013Cyc8. How Tup1\u2013Cyc8 represses both IRT1 and IME1 remains unclear. Promoter scanning showed that Tup1 binding peaked in the middle of the IME1 promoter , we propose that Tup1\u2013Cyc8 establishes a repressive chromatin state at the IME1 promoter that spreads to the IRT1 promoter. Our observation that IRT1 expression was further induced during post-diauxic shift in tup1\u0394 cells suggests that Tup1\u2013Cyc8 is not the sole repressor of IRT1 and other factors may also contribute. Another explanation is that the activator of IRT1, Rme1, is regulated by nutrient availability. It is known that Rme1 levels are cell cycle regulated, peaking during late M/early G1  as IME1. In addition, we provide evidence that IRT1 and IME1 are under control of the same repressor complex, Tup1\u2013Cyc8. These findings have several implications. First, they show that mating-type control of IME1 is not active when nutrients are ample (Fig.\u00a0IME1 and IRT1 could serve as a fail-safe mechanism for mating-type control of IME1. Indeed, it has been known that mating-type control of sporulation is essential for preventing haploid cells to enter meiosis, which would be lethal as two consecutive cell divisions would attempt the segregation of a haploid genome into four spores. If IRT1 and IME1 were under control of different signalling pathways and different transcriptional repressors, this could have led to a mis-regulation of mating-type control of IME1. Our observation that IME1 and IRT1 expressions are regulated by the same nutrient sensing pathways and by the same transcriptional repressor complex ensures that IRT1 is activated at the same time when the nutrient requirements for IME1 are met and vice versa. Overall, we propose that the hierarchy between nutrient and mating-type signals ensures that diploid, and not haploid, cells induce IME1 and enter sporulation.It has been known for decades that nutrient availability and mating type are key regulators of ple Fig.\u00a0. In othe"}
{"text": "Several congenital and acquired conditions may result in severe narrowing of the urethra in men, which represent an ongoing surgical challenge and a significant burden on both health and quality of life. In the field of urethral reconstruction, tissue engineering has emerged as a promising alternative to overcome some of the limitations associated with autologous tissue grafts. In this direction, preclinical as well as clinical studies, have shown that degradable scaffolds are able to restore the normal urethral architecture, supporting neo-vascularization and stratification of the tissue. While a wide variety of degradable biomaterials are under scrutiny, such as decellularized matrices, natural, and synthetic polymers, the search for scaffold materials that could fulfill the clinical performance requirements continues. In this article, we discuss the design requirements of the scaffold that appear to be crucial to better resemble the structural, physical, and biological properties of the native urethra and are expected to support an adequate recovery of the urethral function. In this context, we review the biological performance of the degradable polymers currently applied for urethral reconstruction and outline the perspectives on novel functional polymers, which could find application in the design of customized urethral constructs. The male urethra can be affected by several primary, as well as secondary conditions, including hypospadias, fistulas, trauma, and malignancy . In chilOverall, disorders of the male urethra may lead to a breach of the continuity of the urethral mucosa, which results in extravasation of urine, with the possibility of subsequent inflammation and, ultimately, stricture formation. The surgical management of urethral strictures differs according to the severity and length of the affected segment. While the basic approach for short segmental defects comprises resection and end-to-end anastomosis, long defects require open urethroplasty using autologous tissue grafts. Buccal mucosa is currently the most widely used graft material for urethroplasty ,8,9. HowUrethral tissue engineering has recently emerged as a viable alternative to overcome the issues associated with autologous grafts . In addiThe aim of this article is to present the rationale for different designs for urethral replacement, as well as the limitations of each design choice. Given the inability of grafts and non-degradable polymers to meet the clinical performance requirements, this review will focus on the ability of degradable polymeric scaffolds to mimic the native urethral structure, in an effort to restore complete urethral function. Toward this purpose, we initially describe the properties of the male urethra that dictate design requirements for a completely regenerated structure. Then, we review the preclinical and clinical results obtained with current biodegradable biomaterials, discussing their advantages and limitations. Finally, we discuss the perspectives on novel functional polymers, which may find application in the field of urethral tissue engineering.2O. The most distal and longest portion is the penile urethra, which is surrounded by the corpus spongiosum, a richly vascularized erectile tissue that provides support to the urethra. Histologically, the urethra is composed from three different layers: an inner mucosal epithelial lining, a submucosa comprising of fibroblasts, and a muscular layer  can explain the relation between the structure and function of the urethra. Studies have shown that the urethra possesses a nonlinear cross-sectional area pressure, meaning that the tissue is fairly deformable at low pressure (facilitating voiding), but less deformable at higher stress levels (protective against over distention) . It has Adding to the complexity of the picture, in hypospadias and urethral surgery, additional biomechanical and clinical problems may arise ,35,36. AAnother important point that has not received too much attention in the design of scaffolds for urological tissue engineering is the avoidance of urine leak, even when the urine is known to be highly cytotoxic. In the normal urethra, urothelium barrier function is maintained by three structures: uroplakin proteins in the apical cell membrane, tight junctions situated between the superficial umbrella cells, and urothelial GAGs and proteoglycans, covering the umbrella cells . FormatiInitially, non-degradable materials were assessed for urinary tract reconstruction, but they resulted into several complications such as calcification, fistulae ,45, chroThe appropriate synchronization between the biodegradation of the scaffold and cellular component growth is crucial for the success of a tissue-engineered implant. The scaffold should tolerate the mechanical forces sustained during handling, suturing, and normal patient activities . BiodegrDegradable polymers for urethral tissue engineering have been typically obtained from natural sources or by synthesis. Natural biomaterials include acellular matrices obtained from cadaveric or animal organs via enzymatic, physical, or chemical decellularization methods, or natural polymers, such as silk fibroin (SF). In general, natural biomaterials possess integrin-binding peptide sequences and surface topography that can facilitate cellular growth and differentiation, and accelerate the process of angiogenesis . SynthetAcellular matrices, such as small intestinal submucosa (SIS) and bladder acellular matrix (BAM), are by far the most frequent scaffold type assessed in vivo for urethral tissue repair . SIS is BAM is another example of a decellularized matrix, which has shown to successfully support regeneration of the urethra in vivo ,74,75,76Bombyx mori cocoons that holds promise for urethral tissue engineering applications [SF is a natural polymer derived from ications ,80. Tradications ,82. SF iications . In compications ,85. It wications . Xie et ications . As it was previously shown, non-degradable materials did not meet the clinical performance requirements. Despite the moderate success of degradable scaffolds in preclinical studies, the transition from bench-to-bedside remains a challenge. There are, however, some novel approaches and materials being investigated that might be able to meet the clinical performance requirements, alone or in combination with some of the other systems presented here. Natural and synthetic materials can be combined to produce hybrid biomaterials with desired properties for tissue engineering applications. Such properties include mechanical strength, porosity and cell affinity to attract cells, biocompatibility, and biodegradability for enabling replacement of ECM produced by resident cells. Current efforts in biodegradable polymer synthesis are centered on determination of appropriate biomaterials and synthesizing these materials with tailored properties for specific applications. Another important advancement within the present decade is the emergence of a fourth generation of \u201csmart\u201d biomimetic materials. These materials respond reversibly to temperature, ionic strength, pH, or light ,88. The Thermo-responsive polymers are the largest class of smart polymers. These are characterized with a reversibly alterable phase (or volume) transition that occurs in response to a change in temperature. The solubility of thermo-responsive polymers in aqueous solutions depend on the temperature. Above lower critical solution temperature (LCST) polymer chains are precipitated making it hydrophobic, and below LCST, polymer chains are completely hydrated, making it hydrophilic . The mosShape-memory polymers (SMPs) are another class of smart biomaterials. SMPs have been experimented in various vascular and bone tissue engineering/regenerative medicine studies ,97,98. FAnother subset of smart polymers that has shown promise for engineering electrically active tissues is the group of electroconductive polymers. Electroactive polyurethane polymers have shown great potential in bladder tissue engineering applications, when the aim is to regenerate muscular components and innervation ,103,104.Although several experiments have succeeded in regenerating the different urethral tissue layers  ,55,106 nIn the future, advances in understanding the physical and chemical factors responsible for urothelial and smooth muscle cell proliferation, migration, differentiation, and function may be exploited in the development of smart biomaterials, in which biologically active agents are incorporated into acellular natural or synthetic matrices. Not only interactions between urothelium and stroma, but also bi-directional interactions between tissue-engineered grafts and the host tissue environment, are important factors in achieving better outcomes in tissue remodeling. This concept has been termed \u201cdynamic reciprocity\u201d . With a The performance of the current treatments for long urethral strictures remains suboptimal due to the shortage of tissue sources, the significant donor site morbidity, or the inability to completely restore the structure and function of the host. While non-degradable polymers have not met the clinical performance requirements because of the potential risk of migration, encrustation, and ultimate narrowing, tissue-engineered solutions based on biodegradable polymers have emerged as potential alternatives for successful recovery, and therefore function, of the urethral structure. Biological scaffolds have shown utility to repair urethral defects, but they display relative mechanical inferiority and their degradability cannot be easily adjusted. On the other hand, synthetic scaffolds have highly controllable chemical, mechanical, and structural characteristics, but proper reproduction of the native extracellular environment remains a challenge. This suggests that combinations of natural and synthetic polymers could provide synergy with a controllable degradation rate, mechanical compliance, and supportive of formation of different tissue layers and vascularization. It is important to stress that a successful urethral scaffold should maintain clinical performance  following implantation, and synchronize with the preclinical performance requirements . This can potentially be achieved by controlled degradation matching regrowth of healthy tissues. Functional and smart polymeric scaffolds have the potential to better mimic the native tissue and may help tissue engineered solutions to meet the pre-clinical and clinical performance requirements in the future."}
{"text": "C. elegans, a neurotransmitter-sensing G protein-coupled receptor, TYRA-2, is required for avoidance responses to osas#9, an ascaroside pheromone that incorporates the neurotransmitter, octopamine. Neuronal ablation, cell-specific genetic rescue, and calcium imaging show that tyra-2 expression in the nociceptive neuron, ASH, is necessary and sufficient to induce osas#9 avoidance. Ectopic expression in the AWA neuron, which is generally associated with attractive responses, reverses the response to osas#9, resulting in attraction instead of avoidance behavior, confirming that TYRA-2 partakes in the sensing of osas#9. The TYRA-2/osas#9 signaling system represents an inter-organismal communication channel that evolved via co-option of a neurotransmitter and its cognate receptor.Biogenic amine neurotransmitters play a central role in metazoan biology, and both their chemical structures and cognate receptors are evolutionarily conserved. Their primary roles are in cell-to-cell signaling, as biogenic amines are not normally recruited for communication between separate individuals. Here, we show that in the nematode  Inter-organismal signaling is essential for animals to navigate and survive in their natural environment, yet is unclear how these chemical communication channels may have evolved. Here, authors show that TYRA-2, an endogenous tyramine/octopamine receptor, is required for the chemosensation of an octopamine-derived pheromone and that this signaling system represents an inter-organismal communication channel that evolved via co-option of a neurotransmitter and its cognate receptor Chemosensation, both ancient and ubiquitous across all kingdoms of life, underlies social responses mediated by chemical communication2. Social chemical communication requires both cell-to-cell and inter- organismal signaling. First, a chemical cue is released into the environment by one organism that is then detected by specific receptors in another organism. Upon sensation, inter-cellular signaling pathways, e.g., neurotransmitter signaling, are activated that ultimately coordinate a social response.Inter-organismal communication occurs in many forms across the animal kingdom, both within and between species3. The associated signaling pathways often rely on highly regulated biosyntheses, translocation (either by way of diffusion or through active transport), and perception by dedicated chemoreceptors. Many neurotransmitters are perceived via G protein-coupled receptors (GPCRs); in fact, there is a close relationship between GPCR diversification and neurotransmitter synthesis in shaping neuronal systems4. Notably, the most common neurotransmitters share similar behavioral functions across phyla. For example, serotonin is commonly involved in regulating food responses5. Other neurotransmitters, such as tyramine and octopamine, are only found in trace amounts in vertebrates, and act as adrenergic signaling compound in invertebrates6.Neurotransmitter monoamines, such as dopamine, serotonin, tyramine, and octopamine, serve diverse functions across kingdomsCaenorhabditis elegans offers many advantages for studying social chemical communication and neuronal signaling, namely the animal\u2019s tractability, well-characterized nervous system, and robust social behavioral responses to pheromones7. C. elegans secretes a class of small molecules, the ascaroside pheromones, which serve diverse functions in inter-organismal chemical signaling9. As a core feature, these molecules include an ascarylose sugar attached to a fatty acid-derived side chain that can be optionally decorated with building blocks from other primary metabolic pathways9. Ascaroside production, and thus the profile of relayed chemical messages, is strongly dependent on the animal\u2019s sex, life stage, environment, and physiological state12. Depending on their specific chemical structures and concentration, the effects of ascaroside signaling vary from social (e.g. attraction to icas#3) to developmental  and tyramine  for involvement in the osas#9 response  mutant, whereas osas#9 avoidance was largely unaffected in the other neurotransmitter receptor mutants , copper chloride (CuCl2), and glycerol. No defects were found in tyra-2 lof animals\u2019 ability to respond aversively to these deterrents  that has been shown to bind tyramine with high affinity and, to a lesser extent, octopaminents Fig.\u00a0. This ins#9 Fig.\u00a0. Wild-tyons Fig.\u00a0. Howeverons Fig.\u00a0.tyra-2 transcript levels changed under starvation conditions using quantitative RT-qPCR. Starved worms exhibited a nearly two-fold increase in tyra-2 expression . We observed TYRA-2 expression in four sensory neurons: ASH, ASE, ASG, and ASI 38 or peptidegergic signaling (unc-31)39 . The worms expressing the transgene displayed sub-cellular localization in the ASH sensory cilia  elicited by an odorant are specified by the olfactory neuron in which the receptor is present, rather than by the olfactory receptor itself42. We asked whether driving TYRA-2 receptor expression in other sensory neurons will drive behavioral response to osas#9. For this purpose, we ablated the ASH neurons in the pnhr-79::tyra-2 strain, in which tyra-2 is expressed in the ASH and ADL neurons 47. We tested mutants for each of those eight G\u03b1 subunits for their response to osas#9 , their translocation (either by way of diffusion or through active transport), and perception by dedicated receptors60. This mode of signaling is strikingly similar to pheromone-mediated communication systems, which rely on highly specific production and perception of small molecule ligands for inter-organismal signaling61. During evolution, it stands to reason that some machinery from inter-cellular signaling would also be utilized for inter-organismal signaling. Co-option of such signaling systems has been observed in both invertebrates (C. elegans), where a nicotinic acetylcholine receptor senses choline62, and vertebrates (such as mice and zebrafish), where some metabotropic neurotransmitter receptors act as sensors to detect amino acids in the environment65.Exactly how key innovations in metazoan signaling complexity evolved from pre-existing machineries remains to be elucidatedC. elegans , and a related receptor (TYRA-2) for mediating starvation-dependent dispersal in ans Fig.\u00a0, suggest66. The avoidance response was characterized a reversal if the behavior consisted of at least one half of a complete \u201chead swing\u201d followed by a change in direction of at least 90\u00b0 from the original vector. For quantitative analysis, an avoidance response was scored as \u201c1\u201d and no response as \u201c0\u201d. The avoidance index was calculated by dividing the number of avoidance responses by the total number of trials. Each trial was done concurrently with osas#9 and a solvent control.The tail end of a forward moving animal was subjected to a small drop (~5\u2009nl) of solution, delivered through a hand-pulled 10\u2009\u03bcl glass capillary tube. The solution, upon contact, was drawn up to the amphid sensory neurons via capillary action. In response, the animal either continued its forward motion (scored as \u201cno avoidance response\u201d), or displayed an avoidance response within 4\u2009sControl animals and strains containing transgenes in various genetic backgrounds were prepared using common M9 buffer to wash and transfer a plate of animals to a microcentrifuge tube where the organisms are allowed to settle. The supernatant was removed and the animals were resuspended and allowed to settle again. The supernatant was again removed and the animals transferred to an unseeded plate. After 1\u2009h, young adult animals were subjected to the solvent control and chemical of interest at random, with no animal receiving more than one drop of the same solution. Refed animals were transferred to a seeded plate with M9 buffer, and after the allotted time, transferred to an unseeded plate and tested after 10\u2009minutes.66.Ablated and extrachromosomal transgenic animals and controls were gently passed onto an unseeded plate and allowed to crawl around. They were then again gently passed to another unseeded plate to minimalize bacterial transfer. Ablated animals were tested three times with the solvent control and solution of interest with 2\u2009min intervals between dropstyra-2 rescue and misexpression plasmids were generated using MultiSite Gateway Pro Technology and injected into strain FX01846 tyra-2(tm1846) with co-injection marker pelt-2;mCherry by Knudra Transgenics. The promoter attB inserts were generated using PCR and genomic DNA or a plasmid. The tyra-2 insert was isolated from genomic DNA using attB5ggcttatccgttgtggagaa and attB2ttggcccttccttttctctt. PDONR221 p1-p5r and PDONR221 P5-P2 donor vectors were used with attB inserts. The resultant entry clones were used with the destination vector pLR305 and pLR306.odr-10 promoter was isolated from genomic DNA using primers attB1ctcgctaaccactcggtcat and attB5rgtcaactagggtaatccacaattc. Entry clones were used with destination vector pLR305 resulting in podr-10::tyra-2:: RFP and co-injected with pelt-2::mCherry into FX01846.For AWA expression, a 1.2-kb nhr-79 promoter was isolated from genomic DNA using primers attB1gtgcaatgcatggaaaattg and attB5ratacacttcccacgcaccat. Entry clones were used with destination vector pLR306 resulting in pnhr-79::tyra-2::RFP and co-injected with pelt-2::mCherry into FX01846.For ASH expression, a 3-kb nhr-79 promoter was isolated from genomic DNA using primers attB1gtgcaatgcatggaaaattg and attB5ratacacttcccacgcaccat. gpa-6 was isolated from genomic DNA using primers attB5 cgtctctttcgtttcaggtgtat and attB2 tattttcaaagcgaaacaaaaa. Entry clones were used with destination vector pLR304 resulting in pnhr-79::gpa-6::RFP and co-injected with punc-122::RFP into NL1146.For ASH expression, a 3-kb tyra-2::GFP fusions were created by PCR fusion using the following primers to isolate 2\u2009kb ptyra-2 with its entire genomic locus from genomic DNA: A) atgttttcacaagtttcaccaca, A nested) ttcacaagtttcaccacattacaa, and B with overhang) AGTCGACCTGCAGGCATGCAAGCT gacacgagaagttgagctgggtttc. GFP primers as described in WormBook67. The construct was then co-injected with pelt-2::mCherry into both N2 and FX01846.gpa-6::RFP was generated by adding the restriction sites, AgeI and KpnI, to isolate 4\u2009kb pgpa-6 and the entire gpa-6 locus from genomic DNA using primers: acatctggtacccctcaatttcccacgatct and acatctaccggtctcatgtaatccagcagacc. RFP::unc-54, ori, and AMPr was isolated from punc-122::RFP plasmid by PCR addition of the restriction sites AgeI and KpnI with primers: acatctaccggt ATGGTGCGCTCCTCCAAG and ttaataggtaccTGGTCATAGCTGTTTCCTGTG. After digestion and ligation, the clone was injected into N2 with co-injection marker punc-122::GFP.(See Supplementary Tables\u00a013.ascr#3 and osas#9 were synthesized as previously describedhttps://www.sourcebioscience.com/products/life-sciences-research/clones/rnai-resources/c-elegans-rnai-collection-ahringer/). The RNAi clones  originated from the Vidal Library68, were generously provided by the Ambros Lab at UMASS Medical School. We observed that RNAi worked best when animals were cultured at 15\u2009\u00b0C. We used VH624 (nre-1(hd20);lin-15B(hd126)) for the RNAi studies, as it has been previously shown to be sensitive to neuronal RNAi28.RNAi knockdown experiments were performed by following the RNAi feeding protocol found at Source Bioscience  was calculated by dividing the \u0394F value of each frame by F0. F0 was calculated as the average \u0394F of 10 frames prior to stimulus exposure37. \u0394F/F0 (%) was calculated by subtracting 1 from \u0394F/F0 and multiplying 100%; these calculations were then plotted over the duration of the experiment.Calcium imaging was perfomed by using a modified olfactory chip described in Reilly et al.71. cDNA was subsequently synthesized using the Maxima H Minus First Strand cDNA Synthesis Kit. iTaq Universal SYBR Green Supermix was used for amplification with the Applied Biosystem 7500 Real Time system. Primer efficiency was determined to be 97.4% for tyra-2 primers  and 101.8% for the reference gene ama-1  using the equation 10^(-1/slope)-1. Technical replicates with large standard deviations and trials with a Ct within 5 cycles of the negative control (no reverse transcriptase used in prep) were removed from analyses.RNA was isolated from individual animals, either freshly removed from food or after four hours of starvation using Proteinase K buffer: Five animals were gently transferred to a 35-mm plate and filmed for 20\u2009minutes. Movies were generated using the Wormtracker system by MBF Bioscience. Movies were then analyzed and average speed was computed using software WormLab4.1 .Speed: reversals were analyzed and measured using Wormlab (MBF Bioscience) from movies recorded for the holding assay between minute one and two as it was when the divergence was first seen in distance between strains in the holding assay.Reversals72. 10 animals were placed in the center of a 35-mm plate, equidistant from two spots, one containing 1\u2009\u00b5l of solvent control and the other 1\u2009\u00b5l of 10-2 diacetyl. Both spots contained sodium azide for anesthetizing animals that entered the region. After 45\u2009minutes, the chemotaxis index was calculated by subtracting the number of animals in the solvent control from the number of animals in the solution of interest and divided by the total number of animals.Diacetyl chemotaxis assays were carried out with slight modificationsE. coli OP50 liquid culture was spread onto a separate NGM assay plates. These plates were allowed to dry at 25\u2009\u00b0C without a lid for one hour. After an hour of incubation, 4\u2009\u00b5l of either solvent control or 10\u2009pM osas#9 was pipetted onto the agar within the center circle outlined on the template. Ten animals were gently passed into the center circle and their movement was recorded. At 1-minute intervals, the distance the animals traveled from the origin was measured using ImageJ.The leaving assay consisted of the use of 60\u2009mm culture plates containing standard NGM agar. A transparency template that included a 6-mm diameter circle in the center was attached to the underside of the NGM plate. One hour before running the assay, young adult animals were passed on to an unseeded plate and allowed to starve for one hour. 100\u2009\u00b5l of t-test was used. All tests were two-tailed. When comparing different strains/conditions, normalized values of osas#9 avoidance index response relative to the respective solvent control were used. This was done to account for any differences in baseline response to solvent control for the respective genotypes, laser ablations, or physiological conditions. When normalizing fold change of osas#9 response to solvent control response for the avoidance assay within a strain/condition, data was first log transformed so a fold change could still be calculated for control plates that had a \u201c0\u201d value. For avoidance assays, statistical groups were based on the number of plates assayed, not the number of drops/animals. For calcium imaging, averages were calculated by obtaining the max peak value before and during exposure to the chemical of interest for each trial.Statistical tests were run using Graphpad Prism. For all figures, when comparing multiple groups, one factor ANOVAs were performed, followed by Sidak\u2019s multiple comparison test. When only two groups were compared, a Student\u2019s p-value as asterisks, but represent the difference between osas#9 avoidance of a strain/conditions in comparison to wild type, with the exception of panel 5H, which shows the difference between response of all strains/conditions and the reprogrammed AWA::tyra-2For all figures, asterisks depict compared osas#9 avoidance to respective solvent control within groups. \u2018\u2009+\u2009\u2019 signs represent same Further information on research design is available in the\u00a0Supplementary InformationPeer Review FileReporting summarySupplementary Movie 1Source Data"}
{"text": "Articular cartilage is an important load-bearing tissue distributed on the surface of diarthrodial joints. Due to its avascular, aneural and non-lymphatic features, cartilage has limited self-regenerative properties. To date, the utilization of biomaterials to aid in cartilage regeneration, especially through the use of injectable scaffolds, has attracted considerable attention. Various materials, therapeutics and fabrication approaches have emerged with a focus on manipulating the cartilage microenvironment to induce the formation of cartilaginous structures that have similar properties to the native tissues. In particular, the design and fabrication of injectable hydrogel-based scaffolds have advanced in recent years with the aim of enhancing its therapeutic efficacy and improving its ease of administration. This review summarizes recent progress in these efforts, including the structural improvement of scaffolds, network cross-linking techniques and strategies for controlled release, which present new opportunities for the development of injectable scaffolds for cartilage regeneration. Articular cartilage is a highly organized tissue which has remarkable load-bearing and low friction properties that allow for smooth movement of diarthrodial joints , 2. The Currently, strategies of repairing cartilage defects include debridement and lavage, microfracture, as well as autografts (cell and tissue transplantation) . AlthougTo further expand the utilization of biomaterials in cartilage regeneration, injectable hydrogel-based scaffolds have attracted considerable attention these years in cartilage tissue engineering , 14. HydAn ideal injectable scaffold for cartilage regeneration should typically meet the following criteria: (i) ease of administration under physiological conditions, (ii) guaranteed injectability , (iii) excellent biocompatibility and potential biodegradability, (iv) the ability to mimic cartilaginous ECM features and promote chondrogenic potential of cells, (v) the ability to easily fill defect sites inside the joint and integrate with the surrounding native cartilage tissue rather than shifting readily and (vi) a sustained release profile if associated with local drug delivery , 27\u201329. Hydrogels possess high water content and elastic properties with cross-linked, multiporous networks . The potet al.  prepared two kinds of HA-based injectable hydrogels by Michael addition, using the amino derivative of HA (HA-EDA), \u03b1-elastin-grafted HA-EDA and \u03b1,\u03b2-poly(N-2-hydroxyethyl)-dl-aspartamide derivatized with divinylsulfone. The controllable swelling and degradation kinetics and its ability to integrate articular chondrocytes of the hydrogel suggested that this scaffold processed desirable properties for cartilage regeneration.The Michael addition reaction has been commonly used to prepare injectable hydrogels, ascribed to its mild reaction condition and controllable reaction time . Jin et et al.  reportedet al. showed that the HRP-mediated cross-linking systems can covalently bind the phenol-conjugated polymers (heparin-tyramine and dextran-tyramine conjugates) to the ECM proteins of the surrounding tissues, which is beneficial in maintaining the structural integrity for arthroscopic cartilage repair [The enzyme-catalyzed chemical cross-linking method has attracted increasing attention for hydrogelation, due to its fast gelation rate, high site specificity, ability to work at normal physiological conditions and low cytotoxicity . There he repair .et al. [et al. [In vivo implantation of chondrocyte-loaded SerMA hydrogels adequately formed artificial cartilages. Although UV-mediated cross-linking is characterized by low cytotoxicity, UV radiation may still have a negative influence on cells, proteins and tissues. Hence, considerable attempts in visible-light-initiated polymerization for cartilage repair have been investigated. For instance, Park et al. [et al. [Photo-cross-linking involves multiple steps, including initiation, propagation and termination, under light illumination. This method requires the introduction of free radical groups, such as vinyl and methacrylate residues together with photo-initiators. In recent years, the photo-cross-linking method has been widely applied to synthesize injectable hydrogels for cartilage tissue engineering owing to the flexible ability to control the timing and location of hydrogel cross-linking . For exaet al.  reported [et al.  designedk et al.  reported [et al.  also repHydrogels are versatile and their various properties, such as high water content, biodegradability, porosity and biocompatibility, allow them to be used often for cell therapy , 120. Inet al. [in vitro. During in vitro culture, chondrogenesis occurred with the formation of cartilage ECM, including type II collagen and aggrecan, which were homogenously distributed throughout the entire hydrogel. Roberts et al. [b-PEG-b-oligo(lactic acid) improved the formation of a cartilage matrix consisting of aggrecan and collagen types II/VI. Although chondrocyte-based biomaterial therapy has demonstrated promising in cartilage tissue engineering, two notable limitations should be considered. First, chondrocyte harvesting involves collecting healthy cartilage tissues from non-load-bearing areas and long-term in vitro culturing (\u223c1\u2009month) [Autologous chondrocyte implantation has been successfully used in clinic to treat cartilage defects . Howeveret al.  developes et al.  demonstr1\u2009month) , 140. Beet al. [\u03b21 and bone morphogenetic protein) created a synergistic environment for chondrogenesis. The encapsulated ESCs were able to differentiate into chondrogenic cells and promote the production of neocartilage ECM [in vitro research has demonstrated that MSC proliferation and differentiation potential decreases with aging and with aging-related diseases [Biomedical therapies incorporating stem cells and hydrogels for cartilage regeneration commonly include ESCs, MSCs, induced pluripotent stem cells (iPSCs) and predifferentiated MSCs. ESCs, isolated from the tissues of early embryos, show an unlimited self-renewal capacity while maintaining a pluripotent differentiation potential . Howeveret al.  have replage ECM . MSCs, dlage ECM , 143. MSlage ECM . Ample slage ECM , 144\u2013147diseases , likely et al. [Recently, iPSCs have attracted significant attention because they exhibit pluripotency that is quite similar to ESCs in terms of multiple differentiation routes, thus resulting in increasingly widespread applications in regenerative medicine, which can be obtained from somatic cells including fibroblasts , 149. Xuet al.  have demet al. . Recentlet al. . HoweverMany therapeutics exhibit limited efficacy due to the rapid clearance of the drugs in joints. Injectable scaffolds, on the other hand, can sustain drug release and extend the drug retention time. Numerous studies have investigated natural and synthetic biomaterials to develop scaffolds with unique properties, such as improved joint articular dwelling time with sustained drug release while ameliorating the biodegradation of delivery systems. Strategies investigated for the release of biologics with biological activity for treating cartilage defects have developed from simple bolus injections into the focal cartilage defect to multifunctional delivery systems.et al. [Microparticles (MPs) and NPs are desirable formulations for controlled drug release due to their high surface area to volume ratios, small dimensions, high drug encapsulating efficiencies and the capacity to quickly respond to surrounding environmental stimuli, such as temperature, pH, magnetic fields or ultrasound . Recentlet al.  have recet al. . Recentlet al. . This inet al. .in vivo. Second, to enhance the efficiency and duration of the delivery of growth factors or other pharmaceuticals, advanced formulations such as MPs and NPs have been investigated in scaffolds for controlled drug delivery. These advances have also garnered interest in presenting biochemical cues in a controllable manner.To date, injectable scaffolds have provided a promising therapeutic platform for cartilage regeneration. As surveyed above, a number of hydrogel-based scaffolds have been developed with inherent capabilities in cartilaginous tissue engineering, and sufficient mechanical properties for repairing cartilage defects to restore normal joint function. First, to enhance the mechanical properties of scaffolds, traditional single-network hydrogels have been supplemented with either additional networks or mixtures of polymers, and many nanocomposites have been utilized to vary the mechanical properties of scaffolds. These strategies have also been used to produce hydrogels which can improve the integration with surrounding cartilage while promoting chondrogenesis of stem cells encapsulated in hydrogels de novo ECM could compromise their mechanical stability and long-term therapeutic efficacy. One option to overcome this issue is to incorporate appropriate exogenous cells, such as MSCs, within these scaffolds, which could potentially replace the scaffolds as they degrade with newly formed tissue. Third, signaling pathways and particular mechanisms from stem cells to specific cartilaginous cells need further in-depth understanding. It emphasizes more fundamental biological studies of cartilage development and regeneration, which could significantly contribute to the optimization of the injectable scaffolds in the long run. It is also essential to highlight the potential translation of the systems at the beginning of the design. Factors, such as biocompatibility of materials, ease of administration, feasibility of large-scale manufacturing and overall cost should be thoroughly evaluated. Lastly, the next generation of cartilage tissue engineering could be combined with noninvasive/minimally invasive diagnostic technologies to provide real-time assessment of the disease status and overall treatment performance, leading to personalized therapy.Looking ahead, there are still limitations of injectable scaffolds that restrict the complete regeneration of articular cartilage. First, it is essential that the injectable scaffolds can fill the defect area with a smooth interface that is similar to the native cartilage, without integrating into the surrounding healthy tissue. Second, the progressive degradation of hydrogels before they can be replaced by the"}
{"text": "Oceanic mesoscale eddies are common, especially in areas where zonal currents with meridional shear exists. The nonlinear effects complicate the analysis of mesoscale eddy dynamics. This study proposes a solitary (eddy) solution based on an asymptotic expansion of the nonlinear potential vorticity equation with a constant meridional shear of zonal current. This solution reveals several important consequences. For example, cyclonic (anticyclonic) eddies can be generated by the negative (positive) shear of the zonal current. Furthermore, the meridional structure of an eddy is asymmetrical, and the center of a cyclonic (anticyclonic) eddy tilts poleward (equatorward). Eddy width is inversely proportional to shear intensity. Eddy phase speed is proportional to shear intensity and the wave amplitude, and their spatial distribution show band-like pattern as they propagate westward. This nonlinear solitary solution is an extension of classical linear Rossby theory. Moreover, these findings could be applied to other areas with similar zonal current shear. This finding has triggered a number of theoretical works exploring the enhancement with consideration of background flow2, bottom topography3, other factors7. Killworth and Blundell9 provided a comprehensive theory (including both background flow and topography effects) that showed a large-scale bottom slope is insufficient to explain the observed rate of propagation. Aoki et al.10 analyzed the output of a high-resolution ocean general circulation model, and argued that the dominant factor enhancing the phase speed is bottom pressure decoupling related to rough bottom topography, while north of 30\u00b0N, the background flow makes a strong contribution to the enhancement of phase speed. However, some of the observed Rossby wave features cannot be interpreted using classical Rossby wave theory. Subsequent observations of high-resolution SSH fields, constructed by merging the measurements of two simultaneously operating altimeters, have revealed that westward-propagating signals can be identified as nonlinear eddies12. Previous theoretical research has focused mainly on linear models or numerical simulations13 because of the difficulty in solving nonlinear problems.Mesoscale eddies are ubiquitous in the ocean, with typical horizontal scales on the order of 100\u2009kilometers and timescales on the order of a month. Mesoscale eddies play a key role in the transport and mixing of momentum and tracers across the World Ocean. Satellite observations of sea surface height (SSH) have enabled visualization of the westward phase propagation of SSH anomalies. It has been revealed that the phase speeds of isolated abnormal SSHs that are faster than expected based on classic mid-latitude Rossby wave theory14 found that solitary waves are possible in a fluid system confined by rigid boundaries, and in certain atmospheric motions. Boyd15 applied the multiple scales method to the primitive equations to show that long, small amplitude Rossby waves are governed by either the Korteweg-de Vries (KdV) equation or modified KdV (mKdV) equation. Helfrich et al.17 developed an asymptotic time-dependent theory for coherent structures on a marginally stable baroclinic flow. Yang at el.18 discussed the interaction of algebraic solitary Rossby waves with topography and atmospheric blocking. Hodyss and Nathan19 studied the dynamics of solitary Rossby waves in a meridionally sheared, zonally varying jet flows, and showed that the zonally varying background flow yielded three general classes of behavior: reflection, transmission, or trapping. They show the oscillatory decay, creation and steady state of solitary Rossby waves, when there is zonally varying jet flow. The KdV equation also has been obtained by Benney20, Redekopp21, Yamagata22, and Warn23. Based on KdV equation, the authors investigated the spatial structure and propagation characteristics of solitary waves, and point out that the background flow shear is a necessary condition for the existence of solitary waves.The nonlinear term reflects important physical phenomena. Long24, a nonlinear model and its corresponding asymptotic solution are derived in this paper. By using the asymptotic solution, the influence of background flow shear is discussed in detail. Furthermore, we examine some typical solutions and compare them with classical Rossby wave theory in the interpretation of the observed westward-propagating features.Despite recent progress, how the varying background flows influence the phase speed, wave width and the symmetry of solitary Rossby wave, however, remains to be addressed. Based on the reduced-gravity potential vorticity equation, and using scale transformations and the perturbation expansions method25, where cyclonic eddies might exist in one latitude band and anticyclonic eddies exist in the adjacent latitude band  zone is one of the regions with most eddy activity. Qiu et al.30 pointed out that in the STCC area, both submesoscale and mesoscale eddies are influenced by baroclinic instability, and show seasonal variation.Figure\u00a031, it does not show Rossby wave dispersion32, and it demonstrates a westward increase in amplitude and phase speed1.Moreover it has been reported that the westward-propagating wave  has some meridional asymmetryHowever, the influences of background flow shear on the spatial structure, propagation velocity and wave width of solitary Rossby waves remain absent. The objectives of this article are to elucidate the background flow horizontal shear effects on Rossby waves in a nonlinear regime, and to interpret those observed characteristics of isolated anomalies that classical theory cannot explain.33:L is a characteristic length scale of the motion, Rd is the Rossby deformation radius, \u03c8 is the stream function, \u03b2\u2009=\u2009\u03b2*L2/U is the gradient of the Coriolis parameter, and U is the characteristic horizontal velocity scale of the motion.We consider the following nondimensional reduced-gravity quasi-geostrophic potential vorticity equationThe horizontal velocity can be obtained fromy*\u2009=\u2009yL, where L represents domain size. The boundary condition isIn this paper, the dimensional variables are denoted by an asterisk, for example The background stream function has the form\u03c8 as a disturbance stream \u03b5\u03d5 pre-imposed on the zonal flow u:\u03b5 represents the Rossby number, which is a small parameter. Substitution of (4) into (1) yieldsWe take the total stream function 15:c0 is the linear Rossby wave phase speed, which can be determined by solving following eigenvalue problem. Using the multiple scale method, we write the disturbance stream function as\u03d51\u2009=\u2009A\u03c81(y), A is the amplitude, and \u03c81(y) is the meridional structure of the waves. After a series of manipulations (see Supplementary Equations 1), we obtain the KdV equation21 for the amplitude A\u03c81(y)In order to balance the nonlinearities and dispersions, we introduce the following slow space and time scales20, Redekopp27, Yamagata22, and Warn23 also obtained the same KdV equation as equation . The governing equation of the amplitude (7) can be reduced to:If there is no shear in the background flow, the solution of the eigenvalue equations  can be ouy\u2009\u2260\u20090, and as u is function of variable y, it is difficult to obtain the analytic solution of eigenvalue equations  is asymmetry because of the basic flow shear.O(\u03b42) term gives:Substituting  and 12)12) into m represents the modulus of Jacobi elliptic function, A0 is the amplitude of the waves, m\u21921, cnoidal waves solution  must be positive to keep this width physical meaningful. In other words, if the background flow shear is positive (\u03b4\u2009>\u20090), A0 must be positive too. Positive A0 means there are anticyclonic solitary Rossby waves . On the other hand, if it is negative (\u03b4 < 0), there are cyclonic solitary Rossby waves . When n\u2192\u221e, the width w will tend to be zero and the sea surface will seem like flat that corresponds to the background geostrophic current. When n\u2009=\u20091, the solitary wave shows the largest width. When \u03b5\u21920(the current is absolutely in geostrophy), the w\u2192\u221e and it means that given a constant energy of solitary wave, the amplitude will be negligible and the solution is the background geostrophic current.Using Jacobi elliptic function expansion methods and equation , the cnoThe phase speed of the solitary Rossby waves isc0. This feature agrees with the observations that large-amplitude solitary Rossby waves propagate faster than small-amplitude waves1. A notable feature of solitary Rossby waves that distinguishes them from linear Rossby waves is that their speed is dependent on amplitude. Furthermore, this solution shows another kind of solitary Rossby wave whose phase speed is slower than the classic Rossby phase speed. This solution remains to be verified by observations.It is important to note that the phase speed of solitary Rossby wave proportional to its amplitude and could be faster or slower than the classical Rossby wave phase speed. When n must be an odd number, otherwise, a solitary Rossby wave cannot exist. The present analysis takes n\u2009=\u20091 and it focuses on latitude 23\u00b0N in the North Pacific. At this latitude, the typical values of parameters for oceanic solitary Rossby waves are \u03b2*\u2009=\u20092.1\u2009\u00d7\u200910\u221211m\u22121s\u22121, L\u2009=\u20091.6\u2009\u00d7\u2009105m, \u03b5\u2009=\u20090.2, U\u2009=\u20090.045\u2009ms\u22121 and Rd\u2009=\u20095\u2009\u00d7\u2009104m34. We take |A0|\u2009=\u20091 and u* as follows:u* is smaller than the linear long Rossby wave phase velocity From the first equation of , n must \u03b4 < 0, the meridional structure tilts northward and when \u03b4 > 0, the meridional structure tilts southward. When \u03b4\u2009=\u20090, which reduces to linear Rossby waves, the meridional structure has north\u2013south symmetry.The meridional structure of Rossby waves can be determined from . From FiA in (m (\u03b4\u2009=\u20090.1) and \u03b4 (m\u2009=\u20090.8), when X0\u2009=\u20090, t\u2009=\u20090, and |A0|\u2009=\u20091, is shown in Fig.\u00a0m represents the modulus of the cnoidal waves , cyclonic solitary Rossby waves occurs (A < 0). When the flow shear is positive (\u03b4 > 0), anticyclonic solitary Rossby waves occurs (A>0). When \u03b4\u2009=\u20090, the model degenerates into the linear model and either anticyclonic or cyclonic solitary Rossby waves exist (the amplitude can be arbitrary).The amplitude A in  of Rossbal waves , which iA0 is, the smaller the width is. It means that this solution permits strong SSH anomalies with a small diameter. Moreover, it is interesting to note that the width of the solitary wave is proportional to the gradient of the planetary vorticity \u03b2 and u0. Thus, the wave width tends to increases equatorward. However, this equation is not applicable to equator because geostrophic balance in the lowest order needed by equation , the phase speed is proportional to the amplitude (|A0|), and the greater the shear, the more significant the effect of amplitude on the phase speed. If \u03b4\u2009=\u20090, the model degenerates into the linear model and the amplitude has no effect on phase speed. For a given amplitude, the phase speed is proportional to the intensity of the background flow shear (|\u03b4|), and the minimum value of phase speed is obtained when \u03b4\u2009=\u20090, which is exactly the result of the linear model. It is worth noting the small difference in phase speed when \u03b4 takes a different sign. This occurs because the flow shear changes the background flow, which further changes the phase speed because of the Doppler shift. However, the flow shear effect is much smaller than the amplitude effect on the phase speed.Figure\u00a012. In addition, the background flow shear also contributes to the band-like eddy polarity pattern in the STCC zone , because of the weak shear itself. A stronger shear is expected to correspond to more significant modulation of wave properties, but this will need to be confirmed by a separate study. Using sea-surface height fields constructed from the merged TOPEX/Poseidon and ERS-1/2 altimeter datasets, Chelton et al.11 investigated global ocean mesoscale eddies in detail. The propagation speeds and directions of the observed eddies are consistent with the theories for nonlinear dynamics, which predict that eddies should propagate westward with little meridional deflection at the phase speeds of nondispersive baroclinic Rossby waves13. The poleward (equatorward) movement of westward propagating cyclonic (anticyclonic) eddies are expected from the combination of the \u03b2 effect and self advection. The observed weak dispersion in wavenumber frequency spectra of SSH also confirm the property of nondispersion32, because the eddies retain their shapes as they propagate the energy at every wavenumber propagates at the same speed. The eddies generation mechanism is most likely due to the instability of the background currents. The width of solitary wave is inversely related to the background current shear strength. If the shear is too strong, it will produce sub-mesoscale eddies, such as the distribution of eddies across the Kuroshio in the East China Sea35. The asymmetrically distribution of eddies across the Kuroshio in the East China Sea (predominant cyclonic eddies are on the western sides of Kuroshio and anticyclonic eddies are on the eastern sides of Kuroshio) is also related to the different horizontal velocity shear on both sides of the Kuroshio axis35. These effects of background flow shear on solitary Rossby waves are summarized in Fig.\u00a0The above discussion shows the background flow shear has significant impact on the Rossby waves. Consideration of the nonlinear effects shows that solitary Rossby waves exist with properties that are quite different from classic Rossby waves but consistent with satellite observations. If the background flow shear is positive (negative), anticyclonic (cyclonic) solitary Rossby waves exist and their meridional structure is tilted southward (northward), which is consistent with the observations that the eddies propagate westward at approximately the phase speed of linear baroclinic Rossby waves, and cyclonic (anticyclonic) eddies deviate slightly poleward (equatorward) with respect to the latitude circleL\u2009=\u20095\u2009\u00d7\u2009105\u2009m, n\u2009=\u20093, and \u03b4\u2009=\u20090.1, and the other symbols have the same values as discussed above. The background flow shear effects on amplitude, width, and phase speed are consistent with the conclusions derived when n\u2009=\u20091; the obvious difference is the meridional structure \u03c81. The meridional structures and streamlines of solitary Rossby waves are illustrated in Fig.\u00a0\u03b4\u2009=\u20090.1, the meridional structure tilts southward, and both the amplitude and the width are larger in the north. In contrast, when \u03b4\u2009=\u2009\u22120.1, the meridional structure tilts northward, and both the amplitude and the width are larger in the south. It is reasonable that the meridional shear of zonal current determine the southward or northward tilting.In this section, we choose u\u2009=\u2009u0 +\u03b4y, the effects of flow shear on the meridional structure, amplitude, width, and phase speed of solitary Rossby waves were studied.In this paper, by employing perturbation expansions and scale transformations of the time and space method, an asymptotic solution of the potential vorticity equation was derived. For a specific background zonal flow \u03b4|). Solitary Rossby waves are non-dispersive waves, and the width of solitary Rossby waves is inversely proportional to the intensity of the flow shear (|\u03b4|). Chelton et al.1 pointed out that the standard theory for free, linear Rossby waves is an incomplete description of the observed waves. Observed characteristics of isolated anomalies were found to be broadly consistent with our nonlinear quasi-geostrophic theory, which suggest the importance of nonlinear dynamics. Based on the analytical solution, the background flow shear effect can be used to explain the band-like distribution of mesoscae eddies in the subtropical counter current zone.Background flow shear is required for the existence of solitary Rossby waves. Cyclonic (anticyclonic) solitary Rossby waves exist in a cyclonic (anticyclonic) mean flow, and their meridional structure tilts northward (southward). The phase speed of solitary Rossby waves is proportional to the amplitude, and the greater the flow shear, the more significant the effect of amplitude on phase speed. The phase speed is also proportional to the intensity of the flow shear  equation may imply instability due to singular behavior near a potential critical layer, i.e. a latitude where u\u2009=\u2009c0. However, for eastward currents (u > 0), this singular behavior is absent. Therefore the solitary wave solution is nearly absent in area where the zonal current flows eastward, while solitary waves (eddies) can be expected to be found in the westward flowing zonal current area. The solution is only applicable to the area with a weak zonal shear, and strongly sheared flows may exhibit different properties. Flow with a strong horizontal shear will also be subject to barotropic instability, which can further modify the solution. Furthermore, it is especially favorable in the westward flowing zonal current area. In the STCC zone, solitary eddies mainly concentrate in the areas with weak background flow (north of 20\u00b0N), while the number of solitary eddies in the area with strong westward flow (south of 20\u00b0N) is less .Supplementary Information"}
{"text": "Microcystis aeruginosa. Even in microcystin-producing strains, other classes of oligopeptides including cyanopeptolins, aeruginosins, and aerucyclamides, were often the more dominant compounds. The distinct and large variation between strains of the same widespread species highlights the need to characterize the metabolome of a larger number of cyanobacteria, especially as several metabolites other than microcystins can affect ecological and human health.Cyanobacteria are notorious for their potential to produce hepatotoxic microcystins (MCs), but other bioactive compounds synthesized in the cells could be as toxic, and thus present interest for characterization. Ultra performance liquid chromatography and high-resolution accurate mass spectrometry (UPLC-QTOF-MS/MS) combined with untargeted analysis was used to compare the metabolomes of five different strains of the common bloom-forming cyanobacterium,  Visible accumulations of cyanobacterial biomass in the form of surface blooms have been increasing over the past few decades ,2, mainlMicrocystis, Dolichospermum (Anabaena), and Planktothrix -MC-LR and [Leu1]-MC-LR, three unconfirmed variants of microcystins were detected. Those metabolites were identified as microcystins because of the presence of the ADDA fragment  include more than 82 variants , as variM. aeruginosa, M. viridis and Planktothrix (Oscillatoria) agardhii -LR variants were bought from Enzo Life Sciences . In addition, an MC standard for the variant [Dha7]-LR  was provided by Dr. S. Sauv\u00e9, D\u00e9partement de Chimie, Universit\u00e9 de Montr\u00e9al. All 12 standards had a purity over 95%, and in each case 10 ppm in methanol was prepared as identification references. The oligopeptide nodularin has been used in previous studies as an internal standard to estimate the recovery of microcystins during extraction [Commercially available microcystins  and nodularin were included in this study. Nodularin standard (CAS 118399-22-7) and MCs standards for LR (CAS 101043-37-2) and LA (CAS 96180-79-9) variants were bought from Cayman Chemicals . MC-LF (CAS 154037-70-4), MC-LW (CAS 157622-02-1), MC-LY (CAS 123304-10-9), MC-RR (CAS 111755-37-4), MC-WR (CAS 138234-58-9), MC-YR (CAS 101064-48-6) and [Asptraction ,65,66. IAll LCMS analyses were performed on a UPLC-QTOF system . LCMS system was comprised of an ultra-high-performance liquid chromatograph, upper pressure limit 1200 bars (Acquity UPLC), connected to a quadrupole time of flight mass spectrometer (Xevo G2 QTOF). Chromatographic separations were performed on an Acquity UPLC BEH C18 column . LCMS grade mobile phases were (A) acetonitrile and 0.1% formic acid, and (B) water with 0.1% formic acid. Mobile phases were delivered at 0.8 mL/min with a linear gradient of 5% to 95% A in five minutes at column oven temperature of 50 \u00b0C. m/z 50 to m/z 1500 Da. All the data were acquired without mass correction using MassLynx V4.1 SCN918.QTOF was operated at unit resolution. Two separate injections (0.2 \u03bcL) were performed to obtain positive and negative ions at collision energies of 6 V and 20\u201350 V to obtain low and high fragmentation spectra of each signal that was above the specified noise level. Other QTOF parameters were: scan time 0.1 s; sample cone voltage 40 V; capillary voltage 1.2 kV for positive ionization, and 2.5 kV for negative ionization; extraction cone 4-35 V; source temperature, 150 \u00b0C; desolvation temperature, 500 \u00b0C; desolvation gas flow, 1200 L/h; cone gas flow, 20 L/h. MS data were collected in scan mode from TM (V 8.03) to generate unsupervised  and supervised  plots [Data were collected on the QTOF between 0.3\u20136 min RT and exported to MarkerLynx to generate a matrix consisting of RT, accurate mass pairs, and peak heights. These raw data were then transferred to EZInfoA) plots . For prihttps://metlin.scripps.edu) was used. For tentative identification of metabolites mass accuracy threshold was set at \u00b1 5 ppm for the parent ion and \u00b1 10 ppm for the respective product ions and finalized by mass fragment and ChemDraw  or as seen in available standards of similar metabolites. To search for unidentified microcystins in the samples, the total ion chromatograms (TIC) were scanned for the ADDA moiety molecular weight (structure available in The identification of microcystin variants in cell culture extracts was performed by matching the (1) RTs, (2) elemental compositions, (3) parent ions, and (4) product ions. METLIN (Scripps Center for Metabolomics:"}
{"text": "It is a computational challenge for current metagenomic classifiers to keep up with the pace of training data generated from genome sequencing projects, such as the exponentially-growing NCBI RefSeq bacterial genome database. When new reference sequences are added to training data, statically trained classifiers must be rerun on all data, resulting in a highly inefficient process. The rich literature of \u201cincremental learning\u201d addresses the need to update an existing classifier to accommodate new data without sacrificing much accuracy compared to retraining the classifier with all data.th of the non-incremental time with no accuracy loss.We demonstrate how classification improves over time by incrementally training a classifier on progressive RefSeq snapshots and testing it on: (a) all known current genomes (as a ground truth set) and (b) a real experimental metagenomic gut sample. We demonstrate that as a classifier model\u2019s knowledge of genomes grows, classification accuracy increases. The proof-of-concept na\u00efve Bayes implementation, when updated yearly, now runs in 1/4It is evident that classification improves by having the most current knowledge at its disposal. Therefore, it is of utmost importance to make classifiers computationally tractable to keep up with the data deluge. The incremental learning classifier can be efficiently updated without the cost of reprocessing nor the access to the existing database and therefore save storage as well as computation resources. Recent advances in genomics have resulted in exponential increases in the rate at which data is collected. Inspired by Zynda , we visuMoreover, driven by advances in technology and significant reductions in the cost of analysis, microbiome research has unlocked a wealth of data in recent years . In factOne of the main challenges in metagenomics is to answer, \u201cWho is there?\u201d: identifying the microorganisms in the sample. Taxonomic classification \u2013 classifying the reads in metagenome sequencing data \u2013 uses aligners, read mappers, classifiers and other \u201cbase techniques\u201d to solve this problem \u201311. Taxocontinuous assembly approach\u201d (supported by the institution\u2019s infrastructure and the scientific community supplying the data sources) ), the user can specify the number of threads made available to NBC++. The program will then attempt to run as many parallel instances as threads it has available, and load training/testing data into the available memory for all the threads. The scalability of the previous na\u00efve Bayes classifier is improved. NBC++ can now work within a pre-set memory limit. The program will automatically adjust how many reads it loads into memory, dynamically creating multiple \u201cbatches\u201d of various sizes, trying to fit as many as possible in one cycle. This is a sub-optimal but necessary operating mode, as dataset sizes often exceed available RAM. The performance penalty of this process in the case of classification is derived from the repeated iterations through the training database \u2013 repeated for each batch. The trade-off is to load and unload the same training classes in/from memory multiple times, because we need to classify multiple batches of reads. We describe the detailed implementation below.One way in which NBC++ facilitates computational scalability is by automatically separating reads into batches, depending on the amount of memory the user decides to use. By using the -m [size] argument, the user can instruct NBC++ to keep all batches under the specified memory cap, thus allowing the user to train and classify large datasets on a variety of systems, getting optimal performance on each run without the need for users to manually adjust batch contents. This is particularly helpful when reads in the database have uneven sizes, which would normally make them difficult to manually add to a batch containing a fixed number of reads.To demonstrate this behavior, consider a scenario where the program is given 510 sequences (of greatly varying lengths) and the memory is capped to 32GBs. Figure\u00a0An additional argument, -n [nbatch] is provided as a manual override for the number of reads to include in a batch. This argument is not compatible with the memory cap option and should only be used if the user prefers to process a fixed number of reads at a time, rather than trying to use all available memory optimally.We also allow for multi-threaded computation through the -t [threads] argument, which prompts NBC++ to create worker threads that will concurrently handle one class each. This option is independent of the memory cap, which means that users should allow for some additional memory to be used by each thread in loading their training class savefiles: total_memory = read_memory_cap + n_threads \u00d7 savefile_average_size.With these two options enabled, NBC++ will first create a batch of reads that fit within the provided memory cap. The program will then create the specified number of threads, loading one class savefile for each and processing in parallel all reads within the batch. When we\u2019ve finished processing all the reads in the batch, the class savefile is unloaded and the next class is read from disk. The thread will then begin to process reads from the beginning. The batch is discarded when this operation has ran for all existing classes, in which case the program will begin creating a new batch and repeating the process until the entire dataset is processed.The multi-threaded computation along with memory cap is very useful in computing cluster environment. We use a case study here to illustrate the usage. Suppose we allocated 16 cores and a total of 64 GB memory resources to run NBC++. Then, the value we pass to -t [threads] would be 15 since we need 1 core for master process and the rest of 15 can be used for multi-threading. The memory cap should be considered as the memory available solely for testing reads. Given we have 16 cores and 64 GB memory, we have 4 GB per core. If the maximum size of training class savefile (class object of a species derived from training data) is 2 GB. Then 2 GB per core are available for testing. To be safe, we don\u2019t include the memory for master core for testing reads. Then the total amount of memory for testing can be set to 2\u00d715=30 GB. Therefore, we pass 30 GB to -m [size] parameter. In this way, we manage to balance the loading of both save files (training) and testing data in memory.Additional file 1 The number of taxonomic labels per year. The number of updates in the NCBI bacteria genome database on six taxonomic levels, namely, species, genus, family, order, class and phylum. We have a figure for \u201cAccumulative number of updates per year\u201d per taxonomic level  and a figure for \u201ccompared with last year, the number of new updates per year\u201d per taxonomic level .Additional file 2 Histogram of the number of genomes per species. We plot the histogram of the number of genomes per species every year. The figures show that many species have only one genome. We designed our experiment so that we can train a model on some genomes of a species and then evaluate the model with other genomes of the same species. Therefore, when we train on those species, we don\u2019t have a testing genome to simulate testing reads from. And when we do simulate testing reads from those genomes, they don\u2019t exist in the training set. To this end, we evaluate our model with two metrics: accuracy for all reads and accuracy for known reads (reads from known species).Additional file 3 RefSeq bacterial genomes published every year. This table shows the release year, the organism name and taxonomic ID of completed genomes in RefSeq Bacterial assembly summary.Additional file 4 The average accuracy per species from 1999 to 2019. The table shows the average accuracy per species for 5-fold cross-validation.Additional file 5 The standard deviation of the accuracy per species from 1999 to 2019. The table shows the standard deviation of the accuracy per species for 5-fold cross-validation.Additional file 6 Profiling results change over time on species level. The NBC incremental learning classifiers trained on different years are evaluated on a real human fecal sample (SRA ID: SRS105153) on species level. The figure shows that the predicted composition of the sample changed over time and is influenced by the training data. Taxa with lower than 5% relative abundance is moved to either \u201cOthers: New\u201d category or \u201cOthers: Old\u201d category depending on weather the taxa is recently added or was added in previous section.Additional file 7 Profiling results change over time on order level. The NBC incremental learning classifiers trained on different year are evaluated on a real human fecal sample (SRA ID: SRS105153) on order level. The figure shows that the predicted composition of the sample changed over time and is influenced by the training data. Taxa with lower than 5% relative abundance is moved to either \u201cOthers: New\u201d category or \u201cOthers: Old\u201d category depending on weather the taxa is recently added or was added in previous section.Additional file 8 Misclassified reads \u2013 phylum level. We trace our species classification results back to phylum level and most of the reads are assigned to the correct phylum level taxonomic labels. This table shows the reads that got misclassified in phylum level.Additional file 9 15-mer shared with B. aphidiciola (taxid: 9). 15-mer shared between the case example read in \u201cB. aphidiciola (taxid: 9).Additional file 10 15-mer shared with C. botulinum (taxid:1491). 15-mer shared between the case example read in \u201cC. botulinum (taxid:1491).Additional file 11 Blast result for B. aphidiciola (taxid: 9). Blast result for the case example read in \u201cB. aphidiciola (taxid: 9) exclusing strain Schlechtendalia chinensis.Additional file 12 Blast result for C. botulinum (taxid:1491). Blast result for the case example read in \u201cC. botulinum (taxid:1491).Additional file 13 Blast search strategies for B. aphidiciola (taxid: 9). The Blast search strategies for the case example read in \u201cB. aphidiciola (taxid: 9) exclusing strain Schlechtendalia chinensis. The file ends in ASN and the reader can also open it as a normal text file.Additional file 14 Blast search strategies for C. botulinum (taxid:1491). The Blast search strategies for the case example read in \u201cC. botulinum (taxid:1491). The file ends in ASN and the reader can also open it as a normal text file."}
{"text": "Tetragonula carbonaria and Tetragonula hockingsi species in Australia, from Geniotrigona thoracica and Heterotrigona itama in Malaysia and from Tetragonisca angustula in Brazil. The previously unrecognised abundance of trehalulose in stingless bee honeys is concrete evidence that supports some of the reported health attributes of this product. This is the first identification of trehalulose as a major component within a food commodity. This study allows the exploration of the expanded use of stingless bee honey in foods and identifies a bioactive marker for authentication of this honey in associated food standards.Stingless bee (Meliponini) honey has long been considered a high-value functional food, but the perceived therapeutic value has lacked attribution to specific bioactive components. Examination of honey from five different stingless bee species across Neotropical and Indo-Australian regions has enabled for the first time the identification of the unusual disaccharide trehalulose as a major component representing between 13 and 44\u00a0g per 100\u00a0g of each of these honeys. Trehalulose is an isomer of sucrose with an unusual \u03b1-(1\u2009\u2192\u20091) glucose-fructose glycosidic linkage and known acariogenic and low glycemic index properties. NMR and UPLC-MS/MS analysis unambiguously confirmed the identity of trehalulose isolated from stingless bee honeys sourced across three continents, from  Like the more well-recognised Apis mellifera honeybees, stingless bees live in permanent colonies made up of a single queen and workers, who collect pollen and nectar to feed larvae within the colony and likewise store honey in the hive for this purpose. Honey produced by stingless bees is known by various names such as Meliponine honey, pot-honey, sugarbag honey , and Kelulut honey . Under these and other names, stingless bee honey has a long history of traditional indigenous use with a range of purported therapeutic properties2, including antidiabetic and antioxidant activity4. Various studies have been conducted of physicochemical and nutritional composition of stingless bee honey5, but to date few bioactive components have been identified2. While these studies all acknowledged that the composition of stingless bee honey is different to that of European bee honey, no rigorous identification of the major components and potential therapeutically active compounds has been reported. In addition to the importance of identifying the potential therapeutic components of stingless bee honey, the rapidly increasing consumer demand for stingless bee honey derived products has highlighted the need to produce food standards to enable establishment of authenticity and provenance of such products6.Stingless bees (Meliponini) occur in most tropical and sub-tropical regions, with over 500 species of these eusocial bees distributed across Neotropical, Afrotropical and Indo-Australian regions1) \u2212) m/z 341.1082  was clearly a disaccharide, but did not match any of our initially available disaccharide standards. Previous analysis of stingless bee honeys have suggested that the disaccharide present was the glucose-glucose disaccharide maltose (2)18. However, the improved resolution and mass spectral data provided by our UPLC-MS/MS method demonstrated that the disaccharide present in all five stingless bee honeys, was in fact not maltose. This enigmatic disaccharide eluted with a slightly shorter UPLC retention time compared to a maltose standard  1a) and (1b). Tentative structural assignments were compared with literature enabling the unambiguous assignment of the unknown honey disaccharide as trehalulose  being present at a higher level than 1-O-\u03b1-d-glucosylpyranosyl-\u03b2-d-fructofuranose tautomer (1b)19. Trehalulose was previously isolated from excrement of sweet potato whitefly Bemisia tabaci by Bates et al.20 These authors reported both 13C and 1H NMR assignments in D2O of three tautomers present in 20:4:1 ratio. Their NMR data were similar to incomplete details reported previously by Cookson19, who had isolated trehalulose from a mixture of glucose, fructose and isomaltulose produced by immobolised microbial cells, with the isolated disaccharide reported to be a 2:1 mixture of fructopyranose and fructofuranose forms by 13C NMR and other methods.1D and 2D NMR analysis of the isolated disaccharide suggested a 1,1-linkage between glucose and fructose monosaccharides with evidence of major/minor tautomers for the fructose ring (1a) and (1b), which were present in a 3.6:1 ratio by integration of the anomeric proton signals for the glucose rings (Table\u00a01a) were irradiated in separate 1D TOCSY experiments to identify the proton signals in each monosaccharide spin system. This allowed full elucidation of the pyranose tautomer of fructose (\u03b2-d-Frup) predominant in trehalulose (1), with assigned 13C and 1H NMR data of (1a) shown to be in close agreement to that previously reported by Bates et al.20 for this compound  were partly obscured by the more dominant fructopyranose tautomer (1a) in the isolated trehalulose. Only the anomeric glucosyl proton doublet  could be clearly distinguished. Based on 2D HSQC, TOCSY and COSY experiments, all other protons and carbon shifts of the minor fructofuranose conformer (1b) were assigned as shown in Table\u00a020. A third more minor tautomer with anomeric glucosyl proton doublet  could be seen in our trehalulose NMR spectra, but due to the low concentration and overlap with the other anomeric signals it is not possible to report full data for this compound. This is presumably the component speculated to be the \u03b1-furanose tautomer by Bates et al.20.1) with minor disaccharides tentatively identified as sucrose, maltulose and turanose by comparison of NMR chemical shifts with literature22. Isomaltulose (3)22 was not detected in these NMR spectra of trehalulose isolated from stingless bee honey.Close examination of NMR spectra demonstrated that the disaccharide isolated from each of the five stingless bees comprised\u2009>\u200990% trehalulose  MS/MS fragmentation for trehalulose (1) has not previously been reported. UPLC-MS/MS analysis of trehalulose isolated from each of the stingless bee species showed a single unresolved peak for (1a) and (1b) tautomers  structure. Glycosidic bond cleavage of the molecular ion ([M-H]\u2212) m/z 341 of trehalulose (1) produces a dominant m/z 179, with fragmentation of this ion to m/z 161, 143, 131, 119 and 113  differed markedly from that of maltose. Most notably, the m/z 221 peak corresponding to the glucosyl-glycoaldehyde anion observed in the mass spectra of maltose (2) and isomaltulose (3)26, was not observed in the 1\u2009\u2192\u20091-linked trehalulose (1) spectrum , but the authentic standard erroneously contained a second minor disaccharide peak which proved by UPLC-MS/MS analysis to be an isomaltulose  (3) contaminant. This second peak had identical retention time and MS/MS fragmentation to authentic isomaltulose (3) 24. Isomaltulose (3) and trehalulose (1) are regioisomeric disaccharides which occur concomitantly in reported biological sources of these disaccharides27, and the presence of isomaltulose (3) as a 5% contaminant in the commercial trehalulose standard is understandable. Industrial trehalulose production has been achieved from sucrose using immobilised enzymes, with differing ratios of (3) to (1) produced depending on the enzyme used28.The authentic standard of trehalulose obtained for confirmatory comparison exhibited a major UPLC peak with the same retention time and MS/MS fragmentation as our isolated disaccharide 3) Figs.\u00a0, 3, incl Figs.\u00a0, 1) isolated by preparative HPLC from each of our stingless bee honeys contains no evidence of co-occurring isomaltulose (3) in either UPLC-MS/MS chromatograms . This observation highlights the potential of stingless bee honey as a novel source of pure trehalulose (1).It is worth noting that trehalulose  as a major component representing between 13 and 44\u00a0g per 100\u00a0g of each stingless bee honeys. The highest proportion of trehalulose was present in the sample of Malaysian Geniotrigona thoracica honey in which it represented 84% (w/w) of the total sugar content. The only other sugars present at significant levels were the monosaccharides glucose and fructose.UPLC-MS/MS quantitative analysis of the sugars present in the same five stingless bee honey samples employed in preparative HPLC isolations confirmed the presence of trehalulose  glycosidic bond  as a distinguishing disaccharide in these stingless bee honeys thus provides a ready marker for authenticity, in the same way that specific marker compounds are used to authenticate high value m\u0101nuka honey34. Trehalulose therefore represents an ideal indicator of authenticity to be incorporated in the development of relevant stingless bee honey standards6. Previous attempts to develop a fast FTIR-ATR analysis of sugars in H. itama honey were unfortunately ill-founded in the belief that the major disaccharide present in this stingless bee honey was maltose (2)16. However, it is likely that the chemometric PLS regression analysis presented by these authors will still hold true for quantitation against trehalulose , presenting the ready opportunity for the development of a fast FTIR-ATR analysis method for trehalulose (1) in stingless bee honey. This would facilitate the development of a rapid method for the authentication of stingless bee honey products.This is the first isolation of trehalulose from a food source, namely stingless bee honey. Stingless bee honey represents a highly valued food with accredited biological activity, and this reported activity may in part be attributable to the previously unrecognised abundance of trehalulose in these honeys. The presence of trehalulose Tetragonula hockingsi (syn. Trigona hockingsi)35 and Tetragonula carbonaria (syn. Trigona carbonaria)35 honey samples were collected from hives located in suburban backyards in Brisbane, Queensland Australia. Geniotrigona thoracica (syn. Trigona thoracica)35 honey was purchased from a producer in Kampung Rinching Hilir, Selangor, Malaysia. Heterotrigona itama (syn. Trigona itama)35 honey was purchased from a producer in Batang Kali, Selangor, Malaysia. Tetragonisca angustula (syn. Trigona angustula)35 honey (Brazil) was provided as a gift. All stingless bee honey samples were stored in a refrigerator (4\u00a0\u00b0C) before analysis.Authentic trehalulose (specified by supplier\u2009>\u200990% purity) was purchased from Biosynth Carbosynth . Maltose, sucrose, glucose and fructose were purchased from Sigma Aldrich , and isomaltulose from Myopure .4OH and Mobile Phase B: 20% RO water/80% acetonitrile with 0.1% NH4OH, utilising a gradient as follows: 0\u20131\u00a0min, 100% B; 1\u201313\u00a0min, 100% B to 50% B; 13\u201416\u00a0min, 50% B to 100% B; 16\u201320\u00a0min, 100% B.Honey samples (0.5\u00a0g) were dissolved in ultrapure water (50\u00a0mL) and further diluted 1:10 in water and then 1:4 in acetonitrile. Sugar standards were similarly dissolved in Millipore water and diluted sequentially in aqueous acetonitrile to provide a concentration range of glucose 1\u2013204\u00a0\u00b5g/mL, fructose 1\u2013195\u00a0\u00b5g/mL, sucrose 1\u2013198\u00a0\u00b5g/mL and trehalulose 1\u2013203\u00a0\u00b5g/mL. Analysis of sugars in individual honey samples was conducted on a Shimadzu Nexera ultra high-performance liquid chromatograph (UHPLC) coupled with a Shimadzu 8045 MS/MS detector with Lab Solutions software and a CTO-20AC column oven was operated at 35\u00a0\u00b0C. Separations were conducted on a Waters Acquity UPLC BEH Amide 1.7\u00a0\u00b5m, 2.1\u2009\u00d7\u2009100\u00a0mm column eluted at a flowrate of 0.2\u00a0mL/min with Mobile Phase A: 70% RO water/30% acetonitrile with 0.1% NH2) typically in the range of 0.98\u20130.99. Percentage recoveries of standard additions to five honeys at four levels for each of glucose, fructose, sucrose and trehalulose were calculated, with values for spiked samples calculated by subtraction of the endogenous, no-spike value. Recoveries for spiked samples were calculated by using the expected value and averaged 93\u2013119% with standard deviations of 2\u20134% at the highest spike level, 4\u201315% at the intermediary spike levels and 18\u201340% at the lowest spike level.Method validation was conducted by comparing the results for calibration using external sugar standards to a standard additions method for determining sugar concentrations. For standard additions, squared linear correlation coefficients (R\u2212) m/z 341.1 was fragmented at both 20\u00a0V and 8\u00a0V to examine differences in fragmentation of individual eluted disaccharides. Selected reaction monitoring (SRM) transitions of m/z 341.2\u2009\u2192\u2009179.2 were used for quantitation of trehalulose in each of the analysed honeys with confirmation transitions of m/z 341.2\u2009\u2192\u2009251.2 and m/z 341.2\u2009\u2192\u2009161.2. Sucrose was quantitated using m/z 341.2\u2009\u2192\u2009179.2, with m/z 341.2\u2009\u2192\u2009161.2 and m/z 341.2\u2009\u2192\u2009119.1 used for confirmation. Similarly, glucose and fructose were analysed based on SRMs of m/z 179.2\u2009\u2192\u200989.0 (quantitation) with m/z 179.2\u2009\u2192\u2009101.1 and m/z 179.2\u2009\u2192\u2009113.1 (confirmation).The disaccharide molecular ion  using full-scan ddMSMS mode using an inclusion list of 341.1089 ([M-H]\u2212) and 387.1144 (M\u2009+\u2009HCOO\u2212). The normalized collision energy (NCE) was set to 20%. Xcalibur  was used for instrumental control and spectral inspection.High resolution mass spectral data was conducted on a Thermo Dionex Ultimate 3000 ultra high-performance liquid chromatograph (UHPLC) coupled with a Q Exactive Orbitrap high resolution accurate-mass (HRAM) spectrometry system. LC separation was carried out on a Waters Acquity UPLC BEH Amide column  at 35\u00a0\u00b0C using a flowrate of 0.2\u00a0mL/min with mobile phase A: 70% RO water/30% acetonitrile with 0.1% NH2 100\u00a0\u00c5 250\u2009\u00d7\u20094.6\u00a0mm column with an isocratic mobile phase comprised of 85% acetonitrile and 15% RO water at a flow rate of 2.5\u00a0mL/min. Eluted sugars were monitored with a Shimadzu ELSD- LT (Low Temperature) detector operated at 350\u00a0kPa and 45\u00a0\u00b0C. The elution flow was diverted to a collection tube when the target peak emerged and 5\u00a0mL (2\u00a0min) fractions collected before reconnection of the column eluant to the ELSD detector (to see the tail end of the peak). Collected fractions were analysed \u2018as is\u2019 by UPLC-MS/MS (as above), and a second portion freeze-dried and dissolved in D2O for NMR analysis.To enable separation of individual disaccharides, the honey samples were chromatographed on a Shimadzu HPLC-ELSD system consisting of a Shimadzu Class VP Pump LC-10AD VP/Valve FCL-10AL VP/Degasser DGU-14A with a Class VP Software/ SCL-10A VP controller, SIL-10AD VP autosampler and a CTO-10A VP column oven operated at 40\u00a0\u00b0C. Separations were performed on a Phenomenex Luna 5\u00a0\u00b5m NH1H nuclear magnetic resonance (NMR) analysis performed on an AV500 (500.13\u00a0MHz) Bruker Avance system using 5\u00a0mm SEI Probe. A zg45 pulse experiment at 298\u00a0K with 64 scans and a spectral width of 12.0\u00a0ppm  was applied. Spectra were recorded in D2O, with chemical shifts (\u03b4) values recorded in ppm. Residual protonated solvent signals were used as internal standard (\u03b4 4.80). NMR data presented as: chemical shift, multiplicity , coupling constant (J Hz), assignment. Multiplicities, and hence coupling constants, reported are apparent values. 13C NMR spectra were recorded on a Bruker Avance 500 (125.77\u00a0MHz) spectrometer with complete proton decoupling. Spectra were recorded in D2O with added 1% 1,4-dioxane (\u03b4 67.40) used as reference. 2D COSY, TOCSY, HSQC, HMBC (500\u00a0MHz) spectra were used to confirm spectral assignments. Trehalulose exists in aqueous solution as a mixture of both pyranose and furanose forms (3.6:1) with both tautomers assigned as below.The purified sugar was analysed via O-\u03b1-d-glucopyranosyl-\u03b2-d-fructopyranose (1a). 1H NMR  \u03b4 4.98 , 4.08 , 4.02 , 3.94 , 3.92 , 3.88 , 3.85, 3.79 , 3.80\u20133.76 , 3.73 , 3.72 , 3.58 , 3.48 , 3.44\u00a0ppm . 13C NMR  \u03b4 99.32 (C-1\u2032), 98.64 (C-2), 73.81 (C-3\u2032), 72.73 (C-5\u2032), 72.28 (C-2\u2032), 70.41 (C-4\u2032), 70.34 (C-4), 69.93 (C-1), 69.89 (C-5), 68.70 (C-3), 64.35 (C-6), 61.31\u00a0ppm (C-6\u2032).1-O-\u03b1-d-glucosylpyranosyl-\u03b2-d-fructofuranose (1b). 1H NMR  \u03b4 5.01 , 4.13 (H-4), 4.15 (H-3), 3.89 (H-6\u2032), 3.88 (H-5), 3.81 (H-6), 3.76 (H-3\u2032), 3.72 (H-5\u2032), 3.68 (H-6\u2032), 3.59 (H-2\u2032), 3.56 ppm\u00a0(H-1). 13C NMR  \u03b4 101.69 (C-2), 81.49 (C-5), 77.11 (C-3), 75.19 (C-4), 72.91 (C-5\u2032), 72.23 (C-2\u2032), 69.29 (C-1), 63.13 (C-6), 61.35\u00a0ppm (C-6\u2032).1-1a) and (1b).NMR analysis of authentic trehalulose  provided matching NMR data for both tautomers (Supplementary Information."}
{"text": "Psilocybe, among others, and is the active ingredient in so-called \u201cmagic mushrooms\u201d. Although its notoriety originates from its psychotropic properties and popular use as a recreational drug, clinical trials have recently recognized psilocybin as a promising candidate for the treatment of various psychological and neurological afflictions. In this work, we demonstrate the de novo biosynthetic production of psilocybin and related tryptamine derivatives in Saccharomyces cerevisiae by expression of a heterologous biosynthesis pathway sourced from Psilocybe cubensis. Additionally, we achieve improved product titers by supplementing the pathway with a novel cytochrome P450 reductase from P. cubensis. Further rational engineering resulted in a final production strain producing 627\u00a0\u00b1\u00a0140\u00a0mg/L of psilocybin and 580\u00a0\u00b1\u00a0276\u00a0mg/L of the dephosphorylated degradation product psilocin in triplicate controlled fed-batch fermentations in minimal synthetic media. Pathway intermediates baeocystin, nor norbaeocystin as well the dephosphorylated baeocystin degradation product norpsilocin were also detected in strains engineered for psilocybin production. We also demonstrate the biosynthetic production of natural tryptamine derivative aeruginascin as well as the production of a new-to-nature tryptamine derivative N-acetyl-4-hydroxytryptamine. These results lay the foundation for the biotechnological production of psilocybin in a controlled environment for pharmaceutical applications, and provide a starting point for the biosynthetic production of other tryptamine derivatives of therapeutic relevance.Psilocybin is a tryptamine-derived psychoactive alkaloid found mainly in the fungal genus  \u2022De novo production of psilocybin in S. cerevisiae.\u2022P. cubensis significantly boosts production.Expression of a novel cytochrome P450 reductase from \u2022Rational metabolic engineering results in 627\u00a0mg/L psilocybin production.\u2022Production of natural and new-to-nature tryptamine derivatives demonstrated including norbaeocystin, baeocystin, and aeruginascin. Psilocybin itself is not psychoactive - rather it is the dephosphorylated derivative psilocin that causes the hallucinogenic effect. Psilocybin is rapidly dephosphorylated to psilocin following ingestion in the mucosa by alkaline phosphatases and nonspecific esterases  Fig. 1)Fig. 1). 50 of 280\u2013285\u00a0mg/kg in rats and mice  to make extraction a commercially viable option , with cuPsilocybin preparations for pharmaceutical and research use currently rely on chemical synthesis via a difficult and expensive process . AlthougP. cubensis was recently elucidated (Aspergillus nidulans was established with titers reaching 110\u00a0mg/L (Escherichia coli (E. coli) by the in vivo bioconversion of added substrates 4-hydroxyindole, serine and methionine, with a titer of 1.16\u00a0g/L reported  as previously reported ) to exponentially growing cells and aseptically storing 1\u00a0mL aliquots at \u221280\u1d52C. Cultures were grown in synthetic medium according to the following recipes. Synthetic medium was prepared with 7.5\u00a0g/L (NH4)2SO4, 14.4\u00a0g/L KH2PO4, 0.5\u00a0g/L MgSO47H2O and appropriate growth factors (4)2SO4. YP medium was prepared with 10\u00a0g/L yeast extract and 20\u00a0g/L peptone. In all cases unless stated otherwise, 20\u00a0g/L glucose was added. Media was supplemented with 200\u00a0mg/L G418 and 100\u00a0mg/L nourseothricin when required. E. coli strains were grown in Luria\u2013Bertani (LB) media and supplemented with 100\u00a0mg/L ampicillin when required. Agar plates were prepared as described above but with the addition of 20\u00a0g/L agar.All is study  were deris study . Frozen  factors . Synthet2.2E. coli DH5\u03b1 was used for all plasmid cloning and propagation. Single integration plasmids were constructed using the EasyClone-MarkerFree system (S. cerevisiae genome was achieved using a Kluyveromyces lactis URA3 gene (KlURA3) under control of a truncated 10bp KlURA3 promoter. Heterologous genes were codon-optimized for expression in S. cerevisiae using the JCat algorithm  cultivation of psilocybin producing S. cerevisiae strains, cells were inoculated from a 400\u00a0\u03bcL synthetic media pre-culture into 500\u00a0\u03bcL synthetic media to a starting OD600 of 0.1 in a 96-deep well microtiter plate with air-penetrable lid  and incubated for 72\u00a0h with shaking at 300\u00a0rpm. When required, uracil was added to a final concentration of 200\u00a0mg/L.2, O2 and ethanol were monitored continuously , and data acquisition was achieved using the Lucullus software . Seed culture was prepared by cultivating the strain for 48\u00a0h\u00a0at 30 \u1d52c in 50\u00a0mL of synthetic media containing; 3\u00a0g/L KH2PO4, 0.5\u00a0g/L MgSO4.7H2O, 5\u00a0g/L (NH4)2SO4, 20\u00a0g/L glucose and appropriate vitamins and trace elements , fed-batch phase was initiated at a starting feed rate of 0.45\u00a0g/h with an exponential increase of 0.02 h\u22121), fed-batch phase was initiated at a starting feed rate of 0.45\u00a0g/h with an exponential increase of 0.02 h\u22121. Feed media contained; 30\u00a0g/L KH2PO4, 6.3\u00a0g/L MgSO4.7H2O, 50\u00a0g/L (NH4)2SO4, 0.35\u00a0g/L Na2SO4, 500\u00a0g/L glucose, 1\u00a0mL/L Antifoam 204 and a 10 fold higher vitamin and trace element concentration  equipped with measurement probes for pH, dissolved oxygen (DO) and temperature. During fermentation, off-gas COelements . The seentration . During Extraction of extracellular tryptamine derived metabolites for analysis was performed as follows. Cell culture broth was supplemented with 100% acetonitrile at a ratio of 1:1, vortexed thoroughly then centrifuged at 3000\u00a0g for 5\u00a0min. The resulting supernatant was further diluted in 50% acetonitrile (v/v) if required and analyzed using LC-MS with the following conditions; High resolution LC-MS measurements were carried out on a Dionex UltiMate 3000 UHPLC , connected to an Orbitrap Fusion Mass Spectrometer . The UHPLC was equipped with a SeQuant zic-Hilic column (Merck KGaA), 15\u00a0cm x 2.1\u00a0mm, 3\u00a0\u03bcm. The temperature was 35\u00a0\u00b0C and the flow rate 0.5\u00a0mL/min. The system was running an isocratic gradient with a mobile phase consisting of 20% 10\u00a0mM ammonium formate (pH 3) and 80% acetonitrile, with 0.1% formic acid. The samples were passed on to the MS equipped with a heated electrospray ionization source (HESI) in positive-ion mode with sheath gas set to 50 (a.u.), aux gas to 10 (a.u.) and sweep gas to 1 (a.u.). The cone and probe temperature were 325\u00a0\u00b0C and 350\u00a0\u00b0C, respectively, and spray voltage was 3500\u00a0V. Scan range was 100\u2013800\u00a0Da and time between scans was 50\u00a0ms. Psilocybin, psilocin and tryptamine authentic analytical standards were obtained from Sigma-Aldrich and used to quantify production in engineered strains.Extraction of all other extracellular metabolites was performed by centrifuging cell cultures and collecting the resulting supernatant which were analyzed for quantification of ethanol (and other metabolites) as follows. Metabolites were detected and quantified using a high performance liquid chromatography (HPLC) Agilent 1100 series with a refractive index detector and a Bio-Rad Aminex HPX-87H column (300\u00a0mm\u00a0\u00d7\u00a07.8\u00a0mm) with 5\u00a0mM H2SO4 as an eluent at a flow rate of 0.6\u00a0mL/min with column oven temperature set to 50\u00a0\u00b0C. To protect the HPX-87H column from contamination and foreign particles, a guard column was fitted to the system.33.1S. cerevisiae strain ST8251 (CEN.PK113-5D\u00a0+\u00a0Cas9) (Catharanthus roseus (C. roseus) tryptophan decarboxylase (CrTdc) was used instead of the P. cubensis variant (PsiD), due to its previously confirmed efficacy in S. cerevisiae (PcPsiH). Cytochrome P450 enzymes are characterized by their dependency on a cytochrome P450 reductase (CPR), which facilitates electron transfer between NADPH and cytochrome P450 enzymes  or spontaneously degraded to psilocin, however the 4-hydroxytryptamine kinase (PcPsiK) has been shown to also act on psilocin, resulting in a psilocybin-psilocin equilibrium reaction  . The biorevisiae . Tryptam enzymes . In S. creaction . Finallyreaction .S. cerevisiae (resulting in strain ST9327), then, using an Orbitrap Fusion Mass Spectrometer and authentic analytical standards, successful production of psilocybin, as well as the pathway intermediate tryptamine, and the spontaneous degradation product psilocin was confirmed in micro-titer plate cultivation (The basic heterologous pathway was introduced into tivation . Quantif3.2PcpsiH. Cytochrome P450 enzymes (CYP) belong to a superfamily of heme-containing monooxygenases and require a cytochrome P450 reductase (CPR) partner to deliver one or more electrons to reduce the heme-bound iron and oxidized substrates (S. cerevisiae CPR (Ncp1) could carry out this reduction, the accumulation of tryptamine suggested a sub-optimal interaction between the two enzymes. Due to the importance of the CYP-CPR interaction for optimal catalytic activity  with a tBLASTx search of the P. cubensis genome  AtAtr2 was also tested with additional overexpression of the S. cerevisiae cytochrome b5 (CYB5) as this has previously been shown to enable functional expression of other CYP's , and expression of Pccpr from the medium-strength TEF2 promoter only a small increase in titer (ST9329), expression of Pccpr from the strong TEF1 promoter produced a significant increase in psilocybin and psilocin titer (ST9328), reaching 137.1\u00a0\u00b1\u00a08.3\u00a0mg/L and 82.8\u00a0\u00b1\u00a03.7\u00a0mg/L respectively in micro-titer plate, representing a 29-fold increase over the parental strain  led to only a minor increase in titer.While psilocybin was successfully produced in yeast, the initial titers were low. Furthermore, analysis revealed the extracellular accumulation of tryptamine (120.3\u00a0\u00b1\u00a011.1\u00a0mg/L) indicating a significant limitation in the conversion of tryptamine to 4-hydroxytryptamine encoded by the cytochrome P450 gene bstrates . While tactivity , we attes genome  using Ncer CYP's . Finallyl strain A. This n3.3PcCpr resulted in a significant increase in psilocybin and psilocin titers, and furthermore, significantly reduced extracellular accumulation of the first product in the heterologous pathway, tryptamine , overexpression of feedback insensitive mutant genes encoding proteins in the shikimate pathway  (RIC1) (RIC1 (resulting in strain ST9179) and subsequent overexpression of ARO1 and ARO2 (resulting in strain ST9316) lead to a significant increase in psilocybin and psilocin titers. While further overexpression of feedback insensitive Aro4K229L, Trp2S65R, S76L (resulting in strain ST9318) resulted in a decrease in titer. In all three strains a significant increase in the LC-MS peak areas corresponding to norbaeocystin and baeocystin was observed compared to the parental strain containing the psilocybin biosynthetic pathway and optimized Pccpr expression (ST9328)  , and del) (RIC1) . Iterati(ST9328) . While ibased on  using a ectively B.PcpsiK on a Ty-integrative vector . By cultivating the strain in bioreactors, the pH, oxygen supply and aeration could be accurately controlled and higher glucose amounts could be fed, which should allow for comparatively higher production compared to micro-titer plate cultivation. Fed-batch fermentation was performed in triplicate with an initial exponential feed-rate of 0.02 h\u22121 with a 513\u00a0g/L glucose feed media . In total, 266.6\u00a0\u00b1\u00a05.2\u00a0g/L of glucose was fed over a period of 213.7\u00a0h. Controlled fed-batch fermentation of ST9482 led to the production of 627\u00a0\u00b1\u00a0140\u00a0mg/L of psilocybin and 580\u00a0\u00b1\u00a0276\u00a0mg/L of psilocin  accepting both tryptophan and 4-hydroxytryptophan (PcPsiK) (ST9441). Interestingly, omitting this gene abolished all production indicating that PcPsiM only accepts phosphorylated 4-hydroxytryptamine substrates (Pccpr expression) tentatively  detected the presence of the pathway intermediates norbaeocystin (non N-methylated)  led to a 21-fold increase in the dephosphorylated aeruginascin peak area , previously demonstrated to convert 5-hydroxytryptamine (serotonin) into N-acetyl serotonin (normelatonin) in S. cerevisiae (N-acetyl-4-hydroxytryptamine in the constructed strain (ST9442) demonstrating not only the relaxed substrate specificity of BtAANAT, but also the successful production of a novel molecule structurally similar to both psilocin and normelatonin with potentially novel pharmacological activity  A, baeocyhylated) B and psihylated) C catalyzginascin . Intereseak area , therebyrevisiae  could alactivity E.Fig. 6P4Saccharomyces cerevisiae, demonstrating a feasible option for the future production of this pharmaceutically interesting molecule. While introducing the basic biosynthetic pathway into yeast led to the production of psilocybin, high-level production, and corresponding consumption of excess tryptamine was achieved only upon expression of a putative cytochrome P450 reductase (Pccpr) from the host species P. cubensis. Functional expression was also dependent on the level of Pccpr transcription, with expression from the strong constitutive promoter pTEF1 resulting in an increase in psilocybin titers (ST9328) while expression from the mid-strength constitutive promoter pTEF2 resulted in only a small increase in psilocybin titers (ST9329) (S. cerevisiae CPR (NCP1) expressed both from its native promoter and strong constitutive promoter pTEF1 as well as A. thaliana CPR (AtAtr2) are both poorly compatible with the P. cubensis CYP (PcPsiH) is completely in-line with previous studies and demonstrates the importance of investigating the CYP:CPR interaction carefully (PcpsiH required strong constitutive expression of Pccpr from pTEF1. Excess expression of CPR's are often toxic to the cell as it leads to electron transfer uncoupling and the production of reactive oxygen species (ROS). For this reason, most native and heterologous CYP enzymes are expressed far in excess of their CPR partner  A. Overalarefully . Interes partner . The obs partner . This fuRIC1 produced an 18% increase in titer (ST9179) , a further substantial increase was achieved by introducing multiple copies of PcpsiM (ST9492)  may be explained by the increased accumulation of pathway intermediates baeocystin and norbaeocystin and their possible negative impact on cell physiology. Indeed a significant decrease in final OD600 was observed for this strain which subsequently increased after introducing multiple copies of PcpsiM (data not shown) and observing a decrease in the LC-MS peak areas of baeocystin and norbaeocystin  B. This gnic acid  suggesti(ST9492) B indicateocystin . While igrations . HoweverS. cerevisiae contains multiple phosphatase enzymes capable of removing phosphate groups from proteins and small-molecules  and aeruginascin  provided a proof-of-concept for industrial-scale production, and while separation and purification of psilocybin from the fermentation broth were not investigated in this work, the observation that psilocybin was efficiently excreted into the extracellular space by yeast will facilitate a simple and cost-effective downstream processing procedure. While we were able to demonstrate high-level psilocybin production (627\u00a0\u00b1\u00a0140\u00a0mg/L in fed-batch fermentation), this was accompanied by concomitant production of psilocin (580\u00a0\u00b1\u00a0276\u00a0mg/L). In fact, significant accumulation of psilocin was observed in all strains tested  indicatiolecules , which molecules . Indeed . Indeed  showed tter 139h  suggestiginascin , and then titers , suggestnidation , it can S. cerevisiae to produce derivatives from 4-hydroxylated substrates. It was found that omitting PcPsiK resulted in no production of psilocybin or psilocin phosphorylate alternate substrates. Production of Psilocybe derived tryptamine molecules in S. cerevisiae further offers the possibility of isolating useful quantities of these molecules in high purity thereby facilitating increased investigation into their in vivo function, which, so far has been severely limited by their availability.While psilocybin is an interesting and pharmaceutically relevant molecule in its own right, one of the unique features of synthetic biology is the ability to \u201cmix and match\u201d enzymes to create new interesting molecules that aren't found in nature and are infeasible to produce by chemical synthesis. Tryptamine derivatives are an interesting class of molecule that are known to exert their effect through interaction with different serotonin receptors in the body . While mpsilocin  indicatiin vitro . Our effinascens . Interesngestion . This dingestion , and theN-acetyl-4-hydroxytryptamine was produced by introducing a serotonin N-acetyltransferase into a 4-hydroxytryptamine producing strain (ST9442) thereby resulting in a (to our knowledge) novel molecule structurally similar to the human neurotransmitter N-acetylserotonin (normelatonin) with the hydroxyl group on the 4 position instead of the 5 position. While it would be premature to speculate on possible pharmacological functions of this new molecule, it demonstrates how in vivo enzymatic biosynthesis can be used to create novel structural variants of molecules that would otherwise be too complex to produce by chemical synthesis. Indeed, stereoselective introduction of hydroxyl groups into aromatic rings has been described as \u201cone of the most challenging fields in modern  synthesis\u201d (S. cerevisiae strains in the drug discovery process.nthesis\u201d , thereby5Saccharomyces cerevisiae. Implementation of the biosynthetic pathway from Psilocybe cubensis with expression of a novel cytochrome P450 reductase resulted in high-level de novo production from glucose. Further rational engineering of native S. cerevisiae metabolism demonstrated how improved production can be achieved by boosting the native supply of the pathway precursor tryptophan. Finally, the production of natural and new-to-nature 4-hydroxytryptamine derivatives demonstrates the versatility of enzymatic biosynthesis, and how S. cerevisiae can be used to produce novel drug candidates that go beyond what is feasible with chemical synthesis or extraction from natural sources.In this work, the successful production of psilocybin was demonstrated in N. Milne: Conceptualization, Methodology, Validation, Investigation, Writing - original draft, Writing - review & editing. P. Thomsen: Validation, Investigation, Visualization. N. M\u00f8lgaard Knudsen: Investigation, Visualization, Validation. P. Rubaszka: Validation, Investigation. M. Kristensen: Methodology, Validation, Investigation. I. Borodina: Funding acquisition, Project administration, Supervision, Writing - original draft.NM and IB are co-inventors on a patent application related to this research."}
{"text": "In recent years, many researchers have shown increasing interest in music information retrieval (MIR) applications, with automatic chord recognition being one of the popular tasks. Many studies have achieved/demonstrated considerable improvement using deep learning based models in automatic chord recognition problems. However, most of the existing models have focused on simple chord recognition, which classifies the root note with the major, minor, and seventh chords. Furthermore, in learning-based recognition, it is critical to collect high-quality and large amounts of training data to achieve the desired performance. In this paper, we present a multi-task learning (MTL) model for a guitar chord recognition task, where the model is trained using a relatively large-vocabulary guitar chord dataset. To solve data scarcity issues, a physical data augmentation method that directly records the chord dataset from a robotic performer is employed. Deep learning based MTL is proposed to improve the performance of automatic chord recognition with the proposed physical data augmentation dataset. The proposed MTL model is compared with four baseline models and its corresponding single-task learning model using two types of datasets, including a human dataset and a human combined with the augmented dataset. The proposed methods outperform the baseline models, and the results show that most scores of the proposed multi-task learning model are better than those of the corresponding single-task learning model. The experimental results demonstrate that physical data augmentation is an effective method for increasing the dataset size for guitar chord recognition tasks. Automatic chord recognition (ACR) is a fundamental problem in the music information retrieval (MIR) field, wherein a chord is one of the key elements for understanding music. ACR remains a challenging problem because of the richness of the acoustic signals, broad types, and complexity of the music signal. The purpose of chord recognition is the automatic recognition of the chord progression in music recordings and its labeling in an appropriate form, such as A:maj, A:min, and B:sus. Popular applications of ACR can be found in music identification, music segmentation, and similar music recommendation systems. Recent ACR studies have shown that the chord recognition performance can be significantly improved using deep learning models, especially convolutional neural networks (CNNs) and recurrent neural networks (RNNs) ,2. Many An ACR system consists of three main components, namely feature extraction, classifiers, and chord sequence decoding. In the feature extraction part, an input audio signal is converted to its time-frequency representation using a short-time Fourier transform or frequency spectrogram. The log mel-spectrogram and constant Q transform (CQT) are widely used features in chord recognition ,5. MoreoDeep neural networks (DNNs) and CNNs are widely used for classification in audio music classification tasks ,8. In reIn this study, we used two types of datasets, namely the GuitarSet  and physhttps://github.com/gerelmaab/Physically_augmented_guitar_chord_dataset) a large-vocabulary dataset of guitar chords, which is created by the physical data augmentation method.5.In this paper, we address the problem of the relatively large-vocabulary chord recognition task by introducing multi-task deep learning architecture that learns the chord roots and qualities individually, and the output is integrated onto the symbolic label. Furthermore, we sought to generate an augmented dataset using robotics and prove its effectiveness via experimental evaluations. We also aimed to construct and open . The output root note and quality, respectively, are estimated/generated and then combined into one label. The output of the learning models is converted into label files to evaluate the performance of the architectures. We tested the recognition system only on a human dataset.The robot system comprises a string-pushing unit, picking unit, and linearly moving mechanical unit. A snapshot of the developed guitar-playing robot system is shown in The guitar-playing robot pushes the strings correctly at the right positions and subsequently generates various types of tones from the guitar. For the string-pushing unit, a four-line solenoid bar with six solenoids used in each line to fit six strings were installed; in total, there are 24 solenoids, so that any variation of a chord can be played as shown in Hence, the input force  feature for speech recognition tasks along with their delta and delta-delta to describe the acoustic energy distribution in each of the several different frequency bands . This reLibrosa  computedThe neighboring frames of the input representation can be expected to contain similar content, as the chords will not change on a frame-by-frame basis. Through systematic experiments on the validation folds , we founIn the dataset annotation, chord description is represented as G#:maj6/1. To formulate chord recognition as a classification task, we define a mapping of the dataset from chord description to chord vocabulary. First, we discard the chord inversions and suppressed or additional notes. For example:D#:sus2(7)/1 \u2192 D#:sus2maj6 \u2192 majmin6 \u2192 minmaj9, minmaj7 \u2192 maj7min9, min11 \u2192 min79, 11 \u2192 7dim \u2192 dim7Next, we introduce some conversion from the chord label with a short duration to the analogy label. We use ten types of quality, including maj, min, aug, maj7, min7, 7, dim7, hdim7, sus2, and sus4. The final vocabulary contains 98 classes. We incorporate a conversion over a chord as follows:For the labeling, a single label is estimated with the superframe. The chord label of the middle frame is used to the audio context clip label as illustrated in The GuitarSet dataset: The GuitarSet contains musical audio files and the corresponding chord annotations, which were annotated with [ted with . Three cThe augmented dataset: The augmented dataset was recorded directly from the guitar playing robot. This dataset consists of 12 root notes and 10 types of chord quality in a total of 97 classes of chords. Each chord was played individually with five types of stroking patterns, including D DU DU DU D, D DU UDU, D D DU UDD, D D DU, and simple fingerstyle, where D represents a downstroke, U represents an upstroke, and a space represents the gap time between the strokes. The recording environment was a sound isolation chamber. The microphone was placed near the guitar sound hole. Each specific chord was recorded for approximately 40\u201345 s, indicating that the created augmented dataset was evenly distributed over all the chord types. This dataset was recorded in an identical manner as the human dataset, in the WAV format and sampled at fs = 44,100 Hz. We annotated the chords manually using the chord annotation method proposed by [posed by .The Guitarset dataset is an unbalanced dataset over the chords, e.g., the C#:aug and C#:sus4 chords have the least duration of approximately 1.2 s; in contrast, the C#:maj chord has the longest duration of approximately 380 s. The distribution of the chord types of the Guitarset dataset is shown in This section details single-task learning and the structure of the proposed MTL model.The single-task learning network contains seven convolutional layers, two recurrent layers, and two fully connected (FC) layers. The architecture of the proposed convolutional recurrent neural network (CRNN) is shown in Training deep learning systems usually requires large and balanced datasets to train a good system and learn accurate parameters. However, in some applications such as medical imaging or where there is a relative lack of data  this requirement cannot be satisfied. In a large-vocabulary chord dataset, the majority class examples, such as major and minor, far outnumber the minority class examples such as suspended or augmented. In these cases, the single-task learning model lacks knowledge of some classes, and accurate learning is difficult. However, multi-task learning is a useful approach in cases where useful information can be derived from other related learning tasks to handle the data sparsity problem.The proposed model learns a mapping between an audio representation, such as the CQT, and the root notes and qualities. Essentially, the model can be viewed as a multi-task leaning model. From the pre-processed input, the proposed model computes the root and quality outputs directly. The model is trained with a multi-task learning method using two cost functions. In each cost function, the cross entropy (CE) between the ground truth and predicted labels is used. In summary, the root note and quality are modeled jointly with a shared network by the proposed model. This learning method is designed for chord recognition.In the case where the labeled data for one of the tasks are scarce, MTL can be adapted to the labeled data of the related task. In our dataset, the suspended, augmented quality training examples are short compared with the other classes of quality. As the two tasks have a different number of outputs, the potentially shareable layers are the middle layers of the model, resulting in a final layer of different dimensionality. In the proposed model, one sub-network learns 12 root notes, while the other sub-network learns 10 types of qualities, including major, minor, dominant seventh, dominant major and minor seventh, suspended, augmented, and half diminished 7 and diminished 7. The outputs of the two networks are then combined to obtain the \u201droot:quality\u201d annotation form, which was proposed in . In thisWe combined MTL with the CNN and RNN framework by sharing some layers between the two related tasks. The input features are passed through two identical sub-networks, where each sub-network architecture is the same as a single-task learning model except for the output layer. The two identical architectures perform root note and quality recognition. The output layers have a different number of outputs. The output of the first task is 12 because there are twelve music notes. The output of the second task is 10 because ten types of chord qualities are employed. The proposed MTL model is shown in The MTL model has one shared layer and uses soft parameter sharing in the FC layers of the two sub-networks. The output of the FC layer of the root learning sub-network is concatenated to the output of the FC layer of the quality learning sub-network. Therefore, the classification of quality has some information of the chord root.In the experiment, 6-fold cross-validation was applied to the entire dataset. In each training fold, five players\u2019 recordings were used for training, while the other was used for testing the dataset. First, the complete network was trained only with the human dataset (Guitarset dataset). Subsequently, the physical data augmented dataset was combined with the training subset of the human dataset, and the same experiment as the first was performed. In the second experiment, the test subset only consisted of the human played chords, similar to the first experiment.In the training phase, a frame-based strategy was used, wherein each song was divided into frames, and each frame was treated as an independent training sample. On average, each song was divided into approximately 250\u2013350 frames, resulting in approximately 32,500 and 75,000 training samples in the human and augmented datasets, respectively, and approximately 9800 test samples.The neighboring frames of the input representation can be expected to contain similar content, as the chords will not change on a frame-by-frame basis. Therefore, the models were trained with 11 frames (of 1 s duration). The networks were implemented using the Keras library that runs on top of TensorFlow. The Adam optimizer  was emplct is the duration of the correctly classified chord segments and at is the duration of the entire chord segments.Weighted chord symbol recall (WCSR) was used for evaluation. The WCSR score can be computed using Equation , where tThe WCSR score was computed with mir_eval . The rooIn this experiment, cross-validation was not employed. In both the model cases, the GuitarSet dataset was used to train and test the models. Five players\u2019 recordings were used as the training dataset, and the other player\u2019s recordings were used as the test dataset. The CNN model is a VGG-style  CNN. TabHere, a VGG-style CNN architecture was used to evaluate the context size. We determined the optimal amount of context for each score experimentally using the one-fold experiment, as shown in In this experiment, we used the simple CNN model with the CQT and delta and delta-delta features, along with a small dataset. In the data augmentation method, time-stretching data augmentation was used, which slows down or speeds up the audio sample while keeping the pitch unchanged. Each sample was time-stretched using four randomly selected factors: 0.8, 0.9, 1.1, and 1.2. Four types of metrics were used for comparison because a small dataset was employed. Here, we compare the performance of the proposed and baseline methods on the same datasets. It is not simple to define a particular method as a state-of-the-art method because the chord recognition methods were evaluated on different datasets. Among the different models, we chose four baseline methods, namely the deep neural network (DNN) model, VGG-style CNN model, CNN  model, aThe experimental results of the baseline models and proposed methods are presented in When comparing the proposed methods, the MTL model trained with the augmented dataset, which was proposed method 3, obtained better performance in terms of four metrics, namely the root, thirds, tetrads, and maj-min. The other metrics showed comparable performance with the proposed methods. The STL performed better for the triad, sevenths, and MIREX. The proposed method achieved better performance than the baseline models and single-task learning model. The MTL models achieved better scores for chord root and triad recognition.Based on the above results, a CNN proved more effective for the chord recognition task compared with the traditional DNN learning method. The proposed MTL model based on the CNN and RNN networks showed good performance for the large-vocabulary guitar chord recognition task. The presented results clearly demonstrate that the performance of the proposed method was superior to that of the baseline models and single-task learning model. We demonstrated that the static feature along with the dynamic (delta) and acceleration (delta-delta) features are useful for the guitar chord recognition task. In contrast, the physical data augmentation method showed acceptable performance in the guitar chord recognition task. This physical data augmentation method can be used for any musical instrument. Using a robotic performer, we can create a large-sized and balanced dataset, which also includes sufficient training examples of the rarely played chords such as the sustained and eleventh. However, there are some limitations, including the hardware implementation and complexity of the robot design.In this paper, we applied a multi-task learning model based on a CNN and RNN to a relatively large-vocabulary guitar chord recognition task and demonstrated the physical data augmentation method and its utility/performance. The experimental results demonstrated that the multi-task learning model outperformed the baseline models and achieved better performance than its equivalent single-task model. In addition, we found that an augmented dataset created by a robot is also efficient for guitar chord recognition. Both dynamic and acceleration features were used as the model\u2019s input features, resulting in good performance. The models trained by a human with the augmented dataset achieved improved performance in terms of most of the metrics. An advantage of multi-task learning for chord recognition is that its training speed is faster than that of single-task learning."}
{"text": "The solid transport media is a small size card that allows fast, easy DNA extraction from a variety of biological samples. In 2016 we developed a solid media transport card; for that pilot study to control the self-collection we used a pseudo-self-collection technique. The current study expands this prior work using true self-collections and only the POI card, and aims to evaluate the solid media transport card to detect HR-HPV in self-samples compared to liquid transport media.Ten thousand eight hundred eighty-five women between the ages of 30\u201359 with no screening for 3\u2009years were enrolled. The self-collected sample was first applied to a new solid media transport card (Labeled as SC) then the brush placed in 6\u2009ml ThinPrep liquid (Labeled as SL). Then a physician collected a direct endocervical specimen into ThinPrep liquid (Labeled as DL). Samples were tested with Cobas 4800 and the SeqHPV NGS assay for HR-HPV. Patients positive on any test were recalled for colposcopy and biopsy.p\u2009=\u20091.00).Ten thousand three hundred thirty-nine participants had complete data. The mean age was 43.9\u2009years. CIN 2+ rates were 1.4% (142/10339). The agreement in HPV detection between the two different self-sample collection media was also good . Tested with Cobas, the sensitivity of Cobas-SL and Cobas-SC for CIN 2+ was95.07 and 94.37%; and for CIN3+ was 96.30, 96.30% respectively. The specificity of Cobas-SC, and Cobas-SL for CIN2+ was 88.74 and 87.35%; for CIN3 was 88.04and 86.65% respectively. Tested with SeqHPV, the sensitivity for CIN2+ of Seq-SC and Seq-SL was 95.77 and 96.48%; for CIN3+, both the SC and SL specimens had a sensitivity of 100%. The specificity for CIN2+ of Seq-SC and Seq-SL was 89.54 and 89.53%; for CIN3+ was 88.84,88.82% respectively. For both HR-HPV assays, the sensitivities were similar for the two self-sample media (SC vs SL, The solid transport card for collecting vaginal self-samples as accurate as liquid transport media assayed by two different PCR based HR-HPV tests. The solid transport media is a suitable medium for collecting and storing vaginal self-samples.The online version contains supplementary material available at 10.1186/s13027-020-00333-4. Traditionally cervical swabs have been placed in liquid media for transport. Due to the logistical difficulties such as spillage, flammability, and weight, adding to the risks and costs of liquid transport media, solid carriers consisting of chemically treated or untreated filter paper have been investigated for hrHPV testing. These filter paper cards are easy and safe to store and transport \u201313. ReceThe Cobas 4800 HPV test, the first approved HPV assay for primary screening by US FDA, is a qualitative multiplex assay, providing specific genotyping information for HPV types 16 and 18, and then 12 other high-risk HPV types as a pooled result . Our stuBetween Aug 2016 to Aug 2018, a multi-center, population-based cross-sectional cervical cancer screening study [Chinese Multi-Center Screening Trial (CHIMUST)] was conducted in China.10,885 subjects were recruited from 15 screening sites in 7 provinces. Women in those sites were eligible if they were 25\u201359\u2009years of age, sex-experienced but not pregnant, had no cervical cancer screening for at least 3 years, no prior hysterectomy, and no prior pelvic radiation. The study protocol was approved by the human subject review boards of the Peking University Shenzhen Hospital (PUSH), Shenzhen, China, and the Cleveland Clinic, Cleveland, USA. In addition, the study was registered with the Chinese Clinic Trial Registry (chiCTR-EOC-16008456), an international clinical trials registry platform approved by the WHO. Women with incomplete data were excluded from the analyses. This included: (1) women testing positive by any HPV test without having colposcopy and biopsies; (2) Specimen is not sufficient or no sample for an HPV test; (3) Failure of any HPV test.Every woman had contributed two specimens, one was collected by herself (Self-Sample), and one was collected from the endocervix by a clinician (Direct-Sample). The self-collected sample was first applied to the solid media transport card (labeled as SC-sample), then the brush placed in 6\u2009ml ThinPrep\u00ae PreservCyt\u00ae Solution  (labeled as SL-sample). The brush was then agitated in 6\u2009ml PreservCyt Liquid (as a split sample). Self-sampling instructions were provided by poster diagrams and personal instruction. The physician-collected samples were placed in 20\u2009ml ThinPrep\u00ae PreservCyt\u00ae Solution (labeled as DL-sample). All samples were stored at room temperature and were tested with Cobas 4800 HPV test and SeqHPV test for HR-HPV within 2 months of collection. Patients testing HPV positive (self or direct), were recalled for colposcopy with directed and random 4 quadrants micro-biopsies plus endocervical curettage (ECC). Histology slides were interpreted by a gynecologic pathologist from PUSH (Author C.W). Immunochemical staining with p16 was selectively obtained to adjudicate difficult cases.The new solid transport card consists of PK 226\u00ae paper  treated with a combination of a lysing solution and a dye . The lysing solution contains an ionic detergent to lyse cell membranes and stabilize DNA as well. Similar, to the FTA card, the indicating dye changes color when the sample is applied. The sample area on the card was punched using a 5-mm Harris micro-punch . Each card was manually punched 3 times and placed in a single well in a 96-well plate. Then they were all washed once using 100\u2009\u03bcl of sterile water. The water is carefully removed with a sterile fine-tip pipette. The DNA elution is performed with 50\u2009\u03bcl of sterile water at 56\u2009\u00b0C for 30\u2009min immediately followed by 95\u2009\u00b0C for 15\u2009min. in a heating block. The 96-well plate containing DNA elution and pieces of card are then centrifuged at 4000\u2009rpm for 3\u2009min and the eluted DNA is transferred into a new 96-well plate. When performing the assays, 5ul of DNA will be used in each well of the 96 well plates for PCR, for Cobas assay, and SeqHPV. Our prior study shows that 5ul is the standard volume used for the Cobas assay, and SeqHPV, and it has been thoroughly tested and demonstrated to be optimal with >\u200999% adequate specimens. (Any storage for future use will be at \u2212\u200980\u2009\u00b0C) , 15.All samples were tested with Cobas 4800 HPV test and SeqHPV test for HR-HPV according to the manufacturer\u2019s instructions. All the DL-Samples and SL-samples accepted by the PUSH lab were split, after thoroughly mixed by shaking, 1\u2009cc used for Cobas 4800 and 1\u2009cc for SeqHPV testing. After splitting, the physician-collected samples were processed for cytology interpretation. The Cobas 4800 system platform , consists of the Cobas \u00d7\u2009480 instrument and the Cobas z480 analyzer. We used two different specimen preparation procedures for the Cobas z480 that had previously been optimized. Nucleic acids used for the Cobas assay from the two liquid specimens (DL and SL), were prepared using Cobas \u00d7\u2009480. The instrument could yield 50\u2009\u03bcL of nucleic acid, eluted from 500\u2009\u03bcL of ThinPrep solution used per subject. The eluted DNA solutions from the solid cards were prepared according to the Cobas4800 device \u201cspecial instructions\u201d. The \u201cPCRONLY\u201d program was performed using Cobas z480.5\u2009\u03bcL DNA solution from the solid card samples were needed to ensure a sufficient sample (adequate DNA) was present for valid detection.The \u201csplit sample\u201d methodology we used, was used extensively in the 1990\u2019s for the development of liquid based cytology . The BotCytology using the Hologic I2 imager systems (computer assisted diagnosis) will be used for future research not for patient care in the current study.Data were entered in an ACCESS database specially designed for CHIMUST. To evaluate the effectiveness of different sample collection media for vaginal self-samples in population-based screening, we calculated sensitivities for detecting CIN2+ and CIN3+, the concordance in detecting high-risk HPV, and the differences in HPV assay performance using solid (filter paper cards) and liquid based specimen transport for the self-collected and physician collected cervico-vaginal specimens. Sensitivity and specificity of the Cobas and SeqHPV testing results in detecting high-risk HPV and CIN2\u2009+\u2009were calculated using CIN2+ as the endpoint. McNemar\u2019s Chi-square was performed to calculate differences between paired proportions at a probability level of 0.05. Agreement between self and direct samples was measured by absolute agreement and Kappa statistics (Cohen\u2019s Kappa). Agreement between the solid transport media and liquid transport media for detecting HR-HPV in vaginal self-samples was also measured. All data were analyzed using SPSS 17.0.Ten thousand three hundred ninety-nine women had complete data. Mean age was 43.9\u2009years. The return rate for colposcopy was 81.0%. 1.4% (141 patients) had CIN2+ and 0.5% (or 54 patients) had CIN3\u2009+\u2009.101 (0.93%) women were dropped from the analysis due to HPV test failure. 6 (0.05%), 2 (0.02%), 29 (0.27%),34 (0.31%), 19 (0.17), and 19 (0.17) were missing Cobas-DL, Cobas-SL, Cobas-SC, Seq HPV-DL, SeqHPV-SL and SeqHPV-SC, respectively. Testing failure in both the assays were reported by the lab as inadequate DNA , and 13.7% for Cobas and 11.6% for SeqHPV in self-samples placed in liquid medium (labeled as SL-sample), and 12.4% for Cobas and 11.6% for SeqHPV in self-samples collected on the solid transport card (labeled as SC-sample) . The card (SC) was significantly more specific than the self-liquid sample (SL) on the Cobas assay but similar with SeqHPV for both CIN2+ and CIN3+  and the SL (liquid) samples. Our data shows that the POI Card performed well in this self-collection trial demonstrating equal sensitivity to liquid samples run both on Cobas and SeqHPV. We know from our prior work in SPOCCS III, that self-collected specimens will identify more HPV than direct endocervical specimens. This excess HPV found in the vagina is unassociated with CIN in the cervix . Of inteIn 2016 we published our work developing a solid media transport card . The newAfter developing the POI card, we published a second study comparing liquid (SurePath) vs solid media (iFTA and POI cards) with Cobas. For this pilot study to control the self-collection we used a pseudo-self-collection technique  . We wereIn a study from Sweden evaluating the HRVIR assay (laboratory developed test) compared to Cobas using FTA cards, the clinical sensitivity of the FTA card and HPVIR test was equivalent to Cobas, and the Cobas assay detected 63 of 67 women with CIN2+ [94.0% (95% CI\u2009=\u200985.2\u201398.1)] . LikewisIn our trial when split samples were used, we have twice encountered discordant results, once with the primary card sample and once with the secondary liquid sample. Not with standing, we believe the strength of our work and the current literature supports the equivalency of solid media specimen transport, and liquid transport methodologies. The potential impact for non-liquid specimen transport on mass population-based screening is profound. Especially in current times of COVID, where self-collection methodologies will be preferable than bringing large populations together for move conventional cervical cancer screening events.We believe that the current study adds considerable power to the literature on specimen media comparisons, with 141 cases of CIN2+. The use of non-liquid forms of specimen transport, especially integrated with self-collection sampling screening programs appears to demonstrate equivalency and is an important area for future study and implementation.Additional file 1: Table supplement 1. Rate of HPV testing failure."}
{"text": "In this work, which is part of a larger research program, a framework called \u201cvirtual data fusion\u201d was developed to provide an automated and consistent crack detection method that allows for the cross-comparison of results from large quantities of X-ray computed tomography (CT) data. A partial implementation of this method in a custom program was developed for use in research focused on crack quantification in alkali-silica reaction (ASR)-sensitive concrete aggregates. During the CT image processing, a series of image analyses tailored for detecting specific, individual crack-like characteristics were completed. The results of these analyses were then \u201cfused\u201d in order to identify crack-like objects within the images with much higher accuracy than that yielded by any individual image analysis procedure. The results of this strategy demonstrated the success of the program in effectively identifying crack-like structures and quantifying characteristics, such as surface area and volume. The results demonstrated that the source of aggregate has a very significant impact on the amount of internal cracking, even when the mineralogical characteristics remain very similar. River gravels, for instance, were found to contain significantly higher levels of internal cracking than quarried stone aggregates of the same mineralogical type. Despite decades of research, the problem of harmful alkali-silica reaction (ASR) in the field of concrete construction has not yet been satisfactorily solved. For the first time in 1940, Stanton ,3 develo2 within aggregates reacts with alkalis  in the presence of water to form expansive alkali silicate hydrates (ASR gels). Because the tensile strength of road surface concrete is often significantly lower than the swelling pressures caused by ASR gels, cracking can be induced . Al. Al44]. For the categories GK1 and GK4, the selected stones were sieved from a natural river gravel. Such river gravels are typically characterized by significant mineralogical deterioration due to naturally occurring weathering processes. In order to characterize these river gravels, which have a heterogeneous mineralogical composition, the primary types of rock  occurring in GK1 and GK4 were determined and 10 individual grains of each type were selected for CT analysis.For the categories GK2 and GK3, the selected stones were sieved from crushed stone chips that were quarried from solid rock deposits. Such quarried stones are typically characterized by greater mineralogical integrity than river gravels because they have not been exposed to significant weathering. Due to the homogeneity of the quarried stone, the selection of individual grains was limited to 10 each for GK2 and GK3. Thus, combining all the individual grains from each of the four stone categories included in this research study, a total of 90 different individual grains were investigated.During this research program, an acceleration voltage of 130 kV and current of 180 \u00b5A were used for the X-ray source. The X-ray beam was also filtered using a 0.5 mm thick Copper plate immediately upon leaving the source in order to remove (unwanted) photons of small energies from the X-ray beam, thereby increasing the contrast of the resulting images. The flat panel detector used for this scanning contained a 2048 \u00d7 2048 pixel field.Individual aggregates were sorted based on mineralogical characteristics and placed within corresponding plastic tubes with small pieces of foam separating the aggregates from one another. As a result of heating and deterioration of the target material within the X-ray tube as well as changes in detector sensitivity over time, significant variations in the measured X-ray beam intensity and distribution can occur. To compensate for these variations, \u201cdark-field\u201d and \u201cbright-field\u201d images, which correspond to blank images  acquired with no illumination and full illumination, respectively, were acquired prior to the scanning of each plastic tube of samples. These images were then used to calibrate the X-ray images of the samples.The CT machine was pre-programmed to collect a complete scan of each aggregate before repositioning the plastic tube using a manipulator and beginning the scan of the next aggregate. Thus, the scanning conditions for all stones within any given plastic tube were identical. All scanning conditions other than resolution were also held constant for all plastic tubes.It was important to maintain scanning conditions that were as consistent as possible to ensure that the results of the crack analysis would be comparable. In spite of this, the resolution was maximised for each stone type, if they significantly varied in size and shape. This was done by adjusting the distance between the plastic tube and the X-ray source. The corresponding voxel sizes were then calculated directly from the measured distances between the X-ray source, the sample holder and the X-ray detector for each individual set of scans.Although these variations in image resolution are known to directly affect measurements of crack properties, such as surface area , some estimation of the magnitude of this effect can already be accounted for based on a recent study . The resIn such an environment, where many analysis methods are readily available, but no individual method is sufficiently accurate to provide the needed measurements, the use of a data-fusion inspired approach becomes very promising and attractive. Data fusion enables researchers to combine data from multiple sources in order to produce more consistent and accurate results than those provided by any single source . In non-It is, however, often the case that researchers only possess meaningful data from a single measurement technique, such as CT (often indeed used as a reference), or do not have access to further non-destructive testing equipment. Even in this case, it should be possible to use the theory behind the data fusion approach to improve the overall quality of the quantitative determinations resulting from image analysis. Rather than relying on a wide variety of physical measurement techniques, data fusion in this approach would be carried out by using the output from an array of different image analysis techniques. Since such an approach relies on the fusion of different computationally generated data sources resulting from the same original CT image rather than on a variety of different physical measurement techniques, it can be more appropriately described as virtual data fusion. This is similar to the process that is thought to occur when an expert identifies cracks using the human eye. The expert has only one measurement technique , but by considering its many different aspects , the expert is able to quite easily and accurately detect a crack on the surface of a specimen.Although, in theory, twelve or more different analysis methods could be used in the virtual data fusion implementation for analysing the ASR-sensitive aggregate dataset, in practice such a full implementation was impractical. We selected a partial implementation of the scheme including only three analysis approaches. The choice included the approaches that would produce cracking data with sufficient accuracy for this specific application while simultaneously testing the effectiveness of the virtual data fusion concept for obtaining accurate and consistent results. A successful demonstration of the virtual data fusion method with only three analysis components would then give justification for the further development of the algorithm to gradually include additional analysis modules, simultaneously growing in accuracy and resiliency. Moreover, the modular architecture of the strategy could more easily be adapted to different problems than a full but rigid analysis.In fact, for the specific ASR-sensitive aggregate analysis described in this paper, it was not important to separate internal pores from internal cracks since the surface area of both pores and cracks was vulnerable to ASR degradation. Thus, modules related to this differentiation could be left out of the analysis. Furthermore, since scans were not available at varying levels of degradation, all methods relying on changes in sample state relative to time (such as DVC-based methods) were also left out of this analysis. All image analysis described in this paper was completed using custom algorithms developed and implemented in MATLAB .When cracks or pores have widths exceeding two voxels, the voxels in their centres are completely filled with air. Thus, these central voxels are characterized by a particularly low greyscale value. In order to separate these voxels, a threshold has to be selected and subsequently used for image binarization. All voxels darker than the threshold would then be transformed to white and all voxels lighter than the threshold transformed to black. Given that this threshold must be consistently applied for a large range of datasets, an automated selection method was implemented.Using the triangle selection algorithm ,51, a viWhen an object in a CT-image has either a much higher or a much lower greyscale value compared to the surrounding material, its edges can be identified as regions of high gradient. For this purpose, a gradient-magnitude image is calculated from the original CT-image through the use of the Sobel operator  52]. Si. Si52]. Prior to noise identification and removal, the results from Modules 1 and 2 were combined into a single image . This enIt was found that the use of smaller cubes than 125 voxels (with five voxel long sides) tended to leave considerable noise within the image while the use of larger cubes resulted in the loss of a considerable number of voxels along the path of the cracks. Given that the full CT images each contained over seven billion voxels, such an object with a volume of 125 voxels represented less than one ten-millionth of the total image volume. A flowchart of the entire crack-detection process is provided in After the cracks and internal voids were identified within each of the aggregates, their characteristics could be quantified and compared. Of primary interest for this analysis was the determination of volume and surface area characteristics. In particular, in order to compare the results of the CT-analysis with those of other non-destructive measurement techniques, it was important to separate surface-connected cracks and voids (referred here to as \u201copen voids\u201d) from internally isolated cracks and voids (referred to here as \u201cclosed voids\u201d). This is because measurements of internal surface area using the Brunauer\u2013Emmett\u2013Teller (BET) method ,54 only The crack/pore surface area measurements obtained using this approach are provided for all of the river-gravel type aggregates in Error bars in From It is also clear from This research clearly demonstrates the need for universal, automated, and consistent crack detection methods that allow the cross comparison of results from large quantities of CT-scan data from different sample types. A framework, called \u201cvirtual data fusion\u201c, was developed that has the potential to successfully provide such a method. A partial implementation of this method in a custom program was developed for use in research focused on crack measurement in ASR-sensitive aggregates. Our results demonstrated the success of the program in effectively identifying crack-like structures and measuring their characteristics such as crack extension (relative surface area) and surface connectivity.These results demonstrate the significant impact that the source of extraction can have on the characteristics of aggregates. Even for aggregates of the same mineral type, river gravels contain significantly higher levels of internal porosity and cracking than quarried stone. This is thought to result from the aggressive weathering process that river gravel is subjected to prior to its selection and use for construction. This indicates that the selection of high-quality aggregate based on mineralogical characteristics alone may be insufficient. It is also clear from these results that there is a significant amount of variability in internal porosity and cracking even for stones with the same mineralogical characteristics and extraction source. Thus, large statistical samples will be necessary to properly characterize each stone type for ASR sensitivity."}
{"text": "To describe characteristics of the vitreomacular interface (VMI) in traumatic macular holes (TMH) compared to idiopathic macular holes (IMH) using immunofluorescence and electron microscopy, and to correlate with clinical data.For immunocytochemical and ultrastructural analyses, premacular tissue with internal limiting membrane (ILM) and epiretinal membrane (ERM) was harvested during vitrectomy from 5 eyes with TMH and 5 eyes with IMH. All specimens were processed as flat mounts for phase-contrast microscopy, interference and fluorescence microscopy, and transmission electron microscopy (TEM). Primary antibodies were used against microglial and macroglial cells. Clinical data was retrospectively evaluated.Surgically excised premacular tissue of eyes with TMH showed a less pronounced positive immunoreactivity for anti-glutamine synthetase, anti-vimentin and anti-IBA1 compared to eyes with IMH. Cell nuclei staining of the flat-mounted specimens as well as TEM presented a lower cell count in eyes with TMH compared to IMH. All detected cells were found on the vitreal side of the ILM. No collagen fibrils were seen in specimens of TMH. According to patients\u2019 age, intraoperative data as well as spectral-domain optical coherence tomography (SD-OCT) analysis revealed an attached posterior vitreous in the majority of TMH cases (60%), whereas all eyes with IMH presented posterior vitreous detachment.The vitreomacular interface in TMH and IMH shows significant differences. In TMH, glial cells are a rare finding on the vitreal side of the ILM. The traumatic macular hole (TMH) is a rare full-thickness retinal tissue defect of the fovea with an interruption of all neural retinal layers leading to severe vision loss and includes 5\u20138.2% of all various types of macular holes \u20133. TraumUnlike in idiopathic macular holes (IMH), spontaneous closure is common in TMH. In the literature, the spontaneous closure rates vary between 10 and 50% , 12\u201320. The pathogenesis of TMH is still under discussion. The most common theory implies that anteroposterior compression and equatorial expansion of the globe appear to result in retinal stress, which may result in a full-thickness macular defect without loss of foveal retinal tissue , 8, 9. AHowever, there is less information about cellular components at the vitreomacular interface in these traumatic types of macular holes. To our knowledge, there is only one case series with one analysed TMH specimen presenting positive immunostaining of glial fibrillary acidic protein (GFAP) and neuron-specific enolase (NSE) . ImmunosPrevious studies showed an attached posterior vitreous body in the majority of eyes with TMH using SD-OCT and clinical examination , 10, 23.The aim of our study was to firstly identify vitreomacular interface changes in surgically excised premacular tissue of eyes with TMH by immunocytochemistry and TEM and then compare the results with the findings in IMH. For clinical correlation, demographic data and SD-OCT findings of both entities were retrospectively analysed.In this clinicopathological study, surgically excised premacular tissue of internal limiting membrane (ILM) and epiretinal membrane (ERM) from eyes with TMH (5 eyes) and eyes with IMH (5 eyes) was consecutively obtained by three different surgeons during vitrectomy at the Ludwig-Maximilians-University, Department of Ophthalmology, between April 2016 and January 2020. All 10 specimens were processed as flat mounts for phase contrast, interference and immunocytochemistry. All 10 specimens were also processed for ultrastructural cell analysis using transmission electron microscopy (TEM). Based on the size of the macular hole diameter using preoperative spectral-domain optical coherence tomography (SD-OCT), control specimens of IMH were selected comparable to specimens of TMH. Clinical data as well as SD-OCT scans using Heidelberg Spectralis OCT  were retrospectively analysed.The Institutional Review Board and the Ethics Committee of the Ludwig-Maximilians-University, Munich, approved the surgical removal as well as the histopathologic preparation and analysis of the patients\u2019 specimens (No. 471\u201314). Informed consent was obtained from each patient. The study was conducted according to the tenets of the Declaration of Helsinki.The included patients presented with a reduced visual acuity and full-thickness macular holes on biomicroscopy and showed a full-thickness macular defect on SD-OCT. All patients with TMH reported an ocular trauma shortly before the reduction of visual acuity. Besides, typical SD-OCT characteristics for TMH, such as eccentric, ellipsoid-shaped full-thickness macular defects, a large basal macular hole diameter, little to no intraretinal fluid or additional defects like rupture of retinal pigment epithelium (RPE), were found , 10, 23.Patients\u2019 charts were reviewed for age, sex, preoperative and postoperative best corrected visual acuity (BCVA), period of time between diagnosis and surgery, and the follow-up period Table . Using SThe performed surgical technique was a standard 23 gauge pars plana vitrectomy with sequential ILM peeling using end-gripping forceps. For membrane peeling, a vital dye of 0.25\u00a0mg/mL solution of Brilliant Blue  was used. At the end of surgery, the vitreous cavity was filled with a tamponade of either air, 20% diluted SF6 or 16% diluted C2F6. For transfer, the tissue was kept in a balanced salt solution (BSS) .After fixation, specimens were flattened and unfolded showing the maximum surface area using a stereomicroscope . Antifading mounting medium 4\u2032,6-diamidino-2-phenylindole  was used to stain the cell nuclei. Primary antibodies were used to identify retinal microglial cells with anti-ionised calcium-binding adaptor molecule 1 (anti-IBA 1)  and macroglial cells with anti-glutamine synthetase (anti-GS)  and anti-vimentin (anti-VIM)  as listed in Table Preparing negative controls, all specimens were dissected into pieces and the primary antibody was substituted with both diluent and isotype controls . All other procedures were identical to the procedures described above.For ultrastructural analysis, dehydration in graded concentrations of ethanol and embedding in Epon 812 were performed directly after post fixation with 2% osmium tetroxide . For staining of the semi-thin sections of 400\u00a0nm, an aqueous mixture of 1% toluidine blue and 2% sodium borax was used. Ultrathin series sections of 60\u00a0nm followed and were contrasted with uranyl acetate and lead citrate. Using a Zeiss light microscope and a Zeiss EM 9 S-2 electron microscope , 5 grids (each with 8\u201310 ultrathin sections) per specimen were analysed.In this interventional laboratory investigation, we included surgically excised premacular tissue of ILM and ERM from 4 women (1 eye with TMH and 3 eyes with IMH) and 6 men (4 eyes with TMH and 2 eyes with IMH), corresponding to 5 right and 5 left eyes. The clinical data as well as the analysed SD-OCT characteristics are given in Table The patients\u2019 mean age at the time of surgery was 39.0\u2009\u00b1\u200929.3 SD years  in TMH and 70.8\u2009\u00b1\u20097.8 SD years  in IMH. The mean macular hole diameter was 448.8\u2009\u00b1\u2009139.2 SD \u00b5m in TMH and 379.6\u2009\u00b1\u200927.9 SD \u00b5m in IMH. The vitreous was attached to the posterior pole in 3 of 5 eyes (60%) with TMH. One eye with TMH showed a complete PVD (20%) and one eye showed an incomplete PVD (20%). All eyes with IMH showed a PVD, of which a complete PVD was seen in 2 eyes (40%) and an incomplete PVD in 3 eyes (60%). The mean period of the time between diagnosis of macular hole and vitreoretinal surgery was 30.3\u2009\u00b1\u20096.8 SD months  in eyes with TMH and 2.6\u2009\u00b1\u20092.3 SD months  in eyes with IMH.2F6. TMH showed a primary closure rate of 60% and IMH 80%, respectively. Patient 2 required a second vitrectomy in order to close the TMH. Table The BCVA of patients with TMH was 0.8\u2009\u00b1\u20090.3 SD LogMAR preoperatively  and 0.7\u2009\u00b1\u20090.4 SD LogMAR at last follow-up examination . Patients with IMH showed a preoperative BCVA of 0.9\u2009\u00b1\u20090.1 SD LogMAR  and a BCVA at last follow-up examination of 0.8\u2009\u00b1\u20090.7 SD LogMAR . One patient was lost to follow-up and had a BCVA of 2.0 LogMAR 2\u00a0days after surgery with 90% of the vitreous cavity filled with CThe immunocytochemical analysis as well as the cell count and area of each specimen are shown in Table 2  and in eyes with IMH 1.4\u2009\u00b1\u20090.7 SD mm2 .In summary, eyes with TMH showed a mean cell count of 39.2\u2009\u00b1\u200949 SD . Eyes with IMH presented with a mean cell count of 164.4\u2009\u00b1\u2009186.4 SD . The mean surface area in eyes with TMH was 3.4\u2009\u00b1\u20092.3 SD mmIn the majority of eyes with TMH (3 of 5 eyes), positive immunoreactivity for the microglial cell marker anti-IBA 1 was seen. For macroglial cells, anti-GS was documented positive in 2 of 5 eyes and anti-VIM in 1 of 5 eyes. All eyes with IMH (5 of 5 eyes) revealed a positive immunoreactivity for anti-IBA 1. For anti-GS, 5 of 5 eyes and, for anti-VIM, 4 of 5 eyes with IMH showed a positive immunostaining. Negative controls revealed no immunoreactivity. Figure\u00a0Colocalisations were seen in both entities and are listed in Table Ultrastructure was analysed in all 10 specimens using TEM. Table The ILM was found in all analysed specimens Fig.\u00a0 and was In 3 of 5 specimens with TMH, single-layered glial cells were found at the VMI by series sections of the TEM Fig.\u00a0. An exemIn contrast, specimens of IMH showed multi-layered cells as well as cell clusters on the vitreal side of the ILM as illustrated in Fig.\u00a0This clinicopathological study presents different immunocytochemical and ultrastructural findings at the VMI analysing surgically excised premacular tissue of ILM and ERM in eyes with TMH and IMH. Compared to a higher cell count and multi-layered cell composition in eyes with IMH, the fibrocellular composition shown in eyes with TMH revealed few single cells without tractive properties.By immunocytochemistry, both entities presented a positive immunoreactivity for the macroglial cell markers anti-VIM and anti-GS as well as for the microglial cell marker anti-IBA 1. However, in eyes with TMH, a large variation of the cellular elements was seen. In general, a positive immunoreactivity of the used glial cell markers was found more often in eyes with IMH. In accordance, transmission electron microscopy (TEM) showed significantly more cellular structures identified as hyalocytes, astrocytes or myofibroblasts in specimens of IMH than of TMH.To our knowledge, there is only one case series investigating the ILM in various maculopathies, among others an eye with TMH . Kanavi Macroglial cells such as Mueller cells and astrocytes are neuronal cells and of a neuroectodermal embryonic origin. In contrast, microglial cells are non-neuronal cells with a mesodermal origin. They originate from macrophages that invade the brain during early development and have macrophage activity . MicroglMacroglia is identified by immunocytochemistry using several markers such as anti-GFAP, anti-VIM and anti-GS \u201340. AntiIn our study, all three analysed primary antibodies were tested positive in eyes with TMH and IMH. One specimen of TMH revealed no cells, so that immunocytochemistry could not be evaluated (No. 4). Another specimen of TMH only showed 5 cells, which were not detected with positive immunoreaction (No. 1). In IMH, positive immunoreactivity was seen more frequently in all specimens. These findings might allow the conclusion that macroglial and microglial cells are involved in the clinical course after TMH and IMH development. This is supported by the findings of colocalisations. Colocalisation of anti-VIM and anti-IBA 1 was found in 2 of 5 specimens of TMH, which might give evidence of the presence of activated microglia. In specimens with IMH, no colocalisation of anti-VIM and anti-IBA 1 was seen. The colocalisation of anti-VIM and anti-GS that was detected in some specimens of IMH and TMH might indicate the presence of Mueller cells. Unexpectedly, both entities showed the colocalisation of anti-GS and anti-IBA 1. Whether this colocalisation indicates the potential of microglia to endogenously express GS or demonstrates microglia that have previously phagocytised GS-positive cell debris still remains unclear. Though, microglia is not yet known to express the macroglia marker anti-GS.In the literature, there is only one other known TEM case series that describes the analysis of ultrastructural details of the VMI of eyes with TMH, namely by Kumar and colleagues . They idFurthermore, clinical data of the patients in our study revealed that the vitreous was attached to the posterior pole in the majority of eyes (60%) with TMH. However, it remains unclear whether PVD was induced by the ocular trauma or had already existed beforehand as the 2 patients  with preoperative PVD were patients older than 65\u00a0years. A high rate of an attached posterior vitreous body is in concordance with findings of previous studies. Huang and colleagues noted that the vitreous was still attached to the fovea in all included patients with TMH . YanagiyAccording to current data, there is no established therapy for TMH. In some cases, surgery might be needed, and in others, the TMH closes spontaneously. In fact, TMH do have a relatively high rate of spontaneous closure up to 50% within the first 9\u00a0months after development , 20, 48.On the other hand, it is known that TMH persisting for more than 1\u00a0year are less likely to close spontaneously . The recIf surgery is needed, vitrectomy with fluid-gas exchange, gas tamponade and postoperative prone positioning, with or without ILM peeling or ILM flap, with adjunctive agents like TGF\u03b22 or autologous platelet concentrate and TMH closure using amnion-patches are all methods that showed positive results concerning TMH closure and BCVA gains in several studies , 56\u201363.Limitations of our study include its relatively small number of analysed specimens, its retrospective analysis of clinical data and the variable period of follow-up. Furthermore, the collection of premacular tissue during pars plana vitrectomy might have been incomplete and could have led to incorrect numbers of cell count measurements. Additionally, it must be noted that due to the preparation of flat-mounted membranes, we were only able to test 3 different primary antibodies and decided to focus on glial cell markers. Comparing the cell count found via immunocytochemistry and TEM, it is likely that not every cell was cut through ultrathin serious sections of 60\u00a0nm for TEM. Therefore, we did not focus on statistical analysis and correlation of ultrastructural findings and functional parameters.In conclusion, our results present less cells on the vitreal side of the ILM in eyes with TMH compared to multi-layered cell composition in eyes with IMH. Furthermore, we found a positive immunoreactivity for macro- and microglial cell markers in both entities. Clinical data revealed an attached vitreous body in the majority of eyes with TMH. Vitreous collagen was only detected in specimens of IMH but not in specimens of TMH, suggesting that an incomplete posterior vitreous detachment with vitreoschisis plays no role in the development of TMH."}
{"text": "Hollow nerve guidance conduits are approved for clinical use for defect lengths of up to 3 cm. This is because also in pre-clinical evaluation they are less effective in the support of nerve regeneration over critical defect lengths. Hydrogel luminal fillers are thought to improve the regeneration outcome by providing an optimized matrix inside bioartificial nerve grafts. We evaluated here a modified hyaluronic acid-laminin-hydrogel (M-HAL) as luminal filler for two clinically approved hollow nerve guides. Collagen-based and chitosan-based nerve guides were filled with M-HAL in two different concentrations and the regeneration outcome comprehensively studied in the acute repair rat sciatic nerve 15 mm critical defect size model. Autologous nerve graft (ANG) repair served as gold-standard control. At 120 days post-surgery, all ANG rats demonstrated electrodiagnostically detectable motor recovery. Both concentrations of the hydrogel luminal filler induced improved regeneration outcome over empty nerve guides. However, neither combination with collagen- nor chitosan-based nerve guides resulted in functional recovery comparable to the ANG repair. In contrast to our previous studies, we demonstrate here that M-HAL slightly improved the overall performance of either empty nerve guide type in the critical defect size model.  Peripheral nerve injures (PNIs) arising from trauma with a 2\u20133% incidence have a strong impact on patients due to their accompanying sensory and motor function loss; for example, dysesthesia, paralysis, and neuropathic pain . Althoug\u00ae Nerve Guide for which a large body of pre-clinical and clinical data demonstrate its value as an off-the-shelf product ; PL CMAP AUC = 2.11 \u00b1 0.28 [ms * mV].We further analyzed the recorded CMAPs for quantitative parameters, e.g., their CMAP amplitude area (AUC), from which we also calculated the percentile loss of functional axons in comparison to the contralateral non-lesioned nerve, and their CMAP amplitude ratio, displaying the degree of recovery in relation to the non-lesioned side. The amplitude area of the recorded CMAPs reflects the number of functional axons reinnervating the target tissue, and can therefore be regarded as a sign of nerve recovery. As a reference, the CMAP AUC of the TA , we have not again investigated in the current study, experimental groups we have already been investigating before in the same model . However, for a more comprehensive evaluation of the new data derived from the current study, we want to report specific previously published data again ,31. ThesWith regard to recovery rates, in both previous studies and in accordance to the current study, the ANG repair supported recovery of evocable TA muscle CMAPs in all animals (100%) from 60 days post-surgery onward ,31. RecoAccordingly, data from axon loss calculation demonstrate the same differences as described before for axons innervating the TA muscle. The results are depicted in With regard to recovery of PL muscle function, recovery rates after ANG treatment displayed a similar outcome in both previous studies ,31. Recon = 5; NNG: n = 6; NNG + 0.4% M-HAL: n = 5; NNG + 0.7% M-HAL: n = 6; CNG + 0.4% M-HAL: n = 5; CNG + 0.7% M-HAL: n = 5.The assessment of functional motor recovery by noninvasive electrodiagnostic recordings was supported by the determination of the respective muscle weight ratios (MWRs) of the largest lower hind limb muscles. A high MWR, approximating 1, indicates a recovery in muscle mass due to successful target muscle reinnervation. Therefore, the anterior tibial (TA) muscle and gastrocnemius (GC) muscle were harvested at the 120 days endpoint of the observation period. The ratio between the muscle weights of the treated  limb in comparison to the non-lesioned  limb was calculated. Please note that the muscle weight of two animals was accidentally not recorded and that two animals died during the course of the electrodiagnostic measurements at 60 days post-surgery. Despite this, all animals reaching the endpoint of the observation period, were included in this analysis: ANG: Results from the evaluation of MWRs are graphically depicted in Non-lesioned, contralateral nerve segments, and segments dissected distal from the graft of the reconstructed sciatic nerve were harvested after 120 days, at termination of the observation period. The segments were, fixed, stained, embedded, and sliced into semi-thin cross-sections for histomorphometrical analysis. Stereological analysis was only performed, if the fiber density of the section was high enough to ensure a valid analysis with the described method (see section Nerve Histomorphometry). Consequently the number of analyzed samples did not for all groups match the number of evaluated animals.Since the cross-sectional areas of the samples are not well comparable with one another, the nerve fiber density is considered in the following. As depicted in g-ratio  in two different concentrations. The rationale for adding hydrogel luminal fillers into otherwise hollow nerve guidance channels is based on the fact that empty nerve conduits provide sufficient clinical outcome only when applied for short nerve gap repairs . Both, l\u00ae Nerve Guide [\u00ae Nerve Guide [\u00ae Nerve Guides (NNG) as control and compared all results from the current study with more control conditions, which we have recently evaluated in the same model. Repetition of these control conditions were avoided for ethical reasons. These conditions were likewise ANG repair in both previous studies [\u00ae Nerve Guides (emptyCNG) [Therefore, we chose two clinically approved nerve guidance conduits, NeuraGenve Guide  and Reaxve Guide . We haveve Guide ,28,30. R studies , and empmptyCNG) , or CNG Electrodiagnostic recordings of evocable compound action muscle potentials (CMAPs) from muscles at more proximal and more distal locations distal to the lesion site give indications about the temporal progress of functional motor recovery . Here, wFrom analyzing the PL muscle function , it can In comparison to our previous studies, we can summarize that reconstruction of the 15 mm sciatic nerve gap with empty collagen-based  demonstrated a slightly better support than repair with empty chitosan-based  nerve gAs already mentioned above, PL muscle function cannot be considered fully developed at 120 days after surgery for M-HAL associated treatments and comparison to results from our previous studies would rather be a non-appropriate overestimation. It appears noteworthy, however, that adding 0.7% M-HAL was superior in supporting PL muscle recovery over 0.4% M-HAL in the current study. The percentile content of HA in our laminin-hyaluronic acid-based hydrogel luminal filler is influencing the viscosity or stiffness of the luminal content provided to invading cells and regenerating axons. From many studies, it can be concluded that optimally tuned nerve graft mechanical properties can give optimal support to repair Schwann cells as well as pro-regenerative macrophages as well as regenerating axons ,26. Whil2) recovered to a degree comparable to that seen in ANG-treated nerves , but the cell density after three days in vitro (DIV 3) was not significantly different from that in the other conditions anymore. This indicates that as soon as the cells get arranged in M-HAL, they survive and proliferate. Furthermore, this finding demonstrates again that initially cell-free luminal filler hydrogels need to provide mechanical properties and in vivo degradation behavior that would allow timely invasion of regeneration promoting cells into the bioarticial grafts [gndf, fgf-2, and ngf and also gene expression of sox2 and c-jun, transcription factors typically elevated in repair Schwann cells [bdnf showed a trend to be slightly elevated in the 0.4% M-HAL condition than in the other three groups, although the difference was not statistically significant. We can only speculate that expression of brain derived neurotrophic factor, BDNF, has also been elevated within the M-HAL composite bioartificial nerve guides in vivo, and may have accounted for the better outcome in regeneration of myelinated functional motor axons discussed above. Indeed, BDNF plays a role as myelination factor in peripheral nerve regeneration [Luminal filler hydrogels may serve as a cell carrier system for introducing regeneration supporting cells directly together with the bioarticial nerve graft . In thisin vitro , DIV 3 wl grafts . With rel grafts ,20,30. Fnn cells ,40 was rneration .At this point, it seems appropriate commenting on the fact 0.7% M-HAL did not provide optimal properties for our in vitro Schwann cell cultures, but was still evaluated and supportive of axonal regeneration in vivo. We have experienced before that another hydrogel perfectly supporting Schwann cell and even dorsal root ganglion neurite outgrowth in vitro was not at all supportive to axonal regeneration in vivo . TherefoWith regard to a recent report describing more pronounced beneficial effects of hyaluronic acid-laminin hydrogel in a delayed repair approach for 25 mm tibial nerve defects in the rabbit , we wantFrom the current study, we can, at first, conclude that the achievable benefit of adding 0.4% or 0.7% M-HAL as luminal filler, to otherwise empty nerve guides, did not significantly differ with regard to the material the bioartificial nerve graft was made of. Therefore, both collagen- or chitosan-based nerve guides appear to be equally suitable for a combination with M-HAL luminal filler hydrogel. Second, both concentrations of M-HAL provided a better support for axonal and functional recovery than 0.2% HAL in chitosan-based nerve guides before . Finallyw/v) or 0.7% (w/v) hyaluronic acid  [w/v) and 0.7% (w/v) HA solutions were stored at 4 \u00b0C. The gel was stored on ice until use. M-HAL was prepared prior to use, based on 10 \u03bcg/mL laminin , and 0.4%  . HA stocThe animal experiments were conducted in accordance with the German animal protection regulations and European Communities Directive 2010/63/EU for the protection of animals for experimental purposes. The experiments were previously approved by the Animal Care Committee of Lower Saxony, Germany  in accordance with the local Institutional Animal Care and Research Advisory.p < 0.05, and type II error: \u03b2: 0.2, power 50%.In this study, we used 36 young adult female Lewis rats , which were obtained from Janvier Labs SAS  at an age of 10 weeks. Group size was calculated by power analysis with Graphpad Statmate 2.0 software , based on data from previous investigation of another hydrogel , with ef\u00ae, Neuraxpharm Arzneimittel GmbH, Langenfeld, Germany) from two weeks ahead of the surgery until the study was completed, to prevent self-mutilation [During the experiment, the animals were housed in groups of four in an enriched environment, under uniform housing conditions . Food and water were provided ad libitum. The drinking water was supplemented with amitriptyline hydrochloride .All surgeries were performed on 13-week old rats under deep anesthesia  and aseptic conditions. Throughout the surgery, the animals were placed on a heating pad to mitigate the decrease in body temperature. Additionally, a heating lamp was used during anesthesia induction and recovery phase. Rectal body temperature was measured before and after surgery in order to ensure a body temperature not lower than 36.5 \u00b0C. The recovery phase was supported by applying 2 mL of electrolyte solution  subcutaneously. A sufficient level of analgesia was achieved by subcutaneous injection at a dosage of 0.5 mg/kg Butorphanol  and lidocaine  were topically applied on the exposed sciatic nerve 5 min before nerve transection, in order to ensure sufficient analgesia. Using a micro scissor, the first incision was applied 5 mm distal to the gluteus muscle\u2019s aponeurosis. A 15 mm nerve defect was established for autologous nerve grafts (ANGs). The nerve graft was flipped over, rotated 180\u00b0, and sutured distal and proximal, each with three epineural 9-0 stitches spaced approximately 120\u00b0 apart. A 13 mm nerve defect was established in all experimental groups and reconstructed with a 19 mm artificial nerve graft, generating a 2 mm overlap of both nerve ends  and Reaxon\u00ae Nerve Guides  were preconditioned in 0.9% sodium chloride rinsing solution  for at least 20 min. Before tying the knot at the distal suture of the artificial nerve grafts, 60\u2013120 \u00b5L of M-HAL luminal filler were applied. Wounds were closed with 3\u20134 resorbable single button sutures in the femoral biceps muscle  followed by 3\u20134 nonresorbable mattress sutures  for skin closure.Ahead of luminal filling, NeuraGenFor ethical and animal welfare reasons , we have not investigated again in the current study experimental groups we have already investigated before in the same model . However, we used the previously obtained data for a more comprehensive evaluation of our new data derived from the current study. These previously obtained data have been published in St\u00f6\u00dfel et al. 2018 , and in The progress of functional motor recovery was monitored by serial non-invasive electrophysiological measurements 60, 90, and 120 days after nerve reconstruction. The muscle weight ratio (MWR) for lower hind limb muscles was determined after completion of the 120-day observation period. All surgery was performed by KHT and evaluators of regeneration progress were blinded to the conditions of sciatic nerve reconstruction applied.Assessment of functional motor recovery with transcutaneous electrodiagnostic recordings: \u00ae Keypoint\u00ae Focus device; Natus Europe GmbH, Planegg, Germany) was used. The electrodiagnostic managements were performed in accordance with previously published studies of our group [For the evaluation of ongoing muscle reinnervation 60, 90, and 120 days post-surgery, a portable electrodiagnostic device  = AUChealthy \u2212 AUCregenerated/AUChealthy \u00d7 100. For the statistical analyses of electrodiagnostic measurements , all animals reaching the endpoint of the analysis were considered. Two animals died due to anesthesia complications after the first functional evaluation at 60 days post-surgery (ANG-group and CNG + 0.4% M-HAL-group).Functional motor recovery was described qualitatively in terms of recovery rates (%) that were calculated from the number of animals per group displaying evocable CMAPs. Quantitative parameters were derived by analyzing the area under the curve (AUC) of the negative peaks of the CMAP Values for CMAP amplitude area and amplitude ratio were set to 0 for certain animals, which did not show evocable CMAPs, whereas the respective values for axon loss were set to 100%. Muscle weight ratio: After the last electrophysiological recording at 120 days post-surgery and harvest of nerve tissue for histology (see below), the anaesthetized animals were sacrificed in carbon dioxide atmosphere and by cervical dislocation after deep anesthesia was induced. The gastrocnemius (GC) and TA muscle of both hind limbs were excised and weighed. The MWR was calculated dividing the muscle weight of the lesioned side by the muscle weight of the non-lesioned side.n = 3). The dissected nerve segments were transferred in Karnovsky fixative  for 24 h. Afterwards, the samples were rinsed with 0.1 M sodium cacodylate buffer supplemented with 7.5% sucrose and post-fixed in 1% osmium tetroxide for 1.5 h. Staining of the myelin sheath was performed in 1% potassium dichromate (24 h), 25% ethanol (24 h), and hematoxylin  [Histomorphometrical analysis of the regenerated nerves was performed in accordance with a previously described protocol . The samor 24 h) . SubsequThe stereological evaluation was performed according to our previously published work ,31,45. In = 3; ANG: n = 5; NNG: n = 4; NNG + 0.4% M-HAL: n = 6; NNG + 0.7% M-HAL: n = 6; CNG + 0.4% M-HAL: n = 4; CNG + 0.7% M-HAL: n = 5. One sample from the CNG + 0.7% M-HAL was further excluded from consecutive nerve morphometrical analysis, because it was not showing an appropriate number of regenerated myelinated axons. Stereological analysis was only performed if the fiber density of the section was high enough to ensure a valid analysis with the described method. Consequently the number of analyzed samples did not for all groups match the number of evaluated animals: non-lesioned control: g-ratio plug-in [g-ratio. Depending on the regeneration of the sample, a total number of at least thirty to a maximum of eighty axons per animal was evaluated. The data was collected under the assumption that the axons show a circular shape. Samples that showed no quantifiable axonal regeneration in the stereological analysis were excluded from morphometrical analysis. For each animal, six to eight view fields (in 100\u00d7 magnification) of regions showing a high fiber density were acquired to analyze the morphometry of the regenerated nerves. ImageJ  extended by a  plug-in ,31,47 wa2 in a humidified atmosphere. PLL coating was performed by covering the culture dishes with PLL for 45 min at room temperature. After removing the PLL, plates were washed 2 times with Ampuwa\u00ae . To prevent excessive fibroblast contamination, 1 mM of arabinoside-c  was added at 2 and 3 days in vitro, respectively. The cells were finally purified to >90% by immunopanning, purity was controlled in immunocytochemistry, and cells propagated in medium as described above, just with an increased concentration of 2 \u00b5M Forskolin [Schwann cell cultures at passage 11 were taken from storage in liquid nitrogen and thawed as required. These cells were previously derived from primary neonatal Schwann cells (SCs) obtained from Wistar RjHan:WI rat pups and cultured and purified following a previously published protocol  and in aorskolin . Neonatal rat SCs were cultured in a six-well plate  containing the above described medium (see section Primary Schwann cell culture), serving as control. The initial cell density was 300,000 cells per well. Experimental conditions were cultured within 0.2% HA, 0.4% HA, or 0.4% M-HAL. We excluded 0.7% M-HAL culture conditions from this analysis, because Schwann cells could not be suspended gently enough in this concentration. Further, appropriate amounts of total RNA could not be extracted. Medium was used for preparing the needed concentrations. The respective solutions were prepared one day ahead, as described above (see section 0.4% M-HAL and 0.7% M-HAL preparation), except that the HA was dissolved in culture medium instead of PBS, vortexed thoroughly and stored overnight at 4 \u00b0C. The 0.4% M-HAL was prepared freshly. TM cDNA Synthesis Kit . The qRT-PCR was performed according to a previously describes protocol [T-values were calculated with StepOne-software version 2.3 using a constant cycle threshold of 0.2. Calculation of relative amount of transcript in cDNA levels was performed and normalized to the housekeeping gene peptidylprolyl isomerase A (ppia). The primer sequences are given in Total RNA of 3 wells was analyzed after 3 days in vitro as described previously . In brieprotocol . The reaStatistical analysis of data obtained from the current study was performed using Excel Version 2010  and GraphPad Prism version 8.01 . Normal distribution of all datasets was examined with Shapiro-Wilk test. If normal distribution was given, one-way study of variation (ANOVA) with Tukey\u2019s multiple comparisons post-hoc test was used to identify significant differences. If normal distribution was rejected, the data was subjected to Kruskal\u2013Wallis test with Dunn\u2019s multiple comparisons post-hoc test was applied. A two-way ANOVA with Tukey\u2019s multiple comparisons post-hoc test was used to compare the electrodiagnostic recordings during the observation period. All results are presented as percentages or mean \u00b1 SEM, as indicated in the respective tables or figures.p < 0.05; two symbols = p < 0.01; three symbols = p < 0.001. Statistical significance was defined and indicated as follows: one symbol ="}
{"text": "Aspergillus spp. are spore forming molds; a subset of which are clinically relevant to humans and can cause significant morbidity and mortality. A. fumigatus causes chronic infection in patients with chronic lung disease such as asthma, chronic obstructive pulmonary disease (COPD) and cystic fibrosis (CF). In patients with CF, A. fumigatus infection can lead to allergic disease, such as allergic bronchopulmonary aspergillosis (ABPA) which is associated with high rates of hospitalizations for acute exacerbations and lower lung function. ABPA results from TH2 immune response to Aspergillus antigens produced during hyphal growth, marked by high levels of IgE and eosinophil activation. Clinically, patients with ABPA experience difficulty breathing; exacerbations of disease and are at high risk for bronchiectasis and lung fibrosis. Oral corticosteroids are used to manage aspects of the inflammatory response and antifungal agents are used to reduce fungal burden and lower the exposure to fungal antigens. As the appreciation for the severity of fungal infections has grown, new therapies have emerged that aim to improve treatment and outcomes for patients with CF. Aspergillus spp. are ubiquitous spore forming molds, a subset of which are clinically relevant to humans and can cause significant morbidity and mortality. Pulmonary infection from A. fumigatus, the most common Aspergillus pathogen, causes a diverse set of diseases, ranging from acute invasive disease to long-term, chronic infections [fections . The typfections . The morfections ,4 and prfections . PatientAspergillus can result from stable active infection of the lung or from allergic sensitization resulting from the exposure to Aspergillus antigens. In the first case, disease results from stable and persistent infection of the airways with Aspergillus resulting in fungal growth and an inflammatory response that aims to clear the infection from the lung. In some instances, this has been referred to aspergillus bronchitis [H2-driven immune response to Aspergillus antigens, include both severe asthma with fungal sensitization (SAFS) and allergic bronchopulmonary aspergillosis (ABPA). Both SAFS and ABPA are significant clinical issues in patients with asthma, with the latter being a significant clinical problem in patients with CF [A. fumigatus is the common cause of ABPA, however sensitization to other Aspergillus species has been noted [Aspergillus species. It has been suggested that there may be a continuum of disease that starts with aspergillus bronchitis and progresses to sensitization and ultimately ABPA [Chronic diseases caused by onchitis , which m with CF ,8. A. fuen noted . In the ely ABPA , for theAspergillus colonization and persistence may vary among patients and require continued characterization, allergic fungal infections have a clear deleterious clinical impact. CF patients with sensitization to A. fumigatus antigens have a distinct and robust TH2 inflammatory response in sputum samples after allergen challenge. This inflammation is marked by increases in sputum eosinophils and increased expression of IL-5 and IL-13 [H2 hypersensitivity reaction in response to fungal antigens that drives immune cell activation and eosinophil recruitment  samples with similar prevalence and at similar ages as the common the bacterial colonizers Staphylococcus aureus, Pseudomonas aeruginosa, and Haemophilus influenzae. However, whereas S. aureus and P. aeruginosa prevalence decreased over time due to antibiotic therapy, Aspergillus prevalence remained unchanged [. flavus ,19,20. Totic use ,22. Moreotic use ,24,25. Inchanged . Aspergillus colonization and persistence has increased in recent years. Several studies have suggested an association between A. fumigatus infection, respiratory function and severe pulmonary exacerbations. In several studies, CF patients with chronic A. fumigatus infection have lower percent predicted forced expiratory volume (FEV1) than uninfected controls [Aspergillus were associated with air-trapping on HRCT, although the same study failed to show an association with lung function decline between the ages of 5 and 14 [Aspergillus culture positivity to changes in structural lung disease [Aspergillus infection was associated with worse initial CT scores that declined further in the subsequent year, with the most significant impact on air-trapping and mucus plugging [Aspergillus infections over the course of the study, suggesting a dose-responsive relationship between infection and disease. A similar association with progression of lung diseases was observed for P. aeruginosa infection, but not for S. aureus and H. influenzae infections. An appreciation for the clinical significance of controls , higher controls , show mocontrols ,26,27 ancontrols . Declinecontrols ,30, whic5 and 14 . A recenAspergillus are required criteria together with at least two additional supportive features: eosinophilia (>500 cells/\u03bcL), Aspergillus-specific IgG, and/or radiographic findings [An understanding of incidence and prevalence is further hampered by the difficulty of diagnosing disease. Diagnostic criteria for ABPA include both obligatory and supportive criteria in addition to having either asthma or CF. High levels of serum IgE (>1000 U/mL) and a positive hypersensitivity skin test or increased IgE antibody to findings . ABPA isfindings .Aspergillus detection compared to molecular methods, such as quantitative PCR [Aspergillus in sputum using RT-PCR and high-volume culture techniques have the potential to significantly increase the sensitivity of detection and ultimately, diagnosis [Aspergillus, those with ABPA and those with aspergillus bronchitis [The range of reported disease prevalence and variations in diagnostic approaches suggests that pulmonary fungal infections in CF may be under diagnosed. This is further complicated by the use of culture-based diagnostic methods, which underestimate tive PCR ,33. New iagnosis ,34. Usinonchitis . Using tonchitis . They foonchitis .P. aeruginosa and Stenotrophomonas maltophilia infections are positively correlated with Aspergillus infections [Burkholderia cepacia complex was negatively associated with both current and future Aspergillus infection [Aspergillus infections. Potential interactions between Aspergillus species and non-tuberculous mycobacterial (NTM) infections have not been well characterized. Given the importance of NTM infections in CF [A. fumigatus can negatively impact NTM infection in mice [CF patients have a complex lung microbiota, where there is likely significant interplay between colonizing bacteria and fungi . Longitufections . In contnfection , indicatns in CF  and the  in mice , a more P. aeruginosa and A. fumigatus, respectively [Aspergillus colonization [In CF patients, the most common bacterial and fungal isolates are ectively  and coloectively ,41. Givenization . P. aeruginosa and A. fumigatus form biofilms in vivo and in vitro [P. aeruginosa inhibits A. fumigatus planktonic growth and biofilm formation by secreted factors and different isolates of P. aeruginosa exhibit different degrees of toxicity [P. aeruginosa inhibits A. fumigatus growth by the production of pyoverdine, a siderophore that sequesters iron. P. aeruginosa mutants defective in pyoverdine production are not toxic to A. fumigatus, and the addition of pyoverdine to mutant cultures restores A. fumigatus toxicity [Both in vitro ,43. Sevetoxicity ,44. P. atoxicity . More reS. maltophilia is a Gram-negative pathogen of increasing significance in CF. Data from an in vitro mixed-culture biofilm model of A. fumigatus and S. maltophilia suggest an inhibitory effect of S. maltophilia on A. fumigatus growth and production of extracellular matrix [A. fumigatus to amphotericin B was increased in mixed-culture biofilms, whereas S. maltophilia susceptibility to levofloxacin decreased [A. fumigatus and bacteria other than P. aeruginosa. Further study of interactions between A. fumigatus and bacteria commonly found in the CF patients is warranted. r matrix . Co-cultecreased . These dAspergillus from the airways to reduce antigen stimulation of the allergic response [In addition to managing the symptoms of asthma or CF, treatments targeted at treating ABPA aim to prevent acute exacerbations, reduce pulmonary inflammation and to prevent progression toward end-stage fibrotic disease . While tresponse . Theraperesponse ,49. Imprresponse ,51. CurrThe use of corticosteroids in treating ABPA in asthma has largely been based on experience in clinical practice with few randomized, controlled clinical trials studying steroid use as chronic therapy. Long-term steroid use is associated with adverse side-effects, which must be managed in parallel with the management of ABPA ,57,58 anAspergillus infection in the airway and the resulting allergic inflammatory response that is the hallmark of ABPA inflammation. A high percentage of asthmatics sensitized to A. fumigatus are sputum culture-positive for A. fumigatus growing in their airways [Aspergillus-specific IgG and IgE [Aspergillus infection in patients with ABPA and SAFS, 9 patients that were positive for Aspergillus infection by PCR became negative for Aspergillus infection following treatment with itraconazole. This conversion was associated with a reduction in total serum IgE [Use of antifungals in management of ABPA is supported by a strong biological link between  airways , which c airways . Fungal  airways ,62,63, h and IgE . Likewiserum IgE . Aspergillus bronchitis [cyp51A gene, the molecular target of azole activity, the development of resistance to one azole can result in broad cross-resistance to multiple azoles [cyp51B, a second 14-\u03b1 sterol demethylase, which may be further exacerbated by a second mutation in hmg1 [The most common antifungal therapy used in the management of ABPA is itraconazole, a triazole that inhibits fungal cytochrome P450 synthesis of ergosterol, a critical component of the fungal cell wall . Clinicaonchitis  and ABPAonchitis ,54,55,68onchitis . As withonchitis . Of parte azoles . This co in hmg1 . Oral itraconazole efficacy in asthmatics with ABPA has been studied in two randomized, placebo-controlled studies to study the clinical response and anti-inflammatory effect of treatment ,54. In aA. fumigatus antigen exposure is the main driver of clinical disease. In a second randomized, double-blind placebo-controlled study the effect of itraconazole on pulmonary inflammation was assessed in 29 subjects with stable ABPA [Aspergillus antigens, were also reduced [p = 0.007), itraconazole had a significant benefit to the majority of patients, with fewer side effects than steroid treatment [Inflammation resulting from ble ABPA . Over 16 reduced . More rereatment . Although anti-fungal drugs have not been widely studied in CF patients with ABPA, data generated in asthmatics suggests that antifungal therapy may provide benefit to CF ABPA patients. This is further supported by small studies of itraconazole in patients with CF. In a study of itraconazole in six ABPA patients, three of whom had CF, itraconazole treatment reduced steroid use and two of the three CF patients had clinical benefit, including improved lung function . An addiAmphotericin B, a polyene anti-fungal that acts by disruption of the fungal cell wall, is commonly used as an intravenous drug to treat severe fungal infections in immunocompromised patients . In an eElevated serum and sputum IgE levels are a hallmark of ABPA. IgE can trigger mast cell degranulation and cause hypersensitivity responses in the lung, which together drive the pathophysiology of the disease . OmalizuA. fumigatus [Despite the advances in diagnosis and management of ABPA, there remains a significant unmet medical need for the treatment of ABPA. The primary antifungal therapy, oral itraconazole, is generally safe and well tolerated in both CF and non-CF patients, though there is an extensive list of drug-drug interactions (DDI), which requires drug monitoring during therapy. Itraconazole absorption and pharmacokinetics can be highly variable, resulting in inconsistent exposure across patients, which may impact the consistency of clinical responses ,72. In humigatus . Variablumigatus . A. fumigatus. In addition, PC945, a novel azole delivered by liquid nebulization is also in development as a therapy for treating pulmonary fungal infections  is a dry powder formulation of itraconazole being developed using a proprietary inhaled delivery technology called iSPERSE . A PhaseZP-059  is a dry powder formulation of voriconazole being developed using a novel spray drying technology for the treatment of ABPA in asthma . This foTFF-VORI  is a dry powder formulation of voriconazole formulated using thin film freezing technology, which produces excipient-free nanoaggregates of drug for inhalation ,95. A PhA. fumigatus [PC945  is a novel triazole being developed for liquid nebulization for the treatment of IPA, with potential for use in ABPA. PC945 is a potent inhibitor of ergosterol synthesis, exhibiting 14-fold greater potency than voriconazole and 2.6-fold more potency than posaconazole against umigatus . A Phaseumigatus . Aspergillus-related allergic diseases in patients with CF. With this understanding, more work is needed to decipher the relationship between A. fumigatus infections and different clinical outcomes. An increased appreciation of the clinical significance of ABPA has led to an understanding of the importance of the interactions between fungal and bacterial infections. Additional research in these areas is warranted to further characterize the complex microbial ecology of the CF lung and to help identify new treatment strategies for the management of disease. In recent years there have been several large, well-controlled clinical studies of therapies for ABPA, which have significantly improved treatments for patients and established a framework for the continued study of new therapies in development. The assessment of anti-fungal drugs with novel mechanisms of action as treatments for ABPA and other allergic fungal diseases would be a welcome step towards improving patient lives. Significant advances have been made in understanding the incidence and severity of"}
{"text": "Aspergillus sp. found most commonly in patients with underlying asthma or cystic fibrosis. Host factors which alter the innate and adaptive immune responses to this abundant airborne fungus contribute to the development of chronic airway inflammation, bronchiectasis, and fibrosis. Traditionally, treatment has focussed on reducing fungal burden and immune response to fungal antigens. However, a significant proportion of patients continue to suffer recurrent exacerbations with progressive lung damage, and the side effect burden of existing treatments is high. New treatments including novel antifungal agents, monoclonal antibodies against aspects of the adaptive immune response as well as targeted immunotherapies may be better tolerated and achieve improved outcomes but have not yet been studied in large-scale randomised control trials.Allergic bronchopulmonary aspergillosis is an allergic pulmonary condition caused by hypersensitivity to antigens of  Aspergillus. The most common pathogen in this genus, Aspergillus fumigatus, is abundant in both indoor and outdoor environments and does not usually cause disease in immunocompetent individuals.2 In immunocompromised individuals or in those with underlying lung disease however, it can cause a spectrum of disorders ranging from invasive aspergillosis to allergic aspergillosis. Allergic aspergillosis has been categorised into ABPA and severe asthma with fungal sensitisation.Allergic bronchopulmonary aspergillosis (ABPA) is defined as an allergic pulmonary condition caused by hypersensitivity to allergens of the common saprophytic filamentous fungi et al. in 1952 and is found in patients with asthma and cystic fibrosis (CF), as well as in rarer conditions, such as chronic granulomatous disease and hyper-immunoglobulin E syndrome. Characteristically, individuals with ABPA present with respiratory symptoms including poorly controlled asthma, wheeze, haemoptysis, and productive cough as well as systemic symptoms, such as fever and weight loss and can suffer recurrent exacerbations. In CF patients, ABPA may present with worsening symptoms or lung function that is not responsive to usual antibiotic treatments. ABPA can typically be a cause of large airway collapse and lead to bronchiectasis. In certain cases, ABPA may develop into chronic pulmonary aspergillosis. End-stage disease is typified by cor pulmonale and type-2 respiratory failure.ABPA was first described by Hinson  The prevalence in severe asthma is likely to be much higher, for example, a prospective study of patients with severe asthma attending a tertiary centre clinic in Northern India showed a prevalence of 70%. The prevalence of ABPA complicating asthma in the United Kingdom is predicted to be between 50,000 and 250,000. Studies on CF have found a wide prevalence range between 2% and 19% dependent on definition criteria.13The estimated prevalence of ABPA in asthma depending on definition criteria is between 0.7% and 22%, and therefore is likely to affect 4.8 million patients globally.In this review, we describe the diagnostic criteria and pathophysiology of ABPA, current therapeutic options, and future potential therapeutic targets. the ISHAM criteria , and one proposed more recently by Asano et al., as well as a modified ISHAM criteria based on latent class analysis proposed by Saxena et al. There are different criteria used for patients with CF (proposed by the CF Foundation) due to overlapping clinical features with bacterial exacerbations in CF, and for patients with allergic bronchopulmonary mycosis (ABPM).16The diagnosis of ABPA is based on a combination of clinical, serological, and radiological features. There are several criteria proposed for diagnosis including the Rosenberg\u2013Patterson criteria,Aspergillus skin tests, sputum cultures, peripheral eosinophilia, total serum immunoglobulin E , A. fumigates-specific IgE, A. fumigates-specific immunoglobulin G (IgG), and radiological findings. Various cut-off values for these investigations have been proposed as several of these investigations may be abnormal in other fungal or related diseases, and there can be difficulties with the effects of treatment on some parameters.These criteria use the results of several investigations to aid diagnosis, including 1618 Total serum IgE levels can be used to monitor treatment with reductions in IgE of 25\u201350% correlating with improved symptoms and radiological appearances and increasing levels (e.g. a doubling in IgE level) suggesting an impending exacerbation. In addition, lung function can be used to determine the severity of underlying lung disease and monitor response to treatment. Fixed airflow obstruction and reduced lung volumes can be found in progressive disease. Sputum cultures are not diagnostic as they may be positive in patients without ABPA who are colonised with Aspergillus but are important in determining azole resistance prior to treatment.Some of these investigations may also be used in determining exacerbations and monitoring treatment efficacy.21 Mucus impaction is another common finding on computed tomography (CT) imaging and high attenuation mucus  is a pathognomonic feature of ABPA.2225Central bronchiectasis  is the defining radiological feature of ABPA and is part of the Rosenberg\u2013Patterson and Asano diagnostic criteria.et al. in 1982. This staging involved five categories: acute, remission, exacerbation, steroid dependent asthma, and fibrotic lung disease. The International Society of Human and Animal Mycology (ISHAM) group proposed a new staging system, with seven stages ranging from 0 (asymptomatic) to 6 (advanced ABPA) as described in ABPA was originally staged by Patterson 27 This divides patients into four stages with differing radiological appearances. These include ABPA-S  which includes all diagnostic features of ABPA but no abnormality on CT, ABPA-B (ABPA with bronchiectasis), ABPA-HAM (ABPA with high attenuation mucus), and ABPA-CPF (ABPA with chronic pleuropulmonary fibrosis) which includes other radiological features including pulmonary fibrosis, parenchymal scarring, fibrocavitatory lesions, aspergilloma, and pleural thickening without the presence of mucoid impaction or HAM. In a study of 234 patients which were categorised in this way, the immunological severity also increased between the stages. These studies show clearly that ABPA represents a heterogeneous group of endotypes which will likely be important in evaluating future novel therapeutic strategies.Radiological staging has also been proposed by the ISHAM group. Treatment can be effective in maintaining lung function and lack of treatment or late diagnosis can lead to progressive and even fatal disease.30 Therefore, early diagnosis and treatment of ABPA is crucial in preventing the development of serious and potentially irreversible lung damage, such as bronchiectasis or fibrosis.There are limited studies on the long-term prognosis of ABPA. In a study following 120 patients over 4 years, 33% went into remission, 20% became steroid dependent, and 2% developed end-stage fibrotic lung disease.A. fumigatus is the most common pathogen involved in ABPA but other species including A. flavus, A. niger, and A. oryzae may also be involved. Other fungal species including Schizophyllum commune may cause similar pathology to ABPA, and this disease is termed ABPM.33A. fumigatus produces tiny (2\u20135 micrometre) spores, known as conidia, which are able to remain in the atmosphere for long periods of time and are therefore inhaled in large numbers.34A. fumigatus is ubiquitous in the environment and does not cause disease in most individuals. It is clear therefore that disease is caused by host factors, including genetic predisposition, which affect the host response to Aspergillus by affecting innate and adaptive immune responses. It is these innate and adaptive immune responses that are the current targets for treatment of ABPA, as well as treatment to reduce fungal burden.Aspergillus conidia to swell and develop hyphae. Innate immune systems are involved in preventing this by acting to clear fungal spores from the airways.Innate immune responses include non-specific physical, chemical, and cellular responses to pathogens, and defects in these processes have been shown to be involved in the pathogenesis of ABPA. A key factor in the development of disease is the ability of  and therefore results in defective clearing of Aspergillus spores from the airway, predisposing patients to ABPA. Aspergillus itself is also involved in reducing the efficacy of the mucociliary escalator. For example, Aspergillus produces metabolites such as gliotoxin which impair ciliary beating.The first innate barrier to infection is the airway epithelium. In larger airways, the epithelial layer contains goblet cells and ciliated cells. Goblet cells produce mucus which traps foreign bodies , and ciliated cells move the mucus up the airways towards the mouth, where it can be coughed up or swallowed. This mucociliary escalator is impaired in individuals with CF or asthma CF patients are known to have an increased risk of ABPA, and evidence has been found that mutations in the CFTR gene (insufficient for a diagnosis of CF) are associated with ABPA in asthmatic patients. Evidence from pooled results from four studies showed an increased likelihood of encountering CFTR mutations in patients with ABPA. The viscosity of mucus is another target in the treatment of ABPA.The composition of mucous may also be a factor predisposing to ABPA. Polymorphisms in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene, which regulates the flow of sodium and chloride ions across cell membranes, affect the viscosity of mucous and increase the risk of ABPA.Aspergillus. Eosinophils undergo cytolysis and release filamentous chromatin fibres .40 EETs act to immobilise Aspergillus via hydrophobic interactions; however, EETs may also contribute to increased mucus viscosity and sputum plug formation. A case report showed abundant EETs in mucous plugs found in a patient with ABPA, and a significant reduction in EETs once the patient was treated with steroids. In addition, there is evidence that EETs are not effective in killing Aspergillus, and so may contribute to pathogenesis.ABPA is characterised by eosinophilic recruitment to the airways and peripheral eosinophilia. Eosinophils have recently been shown to undergo a process of extracellular trap cell death in response to Aspergillus conidia and target them for phagocytosis by neutrophils and macrophages.44 Genetic polymorphisms that cause changes in the collagen region of surfactant protein A2 have been shown to be associated with increased levels of IgE and increased eosinophilia compared to patients with ABPA who lacked these single-nucleotide polymorphisms (SNPs), suggesting that changes in the function of surfactant proteins may contribute to worsened disease.A further innate immune response occurs within the smaller airways, where Type-II pneumocytes are responsible for secreting surfactant proteins, including surfactant proteins A and D. In addition to their other functions, these act as opsonins that bind A. fumigatus innate responses,47 which they detect via pattern recognition receptors (PRRs). These receptors, located on the cell wall detect pathogen-associated molecular patterns (PAMPs) including B glucan, chitin, and galactomannan. Toll-like receptors (TLRs) are located within the plasma membranes of cells and on intracellular endosomes and detect PAMPs on the fungal cell wall. Binding to these receptors, triggers secretion of pro-inflammatory cytokines, and TLR activation on dendritic cells causes propagation of an adaptive immune response. Genetic polymorphisms in TLR3 and TLR9 and mannose binding lectin have been shown to cause susceptibility to ABPA, and TLR agonists have been considered as adjuvants in allergy immunotherapy treatment including in ABPA.4851A number of other innate cells including alveolar macrophages, neutrophils, monocytes, and dendritic cells are involved in  While there are no studies on ILC2s in ABPA specifically it is likely that these cells which respond to allergen exposure and when activated cause release of type-2 cytokines (including interleukin (IL)-5 and IL-13) resulting in eosinophilia and mucus hypersecretion may also be involved in the pathogenesis of ABPA and therefore may be a future therapeutic target. A recent study showed that in a murine model of eosinophilic asthma, inhibition of ILC2s by 2\u20193\u2019-cGAMP resulted in decreased airway hyper-responsiveness and lung eosinophilia in response to challenge with Aspergillus flavus, suggesting that inhibition of ILC2s may reduce type-2 inflammation in patients with ABPA.Innate lymphoid cells (ILCs) are a recently discovered group of innate immune cells, and group-2 ILCs (ILC2s) have been shown to have a significant role in allergic diseases including asthma. The host response to Aspergillus in ABPA however is skewed towards a Th2 response, and this is thought to cause progressive disease. Th2 responses counteract Th1 responses and promote IgE and eosinophilic responses. Th2 cytokines include IL-4, IL-5, IL-10, and IL-13. IL-4 stimulates activated B cells and promotes differentiation of B cells into IgE producing plasma cells. IL-5 is a mediator for eosinophil production and activation. IL-13 induces airway hyper-responsiveness, goblet cell metaplasia, and mucous hypersecretion. SNPs in IL-4R and IL-13 genes have been shown to be associated with increased risk of ABPA and the 1082GG genotype of the IL-10 promoter has been associated with the development of ABPA in CF patients.58 Monoclonal antibodies have been designed to target aspects of the Th2 inflammatory response and have been shown to be effective in the treatment of ABPA.5962The adaptive host response involves T and B lymphocytes and is pathogen specific. In general, the host response to a pathogen may be either a T-helper (Th) 1 or Th2 response and both cell types produce specific cytokines. Th1 responses are generally pro-inflammatory and involve cytokines, such as interferon gamma (IFN \u03b3), IL-2 and tumour necrosis factor beta (TNF \u03b2). Th1 cytokines enhance cytotoxic and macrophage activity and therefore promote fungal clearance.in vitro compared with controls.A. fumigatus has also been shown to generate extensive lung inflammation and an enhanced Th2-biased immune response in CFTR deficient mice compared with controls.As well as affecting the viscosity of mucus, mutations in the CFTR gene have also been shown to affect the adaptive immune response. For example, mutations in the CFTR gene have been shown to be involved in maintaining the balance between Th1 and Th2 responses, with CD4+ T-cells derived from CF patients exhibiting Th2 bias 6567 It is thought that these patients express a major histocompatibility complex/HLA that restrict the phenotype of expression in antigen presenting cells and skews the immune response towards a Th2 response.Observational studies have shown an increased risk of ABPA in patients who express HLA-DR2 and/or DR5 but not HLA-DQ2. HLA-DRB1*1501 and 1503 are associated with higher risk and HLA-DQB1*0201 are associated with lower risk.A. fumigatus also has various mechanisms which drive the adaptive immune response towards a Th2 response rather than a Th1 response. For example, A. fumigatus has been shown to inhibit IFN\u03b2 signalling through the JAK-STAT pathway, which leads to a reduction in the chemokine CXCL 10 and drives the response towards a Th2 response. Aspergillus has also been shown to cause activation of certain receptors (protease-dependent receptor 2 and tyrosine-protein phosphate non-receptor type) in bronchial epithelial cells which results in suppression of CXCL 10, promoting a Th2 response,69 in addition to secretion of proteases such as alkaline serine proteases which have elastolytic and collagenolytic activity and cause damage to epithelial cells and airway structural components.7072 Repair mechanisms in response to damage by Aspergillus proteases, mast cell degranulation, eosinophils, and EETs result in proliferation of epithelial cells, endothelial smooth muscle cells and fibroblasts, resulting in remodelling of the airways, and development of bronchiectasis.7375 Due to these factors, antifungal therapeutics aiming to reduce fungal colonisation of the airways are an important consideration in management of ABPA.27 Treatment therefore has traditionally included immune suppression using steroids and antifungal therapy to reduce fungal burden. Novel treatments including monoclonal antibodies, immunotherapy, and novel antifungal agents may be of benefit in the treatment of ABPA but have not been studied in large-scale randomised control trials. A summary of the action of different therapeutic agents in the pathogenesis of ABPA is shown in The overall therapeutic goal of ABPA management is to minimise the pro-inflammatory response and reduce airway fungal burden to control symptoms, reduce exacerbations, maintain and normalise lung function, and prevent radiological progression. The medium-dose regimen consisted of prednisolone 0.5 mg/kg/day for 1\u20132 weeks, then alternate day therapy for 6\u20138 weeks, and finally tapering by 5\u201310 mg every 2 weeks until ceasing after 3\u20135 months. The high-dose regimen consisted of prednisolone 0.75 mg/kg/day for 6 weeks followed by 0.5 mg/kg/day for 6 weeks. The dose was then reduced by 5 mg every 6 weeks to complete a treatment duration of 6\u201312 months. A retrospective study in 55 patients with ABPA-S showed that treatment with high-dose steroid regime induced remission (defined as a reduction in serum IgE levels by at least 25%) in all patients at 3 months. This indicates that the use of systemic corticosteroids may be significant in reducing progression to radiologically apparent disease; however, the study has a number of limitations including size, its retrospective nature and the lack of a control group.At present, glucocorticoids are the current mainstay of treatment; however, there is a paucity of clinical trials evaluating effectiveness, dose, and duration. To date, there have been two dose regimens for oral glucocorticoid therapy studied in the literature: medium and high dose. A recent review by Ishiguro et al. into patients with ABPM showed that systemic corticosteroids are also effective in this related condition. Intravenous pulsed steroids have been studied and shown to be beneficial in children with refractory ABPA exacerbations associated with long-term steroid use.79 Although effective, the use of systemic glucocorticoids is limited by significant side effects including obesity, osteopenia, development of type-2 diabetes, insomnia as well as many other effects. In addition, long-term glucocorticoid use can cause downregulation of glucocorticoid receptors inducing a steroid-resistant state.A randomised control trial of 92 patients with asthma found that the medium dose regimen was as effective and less harmful than high-dose regimen in acute ABPA, with no significant difference in time to exacerbation or progression to steroid dependent ABPA. There was in addition a significantly higher number of patients with steroid-related complications in the higher dose group.82 The recommendation of the ISHAM committee was that high-dose inhaled corticosteroids should not be used in isolation in ABPA due to lack of evidence of efficacy.84Inhaled steroids have been investigated in numerous case studies for treatment of ABPA. These studies often included patients on systemic corticosteroids in addition and assessed efficacy in a variety of different ways including radiologically and with lung function, rather than serology.83 Given the significant side effect profile of steroid treatment often antifungal strategies are considered in steroid dependency.Despite corticosteroids being the mainstay of treatment in ABPA, 50% of patients relapse once systemic steroids are reduced and up to 45% become steroid dependent.Aspergillus spore exposure. Patients may therefore be advised to avoid high-risk environments, for example, areas with decomposing matter and mouldy indoor environments. Given the ubiquity of Aspergillus in the environment however, this is unlikely to reduce the fungal burden significantly for most patients. Other strategies to reduce fungal burden include treatment with antifungal agents.As detailed above, antifungal agents have been used in ABPA as it is thought reducing the fungal burden in the airways will reduce the antigenic stimulus and therefore reduce inflammation. The easiest way to reduce fungal burden is to reduce A. fumigatus and are predominantly first-line therapy in the management of Aspergillus-related infection and allergy in chronic respiratory disease. Triazole antifungals include first-generation drugs, including itraconazole and fluconazole and second-generation triazole antifungals, such as voriconazole, posaconazole, and isavuconazole. Ketoconazole was the first antifungal agent used to treat ABPA; however, this has now been largely superseded by itraconazole. In a study comparing itraconazole to placebo in steroid-dependent ABPA, it was shown that itraconazole reduced steroid dose by more than 50% and reduced total IgE levels by more than 25%. There were also clinical improvements including improved exercise capacity, resolution of radiological opacities on chest radiograph and improved spirometry, although these were not statistically significant. A further study in clinically stable patients showed a reduction in sputum inflammatory markers, serum total IgE levels, and frequency of exacerbations with itraconazole.Oral triazole antifungal drugs are effective against versus itraconazole monotherapy in acute ABPA showed no difference in the proportion of patients achieving full remission after 3 and 6 months of treatment and no difference in time to first exacerbation, which the authors suggest shows itraconazole can be used as a steroid alternative. However, their findings did show that steroid treatment resulted in a significantly greater initial response (within 6 weeks), measured as a composite score consisting of improved symptoms, improved chest radiograph appearances and decline in serum IgE by more than 25%. The rate of adverse outcomes however, including cushingoid habitus, weight gain and acne was significantly higher in the steroid group. A limitation of this study was that there was a significant proportion of patients (12%) who did not initially respond to itraconazole and were excluded from subsequent follow-up investigations, with no ability to predict non-response.A study comparing the effectiveness of steroid monotherapy  Itraconazole is a cytochrome P450 inhibitor and therefore may have interactions with other medications including corticosteroids. Therefore, when used in cases of steroid dependency, effectiveness of azole therapy when given in combination with steroids may potentially relate to increased steroid bioavailability. The use of inhaled corticosteroids (e.g. fluticasone and budesonide) can result in adrenal suppression and Cushing\u2019s syndrome.Long-term azole use, however, can have several adverse effects including gastrointestinal (GI) disturbance, hyperlipidaemia, peripheral oedema, peripheral neuropathy, and heart failure. Posaconazole and voriconazole have been shown to induce clinical response in 78% and 70% of patients, respectively, in a study of 25 patients with previous itraconazole treatment failure, with 75% of patients able to discontinue oral corticosteroids, a reduction in serology, healthcare utilisation, and short-term beta-agonist use and improvement in radiological appearances at 9 months. The study also noted significant adverse events with voriconazole (40%) with 26% of patients requiring treatment cessation, with no significant adverse effects with posaconazole.Alternative newer azole medications (e.g. posaconazole and voriconazole) have been used in treatment failure or intolerance with itraconazole.Aspergillus IgE with posaconazole in comparison to corticosteroids only or other azoles, with Aspergillus IgE levels inversely correlated to drug levels. The authors suggest the improved serological response to posaconazole may be due to its improved bioavailability and ability to achieve therapeutic drug levels or enhanced antifungal activity. The study has a number of limitations, however, and randomised controlled trials are required to look at the relative effectiveness of novel azole therapies in ABPA. There are a number of novel inhaled azole compounds in clinical trials with an aim to reduce the systemic side effect profile often related to azole therapy. Itraconazole has been developed as a dry powder inhaler and is currently in phase-II clinical trial. In addition, a novel triazole, PC945 has been shown to be more effective against Aspergillus than voriconazole in vitro and in vivo, has limited systemic bioavailability and is due to commence phase-III clinical trials in 2021.In the CF population, there is some evidence to suggest that posaconazole may be more effective than other triazoles in the treatment of ABPA. A retrospective study of 32 CF patients with ABPA treated with itraconazole, voriconazole, and posaconazole showed a significant reduction in Aspergillus diseases where azole resistance is an issue. Newer echinocandin agents are currently in clinical trial with modified pharmacokinetic properties allowing for reduced frequency administration (e.g. Rezafungin), with phase-3 trials in the setting of invasive fungal disease ongoing. Further novel echinocandin agents with oral bioavailability (e.g. ibrexafungerp) are also in phase-3 clinical trials. Whether these agents will be useful in ABPA management remains to be studied.Other currently available classes of antifungal therapy include the echinocandin group  and the polyenes (e.g. amphotericin). No trials as yet have been conducted into the use of echinocandins in the management of ABPA. However, they have been used in other  It is thought that lipid formulations (e.g. ambisome) may be better tolerated and there is some evidence for its use in paediatric patients with CF.101Amphotericin B in nebulised form has been used in the treatment of ABPA. Nebulised amphotericin (in sodium deoxycholate formulation) was found to be effective in 3 of 21 patients; however, the remaining 18 patients had to discontinue due to bronchospasm.in vitro against Aspergillus and phase-2b clinical trials in the setting of invasive fungal infections are ongoing. Fosmanogepix is a pro-drug of manogepix, which is an inhibitor of the fungal enzyme GPI-anchored wall transfer protein 1 (Gwt1) which is involved in glycolipid biosynthesis and has been shown to have significant in vivo efficacy against Aspergillus. It is currently in phase-2 clinical trials and has shown excellent oral bioavailability, favourable drug\u2013drug interaction and tolerability.There are additionally several completely novel antifungal agents in late phase clinical trials that may potentially be of use in the treatment of ABPA. Olorofim inhibits the enzyme dihydroorotate which is a key step in pyrimidine synthesis. It has been shown to be active Aspergillus additionally produces a variety of different toxins which affect the airway and interact with the host response and there has been interest in these as therapeutic targets in ABPA. Alkaline protease 1 (Alp1) may be an example of a potential new target for treatment in ABPA. This A. fumigatus serine protease has been shown to cause airway hyper-responsiveness, inflammation, and smooth muscle contraction which contributes to pathogenesis of ABPA and is independent of the host immune response. Targeting such secreted products may thus be a novel future approach to managing this complex disease. The dose is dependent on the initial IgE level (0.016 mg/kg/IU) with an upper IgE limit of 1500 IU/mL and a maximum dose of 1200 mg monthly. As serum IgE levels are usually very high in ABPA, large doses are usually required.There is increasing evidence for the use of monoclonal antibodies in treating ABPA. Omalizumab (Xolair) is a humanised monoclonal IgG antibody against IgE. It acts to bind free serum IgE and down regulates cell-surface high-affinity receptors for IgE (Fc\u03b5R1) on basophils and mast cells. A systematic review which included 102 patients with predominantly prior treatment failure with steroids and antifungals from 30 studies was done to assess the effectiveness of omalizumab. This showed there was a reduction in clinical symptoms, exacerbation rates, steroid use, serum total IgE levels, and FENO following treatment with omalizumab. There was a suggestion that there were greater effects in patients with higher baseline total IgE levels receiving treatment via the subcutaneous route. However, the majority of the data in this study was derived from case reports. Omalizumab has also been reviewed in the CF population. A retrospective study into CF patients with ABPA showed no significant reduction in cumulative steroid dose, days on IV antibiotics or days in hospital. However, a small proportion (4/11 patients) managed to reduce their steroid dose by over 50%. All the studies performed to date in CF and non-CF ABPA are limited by a lack of placebo control, with small patient numbers and often retrospective analysis. Further prospective clinical trials are required to analyse the long-term effectiveness of omalizumab or other anti-IgE monoclonal antibodies (e.g. ligelizumab and quilizumab) in ABPA.A randomised cross-over study evaluated the effectiveness of omalizumab compared with placebo in 13 patients with ABPA and found that there was a significant reduction in exacerbations in the treatment arm and FENO reduced significantly from baseline. There were no adverse events. Subcutaneous mepolizumab 100 mg every 4 weeks was given to all patients. Eosinophil numbers dropped significantly in all patients, but only four patients had a significant reduction in total IgE levels. There were however improvements in FEV1 and radiological findings, and there was a clinical improvement in all patients with no adverse effects identified. Reslizumab and benralizumab also interrupt signalling via IL-5. Reslizumab is a second anti-IL-5 monoclonal antibody and benralizumab is a monoclonal antibody against the \u03b1 unit of the IL-5 receptor. Both have been shown to reduce blood eosinophil levels in asthma patients with potential efficacy in ABPA. A retrospective study of anti IL-5/5R treatment in patients with severe asthma with fungal sensitisation and ABPA showed a reduction in exacerbations in the ABPA subgroup. However, this study is limited by the small patient numbers in the ABPA subgroup (N\u2009=\u20099) and large randomised controlled trials are required to definitively understand the utility of anti-IL-5 therapy in ABPA.Mepolizumab is a humanised monoclonal antibody to IL-5, which is a key mediator in eosinophil differentiation, activation, migration, and survival. A systematic review evaluated the effectiveness of mepolizumab in ABPA in seven studies, with a total of eight patients. The patient was commenced on dupilumab in addition to high-dose inhaled corticosteroid, long acting beta-agonist and prednisolone 20 mg and symptoms resolved at 4 months. The patient was able to taper steroids successfully, and there was significant improvement in lung function sustained at 8 months. IgE levels and eosinophil levels had also normalised by 8 months. Dupilumab holds significant potential as a therapeutic in ABPA and a phase-III randomised control trial of dupilumab in asthma patients with ABPA is currently underway (NCT04442269).Dupilumab is an IL4-R\u03b1 antibody that has been used in atopic dermatitis, severe asthma, and chronic rhinosinusitis and inhibits Th2 cytokine signalling via IL-4 and IL-13. A recent case report documented the use of dupilumab in a patient with ABPA who had previously failed treatment on itraconazole, omalizumab, and benralizumab. Given its actions on Th2-mediated immune responses and airway remodelling it again may show significant promise as a future therapeutic agent in ABPA.Tezepelumab is a monoclonal antibody against thymal stromal lymphopoietin (TSLP) which acts as an upstream mediator of the inflammatory response to common asthma precipitants including viruses, allergens, and other airborne irritants. TSLP acts on multiple aspects of the inflammatory response including allergic inflammation, eosinophilic inflammation, neutrophilic inflammation, and airway remodelling. Tezepelumab has been shown to reduce exacerbation rates, improve lung function and reduce symptoms in patients with a wide variety of asthma phenotypes. This small trial showed a reduction in sputum eosinophil percentage by 4.5 times and may therefore be of benefit in patients with ABPA.Similarly, Fevipiprant, an antagonist of prostaglandin D2 receptor 2 has been shown to reduce eosinophilic airway inflammation in a randomised controlled trial of moderate \u2013 severe asthma patients. Several DARPins have been shown to be effective in vitro including DARPIN E2_79 and D11112. While the early results are promising and may be applicable for use in ABPA, further studies are required.Future potential therapeutics targeting IgE-mediated Th2 inflammation includes designed ankyrin proteins (DARPins) which prevent IgE-mediated activation of effector cells. They act to disrupt the formation of IgE/receptor complexes and break down formed complexes.In addition to anti-inflammatory and antifungal drugs, treatments that reduce mucus viscosity have been used to reduce the symptom burden in patients with ABPA. Hypertonic saline can be used  to reduce sputum viscosity and promote clearance, although no studies on long-term benefit have been performed.N-acetylcysteine; however, no ABPA-specific clinical trials have been performed. Dornase-alpha is potentially of benefit in ABPA, given the significant contribution of filamentous chromatin-rich EETs to sputum viscosity. A recent observational study of DNase use in the UK CF population showed modest long-term improvements in patients with lower lung function (FEV1\u2009<\u200970% predicted) but was not able to distinguish any additional benefit in the ABPA subset. A recent case series reviewed the use of bronchoscopy with instillation of DNase in five patients with CF and ABPA who developed lobar atelectasis, and reported full lung re-expansion in all cases. However, it is possible that bronchoscopy and manual removal of secretions resulted in this good outcome rather than DNase use and further randomised trials are needed to determine the efficacy of DNase in ABPA.There are a number of other licenced mucoltyics available including nebulised Dornase-alpha and Allergy immunotherapy has been shown to be effective in atopic asthma and allergic rhinitis and is effective in preventing new allergen sensitivities. Small amounts of allergen are given sublingually or subcutaneously with the aim of inducing immunological tolerance which is maintained even after discontinuation of treatment. The first effect is the desensitisation of Fc\u03b5R1 bearing mast cells and basophils, and this is followed by T-cell tolerance which is mediated by IL-10 and TGF-\u03b2. Immunotherapy has been shown to decrease nasal symptoms in allergic rhinitis and prevent progression to asthma.Aspergillus sp seen in ABPA. However, this treatment has a significant side effect profile including risk of anaphylaxis, with a reported systemic reaction to subcutaneous allergy immunotherapy of 0.1% per injection. Patients have been shown to require treatment monthly for at least 4 years to induce long-term benefit once treatment is discontinued. Sublingual immunotherapy has a better safety profile with similar efficacy. However, both routes of administration have significant issues with adherence, given the need for repeated doses.Immunotherapy may in the future have a role in reducing the allergic response to  Several TLR agonists have been investigated in the context of allergy immunotherapy and have shown efficacy in enhancing Th1 responses, although these data are largely from in vitro and animal models. Synthetic TLR4 and TLR9 agonists have been evaluated in clinical trials and synthetic TLR2, TLR5, and TLR7 have shown efficacy in human in vitro studies and animal in vivo studies. Similarly, monophosphoryl lipid A is an adjuvant that binds TLR4 and short segments of DNA with CpG motifs bind TLR 9. It may be possible in the future therefore to use TLR agonists as adjuvants in allergen immunotherapy directed against Aspergillus.TLR agonists have been investigated as adjuvant treatment in immunotherapy for common allergens involved in allergic rhinitis. They have been shown to favour an anti-allergic inflammatory profile favouring Th1 responses and when administered with allergens promote immunological tolerance. would be to initiate medium-dose steroid treatment or antifungals (itraconazole) in clinical stage 1, depending on patient factors and patient-specific risks for each treatment. Physiotherapy and mucolytic therapy as necessary should be instituted. Treatment response should be monitored initially at a 6- to 8-week interval with serum IgE levels, chest radiography, lung function, and quality-of-life questionnaires. The aim of therapy should be to reduce the IgE level by 25\u201350% and achieve clinical remission and stability. Steroids can then be reduced or tapered in remission (stage 2). A further exacerbation (stage 3) should be treated with either steroids alone or in combination with an antifungal . If the patient becomes treatment dependent (stage 5), alternative antifungals, pulsed methylprednisolone, nebulised amphotericin, or biologic agents could be considered.A suggested protocol for treatment of ABPAAspergillus sp, with failure in innate and adaptive immune systems resulting in reduced clearance of fungal spores from the airways and the ability for Aspergillus to form hyphae. This results in further Th2-weighted immune responses which in combination with substances secreted by Aspergillus itself, such as fungal proteases lead to airway hyper-responsiveness and excess mucus production, airway remodelling, inflammation, bronchiectasis, and fibrosis.ABPA is caused by an abnormal host response to The traditional treatments for ABPA focus on reducing the immune response with corticosteroids and reducing fungal burden with antifungal agents. However, despite this, a significant number of patients continue to suffer from active disease and exacerbations which cause further lung damage, bronchiectasis, and fibrosis. In addition, many of the current treatments have significant adverse effects which cause increased morbidity.Targeted immune treatments against aspects of the aberrant Th2 response have been shown to be effective and novel antifungal agents may be better tolerated and should be considered in patients with hard to treat disease or recurrent exacerbations. However, despite the potential role of novel biologic and antifungal therapies there is a critical lack of large-scale randomised control trials in ABPA which is a widespread global disease with significant health burden and morbidity. The current evidence for novel biologic and antifungal therapies is limited to case series and subgroups of larger trials, limiting the therapeutic options for patients. An understanding of disease heterogeneity in ABPA and endotypes will also be critical to ensure therapeutic stratification and success of future clinical trials."}
{"text": "Purpose: The importance of dental care and oral hygiene is often underestimated in people with autism spectrum disorder (ASD). Comorbidity with dental anxiety is greater in ASD subjects who also show unusual reactions to sensory stimuli. The aim of our study was to assess the efficacy for a sensory-adapted environment and targeted methods in reducing anxiety and positively influencing cooperation in children with ASD during a dental examination or specific treatments. Material and methods: The sample consisted of 50 Italian children with a diagnosis of ASD  presenting with mild intellectual disability (ID) and verbal language skills. The subjects enrolled in the study had at least two decayed teeth and all were treated in two different dental environments: regular dental environment (RDE) and sensory-adapted dental environment (SADE). Results: 20% of the sample was successfully treated in RDE, while 68% of subjects were successfully treated in SADE. Conclusions: Results suggest that a sensory-adapted environment positively affects the therapeutic dental treatment in patients with ASD and reaffirm that sensory dysregulation in children with ASD is a crucial factor influencing the successful outcome of oral care. Dental care and oral health are very important and are a crucial aspect in the overall health and quality of life for individuals. For some time now, the World Health Organization has stressed the importance of oral health among the health topics that each Member State should pursue. This topic, however, does not attract a great deal of attention and is often disregarded and undervalued in people with autism spectrum disorder (ASD) who present with abnormalities in communication, socialization, and restricted-repetitive behavioral patterns. Such difficulties, occurring in children from their earliest years of life and in different ways, are classified according to the severity of symptoms and are often associated with intellectual disability (ID). Moreover, these conditions may be associated with varying degrees of cognitive disability . People In a recent systematic review, Ismail et al. analyzed four studies assessing the effectiveness of SADE on children with special needs who received dental treatment. The studies analyzed showed that children with special needs treated in SADE make significant improvements in terms of physiological changes, behavior, pain, and sensory discomfort .In light of the aforementioned studies, the aim of the present study was to assess the efficacy for a sensory-adapted environment and targeted methods in reducing anxiety and positively influencing children with ASD to cooperate during a dental examination or specific treatments. Undergoing dental treatment is a challenge for children\u2019s self-control and self-modulation skills. Children with ASD also adapt with greater difficulty to a normal dental setting because of their sensory anomalies. Hypo and hypersensitivity and the difficulty in discriminating between different sensorial channels can worsen the stress and anxiety perceived by ASD children when visiting a dentist, thus leading inevitably to a poor final outcome in the dental procedure. Therefore, the purpose of this study was to check whether a sensory-adapted dental environment may increase the percentage of ASD patients successfully treated for their class-1 caries.The study was approved by the local Ethical Committee of the Oasi Research Institute\u2013IRCCS in Troina, Italy (CE17/06/2013 OASI). Written informed consent was obtained from the participants. The subjects were recruited among 55 patients referred to diagnostic and rehabilitation services at the Oasi Research Institute\u2013IRCCS , a research institute dealing with treatment and rehabilitation in the field of intellectual disabilities.The inclusion criteria were: (a) a stable diagnosis of ASD made by expert qualified psychologists  followinExclusion criteria were: (a) patients with one permanent tooth with class-I caries or no permanent teeth with caries.Starting from 55 patients initially recruited, the sample was reduced to 50 patients because five of them had only one decayed tooth (exclusion criterion). Indeed, according to the study design, all patients should present with at least two decayed permanent teeth. In a first phase, they were brought to the RDE in order to try and treat one decayed permanent tooth and, subsequently, all patients were led to SADE to treat the second decayed permanent tooth. If we had recruited patients with only one decayed tooth, we would not have had the possibility in the second phase to be able to cure the second decayed tooth.-A regular dental environment (RDE);-A sensory-adapted dental environment (SADE).In our study, we used two different dental environments:The same dentist, with 20 years\u2019 experience in the treatment of children with ASD, treated the two permanent teeth with class-I caries in the different dental environments. The two different dental environments are located in the Odontostomatology Unit of Oasi Research Institute\u2013IRCCS in Troina.In contrast to the RDE, the SADE was provided with a screen to project movies, cartoons, or advertisements , soft lighting, and a sponge-coated dental turbine drill to minimize the noise. Firstly, all patients were treated in the RDE and, after two months, dental interventions were performed in the SADE.In the first phase in the RDE, the patient was seated on the dental chair and through the dental turbine, the class-1 cavity was removed and the filling was made with glass ionomer restorative material.In the second phase, the patient was transferred to the SADE with soft lighting. The patient was then seated on the dental chair while a screen projected movies, cartoons, or advertisements . By using a sponge-coated dental turbine drill to minimize the noise, the class-1 cavity was removed and, once removed, the resulting cavity was filled with glass ionomer restorative material .The dental treatments for 50 patients were scheduled one per day; therefore, the average time elapsed between the RDE and the SADE treatment was about two months.The study was carried out between January 2014 and April 2014. According to our a priori hypotheses, the adapted setting would have led to better results.N for a 2 \u00d7 2 chi-squared table is less than about 40, the Yates continuity correction was used. P values less than 0.05 were considered to be statistically significant. The statistical appropriateness of the chi-squared tests used in this study was assessed \u201ca posteriori\u201d by first calculating the effect size and then calculating the corresponding sample size required with \u03b1 = 0.05, resulting in an actual power of 98% and a required sample size of 45 for the 2 \u00d7 2 matrix.The experimental design evaluated the differences between \u201cbefore\u201d and \u201cafter\u201d by using a 2 \u00d7 2 contingency table McNemartest . Since the total The final sample for the study consisted of 50 patients , each with two permanent teeth with class 1-caries. All subjects received a stable diagnosis of ASD by expert qualified psychologists according to the DSM-5 criteria and after administration of C.A.R.S., ADOS, and ADI-R; moreover, they presented with mild ID (IQ ranging from 50 to 70) and verbal language skills in the absence of concomitant psychiatric and neurological pathologies.In the first phase of the study, all patients of the sample were taken in RDE. In this phase, 11 patients  were positively treated for class-1 caries of a permanent tooth; in the remaining 39 patients , this was not possible. In the second phase, the entire sample were led to SADE. During the SADE phase, 34 patients  were positively treated for class-1 caries of the second permanent tooth, while in 16 patients  it was not possible to treat the class-1 caries. . Furtherp-value < 0.0001). The duration of each treatment was not detected.Difference between the two groups (RDE vs. SADE) is statistically significant at the 0.05 level  and not for female patients .Statistical analyses were conducted to understand the statistical significance between RDE and SADE in females and males respectively. The results show a statistical significance for male patients  the sample examined was small and consisted mainly of males, (b) there was no control sample of children with typical development, (c) the evaluation in the effectiveness of the dental treatment was left exclusively to the dentist\u2019s judgment.Moreover, all children in the sample were brought to a traditional dental environment to try and treat the class-1 caries, and at a later time they were brought to a sensory-adapted dental environment; therefore, in the second phase of the study, ASD children had already experienced the dental environment. This first phase, even if performed in a regular dental environment, may have favored a better compliance during the second experience regardless of the environment used. However, we believe that ASD individuals tend to crave sameness, thus a single experience is not enough to produce relevant habituation phenomena.Consistent with previous literature findings, the results from our study highlight that an adapted environment positively affects the therapeutic dental treatment performed on patients with ASD. Interestingly, the use of a SADE leads to significant successful treatment of caries in patients with ASD.For many children with ASD, dental care represents one of the main stressors, so parents tend to avoid dental examinations for their children, thus causing irreversible and irreparable damages over time.In a randomized crossover study performed by Cermak et al., 22 children with ASD and 22 typically developing children received two dental cleanings. One treatment was carried out in an RDE and the other was carried out in a SADE. Their results were similar to our study, showing positive benefits from interventions carried out in an adapted environment and patients, families, dentists, clinic staff, and investigators positively responded to the SADE experience .Watching a video serves as a distractor to efficiently reduce the anxiety associated with a non-collaborative behavior presented by a child with ASD. The use of soft lighting in a sensory-adapted environment minimizes the disruption from visual overstimulation ,19,20. TIn this context, it is important to also emphasize the role of the waiting room. A sensory-adapted waiting room environment seems to be less important in reducing the anxiety in typically developing children compared to other parameters, such as longer waiting time prior to treatment and visit purpose .Similarly, an appropriate design of dental waiting areas improves the waiting experience and reduces the preoperative anxiety before a dental appointment. For instance, the majority of children prefer waiting in a room with natural light, walls with pictures or posters, looking at an aquarium or watching television, listening to music, and the possibility to play ,25.Consistent with this evidence, at Oasi Research Institute, we chose not to keep children with ASD waiting in a traditional waiting room, but let them wait their turn in the playroom or in recreational spaces.Our results, in line with evidence in the scientific literature, suggest that a sensory-adapted environment positively affects the therapeutic dental treatment in male patients with ASD and reaffirm that sensory dysregulation in children with ASD is a crucial factor influencing the successful outcome in oral care. Future research studies, as well as the development and implementation of further environmental changes, are needed to obtain successful dental treatments for people with ASD with the aim of providing an experience with a greater perception of comfort, a strength in this particular population.Although parents of children with ASD tend to consider oral health less important than the primary disease, more attention is required for their oral healthcare through targeted approaches to improve the wellbeing of individuals and their families."}
{"text": "ABSTRACT IMPACT: Our findings could potentially identify CVD at-risk persons living with HIV who might benefit from aggressive risk-reduction. OBJECTIVES/GOALS: PWH have higher rates of CVD than the general population yet CVD risk prediction models rely on traditional risk factors and fail to capture the heterogeneity of CVD risk in PWH. Here we identify protein biomarkers that are able to discriminate between CVD cases and controls in PWH, and we assess their added benefit beyond traditional risk factors. METHODS/STUDY POPULATION: We analyzed 459 baseline protein expression levels from five OLINK panels in a matched CVD  case-control study with 390 PWH from INSIGHT trials . We formed 200 datasets via bootstrap. For each bootstrap set, a two-component partial least squares discriminant model (PLSDA) was fit. The importance of each variable in the discrimination of cases and controls in the PLSDA projection was assessed by the variable importance in projection (VIP) score. Proteins with average VIP scores > 1 were used in penalized logistic regression models with elastic net penalty, and proteins were ranked based on the number of times the protein had a nonzero coefficient. Proteins in the top 25th percentile were considered to have high discrimination. RESULTS/ANTICIPATED RESULTS: Participants had mean age 47 years, 13% were females, 4.9% had CVD at baseline and 69% were on ART at baseline. Eight proteins including the hepatocyte growth factor and interleukin-6 were identified as able to distinguish between CVD cases and controls within PWH. A protein score (PS) of the top-ranked proteins was developed using the bootstrap (for weights) and the entire data. The PS was found to be predictive of CVD independent of established CVD and HIV factors (Odds ratio: 2.17 CI: 1.58-2.99). A model with the PS and traditional risk factors had a 5.9% improvement in AUC over the baseline model (AUC=0.731 vs 0.69), which is an increase in model predictive power of 18%. Individuals with a PS above the median score were 3.1 (CI: 1.83- 5.41) times more likely to develop CVD than those with a protein score below the median score. DISCUSSION/SIGNIFICANCE OF FINDINGS: A protein score developed improved discrimination of PWH with CVD and those without, and helped identify PWH with high risk for developing CVD. If validated, this score and/or the individual proteins could be used in addition with established factors to identify CVD at-risk individuals who might benefit from aggressive risk-reduction."}
{"text": "Computational modeling is an essential component of modern drug discovery. One of its most important applications is to select promising drug candidates for pharmacologically relevant target proteins. Because of continuing advances in structural biology, putative binding sites for small organic molecules are being discovered in numerous proteins linked to various diseases. These valuable data offer new opportunities to build efficient computational models predicting binding molecules for target sites through the application of data mining and machine learning. In particular, deep neural networks are powerful techniques capable of learning from complex data in order to make informed drug binding predictions. In this communication, we describe Pocket2Drug, a deep graph neural network model to predict binding molecules for a given a ligand binding site. This approach first learns the conditional probability distribution of small molecules from a large dataset of pocket structures with supervised training, followed by the sampling of drug candidates from the trained model. Comprehensive benchmarking simulations show that using Pocket2Drug significantly improves the chances of finding molecules binding to target pockets compared to traditional drug selection procedures. Specifically, known binders are generated for as many as 80.5% of targets present in the testing set consisting of dissimilar data from that used to train the deep graph neural network model. Overall, Pocket2Drug is a promising computational approach to inform the discovery of novel biopharmaceuticals. Recent developments in genomics revealed novel disease-related molecular targets, many of which are yet to be characterized with respect to the possibility of modulating their functions with pharmaceutical agents. Another challenge in pharmacotherapy arises from resistance effects to existing drugs complicating the treatment of particularly infectious diseases  and cancTo make the drug discovery process more efficient, modern approaches incorporate miscellaneous computational components. Virtual screening (VS) is perhaps the most widely used strategy to help identify potentially bioactive molecules from large collections of commercially available as well as virtual compounds . Despitede novo drug discovery, where RNNs were trained to model the probability distribution of a drug dataset (Deep learning (DL) is a family of modern machine leaning models utilizing deep neural networks (DNNs). DL models have been demonstrated to be powerful feature extractors for ligand binding site classifiers  and metrge model , the pro dataset . These m(SMILES) , where iIn order to achieve this goal, we developed Pocket2Drug, a new deep generative model with the encoder-decoder architecture. Inspired by the framework of image captioning models taking images as the input to generate corresponding captions , the basPocket2Drug has a similar encoder-decoder architecture consisting of an encoder to extract features and a decoder to generate molecules. Nonetheless, Pocket2Drug differs from typical image captioning models in that it employs a graph representation of drug binding sites instead of images. Consequently, a GNN is employed as the encoder to extract the prior information from input pockets followed by an RNN decoder to generate molecule strings, which are the equivalents of image captions. In comprehensive benchmarking simulations against ligand-bound, ligand-free, and low-homology datasets of binding sites, we show that Pocket2Drug employing the encoder-decoder DNN effectively predicts binding drugs for input pocket structures.eFindSite   was usedBinding pockets are represented as graphs, in which nodes are non-hydrogen atoms and edges connect pairs of atoms spatially located within 4.5\u00a0\u00c5 from one another . Node fePocket2Drug is implemented in PyTorch v1.7.1  and emplThe GNN encoder extracts latent features from the input pocket graphs. We use the embedding network implemented in the GraphSite classifier as the feature extractor with the last fully connected layer removed and the remaining parts of the classifier employed as the feature extractor. The message passing function utilizes weighted neighbor node features, in which weights are generated by a two-layer, fully connected neural network taking edge features as the input. Updated node features in -network . The JK--network  to constAs a decoder, we use the gated recurrent unit (GRU), which is a variation of the vanilla RNN . The decDashed arrows in de novo drug design applications to learn the distribution of a drug dataset , another molecule tokenization scheme designed for machine learning applications . The SELPocket2Drug was trained on the Pocket2Drug-train dataset and validated against Pocket2Drug-holo, -apo, and -lowhomol datasets. We first analyze the size of molecules generated for the Pocket2Drug-holo dataset. de novo drug design.Next, the quality of molecules generated for the Pocket2Drug-holo dataset is evaluated using two complementing protocols, one based on the chemical similarity of binding molecules  and anotThe performance of Pocket2Drug, ZINC, and vanilla RNN are evaluated with the TC between the generated molecules and label ligands. For each pocket in the Pocket2Drug-holo dataset, TC values are calculated for a specified number of molecules sampled from the model output and the highest TC is selected as the final score. Next, the performance of Pocket2Drug is assessed against the Pocket2Drug-apo dataset. The mean root-mean-square deviation (RMSD)  of liganWe also evaluate the ability of Pocket2Drug to generalize to unseen data by measuring its performance against the Pocket2Drug-lowhomol dataset. As reported in d-allose binding protein (ALBP) from E. coli. MSK1 is involved in the regulation of mitogen activated kinases and it is required by the tumor-promoter-induced neoplastic cell transformation  and a sugar binding site in ormation . The comormation  was chosormation . Figure ormation , the dif2 in adenine, 3\u2032 OH in pentose sugar, OH in \u00df-phosphate, NH linking \u00df- and \u03b3-phosphates and OH in \u03b3-phosphate in the complex crystal structure  transporter family facilitating the import and export of various molecules across the cell membrane  of 22\u00a0nm (Kd) of 100\u00a0nm (PDB-ID: 4nct)  . Figure D: 4nct) .Kd of 0.37\u00a0nm and has been tested for its anti-proliferative activity in the SF-268 cell line. It inhibits the viability of EphA2 growth dependent glioblastoma cells with a half-maximal effective concentration (EC50) of 5\u00a0\u03bcm (The second example is the human angiopoietin-1 receptor (Tie-2), an enzyme involved in vessel remodeling, branching, stability, and maturation . Using t of 5\u00a0\u03bcm . Despite of 5\u00a0\u03bcm . Docking of 5\u00a0\u03bcm .viz. those pockets extracted from proteins that are different from training instances. These findings are particularly important in drug discovery against novel protein structures, where it can help significantly reduce the search space of drug candidates. In contrast to traditional virtual screening typically employing a library of 200,000 to over 1,000,000 molecules , utilizing the RNN with the prior information , to the An attention mechanism was shown to significantly improve the performance of image captioning because it helps the model capture more semantically meaningful parts of images . We expe"}
{"text": "Background: Carboplatin, the key drug used in treating gynaecological cancer, has an approximately 12\u201316% risk of hypersensitivity reactions. We aimed to investigate the efficacy and adverse effects of carboplatin desensitisation therapy for gynaecological cancer. Methods: The desensitisation protocol was standardised as a four-step, 4-h, carboplatin administration in the hospital. A retrospective medical record review was conducted on 15 patients who underwent carboplatin desensitisation for gynaecological malignancies at our hospital. Patients\u2019 data were analysed to evaluate the treatment success rate, therapeutic effect of desensitisation, adverse events, and treatment. Results: Of 91 carboplatin desensitisation cycles scheduled; the completion rate was 93.4% (85/91). Adverse events occurred in 23 of these 91 (25.3%). In four (4.4%) of the 23 cycles, hypersensitivity reactions could be treated only by discontinuing the infusion and slowing the administration, while in the remaining 19 (20.9%), medication was administered intravenously after discontinuing the infusion to manage hypersensitivity reactions. No treatment-related deaths occurred. Overall, 23 series of anti-cancer agent regimens, including carboplatin desensitisation, were administered to the 15 patients. The therapeutic response rate was 82.6% and the disease control rate was 95.7%. Conclusions: Carboplatin desensitisation was beneficial in patients with a history of carboplatin-induced hypersensitivity reactions. Platinum agents are some of the most effective drugs for the treatment of gynaecological malignancies including ovarian, cervical, and endometrial cancers. Carboplatin, one of the platinum agents, is used most frequently. Compared to cisplatin, carboplatin demonstrates the same therapeutic efficacy with fewer adverse events  ,2. PlatiThe clinical symptoms of platinum HSRs range from mild to severe and death can also occur ,12,13. MHSRs to key drugs are problematic in some cases because of the lack of alternative therapies. Management options include enhanced premedication with antihistamines and corticosteroids, the discontinuation of carboplatin and switching to another drug, and carboplatin desensitisation (CD).The goal of desensitisation is for patients to react less strongly to chemotherapeutic agents. In some reports, CD was successful in patients who experienced platinum-related HSRs ,19,20,21The purpose of this study was to summarise the clinical features, toxicity, and effects of CD therapy on therapeutic efficacy, and outline possible appropriate prophylaxis and management strategies for treating the adverse events.We retrospectively evaluated the experience of CD in patients with gynaecological malignancies who experienced HSRs with previous chemotherapy. Our study was conducted at a teaching hospital attached to a university medical school, a general hospital with approximately 900 beds. This study was approved by the Institutional Review Board of Nippon Medical School (No. 30-01-1067). We reviewed all patients who underwent CD between January 2015 and December 2019. In this retrospective review study, only patients who underwent CD following careful consultation were included. That is, among all gynaecological cancer patients, only those who had developed HSRs because of carboplatin administration and who consented to the risk of undergoing desensitisation were included. Patients who developed HSRs to carboplatin and who consented to CD but for whom detailed information on HSRs was not available, and patients who had not completed an anti-cancer agent treatment cycle, including CD at our hospital, were excluded. Due to the nature of the disease, all subjects were female. Initial HSR symptoms varied and included, cutaneous symptoms ; respiratory symptoms ; cardiovascular symptoms ; gastrointestinal symptoms ; and atypical symptoms (limb dysesthesia and discomfort). Patients with adverse events associated with carboplatin administration were examined by oncologists. If the oncologist determined that their symptoms were carboplatin-induced HSRs, they were offered treatment alternatives, including CD therapy, another anti-cancer agent therapy, or best supportive care only. All patients understood the risks, including death, as well as the benefits of re-medication from the description of CD therapy, and they signed written informed consent for desensitization therapy. Consent to use the participants\u2019 clinical information was obtained in writing and consent limited to this study was obtained by an opt-out method. After applying the inclusion and exclusion criteria, 15 patients with gynaecological malignancies  subsequently opted for CD at our hospital. None of the patients underwent treatment after developing HSRs at another hospital or underwent an intradermal reaction test for carboplatin.The desensitisation protocol followed at our institution was standardised as a four-step, 4-h, carboplatin administration based on the report by Takase et al.  That is,Under this desensitisation protocol, four different dilutions of carboplatin solutions were administered to patients over 1 h each. The total dose of carboplatin (AUC5-6 according to the regimen) was calculated using the Calvert formula. First, the total dose of carboplatin was dissolved in 250 mL of 5% glucose. Next, 25 mL of the solution were removed from the first solution and diluted with 225 mL of 5% glucose to obtain the second solution. This operation was repeated in sequence to prepare 1/10, 1/100, and 1/1000 diluted solutions. In other words, 250 mL of 0.1% solution, 225 mL of 1% solution, 225 mL of 10% solution, and 225 mL of 100% solution were prepared. Each solution was infused over 1 h, and all infusions were completed over 4 h. Prior to desensitisation, all patients were intravenously treated with glucocorticoids (dexamethasone 19.8 mg), H2 antagonists (famotidine 20 mg), H1 antagonists (chlorpheniramine 5 mg), and 5-HT3 antagonists  .If HSRs re-emerged during desensitisation, carboplatin administration was immediately discontinued, and the patient was examined by the attending doctor. After confirming the improvement of the symptoms, the patient was allowed to resume the treatment 30 min later. When the administration was resumed, it was re-initiated at half the infusion rate at the time of discontinuation, and if no abnormalities were observed for 30 min, the infusion rate was restored to the original rate. If a mild reaction occurred, careful observation of the symptoms was performed without medication. When a moderate reaction occurred, an H1 antagonist (chlorpheniramine 5 mg), an H2 antagonist (famotidine 20 mg), and glucocorticoid (hydrocortisone 100 mg or methylprednisolone 125 mg) were administered intravenously. In addition, a phosphodiesterase inhibitor (aminophylline 250 mg) was used to treat respiratory symptoms. For severe reactions or anaphylaxis, an additional 0.3 mg of adrenaline was administered in addition to the glucocorticoid. The gynaecological oncologist in charge decided whether to continue or discontinue the desensitisation depending on the symptoms of CHRs. If treatment continuation was an option, the patient was verbally consulted, and consent obtained. Even if the doctor-in-charge determined that continuous administration was possible, the administration was discontinued according to the patient wishes. Desensitisation was discontinued in all cases of severe hypersensitivity and anaphylaxis.The clinical-stage was evaluated based on the staging criteria of the International Federation of Gynaecology and Obstetrics. Therapeutic effects were evaluated according to the Revised Response Evaluation Criteria in Solid Tumours guidelines (version 1.1) . AdverseThe primary endpoint was the success rate of CD administration, which was calculated as the percentage of patients who completed all planned CDs among all patients and the percentage of completed CD cycles among the total CD cycles. The secondary endpoint was the response rate of the anti-cancer agent therapy, including CD. The treatment response rate was calculated as the percentage of consecutive treatments in which tumour shrinkage was observed in all consecutive treatments, including CD. An analysis using descriptive statistics was performed. The survey results were described and evaluated in terms of range, median, percentage, and so forth.2 . The initial HSR grades ranged from 1 to 3 .Patient characteristics are shown in n = 20), paclitaxel + carboplatin + bevacizumab (n = 30), docetaxel + carboplatin (n = 6), docetaxel + carboplatin + bevacizumab (n = 8), gemcitabine + carboplatin (n = 19), and gemcitabine + carboplatin + bevacizumab (n = 8).The chemotherapy regimens used for desensitisation were paclitaxel + carboplatin  were completed without adverse events. In 23 (25.3%) of the CD treatments, patients developed some CHRs, but symptoms were relieved by a temporary suspension of administration or additional medication; among those, 17 CD cycles were completed as planned. As a result, 85 CD cycles (93.4%) were completed as originally planned.Seven patients (46.7%) did not develop CHRs. Eight patients (53.3%) developed CHRs during the CD. Among them, three patients (20.0%) completed the scheduled treatment with only temporary interruptions or some changes in medication, while five patients (33.3%) discontinued the CD after consulting with their doctor. Treatment was not discontinued due to adverse events other than CHR or tumour exacerbation during the course of the treatment.After completing the series of regimens including CD, the therapeutic effect was determined by comparing tumour image measurements before and after treatment. A total of 23 series of anti-cancer agent regimens, including CD, were administered to the 15 patients. Results were evaluated according to the Response Evaluation Criteria in Solid Tumours (version 1.1) as complete response (CR) 15 series, partial response (PR) 4 series, stable disease (SD) 3 series, and progressive disease (PD) 1 series. The response rate [(CR + PR)/(CR + PR + SD + PD)] was 82.6%, and the disease control rate [(CR + PR + SD)/(CR + PR + SD + PD)] was 95.7%. The average platinum-free interval before the start of the anti-cancer treatment series, including the CD regimen, was 17.8 months  in 22 series, excluding one series of adjuvant therapy. Comparing the median platinum-free interval by treatment result, 14 series of CR was 19.5 (6\u201333) months, 4 series of PR was 14.5 (10\u201329) months, 3 series of SD was 10.0 (7\u201312) months, and 1 series of PD was 24 months.Adverse events were observed in 23 of the 91 total CD cycles (25.3%). In 4 (4.4%) of these cycles, CHRs could be treated only by discontinuing the infusion and slowing down the administration. In the remaining 19 cycles (20.9%), medication was administered intravenously after the discontinuation of the infusion to manage CHRs.Cutaneous adverse events were most common. Skin rash and itching were observed in seven patients; they were alleviated by discontinuation of CD or administration of additional drugs (grade 1 or grade 3). The next most commonly observed adverse events were those affecting the gastrointestinal system, such as stomach-aches and diarrhoea. Two patients developed symptoms and were treated with CD discontinuation and administration of H1 or H2 blockers (grade 1 or grade 3). One patient experienced grade 3 anaphylaxis (hypotension) but recovered quickly after discontinuing the carboplatin infusion, without requiring adrenaline and with no sequelae. Another patient experienced grade 3 anaphylaxis (bronchospasm and hypoxia) but quickly recovered with the addition of medications containing adrenaline. No treatment-related deaths occurred.We reported that carboplatin could be re-administered to patients who experienced CHRs, using the CD protocol. The therapeutic effect was satisfactory, and the recurrence of adverse events was in an acceptable range. This result is of great importance for patients; it stresses that prolonging their lives through additional carboplatin is feasible.Platinum agents, such as carboplatin, are essential for the treatment of gynaecological malignancies, especially ovarian cancer. However, multiple doses of carboplatin can cause HSRs, and abandoning subsequent platinum administration and switching to platinum-free anti-cancer therapy is of great detriment to a patient\u2019s prognosis. CHRs usually appear in 8\u201319% of patients receiving repeated doses of six cycles or more (eight times on average) . CHRs arPreviously, unsuccessful attempts to re-administer the drug that caused HSR using premedication alone have been reported . On the In this study, we adopted a four-step, 4-h CD protocol in the hospital. The advantages of this protocol include its simplicity, short infusion times, and acceptable HSR rates . The CD The majority of our patient cohort completed the CD without experiencing serious adverse events. In our study, HSRs occurred in 25.3% of the CD cycles, which is close to the incidence of 25.0% reported in the largest desensitisation study by Altwerger et al. . OverallReviewing our results, discontinuation of CD was limited to 6 CD cycles, with 93.4% of cycles ending successfully. However, five patients did not complete the targeted number of CD cycles. Of the five dropouts, three were discontinued at the patient\u2019s request. Strict adherence to our protocol rules meant that two patients failed CD, for a success rate of 86.7%. These two patients had initial CHRs with respiratory and circulatory symptoms and were at risk of developing severe adverse events during CD. As mentioned previously, we speculate that more stringent eligibility criteria for CD and exclusion of these two patients would have resulted in a higher success rate of desensitization, consistent with that reported by Li et al. .The discontinuation criteria in this study were not clear, and the decision to discontinue the CD depended on the judgment of the attending doctor, which could obscure the results of the analysis. In our study, two patients with CHR that affected their hemodynamic status and respiratory function discontinued CD and did not resume the subsequent CD cycle because of the strong expectation of more serious life-threatening adverse events. On the other hand, the three patients with milder symptoms also discontinued the subsequent CD cycle after consulting with their doctors, considering that the purpose of treatment for recurrent cancer was not curative. Lee et al. and Castells et al. allowed resumption of subsequent CD, even in patients who required adrenaline, corticosteroids, or oxygen, but Takase et al. did not ,19,22. TApart from the ambiguity of patient eligibility criteria and treatment discontinuation criteria mentioned above, the limitations of our study are its small sample size and retrospective nature. Because this was a retrospective study, patient characteristics were uncontrolled and varied in disease, stage, and the number of treatments. Therefore, in the future, it will be necessary to carefully consider the adaptation and discontinuation criteria, develop and comply with a protocol with unified standards, and conduct a large-scale investigation. In addition, the fact that male patients are not included in this study limited to gynaecologic cancers, will limit the versatility of this protocol. Although there are successful reports of CD on other types of cancer patients, that included males, using a protocol similar to ours, the findings derived from our study are limited to females ,42. As aIn conclusion, our findings suggest that CD is a good option for patients with a history of platinum-sensitive gynaecological cancer and CHR. CD carries some risk, but strict adaptation and discontinuation criteria may contribute to risk reduction. In addition, our improved protocol, which secures a day dedicated to carboplatin administration only, and which strictly regulates a slow administration, as a re-administration method after CHR, made it possible to administer CD more safely than the conventional protocols."}
{"text": "Maximum safe resection followed by chemoradiotherapy as current standard of care for WHO grade III and IV gliomas can be influenced by the occurrence of perioperative adverse events (AE). The aim of this study was to determine the association of AE with the timing and choice of subsequent treatments as well as with overall survival (OS).Prospectively collected data of 283 adult patients undergoing surgery for WHO grade III and IV gliomas at the University Hospital Zurich between January 2013 and June 2017 were analyzed. We assessed basic patient characteristics, KPS, extent of resection, and WHO grade, and we classified AE as well as modality, timing of subsequent treatment , and OS.In 117 patients (41%), an AE was documented between surgery and the 3-month follow-up. There was a significant association of AE with an increased time to initiation of subsequent therapy (p = 0.005) and a higher rate of interruption (p < 0.001) or non-initiation (p < 0.001). AE grades correlated with time to initiation of subsequent therapy (p = 0.038). AEs were associated with shorter OS in univariate analysis (p < 0.001).AEs are associated with delayed and/or altered subsequent therapy and can therefore limit OS. These data emphasize the importance of safety within the maximum-safe-resection concept. The current standard treatment for WHO grade III and IV gliomas is maximum safe resection followed by radiotherapy plus/minus concomitant and maintenance alkylating-based chemotherapy . PeriopeAE are considered to affect the course of further therapy and might lead to non-initiation, interruption, or delay of subsequent therapy and eventually to worse overall survival (OS) , 7. HoweHere, we analyzed the association between perioperative AE and both the timing of subsequent therapy as well as OS.We prospectively collected data from the patient registry of the Department of Neurosurgery at the University Hospital Zurich . We screAll included patients underwent initial neurosurgical intervention for WHO grade III or IV glioma. The extent of resection (EOR) varied between biopsy-only, partial resection <98%, and gross total resection \u226598%. The protocol of subsequent therapy during the study period was based on the EANO guideline from 2014 . The staParameters extracted from the patient registry were age, sex, functional state, EOR, WHO grade, length of hospital stay (LOS), procedure and timing of subsequent therapy, any delay or interruption or non-initiation of the subsequent therapy protocol, the occurrence of AE, and OS. The patients\u2019 functional state was quantified using the Karnofsky Performance Status (KPS). A worsened functional state was defined as a decrease in the KPS 3 months postoperatively compared to the preoperative KPS. EOR was assessed by three-dimensional volume measurements of pre- and <72\u00a0h postoperative MRI scans using Smartbrush application of Brainlab Elements, Brainlab AG Munich. In case of lacking MRI data, EOR was not further evaluated.Perioperative AE with its corresponding clinical diagnosis were assessed using the Clavien\u2013Dindo Grade (CDG) classification and graded accordingly Table\u00a01 We defined the variable \u201caltered subsequent therapy\u201d as the occurrence of either a delay, interruption, or non-initiation of the subsequent therapy. The time to initiation of subsequent therapy was defined as duration between the intervention and the beginning of subsequent therapy. A delay in subsequent therapy was defined as a duration of >42 days until initiation. Any interruptions of therapy were additionally registered and defined as any break in the protocol of subsequent therapy. The non-initiation of subsequent therapy was defined as the absence of subsequent chemo- and radiotherapy.OS was defined as the time from surgery until death or the last date when the patient was known to be alive.2 tests, correlations using Spearman correlation tests, OS using Kaplan\u2013Meier and log-rank tests, and multivariate analysis using Cox\u2019s proportional hazard model. Hazard ratios (HR) are given with 95% confidence intervals (CI).The patient registry is based on FileMaker Pro version 13.0. For statistical analysis, IBM SPSS Statistics v24 and MATLAB R2019a were used. A p-value of \u22640.05 was considered statistically significant. Continuous data were analyzed with two-tailed Mann\u2013Whitney U tests and Student\u2019s t-tests and categorical data with two-sided Pearson \u03c7The local ethics committee  approved prospective data collection in the patient registry and waived patient consent due to the observational nature of the study (PB-2017-00093). The study was registered at clinicaltrials.gov (NCT01628406).Two hundred eighty-three patients were included in our study. The main clinical characteristics and outcome data of the study group stratified for AE are depicted in The mean time to initiation was significantly higher for patients with AE prior to therapy  and correlated significantly with the grade of AE  with a slope of -9.5 KPS points per increment of CDG in the linear fit Figure\u00a02OS for patients with AE was shorter  . There was a trend toward shorter OS in patients with AE with HR = 1.32 (CI 0.96\u20131.77), although this did not reach statistical significance (p = 0.063). Altered subsequent therapy had a stronger and significant association with shorter OS  Table\u00a03.There is only scarce information about the frequency and the exact clinical repercussions of AE in glioma surgery. The risk of AE in the resection of WHO grade III and IV glioma is relatively high due to the difficult balancing between a maximal tumor resection and new postoperative neurological deficits and other AE . TherefoThe impact of timing of subsequent therapy on OS is still unclear. Nevertheless, different studies indicate that a delay of >42 days should be avoided \u201312. We oRegarding OS, patients with AE had significantly decreased median survival in a univariate analysis in line with findings of previous studies , 7. In aAs a retrospective analysis of prospectively collected data, our study is subjected to the general limitations of retrospective studies. Still, our outcome data was collected prospectively and modified retrospectively only in case of incompleteness, which minimized the risk of information bias. It has to be taken into account that some patients already started subsequent therapy within the 3-month period in which AE were measured. Thus, it cannot be excluded that some of the AE might also be due to subsequent therapy and are not related to surgery. Although the majority of AE occurred in close temporal proximity to the surgical intervention and measured AE are almost exclusively logically attributed to surgery rather than subsequent therapy, this limitation has to be considered. Furthermore, one must keep in mind that the lower patient age and better KPS preoperatively for patients without an AE as well as molecular tumor markers play a major role in prognosis and OS in high-grade glioma patients and can therefore interfere with our results, which poses another source of limitation for our study.Future projects should incorporate the new 2021 WHO classification of brain tumors and should also reflect measurements for AE severity such as the Therapy\u2013Disability\u2013Neurology Grading as well as measures for the presurgical factors such as initial patient status or the complexity of the tumor surgery such as the Milan Complexity Score .In conclusion, our results support the hypothesis that AE reduce the rate of successful and uninterrupted chemoradiotherapy and ultimately limit OS. While this association seems intuitively true, our study now supports it with data from a large patient cohort. In the sensitive balancing act between maximal resection and postoperative neurological function, our study quantifies the risk of causing AE and by that a possible impairment of the course of subsequent therapy and OS. Therefore, these findings have implications in risk stratification and quality management of WHO grade III and IV glioma surgery.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.This study was reviewed and approved by Kantonale Ethikkommission Z\u00fcrich, Stampfenbachstrasse 121, 8090 Z\u00fcrich, Switzerland. The ethics committee waived the requirement of written informed consent for participation due to the observational nature of the study.Study design: LW, JS, MN. Data acquisition: LW, TM, JV, FV, SV, LP, JS, MN. Statistical analysis: LW, LP. Interpretation: all authors. Writing of original draft: LW, L P. Review and revision: all authors. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "N\u2009=\u200928) and after  the addition of the balcony. Locomotor and morphological differences were compared after a mild-moderate T9 spinal cord contusion injury in wild-type mice. Post-injury assessments of locomotor function for 6 weeks included Basso Mouse Scale (BMS) and treadmill kinematic assessments (week 6). Balcony-housed mice showed greater improvements not only in basic locomotor functions  compared to those in standard housing, but also surpassed mice in standard housing without the balcony in higher-order locomotor recovery outcomes, including BMS late-stage recovery measures . Additionally, balcony-housed mice had overall higher BMS scores, consistently attained more BMS subscores, and had better treadmill track width and stride length compared to those with no balcony. The housing enhancement of a balcony led to unforeseen consequences and unexpected higher recovery outcomes compared to mice in standard housing. This retrospective study highlights the importance of housing conditions in the key outcomes of locomotor recovery after incomplete contusive SCIs in mice.It is well established that both positive and negative housing conditions of laboratory animals can affect behavioral, biochemical, and physiological responses. Housing enhancements have been shown to have beneficial effects on locomotor outcomes in rodents with spinal cord injury (SCI). Subsequent to an unplanned housing enhancement of the addition of a balcony to home cages by animal care personnel at a research facility, a retrospective analysis of multiple SCI studies was performed to determine whether outcomes differed before (four studies,  However, unanticipated events can result in unintentional effects on recovery outcomes.4\u20136A variety of rehabilitative methods have been used to promote functional locomotor recovery after spinal cord injury (SCI) in the rodent model, including activity, exercise, and step training with treadmill walking.During a series of SCI research experiments at a research facility, the standard housing conditions of the laboratory animals were altered by the animal care facility, inadvertently changing the housing conditions of subsequent experiments compared to earlier identical studies. A balcony was added to the home cage of uninjured and mid-thoracic SCI mice to enhance well-being. After multiple experiments, it appeared that mice in the home cage with the balcony had better locomotor recovery post-injury compared to mice that had been housed in standard cages.8 Studies using environmental enrichment that include in-cage enhancements by inserting objects to encourage activities, such as tunneling, incline walking, and climbing behaviors, have shown improvements in locomotor recovery.10 Moreover, there is evidence that acute spontaneous effects referred to as \u201cself-training\u201d or \u201cin-cage training\u201d can have positive results on functional recovery.11\u201313 Housing enhancements as well as spontaneous self-training can unintentionally influence experimental research outcomes as a result of increased activity.5 Other environmentally related housing factors, including housing density, cage size, and design, can lead to experimental outcome variability and affect scientific validity.6 The following retrospective analysis was undertaken to determine whether an unintended housing enhancement during a series of SCI research experiments resulted in unexpected enhanced locomotor recovery in mild-moderate SCI in mice.It is well established that the well-being of laboratory animals, as well as their behavioral, biochemical, and physiological responses, can be affected by housing conditions.N\u2009=\u200911, B: N\u2009=\u20095, C: N\u2009=\u20092, and D: N\u2009=\u200910; total\u2009=\u200928) with four studies where a balcony was added to the home cage . These eight experiments included four published14 and four yet-to-be published studies.A retrospective analysis was performed to compare four studies where mice were housed in standard cages  mice . Mice read libitum. In four experiments, a balcony was inserted in their home cages (7 in length\u2009\u00d7\u20095 in weight\u2009\u00d7\u20092\u00be in depth) with easy accessibility for climbing (Mice were group housed in standard cages (3\u20135 per cage) for 6 weeks post-injury. Food and water were available climbing  through 18 All components of BMS scoring were examined  by two trained observers blinded to experimental conditions.examined , \u201cAdded\u201d20 Briefly, a high-speed digital video camera recorded the ventral view of the treadmill belt as animals walked across. Images were recorded at 100 frames/s and analyzed using MaxTRAQ . Acceptable passes included walking in the middle of the treadmill, stepping with few lateral deviations, and stepping without pauses.Treadmill walking was assessed , as previously described.17 To detect the extent of spared white matter (SWM) at the injury epicenter, iron eriochrome cyanine with an alkali differentiator was used to stain myelin, as previously described.22 Sections were imaged, quantified, and the epicenter identified, as previously described.17 SWM from the experimental group was normalized to average white matter content at identical spinal levels from a separate cohort of na\u00efve control animals.At 6 weeks post-SCI, mice were perfused and spinal cords processed, sectioned, and mounted, as previously described.23 TreadScan assessments were normalized to baseline (BL) values (week 6/BL\u2009\u00d7\u2009100) and analyzed using repeated-measures analysis of variance , followed by Bonferroni post hoc t-tests. Independent t-tests  were limited to reduce the probability of a type 1 error and were used to compare the balcony groups' kinematic speed and coordination measures.24 Non-parametric Spearman rank correlations were performed among BMS, TreadScan, and SWM outcomes.23 Values represent mean\u2009\u00b1\u2009SD. Data were analyzed using SPSS statistical software .Four BMS outliers (\u22652.5 standard deviations [SDs]) were removed. BMS scores and component left- and right-side values were not different and were averaged. Time course of recovery was assessed by averaging acute (days 3 and 7), chronic (weeks 5 and 6), and all  time points. Group comparisons of BMS component scores were performed using non-parametric Mann-Whitney U tests. Frequency counts were compared using binomial proportion tests, corrected for small sample size when appropriate.Balcony group mice had higher BMS , BMS + subscore  compared to the group without a balcony  when walking on the treadmill compared to those without a balcony , as well as the Plantar Stepping Index (a measure of forelimb to hindlimb stepping), did not differ between the balcony groups .Terminal assessment of the amount of SWM 6 weeks post-injury yielded no significant group difference  is a fundamental component of functional recovery, it is likely that rehabilitative training incorporating BWS alone is not sufficient to restore locomotor function beyond what occurs \u201cspontaneously.\u201d3 Injured animals undergoing rehabilitative activities, such as step training with BWS, either through a harness and treadmill or in shallow water, have the ability to produce well-organized patterns of stepping on a treadmill. However, they are unable to do so overground because of a lack of balance.29\u201331A key component necessary to improve functional locomotor recovery and enhance plasticity begins with weight-supported stepping.32\u201334 The modulation of muscle output by sensory inputs leads to \u201cfine-tuning\u201d in which the basic locomotor pattern generated by the central pattern generator is fine-tuned to adapt to terrain and walking surface changes.36 This fine-tuning is dependent on the step phase (stance vs. swing) and thus is important for both intra- and interlimb coordination.37Locomotor training techniques have revealed the need not only for load-bearing weight support for functional improvement, but also the importance of proprioceptive input.The outcome measures of the BMS, its components, and kinematic assessments utilized to assess locomotor functional recovery in the present studies can be categorized according to basic  and higher-order  functional outcomes. In the present studies, balcony group mice showed greater improvement in the BMS's early stages of recovery for basic ankle limb movements, plantar placement, and plantar stepping, in addition to kinematic foot base of support. Thus, mice with the balcony improved more in all basic locomotor recovery abilities compared to mice without a balcony, first developing weight support, then plantar placement of the paw, followed by weight-supported plantar stepping.As previously alluded to, the relationship between trunk control and balance is an integral feature in the successful acquisition of basic locomotor function after SCI. Moreover, it also plays an important role in the subsequent improvement of more complex higher-order locomotor abilities. Mice housed with the balcony performed better in multiple balance-related outcome measures, including paw rotation, trunk stability, and tail position, with a corresponding reduction in adverse trunk events. Also, kinematic outcomes for stride length and track width were better for balcony-housed mice compared to those mice housed in standard cages. These achievements illustrate that mice housed with access to the balcony advanced beyond basic weight-supported stepping, exhibiting continued improvements in stability and balance over and above those of standard housed mice.The progression to fine-tuned complex motor behaviors representing higher-order recovery also was better in balcony-housed mice compared to those housed without the balcony. This is exemplified by balcony group mice having higher overall BMS and BMS + subscore results, clearly demonstrating better overall locomotor performance. In addition, other evidence of higher-order functional outcome measures supporting greater improvements in mice housed with a balcony compared to those in standard housing include the significant relationship among locomotor and kinematic functional outcomes. Specifically, there was a positive relationship between BMS subscores and kinematic rear track width for balcony-housed mice only, suggesting that the continued improvement in stepping and finer details of locomotion were related to recovery of balance.However, neither BMS nor TreadScan outcome measures for coordination revealed significant differences between the balcony and no-balcony groups. It is suggested that climbing up onto the balcony and other activities promoted by the presence of the balcony likely contributed to the ability for plantar placement of the hindlimbs. In turn, it is conceivable that an increase in basic plantar placement was associated with increased muscle strength attributable to repeated limb-loading at acute time points with or without improvement in balance.Another important indicator supporting functional improvement can be gleaned from the morphological assessment of SWM. In the current studies, direct comparisons of the SWM area between groups revealed no significant differences; however, the relationship between SWM and stride length were different for the two groups. Animals without the balcony had poor stride lengths while walking on the treadmill, and poor stride lengths were significantly related to poorer white matter sparing outcomes. Taken together, these assessments, along with the morphological findings, confirm the superiority of fine-tuned locomotor skills for mice with access to the balcony.1 A common goal of rehabilitative methods that utilize training is the development of a skill that is retained post-training. It could be argued that the addition of the balcony resulted in increased exercise through the activity of climbing and constituted the attainment and practice of an acquired skill without formal or applied training. Although activity levels were not directly measured in the current studies, climbing is a natural behavior in mice and, given the opportunity, they will spend a considerable amount of time engaging in high-energy activities, such as climbing and wheel running, compared to walking or other natural  behaviors.39 As concluded by B\u00fcttner, \u201cclimbing is obviously a regular component of activity\u2026and is a factor in locomotor activity.\u201d39Adkins and colleagues promoted the concept that different skills result in different physiological changes and that the properties of strength, endurance, and skill training are necessary components to accomplish locomotor improvement.40 Thus, given the opportunity, animals with the capability will engage in both their \u201cnatural\u201d (climbing) and \u201cun-natural\u201d (wheel-running) behaviors if present and available in their environment.41In the present studies, where level and severity of the SCI did eliminate the ability to climb acutely post-injury in all animals, it is likely that balcony-housed mice had increased exercise by engaging in climbing. This is supported by a study using rats with mild-moderate SCI housed in environmentally enriched cages with activities for climbing that reported significant improvement in locomotor scores and subscores, as well as the kinematic outcome measures, thus attaining higher-order fine-motor skills as compared to animals housed without enrichment.39A higher percentage of balcony-housed mice were able to achieve frequent stepping compared to those without the balcony , suggesting that the activities made possible by the balcony  influenced the capacity to step. Thus, the specific preference for climbing compared to other activities demonstrated previously support the contention that mice in the present studies were highly likely to engage in the activity of climbing, even though this behavior was not monitored.1 Moreover, climbing likely involves most of the five levels of motor control needed for locomotor recovery as defined by Prochazka and Yakovenko: skeletomuscular and stretch reflex properties associated with load compensation, body motion and pattern generation, adaptation and prediction, and behavioral goals and context.33The improved outcomes reported here suggest that the activity of climbing positively influenced at least two of the three training-related tasks as outlined by Adkins and colleagues: skill and strength, and possibly the third, endurance for locomotor recovery.The present studies show a clear improvement in locomotor recovery in SCI mice after exposure to a housing enhancement , adopted primarily to improve animal well-being and reduce stress. The incorporation of a balcony in the present studies represents both a type of environmental enrichment with increased activity levels and also, simultaneously, the opportunity for in-cage self-training that involves whole-body movements, trunk control, limb strength, and balance. Results support the contention that the addition of a balcony provided training opportunities that allowed critical milestones in basic and fine-motor skills to be acquired that surpassed those of animals in standard cages without a balcony. These studies reveal that substantial functional locomotor improvements can occur unintentionally from enhanced housing that encourages an increase in general activity and specific skill-learning, such as climbing.The capability of experimental studies to discern effects from experimental manipulations versus extraneous, unintended influences is imperative for scientific validity. In the current body of studies, the unplanned addition of a balcony to standard cage housing resulted in unintended effects to experimental outcomes in SCI mice. Results demonstrated broad functional improvement, encompassing both basic and higher-order locomotor abilities in mice housed with the balcony compared to no balcony. The present results clearly illustrate that significant functional changes in locomotor outcomes can occur unintentionally after mild-moderate contusion SCI from enhanced housing that encourages an increase in general and specific activity such as climbing."}
{"text": "N\u2009=\u200912) talk about their identities, prosocial behaviors, and connections between them. Of special interest was whether and how the participants included their experiences of dehumanization. Focus group data were analyzed using modified analytic induction. Participants felt good about their racially gendered identities but felt they occupied a precarious position in the United States. Participants\u2019 beliefs about how others viewed them motivated restraint from engaging in too many prosocial acts to prevent appearing vulnerable. Participants explicitly referred to their experience of oppression in these discussions and its interaction with identity and prosociality. Results suggest research must consider how macro\u2010level processes like racism influence the identities and prosocial behaviors of adolescent Black males.This qualitative study examined how adolescent Black males ( During adolescence, Black males in the United States face complex and daunting challenges Brooms, . In K\u201012Despite growing up in the context of anti\u2010Blackness, many Black youth develop positive racial\u2010ethnic identities (REI); these youth have higher self\u2010esteem, better short\u2010 and long\u2010term academic outcomes, and are less affected by discrimination than peers who have more negative feelings about their REI , and they contribute to academic and social success, two important outcomes of adolescent development  to control their bodies Coates, . The higperceptions of their macro\u2010 and micro\u2010social contexts  is an identity\u2010centered ecological model that focuses on an individual\u2019s Spencer, , 2008. Racross contexts. Net vulnerability balances possible risk factors  with possible protective factors (supportive parents and strong community ties) to determine overall risk. Similarly, net\u2010stress engagement balances an adolescent\u2019s actual engagement with stress with their reactive coping mechanisms. The adolescent\u2019s net engagement with stress will lead to positive or negative outcomes that are represented within the stage\u2010specific outcome component. We focus here on three components of P\u2010VEST: net vulnerability, emergent identities, and stage\u2010specific outcomes. We foreground anti\u2010Blackness as a contributor to net vulnerability and examine whether and how adolescent Black males speak about their vulnerability in relation to their emergent identities and to the stage\u2010specific outcome of prosociality.Phenomenological variant of ecological systems theory is comprised of five bidirectional components: emergent identity, net vulnerability, net stress engagement level, reactive coping mechanisms, and stage\u2010specific outcomes Spencer, , 2008. AIntersectionality theory describes the ways interlocking systems of oppression shape one\u2019s experience  investigation to examine if and how adolescent Black males\u2019 racial\u2010ethnic and gender identities predict self\u2010reported prosocial behaviors within an urban school context  identified as male and as Black or African American. The sample size constitutes all available participants for the qualitative portion of the larger mixed\u2010method study. The mean of prosocial scores on the Prosocial Behavior Scale  was 3.04. The participants invited to participate in the qualitative portion scored in the top and bottom quartile of prosocial scores and represented over 50% of their group\u2019s respective quartile, supporting saturation efforts  (a pseudonym), a public charter high school operating within a large metropolitan school district in the southeastern region of the United States. Over 98% of students attending CA identify as Black or African American. College for All is a Title 1 school  located in an economically depressed area. Additionally, all students attending CA qualified for the federal lunch subsidy, indicating their family incomes were at or below 130% of the national poverty level.The IRB at Georgia State University approved the present study (IRB00000716). All invited participants elected to participate in a focus group. They were provided a pizza lunch and 10 dollars for their participation. Focus groups were conducted on school grounds in Fall 2017. Each session took approximately 65\u2009min, and both were audio\u2010recorded. See Appendix\u2009between participants is equally important to information told directly to the researcher  and the contextual variable perceptions of discrimination were used as initial descriptive codes and were applied line by line to the transcripts. Any lines containing irrelevant information (such as discussing favorite pizza toppings) were excluded from coding.We used modified analytic induction when coding qualitative data , more specific interpretive codes were added. A line such as \u201cI bring her her favorite snack\u201d was further coded with the interpretive code Data were coded with an educational psychology doctoral student using the mixed method coding software Dedoose  can be spaces of liberation rather than contexts of oppression. She believes that we must listen to the voices of Black youth to best understand their development and resistance to the anti\u2010Blackness endemic to the U.S. context to achieve this and therefore uses research methodology that centers participants\u2019 perspectives. The second author is a White female senior faculty member in a large urban research university in the Southeastern US. During the last 15 years her research has focused on Black adolescents\u2019 girls\u2019 thoughts and feelings related to psychological development within urban school contexts. The first author conducted focus groups and led analysis of the data.The positionality of the authors informed the research methodology. Given the authors positionality as women, it was particularly important to utilize methodological approach that centered the voices of participants, adolescent Black males. Through modified analytic induction and focus groups, participants\u2019 beliefs were the guiding point for focus group questions and follow up questions. Moreover, the subsequent analysis used a lens that centered participants\u2019 race and gender through a macro\u2010level lens to understand their experiences.Participants described their feelings about their gender identity, REI, and racially gendered identity. In both groups the words they used to describe their gender were: \u201cpowerful,\u201d \u201ctrustworthy,\u201d \u201cstrong and smart,\u201d and \u201cleader.\u201d For race, participants said \u201cscared,\u201d \u201cdiscriminated,\u201d \u201cunique,\u201d \u201ctargeted,\u201d \u201chumble,\u201d \u201cpowerful,\u201d \u201cblessed,\u201d \u201ctalented,\u201d \u201chighly favored,\u201d and \u201cfeared.\u201d When asked about what words come to mind regarding their racially gendered identity as adolescent Black men, the following descriptions emerged: \u201cfear,\u201d \u201coppressed,\u201d \u201cflashy,\u201d and \u201cprovider.\u201dWe asked participants if their perspectives represented their point of view as a Black person, a male, or a Black male. All participants stated their perspective was of a Black male. As Rico stated, the identities \u201ccome together.\u201d Both groups agreed they could not untangle gender from race. Interestingly, despite stating the two identities were intertwined, the conversations in the groups focused primarily on REI.Yeah, I was going to say, I feel good about being Black because it just\u2014I feel like I\u2019m bonded with everybody. There\u2019ll be people I don\u2019t even know. I can just be like \u2018Hey, how you doing?\u201d or \u201cWhat\u2019s up?\u2019Participants expressed high private regard for their REI. In both focus groups, participants discussed that despite Black Americans facing a range of historical and present\u2010day traumas, they thrive and maintain a strong sense of community. Some went further and cited Black Americans\u2019 resilience as evidence of \u201cBlack people being blessed\u201d and a source of pride for them. Tyrese extended this sentiment.Because you can see, in everything we do, we already got some hate thrown at us. Like most of the movies and shows on TV, it\u2019s White folks on there. Then once you go into the suburbs\u2014cuz they separate it, the suburbs, then urban. All the Black folks in the urban with all the broke down stuff. Messed up TVs, all that. Then you got the suburbs with the White folk.Participants\u2019 responses on how other people viewed their race  were mainly negative. They were keenly aware of the discrimination Black Americans faced. Zaire from the low prosocial group used the following example of segregated communities and media portrayals of Black Americans to illustrate this point.\u2026I say feared\u2026cuz I know I\u2019ve been walking down the street before and a cop just looked at me and approached me for\u2014and talked to me, stuff like that. I\u2019ve been in places where White people see us, and they clutch their purses. They look at us the wrong way, go to the opposite side of the way.While he spoke, other participants nodded their heads, quietly affirming his frustrations about the persistent inequality in America. Participants in both groups used words like \u201cdangerous,\u201d \u201cfeared,\u201d and \u201ctargeted\u201d when describing other peoples\u2019 feelings and opinions about Black people and Black males. When probed on the fear aspect, Chad from the high prosocial group had this to say:They pitch to us, like when we leave high school, sports are gonna get us out. They don\u2019t pitch us as doctors or lawyers or stuff like that. They try to teach us to dumb us down, so that\u2014because the Black man in power is\u2014he\u2019s dangerous to everybody else\u2026 I think they only accept us when we\u2019re making their money instead of takin\u2019 away from their pockets. That\u2019s when they try to get rid of us.They believed others viewed their racially gendered identity in a positive light only when related to certain stereotypes about Black men. In both groups, participants stated the two areas in which they were positively perceived by others were in sports and with women. To quote Rico in the high prosocial group, \u201cThey like us when it comes to our athletic abilities and sexual desires.\u201d In the low prosocial group, Ray said,Regarding sex, the commentary moved into a back and forth about White girls approaching them, saying things such as, \u201cWe like Black boys.\u201d Participants were not disturbed by these experiences but rather amused and a bit boastful. For example, when Michael from the high prosocial group proudly stated, \u201cWhite girls love us,\u201d all other participants vigorously agreed.treated a particular way because of their race. Most examples provided were of other people treating them with suspicion. Participants surmised it was due to their race or their positioning as Black males. Tyrese shared the following experience,\u2026I was on the train. A couple players on my football team, we were just walking on a train. People were giving us looks. We were just chilling. Some people would like to move away. I don\u2019t know why. I guess cause we were Black.Participants were then asked to think deeply about instances when they were they. When probed on whom they referred to, Maurice stated \u201cWhite people\u201d absentmindedly while playing with his pencil, and the others quickly nodded in agreement. When asked to elaborate, Maurice made eye contact and firmly stated, \"Look at our presidentWhen asked to share specific experiences of being treated a certain way due to their identity, the low prosocial group recounted only examples of negative treatment. During their conversations and descriptions of events, low prosocial group members frequently used the term us.\u201d Others in the low prosocial group stated learning about American history shaped their current perspective. Ray explained, \u201cIt started when like ever since I started learning about slavery\u2026 As I got older, as I started to notice history repeats itself. It gained on me. It got bigger.\u201d Participants agreed learning more about the world and their positions as young Black males soured them to the intentions of White Americans.The group went on to state these opinions were formed as they \u201cgot bigger\u201d with Ashad elaborating, \u201cAs I got bigger\u2014I became a bigger target.\u201d The justice system also influenced these views; Maurice quietly stated, \u201cThe White man have justice over they frequently but when probed further about it, participants stated \u201cthey\u201d referred to anybody. Tyrese explained:I see it everybody the same. It\u2019s just that\u2019s what they see, what they perceive the world as and what you see it as may be different because so many people see the world in their own type of way.The high prosocial group presented a different perspective on the relationship between White and Black Americans. When asked to share experiences of positive or negative treatment predicated on race, only half of the group reported negative experiences they believed to be due to their race. This high prosocial group also used the word Some people, and I\u2019m not even gonna label them as White people, just they cool people, I\u2019m not gonna be like, \u2018Oh that\u2019s a White person over there.\u2019 I\u2019m trying to get past that. I still wouldn\u2019t tolerate a White person calling me the n\u2010word tho.Chad expounded on Tyrese\u2019s point, explaining:Participants in both groups stated that others\u2019 feelings about Black Americans did not affect how the participants in turn behaved toward them. However, the low prosocial group was more explicit than the high prosocial group in naming and critiquing White people.To probe their thinking about prosociality in a conversational way, participants were first asked to provide examples of kindness . The examples were, by and large, acts of generosity. The two most common acts were sharing food or money with those around them. Responses included \u201cHelp with work and stuff,\u201d \u201cKind is when you nice to everybody, and you just\u2014you just not mean to nobody,\u201d \u201cHelping with priceless things. Help with work and stuff,\u201d and \u201cYou just nice to everybody. Just a good person.\u201d When further probed, participants agreed kindness was going beyond what was expected of you. Jared and Kenny in the high prosocial group discussed how they were kind to other students at their school. Jared said, \u201cJust on a day\u2010to day\u2010basis, opening the door for anybody\u2010 just hold the door.\u201d Kenny stated, \u201cMatter afact, just earlier I just gave someone a dollar because he asked me for a dollar\u2026if you need help, I got you.\u201dbecause of respect for them. Participants defined respect as an understanding of physical and emotional boundaries. As Kenny succinctly put it, \"Respect is people knowing what I tolerate and what I don't tolerate.\" Kindness, or even liking another person, was not required to give or receive respect. Bobby shared:Like, I don't like you, but I respect you as a man. You see someone getting picked on, or you see\u2010 if you see an incident going on\u2026like a fight. The person he got a big presence and like, \u2018Nah man I ain\u2019t gonna fight you.\u2019 I respect you. Don't mean we tight. That don't mean we cool, but I respect you for being a bigger person\u2026I respect you as a man, but that don't mean we got any type of friendship, or anything. I just respect you.Besides generosity, respect was one of the first words participants in both groups used when asked to define being kind to another person. When asked to expand upon respect, participants stated being respectful was different from being kind or generous. According to participants, one is often prompted to engage in prosocial behaviors with another person Within their school context, participants showed respect to peers and school staff through acts of deference. As an example, participants cited acquiescing to a teacher\u2019s demand without complaint or comment, even if they did not understand or agree with the request. Zion stated, \u201cRespect is like if she tell you to be quiet, just be quiet. Don\u2019t talk back.\u201d Similarly, with peers, participants showed other students respect by not engaging in or escalating a potentially volatile situation. When asked about which they valued more, respect or kindness, all participants stated respect. Participants felt it was essential to be respected across contexts. They stressed a nice person who did not show them respect was essentially worthless.I don\u2019t wanna be\u2014I don\u2019t wanna come out the hood doing good and not leavin\u2019 them. It\u2019s like, say I did come out, I make it, and then like, dang, he was over here and he ain\u2019t even doin\u2019 nothin\u2019 for us. I wanna at least give back so they could have an idea like do right.Participants reflected on how their identity, the context of dehumanization, and their prosocial attitudes interact in their lives. They described how racial socialization influenced their identity and that their identity was influential in how they treated others. Some participants said they were raised to be kind, and Black people in general are community oriented. When asked how their REI motivated them to be kind to others, Tyrese and Tommy in the high prosocial group explained the relationship. Tyrese started by stating, \u201cIt\u2019s in my heart,\u201d and Tommy confirmed these sentiments in saying, \u201cIt\u2019s just the way we were brought up.\u201d The low\u2010prosocial group had similar beliefs, and Locksley from the group discussed the community aspect that was important to his identity.Zion: Okay\u2026so that moment you walk by the car, and she lock the doors so you\u2014that makes you wanna go harder so 10\u2009years later you a successful Black man. She lookin at the TV. She see your name pop up and she say, \u2018Oh that look exactly like the Black boy that walked by my car and I locked the door on him.\u2019Ashad: I think if they lock the doors, the next day come say something to her. Say something nice to her. Don\u2019t try to act aggressively and keep doing that. Then eventually, she\u2019ll feel stupid for even trying to treat you like a threat or something.Although motivated to give back to their own community, the threat of being stereotyped in the larger world was simultaneously looming. To counter negative stereotypes about Black males being dangerous, some participants were motivated to be successful or kind to show the person the error of their ways. Zion and Ashad from the low prosocial group described a hypothetical situation with a woman who may lock her doors upon sighting a young Black male.The participants with the highest prosociality scores were explicit about the limits and risks of being kind, about needing to protect themselves from appearing too kind and thus being vulnerable. This was not observed in the low prosocial group.Kenny: Let\u2019s say I come\u2014we come to school every day and I give you a dollar every day. You be like thank you, thank you the first time I give you a dollar. If I constantly keep giving you that dollar you gonna expect me to did not giving you that dollar.Jared: Then that one day you don\u2019t give them a dollar!Kenny: Then they are gonna get mad at you, \u2018Where\u2019s my dollar?!\u2019 I\u2019m like \u2018Yo dollar?! What you mean?! I gave it out my heart, my kindness.When asked what they would tell a younger brother about being kind, Sammy in the high prosocial group responded, \u201cI\u2019d tell him to treat people the way you want to be treated. Don\u2019t be easily provoked\u2026Sometimes they make take your kindness as a weakness, but I feel like I should just treat people like you want to be treated.\u201d In response to this, Kenny stated, \u201cBe kind, but don\u2019t be too kind,\u201d and Malcolm added, \u201cDon\u2019t be vulnerable.\u201d This began an exchange in which they discussed how they may be taken advantage of if they are too kind to those around them. Kenny and Jared used a hypothetical situation to illustrate their point.Kenny explained one consequence of their oppressed status, saying, \u201cIt\u2019s being vulnerable because they feel like us being Black, we\u2019re vulnerable to rap. They feel like if they provoke us enough, we\u2019ll explode.\u201d They went on to explain their identities as Black males made them more susceptible to being taken advantage of or unfairly tested. Malcolm stated, \u201cThe fact that we\u2019re Black men, we\u2019re the target anyways. They\u2019re going to try to see if the stereotypes if they hear are true\u2026Some folks in the world\u2014they want to see you\u2014I don\u2019t know\u2014they want to see you fail.\u201dParticipants stated there are only a few people with whom they can be vulnerable and kind. They named their mother as one with whom they were unabashedly open and generous. As one participant stated, \"My mom, that's all I need in this world.\" They went on to state certain contexts afforded vulnerability such as a sports game or graduation, but generally, they were very protective of their feelings, which influenced the ways they engaged with others.This study examined adolescent Black males\u2019 talk about their racially gendered identity and prosocial behaviors, the relationship of these constructs to each other, and the role of systemic bias in the meaning\u2010making process. Theory  shape emergent identities Spencer, . As predScholars have noted that Black males must develop an identity in a terrain in which they are simultaneously desired and despised Cooper, . As BoykA difference between the focus groups emerged in the participants\u2019 interpretation of the forces at play that create hostility and discrimination in their environment. As found previously in the quantitative study, those participants who scored lower on a measure of prosociality also scored lower on racial public regard, or how they believe others see them. In their focus group the low prosocial participants recounted episodes of being treated negatively because of their social position, and they used \u201cothering\u201d language in their narratives, referring to those who mistreated them as \u201cthey.\u201d When probed, the participants described \u201cthey\u201d as Whites and painted a picture of their social world as a battlefield where White and Black Americans are continually at odds. The low level of prosocial behaviors they reported in their immediate social network could be a coping response to their perceived powerlessness in the face of discrimination. They also may be unwittingly incorporating society\u2019s negative stereotypes about Black males into their burgeoning identities . These findings recall previous studies illustrating the contribution of racial socialization messages to prosociality  to protect themselves.The interaction of factors in these adolescent Black boys\u2019 social development is illustrated in these findings. The participants described the complexities and contradictions they negotiate in constructing a self and moving through the world. For example, the participants feel pride about who they are and at the same time understand that the larger world is hostile because of who they are. They describe how their identity includes the values of kindness and respect, while others stereotype them as inherently callous and dangerous. To protect their identity and possibly their physical integrity, these youth go out of their way to be prosocial, to dispel negative stereotypes. At the same time, they guard their behavior and try not to be or because of the low regard others have for them. One may not think of \u201chelping behaviors\u201d as a coping mechanism but where adolescent Black males are considered threatening, prosociality creates a counternarrative for others and possibly also for themselves.These findings echo established predictors of prosociality in adolescent Black boys  identity in Black boys can promote prosociality (to cope with and rebut stereotypes) and community engagement (as an act of solidarity), but also can promote guardedness and withdrawal from engagement (to look imperturbable and deflect threat). The development of prosociality is frequently characterized in relation to micro\u2010level influences like peers and parents, but these findings indicate the macro\u2010level context of racial discrimination and inequity influences how adolescent Black males think about the social world and the meaning and purpose of prosociality. Our participants\u2019 beliefs about the fundamental elements of social relationships were constructed through their understanding of themselves as Black males which was, in turn, informed by anti\u2010Blackness and systemic oppression within the United States.While this study uncovered valuable information about Black males\u2019 social development, some limitations should be noted. Our small sample size and single location limit generalizability but allowed us to learn important detail about the participants\u2019 thinking. We also were not able to look at differences by age or over time. A longitudinal study may reveal shifts in these processes. Additionally, grouping participants by prosocial scores may have led to the absence of more varied voices and exaggerated the group differences. Further, we realize social acceptability may have influenced participants\u2019 responses in the focus groups. Last, we acknowledge that our data are based on boys\u2019 quiet reflection in a safe space, and that may be different from their behavior in real time. Despite these limitations, this study demonstrates the value of using qualitative approaches, the P\u2010VEST framework, and an anti\u2010Blackness lens to understand pathways and outcomes for youth of color.One finding meriting future investigation was the importance of respect to these adolescents\u2019 thinking about relationships. Future examination of the function and development of respect can elucidate its relationship to adaptive developmental outcomes. Similarly, reflected appraisals, particularly the influence of low racial public regard, were central to our participants\u2019 thinking and merit further investigation to explicate the processes of development in a hostile context.These findings also demonstrated the ways adolescent Black males both accommodate and resist societal expectations of them. Future research should explore the risks and benefits for development that arise as marginalized youth manage dominant messages about who they should be and how they should act. Moreover, given the specific experiences attached to racially gendered identity in these findings, using an intersectional lens will be essential to further our understanding.because of their entrance into adolescence. Thus, future research on young Black males must include a developmental perspective that explicitly considers the role of macro\u2010levels processes like racism and discrimination in normative developmental outcomes.Finally, as previously noted, adolescent Black males must negotiate tensions between their private regard and public disregard during their adolescence"}
{"text": "The skin, as the largest organ of human body, can use ions as information carriers to convert multiple external stimuli into biological potential signals. So far, artificial skin that can imitate the functionality of human skin has been extensively investigated. However, the demand for additional power, non-reusability and serious damage to the skin greatly limits applications. Here, we have developed a self-powered gradient hydrogel which has high temperature-triggered adhesion and room temperature-triggered easy separation characteristics. The self-powered gradient hydrogels are polymerized using 2-(dimethylamino) ethyl metharcylate (DMAEMA) and N-isopropylacrylamide (NIPAM) under unilateral UV irradiation. The prepared hydrogels achieve good adhesion at high temperature and detachment at a low temperature. In addition, according to the thickness-dependent potential of the gradient hydrogel, the hydrogels can also sense pressure changes. This strategy can inspire the design and manufacture of self-powered gradient hydrogel sensors, contributing to the development of complex intelligent artificial skin sensing systems in the future. As an important organ of the human body, the skin can not only protect the human body from external bacteria and viruses, but also accurately receive and sense various external physical and chemical stimuli. To date, people have developed multiple artificial skins to realize the function of human skin ,2,3. AmoTraditional artificial skin adhesives mainly include bionic microstructure adhesives inspired by octopuses ,17,18, tHere, we have developed self-powered gradient hydrogel sensors with a reversible adhension capacity based on the copolymers with phase transition temperature, which are polymerized by 2-(dimethylamino)ethyl metharcylate (DMAEMA) and N-isopropylacrylamide (NIPAM). The hydrogels have great adhesion through their own hydrophobicity, where the amino group of the hydrogel forms a hydrogen bond with the substrates, and the ammonium ion forms an electrostatic complexation when the human body\u2019s temperature is higher than the lower critical solution temperature (LCST). The hydrogel adhesive has high viscosity above 37 \u00b0C, can maintain the adhesive state, and has reduced adhesion at room temperature, which means that it is easy to remove from the skin. This study demonstrates the potential application of the developed hydrogel adhesives in artificial skin and self-powered biomechanical monitoring system.N,N-Methylenebisacrylamide  and the UV absorber (UV F-22) were purchased from Weihai Huaen Rubber Plastic New Material Co.  Alkaline alumina was used (200\u2013500 mesh).2-(Dimethylamino)ethyl metharcylate  and 2-hydroxy-4\u2032-(2-hydroxyethoxy)-2-methylpropiophenone  were purchased from Aladdin Reagents Co. . N-Isopropylacrylamide  was purchased from TCI . The gradient PDMAEMA/PNIPAM hydrogels were fabricated by free radical polymerization under UV irradiation for 4 h and in the presence of a UV adsorber. In brief, the total content of the two monomers in the solution was 30 wt %, and the ratio of DMAEMA to NIPAM was 10:1, such that there was 0.15 wt % MBAA (cross-linker), 0.3 wt % 2959 (photoinitiator) and 0.1 wt % UV absorbers. These were sequentially dissolved into deionized water and the mixed solution was stirred. After standing, the precursor solution was injected into a home-made mold consisting of two glasses and a spacer. Then, then the mold was placed under 360 nm ultraviolet light for 4 h to polymerize. The PDMAEMA/PNIPAM gradient hydrogel was finally obtained by radical polymerization under ultraviolet light.The self-powered hydrogel sensor can be easily integrated by connecting the upper and lower sides of the hydrogel to two copper foil electrodes respectively. During the sensing processes, the hydrogel sensors were attached to the tested solid or skin surface by commercial biaxially oriented polypropylene (BOPP) tape and copper foil tape. The stress and strain sensing performance as well as the large deformation of human body based on the hydrogel sensors were measured.The cross-sectional morphologies of the PDMAEMA/PNIPAM gradient hydrogels were observed using a scanning electron microscope . The element content distribution on the upper and lower surfaces of the gradient hydrogels were analyzed using X-ray photoelectron spectroscopy . The transparency of the receptors was characterized by an ultraviolet and visible spectrophotometer . The mechanical properties were characterized with the strip-like hydrogel using a testing machine (WDW-5T) at tensile speed of 5 mm/min. The peel strength of the hydrogel film was measured with a peeling speed of 20 mm/min using a mechanical testing machine (WDW-5T). The electrochemical measurements were performed on a CHI660 electrochemical workstation . The sensing performance and the output voltage of the receptors regarding external stimulus such as pressure and strain were monitored by a digital source meter .The hydrogels were prepared by free radical polymerization, and the gradient structure was induced by ultraviolet light irradiation in the presence of an absorber . FirstlyThe gradient structure of the hydrogels was characterized by SEM and XPS, respectively. The HD side of the hydrogel has a denser polymer network than the other side, according to the cross-sectional SEM image of the hydrogels a. In addIt is important to manipulate the phase transition temperature of the hydrogel to be close to the temperature of human body. The transition temperature of the hydrogel was tuned by modifying the DMAEAM:NIPAM weight ratio and was measured via turbidity measurements. The mechanical properties of gradient hydrogel membranes were further investigated to ensure that they can be used at a higher temperature than LCST. Their tensile mechanical properties at different temperatures were measured, respectively. As shown in 2 respectively, which is much higher than that at room temperature. This is because the hydrogel loses water at high temperature, and the hydrogen bonds and electrostatic complexation of the hydrogel increase. With the increase of the proportion of DMAEMA monomer, the interaction of hydrogen bonds increase, the average peel strength between the hydrogel and various substrate materials is also increasing. When standing in ambient air for a while or cooling with water to room temperature, the hydrogen bonds between the hydrogel and the base material break, the average peel strength decreases, and the hydrogel is easy to peel. Therefore, no matter the cooling method, the adhesion between the hydrogel at room temperature and the tested substrate surface is poor. Therefore, in addition to its application in skin devices, the PDMAEMA/PNIPAM hydrogels can also be used in other specific scenes such as the various substrates requiring adjustable adhesion. To illustrate the reversible adhesion capacity of gradient hydrogel, we used DMAEMA: NIPAM = 10:1 hydrogel with silicone rubber as the adhesive substrate and carried out 10 repeated peel tests on it. It was found that the interfacial toughness fluctuates slightly and only decreases slightly, as shown in The gradient PDMAEAM/PNIPAM hydrogels can realize the reversible adhesive on various solid surfaces by adjusting the temperature due to their thermal sensitivity. The hydrogel films are adhered to flat or bent insulating substrates, including platinum, copper, silicone rubber, and glasses by sticking and gently pressing a\u2013d. In oF, R and T denote the Faraday constant, gas constant, and temperature respectively, and Ac-C(h) and Ac-C(l) are ions (OH\u2212) concentration on HD side and LD side of gradient hydrogel respectively.It is important to explore the sensing mechanism of the self-powered gradient hydrogels. The self-powered potential of PDMAEMA/PNIPAM gradient hydrogel can be calculated as follows:kth and (k + 1)th) can be expressed as:Ac-(k)C and Ac-C(k + 1) represent the concentrations of OH\u2212 at the middle of kth layer and (k + 1)th layer. Therefore, the total built-in potential of gradient hydrogel can be converted intoThe gradient hydrogels can be considered as an aggregate of many ultrathin homogeneous layers, whose density of charged groups increases gradually along the vertical direction . AccordiAc-C(n) and AcC-(1) represent OH\u2212 concentration on the upper surface of the n-th ultrathin layer and the bottom surface of the first ultrathin layer respectively. When the sensor is stretched or squeezed, the thickness of each ultrathin layer decreases, leading to a reduction in diffusion distance (\u2212 diffuses from the (k + 1)th layer to the kth layer (or from nth layer to 1th layer). Therefore, the ratio of Ac-C(k + 1)/Ac-C(k) and Ac-C(n)/AcC-(1) is decreased, resulting in a decrease in the output voltage of the sensor when it is stretched or pressed.In the formula, distance , and morThe gradient PDMAEMA/PNIPAM hydrogels also can be applied as self-powered ionic sensors as their self-induced potential varies with thickness. When an external pressure is applied to the self-powered hydrogel sensors, its maximum output voltage  gradually decreases along with the reduction of thickness a. The pr\u03b5) is defined as S\u03b5 = |\u0394V/\u0394\u03b5|, where \u0394\u03b5 is the change of the applied strain. A relatively high strain sensitivity of 2.71 can be obtained under a small strain of less than 40%. When the strain increases to 100%, the strain sensitivity decreases to 1.53. The hydrogel sensor has a wide strain sensing range and can generate repeatable waveforms to respond to 10% to 100% strain , the amino groups of DMAEMA can form hydrogen bonds with the substrate materials, and the ammonium ions form electrostatic complexation. The hydrophobicity also contributes to the adhesion ability of the hydrogels. When the temperature drops below the LCST, the hydrogel becomes easy to separate due to the breaking of hydrogen bonds. Additionally, benefiting from the thickness-dependent potential of gradient hydrogel, the sensors can precisely perceive a tiny variation in pressure and accurately sense tiny changes in strain. The hydrogel sensors can sense the changes of human fingers, wrists, and other joints. This study proves the potential application of self-powered gradient hydrogel in artificial skin and human biological monitoring system."}
{"text": "Gfap) mRNA and allograft inflammatory factor 1 (Aif1/Iba1) mRNA in the denervated oml. We compared the use of single RGs for normalization with the normalization index and found that single RGs yield variable results. In contrast, the normalization index gave stable results. In sum, our study shows that qPCR can yield precise, reliable, and reproducible datasets even under such complex conditions as brain injury or denervation, provided appropriate RGs for the model are used. The algorithm reported here can easily be adapted and transferred to any other brain injury model.Quantitative PCR (qPCR) is a widely used method to study gene expression changes following brain injury. The accuracy of this method depends on the tissue harvested, the time course analyzed and, in particular on the choice of appropriate internal controls, i.e., reference genes (RGs). In the present study we have developed and validated an algorithm for the accurate normalization of qPCR data using laser microdissected tissue from the mouse dentate gyrus after entorhinal denervation at 0, 1, 3, 7, 14 and 28\u00a0days postlesion. The expression stabilities of ten candidate RGs were evaluated in the denervated granule cell layer (gcl) and outer molecular layer (oml) of the dentate gyrus. Advanced software algorithms demonstrated differences in stability for single RGs in the two layers at several time points postlesion. In comparison, a normalization index of several stable RGs covered the entire post-lesional time course and showed high stability. Using these RGs, we validated our findings and quantified glial fibrillary acidic protein ( To ensure accurate and reproducible data, qPCR experiments comprise several aspects, including experimental design, sample preparation and data analysis6. The use of reference genes (RGs) is the most common strategy to normalize target gene expression of interest. However, their suitability must be experimentally validated11. Several studies demonstrated that expression levels of some commonly used RGs might vary considerably depending on the specific condition investigated, e.g., traumatic brain injury16. Unfortunately, there is no ideal RG for all experimental conditions and stability of RGs cannot be simply assumed. Under conditions of brain injury, the situation may be even more complex, because gene expression for multiple pathways of injury and repair vary with time following lesion19 as well as with age22. Furthermore, gene expression levels of neurons and glial cells depend on their distance from the lesion23 and, thus, studies using laser microdissected tissues may provide more precise, robust and reproducible results than studies using homogenized larger tissue blocks24.Quantitative polymerase chain reaction (qPCR) has emerged as a standard for precise analysis of quantitative changes in gene expression, especially when only a few target genes are examined or when a small amount of tissue is used28. In this model, transection of the perforant path results in the denervation of the outer molecular layer (oml) of the DG, accompanied by a strong glial reaction30. Candidate RGs were chosen based on earlier entorhinal lesion studies of the rodent brain32 and because of other relevant brain injury studies36. In contrast to previous studies using total hippocampal tissue following entorhinal lesion32, we used laser microdissection to harvest two hippocampal layers, i.e., the granule cell layers, where the denervated granule cells are located and the oml, i.e., the zone of denervation where strong glial reactions have been reported38. Expression stability of ten putative RGs, i.e., actin, beta (Actb), aminolevulinic acid synthase 1 (Alas1), beta-2 microglobulin (B2m), glyceraldehyd-3-phosphate dehydrogenase (Gapdh), hypoxanthine guanine phosphoribosyl transferase (Hprt), phosphoglycerate kinase I (Pgk1), peptidyl propyl isomerase A (Ppia), ribosomal protein L13A (Rpl13a), succinate dehydrogenase complex subunit A (Sdha) and transferrin receptor (Tfrc), were evaluated using commercially available software algorithms, i.e., NormFinder39 and geNorm40, and consensus ranking analysis41. To validate our findings, two prominent glial genes were chosen, i.e., glial fibrillary acidic protein (Gfap), a marker for reactive astrocytes, and allograft inflammatory factor 1 (Aif1)\u2014better known as ionized calcium binding adaptor molecule 1 (Iba1)\u2014a marker for activated microglia cells. Both genes are known to be upregulated after brain injuries and following entorhinal lesion44. Our study showed that single RGs were not sufficiently stable to study the time course of these genes over the entire postlesional time. In contrast, an index of several RGs yielded reliable, reproducible, and accurate results. This index should be used for normalization of qPCR data following entorhinal denervation and similar indexes should be identified using the algorithm described here for other lesion models to provide accurate qPCR data.To demonstrate the usefulness of this combined approach in a proof-of-principle experiment, we investigated the expression stability of candidate RGs in the dentate gyrus (DG) following entorhinal cortex lesion, a classical model for neural reorganization of the brain after injury29 was used to examine the expression stability of putative RGs in the denervated adult mouse DG  and oml of the DG to prove for abundance as well as to examine the variability of selected RGs. Laser microdissection was used to dissect and harvest the two dentate layers Fig.\u00a0a. RNA inded Fig.\u00a0b.Figure Hprt and Ppia as the best pair of RGs, whereas geNorm determined Gapdh, Pgk1 and Hprt as the most stable RGs for qPCR normalization. Summarized by RankAggreg, the consensus stability list of RGs for the entire lesion period reads as follows (most stable to least stable): Gapdh\u2013Pgk1\u2013Hprt\u2013Ppia\u2013Sdha\u2013Rpl13a\u2013Actb\u2013Alas1\u2013B2m\u2013Tfrc.Ten putative RGs were tested for their expression stability in the dentate gcl at different time points following entorhinal denervation, i.e., 1, 3, 7, 14 and 28\u00a0days. RGs were ranked according to the stability values calculated by NormFinder and by averaged expression using geNorm. RG stability measurements calculated by these algorithms were then used for a consensus ranking analysis employing RankAggreg Table a. CalculAlas1, Hprt, and Tfrc were excluded, see above) was studied in the microdissected dentate oml after entorhinal denervation using the same approach as for the gcl, i.e., using geNorm, NormFinder and a consensus ranking analysis by RankAggreg : Sdha\u2013Ppia\u2013Gapdh\u2013Rpl13a\u2013Actb\u2013Pgk1\u2013B2m.Expression stability of seven putative RGs  against a single candidate RG, (2) against RG indices calculated by geNorm and NormFinder for each lesion time-point, and (3) using the recommended minimal number of RGs for normalization for the entire lesion period based on the consensus ranking analysis. Normalization against a single RG resulted in high variabilities of Gfap mRNA expression levels in the denervated oml  was found. Likewise, using the minimal number of RGs for accurate normalization determined by geNorm, Gfap mRNA expression was also found to be significantly upregulated at 3, 7 and 14 dpl   and 7 dpl , respectively. Finally, using a consensus stability ranking taking all time points and both software algorithms into account, an index of the most stable RGs, i.e., Sdha, Ppia, Gapdh, was used for normalization. Here, a significant upregulation of Aif1 mRNA was found again at 3 dpl and 7 dpl as well as at 14 dpl with corresponding expression levels of 3.3-, 3.1- and 2.4-fold compared to control situation , which found that Actb was significantly upregulated at 2 dpl in the deafferented hippocampus, while at 7 and 15 dpl no apparent change of expression relative to control was detectable16. Interestingly, only Ppia (Cyclophilin A) demonstrated a relatively high expression stability at all lesion time points  in this study. In our study, Ppia was recognized as a suitable RG in the denervated oml, too. In addition, various studies analyzed Ppia in other commonly used brain injury models and identified it as being one of the most stable RGs64. In contrast, B2m was recognized as a less stable RG in several studies63, but was postulated also as suitable RG in a few research papers65. In our study, B2m was identified as the least stable RG in the denervated oml at all time points analyzed following lesion. In contrary, Sdha was identified as the most stable RG in the oml throughout all time points after denervation. This is in accordance with previous brain injury studies, where Sdha was used as RG for accurate qPCR normalization65.Initially, the expression of up to ten selected RGs was evaluated in two DG layers, i.e., the gcl and oml, to examine for abundance and variability of RGs. Of note, a few putative RGs had to be excluded from further validation analysis in the denervated oml, since they showed insufficient amplification because of low abundance expression, which could have influenced accurate qPCR quantification. Therefore, ten candidate RGs for the gcl and seven RGs for the oml were investigated for their expression stability after entorhinal denervation. Validation of RGs was performed at five individual time points after lesion, i.e., 1, 3, 7, 14 and 28 dpl, compared to control situation. Gfap and Aif1/Iba1, respectively. Both genes are upregulated in the denervated zone and reflect the strong glial response to entorhinal denervation66. Using immunofluorescence labeling for AIF1/IBA1 and GFAP, a major upregulation of these proteins in microglial cells as well as astrocytes, respectively, could also been seen at the protein level at 3 and 7 dpl in the denervated oml29. In previous studies, Gfap mRNA levels were measured in hippocampal samples using dot plot hybridization analysis67 or using laser microdissection in combination with qPCR using a single RG for qPCR normalization24. We now extended these earlier studies by analyzing the effect of different qPCR normalization strategies: target expression levels of Gfap and Aif1 mRNA were normalized in the denervated oml (1) against single candidate RGs, (2) against RG indices calculated by geNorm or NormFinder for each specific time-point following denervation, and (3) using the minimal number of RGs calculated for accurate qPCR normalization based on a consensus stability ranking for the entire lesion period and across the software algorithms used. Normalization against a single RG demonstrated a relatively high variation of mRNA expression levels for Gfap and Aif1 in the denervated oml. Significant upregulation of Gfap mRNA expression was found at 3, 7, 14 and 28 dpl depending on the RG that was used for normalization. Except for Pgk1, maximal upregulation of Gfap mRNA was detected at 7 dpl with expression levels varying considerably from 6.5- fold using B2m to 19.8- fold using Rpl13a. Similarly, a significant upregulation of Aif1 mRNA expression was found either at 3, 7 or 14 dpl depending on the RG used for qPCR normalization. Maximal upregulation of Aif1 mRNA was identified at 3 dpl using Gapdh, Pgk1, Rpl13a or Sdha. In contrast, normalization against Actb or B2m resulted in no significant expression changes of Aif1 mRNA. Of note, B2m was found to be the least stable RG in the oml at all time points analyzed following denervation. Similarly, Actb should also not be considered at earlier time points after denervation, but might be more suitable at later time points, which was also shown in the study of Harris and colleagues (2009). Using an index of suitable RGs according to the different software approaches by NormFinder and geNorm, a significant upregulation of Gfap mRNA at 3, 7 and 14 dpl and for Aif mRNA at 3 and 7 dpl was found. Importantly, a maximal upregulation of Aif1 mRNA was observed at 3 dpl, whereas maximal upregulation of Gfap mRNA upregulation was found at 7 dpl, which in both cases returned to lower levels at later time points after injury. Finally, qPCR normalization was performed using an index of the three most stable RGs, i.e., Sdha, Ppia and Gapdh, calculated based on a consensus stability ranking by including all lesion time-points and both software algorithms used. As a result, a significant upregulation of Aif1 mRNA and Gfap mRNA was found for both transcripts at 3, 7 and 14 dpl. Again, maximal upregulation of Aif mRNA was observed earlier (3 dpl) compared to Gfap mRNA (7 dpl). These results are in line with the early response of microglia cells, followed by the later reaction of astrocytes in rodents following entorhinal lesion66. Differences in the detailed time course of Gfap mRNA expression might be explained by anatomical species variations between mouse and rat or by distinct lesion techniques26. Our results demonstrate that normalization against non-validated or relatively non-stable RGs can lead to inconsistencies in qPCR expression analysis and, consequently, might lead to misinterpretation of real biological data. In contrast, normalization against an index of validated RGs determined by advanced software algorithms yields more accurate data. In addition, the precise harvesting of tissue, e.g., by using laser microdissection, helps to identify local changes after brain injury, which is of the essence to understand the sequence of events following damage. Based on our results, a normalization index with a minimal number of suitable RGs is sufficient for accurate qPCR quantification of target genes following entorhinal denervation. For a more precise analysis, we would recommend using time-point specific reference gene sets. However, the usage of a more broader normalization index of RGs calculated by consensus stability ranking for an entire lesion period is also highly appropriate and, thus, might be used in forthcoming studies, where more lesion time-points across different subregions are analyzed.As proof-of-principle, we used the RGs found to be suitable for accurate qPCR normalization after denervation to analyze the expression of two mRNAs of astrocytes and microglia, i.e., Map2 mRNA in granule cells. Microdissection of this neuronal layer is an excellent tool to harvest tissue enriched in granule cell mRNA, since granule cells are densely packed in this layer and greatly outnumber other neurons and glial cells. However, in contrast to glial cells, which react strongly to the degeneration of axon terminals and axons in the outer molecular layer, granule cells show only a very weak response. In fact, earlier studies performed in rats46 reported only very mild changes, which were an order of magnitude weaker than the changes found in glia and which were close or even under the threshold of detection using classical methods. Using laser microdissection and qPCR with a reference gene index established in the present study, we could, however, detect a mild upregulation of Map2 mRNA in mouse granule cells around day 3 to 7. This demonstrates that the algorithm proposed in this study also works with neurons and most likely any other cell type and allows for the identification of an index of stable and reliable reference genes.To demonstrate the usefulness of our algorithm for the detection of neuronal genes, we also analyzed changes in In conclusion, we have shown here using the well-established and thoroughly studied entorhinal cortex lesion model, that tissue from different time points after lesion harvested with laser microdissection and analyzed with qPCR yields precise, reliable, and reproducible quantitative datasets. To achieve this precision, it was of the essence to identify an index of RGs that is (i) appropriate for the model and (ii) covers the entire time course postlesion. The algorithm reported here can easily be adapted and thus transferred to any other brain injury model, making qPCR data in the field of brain injury and regeneration more precise and reproducible.For experimental analysis, adult male mice  were used. Mice could survive 1, 3, 7, 14 or 28\u00a0days after entorhinal denervation. Experiments were carefully designed to examine control and lesioned animals of similar age.Animal care and experimental procedures were performed in agreement with the German law on the use of laboratory animals  and approved by Regierungspr\u00e4sidium Darmstadt . The animal experiments described in this study were conducted in accordance with ARRIVE guidelines.29. Correct placement of the wire knife cut was verified on horizontal brain sections  containing the lesion site and parts of the temporal dentate gyrus (DG). In addition, entorhinal denervation was verified on frontal hippocampal sections (25\u00a0\u00b5m) using Fluoro-Jade C (HistoChem Inc.) at early time points post lesion to monitor the appearance of degeneration products68 and counterstained with Hoechst 33242 (Invitrogen).Unilateral transection of the perforant path was performed using a wire knife  as described previouslyMice were deeply anesthetized with an overdose of pentobarbital (300\u00a0mg/kg body weight) and transcardially perfused with 0.9% sodium chloride (NaCl) followed by 4% paraformaldehyde (PFA) in phosphate-buffered saline (pH 7.4). Brains were removed, post-fixed for 24\u00a0h in 4% PFA and sectioned in the coronal plane (40\u00a0\u00b5m) using a vibratome . Free-floating sections were incubated in a blocking buffer containing 0.5% Triton X-100 and 5% bovine serum albumin (BSA) in 0.05\u00a0M Tris-buffered saline (TBS) for 30\u00a0min at room temperature followed by incubation in the primary antibody (diluted in 0.1% Triton X-100 and 1% BSA in 0.05\u00a0M TBS) overnight at 4\u00a0\u00b0C. The following primary antibodies were used: rabbit anti-GFAP , mouse anti-NeuN  and anti-AIF1/IBA1 . After several washes, sections were incubated with the appropriate secondary Alexa-conjugated antibodies  for several hours at room temperature and finally mounted in DAKO Fluorescent Mounting Medium (Dako).Figures were prepared digitally using commercially available graphics software (Photoshop Adobe Inc.). Fluorescent images were acquired using a digital camera  or confocal microscopy . Single fluorescent images of the same section were digitally superimposed. The contrast, brightness and sharpness of images were adjusted as needed for each section. No additional image alteration was performed.For layer-specific analysis of the granule cell layer (gcl) and outer molecular layer (oml) of the DG, prepared brains were embedded in tissue freezing medium and immediately flash-frozen in \u2212\u200970\u00a0\u00b0C isopentane cooled by dry ice for 2\u00a0min. Until further processing, brains were transferred and stored at \u2212\u200980\u00a0\u00b0C. For laser microdissection, 16\u00a0\u00b5m thin brain sections were cut using a cryostat (Leica Biosystems) and mounted on polyethylene naphthalene (PEN) membrane slides (Leica Microsystems). Sections were dried shortly at room temperature (RT), fixed in \u2212\u200920\u00a0\u00b0C cold 75% and 100% ethanol (AppliChem) and stored at \u2212\u200980\u00a0\u00b0C until further processing. Before laser microdissection, sections were thawed and stained quickly with 1% cresyl violet staining solution (Sigma-Aldrich) at RT and briefly dehydrated in 75% and 100% ethanol. Using a Leica LMD6500 system (Leica Microsystems), defined tissue portions of the gcl and oml of the DG from the same brain sections were collected separately in 50\u00a0\u00b5l lysis buffer  with \u00df-mercaptoethanol. Tubes were refilled to 350\u00a0\u00b5l with lysis buffer, vortexed for 30\u00a0s and transferred immediately to \u2212\u200980\u00a0\u00b0C until further processing. Total RNA was isolated using the RNeasy Plus Micro Kit (Qiagen) according to the manufacturer\u2019s recommendations. RNA integrity was assessed using the Agilent 2100 Bioanalyzer system and Agilent RNA 6000 Pico Kit (Agilent Technologies). Only high RNA quality  samples were used for further processing.Actb), aminolevulinic acid synthase 1 (Alas1), beta-2 microglobulin (B2m), glyceraldehyd-3-phosphate dehydrogenase (Gapdh), hypoxanthine guanine phosphoribosyl transferase (Hprt), phosphoglycerate kinase I (Pgk1), peptidyl propyl isomerase A (Ppia), ribosomal protein L13A (Rpl13a), succinate dehydrogenase complex subunit A (Sdha) and transferrin receptor (Tfrc)  following the manufacturer\u2019s recommendations. Quantitative PCR (qPCR) was performed using the StepOnePlus Real-Time PCR System (Applied Biosystems). qPCR conditions were carried out using EXPRESS SYBR GreenER qPCR SuperMix with Premixed Rox (Invitrogen) and a final primer concentration of 500\u00a0nM. Primers were designed to be intron-spanning to exclude amplification of genomic DNA. Ten potential reference genes (RGs) were selected for analysis: actin, beta , which is the average pairwise variation of a single gene to all other putative RGs and is the result of a stepwise exclusion of the least stable gene within the panel of RGs. In addition, to reach an unbiased consensus for both software algorithms, a comprehensive ranking analysis was performed using RankAggreg41. Minimum number of RGs for accurate normalization was calculated based on optimal gene rank lists by pairwise variation between two sequential normalization factors containing an increasing number of genes40. Based on this study, 0.15 was set as a cut-off, below the inclusion of an additional RG was not required for proper normalization. Statistical analysis of qPCR data was performed using GraphPad Prism 6 software. For one-way ANOVA, multiple comparisons between individual time-points and control were used in combination with Dunnett\u2019s multiple comparisons test. P-values\u2009<\u20090.05 were considered statistically significant.To evaluate the gene expression stability of candidate RGs, two different software algorithms, i.e., NormFinderSupplementary Information 1.Supplementary Information 2."}
{"text": "The present study aimed to evaluate the effectiveness of the Brainballs on the physical fitness of 2nd-grade students at a primary school in Vietnam during and eight months after the experiment.The study included 55 pupils (23 boys and 32 girls) aged seven years. The study design was a pedagogical experiment with a parallel-group technique, including experimental and control groups. The examination was carried out in 2019/2020 in three terms pre- (September 2019), post- (January 2020), and follow-up (September 2020). Physical fitness was tested with the use of the International Physical Fitness Test. The Brainball program, conducted twice a week for 35 minutes, combined physical education (PE) with subject-related content, utilizing 100 balls with painted letters, numbers, and signs.p = 0.0044), toe touch (p = 0.0137), standing long jump (p = 0.0076), 4 \u00d7 10 m sprint (p = 0.0333), hand strength (p = 0.0233).Results show that the fitness level was not increased significantly after 20 weeks of the intervention program, neither in experimental nor control groups. However, it significantly improved eight months later at the follow-up examination. The analysis of covariance indicated that pupils from the experimental group improved significantly on most physical fitness as compared to the control group, specifically on the following tests: 50-meter running (These results have shown long-term positive effects of the use of \u201cBrainball\u201d educational balls in physical education classes on the physical fitness development of students, especially in the qualities of speed, strength, and flexibility. Evidence  proves tFor children and adolescents, PA includes games, sports, recreation, physical education (PE), or planned exercise as part of the family, school, and community activities . HoweverIn an effort to find a new teaching method to improve teaching and learning for students, researchers at the Wroclaw University of Health and Sports Science, Poland, have created an active teaching method called Eduball/Brainball. The primary teaching method of the program is to use games and exercises designed with educational balls to integrate the contents of other subjects into physical education classes , 17. AftThe idea of the educational balls was coined in 2002 in the Department of Team Sports Games at the Wroclaw University of Health and Sport Sciences, Poland. The first name of educational balls was \u201cEdubal.\u201d After 10 years of experience and research with Edubals, the set was modified and the next edition of educational balls, called \u201cEduball,\u201d was prepared. In 2018, the English edition of education balls called \u201cBrainball\u201d started; although the name is different, the idea of Edubal/Eduball/Brainball is the same; children learn while playing! .*), division (:), greater than (>), less than (<), parentheses , and the at sign (@)]  . The setign (@)] . The numign (@)] . The gamign (@)] , 32.Eduball/Brainball has been implemented in the official list of teaching aids for elementary schools in Poland. They were accredited and approved by the Polish National Ministry of Education. Eduball/Brainball has also been launched and confirmed its benefits in Germany, Portugal, Finland, Greece, the USA, Singapore, and Taiwan (China) . HoweverThe research sample was students from two second-grade classes in a primary school in the center of An Giang province, a province located in the Mekong Delta region of Southern Vietnam. A total of 55 students  participated in the study. The study was conducted during the 2019\u20132020 academic year. The study design included pedagogical experiments using parallel grouping techniques under natural conditions. Participants were randomly divided into a control group of 27 students (11 boys and 16 girls) and an experimental group of 28 students (12 boys and 16 girls). The teaching process of both groups  was conducted according to the same curriculum prescribed by the Ministry of Education and Training of Vietnam. The only difference is the introduction of Brainball into the teaching and learning in the experimental group. All participants' parents and guardians signed informed consent for their children to participate in this study. The study was approved by the local Ethics Committee for Research Involving Human Subjects . It was conducted according to the principles of the Declaration of Helsinki.The experimental factor was a PE program combined with Brainball games and exercises . The expIn the control group, physical education classes also took place twice a week for 35 min and were conducted using traditional styles . The same PE teacher with 10 years of experience, taught physical education in both groups . Due to the experiment the teacher was trained in the Brainball method to organize and perform games and exercises with these balls.The International Physical Fitness Test  was usedAt the command \u201con your marks,\u201d the pupil doing the exercise stands still in front of the starting line with one leg put forward . Then, at the \u201cstart\u201d signal, he runs to the finish as quickly as possible. Time is measured with an accuracy of 0.1 s.The subject stands with legs extended; naturally, toes are placed close to the boundary line; when jumping and landing, both feet do it simultaneously. The jump length is measured from the setline (beam) to the nearest footstep left by the jumper's heel. The result is the longest distance jumped, the best of two attempts.The subject stands with feet shoulder-width apart. The dominant hand holds the dynamometer toward the palm and extends straight along the body. The subject performed the exercise by reducing the dynamometer to maximum power. The result is the highest of two attempts.The task is to remain as long as possible, hanging with arms bent in elbow joints. Upon starting the test, the person doing the exercise holds the bar with fingers directed downwards and the thumb from the bottom upwards, at the shoulders' breadth, so that his chin would be above the bar. The test starts when the person doing the exercise hangs on the bar unaided and ends when his eyes go below the bar. Time is measured in 0.1-s units.The subject lies supine on a mattress, knees bent, hands clasped on the neck, and performs sit-ups, feet held firmly by an assistant. The result is the exact number of sit-ups in 30 s.The subject stands with one foot forward (standing start) in front of the starting line. On signal, the subject runs to the finish line to pick up a block, runs back, and places the block behind the start line. The subject then runs back to the finish line, picks up a second block, and runs back to put it behind the start line. If the block is thrown and not placed behind the starting line, the test is considered invalid and must be repeated. Time is measured with an accuracy of 0.1 s.The subject was not wearing shoes, stood on a stool or bench, toes placed close to the edge of the stool, feet together, and knees straight. From this position, the person doing the exercise bends forward with a continuous movement to reach the furthest with his fingers. Such a position of a maximum bend must be kept for 2 s. If the person doing the exercise reaches the level he is standing on while bending with a continuous movement, he scores 0. He scores a plus point for every centimeter below the surface of the stool. Otherwise, he scores a minus point for every centimeter above the surface of the stool. The test is invalid if, during bending, the legs are bent in knee joints. Any vigorous movements during bends are not permitted, either. The result is the best of two attempts.All measurements were taken in September 2019 (marking the beginning of academic year), and in January 2020 . The final, third examination took place in September 2020  to estimate the long-term impact. Technical researchers conducted fitness tests on the training ground during physical education classes. Measurements were carried out in a natural environment with the help of teachers and students. Additionally, principals, teachers, and parents approved information on testing procedures before testing.t-tests for the dependent variables were used to compare the differences in the mean parameters of the tests performed between the experimental and control groups. Next, to determine the statistically significant differences between the experimental and control groups after 1 year of study, an analysis of variance (ANOVA) was performed. Partial eta squared (\u03b7p2) was used to quantify the effect size   was used for statistical analysis. The main dependent variables were the scores on the physical fitness test obtained by testing students in the control and experimental groups. First, the Shapiro-Wilk test confirmed the normal distribution of the physical fitness test. Then, the students'  = 0.14) . Newmanap < 0.001.The results in F = 5.72, p = 0.004] and toe touch , standing long jump , 4 \u00d7 10-meter sprint , and hand strength [F = 3.90, p = 0.023; A repeated-measures analysis of variance ANOVA (2 \u00d7 2) was performed to compare the effectiveness of the Brainballs program on pupil physical fitness. The analysis showed that after 1 year of study, there were significant differences in the level of physical fitness improvement between the groups. Pupils in the experimental group were significantly better than those in the control group in most tests, especially the 50-meter run [p = 0.004), toe touch (p = 0.014), standing long jump (p = 0.008), 4 \u00d7 10 m sprint (p = 0.033), and hand strength (p = 0.023) tests. These findings indicated that the Brainball program did not positively affect the pupils' physical fitness development in the experimental period, however, it showed progress in the follow-up, which may indicated long-term positive effects on the pupils' physical fitness development.The main objective of this study was to evaluate the effectiveness of Brainball program on the physical fitness of 7-year-old children in a primary school in Vietnam. The Brainball program is an innovative, comprehensive educational program that encourages and provides opportunities for intensive activities to improve health-related fitness and motor performance skills and enhance achievement learning to improve academic performance in comprehensive content. The study showed that after 20 weeks of the experiment, there was no significant difference in the level of physical development of the pupils in both groups . However, after a year of study, there were significant differences between the two groups. The improvement in physical fitness of the pupils in the experimental group was significantly better than that of the pupils in the control group, especially in 50-meter running . Compared with previous studies, when educational balls were applied in Poland  in case of Vietnamese intervention the time duration (2 times a week 35 min) might have been an issue. Exciting physical activities with colorful balls  could help pupils actively participate in movement, improve coordination, and develop motor skills, but did not impact level of fitness so significantly as the operational time was too short for pupils to absorb and develop fitness. Explanation may come from Rink , who staThe follow-up test results showed that after 1 year of study, the physical fitness of the pupils in the experimental group was significantly improved compared to the pupils in the control group, especially in terms of speed, strength, and flexibility. This suggests an association between the use of Brainballs in physical education classes and the physical development of pupils in the experimental group. Games and exercises with Brainball can be the cause of this relationship. Exciting activities with educational balls have made the class lively and attractive, students actively participate in and acquire knowledge . All theResearchers have previously demonstrated that the development of physical fitness is not only influenced by physical activities and sports, but also by factors such as genetics, environment ; socioecThere are limitations to our study. Firstly, this is the first study to apply for the Brainballs program in physical education classes for students in Vietnam. Teachers and students are very interested in this new method of teaching and learning, but sometimes they are confused and unfamiliar with how to organize and perform exercises. Secondly, the study sample is relatively small, so it is difficult to generalize the research results. Despite its limitations, the study has many advantages. The study used an experimental pedagogical design with two parallel groups conducted in a natural environment. The students voluntarily participated in this study and received special attention from principals, teachers, and parents. During the implementation, classroom and physical education teachers coordinated rhythmically in the content of the curriculum, which is a new thing in the Vietnamese education system. The findings provide further insight into the effectiveness of using educational balls to promote healthy physical development in Vietnamese 7-year-olds' physical education classes. As for the pupils, they had the opportunity to experience new ways of learning and participate in exciting sports activities with Brainballs. This helped increase their interest while learning and fostering the absorption of knowledge. In addition, the results of this study will be the premise for further studies with a broader and deeper scope of research to precisely evaluate the impact of Brainball on the physical fitness development of students.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by Resolution of the Senate Committee on Ethics of Scientific Research at the Wroclaw University of Health and Sport Sciences in Wroclaw. Written informed consent to participate in this study was provided by the participants' legal guardian/next of kin.VP, AR, and MB developed ideas, managed the project, provided critical scholarly guidance for the drafting and interpretation of the manuscript, and critically revised the intellectual content of the manuscript. VP, SW, IC, and MB researched background literature, analyzed data, and wrote the manuscript. All authors approved the final version of the manuscript, ensured the accuracy of the work, and agreed to take responsibility for all aspects of the work."}
{"text": "Background: The American College of Obstetricians and Gynecologists released Committee Opinion No. 736: Optimizing Postpartum Care (CO No. 736) to address severe maternal morbidity and mortality in the United States by outlining recommendations for care in the critical time following birth. This study aimed to evaluate implementation of and barriers to the recommendations of CO No. 736 among obstetricians in south Louisiana.Methods: A survey to general obstetric providers assessed opinions on the CO No. 736 recommendations, implementation of these recommendations, and barriers to implementation. Fisher exact test was used to compare distributions between resident and attending groups. Qualitative, free-text responses about barriers to implementation were organized by common themes and categorized into systemic and patient factors.Results: Of 124 survey responses, 59.7% of respondents reported that they had read CO No. 736. Of the respondents who had read the document, 86.5% believed it was important to implement these recommendations, but only 50.0% had established the recommendations in their practices. Overall, fewer than half (46.8%) of respondents reported actively implementing the recommendation to make contact with postpartum patients at 3 weeks or sooner, but 86.3% reported having comprehensive clinic visits within 12 weeks of delivery. Commonly identified systemic barriers to implementation included the 3-week contact not being common practice, overbooked schedules, and unclear provider expectations. Commonly identified patient factor barriers to implementation included childcare or transportation and no-shows at postpartum appointments.Conclusion: Both resident and attending obstetricians in South Louisiana believe that the CO No. 736 recommendations are important but reported lacking the ability to implement them into clinical practice. CO No. 736 contains 10 recommendations that focus on the continuum of care during pregnancy and the postpartum period and address the timing and content of provider assessments, reproductive life planning, and the management of medical conditions. With growing evidence for improved outcomes based on optimization of postpartum care,5 CO No. 736 was developed to support the implementation of these recommendations into clinical practice. The opinion, developed by the ACOG Presidential Task Force on Redefining the Postpartum Visit and the Committee on Obstetric Practice,1 has been endorsed by key stakeholders in the field of maternal health.In May 2018, the American College of Obstetricians and Gynecologists (ACOG) released Committee Opinion No. 736: Optimizing Postpartum Care (CO No. 736) to address severe maternal morbidity and mortality in the United States by outlining recommendations for care during the critical time following birth.6 We purposely focused on practices caring for an underserved population at risk for higher rates of maternal morbidity and mortality. The primary aim of our study was to survey if obstetricians in south Louisiana are applying or attempting to apply the CO No. 736 recommendations in their office practices. A secondary aim of our study was to identify perceived barriers to implementation of the CO No. 736 recommendations. We were specifically interested in the frequency of postpartum follow-up among providers, considering that CO No. 736 recommends a patient encounter within 3 weeks of delivery. We posited that the majority of obstetrics and gynecology (OB/GYN) providers surveyed were not implementing contact within 3 weeks postpartum but were implementing the recommendation for a comprehensive visit within 12 weeks.The goal of this study was to understand postpartum care practices in south Louisiana, a state with maternal mortality rates higher than the national average.The study team disseminated a 17-item survey  in perso8 REDCap is a secure, web-based software platform designed to support data capture for research studies, providing (1) an intuitive interface for validated data capture; (2) audit trails for tracking data manipulation and export procedures; (3) automated export procedures for data downloads to common statistical packages; and (4) procedures for data integration and interoperability with external sources.Surveys were anonymous, and no identifying information was collected from respondents. In New Orleans, surveying took place from June through September 2019 and was conducted in person at OB/GYN Grand Rounds, department meetings, and resident didactics sessions. In Baton Rouge, surveying took place from October through November 2020. Surveying was conducted in person in the physicians\u2019 lounge, but the majority of the surveys at all sites were collected electronically using a REDCap (Vanderbilt University) survey link. Study data collected on paper were transcribed to REDCap for data aggregation. Study data were collected and managed using REDCap electronic data capture tools.1 Level of training, location of practice, and knowledge of CO No. 736 were assessed in survey questions 1 through 3. All survey participants answered 11 questions (questions 1 through 3 and 10 through 17), but only participants who responded \u201cyes\u201d to having previously read CO No. 736 answered 6 of the questions (questions 4 through 9). Responses were 5-point Likert scales. A blank space after each Likert scale question was provided to allow respondents to voluntarily describe barriers that they faced in implementing that specific recommendation. Question 17 invited free-text responses regarding implementation of the recommendations.The 17 questions on the survey  were infP values <0.05 were considered statistically significant.Responses were grouped into 2 categories: low implementation of recommendations  and high implementation of recommendations . To compare the distribution of answers among resident and attending physicians, Fisher exact test was used to compare the resident and attending physician groups to test differences in training level on implementation of recommendations. This approach avoided the low response counts if Likert score values were tested individually, which would cause the test to behave poorly. Researchers coded qualitative responses based on common themes that fell into 2 categories\u2014systemic factors and patient factors\u2014using a general inductive approach after all results were collected. These qualitative responses are also presented by training level. Because our study was exploratory in nature and without a specific hypothesis to test or preliminary data, a power analysis was not conducted.A total of 124 surveys were collected from resident (n=44) and attending (n=80) OB/GYN providers from an available physician pool of 225, for an overall response rate of 55.1%. The response rates for New Orleans physicians were 52.9% (n=68) and 46.2% (n=78) for residents and attendings, respectively. The response rates for Baton Rouge physicians were 50.0% (n=16) for residents and 69.8% (n=63) for attendings, respectively.In addition to respondent training level and geographic location, P=0.001). Both groups reported high implementation levels for the majority of the recommendations.A composite score (0-7) was calculated for each survey respondent based on their self-reported high or low implementation of each of the 7 primary recommendations of CO No. 736: contact within 3 weeks of giving birth; comprehensive postpartum visit no later than 12 weeks after birth; discussion of postpartum care plan; discussion of reproductive life plans; counseling about future cardiovascular disease risk; counseling for chronic medical conditions; and follow-up visit after miscarriage, stillbirth, or neonatal death. The mean composite score for attending OB/GYN providers was 6.0 \u00b1 1.1, which was slightly higher than the OB/GYN resident mean score of 5.2 \u00b1 1.2 (P=0.04). Both residents (72.7%) and attendings (93.8%) reported high implementation of the recommendation for a comprehensive postpartum visit within 12 weeks following delivery; however, implementation among attendings was significantly higher than among residents (P=0.002).The lowest compliance rate was for the recommendation that patients have contact with a maternal care provider within 3 weeks postpartum. Only 34.1% of OB/GYN residents reported \u201cusually\u201d/\u201calways\u201d having contact with patients within 3 weeks of delivery vs 53.8% of OB/GYN attendings, a statistically significant difference (P=0.013). For the recommendations to discuss reproductive life plans and to counsel patients with pregnancies complicated by diabetes or hypertensive disorders that these disorders are associated with a higher lifetime risk of cardiovascular diseases, high implementation was reported overall by 86.3% and 87.7% of respondents, respectively, with no differences seen between residents and attendings in the reported rates of implementation.The recommendation with the second lowest implementation rate was providing anticipatory guidance and developing a postpartum care plan that addresses infant feeding, \u201cbaby blues,\u201d postpartum emotional health, and the challenges of parenting and postpartum recovery from birth. Overall, 71.0% of respondents reported high implementation of this recommendation, with a significantly lower implementation reported by residents (56.8%) vs attendings (78.8%) (P=1) and follow-up visits after a miscarriage, stillbirth, or neonatal death .The 2 recommendations for which respondents reported the greatest level of high implementation were counseling patients with chronic medical conditions about the importance of timely follow-up  were asked additional questions about implementing the recommendations in their clinical practice . OverallFree-text qualitative data were collected for respondents who answered anything except a score of 5  on the 5-point Likert scale for questions 10 through 16. Comments about the barriers to contacting patients within 3 weeks of delivery (the recommendation with the lowest implementation) were organized by theme\u2014systemic factors or patient factors\u2014and reported as resident and attending physician responses . Both reComments for barriers to implementing a comprehensive postpartum visit by 12 weeks were also organized by theme\u2014systemic factors or patient factors\u2014and reported as resident and attending physician responses . MirroriFor both the 3-week contact and the comprehensive visit by 12 weeks, attendings cited problems with insurance coverage for patients and reimbursement for physicians as barriers to implementation more frequently than residents.Among the surveyed population representing a diverse snapshot of OB/GYN providers in the Baton Rouge and New Orleans areas, our survey study revealed that only 59.7% of the respondents had read the ACOG Committee Opinion No. 736: Optimizing Postpartum Care. Regardless of whether respondents had or had not read CO No. 736, our study revealed that the majority of respondents were implementing the opinion recommendations to a limited degree. We found that the postpartum care recommendations were implemented less frequently among residents compared to attending OB/GYN providers.9 Consequently, the postpartum period must be part of any strategy to reduce maternal morbidity and mortality. Particularly relevant to the surveyed population, Louisiana has one of the highest maternal mortality rates in the country, and the mortality rate is increasing at a higher rate than the rest of the United States.9 Postpartum care practices contribute to maternal morbidity and mortality,1 making this phase of care an important topic for all providers. Credit should be given to CO No. 736 for recommending postpartum care as an ongoing process rather than an isolated visit at 6 to 12 weeks after delivery. Ultimately, full implementation of these recommendations to change the scope of postpartum care must be facilitated by reimbursement policy.Our study provides important insight from OB/GYN providers into feelings about and barriers to implementation of the ACOG postpartum care optimization recommendations. Implementation of these recommendations deserves thoughtful consideration as more than half of pregnancy-related deaths occur after delivery.Free-text responses provided insight into perceived barriers that may be limiting implementation of the CO No. 736 recommendations, and both resident and attending OB/GYN providers provided similar insights. The most commonly reported barriers to implementation of making contact by 3 weeks postpartum and completing a comprehensive visit by 12 weeks were consistent among residents and attendings and included overbooked schedules, unclear roles of providers for these visits, patient no-shows, and patient transportation or childcare. Respondent suggestions for alleviating these barriers included using midlevel providers to schedule appointments, contacting patients during the 3-week postpartum window, and assisting with patient reminders for postpartum visits.Moreover, those who had read CO No. 736 reported feeling that their facility had not implemented the recommendations despite their opinion that the recommendations are important. Institutional support, both endorsement and allocation of resources, for piloting the 3-week postpartum contact is an opportunity to help providers implement this recommendation into their practices.1 with lower attendance rates for patient populations with limited resources.10 At the academic medical centers where the surveys for this study were disseminated, attendance rates for the comprehensive postpartum clinic visit 6 to 12 weeks after delivery were approximately 50% in Baton Rouge and 42% in New Orleans in 2021, both below the national average.An additional common barrier to postpartum care recommendations that deserves discussion is the report of no-shows to postpartum appointments. Approximately 60% of patients attend a postpartum visit in the United States,Incorporation of additional visits or contacts into the standard postpartum visit schedule would require considerable effort to support patient compliance as attendance at the standard 6- to 12-week postpartum visit is already lacking. However, increasing patient contact in the postpartum period stands as a potentially high-reward opportunity among the obstetric population who experience both limited postpartum follow-up and high rates of pregnancy-related morbidity in the postpartum period.Our study has strengths, limitations, and opportunities for future work. A strength of our study is sampling among multiple academic centers (n=3) in 2 regions in south Louisiana. Another strength is receipt of physician responses across several different practice groups and settings, particularly among attending physicians in Baton Rouge and resident physicians in New Orleans. A limitation is the low response rate among all the eligible providers in the regions sampled. Another limitation is the inability to distinguish academic vs private practice responses because of the anonymity of the survey. Regarding future opportunities with this work, many barriers reported are organizational barriers; therefore, future studies should focus on investigating specific organizational opportunities to implementation of postpartum care. Expansion of this work will include statewide dissemination to obstetric providers to increase responses and gain insight outside of urban settings. Future retrospective studies could also be performed that use actual occurrence rates of postpartum care practices rather than provider self-reported rates. Suggestions to begin working toward the implementation of the optimal postpartum care recommendations include supporting obstetric practices in implementing the recommendations from CO No. 736, emphasizing postpartum care at prenatal visits, using support staff to remind patients of their appointments, using midlevel providers to assist with schedule burden, emphasizing postpartum visits in discharge planning, scheduling postpartum telehealth visits and comprehensive visits at discharge, and sending text or email reminders. Advocacy for support of statewide insurance coverage for the 3-week visit could also reduce barriers to implementing that visit. Providing childcare services in clinic and allowing children to accompany the patient for the first postpartum visit could also potentially assist in boosting attendance rates. Looking ahead, we are conducting a quality improvement project in which these insights will be applied to a 3-week postpartum telehealth visit with patients in an academic resident clinic.Our survey results show that the ACOG Committee Opinion No. 736: Optimizing Postpartum Care recommendations are being implemented intermittently by both resident and attending OB/GYN providers in South Louisiana. The barriers are several and vary depending on the provider and training level. This work should serve as a reminder of the importance of postpartum comprehensive care in reducing maternal morbidity and mortality in the state of Louisiana. We also hope that the findings from this study serve as a platform to advocate for the reduction of financial barriers across the state to allow patients to access this recommended model of care."}
{"text": "Esophageal cancer (ESCA) is a common gastrointestinal tumor, and China is one of the regions with a high incidence. Tumor immune-related cells play important roles in the tumorigenesis and development of ESCA. However, the role of tumor immune-related genes in the development of ESCA has not been established.  In this study, weighted gene coexpression network analysis (WGCNA) was used to analyze ESCA gene expression using data from The Cancer Genome Atlas (TCGA) database. Gene expression was associated with clinical traits, and modules related to CD8+T cells, dendritic cells, and regulatory T cells (Tregs) were obtained. P < 0.05). The risk assessment analysis also showed that tumor stage was positively correlated with tumor risk in ESCA (P < 0.05). Therefore, more than 50 pairs of tumor tissues from the T1\u2013T3 stages with different degrees of differentiation and paracancerous tissues were selected to confirm the expression of the three genes using RT-qPCR and immunofluorescence (IF). The infiltration of CD8+ T cells in tumor tissues was lower than that in normal tissues. According to the RT-qPCR, the expressions of IL17\u2009C, TNFSF15, and MIA in moderately and poorly differentiated tissues were significantly higher than those in normal tissues (P < 0.05). In contrast, their expressions were decreased in high differentiated tissues (P < 0.05). Furthermore, IL17C, TNFSF15, and MIA were all positively correlated with immune checkpoint PD-1; TNFSF15 and MIA were also positively correlated with CTLA4, TIGIT, and CD96.  The GO analysis showed that inflammatory chemotaxis networks were activated by cell chemotaxis, chemokine activity, and chemokine binding receptor. Three hub genes  related to tumor immunity and metastasis were identified by WGCNA, and the abnormal expression of each hub gene in ESCA has a poor prognosis, especially in patients with high expression ( In summary, IL17C, TNFSF15, and MIA may act as biomarkers for prognosis in moderately and poorly differentiated ESCAs, and they may be used as predictive genes of immunotherapy associated with CD8+ T cell and Tregs invasion in ESCAs. Esophageal cancer (ESCA) is one of the most aggressive tumors and the sixth leading cause of cancer-related deaths globally. In developing countries, ESCA ranks eighth in incidence and fifth in mortality . It is e+ FoxP3-T cells (TCONV) are capable of inhibiting antitumor immune responses, promoting tumorigenesis, and accelerating metastasis [+ T cells in ESCA and provide a basis for ESCA treatment.Tumor-infiltrating immunocytes have been implicated during different stages of tumorigenesis and development . Activattastasis \u201312. Tumohttps://www.bioconductor.org). At the same time, we converted RNA-seq-FPKM-count to RNA-seq-TPM-count. Finally, only 1078 immune-related genes downloaded from the ImmPort database (https://www.immport.org/) were selected for WGCNA.We obtained RNA expression and clinical data of ESCA from TCGA, including those for 165 tumor specimens and 11 normal specimens. First of all, we used the \u201corg.Hs.eg.db\u201d package in R language to convert the \u201cEnsembl id\u201d into a gene symbol . It can accurately estimate the immune components of the tumor biopsies . Therefohttps://software.broadinstitute.org/gsea/msigdb/index.jsp) were enriched and analyzed using the GSEA_4.1.0. The immune-related pathways were also enriched.According to the median of gene expression, we divided the patients into two groups as follows: high and low expression groups. The hallmark, c2, c5, and c7 gene sets downloaded from the Molecular Signatures Database (R2\u2009=\u20090.85) to construct the weighted adjacency matrix. Furthermore, the weighted adjacency matrix was transformed into a topological overlap matrix (TOM) to estimate the connectivity of genes in the network generation. Based on the differential detection of TOM, we chose a cutting height of 0.25 and a minimum module size of 30 and divided the gene into nine different modules.The R software package \u201cWGCNA\u201d is used to construct a coexpression network with the expression values of 1078 genes to generate sample clusters and detect outliers . \u201cFlashCP < 0.05, an individual module was considered to be significantly related to immune cells. We selected the immune cell subtypes of interest and the module with the highest correlation coefficient and formed the hub module with them. In addition, we calculated the correlation between the genes and clinical features (cor. gene significance) and the correlation between the genes and MEs (cor. Gene module membership) to screen key genes in the hub module.Module eigengenes (MEs) are defined as the principal components of each module. To determine the significance of the modules, we calculated the correlation between the MEs and the level of immune cell infiltration in the tumor tissue using the Pearson test. At We performed multivariate Cox proportional hazards regression analysis to determine the association of clinical parameters, including age, gender, tumor stage, and smoking, with a prognostic assessment of ESCA. Risk scores were calculated using the following formula:In addition, the correlation between three genes and immune cells was, respectively, analyzed by the Pearson correlation coefficient. Furthermore, the same correlation coefficient was used to analyze the correlation between three hub genes and immune checkpoints. Pearson correlation coefficient was calculated using the following formula:https://kmplot.com/analysis/) to analyze the correlation between the panoncogene (hub gene) mutation group and the normal control group in patients with ESCA. In addition, we obtained the mutation rate of hub genes from the cBioportal database .Genes related to inflammation and metabolism were selected as hub genes for the key genes. Next, we used Kaplan\u2013Meier plots  and eosin (Solarbio) and partly with immunofluorescence, incubated with CD8 (Bioss) antibodies, and then examined under a fluorescent microscope.We fixed the collected ESCA tissue as well as paracancerous tissue in 4% paraformaldehyde (PFA) followed by paraffin embedding. The wax blocks were cut into 5\u2009#K1622, Thermo Fisher Science). The cDNAs were amplified by real-time quantitative PCR (RT-qPCR) with specific primers  was used as the luminescent substrate. Finally, we analyzed the melting curve, and the expression of the hub gene was normalized with \u03b2-actin.The tissues were lysed with Trizol reagent (TaKaRa), and the total RNA was extracted. The concentrations of total RNA were detected using a NanoDrop 2000\u2009C spectrophotometer . The total RNA was reverse-transcribed into cDNA by Revertaid First Strand cDNA synthesis reagent , while the infiltration of na\u00efve B-cells in the tumor was higher than that in the normal group (P < 0.05)  . As showP < 0.05); the downregulated IL6 deprivation pathway genes were enriched in tumor tissues (P < 0.05) (+FoxP3-T (TCONV) cell characteristic genes that promote tumor migration and metastasis were enriched in tumors, while nature Treg cell characteristic genes were downregulated  , CD4+Foxegulated , and melegulated .We obtained 1100 gene expression matrices and clinical information related to adaptive immunity in ESCA tissues from the TCGA database, excluding one outlier sample, and constructed a hierarchical clustering tree  for the + T cells, na\u00efve B cells, plasma cells, memory resting CD4 T cells, and regulatory T cells. We selected two modules with the highest correlation in the CD8+ T cells, as denoted by the ME-turquoise  and ME-blue rows . At the same time, we selected two modules with the highest correlation in the regulatory T cells, as denoted by the ME-turquoise  and ME-brown  rows  rows . The bub05) rows .+ memory-activated T cells. In addition, TNFSF15 and MIA expression were positively associated with Tregs and CD4+ memory resting T cells, respectively (P < 0.05) (P < 0.05), and they all presented several alterations including amplification and deletion in patients with ESCA  . In addiith ESCA .P < 0.05). The overall survival duration of patients with IL17C gene abnormalities was shorter, even less than one year (P < 0.05). Moreover, we also analyzed the relationship between the expression of the three genes and prognostic survival using the TCGA database. The results showed that patients with low expression of IL17C, TNFSF15, or MIA lived longer than those patients with high expression of one of them (P < 0.05)  of the patients with the three abnormal hub genes was analyzed using the cBioPortal database. The cBioPortal database contains 2201 clinical samples from eight ESCA-related research websites. As shown in  < 0.05) .P < 0.05). Therefore, tissues from patients with stage-T1 to T4 ESCA who were only treated with surgery were selected to verify these candidate genes. The tumor stage was determined based on the results of pathological HE staining   ; IL17C expression was positively correlated with PD-1 (P < 0.05)  .+FoxP3-T (TCONV) cell characteristic genes that promote tumor migration and metastasis were enriched in tumors, while nature Treg cell characteristic genes were downregulated. Therefore, to determine the characteristics of adaptive immunity-related genes in ESCA, we performed RNA-seq analysis of the ESCA samples and compared the expressions of adaptive immunity-related genes with that of normal tissues, and three modules related to CD8 T cells and Tregs were obtained.CD8+ T cells play an essential role in effective immune responses. In our study, the infiltration of cytotoxic T cells was decreased in tumor tissues, suggesting that tumor immunity was disregulated. Furthermore, CD4\u03b1, which plays an important role under disease conditions, such as cancer and stroke, by maintaining vascular and lymphatic vessel homeostasis [On this basis, IL17C, TNFSF15, and MIA which were related to tumor immunity, invasion, and metastasis were identified. IL17C, an autocrine cytokine, is an important factor in the innate immunity of the epithelium. IL17C may promote or inhibit tumorigenesis by regulating immune cell function [eostasis \u201321. In oeostasis . But in Furthermore, the analysis of immunocyte infiltration in ESCA suggested that CD8+ T cells were significantly lower than that in paracancerous tissue, and we used IF to confirm that CD8+ T cells were reduced in ESCA tissues. PD-1, CTLA4, CD96, and TIGIT are associated with each other in tumor immunity, which are candidates for immunotherapy \u201326. IL17However, there were some limitations in our study, such as the sample size limiting the accuracy of the analysis and the experimental results. Furthermore, more time was needed to review patients with special gene phenotypes and evaluate their prognosis. Finally, the specific mechanisms underlying the actions of these alteration genes in ESCA need to be elucidated in future research.In summary, we used multiple biological information analyses and experiments involving clinical samples to identify potential biomarkers of ESCA. Three hub genes were identified to be abnormally expressed in tumors, and they affected the prognosis of patients with ESCA. The immune cell function regulating IL17C, TNFSF15, and MIA have been identified as potential biomarkers for the evaluation of ESCA diagnosis and prognosis, which may also be predictors of immunotherapy.In this study, CD8+ T cells were decreased in tumor tissues which contributed to the immune imbalance of the tumor. WGCNA was used to identify the characteristics of immune-related genes in ESCA. Three modules related to CD8+ T cells and Tregs were identified, and three hub genes related to the survival duration and prognosis of ESCA were obtained, which are IL17C, TNFSF15, and MIA, and they can be used as therapeutic targets for further study and clinical markers to predict the prognosis of patients."}
{"text": "In vitro studies of the affinity of the synthesized compounds to the protein target have been carried out. Based on these ligands, a series of bimodal conjugates with a combination of different mitosis inhibitors and antiandrogenic drugs were synthesized. The cytotoxicity of the compounds obtained in vitro was investigated on three different cell lines. The efficacy of the two obtained conjugates was evaluated in vivo in xenograft models of prostate cancer. These compounds have been shown to be highly effective in inhibiting the growth of PSMA-expressing tumors.Prostate cancer is the second most common cancer among men. We designed and synthesized new ligands targeting prostate-specific membrane antigen and suitable for bimodal conjugates with diagnostic and therapeutic agents.  Prostate cancer (PCa) is currently the second most newly diagnosed cancer in men . CurrentS)-2-(3-((S)-5-amino-1-carboxypentyl)ureido)pentanedioic acid) and DUPA -2,2\u2032-(carbonylbis(azanediyl))dipentanedioic acid) are used as vector fragments in these studies.Another promising approach in modern cancer therapy and diagnosis is the use of a combination of different agents. A number of examples of different combinations of therapeutic or diagnostic agents, are present in the literatures ,10,11. IIn vitro affinity studies of the resulting compounds have confirmed their ability to bind effectively to PSMA. In order to test the possibility of efficiently producing double conjugates, it was decided to synthesize a series of therapeutic conjugates with a combination of antiandrogenic agents and mitosis inhibitors based on the obtained PSMA ligands. The selection of this mix of drugs is based on a number of studies that have already tested such combinations R = 11.05 min.HPLC-MS: target compound content\u201499.9%, t56H77ClN12O14: m/z calculated for [M+H]+ 1177.5371, found: 1177.5443; m/z calculated for [M+Na]+ 1199.5269, found: 1199.5263.ESI-HRMS: for C6bSynthesis of compound 5b and 7 mL of a mixture of trifluoroacetic acid, triisopropylsilane, water and dichloromethane, 126 mg (80% yield) of compound 6b was isolated individually using reverse phase column chromatography  as a white amorphous powder.From 199 mg (0.129 mmol) of compound 1H NMR  \u03b4, ppm: 12.45 , 9.22 , 8.29 , 8.10 , 7.88\u20137.96 , 7.75\u20137.82 , 7.65 , 7.55\u20137.59 , 7.54 , 7.48 , 7.19\u20137.25 , 7.09\u20137.19 , 7.03 , 6.65 , 6.26\u20136.37 , 4.49\u20134.43 , 4.28\u20134.38 , 4.08 , 3.27\u20133.32 , 3.12\u20133.21 , 3.05\u20133.12 , 2.88\u20133.05 , 2.77\u20132.85 , 2.73 , 2.61\u20132.69 , 2.26\u20132.35 , 2.14\u20132.26 , 1.85\u20131.96 , 1.65\u20131.75 , 1.57\u20131.65 , 1.45\u20131.55 , 1.34\u20131.44 , 1.31 , 1.12\u20131.29 .13C NMR  \u03b4, ppm: 174.55, 174.26, 173.82, 172.71, 172.07, 171.77, 171.59, 171.24, 171.08, 157.32, 155.91, 138.02, 137.94, 131.55, 131.24, 130.03, 129.72, 129.02, 128.64, 128.09, 127.84, 126.29, 120.14, 119.92, 114.99, 55.00, 52.61, 52.17, 51.73, 51.24, 48.23, 46.74 38.66, 36.87, 35.85, 31.90, 31.17, 30.77, 30.58, 29.97, 29.07, 28.26, 27.59, 26.65, 26.29, 24.72, 24.59, 22.31.20D = \u22129.0\u00b0[\u03b1]R = 10.8 min.HPLC-MS: target compound content\u201499.9%, t56H77BrN12O14: m/z calculated for [M+H]+ 1221.49383, found: 1221.4937.ESI-HRMS: for C6cSynthesis of compound 5c and 11 mL mixture of trifluoroacetic acid, triisopropylsilane, water and dichloromethane, 126 mg (80% yield) of compound 6c was isolated individually using reverse phase column chromatography  as a white amorphous powder.From 282 mg (0.180 mmol) of compound 1H NMR  \u03b4, ppm: 12.56 , 9.22 , 8.29 , 8.10 , 7.89\u20137.97 , 7.87 , 7.74\u20137.82 , 7.65 , 7.53\u20137.60 , 7.25\u20137.32 , 7.18\u20137.25 , 7.12\u20137.18 , 7.03 , 6.60\u20136.69 , 6.25\u20136.38 , 4.60\u20134.53 , 4.26\u20134.38 , 3.98\u20134.16 , 3.32 , 3.17 , 3.05\u20133.13 , 2.88\u20133.05 , 2.69\u20132.86 , 2.60\u20132.69 , 2.30\u20132.39 , 2.24\u20132.30 , 2.20 , 1.84\u20131.96 , 1.56\u20131.74 , 1.37\u20131.55 , 1.32 , 1.14\u20131.29 .13C NMR  \u03b4, ppm: 174.50, 174.21, 173.78, 172.62, 171.73, 171.55, 171.23, 171.07, 167.21, 157.30, 155.89, 137.94, 130.04, 129.78, 129.47, 129.02, 128.09, 127.83, 127.38, 126.29, 114.98, 54.97, 52.56, 52.13, 51.67, 48.23, 38.68, 36.88, 35.85, 31.78, 29.91, 28.26, 27.52, 26.62, 24.71, 22.27.20D = \u22129.7\u00b0[\u03b1]R = 10.25 min.HPLC-MS: target compound content\u201499.0%, t56H78N12O16: m/z calculated for [M+H]+ 1187.57315, found: 1187.572.ESI-HRMS: for C6dSynthesis of compound 5d and 6 mL of a mixture of trifluoroacetic acid, triisopropylsilane, water and dichloromethane, 71 mg (76% yield) of compound 6d was isolated individually using reverse phase column chromatography  as a white amorphous powder.From 119 mg (79.6 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 12.55 , 8.30 , 8.17 , 7.89\u20137.99 , 7.87 , 7.77\u20137.84 , 7.56\u20137.68 , 7.22\u20137.30 , 7.20 , 7.15 , 6.26\u20136.36 , 4.60\u20134.53 , 4.39\u20134.48 , 4.31 , 3.98\u20134.17 , 3.32 , 3.12\u20133.25 , 3.07\u20133.12 , 2.97\u20133.07 , 2.87\u20132.97 , 2.73 , 2.59\u20132.69 , 2.30\u20132.38 , 2.13\u20132.30 , 1.85\u20131.96 , 1.64 , 1.50 , 1.41 , 1.12\u20131.34 .20D = \u22127.9\u00b0[\u03b1]R = 10.7 min.HPLC-MS: target compound content\u201499.9%, tm/z calculated for [M+H]+ 1171.57824, found: 1171.5782.ESI-HRMS: for C56H78N12O15: 8a\u2013dGeneral procedure for the preparation of monoconjugates 6a\u2013d was dissolved in DMF. Compound 7 (1.2 eq.) and DIPEA (6 eq.) were added to the solution. The reaction mixture was stirred until the reaction was completed (the reaction was monitored using TLC in a system of 10% methanol in dichloromethane + 1% trifluoroacetic acid). The solvent was removed under reduced pressure. The dry residue was precipitated with acetonitrile, then decanted and the precipitate was washed three times with acetonitrile.1 eq. of compound 8aSynthesis of compound 6a, 51 mg (92.9 \u00b5mol) of compound 7 in the presence of 81 \u00b5L (0.464 mmol) of DIPEA in 10 mL of DMF, 131 mg (85% yield) of compound 8a was obtained as white powder.From 100 mg (77.4 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 8.53 , 8.39 , 8.15 , 8.01 , 7.84\u20137.92 , 7.74 , 7.55\u20137.64 , 7.47 , 7.23\u20137.40 , 7.08\u20137.23 , 6.98\u20137.08 , 6.65 , 6.28\u20136.38 , 6.08 , 5.27\u20135.38 , 4.36\u20134.52 , 4.24 , 3.95\u20134.12 , 3.28 , 3.14 , 2.99\u20133.10 , 2.97 , 2.74\u20132.93 , 2.58\u20132.69 , 2.42 , 2.08\u20132.38 , 1.92\u20132.01 , 1.89 , 1.78 , 1.54\u20131.73 , 1.26\u20131.53 , 1.08\u20131.26 , 0.84\u20131.08 .R = 8.26 min.HPLC-MS: target compound content\u201497%, t8bSynthesis of compound 6b, 40 mg (72.7 \u00b5mol) of compound 7 in the presence of 63 \u00b5L (0.364 mmol) of DIPEA in 9 mL of DMF, 80 mg (80% yield) of compound 8b was obtained as white powder.From 81 mg (60.6 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 8.54 , 8.39 , 8.28\u20138.34 , 8.15 , 7.97\u20138.05 , 7.92\u20137.97 , 7.82\u20137.92 , 7.74 , 7.61 , 7.41\u20137.55 , 7.33 , 6.98\u20137.24 , 6.65 , 6.26\u20136.36 , 6.08 , 5.32 , 4.33\u20134.53 , 4.25 , 3.94\u20134.10 , 3.28 , 2.74\u20133.22 , 2.58\u20132.70 , 2.38\u20132.45 , 2.08\u20132.38 , 1.83\u20132.08 , 1.26\u20131.82 , 1.08\u20131.26 , 0.84\u20131.07 .R = 8.40 min.HPLC-MS: target compound content\u201497%, t8cSynthesis of compound 6c, 16 mg (29.5 \u00b5mol) of compound 7 in the presence of 30 \u00b5L (0.172 mmol) of DIPEA in 5 mL of DMF, 31 mg (78% yield) of compound 8c was obtained as white powder.From 32 mg (24.6 \u00b5mol) of compound R = 4.60 min.HPLC-MS: target compound content\u201499.9%, t85H111N13O19: m/z calculated for [M+H]+ 1618.8119, found: 1618.82.ESI-HRMS: for C8dSynthesis of compound 6d, 24 mg (44.8 \u00b5mol) of compound 7 in the presence of 45 \u00b5L (0.261 mmol) of DIPEA in 7 mL of DMF, 53 mg (88% yield) of compound 8d was obtained as white powder.From 48 mg (37.3 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 8.54 , 8.39 , 8.22 , 8.05 , 7.81\u20137.93 , 7.74 , 7.62 , 7.53 , 7.33 , 7.21\u20137.29 , 7.06\u20137.21 , 6.31 , 6.08 , 5.32 , 4.50\u20134.57 , 4.38 , 4.23 , 4.06 , 4.01 , 3.29 , 2.78\u20133.13 , 2.57\u20132.68 , 2.43 , 2.15\u20132.30 , 1.88\u20131.99 , 1.77 , 1.53\u20131.69 , 1.30\u20131.50 , 1.19 , 0.97 .R = 6.89 min.HPLC-MS: target compound content\u201499.9%, t10a\u2013d conjugates using an azide\u2013alkyne cycloaddition reaction.General procedure for the preparation of bimodal 8a\u2013d (1 eq.) and Docetaxel-alkyne 9 (1.2 eq.) were dissolved in a mixture of DMF and water. The flask was filled with argon, then aqueous solutions of sodium ascorbate (1.2 eq.) and copper sulfate pentahydrate (0.4 eq.) were added to the system. The reaction mixture was stirred for 18 h. Afterwards, EDTA (0.8 eq.) was added and stirred for another three hours with access to oxygen in air. The solvent was removed under reduced pressure, the dry residue was precipitated with acetonitrile and decanted. Then, the product was isolated individually using reverse phase column chromatography using acetonitrile\u2013water mixture as eluent.Monoconjugate 10aSynthesis of compound 8a, 40 mg (44.8 \u00b5mol) of Docetaxel-alkyne 9, 9 mg (44.8 \u00b5mol) of sodium ascorbate, 4 mg (14.9 \u00b5mol) of copper sulfate pentahydrate in 8 mL DMF/water mixture (3/1), followed by addition of 9 mg (29.8 \u00b5mol) EDTA was isolated individually using reverse phase column chromatography  85 mg (90% yield) of compound 10a as white powder.From 60 mg (37.3 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 8.76 , 8.62 , 8.33 , 7.94 , 7.82 , 7.78 , 7.69 , 7.56\u20137.66 , 7.21\u20137.44 , 6.97\u20137.21 , 6.65 , 6.37 , 5.75 , 5.36 , 5.31\u20135.34 , 4.98\u20135.09 , 4.84\u20134.90 , 4.36\u20134.52 , 4.19\u20134.33 , 4.03\u20134.11 , 3.93\u20134.03 , 3.14 , 2.97 , 2.77\u20132.90 , 2.54\u20132\u201370 , 2.37\u20132.46 , 2.30 , 2.20\u20132.26 , 2.19 , 2.15 , 2.04\u20132.08 , 1.97\u20132.02 , 1.72\u20131.97 , 1.68\u20131.72  1.66 , 1.54\u20131.64 , 1.47 , 1.29 , 0.98 , 0.94 .13C NMR  \u03b4, ppm: 209.29, 174.39, 174.05, 173.76, 172.45, 172.18, 171.87, 171.81, 171.57, 171.24, 170.89, 169.66, 169.20, 165.40, 157.34, 155.64, 155.23, 148.53, 145.94, 141.01, 140.76, 140.59, 140.28, 139.83, 137.58, 136.76, 136.10, 134.62, 133.57, 133.35, 133.07, 130.62, 130.28, 129.99, 129.88, 129.58, 128.92, 128.74, 128.64, 128.13, 128.00, 127.39, 127.08, 126.88, 126.38, 126.20, 126.00, 124.92, 122.13, 121.86, 118.22, 114.94, 83.80, 80.22, 78.65, 76.75, 75.03, 74.68, 73.62, 73.24, 71.20, 70.67, 56.96, 56.88, 55.22, 52.86, 52.13, 51.51, 49.49, 46.88, 46.65, 42.84, 37.62, 36.25, 35.68, 34.57, 33.99, 32.62, 31.87, 31.52, 31.18, 30.85, 30.61, 29.75, 28.94, 28.73, 28.03, 27.32, 26.38, 26.21, 24.70, 24.25, 24.09, 22.81, 22.47, 20.76, 20.26, 18.87, 15.92, 13.66, 9.78.R = 9.96 min.HPLC-MS: target compound content\u201499.9%, t133H169ClN14O32: m/z calculated for [M+H]+ 2510.1716, found: 2510.18.ESI-HRMS: for C10bSynthesis of compound 8b, 26 mg (29 \u00b5mol) of Docetaxel-alkyne 9, 6 mg (29 \u00b5mol) of sodium ascorbate, 3 mg (9.68 \u00b5mol) of copper sulfate pentahydrate in 8 mL DMF/water mixture (3/1), followed by addition of 6 mg (19.4 \u00b5mol) EDTA was isolated individually using reverse phase column chromatography  40 mg (65% yield) of compound 10b as white powder.From 40 mg (24.2 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 8.73 , 8.60 , 8.26 , 7.94 , 7.78 , 7.66\u20137.77 , 7.58\u20137.66 , 7.50 , 7.45 , 7.38 , 7.31 , 7.13\u20137.22 , 7.00\u20137.13 , 6.65 , 6.33 , 5.74 , 5.29\u20135.40 , 4.97\u20135.10 , 4.87 , 4.40\u20134.46 , 4.18\u20134.33 , 3.92\u20134.12 , 3.06\u20133.22 , 2.90\u20133.06 , 2.80\u20132.88 , 2.66 , 2.58 , 2.42 , 2.26\u20132.37 , 2.10\u20132.26 , 1.54\u20131.92 , 1.47 , 1.33\u20131.42 , 1.29 , 1.07\u20131.25 , 0.83\u20131.05 .R = 10.06 min.HPLC-MS: target compound content\u201499.9%, t133H169BrN14O32: m/z calculated for [M+H]+ 2554.1211, found: 2554.13.ESI-HRMS: for C10cSynthesis of compound 8c, 10 mg (11.1 \u00b5mol) of Docetaxel-alkyne 9, 2.2 mg (11.1 \u00b5mol) of sodium ascorbate, 1 mg (3.70 \u00b5mol) of copper sulfate pentahydrate in 6.7 mL of DMF/water mixture (3/1), followed by the addition of 2.2 mg (7.41 \u00b5mol) EDTA was isolated individually using reverse phase column chromatography  14 mg (77% yield) of compound 10c as white powder.From 15 mg (9.26 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 8.82 , 8.69 , 8.49 , 7.87\u20138.01 , 7.85 , 7.78 , 7.65\u20137.75 , 7.57\u20137.65 , 7.34\u20137.47 , 7.31 , 7.25 , 7.13 , 7.17 , 6.98\u20137.11 , 6.65 , 6.43 , 5.69\u20135.79 , 5.29\u20135.39 , 4.97\u20135.08 , 4.87 , 4.45\u20134.57 , 4.40 , 4.15\u20134.32 , 4.05 , 3.91\u20134.03 , 3.58\u20133.60 , 3.15 , 2.89\u20133.09 , 2.84 , 2.64 , 2.58 , 2.42 , 2.30 , 2.10\u20132.26 , 2.03\u20132.10 , 1.97 , 1.72\u20131.93 , 1.69 , 1.66 , 1.58 , 1.61 , 1.47 , 1.31\u20131.41 , 1.29 , 1.19 , 1.08 , 0.83\u20131.06 .R = 8.81 min.HPLC-MS: target compound content\u201499.9%, t134H170N14O34: m/z calculated for [M+H]+ 2520.2004, found: 2520.21.ESI-HRMS: for C10dSynthesis of compound 8d, 32 mg (35.9 \u00b5mol) of Docetaxel-alkyne 9, 7 mg (35.9 \u00b5mol) of sodium ascorbate, 3 mg (11.9 \u00b5mol) of copper sulfate pentahydrate in 10.6 mL of DMF/water mixture (3/1), followed by addition of 7 mg (23.9 \u00b5mol) EDTA was isolated individually using reverse phase column chromatography  64 mg (85% yield) of compound 10d as white powder.From 48 mg (29.9 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 8.82 , 8.69 , 8.51 , 7.92\u20137.99 , 7.80\u20137.92 , 7.78 , 7.65\u20137.75 , 7.58\u20137.65 , 7.28\u20137.41 , 7.20\u20137.28 , 7.01\u20137.20 , 6.44 , 5.67\u20135.79 , 5.36 , 5.31 , 4.97\u20135.08 , 4.87 , 4.50\u20134.57 , 4.32\u20134.45 , 4.17\u20134.31 , 3.92\u20134.12 , 3.59 , 3.09\u20133.22 , 2.89\u20133.09 , 2.78\u20132.89 , 2.54\u20132.68 , 2.41 , 2.10\u20132.36 , 1.77\u20132.10 , 1.54\u20131.74 , 1.47 , 1.24\u20131.41 , 1.06\u20131.24 , 0.98 , 0.94 .R = 9.49 min.HPLC-MS: target compound content\u201499.9%, t134H170N14O33: m/z calculated for [M+H]+ 2504.2055, found: 2504.21.ESI-HRMS: for C12a\u2013dGeneral procedure for preparing monomodal conjugates 6a\u2013d (1.1 eq.) and MMAE-alkyne  were dissolved in a mixture of DMF and water. The flask was filled with argon, then aqueous solutions of sodium ascorbate (1.2 eq.) and copper sulfate pentahydrate (0.4 eq.) were added. The reaction mixture was stirred for 18 h. Afterwards, EDTA (0.8 eq.) was added and stirred for three hours with access to oxygen in air. The solvent was removed under reduced pressure, then the dry residue was precipitated with acetonitrile and decanted. Then, the product was isolated individually using reverse phase column chromatography using acetonitrile\u2013water mixture as eluent.Ligand 12aSynthesis of compound 6a, 89 mg (73.2 \u00b5mol) of compound 11, 17 mg (87.8 \u00b5mol) of sodium ascorbate, 6 mg (29.3 \u00b5mol) of copper sulfate pentahydrate in 13.5 mL DMF/water mixture (3/1), followed by addition of 17 mg (58.6 \u00b5mol) EDTA was isolated individually using reverse phase column chromatography  86 mg (49% yield) of compound 12a as white powder.From 104 mg (80.5 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 12.51 , 10.00 , 9.22 , 8.28 , 8.13 , 7.84\u20137.96 , 7.82 , 7.52\u20137.74 , 7.09\u20137.40 , 7.00\u20137.07 , 6.65 , 6.31 , 5.99 , 5.42 , 4.90\u20135.13 , 4.59\u20134.77 , 4.44\u20134.59 , 4.18\u20134.43 , 3.90\u20134.17 , 3.30 , 3.14\u20133.26 , 3.10 , 2.91\u20133.07 , 2.70\u20132.90 , 2.61\u20132.69 , 2.56 , 2.30\u20132.44 , 2.14\u20132.29 , 2.11 , 1.84\u20132.01 , 1.56\u20131.84 , 1.34\u20131.56 , 1.10\u20131.34 , 0.94\u20131.07 , 0.67\u20130.89 .13C NMR  \u03b4, ppm: 174.50, 174.20, 173.77, 172.52, 172.17, 172.11, 171.71, 171.50, 171.34, 171.10, 170.62, 169.85, 168.75, 158.96, 157.29, 155.88, 146.46, 143.69, 141.22, 137.88, 133.41, 133.05, 130.62, 130.26, 130.05, 129.03, 128.18, 128.08, 127.83, 127.77, 127.19, 126.86, 126.68, 126.43, 126.29, 126.09, 124.97, 121.96, 118.81, 114.98, 114.84, 81.64, 74.82, 66.11, 63.29, 60.95, 58.18, 57.56, 57.14, 54.92, 53.18, 52.57, 52.15, 51.66, 50.28, 49.75, 49.18, 47.23, 46.86, 46.26, 43.77, 43.21, 38.71, 37.14, 36.97, 35.81, 35.06, 34.67, 32.28, 31.81, 31.57, 31.21, 30.79, 30.59, 30.47, 29.91, 29.84, 29.34, 29.10, 27.79, 27.54, 26.83, 26.65, 26.29, 25.43, 24.66, 24.37, 23.14, 22.52, 22.26, 19.28, 18.95, 18.77, 18.56, 18.40, 18.24, 15.91, 15.48, 15.33, 15.05, 10.32.R = 11.47 min.HPLC-MS: target compound content\u201499.9%, t120H177ClN22O27: m/z calculated for [M+2H]2+ 1197.64938, found: 1197.645.ESI-HRMS: for C12bSynthesis of compound 6b, 73 mg (59.5 \u00b5mol) of compound 11, 14 mg (71.4 \u00b5mol) of sodium ascorbate, 6 mg (23.8 \u00b5mol) of copper sulfate pentahydrate in 10.8 mL DMF/water mixture (3/1), followed by addition of 14 mg (47.6 \u00b5mol) EDTA was isolated individually using reverse phase column chromatography  60 mg (41% yield) of compound 12b as white powder.From 80 mg (65.5 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 12.52 , 9.99 , 9.20 , 8.24\u20138.37 , 8.11\u20138.15 , 7.84\u20137.96 , 7.82 , 7.59\u20137.70 , 7.51\u20137.59 , 7.48 , 7.08\u20137.35 , 7.03 , 6.65 , 6.29\u20136.33 , 6.00 , 5.41 , 4.95\u20135.14 , 4.62\u20134.73 , 4.23\u20134.53 , 3.38\u20134.23 , 3.08\u20133.26 , 2.78\u20133.08 , 2.70\u20132.78 , 2.60\u20132.69 , 2.52\u20132.60 , 2.15\u20132.42 , 2.11 , 1.84\u20132.04 , 1.63\u20131.84 , 1.33\u20131.58 , 1.11\u20131.33 , 0.89\u20131.08 , 0.65\u20130.89 .13C NMR  \u03b4, ppm: 174.51, 174.22, 173.78, 172.37, 172.09, 171.71, 171.50, 171.35, 171.10, 168.74, 158.96, 157.28, 155.88, 146.45, 143.70, 138.03, 137.88, 131.57, 131.25, 130.05, 129.73, 129.03, 128.65, 128.19, 128.08, 127.83, 126.47, 121.97, 119.93, 114.98, 74.80, 60.95, 60.31, 57.18, 54.92, 54.15, 51.65, 46.86, 43.21, 38.70, 37.48, 36.99, 35.80, 34.67, 31.80, 30.48, 29.91, 29.02, 27.54, 26.65, 26.30, 25.43, 24.65, 24.36, 22.27, 19.28, 18.24, 15.49, 15.32, 10.31.R = 11.68 min.HPLC-MS: target compound content\u201499.9%, t120H177BrN22O27: m/z calculated for [M+2H]2+ 1219.62412, found: 1219.6244.ESI-HRMS: for C12cSynthesis of compound 6c, 93 mg (76.6 \u00b5mol) of compound 11, 18 mg (91.9 \u00b5mol) sodium ascorbate, 8 mg (30.6 \u00b5mol) copper sulfate pentahydrate in 13.5 mL DMF/water mixture (3/1), followed by the addition of 18 mg (61.3 \u00b5mol) EDTA was isolated individually using reverse phase column chromatography  101 mg (55% yield) of compound 12c as white powder.From 100 mg (84.2 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 12.62 , 9.99 , 9.22 , 8.24\u20138.37 , 8.10\u20138.16 , 7.84\u20137.96 , 7.82 , 7.54\u20137.66 , 7.10\u20137.35 , 7.03 , 6.64 , 6.23\u20136.40 , 6.00 , 5.41 , 4.91\u20135.13 , 4.73 , 4.18\u20134.66 , 4.03\u20134.18 , 3.89\u20134.03 , 3.13\u20133.27 , 2.91\u20133.10 , 2.79\u20132.91 , 2.54\u20132.79 , 2.13\u20132.39 , 2.11 , 1.84\u20132.01 , 1.34\u20131.84 , 1.10\u20131.34 , 0.93\u20131.08 , 0.64\u20130.90 .13C NMR  \u03b4, ppm: 174.50, 174.21, 173.77, 172.53, 172.31, 172.10, 171.71, 171.51, 171.34, 171.10, 170.60, 169.91, 169.85, 168.74, 167.21, 158.96, 157.89, 157.28, 155.88, 146.45, 143.77, 143.69, 137.88, 130.05, 129.78, 129.47, 129.02, 128.19, 128.08, 127.83, 127.77, 127.39, 126.67, 126.47, 126.42, 126.28, 121.96, 118.95, 114.98, 89.66, 74.80, 60.95, 60.31, 58.68, 57.57, 57.17, 54.95, 54.14, 53.15, 52.57, 52.12, 51.65, 46.87, 40.44, 38.71, 37.02, 35.81, 34.68, 32.32, 31.78, 31.54, 31.22, 30.80, 30.48, 29.91, 29.84, 29.35, 29.12, 27.53, 26.65, 26.31, 25.43, 25.37, 24.66, 24.36, 23.14, 22.52, 22.25, 19.28, 18.98, 18.24, 15.49, 15.32, 15.05, 10.33.R = 11.32 min.HPLC-MS: target compound content\u201499.9%, t121H178N22O29: m/z calculated for [M+2H]2+ 1202.66378, found: 1202.664.ESI-HRMS: for C12dSynthesis of compound 6d, 47 mg (38.8 \u00b5mol) of compound 11, 9 mg (46.6 \u00b5mol) of sodium ascorbate, 4 mg (15.5 \u00b5mol) of copper sulfate pentahydrate in 9.5 mL DMF/water mixture (3/1), followed by addition of 9 mg (31.1 \u00b5mol) EDTA was isolated individually using reverse phase column chromatography  43 mg (45% yield) of compound 12d as white powder.From 50 mg (42.7 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 12.45 , 9.99 , 8.23\u20138.39 , 8.02\u20138.23 , 7.79\u20138.01 , 7.56\u20137.74 , 7.10\u20137.38 , 6.17\u20136.44 , 6.00 , 4.93\u20135.18 , 4.72 , 4.24\u20134.66 , 3.56 , 3.28\u20133.58 , 3.08\u20133.26 , 2.79\u20133.08 , 2.75 , 2.53\u20132.61 , 2.08\u20132.40 , 1.85\u20132.00 , 1.62\u20131.84 , 1.34\u20131.62 , 1.09\u20131.34 , 0.94\u20131.08 , 0.66\u20130.92 .13C NMR  \u03b4, ppm: 174.55, 174.50, 174.21, 173.78, 172.54, 172.09, 171.75, 171.53, 171.33, 170.94, 168.74, 158.95, 157.28, 146.46, 143.70, 137.83, 129.78, 129.46, 129.37, 129.12, 129.01, 128.18, 128.08, 127.83, 127.77, 127.39, 126.76, 126.45, 121.98, 74.81, 57.14, 54.50, 52.60, 51.65, 46.87, 38.71, 35.83, 31.80, 30.55, 29.91, 29.12, 27.55, 26.65, 26.33, 25.44, 24.70, 23.14, 22.27, 19.28, 18.96, 18.24, 15.49, 15.32, 15.06, 10.32.R = 11.46 min.HPLC-MS: target compound content\u201499.9%, t121H178N22O28: m/z calculated for [M+2H]2+ 1194.66632, found: 1194.6669.ESI-HRMS: for C13a\u2013dGeneral methodology for producing bimodal conjugates 12a\u2013d (1 eq.) was dissolved in DMF to which NHS-ester of Abiraterone  and DIPEA (6 eq.) were added. The reaction mixture was stirred for 20 h, after which the solvent was removed under reduced pressure. The dry residue was precipitated with acetonitrile, the resulting precipitate was decanted and washed three times with acetonitrile. The solvent residue was removed under reduced pressure.Monoconjugate 13aSynthesis of compound 12a, 9 mg (17.0 \u00b5mol) of compound 7 and 15 \u00b5L (85.1 \u00b5mol) of DIPEA, 38 mg (95% yield) of compound 13a was obtained as white powder.From 34 mg (14.2 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 12.46 , 9.99 , 9.20 , 8.58 , 8.42 , 8.33 , 8.03\u20138.21 , 7.83\u20138.01 , 7.81 , 7.68\u20137.78 , 7.51\u20137.67 , 7.08\u20137.40 , 7.04 , 6.64 , 6.23\u20136.37 , 6.10 , 5.98 , 5.42 , 5.35 , 4.91\u20135.15 , 4.59\u20134.77 , 4.16\u20134.59 , 4.03\u20134.16 , 3.88\u20134.03 , 3.57 , 3.13\u20133.26 , 3.11 , 2.90\u20133.08 , 2.77\u20132.89 , 2.60\u20132.70 , 2.53\u20132.60 , 2.43 , 2.13\u20132.40 , 1.85\u20132.13 , 1.74\u20131.84 , 1.56\u20131.74 , 1.44\u20131.56 , 1.11\u20131.43 , 0.92\u20131.11 , 0.67\u20130.92 .13C NMR  \u03b4, ppm: 174.50, 174.20, 173.77, 172.38, 172.31, 172.10, 171.79, 171.58, 171.48, 171.34, 171.09, 170.56, 169.90, 169.84, 168.75, 158.92, 157.27, 155.86, 151.01, 147.84, 147.20, 146.40, 143.69, 141.22, 140.81, 139.87, 137.86, 133.33, 133.05, 132.16, 130.59, 130.24, 130.00, 129.01, 128.17, 128.05, 127.94, 127.76, 127.21, 126.75, 126.42, 126.25, 126.08, 124.96, 123.43, 121.98, 121.92, 118.98, 114.98, 85.43, 74.81, 73.17, 60.94, 60.30, 58.67, 58.19, 57.59, 57.14, 56.99, 54.99, 54.17, 53.17, 52.88, 52.17, 51.68, 49.63, 49.18, 47.16, 46.84, 46.66, 46.27, 43.78, 43.22, 38.44, 37.71, 36.42, 36.31, 35.77, 34.67, 34.55, 32.29, 31.87, 31.54, 31.33, 30.96, 30.75, 30.57, 30.45, 29.95, 29.89, 29.36, 29.10, 28.91, 27.80, 27.60, 27.35, 26.84, 26.30, 25.41, 24.66, 24.36, 23.14, 22.91, 22.35, 20.40, 19.27, 18.93, 18.58, 18.24, 16.28, 15.87, 15.48, 15.30, 15.04, 10.43.R = 1.64 min.HPLC-MS: target compound content\u201499%, t148H210ClN23O30: m/z calculated for [M+2Na]2+ 1435.25435, found: 1435.2559.ESI-HRMS: for C13bSynthesis of compound 12b, 10 mg (17.2 \u00b5mol) of compound 7 and 16 \u00b5L (86.1 \u00b5mol) of DIPEA, 33 mg (80% yield) of compound 13b was obtained as white powder.From 35 mg (14.4 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 12.40 , 9.98 , 9.21 , 8.58 , 8.39\u20138.46 , 8.32 , 8.10\u20138.19 , 7.96\u20138.10, , 7.82\u20137.96, , 7.78\u20137.82 , 7.74 , 7.50\u20137.65 , 7.47 , 7.08\u20137.41 , 7.04 , 6.64 , 6.24\u20136.36 , 6.10 , 5.97 , 5.32\u20135.45 , 4.92\u20135.12 , 4.56\u20134.79 , 4.18\u20134.51 , 3.90\u20134.14 , 3.51\u20133.60 , 3.08\u20133.24 , 2.90\u20133.06 , 2.80\u20132.90 , 2.52\u20132.70 , 2.15\u20132.35 , 1.85\u20132.13 , 1.74\u20131.84 , 1.63\u20131.74 , 1.55\u20131.63 , 1.44\u20131.55 , 1.29\u20131.44 , 1.12\u20131.28 , 0.94\u20131.05 , 0.70\u20130.88 .13C NMR  \u03b4, ppm: 174.53, 174.24, 173.81, 172.38, 172.11, 171.80, 171.60, 171.49, 171.35, 171.12, 170.57, 169.85, 168.76, 158.93, 157.28, 155.87, 151.00, 147.84, 147.19, 146.40, 143.69, 139.87, 137.85, 133.33, 132.14, 131.56, 131.24, 130.01, 129.73, 129.01, 128.66, 128.18, 128.06, 127.94, 127.83, 127.77, 126.74, 126.47, 126.27, 123.45, 121.99, 120.15, 119.93, 118.96, 114.99, 81.64, 74.80, 73.17, 60.95, 60.31, 57.59, 57.17, 56.99, 55.02, 54.17, 53.17, 52.89, 52.13, 51.69, 49.63, 46.83, 46.65, 46.28, 43.78, 43.23, 38.44, 37.71, 36.41, 36.31, 35.83, 34.66, 34.54, 31.80, 31.33, 30.96, 30.45, 29.89, 29.36, 29.10, 28.91, 27.74, 27.62, 27.35, 26.84, 26.32, 25.41, 24.73, 24.65, 24.36, 22.92, 22.36, 20.40, 19.27, 18.94, 18.55, 18.25, 16.28, 15.86, 15.65, 15.48, 15.31, 15.05, 10.32.R = 9.27 min.HPLC-MS: target compound content\u201499.9%, t148H210BrN23O30: m/z calculated for [M+2Na]2+ 1457.22909, found: 1457.2319.ESI-HRMS: for C13cSynthesis of compound 12c, 14 mg (25.0 \u00b5mol) of compound 7 and 22 \u00b5L (0.125 mmol) of DIPEA, 49 mg (83% yield) of compound 13c was obtained as white powder.From 50 mg (20.8 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 12.47 , 9.98 , 9.21 , 8.58 , 8.42 , 8.24\u20138.36 , 8.10\u20138.17 , 8.02\u20138.10  7.82\u20138.01 , 7.81 , 7.67\u20137.77 , 7.53\u20137.64 , 7.22\u20137.33 , 7.16\u20137.22 , 7.10\u20137.16 , 7.00\u20137.07 , 6.64 , 6.25\u20136.34 , 6.10 , 5.97 , 5.30\u20135.44 , 4.91\u20135.10 , 4.68\u20134.87 , 6.50\u20134.61 , 4.39\u20134.50 , 4.30\u20134.39 , 4.16\u20134.30 , 4.04\u20134.14 , 3.89\u20134.03 , 3.50\u20133.60 , 3.12\u20133.24 , 3.10 , 2.90\u20133.07 , 2.80\u20132.89 , 2.61\u20132.69 , 2.56 , 2.41\u20132.46 , 2.16\u20132.34 , 1.84\u20132.07 , 1.74\u20131.83 , 1.56\u20131.74 , 1.29\u20131.56 , 1.11\u20131.29 , 0.95\u20131.05 , 0.70\u20130.89 .13C NMR  \u03b4, ppm: 174.55, 174.22, 173.79, 172.37, 172.31, 172.12, 171.79, 171.60, 171.49, 171.35, 171.11, 170.57, 169.84, 168.75, 167.22, 158.93, 157.28, 155.86, 151.01, 147.81, 147.16, 146.40, 143.76, 143.69, 139.86, 137.85, 133.30, 130.01, 129.77, 129.46, 129.01, 128.18, 128.06, 127.94, 127.82, 127.77, 127.39, 126.67, 126.47, 126.27, 121.98, 121.92, 118.98, 114.98, 85.42, 74.80, 73.17, 60.95, 60.31, 58.18, 57.60, 57.14, 56.98, 55.07, 53.18, 52.89, 52.15, 51.68, 49.62, 49.18, 46.83, 46.65, 46.27, 43.22, 38.43, 37.71, 36.41, 36.31, 35.86, 34.67, 34.53, 31.82, 31.50, 31.33, 30.96, 30.74, 30.46, 29.94, 29.88, 29.35, 28.90, 27.58, 27.34, 26.84, 26.23, 25.41, 24.65, 24.38, 23.14, 22.91, 22.37, 20.39, 19.27, 18.93, 18.41, 18.25, 16.27, 15.87, 15.65, 15.48, 15.31, 15.05, 10.32.R = 8.91 min.HPLC-MS: target compound content\u201499.9%, t149H211N23O32: m/z calculated for [M+2Na]2+ 1440.26875, found: 1440.2652.ESI-HRMS: for C13dSynthesis of compound 12d, 11 mg (19.1 \u00b5mol) of compound 7 and 17 \u00b5L (95.5 \u00b5mol) of DIPEA, 35 mg (78% yield) of compound 13d was obtained as white powder.From 38 mg (15.9 \u00b5mol) of compound 1H NMR  \u03b4, ppm: 12.53 , 9.98 , 8.57 , 8.42 , 8.05\u20138.36 , 7.79\u20138.01 , 7.74 , 7.53\u20137.70 , 7.02\u20137.40 , 6.30 , 6.10 , 5.98 , 5.35\u20135.42 , 4.93\u20135.14 , 4.72 , 4.34\u20134.66 , 4.16\u20134.33 , 3.88\u20134.16 , 3.14\u20133.25 , 2.79\u20133.14 , 2.53\u20132.70 , 2.43 , 1.84\u20132.40 , 1.10\u20131.84 , 0.93\u20131.10 , 0.68\u20130.93 .13C NMR  \u03b4, ppm: 174.53, 174.23, 173.80, 172.10, 171.80, 171.62, 171.35, 170.96, 170.57, 169.85, 168.74, 156.93, 150.99, 147.18, 146.40, 143.69, 139.86, 137.93, 137.82, 133.34, 129.76, 129.46, 129.08, 129.00, 128.18, 128.07, 127.83, 127.38, 126.68, 126.46, 123.45, 122.00, 121.92, 118.93, 81.75, 77.71, 74.80, 73.17, 60.95, 60.31, 57.59, 57.14, 56.98, 54.99, 54.67, 53.17, 52.92, 49.62, 46.84, 46.64, 46.26, 43.24, 37.70, 36.40, 36.31, 35.79, 34.54, 31.81, 31.54, 31.33, 30.96, 30.46, 29.87, 29.34, 29.12, 28.91, 27.63, 27.34, 26.85, 26.32, 25.42, 24.65, 24.37, 23.14 CH2 , 22.91, 20.40, 19.27, 18.93, 18.42, 18.25, 16.27, 15.48, 15.31, 15.05, 10.31.R = 8.39 min.HPLC-MS: target compound content\u201496%, t149H211N23O31: m/z calculated for [M+2Na]2+ 1432.27129, found: 1432.2719.ESI-HRMS: for C15Synthesis of a bimodal conjugate with the MMAE/Enzalutamide drug pair 12a and 24 mg  of compound 14 were dissolved in 20 mL of DMF. To the resulting solution, 38 \u03bcL  of DIPEA was added. The reaction mixture was stirred for 24 h, after which the solvent was removed under reduced pressure. Then, the product was precipitated with acetonitrile, decanted and the resulting precipitate was washed with acetonitrile. The target product was isolated individually using reverse phase column chromatography using a mixture of acetonitrile and water  as eluent. 20 mg (20% yield) of compound 15 was obtained as white powder.86 mg  of compound 1H NMR  \u03b4, ppm: 12.49 , 9.99 , 9.20 , 8.35\u20138.62 , 8.28 , 8.02\u20138.20 , 7.70\u20137.98 , 7.49\u20137.69 , 6.94\u20137.45 , 6.63 , 6.29 , 5.97 , 5.29\u20135.47 , 5.03 , 4.72 , 4.18\u20134.65 , 3.87\u20134.15 , 3.50\u20133.80 , 3.08\u20133.26 , 2.75\u20133.07 , 2.62\u20132.74 , 2.03\u20132.36 , 1.90 , 1.63\u20131.83 , 1.09\u20131.61 , 0.99 , 0.64\u20130.89 .R = 9.20 min.HPLC-MS: target compound content\u201499.9%, t140H188ClF4N25O29S: m/z calculated for [M+2Na]2+ 1436.15673, found: 1436.1587.ESI-HRMS: for C2 vial, the cells were washed with PBS buffer and incubated for 5 min with 0.25% trypsin (1 mL). Trypsin was inactivated with complete growth medium (2 mL), washed with PBS, transferred 106 cells to a test tube, and 500 \u03bcL of lysis buffer  and 1\u00d7 Proteinase Inhibition cocktail) was added. The suspension was incubated for 30 min on ice and sonicated  on ice to avoid overheating. The suspension was centrifuged for 10 min at 1000g at 4 \u00b0C, and the supernatant was used in further analysis.LNCaP cells were cultured in RPMI medium with 10% FBS , 1xGlutamax (Gibco) and 1x penicillin-streptomycin mixture . To suspend the cells, growth medium was removed from the 25 cm\u00ae Red reagent stock solution, 1.25 \u03bcL HRP stock solution, 8 \u03bcL L-glutamate oxidase, 2.5 \u03bcL L-glutamate pyruvate transaminase, 0.5 \u03bcL L-alanine, 483 \u03bcL 1\u00d7 reaction buffer. Incubation was performed for 1 h at 37 \u00b0C. The fluorescence of resorufin produced by conjugated glutamate detection kit reactions was detected on a VICTORX5 multidetector plate  at an excitation length of 555 nm and detection at 580 nm. As a control for endogenous glutamate levels with replacement of the NAAG solution with water.The inhibition by PSMA ligands was analyzed using a non-radioactive protocol with detection of the glutamate released during the reaction. LNCaP cell line extract (10 \u03bcL) was mixed with 2 \u03bcL of the appropriate compound preparation. A series of dilutions of 2 nM-100 \u03bcM compounds was used for initial testing, with dilution steps of 3\u20135 times. To the resulting mixture, 1 \u03bcL of 100 \u03bcM NAAG solution was added. The mixture was incubated for 2 h at 37 \u00b0C. After incubation, the mixture was doubled with reaction buffer (13 \u03bcL) from the Amplex Red Glutamic Acid Kit , and the multi-component glutamate detection reaction mixture prepared according to the manufacturer\u2019s protocol (26 \u03bcL) was added. Amplex Red stock solution: 5 \u03bcL Amplex2. Later, the culture medium from each well was removed and 20 \u03bcL of MTS reagent  were added to each well with 100 \u03bcL of new culture medium. After 4 h incubation at 37 \u00b0C in darkness, the absorbance of the solution was measured at 490 nm wavelength using Thermo Scientific Multiskan GO spectrometer. Cell viability was calculated as a percentage compared to control cells. The absorbance of MTS reagent in culture medium without cells was taken as zero. MTS assay revealed 100% cell death after incubation with 30% DMSO. Experiments were performed in triplicates. Data were analyzed using Prism 9\u2014GraphPad version 9.2.0 software. p values < 0.05 were considered significant.The cytotoxicity of the investigated substances was tested using the MTS assay  with somAll animal procedures were conducted in strict adherence to the European Convention for the Protection of Vertebrate Animals Used for Experimental and other Scientific Purposes (ETS 123), Strasbourg, 1986. The procedures with animals were reviewed and approved by the bioethical committee of the National Medical Research Radiological Centre of the Ministry of Health of the Russian Federation, Protocol No. 23 from 22 June 2021.BALB/c nu/nu (nude) mice, males with body weights of 21\u201325 g (aged 8\u221210 weeks) were used. Animals were obtained from SPF-vivarium of the Center for Collective Use in Novosibirsk. All animals came with a veterinary passport and a certificate of quality.2 vials  in RPMI-1640 medium  with the addition of 2 mM L-glutamine  and 10% fetal calf serum  under standard conditions of cultivation (in a humidified atmosphere at 37 \u00b0C and 5% CO2). Cells of 6\u201310 passages were used to inoculate the animals. Cell suspension was prepared with a concentration of 5 \u00d7 106 cells in 0.05 mL of the 22Rv1 medium and in 0.1 mL of the PC-3 medium. 22Rv1 cells were inoculated into animals in Matrigel . Manipulations with Matrigel were performed on a refrigerated plate using precooled materials, tubes and instrumentation. For animal administration, 50 \u03bcL of the cell suspension (5 \u00d7 106 cells) was transferred to a chilled tube containing 50 \u03bcL of Matrigel; after mixing, the cellular material  was injected subcutaneously into the groin area of the animal. To obtain subcutaneous xenograft PC-3, a 5 \u00d7 106 suspension of tumor cells was inoculated subcutaneously into the inguinal cavity of male mice in a volume of 0.1 mL.Two cell lines were used: human prostate carcinoma 22Rv1 and prostate adenocarcinoma PC-3 (ATCC collection). Cells were cultured in 75 cmTissue samples obtained by the autopsy of animals on 14\u201321 days after cell inoculation were fixed in neutral buffered 10% formalin and encased in paraffin after a standard histological examination. Serial tissue sections with a 4 \u03bcm thickness were prepared. For histological analysis, the sections were stained with hematoxylin and eosin (H&E) according to the standard technique.Polyclonal rabbit antibodies Ab58779  were used to detect PSMA expression at a dilution of 1:100. Sections were stained using a common indirect immunoperoxidase assay technique. To demask the antigen, glasses with deparaffinized sections were incubated in 0.1 M sodium citrate buffer (pH 6.0) at 95 \u00b0C for 20 min. The system of secondary reagents included biotinylated polyclonal antibodies to rabbit immunoglobulins , streptavidin conjugate with horseradish peroxidase  and the chromogenic substrate Liquid DAB + Substrate Chromogen System . Non-specific rabbit immunoglobulins  were applied to control sections instead of primary antibodies. After the completion of the reaction, cells and sections were stained with hematoxylin and encapsulated in Canada balsam. Micropreparations were analyzed under an Olympus BX51 microscope equipped with an image documentation system.3. As a control substance, 0.9% sodium chloride solution was used. Experimental groups included five animals each. Conjugates 13a, 15, I and MMAE were formulated with Pluronic F-127 (the compound/Pluronic F-127 F weight ratio was 1:5). The mixture was dissolved in DMSO  and diluted with hemodesum (30% low-molecular-weight polyvinylpyrrolidone (Mw = 8000 \u00b1 200) saline infusion solution). The presence of tumors and their sizes, as well as the body weights of the mice, were recorded every five days during the observation of the animals. The antitumor effect was assessed by comparing the tumor volumes in the experimental and control groups as well as the amount of tumor growth inhibition .To study the antitumor efficacy, conjugates were administered intravenously at a dose of 132.3 nM/kg to tumor-bearing mice three times at five-day intervals; administration was started 7\u22128 days after cell inoculation, and the tumor size was 70\u221290 mm2 inhalation chamber . All animals were euthanized either once the tumor volumes in the control group reached 2500 mm3 or due to the presence of necrosis or ulceration unrelated to tumor growth.In line with humane principles, animals were euthanized by placing mice in a COt-test or Mann\u2013Whitney U-test were used to assess the reliability of differences between the groups, depending on the nature of the distribution of the trait in the groups.The data were statistically processed using the Statistica 8.0 software package . Group arithmetic mean (M) and standard error of the mean (m) as well as median (Me) were calculated for all quantitative data. Student\u2019s 1, d2 and d3 are the three mutually perpendicular dimensions of the tumor.Tumor volume was calculated using Formula (1):k and Vo are average tumor volumes in the experimental and control groups, respectively.TGI was calculated according to Formula (2):6a\u2013d), suitable for the creation of various bimodal conjugates targeting PCa cells. The introduction of a lysine residue into the structure of the linker peptide fragment did not lead to a significant decrease in the affinity to the protein target. We proposed a new bimodal conjugate preparation technique and used it to synthesize a series of bimodal conjugates based on ligands 6a\u2013d with Docetaxel/Abiraterone drug pairs. In vitro cytotoxicity studies of these compounds showed the selective effect of these drugs on PCa cells with a range of PSMA expression levels. However, the cytotoxicity values were rather moderate. Subsequently, we performed the synthesis of four bimodal conjugates with the Abiraterone/MMAE drug pair and one conjugate with the Enzalutamide/MMAE drug pair. A further optimization of the synthetic route was carried out to obtain these five compounds. Subsequent in vitro studies showed that the obtained compounds show toxicity comparable to that of the Monomethyl Auristatin E conjugate previously described in the literature. Further in vivo studies in xenograft models of PCa demonstrated that the two bimodal conjugates 13a and 15 had efficacies comparable to the previously described conjugate with MMAE and were superior to the free MMAE. By using PSMA expressing and PSMA non-expressing models, we confirmed a further significant increase in the efficacy of such compounds on PSMA-expressing PCa cells.In this work, we synthesized four new PSMA ligands ("}
{"text": "Furthermore, compounds B4 and D4 exhibited lower hepatotoxicity than tacrine in cell viability, apoptosis, and intracellular ROS production for HepG2 cells. These properties of compounds B4 and D4 suggest that they deserve further investigation as promising agents for the prospective treatment of AD.A series of OA-tacrine hybrids with the alkylamine linker was designed, synthesized, and evaluated as effective cholinesterase inhibitors for the treatment of Alzheimer\u2019s disease (AD). Biological activity results demonstrated that some hybrids possessed significant inhibitory activities against acetylcholinesterase (AChE). Among them, compounds B4 (  Acetylcholinesterase inhibitors (AChEIs), the first drugs used in the treatment of AD, can enhance the concentration of ACh in the synaptic cleft and improve behavioral disorders in AD patients. Five AChEIs  have bee,,,The research of traditional Chinese medicine (TCM) in China has a long history and resource advantage. TCM treatment is characterized by integrity and multi-targets. Therefore, starting from natural active ingredients, is very beneficial to the treatment of AD with complex and multiple etiologies. Many natural products have significant therapeutic effects on AD, such as flavonoids, coumarins, alkaloids, phenylpropanoids, triterpenoid saponins, etc. Oleanolic acid OA, , a bioacIt was demonstrated by X-ray crystallography that AChE contains two binding sites: the catalytic active site (CAS) and the peripheral anionic site (PAS) connected by a 20\u2009\u00c5 deep hydrophobic gorge.3a\u2013g were obtained from commercial methyl anthranilate by hydrolysis, condensation, and chlorination reactions. And then, target compounds A1\u2013G5 were synthesized via the reaction of diamine intermediates 4a1-4g5 and the commercial OA. The structures of all newly synthesized compounds were confirmed by various methods of spectroscopic analysis, such as 1H NMR, 13C NMR, and ESI-MS.As shown in hAChE and hBuChE inhibitory activities of OA-tacrine hybrids were measured by Ellman\u2019s method using tacrine as reference compound.50 values and selectivity index (SI) values are shown in 50 values of B1-4, D1-5, and F1-5, compounds with Cl or Br substitution from the benzene ring of tacrine performed much better activities than that with F substitution in hAChE inhibition. Among them, compound D4  with Br substitution showed the most potent inhibitory activity and selectivity for hAChE, which was stronger than the reference compound tacrine . Compounds B4  and D4 with R1-position substitution had more potent hAChE inhibitory activities than compounds C5  and E4  with R2-position substitution. Compounds G1-5 with R2-position substitution had more potent hBuChE inhibitory activities. Among them, G1  with F substitution showed the most potent inhibitory activity and selectivity for hBuChE.The To gain insights into the binding patterns of these compounds with the AChE enzymes, the molecular modeling study based on AChE (PDB code: 2CKM) was performed using the docking program, AutoDock 4.2 package with Discovery Studio 2.0. As shown in hAChE inhibitory activities, were selected as representative compounds to be evaluated for potential cytotoxic effects at the concentrations of 25, 50, 100\u2009\u03bcM. OA and tacrine were used as the reference. As shown in The safety is extraordinarily important for the CNS drugs, so the potential toxicity effect of OA-tacrine hybrids was investigated on SH-SY5Y cells and HepG2 cells by Cell Counting Kit-8 (CCK-8) assay. Compounds B1, B4, and D4, which had more potent As mentioned above, hepatotoxicity is a major side effect for tacrine. Considering hepatoprotective efficacy of OA, the strategy adopted for the design of OA-tacrine hybrids in this work. To further investigate the hepatotoxicity of hybrids, AnnexinV/PI double staining method was used to evaluate the effects of compounds B4 and D4 on cell apoptosis at the concentration of 50\u2009\u03bcM. As shown in ,.Studies have shown that the hepatotoxicity induced by tacrine mainly resulted in elevating the levels liver transaminase, decreasing albumin concentration and inducing ROS in hepatocyte hAChE, IC50 = 14.37\u2009\u00b1\u20091.89\u2009nM; SI > 695.89) and D4  showed more potent inhibitory activities and selectivities for hAChE, which were stronger than the reference compound tacrine . The molecular modeling study has been done to gain insights into the binding patterns of these compounds with the AChE enzymes. More importantly, the cytotoxicity tests showed that compounds B4 and D4 had low cytotoxic activity toward SH-SY5Y cells and HepG2 cells. Besides, these compounds showed lower hepatotoxicity in HepG2 cells by inducing less cell apoptosis and intracellular ROS than tacrine. These properties highlighted that compounds B4 and D4 with high AChE inhibitory activities, low neurotoxicity and hepatotoxicity could be considered as potential agents for the development of anti-AD drugs.In summary, a series of OA-tacrine hybrids with the alkylamine linker was designed and synthesized as effective ChEs inhibitors against AD. Among the synthesized compounds, compounds B4 . 1H NMR and 13C NMR spectra were measured on a Bruker ACF-500 spectrometer at 25\u2009\u00b0C and referenced to TMS. Chemical shifts are reported in ppm (\u03b4) using the residual solvent line as internal standard. Splitting patterns are designed as s, singlet; d, doublet; t, triplet; m, multiplet. Mass spectra were obtained on a MS Agilent 1100 Series LC/MSD Trap mass spectrometer (ESI-MS).All chemicals (reagent grade) used were purchased from Sino pharm Chemical Reagent Co., Ltd. (China). Reaction progress was monitored using analytical thin layer chromatography (TLC) on precoated silica gel GF254  plates and the spots were detected under UV light (254\u2009nm). Column chromatography was performed on silica gel (90\u2013150\u20091a\u2013g (5.0\u2009mmol) were dissolved in 20% NaOH aqueous solution stirred for 5\u2009h, adjusted the pH to 2, filtered and dried to obtain anthranilic acid 2a\u2013g. Then under ice bath (0\u2009\u00b0C), slowly add compound 2a\u2013g (5.0\u2009mmol) and cyclohexanone (6.0\u2009mmol) to POCl3 (15\u2009ml). 5\u2009min later, removed the ice bath and stirred at 90\u2009\u00b0C with refluxing for 5\u2009h, adjusted the pH to 10, extracted with dichloromethane and subjected to column chromatography (petroleum ether: ethyl acetate = 10: 1).Commercial methyl anthranilate 1H NMR  \u03b4 8.12 , 7.94 , 7.75 , 7.64 , 3.04 , 2.96 , 1.88 ; ESI-MS m/z 218.1[M\u2009+\u2009H]+.White solid , yield 82.00%. 1H NMR  \u03b4 8.08 , 7.76 , 7.42 , 3.20 , 3.00 , 1.95 ; ESI-MS m/z 252.1[M\u2009+\u2009H]+.Yellow solid , yield 78.03%. 1H NMR  \u03b4 7.29\u2009\u2212\u20097.23 , 7.06 , 6.93 , 2.78 , 2.15\u2009\u2212\u20092.06 , 1.95\u2009\u2212\u20091.88 , 1.41 ; ESI-MS m/z 252.1[M\u2009+\u2009H]+.Yellow solid , yield 74.10%. 1H NMR  \u03b4 8.18 , 8.01 , 7.60 , 3.12 , 2.98 , 1.95 ; ESI-MS m/z 295.9[M\u2009+\u2009H]+.Yellow solid , yield 86.03%. 1H NMR  \u03b4 8.15 , 7.99 , 7.36 , 3.24\u2009\u2212\u20093.17 , 3.07\u2009\u2212\u20092.99 , 1.96 ; ESI-MS m/z 295.9[M\u2009+\u2009H]+.Yellow solid , yield 83.97%. 1H NMR  \u03b4 8.15 , 7.60 , 7.31 , 3.10 , 2.99 , 1.94 ; ESI-MS m/z 236.1[M\u2009+\u2009H]+.Brown solid , yield 70.02%. 1H NMR  \u03b4 7.93 , 7.45 , 7.35 , 3.18 , 3.02 , 1.95 ; ESI-MS m/z 236.1[M\u2009+\u2009H]+.Brown solid , yield 64.03%. 3a\u2013g (1.0\u2009mmol), diaminoalkanes (6.0\u2009mmol) of various lengths  and KI (0.1\u2009mmol) were mixed and dissolved in ethylene glycol (10\u2009ml). Heat up to 160\u2009\u00b0C and stirred for 8h, then extracted with dichloromethane and concentrated to obtain brown oil diamine intermediates 4a1\u20134g5. Meanwhile, oleanolic acid (1.1\u2009mmol) was dissolved in THF with HATU (1.1\u2009mmol) and DIPEA (2.2\u2009mmol) at room temperature and stirred for 0.5h. Then added brown oil diamine intermediates 4a1\u20134g5 to them. About 3-5h later, concentrated to column chromatography (dichloromethane: Methanol = 20: 1).Tacrine derivatives 1H NMR  \u03b4 12.18 , 8.23 , 7.87 , 7.83 , 7.69 , 7.51\u2009\u2212\u20097.46 , 5. 46 , 3.97 , 3.64 , 3.44 , 3.26\u2009\u2212\u20093.18 , 3.12 , 3.02 , 2.63 , 2.59 , 2.08\u2009\u2212\u20091.98 , 1.95\u2009\u2212\u20091.90 , 1.86 , 1.76 , 1.73\u2009\u2212\u20091.66 , 1.58\u2009\u2212\u20091.52 , 1.44 , 1.25 , 1.14 , 0.97 , 0.90 , 0.81 , 0.75 , 0.70 ; 13C NMR  \u03b4 156.22, 150.44, 143.38, 138.33, 132.82 (C6-Tacrine), 129.84 (C5-Tacrine), 129.80 (C7-Tacrine), 125.35 (C8-Tacrine), 124.72, 123.72, 119.79, 115.50, 111.43, 54.94, 54.84, 47.77, 47.32, 46.36, 46.33, 43.00, 41.80, 41.51, 39.28, 38.64, 38.31, 36.80, 33.90, 32.84, 32.21, 30.52, 29.63, 28.19, 27.98, 27.60, 27.13, 25.72, 23.39, 23.36, 21.74, 20.59, 18.40, 18.15, 16.97, 16.85, 15.50, 15.14, 12.47; ESI-MS m/z 680.5 [M\u2009+\u2009H]+.White solid , yield 32.33%. 1H NMR  \u03b4 10.74 , 8.28 , 8.19 , 7.82 , 7.69 , 7.46 , 5.44 , 4.16\u2009\u2212\u20094.07 , 3.85\u2009\u2212\u20093.59 , 3.19 , 3.03 , 2.74\u2009\u2212\u20092.66 , 2.66\u2009\u2212\u20092.60 , 2.08\u2009\u2212\u20092.00 , 1.95\u2009\u2212\u20091.91 , 1.88 , 1.74 , 1.59\u2009\u2212\u20091.56 , 1.54\u2009\u2212\u20091.51 , 1.23\u2009\u2212\u20091.18 , 1.14 , 0.96 , 0.90 , 0.78 , 0.74 , 0.55 ; 13C NMR  \u03b4 182.29, 157.03, 143.70(C6-Tacrine), 132.95(C5-Tacrine), 125.20(C7-Tacrine), 123.50(C8-Tacrine), 119.49, 115.56, 111.43, 55.72, 47.31, 46.44, 46.28, 43.67, 41.81, 41.61, 39.67, 39.20, 38.63, 38.30, 36.80, 33.93, 32.87, 32.61, 32.13, 30.60, 29.62, 29.58, 29.24, 28.22, 27.94, 27.16, 27.13, 26.98, 23.49, 23.41, 23.33, 21.89, 20.69, 18.48, 18.06, 17.02, 16.54, 15.41, 15.11, 14.05, 12.59; ESI-MS m/z 708.5 [M\u2009+\u2009H]+.White solid , yield 35.29%. 1H NMR  \u03b4 11.30 , 8.25 , 7.82 , 7.72 , 7.49 , 6.15 , 5.38 , 3.92 , 3.71 , 3.35 , 3.24\u2009\u2212\u20093.17 , 3.06\u2009\u2212\u20093.02 , 3.00 , 2.63 , 2.55 , 1.93 , 1.91\u2009\u2212\u20091.87 , 1.75 , 1.68\u2009\u2212\u20091.58 , 1.57\u2009\u2212\u20091.51 , 1.43 , 1.43\u2009\u2212\u20091.38 , 1.36 , 1.27\u2009\u2212\u20091.22 , 1.20\u2009\u2212\u20091.18 , 1.15 , 0.98 , 0.90 , 0.86 , 0.75 ; 13C NMR  \u03b4 156.29, 150.06, 144.45, 138.19, 132.99, 125.31(C6-Tacrine), 124.95(C5-Tacrine), 122.87(C7-Tacrine), 119.57(C8-Tacrine), 115.37, 111.32, 55.62, 54.93, 48.03, 47.35, 46.54, 46.15, 43.58, 41.98, 41.91, 39.22, 38.98, 38.62, 38.30, 36.81, 33.99, 32.85, 32.63, 32.27, 30.58, 30.20, 29.01, 28.21, 27.98, 27.12, 26.96, 25.95, 25.63, 25.58, 23.68, 23.44, 23.37, 22.88, 21.61, 20.52, 18.40, 18.14, 16.88, 15.49, 15.20, 12.68; ESI-MS m/z 722.5 [M\u2009+\u2009H]+.White solid , yield 51.21%. 1H NMR  \u03b4 11.47 , 8.24 , 7.90 , 7.73\u2009\u2212\u20097.68 , 7.51\u2009\u2212\u20097.44 , 6.07 , 5.38 , 3.93 , 3.40 , 3.21 , 3.04 , 2.61 , 2.56\u2009\u2212\u20092.50 , 2.00 , 1.92 , 1.90\u2009\u2212\u20091.86 , 1.75 , 1.70\u2009\u2212\u20091.64 , 1.60 , 1.59\u2009\u2212\u20091.57 , 1.55 , 1.54\u2009\u2212\u20091.50 , 1.47 , 1.45 , 1.36 , 1.33 , 1.27\u2009\u2212\u20091.24 , 1.23 , 1.19 , 1.15 , 1.08\u2009\u2212\u20091.00 , 0.98 , 0.95 , 0.89 , 0.86 , 0.75 ; 13C NMR  \u03b4 178.95, 156.39, 150.62, 144.68, 138.30, 133.14, 125.45(C6-Tacrine), 124.81(C5-Tacrine), 122.95(C7-Tacrine), 120.00(C8-Tacrine), 115.53, 111.28, 55.03, 53.43, 50.87, 48.73, 47.46, 46.71, 46.33, 42.13, 42.04, 39.35, 38.87, 38.73, 38.40, 36.92, 34.11, 32.95, 32.73, 32.33, 31.92, 31.90, 30.70, 30.01, 29.77, 29.69, 29.65, 29.60, 29.55, 29.51, 29.48, 29.36, 29.34, 29.30, 29.23, 28.31, 28.08, 27.26, 27.20, 27.09, 25.74, 24.03, 23.83, 23.56, 23.48, 23.21, 22.68, 21.73, 20.59, 18.25, 16.99, 15.57, 15.32, 14.12; ESI-MS m/z 736.5 [M\u2009+\u2009H]+.White solid , yield 27.51%. 1H NMR  \u03b4 7.99\u2009\u2212\u20097.95 , 7.92 , 7.28 , 6.00 , 5.30 , 3.57 , 3.43\u2009\u2212\u20093.36 , 3.20 , 3.07 , 3.04 , 2.68 , 2.47 , 1.96 , 1.91 , 1.84 , 1.75 , 1.68 , 1.63\u2009\u2212\u20091.60 , 1.61\u2009\u2212\u20091.58 , 1.57 , 1.55 , 1.53\u2009\u2212\u20091.50 , 1.44 , 1.25 , 1.15 , 1.03 , 0.98 , 0.89 , 0.84 , 0.77 , 0.70 ; 13C NMR  \u03b4 178.61, 145.02(C6-Tacrine), 124.67(C5-Tacrine), 124.59(C7-Tacrine), 122.79(C8-Tacrine), 55.06, 48.76, 47.47, 46.77, 46.32, 42.30, 42.10, 39.35, 38.93, 38.76, 38.45, 36.93, 34.13, 32.95, 32.61, 32.31, 30.72, 29.71, 29.33, 28.95, 28.09, 27.27, 27.22, 27.14, 27.05, 25.71, 24.66, 23.87, 23.56, 23.50, 22.80, 22.34, 18.27, 16.97, 15.57, 15.33, 14.13; ESI-MS m/z 714.5 [M\u2009+\u2009H]+.White solid , yield 30.79%. 1H NMR  \u03b4 12.48 , 8.16 , 7.92 , 7.32 , 6.31 , 5.41 , 3.96 , 3.42 , 3.21 , 3.15 , 3.09 , 2.63 , 2.58 , 2.01 , 1.92\u2009\u2212\u20091.88 , 1.86 , 1.75 , 1.72\u2009\u2212\u20091.64 , 1.64\u2009\u2212\u20091.54 , 1.53\u2009\u2212\u20091.49 , 1.25 , 1.22\u2009\u2212\u20091.18 , 1.16 , 0.98 , 0.90 , 0.87 , 0.76 ; 13C NMR  \u03b4 179.34, 156.02, 151.21, 144.41(C6-Tacrine), 139.02, 138.83, 126.62(C5-Tacrine), 126.02(C7-Tacrine), 123.14(C8-Tacrine), 118.65, 113.89, 111.73, 55.08, 47.92, 47.51, 46.67, 46.32, 42.02, 41.96, 39.39, 38.76, 38.69, 38.44, 36.96, 34.15, 32.98, 32.84, 32.39, 30.71, 29.71, 29.35, 29.33, 28.43, 28.10, 27.54, 27.30, 27.22, 27.14, 26.84, 25.78, 23.81, 23.56, 23.52, 23.49, 21.74, 20.54, 18.28, 17.04, 15.59, 15.33, 14.13; ESI-MS m/z 742.5 [M\u2009+\u2009H]+.White solid , yield 25.59%. 1H NMR  \u03b4 10.13 , 8.30 , 7.98 , 7.38 , 6.86 , 5.37\u2009\u2212\u20095.33 , 4.11\u2009\u2212\u20094.00 , 3.69\u2009\u2212\u20093.66 , 3.64\u2009\u2212\u20093.61 , 3.16 , 3.12 , 3.06 , 2.85 , 2.62 , 1.97 , 1.87 , 1.77 , 1.65 , 1.60\u2009\u2212\u20091.51 , 1.49 , 1.06 , 0.88 , 0.83 , 0.67 , 0.39 ; 13C NMR  \u03b4 182.22, 165.55, 157.70, 143.32(C6-Tacrine), 136.61(C5-Tacrine), 125.69(C7-Tacrine), 123.47(C8-Tacrine), 112.34, 78.71, 77.37, 77.16, 76.95, 55.60, 55.49, 55.36, 54.98, 52.15, 47.34, 46.37, 46.20, 43.44, 41.71, 41.34, 41.20, 39.62, 39.20, 38.67, 38.63, 38.63, 38.59, 38.56, 38.34, 37.95, 36.82, 33.96, 32.95, 32.77, 32.25, 31.83, 30.60, 29.62, 29.24, 28.74, 28.02, 27.21, 27.01, 25.82, 25.70, 23.45, 23.30, 23.26, 21.71, 20.68, 18.40, 18.27, 18.15, 17.00, 16.89, 16.76, 16.52, 15.60, 15.54, 15.12, 12.71; ESI-MS m/z 756.5 [M\u2009+\u2009H]+.White solid , yield 35.69%. 1H NMR  \u03b4 8.33 , 8.19 , 7.34 , 6.08 , 5.36 , 3.87 , 3.40 , 3.22 , 3.19 , 3.06\u2009\u2212\u20093.01 , 2.66\u2009\u2212\u20092.62 , 2.53\u2009\u2212\u20092.48 , 1.97 , 1.92 , 1.89 , 1.75 , 1.71\u2009\u2212\u20091.64 , 1.60 , 1.58\u2009\u2212\u20091.53 , 1.51 , 1.47 , 1.45 , 1.37\u2009\u2212\u20091.32 , 1.28\u2009\u2212\u20091.21 , 1.18 , 1.15 , 1.03 , 0.98 , 0.89 , 0.87 , 0.75 ; 13C NMR  \u03b4 178.78, 155.25, 144.85(C6-Tacrine), 126.10(C5-Tacrine), 125.87(C7-Tacrine), 122.84(C8-Tacrine), 114.47, 111.65, 55.04, 50.84, 48.69, 47.47, 46.75, 46.32, 45.91, 42.18, 42.06, 39.35, 38.75, 38.43, 36.94, 34.12, 32.95, 32.70, 32.33, 30.71, 30.23, 29.69, 29.42, 28.08, 27.27, 27.13, 25.73, 24.08, 23.85, 23.75, 23.58, 23.50, 21.92, 20.72, 18.26, 16.98, 15.58, 15.35, 14.12, 8.65; ESI-MS m/z 770.5 [M\u2009+\u2009H]+; HRMS(ESI) m/z [M\u2009+\u2009H]+ calcd for C49H73N3ClO2+ 770.5391, found 770.5406.White solid , yield 35.04%. 1H NMR  \u03b4 8.69 , 8.38 , 7.40 , 5.34 , 3.22 , 3.11 , 2.98\u2009\u2212\u20092.91 , 2.28 , 2.18 , 2.13\u2009\u2212\u20092.05 , 2.04\u2009\u2212\u20091.98 , 1.87 , 1.76 , 1.61 , 1.57\u2009\u2212\u20091.54 , 1.54\u2009\u2212\u20091.47 , 1.45\u2009\u2212\u20091.42 , 1.42\u2009\u2212\u20091.39 , 1.35 , 1.27 , 1.25 , 1.22 , 1.00 , 0.98 , 0.96 , 0.90 , 0.87 , 0.85 , 0.79 , 0.75 ; 13C NMR  \u03b4 173.29, 151.48(C5-Tacrine), 142.07, 140.79, 134.95(C6-Tacrine), 129.17(C7-Tacrine), 123.66(C8-Tacrine), 120.56, 55.20, 47.56, 47.44, 45.54, 41.87, 41.59, 39.43, 38.70, 38.47, 36.95, 33.64, 32.88, 32.73, 32.11, 30.56, 29.62, 28.05, 28.03, 27.12, 25.66, 23.46, 23.40, 23.25, 18.29, 16.87, 15.51, 15.33; ESI-MS m/z 714.5 [M\u2009+\u2009H]+.Yellow solid , yield 46.18%. 1H NMR  \u03b4 8.69 , 8.38 , 7.40 , 5.34 , 3.22 , 2.97\u2009\u2212\u20092.91 , 2.28 , 2.18 , 2.13\u2009\u2212\u20092.06 , 2.01 , 1.87 , 1.76 , 1.63\u2009\u2212\u20091.58 , 1.58\u2009\u2212\u20091.54 , 1.50 , 1.47\u2009\u2212\u20091.45 , 1.43 , 1.41 , 1.35 , 1.28\u2009\u2212\u20091.26 , 1.25 , 1.22 , 1.10 , 1.00 , 0.98 , 0.96 , 0.90 , 0.85 , 0.79 , 0.75 ; 13C NMR  \u03b4 172.34, 150.54(C5-Tacrine), 141.13, 139.84, 134.01, 128.23(C6-Tacrine), 122.72(C7-Tacrine), 119.62(C8-Tacrine), 54.26, 46.62, 46.50, 44.60, 40.93, 40.65, 38.49, 37.76, 37.53, 37.13, 36.01, 32.70, 31.94, 31.79, 31.17, 30.22, 29.62, 28.68, 27.11, 27.09, 26.18, 24.72, 22.52, 22.46, 22.31, 17.35, 15.93, 14.57, 14.39; ESI-MS m/z 728.4 [M\u2009+\u2009H]+.Yellow solid , yield 23.34%. 1H NMR  \u03b4 8.17 , 7.76 , 7.41 , 6.22 , 5.37 , 3.88 , 3.37 , 3.19 , 3.13\u2009\u2212\u20093.09 , 3.07 , 2.69 , 2.59\u2009\u2212\u20092.53 , 1.98 , 1.91 , 1.89\u2009\u2212\u20091.85 , 1.82 , 1.73 , 1.64 , 1.55 , 1.52 , 1.43 , 1.24 , 1.14 , 1.08\u2009\u2212\u20091.00 , 0.96 , 0.88 , 0.84 , 0.75 , 0.71 ; 13C NMR  \u03b4 177.81, 154.97, 151.51, 143.46(C5-Tacrine), 135.24, 131.02(C6-Tacrine), 123.99(C7-Tacrine), 123.85, 123.09, 121.96(C8-Tacrine), 116.65, 112.64, 54.06, 52.43, 47.44, 46.49, 45.65, 45.24, 40.96, 40.90, 38.34, 37.75, 37.73, 37.42, 35.93, 33.15, 31.99, 31.76, 31.39, 29.69, 28.89, 28.68, 27.08, 26.71, 26.28, 26.12, 25.78, 24.75, 22.70, 22.57, 22.45, 20.84, 19.95, 17.26, 16.00, 14.58, 14.29; ESI-MS m/z 742.5 [M\u2009+\u2009H]+.Yellow solid , yield 33.67%. 1H NMR  \u03b4 8.16 , 7.76 , 7.40 , 6.06 , 5.36 , 3.80 , 3.73 , 3.35 , 3.20 , 3.11 , 3.02 , 2.68 , 2.53 , 1.94\u2009\u2212\u20091.90 , 1.88 , 1.85\u2009\u2212\u20091.83 , 1.81 , 1.74 , 1.67\u2009\u2212\u20091.61 , 1.59 , 1.56 , 1.53 , 1.51 , 1.42 , 1.20 , 1.14 , 1.05\u2009\u2212\u20090.99 , 0.97 , 0.89 , 0.86 , 0.76 , 0.73 ; 13C NMR  \u03b4 177.49, 154.42, 152.25, 143.72(C5-Tacrine), 136.11, 130.63, 124.88(C6-Tacrine), 123.62, 122.96(C7-Tacrine), 121.85(C8-Tacrine), 117.09, 112.95, 97.44, 66.96, 66.41, 54.06, 48.05, 46.50, 45.72, 45.25, 41.09, 41.02, 38.34, 38.01, 37.73, 37.43, 35.93, 33.15, 32.28, 31.98, 31.68, 31.37, 30.91, 29.70, 29.45, 29.18, 28.68, 28.64, 28.35, 28.17, 27.40, 27.08, 26.28, 26.13, 24.73, 24.60, 23.10, 22.77, 22.70, 22.58, 22.48, 22.37, 21.68, 20.94, 20.13, 17.26, 15.97, 14.57, 14.32, 13.11; ESI-MS m/z 756.5 [M\u2009+\u2009H]+.Yellow solid , yield 30.40%. 1H NMR  \u03b4 8.69 , 8.38 , 7.40 , 7.32\u2009\u2212\u20097.31 , 5.34 , 3.78 , 3.52 , 3.27\u2009\u2212\u20093.16 , 2.94 , 2.52\u2009\u2212\u20092.45 , 2.35\u2009\u2212\u20092.24 , 2.23\u2009\u2212\u20092.15 , 2.10 , 2.05\u2009\u2212\u20091.98 , 1.95\u2009\u2212\u20091.88 , 1.88\u2009\u2212\u20091.86 , 1.76 , 1.63\u2009\u2212\u20091.58 , 1.57\u2009\u2212\u20091.53 , 1.43 , 1.40\u2009\u2212\u20091.31 , 1.30\u2009\u2212\u20091.23 , 1.22 , 1.17\u2009\u2212\u20091.13 , 1.00 , 0.98 , 0.96 , 0.89 , 0.85 , 0.78 ; 13C NMR  \u03b4 177.39, 173.35, 151.55(C5-Tacrine), 144.63, 142.13, 140.84, 135.01, 129.33(C6-Tacrine), 129.23, 128.29, 123.72(C7-Tacrine), 122.60, 120.63(C8-Tacrine), 55.25, 55.09, 47.62, 47.52, 47.50, 46.75, 46.30, 45.60, 42.28, 42.17, 41.92, 41.64, 39.48, 39.37, 38.76, 38.73, 38.60, 38.52, 38.47, 37.01, 36.96, 34.13, 33.70, 32.96, 32.94, 32.78, 32.53, 32.16, 30.69, 30.62, 28.11, 28.09, 27.31, 27.18, 27.15, 25.72, 25.59, 23.60, 23.52, 23.50, 23.46, 23.31, 18.35, 18.25, 17.56, 16.92, 15.58, 15.56, 15.38; ESI-MS m/z 770.5 [M\u2009+\u2009H]+.Yellow solid , yield 22.06%. 1H NMR  \u03b4 8.29 , 8.08 , 7.30 , 5.43 , 4.15 , 3.84 , 3.66 , 3.23\u2009\u2212\u20093.09 , 2.72\u2009\u2212\u20092.57 , 2.03 , 1.91\u2009\u2212\u20091.86 , 1.77\u2009\u2212\u20091.68 , 1.64\u2009\u2212\u20091.57 , 1.57\u2009\u2212\u20091.51 , 1.29\u2009\u2212\u20091.23 , 1.15 , 0.97 , 0.91 , 0.83 , 0.75 , 0.70 , 0.64 ; 13C NMR  \u03b4 180.97, 143.22(C6-Tacrine), 126.80(C5-Tacrine), 125.38(C7-Tacrine), 122.34(C8-Tacrine), 54.04, 52.42, 50.64, 46.43, 45.55, 45.35, 40.94, 40.79, 38.95, 38.34, 37.73, 37.40, 35.93, 33.04, 31.95, 31.78, 31.22, 29.72, 28.77, 28.69, 28.35, 28.31, 27.63, 27.05, 26.28, 26.20, 26.11, 24.76, 22.97, 22.66, 22.60, 22.47, 21.68, 21.05, 19.78, 17.22, 15.76, 14.54, 14.34, 14.30, 13.12; ESI-MS m/z 758.5 [M\u2009+\u2009H]+.Brown solid , yield 19.78%. 1H NMR  \u03b4 12.57 , 7.57 , 7.51 , 7.14 , 7.09 , 4.41 , 3.59 , 3.32 , 3.25 , 2.93 , 2.73 , 2.45 , 2.32 , 2.25 , 1.21 , 1.14 , 1.06\u2009\u2212\u20090.98 , 0.91 , 0.85\u2009\u2212\u20090.79 , 0.70 , 0.68\u2009\u2212\u20090.64 , 0.62 , 0.60 , 0.58 , 0.57 , 0.55 , 0.54 , 0.38\u2009\u2212\u20090.35 , 0.31 , 0.26 , 0.17 , 0.16 , 0.13 , 0.08 , \u22120.06 , \u22120.13 ; 13C NMR  \u03b4 181.33, 159.18, 114.35, 92.19, 91.24, 76.16, 75.96, 75.88, 75.52, 74.04, 71.09, 70.42, 70.30, 69.60, 68.00, 65.80, 64.52, 64.42, 63.12, 61.03, 60.40, 59.86, 58.94, 58.16, 55.72, 55.40, 54.37, 53.83, 53.54, 52.35, 50.13; ESI-MS m/z 772.4 [M\u2009+\u2009H]+.Brown solid , yield 23.30%. 1H NMR  \u03b4 8.18 , 7.65 , 7.21 , 6.83 , 5.45 , 4.12\u2009\u2212\u20093.99 , 3.79 , 3.63\u2009\u2212\u20093.56 , 3.19 , 3.01 , 2.65 , 2.04 , 1.93 , 1.90\u2009\u2212\u20091.86 , 1.74 , 1.70\u2009\u2212\u20091.62 , 1.61\u2009\u2212\u20091.55 , 1.51 , 1.45\u2009\u2212\u20091.39 , 1.39\u2009\u2212\u20091.32 , 1.27\u2009\u2212\u20091.22 , 1.22\u2009\u2212\u20091.17 , 1.14 , 1.04 , 0.95 , 0.90 , 0.81 , 0.73 , 0.68 , 0.60 ; 13C NMR  \u03b4 181.29, 181.27, 164.75, 154.97, 154.94, 149.85, 142.58(C6-Tacrine), 142.56, 138.50, 137.53, 137.49, 126.19(C5-Tacrine), 124.39, 124.34(C7-Tacrine), 122.67(C8-Tacrine), 117.81, 113.10, 111.32, 111.28, 54.04, 50.79, 46.44, 45.48, 45.32, 40.85, 40.60, 40.58, 38.65, 38.32, 37.70, 37.66, 37.39, 35.89, 33.06, 31.96, 31.86, 31.26, 29.67, 28.68, 27.72, 27.05, 26.27, 26.10, 24.75, 22.66, 22.52, 22.48, 22.41, 20.92, 19.84, 17.21, 15.64, 14.54, 14.20; ESI-MS m/z 786.4 [M\u2009+\u2009H]+.Brown solid , yield 27.98%. 1H NMR  \u03b4 8.02 , 7.94 , 7.44 , 6.17 , 5.36 , 3.78 , 3.36 , 3.19 , 3.09\u2009\u2212\u20093.02 , 2.98 , 2.60 , 2.57\u2009\u2212\u20092.50 , 2.00\u2009\u2212\u20091.94 , 1.90 , 1.86 , 1.82 , 1.73 , 1.68\u2009\u2212\u20091.60 , 1.57 , 1.55 , 1.50 , 1.46\u2009\u2212\u20091.39 , 1.36\u2009\u2212\u20091.29 , 1.23 , 1.13 , 1.02 , 0.96 , 0.88 , 0.83 , 0.74 , 0.69 ; 13C NMR  \u03b4 177.39, 173.35, 151.55(C6-Tacrine), 142.13, 140.84, 135.01, 129.33(C5-Tacrine), 129.23, 128.29, 123.72(C7-Tacrine), 122.60, 120.63(C8-Tacrine), 55.25, 55.09, 47.62, 47.52, 47.50, 46.75, 46.30, 45.60, 42.28, 42.17, 41.93, 41.64, 39.48, 39.37, 38.77, 38.76, 38.73, 38.60, 38.53, 38.47, 37.01, 36.96, 34.13, 33.70, 32.96, 32.94, 32.78, 32.53, 32.17, 30.69, 30.62, 28.11, 28.09, 27.31, 27.18, 27.15, 25.72, 25.59, 23.60, 23.52, 23.50, 23.46, 23.31, 18.35, 18.25, 17.56, 16.92, 15.58, 15.56, 15.39; ESI-MS m/z 800.5 [M\u2009+\u2009H]+; HRMS(ESI) m/z [M\u2009+\u2009H]+ calcd for C48H71N3BrO2+ 800.4730, found 800.4744.Brown solid , yield 41.23%. 1H NMR  \u03b4 8.07 , 8.05 , 7.50 , 6.01 , 5.37 , 3.85 , 3.35\u2009\u2212\u20093.29 , 3.21 , 3.04 , 3.02\u2009\u2212\u20092.95 , 2.61 , 2.50 , 1.99\u2009\u2212\u20091.93 , 1.91 , 1.81 , 1.75\u2009\u2212\u20091.67 , 1.60 , 1.57\u2009\u2212\u20091.52 , 1.46 , 1.43\u2009\u2212\u20091.38 , 1.38\u2009\u2212\u20091.33 , 1.31 , 1.16 , 1.06 1.02 , 0.98 , 0.90 , 0.77 , 0.72 ; 13C NMR  \u03b4 177.40, 154.33, 151.25, 143.96(C6-Tacrine), 139.48, 127.40(C5-Tacrine), 125.86, 125.29(C7-Tacrine), 122.38, 121.81(C8-Tacrine), 113.82, 111.32, 54.06, 52.42, 49.83, 47.87, 46.50, 45.75, 45.26, 41.35, 41.10, 38.55, 38.36, 37.75, 37.46, 35.95, 33.13, 31.96, 31.57, 31.37, 29.72, 28.69, 28.64, 28.51, 28.47, 28.41, 28.35, 28.33, 28.31, 28.24, 28.14, 28.11, 28.03, 27.09, 26.28, 26.11, 26.04, 25.55, 24.71, 22.83, 22.56, 22.53, 22.28, 20.83, 19.88, 17.27, 15.96, 14.59, 14.37, 13.11; ESI-MS m/z 814.4 [M\u2009+\u2009H]+.Brown solid , yield 25.79%. 1H NMR  \u03b4 8.23 , 8.02 , 7.24 , 7.13 , 5.37 , 4.08 , 3.78 , 3.59 , 3.15\u2009\u2212\u20093.09 , 2.63\u2009\u2212\u20092.57 , 1.88\u2009\u2212\u20091.76 , 1.56\u2009\u2212\u20091.44 , 1.42\u2009\u2212\u20091.34 , 1.33\u2009\u2212\u20091.25 , 1.21\u2009\u2212\u20091.17 , 1.15 , 1.09 , 0.99 , 0.90 , 0.84 , 0.77 , 0.69 , 0.63 , 0.58 ; 13C NMR  \u03b4 181.92, 155.49, 144.16(C5-Tacrine), 127.74(C6-Tacrine), 126.32(C7-Tacrine), 123.27(C8- Tacrine), 114.25, 111.82, 54.97, 53.36, 51.57, 50.80, 47.37, 46.48, 46.28, 41.87, 41.72, 39.89, 39.27, 39.15, 38.66, 38.33, 36.86, 33.98, 32.89, 32.71, 32.15, 31.85, 30.66, 29.70, 29.63, 29.29, 29.25, 29.18, 28.56, 27.99, 27.22, 27.14, 27.04, 25.69, 23.90, 23.59, 23.53, 23.48, 23.40, 22.62, 21.98, 20.71, 18.16, 16.70, 15.48, 15.24, 14.05; ESI-MS m/z 758.4 [M\u2009+\u2009H]+.Brown solid , yield 21.10%. 1H NMR  \u03b4 10.08 , 8.30 , 8.01 , 7.46 , 5.47 , 3.64 , 3.23 , 3.11 , 2.78\u2009\u2212\u20092.71 , 2.65\u2009\u2212\u20092.59 , 2.08\u2009\u2212\u20092.03 , 1.96 , 1.90 , 1.74 , 1.70\u2009\u2212\u20091.64 , 1.61\u2009\u2212\u20091.50 , 1.22 , 1.15 , 1.07 , 0.97 , 0.90 , 0.86 , 0.76 , 0.71 ; 13C NMR  \u03b4 177.62, 166.77, 164.96, 156.32, 149.47, 143.50(C5-Tacrine), 135.58, 134.22, 133.22, 131.42, 129.89, 128.90(C6-Tacrine), 128.87, 128.47(C7-Tacrine), 127.78(C8-Tacrine), 124.84, 124.57, 121.96, 115.66, 111.95, 111.74, 77.90, 76.23, 76.02, 75.81, 67.14, 66.75, 54.40, 54.06, 47.97, 46.51, 45.68, 45.23, 40.97, 38.33, 37.98, 37.88, 37.73, 37.71, 37.41, 35.93, 33.15, 31.99, 31.71, 31.37, 30.91, 29.69, 29.55, 29.34, 29.29, 28.68, 28.67, 28.64, 28.60, 28.35, 28.31, 28.08, 28.03, 27.97, 27.91, 27.08, 26.27, 26.20, 26.13, 24.75, 22.96, 22.95, 22.72, 22.69, 22.59, 22.46, 21.97, 21.95, 21.68, 20.52, 19.51, 17.54, 17.26, 16.11, 15.97, 14.57, 14.32, 13.11, 13.04, 10.08, 9.95; ESI-MS m/z 772.4 [M\u2009+\u2009H]+.Brown solid , yield 23.31%. 1H NMR  \u03b4 9.92 , 8.36 , 8.06 , 7.50 , 6.42 , 5.48 , 4.05 , 3.78\u2009\u2212\u20093.71 , 3.44 , 3.26 , 3.14 , 3.01 , 2.76 , 2.68\u2009\u2212\u20092.63 , 2.00 , 1.97\u2009\u2212\u20091.92 , 1.79 , 1.67 , 1.51\u2009\u2212\u20091.48 , 1.46 , 1.31 , 1.20 , 1.10 , 1.03 , 0.95 , 0.91 , 0.82 , 0.78 ; 13C NMR  \u03b4 178.61, 167.70, 165.90, 157.30, 144.55(C5-Tacrine), 136.48, 135.17, 134.17, 132.37(C6-Tacrine), 130.82, 129.42, 128.73(C7-Tacrine), 125.69(C8-Tacrine), 125.50, 122.94, 116.68, 112.97, 112.79, 78.86, 77.16, 76.95, 76.74, 68.09, 67.70, 55.01, 48.30, 47.46, 46.65, 46.19, 42.01, 41.96, 39.28, 38.83, 38.81, 38.68, 38.65, 38.37, 36.89, 34.08, 32.91, 32.57, 32.30, 31.86, 30.64, 30.50, 30.28, 29.97, 29.63, 29.25, 29.12, 29.10, 28.91, 28.85, 28.02, 27.20, 27.08, 25.73, 25.69, 25.40, 23.91, 23.70, 23.67, 23.53, 23.45, 22.92, 22.90, 22.62, 21.54, 20.50, 18.21, 16.90, 15.51, 15.30, 14.06, 13.99, 11.03, 10.89; ESI-MS m/z 786.4 [M\u2009+\u2009H]+.Brown solid , yield 31.79%. 1H NMR  \u03b4 9.94 , 8.37 , 8.07 , 7.59 , 7.50 , 5.46 , 4.01 , 3.42 , 3.26 , 3.14 , 3.09 , 2.75 , 2.65\u2009\u2212\u20092.58 , 2.01 , 1.98\u2009\u2212\u20091.93 , 1.83\u2009\u2212\u20091.77 , 1.76\u2009\u2212\u20091.70 , 1.68 , 1.63\u2009\u2212\u20091.59 , 1.42\u2009\u2212\u20091.34 , 1.31 , 1.21 , 1.12\u2009\u2212\u20091.05 , 1.04 , 0.95 , 0.93 , 0.82 , 0.80 ; 13C NMR  \u03b4 177.60, 166.75, 164.94, 156.30, 149.45, 143.48(C5-Tacrine), 135.56, 134.20, 133.20(C6-Tacrine), 131.40, 129.87, 128.88, 128.85, 128.45, 127.76, 124.82(C7-Tacrine), 124.55, 121.94(C8-Tacrine), 115.64, 111.93, 111.72, 77.88, 76.21, 76.00, 75.79, 67.12, 66.73, 54.38, 54.04, 47.95, 46.49, 45.66, 45.21, 42.41, 40.95, 38.31, 37.96, 37.86, 37.71, 37.69, 37.39, 35.91, 33.13, 31.97, 31.69, 31.35, 30.89, 29.67, 29.53, 29.32, 29.27, 28.66, 28.65, 28.62, 28.58, 28.33, 28.29, 28.06, 28.01, 27.95, 27.89, 27.06, 26.25, 26.18, 26.11, 24.73, 22.94, 22.93, 22.70, 22.67, 22.57, 22.44, 21.95, 21.93, 21.66, 20.50, 19.49, 17.52, 17.24, 16.09, 15.95, 14.55, 14.30, 13.09, 13.02, 11.57, 10.06, 9.93; ESI-MS m/z 800.4 [M\u2009+\u2009H]+.Brown solid , yield 38.73%. 1H NMR  \u03b4 10.70 , 8.29 , 7.76\u2009\u2212\u20097.69 , 7.48 , 6.76 , 5.42 , 4.17\u2009\u2212\u20094.06 , 3.71 , 3.19 , 3.01 , 2.73\u2009\u2212\u20092.67 , 2.63 , 1.96\u2009\u2212\u20091.81 , 1.13 , 0.95 , 0.89 , 0.75 , 0.52 ; 13C NMR  \u03b4 182.30, 165.72, 157.19, 143.71(C5-Tacrine), 133.12(C6-Tacrine), 125.36, 123.56(C7-Tacrine), 119.50(C8-Tacrine), 115.69, 111.52, 56.01, 55.90, 55.78, 55.02, 51.89, 47.40, 46.52, 46.35, 43.82, 41.87, 41.64, 39.74, 39.28, 38.72, 38.66, 38.39, 36.88, 34.02, 32.97, 32.72, 32.24, 30.68, 29.71, 28.31, 28.03, 27.25, 27.07, 25.74, 23.53, 23.50, 23.41, 21.98, 20.78, 18.52, 18.20, 18.15, 17.03, 16.67, 16.61, 15.50, 15.18, 12.75; ESI-MS m/z 814.4 [M\u2009+\u2009H]+.Brown solid , yield 33.15%. 1H NMR  \u03b4 13.37 , 8.54 , 7.90 , 7.79 , 7.49 , 5.12 , 4.28 , 4.02\u2009\u2212\u20093.91 , 3.80\u2009\u2212\u20093.72 , 3.62 , 3.57\u2009\u2212\u20093.51 , 3.42 , 3.14 , 3.07\u2009\u2212\u20093.01 , 2.97\u2009\u2212\u20092.92 , 2.66 , 1.84 , 1.75\u2009\u2212\u20091.69 , 1.62\u2009\u2212\u20091.49 , 1.39 , 1.32 , 1.01 , 0.87 , 0.85 , 0.83 , 0.63 , 0.57 , 0.13 ; 13C NMR  \u03b4 178.90, 164.89, 163.22, 162.77, 162.01, 160.59, 156.46, 144.17(C6-Tacrine), 130.11(C5-Tacrine), 122.01(C7-Tacrine), 111.70(C8-Tacrine), 77.18, 55.39, 47.28, 46.29, 45.74, 42.31, 41.53, 36.88, 36.25, 33.92, 33.83, 33.25, 33.12, 32.46, 31.23, 30.84, 29.56, 29.51, 28.64, 28.42, 27.35, 27.25, 25.95, 24.71, 23.88, 23.24, 22.68, 22.34, 21.83, 20.93, 18.55, 18.30, 17.20, 16.67, 16.41, 15.19, 12.96; ESI-MS m/z 698.5 [M\u2009+\u2009H]+.Brown solid , yield 24.34%. 1H NMR  \u03b4 13.38 , 8.49 , 7.52\u2009\u2212\u20097.48 , 7.48\u2009\u2212\u20097.45 , 7.41 , 5.11 , 4.29 , 3.83 , 3.19 , 3.08 , 2.95 , 2.65 , 1.91\u2009\u2212\u20091.85 , 1.85\u2009\u2212\u20091.80 , 1.74\u2009\u2212\u20091.67 , 1.64\u2009\u2212\u20091.57 , 1.50 , 1.40 , 1.39\u2009\u2212\u20091.36 , 1.35 , 1.32 , 1.30\u2009\u2212\u20091.20 , 1.04 , 1.01 , 0.88 , 0.83 , 0.77 , 0.65 , 0.59 , 0.41 ; 13C NMR  \u03b4 177.17, 165.06, 164.87, 163.20, 162.77, 156.32, 144.45(C6-Tacrine), 121.75(C5-Tacrine), 114.89(C7-Tacrine), 111.94(C8-Tacrine), 77.20, 55.08, 47.37, 46.37, 46.33, 45.69, 41.61, 38.41, 36.91, 36.43, 36.25, 34.03, 33.33, 33.30, 32.69, 31.24, 30.85, 30.41, 28.67, 27.38, 27.33, 26.01, 23.95, 23.23, 22.71, 21.86, 20.83, 18.36, 17.09, 16.44, 15.33; ESI-MS m/z 712.5 [M\u2009+\u2009H]+.Brown solid , yield 36.49%.1H NMR  \u03b4 13.34 , 8.44 , 7.48 , 7.23 , 5.10 , 4.30 , 3.80 , 3.12\u2009\u2212\u20093.06 , 2.95 , 2.72 , 2.64 , 1.83 , 1.66 , 1.61 , 1.45 , 1.42\u2009\u2212\u20091.37 , 1.34 , 1.23 , 1.03 , 0.98 , 0.87 , 0.85 , 0.83 , 0.64 , 0.60 , 0.48 ; 13C NMR  \u03b4 176.72, 144.55, 121.70, 77.19, 55.10, 47.41, 46.45, 38.87, 38.80, 38.42, 36.91, 34.07, 33.37, 33.21, 32.84, 30.87, 29.49, 28.68, 27.97, 27.38, 26.88, 26.03, 23.97, 23.27, 22.71, 22.00, 18.35, 17.26, 16.47, 15.33; ESI-MS m/z 726.5 [M\u2009+\u2009H]+.Brown solid , yield 30.28%.1H NMR  \u03b4 13.43 , 8.47 , 7.54\u2009\u2212\u20097.50 , 7.50\u2009\u2212\u20097.45 , 7.21 , 5.15 , 4.29 , 3.80 , 3.04 , 2.98 , 2.96\u2009\u2212\u20092.94 , 2.76 , 2.73 , 2.63 , 2.02\u2009\u2212\u20091.95 , 1.88 , 1.83 , 1.75\u2009\u2212\u20091.69 , 1.63 , 1.56\u2009\u2212\u20091.49 , 1.40 , 1.30 , 1.24\u2009\u2212\u20091.21 , 1.15\u2009\u2212\u20091.11 , 1.05 , 1.02\u2009\u2212\u20090.99 , 0.87 , 0.85 , 0.78 , 0.69 , 0.67 , 0.62 , 0.57 ; 13C NMR  \u03b4 176.62, 164.74, 163.06, 162.78, 155.86, 144.60(C6-Tacrine), 130.11(C5-Tacrine), 121.73(C7-Tacrine), 114.92(C8-Tacrine), 114.76, 113.30, 111.92, 77.21, 70.26, 55.39, 55.15, 48.07, 47.46, 46.49, 45.67, 38.98, 38.79, 38.72, 38.44, 36.94, 36.25, 34.09, 33.38, 33.22, 32.86, 31.76, 31.24, 30.89, 29.85, 29.56, 29.50, 29.26, 29.17, 29.05, 28.76, 28.67, 27.38, 26.06, 24.19, 24.01, 23.31, 22.75, 22.57, 21.89, 20.85, 18.37, 17.31, 16.44, 15.39, 14.43; ESI-MS m/z 740.5 [M\u2009+\u2009H]+.Brown solid , yield 44.57%.1H NMR  \u03b4 13.38 , 8.45 , 7.51 , 7.50 , 7.20 , 5.16 , 4.29 , 3.81 , 3.06\u2009\u2212\u20093.01 , 2.95 , 2.76 , 2.63 , 1.83 , 1.71 , 1.64 , 1.54 , 1.44\u2009\u2212\u20091.41 , 1.41\u2009\u2212\u20091.35 , 1.35\u2009\u2212\u20091.31 , 1.27\u2009\u2212\u20091.23 , 1.19\u2009\u2212\u20091.14 , 1.13\u2009\u2212\u20091.09 , 1.05 , 1.02\u2009\u2212\u20091.00 , 0.86\u2009\u2212\u20090.84 , 0.71 , 0.63 , 0.60 , 0.59 ; 13C NMR  \u03b4 176.57, 164.80, 163.12, 155.97, 144.64(C6-Tacrine), 121.71(C5-Tacrine), 115.00(C7-Tacrine), 114.84(C8-Tacrine), 111.76, 77.19, 55.39, 55.15, 47.85, 47.48, 46.49, 45.67, 41.70, 40.92, 39.06, 38.77, 38.45, 36.95, 34.09, 33.40, 33.24, 32.88, 30.89, 30.20, 29.41, 28.64, 27.39, 26.61, 26.27, 26.08, 24.02, 23.34, 22.73, 21.86, 20.80, 18.37, 17.36, 16.41, 15.39; ESI-MS m/z 754.5 [M\u2009+\u2009H]+.Brown solid , yield 31.81%.1H NMR  \u03b4 7.99 , 7.95 , 7.43\u2009\u2212\u20097.38 , 7.29 , 5.05 , 4.27 , 3.68\u2009\u2212\u20093.55 , 3.39 , 3.25 , 2.97\u2009\u2212\u20092.94 , 2.91 , 2.89 , 2.73 , 1.88 , 1.81 , 1.70 , 1.62\u2009\u2212\u20091.55 , 1.48 , 1.40 , 1.37\u2009\u2212\u20091.32 , 1.24\u2009\u2212\u20091.20 , 1.12\u2009\u2212\u20091.03 , 1.00 , 0.86 , 0.83 , 0.79\u2009\u2212\u20090.73 , 0.65 , 0.60\u2009\u2212\u20090.54 , 0.29 ; 13C NMR  \u03b4 177.84, 162.76, 144.29(C5-Tacrine), 123.00(C6-Tacrine), 121.93(C7-Tacrine), 120.07(C8-Tacrine), 77.25, 55.38, 55.14, 49.03, 47.41, 46.41, 45.67, 41.55, 40.84, 38.80, 38.71, 36.92, 36.24, 33.99, 33.29, 33.07, 32.47, 31.23, 30.83, 28.66, 27.38, 27.30, 26.00, 25.33, 23.93, 23.25, 22.88, 22.86, 22.49, 18.30, 16.81, 16.41, 15.31; ESI-MS m/z 698.5 [M\u2009+\u2009H]+.Black solid , yield 22.91%. 1H NMR  \u03b4 8.02 , 7.95 , 7.49 , 7.37\u2009\u2212\u20097.32 , 5.11 , 4.27 , 3.59\u2009\u2212\u20093.50 , 3.17 , 3.04\u2009\u2212\u20092.99 , 2.95 , 1.81 , 1.72 , 1.62 , 1.51 , 1.43\u2009\u2212\u20091.39 , 1.36 , 1.28 , 1.26\u2009\u2212\u20091.22 , 1.07 , 1.01 , 0.91 , 0.87 , 0.84 , 0.79 , 0.67 , 0.61\u2009\u2212\u20090.57 , 0.43 ; 13C NMR  \u03b4 177.07, 165.06, 162.77, 144.46(C6-Tacrine), 123.59(C5-Tacrine), 121.77(C5-Tacrine), 120.21(C8-Tacrine), 77.25, 55.17, 47.43, 46.44, 46.29, 45.68, 41.63, 36.93, 36.68, 36.25, 34.07, 33.34, 33.30, 32.74, 31.23, 31.02, 30.85, 29.52, 28.68, 27.40, 27.35, 26.02, 25.36, 23.97, 23.27, 22.73, 22.69, 22.57, 22.18, 18.35, 17.10, 16.43, 15.36; ESI-MS m/z 712.5 [M\u2009+\u2009H]+.Black solid , yield 28.07%. 1H NMR  \u03b4 13.24 , 8.19 , 7.82 , 7.56 , 7.24 , 5.11 , 4.31\u2009\u2212\u20094.27 , 3.84 , 3.11 , 3.02 , 2.96 , 2.75\u2009\u2212\u20092.70 , 2.67 , 2.02\u2009\u2212\u20091.95 , 1.69 , 1.61 , 1.52 , 1.46 , 1.43\u2009\u2212\u20091.36 , 1.25 , 1.23 , 1.02 , 0.88\u2009\u2212\u20090.81 , 0.62 , 0.61\u2009\u2212\u20090.56 , 0.46 ; 13C NMR  \u03b4 176.73, 155.80, 144.54(C6-Tacrine), 130.12(C5-Tacrine), 125.16(C7-Tacrine), 121.69, 112.61(C8-Tacrine), 77.18, 55.39, 55.08, 47.59, 47.40, 46.45, 45.67, 41.68, 39.22, 38.87, 38.78, 38.42, 36.89, 34.07, 33.37, 33.22, 32.82, 30.87, 29.56, 29.50, 29.17, 28.66, 28.05, 27.37, 26.88, 26.01, 23.97, 23.26, 22.71, 22.57, 21.84, 20.77, 18.29, 17.25, 16.45, 15.30, 14.43; ESI-MS m/z 726.5 [M\u2009+\u2009H]+.Black solid , yield 38.54%. 1H NMR  \u03b4 8.23 , 7.53 , 7.17 , 6.12 , 5.37 , 3.82 , 3.38 , 3.21 , 3.06 , 3.02 , 2.61 , 2.53 , 1.99 , 1.91\u2009\u2212\u20091.87 , 1.75 , 1.69\u2009\u2212\u20091.62 , 1.56 , 1.48\u2009\u2212\u20091.44 , 1.37\u2009\u2212\u20091.31 , 1.22\u2009\u2212\u20091.17 , 1.15 , 1.04 , 0.98 , 0.89 , 0.86 , 0.76 , 0.75 , 0.73\u2009\u2212\u20090.69 ; 13C NMR  \u03b4 178.96, 165.00, 163.30, 155.34, 152.82, 144.82(C6-Tacrine), 141.99, 141.90, 127.93(C5-Tacrine), 127.86, 123. 08(C7-Tacrine), 115.05, 114.89, 113.46, 112.10(C8-Tacrine), 106.24, 106.08, 55.20, 49.02, 47.63, 46.86, 46.45, 42.27, 42.19, 39.50, 39.13, 38.88, 38.57, 37.08, 34.27, 33.10, 32.88, 32.50, 32.06, 30.84, 30.30, 29.84, 29.79, 29.66, 29.53, 29.50, 29.48, 29.46, 29.38, 28.23, 27.42, 27.26, 25.88, 24.21, 23.96, 23.70, 23.63, 23.46, 22.83, 22.06, 21.06, 18.40, 17.13, 15.71, 15.45, 14.26; ESI-MS m/z 740.5 [M\u2009+\u2009H]+.Black solid , yield 47.27%. 1H NMR  \u03b4 8.08 , 7.60 , 7.48\u2009\u2212\u20097.41 , 7.19 , 5.16 , 4.28 , 3.65 , 3.02 , 2.99\u2009\u2212\u20092.96 , 2.95\u2009\u2212\u20092.92 , 2.75 , 2.68 , 1.82 , 1.76\u2009\u2212\u20091.68 , 1.66\u2009\u2212\u20091.62 , 1.56\u2009\u2212\u20091.50 , 1.40 , 1.34 , 1.29 , 1.25\u2009\u2212\u20091.21 , 1.14\u2009\u2212\u20091.09 , 1.05 , 0.85 , 0.71 , 0.60 ; 13C NMR  \u03b4 176.54, 162.78, 144.64(C6-Tacrine), 124.21(C5-Tacrine), 121.73(C7-Tacrine), 121.21(C8-Tacrine), 77.21, 55.17, 48.05, 47.50, 46.50, 45.66, 41.69, 38.77, 38.46, 36.96, 34.10, 33.40, 33.23, 32.88, 30.90, 30.63, 29.47, 28.65, 27.39, 26.72, 26.42, 26.08, 24.96, 24.03, 23.34, 22.73, 22.30, 21.59, 18.36, 17.34, 16.40, 15.39; ESI-MS m/z 754.5 [M\u2009+\u2009H]+.Black solid , yield 25.18%. hAChE, hBuChE, Acetylcholinesterase Activity Assay Kit and Butyrylcholinesterase Activity Assay Kit were purchased from Sigma Aldrich. And tacrine hydrochloride were purchased from MedChemExpress. The capacity of all the target compounds to inhibit hAChE and hBuChE activities were assessed by Ellman\u2019s method. The concentration of compound producing 50% of enzyme activity inhibition (IC50) was calculated by nonlinear regression analysis of the response-concentration (log) curve, using the Graph-Pad Prism program package . Results are expressed as the mean\u2009\u00b1\u2009SD of at least three different experiments performed in triplicate.Preparation of 50\u2009mM Tris\u2013HCl buffer solutions: 5\u2009ml Tris solution  was dissolved in distilled water (95\u2009ml) and adjusted with HCl to a pH of 8.0\u2009\u00b1\u20090.1. Buffer was freshly prepared and stored in the refrigerator. AChE solution 2.005\u2009U/ml: the enzyme  was dissolved in freshly prepared buffer pH 8.0 (5\u2009ml). BChE solution 2.040\u2009U/ml: the enzyme  was dissolved in freshly prepared buffer pH 8.0 (5\u2009ml). DTNB solution 3\u2009mM: DTNB (23.8\u2009mg) was dissolved in freshly prepared buffer pH 8.0 (20\u2009ml) containing NaCl (116.8\u2009mg) and MgCl2 (38.0\u2009mg). ATChI solution 15\u2009mM: ATChI (43.4\u2009mg) was dissolved in distilled water (10\u2009ml). BTChI solution 15\u2009mM: BTChI (47.6\u2009mg) was dissolved in distilled water (10\u2009ml). All solutions were stored in Eppendorf caps in the refrigerator or freezer, if necessary. The pure compounds were initially dissolved in DMSO, Tacrine as standard was dissolved in distilled water. The final concentrations for the enzymatic assay were yielded by diluting the stock solution with bi-distilled water. No inhibition was detected by residual DMSO (<0.5%).A mixture of the DTNB solution (160\u2009\u00b5L), enzyme solution (50\u2009\u00b5L) and compounds solutions  was prepared and incubated at 37\u2009\u00b0C for 10\u2009min. The substrate (30\u2009\u00b5L) was added to start the enzymatic reaction. The absorbance data (l\u2009=\u2009405\u2009nm) was recorded under a controlled temperature of 30\u2009\u00b0C for 15\u2009min at 1\u2009min intervals. All measurements were performed as triplicates.Molecular docking studies were performed using the Discovery Studio 2.0 software program (DS 2.0). The X-ray crystallographic structure of AChE (PDB code 2CKM) was obtained from the PDB (the Protein Data Bank). First, Water molecules were removed. Second, hydrogen atoms were added. Third, side chain amides and side chains bumps were fixed. The compounds B4 and D4 was imported to DS 2.0 and docked into the active site to investigate the binding modes.\u22121 penicillin/streptomycin and maintained in a humidified atmosphere of 5% CO2 at 37\u2009\u00b0C. Initially, 8000 cells per well were seeded in 96-well plates for HepG2 or SH-SY5Y cells, then treated with vehicle alone or tested compounds for 24\u2009h. Then 10\u2009\u03bcL CCK8 purchased from CELLCOOK was added to each well and further incubated for another 3\u2009h. The absorbance was measured using a microplate reader (450\u2009nm).HepG2 and SH-SY5Y cells were obtained from the Cell Bank of Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences . HepG2 and SH-SY5Y cells were cultured in MEM or MEM/F12 supplemented with 10% FBS, 100 units mL\u03bcL of binding buffer. After stained with 5\u2009\u03bcL AnnexinV-FITC and 5\u2009\u03bcL propidium iodide at room temperature for 15\u2009min. Cells were then analysed by BD Accuri C6 flow cytometer with cell quest software . Cells undergoing apoptosis are both Annexin V positive and PI negative.Annexin V-FITC and propidium iodide were used to evaluate apoptotic cells by flow cytometry. Cells were treated with different concentrations of tested compounds for 24\u2009h. Then the cells were washed twice with phosphate-buffered saline (PBS) . The collected cells were then resuspended in 500\u20095 cells/well, treating with different tested compounds for 24\u2009h, and then washed three times and incubated with final concentration of 10\u2009\u03bcM DCFH-DA for 30\u2009min at 37\u2009\u00b0C in the dark. After incubation, cells were washed three times and harvested in free-serum medium. The fluorescence of 2\u2032, 7\u2032-dichlorofluorescein (DCF) was detected by flow cytometry (488\u2009nm excitation and 525\u2009nm emission filters) using BD Accuri C6 flow cytometer . Data were processed by using cell quest software .The level of intracellular ROS was measured by using the ROS-sensitive dye, 2\u2032,7\u2032-dichloro-fluorescein diacetate (DCFH-DA), as a probe. In brief, cells were seeded in six-well plates at 2.0\u2009\u00d7\u200910"}
{"text": "Aedes aegypti is a vector of several arboviruses, notably dengue virus (DENV), which causes dengue fever and is often found resting indoors. Culex spp. are largely nuisance mosquitoes but can include species that are vectors of zoonotic pathogens. Vector control is currently the main method to control dengue outbreaks. Indoor residual spraying can be part of an effective vector control strategy but requires an understanding of the resting behavior. Here we focus on the indoor-resting behavior of Ae. aegypti and Culex spp. in northeastern Thailand.Ae. aegypti, Aedes albopictus and Culex spp. Dengue virus was detected in Ae. aegypti. Association analyses between urban/rural and within-house location , household variables, geckos and mosquito abundance were performed.Mosquitoes were collected in 240 houses in rural and urban settings from May to August 2019 at two collection times (morning/afternoon), in four room types  in each house and at three wall heights  using a battery-driven aspirator and sticky traps. Household characteristics were ascertained. Mosquitoes were identified as Aedes aegypti and Culex spp. accounted for 44.78% and 53.17% of the specimens, respectively. Only 2.05% were Ae. albopictus. Aedes aegypti and Culex spp. rested most abundantly at intermediate and low heights in bedrooms or bathrooms . Clothes hanging at intermediate heights were associated with higher mean numbers of Ae. aegypti in rural settings (0.81 [SEM: 0.08] vs. low: 0.61 [0.08] and high: 0.32 [0.09]). Use of larval control was associated with lower numbers of Ae. aegypti . All DENV-positive Ae. aegypti  were collected in the rural areas and included specimens with single, double and even triple serotype infections.A total of 2874 mosquitoes were collected using aspirators and 1830 using sticky traps. Knowledge of the indoor resting behavior of adult mosquitoes and associated environmental factors can guide the choice of the most appropriate and effective vector control method. Our work suggests that vector control using targeted indoor residual spraying and/or potentially spatial repellents focusing on walls at heights lower than 1.5\u00a0m in bedrooms and bathrooms could be part of an integrated effective strategy for dengue vector control.The online version contains supplementary material available at 10.1186/s13071-023-05746-9. Aedes aegypti  is a tropical and subtropical mosquito species widely distributed globally. It is a primary vector of the dengue virus (DENV) and is well adapted to completing its entire life cycle within urban areas and around houses, primarily feeding on humans. It also transmits yellow fever, Zika and chikungunya viruses. Aedes albopictus is a secondary vector of DENV and, although more rural, also exhibits peridomestic resting and biting behaviors.Dengue is the most widespread mosquito-borne viral disease in the world. The number of dengue cases reported to the World Health Organization has increased more than eight-fold over the last two decades . An estiAe. aegypti generally rest indoors rather than outdoors  0.13 vs. sticky trap mean: 3.98, SEM: 0.22. Culex spp. aspirator mean: 0.91, SEM: 0.19 vs. sticky trap mean: 3.86, SEM: 0.19). However, per sampling sticky traps were deployed for a lot longer . For the comparison, only aspirator mosquito collections from houses that had sticky traps deployed were used. Taking into account the differences between area, village, room and height, the aspirator method was more efficient per sampling time effort in collecting Ae. aegypti  and Culex spp.  mosquitoes. Aspirators collected a mean of 0.019 Ae. aegypti/min and 0.029 Culex spp./min, whereas sticky traps collected a mean of 1.3\u2009\u00d7\u200910\u20134Ae. aegypti/min and 1.28\u2009\u00d7\u200910\u20134Culex spp./min. Although the efficiency of capture was higher at all heights, for Ae. aegypti there was a significant interaction effect where aspiration was even better at higher heights .Overall, in houses where mosquitoes were collected both by aspiration and sticky traps, the sticky traps collected more mosquitoes  were positive for the virus. This was too few to analyze with respect to their distribution in rooms and across heights. Two specimens were positive for DENV-1 (0.7%), one for DENV-3 (0.3%), and one with a mixed DENV-1 and DENV-3 infection (0.3%). One specimen was positive for DENV-1, DENV-2, and DENV-3 combined (0.3%). All DENV-positive mosquitoes were collected by aspiration in May 2019 in the rural village of Ku Thong, Mahasarakham province. These five specimens were found in one positive pool of 10 mosquitoes. Three positive mosquitoes were found in the living rooms of two houses, and two mosquitoes were found in the bedroom of one house. All five positive mosquitoes were found at a height of 0.75\u20131.5\u00a0m.Of the 422 Summary household information collected using the questionnaire is shown in Additional file P-values for the univariable analyses of the association of socioenvironmental variables with Ae. aegypti or Culex spp. mosquito numbers are shown in Additional file Ae. aegypti number, and the Yes category was found to be associated with increased numbers of mosquitoes . In rural settings, the following variables were found to be associated with higher Ae. aegypti number: use of temephos for larval control with low use (only every 3\u00a0months) was associated with higher numbers of mosquitoes ; cement walls , outdoor toilets  and increasing number of rooms . Clothing location was also associated with mosquito numbers , with intermediate height of hung clothing being associated with more mosquitoes than lower or higher levels . With 38 variables analyzed and one multivariable analysis would yield a Bonferroni-corrected P-value of P\u2009=\u20090.0013. Thus, the associations observed above must be taken with caution.The Culex spp. mosquitoes in urban settings, the following variables were found to be associated with higher mosquito numbers: absence of open eaves , infrequent use of fogging (every 3\u00a0months)  and low levels of wind flow . In rural settings, the use of fogging  was associated with lower numbers of mosquitoes, and the quantity of hung clothing  was associated with higher numbers of mosquitoes. Shopkeeping as the household occupation was also associated with higher mosquito numbers . As above, the application of the Bonferroni-corrected P-value threshold would suggest that only the use of fogging can be safely considered associated with lower mosquito numbers.For N\u2009=\u200982), followed by bedrooms , living rooms  and kitchens . Geckos were caught on the lower , intermediate  and upper levels .A total of 297 geckos were caught, of which 133 (45%) were in the urban area and 164 (55%) in the rural area. Close to 28% of the geckos were collected in bathrooms . By contrast, there was a positive association between gecko number and the total number of Culex spp. caught by aspiration . These associations remained in a multivariable analysis that included the above-identified significant socioenvironmental variables.Univariable fitting of the gecko number caught revealed no significant association of gecko number with either the Ae. aegypti mosquito resting behavior and environmental factors therewith associated. We found that the majority of female Ae. aegypti mosquitoes rested in bedrooms (35\u201339% of specimens) and bathrooms (ca. 30%) and at intermediate heights (48\u201353% of specimens). Similar results were found in Trinidad, Mexico and Panama, where female Ae. aegypti generally rested in bedrooms, but less so in bathrooms [Culex spp. were also predominantly found in bedrooms and bathrooms and at low and intermediate heights. The similarities in place and height of resting across the genera are interesting but must be treated with caution, especially as the Culex spp. were not identified to the species level. Mosquitoes are abundant in bedrooms likely because people spend a comparatively long time in this room while sleeping, attracting blood-seeking mosquitoes by their body heat and carbon dioxide [This study identified a number of aspects of athrooms , 8, 10.  dioxide . Bathroo dioxide .The tendency for resting to predominantly occur at low (<\u20090.75\u00a0m) to intermediate heights (0.75\u20131.5\u00a0m) was observed for both genera. At lower heights there is less air movement, and it is generally darker than the wall near the ceiling and often lit by light bulbs. Furthermore, ceiling fans are often installed, which may interfere with mosquito resting. Finally, at lower heights, there are often hanging objects such as clothes, towels and mosquito nets as well as furniture that create sheltered dark sites, offering an ideal hiding place to rest and digest . MosquitAe. aegypti were observed to increase in the living room in the afternoons, such rooms being the most juxtaposed to the outdoors. Such exiting behavior is thus likely important to take into account for similar studies.For both genera of mosquitoes, there was a tendency for numbers to decrease in the afternoon, suggesting that the mosquitoes were heading outdoors, potentially looking for oviposition sites. Oviposition has been found to peak in late afternoon to early evening . This miAe. aegypti in rural settings. The absence of eaves and low wind flow were associated with more Culex spp. in urban settings, although the strength of the associations observed was weak. In addition to such house characteristics, it was notable that infrequent use of fogging or larval control was associated with increased numbers of Culex spp. and Ae. aegypti. Whilst this would make sense, the subjective nature of memory on how frequently vector control was carried out may generate a bias and thus be treated with caution. Identifying household features that provide a conducive environment for mosquitoes can contribute to efforts for implementing push\u2013pull strategies to make houses less attractive [Several of these explanations as to why the mosquitoes were thus distributed are supported by observed associations with the environmental features of the houses. Notably, hanging clothes at intermediate heights was associated with increased numbers of tractive . This cotractive . Whilst tractive , 28. SucComparing the performance of active aspiration versus passive sticky traps to measure mosquito abundance, we found that, broadly, both methods revealed the same resting behavior tendencies, suggesting that low-cost, low-manpower sticky traps offer a viable alternative to aspirators, even if their efficiency (mosquitoes per time) is lower.Ae. aegypti mosquitoes collected by aspiration in rural settings, indicating a protective effect by the presence of more geckos. On the other hand, Culex spp. were positively associated with geckos. This might suggest that the predation by geckos favored Culex spp. potentially through the intermediate predation of spiders, whereas Ae. aegypti was directly affected by gecko predation. However, these results only applied to the urban settings and require a more detailed study.Few have studied potential links between mosquito predators, food web interactions and mosquito vector control , 30. GecA limitation of our study was that we did not distinguish between mosquitoes resting on clothes compared to walls. This was due to methodological complications. However, it would be important for vector control strategies to know whether mosquitoes rest on clothes more than on walls. While it is possible to use IRS on walls, IRS cannot be done if mosquitoes rest on clothes. Furthermore, IRS in bathrooms is not likely to be effective, and other strategies should be employed in such situations. Another limitation of the study was the absence of meteorological data. However, as the villages were sampled sequentially and were taken into account in the analyses, the major findings of the work are unlikely to have been significantly altered by the inclusion of meteorological data. Furthermore, the results were so consistent across the sites whether using aspirators or sticky traps, that although the effect of changes in humidity, rainfall and temperature may have altered total numbers, the behavioral trends remain. Although data were analyzed separately by urban/rural setting, there might be heterogeneity within areas, especially urban areas, for example depending on rich and poor neighborhoods. We did not capture this potential urban heterogeneity. Another limitation is in the sampling strategy used for mechanical aspiration, which always started at the lower wall heights and then progressively moved upwards. Sampling might have been better designed to start at different heights in a randomly selected height protocol. However, that the mosquitoes were predominantly found resting at the lower heights would suggest that any disturbance of mosquitoes pushing them to higher heights did not happen. Finally, the gecko collections were not an initial aim of this study and would therefore benefit from a more targeted study informed by previous studies.Culex spp. are vectors of a number of arboviruses in the region, and thus our work provides an evidence base for understanding vector control for such vector-borne pathogens. Finally, this study highlights the importance of regular mosquito control, which can be targeted through education programs.Our work suggests that vector control using targeted IRS focusing on walls at heights lower than 1.5\u00a0m in bedrooms and bathrooms could be part of an integrated effective strategy for dengue vector control. Although we predominantly focused on dengue, Additional file 1: Table S1.Ae. aegypti mosquitoes collected by mechanical battery-driven aspirator differentiated by collection time, room and wall height above the floor in (A) rural areas and (B) urban areas in northeastern Thailand, 2019.Additional file 2: Table S2.Culex spp. mosquitoes collected by mechanical battery-driven aspirator differentiated by collection time, room and wall height above floor in (A) rural areas and (B) urban areas in northeastern Thailand, 2019.Additional file 3: Table S3.Ae. aegypti mosquitoes collected by sticky traps differentiated by collection room and wall height above floor in (A) rural areas and (B) urban areas in northeastern Thailand, 2019.Additional file 4: Table S4.Culex spp. mosquitoes collected by sticky traps differentiated by collection room and wall height above floor in (A) rural areas and (B) urban areas in northeastern Thailand, 2019.Additional file 5: Table S5. Household environmental and socioeconomic characteristics.Additional file 6: Table S6. Univariable P-values for association analyses of socioeconomic and environmental variables with Aedes aegypti abundance.Additional file 7: Table S7. Univariable P-values for association analyses of socioeconomic and environmental variables with Culex spp. abundance.Additional file 8: Dataset S1. Dataset on mosquito resting and gecko collections.Additional file 9: Dataset S2. Dataset on socioenvironmental characteristics."}
{"text": "Cytosolic DNA sensors (CDSs), expressed in various types of immune and tumor cells, recognize double-stranded DNA (dsDNA) in the cytoplasm. These molecules are activated after the dsDNA recognition and initiate a cascade of events that culminate in the activation of innate and acquired immunity. CDSs were previously believed to recognize pathogen-derived DNA only. However, they can also respond to cytosolic DNA derived from tumor cells. This suggests that CDSs can be used as small-molecule inhibitor targets in combination with existing immunotherapies to enhance anti-tumor immune responses. This review summarizes current research on the mechanisms underlying CDSs, absent in melanoma 2 (AIM2), cyclic GMP-AMP synthase (cGAS), and stimulator of interferon genes (STING)\u2014downstream signaling effectors of cGAS\u2014in the tumor microenvironment. Furthermore, this review discusses the prospects for future anti-tumor immunotherapy strategies based on these molecules.cGAS and AIM2 are CDSs that are activated in the presence of cytosolic dsDNA and are expressed in various cell types, including immune and tumor cells. The recognition of tumor-derived dsDNA by CDSs in the cytosol of tumor-infiltrating dendritic cells (TIDCs) activates the innate and acquired immunity, thereby enhancing anti-tumor immune responses. STING is the downstream signaling effector of cGAS that induces type I interferon (IFN) signaling. Owing to their ability to activate TIDCs, STING agonists have been intratumorally injected in several clinical trials to enhance the anti-tumor immune response elicited by immune checkpoint antibodies. However, they have shown minimal effect, suggesting the importance of optimizing the dose and route of administration for STING agonists and deciphering other immune pathways that contribute to anti-tumor immune responses. Recent studies have revealed that AIM2 activity induces pro-tumor growth through multiple parallel pathways, including inhibition of STING-type I IFN signaling. Thus, AIM2 could be a potential molecular target for cancer immunotherapies. This review summarizes the current research on the roles of cGAS, STING, and AIM2 in immune cells and tumor cells in the tumor microenvironment and discusses the future prospects of anti-tumor treatment approaches based on these molecules. Mammalian cells can sense pathogen invasion and induce innate immunity through nucleic acid recognition. When dsDNA enters the cytoplasm of dendritic cells (DCs) and macrophages after a bacterial or viral infection, CDSs are activated to induce an inflammatory response. These include cyclic GMP-AMP synthase (cGAS) and absent in melanoma 2 (AIM2).Vaccinia virus compared with 30% mortality in wild-type mice . cGAype mice . In addiype mice ,3,4.Listeria, Francisella, and Mycobacteria tuberculosis. The AIM2-deficient mice are more susceptible to these intracellular bacteria .,23.22,23Most studies focus on immune cells within tumors. Therefore, data on the function of STING in tumor cells are limited. Studies using mouse and human colon cancer samples, as well as lung cancer model mice and the TCGA lung cancer dataset, found that tumor cells suppress the high-level expression of cGAS and STING through epigenetic regulation or the production of DNase ,25. ConsChromosomal instability (CIN) is a phenomenon that has been observed in some cancer types, where some or all chromosomes increase or decrease in number. Binding between cGAS and dsDNA is more likely to occur in \u201cCIN-high\u201d cancers than in \u201cCIN-low\u201d cancers. Although STING is activated, the downstream type I IFN signaling pathway is not, resulting in discrepancies, such as a high potential for cancer cell proliferation and metastasis . In CIN-This finding suggests that the activation of the type I IFN signaling pathway could be suppressed despite the activation of tumor cell STING signals. Therefore, the treatment should cause the release of cGAMP and CDNs from tumor cells into the tumor\u2019s microenvironment to activate STING in the cDC1 TIDCs that have infiltrated the cancerous growth, thereby enhancing the anti-tumor immune response.The first STING agonist evaluated for efficacy against cancer was DMXAA, which exhibited antitumor activity in preclinical models. However, phase III trials that compared DMXAA in combination with carboplatin and paclitaxel chemotherapies (CP therapy) to only CP therapy for previously untreated non-small cell lung cancer failed to demonstrate an improved response rate, progression-free survival (PFS), or OS . Later sBased on previous results of DMXAA, Aduro Biotech has developed MIW815 (ADU-S100), a CDN that agonizes cGAMP, thereby activating human STING isoforms and acting as a human STING agonist. CDNs are susceptible to enzymatic degradation by serum phosphatases and hydrolases , leading+CD8\u2212 dendritic cells but not on cDC1s in tumor-draining lymph nodes. In contrast, oral MSA-2 significantly decreased the tumor volume of melanoma, colon, and lung cancer mouse models when combined with anti-PD-1 therapy. These results suggest that the molecular properties of STING agonists and administration modes should be optimized to achieve optimal treatment outcomes.To overcome these challenges, a non-CDN small molecule STING agonist, GSK3745417 (diABZI), that is systemically administered, has been developed . As it sNew types of packaged STING-activating CDNs with improved cytosolic delivery and stability are also candidates for future STING agonists . Since l+ T-cells. In addition, loss of AIM2-dependent IL-1\u03b2 and IL-18 processing further enhances the treatment response by limiting the recruitment of T regulatory cells (Tregs). Hence, AIM2-deficient DC vaccination not only enhances immune responses to the tumor by activating STING but also suppresses IL-1\u03b2 and IL-18 production, resulting in synergistic therapeutic responses . Tumor cells that are bonded to antibodies (molecularly targeted drugs), such as the anti-human epidermal growth factor receptor 2 (anti-HER2) and anti-CD20 antibodies, are taken up into TAMs as a result of antibody-dependent cellular phagocytosis (ADCP). After ADCP, TAMs inhibit NK cell-mediated antibody-dependent cellular cytotoxicity (ADCC) and T-cell-mediated cytotoxicity in a breast cancer and lymphoma mouse model. Moreover, AIM2 is recruited to the phagosomes through Fc\u03b3 receptor signaling and activated by sensing the phagocytosed tumor DNAs through the disrupted phagosome membrane. This subsequently activates IL-1\u03b2 signaling, which induces the expression of the immune checkpoint molecules PD-L1 and indoleamine 2,3-dioxygenase (IDO) on the TAM cell surface. These results revealed the role of ADCP of TAMs in cancer immunosuppression and suggested that simultaneous therapeutic antibodies and AIM2 inhibition of TAMs provide synergistic effects in cancer treatment .c-myc and, conversely, suppresses the expression of FOXP3. Therefore, when AIM2 is removed from the Tregs at sites of chronic inflammation, the AKT\u2013mTOR pathway is activated, c-myc expression is increased, and FOXP3 expression is decreased. This reduces the number of bona fide Tregs. Moreover, multiple models of chronic inflammation have shown that increasing the amount of IFN-\u03b3 produced by Tregs and decreasing the immunosuppressive action exacerbates inflammation. These findings suggest that, in addition to its suppression in TIDCs, the suppression of AIM2 in TAMs and Tregs also increases antitumor immune response [Although AIM2 has long been investigated for its function in bone marrow cells, such as DCs and macrophages, it is more strongly expressed in Tregs. Therefore, there has been a new focus on its function in this class of T-cells. In experimental autoimmune encephalomyelitis and chronic inflammation in enteritis, the expression of AIM2 by Tregs maintains the expression of the transcription factor forkhead box P3 (FOXP3). In other words, AIM2 maintains Treg homeostasis in cases of inflammation. As AIM2 binds with the receptor for activated C kinase 1 (RACK1) and protein phosphatase 2A (PP2A), it suppresses activation of the protein kinase B\u2013mammalian target of the rapamycin (AKT\u2013mTOR) pathway. This signaling pathway promotes the expression of the cancer gene response .AIM2 is hardly expressed in melanomas and was initially discovered as a tumor suppressor gene . Most meThe functions of AIM2 have been investigated in many cancer types, including melanoma. For instance, AIM2 has long been known as a marker for poor prognosis in colorectal cancer. This CDS suppresses the phosphoinositide 3-kinase (PI3K)\u2013AKT signaling pathway in colorectal cancer cells. In patients with colorectal cancer with low AIM2 expression, the PI3K\u2013AKT signaling pathway is upregulated, which increases the proliferative and survival abilities of the cancer cells, making them highly malignant. In addition, research using a colon cancer mouse model revealed that low AIM2 expression induced an imbalance of the intestinal flora (dysbiosis), thereby providing a suitable environment for the proliferation of colorectal cancer cells . SimilarSTING agonists that activate cDC1 TIDCs have been investigated as adjuvants for increasing the antitumor immune response elicited by anti-PD-1 immunotherapy. However, the results of combination therapy with anti-PD-1 antibodies + intratumoral STING agonist administration have not been promising. Therefore, STING agonists that can be administered systemically and stabilize the close confirmation of STING to decrease the toxicity may be an effective approach for targeting the STING-type I IFN signaling pathway. Combination therapy consisting of the anti-PD-1 Ab+ systemic STING agonist should be investigated in future clinical trials since it has the potential to transform the therapeutic landscape once optimized.+ T-cells. As there is no drug that selectively inhibits AIM2, it would be impossible for a treatment that targets this molecule to be put to clinical use in the near future. In addition to being used as a STING agonist, anti-AIM2 therapy would activate TIDCs and act as an IL-1\u03b2 and IL-18 inhibitor, thus acting on more pathways than the STING agonist does. Therefore, as a candidate for molecularly targeted drug therapy, AIM2 could be more effective at reinforcing antitumor immunotherapies. Researchers have recently reported the engineering of a nanomolecular STING agonist vaccine that has been modified to be taken up by cDC1 [+ cells could be a novel cancer immunotherapy.In addition, there remains a need to analyze other immune pathways that contribute to the immune infiltration into tumors and thus help to determine their \u201chot\u201d or \u201ccold\u201d states. Researchers have begun testing antibodies against TIM-3, which is an immune checkpoint receptor that suppresses the efficacy of STING agonists and regulates CD8 by cDC1 . An AIM2"}