{"text": "Tumour growth rates were measured in 105 patients using in vivo incorporation of bromodeoxyuridine (BrdU) and investigated for any relationship to tumour factors or survival. The median labelling index (LI) was 8.7%, the duration of S-phase (Ts) was 14 h and the potential doubling time (Tpot) was 5.9 days. The labelling index in aneuploid tumours was significantly higher than that in diploid tumours. However the total labelling index (TLI) did not differ significantly between aneuploid and diploid tumours, and so it would seem likely that the difference in LI is due to the dilutional effect of benign tissue upon the calculation of LI in diploid tumours. The total labelling index, duration of S-phase and potential doubling time were not related to the tumour factors examined . Interim survival analysis was carried out and there was no difference in survival between those patients with high values for TLI, Ts, and Tpot and those with low values."}
{"text": "The two techniques of flow cytometry analysis (FCM) and immunohistochemical localisation of bromodeoxyuridine (BrdUrd) incorporation after in vivo administration, were combined to study proliferation in squamous cell carcinoma of the head and neck region. Care was taken in this study to ensure that similar material was processed using both techniques such that comparisons could be made. FCM underestimated the labelling index (LI) in tumours classified as diploid compared to the histological evaluation of the tumour cells within those tumours (4.6% vs 17.1%). However, in aneuploid tumours, the FCM LI (10.7%) was similar to that obtained from histology (13.5%). Indeed, proliferation assessed by the combination of histology LI and FCM duration of S-phase (Ts) indicated that diploid tumours had a shorter median potential doubling time (Tpot) of 2.1 days compared to aneuploid (2.8 days). Despite the heterogeneity of proliferation evident histologically within the specimens, there was not a wide variation in the results of FCM analysis when multiple samples from resections were studied. Using FCM data alone, 46% of the tumours showed a Tpot of less than 5 days. When the Ts from the FCM data was combined with the average histological LI, 84% were less than 5 days and with the maximum LI, 99% were within this time interval. Compared with previous estimates, the proportion of tumours possessing proliferative characteristics which may indicate the need for acceleration of treatment seems to be much larger."}
{"text": "The prognosis of colorectal cancer has not significantly changed during the last 30 years. While evaluation of tumour cell proliferation may provide prognostic information, results obtained so far have been contradictory Heterogeneity in tumour cell proliferation may explain these contradictions. With in vivo injection of iododeoxyuridine (IdUrd), estimation of labelling index (LI), S-phase transit time (Ts) and potential doubling time (Tpot) may be performed from a single sample. A total of 109 colorectal cancers were studied after in vivo injection of IdUrd before surgical removal. From each cancer, four to eight samples were processed for both flow cytometrical (FCM) and immunohistochemical (IHC) visualization of IdUrd incorporation. LI/IHC was morphometrically quantified at both the luminal border and the invasive margin of these tumours. LI was significantly higher at the luminal border compared with the invasive margin, although they were correlated with each other. Using combined IHC and FCM methods, rapidly growing colorectal cancers (high LI and/or low Tpot) showed an increased survival  in the entire unselected material and for radically removed Dukes' B tumours. FCM data alone did not discriminate for survival, with the exception of Ts in diploid and radically removed Dukes' B tumours."}
{"text": "The proliferative potential of human solid tumours, in vivo, was investigated using bromodeoxyuridine (BrdUrd) incorporation and flow cytometry (FCM). Patients with solid tumours from a variety of sites were injected with 500 mg BrdUrd, intravenously, several hours prior to biopsy or surgical excision. The labelling index (LI), duration of S-phase (Ts) and thus the potential doubling time (Tpot) could be measured within 24 h of sampling. The results show that both the LI and Ts vary greatly between tumours (Ts ranges from 5.8 to 30.7 h). However, within this study of 26 evaluable patients, tumours of the same tissue origin tended to have similar Ts values. Melanomas had the shortest Ts (8.8 h), nine patients with head and neck cancer had Ts values ranging from 5.8 to 18.8 h (median 12.5 h). The longest Ts values (24 h) were found in lung and rectum. The estimates of Tpot ranged from only 3.2 days in an oat cell carcinoma to 23.2 days in a lymphoma. The striking feature of the study was that 38% of the tumours had a potential doubling time of 5 days or less. We found no relationship between proliferation and histopathological differentiation or DNA ploidy. It should now be possible to assess the prognostic significance of pretreatment cell kinetic measurements which may, in the future, aid in the selection of treatment schedules for the individual patient."}
{"text": "ADH1B) genotype was not an independent risk factor for breast cancer, athough the possibility was raised that it modifies risk associated with high levels of alcohol consumption  0.8\u20131.6 for ADH1B*1/*1 genotype vs 0.2, 95% CI 0.1\u20131.0 for ADH1B*2 carriers).In a population-based study of 613 cases and 1082 controls, alcohol dehydrogenase 1B ( Of all 2257 eligible controls, 1381 (61.2%) participated. Detailed information on demographic characteristics and various risk factors was elicited by means of a self-administered questionnaire. Alcohol consumption was assessed for three time periods, that is, 15\u201320, 20\u201330 and 30\u201350 years, and for different types of beverages . The detailed method for the calculation of average daily alcohol intake has been described previously .ADH1B gene. Two minor-groove-binding (MGB) DNA probes were synthesised. The probe corresponding to the wild type (5\u2032-FAM-TCTGTCGCACAGATG-MGB-3\u2032) was labelled with 6-FAM, and the probe corresponding to the mutation (5\u2032-VIC-AATCTGTCACACAGATGA-MGB-3\u2032) was labelled with VIC at the 5\u2032-end. The genotypes were analysed in software \u2018Sequence Detector\u2019 version 1.7 by procedure allelic discrimination after PCR.Genomic DNA was extracted from peripheral blood using the QIAamp DNA Blood Kit . Primer and hybridisation probes were designed with Primer Express. Sense primer 5\u2032-CTCTTTATTCTGTAGATGGTGGCTGTAG-3\u2032 and antisense primer 5\u2032-GGGTCACCAGGTTGCCACTA-3\u2032 were used to amplify a 76\u2009bp fragment containing the G47A polymorphism of the \u03bcl containing 40\u2009ng of DNA, 300\u2009nM of each primer, 200\u2009nM of each probe and 12.5\u2009\u03bcl of TaqMan Universal PCR Master Mix .Amplification was performed in a final volume of 25\u2009In every assay, negative controls as well as controls for the wild type, mutant type and heterozygote were included. The PCR conditions were as follows: 2\u2009min at 50\u00b0C plus 95\u00b0C for 10\u2009min, followed by 40 cycles of denaturation at 92\u00b0C for 15\u2009s, annealing and extension in one step at 60\u00b0C for 1\u2009min. Genotyping was performed blinded to case\u2013control status of the blood sample providers.\u03c72 tests were used to assess deviation from Hardy\u2013Weinberg equilibrium. Multivariate conditional logistic regression analysis with 5-year age strata was carried out using the PHREG procedure of the statistical software package SAS release 8.2 .ADH1B genotype and alcohol consumption was tested by using multiplicative interaction terms and evaluated by the likelihood ratio test.In the multivariate model, we included several relevant variables influencing breast cancer risk see . VariablADH1B*2 allele, corresponding to allele frequencies of 0.06 and 0.05, respectively. The distribution of ADH1B genotypes was in Hardy\u2013Weinberg equilibrium (P=0.4 for cases and P=0.6 for controls).Selected characteristics of the study population are depicted in ADH1B genotype and several risk factors, including first-degree family history of breast cancer, body mass index, parity, breastfeeding or smoking status (data not shown). However, alcohol consumption was found to differ significantly by ADH1B genotype among controls, with a mean average daily alcohol intake of 7.2\u2009g (standard deviation (s.d.) 9.1) in women with ADH1B*1/*1 genotype and 5.8\u2009g (s.d. 7.8) in carriers of the *2 allele (Wilcoxon's rank-sum test P=0.01). Results were virtually identical when all study subjects were considered (data not shown).We did not observe an association between ADH1B genotype on breast cancer risk  0.7\u20131.4). However, multivariate analysis separately for carriers and noncarriers of the ADH1B*2 allele yielded differences in breast cancer risk associated with increasing levels of alcohol intake , although the odds ratio (OR) was significant only for the category of 12\u2009g or more alcohol per day. In contrast, among women with ADH1B*1/*1 genotype, breast cancer risk increased with increasing alcohol consumption (P=0.03). The interaction between ADH1B genotype and alcohol intake was borderline statistically significant for the highest category of alcohol consumption (P=0.05) but not for low or moderate levels.The analysis revealed no main effect of l intake . Among cADH1B genotype in our study population, which was apparent only at the highest consumption category of 12\u2009g or more alcohol per day. We showed previously that breast cancer risk increased significantly with high daily alcohol intake of \u2a7e19\u2009g in this study population . However, since ADH1B genotype and alcohol intake are not independent in our study population, the modifying effect of the ADH1B genotype on breast cancer risk associated with alcohol consumption is overestimated in the case-only analysis, partly due to residual confounding by differences in alcohol consumption caused by the genotype (ADH1B genotype and alcohol consumption, alcoholism or adverse reactions such as flushing were observed in previous studies (Our data raise the possibility of an effect modification of the association between alcohol consumption and breast cancer risk by ADH1B genotype on alcohol pharmacokinetics in vivo. Most studies failed to detect differences in blood alcohol or acetaldehyde levels by ADH1B genotype (ADH1B*2 allele (There is still controversy in the literature regarding the effect of ADH1B*2 allele in our study could therefore be explained by a higher alcohol elimination rate in these subjects. Owing to the low allele frequency of the ADH1B*2 allele in Caucasians, our study had limited power to detect a gene\u2013environment interaction for high alcohol consumption levels and our findings about ADH1B genotype as an effect modifier of breast cancer risk associated with high alcohol consumption need confirmation in larger studies.The reduction in breast cancer risk associated with high consumption levels in carriers of the"}
{"text": "Objective. The purpose of the study was to compare the cognitive skills of young children diagnosed with autism spectrum disorder (ASD) to same-aged peers referred for possible developmental delays or behavioral concerns using the Bayley Scales of Infant Development-Third Edition. Method. A retrospective chart review was conducted of 147 children ages 16 to 38 months who were referred to a diagnostic clinic for developmental evaluation. Children with ASD were compared to those without ASD with respect to cognition and language outcomes, both overall and by age. Results. While language skills in children with ASD were more significantly delayed than language skills in children without ASD, there was less discrepancy in the cognitive skills of children with and without ASD. Conclusion. Formal cognitive assessment of children with ASD can provide guidance for developmental expectations and educational programming. Cognitive skills of children with ASD may be underappreciated. The number of children diagnosed with autism spectrum disorder (ASD) has rapidly increased in recent years. Best estimate of current prevalence of children with ASD is just over one per 100 [Autism was first described by Kanner , who obsDiagnostic and Statistical Manual of Mental Disorder-IV with 70% to 75% of children having both [The prevalence of intellectual disability  in children with autism was estimated to be 90% before 1990 . Prevaleing both . EdelsonExpanded definitions of the autism spectrum have included children without intellectual disability, and ASD now includes the subgroups of autistic disorder, Asperger syndrome, and pervasive developmental disorder . Recent Since the DSM-IV and inclusion of a broader definition of children with ASD, more studies have been conducted looking at the developmental profiles of children with this disorder, including their IQ, motor, and language skills. In her review, Edelson  found th According to Mayes and Calhoun , 67% of The Bayley Scales of Infant Development\u2014Third Edition [ Edition  included All composite and subtest scores for the PDD group were significantly lower that those obtained by children in the matched control group. Cognition scores were one standard deviation lower for children in the PDD group, and language scores were even more significantly delayed than cognitive skills. In summary, the ability profiles of children with autism spectrum disorder have been highly variable in former studies. There is limited research on the comparison of the cognitive profiles of young children with and without autism who are referred for language and behavioral concerns. To further explore the cognitive profiles of children with and without autism spectrum disorder, the following research questions were asked: how do the cognitive profiles of young children with ASD differ from same-aged children seen for developmental evaluation who do not have ASD? Do young children diagnosed with ASD have higher cognitive scores than language scores on a standardized assessment tool? Are there age, gender, and socioeconomic differences between the children with ASD and those without ASD with respect to cognitive abilities?This study was a retrospective chart review of children referred to the Kluge Children's Rehabilitation Center Infant and Young Child Clinic for developmental assessment during an 18-month period in 2007 and 2008. A total of 147 children ages 16 to 38 months were included in the study, with a median age of 27 months. There were 107 males (73%) and 40 females (27%). Most of the children were referred to the diagnostic clinic by either their primary physician or a family member and were seen for concerns regarding their development in areas such as language, behavior, possible autism, or global developmental delay. Each child was seen by an early childhood special educator and a developmental pediatrician. The majority of the children were from central Virginia and surrounding areas. The family's health insurance status\u2014whether they had public insurance (Medicaid) or private insurance\u2014was used as a proxy measure of socioeconomic status (SES). During the clinic visit, each family reported whether the child was receiving early intervention and/or therapy services, and the child was referred to appropriate services if they were not already enrolled in a local program. The study was approved by the Human Investigation Committee of the University of Virginia.Bayley Scales of Infant Development\u2014Third Edition (BSID-III) by a person certified in their administration. Other tests of the BSID-III such as fine and gross motor and social and adaptive tests were not administered during the clinic visit due to time constraints. The third edition of the BSID [Each child was given the cognitive and language tests from the the BSID  was publChildhood Autism Rating Scale (CARS) [For children referred for screening of possible autism spectrum disorder, the e (CARS)  was admie (CARS) . P-value <.05. Overall comparisons between the two groups (those with ASD versus those without ASD) were made via chi-square tests for categorical variables and t-tests for continuous outcomes. Linear models were fit to the cognition and language outcomes, with age and group (and their interaction) as predictors. Comparisons between the two groups were then made at each of four standard ages  based on estimates from these models.All analyses were performed utilizing SAS Version 9.1; statistical significance was defined as a More children referred to the diagnostic clinic were male (73%) than female. Socioeconomic status as determined by public or private insurance was not significantly different for children with ASD and without ASD, although fewer children with ASD (26%) were insured by Medicaid than children without ASD (37%). Sixty percent of the children referred to the clinic were receiving early intervention and/or therapy services at the time of the clinic visit. Of the 147 children referred to the clinic, 64 children were administered both the BSID-III and the CARS compared to 72 children who received only the BSID-III assessment because they were not observed to exhibit any behavioral characteristics associated with ASD. There were 54 children who were diagnosed with ASD using the CARS criteria, with a higher number of males (42) than females (12). In regards to the age of diagnosis of ASD, 42 were over 24 months of age and 12 were under 24 months of age. In addition, eleven children were uncooperative during the testing session in order to complete the BSID-III tests and were not included in the analyses. These eleven children did receive a CARS evaluation by observation and parental report. Of the 11, all but one child met criteria for ASD. P = .0006). The mean ASD language composite score was over 16 points lower (P < .0001). Developmental age equivalents were also lower for children with ASD in cognitive, receptive, and expressive language . Significant cognitive differences between children with and without ASD were observed only for older children (over two years old) . Including gender in the model did not impact the results.However, significant interactions existed between age and ASD status with respect to the cognitive outcomes (interaction ars old) . Childrears old) ; no signIn the current study, the majority of young children referred to a diagnostic clinic were able to receive a standardized assessment using the BSID-III, including children who were found to have characteristics of ASD. As seen in other studies, males were more likely to be diagnosed with ASD than females. While the cognitive skills of children with ASD were generally lower than the children without ASD, many of the children with ASD scored in the average and low-average range in cognition. This relative strength in cognitive or nonverbal reasoning ability that is seen in children with ASD may provide valuable information for families or intervention agencies struggling to meet the needs of this challenging population. M = 78) and younger age (M = 42 months) were both predictive of placement of children with ASD in a regular classroom rather than a special education classroom following a preschool program that provided treatment using intensive applied behavioral analysis (ABA) [For example, the assessment of cognitive skills by a standardized tool such as the BSID-III may assist with future prognosis. Harris and Handleman found that a higher IQ (is (ABA) . Cognitiis (ABA) . Childreis (ABA) .An additional finding in the current study was the discrepancy in the cognitive scores of children with ASD by age, with older children having lower cognitive scores than children below two years of age. One reason for the difference in cognitive scores between younger and older children with ASD may be that the cognitive measure of the BSID-III incorporates increasingly difficult verbal directions and responses for children two years of age and older. Language-based concepts, such as size and color discrimination and number concepts, are included in items on the cognitive test that are asked of older children. Children with ASD may have more difficulty providing the requisite verbal responses than their peers without ASD. As would be expected, children with ASD scored significantly lower in language skills as a group than children without ASD. Individualized assessment of language skills may assist in selecting the appropriate communication approach to use with a child. The development of a functional communication system  or augme There is a growing consensus that critical components of an effective intervention program for children with ASD include early entry into a program following diagnosis, inclusion of parent training, incorporation of a high degree of structure, implementation of strategies for generalization, and low student-to-teacher ratio including one-on-one time . StandarChildren who have difficulty approaching tasks may require the intensive behavior methods of the ABA approach . In a reEarly diagnosis and intervention services may help to ameliorate the parenting stress involved with having a child with ASD. Parents and siblings of children with ASD report experiencing more depression than those of typically developing children or even children with other disabilities . ParentiEarly identification of children with ASD will need to be addressed by a variety of health care providers, including primary care physicians, pediatricians, and public health nurses. Referral for differential diagnosis should be completed as soon as concerns are raised. Because of the ongoing needs of families with children with ASD, health care providers will need to have knowledge regarding community resources that may be able to assist the family including early intervention programs, early childhood special education programs through the local public schools, child and family counseling services, and parent support groups.The current study is limited by the retrospective nature of the data collection. The subjects were children who were referred to a diagnostic developmental clinic and therefore may not represent a broader sample of the population. The assessment of the children was limited to cognitive and language domains of the BSID-III so that other areas of development were not included that may have been useful for instructional or diagnostic purposes. The children were seen only once by the educator so that longitudinal information was not available. The children were young and may have significantly different developmental profiles in the future due to maturation or intervention. It should be noted that the educator conducting the evaluations is also one of the authors of this study.The current study found that young children being screened for possible ASD were able to be evaluated using a standardized measure such as the BSID-III. As observed in other studies, males were much more likely to be diagnosed with ASD than females. Children who were over two years of age were more likely to be diagnosed with ASD and demonstrated lower cognitive scores than younger children or children without ASD. While the cognitive skills of children with ASD were slightly lower than children without ASD, specific abilities were observed that could be used to match a child's skills with treatment options. Language skills were significantly more impaired and predictive of a diagnosis of ASD, but children without ASD also exhibited a high rate of language delay and would benefit from early intervention services. The developmental profiles from standardized assessments may be used for referral to appropriate educational programs and provide valuable information for intervention strategies. While all children with language delays will benefit from referral to services, children with ASD will require more intensive services tailored to their specific strengths and challenges."}
{"text": "CD36) variants with polypoidal choroidal vasculopathy (PCV) and compare them with those in typical neovascular age-related macular degeneration (tAMD).To clarify the association of cluster of differentiation 36  and 198 age-matched controls. Four tag single-nucleotide polymorphisms (SNPs)\u2014rs10499862, rs3173798, rs3211883, and rs3173800\u2014in the Although none of the SNPs tested were associated with PCV, the allelic frequencies of rs3173798 and rs3173800 were significantly different between PCV and tAMD patients. Genotype association analysis demonstrated different associations of these two SNPs between PCV and tAMD in the genotype model. Haplotype analysis revealed that the association of the major haplotype (T-T-T-T) at four selected SNPs in CD36 differed significantly between PCV and tAMD patients.CD36 region may be associated with the difference in genetic susceptibility for PCV and tAMD.The  Age-related macular degeneration (AMD) is a leading cause of central vision loss in the elderly in industrialized countries . AlthougCD36 region with the incidence of neovascular AMD (corresponding to tAMD in the present report) in the Japanese population ).None of the SNPs reported in the present study showed any significant deviations from the Hardy\u2013Weinberg equilibrium over the entire sample (p>0.05). nt model . In addiand tAMD . There wCD36 region, and found that the minor allelic frequencies at SNPs rs3173798 and rs3173800 and the haplotype at four selected SNPs in the CD36 region were significantly associated with the difference in genetic susceptibility to PCV and tAMD. Namely, T, T alleles were less frequent than C, A alleles in PCV than in tAMD patients at rs3173798 and rs3173800, respectively. Moreover, the T-T-T-T haplotype at rs10499862, rs3173798, rs3211883, and rs3173800 on introns 3 and 4 in the CD36 region was significantly less frequent in PCV than in tAMD.We genotyped four tag SNPs in the CD36 region with neovascular AMD [CD36 in genetic susceptibility for PCV and tAMD, which may contribute to the different clinical characteristics of PCV  from tAMD [rs10499862, rs3173798, rs3211883, and rs3173800 were not covered by the gene chips used in previous genome-wide association studies [CD36 with the incidence of tAMD. However, these SNPs did not remain significant in the prevalence of PCV. Moreover, a statistically significant difference was detected in the association of this region between tAMD and PCV. This suggests a different association of the CD36 region with the phenotype of neovascular AMD, although the details have not yet been clarified. A recent in vivo study demonstrated that a downregulation of CD36 in capillary sprout endothelial cells facilitated angiogenesis [CD36 have been found to be more susceptible to light-induced retinal damage, and are more likely to develop age-related retinal degeneration and choriocapillary rarefaction [Although our previous report demonstrated an association of SNPs in the ular AMD , the pherom tAMD ,6-9. Sin studies ,29, they studies , furtherogenesis . Rats caefaction -22. In pefaction  and in tefaction . A recenefaction . An immuefaction . Moreoveefaction .CD36 is currently unknown, because the haplotype in the present study does not reside in the coding sequence of CD36. FASTSNP [rs3173798 is located at splicing site with medium-high effect, but it was not shown whether it is located at splice donor site or acceptor site [rs3173798 tended to increase CD36 expression while reducing high-density lipoprotein levels [rs3173798 was less frequent in the tAMD group than the PCV and control groups, the reduced expression of CD36 might be correlated with tAMD but not PCV pathogenesis. Moreover, Picard et al. have recently demonstrated an accumulation of oxLDL in Bruch\u2019s membrane among aged CD36 knockout mice [CD36 variants with tAMD and PCV.The biologic basis of the association with the haplotype in  FASTSNP  gave thetor site . Thus, tn levels ,42. Sincout mice . The oxLout mice . HoweverCD36 variants may indirectly contribute to AMD via abnormal lipid metabolism. However, the results of this study suggest a possible role of lipid metabolism in the different pathogeneses between PCV and tAMD.The limitation of this study was a possible influence of lipid metabolism on AMD pathogenesis ,46. SincIn conclusion, the present study suggested some clinical possibilities for genetic association analysis that can be further investigated to determine the specific pathogenesis of PCV as distinct from that of tAMD."}
{"text": "Salvia miltiorrhiza radix, has been reported to have antioxidant effects. We examined the effects of LAB on the prevention of diabetic retinopathy in Otsuka Long-Evans Tokushima Fatty (OLETF) rats, an animal model of type 2 diabetes.Lithospermic acid B (LAB), an active component isolated from LAB (10 or 20 mg/kg) or normal saline were given orally once daily to 24-week-old male OLETF rats for 52 weeks. At the end of treatment, fundoscopic findings, vascular endothelial growth factor (VEGF) expression in the eyeball, VEGF levels in the ocular fluid, and any structural abnormalities in the retina were assessed. Glucose metabolism, serum levels of high-sensitivity C-reactive protein (hsCRP), monocyte chemotactic protein-1 (MCP1), and tumor necrosis factor-alpha (TNF\u03b1) and urinary 8-hydroxy-2\u2032-deoxyguanosine (8-OHdG) levels were also measured. Treatment with LAB prevented vascular leakage and basement membrane thickening in retinal capillaries in a dose-dependent manner. Insulin resistance and glucose intolerance were significantly improved by LAB treatment. The levels of serum hsCRP, MCP1, TNF\u03b1, and urinary 8-OHdG were lower in the LAB-treated OLETF rats than in the controls.Treatment with LAB had a preventive effect on the development of diabetic retinopathy in this animal model, probably because of its antioxidative effects and anti-inflammatory effects. However, the causes of these problems and therapeutic options have yet not been fully uncovered. Among the side effects, diabetic retinopathy is the most common microvascular complication of individuals with both type 1 and type 2 diabetes, with nearly all patients with type 1 diabetes and more than 60% with type 2 diabetes being estimated to develop diabetic retinopathy 20While laser treatment at best permits preservation of visual acuity in cases of diabetic retinopathy, many agents such as fenofibrate, ruboxistaurin, renin-angiotensin system blockers, and peroxisome proliferator-activated receptor gamma agonists have been used in attempts to delay or prevent diabetic retinopathy It is currently believed that retinopathy is an inflammatory process, because various studies have shown that the circulating leukocytes activated in diabetic patients play an important role in the increased adhesion of leukocytes, macrophages and vascular adhesion molecules, and in the process of vascular occlusion and retinal ischemia Today, antioxidants are known to be effective against microvascular complication such as diabetic nephropathy as well as macrovascular complications of diabetes such as myocardial infarction, atherosclerosis and stroke Salvia miltiorrhiza radix is a traditional Chinese herbal medicine that has been used for many years in East Asia for the treatment of diabetic complications. Lithospermic acid B (LAB), a recently isolated component of S. miltiorrhiza, is known to have multiple pharmacological actions such as antihypertensive in vivo and platelet-derived growth factor-induced vascular smooth muscle cell proliferation and migration in vitroTreatment with LAB showed protective effects against micro- and macrovascular complications of diabetes Reactive oxygen species have been reported to be associated with microvascular complications in patients with diabetes weeks of age, when obesity and insulin resistance develop. The OLETF rats were held in the Preclinical Laboratory of Seoul National University Bundang Hospital, South Korea, for the duration of the study.All animals were handled in compliance with the Guide for Experimental Animal Research of the Laboratory, Seoul National University Bundang Hospital. Seoul National University Hospital Ethics Committee for Animal Study approved this study (63-2010-020). Thirty five-week-old male Otsuka Long-Evans Tokushima Fatty (OLETF) rats, an obese animal model of insulin resistance, were donated by the Otsuka Pharmaceutical Co. . They were allowed to grow to 24mL normal saline per day and the experimental rats were given 10mg/kg or 20mg/kg of LAB per day. Rats were administered with LAB or normal saline using an oral Zonde needle  at 9\u201310 am for 52weeks. All rats were fed a regular chow diet and had free access to water; they were maintained in plastic cages in an air-conditioned room at 22\u00b12\u00b0C and 55\u00b110% humidity.We divided the rats into three groups (n\u200a=\u200a10 each). Controls received 5Salviae miltiorrhizae Radix, and subsequently purified by normal silica gel column chromatography with polar-eluent  to give a 1.01% yield. Acidification of magnesium lithospermate B with 0.5N-HCl afforded lithospermic acid B at an 84% yield Lithospermate B was isolated from 80% MeOH extract of weeks. All retinal photographs and fluorescein angiography images were independently reviewed twice by one ophthalmologist (SJW), and the retinal vascular caliber was measured in each blood vessel 1mm distant from the optic disc and averaged for each eye.Fundus photography on both eyes of each animal was performed by an experienced technician using a 45\u00b0 fundus camera  at week 0, 12, 24, 36, and 52 of the dosing phase. Fundus fluorescein angiography was performed on both eyes at 52Eyeballs were enucleated from rats (both control and LAB groups) after euthanasia with a lethal dose of pentobarbital and fixed in 10% neutral buffered formalin solution. They were embedded in paraffin wax. Sections (4 \u00b5m thickness) perpendicular to the optic disc were stained with hematoxylin and eosin (H&E) for light microscopy. Digital images were obtained using a high-resolution digital camera system  linked to a microscope  and desktop computer. For all eyes, retinal images were obtained at the same distance (1500 \u00b5m) from the optic nerve.h at room temperature. Slides were washed with PBS.Sections were deparaffinized in xylene, rehydrated in a graded ethanol series, and stained using a BenchMark XT automated immunostainer . Immunohistochemistry was performed using an anti-VEGF antibody . Sections were washed with phosphate buffered saline (PBS) and incubated with a secondary antibody , prepared in PBS containing 1% horse serum, 1% bovine serum albumin and 0.3% Triton X-100, for 1mL syringes and 30 gauge needles. Samples were stored at \u221270\u00b0C until assayed. The VEGF concentration was measured with a rat VEGF-specific polyclonal antibody using a commercial enzyme-linked immunosorbent assay (ELISA) . The detection limit of the method was 31.2\u20132000 pg/mL, based on a standard curve from the manufacturers. All measurements were carried out in duplicate. The coefficients of variation in intra- and interassay variations were 7.2% (79.4\u00b15.7 pg/mL) and 9.4% (87.6\u00b18.2 pg/mL), respectively.Immediately after the rats were euthanized, the VEGF concentration was measured in ocular fluid\u2013a mixture of the aqueous humor and vitreous fluid\u2013by puncturing the ocular globe using disposable 1M cacodylate buffer (pH7.4) for 1h, and then postfixed in 2% osmium tetroxide. They were then dehydrated in ethanol series, and embedded in epoxy resin. Semithin sections (1 \u00b5m) were stained with toluidine blue for orientation and identification of the capillaries. Thin sections (60nm) were cut with a diamond knife, placed on 300-mesh copper grids, and stained with uranyl acetate and lead citrate. The sections were viewed and photographed using a JEOL JEM-100SX transmission electron microscope . Each micrograph was analyzed using a commercial image analysis program . Basement membrane thickness was measured on four distinct capillaries for each eye and five measurements were taken per capillary with 10 independent measurements from each eye. One researcher (SJW) examined all eyes in the study and was blinded to the treatment groups.Electron microscopy was performed to determine the retinal basement membrane thickness. The eyes were enucleated, opened at the equator, fixed in 3.5% glutaraldehyde in 0.1mM Tris-HCl pH7.6, 150mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS), and the proteins (10mg/sample) were immediately heated at 100\u00b0C for 3min. Total cell lysates were subjected to sodium dodecyl sulfate\u2013polyacrylamide gel electrophoresis on gels containing 15% (wt/vol) acrylamide with each lane receiving 20 \u00b5g of the sample. After electrophoresis, proteins were transferred onto a nitrocellulose membrane for 2h. The membrane was blocked by treatment with 5% skim milk in Tris-buffered saline (TBS) supplemented with 0.1% Tween-20 (TBST) for 1h. It was then incubated with a primary polyclonal antibody  at a final dilution of 1:1000, overnight in TBST. After three washes in TBST, the membrane was incubated with peroxidase-conjugated secondary antibody  in TBS for 1h and subsequently washed. An enhanced chemiluminescence reaction agent was reacted with the membrane for 3min. Band density was quantified using a densitometer .Tissue samples were homogenized in lysis buffer, and the protein concentration was determined using a protein assay kit . Extracted retinal tissues were lysed in RIPA buffer (252 \u200a=\u200a0.994) over the concentration range of 1.0\u20131,000 \u00b5g/mL. The intra- and interassay coefficients of variation were 6.2% and 2.7%, respectively. The mean serum concentrations of LAB were 12.3\u00b12.4 and 17.1\u00b13.1 \u00b5g/mL in the rats treated with 10 and 20mg/kg of LAB, respectively. LAB was not detected in the control rats.Levels of LAB were measured using a liquid chromatography-tandem mass spectrometry (LC-MS/MS) system from plasma samples collected at the end of the study. The standard curve was linear  was done at baseline and after 24 and 52weeks of LAB treatment. After the 12h fasting glucose concentration had been measured, each animal was injected intraperitoneally with 1.5 g/kg of a 50M glucose solution. Blood samples (about 10 \u00b5L) were collected from an incision in the tail at 30, 60, 90 and 120min after the glucose load. Plasma glucose concentration was measured using reagent strips read in a glucose meter . Insulin was measured in duplicate using a commercial liquid phase radioimmunoassay kit . The homeostasis model assessment of the insulin resistance (HOMA-IR) was calculated using fasting insulin and glucose levels. In addition, the area under the curve for glucose (AUCglucose) was calculated using the trapezoid rule for glucose data from 0 to 120min. High sensitivity C-reactive protein (hsCRP) was measured using ELISA kits developed by BD Biosciences Pharmingen . Monocyte chemotactic protein-1 (MCP1), tumor necrosis factor-alpha (TNF\u03b1), and plasminogen activator inhibitor-1 (PAI1) activity were also measured using a multiplex kit .Possible relevant factors affecting the degree of diabetic retinopathy, such as glucose homeostasis, cytokines, and inflammatory status were evaluated. For glucose homeostasis, postprandial glucose concentrations were measured 2weeks of treatment of LAB or control, urine samples were collected directly from the urinary bladder with a 10mL syringe on the day of euthanasia after fasting the rats overnight. The oxidative DNA damage marker, 8-OHdG was measured in the urine samples using an established high performance liquid chromatographic method based on anion exchange chromatography, fraction collection, and electrochemical detection After 52post hoc test, and P values <0.05 were considered statistically significant. Analysis was done using SPSS for Windows .Results are reported as the mean \u00b1 standard error (SE). Mean values were compared for the LAB-treated groups and control group by analysis of variance (ANOVA) with Tukey's b mg/kg LAB group, 53.2\u00b18.8 \u00b5m in the 20mg/kg LAB group . Fluorescein angiography allowed more precise quantitative analysis of diabetes-induced microvascular dysfunction. At the end of treatment, the diabetic rats (control group) showed multiple diffuse leakages from retinal capillaries in the late phase of angiography . The high dose (20mg/kg) LAB-treated group showed lower VEGF expression than did the low dose group (P<0.05).Immunohistochemical staining showed greater VEGF expression in the control diabetic rats than in the LAB-treated rats Fig. 4. mg/kg LAB-treated, and five 20mg/kg LAB-treated rats. The concentration of VEGF in the high dose treated group was significantly lower than in control rats .Ocular fluid was obtained from five control, six 10rol rats Fig. 5mg/kg LAB group, and 0.09\u00b10.02 \u00b5m in the 20mg/kg LAB group, P<0.05 among groups).Retinal capillary basement membrane thickness was assessed by electron microscopy. For each animal, a minimum of 40 separate measurements of the basement membrane thickness was obtained. A representative micrograph of the basement membrane from each of the three groups is shown in h glucose concentrations from weeks 24 to 50  revealed that control rats had higher glucose concentrations at weeks 46 and 48 than did the LAB-treated rats. There was no difference in glucose excursion for the IPGTTs performed at week 24 among the three groups . After 52weeks of LAB treatment, the 90min and 2h postload glucose concentrations and the AUCglucose during the IPGTT decreased significantly compared with that of the controls .Postprandial 2mg/kg LAB group was not significant. LAB treatment also reduced the level of 8-OHdG, an oxidative stress marker, in a dose-dependent manner  for 52weeks alleviated the development of diabetic retinopathy. Systemic LAB treatment prevented vascular leaking, reduced the expression and concentration of VEGF, and attenuated the disruption of the neurovascular units in the retina. The antioxidative and anti-inflammatory properties of LAB seem to account for this protective role. A significant improvement in postload glucose excursion with LAB treatment can be considered to contribute to this beneficial effect on the development of retinopathy.In this OLETF rat model of type 2 diabetes, treatments with LAB Click here for additional data file.File S1Supporting Figures.Figure a, Fundoscopic findings in 76-week-old OLETF rats after 52weeks of treatment with LAB. A: Control group. B: 10mg/kg LAB group. C: 20mg/kg LAB group. Figure b, Postprandial 2h glucose concentrations from weeks 26 to 50 in the LAB-treated and control rats. Figure c, Glucose concentrations from the intraperitoneal glucose tolerance test (IPGTT) at week 24 in the LAB-treated and control rats. Figure d, Glucose concentrations from the intraperitoneal glucose tolerance test (IPGTT) at week 52 in the LAB-treated and control rats.(DOCX)Click here for additional data file."}
{"text": "Magnetic nanostructures of two ferromagnetic metals have been combined within porous silicon, and the magnetic switching behavior of the resulting porous silicon/metal nanocomposite has been modified by varying the arrangement. The two magnetic materials are Ni and Co, whereas Co is the magnetic harder one. These \u201chard/soft\u201d magnetic nanocomposites have been achieved by two different routes. On the one hand, double-sided porous silicon has been used whereas one side has been filled with Ni nanostructures and the other one with Co nanostructures. On the other hand, Ni and Co have been deposited within one porous layer alternatingly. The filling of the pores has been carried out by electrodeposition with varying the deposition parameters. In systems which offer two distinct slopes of the hysteresis curves due to the different saturation behavior of the two types of deposited metal, magnetic exchange coupling is not present. For samples which show smooth hysteresis curves exchange, coupling between the Ni and Co nanostructures seems to be present. The aim is to control especially the structure size of the soft and the hard magnetic materials and the distance between them at the nanoscale to optimize exchange coupling resulting in a maximum energy product. The utilization of low-dimensional structures becomes more and more important due to the miniaturization of devices and also due to the novel arising nanoscopic properties. The fabrication of such nanostructures is often carried out by nanopatterning using lithographic methods. On the other hand, self-assembling techniques are of great interest due to the uncomplex and low-cost fabrication process. Quite common are nanoparticles grown on a substrate by self-organization. Also, three-dimensional arrays of nanostructures  have been formed without prestructuring in using hexagonal arranged porous alumina as matrices . Also, qConsidering the achieved nanocomposites, magnetization reversal processes with the concomitant domain wall motion within the deposited metal nanostructures, the interactions among them, and also transport phenomena like magnetoresistance in spin valves are of great interest. Magnetic materials in the nanometer scale exhibit changed properties compared to bulk material and therefore offer great potential for novel nanotechnological applications. The nanoscopic systems consist either of particles or wires with magnetic properties dependent on their geometry and arrangement. For technical application of the system, the magnetic nanostructures should be ferromagnetic at room temperature. In some cases, a high anisotropy between the two magnetization directions, perpendicular and parallel to the surface, is of interest and thus needle-like structures are favorable due to their high demagnetizing field. One method to achieve low-dimensional structures is the deposition of metal nanostructures on patterned surfaces or into porous membranes with channels perpendicular to the surface, and therefore, the metal structures exhibit a high density with respect to the sample surface. Templates like porous alumina or polycarbonate foils are usually electrochemically fabricated and afterwards filled with a magnetic material by electrochemical deposition. In commercial microelectronics, most devices are based on silicon technology and thus for process compatibility, a silicon substrate is a good precondition for applicability.In the present work, a combined porous silicon/\u201chard-soft\u201d magnetic nanocomposite is investigated and the results concerning the magnetic properties with respect to the switching behavior are figured out.+ silicon wafer. On the one hand, a silicon wafer has been porosified on one side with an average thickness of the porous layer of 40\u00a0\u03bcm. On the other hand, ultrathin wafers have been etched on both sides (front and back) in using an electrolytic double tank cell. The thickness of the porous layers was around 20\u00a0\u03bcm on each side. As anodization electrolyte, an 10\u00a0wt% aqueous hydrofluoric acid solution has been used. To achieve pore diameters of about 60\u00a0nm, a current density of 100\u00a0mA/cm2 has been applied. The etching rate was around 4\u00a0\u03bcm/min.Two kinds of porous silicon templates have been fabricated by anodization of an n2 with 0.05\u00a0Hz and for the Co deposition, a current density of 20\u00a0mA/cm2 with 0.1\u00a0Hz has been applied. In the case of the one-sided sample, both metals have been electrochemically deposited alternately inside the pores resulting in a stacked arrangement of Co and Ni nanostructures. As electrolytes, a Ni and Co metal salt solution  has been used. The deposition time for each metal was up to 10\u00a0min. Magnetic characterization of the samples has been performed by SQUID (superconducting quantum interference device) magnetometry .The prepared porous silicon templates offer a morphology in the mesoporous regime with a quasi-regular pore arrangement. Within the pores of these templates, nanostructures consisting of two different magnetic materials have been incorporated by electrodeposition. The double-sided porous silicon has been filled with Ni on one side and with Co on the other side, also using a double tank cell. Depending on the polarity of the applied current, either Ni on the one side or Co on the other side is deposited. For the Ni deposition, a current density of 25\u00a0mA/cmThe deposited magnetic nanostructures consist of Co and Ni, whereas Co is the magnetic \u201charder\u201d material. Considering the magnetization measurements of double-sided porous silicon containing Co nanostructures on one side and Ni nanostructures on the other side, one sees that the magnetic behavior is composed of two terms. The first one is due to the softer magnetic material, Ni, which exhibits a saturation magnetization of 0.6\u00a0T (bulk Ni). The second one is due to the harder magnetic material, Co, which exhibits a saturation magnetization of 1.7\u00a0T (bulk Co). Thus, the hysteresis curves of the investigated nanocomposite systems show two different slopes corresponding to the two different materials. Figure\u00a0HC of the nanocomposite depends mainly on the size and shape of the deposited metal structures. In the case of a dense spatial distribution with magnetically coupled deposits, additionally, the interaction influences HC. The magnetic anisotropy is mainly due to shape anisotropy and increases with the elongation of the deposited metal structures. However, the deposition of densely packed structures results in a wire-like behavior caused by magnetic coupling between them. Generally, the coercivity decreases with the elongation of the metal deposits. In Table\u00a0MR/saturation magnetization MS) of Ni deposited within porous silicon is given. Considering double-sided samples containing two metals, the magnetic characteristics are a combination of both metals. Considering single-sided samples consisting of stacked Co/Ni nanostructures, the magnetic behavior depends on the kind of deposition. In the case of using one combined electrolyte bath, consisting of the Ni- and the Co-salt, different voltages have been applied for the two metals. The samples show also a clear kink in the hysteresis curve demonstrating that exchange coupling between the two materials is excluded which can be ascribed to a distance greater than 2\u00a0nm between the different nanostructures or an oxide formation separating them. Details of this circumstance are currently under investigation. An example of such a sample with combined filling can be seen in Fig.\u00a0In the case of double-sided samples filled with Ni and Co, magnetic interactions can only occur between nanostructures within one layer. The distance between the two porous layers is in the range of 30\u00a0\u03bcm which makes dipolar coupling negligible. For non-interacting deposits, the coercivity Figure\u00a04 solution), field-dependent magnetization shows a smooth hysteresis which indicates the presence of exchange coupling between the Ni and Co deposits  can be modified by varying the size and shape of the Ni and Co deposits. Therefore, the magnetic characteristics of the specimens can be broadly tailored, as desired. The magnetic properties of the resulting nanocomposites are not only correlated with the size, shape, and spatial distribution of the deposited metal structures but also strongly depend on the filling ratio between the \u201csofter\u201d (Ni) and \u201charder\u201d (Co) magnetic materials as well as on the way how the electrodeposition is performed (from a combined or separate solutions).The presented \u201chard/soft\u201d magnetic nanocomposite is fabricated during a low-cost two-step electrochemical process whereas double-sided as well as one-sided porous silicon acts as template. Considering the magnetic behavior of double-sided systems and single-sided systems gained from a combined electrolyte solution, two characteristic terms are observed. The first one is caused by the magnetic properties of the \u201csofter\u201d magnetic metal (Ni) and the second one is caused by the higher saturation magnetization of the deposited \u201charder\u201d magnetic nanostructures (Co). In the case of depositing Co and Ni alternatingly from a Watts-solution and CoSO"}
{"text": "We show that FoxP3hiCD45RA\u2212CD4+ Treg cells [activated Treg (aTreg) cells] are the predominant cell population among tumor-infiltrating FoxP3+ T cells, and that high aTreg cell-infiltrating content is associated with reduced survival in patients with head and neck squamous cell carcinoma (HNSCC). In vitro studies have demonstrated that aTreg cells can suppress tumor-associated antigen (TAA) effector T cell immune responses in HNSCC. Moreover, C-C chemokine receptor 4 (CCR4) was specifically expressed by aTreg cells in the peripheral blood of HNSCC patients. Using a RayBiotech human chemokine antibody array, we showed that monocyte chemoattractant protein-1 (MCP-1), an endogenous CCR4-binding ligand, was specifically upregulated in the HNSCC microenvironment compared to the other four CCR4-binding ligands. Blocking MCP-1/CCR4 signaling-induced aTreg cell recruitment using a CCR4 antagonist evoked antitumor immunity in mice, and lead to inhibition of tumor growth and prolonged survival. Therefore, blocking aTreg cell trafficking in tumors using CCR4-binding agents may be an effective immunotherapy for HNSCC.FoxP3 In addition, both a monoclonal antibody against human MCP-1 and a CCR4 antagonist significantly blocked tumor extract-induced aTreg cell migration (P < 0.01 for each). In support of these results, recombinant MCP-1 induced significant aTreg cell migration (P < 0.01 versus control) that was efficiently blocked by the anti-MCP-1 antibody and CCR4 antagonist (P < 0.01 for each) . After administration of a CCR4 antagonist, we observed inhibition of SCC-VII tumor growth at day 33 , suggesting that the CCR4 antagonist inhibited aTreg cell migration in vivo   Figure .+ Treg cells can suppress tumor-specific immunity, which provides a clear rationale for development of immunotherapies that can modulate the influence of these regulatory cells [+ T cell subsets in HNSCC tissues. Intriguingly, our data showed that the majority of tumor-infiltrating FoxP3+ T cells were aTreg cells. Although there is a large amount of evidence that FoxP3+ T cells predominantly infiltrate tumor tissues [+ T cells have not been characterized. Our finding of predominant aTreg cell infiltration revealed the phenotypes of such cells. Additionally, aTreg cell numbers were significantly higher in late-stage (III and IV) HNSCC tumor tissue than in early-stage tissue (I and II), and were inversely correlated with patient prognosis. Given the clinical importance of tumor-infiltrating aTreg cells, inhibition of aTreg cell recruitment in HNSCC may be an effective immunotherapeutic strategy.Accumulating evidence indicates that FoxP3ry cells , 28. Her tissues , 29, 30,in vitro. These findings provide a rationale for the development of immunotherapies to control the effects of aTreg cells in HNSCC.We recently confirmed that aTreg cells suppress proliferation of non-TAA T cells , 25. How+/\u2212CD4+ T cell subsets and other types of immune cells. This result was consistent with a previous study, which showed that CCR4 was predominantly expressed in peripheral blood aTreg cells from melanoma patients [Since chemokine receptors have central roles in the recruitment of immunoregulatory cells , 32, 33,patients . These d+ Treg cells express CCR4 and migrate in response to TARC and MDC [Circulating FoxP3 and MDC \u201338. Howe and MDC \u201341. Howein vivo studies showed that inhibition of tumor growth and prolonged mouse survival could be attributed to inhibition of aTreg cell recruitment resulting in expansion of tumor infiltrating CD4+ and CD8+ T cells. These data demonstrate that aTreg cells are involved in the progression of HNSCC via their suppressive effects on TAA immune responses. Therefore, therapeutics that bind aTreg cells could be an effective immunotherapy for HNSCC. Several recent clinical trials have shown that depletion of CCR4-expressing FoxP3+CD4+ Treg cells by anti-human CCR4 monoclonal antibody is a promising approach to augment antitumor immune responses in cancer patients [Our patients , 43. TheIn conclusion, our data suggest that a combination of a CCR4-binding therapeutic that can block aTreg cell trafficking in tumors, tumor antigen immunization, and monoclonal antibodies may enhance the clinical efficacy of immunotherapies for HNSCC.PBMCs were obtained from healthy donors and HNSCC patients who had not received any previous oncological treatments. Tumor- and nontumor-infiltrating lymphocytes were obtained from tumor and adjacent nontumor tissues after surgical debulking. Informed consent was obtained from all participants prior to enrollment in the study. The study was approved by the Ethics Committee of The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China .Infiltrating lymphocyte suspensions were prepared by enzymatic digestion . DissectThe SNU899 LSCC cell line was provided by Professor Ja-Lok Ku . The mouse SCC VII OSCC cell line was provided by Professor Si-Xi Liu . Cells were cultured under standard conditions.Eight-week old male C3H-HeN mice were purchased from Slac Laboratory Animal Co., Ltd. . All mice were housed under specific pathogen-free conditions. Experimental procedures were approved by the Institutional Animal Studies Committee and conducted in accordance with Institutional Animal Care and Use Committee guidelines.+ cells were isolated from PBMCs using CD14 Microbeads . The cells were then seeded into a 6-well plate at a density of 1.5 \u00d7 106 cells/well and cultured as described previously [CD14eviously . On day After stimulation for 5 h with a cocktail of phorbol 12-myristate 13-acetate, ionomycin, and Golgi stop (brefeldin A and monensin) (eBioscience), cells were stained for cell surface markers and intracellular cytokines  using anti-hTNF-\u03b1-Alexa Fluor 700, anti-hIL-2-PE-Cy7, and anti-hIFN-\u03b3-APC-eFluor 780 antibodies as well as the Fixation/Permeabilization Buffer and Permeabilization Buffer from eBioscience.+ and CD8+ T cell proliferation and cytokine production of CD4+ T cells were assessed by flow cytometry using anti-hCD3-eFluor 450, anti-hCD4-FITC, anti-hCD8a-PE-Cy7, anti-hIFN-\u03b3-APC-eFluor780, anti-hIL-2-PE-Cy7, and anti-hTNF-\u03b1-Alexa Fluor 700 antibodies (eBioscience). SNU899-derived, lysate-pulsed immature DCs were labeled with 5 \u03bcM 5,6-carboxyfluorescein diacetate succinimidyl ester (eBioscience) and mixed with T cells that had been cultured for 13 days at a ratio of 1:10 in 96-well microplates for 4 h in a 5% CO2 atmosphere at 37\u00b0C. Cytotoxicity was assessed by flow cytometry using APC-annexin V and 7-amino-actinomycin D (7-AAD) (BD Biosciences).Antigen-loaded DCs were added to autologous T cells as stimulators at a ratio of 1:20 in a round bottom 96-well microplate. The aTreg cells were prepared as described previously , 25 and +CD4+ T cell subsets, T cells obtained from tumor tissues, adjacent non-tumor tissues, and blood were stained with anti-hCD3-eFluor 605NC, anti-hCD4-FITC, anti-hCD25-APC, anti-hCD45RA-eFluor 450, and anti-hFoxP3-PE antibodies (eBioscience).To identify FoxP3th edition of the Union for International Cancer Control (UICC 2008) tumor-node-metastasis classification of malignant tumors. Detection of FoxP3  and CD25  was performed on 4 \u03bcm-thick, paraffin-embedded sections of tissue samples with the indicated antibodies using a double staining kit . For chemokine receptor ligand staining, sections of tissue samples were stained with anti-MCP-1, -MDC, or -TARC antibodies using an ABC kit .The main clinical and pathological characteristics of LSCC patients are presented in The expression of CCR2, CCR4, CCR5, CCR6, CCR7, and CXCR4 on lymphocytes was analyzed by flow cytometry using anti-hCD3-eFluor 605NC or anti-hCD3-eFluor 450, anti-hCD4-FITC, anti-hCD8-PE-Cy7, anti-hCD25-APC, anti-hCD45RA-eFluor 450, anti-hFoxP3-PE, anti-hCD14-FITC, anti-hCD19-PE-Cy7, anti-hCD11c-Alexa Fluor 700, anti-hCD16-PE, anti-hCD56-APC, anti-hCCR6-PerCP-eFluor710, anti-hCCR7-APC-eFluor780, and anti-hCXCR4-PE-Cy7 antibodies (eBioscience). The anti-hCCR2-Alexa Fluor 647, anti-hCCR4-PerCP-Cy5.5, and anti-hCCR5-APC-Cy7 antibodies were purchased from BD Pharmingen .A Human Chemokine Antibody Array  was used according to the manufacturer's instructions. After development, films were scanned and the images processed and quantified using the National Institutes of Health ImageJ software. The intensities were normalized to internal positive controls for comparison.4 aTreg cells. Human recombinant MCP-1 , a human anti-MCP-1 antibody , or tumor tissue extract were added to the lower chamber. The aTreg cells were preincubated with a CCR4 antagonist  for 30 min at 37\u00b0C. Migrated cells were counted using an automated cell counter .Migration was assessed as described previously  using 5 5 tumor cells were injected subcutaneously into the right flank. Either a CCR4 antagonist (87.5 \u03bcg) or saline were injected intraperitoneally three times per week for 3 weeks from day 5 after tumor cell injection. In parallel, a group of six mice was used as a blank control. Tumor size was measured every 3 days using fine calipers. Tumor volumes were calculated as length \u00d7 (width)2 \u00d7 0.52. All mice were sacrificed 7 days after the last injection.Eighteen C3H-HeN mice were randomly and equally divided into three groups and ear tagged prior to treatment. On day 0, 1 \u00d7 10After sacrifice, tumors were removed and single cell suspensions were prepared by enzymatic digestion. The types of tumor infiltrating cells were analyzed by flow cytometry using anti-mouse CD3-FITC, anti-mouse CD4-eFluor 450, anti-mouse CD8-Alexa Fluor 700, anti-mouse CD25-APC, anti-mouse IL-2-PE, anti-mouse IFN-\u03b3-PE-Cy-5, anti-mouse TNF-\u03b1-PE-Cy7, anti-mouse FoxP3-PE, and anti-mouse CD45RA-FITC antibodies , and a fixation/permeabilization kit. All antibodies were purchased from eBioscience unless otherwise specified. An additional three randomly divided groups of mice were used for survival analysis. The observation period was 50 days.U-tests, Student's t-tests, or Kruskal-Wallis tests. Comparisons of aTreg cell infiltration levels between groups were performed using the Wilcoxon matched-pairs signed-ranks test. Survival variables were estimated using the Kaplan-Meier method and compared using log-rank tests. Multivariate analysis using the Cox proportional hazard model was used to determine the influence of each variable, when adjusted to the others, on overall survival. A P-value of less than 0.05 was considered statistically significant.Statistical analysis was performed with SPSS Standard version 13.0 software . Differences between groups were assessed using Mann-Whitney"}
{"text": "Then we evaluated their anticancer activities in vitro and in vivo by utilizing human lung cancer cell line A549. The in vitro results showed that among the compounds, 3d performed effectively anti-growth activity by inducing A549 lung cancer cell apoptosis and activating Nrf-2/HO-1 (heme oxygenase-1) pathway. In vivo, we proved that compound 3d inhibited the tumor growth effectively through inducing cell apoptosis without affecting CAM normal angiogenesis. These data suggest that our discovery of a novel Nrf-2 activator compound 3d would provide a new point of human lung cancer treatment.Increasing evidence indicates that Nrf-2, named the nuclear factor-erythroid 2-related factor, may perform anticancer function. In this study, a series of novel substituted phenyl- (3-methyl-1H-indol-2-yl)-prop-2-en-1-one  derivatives were synthesized and their effects on Nrf-2 activity were observed. We found that compounds 3a Therefore, much more attention has been paid to the discovery of new anticancer drugs2.Lung cancer is a considerable worldwide public health concern. Comparing with the survival rates of other cancers, 5-years survival rate of lung cancer is lower3. It has been reported that cell death plays a crucial role in the progress of cancer. As we know, apoptosis and programmed necrosis are two major types of cell death which show different cell morphologies and pathways. Furthermore, as a new alternative target in tumor treatment, autophagy needs us to pay more attention4. Discovering new agents in anticancer therapy by inducing different cell death types is meaningful.Cytotoxicity induced by xenobiotic can cause cell death5. There are a lot of chalcone derivatives that have been synthesized and identified by researchers in the laboratory through different chemical methods6. Many reports have displayed that minor structural transformation of chalcones could induce considerable difference in the effect of anticancer, anti-inflammatory or autoimmune diseases7. For example, compound II2, a novel dithiocarbamate\u2013chalcone derivative could apparently inhibit the growth of SK-N-SH cells by triggering apoptosis and blocking the cell cycle8. Chalcones could prevent cancer by inhibiting p53 degradation9. In human breast cancer, Cathepsin-K contributes to tumor spread. Chalcones agents can suppress Cathepsin-K enzyme activity and effectively inhibit tumor invasiveness in body10. As we know that PI3K/Akt/mTOR pathway which modulates cell proliferation, metabolism, apoptosis, autophagy and other cellcular biological activities is important in tumorigenesis12. A novel quinazolinone chalcone derivative (QC) has been reported to inhibit PI3K/Akt/mTOR signaling pathway and trigger human HCT-116 cells apoptosis13. A pyrrole derivative of chalcone, (E)- 3-phenyl-1-(2-pyrrolyl)-2-propenone (PPP) performs anti-inflammatory effect through inhibiting the activity of Syk, Src, and TAK114. It has been also reported that the dysfunction or abnormal proliferation of immune cells may cause autoimmune diseases, atherosclerosis, and tuberculosis16. Chalcones as immunomodulatory drugs show different effects on various immune cells, including triggering apoptosis in dendritic cells17, inhibiting superoxide anion production by weakening the activity of PKC in PMA-induced rat neutrophils18, performing anti-inflammatory potential in monocytes and macrophages19, suppressing rabbit platelets aggregation caused by arachidonic acid or collagen21, inhibiting the generation of functional cytotoxic T cells from mouse spleen and so on22.Chalcones, are diffusely existing in natural plant products. It has been reported that chalcones have many pharmacological and biological activities, such as anti-oxidative, anti-cancer, anti-mutagenic, anti-inflammatory, etc. The biological activities of chalcones maybe changed through the interaction with different compounds23. Indole alkaloids with biological activity are plentiful in the nature, such as strychnine and lysergic acid diethylamide. Various indole alkaloids isloated from plants have been reported for some therapeutic value, including anticancer, the treatment of Hodgkin\u2019s diseases24 and psychiatric disorders25, anti-inflammatory, cytotoxicity, antiviral26, being as antimicrobial agents27 and so on. Therefore, indole derivatives have attracted many researchers\u2019 attention and a lot of indole derivatives have been synthesized or extracted from natural resources28.Indole is anther important chemical group in this series of compounds which we have synthesized. It has been reported that indole is known as its heterocyclic system, it involves in the protein synthesis in the form of tryptophan29. \u03b1-Cyano bis (indolyl) chalcone inhibits the growth of A549 lung cancer cells effectively by promoting tubulin polymerization30.It has been reported that chalcones or indoles have a lot of medicinal value in the treatment of diseases, and various chalcones or indole derivatives have been synthesized. However, to date, few indolyl-chalcone compounds have been reported. Novel indoly-chalcone derivatives (CITs) have been synthesized and identified to play a role in anti-cancer treatment through inducing cell death and inhibiting proliferation in PC3, A549, CLR2119 and PAN02 cells31. Nrf-2 maintains cellular redox balance by Kelch-like ECH-associated protein 1 (Keap1)-Nrf-2-antioxidant response element (ARE) pathway to make response to endogenous and exogenous stresses32. It has been reported that oxidative stress involves in the initiation of cancer, Nrf-2 might exert anticancer function and is implicated in chemoprevention. For example, as an Nrf-2 activator, the natural product sulforaphane (SFN) that presents in cruciferous vegetables has been researched in clinical trials of different cancers33. Moreover, a recent study shows that cisplatin as a well-known anticancer drug has been proved to induce oxidative damages and cell death in Hep-2 cells through improving the expression of Nrf-2 and HO-1. According to the current studies, intensifying Nrf-2 activity seems to be an attractive strategy in the process of cancer treatment.As we know, Nrf-2 (nuclear factor-erythroid 2-related factor) encoded by NFE2L2  gene belongs to the basic-leucine zipper (bZIP) family of transcription factors and is expressed in various tissues3d, which dramatically inhibited tumor growth in vitro and in vivo by inducing A549 lung cancer cell apoptosis and activating Nrf-2/HO-1 pathway. Additionally, compound 3d did not show any significantly autophagy or necrosis in A549 lung cancer cells. Consequently, the discovery of the novel Nrf-2 activator would provide a new point of human lung cancer therapy.Here, we synthesized a novel series of indolyl-chalcone derivatives and identified a new Nrf-2 activator named indolyl-chalcone derivative 34. Compound 3 was synthesized from compound 2. Firstly, the mixture of compound 2 (1\u2009mmol) and NaOH (2\u2009mmol) in ethanol (10\u2009ml) were stirred at room temperature, and then substituted aldehyde (1.2\u2009mmol) in ethanol (5\u2009ml) was added dropwise. The mixture was stirred for 2\u20134\u2009h. The end of reaction was detected by TLC. Then the mixture was poured into cold water and filtered. The crude product was recrystallized from ethanol to obtain compound 3 in 60-90% yield. Compounds 4 and 5 were synthesized according to previous reported method36. Compound 6 was procured by the following reactions. The mixture of substituted acetophenone (1\u2009mmol) and NaOH (2\u2009mmol) in ethanol (10\u2009ml) were stirred at room temperature, and then compound 5 (1.1\u2009mmol) in ethanol (5\u2009ml) was added dropwise. The mixture was stirred for 2\u20134\u2009h. The end of reaction was detected by TLC. Then the mixture was poured into cold water and filtered. The crude product was recrystallized from ethanol to obtain compound 6 in 60\u201390% yield.A series of indolyl-chalcone derivatives were designed and synthesized Fig.\u00a0. Compoun33, especially in cancer treatment, we firstly analyzed endogenous Nrf-2 activity in HeLa cells which were transfected with luciferase-based Nrf-2 reporter plasmid after treatment with a series of novel substituted phenyl-(3-methyl-1H-indol-2-yl)-prop-2-en-1-one, indolyl-chalcone derivatives . The luciferase assay suggested that compounds 3a, 3b, 3c, 3d and 6c (10\u2009\u03bcM) elevated Nrf-2 activity significantly compared with the control after treatment for 12\u2009h or 24\u2009h  assay suggested that compound 3d inhibited the growth of A549 lung cancer cells most efficiently  induced apoptosis of A549 lung cancer cells, we performed Hoechst 33258 staining assay. The data suggested that compound 3d (2.5\u2009\u03bcM) could notably trigger apoptosis in A549 lung cancer cells through inducing chromatin condensation and nuclear fragmentation formation  in A549 lung cancer cells. As a major member of Poly (ADP-ribose) polymerases (Parps) family, PARP plays a crucial role in modulating DNA repair and death of cells37. Moreover, up-regulation of cleaved-PARP is one of the main characteristics of cell apoptosis38. The results showed that the level of cleaved-PARP (89 KDa) increased after treatment with compound 3d   staining assay, western blot analysis  and LDH assay. The results demonstrated that compound 3d did not cause autophagy or necrosis in A549 lung cancer cells (data not shown).To detect whether compounds 3c, ion Fig.\u00a0. We furt\u03bcM) Fig.\u00a0. It indi39. Cancer cells are vulnerable to high levels of reactive oxygen species (ROS)40. Evidence indicates that ROS influences proliferation and apoptosis in various cancers41. The overproduction of ROS results in oxidative stress and induces in cell apoptosis42. Therefore, we detected the level of ROS after treatment with compound 3d (2.5\u2009\u03bcM) for 12\u2009h and 24\u2009h. The data demonstrated that 3d time-dependently increased the level of ROS  for 0.5, 1, 3, 6, 12, 24, 48\u2009h. The data revealed that compound 3d elevated the expression of HO-1 remarkably in A549 lung cancer cells  has been widely used in studying tissue grafts, tumor growth, angiogenic or toxicological analysis as the chick\u2019s immunocompetent system and the immune rejection are not fully developed44. Therefore, we investigated the effect of 3d on tumor growth and normal angiogenesis by CAM model. 5-FU was used for positive control drug. After seeding A549 lung cancer cells on the CAM surface for 2 days, the tumor tissue masses formed locally. Then from the day 3 to 8, we treated the tumor tissue masses with PBS, PBS/3d or PBS/5-FU every 2 days. The results demonstrated that 3d significantly suppressed tumor growth  for 48\u2009h, the cell cycle of A549 lung cancer cells has not been arrested  -prop-2-en-1-one compounds, we observed a dose-dependent and time-dependent inhibition of growth in A549 lung cancer cells. Among the nine indolyl-chalcone derivatives, compound All experimental procedures and animal care in this work were performed in accordance with the ARRIVE guidelines 39 and approved by the ethics committee in Shandong University.1H NMR (300\u2009MHz or 400\u2009MHz) and 13C NMR (75\u2009MHz or 100\u2009MHz) spectra were acquired on a Bruker Avance 300 spectrometer or Bruker Avance 400 spectrometer, with d6-DMSO or d6-Acetone used as a solvent and tetramethylsilane (TMS) as an internal standard. High resolution mass spectrometry (HRMS) involved a Q-TOF6510 spectrograph (Agilent). Unless otherwise stated, all reagents were used without further purification from merchants. Twice-distilled water was used throughout all experiments.2. Cells were seeded in 24 well plates or other appropriate dishes (30000 cells/ml).Human lung cancer cell line A549 grew in RPMI-1640 medium  containing with 10% (V/V) bovine calf serum. HeLa cells which were transfected with luciferase-based Nrf-2 reporter plasmid were grown in Dulbecco\u2019s modified Eagle\u2019s medium  with 10% bovine calf serum. All cell lines were cultured at 37\u2009\u00b0C in humidified air with 5% CO3d, 6a-6e and 5-FU at 0.1, 1, 2.5, 5, 10\u2009\u03bcM for 24\u2009h or 48\u2009h. Cell viability was analyzed by Sulforhodamine B  assay according to the manufacturer\u2019s instructions.A549 lung cancer cells were cultured onto 96 well plates as previously described. Next, treating cells with 0.1% DMSO or compounds 3a-Cells were washed twice with PBS and lysed in 100\u2009\u03bcl protein lysis buffer . All cell lysates were centrifuged at 12,000\u2009\u00d7\u2009g for 15\u2009min by using a refrigerated centrifuge. Then the protein concentrations were analyzed by using bicinchoninic acid (BCA) protein assay kit . After SDS-PAGE at 4\u2009\u00b0C for 2\u2009h, transferred to PVDF membranes . At room temperature, the membrane was blocked with 5% non-fat milk in TBST (TBS containing 0.05% Tween 20) for 1\u2009h. Thereafter the membrane was incubated with anti-PARP  and anti-\u03b2-actin  antibodies overnight at 4\u2009\u00b0C, washed 3 times with TBST for 5\u2009min. Subsequently incubated with secondary antibodies which are HRP-conjugated for 1\u2009h at room temperature. The membrane was incubated with HRP substrate for 4\u2009min after washed 3 times with TBST and the fluorescence signals were detected by using X-ray films. The protein was quantified using Image J software.3d, 6c for 24\u2009h and 48\u2009h. Cells were washed with PBS for twice then photographed by using an Olympus (Japan) BH-2fluorescence microscope.A549 lung cancer cells grew on 24 well were stained with 10\u2009mg/ml Hoechst 33258 and avoid the light for 30\u2009min at 37\u2009\u00b0C after treatment with 0.1% DMSO or compounds 3c, As previously described, A549 lung cancer cells grew on 24 well were washed with RPMI-1640 medium for 5\u2009min and incubated with 10\u2009\u03bcM 2\u2032, 7\u2032-dichlorodihydrofluorescein  at 37\u2009\u00b0C for 30\u2009min. After washed 3 times with PBS, it was photographed by utilizing an Olympus (Japan) BH-2fluorescence microscope./pGL4-3\u2009\u00d7\u2009ARE-basic luciferase reporter vector were seeded onto 96-well plates and cultured overnight, then incubated with indolyl-chalcones derivatives (3d) at the different concentrations  and times (12\u2009h or 24\u2009h). Luciferase activity of cells was examined by using Luciferase Reporter Gene Assay Kit  and normalized to cell viability measured by Sulforhodamine B (SRB) assay.HeLa cells which contain Nrf-2-responsive49. In brief, A549 lung cancer cells were fixed with 4% paraformaldehyde for 15\u2009min and blocked with 3% normal donkey serum  for 20\u2009min at room temperature. Then, the cells were incubated with primary antibody (1:100)  at 4\u2009\u00b0C overnight and then corresponding secondary antibody (1:200) at 37\u2009\u00b0C for 1\u2009h. Cells were washed 3 times with 0.1\u2009M phosphate-buffered saline . Cells were incubated with DAPI for 10\u2009min and washed 3 times with PBS, then photographed by using confocal fluorescence microscopy Zeiss LSM700 (Germany).Immunofluorescence assay was performed as describedExtraction of total RNA use of Trizol reagent . The reverse transcription step involved use of the PrimeScript RT reagent kit with gDNA Eraser . The relative mRNA level of HO-1 was quantified by SYBR Premix Ex Taq (Tli RNaseH Plus) RT-PCR reactions. The expression of \u03b2-actin was used to normalize with a melting curve for each reaction. Primers for HO-1 were: sense TGCACATCCGTGCAGAGAAT; antisense CTGGGT TCTGCTTGCTTGTTTCGC. Primers for \u03b2-actin were: sense GAAGTGTGACGTGGACATCC; antisense CCGATCCACACGGAGTACTT.3d at the concentrations of 100 or 200\u2009\u03bcM every 2 days, 5-FU (200\u2009\u03bcM) was as the positive control group. After treatment with 3d or 5-FU for 6 days, samples of the CAM and tumors were taken. The size of tumors were measured and the tumor volume calculation was performed as described in literature50.The fertilized chicken eggs were incubated at 37\u2009\u00b0C with 60% relative humidity. On embryonic day 8, a silicone ring with a 5.5\u2009mm inner diameter was placed on the CAM, and then 8 million A549 lung cancer cells in 20\u2009\u03bcl of medium were seeded into this silicone ring. Eggs were divided into four groups in which 5 eggs were contained. On day 3, every egg was treated with TUNEL assay was performed according to the manufacturer\u2019s instructions  to detect DNA fragmentation of the tumor tissues. Then the apoptosis was assessed by utilizing laser scanning confocal microscopy Zeiss LSM700 (Germany).3d (100 and 200\u2009\u03bcM) or DMSO was placed on the CAM. The treatment with 3d or DMSO was performed every 2 days. After 6 days, the CAM zones including the gelatin sponge were taken out. The biomicroscopy image and quantitative analysis were performed by Image-Pro Plus.The fertilized chicken eggs were incubated at 37\u2009\u00b0C with 60% relative humidity. On embryonic day 9, the gelatin sponge absorbed compound A549 cancer cells were treated with compound 3d (2.5\u2009\u03bcM) or DMSO for 48\u2009h, then gathered by centrifugation at 400\u2009g, 4\u2009\u00b0C for 5\u2009min. Cells were fixed with 75% ethanol, then stained with 2\u2009mg/ml propidium iodide (PI) containing 1\u2009mg/ml RNase A at 4\u2009\u00b0C for 30\u2009min. The stained cells were analyzed by flow cytometry .All data were presented as means\u2009\u00b1\u2009SEM from at least three independent experiments and analyzed by SPSS  software. When p value was\u2009<\u20090.05, differences were recognized as statistically remarkable.Supplementary Information"}
{"text": "The transformation is achieved by a merged iminium\u2013enamine activation. The enantioselective desymmetrization reaction, leading to three adjacent stereocenters, furnished the target products in complete regioselectivity and moderate to high diastereo\u2010 and enantioselectivities (d.r. up to 15:1 and e.r. up to 93:7). In all cases a slight decrease of the enantiomeric ratio was observed compared to the optimized model system.With the optimized results in hand, a variety of sulfenyl chlorides and phenylselenyl chloride were subjected to the reaction Table\u2005. Varioustert\u2010butyl sulfenyl chloride, the system avoided the steric hindrance between the bulky tert\u2010butyl moiety and the aliphatic chain by forming the disulfide 3\u2009g, and thus two equivalents of the sulfenyl chloride had to be used; lower amounts resulted in the same product and selectivity, but with lower yield. With primary alkyl sulfenyl chlorides the desired products were not observed. Additionally, commercially available methoxycarbonyl sulfenyl chloride and phenylselenyl chloride were tested as reagents. The products 3\u2009h and 3\u2009i were obtained, respectively, in good yield with acceptable diastereo\u2010 and enantioselectivity. The use of analogous sulfenyl and selenyl bromides showed no conversion of 1\u2009a, probably because the less polarized S\u2212Br and Se\u2212Br bonds are not sufficiently reactive.The use of sterically demanding alkyl sulfenyl chlorides \u2010enantiomer as major product of the reaction  should be addressed to the authors.SupplementaryClick here for additional data file."}
{"text": "Mesenchymal stem cells (MSCs) have emerged as a promising treatment for inflammatory diseases. The immunomodulatory effect of MSCs takes place both by direct cell-to-cell contact and by means of soluble factors that leads to an increased accumulation of regulatory immune cells at the sites of inflammation. Similar efficacy of MSCs has been described regardless of the route of administration used, the inflammation conditions and the major histocompatibility complex context. These observations raise the question of whether the migration of the MSCs to the inflamed tissues is a pre-requisite to achieve their beneficial effect. To address this, we examined the biodistribution and the efficacy of intraperitoneal luciferase-expressing human expanded adipose-derived stem cells (Luci-eASCs) in a mouse model of colitis. Luci-eASC-infused mice were stratified according to their response to the Luci-eASC treatment. According to the stratification criteria, there was a tendency to increase the bioluminescence signal in the intestine at the expense of a decrease in the bioluminescence signal in the liver in the \u201cresponder\u201d mice. These data thus suggest that the accumulation of the eASCs to the inflamed tissues is beneficial for achieving an optimal modulation of inflammation. Mesenchymal stem cells (MSCs) are multipotent adult stem cells that exist in the bone marrow , adipose+ T-cells was determined at 120 h by flow cytometry. Luci-eASCs inhibited T-cell proliferation at similar levels as the untransduced eASCs as described in %) and in TNBS-colitic mice , the liver  and the spleen . In contrast, very low bioluminescence signals were detected in the lungs, heart and peripheral blood following administration of the Luci-eASCs by IP route C. The inAs shown in Overall, these data indicate that IP infusion of Luci-eASCs favors the accumulation of the Luci-eASCs in the intestine, spleen and liver being practically undetectable within the lymphatic system. When colonic inflammation was induced, an increased amount of bioluminescence signal was found in the intestine in TNBS-colitic mice with a concomitant decrease in the liver.To know whether the presence of the Luci-eASCs at the site of inflammation can be correlated with their anti-inflammatory and immunomodulatory effect in vivo, the main goal of this study, we analyzed the efficacy of the IP-administered Luci-eASCs in our model of TNBS-induced colitis. To this end, body weights A, diseasAs expected, TNBS-treated mice had a significant reduction in the body weights at 24 h (\u22122.1[\u22122.9 to \u22120.72] fold-change in body weight) and 48 h (\u22123.0[\u22124.2 to \u22121.1] fold-change in body weight) with respect to the control groups  A. ImportSimilarly, all Luci-eASC-treated colitic mice had a significant reduction in the disease activity index at 24 and 48 h  with respect to the TNBS-colitic mice  with respect to the spleen (23.4[3.5\u201329.8]%) and the liver (3.2[1.5\u20136.6]%). Moreover, the bioluminescence signal of the intestine in the \u201cresponder\u201d mice tended to increase with respect to the \u201cnon-responder\u201d mice (56.2[33.9\u201367.7]%), although this difference did not reach statistical significance. This was in parallel to a tendency to decrease the total bioluminescence signal in the liver in the \u201cresponder\u201d (3.2[1.5\u20136.6]%) with respect to the \u201cnon-responder\u201d mice (18.2[9.3\u201335.8]%), again not significantly. No differences were found in the spleens in \u201cresponder\u201d mice (23.4[3.5\u201329.8]%) with respect to the spleens in the \u201cnon-responder\u201d mice (24.8[8.8\u201329.0]%) A.When the bioluminescence signal was analyzed separately in the different LNs in the \u201cresponder\u201d and \u201cnon-responder\u201d mice, although low, a tendency to decrease the bioluminescence signal in the different lymph nodes analyzed in the \u201cresponder\u201d with respect to the \u201cnon-responder\u201d mice was observed B.Altogether, these results suggest that the slight increase accumulation of the eASCs at the inflamed colonic tissue in \u201cresponder\u201d mice may explain, at least in part, their positive response to the cell therapy treatment with the eASCs.The biodistribution of MSCs has been studied in a variety of animal models and experimental settings , IP and IL administration has been demonstrated under different inflammatory conditions ,25,34,38and mLNs ,46 togetand mLNs . Furtherand mLNs .C57/BL6 male mice (6\u20138 weeks) were obtained from Charles River. All experiments were performed in accordance with the corresponding regulations regarding experimental animal welfare (RD 223/1998 and Directive 2010/63/EU protocols). The experimental protocol was reviewed and approved by the ethics committee for animal research of the CIEMAT and Comunidad de Madrid (based on the RD 53/2013).4Cl to eliminate remaining erythrocytes and suspended in culture medium (Dulbecco\u2019s modified Eagle medium with 10% FBS). Cells were seeded in tissue culture flasks and expanded . Cells were transferred to a new flask when they reached 90% confluence. Experiments were performed with a pool of cells from three male and three female adult donors at population doublings 12\u201314. All the eASCs used fulfilled the release criteria of identity, purity and potency needed for their clinical use.Human samples were obtained after informed consent as approved by the Spanish Ethics Committee of reference for the site of tissue procurement . Human adipose tissue aspirates from healthy donors were processed as described elsewhere . BrieflyReporter Luciferase-EGFP bicistronic retroviral vector was constructed using standard cloning procedures as described . BrieflyLuci-eASCs were defined according to the criteria of the International Society for Cellular Therapy . Luci-eABuffy coats were provided by the National Transfusion Centre of the Comunidad Autonoma of Madrid, Spain. Peripheral blood mononuclear cells (PBMCs) were isolated by density centrifugation gradient using Ficoll-Paque Plus  following the supplier\u2019s protocol.7) were resuspended in 10 mM of 5(6)-carboxyfluorescein diacetate N-succinimidyl ester  solution and incubated at 37 \u00b0C for 10 min. Reaction was stopped by adding ice-cold medium (RPMI + 10% FBS) and cells were washed with ice-cold phosphate buffer saline. After resting overnight, CFSE-labeled PBMCs were cultured in 24-well plates alone or with Luci-eASCs  in a RPMI+10% FBS and were activated with the Pan T Cell Activation Kit  following the manufacturer\u2019s instructions [+/7-AAD\u2212 population (viable CD3 T lymphocytes) was determined by flow cytometry, according to the decrease in the CFSE fluorescence intensity. Data were analyzed with the use of FCSExpress 4 software  [PBMCs  .5 of Luci-eASCs per mouse were administered IP. As controls, healthy mice with the Luci-eASC treatment and preimmunized mice with intrarectal 50% EtOH (vehicle of the TNBS) with the IP Luci-eASC treatment. Colitis score  was monitored for 48 h. The fold-change in body weights were calculated by the difference with respect to the initial body weight at day 0. Disease activity score was defined as follows: (1) Body weight loss ; (2) stool consistency  and (3) the general activity .To induce colitis, anaesthetized mice were preimmunized on their shaped back with 1% of trinitrobenzene sulfonic acid . After one week, colitis was induced by intrarectal administration of 3 mg of TNBS in 50% ethanol (100 \u00b5L) per mouse. One hour after, TNBS administration, 3.2 \u00d7 10Colons were surgically removed and fixed with formalin overnight at 48 h, following the TNBS administration. 1-cm colon tissues cut were collected. Colon sections were embedded in paraffin and stained with hematoxylin/eosin. The sections were microscopically examined for histopathological changes using the following scoring system .2 per steradian using Living Imaging 3.0 . For photon quantification, a region of interest was manually selected and kept constant within each experiment.Bioluminescence imaging analysis was conducted at 48 h, following the infusion of the Luci-eASCs, with the IVIS 200 imaging system . Whole body bioimaging analysis was done in anesthetized mice. The bioimaging analysis in main organs, tissues  and secondary LNs  were determined immediately after culling the mice. Photons emitted were acquired as photons per s/cmBioluminescence signal was analyzed as percentage of light units per tissue relative to the total number of light units per mouse. Total bioluminescence signal for tissues, organs and LNs was calculated as the sum of the light units in each tissue. Values of bioluminescence signal below 10,000 light units were considered negative.Data are presented as the interquartile range,  and the mean and standard error of the mean (SEM). Normal distribution was analyzed by the Shapiro-Wilks test. Non-parametric techniques (Mann-Whitney U test) were used (with Bonferroni adjustment). Analysis was performed using the software Stata 11  and GraphPad Prism 7.00 .Our results indicate that when eASCs are administered IP in colitic mice, the IP-infused MSCs tend to accumulate in the inflamed intestine to perform their therapeutic effect. The stratification analysis based on the response to MSC treatment provides a very useful approach that may help to clarify the mechanisms mediating the therapeutic effects of MSCs and, hence, improve the use of MSC-mediated therapies in the clinic."}
{"text": "We aimed to investigate the effects of red ginseng extract (RGE) on the expression of efflux transporters and to study the pharmacokinetics of representative substrate. For this, rats received single or repeated administration of RGE (1.5 g/kg/day) for 1 and 2 weeks via oral gavage. mRNA and protein levels of multidrug resistance-associated protein2 (Mrp2), bile salt export pump (Bsep), and P-glycoprotein (P-gp) in the rat liver were measured via real-time polymerase chain reaction and Western blot analysis. Ginsenosides concentrations from the rat plasma were also monitored using a liquid chromatography\u2013tandem mass spectrometry (LC\u2013MS/MS) system. Plasma concentrations of ginsenoside Rb1, Rb2, Rc, and Rd following repeated administration of RGE for 1 and 2 weeks were comparable but significantly higher than those after single administration of RGE. These dosing regimens did not induce significant biochemical abnormalities in the liver, kidneys, and lipid homeostasis. In the RGE repeated oral administration groups, the mRNA and protein levels of Mrp2 significantly decreased. Accordingly, we investigated the changes in the pharmacokinetics of methotrexate, a probe substrate for Mrp2, following intravenous administration of 3 mg/kg methotrexate to rats in the RGE 1-week repeated oral administration group, compared to that in the control group. Biliary excretion, but not urinary excretion, of methotrexate decreased in the RGE repeated administration group, compared to that in the control group. Consequently, the plasma concentrations of methotrexate slightly increased in the RGE repeated administration group. In conclusion, repeated administration of RGE for 1 week resulted in a decrease in Mrp2 expression without inducing significant liver or kidney damage. Pharmacokinetic herb\u2013drug interaction between RGE and methotrexate might occur owing to the decrease in the mRNA and protein levels of Mrp2. Panax ginseng C.A. Meyer) has been extensively used for more than 2000 years in East Asian countries [Ginseng  resulted in slight inhibition of CYP2D6 activity, with no significant effects on CYP3A4, CYP1A2, and CYP2E1 in elderly subjects [Similar to other herbal medicines, ginseng products are frequently co-administered with prescribed Western medications. Accordingly, the potential for pharmacokinetic herb\u2013drug interactions between ginseng and concomitantly administered drugs should be evaluated since they may result in toxicity or treatment failure . Ginsengsubjects . Two-weesubjects .Besides inhibition or induction of CYP, the modulation of drug-transporters is also an important mechanism for herb\u2013drug interaction ,12,13. DTherefore, in the present study, we investigated the effects of single or repeated administration of RGE on efflux transporters and examined the potential changes in the pharmacokinetics of their substrate drugs. Of these, Mrp2 drew our interest because it is mainly involved in the pharmacokinetics and renal and biliary elimination of its substrate anions as well as amphipathic drugs that conjugate with glucuronide, sulfate, and glutathione (GSH) ,18. For To measure ginsenoside concentrations, we developed analytical methods for quantification of 14 ginsenosides in diluted RGE and rat plasma samples with slight modification of a previously described method . Among t1/2). For example, Rb1 is the most abundant and stable ginsenoside with a long elimination half-life of 58.47 h [After RGE was orally administered to rats at single or multiple doses for 1 or 2 weeks, the plasma concentrations of ginsenosides were also monitored. Among the 14 ginsenosides monitored, only four ginsenosides  could be quantitated ; however 58.47 h ,29. The  58.47 h ,30.Because of the potential of drug interactions between herbal medicines and efflux transporters, we measured the mRNA expression of efflux transporters, such as Bsep, P-gp, Mrp1, and Mrp2 in the liver tissues from rats in the control, SA, 1WRA, and 2WRA groups . The expTo confirm the decrease in the mRNA expression of Mrp2 in the repeated-dose RGE-treated groups, Western blot analysis was performed using the liver tissues collected from rats in the control, SA, and 1WRA groups. As shown in The levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were not significantly affected by multiple-dose administration of RGE (1.5 g/kg/day), suggesting that it had negligible effects on liver function . AdditioNext, we investigated the effects of RGE on the biliary excretion of Mrp2 substrate drug in rats. Methotrexate was selected as a representative substrate for Mrp2 because 62% and 27% of methotrexate intravenous dose is excreted into the bile and urine, respectively, within 3 h mainly by Mrp2 .1/2, in the 1WRA group, which resulted in a significant decrease in the CLtotal and a significant increase in the area under plasma concentration-time curve (AUC) of methotrexate  was obtained from Punggi Ginseng Cooperative Association . Methotrexate was purchased from Sigma-Aldrich . Analytical standard ginsenosides were purchased from Ambo Institute .Male Sprague\u2212Dawley rats  were purchased from Samtako Co. . All animal procedures were approved by the Animal Care and Use Committee of Kyungpook National University  and carried out in accordance with the National Institutes of Health guidance for the care and the use of laboratory animals.Rats in the control group received water (2 mL/kg as a vehicle treatment) orally at 9 a.m. for 7 days by oral gavage. RGE suspension  was administered to rats by oral gavage at 9 a.m. once (SA group), for 7 days (1WRA group), and 14 days (2WRA group), respectively. Two hours after the last treatment of RGE, abdominal arterial blood (about 5 mL) and liver tissues were collected from rats in all groups. The liver tissues were snap-frozen for analysis of the mRNA and protein expression of efflux transporters. The plasma samples were used for measurement of plasma ginsenoside concentrations and biochemical parameters. The biochemical parameters such as ALT, AST, triglycerides, plasma cholesterol levels, free fatty acids, blood urea nitrogen and serum creatinine were measured from the service of Seoul Clinical Laboratories  using UV spectrophotometric assay kits from Young-Dong Diagnostics Co. . Lyphocheck assayed chemistry control  were used as positive control and YD calibrator (Young-Dong Diagnostics Co.) was used for external calibration.Ginsenoside concentrations in RGE and plasma samples were analyzed using an Agilent 6470 triple quadrupole liquid chromatography\u2013tandem mass spectrometry (LC\u2013MS/MS) system  equipped with an Agilent 1260 high-performance liquid chromatography (HPLC) system according to the previously published method . Brieflym/z 1131.6 \u2192 365.1 for Rb1 (retention time (rt) = 4.1 min), m/z 1101.6 \u2192 335.1 for Rb2 (rt = 5.0 min) and Rc (rt = 4.2 min), m/z 969.9 \u2192 789.5 for Rd (rt = 5.1 min) and Re (rt = 1.8 min), m/z 823.5 \u2192 365.1 for Rf (rt = 2.7 min), m/z 824 \u2192 643.6 for Rg1 (TR = 1.9 min), m/z 807.5 \u2192 365.1 for Rg3 (TR = 6.0 min), m/z 661.5 \u2192 203.1 for Rh1 (rt = 3.2 min), m/z 645.5 \u2192 645.5 for Rh2 (rt = 6.9 min), m/z 661.5 \u2192 203.1 for F1 (rt = 3.7 min), m/z 807.5 \u2192 627.5 for F2 (rt = 6.1 min), m/z 645.5 \u2192 203.1 for compound K (rt = 6.8 min), m/z 483.4 \u2192 483.4 for protopanaxadiol (rt = 6.8 min), m/z 499.4 \u2192 499.4 for protopanaxatriol (rt = 6.8 min), and m/z 336.1 \u2192 320 for berberine  (rt = 3.7 min) in the positive ionization mode with collision energy (CE) of 30\u201365 eV.Quantification of a separated ginsenoside peak was performed using MRM mode at Total RNA was extracted from liver samples (100 mg) using Qiazol , according to the vendor\u2019s protocol. The concentration of total RNA was determined by Nano Vue Plus .RT-PCR of Mrp1, Mrp2, Bsep, and P-gp was performed using a LightCycler 96 real-time PCR system  as previously described ,37. PrimProtein expression of Mrp2, Bsep, and P-gp was measured as previously described . BrieflyPharmacokinetic study of methotrexate was performed as previously described . BrieflyMethotrexate solution  was injected intravenously to rats. Blood samples (about 150 \u03bcL) were collected from the femoral artery at 0, 0.03, 0.08, 0.25, 0.5, 1, 2, 4, and 6 h after the methotrexate injection. Bile samples were collected at 1 and 2 h and every 2 h up to 12 h through the bile cannula. Urine samples were also collected every 4 h up to 12 h through urinary bladder.g for 10 min, an aliquot (1 \u03bcL) of the supernatant was injected directly into the Agilent 6430 triple quadrupole LC\u2013MS/MS system, according to the previously described method [v/v) and eluted at a rate of 0.25 mL/min. Quantitation was carried out at m/z 455.2 \u2192 308.1 for methotrexate and m/z 260 \u2192 116 for IS in the positive ionization mode.Aliquots (50 \u03bcL) of plasma, bile, and urine samples were added to 250 \u03bcL of acetonitrile containing 2 ng/mL of propranolol (IS). After vortexing for 10 min and centrifugation at 10,000\u00d7 d method . BrieflyPharmacokinetic parameters were calculated by non-compartmental analysis using WinNonlin version 2.0 software .t-test using the Statistical Package for the Social Sciences . A p value < 0.05 was considered statistically significant.Statistical comparisons were performed by"}
{"text": "Nfe2l2) induces expression of numerous detoxifying and antioxidant genes in response to oxidative stress. The cytoplasmic protein Keap1 interacts with and represses Nrf2 function. Computational approaches were developed to identify factors that modulate Nrf2 in a mouse liver gene expression compendium. Forty-eight Nrf2 biomarker genes were identified using profiles from the livers of mice in which Nrf2 was activated genetically in Keap1-null mice or chemically by a potent activator of Nrf2 signaling. The rank-based Running Fisher statistical test was used to determine the correlation between the Nrf2 biomarker genes and a test set of 81 profiles with known Nrf2 activation status demonstrating a balanced accuracy of 96%. For a large number of factors examined in the compendium, we found consistent relationships between activation of Nrf2 and feminization of the liver transcriptome through suppression of the male-specific growth hormone (GH)-regulated transcription factor STAT5b. The livers of female mice exhibited higher Nrf2 activation than male mice in untreated or chemical-treated conditions. In male mice, Nrf2 was activated by treatment with ethinyl estradiol, whereas in female mice, Nrf2 was suppressed by treatment with testosterone. Nrf2 was activated in 5 models of disrupted GH signaling containing mutations in Pit1, Prop1, Ghrh, Ghrhr, and Ghr. Out of 59 chemical treatments that activated Nrf2, 36 exhibited STAT5b suppression in the male liver. The Nrf2-STAT5b coupling was absent in in vitro comparisons of chemical treatments. Treatment of male and female mice with 11 chemicals that induce oxidative stress led to activation of Nrf2 to greater extents in females than males. The enhanced basal and inducible levels of Nrf2 activation in females relative to males provides a molecular explanation for the greater resistance often seen in females vs. males to age-dependent diseases and chemical-induced toxicity.The transcription factor Nrf2 (encoded by  Induction of oxidative stress has been observed following exposure to chemicals that activate xenobiotic receptors including the aryl hydrocarbon receptor (AhR), constitutive androstane receptor (CAR), and peroxisome proliferator-activated receptor \u03b1 (PPAR\u03b1). Chemicals that activate these receptors cause liver cancer through nongenotoxic mechanisms and generally act at the promotion stage by increasing cell proliferation [Oxidative stress reflects an imbalance between reactive oxygen species (ROS) and the ability of a biological system to detoxify reactive intermediates or to repair resulting damage. Disturbances in the normal redox state of cells through the production of ROS can damage critical cellular components leading to injury or disease. Oxidative stress plays roles in chemical-dependent and -independent cytotoxicity and tumor promotion , 2. Therferation \u20135.Cellular oxidants activate the nuclear factor erythroid 2-related factor 2  transcription factor  which isClinical and preclinical studies show sexually dimorphic responses of the liver to various stressors with females often exhibiting resistance to damage compared to males. Examples of heightened susceptibility of males include liver ischemia reperfusion, hemorrhagic shock-resuscitation, liver cirrhosis, and hepatocellular carcinoma. Estrogen has been suggested to be a factor responsible for this sexual dimorphism \u201319. One Pit1 dwarf mice have elevated mRNA levels for several Nrf2-dependent genes, as well as cellular traits, such as elevated glutathione levels, resistance to lipid peroxidation, that are known to be modulated by Nrf2 function [Prop1 and Snell dwarf mice in the absence of chemical induction [There is a growing body of evidence that Nrf2 is activated in mice with defects in GH signaling, under conditions in which the liver genome would be feminized. These mice have a number of overlapping traits including dwarfism, increased resistance to stressors, and increased longevity . Fibroblfunction . A set onduction , 37. Mornduction . Thus, eIn the present study, a gene expression biomarker was used to identify factors in a microarray database that led to Nrf2 activation or suppression. We then determined the relationship between Nrf2 activation and suppression of STAT5b using a previously characterized gene expression biomarker .https://www.illumina.com/products/by-type/informatics-products/basespace-correlation-engine.html; formally NextBio) was used as the starting point to create a compendium of mouse liver biosets. The BSCE database contains over ~21,600 highly curated, publically available, omic-scale studies across 15 species including ~134,000 lists of statistically filtered genes . Each list (bioset) is compared to all other biosets in the database using a fold-change rank-based statistical algorithm called the Running Fisher algorithm which allows an assessment of the overlap in genes and whether those genes are regulated in a similar or opposite manner. In this study, only biosets from mouse liver, mouse primary hepatocytes, or hepatocyte-derived cell lines were evaluated. Available information about each bioset was extracted from BSCE and used to populate a compendium of information about the experiments. Each bioset was further annotated using information derived from the original GEO submission and/or the original publication. Each bioset was annotated for the type of factor  and the name of the factor  examined. To assess Nrf2 activation or suppression, the Nrf2 biomarker was uploaded into the BSCE database and compared to all biosets in the database using the Running Fisher algorithm. Results of the test were exported and used to populate the annotated compendium with p-values of each comparison. We have previously used this analysis strategy to accurately identify factors that activate or suppress other transcription factors  [The methods used in this study are outlined in eptor \u03b1) \u201342.No animal experiments were conducted as part of this study. However, we did utilize tissues from animals that were part of published studies as discussed below.Mus musculus genome version mm9. A total of 23,238 genes were analyzed. Statistically significant genes were identified by one-way ANOVA with a false discovery rate (Benjamini-Hochberg test) of \u2264 0.01. The raw microarray files have been archived in Gene Expression Omnibus (GEO) under accession number GSE85222.Gene expression was measured in the livers of wild-type or Nrf2-null mice treated with oltipraz or vehicle in which mice were treated each day for 4 days with 75 mg/kg/day . Four biAlmost all of the statistically filtered gene lists used in our study were generated using BSCE standardized microarray analysis pipelines and are available in a searchable annotated format in the BSCE database . AdditioIndependent of the BSCE database, a database of gene expression changes was assembled by our group using comparisons from mouse liver, mouse primary hepatocytes and hepatocyte-derived cell lines. All of these experiments were conducted using Affymetrix microarrays. Affymetrix .cel files were downloaded from publicly available sources including GEO and ArrayExpress, which were first analyzed by Bioconductor SimpleAffy  to assesAnnotation has been described in our previous study . Assignmhttp://linus.nci.nih.gov/BRB-ArrayTools.html) [Analyses were performed using BRB-ArrayTools version 4.2.1 Stable Release developed by Dr. Richard Simon and BRB-ArrayTools Development Team (ls.html) . The metls.html) . Two traFA/FA) [FA/FA) compared to control wild-type mice [Probe sets that comprise the Nrf2 biomarker were derived from comparisons using livers of wild-type and Nrf2-null mice treated with CDDO-Im for 6 hrs  and untrFA/FA)  or additype mice , 49. Theype mice , 39\u201341. ype mice  to find ype mice , 39\u201341. \u22124 after a Benjamini Hochberg correction of \u03b1 = 0.001 resulted in a balanced accuracy of 88%, 97%, 98%, and 98% for AhR, CAR, PPAR\u03b1 and STAT5b activation, respectively [\u22124) is found in Biosets from microarray experiments in which the Nrf2 activation state was known were manually curated from the following studies: GSE55001, GSE55084, GSE54597, E-MEXP-1231, E-MEXP-153, E-MEXP-347, E-MEXP-438, GSE10082, GSE10769, GSE1093, GSE11287, GSE15633, GSE15859, GSE16381, GSE16777, GSE20944, GSE23780, GSE24751, GSE25142, GSE3150, GSE33575, GSE34423, GSE35124, GSE39313, GSE40120, GSE40773, GSE4259, GSE6721, GSE867, GSE8969, GSE55002, and GSE55003. The number of biosets used to test for Nrf2 activation was 67 positives and 14 negatives. Unlike more traditional machine learning classification methods, optimal conditions for classification were not derived from gene behavior as the biomarker was fixed. In this and in our previous studies , the bioectively . The samChIP-seq data from experiments that exposed mouse cells to Nrf2-activating chemicals were obtained from GEO . Briefly, raw sequencing reads downloaded from NCBI Sequence Read Archive (SRA) were mapped to the mouse genome (mm9) using the BWA (Burrows-Wheeler Aligner) . ReplicaThe full list of genes in the Nrf2 biomarker was analyzed using the Ingenuity Pathways Analysis (IPA) canonical pathway and upstream analysis functions. The significance for canonical pathways was calculated using a right-tailed Fisher's Exact test by IPA. The p-value is the probability that the Nrf2 biomarker gene list would coincide with the IPA gene list. Upstream analysis function of potential regulators of Nrf2 biomarker genes was based on the number of differentially expressed downstream genes in the biomarker and quantified using a Z-score and p-value. The Z-score is a correlation measure of how consistent the direction of expression changes in the biomarker gene list matches the direction of change from the annotated literature for targets in the biological or regulatory group.Livers used for the RT-PCR experiments were from wild-type and Nrf2-null mice treated with the Nrf2 activator oltipraz (75 mg/kg/day for 4 days) as described above. The levels of expression of selected genes were quantified using real-time reverse transcription-PCR (RT-PCR) analysis. Briefly, total RNA was reverse transcribed with murine leukemia virus reverse transcriptase and oligo(dT) primers. The forward and reverse primers were designed using Primer Express software, version 2.0 . The SYBR green DNA PCR kit  was used for real-time PCR analysis. The relative differences in expression between groups were expressed using cycle threshold (Ct) values . The Ct values of the genes were first normalized with \u03b2\u2013actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) of the same sample. Means and S.D. (n = 3\u20135) for RT-PCR data were calculated by Student's or Aspin-Welch\u2019s t-test. The level of significance was set at p \u2264 0.05.2 and F-test p-values were determined.Regression analyses were carried out in Excel. RA number of computational strategies were initially examined to identify Nrf2 modulation in genomic databases. We first examined the utility of machine learning algorithms to identify gene sets that would correctly predict Nrf2 activation status. None of the models were adequate for predicting Nrf2 .A rank-based enrichment analysis strategy called the Running Fisher algorithm  as evaluTo evaluate the Nrf2 biomarker genes for direct interactions with Nrf2 (and presumably direct transactivation), genes were compared to existing mouse Nrf2 ChIP-seq datasets. In total, 3641 genes mapped nearest to Nrf2 binding regions . Of the Nfe2l2 (Nrf2) . Other transcription factors included small Maf family members including Mafk, Mapff, and Mafg, all known heterodimeric binding partners with Nrf2.Nrf2 biomarker genes were evaluated for canonical pathway enrichment by Ingenuity Pathway Analysis (IPA) . The topThe biomarker was compared to statistically-filtered gene lists using the Running Fisher algorithm which computes a correlation direction (positive or negative) and an associated p-value of the correlation . To visuThe Nrf2 biomarker was evaluated for ability to correctly classify biosets with known Nrf2 activation status. Not surprisingly, the biosets from either the wild-type mice treated with CDDO-Im or the three Keap1-disrupted vs. wild-type comparisons exhibited statistically significant correlations , whereas the bioset from CDDO-Im treated Nrf2-null mice did not have significant positive correlation .Nqo1, Ces1g and Abcc3 which are part of the Nrf2 biomarker. The expression of these genes was confirmed by RT-PCR , but ony RT-PCR , middle.To determine the predictive behavior of the biomarker, classification was performed on a set of biosets with known Nrf2 activation status. Criteria for classification included a p-value \u2264 1E-4. The final number of biosets evaluated were 67 positives and 14 negatives. Using this relatively modest number of biosets, the biomarker had a 91% sensitivity and a 100% specificity, giving a balanced accuracy of 96% .There are published examples of sex differences in response to various stressors that may induce Nrf2 . The molThe biosets of female vs. male comparisons were analyzed for similarity to the Nrf2 biomarker using the Running Fisher algorithm as described in the Methods. Pou1fd1 (Pit1) gene which controls sex-specific GH secretion from the anterior pituitary. There was no obvious explanation to why the other bioset (mice treated for 2 wk with 5000 ppm o-nitrotoluene) did not exhibit feminization. The relationship between the Nrf2 predictions and expression of the genes in the biomarker is shown in Nqo1. Genes in the Nrf2 biomarker that exhibited significant sex differences included those that had decreased expression in females compared to males . A plot of the\u2013logs of the Nrf2 and STAT5b predictions shows a trend toward more significant Nrf2 activation with more significant suppression of STAT5b   . All 37 Sex differences in the hepatic transcriptome are under control of sex hormones. It was hypothesized that Nrf2 activation is also under control of sex hormone levels. To test this hypothesis, biosets were evaluated in which sex hormone levels were altered; these included effects of castration, ovariectomy, and exogenous treatments with testosterone (T), dihydrotestosterone (DHT), or estradiol (E2) . Ovariectomy compared to intact mice from two biosets had no effect on Nrf2 activation, and two biosets from castrated mice exhibited Nrf2 activation, but these comparisons did not reach statistical significance  (data not shown). We next determined the dose- and time-dependent effects of exposure to the estrogen receptor agonist ethinyl estradiol (EE). Mice were exposed for 7 or 28 days to EE in the feed (described in ). Nrf2 wPou1fd1 (Pit1), Prop1), 2) prevent the synthesis and secretion of GH from the pituitary , or 3) affect the function of the GH receptor (Ghr). All of these mutations result in dwarfism and most lead to increases in longevity compared to wild-type mice through a delay in age-dependent diseases [Ghrhr and Prop1 mutants. None of the Pit1 mutant biosets reached significance. Biosets from Ghr deletion mutants exhibited different effects on Nrf2 depending on the location of the deletion. Ghr truncated at amino acid 569  had no effect on Nrf2 or STAT5b. These results were consistent with the weak to moderate effects on GH-dependent phosphorylation of STAT5b by JAK2 activated through GHR [Ghrh-null vs. wild-type mice  . Simila 2.4E-4) . Taken t2 = 0.170; p-value = 1.22E-6) (S1 File). Only one bioset caused suppression of Nrf2 and STAT5b activation .Feminization of the liver transcriptome is a common feature upon chemical treatment in male mice . We hypo1.22E-6) . Most  (S1 File). Chemicals that activated Nrf2 and caused feminization included 1,5-naphthalenediamine, malathion, oxazepam, phenobarbital, propylene glycol mono-t-butyl ether, TCDD, and TCPOBOP. Benzofuran, coumarin, and methylene chloride caused increases in Nrf2 activation and activation of STAT5b (masculinization). TCPOBOP was the only chemical that caused suppression of Nrf2 with no effects on STAT5b. Overall, these results indicate that coincident activation of Nrf2 and suppression of STAT5b often occurs in male but not female mice.In female mouse livers, there was no clear relationship between Nrf2 activation and feminization after chemical exposure (R= 0.003) . For mos2 = 0.009; p-value = 0.400). The chemicals that altered Nrf2 in vitro in the absence of effects on STAT5b are summarized in We hypothesized that if the linkage between Nrf2 and STAT5b is hormonally-driven, the observed coupling of effects would be absent in in vitro cultures. To test this hypothesis, biosets from chemically-treated primary hepatocytes or hepatocyte cell lines were examined. Given the higher basal activation of Nrf2 in females than males, we hypothesized that there would be sex differences in Nrf2 responsiveness after chemical exposure. Male and female mice were exposed under identical conditions to 11 chemicals . The livSex differences could be due to differences in levels of internal exposure to the compounds which could lead to sex differences in total number of genes altered. However, there was no clear relationship between higher Nrf2 activation and number of genes altered by the chemical in female mice. For the chemicals with the greatest sex differences, the number of genes that were differentially expressed in the livers was either about the same in each sex  or greater in males than females . These results appear to identify a set of chemicals that induce greater Nrf2 activation in females compared to males.Annotated databases of microarray data provide opportunities through novel methods of reanalysis to gain insights into the network of factors altered by chemical exposure. In the present study, we used a gene expression biomarker that can accurately predict the activation status of the oxidant-induced transcription factor Nrf2 in a microarray database and uncovered a strong linkage between increased Nrf2 activity and feminization of the male liver mediated by suppression of STAT5b. Examination of female versus male comparisons showed that Nrf2 is subtly but reproducibly activated to higher levels in females. Additional analyses showed that feminization of the liver transcriptome by genetic, dietary or chemical modulation under conditions which suppressed STAT5b consistently led to Nrf2 activation. Finally, we found that female mice generally exhibited greater induction of Nrf2-regulated genes after chemical exposure compared to male mice. These studies indicate that feminization of the liver transcriptome through many stressors leads to increased Nrf2 activity. The higher basal and chemical-induced Nrf2 activity may explain in part why female mice are often more resistant to a number of stressors compared to males.Nqo1 and Gst family members  levels and cannot sustain hepatic sex-differences in some drug metabolic genes [To screen for factors in the microarray database that lead to alterations of Nrf2 function, we compared the Nrf2 biomarker to a gene expression compendium of ~2500 annotated microarray comparisons allowing an unprecedented assessment of factors that control Nrf2 activity. The compendium contains 86 female vs. male biosets in which female and male mice were evaluated under identical experimental conditions . Almost measured . Femalesic genes . The facNfe2l2 and Hmox1 genes and decreased ROS-induced DNA damage as measured by 8-Oxo-dG and M1dG adducts in the livers of 12-wk old male offspring [Nqo1 [Sult1e1) which sulfonates and deactivates estrogens [Based on the sexual dimorphism in Nrf2 regulation and the fact that liver sexual dimorphism is under control of STAT5b, we hypothesized that hormone, genetic, dietary, and chemical treatments that disrupt the GH-regulated liver transcriptome dependent on STAT5b would lead to Nrf2 activation. Hormone treatments that activate STAT5b (testosterone or dihydrotestosterone) caused suppression of Nrf2, while treatments that suppress STAT5b  caused activation of Nrf2 . Very liffspring . Dietaryng [Nqo1 . There wstrogens . In a mostrogens \u201365.Prop1, Ghrhr, and Ghrh  after exposure to the oxidative stress inducer diquat [Ggt1 and Nqo1 in females compared to males [Nqo1 and Hmox1 genes as well as protein levels of Nqo1 and Gclc while there was less tissue damage in female mice [Nqo1 was found to be greater in females than males after exposure to TCDD [We found that female mice appear to mount a greater Nrf2 response to chemical exposure than male mice. After exposure to 11 chemicals identically administered to male and female mice, Nrf2 was activated to a higher level in female mice than male mice  based onr diquat . Exposurto males . There wale mice . Inducti to TCDD . Upon TC to TCDD . The dif to TCDD . These sCaenorhabditis elegans [Keap1 in male Drosophila melanogaster increases Nrf2 activity and longevity [Gsta4-null mice, in which detoxification of the lipid peroxidation product 4-hydroxynonenal is impaired, exhibit Nrf2 activation and have an extended life span [There are numerous studies which show a relationship between the activation status of Nrf2, resistance to various stressors, and longevity. Female mice live longer than males , possibl elegans . Disruptongevity . In a coongevity . Gsta4-nife span . In a coife span . The dwaife span . More reife span . When prife span .There is evidence for at least four nonexclusive mechanisms that link suppression of STAT5b and Nrf2 activation. In the first mechanism, estrogens can be metabolized by Cyp family members to 2- and 4-hydroxyestrogens which can activate Nrf2  and suppS1 FileContains 1) list of probesets and genes in the Nrf2 biomarker, 2) description of biosets from chemical treatment experiments that activate or suppress Nrf2 and STAT5b discussed in this study, and 3) genes that are mapped nearest to the location of Nrf2 binding peaks from 4 published mouse ChIP-seq datasets.(XLSX)Click here for additional data file.S2 FileContains the section \u201cClassification analysis of Nrf2 activation using machine learning algorithms\u201d.(PDF)Click here for additional data file."}
{"text": "The dynamic change and functional importance of Nrf2 signaling, as well as Nrf2 targeted intervention, are revealed in permanent, transient, and global cerebral ischemia models. In addition, key considerations, pitfalls, and future potentials for Nrf2 studies in preclinical stroke investigation are discussed.Ischemic stroke is one of the leading causes of death and long-term disability worldwide; however, effective clinical approaches are still limited. The transcriptional factor Nrf2 is a master regulator in cellular and organismal defense against endogenous and exogenous stressors by coordinating basal and stress-inducible activation of multiple cytoprotective genes. The Nrf2 network not only tightly controls redox homeostasis but also regulates multiple intermediary metabolic processes. Therefore, targeting Nrf2 has emerged as an attractive therapeutic strategy for the prevention and treatment of CNS diseases including stroke. Here, the current understanding of the Nrf2 regulatory network is critically examined to present evidence for the contribution of Nrf2 pathway in rodent ischemic stroke models. This review outlines the literature for Nrf2 studies in preclinical stroke and focuses on the  Ischemic stroke is one of the leading causes of death and long-term disability worldwide , a cis-acting regulatory element that contributes to cellular defense in eukaryotes  transcription factors. It is a modular protein composed of seven functional domains, Nrf2-ECH homology (Neh) domains 1\u20137, which have distinct functions  Chan et. The NehOrganisms are equipped with a defense system to maintain homeostasis against constant intrinsic and extrinsic insults that result in the damage of nucleic acids, proteins, and membrane lipids. Nrf2 is a master regulator of the inducible cell defense system by controlling a broad range of cytoprotective genes  Keap1 acts as a sensor of oxidative and electrophilic stresses for Nrf2 with a subcellular localization in the perinuclear cytoplasm   Glutathione (GSH)-based: glutamate\u2013cysteine ligase catalytic (GCLC) subunit and glutamate-cysteine ligase modifier (GCLM) control the entry of cystine into cells; glutathione peroxidase (GPX) 2 produces oxidized glutathione (GSSG) during the reduction of peroxides; and glutathione reductase (GSR) 1 reduces GSSG for maintenance of reduced intracellular GSH levels. (2) Thioredoxin (TXN)-based: Thioredoxin (TXN) 1, thioredoxin reductase (TXNRD) 1, and sulfiredoxin (SRXN) 1 reduce oxidized protein thiols. (3) Others: G6PDH and 6PGD reduce synthesis of NADPH, antioxidant protein Trx, stress response protein heme oxygenase 1 (HO1), and other proteins. Nrf2 coordinately regulates key components in the antioxidant system that precisely controls antioxidant defense at multiple levels, thus ensuring an adequate response to oxidants in time and space  to form iron, carbon monoxide (CO), and biliverdin, which is immediately reduced to bilirubin , 6-phosphogluconate dehydrogenase (Pgd), isocitrate dehydrogenase 1 (Idh1), and malic enzyme 1  is a small non-coding RNA molecule that functions in RNA silencing and post-transcriptional regulation of gene expression. At least eight miRNAs have been identified as direct modulators of Nrf2 expression at the transcriptomic level  The prevailing view is that Keap1 is a primary repressor of Nrf2. Under basal conditions, Keap1 constantly targets Nrf2 for ubiquitination and proteasomal degradation, resulting in the disruption of Nrf2 protein stability and maintenance of Nrf2 signaling capacity at a very low level. In response to electrophiles or stressors, Nrf2 is liberated from the Keap1 repression  by inhibiting ubiquitylation and proteasomal degradation that allows newly-synthesized Nrf2 to be rapidly stabilized and activates transcriptional activation of cytoprotective genes. This view is supported by many reports of Keap1 knockout mice and Keap1 knockdown human cells that exhibited sufficient Nrf2 activity  The Nrf2 is has been described to be suppressed by b-TrCP and GSK-3; in addition to the well-studied Keap1, E3 ubiquitin ligase adaptor \u03b2-TrCP is another negative repressor of Nrf2 stabilization  Permanent cerebral ischemia (pdMCAO and pMCAO): Technically, the MCA can be selectively occluded at a distal or proximal site, referred to as permanent distal MCA occlusion (pdMCAO) or permanent  MCA occlusion (pMCAO) cerebral ischemia model, respectively. The pdMCAO model produces highly reproducible ischemic cortical lesions that are predominantly restricted to the barrel regions of cortex, inducing definable sensorimotor deficits that closely mimics ischemic stroke in humans. Thus, it is believed to be one of the most predictable and useful stroke models, allowing researchers to look at long-term recovery with high survival rates  Transient focal cerebral ischemia (tMCAO): This model is easy to perform in a controlled manner. The intraluminal suture MCAO model in rats and mice is the most frequently used model. This model exhibits reproducible MCA region infarctions that depend on the shape, size, and insertion length of the thread, allowing reperfusion by retracting the suture. MCAO generates ischemic cell death in the striatum and overlying the frontal, parietal, temporal, and portions of the occipital cortex. MCAO also precipitates variable damage in the thalamus, cervicomedullary junction, substantia nigra, and hypothalamus. Ischemic brain injury widely affects diverse brain regions and leads to complex motor, sensory, autonomic, and cognitive deficits  Global cerebral ischemia (GCI): global cerebral ischemia (GCI) during cardiac arrest results in selective and delayed neuronal death of pyramidal neurons in the hippocampal CA1 region, similar to the situation in humans, and consequent cognitive decline  Whether Nrf2 induction is protective against ischemic injury and is facilitative for recovery? Specific focus is given to the in vivo evidence in different rodent cerebral ischemia models. Then, the pitfalls and concerns of current Nrf2 experimental ischemic stroke studies are discussed, which would be valuable for future studies.In recent years, studies reported findings concerning the dynamic change of Nrf2 signaling, its functional importance, and its targeted intervention in cerebral ischemia. These findings provide insights into whether, when and how Nrf2 functions during brain injury. Accordingly, we mainly focused on the following questions. (1) What is the dynamic regulation of the Nrf2 signaling following cerebral ischemia? (2) Does the evidence from Nrf2in vivo evidence of dynamic alternation of Nrf2 expression, as well as its target genes, and cellular and subcellular distribution of Nrf2 during different stages of cerebral ischemia. These findings, utilizing focal ischemia models with or without reperfusion in addition to global ischemia models, help us to identify the role of the Nrf2 regulatory network in the context of cerebral ischemia.Normally, Nrf2 is largely localized in the cytoplasm and is maintained at a low basal level due to its binding affinity to Keap1. However, when cells are exposed to excessive oxidative stimuli during cerebral ischemia, Nrf2 is liberated from Keap1, translocates into the nucleus, and binds to the ARE sequence, thereby upregulating the expression of its target genes, which code cytoprotective proteins like anti-oxidative enzymes. In recent years, studies have provided substantial A number of studies with permanent cerebral ischemia models (pdMCAO and pMCAO) investigated the Nrf2/ARE pathway in response to ischemic insults . Severalin vivo optical signals of Nrf2 expression were not detected in the earliest stages but peaked at 24 h after ischemia. Such Nrf2 expression was mainly detected in in the penumbra area, largely localizing inside neurons and astrocytes  or knockdown animals. Reports showed that Nrf2\u2212/\u2212 mice do not exhibit any overt abnormal phenotype regarding size, body weight, food intake, mobility, fertility, or other characteristics at baseline , which further supports the findings above  was observed before, during, or after ischemia-reperfusion between WT and Nrf2\u2212/\u2212 at indicated time points as monitored by laser-Doppler flowmetry , and more are also depicted in Given the fundamental role of Nrf2 in redox homeostasis, many studies have presented the unique contribution of Nrf2 in neuroprotection against various diseases Ma, . For isc\u2212/\u2212 mice, indicating that the Nrf2 pathway is required for the benefit of DMF and MMF. During the late phase (7\u201314 d), DMF also acted as a potent immunomodulator, reducing the infiltration of neutrophils and T cells and the number of activated microglia and macrophages in the infarct region  and its primary metabolite monomethyl fumarate (MMF) are two typical Nrf2 inducers. Several studies support their neuroprotective efficacy against ischemic brain injury through the activation of the Nrf2/HO1 pathway. DMF and MMF dramatically reduced infarct volume, brain edema, and neurological deficits over 7 days after tMCAO, along with the suppressed acute glial activation , a typical Nrf2 activator, is a naturally occurring isothiocyanate found in cruciferous vegetables. Upregulation of Nrf2 by sulforaphane pretreatment was associated with increased HO1 expression in perivascular astrocytes in the peri-infarct regions and cerebral endothelium of the infarct core. BBB disruption, lesion progression, and neurological deficits were reduced after tMCAO. This indicates that the Nrf2 defense pathway in the cerebral microvasculature provides a novel therapeutic approach for preventing BBB breakdown and neurological dysfunction in stroke victims  is a Nrf2 inducer widely used as a food additive. Nrf2 activation by tBHQ pretreatment reduced cortical damage and sensorimotor deficits from 24 h up to even 1 month after pdMCAO. Interestingly, larger infarcts were observed in Nrf2MicroRNAs (miRNAs) play vital roles in regulating neuronal survival during cerebral ischemia/reperfusion injury. MiR-93, a direct negative modulator of Nrf2 expression at the transcriptomic level, serves as a potential therapeutic target for acute ischemic stroke. MiR-93 levels in the ischemic cortex of mice increased at 24 h and 48 h after tMCAO. MiR-93 antagomir treatment reduced infarction volume, neural apoptosis and neurological deficits through the Nrf2/HO1 antioxidant pathway  is one of the most widely used herbal medicines with reported antioxidant and anti-inflammatory properties, displaying promising potential in neuroprotection. Ginseng pretreatment ameliorated short- and long-term sensorimotor deficits over 28 days, prevented the acute enlargement of lesion volume, attenuated reactive astroglial progression but not microglial activation, and enhanced the induction of Nrf2 target antioxidant proteins after pdMCAO in WT mice, an effect that was abolished in Nrf2\u2013)-Epicatechin (EC) is especially abundant in cocoa, dark chocolate, and green tea, and it boosts antioxidant activity while supporting vascular function. EC-treated ischemic WT mice displayed a reduction of forelimb motor coordination impairments associated with reduced anatomical injury and microglia/macrophage activation in pMCAO and tMCAO models of adult WT mice, impairments which were abolished in tissues and neurons from Nrf2\u2212/\u2212 mice  is a gaseous second messenger produced when heme oxygenase enzymes catabolize heme. At low doses  is one of the main components of Ligusticum wallichii Franchat (Chuan Xiong) that has been used to treat neurovascular and cardiovascular diseases including stroke in traditional Chinese medicine. TMP has been found to protect against pdMCAO injury and reduce inflammation and ischemia-induced neutrophils through Nrf2/HO1 activation  Nrf2 antibody: Getting potent, selective and highly specific antibodies against the various species of Nrf2 has been an ongoing serious issue. Furthermore, what is the correct molecular weight of Nrf2 protein? The biologically relevant molecular weight of Nrf2 protein has been proven to be ~95\u2013110 KDa, but not ~55\u201365 KDa, based on its 2-kb open reading frame or its tertiary structure (Lau et al., This review focusses on Nrf2 activity in the context of ischemic stroke, though, over- or prolonged Nrf2 activation could potentially be problematic. For example, sustained activation of Nrf2 in drosophila would shorten its life expectancy (Tsakiri et al., in vivo evidence revealing the contribution of the Nrf2 pathway in ischemic stroke pathogenesis and neuroprotection. This review highlighted the promising potential of interventions targeting Nrf2, implying that the moderate activation of Nrf2 favors the attenuation of brain damage and long-term recovery from cerebral ischemia. Because the investigations of Nrf2 in stroke are still in the initial stages, future research is expected to elucidate the natural properties of Nrf2 in stroke leading to the development of novel drugs that target Nrf2.Emerging evidence demonstrates that the Nrf2 network plays a crucial role in cellular adaption by controlling a wide range of cytoprotective proteins, counteracting distinct endogenous and exogenous insults while providing a promising optimal therapeutic target against various diseases from cancer to brain disorders. By using various ischemic stroke rodent models, recent preclinical studies provide direct LL and SD conceived the study and designed the databases analysis. LL prepared the manuscript with input from SD. LL and LML searched databases, collected data, performed analyses, and prepared the tables and figure. All authors reviewed, discussed and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Areca catechu, Polygonum minus, and Syzygium polyanthum plant extracts to compare the results of our proposed LoD method with the conventional method. Contrasted to the arduous laborious conventional method, our proposed method offer rapid analysis and simple determination of antioxidant. This proposed LoD method for antioxidant activity in plants would be a platform for the further development of antioxidant assay.Antioxidants are an important substance that can fight the deterioration of free radicals and can easily oxidize when exposed to light. There are many methods to measure the antioxidant activity in a biological sample, for example 2,2-diphenyl-1-picrylhydrazyl (DPPH) antioxidant activity test, which is one of the simplest methods used. Despite its simplicity, the organic solvent that has been used to dilute DPPH is easily evaporated and degraded with respect to light exposure and time. Thus, it needs to be used at the earliest convenient time prior to the experiment. To overcome this issue, a rapid and close system for antioxidant activity is required. In this paper, we introduced the Lab-on-a-Disc (LoD) method that integrates the DPPH antioxidant activity test on a microfluidic compact disc (CD). We used ascorbic acid, quercetin,  Free radicals are atoms with unpaired valence electrons that cause its chemical instability and reactivity. The valence electron of one atom accepts an electron from another molecule, which forms a new free radical. This process repeats itself, creating a free radical cascade. When free radical production becomes excessive in the body, it may cause oxidative stress, a condition whereby the body cannot counter-attack the production of free radicals, leading to cellular damage and cell death . Free raAntioxidants are molecules that can donate electrons to stabilize free radical species. They play many important roles in daily life. For example, antioxidants are hypothesized to prevent the deleterious effects of free radicals on cells . In the There are many methods to determine the antioxidant properties in a sample. Each of the methods work differently based on the chemical mechanism, among which, the 2,2-diphenyl-1-picrylhydrazyl (DPPH) antioxidant activity test is the most common and easiest method used to determine the antioxidant activity in a sample . The DPPDespite the simplicity of the DPPH antioxidant assay, DPPH itself is easily decomposed over time and is highly sensitive to changes in temperature, pH, and light exposure ,14. The Many fundamental bio-assay methods are carried out manually. The experimental steps are often time-consuming and require expert skills. The amalgamation of human-prone error, especially in the pre-analytical phase, may also cause incorrect interpretations or false positive results in the analytical and post-analytical phases . One of Lab-on-a-Disc (LoD), which are also known as centrifugal microfluidic, are a part of the microfluidic device in the form of a disc with a spinning motor. LoD is a part of the Micro Total Analysis System (\u00b5TAS), which offers miniaturization and automation of most of the chemical and biological analysis systems. LoD offers many advantages, such as simplicity of the assay procedure, fast results, and cost efficiency. LoD has automated many bioassays, such as Enzyme-linked Immunosorbent Assay (ELISA) and the loop-mediated isothermal amplification (LAMP) assay ,18. WhenJungwoo et al.  have demAreca catechu, Polygonus minus, and Syzygium polyanthum plant extract.In this paper, we present an approach of LoD method for antioxidant plant activities. We offer automation and sample miniaturization of the DPPH antioxidant activity test with parallel sequential sample loading and mixing. Our proposed LoD method has been tested on ascorbic acid, quercetin, A. catechu, P. minus and S. polyanthum were collected from Selangor and Perak, Malaysia. The plants were chosen based on their reported high antioxidant activity among local plant species [The plants  species ,21,22. TThe antioxidant activity of the samples were determined using the method described by Saha et al. , with soThe photoprotective microfluidic was designed using computer-aided design software (AutoCAD), as shown in All of the engraving of microfluidic channel features was done using a Computer Numerical Control (CNC) machine VISION 2525 by Vision Engraving and Routing Systems, USA, as shown in After preparing the plant extract (as discussed in the previous section), the plant extracts along with the two-standard reagent of antioxidant (ascorbic acid and quercetin) were then preloaded into the plant extract chambers. The plant extract chambers in the middle were designed in four different sizes in duplicate for 25, 50, 75, and 100 mg/mL plant extract. Meanwhile, as shown in There are two devices used to read the antioxidant activity absorbance, which are a microplate reader and the CD reader. The microplate reader was used to compare the antioxidant absorbance activity for both the conventional and LoD method reading over 5 min intervals up to 30 min. The final solutions obtained from the conventional and LoD reaction methods were then transferred to the 96 well plates for the absorbance measurements.Whereas, the CD reader  was usedOur proposed method has minimized human operations in the DPPH antioxidant test, the repetitive pipetting, loading, and mixing steps can be skipped by flow control mechanism of the microfluidic CD. Basically, in our microfluidic CD design, the capillary passive valves were used to control the sequential fluidic flow and the mixing of the liquids. The manipulation of the chamber position, centrifugal force and the capillary valve have determined the sequences of fluids flows to the reaction chamber, the details and analysis of the valves burst frequency is described by Thio et al.  and KazeThio et al. and Kazemzadeh et al. in their paper have been discussed extensively about the theory of the liquid flows inside the passive capillary valves toward the target chamber (in this paper is reaction chamber). In order of the liquid to move from one chamber to another, the capillary pressure need to be overcome by increasing the speed of the motor . In this paper, the location and the geometry of the plant extract chamber and the DPPH chamber on the microfluidic CD have enable the liquid flows manipulation into the reaction chamber.In this section, the comparison results of the conventional and LoD DPPH antioxidant methods are shown and discussed. All of the samples were tested for antioxidant activity by using LoD method and compared with the conventional DPPH antioxidant activity test for 30 min as this is the standard time and common procedures practises in the conventional DPPH assay . SubsequA. catechu, P. minus, and S. polyanthum activity antioxidant has been presented between conventional and LoD method at each concentration. The results showed that there was a significant difference of * p \u2264 0.05 between the conventional and LoD method at each concentration. What can be clearly observed in In Efficacious sample mixing accelerate the chemical reaction and decrease the time of assay . In a chIn A. catechu plant extract gave a result that was 16.25 min faster when compared to the conventional methods at 30 min. The analysis can be seen in Appendix C.The results in S. polyanthum plant extract gave a result that was 21.25 min faster when compared to the conventional methods. Refer Appendix E for the analysis.The results in The results has been shown in P. minus to 5 min, when compared to the standard 30 min of the conventional method. This result may be explained by the fact that the purity, compound mixtures, different form, and weight of molecules that are present in a sample did play a role for diverse antioxidant activity. In this study, the plant extract have been used to test the LoD method, the presence of compound, such as phenol, may cause interference and affect the reading when compared to the actual activity, which expound the different activity time between each plant [Referring to the ch plant ,35.The conventional DPPH method use a high concentrations of the plant extract , which proportionally need large reagent volumes. The proposed method reduced the volume usage to the final of 200 \u00b5L to provide a good range of detection as the conventional method . Figure 2 = 0.96) between the reading from the CD reader and the microplate reader, indicating a close relationship between the CD reader and the microplate reader. Unlike the conventional method, the CD reader can read the absorbance of the entire sample directly from the microfluidic CD. It is designed specially to work in complement with the microfluidic CD, and the pipetting process of transferring the solutions to the 96 well plate has be eliminated. The process of transferring the solutions to the 96 well plate risks losing volume, which can be rectified by a closed and automated system, such as that used in the LoD platform. This CD reader endpoint reading system complete and support to the development of an integrated platform for the antioxidant microfluidics CD system.The experimental work was carried out with a modified version of custom-made CD spin test system ,37. The In this study, we have integrated the conventional DPPH antioxidant activity test by proposing a microfluidics CD method for the detection of antioxidant activities in plants. The sequential sample loading and mixing in a closed LoD system minimizes human error and volume loss due to manual pipetting procedures. The \u201cload and run concept\u201d in the proposed LoD method has omitted the repetitive pipetting, mixing, and loading steps in the DPPH conventional method. With four parallel concentrations and duplications that able been run simultaneously on the microfluidic CD, this study has shown that the proposed LoD method for antioxidant activities of the plant extracts procedures has been automated. Using this LoD technique not only it automates the processes but also helps to reduce the incubation time to five minutes, to reach the same antioxidant activity level as the conventional method of 30 min. This approach would work as an application for antioxidant activity and will act as a platform for the determination of future antioxidant activity in a plants or another type of sample."}
{"text": "Asthma is the most frequent chronic disease in children, and its pathogenesis involves genetic, epigenetic, and environmental factors. The rapid rise in the prevalence of asthma registered over the last few decades has stressed the need to identify the environmental and modifiable factors associated with the development of the disease. In particular, there is increasing interest in the role of modifiable nutritional factors specific to both the prenatal and post-natal early life as, during this time, the immune system is particularly vulnerable to exogenous interferences. Several dietary factors, including maternal diet during pregnancy, the duration of breastfeeding, the use of special milk formulas, the timing of the introduction of complementary foods, and prenatal and early life supplementation with vitamins and probiotics/prebiotics, have been addressed as potential targets for the prevention of asthma. In this review, we outline recent findings on the potential role of prenatal and perinatal dietary and nutritional interventions for the primary prevention of pediatric asthma. Moreover, we addressed unmet needs and areas for future research in the prevention of childhood-onset asthma. The role of several dietary factors, including maternal diet and vitamin status, composition of the microbiome, duration of breastfeeding, the use of hydrolyzed formulas and the introduction of complementary foods, has been investigated in recent clinical trials, to identify potential targets for the prevention of childhood-onset asthma , vitamin E, and zinc had a protective effect against early life wheezing in offspring, but not on childhood-onset asthma or other atopic conditions. One recently published study, assessing the impact of pre-pregnancy diet on the risk of allergic outcomes in children  in asthma prevention is still controversial. Two early RCTs showed no significant difference between pHF and eHF in the prevention of allergic diseases in children, including asthma , 42. In In a recent birth cohort study, infants received breast milk only, pHF with or without a hypoallergenic label, or non- hydrolyzed formula. The use of the pHF-with hypoallergenic label, compared to non-hydrolyzed formula, had no protective effect on the risk of asthma up to 2 years of age and was related to a higher risk of wheezing at 1 year in high-risk infants . A recenThe hypothesis that VD status in childhood might influence the susceptibility to childhood asthma and allergy is supported by the evidence on the role of VD as a key modulator of lung growth and innate and adaptive anti-inflammatory immune responses \u201350. ExpeInterestingly, VD supplementation during pregnancy and infancy has been related to a reduced risk of sensitization to house dust mites at age 18 months .in-utero  or a diet-limited supplementation (control group) showed a 34% reduced risk for recurrent wheezing by 12 months in the intervention group . There iin-utero  and postin-utero , and proin-utero . InterveThere is mounting evidence showing the relationship between the composition of the early-life gut microbiome and the risk of asthma in children , 58, whiIn a 2-year follow-up RCT involving 132 infants at risk of atopy, infants that were fed with a formula containing a mixture of prebiotic oligosaccharides reported a lower incidence for recurrent wheezing compared to the placebo group . In a 1-Taken together, the evidence on the effects of oral probiotics and prebiotics for the prevention of pediatric asthma is so controversial that no definitive recommendation can be made. Differences in the probiotic strain specificity, the population treated, the timing of administration, and the duration of the intervention all contribute to the heterogeneity of the meta-analysis and of RCT outcomes.The supplementation with omega-3 long-chain polyunsaturated fatty acids (LCPUFA) during pregnancy and early life, through the administration of fish oil, has been proposed for the prevention of allergic sensitization and atopic disease, including asthma , 73. LCPConflicting results have been found in studies investigating fish oil supplementation in infants and children for the prevention of allergic sensitization and asthma \u201367 Tabl. A meta-Recent advances in the field of allergy prevention showed that early 2000s recommendation to delay the introduction of solid allergenic foods to the infant's diet is not an effective approach to reduce the risk of allergic sensitization and atopic diseases in children \u201388. MoreThe timing of the introduction of fish is of particular interest to the purpose of primary prevention of asthma, given its high content in LCPUFA. Despite the heterogeneity in the methods of analysis and outcome measures, the early introduction of fish has been associated, in many observational studies, with a reduced risk of allergic sensitization , 94. HowThe significant increase in the prevalence of asthma and allergic diseases registered in recent years has promoted research on the identification of modifiable risk factors for the prevention of such disorders. It is well-acknowledged that respiratory health is determined by a complex interaction between genetic factors and environmental drivers that occur during prenatal and early postnatal life, including dietary factors. However, it remains difficult to define the contribution of specific dietary supplements and nutritional food sources to the risk of developing pediatric asthma, due to the heterogeneous pathogenesis of this disease and the limitations of the currently available evidence, in terms of study design, type and duration of interventions and outcomes measures.Further research is needed to accurately identify dietary and nutritional modifiable risk factors for asthma and to address whether the modulation of such factors, either alone or in combination, could contribute to the primary prevention strategies of pediatric asthma.DP, GN, IT, GC, and PC made substantial contributions to conception, design, and acquisition of data. GC, IT, GN, and PC drafted the initial manuscript. DP, EV, ED'A and PC critically reviewed it for important intellectual content. All authors approved the final version of the manuscript. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "P< 0.001), while there was no significant improvement in the control group\u2019s scores. Students' attitudes towards professionalism and their professional behaviors did not change significantly.Many medical schools around the world have included professionalism training in their formal curriculum. However, these efforts may not be adequate; given the exposure of students to unprofessional behaviors in the clinical settings. In the present study, we aimed to design, implement, and evaluate a longitudinal program to improve professionalism among medical students upon their transition to clinical settings. A total of 75 medical students were enrolled in the study and randomly assigned to two groups. The control group did not receive any training, while for the intervention group; a 10-hour program through 16 weeks was organized based on the Holmes' reflection approach. The effectiveness of the program was evaluated by measuring three outcomes in both groups. Data analysis was performed using paired t-test and Multiple Linear Regression. Scores of judgment of professionalism increased in the intervention group (from 7.56 to 10.17; Based on our findings, the Holmes reflection approach helps students improve their cognitive base of professionalism. Long-term follow-up and further qualitative studies will help us better understand the effects of this approach on other desirable outcomes.  Professionalism, one of the six core competencies proposed by the Accreditation Council of Graduate Medical Education , has becThe development and maintenance of professionalism are one of the challenging issues in medical education. It is important to explicitly teach professionalism and actively reinforce the desired values, throughout both the undergraduate and postgraduate curricula . Apart fReflection is described as a core element of clinical competence and a fundamental element in teaching professionalism . PhysiciThere is little evidence concerning the application and effectiveness of the Holmes' approach. Seen from a broader perspective, research in the field of medical professionalism is mostly composed of descriptive reports or qualitative studies, most of which have discussed the importance of professionalism or have elaborated on different methods of teaching professionalism , 9, 15. In this study, we tried to provide robust evidence by evaluating the educational outcomes of our longitudinal program at different levels of reaction, learning, and behavior using the Holmes' reflection approach. We chose clerks  because noticing and observing unexpected behaviors, which are in contrast with the ethical values learned in the formal curriculum, more likely occurs at the beginning of a new period of training.Study design This pre-test post-test randomized controlled study was conducted in 2017-2018 on medical students. TUMS medical students are mainly admitted to the university from high school and the total duration of their training, including the internship, is seven years. The preclinical period is an integrated organ system-based curriculum that continues for three and a half years. These medical students have to follow two unit course in ethics in the pre-clinical period. While these students have an early clinical exposure during the pre-clinical period, their first clinical experience at the patient's bedside starts in the fourth year when they are assigned to the university-affiliated hospitals for their clerkship. The internal medicine clerkship was selected for this study, as it is the longest rotation (16 weeks) and the starting point of clinical practice for many students. In the briefing session at the beginning of the internal medicine clerkship, the study objectives and procedures were described for all students, and those who were willing to participate were enrolled in the study. For data analysis, we excluded students who were absent for two or more sessions as well as those who failed to complete the evaluations. A sample size of 23 was estimated for each group as a prior; however, concerning the probability of dropouts, we considered a larger sample size. Students were randomly assigned to the control and intervention groups. The control group did not receive any training, while the intervention group participated in five sessions. To minimize the risk of contamination, participants were asked not to share program details with friends and classmates of the control group .Design and delivery of the educational interventionThe research team met regularly to discuss the details of the design and structure of the longitudinal program based on the Holmes\u2019 approach. They made decisions on the schedule, teaching methods, content, and implementation of the intervention.We finally decided to organize the whole program as five 2-hour sessions within 16 weeks. With regard to the teaching methods, we decided to use the small group technique. Hence, we randomly allocated the students into six small groups (five groups of six and one group of eight people). As we needed facilitators to coordinate discussions in small groups, we invited a number of medical interns who were collaborating with the Educational Development Office at the Medical School. These medical interns were previously trained to play the role of facilitators; yet, before the beginning of the program, we oriented them about our study objectives, the intervention procedure, and the purpose of the sessions. We also provided them with a written guideline. The facilitators were instructed to use their own experience to encourage discussions in the small groups. With regard to the content of the program, we decided to apply the Holmes' steps in five sessions:In the first session, the program was introduced, and the importance and necessity of teaching professionalism were discussed interactively. A notebook was given to the students to record daily diaries immediately to prevent contamination of the memory. Then, the first step of Holmes' reflection approach, priming, was implemented. For this purpose, some examples of how medical students in a clinical setting might yield to external pressures to engage in inappropriate behaviors were presented. The facilitators shared their experience in this area and encouraged the students to participate in the discussion. The students were asked to pay attention to unprofessional behaviors that might occur in upcoming days during their rotation and to document their daily memories in their clinical notebooks. In the second session, according to the second step of Holmes' reflection approach, noticing, the students described the ethical issues that they were exposed to. They were encouraged to share their notes of unprofessional behaviors, to express the emotion that they had felt at those moments, and to discuss their experiences. In the third session, the third step of Holmes' reflection approach, processing, was implemented. The objective of this session was to help students develop feasible action plans to deal with similar situations in the future. In the fourth session, we repeated the processing step, so that all students would have the opportunity to reflect deeply and critically on their observations and to receive feedback. In the last session, the fourth step, choosing, was implemented. The objectives of this session were to support students in identifying and adopting behaviors aligned with the profession's values and to avoid misconducts; help students apply their action plans (an outcome of steps 3) in a way that it reinforces their progress without alienating them from their peers or seniors, and show students how to politely disagree with others. In this session, a sample of poor reflections was compared with some good reflections, and group discussions were conducted. Each facilitator was assigned to a small group and encouraged students to reflect. The facilitators provided feedback about the students' reflection and helped them distinguish a poor reflection from a good one, using a guideline . Investigation of outcomeThe assessment of outcomes was carried out at the beginning of the study and one month after the program, for both intervention and control groups. We used several tools to determine the effectiveness of the program:We evaluated the cognitive base of professionalism (level 2A of Kirkpatrick's framework) using a Situational Judgment Test (SJT), consisting of 11 clinical scenarios (seven constructed-response questions and four selected-response questions). Some examples of this test are presented in The students' attitude toward professionalism (level 2B of Kirkpatrick's framework ) was assMoreover, the students' professional behaviors were evaluated (level 3 of Kirkpatrick framework) using the Professionalism Mini-evaluation Exercise (P-MEX). The content validity assessment showed that five items  were not suitable for evaluating the TUMS clerks, and thus, were omitted. The internal consistency of the 16-item scale was found to be 0.95, based on Cronach's alpha. Since each item of the P-MEX is graded as follows: 1= unacceptable; 2= below expectations; 3= met expectations; and 4=exceeded expectations, the total score ranged from 16 to 64. Interns, residents, fellows, and faculty members used P-MEX to assess participants. One of the researchers provided the necessary instructions on the tool before conducting the assessments. Data analysis was carried out only for students whose evaluations were completed before and after the intervention, and for those who participated in three sessions and more.StatisticsThe demographics of participants were summarized using frequency, mean, and standard deviation. The paired t-test was performed to compare means of SJT, QUBPI, and P-MEX scores. Multiple Linear Regression (MLR) was performed using medical students' post-test mean scores of SJT, QUBPI, and P-MEX as the dependent variables; and the pre-test mean scores and the group as the independent variables. All data analyses were performed using SPSS version 21.The study protocol was approved by the Ethics Committee of Tehran University of Medical Sciences (TUMS) (No. IR.TUMS.MEDICINE.REC.1395.1722).Among 105 eligible students, 75 (71.4%) voluntarily participated in this study and were randomly allocated to the intervention and control groups. The mean age of students in the intervention group was 22.12 years (SD=0.95), and 44.7% (N=17) were female. The mean age of the control group was 22.77 years (SD=0.95), and 35.5% (N=11) were female. There was no significant difference between the mean age of the students in the control and intervention groups. The mean and standard deviation of pretest and posttest scores of judgment (SJT), Attitude (QUBPI), and behavior (P-MEX), before and after the program is presented for the control and intervention groups in P<0.001). Based on the results of the MLR of SJT, independent variables of \u201cgroup\u201d and \u201cmean pre-test score\u201d explained 64% (R2) of variance scores (dependent variable). Considering the students' attitude (QUBPI), the MLR showed that independent variables of \"group\" and \"mean pre-test score\" explained only 16% of the variance in the mean score. The MLR of students' behaviors (P-MEX) showed that independent variables of \"group\" and \"pre-test behavior score\" could explain only 0.23% of the variance in the mean score. Post-test judgment was improved in the intervention group, showing a significant difference between the control and intervention groups . Also, in line with the paired t-test results, after controlling the confounders using MLR, the students' judgment in the intervention group increased significantly in comparison with the control group (P< 0.001). Based on the results of the MLR, by a one-unit increase in the mean pre-test score of the students' attitudes, the mean score of post-test increased by 0.46 units (P< 0.001). However, after controlling the confounders using MLR, in line with the paired t-test results, there was no statistically significant difference between the two groups\u2019 attitudes after the intervention (P= 0.34) (It should be noted that RP= 0.34) . P= 0.07). Also, with a one-unit increase in the mean pre-test score of students' behavior, the mean score of the post-test increased by 0.77 units (P< 0.001). However, after controlling the confounders using MLR in line with the paired t-test results, professional behavior in the intervention group did not show any statistically significant difference (P= 0.07).In the intervention group, in comparison with the control group, the mean score of students' behavior increased by 0.17 units, provided that the variable pre-test value was considered constant . Teaching methods included didactic lectures, journal clubs, small group discussions, and book reviews. They assessed the outcomes using four levels of the Kirkpatrick model. Given the qualitative nature of the data extracted from levels 3 and 4 in this study, outcomes were measured by the incidence of sentinel events. The results showed improvement in knowledge and professional behaviors. In addition, the participants were satisfied with the course; however, their attitude toward professionalism did not change. Since the authors did not use a randomized design, it is difficult to attribute all the changes to the training program. In addition, participants of the study included a diverse range of health professionals who were more involved in patient care, compared to the clerks in our study . Given the lack of comparable quantitative, randomized studies on teaching and assessing professionalism, our \ufb01ndings can be considered in a wider context including medical ethics and ethical judgement.Murrell conducted a cross-sectional study to evaluate medical students' ethical judgment. The results showed that there was no significant difference between students who participated in the professionalism course and those who did not . This fiClearly, there are many variables that could have influenced the professional behaviors of learners and their attitudes toward professionalism. Hence, we were not able to detect a significant improvement in these two outcomes. The hidden curriculum is a very powerful tool for encouraging professional values , 27; yetTo the best of our knowledge, this is the first true experimental research that evaluated a professionalism training program based on a guided reflection method. The current study had several strengths. First of all, we used a conceptual framework that facilitated guided reflection and feedback in multiple sessions. Interestingly, while the Holmes' approach is grounded in a theoretical basis, it is very practical and applicable to the real life. To make the most out of this approach, we managed to design our intervention as a longitudinal program, because standalone educational courses are considered to be less effective. Besides, to provide robust evidence on the effects of our program, we included a control group and performed pre-post comparisons. We also used previously established instruments for all of our measurements, including the cognitive base and attitude of students, as well as their actual behavior, an outcome that has often been ignored in previous studies. On the other hand, our study had also a few limitations. Despite orientating the intervention group not to share material with the control group, information exchange was possible between the two groups. In addition, while we tried to minimize the differences between small group facilitators, through training and written guidelines, their diverse experiences might have resulted in different discussions that in turn could have caused inconsistency in our program. As the TUMS clerks are not involved in direct patient care, so direct observation of their performance using P-MEX might have not been always possible. Secondly, in spite of our effort to train the raters, it is possible that some of residents, fellows, or faculty members have failed to contribute to a valid assessment due to their high workload.Finally, our study was performed on a small scale, we did not evaluate the longterm outcomes, and we did not collect qualitative data which could have provided us with a deep understanding about the impact of the program.The application of Holmes\u2019 reflection approach improved the judgment of professionalism among medical students upon their transition to the clinical settings. It is recommended to conduct mixed-methods studies with long-term follow-ups to better evaluate the effects of reflection on the attitudes and professional behaviors of students."}
{"text": "We did not find any significant correlation between vitamin D concentration and body mass index. Conclusions: The burn injury has an enormous impact on the metabolism and the risk factors of the deficiency for the general population (BMI) have an effect on burned patients. Our study showed that concentration of 25-hydroxycholecalciferol is strongly correlated with serum albumin level, even more than total burn surface area and burn degrees as expected. We suspect that increased supplementation of vitamin D should be based on albumin level and last until albumin levels are balanced.Background: Burned patients have an increased need for vitamin D supply related to the maintenance of calcium\u2013phosphate homeostasis and the regulation of cell proliferation/differentiation. This study aimed to analyze the concentration of 25-hydroxycholecalciferol and its relationship with severe condition after burn injury. Methods: 126 patients were enrolled in the study. Patients were qualified due to thermal burns\u2014over 10% of total body surface area. On the day of admission, the following parameters were assessed: 25-hydroxycholecalciferol concentration, total protein concentration, albumin concentration, aspartate transaminase activity, alanine transaminase activity, albumin concentration, creatinine concentration, c-reactive protein concentration, procalcitonin concentration, and interleukin-6 concentration. Results: Almost all patients (92%) in the study group had an improper level of vitamin D (<30 ng/mL), with the average of 11.6 \u00b1 10.7 ng/mL; 17.5% of patients had levels of vitamin D below the limit of determination\u2014under 3 ng/mL. The study showed that there are several factors which correlated with vitamin D concentration during the acute phase of burn injury, including: total protein ( Burns are one of the most serious injuries, which often include multi-organ dysfunction. Every year, about 1% of Polish people (both children and adults) suffer from various types of burns . Due to The aim of our study was to analyze the level of vitamin D and its relationship with severe condition during the acute phase of burn injury.One hundred twenty-six patients with burn injuries were enrolled in the study. Participants were patients of the Western Pomeranian Center for the Treatment of Burns Injuries and Plastic Surgery in Poland. Patients were qualified due to thermal burns\u2014over 10% of the total body surface area (TBSA); 88% of patients involved in the project meet the major burn criteria. According to the classification used in our hospital, major burn needs to include: \u226525% TBSA, or \u226520% in adults over 40 years old, or \u226510% TBSA with full-thickness burn, or all burn injuries complicated by major trauma/inhalation injury; 12% of patients met the moderate burn criteria . According to their medical history from admission to the unit, none of the included patients suffered from chronic kidney disease. The protocol used in our hospital includes no albumin administration during the first 24 h of burn injury. Instead of albumin patients were given Ringer\u2019s lactate and fresh frozen plasma. The protocol of the study has been accepted by the local bioethical committee at the Pomeranian Medical University in Szczecin (KB-0012/143/16). Every participant signed a consent to take part in the study and was informed about its course, benefits, and potential side effects. Patient characteristics are shown in On the day of admission, the following parameters were assessed: 25-hydroxycalciferol concentration (vitamin D status predictor), total protein concentration, albumin concentration, aspartate transaminase activity, alanine transaminase (ALT) activity, albumin concentration, creatinine concentration, c-reactive protein (CRP) concentration, procalcitonin concentration, and IL-6 concentration. All measurements were performed in a commercial certificated laboratory in the Hospital. The 25-hydroxycholecalciferol measurement was based on validated automatic immunochemical method. Serum was used as basic material for all analysis.p < 0.05 were considered as statistically significant. To control type I errors, the false discovery rate (FDR) approach was used. The calculations were performed using the p.adjust function of the stats package in R 4.0.2. Multiple regression was used to assess the relationship between albumin, total protein, and vitamin D concentration. The values being at the threshold of statistical significance were established at p < 0.055 and the statistical tendency from p = 0.06 to p = 0.1. In reference to the results which were not statistically significant, the abbreviation NS (not significant) was used instead of p.The statistical analysis was performed using the \u201cR 3.0.2\u201d program. In order to check the normal distribution, the Shapiro\u2013Wilk test was used. The distribution did not deviate from the norm, and parametric tests were used in the calculations. The results are presented as mean values and standard deviation (SD). In order to estimate the correlations, the Pearson\u2019s correlation test was used. To estimate the connection between burn degree and concentration of vitamin D, the Poisson regression was used. The values of p = 0.08). The average concentration in particular subgroups is shown in Almost all patients (92%) in the study group had an improper level of 25-hydroxycholecalciferol (<30 ng/mL), with the average of 11.6 \u00b1 10.7 ng/mL; 17.5% of patients had a level below the limit of determination\u2014under 3 ng/mL. Poisson regression showed that there is a statistical tendency between 25-hydroxycholecalciferol concentration and burn degree (Pearson\u2019s test showed a significant correlation between body mass index (BMI), total protein, albumin, percentage of body burns, ALT, CRP, and vitamin D concentration . The mosp < 0.0001). We also performed analysis of the correlation of percentage of body burns with albumin/protein. The results are presented in As we demonstrated that total protein and albumin concentration were significantly correlated , we decided to conduct a multiple regression analysis to demonstrate that only albumin was significantly associated with vitamin D concentration  and almost 20% of them had a level below the limit of the quantification (<3 ng/mL). P\u0142udowski et al. revealed that 89.9% of the Polish population is vitamin D-deficient, with 18.0 \u00b1 9.6 ng/mL of average concentration of 25-hydroxycholecalciferol [The need of supplementation in burned patients is well known and described in many medical protocols . Unfortur = 0.42), serum albumin, (r = 0.62), percentage of body burns (r = 0.36), AST (r = 0.21), and CRP (r = 0.22). However, we did not see a significant relationship between BMI and concentration of 25-hydroxycholecalciferol, which are considered to be one of the most important factors of vitamin D deficiency in the general population [There are multiple factors that are associated with low level of circulating vitamin D. Many of them are connected with poor prognosis in critically ill patients, among others: organ failure , sepsis,pulation . We can Evaluation of the vitamin D level in burned patients is a difficult issue, related to the acute phase development, which is associated with decreased levels of vitamin D binding protein (VDBP). The amount of protein that can bind 25-hydroxycholecalciferol, significantly decreases, and the tested \u201cfree amount\u201d of the active form can be falsified. Reduced protein synthesis persists for several months after burns; therefore, the results obtained can be false . Howeverr = 0.62) and the multiple regression confirm that thesis. A majority (85\u201390%) of 25-hydroxycholecalciferol D is bound to VDBP and 10\u201315% to albumin [Our study reveals that serum protein level, mostly albumin, strongly correlated  with ser albumin . We can  albumin . However albumin .Burn injuries have an enormous impact on the metabolism in burned patients. On the other hand, the risk factors of deficiency for the general population  have a negligible effect on burned patients. Our study shows that the concentration of 25-hydroxycholecalciferol is strongly correlated with serum albumin levels, even more than TBSA and burn degrees, as expected. Albumin can be a good predictor of vitamin D status, especially since the concentration of 25-hydroxycholecalciferol is not measured in standard analysis during admission to hospital. We presume that this direction of vitamin D diagnostic should be tested in randomized clinical trials."}
{"text": "Chamelea gallina) is an important economic resource in the Mediterranean Basin; this species has exhibited a strong quantitative decline in the Adriatic Sea. The aim of this work was to provide a comprehensive view of the biological status of C. gallina to elucidate the bioecological characteristics and genetic diversity of wild populations. To the best of our knowledge, this investigation is the first to perform a multidisciplinary study on C. gallina based on two omics approaches integrated with histological, ecotoxicological, and chemical analyses and with the assessment of environmental parameters. The results obtained through RNA sequencing indicated that the striped venus has a notable ability to adapt to different environmental conditions. Moreover, the stock reduction exhibited by this species in the last 2\u00a0decades seems not to have negatively affected its genetic diversity. Indeed, the high level of genetic diversity that emerged from our ddRAD dataset analyses is ascribable to the high larval dispersal rate, which might have played a \u201ccompensatory role\u201d on local fluctuations, conferring to this species a good adaptive potential to face the environmental perturbations. These findings may facilitate the efforts of conservation biologists to adopt ad hoc management plans for this fishery resource.The striped venus ( Commercially important marine species are frequently threatened by the effects of environmental changes, pollution, microbiological diseases, and overfishing, which may cause reductions in the size and genetic diversity of wild populations.1. The integration of data obtained from different omics approaches with ecotoxicological and environmental assessments has the advantage of creating a more holistic understanding of species, enabling researchers to develop specific tools to implement long-term management plans2.The development of omics sciences provides a remarkable contribution to species conservation biology, significantly increasing the ability of researchers to obtain insights into the molecular mechanisms adopted by species to cope environmental changeChamelea gallina  is a mollusk species that is of considerable importance, both economically and ecologically. This bivalve, which belongs to the Veneridae family, is widely distributed along the eastern Atlantic coast, ranging from, Norway and the British Isles to the Iberian Peninsula, Morocco, the Madeira Islands and the Canary Islands3. This species is also observed in the Black Sea, Mediterranean waters4 and particular in the Adriatic Sea5. C. gallina is a gonochoristic species with a long spawning period, extending from April to August, in which egg emission takes place at intervals12. In the Adriatic Sea, the fishery of C. gallina represents one of the most important resources with approximately 15,000\u00a0t reported for the year 201813, involving 670 fisheries with an annual turnover of approximately 100 million euros. For the Black Sea, the highest yield is reported in Turkey with approximately 40,000\u00a0t of annual catches10. C. gallina, similar to other marine bivalves, is also important in ecosystems, impacting nutrient cycling, creating and modifying habitats, and affecting food webs directly  and indirectly 14. Moreover, due to their filter-feeding abilities and their sessile mode of life, these bivalves play important roles as biosensors for pollution and other environmental changes in coastal waters, enabling the monitoring of the quality of the intertidal zones18. Several factors, including temperature variation, salinity, dissolved oxygen concentration in water and sediment23, presence of toxic substances of anthropogenic origin24, and overfishing25, might have induced a decrease in this fishery resource12.27 from approximately 35,000\u201315,000\u00a0t in the last 2\u00a0decades (FAO FishStat).In the Adriatic Sea, several mortality events due to sudden changes in the coastal environment  have strongly contributed to the decline of clam bedsC. gallina are the transcriptome published by Coppe et al.28 and gene expression analyses obtained by Milan and colleagues27, which detected differences between organisms sampled from two close sites with different local periodic mortality rates in the Italian Adriatic region of Abruzzo. Moreover, very little is known regarding the genetic substructure of C. gallina29.To date, the molecular resources available for C. gallina populations is required.Therefore, to ensure the long-term sustainability of fishery resources, further research elucidating the bioecological properties and the genetic diversity of wild 32. In particular, RNA-Seq is the favored sequencing technique to obtain knowledge on the functional response of organisms to environmental conditions. Indeed, in a multistress context, this technique enables us to depict the alteration of several genes and molecular pathways simultaneously in nonmodel organisms in response to stressful conditions35. ddRAD sequencing is one of the most powerful approaches to resolve fine-scale population structures compared with microsatellites, since ddRAD enables researchers to obtain thousands of markers37. This approach enables us to obtain a comprehensive view of genetic variability that represents a measure of the ability of species to adapt to environmental perturbations. Indeed, species showing low levels of genetic diversity are more prone to extinction. In line with these premises, this work attempted to provide, for the first time, a multidisciplinary strategy to elucidate the functional response of C. gallina to several biotic and abiotic factors and the genetic diversity level of the striped venus natural beds, as determined through RNA and ddRAD sequencing techniques. Moreover, to better contextualize the results obtained by combining omics approaches, we performed detailed histological, ecotoxicological, and chemical analyses and an assessment of environmental parameters.The utilization of high-throughput sequencing techniques, such as RNA sequencing (RNA-Seq) and double digest restriction-site associated DNA sequencing (ddRAD-Seq), is acquiring increasing recognition in the conservation biology research on sensitive and economically important speciesC. gallina to continuously changing environmental conditions. Up- and downregulated genes were functionally annotated through pathway enrichment analyses for all pairwise comparisons performed in this study , energy metabolism (29 genes), environmental information processing (21 genes), protein families: genetic information processing (21 genes), and carbohydrate metabolism (15 genes). For this sampling site, genes upregulated in autumn were more closely related to genetic information processing and protein families: genetic information processing (53 genes) , genetic information processing (18 genes), environmental information processing (17 genes), and protein families: genetic information processing (16 genes) were the most common. Furthermore, another comparison was performed between the two sampling sites in both sampling periods. Concerning the genes upregulated in spring for specimens sampled in S, genetic information processing (18 genes), energy metabolism (12 genes), environmental information processing (12 genes), and carbohydrate metabolism (11 genes) were the most heavily represented, while for the upregulated genes in the SM sampling site, genes fell primarily within genetic information processing (21 genes) and energy metabolism (3 genes). An opposite pattern was observed when analyzing the enriched pathways related to the comparison between S and SM in autumn  and Silvi Marina (SM), two sites to the north and south of Monte Conero, respectively, and belonging to two distinct biogeographic sectors. Differences in gene expression levels between the two sampling sites and sampling times were assessed by performing pairwise comparisons, as reported in Supplementary Fig. In analyzing data related to functional enrichment made using KEGG for the comparison between the two sampling sites and periods Fig.\u00a0, this recellular processes included transport and catabolism, cell growth and death, cellular community (eukaryotes and prokaryotes), and cell motility.In KEGG pathway enrichment analysis, cell growth and death. In particular, the presence of the SCF complex , calmodulin, 14-3-3\u025b protein, C-Myc binding protein, Dna J subfamily member 13, and spermatogenesis associated 4 among the upregulated gametogenesis-related genes was reported. At the same time, the absence of the SCF complex within the upregulated genes in functional enrichment analyses of the autumnal period at the S site was strongly in keeping with histological analyses showing gonadal inactivity  and carbohydrate metabolism (15 entries), while in autumn, only 1 entry was in carbohydrate metabolism, and no entries were in energy metabolism.  than those sampled in autumn when a decrease was observed at SM compared to S Fig.\u00a0A. The lyThe activity of acetylcholinesterase (AChE), as measured with a hemocytes, showed a nonsignificant increase in autumn compared to spring at both sites Fig.\u00a0C.A significant difference in metallothionein content in the digestive glands was observed in clams collected at SM in spring compared to the values detected in the other sampling groups Fig.\u00a0D.Antioxidants, measured in the digestive glands, showed fluctuations primarily related to the season. A slight increase was observed for CAT activity in autumn compared to spring, independent of the sampling site Fig.\u00a0E. The clThe bioaccumulation analyses in clam tissues revealed limited variations in the different analyzed parameters , with the measured levels being similar to those typically observed in organisms from reference areas  between the two sampling stations in terms of seasonal temperature  for salinity in all seasons and for chlorophyll concentration in winter, spring and autumn. It can also be noted  were de novo assembled and filtered by Stacks2.4 algorithms. Only ca. three hundred loci found a match in the GenBank nt database (1e\u221204), primarily with sequences identified as Bivalvia Figure . After fSea Fig.\u00a0E\u2013H. In aSea Fig.\u00a0; the aveion Fig.\u00a0. Even ifThe striped venus is an important economic resource in the Mediterranean Basin. However, it is known that in the Adriatic Sea, this species experienced a quantitative decline, and several factors have been suggested to be responsible for the reduction of natural clam beds.C. gallina in relation to several biotic and abiotic factors, and ddRAD sequencing was employed to assess if the genetic diversity level was enough to ensure the adaptive potential of the species to cope environmental perturbations to which it is continuously subjected. Moreover, ecotoxicological and chemical analyses, assessment of environmental parameters, and histological observations were performed to better contextualize the obtained data.In this study, for the first time, we employed two omics approaches based on high-throughput sequencing, the integration of which may be able to provide a comprehensive view of the biological status of the striped venus: RNA sequencing was performed to obtain information on the functional status of 43. The promontory at this location influences water circulation patterns and the diffusion of runoff waters coming from the main northern Adriatic river (the Po River). The functional enrichment analyses on the DEGs obtained from the performed comparisons demonstrated a different representation of some pathways between specimens of the two sites and within the same site between specimens of the two sampling periods  proteins, which are necessary for the progression of meiosis I and II, respectively44. Another upregulated gene identified in the same pathway was calmodulin, a mediator of cell cycle progression from meiosis I to meiosis II. In addition, 14-3-3\u025b protein was found among the upregulated genes. This biomolecule belongs to a highly conserved protein family that is involved in a wide range of roles in cellular processes in all eukaryotes45, including the control of the cell cycle and the regulation of apoptosis46. Interestingly, the schematic representation of the oocyte meiosis-enriched pathway shows the 14-3-3\u025b isotype in its dissociated form, essential for the progression of meiosis I. Indeed, the 14-3-3\u025b isotype binds the cell division cycle 25C (CDC25C) protein, thereby preventing cell cycle progression47.Of significant interest was the presence of the 48, such as C-Myc binding protein, DnaJ subfamily member 13, and spermatogenesis associated 4, were observed. All these findings suggest a timeline discrepancy in gonadal development in SM specimens compared to those collected at the S sampling site.Among the upregulated genes of sampling site S in the spring period and in SM in the autumnal period, male-specific genes involved in bivalve species gametogenesis49 have affirmed that a low value for this index may be the consequence of an intense biological effort that might be due to the gamete production process of the clams in this study.These observations were consistent with histological analyses, showing ongoing gametogenesis in SM specimens collected in the autumnal period in contrast to S clams. This finding is also in line with values observed for the Condition Index, a general indicator of the physiological status of organisms. In our case, lower values were recorded for specimens collected in the sampling site of SM in autumn. Lucas and Beninger (1985)50 reported an increase in the metabolic rate of animals, which was strictly related to glycolysis. In mollusks, an upregulation of the glycolytic pathway has been described during thermal acclimation in providing additional energy resources52. However, in our case study, the absence of substantial variations regarding surface water temperature enabled us to exclude the possibility that differences in metabolic rates observed between specimens of SM and S might be related to this type of environmental stressor. Therefore, variations in metabolic rates for C. gallina might be linked to the values observed for phytoplankton availability and, consequently, to food intake that could, in turn, have influenced the reproductive state in an opportunistic species.Artigaud and colleagues in 201538 reported that in Portugal, gametogenesis in C. gallina occurs at the same time as the increase in food availability and is able to provide energy useful for this process54. Moreover, recent results38 challenge the canonical evidence reported for the reproductive cycle of C. gallina, in which two peaks of gamete emission in April and October were described9. Indeed, analyses performed on natural populations of C. gallina living in the Gulf of Cad\u00edz, as reported by Delgado and colleagues11, demonstrated a long reproductive period between March and September with a recovery of gametogenesis in November related to the high peak of chlorophyll-a availability observed in October. In addition, an intragonadal and interindividual asynchrony has been reported for the striped venus. These observations are in keeping with the timeline discrepancy in the reproduction of C. gallina specimens between the S and SM sites. This timeline incongruence might be consistent with two possible scenarios: gametogenesis in SM clams is delayed and thus covers a shifted forward period compared to S specimens; either SM clams experienced an additional peak of gamete emission in the autumnal period. Ecotoxicological and chemical analyses supported our interpretation of transcriptomic data. Although it is known that cellular responses can be affected by environmental contaminants, the determination of chemical parameters in the clam tissues enabled us to exclude pollutants as possibly causes of observed variations in both transcriptomics and in biomarker responses. Indeed, detected bioaccumulation values were below regulatory limits for bivalve mollusks (where present) and similar to those found in C. gallina inhabiting nonpolluted areas 55.In 2014, Joaquim and coworkers58. The results obtained in the present study highlighted that in C. gallina, the biological responses utilized as biomarkers were modulated by biotic and abiotic seasonal factors, including salinity, temperature, food availability and reproductive status, confirming again the influence of these factors on biomarker modulation in sentinel marine species60. In particular, in S clams, the higher levels of glutathione and of the activities of all glutathione-dependent antioxidant enzymes  in the spring period can be related to an increased metabolic rate, as also indicated by the upregulation of energy metabolism genes, the higher phytoplankton availability and the active gonadic status. In contrast, only small variations in biological responses  were observed in SM clams between spring and autumn seasons, although a certain difference was observed at the transcriptomic level (upregulation of energy metabolism genes in autumn). This finding could be interpreted as an indication that transcriptional responses occur earlier, and they are translated into a functional effect later.It is known for several bivalve species that biological parameters undergo seasonal variations in natural populations not exposed to contaminated conditions; hence, the differences shown from biomarker analyses in marine organisms employed as bioindicators of environmental quality might be related to a different physiological stateC. gallina in the last 2\u00a0decades did not negatively affect the genetic variability and, consequently, its ability to respond to modified environments.The findings discussed to this point indicate an intriguing ability of the striped venus to adapt to different environmental conditions. It is known that the adaptive potential of species to cope environmental perturbations is positively correlated with genetic diversity. Therefore, the assessment of the genetic diversity level of the striped venus natural beds has been performed to confirm that the quantitative decline experienced by 63 and in species with higher adult dispersal rates, such as squid and cuttlefish64. Moreover, the FST between Adriatic  and Tyrrhenian localities is high compared to the differentiation recorded in the Mediterranean Basin for other marine mollusks, such as the wedge clam65, the octopus67 and the bivalve Pecten jacobaeus37, or more mobile fish species70.The results showed that striped venus individuals sampled at five different localities in the Adriatic Sea, spanning over 600\u00a0km  to SM), are all part of a largely panmictic population Fig.\u00a0, as also73. Genetic interconnection due to larval dispersion between Adriatic sites represents a fundamental counterforce against local population size decline, thereby increasing the ability of population persistence74. Larval dispersion seems to have played a less important role due to the species\u2019 limited and patchy distribution along the Italian Tyrrhenian coast and to the separation from the Adriatic population. Accurate comparisons on diversity and structure are, however, limited because of the scarcity of genomic studies in Mediterranean marine invertebrates75.The high genetic diversity recorded together with the existence of a unique population in the Adriatic Sea confers to this species a higher responsiveness to local environmental perturbations , as reported for invertebrate marine species76, our demographic reconstruction showed no signature of recent decline in the Adriatic population size , a circular current of the upper water masses represents a possible constraint of C. gallina pelagic larval migration, enabling the isolation of the Adriatic one from the other Mediterranean populations. This situation has also been observed in other marine species69. The cause of the differentiation of the Adriatic C. gallina population from that of the Tyrrhenian Sea might also be attributed to the geodynamic evolution of the Mediterranean Basin. The oldest fossil records of the venus clam date to the Oligocene80 and the Messinian Stage in the late Miocene. Most likely, the deep biota underwent extinction, while the shallow-water biota may have survived this drastic event84.Moreover, genetic structure in sessile marine organisms is expected to be related to the length and dispersal capacity of the larval stageC. gallina specimens collected in two different sites of the Italian middle Adriatic coast showed a substantial temporal difference in gonadal development and gamete emission. This characteristic is likely due to the \u201copportunistic\u201d behavior of C. gallina, which is able to exploit local fluctuations in nutrient availability. Ecotoxicological and chemical investigations excluded the effects of pollution and anthropic factors, suggesting a good healthy status of the striped venus. The high genetic diversity level that emerged from our ddRAD dataset analyses suggests that stock reduction has not negatively affected C. gallina natural beds. Indeed, the high larval dispersal rate might have played a \u201ccompensatory role\u201d on local fluctuations, conferring a good adaptive potential of this species to face the environmental perturbations to which it is continuously subjected.This study provides a multidisciplinary approach that is able to provide an exhaustive view of the biological status of striped venus. Comparisons of transcriptomic and histological data between conditio sine qua non in the field of conservation biology to adopt ad hoc management plans of fishery resources, which may also result in positive effects on the fishing economy.Therefore, elucidating the bioecological properties and the genetic diversity of wild populations is a This study was conducted on invertebrates (molluscs), not subjected to specific permissions since the sampling area is not privately owned or protected and did not involve endangered or protected species.Chamelea gallina of similar size and weight  were collected by hydraulic dredge, in different sites and periods.Clams For population genetics analyses, 155 specimens were sampled from five sites  were frozen in liquid nitrogen and stored at \u2212\u200980\u00a0\u00b0C for ecotoxicological analyses (biomarkers); 3 pools of whole tissues (50 organisms per pool) were collected for chemical analyses of bioaccumulation.Concerning transcriptomic, ecotoxicological, chemical, and histological analyses, specimens of the two sampling sites, S and SM, were collected in late spring and autumn 2018. In particular, for transcriptomic analyses, three pools of digestive glands dissected from 10 specimens were analysed for each sampling site and period; for histological analyses 20 specimens for each sampling site were examined to determine the stage of gonadal development. Ecotoxicological and chemical analyses required a total of 235 specimens for each sampling group: whole tissue was collected from 30 individuals for the calculation of Condition Index (CI\u2009=\u2009[dry tissue weight (g)/dry shell weight (g)]\u2009\u00d7\u2009100)https://igatechnology.com) where TruSeq Stranded mRNA Sample Prep kit  was used for library preparation following the manufacturer\u2019s instructions, starting with 1\u00a0\u00b5g of good quality RNA (R.I.N\u2009>\u20097) as input. The poly-A mRNA was fragmented 3\u00a0min at 94\u00a0\u00b0C and every purification step was performed by using 1\u2009\u00d7\u2009Agencourt AMPure XP beads. Libraries were then processed with Illumina cBot for cluster generation on the flowcell, following the manufacturer\u2019s instructions and sequenced on 2\u2009\u00d7\u2009125\u00a0bp paired-end mode on HiSeq2500 .Total RNA was extracted using Trizol reagent  and purity and quantity were checked using Qubit 4.0 fluorometer (ThermoFisher Scientific). RNA integrity was evaluated by Agilent 2100 Bioanalyzer . RNAs were sent to IGA Technology Service  was then used to perform domain search in PFAM database v3292. Functional enrichment analysis was performed with KEGG BlastKOALA95 .Contigs obtained from comparative analyses conducted using DESeq2 were used to perform functional annotation and pathway enrichment analyses. From each comparison, genes were filtered using the Benjamini\u2013Hochberg adjusted Gonadal tissues of specimens from S and SM were histologically examined to determine the stage of gonadal development. After embedding in Killik  medium, sections of 8\u201310\u00a0\u03bcm were obtained using Leica cryostat . The histology prepared slides were stained with haematoxylin and eosin method and inspected using the optical light microscope .97; metallothioneins level98.Ecotoxicological analyses (biomarker) analyses were carried out through standardized procedures and included: Condition Index (CI) calculation; analysis of lysosomal membrane stability in the hemocytes; spectrophotometric determination of acetylcholinesterase activity in the hemolymph; spectrophotometric determination of single antioxidants  and gas-chromatographic assay of total antioxidant scavenging capacity toward peroxyl and hydroxyl radicals99.Chemical analyses of trace metals  and polycyclic aromatic hydrocarbons (PAHs), both low molecular weight  and high molecular weight  were performed on whole clam tissues by conventional procedures base on gas-chromatography with flame ionization detector, HPLC with fluorimetric detection, and atomic absorption spectrophotometryDetails of analytical procedures for both ecotoxicological and chemical analyses are given in Supplementary File p\u2009<\u20090.05, and the post hoc comparison Newman\u2013Keuls. The analyses were performed with the R software.Statistical comparison of biological parameters was performed through the analysis of variance (ANOVA) with a level of significance set at https://marine.copernicus.eu). Temperature and salinity were extracted from the Mediterranean Sea Physics Analysis and Forecast dataset100 which nowadays represents the best available estimate of the physical environment and dynamics of the whole Mediterranean Sea. Chlorophyll timeseries were extracted from the Mediterranean Sea Biogeochemistry Analysis and Forecast dataset101 which is produced by a biogeochemical fluxes model, named MedBFM, driven by physical forcing fields from the aforementioned analysis and forecast dataset. Extracted timeseries span the year 2018. Data were provided as daily means for temperature, salinity, and chlorophyll. The model grid sea-points nearest to S and SM sampling stations were chosen and data were extracted at the sea-floor level. Seasonal means of the year 2018 were calculated and further processed with the aim to check if the two sampling stations exhibit significant differences in terms of monthly and seasonal means of the parameters taken into account. The assessment was performed by applying a one-way analysis of variance (ANOVA) and a Tukey\u2019s test as post-hoc pairwise comparison. The null hypothesis stated that there were no differences in terms of temperature, salinity or chlorophyll concentration between the two sampling stations. The level of significance was set at 0.05. The software Unistat 10 was used to perform the analysis.Historical timeseries of temperature, salinity and chlorophyll concentration are taken from the output of hydrodynamics and biogeochemical models of the Mediterranean Sea, publicly available on E.U. Copernicus Marine Service Information (https://igatechnology.com) where ddRAD libraries were produced using IGATech custom protocol, with minor modifications of Peterson\u2019s and colleagues (2012)102. Libraries were constructed using SphI and HindIII restriction enzymes and sequenced with V4 chemistry paired end 125\u00a0bp mode on HiSeq2500 instrument .Total DNA extraction from foot tissue was performed for 48 individuals of each sampling site Fig.\u00a0 using DNprocess_radtags in Stacks 2.4103 with default settings. Paired-end reads from all individuals were de novo assembled using the script denovo_map.pl in the Stacks package, allowing for maximum two mismatches between stacks to call a locus within and among individuals (-M 2 and -n 2), disabling haplotype calling from secondary reads (\u2013H) and setting the maximum number of stacks at locus to 2 (\u2013max_locus_stacks). The script populations in the Stacks package was employed to discard loci found in less than 40% of individuals across all populations (\u2212\u2009R\u2009=\u20090.4) and with observed heterozygosity higher than 0.8 (\u2013max-obs-het). Before any downstream analysis, our dataset for contamination by non-endogenous DNA was tested. Blast104 was used to map the consensus sequence of each locus to nt database (downloaded on 14/09/19) applying an epsilon threshold of 1e\u221204. Blast results were taxonomically summarized using MEGAN105  was run, selecting only loci with less than 45 SNPs (918 loci), selecting individuals with less than 25% missing data , and the combination of both filters .The scripts fineRADstructure using a custom python script  was calculated in each of the two populations inferred by 108, a model-free method to infer the variation in past coalescent rate within a population through the maximization of the composite likelihood of the site frequency spectrum. The total number of observed sites was calculated as the number of loci times an average locus length of 230\u00a0bp and all bins of the SFS were used given the high confidence in heterozygous sites calling due to the high coverage per locus. As mutation rate is not known in this species, time and population size of the demographic reconstruction are given as scaled by the mutation rate.To separately infer the past demographic histories of the two populations, we used the SFS as calculated before in Stairway PlotSupplementary Information 1.Supplementary Information 2.Supplementary Information 3.Supplementary Information 4.Supplementary Information 5.Supplementary Information 6.Supplementary Information 7.Supplementary Information 8.Supplementary Information 9.Supplementary Information 10.Supplementary Information 11.Supplementary Information 12.Supplementary Information 13."}
{"text": "Background: Factors related to the wellness of taxi drivers are important for identifying high-risk drivers based on human factors. The purpose of this study is to predict high-risk taxi drivers based on a deep learning method by identifying the wellness of a driver, which reflects the personal characteristics of the driver. Methods: In-depth interviews with taxi drivers are conducted to collect wellness data. The priorities of factors affecting the severity of accidents are derived through a random forest model. In addition, based on the derived priority of variables, various combinations of inputs are set as scenarios and optimal artificial neural network models are derived for each scenario. Finally, the model with the best performance for predicting high-risk taxi drivers is selected based on three criteria. Results: A model with variables up to the 16th priority as inputs is selected as the best model; this has a classification accuracy of 86% and an F1-score of 0.77. Conclusions: The wellness-based model for predicting high-risk taxi drivers presented in this study can be used for developing a taxi driver management system. In addition, it is expected to be useful when establishing customized traffic safety improvement measures for commercial vehicle drivers. The number of deaths from traffic accidents is decreasing. However, according to the data on the reduction rate of deaths in traffic accidents by vehicle type in the last 10 years, the reduction rate of noncommercial vehicles was 39%, while that of commercial vehicles was 31% ,3. AccorAlthough there have been various efforts to improve the quality of life and working environments of taxi drivers, continuous management plans for taxi drivers to reduce accidents are still insufficient. As human factors account for about 94% of the major reasons of traffic accidents, it is essential to understand and manage drivers\u2019 intrinsic factors to reduce traffic accidents . TherefoThe purpose of this study is to predict high-risk taxi drivers based on a deep learning method using wellness data. This study consists of Stage 0 through Stage 3. Stage 0 is the data construction phase. In this phase, in-depth interviews are conducted to identify the wellness of commercial vehicle drivers, and this wellness data is matched with an accident dataset collected from the commercial vehicle driver management system operated by the Korea Transport Safety Authority (KOTSA). In Stage 1, the priority of factors affecting the severity of accidents is defined, and the random forest analysis is applied as the methodology. Stage 2 involves constructing an optimized model based on an artificial neural network (ANN), which classifies the severity level of an accident. In this phase, by using the priority of variables derived from Stage 1, combinations of input data are set as scenarios, and optimized classifiers for each scenario are derived. Stage 3 aims to choose an optimized model for predicting high-risk taxi drivers. In this phase, the selection criteria for the optimized model are established and applied. This derived model is expected to be useful in determining high-risk taxi drivers. With the model, it should be possible to support customized consulting systems for commercial vehicle drivers and manage wellness factors that are highly related to accidents. This study can be used to induce active improvements in traffic safety through drivers\u2019 self-diagnosis and feedback.The rest of this paper is organized as follows. In this study, a deep learning method is applied to predict high-risk taxi drivers through driver wellness evaluation, and the process of the study is presented in As of July 2020, there were 254,490 taxi drivers in Korea, of which 89,650, or 35%, belonged to taxi companies. Moreover, private taxi drivers account for 65% of taxi drivers, and ride-hailing services such as Uber do not operate in Korea. In Stage 0, to identify the wellness of taxi drivers, in-depth interviews were conducted by a professional investigator. In the in-depth interviews, professional investigators were matched one-to-one to increase the reliability of the data. The subjects of the in-depth interviews were drivers belonging to taxi companies; these drivers caused serious traffic accidents from the third quarter of 2018 to the second quarter of 2019. Drivers belonging to taxi companies  were selected as the subject of the survey because corporate taxi companies in which serious accidents occurred are obligated to undergo safety inspections and have high access to investigations. Interviews were conducted with 993 drivers at 89 taxi companies from September to October 2019. The survey items consist of 246 variables, including wellness, the characteristics of the driver, and company data. The 20 wellness variables related to traffic safety were selected based on the literature review presented in The investigation items consist of 20 categories related to wellness and traffic safety, which were collected through the interviews, and one accident characteristic factor, which was collected through the commercial vehicle driver management system. The items and scale of the survey are presented in In order to analyze the accident characteristics of the interviewed taxi drivers, we used the dataset of the number of casualties per traffic accident from August 2016 to July 2019; this was obtained from the commercial vehicle driver management system. Accident data were also considered only when the taxi driver was the perpetrator. Among the 993 interviewed drivers, accident data were collected for 781 drivers. From the collected data, the accident severity is classified into three levels based on the severity of the accident, and this is defined as the risk level of accident severity. High-risk (class 3) refers to a driver who has experienced more than a serious injury, medium-risk (class 2) refers to a driver who has experienced a minor injury, and low-risk (class 1) refers to a driver with no accident experience. The numbers of drivers for the different risk levels of accident severity are 66, 164, and 551, respectively.k, is calculated using Equation (1).The random forest model is an ensemble machine learning technique, and it uses an advanced decision tree analysis methodology to overcome the drawbacks of decision tree analysis . In the i is an indicator function that is set as 1 when the value in the parentheses is true and set to 0 when the value is false. Additionally, jt means the jth decision tree in the generated decision tree (t).Here, iOOB is a group of decision trees that is not used in the learning process, by bagging as an observed attribute. If a set of decision trees does not include i) is j, that is,  pk^(xi) . The ver pk^(xi) ,27. Thisif is the ratio of classifying i to the i category correctly, and 1 \u2212 if is the ratio of classifying i to another category. If the model perfectly classifies every category, if is 1 and the value of the GI index becomes 0. A higher MDG value for a particular variable indicates that this value is suitable for correct classification of a certain category, meaning that it decreases the degree of impurity. The MDG value varies from 0 to 100. When an MDG value of one variable is 0, the variable will not be used for classification. However, if the MDG is closer to 100, the observation can be completely classified by the variable.Here, An ANN is a data processing system resulting from the mathematical modeling of the learning process inspired by humans. It consists of an input layer that accepts input data, a hidden layer that processes input values and produces the result, and an output layer that calculates an output value . Each laThe pattern recognition network applied in this study is a feed-forward network, which can be trained to classify inputs according to the classes of outputs. The feed-forward network is a method in which the signal from the input layer is forwarded to the hidden layer and the signal from the hidden layer is forwarded to the output layer. The hyperparameters that need to be optimized in neural networks are the number of hidden layers and neurons, as well as the transfer function that calculates the output value of the neurons. The descriptions of each hyperparameter are shown in x that maximizes the objective function f(x). This is defined as shown in Equation (3) [x*: Optimized hyperparametersx: Hyperparameterf(x): Correct classification rate (CCR) of the models.For neural network optimization, some studies have applied the Bayesian optimization method, which effectively solves the global optimization problem ,32,33. Btion (3) . This stf(x). This process is outlined as follows: (i) With the assumption that f(x) follows the Gaussian process (GP) prior, learn the model by using the given data D, and (iii) include the data point D that has the largest acquisition function value. The acquisition function is a measure used to find the global optimum, which is the hyperparameter affecting the maximum classification accuracy. In this study, the expected improvement (EI) function is selected as the acquisition function. EI minimizes the error of the predicted f(x), and it is defined as shown in Equation (4) [G)z: Normal cumulative distribution function(g)z: Probability density function for z.(Bayesian optimization constructs a probabilistic model for tion (4) ,35,36,37tion (4) ,39,40. The F1-score is 0.77 or higher.Criterion (2) The classification accuracies of each class are 53% or higher.Criterion (3) Scenarios that satisfy criteria 1 and 2, with fewer input variables.From Stage 2, it is confirmed that the performances of the ANN model in each scenario are different. Therefore, in Stage 3, three criteria are designed to select the best model, as follows. Criterion 1 is based on the F1-score, and the 75th percentile value of 0.77 is set as the threshold for satisfying this criterion. Through criterion 1, a model considering the prediction performances of all classes can be determined. However, as the F1-score of the model is highly influenced by the classification accuracy of Class 1 (low-risk) with a large number of samples, criterion 1 is limited in that it does not accurately reflect the classification accuracy of Classes 2 (medium-risk) and 3 (high-risk). In order to address the limitation of criterion 1, the classification accuracies of the three classes are checked as the second criterion. In criterion 2, 53% is defined as the threshold, which is the 75th percentile value of the classification accuracy for Class 3, which shows the lowest average accuracy value. If the classification accuracies of each class are 53% or more, criterion 2 is satisfied. Finally, criterion 3 determines whether the model can show a similar performance with the minimum dataset. In this study, to expand and easily use the classification results in the future, it is expected that a model working with a minimal data collection would be practical. Accordingly, in criterion 3, models satisfying criteria 1 and 2 show similar performance. When the performances of the models are similar, the model with the smaller number of input variables is determined as the better model. A summary of these three criteria is shown below, and the models that satisfy these criteria are shown in As a result of selecting the best model according to the three criteria mentioned above, the model with 16 input variables is selected as the best model. Effective traffic accident prevention is possible when taxi drivers\u2019 working environment, life patterns, and active management of health characteristics, and the degree of interest in taxi companies\u2019 driver management, are improved. The analysis results of this study will be used as basic data to improve the effect of preventing traffic accidents in commercial vehicles. For example, the traffic safety manager of a taxi company may investigate 16 items derived from the analysis results of a taxi driver\u2019s traffic-safety survey. It is possible to perform customized traffic safety consulting for taxi drivers using the factors derived from the best model. Taxis account for the largest share at 40.1% of the traffic accidents in commercial vehicles. Moreover, the reduction rate of deaths in taxi accidents was low compared to other commercial vehicles. Therefore, efforts should be made to improve the traffic safety of taxis by preparing effective measures. Many taxi drivers are exposed to overwork due to inadequate working environments and long working hours. Therefore, a traffic safety management system for taxis based on underlying human factors is required. However, existing studies investigating the relationship between accidents and drivers have focused on physical factors and demographic characteristics, such as accident sites and vehicle factors. Few studies have looked into intrinsic aspects of the drivers.This study develops a risk level of accident severity classifiers to predict high-risk taxi drivers based on a deep learning method with wellness data. The study is broken into several stages. In Stage 0, wellness data are collected, including information related to drivers\u2019 working environments, living environments, and health characteristics, through in-depth interviews conducted with 993 taxi drivers. In addition, high-risk drivers are classified based on the severity of the accidents they experienced, which is derived from the accident dataset of the drivers collected from a driver management system. High-risk drivers were classified based on the severity of the accidents they experienced. In Stage 1, a random forest analysis is used to identify the priorities of factors affecting the risk level of accident severity that taxi drivers experienced. As a result, a driver\u2019s age, living satisfaction, level of job satisfaction, amount of sleeping time, and working hours per week are identified as the top five variables that have the greatest influence on the risk level of accident severity. In Stage 2, optimized ANN classifiers are derived to predict the risk level of accident severity for 16 scenarios using the priority of variables derived in Stage 1. Finally, in Stage 3, the best model for predicting high-risk taxi drivers is selected based on three criteria considering the classification accuracy, F1-score, and number of input variables. As a result, the scenario with input variables up to the 16th priority is selected as the best model; this showed a classification accuracy of 86% and an F1-score of 0.77. With the optimal model derived in this study, high-risk taxi drivers can be identified. Based on these results, it is expected that traffic safety measures can be established to reflect the wellness of individual drivers, which can be used to manage high-risk drivers.In order to increase the reliability of the high-risk taxi driver classifier developed in this study, further studies should be undertaken in the future. First, this study identifies 20 items related to the wellness of taxi drivers through an interview, but it is necessary to consider more variables that can represent wellness, such as the job-related affective well-being scale (JAWS), physical symptoms inventory (PSI), and so on. In the case of health-related variables, the reliability of data can be improved through objective data collection, such as data from medical institutions. In addition, while this study predicts the risk level of accident severity, it is also necessary to consider other variables related to traffic safety, such as the number of accidents and dangerous driving behavior. Additionally, it is necessary to consider the driving distance and the number of working days as exposure to traffic accidents. Second, it is necessary to secure the reliability of the prediction model by collecting additional data. In order to increase the accuracy of the collected data, this study applies an interview method. However, face-to-face interviews take a lot of time. Therefore, a way to collect more data while increasing the accuracy of the response is necessary in the future. Furthermore, it is necessary to predict high-risk taxi drivers with consideration for the types of taxi drivers by expanding the survey groups to individual taxi drivers. Finally, we may be able to increase the reliability of the model by considering various deep learning methods, such as k-fold validation.This study derives classifiers for predicting high-risk taxi drivers based on the driver\u2019s wellness, which goes beyond the physical factors of traffic accidents. It is expected that the results of this study can be used to prepare plans for changing the paradigm of taxi traffic safety measures based on wellness. Additionally, it is also expected that these results can be used as basic data for establishing an effective traffic safety policy."}
{"text": "More recently, we demonstrated a possibility to use thymol to overcome the resistance of a P. nodorum strain able to grow on difenoconazole-containing media. However, potential for thymol to serve as a chemosensitizing agent in seed or plant treatments, to provide an effective suppression of the above-mentioned plant pathogens by triazole fungicides applied in lowered dosages, had yet to be tested. In the work presented here, we showed combined treatments of naturally infected barley seeds with thymol and difenoconazole (Dividend\u00ae 030 FS) synergistically exacerbated the protective effect against common root rot agent, B. sorokiniana, and other fungi (Fusarium spp. and Alternaria spp.). Similarly, co-applied treatment of wheat seeds, artificially inoculated with Fusarium culmorum, resulted in equivalent reduction of disease incidence on barley seedlings as application of Dividend\u00ae, alone, at a ten-fold higher dosage. In foliar treatments of wheat seedlings, thymol combined with Folicur\u00ae 250 EC (a.i. tebuconazole) enhanced sensitivity of P. nodorum, a glume/leaf blotch pathogen, to the fungicide and provided a significant mitigation of disease severity on treated seedlings, compared to controls, without increasing Folicur\u00ae dosages. Folicur\u00ae co-applied with thymol was also significantly more effective against a strain of P. nodorum tolerant to Folicur\u00ae alone. No additional deoxynivalenol or zearalenone production was found when a toxigenic F. culmorum was cultured in a nutrient medium containing thymol at a concentration used for chemosensitization of root rot agents. Accordingly, F. culmorum exposure to thymol at the sensitizing concentration did not up-regulate key genes associated with the biosynthesis of trichothecene or polyketide mycotoxins in this pathogen. Further studies using field trials are necessary to determine if thymol-triazole co-applications result in sensitization of seed- and foliar-associated plant pathogenic fungi, and if thymol affects production of fusarial toxins under field conditions.Thymol, a secondary plant metabolite possessing antifungal and chemosensitizing activities, disrupts cell wall or membrane integrity and interferes with ergosterol biosynthesis. Thymol also functions as a redox-active compound inducing generation of reactive oxygen species and lipid peroxidation in fungal cells. Previously, we showed thymol significantly enhanced the  Redox-active secondary metabolites of various plants attract continuing interest with regard to the diversity of their biological activity . Since mAn important specific feature of a number of redox-active compounds rendering them as promising agents for control of various pathogenic microorganisms, including some plant pathogenic fungi, is their ability to induce oxidative stress in pathogens or impair fungal antioxidation systems . In addiThymus vulgaris found also in other Thymus and Lamiaceae species. Thymol attacks several cellular and metabolic targets in pathogenic fungi. It disrupts cell wall or membrane integrity and interferes with ergosterol biosynthesis (Bipolaris sorokiniana and Parastagonospora nodorum (P. nodorum strain that was able to grow on difenoconazole-containing media (\u00ae 030 FS) against B. sorokiniana, F. culmorum and also accompanying Fusarium and Alternaria species on seedlings grown from barley and wheat seeds treated with this fungicide in combination with thymol. In another experimental series, protection efficacy of wheat seedlings sprayed with thymol-combined tebuconazole (Folicur\u00ae 250 EC) against P. nodorum was assessed. We found significant synergistic augmentation of the protective effect of both difenoconazole and tebuconazole when co-applied with thymol. In addition, a possibility to control a tebuconazole-tolerant P. nodorum mutant strain by co-application of thymol with Folicur\u00ae was showed. We also analyzed deoxynivalenol (DON) and zearalenone (ZEN) production in a toxigenic F. culmorum exposed to thymol and profiled expression of key genes associated with the biosynthesis of trichothecene or polyketide mycotoxins in this pathogen. These experiments demonstrated thymol at sensitizing concentrations did not stimulate DON and ZEN biosynthesis. Collectively, our findings confirm the promise of using chemosensitizing agents as an approach to controlling fungal pathogens in agriculture and possibly contributing to development of better environmentally friendly integrated crop protection systems.The damaging and regulatory effects of redox-active molecules are realized through their interaction with lipids, proteins and DNA. These molecules cause lipid peroxidation, oxidative injury of the cell plasma membrane, protein, and DNA oxidation, as well as nitrosylation and S-glutathionylation of proteins . Thymol ynthesis . Thymol ynthesis . Earlier nodorum . Recentlng media . HoweverFusarium culmorum (OR-02-37) and Parastagonospora nodorum (B-9/47) pathogenic to wheat were provided by the State Collection of Plant Pathogenic Microorganisms at the All-Russian Research Institute of Phytopathology (ARRIP) and the ARRIP Department of Mycology, respectively. F. culmorum stock cultures of the fungi maintained on potato dextrose agar slants were resumed by culturing for 10\u201314 days in Petri plates on the same medium to obtain spore-producing colonies. Suspensions of fungal conidia for inoculations of wheat seeds with F. culmorum and detached wheat leaves with P. nodorum were prepared according to Strains of Bipolaris sorokiniana, a common root rot agent, were collected from plants grown on the ARRIP experimental plots.Samples of barley grain naturally infected with \u00ae 030 FS  and Folicur\u00ae 250 EC , which are commonly applied for seed and foliar treatments of various crops, including cereals.Since thymol (CAS 89-83-8) is slightly soluble in water, solutions of 99% commercial thymol  in dimethyl sulfoxide, (CAS 67-68-5) 99.9%  were used for seed and leaf treatments. Commercial fungicides tested included DividendTo select non-phytotoxic dimethyl sulfoxide (DMSO) and thymol concentrations, spring wheat (cv. Zlata) and barley (cv. Zazersky 85) seeds (200 seeds per each treatment) were soaked overnight in aqueous 0.5, 1.0, or 10% DMSO or in thymol dissolved in the DMSO solutions to final concentrations 10, 100, or 1000 ppm. After such treatments seeds were placed on paper towels , which were rolled-up and put into beakers with distillated water. Plants were grown at 22\u00b0C (day) and 16\u00b0C (night), 60% relative humidity and 16-h light period for 7 days. Seeds treated with distillated water were used as controls. The number of germinated seeds, number of seedlings and their length were recorded after 7 days of plant growth.B. sorokiniana and wheat seeds artificially inoculated with F. culmorum were treated by a 3-h agitation in a minimal volume of aqueous Dividend\u00ae 030 FS allowing complete seed wetting. This was followed by 16\u201318 h incubation with the fungicide formulation at room temperature, without agitation. Prior to treatment with the fungicide, wheat seeds were disinfected  at slow stirring, and then slightly dried. The highest difenoconazole concentration (500 ppm) used for fungicidal treatments of barley and wheat grain samples corresponded to Dividend\u00ae 030 FS dose rate recommended for agricultural practice  were tested. After these treatments, the Dividend-exposed and water-exposed (control) seeds were assayed using rolled-towel test, as described above. After 12\u201314 days post-inoculation, the number of diseased seedling were counted to evaluate root rot incidence, and disease symptoms on were roots and root necks were visually estimated according to a five-score rating scale  of common root rot and Fusarium root rot, on barley and wheat seedlings, respectively, were assayed using the rolled-towel test in parallel with the treatments with the fungicide alone. The incidence of Fusarium spp. and Alternaria spp. accompanying the predominant B. sorokiniana infection of barley seeds was also evaluated.Following the determination of sub-fungicidal DividendP. nodorum spores were suspended to a final concentration of 106 conidia/ml in 1% aqueous DMSO or thymol (from 10 to 5000 ppm) dissolved in 1% DMSO. Control conidial suspensions (106 per ml) were prepared in sterile distilled water (SDW). Eight centimeter long leaf fragments were cut from central parts of detached wheat leaves and placed in Petri plates atop of 1% water agar supplemented with benzimidazole (40 \u03bcg/ml). Aliquots (10 \u03bcl) of the conidial suspensions in DMSO or thymol solutions were dropped on upper  parts of 8-cm leaf fragments. Drops (10-\u03bcl) of conidial suspensions (106 conidia/ml) in SDW (control for DMSO-treated detached leaves) or 1% DMSO solutions (control for thymol-treated leaves) were applied to lower  parts of the same 8-cm leaf fragments. In situ disease development was recorded on 10 leaf sections per each treatment. An additional plate, in which both distal and basal locations on each of 10 leaf fragment were inoculated with pathogenic conidia in SDW, was prepared to confirm that they was able to cause the disease. Disease symptoms were scored at 5 days post-inoculation according to a five-score rating. Sub-fungicidal dosages of Folicur\u00ae 250 EC, tested at concentrations ranging from 0.05 to 0.5 ppm (based on tebuconazole) were determined using the same assay  supplemented with Folicur\u00ae alone or DMSO-dissolved thymol alone, each taken at two sub-fungicidal (0.1 and 0.25 ppm of tebuconazole) or two marginally fungitoxic (50 and 100 ppm of thymol) dosages. In parallel, another seedling series was sprayed with fungal conidia suspended in solutions of the fungicide at a concentration of 0.1 ppm combined with thymol at 50 or 100 ppm. To promote infection, pots with treated and inoculated seedlings were maintained in an inocubation chamber at 80\u201385% relative humidity and 18\u00b0C for 24 h. Thereafter plant growing was continued under above-mentioned controlled conditions for 2 weeks. The disease development was scored according to the commonly approved international James\u2019scale (Spring wheat seedlings (cv. Khakasskaya) were grown in pots  to the two-three leaf stage under controlled conditions . Young seedlings were sprayed with es\u2019scale  at 14\u201315es\u2019scale  as recomes\u2019scale .F. culmorum strains, Fc-M-01-55/3, was grown in submerged culture for 7\u20139 days at 25\u00b0\u00d1 and 220 rpm  in 250-ml shaker flasks with toxigenesis-promoting liquid Myro medium (6 conidia/ml) or by placing a piece of fungal mycelium grown on PDA into the center of the plates. Fungal cultures grown in/on thymol-free media supplemented with corresponding aliquots of 1.0% DMSO under the same conditions served as controls.To estimate production of deoxynivalenol (DON) and zearalenone (ZEN), a toxigenic o medium  suppleme2SO4 and evaporated on a rotary evaporator at 40\u00b0C. Dry residues were dissolved in a mixture of acetonitrile, methanol and water (1:1:0.75) or (1:1:4.0) used as mobile phases in RP-HPLC analyses of ZEN or DON, respectively. Aliquots (10 \u03bcL) of the prepared solutions were applied on a temperature-controlled Symmetry C18  column followed by toxin elution, using the above-mentioned mobile phases, and detected at 254 nm. Mycotoxin concentrations (\u03bcg/mg) were calculated using a calibration curve based on commercial DON and ZEN preparations , which were also added in extracts obtained from control fungal cultures as external standards. All samples were analyzed twice. The limits of detection were 0.5 (DON) and 0.2 (ZEN) ng/mg; the recovery levels averaged 81% and 77% for DON and ZEN, respectively.Upon completion of the cultivation, DON and ZEN were quantified by reverse phase HPLC using a Waters 1525 Breeze HPLC system equipped with a Waters 2487 UV detector, applying isolation procedures slightly modified from those described previously . Briefly\u00ae Plant Mini Kit  according to manufacturer\u2019s protocol. Ten microgram of total RNA were used for cDNA synthesis carried out by the MMLV RT kit .Total RNA was extracted from fungal mycelium using RNeasyTRI5 (trichodiene synthase), TRI6 (transcription factor), PKS4 and PKS13 (polyketide synthesis) were analyzed by qPCR. The translation elongation factor 1 alpha gene (TEF1\u03b1) served as a control as the most suitable housekeeping gene according to q slope method. QGene96 software was used for analyzing the qPCR results.Expression levels of the following four genes responsible for different steps of trichothecene and polyketide biosynthesis were quantified by qPCR: t-test for independent variables at p \u2264 0.05. Experiments involving spraying of wheat seedlings (100\u2013120 ones for each treatment) or assessment of Alternaria incidence on barley seeds were replicated four times. Other experiments were run in triplicate. Each independent experiment with barley or wheat gain included 200 seeds per treatment.Data obtained in the experiments involving seed treatments and spraying of wheat seedlings were analyzed using a STATISTICA 6.1 software (StatSoft Inc.). Mean values, standard deviations and standard errors were calculated. Significant difference between treatments and controls were determined using a Protection efficacy (PE) was calculated using formula PE% = Dc \u2013 Dt/Dc \u00d7 100, where Dc is the average incidence or disease severity in controls, while Dt represents these parameters for treated seeds or seedlings.p \u2264 0.05), was determined  \u2013 X% \u00d7 Y%/100, where X% and Y% are PE% of thymol or the fungicide.To reveal a putative synergy between thymol and tebuconazole or difenoconazole in co-applications on seeds or seedlings, the Limpel criterion, Er \u2265 Ee . These four dosages are indicated below as Dividend/1 (the highest), Dividend/05, Dividend/01, and Dividend/001, respectively. Results of roll-towel assays showed Dividend/1 and Dividend/05 were effective against common root rot infection on barley seedling, while Dividend/01 was the lowest dosage still inhibiting development of B. sorokiniana, a predominant seed pathogen, and did not affect seed germination , but no effect was found in two other ones. Compared to controls, the average incidence of Fusarium rot agents on seedlings decreased to 6.4% or 3.2% after seed treatments with Dividend/01, alone, or Dividend/01 + thymol at 50 ppm, respectively.In addition to the predominant root rot pathogen, \u00ae on artificially inoculated wheat seeds also resulted in augmentation of the suppressive activity of this triazole fungicide against F. culmorum  after application of fungicide, alone  that was lethal to a sensitive wild strain  localized in the trichothecene biosynthetic cluster and two (PKS4 and PKS13) belonging to the polyketide biosynthetic cluster. Gene expression was analyzed 2 days before the maximal accumulation of DON or ZEN in thymol-containing culture media inoculated with the pathogen. Levels of TRI5, TRI6, PKS4, and PKS13 expression were compared to those in control fungal cultures grown without thymol under the same conditions. Expression of the control gene (TEF1\u03b1) was stable in all the samples tested. Expression levels of four target genes in thymol-exposed samples were the same or slightly lower those of the control, in both submerged and agar cultures  pointing to the absence of a calculated synergism  used against a zoophilic yeast Malassezia pachydermatis  and Fusarium crown-foot-root rot, head blight (F. culmorum), and glume/leaf blotch of wheat (P. nodorum).Previously, we found thymol synergistically augmented colonies . In thisngicides . These fngicides  and caus\u00ae and Folicur\u00ae, selected for our experiments to show sensitization by thymol, were at levels that did not protect seedlings or only provided a minor protective effect, and were far lower than dosages recommended for agricultural use  in all experiments.At certain concentrations, thymol is known to be phytotoxic and was reported to inhibit seed germination and growth of some weed plants . Howeverural use , 4, 5. Rde alone , 3. Moreectively , 3. The via ROS generation with the added provocation of osmotic stress, are main mechanisms augmenting sensitivity of fungi to triazoles and other antimycotics : U22464, AY130290, MN313473-313507 (TRI5); MH514940-514957, MH001614-MH001648 (TRI5 and TRI6); AY429625, XM009259983 (PKS4), AY495638, JF966273 (PKS13); DQ019316 (PKS4 and PKS13); KY205745-205748, DQ382164-382166 (TEF1a).The primers and fluorogenic probes were designed based on the alignment of the following sequences retrieved from GenBank (LS and VD conceived the concept of the research and designed the experiments. OM, LA, and DE performed the main experiments, prepared the reagents, materials, and analysis tools. AS performed the experiments on expression of genes associated with mycotoxigenesis. LS and AS wrote the original draft and prepared the figures and tables. LS, VD, and SZ reviewed and edited the drafts of the manuscript. All authors reviewed and approved the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Myelodysplastic syndromes (MDS) like many other blood cancers is a disease of the bone marrow, in which the spongy part of the bone is not able to produce enough healthy blood cells. MDS is primarily a disease of the elderly, but it can affect people at a younger age as well. The disease arises as a result of a combination of complex processes that is thought to be primarily driven by accumulation of genetic mutations in the stem cells. However, there is an increasing evidence implicating the bone marrow environment as a fertile milieu where these mutated stem cells thrive and give rise to the disease. In this review, we have discussed the role of blood stem cells and how other cell types in the bone marrow environment interact with each other, therefore contributing to MDS. In addition, we discuss the therapeutic strategies that can be exploited to treat MDS. Myelodysplastic syndrome (MDS) are clonal haematopoietic stem cell (HSC) disorders driven by a complex combination(s) of changes within the genome that result in heterogeneity in both clinical phenotype and disease outcomes. MDS is among the most common of the haematological cancers and its incidence markedly increases with age. Currently available treatments have limited success, with <5% of patients undergoing allogeneic HSC transplantation, a procedure that offers the only possible cure. Critical contributions of the bone marrow microenvironment to the MDS have recently been investigated. Although the better understanding of the underlying biology, particularly genetics of haematopoietic stem cells, has led to better disease and risk classification; however, the role that the bone marrow microenvironment plays in the development of MDS remains largely unclear. This review provides a comprehensive overview of the latest developments in understanding the aetiology of MDS, particularly focussing on understanding how HSCs and the surrounding immune/non-immune bone marrow niche interacts together. Myelodysplastic syndrome (MDS) represents a collection of clonal haematopoietic stem cell (HSC) disorders primarily diagnosed in elderly, with a median age of diagnosis at 70 years of age. MDS is driven by a complex combination(s) of genetic changes, that results in heterogeneity in both clinical phenotype as well as the disease outcomes, with a high propensity to develop acute myeloid leukaemia (AML) ,2. SigniLike any major metropolitan city in the world, a cell teams with surrounding \u2018specialized workers\u2019 to carry out its daily operations in a highly regulated manner. Detailed reviews on the bone marrow hematopoiesis and niche have been extensively covered elsewhere ,22,23,24Bone marrow niches are also home to immune cells, such as myeloid-derived suppressor cells (MDSCs), regulatory T cells (Tregs), dendritic cells, natural killer cells, monocytes, macrophages, T-cells, B-cells and plasma cells that themselves primarily form the \u2018immuno-microenvironment\u2019 . Approxi+CD38\u2212CD45RA\u2212CD90+/CD49f+), providing the strongest evidence for the existence of Myelodysplastic syndrome-initiating cells (MDS-ICs) . I. I124]. Macrophages are another cell type that are essential component of the innate immune system and their main function is to ingest as well as degrade abnormal cells (or cellular debris), and drive inflammatory processes. Macrophages are also known to be directly regulating HSCs via CD234/CD82 (to inhibit cell cycle progression), CD169 (promote erythroblast differentiation into reticulocytes and destroy the aging erythrocyte) and VCAM-1 (HSC homing) ,130,131.MDSCs , an immature innate immune cell type, known to accumulate in cancer patients, are effector immunosuppressive cells that contribute to cancer progression ,138,139.Recent studies have identified another crucial player in immune regulation, namely FoxP3+ regulatory T cells (Tregs), that are drawing attention for their heterogeneity and noncanonical functions, such as HSC quiescence and engraftment ,144. TreAltered hematopoiesis and associated immunological changes, predominantly cytokines, in the BM milieu are hallmarks of not only MDS  but alsoRecent data have suggested that damage-associated molecular pattern (DAMP)-induced inflammation  in the BM of MDS patients can lead to the uncontrolled activation of inflammasome machinery, causing HPSC lytic cell death mediated via pyroptosis, and this can act as a pathogenetic driver of ineffective haematopoiesis in MDS . The levDeveloping treatment for patients with MDS needs a complex and personalized array of therapeutic approaches. There is a significant lack of progress for treatment options and the only FDA approved treatment that is currently been used in the clinics include the thalidomide analogue lenalidomide and the DNA methyltransferase inhibitors azacytidine and decitabine, and stem cell transplantation . All theRecently, Magrolimab, a monoclonal antibody that specifically interferes with the signal regulatory protein alpha (SIRPa) receptor present on macrophages, which is overexpressed on malignant cells, was tested in a clinical trial alongside azacytidine in high-risk MDS patients. Azacytidine increases the expression of CD47, which leads to the increased binding of magrolimab to CD47, which ultimately results in the increased phagocytosis of tumour cells by macrophages. Notably, this novel combination therapy led to high response rates (complete remission in 42%) and an acceptable toxicity  in high-Despite the initial theoretical optimism; however, results from clinical trials targeting BMME  involving AML patients have generated disappointing results. Hedgehog signalling, which is highly active in endothelial cells, has also been targeted in MDS and other leukaemia using small molecule inhibitors with limited success . FinallyAlthough recent developments in MDS HSC genetics have been instrumental in gaining knowledge of disease pathophysiology and has led to the idea of combined targeted therapies, limited understanding of how all of the components in the bone marrow interact remains a major bottleneck. There is an urgent need to understand the role of various specialized niches where these clonal HSCs reside, especially during the early stage of clonal development. The juxtaposition of malignant HSCs carrying multiple mutation(s) within various niches might have an influence on the function as well as the evolution of these clones, resulting in significant variation in the path it takes during the course of the disease. Dissecting the signalling routes that MDS clonal HSCs use to either remodel its environment and directly or indirectly suppress their normal cohabitating HSCs will be of great therapeutic potential. Furthermore, it shall be of future interest to delineate the interaction between the HSC disease and \u2018inflammaging\u2019 bone marrow memory. Gaining an understanding of how intrinsic and extrinsic inflammation factors contribute to HSC aging and the development of hematological cancers, in general, might provide novel therapeutic options that can be potentially used alongside existing treatments."}
{"text": "The expeditious and world pandemic viral disease of new coronavirus (SARS-CoV-2) has formed a prompt urgency to discover auspicious target-based ligand for the treatment of COVID-19. Symptoms of novel coronavirus disease (COVID-19) typically include dry cough, fever, and shortness of breath. Recent studies on many COVID-19 patients in Italy and the United Kingdom found increasing anosmia and ageusia among the COVID-19-infected patients. SARS-CoV-2 possibly infects neurons in the nasal passage and disrupts the senses of smell and taste, like other coronaviruses, such as SARS-CoV and MERS-CoV that could target the central nervous system. Developing a drug based on the T2Rs might be of better understanding and worth finding better molecules to act against COVID-19. In this research, we have taken a taste receptor agonist molecule to find a better core molecule that may act as the best resource to design a drug or corresponding derivatives. Based on the computational docking studies, the antibiotic tobramycin showed the best interaction against 6LU7 COVID-19 main protease. Aromatic carbonyl functional groups of the molecule established intermolecular hydrogen bonding interaction with GLN189 amino acid and it showed the two strongest carbonyl interactions with receptor protein resulting in a glide score of \u221211.159. To conclude, depending on the molecular recognition of the GPCR proteins, the agonist molecule can be recognized to represent the cell secondary mechanism; thus, it provides enough confidence to design a suitable molecule based on the tobramycin drug. A new strain of single-stranded RNA virus, belonging to the Coronoviridae family, brought the world to a halt, presenting 2020 with the coronavirus pandemic. HCoV-229E, HCoV-OC43, SARS-CoV or SARS-CoV-1, SARS-CoV-2, MERS-CoV (Middle East respiratory syndrome coronavirus), HCoV-NL63, and HCoV-HKU1 are seven members known (to date) to be part of the coronavirus family . The entHowever, studies have already demonstrated that bitter taste receptors have a significant correlation with COVID-19 infection . Barham Unfortunately, drug designing and drug development initiatives to fight against COVID-19 involves several challenges. Despite the urgency of effective drug designing, the processes involved in this regard are quite lengthy and complicated. Frequent mutation in the viral genome is one of the major challenges in such drug designing. The pace at which the SARS-CoV-2 is mutating cannot be made sense by concurrent scientific understanding . Such muHowever, considering the corresponding drug development-related challenges and association of bitter taste receptors with SARS-CoV-2, this study aims to predict a suitable structure for a drug molecule that may have suitable molecular recognition with GPCR proteins.The study used Schr\u00f6dinger docking software to seek core molecules that can efficiently inhibit the pathway of COVID-19 pathogen as it invades cellular membranes, spreading within the body. For T2R, a mechanism that was experimentally validated was used . The docNeutrophils, monocytes, and lymphocytes can express bitter taste receptors (T2Rs), being involved in immune response , and wasAnalysis revealed that among all the different molecules, tobramycin has strong interactions between the aromatic carbonyl functional groups and GLN189 amino acid. Two strong carbonyl interactions with receptor protein had a glide score of \u221211.159, making the drug tobramycin a potential model to design drug molecules or create drug derivatives. The drug azithromycin demonstrated two side chain bonding (between aromatic carbonyl groups and LEU141 and GLY143), along with the presence of a hydrogen bond (GLU166 and carbonyl group) . The docOther drugs and molecular complexes tested, such as diphenhydramine, levofloxacin, HHQ, 3-oxo-C12-HSL, cromolyn, and C8-HSL, respectively, also contained side chain, backbone, and hydrogen bonding interactions. However, the total number of bonding interactions was relatively less than that in tobramycin. Although the drugs had the same binding pocket with different secondary interactions depending on their orientation, the drug tobramycin is speculated to be promising to design a molecule based on its structure. Azithromycin, levofloxacin, C4-HSL, and structure-2D also showed prominent binding interaction with T2R agonist, which accounted to study the number of hit molecules, perform virtual screening, and optimize lead compounds. Studying the docking properties and drug\u2019s molecular dynamics, based on the interactions of the taste receptor and spike protein, upon modifying the complex (the drug\u2013ligand interaction) the pathway where COVID-19 invades adjacent host cells, via cytoplasmic membranes, can be altered and prevent the spread of the virus.The docking results yielded various interactions with the T2Rs agonist molecules, where some ligands were more favorable than others. The drug, tobramycin, had the highest affinity for T2Rs, followed by azithromycin. Depending on the molecular recognition, the GPCR proteins are highly recognized as the agonist molecule to represent the cell secondary mechanism to give confidence in designing a new derivative of the tobramycin drug, to biochemically inhibit the prominent spread of COVID-19."}
{"text": "Mammals are a highly diverse group, with body mass ranging from 2\u2009g to 170\u2009t, and encompassing species with terrestrial, aquatic, aerial, and subterranean lifestyles. The skeleton is involved in most aspects of vertebrate life history, but while previous macroevolutionary analyses have shown that structural, phylogenetic, and functional factors influence the gross morphology of skeletal elements, their inner structure has received comparatively little attention. Here we analysed bone structure of the humerus and mid-lumbar vertebrae across mammals and their correlations with different lifestyles and body size.We acquired bone structure parameters in appendicular and axial elements (humerus and mid-lumbar vertebra) from 190 species across therian mammals . Our sample captures all transitions to aerial, fully aquatic, and subterranean lifestyles in extant therian clades. We found that mammalian bone structure is highly disparate and we show that the investigated vertebral structure parameters mostly correlate with body size, but not lifestyle, while the opposite is true for humeral parameters. The latter also show a high degree of convergence among the clades that have acquired specialised  lifestyles.In light of phylogenetic, size, and functional factors, the distribution of each investigated structural parameter reveals patterns explaining the construction of appendicular and axial skeletal elements in mammalian species spanning most of the extant diversity of the clade in terms of body size and lifestyle. These patterns should be further investigated with analyses focused on specific lifestyle transitions that would ideally include key fossils. In the context of comparative analyses, however, it is impossible to disentangle the effect of phenotypic plasticity from evolutionary acquisitions. Furthermore, it is likely that the reaction norm  of bone structure is under selective pressure and can itself evolve \u2009~\u2009body mass [g]a, the coefficient denoting isometry would be \u2212\u20091 [x-, y-, and z-components of the eigenvector defining the main orientation of the anisotropy; Additional file\u00a0Several traits were acquired to capture the bone structure properties of the whole humerus and whole mid-lumbar vertebra (in consistency with ). Micro-J v. 1.4 ). DE wasJ v. 1.4  Fig.\u00a06)Optimise J v. 1.4 . But it J v. 1.4 . BoneJ wJ v. 1.4 . VOIs heurements , 90. We d be \u2212\u20091  from theBoth humerus and lumbar vertebrae were not available for each sampled specimen. Furthermore, some of the CT scans of Dumont et al.  only capIn order to avoid potential bias affecting bone structure, specimens were selected to be adult , devoid of apparent disease, and coming from the wild. But as marsupials and many small-sized mammals maintain unfused humeral epiphyses well into adulthood (if not throughout life), humeral epiphyses VOI parameters were not included in this analysis. Species body mass were taken from the AnAge  and MOM All data analyses were performed with R  OVAs were performed with generalised least squares linear models comprising a within-group correlation structure based on the optimised lambda value of the model\u2019s residuals  (gls fun package ). For AN package ). Variabp values <\u20090.014; see also Additional\u00a0file\u00a0p values >\u20090.194). Furthermore, the terrestrial taxa also feature a greater disparity in their sizes, their range encompassing all other lifestyles but the largest aquatic taxa. Subsets of the datasets for which the terrestrial class content was pruned to match the size and disparity of the other classes were therefore additionally examined: to compare subterranean and aerial lifestyles to the terrestrial one, the latter was pruned to 60 taxa for the humeral dataset , and to 60 and 62 taxa for the vertebral datasets ; to compare the aquatic and terrestrial lifestyles, the latter was pruned to 7 taxa for the humeral dataset, and 9 and 14 taxa for the vertebral datasets.Body mass and specimen-specific size proxies were used to test the effect of body size on the parameters. For the latter, we used mean total cross-sectional area  see aboC, as theWe investigated the effect of size and lifestyle on each studied bone structure parameters using ANCOVAs. When a significant correlation between the size proxy and the parameter under study was recovered, residuals of the corresponding regression were computed. The latter were regarded as the size-corrected version of these parameters , which wp value (convratsig function), which gives an overall assessment of how much the phenotypes of converging clades evolved towards one another [github.com//eliamson/convevol1d.We quantified the convergent acquisition of each specialised lifestyle using the framework of the convevol package  for R. F another . Because another ). ModifiTo avoid the potential influence of lifestyles, only terrestrial species were included in this analysis. Pagel\u2019s lambda  was comAdditional file 1. Additional figures 1-4.Additional file 2. Distribution of body size according to lifestyle.Additional file 3. Supplementary results. A, Specimen list; B, Descriptive statistics; C, AN(C)OVAs with body mass; D, AN(C)OVAs with specimen-specific body size proxies; Phylogenetic signal.Additional file 4. Phenograms depicting the reconstructed evolution of each trait among specialised clades.Additional file 5. Additional trabecular parameters of the vertebral centrum: a, Trabecular Thickness (Tb.Th); b, Trabecular Spacing (Tb.Sp); c, Degree of Anisotropy (DA), and d, the main direction of the trabeculae (MDT)."}
{"text": "Evidence supports several countries introducing legislation to allow cannabis-based medicine as an adjunctive treatment for the symptomatic relief of chronic pain, chemotherapy-induced nausea, spasticity in multiple sclerosis (MS), epileptic seizures, depression, and anxiety. However, clinical trial participants do not represent the entire spectrum of disease and health status seen in patients currently accessing medicinal cannabis in practice.This study aims to collect real-world data to evaluate health-related quality of life in patients prescribed medicinal cannabis oil and describe any differences over time, from before starting therapy to after 3 and 12 months of therapy.Adult patients newly prescribed medicinal cannabis oil by authorized prescribers and under the Special Access Schemes across Australia will be screened for eligibility and invited to participate. A sample size of 2142 is required, with a 3-month follow-up. All participants will complete the EuroQol 5-Dimension; European Organization for Research and Treatment of Cancer Quality of Life Questionnaire-30; Depression, Anxiety, and Stress Scale-21; Patients\u2019 Global Impression of Change; Patient-Reported Outcomes Measurement Information System (PROMIS) Short Form (SF) version 1.0: Sleep Disturbance 8b; and PROMIS SF Fatigue 13a questionnaires. Patients with chronic pain conditions will also complete the PROMIS SF version 1.0: Pain Intensity 3a and PROMIS SF version 1.0: Pain Interference 8a. Patients with movement disorders will also complete Quality of Life in Neurological Disorders (Neuro-QoL) SF version 1.0: Upper Extremity Function (Fine Motor and Activities of Daily Living) and if chorea is indicated, the Neuro-QoL SF version 2.0: Huntington\u2019s Disease health-related Quality of LIFE-Chorea 6a. All questionnaires will be administered at baseline, 2 weeks (titration), monthly up to 3 months, and then every 2 months up to 1 year.Recruitment commenced in November 2020. By June 2021, 1095 patients were screened for the study by 69 physicians in centers across 6 Australian states: Australian Capital Territory, New South Wales, Queensland, South Australia, Victoria, and Western Australia. Of the patients screened, 833 (39% of the target sample size) provided consent and completed baseline questionnaires. Results are expected to be published in 2022. Results of this study will show whether patient-reported outcomes improve in patients accessing prescribed medicinal cannabis from baseline to 3 months and whether any changes are maintained over a 12-month period. This study will also identify differences in improvements in patient-reported outcomes among patients with different chronic conditions .This protocol contains detailed methods that will be used across multiple sites in Australia. The findings from this study have the potential to be integral to treatment assessment and recommendations for patients with chronic pain and other health indicators for accessing medicinal cannabis.Australian New Zealand Clinical Trials Registry: ANZCTRN12621000063819; https://www.anzctr.org.au/Trial/Registration/TrialReview.aspx?id=380807&isReview=trueDERR1-10.2196/32327 With the first accounts of cannabis being used as medicine dating back to China in 2600 BC, its use for medicinal purposes has been recorded on nearly every continent throughout history . Many coreal-world setting may be confounded by drug-drug interactions [real-world evidence.Evidence from randomized controlled trials indicates that medicinal cannabis can reduce chronic pain -12, neurractions . This suA patient-reported outcome (PRO) is any report coming directly from patients without interpretation by physicians or others about how the patient feels in relation to a health condition and its therapy . PROs caThe Australian Therapeutic Goods Administration (TGA) currently approves Special Access Scheme (SAS) applications from health care providers who provide a clinical justification for prescribing medicinal cannabis where conventional therapies have failed . There achronic primary pain\u2014a disease in its own right such as nonspecific low-back pain\u2014or as chronic secondary pain initiated as a symptom of an underlying disease, such as cancer-related pain or neuropathic pain [Chronic pain is a widespread health issue broadly defined as pain that lasts or recurs for more than 3 months  and is chic pain . In Austhic pain . In the hic pain . In 2016hic pain .Cancer-related pain is experienced by approximately one-third of patients with cancer at diagnosis and during treatment and by approximately three-fourths of patients with advanced-stage cancer. However, 10%-15% of the patients are nonresponsive to conventional pain therapy . ResiduaNeuropathic pain, which is caused by a lesion or disease of the somatosensory nervous system , is expeThe prevalence of chronic pain increases dramatically in patients receiving palliative care ,41. A stMS is a chronic inflammatory and demyelinating neurodegenerative disorder that often involves symptoms such as spasms, tremors, pain, fatigue, bladder dysfunction, cognitive impairment, depression, and impairments in swallowing, speech, vision, and balance . In 2018Epilepsy is a chronic neurological disease characterized by 2 or more unprovoked seizures and affects approximately 50 million people worldwide . High-quPRO assessment can assist health care professionals in monitoring treatment outcomes over time from patients\u2019 perspectives. In 2020, there were no published results from a centralized PRO data collection for a large sample of patients accessing prescribed medical cannabis within Australia that covers all approved health indications using a comprehensive battery of PROMs. Participants studied under controlled clinical trial environments have not always been representative of the entire spectrum of disease and health status seen in people currently accessing medicinal cannabis in practice . TherefoA scoping review that we conducted identified the following limitations in the current evidence on PROs for medicinal cannabis:Very few studies have collected PRO data longitudinally, including baseline, maintenance, and long-term use data .A large proportion of cannabinoid research was focused on pharmacokinetic, animal, and preclinical studies.Many cannabinoid clinical studies include case studies  or have Early studies did not use the currently recommended individualized dosing titration paradigm of starting low and gradually escalating to achieve optimal effects .Formulations studied may not reflect current commercially available cannabinoid products .Many PROMs used have limited validity in the health conditions assessed .Very few clinical studies used comprehensive pain assessments.Therefore, the real-world collection of a comprehensive suite of PROs in a large sample of people across all health conditions, as approved by the TGA, accessing current formulations of prescribed medicinal cannabis in Australia is needed to enable clinically relevant assessment and provide ongoing evidence for decision-making both in practice and at a policy level.The aim of this study is to evaluate PROs in patients who are prescribed medicinal cannabis by authorized prescribers and under the SAS across clinics within Australia. The findings from this study have the potential to be integral to treatment assessment and recommendations for chronic pain sufferers and other patients with health indicators for accessing medicinal cannabis.The primary objective of this study is to describe changes in the PROs  from baseline to 3 months for a large cohort receiving medicinal cannabis.The secondary objectives of this study are to describe changes in PROS  from baseline up to 12 months and to describe differences between patients accessing medicinal cannabis with different chronic health conditions, including, but not limited to, chronic pain, MS, epilepsy, Parkinson disease, and cancer.The exploratory objectives of this study are to explore (1) which individuals are more likely to have lower symptom burden and greater HRQL, (2) associations among PROs, with the hypothesis that a high symptom burden is associated with poorer HRQL, and (3) associations between PROs and resource and medication use over time, with the hypothesis that lower symptom burden is associated with reduced health care\u2013resource use and reduced use of opioids and other prescribed medications for managing symptoms.The study includes 3 hypotheses: (1) PROs will improve from baseline to 3 months in patients accessing medicinal cannabis, (2) improvements in PROs at 3 months will be maintained over a 12-month period, and (3) no differences in PROs will be observed between patients being treated for different conditions .This is a multicenter prospective longitudinal cohort study of patients newly prescribed with medicinal cannabis in Australia by authorized prescribers and under the SAS. The study is registered in the Australian New Zealand Clinical Trials Registry (ACTRN12621000063819).To be eligible to participate in the study, participants must have already been identified as eligible to receive a medicinal cannabis product from an authorized prescriber or under the SAS category B pathway, with approval given by the Australian TGA. This means that a suitable health practitioner has seen and assessed their patient, adhering to relevant standards of good medical practice, and successfully applied to the TGA for access to the particular medicinal cannabis product for the patient. Little Green Pharma Ltd (LGP) is responsible for the manufacture and quality of the products following the TGA guidelines. The prescriber is responsible for the prescription of the product for the patient and seeking TGA approval either as an authorized prescriber or under the SAS-B scheme, including the patient\u2019s informed consent for the product.The University of Sydney researchers are responsible for the design of the cohort study and the data collection and analysis, as outlined in this protocol.LGP is responsible for arrangements for delivery of the product, any subsidization arrangements, and the arrangements entered into with the participating sites and the physicians at these sites.The prescriber is responsible for identifying the patients suitable for the study and obtaining consent to email them an invitation to participate in the study.The inclusion and exclusion criteria are provided in Inclusion criteriaPatient is an adult (aged \u226518 years).Patient has been identified as eligible to receive medicinal cannabis by a Therapeutic Goods Administration\u2013approved authorized prescriber or through the Special Access Scheme  and the physician has sought and obtained Therapeutic Goods Administration approval for the Little Green Pharma Ltd product for their patient.Patient is able to read and understand English.Patient is able to provide informed consent.Patient has not started any prescribed medicinal cannabis therapy in the last 4 weeks or started prescribed Little Green Pharma Ltd medicinal cannabis therapy within the last 2 days (we expect no therapeutic benefit within 2 days) and did not receive any prescribed medicinal cannabis therapy in the last 4 weeks.Patient has a life expectancy of >3 months.Exclusion criteriaPatient is unconscious or confused.Patient has cognitive impairment .Patient is pregnant or breastfeeding.Patient is unable to read and write in English.Patient is denied access to medicinal cannabis under the relevant Special Access Scheme for their country of registration.Objectives section.Our aim is to recruit a large, broad, and representative sample of medicinal cannabis users. Therefore, we will invite every eligible patient treated at each participating center during a 12-month recruitment period. This large real-world cohort will enable several important analyses exploring differences in PROs between disease groups commonly treated with medicinal cannabis, as discussed in the Following the guidelines  for the Recruitment will take place between November 2020 and November 2021, with the aim of including all eligible patients receiving medicinal cannabis at participating sites during the recruitment period. LGP, following the World Health Organization Guidelines on Good Agricultural and Collection Practices for Medicinal Plants and European Union-Goods Manufacturing Practices standards, provides its medicinal cannabis products in Australia under the SAS. As part of this process, LGP engages with medical cannabis\u2013focused clinics, authorized prescribers, and other health care professionals prescribing LGP products and will be responsible for identifying recruitment sites for this study. Advertising and information relevant to the study will be disseminated via a dedicated study website and social media platforms. Content on the study website will inform potential participants and recruitment sites of the study objectives, terms, and conditions, including eligibility criteria, and who to contact for more information. Approved recruitment sites will receive study-specific training from the University of Sydney researchers regarding participant screening and recruitment.Patients from participating centers who meet the eligibility criteria will be invited to participate in the study. Patients will be identified by physicians at recruitment sites and approached to participate by either the physician or site staff. A record of those identified as eligible and invited to participate will be logged in the web-based research database with the patient\u2019s verbal consent. Physicians at recruitment sites will use a generic link to access the study database to create a new record for each patient screened.Registration and Clinical Data section, into the research database, which then sends an invitation to them automatically. Participants will be informed that email addresses are stored within the Research Electronic Data Capture (REDCap) system and used solely for sending reminders to complete questionnaires at scheduled time points. REDCap [The physician or staff at recruitment sites will ask if the patient agrees to have the Participant Information Statement and invitation sent to them through email. Patients will be informed that the process involves recruitment site staff entering the information, as per the . REDCap  is a secAll patients who provide their email address to receive an invitation for the study will receive their medicinal cannabis product at a standardized cost. As medicinal cannabis is still an unregistered product, it has been difficult to control the cost of the product; consequently, there has been considerable variability in what people pay for the product. LGP has partnered with several pharmacies across Australia to ensure that all participants taking part in this study will be charged the same amount for their product, eliminating variability in out-of-pocket costs and enabling a health economic evaluation.opt out without reason.As soon as an email address is entered in the web-based database, the patient will receive an email invitation with a link to the web-based forms for their record. The email will include the Participant Information Statement  to be coParticipants will remain free to withdraw from the study at any time without giving reasons and without prejudicing any further treatment. Participants can withdraw responses from the study before the data have been analyzed; otherwise, they will be included.When physicians at recruitment sites complete the web-based screening form, REDCap will automatically generate a number to be used as the participant\u2019s study ID number for study registration.Study data will be recorded by physicians at recruitment sites on case report forms and by participants in the questionnaire booklets. These will be completed on the web through the University of Sydney research data capture system, REDCap .Screening and registration and clinical data will be completed by the physician at the recruitment sites. The REDCap database will collect information only identifiable by REDCap-assigned study record ID numbers. Physicians at recruitment sites will maintain a record of participants\u2019 study ID numbers for each screened and registered participant entered. Where required, data can be updated for individual participants by notifying the study project manager of the corresponding study ID numbers . If 2 consecutive assessments are missed by participants, the study project manager will contact the physician at the recruitment site to determine the reasons for missed assessments, if known.The following patient screening details will be entered into the REDCap web-based registration form by physicians at recruitment sites: age, sex, country, email address, health indications for accessing medicinal cannabis, neuropathic pain screening using the short-form Douleur Neuropathique en 4 Questions ,56 (if pPatients who provide email addresses will receive an email with a link to the patient consent and demographic form corresponding to their study record ID. Patient consent and demographic questions include the following: consent to participate (or opt out), reasons for declining study participation (if applicable), ethnicity and cultural background, education, living arrangements, marital status, height, weight, gender identity, work status, access to health services, any medication other than medicinal cannabis taken during the last 4 weeks for health indication, and previous history of cannabis use.Baseline PROMs will be presented to participants on the web automatically after completing the demographic questions. Participants self-complete the questionnaires through the web-based platform at home, accessible on a computer or other device with an internet connection, depending on their preference. All the questionnaires will be administered in the same order. It is anticipated that completion of baseline questionnaires may take up to 30 minutes. Follow-up questionnaires may take approximately 25 minutes. We have estimated the time to complete the questionnaires (including demographic questions) based on 10-12 seconds per item .All participants will complete the following PROMs.today. In addition to the 5 items, there is a visual numeric scale of global health rated on a scale of 0-100. The questionnaire has validated language translations suitable for use in Australia.Generic HRQL will be assessed in all participants using the EuroQol 5-Dimension questionnaire (EQ-5D-5L). The EQ-5D-5L is a standardized measure of health status developed by the EuroQol Group to provide a simple, generic measure of health for clinical and economic appraisals . EQ-5D-5To make the EQ-5D-5L suitable for use in economic evaluations, health states were valued using a preference-elicitation method in the general population. Australian national values have been collected and subsequently modeled and will be used for economic analysis .All participants will receive the EORTC QLQ-C30 core quality of life cancer questionnaire , which iThe QLQ-C30 can be used for economic evaluation through the QLU-C10D , a healtsince beginning medicinal cannabis treatment.Patients\u2019 subjective rating of overall change in health status related to their primary health condition will be assessed using the Patients\u2019 Global Impression of Change . The PatAnxiety, depression, and stress will be assessed in all participants with the validated 21-item short version of the Depression, Anxiety, and Stress Scale . The DepSleep quality will be assessed in all participants using the Patient-Reported Outcomes Measurement Information System (PROMIS) Short Form version 1.0: Sleep Disturbance 8b . This meFatigue will be assessed in all participants using the PROMIS Fatigue 13a or the Functional Assessment of Chronic Illness Therapy Fatigue Scale . The 13-The following questionnaires will only be administered to patients with identified conditions or health status.To reduce the burden on patients with a primary health indication of palliative care for advanced, symptomatic, incurable cancer with a life expectancy of a few months, they will receive the EORTC QLQ-C15-PAL instead of the QLQ-C30. It is a shorter, 15-item questionnaire that assesses the same outcomes as the QLQ-C30 questionnaire and is used extensively in the palliative care setting . PalliatParticipants with pain as a health indication in their baseline clinical data will complete additional pain-specific questionnaires :Pain intensity will be assessed using the PROMIS Scale version 1.0: Pain Intensity 3a (PS-PI) . The scaPain interference will be assessed using the PROMIS Short Form version 1.0: Pain Interference 8a . This meParticipants with movement disorder, chorea, as a health indication will be assessed with the Quality of Life in Neurological Disorders Short Form version 2.0\u2013Huntington\u2019s Disease health-related Quality of LIFE-Chorea 6a . This 6-Participants with movement disorders affecting the upper body as a health indication will be assessed using the Quality of Life in Neurological Disorders version 1.0: Upper Extremity Function (Fine Motor and Activities of Daily Living) Short Form . This 8-For participants who indicate that they are working or would normally be working , the impact of health on work performance will be assessed using the absenteeism and presenteeism questions of the World Health Organization\u2019s Health and Work Performance Questionnaire . The queParticipants will receive automatic reminders from the REDCap system to their email addresses at scheduled follow-up assessment time points . Follow-Prospective assessment of newly prescribed patients before and after treatment is required to assess changes in PROs over time. PROs will be completed at baseline before starting medicinal cannabis, at 2-3 weeks after starting medicinal cannabis (end of titration period), and then at 1, 2, 3, 5, 7, 9, and 12 months after the titration period.The acceptable PRO assessment time windows are indicated in All analyses will be performed using SPSS software . Baseline demographic and clinical data will be summarized descriptively for all patients registered for the study. Categorical data will be presented as frequencies and percentages. For continuous scale data, mean, SD, median, 25th and 75th percentiles, and minimum and maximum scores will be presented.PRO analyses will explore changes over time using mixed linear models. Subgroup analyses will compare differences in PROs between underlying conditions, dose, and duration of pain and over time using linear mixed models.A comprehensive PRO-specific statistical analysis plan will be produced by the study statistician. The key considerations include the following:PRO questionnaire responses will be scored into PRO scales for outcome analysis according to standard scoring algorithms provided by the questionnaire developers and custodians.Rates and reasons for missed PRO assessments will be summarized to assess likely missing data mechanisms against missing data assumptions of statistical modeling.For each PRO, all participants with a score for that PRO at baseline and at least one time point after starting medicinal cannabis will be analyzed.Linear mixed models will be used to compare groups in their PRO scores, adjusted for their PRO levels at baseline and with additional covariates such as duration of pain, previous cannabis use, use of other medications, and overall and prespecified subgroups.If the scores are highly skewed, a suitable transformation will be sought to achieve normality.As there are several PRO scales and time points and correlation among them is anticipated, statistical significance levels will be adjusted using an appropriate method .The clinical significance of differences in the PRO questionnaires will be interpreted using existing guidelines  , maintaiMissing items within the PRO questionnaires are not expected. This is because of the web-based administration platform alerting participants of missed items and the requirement to complete those items before progressing to the next page. Only those participants who complete at least 2 questionnaires (baseline and one other) will be included in the analysis. Single missed assessments will be imputed using the last value carried forward technique, that is, no change from that individual\u2019s last assessment. Pattern mixture models will be used to impute scores for missed assessments based on recorded reasons .The economic evaluation will use collected data around pharmaceutical and other medical costs to explore the drivers of patient-level costs. As this study is not a comparative randomized trial, we are not proposing to conduct a formal economic evaluation, resulting in a cost per quality-adjusted life year. We will instead use baseline resource use as an indicator of typical care and contrast resource use throughout the study with baseline data. We will explore the relationship between HRQL and resource use across the cohort, which is potentially important information for future economic evaluation of medicinal cannabis.Participant recruitment in Australia commenced on November 27, 2020. By June 4, 2021, 1095 patients were screened for the study by 69 physicians in centers across 6 Australian states: Australian Capital Territory, New South Wales, Queensland, South Australia, Victoria, and Western Australia. Of the 1095 patients screened, 833 (76.07%) participants provided consent, completed baseline questionnaires, and remained on the study. Baseline recruitment is expected to end in March 2022 when the target sample size of participants has completed the baseline questionnaires and a 3-month follow-up. The final results for the primary objective are expected to be published in 2022.The results of this study will show whether PROs improve in patients accessing prescribed medicinal cannabis from baseline to 3 months and whether any changes are maintained over a 12-month period. This study will also identify whether there are differences in improvements in PROs among patients being treated for different conditions .The findings from this study have the potential to be integral to treatment assessment and recommendations for chronic pain sufferers and other patients with health indicators for accessing medicinal cannabis."}
{"text": "Imaging the dynamics of proteins in living cells is a powerful means for understanding cellular functions at a deeper level. Here, we report a versatile method for spatiotemporal imaging of specific endogenous proteins in living mammalian cells. The method employs a bifunctional aptamer capable of selective protein recognition and fluorescent probe-binding, which is induced only when the aptamer specifically binds to its target protein. An aptamer for \u03b2-actin protein preferentially recognizes its monomer forms over filamentous forms, resulting in selective G-actin staining in both fixed and living cells. Through actin-drug treatment, the method permitted direct monitoring of the intracellular concentration change of endogenous G-actin. This protein-labeling method, which is highly selective and non-covalent, provides rich insights into the study of spatiotemporal protein dynamics in living cells.  Imaging of subcellular localization and dynamics of proteins is a powerful means for elucidating biochemical pathways in cells. Immunostaining, a method used with antibodies to visualize the intracellular distribution of protein in fixed cells, has an edge, but it provides only a snapshot image taken at the time of fixation. Therefore, establishing live-cell protein imaging methods has ever been in high demand, and a number of unique methods have been proposed to visualize protein dynamics in living cells. Out of the numerous techniques developed, the most widely used method to date is the overexpression of the protein of interest as a fusion with a fluorescent protein ,2 or a sTo overcome such limitations, an unconventional live-cell imaging technology that is applicable to non-engineered, endogenous proteins would be useful to a notable extent. One of the most powerful approaches ever developed so far is ligand-directed labeling, where binding of a protein target to its modified ligand leads to proximity-induced covalent labeling of the protein. Selective protein labeling, such as using quenched ligand-directed tosylate compounds  and diazAdditional details are available in the supplemental information.2O and 0.1% trifluoroacetic acid in acetonitrile (0\u221290%) as the solvent, and a flow rate of 3.0 ml/min. All fluorescence spectra were measured with an LS 55 fluorescence spectrometer (Perkin Elmer). Fluorescence spectra were recorded using a FluoroMax\u00ae-4 . The live-cell and fixed-cell imaging were performed using a CellVoyager\u2122 CV1000 Confocal Scanner Box (Yokogawa Electric Corporation) equipped with an ultra-sensitive EMCCD C9100-13 camera (512\u00a0\u00d7\u00a0512 pixels) and an Olympus UPLSAPO 100XO 1.4 oil objective.ESI-mass spectra for the probes and peptides were measured with an LCMS-2020 system (Shimadzu). HPLC purification and profiling was done with an Inertsil ODS-3 reversed phase column , with a linear gradient of 0.1% trifluoroacetic acid in H20 - TGG CCT AGA TAA ATT CGG AGC TT - N20 - GCT TTC GAC GGA GAA TTC -3\u2032] as the template. All PCR reactions were done with KOD FX Neo (Toyobo). Primers used for PCR amplification were: forward [5\u2032-GCT AAT ACG ACT CAC TAT AGG GAT CCA AGC TTG T-3\u2032 (T7 promoter sequence is underlined)] and reverse [5\u2032-GAA TTC TCC GTC GAA AG-3\u2032]. The original DNA pool was in vitro transcribed with T7 RNA polymerase  to give the first RNA pool. After transcription, the mixture was treated with DNase I (Ambion) and precipitated with 1.25 M ammonium acetate/isopropanol. The precipitated RNA was applied to a NAP-5 column  to remove unincorporated NTPs, precipitated with 0.136 M sodium acetate/isopropanol, pelleted by centrifugation, washed with 70% ethanol, and used for the selection step. In each round of selection, RNA was heated to 85\u00b0C in binding buffer (10 mM Tris\u2212HCl (pH7.6), 100 mM KCl) for 10 min\u00a0and cooled in ice for 10 min. MgCl2 was then added to a concentration of 10 mM, and the RNA was incubated on BHQ1-immobilized affinity resin for 15 min at 4\u00b0C. The unbound RNA was collected and 10 \u03bcg of monomeric \u03b2-actin was added. The resulting solution was mixed with BHQ1-immobilized affinity resin and incubated for 30 min at 4\u00b0C. The resin was then drained and washed eight times with binding buffer to remove the non-binding species. Bound RNA species were eluted using binding buffer containing 2 \u03bcg of eluting antibody (BA3R/AC40), three times for 5 min each. The eluted fractions were pooled and precipitated with 0.136 M sodium acetate/isopropanol. Selected RNAs were reverse-transcribed using Prime Script reverse transcriptase (TAKARA), and the resulting cDNA was PCR-amplified with the forward and the reverse primers described above. The DNA templates were transcribed in vitro, and the resulting RNAs were subjected to the next round of selection. After 16 rounds of selection, enriched RNAs were reverse-transcribed and converted to dsDNA by PCR. The resulting DNAs were ligated into pUC19 at the EcoR I and BamH I sites and transformed to Escherichia coli strain DH5\u03b1. Several clones were isolated and sent for sequencing (Eurofins Genomics).The original double-stranded DNA pool was constructed via PCR, using a synthetic oligonucleotide containing 20 random nucleotides flanking both sides of the reported BHQ1 binding sequence [5\u2032- GGA TCC AAG CTT GTT TGG C - NT AAT ACG ACT CAC TAT AGG GAT CCA AGC TTG T-3\u2032], and reverse primer [5\u2032-GAA TTC TCC GTC GAA AG-3\u2032]. RNAs were transcribed from the dsDNA templates using T7 RNA polymerase from T7 MegaScript Kit (Ambion\u00ae) and purified using a NAP-5 column to remove unincorporated NTPs as described above.The dsDNAs for T7 transcription of RNA aptamers were PCR amplified using the recombinant pUC19 plasmid as a template, with T7 primer [5\u2032-GC1  in a buffer , 100 mM KCl, 10 mM MgCl2) and incubated at room temperature for 10 min. Fluorescence spectra of the sample were measured at the excitation wavelength of 620 nm and emission range of 640\u2013800 nm. Competition experiments were performed by adding competitors together with \u03b2-actin. Antibodies were added at a final concentration of 3 \u03bcM, and peptides were added from 0 to 20 \u03bcM at 1% DMSO.RNA aptamer (3 \u03bcM) was denatured at 85\u00b0C for 10 min and cooled on ice for 10 min. The RNA was then mixed with \u03b2-actin (3 \u03bcM) in buffer , 100 mM KCl) for 30 min at 25\u00b0C. The resulting RNA solution was mixed with a solution of conjugate 2, and 0.1 mM ATP. The G actin stock solution was centrifuged at 21,500\u00a0\u00d7 g at 4\u00b0C for 30 min. The supernatant was obtained, and 80 \u03bcl was taken and adjusted to binding buffer conditions (10 mM Tris\u2013HCl (pH 7.6), 100 mM KCl and 10 mM MgCl2). RNA aptamer and conjugate 1 were added to a final concentration of 3 and 2 \u03bcM, respectively. The probe fluorescence of this solution was measured and taken as t\u00a0=\u00a00 min. ME buffer  was then added to the remaining G actin stock and incubated at room temperature for 2 min. KMEI was immediately added containing 50 mM KCl, 1 mM MgCl2, 1 mM EGTA and 10 mM imidazole (pH 7.0). A 100-\u03bcl aliquot was taken, and the fluorescence was immediately measured at the excitation wavelength of 365 nm and emission wavelength of 410 nm every 20 s for 15 min. An aliquot of the remaining, polymerizing G actin stock was taken every 3 min and mixed with the RNA aptamer and conjugate 1. The solutions were adjusted to binding buffer conditions and the probe fluorescence was measured at the excitation wavelength of 620 nm and emission range of 640\u2013800 nm.Monitoring of actin polymerization was adapted according to the protocol described in the Actin Polymerization Biochem Kit , with some modifications. Briefly, 600 \u03bcl of G actin stock solution was prepared by dissolving 5 \u03bcM of actin (3% pyrene labeled) in G-buffer containing 2 mM Tris\u2212HCl (pH 8.0), 0.1 mM CaCl2O) and precipitated with ice-cold ether. The crude product was then dried and subjected to HPLC purification and LC\u2212MS analysis.The peptide epitope with sequence DDDIAALVVDNGSG (BA3R Antibody epitope) was prepared according to standard Fmoc solid phase peptide synthesis. Fmoc-Gly-OH was loaded on to 300 mg of Wang resin (1.03 mmol/g) using 2 eq. of DIC, 2 eq. of HOBt, and 0.1 eq. of DMAP in DCM/DMF for 2 h. Unreacted sites were capped with 0.5 eq. each of acetic anhydride and DIEA in DMF. Fmoc was removed by adding 20% piperidine in DMF in two 2 ml portions for 15 min each. Subsequent amino acids were loaded on the resin using 2 eq. each of HBTU and HOBt with 4 eq. of DIEA and mixed for 1.5 h. Success of couplings and deprotections was monitored by Kaiser test. Successful couplings were followed by capping and deprotection steps. This cycle was repeated until the whole sequence peptide was synthesized on the resin. The peptide was cleaved from the resin with a TFA cleavage cocktail (95% TFA/2.5% TIS/2.5% H\u00ae), supplemented with 1% penicillin, 100 \u03bcg/ml streptomycin sulfate, and 10% (v/v) fetal bovine serum (Biowest), at 37\u00b0C in a humidified incubator kept at 5% CO2. The cells were co-transfected with the RNA-aptamer expression plasmids and pSuper.gfp using FuGENE\u00ae HD transfection reagent (Promega), according to the manufacturer's protocol. The RNA\u2212aptamer sequences were cloned into pSuper vector (Oligoengine). Non-recombinant pSuper vector was used as a control.HeLa cells were maintained in Dulbecco's modified Eagle medium  at 7.5\u00a0\u00d7\u00a0103 cells per well. After 24 h, cells were fixed with 4% paraformaldehyde solution  at room temperature for 10 min, then washed twice with PBS and permeabilized with 0.5% Triton-X 100 for 10 min. The cells were then incubated with a blocking solution containing 10% dextran sulfate, 2 mM vanadyl-ribonucleoside complex, 0.01% salmon DNA, 30 \u03bcg yeast tRNA, 10 mM Tris\u2212HCl (pH 7.6), and 100 mM KCl at room temperature for 1 h. The wells were washed twice with PBS and stained with 50 \u03bcl of 0.3 \u03bcM DNase I at room temperature for 30 min. Excess solution was removed, and the wells were washed twice with PBS. The cells were then incubated with 10 \u03bcM of P-TRap in binding buffer (10 mM Tris\u2212HCl (pH7.6), 100 mM KCl and 10 mM MgCl2) at 4\u00b0C for 12 h, and then the solution was washed out twice with the binding buffer. The cells were stained with DAPI (10 \u03bcg/ml) in a binding buffer (50 \u03bcl) at room temperature for 20 min and treated with 5-\u03bcM conjugate 1 in the binding buffer (30 \u03bcl) at room temperature for 5 min. Excess conjugate 1 was washed out with the binding buffer, and the cells were observed on CV1000. Images were collected as 2 \u03bcm of vertical z-stack range  and presented as MIP.HeLa cells were seeded on poly-5 cells per well. On day 1, the cells were co-transfected with pSuper vector encoding each AcP-TRap1Ex and pSuper.gfp. On day 2, they were stained with Hoechst 33342  in complete growth medium (500 \u03bcl) and incubated at 37\u00b0C for 20 min in a humidified 5% CO2 incubator. Conjugate 1  in a complete growth medium (100 \u03bcl) was then added and incubated at 37\u00b0C for 5 min in a humidified 5% CO2 incubator. Afterwards, the solution was replaced with fresh media, and the cells were observed on CV1000. Live-cell images were collected as 3.3 \u03bcm of vertical z-stack range  and presented as MIP. Time-lapse images were taken every 5 min up to 1 h. For the observation of \u03b2-actin drug effects on fluorescent response, the cells were transfected as described above. The cells were stained with Hoechst 33342 and conjugate 2 and then treated with the actin drug . The live-cell images were collected immediately as 3.3 \u03bcm of vertical z-stack range  and presented as MIP. The time-lapse images were taken as follows: Cytochalasin B 10-min intervals for up to 2 h; Latrunculin B 5-min intervals for up to 1 h; Jasplakinolide 3-min intervals for up to 30 min. The cells transfected with the non-recombinant pSuper were always prepared as control in every imaging experiment.On day 0, HeLa cells were seeded on a 35 mm 4-well Advanced TC glass bottom cell culture dish (Greiner Bio-One) at 5.0\u00a0\u00d7\u00a010Kd value of BHQ1-binding aptamer with conjugate 1 is 4.7 \u03bcM), which was previously discovered through in vitro selection   of 1.5 \u03bcM    . The thrg Figure . Of the The proposed mechanism of aptamer binding involves the binding of two protein-targeting RNA \u2018arms\u2019 to the target protein. We attempted to truncate the arm sequence on both sides to ascertain whether we could optimize a minimal sequence for protein targeting. All the truncated aptamers showed reduced fluorescent response, indicating that the whole sequence of the protein-targeting arms is required for optimal \u03b2-actin binding .1, but no significant increase in fluorescent response was observed even up to 20 \u03bcM of the peptide . Increasing concentrations of the peptide were mixed with AcP-TRap1 and conjugate  peptide . Additio peptide . These r peptide . Anti-\u03b2-To determine whether the aptamers are capable of fluorescent labeling of endogenous \u03b2-actin in the context of human cells, we proceeded to imaging experiments in fixed cells. To verify the specific labeling of actin protein, co-staining of actin was performed with AcP-TRap1 and phalloidin, a well-known actin stain in fixed cells. Interestingly, no overlap staining was observed between AcP-TRap1 and phalloidin . Actin ein vitro actin polymerization assay. During actin polymerization reaction, the response of the aptamer was checked at different time points. As a result, the aptamer response showed an inverse relationship with the degree of actin polymerization  showed equivalent efficacy to the original AcP-TRap1  that is specific for the C-terminal epitope of \u03b2-actin , which has different sequences from those of AcP-TRap1 in the \u03b2-actin targeting \u2018arms\u2019  was also performed from the same initial RNA library as \u03b2-actin targeting aptamers. A bifunctional aptamer, KrP-TRap1 obtained from the in vitro selection for KRAS restored the fluorescence of BHQ1-probe only in the presence of KRAS in in vitro binding assay  or between AcP-TRap4 and antibody (BAR3)) was observed Figure . The antng assay . Thus, tin vitro selection is performed for such a complex, a highly specific P-TRap for the complex of G-actin and the partner protein could be isolated. These results reinforce the fact that this new method excels at protein labeling in an exquisitely selective manner. However, the binding of AcP-TRap to G-actin may affect the G-actin localization or the F-actin formation. Further validation of the new method might permit the detection of a variety of proteins without affecting their dynamics.This non-covalent and cooperative labeling technology permits live-cell imaging of protein dynamics in an extremely selective manner. A bifunctional aptamer for a given target protein can easily be isolated with a well-designed conventional selection. We have demonstrated the effectiveness of this new protein-labeling method through imaging of \u03b2-actin in human cells. In live-cell imaging of \u03b2-actin, the method allowed us to monitor the concentration change of G-actin through response to known chemical stimuli. This is the first reported imaging tool specific for G-actin in mammalian living cells. The identity of G-actin was confirmed independently by co-staining with fluorophore-conjugated DNase I in fixed cells. Although the fluorescent signals well overlapped with those of the fluorescent DNase I, the number of fluorescent spots observed was less than that of the fluorescent DNase I. One possible reason behind this is that AcP-TRap may not recognize G-actin that exists as a complex with other partner proteins. To verify this hypothesis, we examined the binding competition of AcP-TRap1 with three well-known G-actin-binding proteins, cofilin . Both coin vitro selection. A cell-permeable turn-on probe can simply be added to culture media to visualize protein dynamics. As for the modularity of the method, the probe-binding stem-loop structure can be replaced by other probe-binding structures (We have developed a live-cell protein imaging technology that uses a protein-targeting RNA aptamer with a turn-on fluorescent probe. One notable advantage of the technology is that it simply requires practices of commonly used cell biology techniques. A highly selective P-TRap for a specific target protein can be easily isolated by well-designed ructures  (Supplemructures . These agkab839_Supplemental_FilesClick here for additional data file."}
{"text": "In view of the rising relevance of emerging pollutants in the environment, this work studies the photodegradation of three antibiotics, evaluating the effects of the pH of the medium and the concentration of dissolved organic matter. Simulated light  was applied to the antibiotics Ciprofloxacin (Cip), Clarithromycin (Cla) and Trimethoprim (Tri), at three different pH, and in the presence of different concentrations of humic acids. The sensitivity to light followed the sequence: Cip > Cla > Tri, which was inverse for the half-life (Tri > Cla > Cip). As the pH increased, the half-life generally decreased, except for Cla. Regarding the kinetic constant k, in the case of Cip and Tri it increased with the rise of pH, while decreased for Cla. The results corresponding to total organic carbon (TOC) indicate that the complete mineralization of the antibiotics was not achieved. The effect of humic acids was not marked, slightly increasing the degradation of Cip, and slightly decreasing it for Tri, while no effect was detected for Cla. These results may be relevant in terms of understanding the evolution of these antibiotics, especially when they reach different environmental compartments and receive sunlight radiation. In recent years, antibiotics have been used massively to combat bacterial diseases, both in humans and in domestic animals, being recognized as emerging pollutants. This has even increased their scientific interest, as well as the concern of public administrations regarding this topic . To be nDegradation of the antibiotics that reach waterbodies is of main importance to avoid/diminish the magnitude of potential environmental issues. Within degradation processes, it is worth highlighting biodegradation and abiotic degradation, with especial relevance of photodegradation for the latter. As indicated by different authors ,13, it iThe evaluation of photodegradation processes can provide information about the persistence of antibiotics in the environment when they receive sunlight, but also about their possible removal during wastewater treatment ,15. It iAdditionally, it is necessary to bear in mind that one of the potential sources of organic matter in water is that which is solubilized from the soil and ends up reaching waterbodies . It alsoTaking all this background into account, this study is aimed to evaluate the effects of pH and humic acids on the photodegradation of three different antibiotics. Specifically, they belong to three of the groups most widely used in human medicine, being chemically clearly different: Ciprofloxacin (which belongs to the group of quinolones), Clarithromycin (which belongs to the group of macrolides), and Trimethoprim (which is an antibiotic of the group of diaminopyrimidines).The antibiotics used were ciprofloxacin (Cip) (purity 98%), clarithromycin (Cla) (purity 98%), and trimethoprim (Tri) (purity 98%), which were supplied by Sigma Aldrich . Its main characteristics are presented in + simulator  equipped with a 550 W m\u22122 Xenon lamp, and with quartz filters, with a cut-off at 285 nm. It is characterized by having a light spectrum similar to that of natural sunlight, in which the temperature is maintained at 32 \u00b1 2 \u00b0C. Exposure times to simulated light were in the range 0.0833\u2013192 h. Simultaneously, another set of samples remained in the dark at the same time intervals. A 50 \u00b5M antibiotic solution was used, containing separately each of the three antibiotics. Six mL of solution were introduced into glass tubes (in triplicate), with some of them being exposed to simulated light, and other equivalent in number remained in the dark, all this during the different times of the experiments. The concentration of each of the antibiotics was analyzed by HPLC after the different contact times.The photodegradation experiments were carried out in a Suntest CPS\u22121 for the first two antibiotics, and 1 mL min\u22121 for Cla. The temperature was kept constant at 25 \u00b0C throughout the analysis. Between each measurement, a wash was made with a solution composed of methanol and water (50:50).The equipment used for the quantification of antibiotics was an UltiMate 3000 HPLC chromatography device , with a quaternary pump, an autosampler, a thermostatted column compartment, and an UltiMate 3000 ultraviolet-visible detector. Attached to this equipment was a computer with version 7 of the Chromeleon software . Chromatographic separations were performed on a Luna C18 analytical column  from Phenomenex , and a safety column , packed with the same material as the column. The injection volume was 50 \u03bcL in the case of Cip and Tri, and 200 \u03bcL in the case of Cla. Flow rates were 1.5 mL minThe conditions in which Cla was separated were the following: the mobile phase consisted of acetonitrile (phase A), and 0.025 M monopotassium phosphate (phase B). The linear gradient elution program was run from 5 to 70% for phase A (and therefore 95 to 30% for phase B), with a time of 18 min. The initial conditions were restored in 2 min and were maintained for 3 min. The total analysis time was 25 min, with a retention of 13.6 min. The wavelength used for detection was 210 nm.In the case of Cip and Tri, they were separated under the following conditions: the mobile phase was acetonitrile (phase A) and 0.01 M phosphoric acid (pH = 2) for phase B. The linear gradient elution program was executed from 5 to 32% for phase A and from 95 to 68% for phase B, in a period of 10.5 min. The initial conditions were restored in 2 min. The total analysis time was 15 min, with a retention time of 6.5 min for Cip and 5.6 min for Tri. The wavelength used was 212 nm.C/C0 is the fraction of the initial concentration (C0) that remains in the suspension after a given time t (expressed in h), and k (h\u22121) is the dissipation kinetic constant. The half-life  of each compound was calculated as:After finishing with the quantification of all three antibiotics, a pseudo-first order kinetic model was used to describe kinetics results, as follows:To study the photodegradation at different pH, it was firstly adjusted in the solutions corresponding to each antibiotic, to reach values of 4.0, 5.5 and 7.0, using 0.5 M NaOH or 0.5 M HCl. Subsequently, the same steps described above were followed until the completion of the quantification of each of the antibiotics.\u22121. The pH of all solutions was adjusted to 5.5, with 0.5 M NaOH or 0.5 M HCl. The contact time was similar to the half-life of each of the antibiotics, being 15 min for Cip, 8 h for Tri, and 2 h for Cla. The half-lives were previously calculated from the experimental data of degradation in water at pH 4.0, described by the exponential decay model, from which the kinetic constant (k) was obtained, and from this the half-lives were calculated. The chemical characteristics of the humic acids used are described in [The study of the effect of humic acids was carried out at an antibiotic concentration of 50 \u00b5M, with different concentrations of humic acids, specifically: 0.1, 0.2, 0.4, 1.0, 2.0, and 20.0 mg Lribed in .Total organic carbon (TOC) was determined at time zero, 2 h, 16 h and 48 h (end of the experiment) by using a Multi N/C 2100 . It was quantified for Cip and Tri samples. TOC was not measured in the Cla samples since ethanol was used when dissolving the antibiotic, as previously mentioned.All determinations were made by triplicate.None of the three antibiotics showed significant degradation in the dark, at any of the pH and contact times (between 0\u201372 h) tested. Belden et al.  also repConsidering each antibiotic individually, starting with the one that showed the highest sensitivity to light, the degradation of Cip under simulated light was quite rapid for the three pH values studied, being above 85% after 1 h of exposure to the light radiation .Cla degradation under simulated light was slower and decreased with increasing pH values. After 1 h of exposure, it reached 30% at pH 4.0, 27% at pH 5.5, and 17% at pH 7.0 .Even slower was the degradation of Tri. After 1 h of exposure to simulated light, it reached less than 5%, at any of the three pH values tested .2 values (ranging 0.906\u20130.990, k follows the reverse order, increasing with pH for both Cip and Tri, while it decreases for Cla (The pseudo-first order kinetic model satisfactorily described experimental data, judging by the R for Cla .This behavior can be related to the percentages of the different species of antibiotics present as a function of pH, which are presented in a values (between 6.00\u20138.74, The distribution of species as a function of pH is similar for Cip and Tri, with dominance of positively charged forms at pH 4, while neutral forms predominate at pH 7. However, for Cla, positively charged species are predominant at both pH 4 and 7. Similar results were reported in a previous study , where tIn addition, TOC was determined in each of the samples exposed to simulated light at different times and pHs . The resC/C0 value going from 0.12 to 0.37 when the highest concentration of humic acids was added.In general, the presence of humic acids did not cause any changes in the degradation of the three antibiotics when the experiments were carried out in the dark . Under sPrevious studies reported that the presence of humic acids could cause opposite effects on the degradation of antibiotics, promoting it , or decrAll these results could be useful to understand the probable evolution of these three antibiotics when they are spread in environmental comportments, and they are subsequently exposed to variable incidence of solar radiation, under natural conditions. In addition, the results could aid in case of programing eventual treatments applicable in WWTP, in order to achieve the photodegradation of these compounds.Regarding future studies, this line of research could be further explored, with new antibiotics and with an additional variety of conditions tested. It would be interesting to shed further light and achieve further knowledge as regards eventual degradation under simulated natural sunlight, and also testing various catalyst materials with potential to enhance photocatalytic degradation."}
{"text": "The remarkable elastic properties of polymers are ultimatelydueto their molecular structure, but the relation between the macroscopicand molecular properties is often difficult to establish, in particularfor (bio)polymers that contain hydrogen bonds, which can easily rearrangeupon mechanical deformation. Here we show that two-dimensional infraredspectroscopy on polymer films in a miniature stress tester sheds newlight on how the hydrogen-bond structure of a polymer is related toits viscoelastic response. We study thermoplastic polyurethane, ablock copolymer consisting of hard segments of hydrogen-bonded urethanegroups embedded in a soft matrix of polyether chains. The conventionalinfrared spectrum shows that, upon deformation, the number of hydrogenbonds increases, a process that is largely reversible. However, the2DIR spectrum reveals that the distribution of hydrogen-bond strengthsbecomes slightly narrower after a deformation cycle, due to the disruptionof weak hydrogen bonds, an effect that could explain the strain-cycleinduced softening (Mullins effect) of polyurethane. These resultsshow how rheo-2DIR spectroscopy can bridge the gap between the molecularstructure and the macroscopic elastic properties of (bio)polymers. A detailed understandingof the connection between the macroscopic and microscopic propertiesof polymers is essential, not only for predicting the mechanical propertiesof synthetic polymers but also for understanding the molecular originof dysfunctional polymer systems, such as occur in for instance collagen-relateddiseases. The most straightforward way to investigate the molecularorigin of polymer elastic response is to directly observe the changesin molecular structure induced by externally applied strain. Suchexperiments have used a range of different structural probing methods,notably X-ray diffraction12 Combiningrheology with infrared spectroscopy (rheo-IR) to study the molecularchanges in polymers under applied strain . Furthermore, with conventional IR spectroscopy, inhomogeneousspectral broadening (due to a distribution of transition frequencies)cannot be easily separated from homogeneous spectral broadening .In the case of hydrogen-bonded (H-bonded) polymer networks,thestrain-induced structural changes generally involve rearrangementof the hydrogen-bonds (H-bonds) between molecular groups of adjacent(bio)polymer chains. Among the above-mentioned techniques, IR spectroscopyis very suitable to investigate such rearrangements, since the frequenciesand line shapes of the vibrational transitions contain detailed informationon the hydrogen-bond structure.d strain 1A has pr13 Inspired by rheo-IR spectroscopy, we here combinetwo-dimensional infrared spectroscopy with rheometry by insertinga miniature universal stress tester into a 2DIR setup (rheo-2DIR).We use this new method to investigate strain-induced changes in theH-bond distribution of thermal polyurethane, one of the most commonlyused polymers, that exhibits strain-cycle induced softening behaviorthat is believed to be related to changes in the H-bond structure.2These challenges can be addressed by means of two-dimensionalinfrared(2DIR) spectroscopy, which makes it possible to separate overlappingspectral bands, measure vibrational couplings, and separate the homogeneousand inhomogeneous contributions to the line broadening.\u20131 (fwhm) at 1 kHz repetition rate. The IR beamis split into a probe and reference beam (each 5%), and a pump beam(90%) that is aligned through a Fabry-P\u00e9rot interferometer.The pump and probe beams are overlapped in the sample , and the transmitted spectra of the probepulse in the presence and absence of the pump pulse are recorded witha 32-pixel mercury cadmium telluride array. The pump and probe polarizationsare at the magic angle (54.5\u00b0) to obtain polarization-independentspectra.13 In the rheo-2DIR setup (Supporting Information). The film thickness was31 \u00b1 5 \u03bcm (Protex 002) and 18 \u00b1 5 \u03bcm (Sagami001).A detailed description of the 2DIR setupcan be found in refs  and 15)15). BrieIR setup 1B, the p16 The mechanical response to deformation of TPUinvolves changes in the arrangement and strength of the H-bonds formedbetween the urethane links within hard segments and between the urethanelinks of hard and soft segments. In particular, the stress-softeningbehavior upon recovery of zero-stress condition after deformation(Mullins effect) is believed to be connected to the disruption ofweak H-bonds between hard and soft domains.2Thermoplastic polyurethane (TPU) is a block copolymercomposedof urethane- and polyether-based segments 1C. At ro17 Above400%, the polyurethane again stiffens (strain hardening), due to thelimited extensibility of polymer chains as it approaches the fracturepoint. The mechanical response of the sample during the second cycleis much more compliant compared to the first cycle. This strain-softeningbehavior (the Mullins effect)16 has beenextensively investigated, but its molecular origins are still notcompletely understood.2 Here, we show that rheo-2DIR spectroscopycan shed new light on this phenomenon by revealing how the H-bonddistribution changes upon deformation.\u20131, which are due to the hydrogen-bonded(1703 cm\u20131) and free (1733 cm\u20131) carbonyl groups.22 As we mentioned above, since these materials are poly(ether\u2013urethane)s,H-bonds of different strength can form between urethane groups andurethane N\u2013H and ether groups. Clearly, however, ether groupscannot H-bond to the urethane carbonyls. The lowering of the CO-stretchfrequency upon H-bond formation is a well-known effect, that can beused as a sensitive probe of the H-bond structure. The peak of thehydrogen-bonded carbonyl groups is much broader than that of the freeCO groups, and its shape reflects the distribution of H-bond strengthsin the sample (convoluted with the homogeneous line shape). 24). At higher strain, the finite extensibility of the chains leadsto an upturn of the stress\u2013strain curve. When approaching themaximum extension of the chain, hydrogen bonds are weakened and broken,leading to a decrease in intensity of the hydrogen-bonded carbonylvibration in the strain-hardening region.25 To summarize, rheo-IR shows that in the strain-softening regime,the number of H-bond increases because of an enhanced alignment ofthe chains, while it decreases in the strain-hardening regime becausehydrogen bonds are weakened and broken while resisting extension.4, whileconventional IR scales as \u03bc2, where \u03bc is thetransition dipole moment of the vibrational transition).13\u20131 fwhm) pump pulseto excite molecular vibrations (in this case the CO-stretch vibration)at a specific frequency \u03bdpump, and measure the pump-inducedchange in absorption \u0394A at all frequenciesusing a broad-band probing pulse that is detected in frequency-resolvedmanner. The pump polarization is set at an angle of \u223c54.5\u25e6 with respect to the strain direction and the probepolarization. Plotting \u0394A we obtain two-dimensional IR spectra ata specific time delay, Tw, between pumpand probe pulses.13 In A is plotted as red contour areas and negative \u0394A as blue contour areas.After unloading the sample, the infrared spectrumis very similarto the one observed before the deformation cycle 2D with tv = 0 \u21921 transition by the pump pulse causes a decrease in absorption atthe v = 0 \u2192 1 transition (due to depletionof the v = 0 state and v = 1 \u21920 stimulated emission) and an increase in absorption at the v = 1 \u2192 2 transition frequency.13 The dependence of the 2DIR response on the pump frequencyis a measure of the inhomogeneous broadening of the IR band, and thetwo-dimensional line shape can be used to disentangle inhomogeneousand homogeneous contributions to the line broadening.13 Since the inhomogeneous line shape reflects the distributionof H-bond strengths, we can thus investigate changes in this distributioncaused by the strain cycle. The simplest and most robust parameterto characterize the extent of inhomogeneous broadening is the inversevalue of the slope  of the2DIR contours:27 in the limiting case of purelyhomogeneous broadening, the \u0394A contours arevertically aligned , whereas in thecase of purely inhomogeneous broadening the slope is 1.The resonant excitation of the Tw = 1 ps . Samples were strained up to desired deformation and allowed torelax for 10\u201315 min before measuring (measurement time 1\u20132h). In 27 which represents analternative observable of the H-bond inhomogeneity (see Supporting Information). When comparing experimentson Protex 002 and Sagami 001, we find that the decrease of the slopeafter the deformation cycle is reproducible, although the values ofthe nodal line slopes show small variations. Repeating the deformationcycle on the same sample does not further change the slope (see Supporting Information), similar to the stress\u2013straincurve, which also tends to stabilize, with most of the softening occurringin the first deformation cycle. The decrease of the NLS indicatesthat the H-bond distribution has become narrower after a deformationcycle, suggesting that some of the H-bonds that are broken duringloading are not reformed upon recovery of zero-stress condition. Thisis confirmed by A < 0) signal ismaximal. It is difficult to observe this narrowing in the conventionalIR spectrum because of the changes in the background absorption upondeformation . After the deformation cycle, the diagonal carbonylpeak has become narrower, mostly due to disappearance of intensityat the high-frequency side. Thus, the narrowing of the H-bond distributionafter a deformation cycle is due to the disappearance of weak hydrogenbonds.28 Recent X-ray studies have attributed the strain-softeningbehavior of TPU to strain-induced softening of interfacial \u201cfuzzy\u201dregions between the hard and soft domains.2 Ourresults seem to confirm this idea, and they provide a molecular-levelexplanation of the strain-softening of the fuzzy regions. This pictureis confirmed by the lower nodal line slope observed in 2DIR spectrarecorded after deforming the sample at high (\u223c100 \u00b0C)temperature, which probably also destroys the weak hydrogen bondsin the unordered regions (see Supporting Information). The presence and the amount of the fuzzy interface will likelydepend on the degree of mixing between the hard and soft phases, whichis in turn determined by different experimental parameters, such assegments length, chemical composition, and thermal treatment.32 A different degree of mixing will thus affect the initial inhomogeneityand the amplitude of the decrease upon deformation, which probablyexplains the differences between the examined samples (Sagami 001and Protex 002).The rheo-2DIR results show that a strain cyclecauses an irreversiblereduction in the number of weak hydrogen bonds in TPU. These weakH-bonds are found mostly in the amorphous regions between the hardand soft segments, where the urethane NH groups form hydrogen bondsmostly to polyether instead of carbonyl groups.33 canprovide direct information on the degree of interchain coupling asa function of strain in biopolymer networks, where the mechanicalproperties are modulated by the formation and/or disruption of H-bonds.37 Rheo-2DIR can thus help to improve our understanding of the molecularorigin of the elastic response of not only synthetic but also, inparticular, biological polymer-based materials.To conclude, rheo-2DIR spectroscopy sheds newlight on the molecularprocesses that underlie the Mullin effect in polyurethane. Based onthese first experiments, we believe that rheo-2DIR can be a valuableaddition to the existing physical methods for studying the elasticproperties of materials. In particular, comparing the relative amplitudesof the rheo-IR and rheo-2DIR spectra"}
{"text": "Max). A modified stenting technique was applied by landing an oversized DES in the distal segment with the largest luminal diameter and maintaining the distal stent edge partially expanded. Results. The mean dsDMax and stent lengths were 1.7 \u00b1 0.3 mm and 62.6 \u00b1 18.1 mm in the ESDV group and 2.7 \u00b1 0.5 mm and 59.1 \u00b1 16.0 mm in non-ESDV groups, respectively. The acute procedural success rate was high in both the ESDV and non-ESDV groups  with rare distal dissection . The target vessel failure (TVF) rate was 16.3% in the ESDV group and 12.1% in the non-ESDV group at a median follow-up of 65 months without significant differences after propensity score matching. Conclusions. PCI using contemporary DES with this modified stenting technique is effective and safe for diffuse CAD with extremely small distal vessels.Background. The optimal percutaneous coronary intervention (PCI) strategy and clinical outcomes of long lesions with an extremely small residual lumen remain unclear. This study aimed to assess the efficacy of a modified stenting strategy for diffuse coronary artery disease (CAD) with an extremely small distal residual lumen. Methods. 736 Patients who received PCI using second-generation drug-eluting stents (DES) \u226538 mm long were retrospectively included and categorized into an extremely small distal vessel (ESDV) group (\u22642.0 mm) and a non-ESDV group (>2.0 mm) according to the maximal luminal diameter of the distal vessel (dsD Substantial clinical evidence supports the efficacy and safety of percutaneous coronary intervention (PCI) using the current generation drug-eluting stents (DESs) for treating long diffuse coronary lesions ,2,3,4,5.Max) measuring \u22642.0 mm treated using the modified stenting technique and current-generation DESs. We sought to evaluate patient outcomes in this at-risk population and compared them with those with a distal lumen of >2.0 mm.In this study, we investigated the acute procedural and long-term clinical outcomes in patients with long diffuse coronary artery disease (CAD) and maximal diameter of the distal segment  group, and the remaining patients were assigned to the non-ESDV group (dsDMax > 2.0 mm). Patients with simultaneous long lesions of dsDMax \u2264 2.0 and dsDMax > 2.0 mm in different vessels were categorized into the ESDV group. The baseline characteristics, risk factors for atherosclerotic cardiovascular disease, comorbidities, and medications of the included patients were obtained from the electronic medical records.Consecutive patients who underwent PCI at Chang Gung Memorial Hospital, LinKou, Taiwan, between January 2010 and December 2017 were screened retrospectively for eligibility. We identified cases from the medical records with at least one long coronary lesion treated with one or multiple overlapping second-generation DESs with a total stent length of \u226538 mm. We excluded patients presenting with ST-segment elevation myocardial infarction (STEMI) or cardiogenic shock. The included patients with dsDThe study was approved by the Institutional Review Board of Chang Gung Memorial Hospital. All the patients underwent standard medical management. The requirement for written consent from patients was waived owing to the retrospective nature of this study.All interventions were performed according to standard techniques, except for the modified stent deployment technique. For lesions with a small distal luminal diameter \u2264 2.0 mm, a modified stenting technique was used . To accoAll patients were pretreated with standard-dose dual antiplatelet therapy before and after the PCI procedure, according to the clinical condition and judgment of the primary care physician.Max \u2264 2.0 and >2.0 mm in different vessels, only events related to the vessel with dsDMax \u2264 2.0 mm were counted. All patients were clinically followed up via clinic visits or telephone interviews.Procedural success was defined as the attainment of residual diameter stenosis of \u226430% and thrombolysis in myocardial infarction (TIMI) flow grade 3 without angiographic dissection. The primary clinical endpoint was target vessel failure (TVF), defined as a composite of cardiac death, target vessel myocardial infarction (TVMI), and clinically driven-target vessel revascularization (TVR). Death was considered cardiac in origin unless obvious noncardiac causes could be identified. TVMI was defined as myocardial infarction that could be related to the target vessel but not to another vessel. TVR was defined as any repeat percutaneous intervention or coronary artery bypass graft (CABG) of any segment of the target vessel. TVR was considered clinically driven if revascularization was performed in patients with ischemic signs confirmed using noninvasive tests or functional assessment, irrespective of the ischemic symptoms. Definite or probable stent thrombosis was defined according to the Academic Research Consortium criteria . For thet-test was used to test continuous variables, and the results were expressed as mean \u00b1 standard deviation (SD). Propensity score matching was performed at a ratio of 1:1 between the groups. The following variables were used in this analytical model: age, sex, smoking status, diabetes mellitus, hypertension, hyperlipidemia, chronic kidney disease, peripheral artery disease, left ventricular ejection fraction < 40%, clinical presentation of MI, history of MI, history of stroke, number of diseased vessels, culprit vessel, left main disease, chronic total occlusion (CTO), moderate-to-severe calcification, duration of dual-antiplatelet therapy, and stent length. The match tolerance was set to 0.01. The survival curve was plotted using the Kaplan\u2013Meier method, and significance was examined using the log-rank test. Univariate Cox proportional hazard analysis was used to evaluate potential predictors of TVF. All variables (p < 0.05) in the univariate Cox regression analysis were then entered into the multivariate Cox proportional hazard model to determine the independent predictors of long-term TVF. p < 0.05 for a two-sided test was considered statistically significant. All statistical analyses were performed using SPSS version 20.0 . The Chi-square test and Fisher\u2019s exact test, if necessary, were used to compare the categorical variables. The two-sample p = 0.019), and a lower prevalence of smoking  compared with the non-ESDV group. The mean dsDMax was 1.7 \u00b1 0.3 mm and 2.7 \u00b1 0.5 mm in ESDV and non-ESDV groups, respectively (p < 0.005). The ESDV group had more CTO lesions than the non-ESDV group .Among the screened patients, 736 were eligible for analysis. Of these, 307 (42%) patients were categorized into the ESDV group and the remaining 429 (58%) into the non-ESDV group. The baseline and angiographic characteristics of the study population are summarized in p < 0.0001). High-pressure post-dilatation was performed in 99.3% of patients in both groups. There was no significant difference in the number of stents . However, patients in the ESDV group had a longer stent length  and a smaller mean stent diameter  than those in the non-ESDV group.Procedural details and outcomes are summarized in p = 0.7). Angiographically detectable distal edge dissection was observed in one (0.3%) patient in the ESDV group and two (0.5%) patients in the non-ESDV group and was successfully rescued by additional stenting in all cases.The acute procedural success rates were similar between the ESDV and non-ESDV groups . The rate of complete follow-up was 94.1% and 96.5% (p = 0.15) in the ESDV and the non-ESDV groups, respectively. As shown in The median follow-up was 65.4 months (interquartile range: 50.9\u201389.8 months) in the ESDV group and 64.5 months (interquartile range: 51.3\u201388.8 months) in the non-ESDV group (p = 0.73) along with cardiac death, all-cause mortality, TVMI, CDTVR, stroke, and stent thrombosis  is another potential treatment for small and very small vessels, and it has been shown to be non-inferior to DES in recent years. However, the lesions treated with DCB in these clinical trials were short (ranging from 10.5\u201323 mm in length) with a relatively larger vessel diameter (ranging from 2.11\u20132.75 mm in size) ,22,23,24Our study had several limitations. First, this was a single-center retrospective study; therefore, it is inherently prone to bias. Because that patients with the long diffuse disease and an extremely small distal lumen represented a small proportion of patients treated with PCI, the patient number in this study was also limited. Seconds, patients estimated by operators to have a high procedural risk may have avoided PCI. The findings of this study cannot be extrapolated to all long ESDV lesions. Third, this study lacked a control group with ESDV treated using the standard stenting technique, which is not feasible in terms of the risk of distal edge dissection. Therefore, we could not conclude any improvement in the outcomes with the modified stenting technique. Fourth, intravascular imaging was performed in a relatively small proportion of patients. Angiography alone was not capable of evaluating atherosclerotic burden and distinguishing between true small vessels and diffuse diseases with small residual diameters. Last, at the segment distal to the stent of the target vessel, significant stenosis could exist because of diffuse atherosclerosis. Stenting was hardly possible for this segment. Even if adjunctive balloon dilation was performed, residual ischemia could remain after the procedure. Further prospective multicenter trials enrolling larger patient numbers with the guidance of intravascular imaging and functional assessment are mandatory to validate the efficacy and safety of this modified stenting technique in treating the long diffuse lesion with an extremely small luminal diameter.The present study demonstrated that PCI using a contemporary DES and a modified stenting technique resulted in high acute procedural success and favorable long-term clinical outcomes in long diffuse coronary lesions with an extremely small residual lumen. Larger prospective studies are required to corroborate the findings of this retrospective analysis."}
{"text": "Cholesterol, lipids, and lipid metabolism are important in prostate cancer. Lipid metabolism interacts with androgens which are of clear importance in prostate cancer. Additionally, lipid metabolism is intimately involved in the interaction between immune and cancer cells. During cancer progression, there are changes in lipid metabolism in both prostate cancer cells and immune cells; furthermore, these cells can interact with each other. Lipids and cholesterol in the circulation also have a role and may prove to be a future target for diagnostic tools and surveillance in prostate cancer. Modulation of lipid metabolism during cancer development and progression is one of the hallmarks of cancer in solid tumors; its importance in prostate cancer (PCa) has been demonstrated in numerous studies. Lipid metabolism is known to interact with androgen receptor signaling, an established driver of PCa progression and castration resistance. Similarly, immune cell infiltration into prostate tissue has been linked with the development and progression of PCa as well as with disturbances in lipid metabolism. Immuno-oncological drugs inhibit immune checkpoints to activate immune cells\u2019 abilities to recognize and destroy cancer cells. These drugs have proved to be successful in treating some solid tumors, but in PCa their efficacy has been poor, with only a small minority of patients demonstrating a treatment response. In this review, we first describe the importance of lipid metabolism in PCa. Second, we collate current information on how modulation of lipid metabolism of cancer cells and the surrounding immune cells may impact the tumor\u2019s immune responses which, in part, may explain the unimpressive results of immune-oncological treatments in PCa. Prostate cancer (PCa) is the most common malignancy among men and either the second or the third most common cause of cancer death in the developed countries . In 2020While localized prostate cancer can often be managed curatively, treatment of advanced disease is based on androgen deprivation since the growth of PCa initially relies on androgens. Unfortunately, PCa eventually develops castration resistance, i.e., its ability to grow and progress despite a low androgen level. Lipid metabolism is known to be disturbed in cancer cells . In addiThe growth and progression of PCa depend on androgen receptor (AR) signaling, which is the target of established oncological treatments of advanced PCa. Activation of AR targets several genes in the lipid metabolic pathway ,6,7. ConIntraprostatic inflammation is another trait associated with PCa and which can be affected by androgens. In humans, androgen deprivation therapy leads to increased infiltration by immune cells into the prostate . In addiInflammation and immune cell infiltration may have dual roles in the microenvironment surrounding cancer cells . While oCancers can be roughly categorized into immunologically hot or cold types based on their immune responses and immunological activity . In immuImmune-oncological (IO) treatments targeted to activate cytotoxic T-cells have mostly failed in PCa treatment; only a minority of patients have exhibited good treatment responses . The mecRecently, research interest has been focused on the possible link between the regulation of lipid metabolism and immune responses. It remains unclear to what degree the altered lipid metabolism in PCa cells modulates the regulation of the immune response, and whether lipid metabolism is reciprocally altered by immune responses. This review assesses the current knowledge about how lipid metabolism interacts with the immune environment around the PCa tumor cells. First, we describe how lipid metabolism is involved in PCa progression. Second, we review current knowledge on how lipid metabolism in surrounding immune cells is altered in PCa and other solid tumors, and how this may impact the regulation of tumor immune responses. Finally, we review how these may be affected by the circulating lipids and cholesterol.Lipid metabolism is upregulated in PCa, especially in the context of castration resistance. Lounis et al.  conducteIn PCa cells, AR modulates the expression of many important genes in the lipid metabolism pathways . Sterol SREBPs act as transcription factors which bind to sterol regulatory element or E-boxes in the promoter area and activate the expression of lipid metabolism-related genes such as low-density lipoprotein (LDL) receptor and HMG CoA synthase and reductase genes . SREBPs Lipid metabolism is also affected by a host of external influences and other metabolic disorders which are too numerous to cover in this article. A review on that topic has been published elsewhere .Because of their crucial role in the regulation of lipid metabolism, SREBPs can be thought of as master regulators of fatty acid and cholesterol synthesis since not only do they induce the activation of FASN, but they also upregulate cholesterol metabolism by inducing the mevalonate pathway . In partThe importance of SREBP activity for prostate cancer growth is now well demonstrated. Preclinical studies have shown that inhibition of SREBP signaling using fatostatin, a compound which blocks the activity of all forms of SREBP by inhibiting the binding of the SCAP protein to SREBP, suppressing cell proliferation in AR-positive prostate cancer cells, decreasing AR-positive prostate tumor growth, and lowering blood PSA in mice. When combined with docetaxel, fatostatin decreased the proliferation and induced cellular apoptosis in AR-negative cells especially if the cells harbored the p53 mutation ,25. FurtFASN likely has a role in PCa progression. In human samples, the expressions of the FASN and androgen receptor variant 7 (AR-V7) were found in many metastatic tumors, highlighting their importance in advanced PCa . The inhThus, in summary, a modulation of lipid metabolism in PCa has been shown to be important especially during cancer progression and the development of drug resistance. The AR regulates lipid metabolism especially by inducing SCAP expression, mandatory conjugates for SREBP activation. SREBPs in turn augment the expression of the AR. Thus, inhibition of SREBPs and FASN can be considered as potential targets for future PCa therapies. Burch et al.  investigIn another study, the lipidome and activity of lipid pathways were characterized in non-cancerous prostate cells and hormone-sensitive, castration resistant, and docetaxel resistant PCa cell lines . While gLi et al.  investigLipidomic changes in liquid biopsies using blood or urine samples have been investigated among PCa patients for the purpose of finding novel biomarkers for PCa detection. In 2000, Filella et al.  noticed Zhou et al.  were ablIn urine and prostate tissue samples, a high ratio of phosphatidylcholines and lysophosphatidylcholines was associated with PCa compared to samples from benign prostate hyperplasia patients in a Japanese trial . Lin et Taken together, the lipidome profile is altered in tissue samples and liquid biopsy specimens of PCa patients as well as PCa cells compared to non-cancerous cells. The lipidome seems to be constantly modulated during cancer progression and castration resistance. Unfortunately, it remains unclear whether a lipidomic change is the cause or consequence of cancer progression. Nevertheless, in the future, either the lipidome or specific lipid species might prove to be prognostic for PCa surveillance and could possibly be used as a diagnostic tool for PCa diagnosis. Distinct from lipid metabolism, cholesterol metabolism also has an important role in prostate tissue and in PCa progression; while benign prostate epithelial cells synthesize cholesterol, it seems that PCa cells accumulate even more cholesterol. The abundance of cholesterol in PCa cells is due to increased cholesterol production de novo and elevated uptake from the circulation ,43. In aIn PCa, it has been shown that in comparison to normal cells, cancer cells are able to produce more cholesterol; the cholesterol producing pathways and cholesterol uptake are upregulated whereas the cholesterol efflux is downregulated. These alterations are known to occur especially during PCa progression . CholestCholesterol metabolism in PCa cells is affected by the interaction with the microenvironment. Co-culturing of PCa cells and cancer-associated fibroblasts (CAFs) in a three-dimensional (3D) culture, gene expression analysis of PCa cells revealed that cholesterol and steroid biosynthesis pathways were upregulated as compared to the state where PCa cells were cultured without the presence of CAFs . EspeciaIn summary, cholesterol is crucial for prostate cancer cells, and its production is upregulated during the development of castration resistance. In addition, cholesterol production likely has an important role in enzalutamide resistance. Cholesterol metabolism in PCa cells is affected by the microenvironment surrounding the tumor.Even though statin treatment in preclinical models seemed to inhibit the growth of tumor cells, one study in experimental animals administered a low-dose of statin (50 nM) and showed opposite results; after low-dose statin treatment, PCa tumors in mice were growing even better than in the untreated mice . These iIt was demonstrated that androgen depletion enhanced the transition of bone marrow stromal cells into adipocytes . AdipocySo far, only a few clinical trials investigating the impact of statin use on prostate cancer progression have been conducted. We performed a clinical trial assessing the impact of high-dose (80 mg daily) atorvastatin administration on prostate cancer tissue and blood markers before prostatectomy . In the Recently Jeong et al.  investigThese trials once again underline the importance of understanding cholesterol metabolism as a whole during PCa progression and indicate that perhaps statins need to be used in high doses in order to elicit beneficial responses in PCa.Fatty acid metabolism is important for tumor development and progression in many ways, such as increasing the synthesis and storage of fatty acids and decreasing lipotoxicity and ferroptosis in tumors . MaintaiFerroptosis is a recently identified new form of programmed cell death. Ferroptosis is caused by the accumulation of iron-dependent lipid peroxides in the cells. Lipid metabolism is the main regulator of this event. The role of ferroptosis in cancer development and progression is under investigation. Ferroptosis might also impact the immune responses against tumors. Thus, targeting the upregulation of ferroptosis in tumor cells might be a good target for cancer treatment, especially in cancers with high lipid metabolism. This topic has been recently reviewed ,64. HereAn evaluation of the RNA-Seq in prostate cancer tumors compared to noncancerous prostate tissue showed that the gene panel of ferroptosis-related genes was differently expressed in tumors as compared to healthy tissue . Based oWhile it is known that AR activation promotes lipid accumulation in prostate cancer cells, intracellular lipid levels were increased even after treatment with enzalutamide, an AR signaling inhibitor . EspeciaIt appears that cancer cells can downregulate ferroptosis via a SREBP1 mediated pathway: in tumors where PI3K\u2013Akt\u2013mTOR signaling is active, SREBP1 is activated, and this protein suppresses ferroptosis . When SRCastration levels of testosterone inhibited the growth of testosterone sensitive PCa cells by inducing ferroptosis which led to increased immune cell infiltration into the tumor site ,70. In pIncreasing ferroptosis by modulation of lipid metabolism in PCa might be a novel target for treatment to enhance the impact of the traditional therapies. The impact of the induction of ferroptosis in the immune environment of the PCa tumor needs further clarification. AR activation can not only induce energy production via glycolysis but also upregulate de novo fatty acid synthesis and fatty acid uptake and oxidation ,73. LipiIn castration resistance, PCa cells typically display over-expression of AR-regulated metabolic genes compared to androgen-sensitive tissues or cells. Thus, interest has been focused on whether lipid metabolic processes could be targeted as a novel treatment for advanced PCa ,78. SeveIn antiandrogen resistance, there is an increased number of glycerophospholipid species with longer and more unsaturated fatty acyl chains detected in PCa cells . FurtherIn summary, fatty acid metabolism appears to be another crucial metabolic factor in castration resistance and may provide a target for reversing of resistance to antiandrogen resistance. Fatty acid metabolism appears to be linked with ferroptosis in PCa.The metabolism and supply of lipids in both prostate cancer cells and immune cells of the tumor microenvironment may be altered at multiple levels. First, the disturbed lipid metabolism in cancer cells may affect the surrounding immune cells. Second, changes in lipid metabolism in the immune cells may affect their activity and reciprocally also affect cancer cells. Third, the supply of lipids from the serum may promote changes in both immune and cancerous cells.In a mouse model of melanoma, gene enrichment analysis of tumors revealed that lipid associated metabolic pathways were enriched in Treg cells in the tumor as compared to cells from peripheral tissue . A furthRecently the role of cholesterol in immune cell regulation in solid tumors has become a focus of research interest. Ma et al. showed that an increased cholesterol content in CD8+ T-cells and in the tumor microenvironment increased the expression of several immune checkpoints, PD-1, 2B4, TIM-3, and LAG-3, and led to T-cell exhaustion . Thus, bMany cholesterol metabolism related enzymes have an impact on the activity of CD8+ T-cells. Yang et al.  showed tChanges in lipid metabolism of immune cells can induce treatment resistance in prostate cancer cells. In a pre-clinical trial exploiting both mice and cell models, El-Kenawi et al.  were ablIn castrated and eugonadal mice fed with an omega-3-enriched diet, the growth of TRAM-C2 cell xenografts was decreased in comparison to mice fed with an omega-6-enriched diet . An omegA summary of studies in this section is collected in Pharmacological interventions targeting lipid metabolism have demonstrated effects on immune cells in the tumor microenvironment in cases of prostate cancer. In the ESTO1 trial, atorvastatin use before prostatectomy did not significantly change the intraprostatic inflammation score compared to placebo when all subjects were analyzed together. However, when the analysis excluded patients who dropped out during the trial (did not use the study drugs), the intraprostatic inflammation score was decreased among statin users in men with high-grade PCa . In the REduction by DUtasteride of prostate Cancer Events (REDUCE) trial, a high level of high-density lipoprotein (HDL) in the serum was associated with a lower risk for acute inflammation in prostate tissue, while serum levels of total cholesterol, LDL, and triglycerides had no impact . On the The Prostate Cancer Prevention Trial (PCPT) randomized men with no known history of prostate cancer to either finasteride, a 5\u03b1-reductase inhibitor of conversion of testosterone to dihydrotestosterone, or placebo. In the placebo arm, chronic inflammation in prostate biopsies was associated with the risk of high-grade PCa . In the Furthermore, a positive correlation between LDL levels and pro-inflammatory (M1) macrophages and a negative correlation between LDL and anti-inflammatory (M2) macrophages was shown in human adipose tissue collected from healthy kidney donors . TreatmeIn addition, exposure to the tyrosine kinase inhibitor, ESK981, decreased tumor growth in prostate cancer cell lines and mouse xenografts by targeting 1-phosphatidylinositol-3-phosphate 5-kinase (PIKfyve), a lipid kinase . InhibitTreatment with ezetimibe decreased the tumor growth of several cancer cells, including prostate cancer cells, in mice . This waThe prostate is surrounded by white adipose tissue called the periprostatic adipose tissue (PPAT). Prostate and PPAT are separated by the prostate capsule, however, the prostate vasculature crosses the PPAT . As PPATPPAT serves as a source of fatty acids for tumor cells. There is some evidence that PPAT can secrete the adipokine, leptin, which might stimulate PCa progression ,111,112.Cholesterol, lipids, and lipid metabolism play key roles in the progression of PCa. While lipid metabolism interacts with AR signaling, in addition it is closely involved in the regulation of the immune system in the tumor microenvironment. Disturbances in the regulation and changes in the properties of PCa cells and immune cells seem to be important during cancer progression. It is evident that PCa cells can influence lipid metabolism in immune cells in the microenvironment of the tumor and vice versa since both cell types are susceptible to changes in the regulation of lipid metabolism. Furthermore, serum lipid profiling might serve as a target for diagnostic tools and surveillance of PCa progression. Thus, it is important to characterize the impact of changes in the regulation of lipid metabolism leading to disturbances in the properties of prostate cancer cells and immune cells in the tumor microenvironment during tumor progression. By clarifying these alterations, we can gain a better understanding of the interaction between PCa and immune responses, thus creating an opportunity to improve the treatment of this life-threatening disease."}
{"text": "Texture has strong expressiveness in picture art, and color texture features play an important role in composition. Together with texture, they can convey the artistic connotation of portrait, especially in oil painting. Therefore, in order to make the picture form oil painting style and oil painting schema, we need to study the texture and color texture in combination with the previous oil painting art images. But now, there are few samples of good oil paintings, so it is difficult to study the texture and color texture in oil paintings. Therefore, in order to form a unique artistic style of modern oil painting and promote the development of modern oil painting art, this paper studies the texture and color texture characteristics in the environment of few oil painting works. This paper establishes a model through deep neural network to extract the image incentive and color texture of oil painting art works, which provides guidance for promoting the development of oil painting art. The experiments in this paper show that the depth neural network has high definition for the extraction of texture and color texture of small sample oil painting images, which can reach more than 85%. It has high guiding significance for the research and creation of oil painting art. For artistic creation, the first thing is to be based on the shoulders of predecessors. Therefore, it is very necessary to study the works created by predecessors, but it is also a difficult problem to fully study the previous works of art, especially the development of oil painting art. From the perspective of iconography, the texture that can best reflect the artistic language in oil painting art can deeply convey the painter's creative thought and emotion . The secIn this paper, the extraction and analysis of texture and color texture features in the image can not only promote the development and creation of modern art, but also promote the development of modern art education. It makes the development of art more rapid but also has internal meaning. Furthermore, the study of texture and color texture features can help to integrate modern and traditional oil painting art, transforming modern painting into an oil painting style. It is more vibrant and creative. The importance of exploring texture in contemporary oil painting is enormous. The texture composition can reflect the creator's style and spirit while also increasing the aesthetic value of the work. From previous people's oil paintings, the logical relationship between texture, color, and texture features is examined. In their respective systems, they create styles. It can aid students in their exploration and creation of oil painting art. It allows people who practise painting to self-diagnose problems with their work and improve their aesthetic ability after viewing the article.In order to make modern art images from oil painting style, many people have studied the texture, color, and texture of images. Liu's image oil painting style transfer reconstruction algorithm based on generative countermeasure network was difficult to train. He proposed an improved generative countermeasure network based on gradient punishment and constructed the total variance loss function to study the migration and reconstruction of image oil painting style. The experimental results show that the algorithm has better performance of image oil painting style migration and reconstruction and better effect of image oil painting style migration and reconstruction . HoweverIn this paper, the research on the formation of oil painting style and graphic analysis has the following innovations: (1) this paper applies deep neural network to how to analyze the texture and color texture features in the image, and constructs a model system based on neural network, which can recognize more accurate texture and color texture features in the case of few samples. (2) In this paper, the texture and color texture of the image are analyzed with the help of neural network model, and then the image schema is analyzed with the algorithm. It enables the oil painting style to be transmitted and promotes the formation of oil painting style. (3) In this paper, a series of experiments are carried out on the research of color texture features. It proves that the model of this paper can promote the development of art biography and the formation of oil painting style.No matter how a painting is handled, it will produce brush texture, so texture is one of the important formal elements of constructing portraits. With its rich artistic expression, it plays an important role in the field of painting and exists in oil painting in a unique form. Through the expression form of its own unique attributes, it shows the aesthetic feeling of vision and form in oil paintings . The texIn The contrast before and after colouring can be seen clearly in Schema is to serve the formal beauty in painting. Schemata can be divided from time, regional environment, cultural background, personal artistic language, and so on. In all paintings, personal artistic language is to combine the things to be painted in the picture according to their feelings, and strengthen their feelings by using the basic rules of composition . PaintinThe three-dimensional characteristics  of naturThe oil painting style is both traditional and contemporary. We must first understand the oil painting style in order to form it in the transmission of modern art. Oil painting styles and genres are diverse, and there have been countless styles since its inception . Every pIn the previous article, we know the importance of texture and color texture to the image, so if we want to form the oil painting style, we need to extract the texture and color texture features of the classic oil paintings. The specific process of extraction is shown in As shown in For the extraction of color texture features in the image, the histogram method of RGB space is generally adopted. The RGB model is the most commonly used color representation method in the computer, and the statistical histogram of the image is a function, which is usually expressed asv represents the color texture features that need to be extracted in the image, and m is the feature dimension of the feature in the RGB model. In order to make the size change of the picture not affect the image feature recognition, this paper normalizes the function. For the color of the image, the RGB model will obtain the statistical histogram of three different colors: R, G, and B, as shown in In the upper form, v) and AW (v) are similar features of the two pictures, then the color similarity of the two images is calculated as follows: G and the characteristic histogram of the image W in the image library.If the histograms intersect, the horizontal axis is generally used to classify each color. The level depends on the depth of the color, and the vertical axis represents the proportion of the color in the Figure. If AG  is smaller, the value of image contrast is smaller, otherwise, it is larger. The calculation of energy will be affected by the gray value of the image, so assuming that the energy is t, the formula isTexture is divided into thickness. For coarse texture, the value of dGW is more concentrated on the diagonal of the image, the value of T will be larger, and vice versa. When the dispersion degree of dGW value distribution in the gray level co-occurrence matrix is different, the entropy value will change. The more dispersed dGW is, the greater the entropy value will be. The calculation formula is as follows:Because the gray value of the image will affect the recognition of the texture features of the image, it is necessary to measure the uniformity of the gray value distribution of the image. When dGW is \u03bba and \u03bbb, and the standard deviation is \u03c7a and \u03c7b, the formula for calculating the correlation isThe correlation is a measure of the linear relationship between image gray levels. Assuming that the mean value in matrix Therefore, as an example, features can be basically extracted, and then roughness is the measurement of texture granularity, fine or rough. The finer the texture, the finer the image, and the grain size is the size of the basic grain of the texture , which c\u03d1 represents the window with coordinates  as the center, R as the radius, Npt represents the clarity of the image, and Y is the threshold, so the image texture features can be extracted through granularity. Therefore, the extraction principles of color texture features and texture texture features are integrated into the depth neural network model. It integrates the color texture features and texture features of the image into the depth neural network model. Through the autonomous learning ability of the model, it no longer needs to extract step by step according to the above principle. It can not only improve the extraction efficiency of image features but also improve the accuracy of similarity and texture roughness. In the depth neural network model, the image contrast is defined asIn the above formula, \u03bba/H4, H is the standard deviation, and the calculation method is as follows:Among them, A4\u2009=\u2009 H is the intensity of image brightness, and P represents the probability of texture appearing in the image with the same roughness. Therefore, in the deep neural network model, the classical oil painting is put into the neural network model, and then the modern works are transmitted to the deep neural network model for comparison. Then, the similarity between color texture and texture characteristics is obtained, and modern works are constantly adjusted to form oil painting style.In the upper form, This experiment will take two pictures as samples and use the depth neural network model constructed in this paper to recognize the texture of the two pictures. One of the samples is a classic oil painting in the model, while the other is a work of modern art. The sample picture is shown in The specific data of each picture in Therefore, the texture of the picture is recognized and extracted in this experiment, and the texture is shown in Taking the pictures in the above experiment as samples, the above A, B, C, and D pictures have different brightness. Therefore, this experiment first identifies the color similarity of the same picture under different brightness. Taking the diagonal of the picture as the benchmark, the measurement data record of similarity is shown in In In order to better measure the recognition of color features and texture features in this model, this experiment also makes similarity statistics on the color and texture features of the same picture of different pixels in the sample, as shown in In combination with Through the experiment of this paper, the model constructed in this paper plays a very important role in the formation of oil painting style. The texture extraction of oil painting is in place, which can clearly see how the painter writes in the process of painting. This model can find out the gap between classical oil paintings and modern art works by comparing the color characteristics, texture, and texture characteristics. It can help painters approach the oil painting style purposefully and promote the formation of oil painting style in modern art creation. At the same time, the analysis of the texture and other characteristics of the image is the analysis of the schema, and the model in this paper has a good effect on the schema analysis.This paper understands the texture characteristics of oil painting. The texture of oil painting can clearly see the trend of painters' brushes in their creation. A careful study of the texture of classic paintings can be of great help to artistic creation. The artistic expression of oil painting is very strong, especially in the matching of colors. The collocation is very strong, and some have a great visual impact. In the painting materials of oil painting, the roughness of texture produced by the thickness of pigment is different. Therefore, some that need to be distinguished can be reflected by the thickness of the pigment. Therefore, the integration and development of oil painting style and modern art can promote the development of modern art. Schema is very important in portrait, and point, line, and surface lighting constitute the basic structure of portrait. In addition, illustration is essential to the art of painting, especially in the modeling and placement of things in the portrait. This reflects the overall artistic effect of the portrait, so the schema can also be carefully analyzed to promote the development of modern art. Through the experiment of this paper, it can extract and recognize the texture and color texture features in oil paintings, and analyze the schema composition in oil paintings. This model can further compare the gap between classical oil painting and modern art works, and automatically make modern works close to oil painting style and promote the formation of oil painting style. It can also make a very detailed analysis of the schema.This paper explores the role of texture and color texture in the portrait. Texture is the most direct way for oil painting to convey the painter's thoughts and feelings, and it is also the best way to convey the artistic effect of portrait. Color texture can bring great visual impact to people. Therefore, this paper makes a theoretical reasoning on how to form oil painting style and graphic analysis. This paper also constructs a deep neural network model to facilitate the extraction of image texture and color texture features so as to facilitate the graphic analysis in modern creative art and the formation of oil painting style. And the experiment of this paper proves that through the combination of the recognition principle of image color and texture features and the depth neural network model, we can well compare the gap of modern art in oil painting style and promote the formation of oil painting style. However, the research on oil painting texture and color texture features in this paper will still be affected by many uncertain factors. It is hoped that future research can overcome the influence of uncertain factors."}
{"text": "To compare our initial perioperative and postoperative outcomes of the modified anterior approach (MA) with Retzius space preservation robot-assisted radical prostatectomy (RARP) with the standard anterior approach (SA) RARP.A retrospective analysis was performed on 116 patients with RARP completed by the same surgeon between September 2019 and March 2022. They were divided into SA-RARP group (77 cases) and MA-RARP group (39 cases). Propensity score matching was performed using eight preoperative variables, including age, BMI, preoperative PSA, biopsy Gleason score, prostate volume, D\u2019Amico risk classification, SHIM, and clinical T stage. Functional outcome was assessed by urine pad count and SHIM after surgery, and oncological outcome was assessed by statistics of postoperative pathological findings as well as follow-up postoperative PSA. The median follow-up was 13 months and 17 months for MA-RARP and SA-RARP groups respectively.Propensity score matching was performed 1:1, and baseline data were comparable between the two groups after matching. Comparison of postoperative data: MA-RARP group had less mean EBL than SA-RARP group . PSM did not differ between groups (p = 1). In terms of urinary control recovery, the MA-RARP group showed significant advantages in urinary control recovery at 24\u00a0h, 2 weeks, 1 month and 3 months after catheter removal, respectively . This advantage gradually disappeared 6 months or more after surgery. The median time to recovery of sexual function was shorter in the MA-RARP group .MA-RARP is safe and reliable, and can achieve better early urinary control function and sexual function recovery while achieving the primary tumor control goal. Among them, 39 patients underwent modified anterior approach to preserve Retzius space. There were 77 cases in the standard anterior approach group. Patients who had previously undergone surgery for transurethral resection of the prostate (TURP) or neoadjuvant androgen deprivation therapy (ADT) were excluded from the group.2.2via the retzius space as proposed by Menon\u2019s team in 2003 , prostate specific antigen (PSA), puncture biopsy Gleason score, number of positive puncture stitches and percentage of positives, and assessed patients\u2019 D\u2019Amico risk classification. All patients underwent preoperative multiparametric magnetic resonance imaging (MRI) or computed tomography (CT), as well as whole-body bone scan imaging to assess clinical TNM stage, and a statistical survey of sexually active patientssexual health index for men (SHIM). Data on operative time, estimated blood loss (EBL), whether blood was transfused. The fication . PostopePatients were treated perioperatively in the usual way at our institution. The Foley catheter was removed 7 to 8 days after surgery in the MA-RARP group; the Foley catheter was removed 8 to 10 days after surgery in the SA-RARP group. Patients with stage \u2264 pT2, Gleason score \u2264 7 and negative incision margins were not ADT. follow-up data on urinary control at 24 hours, 2 weeks, 1 month, 3 months and 6 months after removal of the urinary catheter were counted  ). Analys2.4via applying non-parsimonious and multivariate logistic regression. Finally, 35 patients in the SA-RARP group were successfully matched to patients treated with MA-RARP in a 1:1 ratio in accordance to the nearest neighbor matching method within the matching strategy(matching tolerance =0.03). The covariate differences were compared before and after matching to delineate the improved balance between the procedure arms after PM.A PM analysis was performed to eliminate the impact of significant differences in preoperative clinical characteristics between the SA-RARP and MA-RARP groups. All preoperative features were taken into account to estimate the propensity score Matching resulted in 35 cases included in each group, for a total of 70 cases in our study. Descriptive statistics were performed for all variables. Categorical variables were expressed as number of cases and percentages, and differences between the two groups were assessed using chi-square tests and Fisher\u2019s exact tests, as appropriate. And continuous variables were expressed using mean and standard deviation (SD) or median and interquartile range (IQR), as appropriate, and continuous variables were analyzed using Student t-test or the MannWhitney U test, as appropriate. All statistical analyses were done using IBM SPSS Statistics version 26.0. All tests were two-sided, with a significance set at p<0.05.33.1Among the 39 patients in the MA-RARP group, 35 patients were finally included in the MA-RARP group because 2 patients had a history of TURP surgery and 2 patients underwent ADT after biopsy diagnosis of prostate cancer. After 1:1 matching of patients in the SA-RARP group, age, BMI, presurgical PSA, biopsy Gleason score, prostate volume, D \u2018Amico risk classification, SHIM, and clinical T stage were comparable Table\u00a01.3.2The mean surgical EBL was less in the MA-RARP group than in the SA-RARP group . Postoperative hospital stay  and catheter removal time  were shorter in the MA-RARP group. The incidence of postoperative complications was not statistically significant between the two groups Table\u00a02.3.3There was no significant difference in PSM between the two groups (p=1). Gleason score and pathological TNM stage were not significantly different between the two groups . However, in the MA-RARP group, all the 4 cases with positive surgical margins were at T3 stage and at high risk according to D \u2018Amico risk classification. Among them, 3 cases had positive sites at the tip, and 1 case had positive sites at the tip and bottom. In terms of pelvic lymph node dissection, there was no statistical significance between the two groups: 17 patients in the MA-RARP group and 19 patients in the SA-RARP group underwent enlarged pelvic lymph node dissection, and postoperative pathology indicated that one patient in the two groups had positive lymph nodes, respectively. The PSA data of 66, 58 and 55 patients were collected by outpatient review or telephone follow-up at 1 week, 3 months and 6 months after operation, and the results showed that there was no significant difference in PSA values between the two groups . The number of patients with BCR was comparable between the two groups during 7-36 months of follow-up  Table\u00a03.3.4For recovery of urinary control, 24\u00a0h after catheter removal in the MA-RARP group , 2 weeks , 1 month , 3 months  had a significant advantage in urinary continence, which gradually disappeared at 6 months or longer after surgery Table\u00a03.4Modified anterior approach preserving the retzius space RARP is modified from the standard anterior approach technique using a non-vascular clip technique. Various types of vessel clips are usually used to reduce bleeding on the cutting surface and maintain clear visual field when the lateral vascular pedicle of the prostate is dissociated by standard anterior approach. For a small amount of bleeding in the modified anterior approach, the use of low-energy electrocoagulation for precise hemostasis can avoid the symptoms of lower urinary tract irritation, perineal pain, hematuria and urination obstruction caused by vascular clamps around the bladder and urethra. At the same time, the non-vascular clip technique is helpful for the early recovery of sexual function. Another major improvement is the use of bladder neck preservation technique: standard anterior approach is usually performed by pulling the catheter to confirm the position of the bladder neck and disconnecting it directly; After the position of the bladder neck was confirmed by the modified anterior approach technique, the bladder sphincter fibers covered by the prostate were exposed by the combination of sharp and blunt separation, and then the bladder neck was severed to preserve the funnel shape of the bladder neck, which was helpful for the recovery of early postoperative urinary control. In addition, the modified anterior approach was performed as a complete intrafascial resection. The intrapelvic fascia is not opened, and the DVC is not dissected or sutured. Ganzer et\u00a0al. demonstrated that at the tip of the prostate and 5\u00a0mm distal to the tip of the prostate, the DVC overlapped laterally with 37% and 30% of the urethral sphincter, respectively. In the case of lateral DVC ligation, most of the sphincter tissues may be ligated together and render them non-functional . TherefoThe prostatic plexus, intrapelvic fascia, Pubic prostatic ligament, detrusor apron and other periurethral support structures were preserved by the modified anterior approach to preserve the Retzius space robot-assisted laparoscopic radical profascial prostatectomy. Compared with SA-RARP, MA-RARP could shorten the postoperative hospital stay  and accelerate the time of catheter removal , and MA-RARP significantly reduced EBL . There was a more advantage in urinary flow control in the first 3 months after surgery , but this advantage gradually disappeared with the extension of postoperative time. This is consistent with the conclusions of Albisinni et\u00a0al. in their systematic review of the efficacy of the anterior approach versus robot-assisted radical prostatectomy with Retzius retained . In termIt is well known that preservation of tissue structure during surgery results in better postoperative urinary flow control and sexual function recovery than structural reconstruction. The modified anterior approach retained Retzius space technique and Student et\u00a0al. performed advanced reconstruction of vesico-urethral support (urine control rate was 62.5% at 4 weeks after surgery) , PorpiglA modified anterior approach preserving the Retzius space robot-assisted laparoscopic radical intrafascial resection of prostate cancer has shown good early urinary control and recovery of sexual function, probably due to the intraoperative preservation of the structures associated with the Retzius space. structures such as the prostatic plexus, the intrapelvic fascia, the pubic prostatic ligament, and the detrusor apron in the Retzius space are closely associated with Urinary control and erectile function are closely related . The visRegarding the mechanism by which preservation of the Retzius space facilitates early recovery of urinary control. A recent study by Chang et\u00a0al. confirmed that patients who retained the Retzius space RARP had a low postoperative bladder mobility, most of the structures adjacent to the membranous urethra were intact, and the bladder neck presented a more anatomical position after surgery . Kadono The study also has several limitations. 1) Although it was a study of propensity to match scores, which minimized baseline differences between the two groups of data, the results of this analysis were limited by residual selection bias, attrition bias, and possible confusion due to the lack of prospective randomization associated defects between the SA-RARP and MA-RARP groups. 2) Although the distribution of nerve sparing techniques among the groups may be a meaningful confounder, it was not summarized in our study because the anatomical methods of neurovascular bundles differ between surgical techniques, making it impossible to make a pure comparison. 3) Our findings are limited to a single center and a single surgeon\u2019s experience, and a well-designed multicenter randomized controlled trial is needed to determine the stronger advantages of a modified anterior approach to preserve the retzius space RARP.5In conclusion, the modified anterior approach preserves the Retzius space for robot-assisted laparoscopic radical prostatic intrafascial resection with less surgical steps, less difficulty, and a short learning curve. Compared with the standard anterior approach, the support and suspension structure of the posterior pubic space can be preserved. Compared with the posterior approach, it has a clearer surgical field and is easier to locate anatomical landmarks. This technique is safe and feasible, and it can better preserve the anatomical structure around the urethra, thus better preserving urinary control and sexual function. Since this procedure is an intrafascial resection technique, it is suitable for patients with early localized prostate and small prostate size. At the same time, we are looking forward to more large sample and multi-center clinical data to further verify the efficacy and safety of this technology.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.HL is the first author. RC, YZ, KW are co-corresponding authors. CY and ZL also contributed to this article. All authors contributed to the article and approved the submitted version."}
{"text": "Copy Number Variations (CNVs) in the human genome account for common populational variations but can also be responsible for genetic syndromes depending on the affected region. Although a deletion in 5p is responsible for a syndrome with highly recognizable phenotypical features, other chromosomal abnormalities might overlap phenotypes, especially considering that most studies in 5p use traditional cytogenetic techniques and not molecular techniques.The authors have investigated 29 patients with clinical suspicion of 5p- syndrome using Chromosomal Microarray (CMA), and have gathered information on previous tests, clinical signs, symptoms, and development of the patients.The results showed 23 pure terminal deletions, one interstitial deletion, one deletion followed by a\u00a03\u00a0Mb duplication in 5p, three cases of 5p deletion concomitant to duplications larger than\u00a020\u00a0Mb in chromosomes\u00a02, 9, and\u00a018, and one 5p deletion with a chromosome\u00a0Y deletion. CMA showed relevant CNVs not typically associated with\u00a05p- that may have contributed to the final phenotype in these patients.The authors have identified three novel rearrangements between chromosomes\u00a05\u00a0and\u00a02 (Patient\u00a027), 5\u00a0and\u00a018 (Patient\u00a011), and\u00a05\u00a0and\u00a0Y (Patient\u00a022), with breakpoints and overlapped phenotypes that were not previously described. The authors also highlight the need for further molecular investigation using CMA, in different chromosomes beyond chromosome\u00a05  to explain discordant chromosomal features and overlapped phenotypes to unravel the cause of the syndrome in atypical cases. The incidence of this syndrome in the general population is\u00a01/15,000 to\u00a01/50,000 live births.,The consequences of this syndrome involve the presence of Intellectual Disability (ID), difficulty breastfeeding (poor suction), difficulty gaining weight during the first years, failure to thrive and communicate verbally, short stature, and also some facial features such as microcephaly, ocular hypertelorism, short philtrum and microretrognathia.,The main cytogenetic technique used in Brazil to investigate suspicion of\u00a05p-\u00a0syndrome is the G-banded karyotype. Although most of the cases involve deletions larger than\u00a010\u00a0Mb and can be seen using the G-banded karyotype, several cases of translocations with other chromosomes remain unsolved, either because of the G-banding pattern or the size of the deletions. In these cases, other molecular techniques are needed. Fluorescence In Situ Hybridization (FISH) and Multiplex Ligation-dependent Probe Amplification (MLPA) is straightforward and precise tools for molecular cytogenetics. However, both require a previous suspicion of the chromosomes that can be involved in the rearrangement for the selection of the target probes or kits, respectively.In this study, the authors analyzed CMA results for\u00a029\u00a0patients with confirmed\u00a05p-\u00a0deletion using cytogenetic molecular testing, and highlighted one case of a deletion followed by duplication in\u00a05p with an unusual phenotype and three atypical cases of complex rearrangements unsolved by the karyotype that required CMA for the complete molecular diagnosis and that were not previously described.Instituto da Crian\u00e7a, Hospital das Cl\u00ednicas \u2012 Universidade de S\u00e3o Paulo (ICr\u2010HCFMUSP) or in the annual national meetings of families of\u00a05p- carriers held in the city of S\u00e3o Paulo between\u00a02015\u20122019. The inclusion criteria were the presence of a high-pitched cry since birth or the detection of the\u00a05p\u00a0deletion using G-banded karyotype, MLPA, FISH, or chromosomal microarray.A cohort of\u00a029\u00a0patients with a clinical diagnosis of\u00a05p-\u00a0syndrome  were selected for this study. All enrolled patients were invited for this study during clinical evaluation by geneticists at the Unit of Clinical Genetics \u2012 To perform CMA, the authors started with an initial input of\u00a020\u00a0ng/\u03bcL concentration of DNA. Genomic DNA was isolated from peripheral blood lymphocytes using a commercially available DNA isolation kit  following the manufacturer's instructions. The quality and quantity of the DNA samples were determined using Qubit Fluorometer (Invitrogen), and the integrity of the DNA was ascertained via agarose gel electrophoresis analysis.CMA was performed for all samples. Twenty-five samples were performed using the Infinium CytoSNP\u2010850K BeadChip, and four samples were analyzed through other platforms.Illumina's recommended protocol was followed, and the raw data were analyzed using BlueFuse\u2122 Multi v4.4 . The genomic positions are given as mapped to the GRCh37/hg19 genome build.https://projects.tcag.ca/variation/), the Database of Chromosomal Imbalance and Phenotype in Humans Using Ensembl Resources , The Clinical Genome Resource (ClinGen) the UCSC Genome Bioinformatics database (http://genome.ucsc.edu), National Center for Biotechnology Information  and Pubmed for publications. The genomic positions are reported according to their mapping on the GRCh37/hg19\u00a0genome build.All the CNVs detected were analyzed according to the most recent American College of Medical Genetics guidelines2 ratio is at least\u00a0\u22120.41 for deletions and +0.32 for duplications and a minimum size of\u00a03\u00a0Mb and\u00a0500\u00a0consecutive probed modified to consider it a Region of Homozygosity (ROH).The following criteria were used to filter the CNVs in BlueFuse\u2122 Multi: no predefined minimum size for a CNV, the need for at least ten consecutive deleted or duplicated probes to assume a CNV as real, ratio cutoff values considered valid when logPreviously, the authors have reported the results of\u00a014\u00a0patients with different deletions in\u00a05p that enabled the detection of a new genomic region that might be associated with the high-pitched cry and microcephaly.After CMA was performed, the authors detected pure terminal deletions in\u00a023\u00a0patients, one interstitial deletion in\u00a05p, one deletion followed by a\u00a03\u00a0Mb duplication in\u00a05p (Patient\u00a05), three cases of deletion concomitant to a large duplication (>20\u00a0Mb) between chromosomes\u00a05\u00a0and\u00a09 (Patient\u00a09), 5\u00a0and\u00a02 (Patient\u00a027), 5\u00a0and\u00a018 (Patient\u00a011), and one case of\u00a05p deletion with a chromosome\u00a0Y deletion (Patient\u00a022).Patient\u00a05 presented, in addition to the\u00a05p deletion, a duplication in the region adjacent to the breakpoint of the deletion [her CMA result was arr[GRCh37] 5p15.33p13.3(25328_29305055)x1, 5p13.3(29320222_32402232)x3] A. The clIt was identified that Patient\u00a011 inherited a derivative chromosome from a maternal complex translocation rearrangement involving chromosomes\u00a05, 10 and\u00a018 . The combination of data available about previous results and the results after CMA provided some insights into the architecture of the derived chromosome, as shown in Patient\u00a011 is the daughter of healthy non-consanguineous parents. During pregnancy, a\u00a020-week ultrasound detected intrauterine growth restriction, and at\u00a024-weeks, pericardial effusion was detected. At\u00a028-weeks, a fetal echocardiogram suggested the presence of tetralogy of Fallot. Then it was detected muscular ventricular septal defects and interatrial communication . The patient was born at\u00a036-weeks with neonatal jaundice, hypotonia at birth, difficulty breastfeeding, low oxygen saturation, and brief shaking episodes in upper and lower members (an epileptiform activity that required medication). Among her recent previous health conditions, she had recurrent respiratory infections and bronchoscopy, and had to use supplemental oxygen (0.1\u00a0L/min).This patient presented severe developmental delay , microcephaly, ocular hypertelorism, slanted eyelid slit down, epicanthal folds, short filtrum, microretrognathia, microstomia, gastroesophageal reflux, mild clinodactyly, syndactyly in toes, second and third finger overlapping.At birth, Patient\u00a022 presented high-pitched cry, difficult breastfeeding, and ocular hypertelorism. During his first year, several clinical tests were conducted: brain MRI showed hypoplasia of the corpus callosum with mild prominence of the lateral ventricles. Other types of testing were conducted , showing no alterations. During childhood, two episodes of pneumonia, several episodes of bronchitis and throat infections were described by the mother.His clinical features included facial asymmetry, epicanthal folds, prominent nasal bridge, dysplastic ears, high palate, microretrognathia, and gastroesophageal reflux. All features mentioned are expected for\u00a05p- syndrome.Patient\u00a027 presented low weight at birth and a high-pitched cry. Several episodes of pneumonia and recurrent respiratory infections during early childhood were mentioned by the mother. The patient cannot communicate verbally, but she understood commands and could communicate using some specific signs. She presented facial asymmetry, ocular hypertelorism, epicanthal folds, prominent nasal bridge, low implantation ears, downturned mouth, and microretrognathia. She presented congenital heart abnormalities such as bicuspid aortic valve, interatrial communication, and ventricular septal defect.As previously reported, the authors have detected some interesting features about a phenotype-genotype association and inferred a new region as responsible for the cat-like cry and evidence of microcephaly.A deeper investigation, including more patients with\u00a05p-\u00a0syndrome phenotype, has revealed rearrangements between chromosome\u00a05 and other autosomes (chromosomes\u00a02\u00a0and\u00a018) and Y chromosome that was not previously reported, bringing light to the possibility of new genomic rearrangements involved in\u00a05p-\u00a0syndrome, usually investigated alone with no further inspection in other co-occurring CNVs.SEMA5A and CTNND2 can lead to ID and autistic spectrum behaviors when both genes are deleted.,CDH18, CDH12, CDH10, CDH9, CDH6), deleted in varying proportions in patients with\u00a05p, also suggest the high susceptibility to the manifestation of the autistic spectrum.The short arm of chromosome\u00a05 contains approximately\u00a0120\u00a0protein-coding genes.The authors have identified that all patients presented ID, but autism could not be assessed since the patients were not evaluated by psychologists and specialists in autism. But yet, some features that the authors have identified as the presence of irritability in\u00a070.4%\u00a0(19/27) of the patients, self-injury in\u00a067.9% (19/28), and aggressive behaviors in\u00a057.1%\u00a0(16/28) might be an indication of autism traits.TRIO are associated with ID with microcephaly in an autosomal dominant pattern. This gene is highly expressed in the developing brain. Intragenic mutations, with consequent loss of function, have been associated with moderate intellectual disability combined with characteristics of the autistic spectrum, hyperactivity, and/or aggressive behavior. In addition, Nguyen et\u00a0al.TRIO mutations that presented recurrent infections probably due to decreased expression of this gene in the early stages of neuronal development and have also shown that the knockdown of TRIO in rats impact on the development of neurites, filaments originating from neuronal cells, and synapse formation.,TRIO, only a few reports about specific variants.Mutations in Concomitant duplications and deletions on the same chromosome, as seen in Patient\u00a05, have already been identified on other autosomal chromosomes and may be associated with overlapping features.16FYB gene could be involved in epileptogenesis, despite the fact that it was inherited from a healthy father and without this feature. Therefore, although Patient\u00a05 in this study does not have the\u00a05p13.1 region involved in duplication, restricting duplication to the\u00a05p13.3 region alone, the authors cannot rule out the responsibility of this region in the occurrences of epilepsy since data on duplication of\u00a05p and its association with epilepsy are still lacking.Patient\u00a05 was one of the four patients in this study who had seizures, which might be associated with\u00a05p duplication since seizures are not often described for\u00a05p- syndrome. Kluger et\u00a0al.The authors have detected four cases of patients  that showed\u00a05p- concomitant to other large CNVs, ranging from\u00a020.6\u00a0Mb (Patient\u00a09) to\u00a048.2\u00a0Mb (Patient\u00a011), from different chromosomal origins . The pic,An interesting fact is that those four patients presented seizures, which are not a typical manifestation of\u00a05p-\u00a0syndrome. Once the authors performed the CMA analysis, other CNVs candidates were detected as the causative origin of the seizures. Patient\u00a09, with a\u00a020.6\u00a0Mb duplication in\u00a09p, was previously reported.This is a unique case regarding the breakpoints of a\u00a024.2\u00a0Mb 5p deletion (5p15.33p14.2) and a 48.2\u00a0Mb 18q duplication (18q12.1q23) A, that wOther cases of complex chromosome rearrangements maternally inherited have been reported before. Pan et\u00a0al.18\u00a0trisomy is a well-described syndrome, also known as Edwards syndrome. The main characteristics of the syndrome include facial and skeletal dysmorphisms with emphasis on the claw closed hand, with overlapping fingers that are generally underdeveloped. They also present feeding difficulties, congenital heart and kidney abnormalities.Patient\u00a022 is a 5-years old boy that presents a\u00a017.8\u00a0Mb deletion in 5p (5p15.33p15.1) and 44.5\u00a0Mb deletion in Yq (Yq11.21q12). The remaining chromosomal fragment of the\u00a0Y\u00a0chromosome was translocated to the deleted region in\u00a05p (and very likely to have generated a dicentric chromosome based on the breakpoints), indicating a karyotype of\u00a045, X, that did not match the visible normal male genitalia nor the clinical features for 5p- syndrome of the patient. After karyotype, MLPA, FISH, and CMA were conducted, the rearrangement was uncovered B.,This is a case of clinical relevance because few cases of men with translocations between chromosomes\u00a05\u00a0and\u00a0Y were published over the past\u00a030\u00a0years, one of which is described in a mosaic .Generally, microdeletions on the\u00a0Y\u00a0chromosome are associated with male infertility and azoospermia.The last case of rearranged chromosomes was Patient\u00a027, a\u00a05-years old girl that initially had a 46, XX G-banded karyotype result, and only by using CMA it was possible to observe that, in fact, she presented a\u00a015.6\u00a0Mb 5p\u00a0deletion (5p15.33p15.1) and a\u00a023.3\u00a0Mb 2p\u00a0duplication (2p25.3p24.1), rearranged in a way that the\u00a02p duplication was positioned in the deleted segment of\u00a05p and could not be distinguished earlier because the banding pattern on G-banded karyotype was similar to what is expected for the short arm of chromosome 5 CThere is not much literature available on the phenotypic effect of isolated duplication of\u00a02p in patients, and it is usually seen with other chromosomal alterations. The phenotypes described in individuals with\u00a02p duplication are associated with low weight, hypertelorism, low nasal bridge, ocular malformations, small jaw, low implantation ears, short neck, difficulty breathing, among others,A case similar to ours regarding cytogenomic findings is the report of molecular characterization of two brothers with the trisomy of 2p24.3-pter and monosomy of 5p14.3-pter, inherited in a paternal manner, in which one of the brothers has spina bifida as a defect of the formation of the neural tube.de novo, as the authors have shown in atypical cases. Here, the authors presented the cases of three patients with classical clinical findings for\u00a05p- syndrome (Patient\u00a022) or overlapped and atypical phenotype, as the presence of seizures (Patient\u00a011\u00a0and\u00a027), but without the molecular rearrangements expected for the syndrome. This emphasizes that this syndrome can manifest in other forms rather than the pure\u00a05p deletion, and full molecular investigation in rare syndromes must be conducted by geneticists and physicians to clarify clinical features observed in patients with unexplained karyotypes or phenotypic overlap.Previous studies carried out to identify deletions in\u00a05p used classical cytogenetics techniques, such as karyotype and FISH, as breakthrough analysis devices. CMA stands out for a more precise delineation of breakpoints, revealing small CNVs not detected on G-banded karyotypes and allowing the inference of rearranged chromosomes inherited from balanced translocations or originated The study was approved by the Institutional Review Board Ethics Committee for Analysis of Research Projects HCFMUSP/CAPPesq (CAAE:\u00a062322416.7.0000.0068) and written consent was obtained from all the participants and/or their parents.All data generated or analyzed during this study are included in this article and its supplementary material files. Further inquiries can be directed to the corresponding author.This work was supported by FAPESP (Funda\u00e7\u00e3o de Amparo a Pesquisa do estado de S\u00e3o Paulo), grants number\u00a02016/09452\u20100 and\u00a018/02385-0, and FINEP (Financiadora de Estudos e Projetos) grants number FINEP/CT\u2010INFRA\u201001/2011.Samar Nasser Chehimi: Formal analysis, Writing \u2013 original draft. Vanessa Tavares Almeida: Methodology, Validation. Amom Mendes Nascimento: Methodology, Validation. \u00c9velin Aline Zanardo: Methodology, Validation. Yanca Gasparini de Oliveira: Methodology, Validation. Gleyson Francisco da Silva Carvalho: Validation, Writing \u2013 review & editing. Beatriz Martins Wolff: Validation, Writing \u2013 review & editing. Marilia Moreira Montenegro: Validation, Writing \u2013 review & editing. Nilson Ant\u00f4nio de Assun\u00e7\u00e3o: Funding acquisition, Resources. Chong Ae Kim: Resources, Methodology. Leslie Domenici Kulikowski: Visualization.The authors declare no conflicts of interest."}
{"text": "Pre-pregnancy BMI (PP BMI) and gestational weight gain (GWG) are prominent anthropometric indicators for maternal nutritional status and are related to an increased risk of adverse pregnancy outcomes. This study aimed to determine the factors affecting total GWG, PP BMI and pregnancy outcomes among pregnant women in West Sumatra, Indonesia.This observational analysis was conducted among healthy women in the Vitamin D Pregnant Mother (VDPM) cohort study. A total of 195 pregnant women and their newborn babies were enrolled, and information regarding their socio-demographic characteristics, obstetric history, dietary intake and anthropometric data were assessed through direct interviews. Furthermore, the Institute of Medicine (IOM) 2009 guidelines were used to obtain the total GWG.p\u2009=\u20090.011) than those whose weight was normal. Furthermore, women with excessive GWG were 27.11 times more likely to have a baby with macrosomia  (p\u2009=\u20090.001) and those with inadequate GWG were 9.6 times more likely to give birth to a baby with low birth weight (LBW)  (p\u2009=\u20090.002).PP BMI was used to categorise the 195 pregnant women as overweight/obese (43.1%), normal (46.7%) and underweight (10.2%). There were 53.3%, 34.4% and 12.3% of women who had inadequate, adequate and excessive GWG, respectively. The multinomial logistic regression model indicated that overweight or obese women at the pre-pregnancy stage were 4.09 times more likely to have an excessive rate of GWG (AOR\u2009=\u20094.09, 95% CI: 1.38\u201312.12, This study demonstrates that the malnutrition status prior to pregnancy and inadequate or excessive GWG status during pregnancy as significant risk factors for developing adverse pregnancy outcomes. These findings highlight the importance of providing information, preconception counselling and health education on weight management for healthy pregnancies.The online version contains supplementary material available at 10.1186/s12884-022-04815-8. Pre-pregnancy BMI (PP BMI) is a factor in a healthy pregnancy  and idenWomen should strive to gain the appropriate weight during pregnancy as this is critical for the growth of the fetus. However, there is a scarcity of data on the investigation of gestational weight gain (GWG) in Indonesia. As identified by the Basic Health Research Survey (Riskesdas) in 2018, the prevalence of overweight, obesity and central obesity status among the adult Indonesian population was 13.6%, 21.8% and 31%, respectively . Recent Pregnancy outcomes such as birth weight, length and head circumference are vital indicators of a newborn\u2019s general health . Low birThis study used prospective data collection and subjects from the Vitamin D Pregnant Mother (VDPM) cohort study in West Sumatra \u201316. It wThe sample size was calculated based on the VDPM cohort study, which identified the association between maternal vitamin D status and LBW  among 23The inclusion criteria included: 1) Minangkabau pregnant women that visited public health care facilities at each site, 2) aged 18\u201340, 3) currently in the first trimester of pregnancy (<\u200913\u00a0weeks), 4) healthy based on a general practitioner examination, and 5) willing to participate by signing the informed consent form and following the study protocol. Meanwhile, the following were excluded from the study: pregnant women with a stillbirth, abortion, congenital disabilities, pre-eclampsia, severe anaemia, hypothyroidism, those suffering from chronic diseases such as diabetes mellitus, hypertension, abnormal heart function and glandular thyroid disease, and multiple gestations. All of the participants were monitored from the first trimester to the delivery process to determine outcomes such as birth weight, length and head circumference.Data characteristics were collected from the socio-demographic questionnaire, including age, working status, pregnant women\u2019s education level and monthly household income. This study also recorded maternal characteristics such as parity status, levels of maternal nutrition knowledge and other physical activity indicators such as the duration and status of outdoor activity. Data were collected from mountainous and coastal areas. Public health centres with a high number of first-trimester pregnant women were also chosen for the data collection. The participants\u2019 pregnancy history was obtained from the Maternal and Child Health (MCH) book, a home-based health record for pregnant women and children. The handbook can be used to monitor health, keep track of healthcare utilisation, promote maternal and neonatal education and provide information when either the pregnant woman or child is referred . Data onBuku KIA). The MCH handbook is often considered the only record book for health workers. Each pregnant woman had an MCH handbook from the beginning of their pregnancy until the baby reached five years of age [Pre-pregnancy body weight was collected through the participants\u2019 interviews and reports from the pregnant women\u2019s MCH handbook  [PP BMI was estimated as the standard formula weight (kg) divided by the square of body height (m) using the self-reported pre-pregnancy weight . Subsequ(Table 1), the participants gained inadequate, adequate or excessive weight during pregnancy. In comparison to the International BMI classification (white Europeans), Asian populations have 3 to 5 per cent higher total body fat and a high correlation with health risks such as type 2 diabetes and cardiovascular disease [Total GWG was calculated and compared with the IOM-recommended weight increase to determine the adequacy of weight growth during each trimester. The IOM guidelines state the following categories for recommended GWG: 12.5\u201318\u00a0kg for underweight, 11.5\u201316\u00a0kg for normal weight, 7\u201311.5\u00a0kg for overweight, and 5\u20139\u00a0kg for obese, as shown in Table  disease . This meMost pregnancy weight gain occurs in the second and third trimesters. Therefore, this study was conducted to identify the differences in dietary intake and food consumption in pregnant women during the third trimester as compared to the daily recommendations. Dietary intake data were assessed using the semi-quantitative food frequency questionnaire (SQFFQ) developed by Lipoeto et al. in 2004 and explained in the previous publication , 27. ThiThe newborns\u2019 birth weight data were recorded in the MCH handbook using a digital baby weight scale , while the length was measured to the nearest millimetre using a stadiometer . Newborn anthropometry status was classified according to the WHO Child Growth Standards for 1) head circumference for age: small head circumference,\u2009<\u200935\u00a0cm and normal head circumference,\u2009\u2265\u200935\u00a0cm; 2) weight for age: LBW\u2009<\u20092,500\u00a0g and normal birth weight\u2009\u2265\u20092,500\u00a0g; and 3) length for age: short birth length,\u2009<\u200950\u00a0cm and normal birth length,\u2009\u2265\u200950\u00a0cm . AdditioAll survey data were analysed and cleaned using IBM SPSS Statistics for Windows . Descriptive statistics provided basic information about the variables, with both numeric and categorical data. These data were presented as the mean levels of continuous variables as a mean\u2009\u00b1\u2009SD, while numbers and percentages were used for the numeric and categorical data.The association between PP BMI and pregnancy outcomes was used to identify the effects of these two variables. The indicators of pregnancy outcomes were classified into continuous and categorical data. Pregnancy outcomes in the form of continuous variables were total GWG, birth weight, birth length, head circumference, gestational age (GA) at delivery and number of antenatal care (ANC) visits, while the categorical variables were status of inadequate weight gain, spontaneous vaginal delivery, Caesarean section, low-birth-weight status, macrosomia, and SGA and LGA status. Furthermore, the independent variables were PP BMI, obstetric history, demographic and socio-economic characteristics, dietary intake and maternal nutrition knowledge, while the dependent variables were GWG status and pregnancy outcomes.p-value smaller than 0.25 and other variables of known clinical relevance could also be included for further multivariable analysis. PP BMI, maternal nutrition knowledge levels and duration of outdoor activity were selected for further multivariate analysis as they had a p-value\u2009<\u20090.25. The first logistic regression models were used to estimate the odds ratio (OR) of the dependent  and independent  variables. The second regression model was used to identify the association between one independent (PP BMI) and the dependent variables . The third regression model was used to identify the association between another independent  and dependent variable (pregnancy outcomes). Furthermore, adjusted odds ratios (AOR) were reported for categorical outcomes, adjusted mean differences were reported for education level for women, and geographical status, maternal age and parity were selected as confounding factors. A p-value with a significance of less than 0.05 was considered statistically significant.A chi-square test analysed the categorical data, and a one-way ANOVA was used to compare the dependent  and independent effects of known risk factors such as dietary intake, education level, socio-economic characteristics, demography, PP BMI and obstetric history. Meanwhile, a While the VDPM cohort study recruited 232 women, only 195 were eligible and included in the study sample. Therefore,195 women and their offspring were analysed after cleaning the dataset and excluding other incomplete data during the follow-up observations from the first trimester to delivery. Figure\u00a0This study found that the mean age of the pregnant women was 29.7\u2009\u00b1\u20095.6\u00a0years. They were mainly in the secondary and tertiary education levels and thus relatively few of them had low levels of education, although the majority (67.7%) had no working status. About 73.8% had a monthly household income greater than or equal to the minimum wage. Most of the participants, 57.4%, engaged in no outdoor activity, while about 76.4% had a parity status of primiparous. Most of the women\u2019s PP BMI was in the normal range, followed by the underweight category, at 46.7% and 43.1%, respectively. The majority had an inadequate GWG status compared to the GWG recommendation. The average energy intake was 2,433.5\u2009\u00b1\u2009706.7\u00a0kcal/day, less than the recommended energy adequacy rate in the third trimester, which should be 2,500\u00a0kcal/day . Just ovp-value\u2009<\u20090.001). Subsequently, multinomial logistic regression indicated that women with an overweight or obese status were four times more likely to have an excessive GWG rate  than those with normal weight status. However, this study also found that women with an overweight/obese PP BMI status had an inadequate total GWG status , as indicated in Table Bivariate analysis was used to determine the factors associated with total GWG during pregnancy Table . This stp\u2009=\u20090.001). Women with a PP BMI\u2009<\u200918.5 had a GWG mean difference of -0.05\u00a0kg (95% CI: -0.38\u20130.29.3) compared to those with a PP BMI of 18.50\u201322.99\u00a0kg/m2 . Overweight women with a PP BMI of 23.00 to 27.49 had a GWG mean difference of 0.55\u00a0kg (95% CI: 0.31\u20130.79) compared to those with normal BMI. Furthermore, the participants with an obese PP BMI status had a GWG mean difference of 1.6\u00a0kg (95% CI: 0.87\u20131.45). A similar result was reported in the relationship between PP BMI and birth weight outcomes, where PP BMI status was significantly associated with newborn birth weight status (p\u2009=\u20090.029).The association between pregnancy outcomes and PP BMI status is presented in Table , head circumference (p\u2009=\u20090.029), low-birth-weight status (p\u2009=\u20090.002) and macrosomia status (p\u2009=\u20090.001). Women with inadequate GWG status gave birth to babies with a birth weight 187.3\u00a0g lower than those who had adequate weight gain. However, women with excessive GWG status had babies that weighed 208.4\u00a0g more than those with adequate status. Subsequently, women with inadequate GWG status were found to have babies with a head circumference 1.01\u00a0cm smaller than those with adequate status. Women with excessive GWG status gave birth to babies with a head circumference 0.25\u00a0cm smaller than women with adequate GWG status during pregnancy. Moreover, women with inadequate GWG status were 10.3 times more likely to have given birth to a baby with macrosomia than those with adequate status. By contrast, women with excessive GWG status were 27.11 times more likely to deliver a baby with macrosomia than those with adequate status.According to recommendations from the IOM, Table p\u2009<\u20090.001) as a factor determining GWG status. Adverse pregnancy outcomes were associated with inadequate or excessive GWG in mothers with low or high PP BMI compared to those with normal status . In this study, adverse outcomes such as LBW and macrosomia were associated with insufficient and excessive GWG. Our findings, if replicated in future studies, may have a significant public health impact in terms of initiating strategies to raise awareness of the importance of PP BMI and GWG in preventing adverse pregnancy outcomes.PP BMI and GWG reflect maternal nutritional status before and during pregnancy. The indicators can also be used to predict fetal growth and development. This study shows that socio-economic characteristics, demography, pregnant women\u2019s education levels, working status, dietary intake and obstetric history were not significantly associated with GWG status. However, PP BMI was significantly associated with GWG  babies than those with adequate weight. Another study conducted by Thapa and Paneru in 2017  found thMoreover, several other aspects might lead to a poor outcome when PP BMI is not carefully maintained . In anotProspective data collection was used, and the participants came from diverse regions of West Sumatra, including different places of residence such as coastal, mountainous, urban and rural areas. The study further used the Asia-specific BMI category to measure the association of PP BMI with pregnancy outcomes. One limitation was the small participant sample size with which to represent the West Sumatran population. By the end of the data collection, nearly 30% of the participants were lost to follow-up from those initially recruited. A further limitation was that the PP BMI data were collected during the first trimester, and the pregnant women were expected to remember their body weight. This self-reported pre-pregnancy weight was obtained from the MCH book of each mother. Therefore, using the IOM\u2019s GWG classification was also a limitation during this study as the IOM guidelines may not be relevant for certain populations, such as Asian women. As a theoretically controllable factor that can enhance outcomes, improved maternal nutrition both before and during pregnancy would be an ideal use for this study in a low-to-middle-income country such as Indonesia. Further studies should be pursued with larger sample sizes and more comprehensive approaches highlighting the interaction of nutritional status, the food environment and socio-economic factors with pregnancy outcomes.Maternal PP BMI and total GWG were significantly related to offspring size. Women who had overweight/obese nutritional status had fourfold increase to have an excessive GWG during pregnancy as well as were twice as likely to have higher birth weight and macrosomia outcomes compared to women with lower PP BMI and GWG. In addition, women who had inadequate GWG during pregnancy had ten times increased risk of low-birth-weight outcome compared to those with adequate GWG status. These findings support the importance of improving the health care services and facilities for women of reproductive age. Additionally, they highlight the need to create preconception counselling or health education to manage weight gain and reduce the risk of adverse pregnancy outcomes due to lower PP BMI and excessive GWG.Additional file 1. Additional analysis pregnancy outcomes in relation to PP BMI based on international WHO BMI category.Additional file 2. Additional analysis pregnancy outcomes in relation to GWG according to IOM recommendation-based International WHO BMI classification."}
{"text": "The rapid growth of wireless communication systems has led to high demand for the design of microwave/millimeter components with multiband characteristics, high performance, and ease of integration with other devices ,2,3. RecIn this Special Issue, we target the latest technology and developments in microwave/millimeter system components and aim to overcome technical challenges by bringing together academics and industrial researchers to identify and discuss novel results within this continuously evolving field. The goal of this Special Issue is to stimulate the community by addressing the key issues on the topic in the hope that antennas and filters will make a greater impact in our society. The 19 published papers in this volume have presented cutting-edge research findings. In total, 17 papers have discussed antennas, MIMO antennas, and RFID, and two of them discussed filters. The submitted papers are from authors from different countries, including Australia, China, Egypt, India, Iraq, Ireland, Italy, Jordan, Malaysia, Morrocco, Pakistan, Palestine, Saudi Arabia, Spain, Turkey, and the United Kingdom. Novel techniques have been reported in this issue for the development of filters and antennas. Multiple-input multiple-output (MIMO) antennas are of great interest due to their attractive features. Five published papers have discussed the design of MIMO antennas for 5G, ultra-wideband (UWB), and other wireless applications. Ultra-wideband (UWB) technology is widely used in many communication scenarios. However, narrowband systems can easily interfere with a UWB system, which generates multipath fading. In order to solve these interferences and meet the design requirements of high isolation of multiple-input multiple-output (MIMO) antennas, two MIMO antennas with double-notch structures are designed (contribution 1). Firstly, two U-shaped slots are etched on the radiating patch and feeder to achieve notch characteristics in WiMAX and ITU bands. Using this antenna element, a two-element antenna is put symmetrically in parallel, and two rectangular branches are loaded to improve the isolation. The size is 0.57\u03bb \u00d7 0.32\u03bb \u00d7 0.013\u03bb (at 2.5 GHz). Then, a four-element antenna is designed to meet the requirements for another application; here, each element is placed orthogonally to each other, and the isolation is improved by loading a cross-shaped branch in the middle of these elements. The size is 0.57\u03bb \u00d7 0.57\u03bb \u00d7 0.013\u03bb. Both antenna samples are tested to verify the design. The measurement results show that the working bandwidths are 2.45\u201314.88 GHz and 2.14\u201314.95 GHz, the isolations are greater than 17 and 20 dB, and the peak gains are 5.7 and 5.9 dBi for the two- and four-element MIMO antennas, respectively. Compared to the references, the designed antennas have a wider bandwidth and a higher gain and radiation efficiency. They are well-suited for diverse wireless applications. 0 \u00d7 0.42\u03bb0) (\u03bb0 was the wavelength at the first lower frequency). A square-shaped defected ground framework was placed on the ground to improve the isolation. Etching square-shaped slots on the ground plane achieved the return losses S11 < \u221210 dB and a 26 dB isolation in the entire operating band of 3.2\u201312.44 GHz (UWB (3.1\u201310.6 GHz) and the X-band (8\u201312 GHz) spectrum and achieved good isolation bandwidth of 118.15%. The MIMO performance was evaluated in terms of diversity gain (DG), envelope correlation coefficient (ECC), Channel Capacity Loss (CCL), and mean effective gain (MEG).In another work, a 4 \u00d7 4 miniaturized UWB-MIMO antenna using FR-4 material with reduced isolation was designed and analyzed using characteristic mode analysis (contribution 2). To minimize the antenna\u2019s physical size and to improve the isolation, an arrangement of four symmetrical radiating elements was positioned orthogonally. The antenna dimension was 40 mm \u00d7 40 mm . The proposed antenna system consisted of two types of antenna modules: an L-shaped antenna module covering the C-band (3.4\u20133.6 GHz) for 5G mobile applications and a folded monopole module for the 5G/WLAN mobile application band (4.5\u20135.9 GHz). Each two antennas formed a pair, six pairs in total, forming a 12 \u00d7 12 MIMO antenna array, and the elements between the antenna pairs could achieve an isolation of 11 dB or more without additional decoupling structures. The experimental results showed that the antenna could cover the 3.3\u20133.6 GHz and 4.5\u20135.9 GHz bands with an overall efficiency greater than 75% and an envelope correlation coefficient of less than 0.04. Finally, the one-hand holding mode and two-hand holding mode were discussed to demonstrate their stability in practical applications, and the results showed that they still exhibited good radiation and MIMO performances when operating in both modes. 3, making it desirable for devices operating in 5G bands. High isolation (>15 dB) was attained with thorough testing without employing a decoupling scheme in the design. Laboratory measurements resulted in a peak gain of 3.49 dBi and an efficiency of around 80% in the entire operating band. The evaluation of the presented MIMO multiband antenna was carried out in terms of ECC, DG, total active reflection coefficient (TARC), and CCL. The measured ECC was less than 0.04, and the DG was well above 9.50. The observed TARC was also lower than \u221210 dB, and the CCL was below 0.4 bits/s/Hz in the entire operating band.Another design of multiband MIMO antennas along with high-isolation characteristics using FR-4 material has been proposed (contribution 4). It operates at the 3.50 GHz, 5.50 GHz, and 6.50 GHz frequencies for 5G cellular, 5G WiFi, and WiFi-6, respectively. The two-element MIMO multiband antenna was miniaturized to 16 \u00d7 28 \u00d7 1.6 mmAl-Khaylani et al. presented a novel design of a reconfigurable MIMO antenna array of a 3D geometry-based solar cell integration that operated at sub-6 GHz for self-powered applications in a 5G modern wireless communication network (contribution 5). The proposed antenna array provided three main frequency bands around 3.6 GHz, 3.9 GHz, and 4.9 GHz, with excellent matching impedance of S11 \u2264 \u221210 dB. The proposed MIMO array was constructed from four antenna elements arranged on a cubical structure to provide a low mutual coupling, below \u221220 dB, over all frequency bands of interest. Each antenna element was excited with a coplanar waveguide (CPW). The proposed radiation patterns were controlled with two optical switches of Light-Dependent Resistors (LDRs). The proposed antenna array was fabricated and tested experimentally in terms of S-parameters, gain, and radiation patterns. The maximum gains were found to be 3.6 dBi, 6.9 dBi, and 3.5 dBi at 3.6 GHz, 3.9 GHz, and 4.9 GHz, respectively. It was realized that the proposed array realized significant beam forming by splitting the antenna beam and changing the main lobe direction at 3.9 GHz after changing LDR switching statuses. Such an antenna array was found to be very applicable for femtocell wireless communication networks in 5G systems.In this Special Issue, three of the published papers are related to reconfigurable antennas and their applications for wireless communications. The first paper presents a reconfigurable wideband monopole antenna for cognitive radio and wireless applications (contribution 6). The reconfigurability was achieved by four varactor diodes embedded in the band pass filter (BPF) structure, which was integrated with the suggested antenna through its feed line. The simulated impedance characteristics coped with the measured characteristics after fabricating the suggested model with/without the reconfigurable BPF. Furthermore, the model achieved the desired radiation characteristics in terms of radiation pattern with acceptable gain values at the selected frequencies within the achieved frequency range (1.3\u20133 GHz). 2. The proposed antenna provides an acceptable matching impedance with S11 \u2264 \u221210 dB at 3.7 GHz, 4.6 GHz, 5.2 GHz, and 5.9 GHz. The antenna radiation patterns are evaluated at the frequency bands of interest with a gain average of 9.1\u201311.6 dBi. Moreover, four optical switches based on LDR resistors are applied to control the antenna gain at 5.85 GHz, which is found to vary from 2 dBi to 11.6 dBi after varying the value of the LDR resistance from 700 \u2126 to 0 \u2126, in a descending manner. It has been found that the proposed antenna provides an acceptable bit error rate (BER) with varying the antenna gain in a very acceptable manner in comparison to the ideal performance. Finally, the proposed antenna is fabricated to be tested experimentally in free space and close to the human body for portable applications. Similarly, the third design introduced a reconfigurable MIMO antenna array of a 3D geometry-based solar cell integration that operates at sub-6 GHz for self-power applications in a 5G modern wireless communication network (contribution 5). The antenna radiation patterns are controlled with two optical switches of Light-Dependent Resistors (LDRs).The second paper presents a novel antenna structure constructed from cascading multi-stage metamaterial (MTM) unit cells-based printed monopole antenna for 5G mobile communication networks (contribution 7). The proposed antenna is constructed from a printed conductive trace that fetches four MTM unit cells through four T-Resonators (TR) structures. Such a combination is introduced to enhance the antenna gain-bandwidth products at sub-6GHz bands after exiting the antenna with a coplanar waveguide (CPW) feed. The antenna circuitry is fabricated by etching a copper layer that is mounted on a Taconic RF-43 substrate and has an effective area of 51 \u00d7 24 mmTwo published papers in this Special Issue have discussed dielectric resonator antennas (DRAs) to achieve circular polarization behavior. The first design discussed a wide dual-band circularly polarized (CP) operation for deployment in indoor radio links and INSAT applications (contribution 8). The metasurface and DRs are hosted above a grounded substrate, which is fed through a single coaxial feed placed at a specific angle, employing a modified upper probe of the coaxial fee to enhance the antenna performance. The proposed hybrid technique utilizes the combined benefits of the feed angle and a well-matched metasurface, resulting in performance improvements. Notably, a measured impedance bandwidth of 88.1% for |S11|is achieved within the frequency range of 4.0 GHz to 10.3 GHz. Furthermore, the antenna design exhibits two overlapping, measured at 3 dB axial ratio (AR) bandwidths: 23.62% from 4.25 GHz to 5.4 GHz and 5.12% from 7.6 GHz to 8 GHz. The peak gain of the antenna is measured at 8.4 dBic. The second design presented a novel approach to design a circularly polarized (CP) hemispherical dielectric resonator antenna with a wide axial ratio (AR) bandwidth by incorporating an additional dielectric substrate between the antenna and the ground plane for 5G communication (contribution 9).In addition to the above-mentioned research work, in this Special Issue, nine novel antennas and filter designs have been presented for various wireless and 5G communication technologies. Zhai et al. proposed a quasi-Yagi antenna with resistor-loaded arms to obtain a filtering response with four radiation nulls (contribution 10). The embedded resistor-loaded arms achieved two additional radiation nulls caused by reverse currents and absorbed the unwanted out-of-band resonant points brought by themselves. The director close to the driver provided a resonant point and a radiation null caused by opposite currents between the driver and the director. Compared with other filtering quasi-Yagi antennas, the proposed design could achieve a filtering response with a compact size along the end-fire direction. A balun-integrated prototype covering the 5G band N78 (3.3\u20133.8 GHz) showed a 10 dB impedance-matching bandwidth of 22.9% (3.21\u20134.04 GHz), four radiation nulls, and a peak gain of 4.73 dBi. Another design introduced a high-gain UWB Vivaldi antenna loaded with artificial electromagnetic material, suitable for ground-penetrating radar (GPR) systems (contribution 11). The artificial electromagnetic units affected the antenna radiation waves by changing the refractive index to enhance the antenna\u2019s directivity. Moreover, four Vivaldi units were arranged into a horn-shaped array, and each of the two units were orthogonally fed to realize dual polarization.A compact-size UHF RFID tag antenna using slot apertures and capacitive gaps with large reads was ranged for outdoor localization applications (contribution 12). The effects of capacitive slots and gaps on the impedance matching between conventional industrial chips and a designed RFID antenna were investigated. Alternatively, a multi-frequency antenna loaded with a ring structure has been presented (contribution 13). The patch consists of resonator structures, and the ground plate consists of a bottom metal strip and three ring-shaped metals with regular cuts to form a defective ground structure to be operated for 5G NR , 4GLTE (1.6265\u20131.6605 GHz), Personal Communication System (1.85\u20131.99 GHz), Universal Mobile Telecommunications System (1.92\u20132.176 GHz), WiMAX (2.5\u20132.69 GHz), and other communications frequency bands. Similarly, another design introduced a multiband planar inverted L-C implantable antenna with SAR values within the safety limits with maximum allowable input power (contribution 14). The proposed antenna operates at low power levels and supports an energy-efficient solution. Additionally, the SAR values are within the safety limits, with a maximum allowable input power (8.43 mW (1 g) and 47.5 mW (10 g) at 402.5 MHz; 12.85 mW (1 g) and 47.8 mW (10 g) at 2.45 GHz; and 11 mW (1 g) and 50.5 mW (10 g) at 2.95 GHz). A wideband graded effective refractive index (GRIN) dielectric lens antenna for 5G mm-wave band applications has been presented (contribution 15). The inhomogeneous holes in the dielectric plate are perforated to provide GRIN in the proposed lens.A UWB monopole antenna with an octagonal patch was fed with a 50 \u03a9 line and with a triple band notch feature (contribution 16). In this design, an L-shaped stub, an inverted C-shaped slot, and a pair of U-shaped resonating structures are introduced into the design, which allows the antenna to generate three band notches at 3.22\u20133.83 GHz, 4.49\u20135.05 GHz, and 7.49\u20138.02 GHz, corresponding to the WiMAX band, Indian national satellite (INSAT) band, and X-band satellite frequencies, respectively. Dayo et al. presented a miniaturized high-performance flower-shaped radiator (FSR) (contribution 17). The antenna can be used for modern smartphones\u2019 connectivity with the sub-6 GHz frequency spectrum of modern 5G mobile communication applications. Furthermore, an antenna pair for mobile terminals using a type of coupling feed planar antenna and a wide band coupling suppression has been proposed (contribution 18). The process of band expansion comes from a dual-band antenna pair and is based on characteristic modes theory (CMA). The multiple defective ground structure (DGS) is introduced for isolation enhancement. Another work has introduced a flexible method for designing a bandpass filter (BPF) using pixel structure and genetic algorithm (GA) optimization (contribution 19). The pixel structure is made up of a grid of metallic microstrip stubs, and the GA is utilized to determine the connections between these stubs. Furthermore, these designs are designed, fabricated, and measured with good trends between the outcomes, which support their ideas to be utilized in different wireless applications.We hope that this Special Issue on antennas and filters will offer readers a good overview of the current state-of-the-art developments in these fast-growing areas of research, as well as an introduction to some of the newest techniques developed in this field."}
{"text": "A multi-frequency microstrip antenna loaded with a ring-like structure has been proposed. The radiating patch on the antenna surface consists of three split-ring resonator structures, and the ground plate consists of a bottom metal strip and three ring-shaped metals with regular cuts to form a defective ground structure. The proposed antenna works in six different frequency bands covering 1.10, 1.33, 1.63, 1.97, 2.08, and 2.69 GHz and works entirely when connected to 5G NR , 4GLTE (1.6265\u20131.6605 GHz), Personal Communication System (1.85\u20131.99 GHz), Universal Mobile Telecommunications System (1.92\u20132.176 GHz), WiMAX (2.5\u20132.69 GHz), and other communications frequency bands. Moreover, such antennas also have stable omnidirectional radiation properties across different operating frequency bands. This antenna meets the needs of portable multi-frequency mobile devices and provides a theoretical approach for the development of multi-frequency antennas. In recent years, with the rapid development of wireless communication technology, wireless communication equipment is widely used in satellite navigation ,2,3, wirIn recent years, various approaches have been developed to design and produce multi-frequency antennas. The main methods include the multilayer method ,23,24, sIn this paper, we introduce a new multi-frequency antenna structure, which can realize the function of the multi-frequency antenna at six frequency points. This method can improve the design of multi-frequency communication equipment.The geometry of the antenna simulation model is shown in LC resonances occur in the metal rings [The radiation patch on the front of the antenna structure consists of three split-ring resonator structures. When an electromagnetic wave is incident on an open resonant ring, the initially stable magnetic field induced by the incident wave changes and the magnetic field induces an induced current in the metal ring. The induced current flows over the metal ring such that the metal ring has an equivalent inductance. Moreover, due to the accumulation of charges between the metal rings, the metal rings generate equivalent inductance, and al rings . Accordial rings .(1)f0=[SRRL is the overall inductance of the SRRs, which is formed by the metal ring inductors in series with the current direction. SRRC is the overall capacitance of the SRRs equivalent circuit. SRR2R is the equivalent conductor loss, the shunt resistance. Its size is related to ring width g, metal thickness t, and metal material \u03c1.Here, the S is:n = 3 is a ring number.The capacitance of the open resonant ring SRRIn the open resonant ring structure, the resonance effect is mainly generated by the outer ring. The inner ring is used to strengthen the coupling between the inner and outer rings so that the total capacitance of the open resonant ring structure is increased to achieve a shift of the resonant frequency to a lower frequency.1R, the middle split-ring resonator radius is 2R, and the outer split-ring resonator radius is 3R The inner, middle, and outer radii of the proposed radiation patch are proposed from [0f is the lowest resonant frequency of the proposed antenna, and The inner split-ring resonator radius is sed from .(5)R3=211) curve corresponding to the antenna evolution process.To explain the motives for developing the multi-frequency antenna, we show the process of antenna design more precisely. It should be emphasized that it is a common method to realize multi-frequency antennas by using multi-loop structures. Therefore, we compare the results of several multi-loop antennas here. 11) is less than \u221210 dB. 11) at the resonant points at 1.10, 1.32, and 2.07 GHz exceed 10 dB but new resonant points are added at 1.63, 1.97, and 2.9 GHz, indicating that the antenna has a multi-frequency capacity and can operate simultaneously in six bands from 0 to 3 GHz.As shown in To better understand the reason for the multi-frequency radiation properties of the antenna, the surface current distribution of the antenna was simulated and analyzed at the following six frequencies: 1.10, 1.33, 1.63, 1.97, 2.08, and 2.69 GHz. The results are shown in As shown in 11) of the antenna is measured by an Agilent vector network analyzer under normal experimental conditions and compared with the simulation results. First, the microstrip line of the antenna is welded to the SMA joint matching the impedance of 50 \u03a9. Then, the network analyzer is connected to a coaxial cable with the same impedance matching and calibrated in the order of open circuit-short circuit-load. After the device calibration, the antenna is connected with a coaxial cable and tested. The measurement of the antenna is shown in To verify the performance of the antenna, we use an electromagnetic computer simulation (CST) microwave studio to simulate and analyze the antenna parameters. The actual return loss , 4GLTE (1.6265\u20131.6605 GHz), Personal Communication System (1.85\u20131.99 GHz), Universal Mobile Telecommunications System (1.92\u20132.176 GHz), WiMAX (2.5\u20132.69 GHz), and other communication frequency bands. The antenna also has excellent omnidirectional radiation properties in different operating frequency bands, which meet the requirements of portable multi-band mobile devices and are of practical engineering interest and utility."}
{"text": "The recent resurgence of new-generation reconfigurable technologies delivers a plethora of various applications in all public, private and enterprise solutions over the globe. In this paper, a frequency reconfigurable polarization and pattern diverse Multiple-Input-Multiple-Output (MIMO) antenna is presented for indoor scenarios. The MIMO antenna is comprised of twelve radiating elements, and polarization and pattern diversity is obtained by arranging them in three different planes: Horizontal Plane (HP), Vertical Plane-I (VP-I), and Vertical Plane-II (VP-II). The proposed antenna operates in mode I (wideband) and mode II (multiband), by combining two different radiators using PIN diodes. The antenna dynamically switches between Mode I (wideband) and mode II (multiband). Mode, I cover the ultra-wideband (UWB) range from 2.3 to 12\u00a0GHz, while mode II covers GSM (1.85\u20131.9\u00a0GHz), Wi-Fi and LTE-7 (2.419\u20132.96\u00a0GHz), 5G (3.15\u20133.28\u00a0GHz and 3.45\u20133.57\u00a0GHz), public safety WLAN (4.817\u20134.94\u00a0GHz), and WLAN (5.11\u20135.4\u00a0GHz) frequency bands. The peak gain and efficiency of the MIMO antenna are 5.2\u00a0dBi and 80%, respectively. However, these significant challenges are due to multipath propagation, which reduces the signal-to-noise ratio and affects link reliability due to polarization mismatch. The fading effect can be mitigated by introducing spatial diversity at the transceivers. Therefore, Multiple-Input-Multiple-Output (MIMO) diversity antennas are used in wireless transceivers to improve communication reliability8. From the literature of similar research works, MIMO antennas are categorized as wideband14, multiband17, and integrated20, which is a combination of wideband and multiband.Due to rapid advancements in the wireless world, to resolve connectivity issues, high data rates, power constraints, miniaturization, and multi-serviceability. Antenna modules have to support transmission and reception simultaneously to provide uninterrupted service to the user. Especially indoor scenarios such as shopping malls, airports, universities, industries, schools, hospitals etc., encounters more connectivity issues9, a quad-element MIMO antenna that covered the 5G band and the C-band in two different states using an LC tank circuit was reported. In10, a slot-based quad-element MIMO antenna was developed for cognitive radio applications. However, the antenna lacked polarization diversity. In11, a compact MIMO antenna was designed to cover the ultra-wideband (UWB) range with a notched band at 5.5\u00a0GHz. In12, an antenna array covering the UWB was reported, and a narrow slot was introduced to achieve high isolation between the unit cells. In13, a four-element UWB MIMO antenna with high isolation between antenna elements was proposed. In14, an eight-port 3-D UWB MIMO antenna with polarization was presented. In15, an eight-element MIMO/diversity antenna was reported with WLAN rejection, which covered the 3G, 4G, and 5G frequency bands. In16, a two-element multiband antenna with decoupling structures was developed for the smartphone. In17, a four-element MIMO antenna with a meandering, and split-ring resonator was reported with high inter-element isolation. However, the majority of above reported MIMO antennas had complicated geometry, and large size, and employed complex decoupling structures.Wideband MIMO antennas are widely used in modern wireless systems due to their multiple advantages, including high data rate transmission and low power consumption. In18, a twelve-port MIMO antenna was reported with five pairs of single and dual band antenna elements and two UWB antenna elements. In19, a MIMO antenna with twelve elements was reported for UWB, GSM, and Bluetooth standards. In20, an eight-element frequency reconfigurable polarization diversity IMA was designed for vehicular communication applications. However, the antenna designs reported in20 had a large size, limited functionality, and limited diversity. The present-day modules must support a wide range of wireless communication standards, integrating a large number of resonating elements with the smallest possible antenna size and minimum inter-element interference. Therefore, reconfigurable antennas could be suitable for indoor scenarios as they are adaptable to user demands. The reconfigurable IMA benefits in the following ways: (i) integrating more radiators in a small space, (ii) enabling multi-serviceability by changing the frequency, pattern, and polarization22, (iii) improving dynamic spectrum accessibility based on user demand25, and (iv) offering filtering characteristics within the MIMO antenna to avoid interferences. Also, metasurface-based concepts were reported in28 to improve the antenna performance.Recently, Integrated MIMO Antennas (IMA) have received a lot of attention due to their high-speed data transmission and multi-serviceability. These antennas offer both wideband and narrowband characteristics and are useful for IoT modules. However, only a few IMA designs, integrating multiple bands into a single entity, are reported in the open literature. InIn this research, a twelve-port frequency reconfigurable MIMO antenna is presented for high scattering environments to offer 360\u00b0 coverage. The proposed antenna is comprised of two radiators: Radiator-I, a modified U-shaped patch that covers the entire UWB spectrum, and radiator-II, which is made up of meandering lines  to support multiple wireless standards, including 2G, 4G, 5G, Wi-Fi, Public safety WLAN and WLAN. Also, the twelve antenna elements are oriented in a 3-D fashion to minimize the probability to occur polarization mismatch and coverage issues in ultra-dense environments.\u00ae software, and the antenna dimensions (in mm) are as follows: L\u2009=\u200926, W\u2009=\u200926, r1\u2009=\u20093, r2\u2009=\u20095.5, l1\u2009=\u20094.9, l2\u2009=\u20095.75, l3\u2009=\u200913, l4\u2009=\u20098.5, l5\u2009=\u200915.5, l6\u2009=\u20096, l7\u2009=\u20092.5, l8\u2009=\u20096.55, l9\u2009=\u200912, l10\u2009=\u200913, l11\u2009=\u20093.25, l12\u2009=\u200910.2, l13\u2009=\u20098.5, l14\u2009=\u20092.25, l15\u2009=\u20096.75, l16\u2009=\u20091, l17\u2009=\u20091, l18\u2009=\u20093.5, l19\u2009=\u20091.8, l20\u2009=\u20091.77, l21\u2009=\u20091.37, w1\u2009=\u20093, w2\u2009=\u20091.5, w3\u2009=\u20093, w4\u2009=\u20090.35, w5\u2009=\u20090.25, w6\u2009=\u20090.55, w7\u2009=\u20090.5, w8\u2009=\u20090.25, w9\u2009=\u20090.5. The equivalent circuit of the PIN diode is shown in Fig.\u00a0m\u2009=\u2009(w\u2009+\u2009l)\u2009\u00d7\u2009p; where p denotes the distance between the radiator and the ground plane, W and l denote the length and width of the proposed antenna, respectively.The schematic of the antenna element is shown in Fig.\u00a0The radiator-I demonstrates the UWB (mode I) operation of the proposed antenna element. Figure\u00a0The radiator-II demonstrates the multiband (mode II) operation of the proposed antenna element. The evolution of the radiator-II and reflection coefficients during the development stages are depicted in the Fig.\u00a0The proposed multiband radiator offers hexa-band resonance, covering a wide range of wireless applications such as 2G, 4G, 5G, Wi-Fi, Public safety WLAN, and WLAN. The proposed antenna element achieves dual functionality by integrating the diode D2. When diode D1 is forward biased and diode D2 is reverse biased, the antenna will radiate over the UWB spectrum. On the other hand, when diode D2 is forward biased and diode D1 is reverse biased, the antenna switches to mode II and radiates over the six bands. The current density plots of radiator I and radiator II are presented in Fig.\u00a0RLC circuit, either parallel or series, based on the impedance characteristics of the antenna as in29. The three parallel resonant circuits connected in series correspond to the UWB radiator and the six series resonant circuits connected in parallel correspond to the multiband radiator. The reflection characteristics of the equivalent circuit are shown in Fig.\u00a0The equivalent circuit of the proposed antenna element is presented in Fig.\u00a030 techniques are becoming increasingly important in addressing the multipath fading effects that degrade signal quality. The probability of signal fading is higher in indoor scenarios due to the existence of multiple obstructions. Hence, the polarization of the signal may change, lowering the signal quality while receiving it.MIMO/diversityIn such a situation, polarization-diverse antennas are strongly recommended to avoid polarization mismatches and increase link reliability. In this work, a twelve-port IMA is proposed with multiple polarization vectors to encounter signal losses. The schematic of the MIMO antenna is shown in Fig.\u00a0The following subsection presents the reflection, coupling and gain characteristics of the twelve-port IMA.Figure\u00a0\u03bb0, where \u03bb0 is calculated at the lowest operating frequency. In both UWB and multiband modes, the proposed antenna achieves isolation greater than 14\u00a0dB, as shown in Fig.\u00a0In the proposed MIMO antenna, the four radiators are arranged orthogonally in the HP, and the remaining eight elements are placed in VP-I and VP-II. The inter-element spacing is kept as 0.16Figure\u00a0The radiation characteristics of the proposed twelve-port diversity antenna are measured in an anechoic chamber.Figure\u00a0The diversity performance of the MIMO antenna is measured using metrics such as Envelope Correlation Coefficient (ECC), Diversity Gain (DG), Mean Effective Gain (MEG), Total Active Reflection Coefficient (TARC), and Channel Capacity Loss (CCL).31 is calculated using the far-field radiation characteristics of the antenna by Eq.\u00a0 and II  and are shown in Tables 29. In all cases, the proposed MIMO/diversity antenna achieves ECC\u2009<\u20090.1.ECCAnother important parameter to consider is Apparent Diversity Gain (ADG), which measures link reliability and is calculated using Eq.\u00a0.3\\docume32 values are evaluated for mode I and mode II at different frequencies by considering ports-2, -5, and -12 with respect to port-1, and are tabulated in Tables The ADGThe EDG values for mode I and mode II at ports-2, -5, and -12 with respect to port-1 are presented in Tables The MEG values for mode I and mode II at ports-2, -5, and -12 with respect to port-1 are presented in Tables 32 characterize the frequency, bandwidth, and radiation capability of multiport antennas and can be calculated using Eqs.\u00a0 of the MIMO antenna when operating in mode I and mode II, are represented in Tables TARC and CCLing Eqs.\u00a0 and 9)8832 charamentclass2pt{minim20, without any performance degradation.The antenna integrates two radiators in a small size of 26\u00a0mm\u2009\u00d7\u200926\u00a0mm, as compared to20 to provide high-speed communication without latency.The antenna supports a wide range of applications, including UWB, GSM, Wi-Fi, LTE-7, 5G, Public safety WLAN, and WLAN than19.The antenna also offers frequency agility, which helps to reduce interferences by turning ON and OFF the respective switches between UWB and multiple bands based on the user\u2019s requirements, as compared to2 and inter-element spacing of 0.16 \u03bb0.The MIMO set achieves greater than 14\u00a0dB isolation without the use of complex decoupling structures, and the twelve radiating elements are oriented in a 3-D fashion, with a size of 62\u2009\u00d7\u200962\u00a0mm12, which suppress polarization mismatches in a highly scattering environment, thereby avoiding signal loss.The proposed MIMO orientation helps in obtaining quad polarization, as compared toThe unique arrangements of antenna elements help in attaining multiple polarization vectors and pattern diversity with uncorrelated beams in both azimuthal and elevation planes.20.The antenna offers ECC\u2009<\u20090.08, TARC less than \u2212\u200913\u00a0dB, and CCL\u2009<\u20090.25 bits/s/Hz, resulting in good diversity performance, as compared toThe antenna's radiation efficiency is maintained at ~\u200970 to 80% as the diodes are integrated with the transmission line without disturbing the radiator, reducing radiation losses.Thus, the proposed multiport antenna achieves spectrum efficiency and possesses better diversity characteristics to resolve connectivity issues in highly scattering environments.Table A multifunctional twelve-port polarization diversity antenna is presented with high link reliability, better connectivity, and a high data rate in ultra-dense scattering environments. The antenna offers a wide impedance bandwidth and stable radiation characteristics in both UWB and multiband modes. The antenna also offers multiple polarization vectors to avoid fading and cross-polarization. The diversity performance of the MIMO antenna is validated by measuring the ECC, TARC, and CCL. The proposed antenna could be useful for indoor wireless network communication scenarios such as smart buildings, smart factories, airports, and shopping malls to obtain high-speed communication."}
{"text": "A miniaturized folded dipole patch antenna (FDPA) design for biomedical applications operating at sub 1 GHz (434 MHz) band is presented. Antenna is fabricated on FR-4 substrate material having dimensions of 16.40 mm  The application of biomedical antenna lies in early-stage cancer detection3, glucose monitoring4, Cardiac pacemaker5, endoscopy6 and cancer treatment through hyperthermia.Advanced development in antenna designing urges the need to integrate antenna with biomedical applications7. Hyperthermia is a non-invasive and effective cancer treatment technique followed by conventional Surgery, chemotherapy and radiotherapy, and it is considered an adjuvant technique for cancer treatment8. Hyperthermia has been used safely for treating previously treated tumors or regrowth of the tumor cells9 in which temperature is raised up to 45 10.Hyperthermia is an important application of bio-medical antennas where a certain temperature is applied for a limited duration to destroy cancer cells12, along with 902.8\u2013928 MHz frequency band13. The Federal Communications Commission (FCC) recently revealed the wireless medical telemetry service (WMTS) band for frequencies between 608\u2013614 MHz and 1.395\u20131.432 GHz14. Moreover, THz frequency band is also gaining popularity with antennas designed at 0.5 to 2 THz15, 1\u20134.43 THz16, 3.6\u20137.4 THz, 8.25\u201310.0 THz17, and 430 to 750 THz18.The frequency band used for the biomedical antenna are Medical implant communication system (MICS) at (401\u2013406) MHz and Industrial, scientific and medical (ISM) bands at 434 MHz, 915 MHz and 2450 MHz19. So, 434 MHz is considered a suitable frequency band for hyperthermia11. However, the larger antenna size at such a lower frequency may limit its applications for developing compact, portable, or implantable devices, especially for endoscopy, where the antenna is implanted inside the capsule20. Therefore, the major challenge while designing the compact antenna at such a lower frequency is to miniaturize its size with suitable radiation performance22.Biomedical antennas operating in low-frequency bands are more suitable for cancer treatment through hyperthermia due to higher penetration depth of electromagnetic fields at low frequencies23. In addition, the performance of an antenna is also influenced by its proximity to the human body for hyperthermia applications24, hence, the appropriate design of miniaturized antenna with stable radiation performance near the human body is also a difficult task.Small antenna size also requires a complex matching network for impedance matching because of small input resistance and large reactance at the input. Therefore, the design of a simple impedance matching configuration for a miniaturized antenna is another challengeThere are three categories of clinical hyperthermia: local, regional and whole-body.In local hyperthermia, cancer cells can be destroyed if a temperature rises up to 25, gynecological  and genitourinary (bladder and prostate).This method is suitable for cancer cells treatment, which exists within or near the body while the applicator is inserted near the natural openings that may include gastrointestinal (esophagus and rectum), pulmonary (trachea and bronchus)Interstitial techniques are used to treat tumors deep within the body, such as brain tumors. When a single antenna fails to attain the necessary SAR uniformity over a tumor size for treatment zones that are substantial compared to penetration depth of the field at a particular frequency, arrays of antennas are used to treat such tumors.26. Cancer treatment for arms, legs, and some other body organs including the liver and lungs can be treated using regional perfusion techniques.Deep-seated tumors especially inside the abdomen and pelvis, require regional heating. Deep regional hyperthermia is performed through arrays comprising multiple antennas27:c Specific heat constant , t Exposed time in seconds.For the treatment of cancer spreading throughout the body parts, whole-body hyperthermia is considered a suitable option. All through the treatment of hyperthermia, the temperature rise is continuously monitored to ensure that desired temperature for destroying cancer tumors is achieved. For hyperthermia treatment, the successful treatment is determined by the rate at which the temperature in the body rises and the final value of temperature. SAR is calculated using the formula ast. SAR can also be calculated from the information of the Electrical field as28:However, Eq.  holds va29 where an electrically small antenna (ESA) was suggested comprising of Coplanar stripline (CPS) and capacitively loaded loops (CLL) to achieve quasi-isotropic radiation pattern. Antenna dimensions were taken as 20.6 mm Equation  is suita30. Antenna size was taken as 32 mm Antenna for hyperthermia applications require antenna performance in terms of Specific Absorption Rate(SAR) along with Effective Field Strength (EFS) and penetration depth (PD). A microwave lens applicator was recommends for the treatment of hyperthermia applications in Ref.31, suggested a sub 1 GHz antenna designed for hyperthermia. Several shapes were tested for antenna performance that, includes a rectangular patch, bow tie, truncated bow-tie, fishtail bow-tie and spiral. Antenna dimensions for the rectangular-shaped patches were 26.5 mm 32 for Hyperthermia applications at 2.45 GHz. Antenna dimensions were 29 Another work represented in Ref.33 to treat breast tumors placed around the breast to focus power inside the tower. Authors have used semi-ellipsoidal and conical-shaped phased array applicators having dimensions of 178 mm Phased array antennas are suggested in Ref.34, in which 18-element phased arrays operate at 434 MHz. Using Genetic Algorithm, 18, 15, 12 and 9 antennas were activated. The temperature of Another phased array applicator for breast cancer was suggested in Ref.35, discussed the design and fabrication of a compact, ultra-thin electromagnetic bandgap (EBG) backed antenna for the 24 GHz ISM band. The proposed antenna has a Koch fractal geometry-based bow-tie slot design, backed by a 5 Article36.A low profile hexagonal-shaped microstrip patch antenna was designed using FR-4 substrate, with dimensions of 124 mm 37. The applicator was made up of a double spiral antenna, an artificial magnetic conductor, and a frequency-selective surface. The applicator includes a frequency-selective surface at the top of the double spiral antenna to direct energy toward the tumor and ensure uniform heating. The research also explored the applicator\u2019s ability to heat deeply-seated tumors, with the outcomes demonstrating a temperature profile of 44 A compact meta-material-based applicator specifically designed for hyperthermia cancer treatment was proposed in Ref.38, for Gastrointestinal track impedance response. Dimensions of dipole and loop are taken as 1.76 mm A meandered dipole and loop implantable antennas operating at 434 MHz, 1.4 GHz, and 2.4 GHz was put forward in Ref.39, multiple silicon layers are suggested to improve the SAR centralization suitable for hyperthermia applications. Antenna dimensions are taken as 1.93 mm In Ref.19, a patch antenna with circular rings was proposed with dimensions of 130 mm In Ref.40 operating between 400 and 800 MHz. The EFS of the antenna exceeds its dimensions (30 mm An open ridged-waveguide antenna (ORWA) was proposed to achieve ultrawideband in Ref.28 at 434 MHz. PD of 12 mm while EFS of 180 mmA microwave applicator for the treatment of gynecological cancers was suggested in Ref.30, lens applicator with dimensions of 32 The ISM band of 2.4 GHz is also frequently used for biomedical antenna design. In Ref.41, at 915 MHz and 2450 MHz. Results indicated that 915 MHz was suitable for stage 1, 2 and 3 cancer, while 2450 MHz was only able to perform well for early-stage cancer. Antenna dimensions at 915 MHz and 2450 MHz are taken as 87.66 mm For Breast cancer hyperthermia, a microstrip applicator designed on RO 4350  is proposed. Antenna operates at 434 MHz where miniaturization is achieved through a novel single lumped element scheme as compared to conventional multiple inductors and capacitors. A simplified design is proposed without any addition of Balun transformer or complex matching network. The EFS and penetration depth results exhibited that the proposed antenna is suitable for hyperthermia and implantable biomedical application. FDPA without lumped element produces a resonance notch at 2.65 GHz. The size reduction through lumped inductor has shifted the resonance notch at 434 MHz band, which is about 83% reduction in the size of the antenna.The manuscript is organized as follows. \u201cThis section comprises the geometry and optimized dimensions of FDPA. A parametric sweep is applied to achieve the optimized antenna performance.The proposed FDPA design comprises of folded dipole patch at the top layer of substrate material while two parallel strips at bottom layer of the substrate are excited through coaxial feed as illustrated in Fig.\u00a0An inductor (lumped element) is added to the front layer of FDPA. Several positions are changed for placing the inductor in FDPA. However, there is no significant change noticed due to the variation in inductor position, hence the inductor is added at the centre of the left length of the patch. Moreover, the gap for this inductor is kept around 1 mm. An inductor value of 200 nH with 603 package is considered suitable for this design as it can be easily soldered to this small patch width of FDPA strip. Self-resonant frequency (SRF) of the inductor should be always greater than the resonance frequency of the antenna. As the final resonance occurs at 434 MHz therefore, the inductor package chosen comprises SRF greater than 434 MHz, which in this case is taken around 800 MHz with a package length 1.2 mm suitable for ESA. Antenna dimensions are summarized in Table\u00a0The optimized return loss curve for the proposed FDPA is shown in Fig.\u00a0Initially, coaxial feed is applied to the parallel strips at bottom of the substrate layer, while no lumped component is added to the FDPA. Here, the position of the feed matters. Antenna resonates at 2.65 GHz band with Applying parametric sweep to the back parallel strip length In the second step, four lumped elements are added in the design comprising of two inductors and two capacitors, to shift the resonance frequency to sub 1 GHz band, while the feed is provided to the parallel strips placed at the bottom layer of the substrate. The position of lumped elements on the top layer of the folded dipole patch antenna is illustrated in Fig.\u00a0Figure\u00a0To shift the impedance to sub 1 GHz, an inductor is introduced in the design of FDPA. The position of the inductor on the vertical length of the folded dipole does not create any difference in the shifting of the resonance frequency. Figure\u00a0Figure\u00a0Variation in The variations in the length of parallel strips . The appropriate value of the Lumped element (inductor) is chosen after various parametric sweeps. A bandwidth of 6 MHz (431\u2013437 MHz) is achieved in this design.The fabricated antenna is presented in Fig. The radiation patterns for the proposed antenna in both E and H planes are illustrated in Fig.\u00a0For measurements of SAR, PD and EFS, the proposed FDPA is placed near the three-layer phantom comprising skin, fat and muscle layer. Each layer has its own permittivity, conductivity and density as mentioned in Table\u00a0Initially, the antenna is placed at a 3 mm distance from the three-layer phantom comprising of skin, fat, and muscles having thicknesses of 1 mm, 2 mm and 25 mm respectively. SAR measured is 3.59 W/kg at 0.5 W input power. EFS of 17 mm SAR for various orientations of antenna plane with respect to the phantom plane is presented in Fig. mentclasspt{minimaAs the antenna contains no ground plane, therefore maximum radiation direction of the antenna is not along broadside, instead, the maximum radiation is noticed at 130The shift in resonance frequency also depends on the distance of the antenna from the body (phantom). For the case of FDPA, a minor shift is observed between 0.42 and 0.43 GHz, as antenna distance is varied between 3 and 6 mm, as indicated in Fig. This work presents a miniaturized FDPA suitable for hyperthermia and implantable biomedical applications. The proposed antenna is electrically small, where impedance matching is achieved without any complex matching circuit or Balun transformer. Initially, the antenna resonates at 2.65 GHz while changing the position of the feed point and adding the lumped element to the folded dipole patch; it resonates in sub 1 GHz band at 434 MHz. Later the SAR, EFS and PD of the antenna in 3-layer human phantom is also calculated for a distance of 3 mm, 6 mm and 9 mm between the FDPA and the phantom. The proposed FDPA provides good performance for SAR, EFS and PD with the additional advantages of simple design and miniaturized size."}
{"text": "This article presents an antenna with compact and simple geometry and a low profile. Roger RT6002, with a 10 mm \u00d7 10 mm dimension, is utilized to engineer this work, offering a wideband and high gain. The antenna structure contains a patch of circular-shaped stubs and a circular stub and slot. These insertions are performed to improve the impedance bandwidth of the antenna. The antenna is investigated, and the results are analyzed in the commercially accessible electromagnetic (EM) software tool High Frequency Structure Simulator (HFSS). Afterwards, a two-port multiple\u2013input\u2013multiple\u2013output (MIMO) antenna is engineered by orthogonalizing the second element to the first element. The antenna offers good value for mutual coupling of less than \u221220 dB. The decoupling structure or parasitic patch is placed between two MIMO elements for more refined mutual coupling of the proposed MIMO antenna. The resultant antenna offers mutual coupling of less than \u221232 dB. Moreover, other MIMO parameters like envelop correlation coefficient (ECC), mean effective gain (MEG), diversity gain (DG), and channel capacity loss (CCL) are also studied to recommend antennas for future applications. The hardware model is fabricated and tested to validate the results, which resembles software-generated results. Moreover, the comparison of outcomes and other important parameters is performed using published work. The outcome of this proposed work is performed using already published work. The outcomes and comparison make the presented design the best option for future 5G devices. The swift advancement in communication systems has been recognized since the last decade. The transformation of third generation 3G) to fourth generation 4G or LTE), and then 4G to fifth generation 5G), and now the current deployment of future sixth generation (6G) all demonstrate many changes in communication models and systems ,2. TheseG to fourG or LTE,G, and noBeing an important and essential component of the communication model, antenna design requirements were revised due to changes in communication devices or models . To meetResearchers and academics have suggested a variety of antennas for this purpose that operate at high gain, wideband, and compact sizes . Multi-iIn many MIMO antennas, the required value of mutual coupling is not met, for which various techniques are used to obtain the mutual coupling below 20 dB. Researchers have adopted many techniques to improve the isolation between elements in MIMO antenna systems. These techniques include the loading of FSS (Frequency Selective Surface) sheets ,16, absoIn the literature, the metamaterials, the defective ground structure (DGS), and the decoupling structures are widely used to upgrade the outcomes of the MIMO antenna in terms of mutual coupling, bandwidth, and gain. To enhance mutual coupling, the antenna is loaded with metastructures, either of one particular layer (same layer or substrate) or a distinct one (load another substrate) . The antIn ,22, a hiThe most efficient technique employed to lessen mutual coupling between MIMO antenna elements is loading decoupling structures between MIMO elements, or parasitic patches/element . In the A DRA antenna loaded with a parasitic patch is given in , which oCompact size and simple design structure;Wideband and high gain;Simple and new decoupling structure;Low mutual coupling;Low value of ECC and acceptable value of other MIMO parameters.A thorough study of the literature reveals that there is still a need for research to develop antennas with small sizes, straightforward geometries, and low profiles, as well as strong gains, wideband, and low mutual coupling. Due to this fact, a unique and straightforward decoupling structure for the antenna is described in this study in order to eliminate mutual coupling. The presented design of an antenna has the following advantages over other work presented in the literature:The rest of the paper is divided into sections. In next section, the single element of the antenna is discussed along with its results. The fabricated antenna prototype and comparison between measured and simulated results are given in X \u00d7 AY \u00d7 t = 10 mm \u00d7 10 mm \u00d7 1.52 mm. The antenna is excited using coaxial cables with 50 \u2126 impedance matching. The coaxial wire connects to the antenna after passing through the substrates. Using a coaxial cable has the advantages of low cost, being easy to wire and expand, and being supportive of high-bandwidth signals [1 = 3 mm; R2 = 2.7 mm; R3 = 2.5 mm; FX = 3.5 mm; FY = 0.5 mm; t1 = 1.52 mm. The antenna is analyzed, and its parameters are studied using an electromagnetic (EM) software tool, High Frequency Structure Simulator (HFSSv9). The geometrical and structural layout of the presented dual-port MIMO antenna is given in  signals . The res1 = 2 mm is obtained using the circular patch antenna equation given in [In the initial design stage, a circular patch antenna with a coaxial feedline is engineered for 28 GHz applications. The radius of the circular patch Rgiven in . The ant2 = 2.5 mm. After this step, the antenna starts resonating at 28.2 GHz, with an impedance bandwidth of 27.1\u201329.2 GHz. The value of return loss also improved after this step and approached 27 dB.To upgrade the bandwidth and refine the return loss of the antenna, another circular stub is loaded onto the antenna, which has a radius of RFor further improvement in results, a circular-shaped slot with a radius of R = 2.5 mm is etched from the antenna. After this step, the final structure of the antenna is obtained, and it starts operating at a broadband of 25.25\u201329.85 GHz. At this stage, the antenna offers a return loss of \u201345 dB.In this manuscript, a broadband antenna with an efficient value of return loss is proposed for future 5G devices. Desired and beneficial outcomes are achieved after going through three design steps. The design process of the proposed antenna is divided into the three stages shown below:11 plot is given in The antenna design evolution along with its impact in terms of the SThe performance evaluation of an antenna is analyzed by studying its S-parameter curve and gain versus frequency curve. It is noticed from The radiating property of the presented broadband design is examined by studying the radiation patterns of proposed antenna. The radiation pattern of a single element of this work is provided in X \u00d7 MY = 10 mm \u00d7 26 mm. Both of the elements are fed by a coaxial cable and are shown in A = 10 mm, PB = 1 mm, PC = 0.5 mm, PD = 0.5 mm, and PE = 5 mm. To lessen the mutual coupling between MIMO parts, the decoupling element is mounted onto the antenna.For the further validation of outcomes, an antenna prototype is constructed and tested. A snap of the antenna prototype is given in The antenna is transformed to a MIMO configuration by placing another antenna element orthogonal to the reference antenna. The two components of the MIMO antenna are separated by an 8 mm gap. The antenna has the same optimal characteristics as the single antenna element covered in In Radiation pattern is the key parameter used to study the radiating properties of a two-port antenna. The antenna\u2019s radiation pattern is shown in For more validation of the recommended MIMO antenna design for millimeter applications, some important MIMO parameters are studied and measured. Envelope correlation coefficient (ECC), mean effective gain (MEG), diversity gain (DG), and channel capacity loss (CCL) are some of these parameters.ECC shows the performance of independent antennas in a MIMO system. Ideally, the value of ECC should be equal to zero or approximately equal to zero and can be calculated using the formula given below .(1)\u03c1eijFor this design, the value of ECC is less than 0.0001 through an operational bandwidth of 25.25\u201329.85 GHz, as given in R\u03c8 refers to the below matrix for receiving antenna correlation and its mathematical relation is given below.Another important MIMO parameter, which is studied in this paper, is channel capacity loss (CCL). The study of correlation losses in MIMO systems is known as CCL. Less than 0.5 bits/Hz/s should be the CCL value, as estimated by the equations provided below .(2)CCL=The CCL of the suggested MIMO antenna is shown in Diversity gain (DG) is one of the most important parameters of MIMO antenna systems, which measures the losses experienced in the diversity scheme, and is the most crucial metric in MIMO systems. The permissible diversity increase value can be calculated by Equation (4) and its maximum value is 10 dB; however, in real-world situations, a value of roughly 10 dB is acceptable . The matAccording to Mean effective gain (MEG) is a key metric of the MIMO system, which shows the received power in the fading area. The acceptable range of MEG is less than \u20133 dB. The proposed work offers MEG less than \u20135 dB, which is under the acceptable range.From the above discussion, it is clear that the proposed MIMO antenna offers an acceptable range of MIMO parameters. A comparison between simulated and measured MIMO parameters is also provided. The value offered and the comparison show that the proposed antenna is a good candidate for future devices, which operate at high data rate.The results in the form of bandwidth, gain, isolation, and ECC of the proposed antenna are compared with published work to prove the antenna\u2019s superiority. In the literature table given below, the antenna given in ,30,31 haTwo-port MIMO antennas for 28 GHz are presented in this article. Initially, a single element was designed after following three design steps. Afterwards, the two-port MIMO antennas were generated, giving a mutual coupling less than \u221220 dB. The decoupling patch was loaded between two antenna elements to overcome mutual coupling. After loading the decoupling structure, the antenna offered mutual coupling less than \u201332 dB. The MIMO antenna presented in this article has a compact size of 25 mm \u00d7 10 mm, with a thickness of 1.52 mm. The antenna operates at a wideband of 25.25\u201329.85 GHz with a peak gain of 10.8 dBi. The antenna offers a good value of ECC, around 0.001, and DG around 9.99 dB. Other MIMO parameters are also analyzed, which are in the acceptable range. The software study of the design and analysis of the antenna was carried out using the EM software tool HFSS (High Frequency Structure Simulator). The hardware prototype was fabricated to validate the simulated outcomes. Moreover, a comparison is provided in the form of table to compare the antenna results with published works. The outcomes and table of comparison make the proposed antenna a potential applicant for future 5G millimeter-wave applications."}
{"text": "This paper presents a printed multiple-input multiple-output (MIMO) antenna with the advantages of compact size, good MIMO diversity performance and simple geometry for fifth-generation (5G) millimeter-wave (mm-Wave) applications. The antenna offers a novel Ultra-Wide Band (UWB) operation from 25 to 50 GHz, using a Defective Ground Structure (DGS) technology. Firstly, its compact size makes it suitable for integrating different telecommunication devices for various applications, with a prototype fabricated having a total size of 33 mm \u00d7 33 mm \u00d7 0.233 mm. Second, the mutual coupling between the individual elements severely impacts the diversity properties of the MIMO antenna system. An effective technique of orthogonally positioning the antenna elements to each other increased their isolation; thus, the MIMO system provides the best diversity performance. The performance of the proposed MIMO antenna was investigated in terms of S-parameters and MIMO diversity parameters to ensure its suitability for future 5G mm-Wave applications. Finally, the proposed work was verified by measurements and exhibited a good match between simulated and measured results. It achieves UWB, high isolation, low mutual coupling, and good MIMO diversity performance, making it a good candidate and seamlessly housed in 5G mm-Wave applications. There is no doubt that this era is one of wireless communication technology that provides its contributed to the development of very high data rates, higher capacity, and reliability in communication applications used daily by a wide range of people ,2. RecenConcerning the separation between the antenna elements, the mutual coupling is inversely proportional to it. However, this distance should be chosen to be at a minimum between \u03bb/4 and \u03bb/2 to have a mutual coupling of less than \u221215 dB and therefore have an efficient working MIMO system. Additionally, a larger MIMO system size results from the increased separation between antenna units. As a result, while designing MIMO antennas, trade-offs between the total size of MIMO systems and the minimizing of mutual coupling should be taken into account . Many researchers aim to enhance the performance of different parameters such as bandwidth, compact size, gain, efficiency, mutual coupling and diversity properties in the Fifth Generation (5G) Millimeter-Wave (mm-Wave) antenna design. So, they use several enhancement techniques to obtain the best performance, like substrate choice, corrugation, multi-element, dielectric lens and mutual coupling reduction techniques ,9. FirstA variety of approaches have been used to reduce mutual coupling between MIMO antenna elements. Neutralization techniques, simultaneous matching of orthogonal feeding or elements, pattern diversity, and significant polarisation are all included ,12,13. IOn the other hand, Diversity properties of MIMO systems like envelope correlation coefficient (ECC), Channel capacity loss (CCL), Diversity Gain (DG), Multiplexing Efficiency (ME) and Total Active Reflection Coefficient (TARC) are strongly affected by the mutual coupling between antenna elements of MIMO system ,28,29,30Although significant work and research were made in the last half-decade to introduce reliable MIMO antennas with acceptable diversity parameters, In this work, the DGS and antenna element orientation are developed to achieve acceptable isolation along the operating band. In this study, a 4-port MIMO antenna system covering the frequency range of 25 to 50 GHz is developed, constructed, and tested. The ground plane\u2019s carved slots between the antenna elements and the orthogonal orientation of the antenna elements form the design\u2019s foundation. A DGS is then used to deploy for mutual coupling reduction and gain enhancement after a reference antenna is tuned for bandwidth enhancement. The work is organised as follows; Since the antenna is the pivot element of MIMO antenna systems, many researchers present different antennas adapted for this technology. Concerning mm-Wave applications, printed antennas are the best candidates for this technology because of their low cost, low profile, compact size, and good choice to achieve a functional element with a proper balance of performance and manufacturing complexity for millimeter wave applications.An overview of the sequential design evolution is shown in ned from :(1)W=c2fThe rectangular patch antenna is improved for a larger band in the second step by etching the ground (DGS) and adding vertically and horizontally oriented circular slots to the three sides, as shown in The long microstrip feed in The fabrication process includes many steps. Based on the available dielectric substrate, we select the appropriate one suitable for the required frequency band. The antenna is modelled on CST microwave studio simulator. The optimization process is developed. Then, the Gerber file and \u201c.Sab\u201d file are exported to the manufacturer. At this step the duty of the academic researchers is finished. On the fabrication side the mask of design is developed. The copper is etched from the top and bottom surfaces using chemical process.When presenting a MIMO antenna along with other fundamental characteristics, Diversity parameters analysis is a must in addition to the fundamental antenna performance evaluations and parameters, such as bandwidth, resonance frequency, radiation patterns, gain, and efficiency. These characteristics are necessary for multi-antenna devices but not for single-antenna elements. The parameters used for this include the TARC, CCL, DG, and ECC The next subsections go over these variables in relation to the suggested antenna design.The antenna is fabricated as shown in The level of correlation between various antenna components in a MIMO configuration is measured by ECC. Lower ECC results in less interdependence between the components and, as a result, better MIMO diversity performance. Equations (6) and (7), respectively, show how to compute the ECC from both the far field radiation pattern and the scattering parameters ,35.(6)\u00a0e useful . HoweverDG value is obtained from ECC, and it can be easily calculated using the following equation:It is clear that ECC and DG are inversely proportional to one another. A high DG value therefore indicates superior performance. The DG may be determined using both the far field radiation pattern and the scattering parameters, much like the ECC can . Better The CCL parameter, which specifies the highest achievable limit of the information transmission rate, can be used to describe the channel capacity of MIMO systems. It calculates the ideal information transfer rate, in other words. An Equations from  can be uME is defined as the ratio between the power of the real antenna and that of the ideal one. The maximum ME has been calculated as :(13)\u03b7maxThe ratio between the square roots of the total power reflected and the total power incident, is known as the total active reflection coefficient (TARC). It may be estimated using the S-parameters and depicts the random signal combinations and mutual couplings between the ports. TARC is the sole MIMO parameter that takes into account the unpredictable phases of incoming signals, which can have a significant impact on MIMO array behavior in certain circumstances. TARC of 4-port MIMO antenna can be calculated as ,40:(14)TThe value of TARC for a MIMO communication system shouldn\u2019t exceed 0 dB. In The proposed MIMO antenna system has been designed to provide high isolation and UWB capability, with a perfect alignment orientation between the four elements and etching the ground using DGS. The proposed antenna system has achieved excellent performance parameters, such as low mutual coupling of less than \u221210 dB, low ECC of less than 0.005, low CCL of 0.25 bits/s/Hz, high DG of 9.999 dBi and low TARC of less than -10 dB, which shows a superior diversity performance. In addition, the wide operational bandwidth of 25 GHz, from 25 to 50 GHz, enables the antenna to be used in multiple applications. The compact design and low-cost design features make it suitable for mm-wave 5G applications and can be easily integrated into telecommunication devices. Furthermore, the suggested MIMO antenna system offers great performance and portability, making it an ideal choice for a wide range of 5G mm-wave applications."}
{"text": "Furthermore, a radiation efficiency of 94.2% and 89.7% is realized at 1.7 and 2.5\u00a0GHz, respectively. The proposed antenna attains a measured average gain of 5.2\u00a0dBi and 6.1\u00a0dBi at the L and S band, respectively.In this paper, a printed monopole antenna with high-gain and dual-band characteristics for applications in wireless local area networks and the internet of things sensor networks is presented. The proposed antenna consists of a rectangular patch with multiple matching stubs surrounded to improve the impedance bandwidth of the antenna. The antenna incorporates a cross-plate structure which is seated at the base of the monopole antenna. The cross-plate consist of metallic plates aligned perpendicularly which enhances the radiations from the edges of the planar monopole to maintain uniform omnidirectional radiation patterns within the antenna\u2019s operating band. Furthermore, a layer of frequency selective surface (FSS) unit cells and a top-hat structure is added to the antenna design. The FSS layer consist of three unit cells printed at the back side of the antenna. The top-hat structure is placed on top of the monopole antenna and comprises of three planar metallic structures arranged in a hat-like configuration. The coupling of both the FSS layer and the top-hat structure presents a large aperture to increase the directivity of the monopole antenna. Thus, the proposed antenna structure realizes a high gain without compromising the omnidirectional radiation patterns within the antenna\u2019s operating band. A prototype of the proposed antenna is fabricated where good agreement is achieved between the measured and full-wave simulation results. The antenna achieves an impedance bandwidth |S Microstrip antennas with compact sizes, wide bandwidth and high-gain performance features are desired for most wireless communication systems3.The advancement of modern wireless systems continually places stringent requirements especially on the performance of antennas. Moreover, the rapid development of mobile communication systems and the wireless local area network (WLAN) also require antennas with high performance, omnidirectional radiation patterns and dual-band characteristics7. Conventional printed monopole antennas however suffer from low gain and stable omnidirectional radiation patterns which limit their operation range8.Printed monopole antennas have received a lot of attention due to their omnidirectional radiation pattern characteristics in addition to their low cost and low profile features which makes them suitable candidates for many wireless applications including the internet of things (IoT) and WLAN10. While these methods are effective gain enhancement techniques, they often result in antennas with large structures.Traditional gain enhancement methods which involve an extension of the length of the monopole patch radiator or increasing the ground plane size have been proposed in a number of studies15. For example, an HIS structure composed of periodic square patches is implemented below the ground plane of a fork-shaped patch antenna to increase the antenna gain11. In Ref12, a wearable antenna which consists of a monopole antenna incorporated on an AMC structure for high-gain properties is presented. Also, a flexible and frequency reconfigurable monopole antenna with an FSS structure is presented for IoT applications13. The gain of the antenna is enhanced by placing an FSS structure beneath the antenna. In Ref14, a monopole directional antenna with a bioinspired elliptical leaf configuration is presented. The omnidirectional radiation pattern is converted to a directional pattern by placing a reflector near the ground plane. Again, in Ref15, a double split ring metasurface reflector is employed to enhance the gain of a monopole antenna. Although a significant gain enhancement is realized, large and complex structures are realized. Moreover, these gain enhancement methods result in bulky configurations since the distance between the reflective surfaces must correspond to about one-half of the wavelength.A popular gain enhancement method used nowadays involves the addition of reflective layers very close to the antenna\u2019s radiating structure. These structures are often composed of metamaterial or periodic structures such as artificial magnetic conductors (AMC), high impedance surface (HIS), and frequency selective surfaces (FSSs) arranged in a particular geometrical manner to provide in-phase reflection to the incident signal which improves the antenna gain17. A high-gain circularly polarized antenna, which utilizes a PRS structure placed above the microstrip patch antenna is presented in16. Also, a high-gain cavity resonator antenna using a metamaterial superstrate is proposed in17. Although a high-gain is attained with this method, large and complex antenna structures are realized. Moreover, the antenna gain enhancement is dominant only in a particular direction, thereby the omnidirectional pattern characteristics of the monopole antenna is distorted.Furthermore, the method of using superstrate layers such as partially reflecting surface (PRS) and metasurface structures to enhance the directivity of microstrip patch antennas have been presented in a number of studies23. Metamaterial structures placed on or around the radiating patch of the antenna have been explored for high-gain while maintaining the compactness of the antenna20. Moreover in21, a circular ring-shaped monopole patch antenna on a hexagonal ground plane has been presented for high-gain characteristics. Although these structures attained high-gain with compact sizes, the omnidirectional radiation patterns are usually distorted. In Ref22, a compact monopole antennas with a sleeve ground plane is presented. The sleeve coupled with the ground plane form a quarter-wavelength cavity which enhances the gain. Although a stable omnidirectional radiation patterns is realized, low gain values were recorded.To attain compact high-gain monopole antennas, several antenna structures have been proposed in a number of worksA closer look at the various gain enhancement methods proposed in prior works usually involve the addition of structures that results in high-gain monopole antennas with one-sided high directive beam patterns or distorted omnidirectional radiation patterns.In this paper, we present a novel method of realizing a printed monopole antenna with high-gain characteristics using a layer of FSS and a top-hat structure. The proposed antenna realizes high-gain with stable omnidirectional radiation patterns within the operating band of the antenna. Furthermore, the proposed monopole antenna realizes dual-band characteristics which makes it suitable for WLAN and various wireless applications including the IoT sensor networks.h) of 0.508\u00a0mm and loss tangent (tan \u03b4) of 0.0009. The top-hat structure is composed of copper metal plate arranged in a hat-like manner and is seated on the TLY-5 Taconic substrate, at the top of the monopole antenna. At the bottom part of the Taconic substrate, a metallic plate is inserted perpendicular to the printed partial ground plane at the backside of the antenna to form a cross-like printed ground plane structure.The configuration of the proposed monopole antenna is given in Fig.\u00a0In the antenna design, the patch radiator is surrounded by stubs placed at optimized distances to improve the impedance bandwidth of the antenna. The rectangular patch is fed by a feedline matched to a 50 \u2126-SMA connecter via an impedance transformer for measurement. The antenna is situated on a circular base with radius 30\u00a0mm, which also serves as a support to the antenna structure. The detailed dimensions of the antenna structure consisting of the patch, FSS unit cells and stubs are illustrated in Fig.\u00a0g (where \u03bbg corresponds to the guided wavelength). For applications in the maritime environment, the base station is usually located several meters above the antenna system embedded on the boats, thereby requiring antenna structures with tilted beam patterns. The current distributions for a dipole or monopole antenna of length 1.5\u03bb and 0.75\u03bb, respectively results in the tilting of the maximum beam in the upward direction. Therefore in this work, the length of the monopole patch radiator is designed at 3/4 \u03bbg (a derivative of 1/4 \u03bbg) in order to generate tilted radiation pattern beams. The conventional monopole antenna exhibits an impedance bandwidth of |S11|\u2009<\u2009\u201210\u00a0dB at 1.35 to 1.6\u00a0GHz and 2.1 to 2.4\u00a0GHz. Moreover, a low gain below 3 dBi is realized at the lower frequency band of the antenna.The conventional monopole antenna is composed of the radiating patch, feedline and the circular base. The radiating patch for the conventional monopole antenna is usually designed at a quarter-wavelength i.e., 1/4 \u03bbl4 and width w3.To improve the impedance matching conditions of the conventional monopole antenna, open-circuited rectangular stubs are added to the sides of the rectangular patch radiator as illustrated in Fig.\u00a011) and voltage standing wave ration (VSWR) are presented and compared to the conventional one in Fig.\u00a011|\u2009<\u2009\u201210\u00a0dB and VSWR\u2009\u2264\u20092 at the lower frequency band of 1.32 to 2.3\u00a0GHz, and an upper frequency band of 2.6 to 2.9\u00a0GHz is achieved with the addition of stubs.The results of the simulated reflection coefficient (Sxoy-plane) does not have a uniform omnidirectional pattern. This is because the radiation pattern is more directive in the yoz-plane compared to the xoz-plane. Furthermore, the omnidirectional radiation patterns of the conventional monopole antenna distorts with frequency variation within the antenna\u2019s operating band. One way to have uniform omnidirectional radiation patterns is to reduce the width of the patch radiator. However, this approach reduces the bandwidth characteristics of the antenna.One of the drawbacks of the conventional printed monopole antenna is that the azimuth radiation pattern .To address this challenge, a cross-plate is incorporated into the conventional monopole antenna as shown in Fig.\u00a0wcross which plays a critical role in attaining a flat omnidirectional radiation pattern is varied. As shown in Fig.\u00a0wcross. It can also be observed that the best azimuth radiation pattern flatness is achieved when wcross\u2009=\u200944\u00a0mm. However, the variation of wcross seems to have no significant impact on the impedance bandwidth of the monopole antenna as depicted in the S11 and VSWR results in Fig.\u00a0To further study the physical significance of the cross-plate, the width of the cross-plate, A, while the conventional monopole with both stubs and cross-plate added is labelled as Structure B. From the azimuth results, it can be observed that stable radiation patterns are attained when the cross-plate is added compared to the conventional monopole antenna. Furthermore, the 3D-peak gain results shown in Fig.\u00a0The azimuth radiation pattern results are given in Fig.\u00a0To enhance the gain of the conventional monopole antenna especially with regards to the lower frequency band , a top-hat structure is added at the end of the monopole antenna. The configuration of the top-hat structure is given in Fig.\u00a0The motivation behind using the metallic top-hat is to present a large radiating aperture to the monopole antenna to enhance the directivity, without increasing the overall size of the antenna. However after the incorporation of the top-hat structure, the realized gain of the monopole antenna deteriorates, although a high directivity is attained. This is mainly attributed to the poor matching conditions of the antenna after the addition of the top-hat.24. The unique frequency-shifting ability of the FSS is employed to improve the matching conditions of the antenna due to its simplicity and ease of fabrication. Moreover, the FSS structures have additional advantages of resonant properties that could be utilized to improve the impedance bandwidth characteristics of the antenna. The FSS unit cell can behave as transmissive and reflective surface based on the dimensions. Therefore, each unit cell is designed with optimized dimensions of 34\u00a0mm\u2009\u00d7\u200934\u00a0mm (0.3\u03bbg\u2009\u00d7\u20090.3\u03bbg) to achieve the desired characteristics of the target band of the monopole antenna.In order to reap the full benefits of the top-hat structure while attaining good matching conditions of the antenna, a layer of frequency selective surface (FSS) consisting of three square-loop metallic unit cells are placed at the backside of the monopole radiating patch. FSS structures are frequency dependent surfaces composed of periodic structures that can manipulate the characteristics of the electromagnetic waves passing through it11| and VSWR results are given in Fig.\u00a011|\u2009<\u2009\u201210\u00a0dB and VSWR\u2009\u2264\u20092 at 1.35\u20132.1\u00a0GHz and 2.4\u20132.75\u00a0GHz.The top-hat structure coupled with the FSS unit cell layer results in a peak gain of about 5.2 dBi at the target band as depicted in Fig.\u00a0LHAT, SHAT and WHAT, respectively), a detailed parametric study in terms of the reflection coefficient (S11), VSWR and realized gain is given in Fig.\u00a0LHAT) as shown in Fig.\u00a0LHAT\u2009=\u200940\u00a0mm.To further study the effect of the key design parameters of the top-hat structure i.e., the length, width and spacing  seems to increase the gain of the antenna at the target frequency band as shown in Fig.\u00a0WHAT variation as the impedance bandwidth performance increases with decreasing WHAT. In this case, the best performance considering both gain and impedance is realized when WHAT\u2009=\u200930\u00a0mm.Moreover, increasing the width of the top-hat (SHAT) is varied to determine its impact on the gain and impedance bandwidth performance as shown in Fig.\u00a0SHAT as in the case of WHAT that, a trade-off occurs between the gain and impedance bandwidth performance. From the results in Fig.\u00a0SHAT\u2009=\u200930\u00a0mm.Furthermore, the spacing between the vertical metallic plates of top-hat  and at 2.4 to 2.85\u00a0GHz (BW\u2009=\u200917.14%).The simulated and measured |SIn addition, the simulated and measured gain results of the proposed antenna are compared in Fig.\u00a0xoy-plane), elevation (xoz-plane) and elevation (yoz-plane) radiation patterns, respectively at 1.7, 1.8, 1.9 and 2\u00a0GHz. It can be observed from the azimuth radiation patterns that the proposed antenna maintains a stable and uniform omnidirectional radiation patterns within the antenna\u2019s operating band. Furthermore, a 3\u00a0dB-beamwidth of 46.4\u00b0, 49.0\u00b0, 41.7\u00b0 and 36.0\u00b0 at 1.7, 1.8, 1.9 and 2.5\u00a0GHz, respectively is observed for the elevation (xoz-plane) shown in Figs. yoz-plane) radiation patterns of the proposed antenna. Both the measured and simulated patterns agree well which shows that the proposed antenna attains stable and uniform omnidirectional radiation patterns within its operating band.Moreover, Figs. 11, however distorted omnidirectional patterns are observed for Ref11. In addition, the proposed antenna realizes a good impedance bandwidth performance compared to the reference antennas. Also, the proposed antenna achieves a good radiation efficiency comparatively. The high-gain characteristics with the added advantages of stable omnidirectional radiation patterns highlights the proposed antenna as suitable for application in wireless communications and WLAN sensor networks.The performance of the proposed high-gain monopole antenna is compared with existing monopole antenna structures in Table In this paper, a novel method of enhancing the gain of a printed monopole antenna while maintaining the omnidirectional radiation pattern characteristics throughout its operating frequency band has been presented. The presented antenna structure is composed of a rectangular patch surrounded by multiple stubs for impedance bandwidth enhancement. To attain good omnidirectional patterns within the antenna\u2019s operating band, a cross-plate structure is incorporated into the base of the antenna to enhance the edge radiations of the monopole antenna thereby preventing shrinking of the omnidirectional radiation patterns. Furthermore, a top-hat and a layer of FSS unit cells, printed at the backside of the antenna is incorporated, which increases the effective aperture of the antenna and enhances the antenna gain. The proposed antenna realizes dual-band characteristics in the L and S band at 1.6 to 2.1\u00a0GHz, and 2.4 to 2.85\u00a0GHz, respectively. A peak gain of 5.2 dBi and 6.1 dBi is realized for the L and S band, with an average radiation intensity of 94% and 89%, respectively. The proposed monopole antenna has a high-gain with the added benefits of stable omnidirectional radiation patterns which makes it suitable for applications in wireless communications and IoT sensor newtorks, and satisfies the stringent requirement of omnidirectional patterns needed for WLAN applications."}
{"text": "The proposed low-cost antenna is easily implemented in a typical university lab-based environment. The total bandwidth for the three modes is close to 1 GHz, while the voltage standing wave ratio (VSWR) of the fabricated version of the antenna does not exceed 1.02, and the return loss is well below \u221240 dB for the three primary resonant frequencies.This paper presents a compact multifrequency reconfigurable patch antenna in terms of design and fabrication for operating in the S and C bands of the RF spectrum, which are overwhelmed by wireless applications. Reconfiguration is achieved by using a single PIN diode on the ground plane. By varying the voltage applied to the diode, three modes can emerge, exhibiting main resonant frequencies at 2.07, 4.63, and 6.22 GHz. Resonance switching requires a voltage of less than 0.9 V. The antenna fabricated on an FR-4 substrate, with a volume of 70 \u00d7 60 \u00d7 1.5 mm The rapid growth of wireless communications has recently led to the demand for platforms supporting several communication standards. Such platforms can benefit highly from reconfigurable antennas, which can function in multiple bands, radiation patterns, or polarizations. Reconfigurable antennas are currently used in cognitive radio systems, satellite communications, MIMO systems, biomedical applications, as well as military and industrial applications ,2. The pReconfigurable antennas can change their resonant frequencies, radiation patterns, polarization, or any combination thereof. Reconfiguration is achieved usually by one of the following methods: electrical switching, optical switching, mechanical switching, and smart materials.Reconfiguration via electrical switching is the most common method used. It involves PIN (positive\u2013intrinsic\u2013negative) diodes, varactor diodes, or RF MEMS . Optical switching concerns using photoconductive switches, while mechanical switching involves the physical movement of radiating parts ,6. FinalMany researchers have presented simulation results of reconfigurable antennas of various geometries . In someMost of the available literature concerning antenna reconfiguration characteristics via PIN diodes has so far concentrated on two or more PIN diodes ,24,25,26The presented antenna was designed for integration into a high-precision signal power measurement setup, akin to the one detailed in . This seThis paper is organized as follows. The structural geometry of the antenna is illustrated in The antenna simulation was conducted using CST Studio Suite 2019 with open-space boundary conditions. To provide excitation, a waveguide port was positioned at the edge of the microstrip feed line, with a port extension coefficient of 7.2. For the substrate material, lossy FR-4 was used, complemented by parts of annealed copper. The model of the PIN diode used is Skyworks SMP1302 in an SC-79 package. According to its datasheet, the diode can be used in applications from 10 MHz to beyond 10 GHz. In the simulation, the diode had to be represented by its equivalent circuit, because the simulation tool does not support nonlinear elements. The diode can be represented by an RL circuit when it is forward-biased (ON state) or by an RLC circuit when reverse-biased (OFF State), as shown in In the simulation, the resistance (R) and the capacitance (C) values were selected from the diode\u2019s datasheet graphs, considering the voltage on the diode to be between 0 and 900 mV. L is always selected as 0.7 nH, as defined for the SC-79 diode package. Simulations encompassed the entire 0 to 900 mV range, corresponding to values of R ranging from 1 to 1000 \u03a9 under forward-bias conditions. Notably, three distinct cases stood out, distinguished by the conspicuously low S11 parameter values observed at their primary resonant frequencies. These cases were denoted as modes 1, 2, and 3. Mode 1 corresponds to 0 voltage on the diode, with values C = 0.3 pF and R = 5 k\u03a9. Modes 2 and 3 correspond to a forward biasing of the diode with no C and R = 160 \u03a9 or R = 4 \u03a9, respectively. The simulated S11 parameter and VSWR results for these three modes are illustrated in x-axis extends towards the front direction of the antenna. The azimuth angle will be referred to as \u03c6, while the elevation angle as \u03b8. Both are 0\u00b0 at the antenna\u2019s front while 180\u00b0 at the back.As indicated by According to the 2.04 GHz radiation pattern, the maximum gain of the antenna is, in this case, 0.82 dBi, observed at angles \u03b8 = 355\u00b0 and \u03c6 = 180\u00b0. Furthermore, in front of the antenna, for \u03b8 = \u03c6 = 0\u00b0, the gain is \u22120.78 dBi. Similarly, the 4.44 GHz pattern shows a maximum gain of \u22120.31 dBi, at angles \u03b8 = 310\u00b0 and \u03c6 = 135\u00b0. In front of the antenna, at \u03b8 = \u03c6 = 0\u00b0, the gain is \u221215.74 dBi. However, the gain can be increased to \u22123.78 dBi with the antenna\u2019s rotation to an angle of \u03b8 = 34\u00b0 on the elevation plane. Finally, the 6.42 GHz radiation pattern shows a maximum gain of 5.68 dBi, at angles of \u03b8 = 20\u00b0 and \u03c6 = 0\u00b0 while at angles of \u03b8 = \u03c6 = 0\u00b0, it equals 4.13 dBi.As derived from the simulation, the antenna performs best when operating on mode 3, with a main resonance at 6.42 GHz. It demonstrates the maximum gain, and lowest return loss and VSWR.Finally, Last but not least, the simulations demonstrate a good radiation efficiency for the antenna across its three primary resonant frequencies. At 2.04 GHz, the radiation efficiency stands at an exceptional 74%, while at 4.44 GHz and 6.42 GHz, it remains notably high at 59% and 54%, respectively. These findings are consistent with typical performance expectations, signifying the absence of significant losses on the antenna.The simulation results for the three resonant frequencies, where the antenna seems to function optimally, are summarized in The front and the back side of the fabricated multi-frequency reconfigurable patch antenna is shown in A Rohde & Schwarz ZVH8 Handheld VNA was used to experimentally validate the performance of the multifrequency reconfigurable patch antenna through S11 and VSWR. It is also essential to mention that, in our setup, we utilized a high-quality DAC as the voltage source for biasing the diode. The DAC\u2019s output has a low impedance of 1 Ohm, ensuring a stable DC bias voltage without significant AC components. Additionally, it provides exceptional isolation from AC signals, about 100 dB. Consequently, while the inclusion of chokes is essential in many cases, it was deemed non-critical for our application.The measurements of the antenna radiation pattern took place in a free-space lab environment in the university with dimensions of 5 m width by 10 m length. The free-space lab measurement plan appears in The S11 and VSWR results are depicted in Regarding the truncation of the VSWR plots , it is iNext, the radiation patterns for these three modes at 2.07, 4.63, and 6.22 GHz, on both the azimuth and the elevation planes, are illustrated in While the cross-polarization pattern can offer valuable insights into how the antenna interacts with signals of different polarizations, it is excluded  for the The experimental results indicate that the antenna operates almost equally well in all three bands of 2, 4, and 6 GHz, at the resonant frequencies of 2.07, 4.63, and 6.22 GHz. However, at 6.22 GHz, a much higher gain can be attained. A summary of the results, derived from the network analyzer measurements and the radiation patterns, is shown in As compared to the simulation results, some slight deviations are observed. In the simulation, the three main resonances were located at 2.04, 4.44, and 6.42 GHz, while, on the fabricated antenna, they were found at 2.07, 4.63, and 6.22 GHz. The deviation between the three cases is 30, 190, and 200 MHz, respectively, or 1.4%, 4.2%, and 3.1%.Also, the experimental results show a better functionality of the antenna at 4.63 GHz, than the one suggested by the simulation at 4.44 GHz. Furthermore, the radiation patterns of the fabricated antenna show better gains than those seen in the simulation. For the 2, 4, and 6 GHz bands, the maximum simulation gain was 0.58, 1.75, and 5.64 dBi, respectively, while the corresponding measured gains were found as 5.48, 3.97, and 12.79 dBi, which are 4.9, 5.72, and 7.15 dB higher than those suggested by the simulation. The deviations between the simulation and the experimental results are overall insignificant, except for the simulated and measured gain. These deviations were expected since many factors were not accounted for in the simulation. Such factors are the effects of solder used for the SMA connector, the PIN diode, and the effects of the pins used for applying voltage on the diode. Also, the antenna was tinned to avoid oxidation, which could also have some effect on its functionality. But more importantly, the deviations could be due to the R and C values selected for the diode\u2019s equivalent circuit in the simulation. Both these parameters, but mostly R, are frequency-dependent. Because the simulation tool does not support nonlinear elements in the simulations, they were both considered constant over the whole simulated frequency range, from 0 to 8 GHz. Furthermore, the graphs in the diode\u2019s datasheet describe these values for frequencies only up to 2 GHz. Thus, the R and C behavior for higher frequencies was considered to be similar, which might not be the case. This probably is the reason that the deviation appears to be minimal at the 2 GHz band. Finally, the deviations in the radiation patterns, and primarily in the gain, might be due to reflections occurring in the vicinity of the antenna, or due to the prime resonances of the fabricated antenna not being identical to those indicated by the simulation.The compact patch re-configurable antenna is controlled by a single PIN diode, in contrast to several other works that require multiple diodes. The antenna has three modes of operation with a total bandwidth of 974 MHz over prevailing tuning in the three frequencies. Furthermore, it has a low cost, volume, and weight and can be easily implemented even in a lab-based environment. The antenna also achieved quasi-omnidirectional radiation patterns that make it ideal for wireless applications where omnidirectional coverage is usually required.As we have already mentioned, there are several techniques to design and implement a reconfigurable antenna. The comparative study is based on antennas being similar to the one presented in this work. They are all printed on an FR-4 substrate and utilize PIN diodes to attain the reconfiguration. In this paper, a novel reconfigurable antenna operating in the 2, 4, and 6 GHz bands is presented. Reconfiguration is achieved using a single PIN diode. The antenna was simulated and implemented. The fabricated antenna exhibits three modes of operation with resonances at 2.07, 4.63, and 6.22 GHz. The three modes were defined by different values of the forward biasing voltage applied to the diode, in the range of just zero to 900 mV. The return loss is well below 40 dB for the primary resonance in every mode, and the VSWR is minimal, 1.01\u20131.02. The experimental results of the radiation patterns suggest that the gain is maximum at the bottom side of the antenna and equal to 5.48 dBi when operating in the 2 GHz band, 3.97 dBi on the bottom side when operating in the 4 GHz band, and 12.79 dBi in front of the antenna when operating in the 6 GHz band. If the antenna works for transmission or reception solely in the forward direction, it should be rotated toward the front by an elevation angle between 12\u00b0 and 25\u00b0 for maximum gain. In this case, depending on the rotation angle, the maximum gain which can be attained in the 2, 4, and 6 GHz band resonances is 3.81, 0.36, and 12.79 dBi, respectively. Finally, the fabricated antenna demonstrated better functionality in the 4 GHz band than suggested by the simulation, while the measured gain was much higher in all cases. Overall, the deviation between the simulation and the experimental results was negligible."}
{"text": "This paper presents a CoPlanar-Waveguide (CPW)-fed stingray-shaped Ultra-WideBand (UWB) Multiple-Input\u2013Multiple-Output (MIMO) antenna system designed for microwave imaging applications. Featuring a diagonal square with four inner lines and a vertical line at the center from toe to tip with a CPW feed line, the unit antenna element looks like a stingray fish skeleton and is, therefore, named as a stingray-shaped antenna. It offers a bandwidth spanning from 3.8 to 12.7 GHz. Fabricated on a 31mil RO5880 RF teflon substrate with a relative permittivity of 2.2, the proposed antenna has dimensions of 26 \u00d7 29 \u00d7 0.787 mm Within the realm of wireless communication, ultra-wideband (UWB) antennas have garnered increasing recognition both for millimeter waves and sub-6-GHz systems ,2. UWB aSeveral UWB antenna systems are developed in the literature ,14,15,16In UWB MIMO systems, multiple antenna elements are utilized at both the transmitting and receiving sides to enhance communication reliability and capacity. These systems leverage spatial diversity and multipath propagation to effectively counter signal fading and interference, resulting in elevated data rates and enhanced resilience in wireless communication ,18. The hing. In , a two-phing. In , artifiching. In , a four-hing. In  presentehing. In , a UWB shing. In , a four-hing. In , a four-hing. In , a MIMO hing. In , a four-This research presents a novel CPW-fed stingray-shaped antenna for biomedical applications, especially for tumor detection in soft tissues. The antenna aims for wideband coverage with adequate time-domain characteristics crucial for precise microwave imaging. Experimental results demonstrate effective performance across a broad frequency range from 3.4 GHz to 18 GHz, with a maximum realized gain of 3.6 dBi at 7 GHz, enabling adequate microwave signal boost for capture and transmission. The antenna exhibits low group delay (<1.5 ns) for face-to-face and side-by-side configurations, minimizing pulse distortion critical for microwave imaging. A MIMO UWB antenna system with enhanced isolation (up to 17 dB) is developed. A comprehensive comparison with other UWB antennas in the literature highlights the CPW-fed stingray antenna\u2019s unique advantages and improved performance, demonstrating its potential for practical microwave imaging applications.The performance of the antenna system has a critical role in the overall performance of the near-field microwave imaging systems. In addition to wide bandwidth, the antennas should be able to transmit pulses with little signal distortion. Also, the transient response of the antenna is critical to have proper penetration into the human tissue with minimal signal waveform distortion. This translates into a pulse duration in the order of nanoseconds, which means there is a multi-gigahertz bandwidth requirement for the antenna. The detailed requirements for antenna design specifications are given in . This woThe remaining part of this paper focuses on ultra-wideband antenna design for near-field microwave imaging and is organized into five sections. A = 10 mm, and B = 8 mm. A and B refer to the width of the vertical line and the diagonal line, respectively.The frequency domain performance of the antenna system has distinctive properties such as gain, polarization, and directivity. However, the specific performance requirements of the ultra-wideband antennas are derived from the time domain analysis, which gives important performance criteria for impulse-driven systems and determines if the system is compliant with the requirements of the intended application. The transient response gives insight into the angles of arrival and departure and polarization.R is the distance from the antenna, D is the maximum dimension of the antenna, and The time domain performance of an antenna system is analyzed in the far-field region where the antenna\u2019s radiation pattern is independent of the distance from the antenna. In order to save the computation resource, the antennas should be placed where the far-field region starts. Equation  defines As the time domain responses show, there is a minimal distortion between face-to-face and side-by-side configurations. This corresponds to a high fidelity factor. The distortion between the radiated and captured signals is given with a cross-correlation value. The highest value of the cross-correlation is defined as the fidelity factor. The fidelity factor is contingent upon the system specifications. It is dependent on the performance parameters of the antenna and the waveform of the excitation signal. The antenna bandwidth should be wide enough to cover the entire pulse spectrum of the excitation signal so that the antenna distortion effect can be properly analyzed . The fidThe face-to-face configuration has a higher fidelity factor of \u221294.5 than the side-by-side configuration of 88.62. A better fidelity factor means lower distortion in the transmitted wave, which is an indicator of a wider bandwidth of the antenna system. The high-fidelity factor antennas are essential for microwave imaging applications. Another important performance parameter of the ultrawideband antennas is the group delay. Group delay is defined as the amount of change in the transmitted signal phase with respect to the frequency change as given in Equation (3)\u03c4=\u2212\u2202\u03b8It varies across the operating spectrum of the antenna system. Microwave imaging systems require a group delay value of less than 2 ns . By asseeristics . Howevereristics ,36. The eristics . Figure The introduction of the isolating structure yields a remarkable enhancement in the isolation response. This enhancement is readily apparent when examining the port isolation values, with notable improvements observed. Depending on the antenna, the isolation values have improved from a minimum of 3 dB up to 20 dB. The isolating structure tremendously improved the isolation, especially between the adjacent antennas, which are antennas 1 and 2, antennas 2 and 3, antennas 3 and 4, and antennas 4 and 1.In It was an interesting observation when non-radiating elements showed noticeable electric currents on their surface in a simple MIMO structure. This was due to the coupling of electromagnetic fields from the radiating elements to the nearby non-radiating ones. This would manifest itself as a reduction in bandwidth and cause distortion. Nonetheless, after a series of experiments, a practical solution in the form of a decoupling structure is employed to reduce these interactions. Many types of simpler truncated polygon structures have been evaluated as decoupling elements. Finally, a unique isolating structure that was derived from the antenna itself is evaluated. The shape and even the length of its corner stubs had a significant effect on the isolation performance. None of the previous experiments were as good as this unique structure for isolating the MIMO antennas. Upon its integration, a noteworthy transformation became evident. Specifically, at 4.5 GHz b, the coSimilarly, at 7.4 GHz d, the cuThe proposed stingray MIMO antenna system is fabricated and tested using the in-house facility. The small differences between the isolation performance of the reciprocal ports of the MIMO antenna system can be attributed to calibration drift, measurement uncertainty, and measurement performance shifts caused by the small bends due to the antenna\u2019s flexibility. Nonetheless, despite the difficulty of keeping these under control, the measured isolation performance is quite successful, reaching a minimum of 22 dB, as shown in xz-plane, by having some gain suppression at two locations. Meanwhile, in the yz-plane, the pattern has some level of gain suppression from all four directions. It is evident that radiation in the vertical direction is more efficient.The simulated and measured 2D radiation pattern of the proposed stingray MIMO antenna at two different frequencies of 6.7 GHz and 11 GHz are shown in xz-plane. This pattern ensures broad coverage in the horizontal plane, making it suitable for various communication and sensing applications. It is compulsory to highlight that the radiation pattern results present a good agreement between simulation and measurement data despite the mechanical challenges faced during the measurements. This agreement validates the accuracy and practicality of the design, proves the success of implementation, and confirms its performance over the distinct frequencies across the band.At higher frequencies, such as 11 GHz e, the anr is the cross-polarization ratio. It can be expressed as Equation (The MIMO performance parameters are shown in Equation .(5)r=10The This study presents a CPW-fed stingray-shaped UWB antenna element and its orthogonal-oriented four-port MIMO antenna implementation without a novel isolating structure. The single antenna element has a 26 mm \u00d7 29 mm while the MIMO structures have 58 mm \u00d7 58 mm size. By incorporating an isolating structure, the isolation performance is improved up to 16 dB. The simulation and experimental results exhibit a good agreement, affirming the accuracy of the simulations and the precision of the practical implementation. The measurement results show that the MIMO antenna had a bandwidth of 10 GHz covering a frequency range of between 4.4 GHz and 14.4 GHz. The overall gain of the antenna system is 5.3 dBi; the typical isolation between the antenna elements is 22 dB. Performance metrics pertinent to Multiple-Input\u2013Multiple-Output (MIMO) systems, such as the Envelope Correlation Coefficient (ECC), Mean Effective Gain (MEG), Channel Capacity, and Diversity Gain (DG), are compliant with the requirements of the target applications. The ECC is less than 0.01, while the MEG is calculated between \u22123 and \u22124 for all antenna elements across the frequency. Furthermore, a thorough evaluation of the antenna systems in the time domain reveals that they are well below the acceptable thresholds. The proposed MIMO antenna design holds considerable promise for integration into MIMO-based medical imaging systems, where antenna efficiency plays a pivotal role. Elevated levels of isolation, with the proposed novel isolating structures, promise to enhance the precision of medical imaging significantly. The design also offers a powerful solution that can enhance the robustness of wireless connections. This enables smooth data transfer and meets the growing needs of modern consumer electronics. Exploiting the benefits inherent in UWB MIMO technology, this antenna system is positioned to substantially enhance the user experience, marking a new era in unlicensed wireless applications over a range of ultra-wideband frequencies. These applications cover various areas, including personal area network wireless connections, radar systems, microwave imaging, and beyond. The future scope of this work will be extended to a system with more MIMO elements integrated with a feeding network realized with cost-effective materials."}
{"text": "An ultra-wideband and high-gain Vivaldi antenna with artificial electromagnetic material, suitable for ground-penetrating radar (GPR) systems, is proposed. Directors loaded inside the antenna gradient slot direct electromagnetic waves by inducing current to improve gain. The artificial electromagnetic material, also called metamaterial, is composed of multiple \u201cH\u201d-shaped units arranged in a certain regular pattern, loaded at the antenna aperture. The artificial electromagnetic units affect the antenna radiation waves by changing the refractive index to improve radiation directivity. The four Vivaldi units are arranged into a horn-shaped array, and each two units are orthogonally fed to realize dual polarization. Experimental results demonstrate that the antenna has good impedance matching of  The demand for GPR technology is becoming increasingly urgent due to the growing requirement for underground resource development and underground target detection. GPR is widely used in the detection of hidden targets such as underground cavities, bridge defects, underground pipelines, and archaeology, due to its advantages of being non-destructive, fast and high resolution. GPR uses the penetrating property of electromagnetic waves to detect targets underground and behind walls. The higher the frequency of the electromagnetic wave, the higher the loss when penetrating the ground and walls. Thus, a GPR system mostly uses a lower operating frequency . In ordeGround-penetrating radar antennas not only need to meet the requirements of UWB, but also require strong directivity. The directivity of an antenna refers to its ability to radiate and receive differently in different directions. Ground-penetrating radar needs to detect underground targets, and in order to minimize interference, high-directional antennas should be used . AntennaUp to now, there have been many methods that improve the bandwidth and gain of the UWB antenna for a GPR system. For example, substrate-integrated waveguide (SIW) is loaded onto a dielectric substrate . SIW is In recent years, artificial electromagnetic material, known as metamaterial, has been widely used to enhance antenna directivity, improve antenna gain and concentrate the antenna beam. Artificial electromagnetic material is formed by the periodic or aperiodic arrangement of artificial units whose sizes are sub-wavelength, which can be equivalent to real electromagnetic material in a macro sense. Theoretically, it can achieve an arbitrary dielectric constant and permeability, such as zero refractive index and negative refractive index . MetamatA four-element director is loaded into the gradient slot of the Vivaldi antenna unit, and the electromagnetic wave is directed to the edge of the director to enhance the middle and high frequency gain;\u201cH\u201d-shaped metamaterial units are designed and loaded into the aperture of the Vivaldi antenna in a periodic arrangement to make the beam more concentrated by changing the refractive index.In this paper, based on the shared aperture dual-polarized Vivaldi antenna, in order to further improve the gain, the following two methods are adopted:By combining all of the above methods, the gain can be increased to 15.2 dBi without affecting the bandwidth, and the working frequency is between 0.9 and 4 GHz.The configuration of the high-gain dual-polarization Vivaldi antenna is shown in A quadruple director with a size of approximately The antenna designed in this paper can maintain a good return loss at 0.9\u20134 GHz, lower than \u221210 dB, and achieve a gain of 15.2 dBi by loading the directors and metamaterials.The director is loaded inside the tapered slot of the initial Vivaldi antenna, which increases the gain of the antenna without changing its size. When the Vivaldi antenna is fed, the radiation electric field produced by the antenna points from one side of the tapered slot to the other side, that is, the radiation electric field is along the x-axis. The electric field of the antenna obtained by CST Studio Suite (CST) software simulation is shown in When the Vivaldi antenna operates, the feeding current is located between the tapered slot lines and propagates toward the aperture along the slot lines. Due to the short distance between the slot lines near the feeding end, which is less than half a wavelength of the antenna\u2019s operating frequency, the electric field transmits toward the antenna aperture within the substrate without radiating outward. As the current travels, when it reaches the slot line with a spacing of half the operating wavelength of the antenna, electromagnetic waves begin to radiate. At this point, the antenna can be equivalent to a radiation source, generating radiation electromagnetic waves. When the length of the director is shorter than half the operating wavelength, the induced electromagnetic waves generated by the induced current of the director are phase-delayed compared to the radiation electromagnetic waves, thereby directing the radiation. Conversely, when the length of the director is longer than half the operating wavelength, the induced electromagnetic waves generated by the director are phase-advanced and will reflect the radiation. The position of the director also affects the antenna\u2019s performance. When the length of the director is less than half the operating wavelength and is located close to the radiation source, it plays a role in directing the radiation. However, when the length of the director is too far away, it will reflect the radiation electromagnetic waves, thereby degrading the antenna\u2019s gain.Based on the above principles, the influence of different lengths of the directors on the antenna gain are compared, as shown in When electromagnetic waves propagate in the air and enter the medium at a certain angle, according to Snell\u2019s law of refraction:n1sin\u03b81=nThis article presents the design of periodic H-shaped metal patches printed on a 1.5 mm thick Rogers RT5880 substrate. n is the effective refractive index, k is the free space wave number, d is the effective substrate thickness, z is the wave impedance. Since the S-parameters are complex, the obtained effective refractive index and wave impedance are also complex. The imaginary part of the refractive index represents the absorption of the electromagnetic wave by the medium, while the real part of the wave impedance represents the attenuation of the electromagnetic wave. Since the medium is a passive medium, the imaginary part of the effective refractive index must satisfy According to the formula proposed in reference :3)n=1kd12+S212,z=1+S112\u2212n=1kd12+SThe square root of a complex number has two values: m is the number of periods. By substituting the simulated S-parameters into Formula (Formulas  and 6)  6) can bn=\u2212jkdln\u0394It can be seen that the \u201cH\u201d-shaped artificial electromagnetic material undergoes resonance at around 13 GHz and maintains a high stability in the frequency range of 0.5\u20136 GHz. For the required frequency band of 0.9\u20134 GHz, the \u201cH\u201d-shaped artificial electromagnetic material is in a non-resonant state, and the imaginary part of the effective refractive index is about 0, while the real part gradually increases from 1.68 to 1.78. Loading the metamaterials in front of the Vivaldi antenna aperture can be used to focus the beam and to improve the gain. The gain improvement effect obtained through simulation is shown in The simulation results show that the maximum gain of the Vivaldi antenna unit with metamaterials is increased by approximately 1 dB. The results indicate that the artificial electromagnetic material can significantly improve the high-frequency gain, but the effect is not ideal at low-frequency. This is because the artificial electromagnetic material is a sub-wavelength artificial structure, and in order to achieve the same gain improvement effect at lower frequencies, a larger structure is required. Considering the size of the antenna, it was decided to use the dimensions of the lens structure mentioned above.As the designed Vivaldi antenna requires four-port feeding, a wideband Wilkinson power divider  was desiThe substrate used for the designed wideband one-to-two power divider in this article is Rogers RT5880, with a thickness of 0.508 mm, relative permittivity of 2.2, and a size of 54.3 \u00d7 40 mmThe proposed antenna array was fabricated, and the performance was measured using the vector network analyzer (E5063A) and the microwave anechoic chamber. The four Vivaldi units were fixed together using screws and were connected using conductive metal stickers, and the antenna prototype is shown in The reflection coefficients obtained through simulation and vector network analyzer measurements are shown in The radiation patterns and gain of the antenna were measured using the microwave anechoic chamber and were compared to the simulated results. This paper proposes an ultra-wideband and high-gain Vivaldi antenna for a ground-penetrating radar system. The gain is enhanced by loading directors inside the gradient slot of the Vivaldi antenna and by periodically arranging artificial electromagnetic material in front of the antenna aperture. The four ports of the antenna are connected to Wilkinson power dividers to obtain high port isolation and are fed orthogonally to form dual polarization. The antenna has good impedance matching throughout the entire operating frequency band of 0.9 to 4 GHz, and the realized gain can reach between 6.7 to 15.2 dBi. The resulting antenna is electrically large, with dimensions of 0.72 \u00d7 0.72 \u00d7 0.86"}
{"text": "In this paper, a 38 GHz 4-port multiple-input multiple-output (MIMO) antenna with considerable isolation and gain enhancement for 5G applications is introduced. The suggested antenna element is a monopole antenna composed of a circular patch with a rectangular slot etched from it and a partial ground plane is used to extend the desired frequency to operate from 36.6 GHz to 39.5 GHz with a center frequency of 38 GHz. The high isolation is achieved by arranging the four elements orthogonally and adding four stubs to reduce mutual coupling between elements at the desired frequency bands. The gain improvement is also introduced by placing a frequency selective structure (FSS) which is designed at the same frequency bands of the antenna under the suggested MIMO antenna to act as a reflector. The proposed four-element MIMO with the FSS prototype is built and tested in order to confirm the simulated results. The suggested antenna operated from 37.2 GHz to 39.2 GHz with an isolation of less than 25 dB across the obtained frequency range. The peak gain of the antenna is enhanced from 5.5 dBi to around 10 dBi by utilizing the FSS structure; furthermore, the back radiation is enhanced. The MIMO performance is validated by extracting its parameters and comparing with the simulated results. The results extracted from the simulation and the measurement show satisfactory matching along with the target band, indicating that the proposed structure could be used for 5G communications. The fifth-generation 5G) communications are distinguished by three distinct characteristics: universal connectivity, extremely low latency, and extraordinarily high data transmission rates ,2. This G communiAntenna design is one of the most complicated issues for future 5G cellular connectivity. Various experts have been working on 5G antennas that resonate at a frequency of 38 GHz ,11,12,13Gain enhancement can be accomplished by utilizing several techniques such as employing array configuration ,19,20, aA feasible configuration of a slotted bowtie antenna with an AMC structure is introduced in . In 22]22], a hi3 are joined and positioned orthogonally with four stubs. The MIMO testing findings in terms of impedance and radiation characteristics are extracted to investigate the desired performance of the MIMO antenna. Moreover, the MIMO diversity parameters such as envelope correlation coefficient (ECC), diversity gain (DG), channel capacity loss (CCL) are also extracted. The novelty of this work is the design of a simple 4-port antenna operated at 38 GHz applications. Second, the antenna achieved isolation between ports around more than 25 dB, which is suitable for this application. Third, the antenna has an enhanced gain of 10 dBi with the help of the FSS structures. Fourth, the antenna has a suitable overall size and diversity performance which is recommended for 38 GHz applications.In this paper, a 38 GHz MIMO antenna composed of highly isolated four elements with an FSS structure is designed and simulated using HFSS for 5G applications. To achieve the anticipated 5G frequency ranges, the circular patch is cut by a rectangular slot. Furthermore, to accomplish the high isolation properties of the MIMO configuration, the four elements of the recommended antenna with a size of 25.95 \u00d7 25.95 \u00d7 0.238 mmr = 3.55, with an overall size of L \u00d7 L = 12 \u00d7 12 mm2. First, a circular patch monopole antenna is designed with a diameter R = 4.94 mm, a partial ground plane with a length (Lg1) of 8 mm, and a 50 \u2126 feedline with a width (Wf) of 0.4 mm and a length (Lf) of 7 mm is introduced as a start point of the design. As shown in The single antenna design phases are shown in 11 level while the bandwidth of the antenna was not affected. The 2D layout with the optimized dimensions is shown in 11 outcomes are displayed in 11 levels of \u221230 around 38 GHz in the recommended band.From the design procedures above, antenna 3 is recommended for producing the desired 38 GHz frequency bands. By using the HFSS simulator, a parametric study is performed to obtain the optimized width (W1) of the rectangular slot as shown in 2. The single antenna unit discussed in the previous section is copied three times and placed orthogonally to each other as depicted in This section discusses the structure of a 4-port MIMO antenna and the method used to enhance isolation between elements. As indicated in 11 with and without stubs shows that the two antennas operated at approximately the same frequency bands. The return loss between antenna elements (S21/S31/S41) is improved by around 5 dB by introducing the four stubs, especially at 38 GHz, which validates the MIMO antenna with stubs to be used instead of without stubs in this paper.For achieving the high performance of the four-element MIMO antenna, parametric studies were performed. The parametric study to show the influence of changing the length of isolation stubs (Ls) on antenna performance operates as depicted in 3 and is joined and positioned orthogonally with four stubs.11 reaches \u221224 dB, and the coupling between antenna elements (S21/S31/S41) is <\u221222 dB. On the other hand, the tested results which are extracted using (R&S ZVA 67 VNA) are from 37 GHz to 39 GHz with S11 reaching \u221236.2 dB, and the isolation between ports (S21/S31/S41) is <25 dB. There is a slight difference between the two outcomes due to fabrication and measurement tolerances that cannot be resolved.This section investigates the characteristic of the FSS unit cell and studies the effect of the cell size on the MIMO antenna performance.a.\u00a0The FSS Unit cellr = 2.2, and a total size of 2.82 mm \u00d7 2.82 mm are utilized in the simulation and fabrication. A copper layer of 0.035 mm in thickness with two rectangular slots is added on top of the substrate, as shown in 21 response lower than \u221210 dB, and the lowest level is introduced at 38 GHz. Additionally, S11 touches 0 dB which means the FSS can be used as a reflector.As discussed in the literature review, The FSS is considered one of the techniques utilized to improve the antenna gain. By placing the FSS array under the antenna, it can be worked as a reflection structure to reflect the back-radiation and enhance the radiation characteristics of the antenna. The FSS unit cell and the suggested FSS array are shown in b.\u00a0Antenna attached with FSS array11 and peak gain, the suggested MIMO antenna is attached with different FSS cells size and placed at a distance of 5 mm, as shown in To investigate the effect of the FSS cells array on the MIMO antenna performance, such as Sr = 1.03 of polystyrene and 5 mm thickness is added between the MIMO antenna and the FSS cells, as shown in 11 and isolation between elements (S21/S31/S41) are shown in Depending on the previous discussion to improve the suggested antenna gain, a 14 \u00d7 14 FSS array (36.2 mm \u00d7 36.2 mm) is added under the proposed MIMO. The suggested 4-port MIMO antenna with a 14 \u00d7 14 FSS cell is fabricated as shown in 11 reaching \u221221 dB, and the isolation between antenna elements (S21/S31/S41) is <20 dB. While the tested outcomes are accomplished by frequency bands from 37.2 GHz to 39.2 GHz, S11 reaches the maximum level of \u221224.4 dB at 38 GHz, and the isolation between antenna elements (S21/S31/S41) equals 25 dB. The simulated and measured outcomes have a good match within the operating band (38 GHz). However, due to the fabrication and measurement tolerances, there is a difference between the two results outcomes.The simulation result shows that the proposed antenna cover the band from 36.7 GHz to 39.5 GHz, with SThe normalized simulated radiation patterns outcomes of the 4-port MIMO antenna at port 1 at 38 GHz with/without FSS are illustrated in The normalized radiation pattern outcomes of the 4-port MIMO antenna with FSS at port 1 at 38 GHz are shown in The measured gain and radiation patterns are extracted by the technique discussed in ,31. It iThe diversity parameters of the MIMO antenna with FSS such as ECC, DG, and CCL are measured to determine the performance of the antenna in the MIMO system. The ECC can be accounted for using S-parameters and radiation field patterns to quantify the multiple port efficiency .(1)ECC=An ECC < 0.5 is considered to be a good level for MIMO systems . Figure The DG can be calculated from ECC using Equation (3) .(3)DG=1The CCL indicates the upper constraint on data transmission rate and is studied to show its effect on the MIMO performance. The CCL should be <0.4 bits/s/Hz . The CCLFor 5G communications, a four-element MIMO antenna with an FSS has been proposed. The proposed MIMO antenna was intended to be operated at frequency ranges from 37.2 GHz to 39.2 GHz, with isolation greater than 25 dB at the operating band. Gain enhancement has been achieved by employing an FSS compared to the MIMO configuration without an FSS structure. MIMO metrics such as ECC, DG, and CCL have been calculated from simulated and measured data to validate the diversity performance of the proposed antenna and to demonstrate its superior features. The simulated and measured data match well through the operated band, implying that the proposed structure can be recommended to be utilized in 5G communications."}
{"text": "Broadside radiation patterns have been realized, and the measured peak gains are 11.1 dBi and 11.3 dBi for two polarizations. The antenna structure and E-field distributions are discussed to clarify its working principle. This dual-polarized double-layer antenna can accommodate 5G and 5G Wi-Fi simultaneously, which can be a competitive candidate for 5G communication systems.A dual-polarized double-layer microstrip antenna with a metasurface structure is proposed for 5G and 5G Wi-Fi. A total of 4 modified patches are used for the middle layer structure, and 24 square patches are used for the top layer structure. The double-layer design has achieved \u221210 dB bandwidths of 64.1% (3.13 GHz~6.08 GHz) and 61.1% (3.18 GHz~5.98 GHz). The dual aperture coupling method is adopted, and the measured port isolation is more than 31 dB. A low profile of 0.096\u03bb The popularity of intelligent wireless terminals, autopilot, Virtual Reality (VR), and the Internet of Things (IoT) has put forward high requirements on wireless communication networks in terms of large system capacity, high transmission speed, and low network delay. Compared with 4th Generation (4G) wireless communication technology, 5th Generation (5G) technology can achieve a high-speed data rate with reduced network delay. It can carry out stable transmission in different scenarios. Recently, 5G wireless systems have been deployed widely. In addition, 5G WiFi has been developed for wireless environments inside buildings to improve indoor wireless network coverage. It has strong anti-interference ability, broad bandwidth, high throughput, and scalability. Most 5G systems operate between 3.3 GHz and 5 GHz, and the 5G WiFi band is from 5.15 GHz to 5.85 GHz.Antennas for 5G and 5G Wireless-Fidelity (Wi-Fi) can be applied in the fields of mobile communication for high-speed data transmission and low-latency communication services, vehicle networking to achieve safer and more intelligent transportation systems, industrial automation for large-scale IoT device connections and data transmission, and medical and health for real-time interaction between medical devices and cloud data.Single-polarized antennas have been studied extensively ,5,6,7,8.0. The bandwidth was extended by a metal plating antenna with a 3D printing process [0 and the isolation was better than 18 dB. A novel dual-polarized magneto-electric dipole was reported in [0. The bandwidth of the dual-polarized magneto-electric dipole antenna was further improved to 65.9% [0.Many antennas with dual-polarization performance have been investigated widely, for example, dipole ,12,13,140 was realized, it had a limited bandwidth of 5.7% with a port isolation of 25.4 dB. A patch antenna was discussed in [0 (\u03bb0 is the free-space wavelength at 3.5 GHz). It had a high isolation greater than 38.5 dB and a low cross-polarization level less than \u221233 dB. A dual-polarized patch antenna was exploited with an etched bowtie slot [0. To further improve the working frequency band, microstrip antenna designs using stacked patches have emerged [For the patch designs, a single-ended, dual-polarized patch antenna was proposed in . Althougussed in  with a hussed in . A wide tie slot . A 10 dB emerged ,20. A tw emerged . A fractS11| less than \u221210 dB from 1.3 GHz to 2.65 GHz. However, the port isolation was only 20 dB, and the profile was 0.27\u03bb0.For the slot designs, a differentially fed dual-polarized slot antenna was proposed for base station application . Two H-sThere are also some other dual-polarized designs. A folded bowtie antenna was discussed in  operatin0 with a \u221210 dB bandwidth of 25%, and the port isolation was greater than 34 dB. To improve the frequency band, a dual-polarized grid-slotted microstrip antenna was designed using a Y-shaped feeding strip [In 2014, a broadband low-profile metasurface antenna was presented based on a periodical mushroom structure . The prong strip . The tesng strip . Its wor0.A comparison is conducted in To achieve the required bandwidth, low profile, high isolation, and higher gain performance, we designed a dual-polarized low-profile broadband antenna to accommodate 5G and 5G Wi-Fi bands. The paper is organized as follows. The background of the dual-polarized antenna is discussed in The proposed dual-polarized antenna is shown in Relong and Epoxy glass fiber (FR4) laminates are employed for the top and middle layer substrates. The double-layer structure of the microstrip antennas has several advantages. It provides improved bandwidth and radiation patterns as the two layers can be designed to have different dielectric constants and thicknesses to achieve desired characteristics. The Relong and FR4 laminates have relative dielectric constants of 2.2 and 4.4, respectively. Their loss tangents are 0.0009 and 0.02. An air gap is used to separate the Relong and FR4 substrates. The use of low dielectric constant materials in microstrip antennas offers several advantages. Firstly, it can decrease the Q factor and improve the radiation efficiency of the antenna by reducing losses due to dielectric absorption. Secondly, it can increase the bandwidth of the antenna by reducing the effect of surface waves. So, low dielectric constant materials in microstrip antennas can improve the antenna\u2019s performance. Detailed antenna structural parameters are in 2. The top layer has a height of 5.3 mm, and the adopted Relong substrate has a size of 80 \u00d7 80 mm2 with a thickness of 1 mm. In G1 with a length of W1. The edge patch has a length of W2 with a gap of G2. The middle layer is placed above the ground with a height of 2 mm. In 2. The patch shape is optimized with a circular slot at the center.The double-layer structure is at the center of the ground with a size of 125 \u00d7 125 mmIn For each polarization in this design, two arc-shaped slots are carved on the ground, stimulated by the feedline on the bottom of this substrate. The feeding strip intersection would result in low port isolation . A powerThe double-layer antenna prototype was fabricated and assembled to verify the proposed antenna design. HFSS (High-Frequency Structure Simulator) software was adopted for antenna simulation and optimization. HFSS is a powerful 3D electromagnetic simulation software widely used in the design and analysis of high-frequency electronic components and systems. It uses the finite element method (FEM) to analyze the electromagnetic characteristics of three-dimensional objects. An air box was used to surround the antenna model. By setting radiation boundary conditions on the surface of an air box, an infinite space can be simulated. HFSS software uses adaptive mesh generation technology to automatically generate accurate and effective meshes to complete the discretization of analysis objects. Usually, the grid size is less than one-tenth of the wavelength corresponding to the solution frequency.The antenna prototype is in S11|, |S22|, |S12|, and gain. Although there were some assembly errors, the test and simulation results are consistent. For Port 1, the calculated frequency band less than \u221210 dB started from 3.29 GHz, and the tested band was from 3.13 GHz to 6.08 GHz with a relative bandwidth of 64.1%. For Port 2, the calculated band started from 3.3 GHz, and the measured band was from 3.18 GHz to 5.98 GHz with a relative bandwidth of 61.1%. Based on the tested results, the frequency band between 3.3 GHz and 5.875 GHz was completely covered.A Rohde & Schwarz ZVA24 network analyzer was used for the measurement of the S-parameter, as shown in S12| is slightly different from the simulation result, the tested |S12| can be maintained below \u221231 dB using the optimized feeding network. So, satisfactory port isolation has been accomplished for the dual-polarized antenna.The calculated and tested port isolations are plotted in The radiation performance was obtained in an anechoic chamber. An ATS200 multi-probe test system with a spherical near-field (SNF) testing method was used to measure the radiation properties of the antenna . The neaThe tested gain performances are also plotted in The calculated and tested radiation patterns of the two polarizations are plotted in The antenna\u2019s structures were discussed to clarify their influence on the antenna\u2019s performance, including the top layer and feedline. Many theories have been developed for antenna mode analysis; for example, the eigenmode  and charS-parameters with and without the top layer is conducted in S22| without the top layer was above \u221210 dB. So, the antenna with only the middle layer had poor impedance matching. After loading the top layer structure, the |S22| was improved effectively, and the curve was below \u221210 dB. So, a top layer structure can improve impedance matching effectively. It was concluded that the middle layer and the ground formed the basic microstrip structure and the top layer was loaded to augment the antenna\u2019s performance.Firstly, the influence of the top layer\u2019s structure on the antenna performance will be discussed. The comparison of the S-parameters with and without edge patches are compared in S22| was barely maintained at \u221210 dB. After loading the eight edge patches, the impedance at the higher frequency became better and the |S22| was less than \u221212 dB across the passband. So, edge patches can improve impedance matching at a higher band effectively, and a wider bandwidth can be accomplished.The S-parameters with different feeding strips are compared in S22| with an ordinary straight feeding strip was only \u22127 dB near 4 GHz. To optimize the working frequency band, the feeding strip structure was modified with an optimized terminal structure. Then, the impedance matching near 4 GHz was improved effectively and the |S22| became better than \u221212 dB across the passband. So, a modified feeding strip can improve the S-parameter at 4 GHz.The Y-axis. As the antenna had a large resonant structure at a low frequency, the effective electric field area was also relatively large in the polarization direction. When the frequency increased, the effective electric field area was reduced in the polarization direction.To analyze the working mechanism of this dual-polarized antenna, effective and instantaneous electric field distributions between the radiating patches and the ground are plotted in 20 mode at low, middle, and high frequencies. So, wideband performance was obtained based on the proposed structure.Corresponding to the effective electric field distribution, the instantaneous electric field is plotted in 20 modes across the passband. A feeding strip with a modified terminal structure can improve the impedance matching of the middle band, and parasitic edge patches can optimize the impedance matching of the higher band effectively. A high port isolation of 31 dB was achieved. Furthermore, the antenna had a low profile of 0.096\u03bb0 for space saving and easy installation. The antenna element had realized high peak gains of 11.1 dB and 11.3 dB with broadside radiation patterns and low cross-polarizations. With these favorable characteristics, this broadband dual-polarized antenna should find widespread applications for 5G and 5G Wi-Fi communications.A dual-polarized double-layer antenna was investigated for 5G and 5G Wi-Fi. The middle layer and the ground constructed the basic antenna structure, and a metasurface structure was applied for the top layer to improve impedance matching. Broadband performances of 64.1% (3.13 GHz~6.08 GHz) and 61.1% (3.18 GHz~5.98 GHz) were achieved with anti-phase TM"}
{"text": "This work presents an efficient design and optimization method based on characteristic mode analysis (CMA) to predict the resonance and gain of wideband antennas made from flexible materials. Known as the even mode combination (EMC) method based on CMA, the forward gain is estimated based on the principle of summing the electric field magnitudes of the first even dominant modes of the antenna. To demonstrate its effectiveness, two compact, flexible planar monopole antennas designed on different materials and two different feeding methods are presented and analyzed. The first planar monopole is designed on Kapton polyimide substrate and fed using a coplanar waveguide to operate from 2 to 5.27 GHz (measured). On the other hand, the second antenna is designed on felt textile and fed using a microstrip line to operate from about 2.99 to 5.57 GHz (measured). Their frequencies are selected to ensure their relevance in operating across several important wireless frequency bands, such as 2.45 GHz, 3.6 GHz, 5.5 GHz, and 5.8 GHz. On the other hand, these antennas are also designed to enable competitive bandwidth and compactness relative to the recent literature. Comparison of the optimized gains and other performance parameters of both structures are in agreement with the optimized results from full wave simulations, which process is less resource-efficient and more iterative. Planar antennas are popular in biomedical applications due to their low profile, lightweight, low fabrication cost, and ease of integration with printed circuit board technology ,2. RecenIn full-wave simulations, designers typically optimize a structure\u2019s parameters based on their understanding of its operating principles. Generated wave behaviors and performance parameters are the main guides to determining the next optimization steps for antennas. This is aided by software using methods, such as Integral Equations (IE), which can be solved using the Method of Moments (MoM) for the complex environment with inhomogeneous lossy dielectrics, Finite Elements (FE), Finite Differences in the Time Domain (FDTD), and Finite Integration Technique (FIT). Such software-based antenna design and optimization processes are often iterative and depend heavily on the knowledge, experience, and understanding of designers on specific antenna topologies. This design process can easily be more tedious than expected, considering that more complex and non-arbitrary modern antennas of today are needed to meet growing requirements due to the demands of multi-standard communications. On the contrary, such a design process can be made more systematic and efficient by generating and understanding the physical insights of the structure using Characteristic mode analysis (CMA).CMA is a method used in electromagnetics to provide insights into the intrinsic resonant qualities of a structure by locating and analyzing the structure\u2019s basic modes ,7,8,9. TFirst, a radiating patch is designed without its ground, substrate, and excitation.Then, an analysis of the structure is performed using CMA to determine the even dominant modes. This is completed by observing the electric field (E-field) results throughout the target operating band.A suitable substrate is then added to the antenna prior to the excitation of the radiating patch. This antenna is analyzed to calculate the values of its forward gain.Estimation of the forward gain of the antenna takes place using the EMC method. The E-field magnitudes of the first two even modes are combined.Finally, the resulting maximum gain of this process provides an estimate of the highest gain value attainable over the frequency band of interest.In this work, a method to estimate gain over a wide operating bandwidth from antennas is proposed and applied to two flexible wideband antennas. Wide operating bandwidth is important for wearable antennas to ensure that they can overcome any performance deviation relative to the required frequency range due to the impact of surrounding human tissues . The varAntenna 1: a planar monopole with a slotted radiator and fed using a coplanar waveguide (CPW). This antenna was designed on a flexible Kapton polyimide film with a thickness of 0.11 mm, whereas 0.01 mm-thick aluminum foil is used as its conductive sections .Antenna 2: a planar monopole with a spring-like radiator and fed using a microstrip line. The antenna is designed on textiles, with a 3 mm thick felt as the substrate and ShieldIt conductive textile (0.17 mm thickness) forming the conductive sections.As the proposed method aims to improve the time- and resource-efficiency needed in the analysis and optimization effort of a complete antenna\u2019s gain, results from EMC for these two wideband planar monopole antenna examples are compared with results from full wave simulations. Their design and main differences are as follows:The rest of the paper is organized as follows. First, the topology, design procedure, and performance of both antennas in free space are explained in 3 (0.69 g\u03bb \u00d7 0.69 g\u03bb \u00d7 1.37 g\u03bb), printed on a Kapton polyimide film flexible substrate  with 0.11 mm thickness. The antenna has a partial ground plane with a width of 51.44 mm. FEKO simulator software is used to design and analyze the proposed antenna. The antenna has moderate gain and wide bandwidth in free space.Additionally, the fabricated antenna demonstrates good radiative properties when operating on both rigid and curved surfaces, making it suitable for different wearable communications applications.This section presents the compact wideband antenna topology. The radiating patch consists of three main sections: a half-circle (at the bottom), ovoid (in the middle), and rectangular (at the top) patches, and connected with two rectangular arms on the left and right edges of the radiator. The CPW feeding technique is adopted in this work to create extra modes and minimize quality factor (Q), resulting in wide and multiband resonance behavior ,17,18,19The proposed Antenna 1 is designed in four steps, as seen in As the first step, a conventional circular patch antenna is designed. In this iteration, the antenna is not matched at the resonant frequencies from 2 to 2.2 GHz. Similarly, no modes are active to cover this range of frequencies, as illustrated in the MS plot in Next, the antenna in the previous step is modified in step 2. A portion from the upper part of the circular patch is removed to achieve miniaturization at the same resonance, as shown in The antenna is further modified by adding two rectangular parasitic patches on the left and right sides of the radiator. It is observed that the antenna operated with a 10-dB reflection coefficient starting from 2 GHz, which is generated by mode 1, as in To overcome this, the top side of the patch is extended by connecting a rectangular-shaped resonator. Using this step, the proposed antenna achieved a bandwidth from 2 GHz to 6 GHz, as shown in The steps involved in the antenna design can be summarized as follows:Additionally, to explain the antenna radiation mechanism, the surface current distributions based on CMA on the patch are shown in Antenna Performance in Free SpaceThis section presents the results and analysis of the proposed wideband antenna in free space in terms of reflection coefficient, radiation patterns, surface current distributions, efficiency, and gain. First, \u03b8 = 90\u00b0), while a bidirectional radiation pattern is found for the E-plane (\u03b8 = 0\u00b0). As the frequency increases, the lower half of the pattern shows a significant distortion with more ripples. Additionally, it is found that the radiation is reduced from the non-radiating edges that are responsible for cross-polarized radiation, which is mainly caused by the currents on the feeding probes. The designed antenna exhibits a peak gain of 8 dBi at 3.6 GHz, 5 dBi at 2.45 GHz, and 4 dBi at 5.5 GHz and 5.8 GHz, respectively.b.Gain Estimation using EMC Method based CMAi.Based on characteristic mode (CM) theory, the proposed Antenna 1 is first analyzed with only the perfect conductor (patch) and without any substrate, ground, and excitation to determine the natural modes of resonance.ii.After the simulation process is performed, the electric field of the first two even modes (mode 2 and mode 4) is obtained from the results, as illustrated in iii.Next, these two modes are then combined to form a wide specific band (from 2 to 6 GHz) as represented in Equation (1). For example, at 3.7 GHz, the electric field of mode 2 is 5.79 V, whereas it is 6.62 V at mode 4. Then, the EMC method is applied as follows:The first design example (Antenna 1) depicting the efficiency of this method is presented and explained in detail as follows:iv.The same procedure is performed for the rest of the frequencies. In v.Finally, the radiating patch is integrated with the substrate and excitation to form the complete antenna. Analysis indicated that the maximum gain of 3.54 dBi is achieved at 3.83 GHz, as indicated in the red box in 3 (0.38 \u03bbg \u00d7 0.5 \u03bbg \u00d7 0.036 \u03bbg) and operated from 2.99 GHz to 5.57 GHz with a bandwidth of 73.8% [h) of 3 mm, a dielectric constant of approximately 1.3, and a loss tangent of 0.044. The single-layered substrate ensures a low-profile structure and reduces potential complexities in fabrication and integration with clothing. The top patch and partial bottom ground are made using a ShieldIt conductive fabric. The overall antenna is fed by a microstrip feed line, with its width (Wf) optimized to ensure good impedance matching.For further verification of the proposed method, an additional flexible patch Antenna 2, also referred to as \u201cspring antenna\u201d is used. This antenna featured a compact dimension of 32 \u00d7 42 \u00d7 3 mmof 73.8% . Figure The steps to calculate the EMC values of Antenna 1 is then applied to Antenna 2 to further validate the proposed method. Only its radiator is first analyzed using CMA. The gains produced from the overall antenna indicate that the maximum gain is achieved at 5.77 GHz, as illustrated in the red box in Several studies in the literature have proposed approaches to estimate the performance of antennas based on different equations and techniques, as summarized in A detailed comparison of the proposed antenna with other state-of-the-art flexible planar antennas from the literature operating in the same frequency range is summarized in a.The size of the antenna is more compact compared to antennas proposed in ,35,37,38b.Its impedance bandwidth is improved compared to antennas proposed in ,38,39,40c.Higher gains are achieved compared with most of the reported antennas in the literature at the relevant frequency .This work describes an efficient design and optimization approach to improving the gain of a wearable antenna based on the CMA approach. Prediction of the forward gain is proposed based on the even mode combination method, which is derived based on the characteristic mode analysis. To predict the forward gain, the combination in the electric field of the first two even modes is computed. Two wearable antennas made using different flexible materials and fed using different feed types are used to validate this method. Both antennas are analyzed over ranges of frequencies from 2 to 6 GHz. Applying the EMC method, it can be observed that the maximum value of gain is achieved between 3.5 and 3.9 GHz, which is in good agreement with optimized values from full wave simulations (with substrate and excitation). Similarly, EMC analysis for the second wearable antenna designed on textile and fed using a microstrip line also enabled an accurate estimation of its maximum gain between 5.7 and 6 GHz. The simulated performance of the designed antenna is analyzed in terms of its reflection coefficient, radiation pattern, gain, and surface current. Both antennas are fabricated, and measurement results showed an acceptable agreement with simulations in terms of reflection coefficients and bandwidth. The first antenna operated from 2 to 5.27 GHz (measured) with gains of 8 dBi at 3.6 GHz, whereas the second antenna operated from 2.99 to 5.57 GHz (measured) and gain of 6 dBi at 3.5 GHz. Their operation in several important wireless frequencies, such as 2.45 GHz, 3.6 GHz, 5.5 GHz, and 5.8 GHz, and their flexibility enable them to be potentially applicable for WBANs, 5G, and IoT communications. The use of such a CMA-based approach can be extended in future works to include new methods to estimate the backward radiation of wearable antennas integrated with the artificial magnetic conductor (AMC). This will then also enable a more efficient prediction of the FBR parameter with less time cost by utilizing the features offered by CMA."}
{"text": "The gain of the MIMO array was increased by introducing frequency-selective surface (FSS) consisting of 7 \u00d7 7 array of unit cells comprising rectangular C-shaped resonators, with one embedded inside the other with a central crisscross slotted patch. With the FSS, the gain of the MIMO array increased to 8.6 dBi at 28 GHz. The radiation from the array is directional and perpendicular to the plain of the MIMO array. Owing to the low coupling between the radiating elements in the MIMO array, its Envelope Correlation Coefficient (ECC) is less than 0.002, and its diversity gain (DG) is better than 9.99 dB in the 5G operating band centered at 28 GHz between 26.5 GHz and 29.5 GHz.In this paper, a radiating element consisting of a modified circular patch is proposed for MIMO arrays for 5G millimeter-wave applications. The radiating elements in the proposed 2 \u00d7 2 MIMO antenna array are orthogonally configured relative to each other to mitigate mutual coupling that would otherwise degrade the performance of the MIMO system. The MIMO array was fabricated on Rogers RT/Duroid high-frequency substrate with a dielectric constant of 2.2, a thickness of 0.8 mm, and a loss tangent of 0.0009. The individual antenna in the array has a measured impedance bandwidth of 1.6 GHz from 27.25 to 28.85 GHz for S The development of wireless communication networks has indeed been a significant modern uprising in the telecom industry. Wireless communication allows for the transmission of voice, data, and multimedia over the airwaves without the need for physical wired connections . BetweenThe 5G networks utilize both sub-6 GHz and millimeter-wave spectrum to provide enhanced performance and capabilities. Sub-6 GHz spectrum refers to the frequency bands below 6 GHz, including bands such as 600 MHz, 700 MHz, 2.5 GHz, 3.5 GHz, and 5 GHz . The subMultiple-input multiple-output (MIMO) antenna systems play a vital role in modern and upcoming mobile communication technologies. MIMO technology enables the use of multiple antennas at both the transmitter and receiver, working simultaneously to improve link reliability, enhance channel capacity, and achieve higher throughput in terms of gigabits per second (Gbps) ,11,12. T3. In [The authors in  reported3. In , the aut3. In  is shown3. In  is a pla3. In , the aut3. In  is a 4 \u00d73. In  has a De3. In  is a twoThis paper describes the results of an investigation of improving the gain and inter radiation element isolation of a 2 \u00d7 2 MIMO antenna array for 5G millimeter-wave applications. To minimize the mutual coupling between the radiating elements in the MIMO array, the radiating elements are spatially arranged to be orthogonal with respect to each other. The proposed MIMO array has an impedance bandwidth of 1.6 GHz, a gain of 7.2 dBi, and an inter radiator isolation greater than 26 dB. It is shown here that the gain of the MIMO array can be enhanced by placing a frequency-selective surface (FSS) over the array. With the FSS, the gain achieved at 28 GHz is 8.6 dBi. The planar MIMO antenna array is compact and of a simple construction that facilitates easy integration in 5G wireless communication systems. 3. 11 \u2264 \u221210 dB. The physical parameter dimensions of the antenna structure are listed in The antenna configuration is based on a standard circular patch antenna that is edge-fed. The circular antenna is modified through four steps, depicted in pression .(1)R=F1The effect of the ground plane rectangular slot on the antenna\u2019s performance was analyzed in detail. 3. The simulation results in The modified circular patch antenna was used in the design of a 2 \u00d7 2 MIMO antenna array operating at 28 GHz. The individual antennas in the array were spatially arranged orthogonally with respect to each other, as shown in It is shown here that by locating the proposed frequency-selective surface (FSS), the proposed MIMO antenna array can reduce mutual coupling between the radiating elements, resulting in improved gain performance. This is because in an antenna array, mutual coupling occurs when the electromagnetic fields from one antenna interact with other antennas in the array. This interaction can lead to changes in the radiation pattern, impedance, and efficiency of the antennas, degrading the overall performance of the array. The FSS is used here as a bandpass structure, allowing signals to pass through the frequency range of interest and isolating the interaction of the antennas outside their frequency band. When electromagnetic (EM) waves incident on the FSS structure, they incite electric currents into the array elements. The level of coupling energy defines the magnitude of the produced currents. The generated currents also work as EM sources, and they create additional scattered fields. Incident EM fields combined with these scattered fields make up the resultant field in the surrounding of FSS. The operational theory of FSS-based structures has been explained by Munk in detail .12 \u2264 \u221210 dB is 2.3 GHz from 26.9 GHz to 29.2 GHz.The steps taken to design the FSS unit cell are shown in 2. The FSS, consisting of a 7 \u00d7 7 array of unit cell matrix, was used to enhance the performance of the antenna. This was achieved by locating the FSS structure over the MIMO antenna. The FSS structure allowed EM radiation to pass through that was within the operational frequency range of the MIMO antenna. The FSS structure was designed to have a bandpass between 27 GHz and 29 GHz. 11 \u2264 \u221210 dB is within the 5G mm wave spectrum between 26.5 GHz and 29.5 GHz. The fabricated prototype of an FSS-based MIMO antenna array is shown in The simulated and measured S-parameters of the FSS-based MIMO antenna are compared in The simulated and measured polar plots of FSS-based MIMO antenna at 28 GHz are shown in iM  is a metric used to quantify the correlation between two antennas in an MIMO system. A high correlation between antennas can limit the benefits of spatial diversity and reduce the potential capacity gain that MIMO offers. On the other hand, a low correlation is desirable because it allows the MIMO system to achieve higher data rates and improved link reliability. The value of ECC should be less than 0.5 to minimize coupling effects. The value of ECC can be estimated using the relation in .(2)ECC=Diversity gain (DG) is the improvement in signal quality and system performance achieved by utilizing multiple antennas at both the transmitter and receiver. The diversity gain of MIMO antenna array can be calculated from the ECC using the following relation :(3)DG=10The diversity gain of the proposed MIMO array in The performance of the proposed MIMO antenna array is compared in In this article, we have demonstrated that mutual coupling between neighboring antennas in an MIMO array can be reduced by spatially arranging the individual antennas orthogonally relative to each other. It is also shown that the impedance bandwidth of the antenna can be widened by defecting the ground plane with a rectangular slot. Moreover, it is shown that the gain of the MIMO array can be enhanced by locating a frequency-selective surface (FSS) over the MIMO array. The FSS unit cell was designed to allow the frequency band at 28 GHz. The gap between the MIMO array and FSS was adjusted to one-half guided wavelength to ensure constructive interference between the forward and FSS reflected electromagnetic waves. The frequency-selective surface consisted of a 7 \u00d7 7 matrix of FSS unit cells. The measured results show that the gain of the MIMO array is increased by including the FSS. The proposed FSS-based MIMO array has an impedance bandwidth between 27.2 GHz and 29 GHz with a total efficiency of 86% at 28 GHz. Moreover, its ECC is less than 0.002 and its diversity gain is better than 9.99 dB in the 5G operating band centered at 28 GHz between 26.5 GHz and 29.5 GHz."}
{"text": "A simple, compact, and low-profile antenna operating over ultrawideband with high gain is presented in this manuscript. The antenna has dimensions of W\u00a0\u00d7\u00a0L\u00a0=\u00a019\u00a0mm\u00a0\u00d7\u00a021\u00a0mm and is placed on the rear side of the FR-4 substrate material. The antenna contains simple geometry, inspired from a circular fractals, which consists of a circular patch with a CPW feedline. The circular patch is loaded with two fractals patches at both top end of the substrate and the rectangular stub is loaded at the lower side, to improve the antenna's bandwidth. The constructed antenna offers a wide band of 3\u201313.5\u00a0GHz. The antenna geometry also contains three semicircular slots, which are etched to generate the notch bands. Each slot is etched step by step, giving notch bands at 3.9\u00a0GHz, 5.2\u00a0GHz, and 8.1\u00a0GHz. In the final stage, two diodes are added to attain reconfiguration. The antenna offers moderate gain and high radiation efficiency. The hardware model of antenna is engineered to verify the simulated results. Moreover, the antenna is compared with other works in literature. The outcomes of the proposed antenna and comparison with the literature work make the suggested work the best candidate for future UWB portable devices. To meetWith the advancement of technology, several sub bands have been introduced that lie inside the UWB spectrum. The existence of these bands may cause interference, which is eliminated by a notch-band antenna ,8. The nIn the literature, the researcher adopts many techniques to get notch band characteristics, such as stub loading , slot in3, operates over an ultra-wide band of 1.8 dBi. The antenna has a low gain setback, and this work also does not offer switching. presentsAs specified in Refs. ,24, a UWA notch-band antenna with reconfigurability shows more potential than an antenna with only notch-band characteristics. The PIN diodes, resisters, and varactor diodes are used for switching. The UWB design given in Ref.  operatesIn , a UWB a\u2022Small and simplified Structure.\u2022The triple reconfigurable notch which covers full targeted band.\u2022Provides reconfigurability over UWB.The above review helps in concluding this fact: there is still a research gap in designing UWB antennas with notch characteristics. The antenna either has limitations in terms of reconfigurable characteristics or is large. Some antennas also have a narrow notch band and low gain. This manuscript recommends an ultrawideband antenna with small and straightforward geometry, operating at high gain with a notch and reconfigurable characteristics. The contribution of this work is:In the rest of the manuscript, the designing methodology and working principles are given in the second section. In the third section, the manicured prototype and its results are compared with the predicted results. In the final section, the work is concluded with a comparison table that compares suggested work with work in literature.22.1P\u2013I\u2013N diodes are placed. To enhance the capabilities of the antenna, slots have been made, and these stubs are loaded. W\u00a0\u00d7\u00a0L\u00a0=\u00a019\u00a0mm\u00a0\u00d7\u00a021\u00a0mm is the total size of the antenna. On the top side of the readily available commercial substrate material FR\u20134, the suggested antenna is developed. The relative permittivity and loss tangent of the utilized substrate are 4.4 and 0.02, respectively. The thickness of the substrate material is 1.6\u00a0mm. The optimized parameters are given below:2.2R of 7\u00a0mm, which is obtained from the equations given in Ref. . This leads to the addition of the PIN diode and the use of resistance-inductor-capacitor (RLC) components in the antenna design. A Dc block 100\u00a0pF capacitor is used to change the current flow path, and the RLC values are provided in [34]. In addition, padding and visas are included in the design framework for improved outcomes.1 is ON and diode C2 is OFF, the antenna gives dual notches at 5\u00a0GHz and 8\u00a0GHz (case 10). In the third case, when diode C1 is in the OFF state and diode C2 is in the ON state, the antenna again gives dual notches at 3.9\u00a0GHz and 5\u00a0GHz (case 01). In the final case, when both diodes are in the OFF state, the antenna offers tri-notch bands at 3.9\u00a0GHz, 5\u00a0GHz, and 8\u00a0GHz, as given in After loading the PIN diode, the antenna provides a notch at 5\u00a0GHz when both diodes are ON (case 11). When diode C3This section discusses the tri-notch band antenna's outcomes in terms of reflection coefficient, gain, efficiency, surface current, and radiation pattern. This part includes explanations of the facts regarding the measuring setup and the fabrication of the prototype. The table of comparisons is provided at the end of the section to express how the suggested work is superior to the work that has already been presented.3.1An electromagnetic (EM) software tool called High Frequency Structure Simulator (HFSS) is utilized to construct and analyze the suggested antenna geometry. Where the design of antennas, simulation of results, and design optimization are performed. The major advantage of using this software tool is that it minimizes the number of tests and verifications needed and the cost of the model, as it avoids fabricating many antennas for testing. The software above has various methods to work with complex geometries, including the finite element method (FEM) and the method of moments (MOM).Later on, a commercially available substrate material, FR-4, is utilized to fabricate the hardware prototype of the recommended work. The fabrication is performed to verify and validate the software-generated results. The Agilent vector network testing equipment is used to test the impedance and radiation pattern. The standard horn antenna is placed as a source antenna for the far-field measurements, whereas the suggested antenna is used as a receiving antenna. 3.2In 3.3The suggested tri-notch band antenna's simulated and tested radiation pattern at specific frequencies of 3.5\u00a0GHz, 4.4\u00a0GHz, and 8.8\u00a0GHz is shown in 3.4The surface current of a tri-notch band antenna at selective frequencies of 3.7\u00a0GHz, 5.2\u00a0GHz, and 8\u00a0GHz is illustrated in 3.5The gain versus frequency plot of the suggested antenna for all possible states of diode switching is given in 1 is OFF and diode C2 is ON, the antenna offers dual notch bands. The antenna under this scenario offers gain >2.75 dBi at operational bandwidth, while the gain goes to negative at notch band regions. In the final case, when both of the diodes are OFF, the antenna offers three notch bands. At this antenna, gain is\u00a0>\u00a03 dBi, while at the notch region, antenna gain decreases, as given in Single notch band and offers gain greater than 3 dBi at operational bandwidth, whereas gain is less than \u22124 dBi at the notch band region. In case 10, when one diode is ON while the other is OFF, the antenna offers a dual-notch band. The antenna offers gain >3.25 dBi through the operational region. The value of gain decreased to\u00a0<\u00a0\u22122.5 dBi at notch band regions, as given in 3.61 is OFF and diode C2 is ON, the antenna offers dual notch bands. The antenna under this scenario offers radiation efficiency greater than 85\u00a0% at operational bandwidth, while the gain goes to 60\u00a0% at notch band regions. In the final case, when both of the diodes are OFF, the antenna offers three notch bands. At this antenna, radiation efficiency is >88\u00a0%, while at the notch region, antenna radiation efficiency decreases, as given in The radiation efficiency of the suggested tri-notch and UWB antenna at various switching states is given in 3.74In this work, an antenna is designed and investigated for three reconfigurable notch bands. The antenna has a compact size of 19\u00a0mm\u00a0\u00d7\u00a021\u00a0mm and operates over an ultrawide band of 3\u201313.5\u00a0GHz. In the first step, an UWB antenna is designed by loading stubs onto a circular patch antenna. Afterward, the semicircular slots are etched to get the notch bands. Three semicircular slots of different radiuses generate the notch bands of 3.7\u20134.2\u00a0GHz, 4.8\u20135.9\u00a0GHz, and 7.6\u20138.3\u00a0GHz. In the last stage, the PIN diodes are loaded for reconfiguration. The placement of two diodes gives four different cases of reconfiguration. In case 1, both of the diodes are in the ON state, and the antenna gives a single notch. The antenna produces two notch bands in the second and third situations when diode C1 is in the ON state and diode C2 is in the OFF state, and vice versa. In the fourth step, the antenna produces triple notch bands when both diodes are off. Additionally, the antenna has a high radiation efficiency of over 90\u00a0% and a moderate gain of about 4 dBi at operational bandwidth. Additionally, a hardware prototype is created to test the outcomes of the simulation. The suggested work is contrasted with previous research in the final section in terms of size, bandwidth, gain, and notch band. Additionally, the outcomes and comparison table demonstrate that the suggested antenna is the top contender for the next UWB portable devices.10.13039/501100004242Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2023R238), 10.13039/501100004242Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia.This work was supported by Data included in article/supplementary material/referenced in article.Musa Hussain: Writing \u2013 review & editing, Writing \u2013 original draft, Validation, Software, Methodology, Formal analysis, Data curation, Conceptualization. Tanvir Islam: Writing \u2013 original draft, Resources, Methodology, Data curation. Mohammed S. Alzaidi: Writing \u2013 original draft, Validation, Investigation, Funding acquisition, Formal analysis, Data curation. Dalia H. Elkamchouchi: Writing \u2013 original draft, Visualization, Resources, Conceptualization. Fahad N. Alsunaydih: Writing \u2013 review & editing, Writing \u2013 original draft, Visualization, Validation, Project administration, Funding acquisition. Fahd Alsaleem: Writing \u2013 review & editing, Writing \u2013 original draft, Visualization, Supervision, Methodology, Funding acquisition, Conceptualization. Khaled Alhassoon: Writing \u2013 review & editing, Writing \u2013 original draft, Visualization, Validation, Supervision, Resources, Project administration, Methodology, Investigation.The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper."}
{"text": "The construction of the four-port MIMO antenna in the form of a sickle is provided in the article. Initially, the single port element is designed and optimized. Next, a structure with two ports is created, and lastly, a design with four ports is completed. This process is repeated until the design is optimized. Three types of parametric analysis are considered, including variations in length, widths of sickle-shaped patches, and varying sizes of DGS. The frequency range of 2\u20138\u00a0GHz is used for structural investigation. The \u2212\u00a018.77\u00a0dB of return loss was observed at 3.825\u00a0GHz for a single-element structure. The optimized one-port structure provides a return loss of \u2212\u00a019.79\u00a0dB at 3.825\u00a0GHz. The port design offers a bandwidth of 0.71\u00a0GHz (3.515\u20134.225). The four-port design represents two bands that are observed at 3\u00a0GHz and 5.43\u00a0GHz. Both bands provide the return loss at respectively \u2212\u00a019.79\u00a0dB and \u2212\u00a020.53\u00a0dB with bandwidths of 1.375\u00a0GHz (2.14\u20133.515) and 0.25\u00a0GHz (5.335\u20135.585). The healthy isolation among both transmittance and reflectance response is achieved. The low-profile material was used to create the design that was presented. The article includes a comparison of the findings that were measured and those that were simulated. The four-port design that has been shown offers a total gain of 15.93\u00a0dB, a peak co-polar value of 5.46\u00a0dB, a minimum return loss of \u2212\u00a020.53\u00a0dB, a peak field distribution of 46.43\u00a0A/m and a maximum bandwidth of 1.375\u00a0GHz. The values for all diversity parameters like ECC are near zero, the Negative value of TARC, Near to zero MEG, DG is almost 10\u00a0dB, and a zero value of CCL is achieved. All diversity parameter performance is within the allowable range. The design is well suited for 5G and aeronautical mobile communication applications. By addressing the growing need for more reliable connections, more effective data rates, and reduced power consumption from the Internet of Things (5G), the future of innovative technologies like virtual reality and intelligent cities becomes brighter2. Using a single antenna in the mm-wave spectrum presents substantial difficulties due to signal fading, atmospheric absorptions, and route loss attenuations3. The Multiple-Input Multiple-Output (MIMO) antenna has been highlighted as a key enabling technology for current and future wireless systems due to its ability to use multiple antennas to increase channel capacity and enable high data rates and throughput on the scale of gigabits per second4.The fast growth of wireless devices, limited bandwidth, and restricted channel capacity have considerably increased the number of people trying to establish improved communication network standards in the current day. As a direct consequence of this, the development of communication systems of the next generation, known as 5G, using the mm-wave spectrum and boasting much-increased channel capacity and data speeds, has been sped up5. The following are recent developments in antenna technology for 5G networks operating in mm-wave frequencies. The significant atmospheric and propagation losses at mm-wave frequency are beyond antenna designs' capabilities at those bands with a modest gain. Several high gains and beam-steering antenna array systems with high signal strength and comprehensive coverage have been proposed to counteract these attenuation7. In reference8, it is stated that a PIFA array in MIMO configuration may achieve a peak simulated gain of 12dBi across a 1\u00a0GHz operating bandwidth. Reference describes a MIMO antenna built on an EBG bandwidth-wise (0.80\u00a0GHz). When supplied from a single port, however, multi-element antenna arrays match the performance of a single antenna. However, MIMO antennas show multipath propagation with 5G's hallmarks of enhanced data throughput, capacity, and connection dependability. Many MIMO antenna designs for 5G mm-wave applications have recently been published9. The maximum gain of 7.41dBi is attained at 28\u00a0GHz with a bandwidth of 1.5\u00a0GHz between 27.2 and 28.7\u00a0GHz, thanks to the antenna\u2019s design. An article on the DRA-based concept for 5G communication is reported in10, although they only support a maximum data rate of around 1\u00a0GHz. Reference11 proposes a multi-element antenna design optimal for 5G communications due to its ability to direct radiation in the desired oblique direction. ECC is also tested to guarantee MIMO performance12. The SIW feeding method has a maximum gain of 7.37, as described in10. The suggested antenna in13 operates between 24.25 and 28.35\u00a0GHz, covering both 5G bands, with a gain that ranges from 8.2 to 9.6\u00a0dBi. In addition, a 12\u2009\u00d7\u200950\u2009\u00d7\u200980.8\u00a0mm3 four-element T-shaped MIMO antenna is demonstrated for 5G applications. Similarly, reference14 reports on a slotted MIMO antenna array fed by an SIW for mm-wave communication. The most significant gain achieved by the suggested MIMO architecture is 8.732\u00a0dB, and its resonant frequency is 25.2\u00a0GHz. The effects of diversity gain, MEG, and ECC are also investigated. For 5G networks, a similar 2-Port MIMO array has been disclosed15.Fifth-generation MIMO antennas are more compact, which aids in assimilation in MIMO systems. Concurrent operation is made possible by the wide bandwidth, while the high gain reduces atmospheric attenuations and absorptions at mm-wave frequencies. Making components with minimal mutual coupling and high isolation, which improves antenna performance, is also challenging in MIMO antenna design16. Dispersion is essential to optical system performance. Recent advances have made the artificial Meta surface a promising dispersion modification alternative. The current meta-atom dispersion manipulation idea only regulates the propagation phase within the operating frequency range or a few wavelengths. This work introduces the chirality-assisted phase to manipulate meta-atom dispersion. This method\u2019s theoretical demonstration is also given. A detailed investigation of the chiral meta-atoms reflective mode dispersion features is given, focusing on its frequency range. This paper proposes and builds two hybrid dispersion-engineered metal mirrors (HDEMs) to demonstrate dispersion manipulation at various frequencies. HDEMs are intended for achromatic lower-half band focusing and highly dispersive upper-half band focusing. HDEMs also have excessive dispersive focusing in the bottom half band and aberrant focusing in the top half band. Full-wave simulation and measured results prove the technique\u2019s validity and applicability. This work uses a new degree of freedom to alter dispersion to construct Meta surfaces with customized dispersion17. The suggested design in18 has a succession of fractally loaded circular patch antenna components on top and a partially grounded, protruding T-shaped stub on the substrate's bottom. Using four triangular slots on the substrate and a T-shaped stub on the ground, sufficient isolation over the appropriate bands is achieved. The recommended design has a succession of fractally loaded circular patch antenna components on top and a partially grounded, protruding T-shaped stub on the substrate\u2019s bottom. Using four triangular slots on the substrate and a T-shaped stub on the ground, sufficient isolation over the appropriate bands is achieved.The notion entails the development of a specialized planar structure with chiral components that exert control over the phase of circularly polarized microwaves. The aforementioned surface retains the distinct circular polarization state of microwaves, allowing the generation of distinct and precise holographic representations for various objects or scenes when exposed to microwaves, all falling within the microwave frequency spectrum. The aforementioned breakthrough exhibits possibilities for utilization in sophisticated imaging systems, communication technologies, and microwave-based technologies that need meticulous regulation of polarization and imaging capabilities19 suggests no extra decoupling mechanism is required for the design to ensure isolation between many ports. By merging four single wideband antenna components, a metallic disc with a circular shape is formed in the ground plane of the proposed antenna. With a 180\u00b0 phase difference, this disc acts as a current pool that isolates individual ports. The lotus-shaped array-based configuration using low-profile material can be used for 5G communication applications. The MIMO antenna comprises a lotus-shaped radiating element, an in-ground DGS and extra slits to facilitate boresight radiation. In both the 4\u2009\u00d7\u20094 and 8\u2009\u00d7\u20098 designs, all radiating elements are organized in an orthogonal manner. To achieve a high isolation level exceeding 16\u00a0dB, a distinctive ground-based decoupling structure is employed20. The advancement involves creating a MIMO antenna with an arc-shaped design featuring two ports, offering improved isolation characteristics. To achieve wideband performance for this antenna, a smaller ground plane is employed21.Articleo between them. This setup incorporates various components such as EBG structure, capacitive elements (CE), DGS, and neutralization line (NL). Additionally, an \"EL\" slot is integrated into the radiating element, and two identical stubs are connected to the partial ground to enhance impedance matching and radiation characteristics across the desired frequency bands22. The SRR-based symmetrical partial ground approach provides a peak gain of 10.6\u00a0dBi. The suggested antenna design can span an extensive frequency range (25.1\u201337.5\u00a0GHz). An 8\u2009\u00d7\u20098 MIMO antenna for 5G devices is shown in another article1, having a substrate size of 31.2\u2009\u00d7\u200931.2\u2009\u00d7\u20091.57\u00a0mm3. Similarly23 represents a 5G MIMO antenna with interconnected metamaterial arrays. The reported EBG-reflector-based antenna system boasts a high gain of up to 11.5\u00a0dB and a broad operational frequency range. The suggested MIMO setup's ECC and diversity gain analysis are observed. Article24 describes a high-gain antenna based on the Fabry\u2013Perot interferometer. The proposed design can achieve a peak gain of 14.1\u00a0dBi at mm-wave frequencies between 26 and 29.5\u00a0GHz. Error correction code (ECC) analysis also assesses how well the proposed antenna arrangement performs in a MIMO setting. In reference9, a two-element MIMO DRA is presented. It presents 5G networks. The described antenna operates in the frequency range of 27.19\u201328.48\u00a0GHz. The 27.19\u201328.48\u00a0GHz band is optimal for 5G because of its high gain. The shown antenna achieves a gain of about 10\u00a0dB.To enhance the isolation between the MIMO antenna elements while keeping complexity and cost low, the antenna elements are aligned in an orthogonal configuration with a spacing of 0.3\u03bb25. Article26 introduces a straightforward yet effective eight-element MIMO antenna array that achieves broadband coverage from 3.3 to 6\u00a0GHz, tailored for fifth-generation (5G) smartphones. The antenna's simplicity is attributed to its multiple-mode structure, incorporating double coupled-fed loop modes and a slot mode activated through the feeding strip linked to the tuning branch. Ingeniously, the inclusion of the tuning branch on the side frames obviates the need for additional lumped elements, streamlining the antenna\u2019s design. Moreover, the implementation of polarization diversity techniques is harnessed to enhance isolation performance. Article27 suggested configuration comprises a singular module, featuring an adapted L-shaped rectangular radiator combined with a Z-shaped slot-loaded defected ground structure (DGS). Optimization of the DGS employs machine learning algorithms to enhance the achievable maximum absolute resonant bandwidth (ARBW) output. This is accomplished by fine-tuning the defected ground structure using Right Shifting (RS) and Left Shifting (LS) techniques, while simultaneously acquiring input features.The Internet of Things (IoT), using industrial, scientific, and medical (ISM) bands like 2.45 and 5.8\u00a0GHz, facilitates remote sharing of heart data from pacemakers to medical professionals. This research introduces the first-ever communication between a compact dual-band MIMO antenna inside a leadless pacemaker and an external dual-band MIMO antenna on the body within ISM frequency bands28. Article29 is a dual-band multiple-input multiple-output (MIMO) antenna designed using metamaterials to achieve high isolation, intended for millimeter-wave communication networks in the context of 5G. The antenna takes the form of a pentagon-shaped monopole, delivering a dual-band performance across the 5G 28/28 bands and boasting a wide operational bandwidth. The four-port MIMO antenna is crafted for 5G-NR band applications, encompassing n77, n78, and n79 frequencies. The MIMO antenna's development trajectory is explored by drawing insights from the characteristics and optimized single-element antenna. Measurement results show a remarkably high impedance match for the MIMO setup and increased isolation within the same band, enhancing the 5G-NR bandwidth performance30.Compact and low-profile dual-band 2\u2009\u00d7\u20092 wideband wearable slot antenna designed for the 3.4\u20133.6\u00a0GHz frequency range (LTE Band 42) to be integrated into a smartwatch. The antenna is optimized to meet the size constraints of smartwatch applications while also ensuring resonance with the upcoming 5G technology represented in ArticleThe suggested design is a high gain that employs low-profile material with strong MIMO properties.The small size and square shape, the proposed MIMO antenna is easily integrated into 5G devices.The disclosed antenna's strong MIMO performance vouchsafes the design\u2019s viability for 5G wireless communications in the future.The design cost of the presented structure is very low due to the FR4-based dielectric material.Sufficient isolation by using passive strips between the radiating elements.Performance of different diversity parameters like ECC, TARC, MEG, DG and CCL is satisfactory.Comparison among simulated and measured results authenticates the response of the design.Design is compared with other existing designs and it represents design performance is good.The key novelty points of the proposed design structure are as follows.The introduction is represented in section\u00a0\u201c3. The finite element method is used to model the proposed antenna structure. There are two stages involved in finalizing the single-element design. The planned single-element design is presented in Fig.\u00a0Figure\u00a0After doing multiple iterations, the shape of a sickle-shaped patch is considered. A parasitic patch in a MIMO antenna system serves numerous roles and offers various benefits. It plays a role in beam steering by altering the radiation pattern and improving signal coverage and reception in specific directions. It also helps reduce mutual coupling between antenna elements, enhancing isolation and minimizing interference. The addition of a parasitic patch can increase antenna gain, improve directivity, and enhance overall MIMO performance by maintaining channel diversity.31. The parasitic patch elements are loaded between two patch-radiating parts. The thickness of the parasitic patch is 2\u00a0mm. The length of the parasitic patch is 25\u00a0mm. The thickness of all radiating patch structures is 2\u00a0mm. The spacing among the two patch elements is 36\u00a0mm. The feed line's spacing from the structure\u2019s outer is 20\u00a0mm. The patch, parasitic element and ground layers are considered copper material. The FR4 epoxy is chosen as a substrate. The FR4 provides a dielectric constant of 4.432. The proposed design is tested in an anechoic chamber, as shown in Fig.\u00a033.Additionally, the compact design of parasitic patches makes them suitable for integration into small form factor MIMO antennas, making them valuable in space-constrained applications35.Here, relative permittivity is represented by, Resonating frequency is represented by entclass1pt{minima36. The impedance bandwidth is the parameter that needs to be taken into consideration for bandwidth calculation. The lower and upper frequencies that adhere to the necessary VSWR are determined by the frequency band on which the antenna operates. The frequency range across which the VSWR is less than 2 is referred to as the operating bandwidth. In the presented work VSWR is chosen for the criteria of 2:1.Analysis and design of high-frequency-operated antennas rely heavily on S-parameters. Antennas are essential components in wireless communication systems and are subject to complex electromagnetic interactions at high frequencies. S-parameters provide valuable insights into the behaviour of antennas, including their impedance matching, radiation patterns, and overall performance. By measuring or simulating S-parameters user can assess the antenna's impedance characteristics, reflection and transmission of signals. S-parameters play a vital role in the analysis, and design of high-frequency operated antennas, enabling engineers to achieve superior performance and reliability in wireless communication systemsParametric iterations in MIMO antenna design provide the benefits of optimizing antenna performance, customization for specific applications, efficient resource utilization, comprehensive trade-off analysis, and enhanced structure robustness. Through iterative adjustments of antenna parameters, researchers can fine-tune the design to meet desired performance metrics, adapt to varying conditions, maximize resource utilization, analyze trade-offs, and ensure reliable operation in challenging environments. There are three types of parametric iterations are considered to achieve the optimum performance of the design.11 is affected due to the thickness variation of the patch region. The return loss of \u2212\u00a017\u00a0dB is achieved for considering 2\u00a0mm thickness, and the maximum broadband response is observed for the 5\u00a0mm size of 2.135 (3.775\u20135.91). To make a uniform design structure the 2\u00a0mm size is taken into consideration. The second parametric consideration is by changing the length of the patch (B) region over the 1\u20135\u00a0mm is observed in Fig.\u00a011 and sufficient bandwidth is kept for the 2\u00a0mm size. The 2\u00a0mm size represents a return loss of \u2212\u00a031.86\u00a0dB and a bandwidth of 1.81\u00a0GHz (3.425\u20135.235). The third parametric iteration in terms of varying lengths of the ground region (11\u201315\u00a0mm) is observed in Fig.\u00a011 and bandwidth value of A, B and G, chosen as 2\u00a0mm, 2\u00a0mm and 11\u00a0mm.The first parametric parameter is to vary the patch width (A). The variation of A is considered over the 1\u20135\u00a0mm is observed in Fig.\u00a038.The validation of antenna performance through simulation and measurement is crucial for multiple reasons. Simulations enable engineers to theoretically analyze antenna behavior, facilitating the design, optimization, and troubleshooting of antenna systems before physical implementation. Simulations offer valuable insights into antenna performance across different scenarios by evaluating parameters like radiation patterns, impedance matching, and gain. However, simulations are based on assumptions and simplifications that may not accurately capture real-world complexities. Hence, it becomes essential to measure the actual performance of antennas to validate the simulated results and ensure their practicality. Measured data allows engineers to verify the antenna's real radiation characteristics, validate the affected models, account for environmental factors, identify any deviations, and fine-tune the design for optimal performance in real-world settings. Ultimately, employing a combination of simulation and measurement provides a comprehensive understanding of antenna behavior, thereby enhancing the reliability and effectiveness of antenna systemsFigure\u00a040.There may be differences between the simulated and measured findings while simulating and measuring antennas owing to numerous variables that induce tolerance. These issues include manufacturing tolerances, material qualities, ambient circumstances, and measuring instrument constraints. Tolerances in manufacturing, such as differences in dimensions, material attributes, and fabrication procedures, may cause departures from the original design. Material parameters like conductivity and permittivity may also deviate from ideal values. Furthermore, environmental factors such as electromagnetic interference and the presence of surrounding objects might impact the antenna\u2019s effectiveness. Finally, measuring equipment limitations, such as intrinsic noise, calibration errors, and bandwidth constraints, brings uncertainty into the estimated data. These variables contribute to the observed tolerance between simulated and measured antenna performance41.The gain response of antennas plays a crucial role in MIMO systems that utilize multiple antennas. MIMO technology uses multiple antennas at the Tx and Rx to achieve spatial diversity and multiplexing gains. The concert of the overall system, including coverage, capacity, and link quality, is influenced by the gain response of the antennas. A higher gain antenna enables more robust signal transmission and reception, improving signal-to-noise ratio (SNR), increasing system capacity, and extending coverage range. Moreover, the gain response affects important MIMO channel characteristics such as channel correlation and spatial efficiency, directly impacting data rate and system reliability. Therefore, optimizing the gain response is grave for maximizing the concert of MIMO systems42. Another aspect is choice of frequency bands can impact antenna gain. Higher-frequency bands, such as millimeter-wave frequencies, often enable the use of smaller, higher-gain antennas. Carefully select the frequency band that aligns with your application's requirements and regulatory considerations. Enhancing gain in a MIMO antenna system requires a holistic approach that considers antenna selection, placement, spatial diversity, beamforming, and frequency band selection. By carefully addressing each of these aspects, you can significantly improve the gain of your MIMO system, resulting in better signal reception and transmission capabilities in wireless communication scenarios43.Enhancing gain in a MIMO antenna system involves a comprehensive approach to maximize signal reception and transmission. The first and most important aspect is selecting the proper shape of the patch and ground shape to help achieve high gain with broader radiation patterns that can focus the signal energy in specific directions. Proper placement of these antennas is crucial. Elevate antennas to reduce interference among radiating elements. Maintain an optimal separation distance between MIMO antennas, which varies depending on the frequency and antenna characteristics. Align antennas according to their polarization, radiation patterns, and proper insertion of parasitic elements among radiating structures. The careful antenna selection and placement are foundational steps to improving gain45. The co-polar and cross-polar response of the planned four-port MIMO antenna for the 3\u00a0GHz resonating frequency is observed in Fig.\u00a0The presentation of the planned four-port MIMO antenna in terms of gain and radiation pattern is represented in Fig.\u00a047. The co-polar and cross-polar directivity response of the planned design is observed in Fig.\u00a0In wireless communication systems, the directivity response of an antenna is crucial. It describes an antenna\u2019s directional bias, indicating how well it can send or receive signals in that direction. Increases in signal intensity and communication range in the desired direction are achieved by increasing directivity, which causes the radiation pattern to become more concentrated. Long-distance communication, expansive signal coverage, and high-quality links all need to be directed energy. It improves the system's overall performance by allowing for more precise regulation of signal propagation and lessening the impact of interference. Directivity enhances the signal-to-noise ratio (SNR) and the overall signal quality of the system by focusing most of the energy in the desired direction. As a result, maximizing an antenna's directivity response is essential for reliable and effective wireless communication48.Knowing and optimizing MIMO systems requires knowing MIMO antenna E-field distribution. MIMO technology transmits and receives signals on distinct spatial streams using multiple antennas at both ends. The E-field distribution shapes the spatial features of these transmitted signals, affecting system performance. MIMO antenna E-field dispersion matters for numerous reasons. First, it impacts MIMO diversity gains. Spatial variety reduces fading and improves signal degradation by regulating the E-field distribution. The antennas' E-field dispersion enhances signal separation and reliability. Second, spatial multiplexing advantages depend on E-field distribution. Spatial multiplexing sends numerous data streams over the same frequency range using separate antenna components. The E-field distribution separates and couples various streams, increasing data speeds and system capacity. Optimizing E-field distribution improves signal coverage and reduces interference. The E-field distribution may be modified to concentrate energy on desired coverage regions by adjusting antenna directionality and radiation pattern, boosting signal strength and quality. E-field distribution management may also reduce interference from nearby antennas or signal sources, guaranteeing a stable communication connection. FEM or MoM numerical electromagnetic simulations are used to analyze and optimize MIMO antenna E-field distributions. These simulations reveal MIMO system spatial properties and performance, enabling effective antenna design and layout. In conclusion, MIMO antenna E-field distribution affects diversity gains, spatial multiplexing gains, coverage, interference reduction, and system performance. MIMO systems may enhance wireless communication data speeds, capacity, and reliability by understanding and optimizing E-field distribution49. In the proposed design passive elements located between the two radiating patches enable the isolation in the structure. The proposed design is resonating at 3\u00a0GHz and 5.43\u00a0GHz. It is very clear from the graph that the surface charge distribution is not able to pass from one radiating element to another radiating element due to the passive structure. Figure\u00a0Checking isolation based on surface current density involves calculating the current flowing along the surface of conductive materials, dividing it by the cross-sectional area, and comparing the resulting surface current density against acceptable thresholds defined by specifications and regulations. This evaluation aims to prevent interference and ensure proper isolation between componentsMIMO antenna systems' impedance matching and radiation efficiency are determined by the TARC . The TARC optimizes MIMO system performance by transmitting and receiving signals concurrently on separate spatial streams. TARC combines the antenna\u2019s reflection coefficient and radiation efficiency. A low TARC implies effective antenna impedance matching, minimizing reflected power and maximizing power flow to the transmission medium. This optimizes power transmission and decreases system losses. MIMO systems need low TARC to preserve signal quality and reduce antenna interference. Common TARC antennas are well-matched to the transmission line and feature low signal reflections. This boosts system capacity and data throughput by lowering antenna interference. Low TARC also improves antenna radiation efficiency. Antenna radiation efficiency is how well it converts electrical energy into electromagnetic waves. Low TARCs improve antenna radiation efficiency by minimizing reflections and maximizing power transmission, producing more robust and dependable signals. MIMO antenna design, impedance matching, and matching network selection optimize TARC. By reducing the TARC, antennas may increase signal transmission and reception, interference, capacity, coverage, and dependability. Finally, the TARC in MIMO antennas affects impedance matching, power transfer efficiency, radiation efficiency, and interference reduction. MIMO systems may improve wireless data speeds and performance by optimizing the TARC. Equation\u00a0 can be u50. MIMO systems can outperform single-antenna systems by leveraging the wireless channel\u2019s spatial dimension. MIMO systems benefit from diversity gain (DG) by employing many antennas at the Tx and Rx to increase signal quality. MIMO sends and receives signals over a standard frequency band using multiple antennas. Wireless signals may fade and attenuate due to many propagation channels. Multiple antennas reduce fading and improve system performance. Calculating DG involves antenna number, correlation, and channel conditions. Several antennas and channel variations increase diversity gain. Uncorrelated channels maximize diversity gain, whereas heavily correlated channels minimize it. Beamforming, precoding, and space\u2013time coding may increase the diversity advantage of MIMO. MIMO diversity gain may improve reliability, capacity, and coverage in wireless communication systems with several antennas.The Envelope Correlation Coefficient (ECC) may assess signal envelope correlation between antenna components. Signal envelope magnitude is independent of phase. The Equal Channel Correlation (ECC) statistic measures signal envelope similarity across antennas. When the ECC is approaching 1, several antennas provide less spatial variety. It shows closely linked antenna signals. However, a small ECC indicates that the antennas\u2019 signals are independent, maximizing spatial diversity gain. The ECC may be calculated using power levels and antenna component correlation coefficients. Cross-correlation and auto-correlation techniques may be used to calculate the correlation coefficient, a linear measure of antenna signals. Reflections and dispersion from nearby objects may raise ECC, antenna, and mutual coupling. The MIMO system may lose spatial diversity if these factors induce unwanted correlations between antenna signals. The ECC may fine-tune a MIMO system's design and execution to increase wireless communication dependability and quality. ECC response of less than 0.5 improves communication. Equation\u00a0 calculatThe DG calculation is done using Eq.\u00a0. As showThe importance of MIMO channel capacity loss in determining the bounds and influencing variables of the maximum capacity of MIMO systems is critical. CCL can be calculated using Eqs.\u00a0\u201311). MI. MI11). The CCL response is less than 0.3 for the proposed frequency span, as shown in Fig.\u00a0The design performance of the presented structure with other articles is shown in Table The sickle-shaped four-port MIMO antenna structure is presented in the manuscript. The design optimization is achieved by initially designing and optimizing the single port element structure, then preparing for two port elements, and finally, the four-port design is finalized. Three parametric analyses are considered, like variation in length, the width of the sickle-shaped patch, and varying length of DGS. The 2\u20138\u00a0GHz frequency span is taken to analyze the structure. The proposed design is fabricated using low-profile material. The judgment among measured and simulated results is incorporated in the article. The presented four-port design provides a total gain of 15.93\u00a0dB, a peak co-polar value of 5.46\u00a0dB, a minimum return loss of \u2212\u00a020.53\u00a0dB, maximum bandwidth of 1.375\u00a0GHz. All diversity parameters like TARC, ECC, MEG, CCL and DG are within the permitted range. She presented a design suitable for the 5G and aeronautical mobile communication applications."}
{"text": "The performance of wireless networks is related to the optimized structure of the antenna. Therefore, in this paper, a Machine Learning (ML)-assisted new methodology named Self-Adaptive Bayesian Neural Network (SABNN) is proposed, aiming to optimize the antenna pattern for next-generation wireless networks. In addition, the statistical analysis for the presented SABNN is evaluated in this paper and compared with the current Gaussian Process (GP). The training cost and convergence speed are also discussed in this paper. In the final stage, the proposed model\u2019s measured results are demonstrated, showing that the system has optimized outcomes with less calculation time. In antenna design, evolutionary algorithms (EAs) are frequently employed. They demonstrate advantages for various design instances due to their capacity to break out of local optima without the need for an initial design and generality. EA-driven antenna design is arguably dominated by particle swarm optimization (PSO) and differential evolution (DE) algorithms. The optimization time, however, can be prohibitive given that full-wave electromagnetic (EM) simulations are frequently required to acquire correct performance of a candidate design and that EAs frequently need tens of thousands of such EM simulations to obtain the best design ,2,3. PriThe MillimeterWave (mmW) has been previously utilized in RADAR systems and satellite communication. These waves can undoubtedly travel through longer ranges in cases where Line of Sight (LoS) is made available; however, without having LoS, they cannot travel several hundreds of meters. Excessive propagation impairment is mainly because the atmospheric absorption of waves should be considered while designing an antenna for mmW . The assThe outcomes related to a modification in the substrate materials designed for 60 GHz V-band highly directive Yagi antenna have been introduced in . IntendeSimilarly, a Resonant Cavity Antenna (RCA) intended for the high-gain dual band is proposed in , in whicPorcelain material based upon a rectangle-shaped Dielectric Resonator Antenna (DRA) is placed over the substrate with relatively low permittivity and fed by a metallic circular patch. The development investigation and analysis are carried out using a cross-slot aperture and rectangular slot. By implementing a cross-slot gap on the ground plane, a substantial improvement in gain along with bandwidth has been accomplished. The singly fed dielectric DRA recommended in this article offers high growth, efficiency, and wide bandwidth.A planar antenna with a high-gain-having conical beam intended for drone applications of mmW is radiated by utilizing some simple monopole  exclusivIn contrast with various other designs on CB planar antennas, the suggested model accomplishes the maximum gain and maximum radiation efficiency, having a relatively decent 10 dB impedance bandwidth. The proposed model in  compriseR. Rehman et al. in  proposedIn , a planaDesigning a single wideband antenna with good directivity and gain for the V-Band , or 50\u20137\u03c3 and mean \u00b5. Based on the The previous section discussed the background and literature of the proposed high-gain antenna design. This section explains the analytical approach for validation of the structure and parameters of the proposed SABNN-based antenna model. At first, the basic principle of currently used techniques such as Gaussian Process (GP) is discussed in this section. Consider the observations function ,26,27,28iscussed ,30 as, and probability are widely used. The LCB method is introduced in this paper using the objective function There are two optimization techniques used for antenna design, named local optimization and global optimization. The global optimization method is applied in this paper for antenna design using an evolutionary algorithm (EA). Taking To meet the requirements for efficient antenna design, such as minimum training cost and prediction uncertainty for design, as well as provide high-quality predicted value, the Bayesian Neural Network (BNN) is a promising solution. The BNN procedure has valuable contribution towards optimized antenna design. Taking the variable Applying the equations related to the patch antenna presented in the preceding part, the antenna\u2019s rough design is created. A parametric sweep and CST optimizer are used to optimize the parameters and variables. 2. The CST MWS design tool simulates the design. The suggested design\u2019s parametric values are shown in mm in D (Driven element), D1T (Top Director 1), D1B (Bottom Director 1), D2T (Top Director 2), and D2B make up the remaining elements (Bottom Director 2). To simulate the antenna design, a double copper-clad board made of RT/Duroid 5880 material (epsilon = 2.2) was used. The Reflector Element R with Wr and Lr; the Driven Element D with Ld and Wd; the Director 1 element D1T and D1B with Ld1 and Wd1 indicating the value of length as well as width; and the Director 2 element D1T and D2B with Ld2 and Wd2, indicating the length and width, respectively. The length of g separates every element along the x-axis. S1 divides the Top Directors 1 and Bottom Directors 1, while S2 displays the separation between the Top Directors 2 and Bottom Directors 2. SL and SW stand for length and width of the substrate, respectively. The substrate has a thickness of 0.1 mm. The substrate\u2019s overall dimensions are 10.01 \u00d7 10.8 mmMicrostrip antennas are often made on a homogeneous substrate and are low-profile, conformal, lightweight, and compact in size. By using a dielectric with a high permittivity value, the size of the antenna can be easily reduced. The energy in the surface wave modes is raised by this rise in dielectric though. Because they are diffracted via the margins of the ground plane of finite size, these surface waves decrease the performance and efficiency of the antenna and cause interference with the radiation pattern. These negative effects might be minimized by the reductions in surface wave modes. The main cause of surface wave radiation for thin-substrate microstrip antennas is unquestionably the TM0 mode, and heterogeneous substrates provide the solution to nearly completely suppress all of the surface waves inspired by this mode.The substrate surrounding the patch is simply removed, either completely or partially, to create heterogeneous substrates. By suppressing the surface waves, this method has been utilized to boost the gain of a microstrip antenna. The antenna has also undergone substrate removal, which has significantly improved bandwidth and efficiency.Therefore, higher gain, bandwidth, and efficiency are due to the heterogeneous substrate, as mentioned in The gaps in the element which separates every specific component, irrespective of whether it is on the x-axis or even the y-axis, execute a vital function in the layout. The gap \u2018g,\u2019 which is undoubtedly on the x-axis, is the gap among all the individual elements along the identical x-axis. This distance is accountable regarding mutual coupling among driven elements and parasitic elements.Due to their shorter length than the driven element, the D1 elements (D1T and D1B) are actually in charge of obtaining beam directionality and producing an additional band at a higher frequency. S1 and S2, which represent the gaps between Top Directors and Bottom Directors and are located along the y-axis, are typically in charge of improving. To obtain the strong coupling between the Driven and Director 1 elements, the S1 parameter needs to be small. The distance between the director and driven components must be kept as short as feasible in order to put the parasitic elements next to the driven elements. The gap capacitance will decrease as the electric field coupling increases. The top surface current distribution shown in A single radiating element with a width of \u20182W\u2019 is how the sides of the D1 elements behave. The S2 parameter can be positioned in a variety of ways to produce the largest possible effective aperture. The electrical width of the effective aperture grows as the S2 parameter increases, increasing the gain. The coupling between the D2 and D1 elements decreases when S2 grows too much, which causes gain to drop. The gap capacitance and the fringing capacitance should be adequate for the D2 element to acquire the required radiation if the S2 value is modest enough.The effects of changing the S2 parameter up or down are clearly seen in the surface current distribution shown in As shown in The millimeter-wave spectrum, which is anticipated to be used in the next generation of 5G technology, is where the band of the intended antenna is located. With regard to applications such as device-to-device communication, WLAN, and WPAN, the V-Band (50\u201375 GHz) of millimeter waves should be used (D-2-D). The optimum range of the presented model is evaluated in 2 in total. The antenna functions according to the conventional Yagi radiation theory. The developed antenna has a maximum return loss of \u221230 dB at 70.6 GHz and excellent impedance matching. It was found that as the electrical width of the effective aperture rises, so does the gain. How several of the parameters changed was examined, which had an impact on how gain improved. The heterogeneous substrate is another method that is used and is in charge of further improving gain, directivity, bandwidth, and efficiency. The developed antenna has an impedance bandwidth of 15.17 percent and 10.72 GHz. The antenna has a high gain of 11.8 dB and a high directivity of 12.1 dBi, respectively. The V-Band of mmW frequency spectrum, i.e., 50\u201375 GHz, is concentrated for the design\u2019s band of operation. The 50\u201375 GHz frequency spectrum of mmW is undoubtedly planned in 5G intended for Device-to-Device (D-2-D) transmission. This is expected to be utilized in ad hoc communication around short distances. Furthermore, this spectrum could be used for high-frequency short-range WLAN, WHDMI, and WPAN.For millimetre waves, a printed high-gain Yagi antenna was developed. The antenna\u2019s straightforward design makes it easy to fabricate. The antenna is lightweight, low-cost, and low-profile. The planned antenna measures 10.8 \u00d7 10.01 mm"}
{"text": "In this paper, a capacitively-fed, ultra-wideband (UWB), and low-profile monocone antenna is proposed for vehicle-to-everything (V2X) applications. The proposed antenna consists of a monocone design with an inner set of vias. Additionally, an outer ring is added with a small gap from the monocone and shorted with six folded wires of different lengths to extend the operating band. The proposed antenna covers the frequency range from 0.75 GHz to 7.6 GHz and has a 164% fractional bandwidth, with a gain value varying between 2 and 10 dBi. The dimensions of the antenna are 0.37 Vehicle-to-everything V2X) technology is gaining increased interest in modern automotive engineering. Vehicle roof-mounted antennas are used for a wide range of applications such as vehicle-to-vehicle (V2V), vehicle-to-infrastructure (V2I), vehicle-to-network (V2N), vehicle-to-pedestrian (V2P), and keyless entry . There aX technolIn a similar approach, identical printed shorting strips on a dielectric substrate were utilized between the top hat and the ground ,15,16,17Recently, 3D-printed antenna designs have gained more interest due to the recent advancement in 3D printing technology and the reduction in its costs ,28. SuchIn this paper, a low-profile capacitively-fed monocone antenna is presented to support V2X applications. The proposed design covers the frequency band between 0.75 GHz to 7.6 GHz, with a 164% impedance bandwidth while keeping a compact size and low profile. The design is realized by adding two sets of grounding configurations that are utilized to achieve significant miniaturization. The inner set is four straight conducting posts between the monocone and the ground, while the outer set is six folded shorting wires to extend the bandwidth. The folded wires have different lengths to further extend the operating band at the lower frequency end. The position and angular spacing between the shorting posts were chosen to improve impedance matching and are presented in this paper. The antenna is fabricated with a 3D printer before the copper coating. The radiation pattern of the proposed design is stable over the frequency of interest. A field test of the proposed antenna was utilized to validate its performance and compare it with a commercially available antenna used for the same applications.1). A capacitive feed is incorporated to allow broad impedance matching over the frequency band of interest. The height and upper radius of the feed are defined as RC2 and RC1, respectively. The design is placed on a metal plate with a thickness of (tbottom = 1.5 mm). The gap (G2) between the monocone and capacitive feeder is filled with a thin-film dielectric with a relative permittivity (\u03b5r) of 2.02 and a loss tangent (tan \u03b4) of 0.0002. The geometry of the proposed antenna is shown in 1. 1) and is grounded through six folded shorting lines. A total of four inner grounding posts are located 90\u00b0 apart from each other. The posts were installed near the capacitive feed to improve impedance matching at the lower frequency range. A planar outer ring is placed beside the open-ended edge of the monocone with a small gap (Gm), while the other four are the short meander (Sm). The folded wires are 2 mm-thick. The thickness of the meander line was also considered for better rigidity to properly support the ground ring while optimizing low band matching performance. These lines are vertically located and connect the ground ring to the ground plane. Two of these folded lines are the long meander  of the four short meander lines (Sm) are located at 35\u00b0, 125\u00b0, 195\u00b0, and 325\u00b0 from the reference line. The angles (\u03b82) of the two long folded lines are located at 90\u00b0 and 270\u00b0. The spacing between the monocone and the ring was adjusted to control for the amount of capacitive coupling along the perimeter of the monocone. The inner and outer radii of the ring are denoted as R2 and R3, respectively. For the short meander, the V1 from 0.6 mm to 3.6 mm. The result indicates that in the lower frequency band regions, the spacing needs to be approximately more than 2.6 mm to avoid frequency notches in the lower frequency band. This is mainly because of the rapid changes in the input impedance imaginary part of the design with the open-edge distance variation. The separation distance (G2) between the monocone and capacitive feed varied from 0.02 mm to 0.1 mm. The simulated results show that if the gap increases to 0.1 mm, the reflection coefficient significantly degrades across the frequency range of 700 MHz to 3 GHz. As separation decreases to 0.02 mm, the return loss across the same region improves, as shown in The effect of the spacing between the open-ended edge of the monocone and the grounded ring is examined by varying GThe impact of the folded wires near the capacitive feed is also investigated. Significant improvement was observed in the presence of the ground posts throughout the frequency band of interest, as illustrated in These folded shorting wires in the proposed design result in the miniaturization of the antenna by shifting the lower frequency band by 250 MHz. To identify the radiating part of the proposed antenna, the current distribution is shown at low, middle, and high frequencies, as illustrated in All components of the proposed antenna are made from low-cost and rigid polylactic acid plastic (PLA) material, with dielectric losses of 0.01, and resin. A 3D printer (Dramel 3D45) and a resin printer (Formlabs Form 3) were used to precisely fabricate the antenna geometry. To make the antenna lightweight, cost-effective, and electrically conductive, MG Chemical\u2019s Super Shield copper conductive nanoparticles (843AR-140G) were utilized for metallization and sprayed on the components followed by drying for 40 min without any directly blown air. The conductive spray was applied only once to cover all of the PLA material of the antenna. The small variation in the copper thickness, 1~2 oz., did not show a significant effect on the antenna\u2019s performance ,30. The The simulated and measured reflection coefficients of the proposed antenna are shown in The proposed antenna was tested to validate the far-field characteristics of the antenna in the Howland Model 3500D anechoic chamber. The measured peak realized gain varied between 2 to 10 dBi at the frequency band of interest, as shown in The radiation patterns were plotted in two principal planes at the representative frequencies, as shown in To show the effectiveness of the proposed monocone antenna in real-life V2X applications, a field test was conducted with the latest V2X communication units available on the market. To facilitate communication, MK6C C-V2X units from Cohda Wireless  were useThe field test was conducted along Bryce Lawn Road at the University of Alabama. This testing site features 700 m of a continuous line-of-sight (LOS) distance, as illustrated in The proposed monocone antenna was placed on the roof of the vehicle and was connected to the OBU through a coaxial cable, as shown in t) of 20 s was applied to the PER, as shown in Equation (1).The test was conducted with three different antenna configurations\u2014the proposed monocone, a commercial antenna with single-port excitation, and the same commercial antenna with two ports excited for spatial diversity. The communication performance parameters, including the packet error rate (PER) and latency, were measured by examining the transmitted and received packets. The PER is defined as the total missed packets over the total packets sent. To examine a large enough time span to obtain accurate data on packet loss, a time window .Five tests were conducted, and the collected data were averaged and plotted. Furthermore, the measured latency for the three different antenna configurations indicated that the proposed antenna showed fewer fluctuations in the latency values over the entire range, as shown in An omnidirectional monocone antenna supported with folded shorting wires was presented in this paper. The proposed design covered the V2X frequency band and beyond with stable omnidirectional radiation patterns and high efficiency from 0.75 GHz to 7.6 GHz. A fractional impedance bandwidth of 164% was achieved with a gain value as high as 10 dBi. The folded shorting wires showed significant capability to miniaturize the antenna by shifting the operating frequency to a lower band. The prototype was fabricated using 3D printing technology for commercially available plastic material and then sprayed with copper particles for appropriate coating. The antenna was fabricated and measured in the anechoic chamber and then tested in the field to validate the design performance and structure fidelity. The PER and latency results from the V2X test are very promising."}
{"text": "In this article, a single-layer frequency selective surface (FSS)-loaded compact coplanar waveguide (CPW)-fed antenna is proposed for very high-gain and ultra-wideband applications. At the initial stage, a geometrically simple ultra-wideband (UWB) antenna is designed which contains CPW feed lines and a multi-stub-loaded hexagonal patch. The various stubs are inserted to improve the bandwidth of the radiator. The antenna operates at 5\u201317 GHz and offers 6.5 dBi peak gain. Subsequently, the proposed FSS structure is designed and loaded beneath the proposed UWB antenna to improve bandwidth and enhance gain. The antenna loaded with FSS operates at an ultra-wideband of 3\u201318 GHz and offers a peak gain of 10.5 dBi. The FSS layer contains 5 \u00d7 5 unit cells with a total dimension of 50 mm \u00d7 50 mm. The gap between the FSS layer and UWB antenna is 9 mm, which is fixed to obtain maximum gain. The proposed UWB antenna and its results are compared with the fabricated prototype to verify the results. Moreover, the performance parameters such as bandwidth, gain, operational frequency, and the number of FSS layers used in the proposed antenna are compared with existing literature to show the significance of the proposed work. Overall, the proposed antenna is easy to fabricate and has a low profile and simple geometry with a compact size while offering a very wide bandwidth and high gain. Due to all of its performance properties, the proposed antenna system is a strong candidate for upcoming wideband and high-gain applications. With the rapid advancements in wireless communication technology, the current and impending communication systems necessitate electrically small, geometrically simple, and low-profile antennas with high gain and wideband characteristics ,2. Due tIn addition to the aforementioned techniques, frequency selective surfaces (FSSs) have been investigated recently for gain improvement. FSSs based on artificial intelligence are used for gain enhancement, however, these types of FSS require a lot of knowledge and coding skill which are time-consuming . Thus, aOn the other hand, various single-layered FSS-loaded antennas are reported in the literature ,36,37,38Considering the limitations and discrepancies observed in previously reported works, this work proposes a simply shaped, compact, ultra-wideband, low-profile, and high-gain FSS-loaded patch antenna for WiMAX, 5G sub-6 GHz, C-band, S-band, and X-band applications used for 5G and future 6G communicating devices. The rest of the article is split into three sections. In In this section, the design of the proposed ultra-wideband antenna as well as proposed FSS, along with design stages and optimization algorithm, is discussed. The performance of the antenna, as well as parametric analysis of key parameters, is also explained in this section.1 \u00d7 L1 \u00d7 H = 32 mm \u00d7 25 mm \u00d7 1.52 mm. Moreover, the results were verified by using the electromagnetic (EM) software High Frequency Structural Simulator (HFSSv9). The optimized parameters of the proposed ultra-wideband antenna are given below:1 = 32, W2 = 11, W3 = 1.5, W4 = 5, W5 = 8, L1 = 25, L2 = 5, L3 = 8, L4 = 4, L5 = 2, L6 = 9.5, R = 8.5, H = 1.52; all units are in millimeters (mm).WIn order to obtain the required antenna characteristics, various design steps were carried out to obtain the final proposed antenna geometry operating at ultra-wideband. In the first step, the hexagonal patch antenna with CPW feedline was designed for the central frequency of 12 GHz. The antenna has operational bandwidth of 2 GHz covering 11\u201313 GHz. In the second step, the rectangular stub was added between the radiating patch and the feedline. The addition of this stub increases the electrical length of the antenna, which results in an improvement in return loss and bandwidth. The antenna starts operating at 11 GHz and 15 GHz with a return loss of less than 15 dB. In the third step, another rectangular stub was added below the existing stub, as shown in 11| and identifying the antenna parameters R, W2, W4, W5, and L3. Refs. [A genetic algorithm (GA) was used in collaboration with the full-wave modeling tool (CST MWS) to improve the characteristics of the UWB antenna. Genetic algorithm optimizers, as is well known, are robust stochastic search techniques based on the ideas and concepts of natural selection and evolution. The optimization was completed quickly and efficiently by identifying design goals for a UWB impedance bandwidth with a low |S3. Refs. ,40,41 ha4 and W5 is discussed in this section. The length of the lower rectangular stub (W4) was analyzed to observe the impact on the |S11| characteristic. At its optimal value of W4 = 5 mm, the proposed antenna offers a wideband of 5\u201317 GHz with resonant frequencies of 8 GHz and 13 GHz. When the value of W4 is fixed at 4 mm, the proposed antenna\u2019s bandwidth is reduced to a dual band of 7.5\u20139.5 GHz and 12\u201317 GHz. Similarly, when the value is increased to 6 mm, again in the dual band, a slight shift towards the left side is noticed, as given in To obtain the final geometry of the proposed UWB antenna, various design steps (as discussed above) as well as parametric analysis of important and key parameters were performed. The parametric analysis of rectangular stubs W5 = 8 mm, ranging from 5\u201317 GHz. If the value is reduced to 7 mm, the wide bandwidth and return loss are compromised and generate dual frequency bands at 8 GHz and 14 GHz with bandwidth ranging from 7.5\u20139 GHz and 12.5\u201315.5 GHz, respectively. If W5 is increased to 9 mm, the suggested UWB antenna operates over 7\u201315 GHz, which implies a reduction of bandwidth, as shown in In X \u00d7 MYM = 50 mm \u00d7 50 mm. The proposed FSS offers a wide stopband, ranging from 4\u201318 GHz, as given in X = 10, CY = 10, C1 = 9, C2 = 9, C3 = 0.5, C4 = 1.25, R1 = 2, R2 = 2.75; all units are in millimeters (mm).To obtain the final geometry of the proposed UWB antenna, various design steps (as discussed above) were carried out. In this portion, the working mechanism of the proposed FSS-loaded UWB antenna is explained. The suggested antenna design is planted above the FSS sheet to reflect the radiation of the antenna coming from the back direction. The reflected wave by the FSS placed behind the antenna is in-phase with the antenna radiation, which results in an improvement in gain. The most important parameter is the distance or gap (G) between the antenna and FSS, which establishes the constructive interface of wave reflecting back from the FSS with the waves radiating from the proposed UWB antenna. The equation given below is used to adjust the gap between the antenna and FSS .\ud835\udf11 \u2212 2\ud835\udefdG11| behavior of the suggested compact and UWB antenna in the presence and absence FSS is given in Equation (1) is composed of three parts: the reflection phase (\ud835\udf11), the free space propagation constant (\ud835\udefd), and the gap between the antenna and FSS (G), while \u03c0 = 3.1415. The space in the middle of the antenna and FSS structure is optimized in order to obtain higher gain as well as wideband. In the case of the proposed work, the gap G = 9 mm. The placement of the antenna over the FSS structure is given in In The recommended UWB antenna\u2019s gain versus frequency plot, either with or without FSS, is displayed in The radiation efficiency of the suggested UWB antenna is given in The suggested UWB antenna\u2019s radiation pattern at resonance frequencies of 8 GHz and 13 GHz is illustrated in In This article presents a geometrically simple, compact, ultra-wideband (UWB) antenna with a frequency selective surface (FSS) that provides high gain. The antenna contains a simple hexagonal patch with multiple stubs inserted to obtain an ultra-wideband of 5\u201317 GHz. Afterwards, to reflect radiation directed backward, the FSS layer is positioned beneath the antenna to slightly improve bandwidth and enhance gain from 6.5 dB to 10.5 dB. The resultant FSS-loaded antenna offers an ultra-wideband of 15 GHz, ranging from 3\u201318 GHz. The FSS array contains 5 \u00d7 5 unit cells, which have an overall size of 50 mm \u00d7 50 mm. The proposed UWB antenna and FSS layer are engineered on top of Rogers RT/Duroid 6002 with a thickness of 1.52 mm. The proposed FSS-loaded UWB antenna is designed using the electromagnetic (EM) software tool High Frequency Structure Simulator (HFSS v9). The software-predicted outcomes of the suggested antenna loaded with FSS were verified with a fabricated hardware prototype. The suggested FSS-loaded UWB antenna was also contrasted with published research, demonstrating that it is a strong contender for future wireless high-gain and wideband devices."}
{"text": "In this paper, a stereoscopic ultra-wideband (UWB) Yagi\u2013Uda (SUY) antenna with stable gain by near-zero-index metamaterial (NZIM) has been proposed for vehicular 5G communication. The proposed antenna consists of magneto-electric (ME) dipole structure and coaxial feed patch antenna. The combination of patch antenna and ME structure allows the proposed antenna can work as a Yagi\u2013Uda antenna, which enhances its gain and bandwidth. NZIM removes a pair of C-notches on the surface of the ME structure to make it absorb energy, which results in two radiation nulls on both sides of the gain passband. At the same time, the bandwidth can be enhanced effectively. In order to further improve the stable gain, impedance matching is achieved by removing the patch diagonally; thus, it is able to tune the antenna gain of the suppression boundary and open the possibility to reach the most important characteristic: a very stable gain in a wide frequency range. The SUY antenna is fabricated and measured, which has a measured \u221210 dBi impedance bandwidth of approximately 40% (3.5\u20135.5 GHz). Within it, the peak gain of the antenna reaches 8.5 dBi, and the flat in-band gain has a ripple lower than 0.5 dBi. The 5G is the current generation of mobile communications expected to provide higher data rates and high-speed connectivity for multimedia applications ,2,3,4,5.In this paper, the magneto-electric dipole (ME) structure is used to improve the bandwidth of the antenna by impedance matching and to enhance the antenna gain by electromagnetic superposition. In order to further improve the gain of the Yagi antenna, metamaterials are proposed below to improve the Yagi antenna gain. In , enhanceIn this paper, we propose the SUY antenna which has ultra-wideband and stable gain for the RF energy harvesting to obtain a stable output voltage and conversion efficiency. The following three steps are used to achieve the characteristics of the ultra-wideband and stable gain: First, the ME structure is used to achieve the reinforcement of broadband and gain. Second, a pair of C-notches is cut out of the surface of the ME structure to make a near-zero-index metamaterial (NZIM). This metamaterial structure not only produces out-of-band radiation suppression by energy absorption but also increases the bandwidth of the antenna. Finally, in order to further improve the stable gain, the director and driven element achieve impedance matching for enhancement of the gain of the suppression boundary. To show the advantages of the SUY antenna stable gain, as shown in  antenna .To analyze the SUY antenna more clearly, the SUY antenna is divided into the A-type antenna, B-type antenna, C-type antenna, and D-type antenna in The C-type antenna realizes the filtering of out of band suppression by NZIM, which also increases the antenna bandwidth. The D-type antenna increases and flattens the gain of the upper suppression boundary at 4.9\u20135.5 GHz by adding director layer. The SUY antenna achieves stable the gain of lower suppression boundary from 3.5 to 4 GHz by cutting out the diagonal of patch 1 and patch 2. The four kinds of antennas are analyzed in the following sections.The ME structure has two characteristics: one is to improve the antenna gain by the electromagnetic superposition principle and the other is its impedance matching to improve the bandwidth as shown in Equations (1) and (2). As shown in First, the reason for the electromagnetic superposition at 4.7 GHz is illustrated to explain that the gain of the B-type antenna can reach more than 9 dBi. As shown in Equation . Finally factors .(2)1Q=Zmpedance .In this section, the dual-C-notch NZIM structure is designed to achieve two targets: one is to improve the out-of-band suppression by introducing the radiation nulls of the lower and upper gain stopbands by energy absorption and other is to enhance the bandwidth by impedance matching. This design idea of dual-C-notch NZIM is derived from absorptive-branch-loaded structure and dual-notch NZIM structure ,31. For The absorption function of NZIM is verified from two aspects: first, it is proved that the dual-C-notch belongs to NZIM at 2.6 GHz and 5.5 GHz; second, it has absorption function at 2.6 GHz and 5.5 GHz by electric field simulation. First, as shown in nit cell .In order to further improve the stable gain, the gain of the suppression boundary is enhanced to achieve two targets: one is to enhance the gain of upper suppression boundary by addition of the director layer from 4.9 to 5.5 GHz and the other is to improve the gain of lower suppression boundary by the diagonal cut of the patch from 3.5 to 4 GHz.Firstly, according to the Yagi antenna principle, the director layer is added to the C-type antenna to improve antenna gain. The antenna is defined as a D-type antenna. As shown in Secondly, there are three ways to improve the gain of upper suppression boundary: one is to add another director layer, another is to change the length of patch 1 and 2, and the last is to change the shape of patch 1 and 2. The first method reduces the overall gain of the antenna, so it is not used. The second and third methods are verified in terms of which method is suitable to improve the gain of upper suppression boundary by the quality factor (ion loss .(5)Qr=3hickness .(6)D=2xTo verify the validity of our design concept, a prototype of the proposed SUY antenna is fabricated and measured. The experimental setup in the anechoic chamber and the SUY antenna fabricated prototype are shown in In this paper, stereoscopic ultra-wideband (UWB) Yagi\u2013Uda (SUY) antenna with stable gain by NZIM has been discussed and analyzed in detail. Its advantages are high gain, wide bandwidth, and stable gain. The disadvantage is that the three-dimensional size is larger. The combination of coaxial feed and ME structure using electromagnetic superposition and the impedance matching principle achieve high gain and excellent broadband performance. The NZIM with two radiation nulls as well as flat in-band radiation gain is realized in a poof-of-concept prototype of SUY antenna. In order to further improve the stable gain, adjusting the director and driven element impedance enhance the gain of the suppression boundary. The demonstration antenna has been designed and implemented, and the simulated and measured results with good accordance have been presented."}
{"text": "To meet the real demand for broadband full-band high-gain antenna sensors in the process of partial discharge (PD) Ultra-High frequency (UHF) detection test and online monitoring of power equipment, this paper builds a resonant cavity monopole UHF antenna sensor based on Fabry\u2013Perot resonant cavity antenna technology, conducts the sensor Voltage Standing Wave Ratio (VSWR) optimization study using curved flow technology, conducts the sensor gain optimization study using slot dual resonant structure, and, finally, tests the sensor performance using the built PD detection test platform. The resonant cavity monopole antenna exhibits outstanding VSWR performance in the frequency range of 0.37 GHz\u20133 GHz, according to simulation and test data: the average gain in the frequency range of 0.3 GHz\u20133 GHz is 4.92 dBi, and the highest gain at the primary resonant frequency of 1.0 GHz is 7.16 dBi, with good radiation performance over the whole frequency spectrum. The electromagnetic pulse signal sensed by the UHF sensor developed in this paper can demonstrate the energy spectrum distribution characteristics of PD radiation electromagnetic wave signal more comprehensively, laying a firm technical foundation for thoroughly understanding the electromagnetic wave radiation characteristics of various types of PD insulation defects of various power equipment and the selection of a specific direction for its supporting optimization. Partial Discharge (PD) is one of the main causes of electrical power failures, which can lead to insulation deterioration, electrical faults, and equipment failures, and can even trigger safety risks such as fire and explosion ,2,3,4.The Ultra High Frequency (UHF) method is a method to determine the location, nature, and intensity of PD by using UHF sensors to receive high-frequency electromagnetic waves (300 MHz~3 GHz) generated by the PD inside the power equipment. By transmitting the received signals to the detection system they can be analyzed and processed, which has the advantages of high sensitivity and strong anti-jamming ability, and has been widely used in the power field and laboratory PD detection test has been widely used ,6,7,8.However, the area where PD is generated by power equipment is not fixed, resulting in the energy spectrum distribution of the electromagnetic wave signals radiated by PD in different types and different insulation environments also not being fixed. Although the International Electrotechnical Commission standard IEC 60270-2015 and China\u2019s national standard GB/T 7354-2018 both put forward explicit requirements for the sensitivity of UHF sensors in the 300 MHz\u20133 GHz band range ,10, fromMore importantly, although a large number of currently developed UHF sensors meet the requirements of the relevant standards, the volatility between the corresponding sensor performance parameters  at different frequency points or different frequency bands means that the PD high-frequency electromagnetic wave signals obtained from power field PD monitoring or laboratory PD detection cannot fully respond to the PD radiation electromagnetic wave energy spectrum characteristics, and cannot guide the subsequent optimization of UHF sensors for different types of PD detection in diverse power equipment  ; therefoTo address the above problems, this paper carries out research on the design of broadband high-gain monopole UHF antenna based on the Fabry\u2013Perot resonant cavity antenna design idea, carries out sensor VSWR optimization using curvilinear flow technique and sensor gain optimization using slot dual resonant structure, and uses High Frequency Structure Simulator (HFSS) to optimize and simulate the antenna structure, in the end, the designed antenna is prototyped and the performance of the antenna is tested and analyzed using a vector network analyzer and PD simulation experimental platform.A monopole patch antenna is a very common antenna, which usually consists of a radiating patch on a thin dielectric substrate and a relatively grounded metal floor for receiving electromagnetic signals propagating in space and feeding through coaxial probes, microstrip, or coplanar waveguides, with the advantages of a low profile, small size, and simple fabrication .R is the base radius of the equivalent cylinder, L is the height of the equivalent cylinder, a is the width of the radiating patch of the monopole antenna, and b is the length of the radiating patch.The planar monopole patch antenna can be approximated with an equal height cylindrical structure , as showg between the metal floor and the radiation patch, the lowest working frequency Lf of the antenna is obtained as follows:c is the speed of light and \u03bb is the wavelength corresponding to the lowest operating frequency. After considering the effect of the dielectric substrate on the resonant frequency of the antenna, Equation (2) is corrected, that iseff\u03b5 is the equivalent dielectric constant. It can be estimated asr\u03b5 is the relative permittivity of the substrate.The real part of the input impedance of the monopole patch antenna is slightly less than 1/4 wavelength monopole length while considering the gap The above theory can be used to estimate the starting size of the monopole patch antenna. Subsequently, the design can be optimized on this basis to achieve the desired performance.w and the microstrip transmission line characteristic impedance z satisfies:h is the thickness of the dielectric substrate. The desired impedance, dielectric substrate thickness, and equivalent dielectric constant are brought into the equation to calculate the microstrip line width for good impedance matching.The microstrip feed line is a common way to feed antennas, its basic principle is to achieve the feed by laying metal strip lines on the dielectric substrate. When the electromagnetic wave propagates to the microstrip feed line, a surface wave is generated between the microstrip line and the ground plane, and this surface wave propagates along the microstrip line and eventually reaches the antenna radiation element. The microstrip transmission line width The Fabry\u2013Perot resonant cavity is a multi-beam optical interferometer that can be used to accurately measure the wavelength and refractive index of light, invented by French physicists Charles Fabry and Alfred Perot in 1897 . The intLater, research scholars discovered that a similar principle could be applied to the field of antenna sensors, leading to the invention of the Fabry\u2013Perot resonant cavity antenna. In the literature , Li Lu ll, between which multiple reflections of electromagnetic waves occur. The feed antenna and its floor are a fully reflective plate with a reflection coefficient of p, and the phase is The Fabry\u2013Perot resonant cavity configuration is shown in n reflections, the superposition of the electric field intensity of all transmitted waves transmitted through the partially reflected layer gives:F(\u03b1) is the feed antenna radiation direction function, E0 is the maximum radiation field strength, n\u03b8 is the phase difference between the transmitted wave beam n, and the transmitted wave beam 0p < 1, we can obtain:\u03b1 direction:\u03b1 = 0\u00b0, and S is maximum when n = 0, 1, 2, \u2026 are satisfied, and its maximum value isp of the partially reflected surface [After The resonant cavity UHF antenna sensor designed in this paper is a Fabry\u2013Perot resonant cavity monopole antenna sensor, which contains two parts: the feed antenna and the partial reflection cladding. The feed antenna is a microstrip monopole patch antenna with optimized VSWR using curved flow technique and optimized gain using slot dual resonant structure.r\u03b5= 4.4, the dielectric loss tangent angle tan\u03b4 = 0.03, and the thickness of the dielectric substrate h = 2.8 mm. The microstrip monopole antenna designed in this paper uses SMA coaxial feed with a characteristic impedance of 50 \u03a9.The dielectric substrate of the microstrip monopole antenna designed in this paper is rectangular rigid material FR-4 epoxy resin, the relative dielectric constant of the substrate Since the energy of the PD signal is concentrated in the range of 500 MHz\u20131.5 GHz, and the common monopole patch antenna is often used in the frequency band above 3 GHz in the communication field, if we want to make it detect partial discharge, we need to extend its working band.In this paper, the patch of monopole patch antenna in Curved flow technology is a technique to make the surface current flow along a specific structure on the metal patch of microstrip antenna by making slots or adding slits, introducing multi-step structure, etc. Such a design can free the equivalent length of the antenna from the physical length limitation, thus effectively increasing the equivalent length of the microstrip antenna and improving the bandwidth of the antenna without increasing its size ,22,23,24HFSS software is used to simulate and analyze the antenna with the above parameters and structure, and the data of VSWR is shown in The traditional slot double resonant structure is in the antenna surface of an artificially created rectangular groove: the groove will form a resonant cavity, so that the propagation of electromagnetic wave resonance thus increasing the antenna gain, but this practice will make the antenna bandwidth greatly reduced. Therefore, this paper uses the idea of slot dual resonant structure to form a slot dual resonant structure similar to the effect of a concave resonant cavity by adding a circle of peripheral patches around the microstrip monopole antenna as shown in The geometric parameters of the slotted dual resonant structure of the antenna in The VSWR and gain performance of the improved monopole antenna are simulated and analyzed. From the VSWR simulation plot in The general partial reflection cladding with the feed antenna has a narrow bandwidth, which is because the reflection coefficient of the partial reflection layer becomes smaller in phase as the frequency increases and is a negative reflection phase gradient . For thiThe partially reflective cladding unit designed in this paper adopts a single-layer double-sided asymmetric square structure, while empirically loading the perforations to make the gain performance smoother, and its structure is shown in a is 60 mm and the back square patch width b is 64 mm. The distance of the perforation with a diameter of 2 mm from both sides of the square patch is 20 mm in both x and y.To meet the desired direction of improvement, the front square patch width Wb = 20.6 mm and Lb = 2.6 mm.The front unit structure is expanded into a uniformly distributed 3 \u00d7 3 partial reflection cladding. The selection of dielectric substrate material is the same as the microstrip monopole antenna, i.e., FR-4 epoxy resin. The dimensions of the whole partial reflection cladding are also consistent with the microstrip monopole antenna, length \u00d7 width \u00d7 thickness = 205.2 mm \u00d7 241.2 mm \u00d7 2.8 mm, and the structure of the composed partial reflection cladding is shown in The feed antenna designed in Voltage Standing Wave Ratio (VSWR) is a parameter used to describe the ratio of reflected signal strength and forward signal strength at the input port of the antenna, measuring the impedance matching ability between the input and output circuits of the antenna. When the signal enters the transmission line and reaches the antenna sensor, part of the signal will be reflected back to the transmission line, while the other part will be transmitted into the air; these reflected waves will be superimposed with the original waveform, creating the so-called \u201cstanding wave\u201d, which has a negative impact on the transmitted energy and signal. VSWR can be calculated by the following equation:In addition, since the UHF antenna sensor operates in a UHF environment, the signal attenuates quickly, so it is necessary to ensure that as much signal as possible is transmitted to the antenna to ensure the sensitivity and accuracy of the antenna. Therefore, a lower VSWR value is critical for the quality and stability of the transmission circuit in this case, so a lower VSWR is a fundamental requirement for the design and use of high-performance UHF antenna sensors. When VSWR \u2264 2 the antenna sensor receives the best electromagnetic energy, but in fact VSWR \u2264 5 can meet the engineering needs, so this paper will use VSWR \u2264 5 as the PD detection bandwidth of power equipment ,32,33,34The Fabry\u2013Perot resonant cavity monopole antenna model in The VSWR of the physical antenna was measured using an E5063A vector network analyzer manufactured by Agilent with the same sweep range of 300 MHz\u20133 GHz. As shown in The gain directional map is a parameter used to describe the directionality of the antenna and the antenna efficiency, measuring the degree of concentration of the radiant energy of the antenna in free space and the degree of effectiveness of the antenna in converting wave energy into high-frequency current or energy ,35,36. TThe gain direction plots of the designed Fabry\u2013Perot resonant cavity monopole antenna at six frequency points of 0.7 GHz, 1.0 GHz, 1.4 GHz, 2.0 GHz, 2.4 GHz, and 3.0 GHz are shown in The HFSS simulation shows that the average gain of the designed resonant cavity monopole antenna is 4.92 dBi in the frequency band of 0.3 GHz\u20133 GHz, and the maximum gain at each frequency point obtained from the simulation is given in 1, a regulator, a step-up transformer T2, a protection resistor Rr, voltage divider capacitors C1 and C2, and a cavity that simulates a GIS structure. The PD signal from the antenna sensor is fed through a coaxial cable to the signal acquisition device Tektronix*MSO44  Tektronix high-performance digital oscilloscope for acquisition. The GIS simulation chamber tank is filled with 0.5 MPa of SF6 gas with 99.999% purity. The experiment uses the air gap discharge model to simulate the insulation fault PD process inside the GIS equipment. The air gap defect is caused by the substandard process of GIS tub insulators, which produces air bubbles during the curing of epoxy resin and the air bubbles evolve into air gaps, and PD will occur in these air gaps during the operation of GIS. The air gap defect model used in this test is as follows: there are three pieces of epoxy resin sandwiched between the high-voltage electrode and the ground electrode, and the middle piece has an air gap defect with a volume of 10 mm \u00d7 10 mm \u00d7 5 mm, which is shown schematically in To verify the performance of the designed Fabry\u2013Perot resonant cavity monopole antenna for detecting PD UHF signals, an industrial frequency, and high voltage testbed without local discharge was built in the laboratory, as shown in The experiment is based on the State Grid Corporation of China\u2019s corporate standard: Q/GDW11304.8-2019 \u201cUltra-high frequency method of partial discharge Charged detection technical standards\u201d .In this paper, a high-performance flexible monopole antenna designed in the literature  is used The results of the PD UHF signals detected by both sensors were recorded when the voltage was increased to 3.7 kV and the discharge was about 17.2 pC, as shown in The spectrum analysis of the detected PD signal and the background noise spectrum analysis are shown in Optimization of monopole patch antenna by using the idea of curved-flow technology and slot dual resonance structure, which greatly broadens the operating band of the antenna sensor and improves the antenna gain directionality. Based on the idea of Fabry\u2013Perot resonant cavity antenna, partial reflection cladding was set up, so that the antenna sensor can obtain full-band high gain performance. The simulated and measured results show that the designed resonant cavity monopole antenna has VSWR \u2264 5 in the frequency band of 0.37 GHz\u20133 GHz, excellent VSWR performance, average gain of 4.92 dBi, peak gain of 7.16 dBi at the main resonant frequency, simple fabrication process, and meets the design requirements of PD UHF antenna sensors.Through the constructed partial discharge test platform, the designed resonant cavity monopole antenna is used to detect the typical air gap discharge defects, and compared with the mature flexible monopole UHF antenna, the results show that the resonant cavity monopole antenna can detect the PD signal more obviously, which proves the feasibility of resonant cavity monopole antenna for PD detection and reflecting the PD radiation electromagnetic wave energy spectrum characteristics.For the current demand for UHF antenna sensors for PD detection of power equipment with broadband full-band high-gain antenna sensors, this paper carries out the research of broadband high-gain resonant cavity monopole UHF antenna for PD detection of power equipment, using curved-flow technology and slot double resonant structure to optimize the monopole antenna. Based on the idea of Fabry\u2013Perot resonant cavity antenna for high gain antenna, the designed antenna was analyzed and verified by experiments:"}
{"text": "This paper proposes a flexible, frequency-reconfigurable monopole antenna design with frequency selective surface (FSS) for Internet of Things (IoT) applications. The proposed antenna operates at three of the IoT frequency bands. This antenna is a coplanar waveguide (CPW)-fed monopole with two balanced arms printed on a thin ROGERS 3003 flexible substrate. The length of the right-hand arm of the antenna is used to achieve frequency reconfiguration by using PIN diodes. Three frequency modes of operation have been obtained; the 2.4\u00a0GHz frequency band with the right-hand arm is fully truncated, the 3.5\u00a0GHz frequency band with the two arms is completely maintained, and the 4\u00a0GHz frequency band with the right-hand arm is partially truncated. To improve the gain of the antenna, a simple FSS surface is designed to be placed under the antenna at a distance of 15\u00a0mm. The FSS operates efficiently from 2 to 4.5\u00a0GHz and has improved the gain of the antenna. A maximum gain of 6.5 dBi, 7.52 dBi, and 7.91 dBi has been achieved at the three frequency bands respectively. The behavior of the flexible antenna has been evaluated in both the flat and bent states, and stable performance has been observed in both cases. The IoT technology put big challenges on the working communications systems as a huge amount of data is required to be transferred between the wireless nodes connected to the network5. By the way, the tremendous speed of progress in wireless communications techniques has led to an urgent necessity to design a high-speed system with efficient spectrum utilization. This in turn has led to the possibility of exploiting a single wireless device in more than one application, and then more than one frequency band has to be utilized. The antenna is characterized by its large size with respect to other components, and it will be impractical to design an antenna for each frequency band on the same platform. For these reasons, a careful design of an antenna that can satisfy the requirements of the next IoT technologies is a vital necessity4. One of the successful choices that satisfy the requirements of IoT applications is the reconfigurable antennas8. Reconfigurable antennas can change their behavior dynamically in a controlled fashion, i.e., they can change their characteristics such as operating frequency, radiation pattern, and polarization10. To achieve the required control on the antenna, a high-frequency switching device such as a varactor diode, PIN diode, field effect transistor (FET), or micro-electromechanical systems (MEMS) can be utilized12. With each switching process, the electrical equivalent circuit of the reconfigurable antenna changes, providing different behavior in each case.Recently, IoT has become an evolutional technology that aims to ease communication between human beings and their surrounding environment. The IoT merges the human and his surrounding wireless devices and sensors in a single network in real-timeDue to their interesting characteristics, reconfigurable antennas have attained more attention from researchers. The reconfigurability of the antenna can be applied to any of its performance parameters such as operating frequency band, radiation characteristics, or polarization.15. In7, a compact reconfigurable microstrip antenna has been designed to switch between different frequency bands which include many of the wireless standards such as ZigBee, WiMAX, Bluetooth, and GSM. Some research papers have reported reconfigurable multiband antenna while more than one frequency band can be switched simultaneously17. In18, a dual-band reconfigurable multiple input multiple outputs (MIMO) antenna has been proposed to cover the frequency band 1.3\u20132.6 GHz. Frequency reconfiguration has been realized by a varactor diode on the microstrip feed line. The antenna has achieved dual-band operation in each switching state. The reconfigurable antenna can be designed with radiation pattern reconfigurability, i.e., the radiated power distribution can be controlled spatially in the antenna's surrounding area21. In19, a reconfigurable radiation pattern MIMO antenna is designed as a rectangular monopole with two parasitic strips equipped with PIN diodes. According to the suitable operation switching between the two strips they act as a reflector or director and then the radiation pattern is switched between directional and bidirectional modes. Moreover, the reconfiguration of the antenna can be applied to the polarization of the radiated fields26. In this case, the antenna can be reconfigured to switch between more than one polarization pattern. For example, a reconfigurable polarization antenna has been proposed in27.Some reconfigurable antennas have been designed with frequency reconfigurability29. Design of the reconfigurable antenna on a flexible substrate is a challenging process due to the difficulties associated with the integration of the switches to a flexible surface in addition to the associated mechanical stability and electronic robustness issues. Despite the large number of reconfigurable antennas that appeared in the literature, a small ratio of them have been printed on flexible substrates.In the case of some IoT nodes that are related to health care and biomedical applications where the flexibility of the antenna is the main requirementIn this paper, a frequency reconfigurable antenna printed on a flexible substrate and equipped with FSS is presented. The antenna is a two arms planar monopole fed by a CPW feed line and matched to 50 \u2126 impedance. Two PIN diodes are used to split one of the two arms of the monopole into three parts, and accordingly, three frequency bands of operation are obtained. The antenna is printed on a ROGERS 3003 flexible substrate and its performance is tested under different degrees of bending. To improve the gain of the antenna, a wideband FSS is designed to be placed under the antenna. The designed FSS works as an upward reflector over the whole antenna's operating frequency. The following section of the paper discusses the reconfigurable antenna design process. The antenna description is studied in \u201cr = 3, h = 0.13 mm, and tangent loss tan \u03b4 = 0.001 is utilized. The antenna dimensions are optimized as displayed in Fig. 3. The reconfigurability of the antenna is achieved by splitting the right-hand arm into three parts while two PIN diodes are used to interconnect these three parts. The state of each PIN diode ON or OFF decides the connection or disconnection of the split parts. The photograph of the fabricated antenna with the disconnecting slots of the right-hand arm is shown in Fig. The proposed antenna's radiator is constructed as a CPW-fed monopole with a width of 3.4 mm and two gaps of 0.2 mm to achieve the 50 \u2126 and with two balanced arms as illustrated in Fig. The reconfigurable antenna has been simulated using CST Microwave Studio Software. Fabrication and measurements have been conducted in the Electronics Research Institute (ERI) Labs. To be compromised with the requirements of IoT applications that require a changeable position of the antenna, the antenna has been added on a flexible substrate. The antenna has been fabricated using a chemical etching process (photo-lithographic technique). The schematic of the antenna is illustrated in Fig. 11 of the reconfigurable flat antenna in the three modes is illustrated in Fig. The antenna's performance is investigated in two different positions; flat and bent. The S11 has been simulated at different degrees of bending for each mode of operation. Simulation results are presented in Fig. To study the behavior of the antenna under bending, the antenna is bent around the y-axis as shown in Fig. 11 curves of the reconfigurable antenna at the different modes of operation are displayed in Fig. 11 of the antenna in the first mode of operation is shown in Fig. 11 with PIN#1 diode ON and PIN#2 OFF is illustrated in Fig. After the fabrication, reconfiguration of the proposed antenna is done by controlling the two PIN diodes (HPND-4005), i.e., PIN#1 and PIN#2, which are connected through the two slots. The two PIN diodes are used as switches and controlled by the biasing voltages applied through the connecting wires as displayed in Fig. The anechoic chamber is utilized to measure and extract the antenna's radiation pattern as displayed in Fig. 1 = 0.6587 pF and L1 = 4.328 nH. This behavior is utilized to enforce the reflection of the RF frequencies within the operating band of the reconfigurable antenna. The complete FSS structure is shown in Fig. It is highly required for the antenna to have a high gain. In this paper, an FSS is designed to improve the gain of the proposed antenna. The FSS is to be inserted under the antenna to force the radiated power in an upward direction. The FSS is a printed periodic structure with frequency filtering characteristics. The single unit of the proposed structure, as shown in Fig. 11 is too high (approximately 0 dB) in the frequency band 2\u20134.5 GHz and S21 is too small (less than \u221210 dB) in the same frequency band in both flat and bending configurations. These results demonstrate the high reflectivity and low transmission through the proposed FSS structure. The best behavior of the FSS is at 3 GHz.S2 as seen in Fig. The complete FSS is composed of 3 \u00d7 3 unit elements with 0.5 mm spacing between cells to achieve an overall dimension of 77 \u00d7 77 mm11 of the flat reconfigurable antenna with FSS are shown in Fig. 11 of \u221219 dB at the 2.4 GHz frequency. The return loss of the antenna with FSS in the second mode of operation while the two PIN diodes are ON is displayed in Fig. The simulation and tested S11 of the antenna is less than -10 dB in the frequency band 3 GHz to 4 GHz as shown in Fig. Looking at Fig. According to the measurements of the antenna with and without FSS, the antenna's gain in the presence of the FSS has been improved as follows: from 1.55 dBi (without FSS) to 6.5 dBi (with FSS) at 2.4 GHz, from 2.95 to 7.23 dBi at 3.5 GHz, and from 2.9 to 7.91 dBi at 4 GHz. The proposed antenna outcomes in comparison with other designs are summarized in Table A frequency-reconfigurable antenna with flexible characteristics equipped with an FSS structure is presented in this paper. The antenna is intended for IoT applications and switches between three frequency bands; 2.4\u00a0GHz, 3.5\u00a0GHz, and 4\u00a0GHz. The antenna has been simulated, fabricated, and measured to investigate its performance. Good electrical characteristics have been obtained at the three bands of operation. The performance of the antenna under bending has been tested while stable behavior has been obtained at different degrees of bending. In addition to the reconfigurability and flexibility, the antenna is equipped with FSS to improve its gain. The performance of the flexible reconfigurable antenna with FSS has been validated using simulations and measurements. The obtained results show that the FSS has contributed to a high improvement in the antenna's gain. All of the measurement results have good matching with the simulated outcomes which supports the suggested antenna to be utilized in IoT systems."}
{"text": "A textile bandwidth-enhanced polarization-reconfigurable half-mode substrate-integrated cavity antenna was designed for wearable applications. A slot was cut out from the patch of a basic textile HMSIC antenna to excite two close resonances to form a wide \u221210 dB impedance band. The simulated axial ratio curve indicates the linear and circular polarization of the antenna radiation at different frequencies. Based on that, two sets of snap buttons were added at the radiation aperture to shift the \u221210 dB band. Therefore, a larger frequency range can be flexibly covered, and the polarization can be reconfigured at a fixed frequency by switching the state of snap buttons. According to the measured results on a fabricated prototype, the \u221210 dB impedance band of the proposed antenna can be reconfigured to cover 2.29~2.63 GHz , and the circular/linear polarization radiation can be observed at 2.42 GHz with buttons OFF/ON. Additionally, simulations and measurements were carried out to validate the design and to study the effects of human body and bending conditions on the antenna performance. Additionally, our previous works [In the last decade, significant progresses were made in the applications of wearable antennas in medical monitoring , sports us works ,18, respus works  and 15.7On the other hand, the reconfigurable antenna became one of the hottest research topics for wearable antennas . The weaThis paper presents a textile HMSIC antenna with an enhanced bandwidth and reconfigurable polarization for wearable applications. Firstly, a textile HMSIC antenna is designed and simulated to investigate its bandwidth. Secondly, a slot is added to enhance its bandwidth to cover the medical body area network (MBAN) and 2.45 GHz industry science medical (ISM) bands, and the linear polarization (LP) and circular polarization (CP) radiations are predicted at different frequencies based on the simulated axial ratio (AR) curve. Thirdly, two sets of metallic snap buttons are installed along the edge of the patch as switches to shift the \u221210 dB band, and simulations with buttons OFF and ON are carried out to illustrate its band and polarization reconfiguration characteristics. The frequency and radiation characteristics of the proposed antenna on the human tissues are simulated and analyzed, and the specific absorption rate (SAR) in the human tissues are, respectively, simulated and analyzed. Lastly, a fabricated prototype of the proposed antenna is measured in an anechoic chamber to validate the design, and the influence of bending conditions is measured and analyzed.2). Other parameters of Antenna I were theoretically calculated based on our previous work [l = 2w = 88.4 mm, fx = 23 mm.As shown in ous work  and optisl, sw and sy. When sl increased, the lower resonance frequency did not change, while the higher resonance frequency increased. When sw increased, the higher resonance frequency stayed unchanged, but the lower resonance frequency increased. Additionally, when sy changed, the impedance matching could be changed. Based on parameter sweeps, the dimensions of Antenna II were optimized as: l = 2w = 88.4 mm, fx = 23 mm, fy = = 25 mm, sl = 28.5 mm, sw = 6.5 mm, sy = 1 mm.Inspired by our previous work , a strai11| parameter was below \u221210 dB in 2.29~2.50 GHz , and both the MBAN and 2.45 GHz ISM bands were covered. The lowest AR was observed at 2.42 GHz with its simulated value being 3.2 dB, which indicates the existence of CP radiation. When the frequency was within the range of 2.29~2.34 GHz, the simulated AR was over 10 dB, and Antenna II could be mainly predicted to be in the LP mode. To conclude, the polarization mode of Antenna II was circular at 2.42 GHz and linear at a lower frequency between 2.29 and 2.34 GHz.Reference  illustral, w, fx, fy, sl, sw, sy for Antenna III were of the same values of those for Antenna II. The reflection coefficient of Antenna III was simulated with different values of yv1 and yvd, and the simulated curves are presented in yv1 and yvd. For the button-ON scenario, however, the simulated curve shifted left when yv1 or yvd increased, and changing yv1 did not lead to the significant change of the impedance matching while changing yvd did. Through parameter sweeps, the values of yv1 and yvd were, respectively, optimized to be 38.4 mm and 1 mm to yield a maximum total frequency coverage with buttons OFF and ON and to keep the |S11| parameter below \u221210 dB at the frequency where the lowest AR was obtained.Parameters As shown in M (red solid lines with arrows), and, therefore, indicates the right-hand circular polarization (RHCP) radiation with buttons OFF. With buttons ON, the distribution of the E-field accords with the xz and yz planes were of a main beam towards the +z direction with a large beam width. The maximum coplanar LP gain was 6.6 dBi, and the maximum cross LP gain was 13.3 dBi lower than the former. Therefore, the pattern simulation results further indicate the RHCP and LP radiations of Antenna III at 2.42 GHz with buttons OFF and ON, respectively. In addition, the simulated radiation efficiency of Antenna III in free space was 95% with buttons OFF and 97% with buttons ON.The free-space gain patterns of Antenna III were simulated at 2.42 GHz and shown in 3 skin-fat-muscle phantom, as shown in A 300 \u00d7 300 \u00d7 60 mmThe simulated patterns of the CP and LP gains of Antenna III on the phantom at 2.42 GHz are shown in With an input power of 0.5 W applied into the feeding port, the SAR (1 g average) in the phantom at 2.42 GHz was simulated for Antenna III. The simulated SAR distributions with a 0.5 W input power are presented in A prototype of is fabricated for Antenna III using computerized embroidery. As shown in x-axis or y-axis with an 8 cm bending radius. In such bending scenarios, both resonance frequencies with buttons OFF slightly increased, but the measured \u221210 impedance band still well covered the target bands. The observed frequency shift can be due to the decrease in cavity width/length caused by physical deformations of the flexible fabric and foam substrate during bending.The reflection coefficient curves of Antenna III were measured by a vector network analyzer and presented in The 2.42 GHz gain patterns of Antenna III in free space were practically measured in an anechoic chamber and are presented in A novel textile bandwidth-enhanced polarization-reconfigurable HMSIC antenna was designed for wearable applications. Firstly, by applying a slot and two sets of metallic snap buttons in the geometry of a textile HMSIC antenna, not only the separate bandwidth with buttons OFF or ON was enhanced, but a larger frequency range can be covered by changing the state of the buttons to reconfigure the band. As shown in"}
{"text": "An impedance BW of 110% (2.85\u20139.81 GHz) frequency boundaries was observed. Based on the measured results, a peak gain of 3.28 dBi was analyzed at 6 GHz. The SAR values were calculated to observe the radiation effects, and the SAR values obtained from the simulation at 4/6/8 GHz frequencies followed the FCC guideline. Compared to typical wearable miniaturized antennas, the antenna size is reduced by 62.5%. The proposed antenna has good performance and can be integrated on a peaked cap as a wearable antenna for indoor positioning systems.In this paper, a miniaturized textile microstrip antenna is proposed for wireless body area networks (WBAN). The ultra-wideband (UWB) antenna used a denim substrate to reduce the surface wave losses. The monopole antenna consists of a modified circular radiation patch and an asymmetric defected ground structure, which expands impedance bandwidth (BW) and improves the radiation patterns of the antenna with a small size of 20 \u00d7 30 \u00d7 1.4 mm Wireless body area networks (WBAN) devices have received increasing attention in recent years and this interest continues to grow . TherefoWearable systems require portable and miniaturized antennas for receiving and transmitting wireless signals ,9,10,11.In this paper, an improved miniaturized UWB antenna was fabricated using denim material by combining UWB electronics with textile technology. To ensure the electromagnetic parameters of the adopted material, the dielectric constant of the denim was measured using the transmission/reflection method in a coaxial line. The UWB tag antenna with an omnidirectional radiation pattern is integrated into a denim cap and can be used for indoor positioning. Since the peaked cap has a bending design, it is necessary to study the effect of bending on the antenna performance. The antenna was tested in a bending test and close to the human head. Tests have shown that the wearable antenna has stable performance regarding radiation patterns and BW. In addition, since the peaked cap was worn on the head, the head effect and the specific absorption rate (SAR) were investigated. It is suitable for communication at the human head. The antenna is miniaturized, bendable, inexpensive, and simple to make.The proposed antenna used denim fabric, as it is flexible, lightweight, and easy to integrate into clothing. The dielectric properties of denim should be known. Thus, the dielectric constant and loss tangent must be measured on the substrate. In this paper, the coaxial circular method was used to test the electromagnetic properties of denim fabrics. The electromagnetic performance test system of the cowboy substrate is shown in \u03b5r and z0. When a plane wave propagates in free space arriving on the surface of a medium of infinite thickness with electromagnetic parameters Using the Nicolson\u2013Ross\u2013Weir (NRW) method, periment ,27. As sElectromagnetic waves are reflected and transmitted multiple times at both ends of the medium. Using the sweep mode of Keysight N5222B Vector Network Analyzer (VNA), it is possible to measure in this case the multiple reflections  will interfere with the received signal of the antenna. To make the impedance BW just cover the frequency range of UWB, the value of l3 is chosen as 9 mm. The resonant frequency shifts to a higher frequency as the increase of l3 and the in-band matching will deteriorate.The proposed antenna generates two resonant frequency points so that a wide BW can be acquired. To study the effects of the patch size on the BW, HFSS 19.0 was used for simulation calculations with different values of the parameters The measurements were performed using Keysight\u2019s 3672D VNA. Measured and simulated radiation patterns of the miniature antenna at 6 GHz in the xoz-plane and yoz-plane of free space are shown in \u22122 m\u22121.The structural deformation of the antenna must be studied to ensure the stability of the antenna. In addition, when an antenna is placed close to the head as a wearable device, bending tests should also be performed to determine whether the results of the reflection coefficient are disturbed. The specific absorption rate (SAR) is defined as the electromagnetic power absorbed or consumed by a unit mass of the biological body. The SAR limit set by the FCC is 1.6 W/kg for 1 g of tissue. For the antenna, this value should not exceed this value for the considered user safety. An ultra-wideband textile antenna for WBAN was designed. The electromagnetic parameters of denim fabrics were measured using the NRW method. The proposed antenna matches the impedance obtained in simulation over the entire UWB frequency range by improving the circular radiating patch with gaps and defected ground structure. However, the impedance BW of 110% (2.85\u20139.81 GHz) frequency bands is observed. Compared to typical wearable miniaturized antennas, the antenna size is reduced by 62.5%. The antenna was designed to be integrated into a peaked cap for indoor positioning. Therefore, the performance of this antenna bent and placed close to the human head was investigated. The measured performance of the antenna in bending and placed in front of the human head is consistent with the simulation. For the proposed antenna structure, it was found that the SAR level obtained from the model placed close to the human head was less than 1.8 W/kg, meeting the FCC guidelines. The antenna is a usable wearable antenna with small size, easy integration, and bendability. The antenna also has the advantage of low cost and simple manufacturing process."}
{"text": "Planar antennas have become an integral component in modern biomedical instruments owing to their compact structure, cost effectiveness, and light weight. These antennas are crucial in realizing medical systems such as body area networks, remote health monitoring, and microwave imaging systems. Antennas intended for the above applications should be conformal and fabricated using lightweight materials that are suitable for wear on the human body. Wearable antennas are intended to be placed on the human body to examine its health conditions. Hence, the performance of the antenna, such as its radiation characteristics across the operating frequency bands, should not be affected by human body proximity. This is achieved by selecting appropriate conformal materials whose characteristics remain stable under all environmental conditions. This paper aims to highlight the effects of human body proximity on wearable antenna performance. Additionally, this paper reviews the various types of flexible antennas proposed for biomedical applications. It describes the challenges in designing wearable antennas, the selection of a flexible material that is suitable for fabricating wearable antennas, and the relevant methods of fabrication. This paper also highlights the future directions in this rapidly growing field. Flexible antennas are the keystone for implementing next-generation wireless communication devices for health monitoring and health safety applications. Advancements in wearable electronics enables the realization of various body-worn applications. Wearable antennas that function as sensors have gained considerable research interest. These antennas can operate perfectly when worn on the human body. They are well suited for military applications, as they can provide soldiers with seamless and efficient communication capabilities while transmitting and receiving data. This can enhance the mobility and effectiveness of soldiers on the battlefield.However, wearable antennas suffer from the problem of signal fading, whereby the signal strength at the receiving end decreases when the path length difference, due to the movement of the mobile terminal, becomes comparable to the signal wavelength ,2. MultiBecause of their functionalities and abilities, body-worn wearable technologies have sparked significant research interest in the past decade . Figure The water absorption and physical changes in the human body will have a substantial impact on the overall effectiveness of the antenna . The desA high-performance antenna system worn on/off the body and communicating nearby can be made possible by conductive fabric materials. Conductive textile (e-textile) materials are created by combining polymer threads or conductive metals with regular fabrics. Flectron, Zelt, pure copper, taffeta, and Sheildith are examples of conductive fabrics ,17,18,19As previously stated, there are numerous ways to determine the dielectric characteristics of textile materials ,22. It mThe design factors considered for the implementation of wearable antennas are summarized below.Wearable antennas must operate perfectly when they are worn on the human body. Wearable antenna technology mostly employs the wireless body area network (WBAN). Hence, the selection of a suitable substrate material (conductive and non-conductive) is a crucial aspect in the design of these antennas. The selected substrate must allow for the placement of the developed antenna in close proximity to a human body. Numerous researchers have conducted in-depth studies to select the ideal substrate material .Human tissues can react with incident electromagnetic waves because of the complex permittivity and conductivity of the tissues. The performance of an antenna is altered when it is placed near to a human body. The resonant frequency of the antenna is reduced owing to the higher value of the human body . MoreoveWhen a wearable antenna is operated near the human body, the back radiation from the antenna is mostly absorbed by human tissues. Continuous exposure to the radiation might damage human tissues. All antenna sensors that are used in proximity to the human body must satisfy the specific absorption rate (SAR) standards defined by international organizations. The SAR value quantifies the amount of power absorbed per unit mass of human tissue. Therefore, while designing body-worn antennas, numerous factors such as the antenna\u2019s radiation properties, the input impedance matching capabilities, and the power absorbed by the antenna should be considered ,28.An antenna that is worn on the human body undergoes bending, stretching, and twisting during the movement of the human body. Consequently, its radiation characteristics may degrade considerably, which affects the antenna\u2019s radiation patterns, frequency tuning, and radiated energy ,30.Body-worn antennas that are fabricated from textile materials face certain operative challenges due to the presence of microscopic holes in the fabric. The microscopic holes can absorb moisture from the environment and increase the dielectric constant of the fibric material. This can significantly impact the antenna\u2019s performance, thereby leading to effects such as frequency detuning, reduced radiation efficiency, and altered characteristics .As the substrate plays a major role in determining the antenna\u2019s characteristics, this study aims to highlight the recent substrates proposed for wearable antennas, with an emphasis on flexible antennas suggested for biomedical purposes. Additionally, it sheds light on the prospective avenues of its applications.The primary difficulty with antennas worn on the body is ensuring that their characteristics remain constant under varying conditions like room humidity variations, body temperature and wet conditions .Similarly, when many wearable antennas/sensors are employed in a single application, the location and distance between the sensors are the most important elements in improving the system\u2019s performance.A UWB health monitoring system tracks plenty of regular activities leading to a healthy lifestyle by employing several wearable sensors at varied locations and distances .Furthermore, most wearable antennas are linearly polarized, and polarization mismatches arise owing to human body movement.Wearable antennas work in close proximity to a lossy human body, which affects the antenna\u2019s efficiency, driving point impedance, bandwidth, and gain. When electromagnetic waves are utilized for communication, part of the radiation is directed at the human body, penetrates through the skin, and is absorbed by the body, resulting in detrimental health consequences. Wearable antennas should comply with a high efficiency and a low specific absorption rate (SAR) in addition to bending and crumpling repercussions and flexibility. The amount of energy that is absorbed by the human body per unit mass is measured in W/kg as the SAR. This problem has been important for the past few years, and various regulating agencies have established a safe limit for the SAR for these antennas.Various solutions have been offered in the past to overcome the aforementioned issues . In 35]35], the To achieve a multiband response, the authors used the method of fractural slot loading. Furthermore, the increased bandwidth comes at the expense of structural complexity . To loweAdditionally, PEC reflectors are employed as an additional antenna component to improve the effective radiation efficiency and lower the SAR of wearable antennas .However, the low-profile property suffers when PEC reflectors are used. The SAR of antennas may also be reduced using ferrite sheets; however, this results in a greater integration cost and a bulkier volume, making the antenna unsuitable for body-worn applications .The purpose of this review study is to summarize the current advancements in the field of wearable antennas for body-centric communication as well as other crucial elements. Conventional antenna materials might be unpleasant and are not suitable for body-worn antennas. To overcome this issue, an appropriate textile material may be employed in their design. Conductive (e-textile) materials have the properties of an imperfect and anisotropic electric conductor. As a result, these conductive materials have different conduction characteristics than standard conductors that are employed in conventional antenna designs . The eleConductive (radiating element) and non-conductive (substrate) materials are the two most critical materials that influence the overall performance of wearable antennas. The dielectric characteristics, deformation , sensitivity to miniaturization, and endurance in the external environment are used to select the substrate materials, while electrical conductivity is used to select the conductive materials. Prior to selecting a conductive material for the radiating portions, such as the feed line, patch, and ground plane, it is required to pick the most appropriate substrate material to support the layers. Wearable antennas will address the demand for comfort while also protecting consumers from dangerous radiation by adopting these materials. Furthermore, the material is chosen based on the aforementioned qualities to provide acceptable gain, high efficiency, and a suitable bandwidth ,44Non-conductive (substrate) materials or smart textiles can play essential roles in the construction of wearable antennas. To achieve higher efficiency, durability, and enough bandwidth, these materials must have minimum dielectric loss, thermal expansion coefficient, and relative permittivity . The nonFurthermore, the substrate material is crucial in terms of functioning, wear resistance, and manufacture. When choosing a substrate material, the permittivity, thickness, loss tangent, and flexibility should all be taken into account. The antenna\u2019s performance, influencing the bandwidth, depends highly on parameters like material thickness and permittivity . The los7 S/m. Conductive textile (e-textile) materials are employed for wearable antennas. As a result, materials with a higher electrical conductivity are preferred. As a result, the conductive materials that are utilized to construct wearable or flexible antennas must be very conductive. Therefore, the electrical characteristics of these materials must be characterized [Conducting materials are required for both the ground plane and the radiating element in all antennas. To maintain adequate antenna emission characteristics, wearable antennas must contain conductive radiating components and ground planes. Conductive materials (electro-textiles) are employed in the creation of wearable/textile antennas to serve as completely flexible and wearable antenna designs. The conductivity of the material determines the current that flows through the conductor, which is responsible for radiation. The conductivity of a substance is its capacity to allow for charges to flow freely through it. The material\u2019s conductivity is measured in Siemens per meter (S/m). The perfect electric conductor (PEC) has unlimited electrical conductivity, making it excellent for antenna construction. In practice, however, all the materials have a limited conductivity. For example, the conductivity of an ordinary copper material is 5.8 \u00d7 10cterized .\u03c4 is the thickness of the material. As a result, a low-loss dielectric material will be required as a substrate, and a highly conductive material will be required as a radiating portion for wearable antennas in order to provide effective electromagnetic radiation and acceptable performance.The electrical conductivity of the chosen material can have a significant impact on the performance of the antennas. Zelt, Flectron, Shieldit, and Taffeta are four different forms of electro-textile materials that have been documented in the literature and are commonly utilized as radiating elements and as ground planes. The conductivity of conductive materials may be estimated using Equation (1) below.Advancements in wireless technology and on-body sensor design can revolutionize the traditional healthcare system by introducing wearable devices for healthcare monitoring . Figure The experimental analysis and design of body-worn antennas is integral to the implementation of body sensor networks (BSNs). Out of eighteen antenna designs, four designs were chosen, and their active and passive performances were assessed. The challenges encountered in this process, such as optimizing the antennas with impedance matching, transforming unbalanced signals to balanced signals, and characterizing antennas in different configurations (on-body and off-body), were investigated and resolved. This resulted in the development of a methodology for characterizing on-body antennas, considering the effects of the transceiver . The proIn this study, we discuss the major challenges faced during the design and testing of on-body antennas in an anechoic chamber. This study builds on prior research by introducing three additional antennas and providing a more comprehensive explanation of the requirements analysis, design, development, and testing procedures. It introduces a systematic approach for actively evaluating the performance of a BSN antenna integrated with battery-powered devices, thereby yielding more realistic results. Additionally, this study examines the influence of the human body on the performance of an antenna through on-body experiments conducted in an anechoic chamber. Finally, it proposes and validates the use of a phantom to simulate and facilitate human experimentation with antennas.3, and a 0.1 mm thick polyimide substrate was used as the dielectric material. The fabricated antenna had three resonant frequencies, 2.4, 5.2, and 5.8 GHz, with a bandwidth of 100\u20131300 MHz. The antenna exhibited relatively low gains of 1.65 and 4.37 dBi at the resonant frequencies of 2.4 and 5 GHz, respectively, despite its small size. This antenna showcases practicality and holds a wide range of potential applications.A sequential array structure consisting of systematically arranged Minkowski fractal array elements was proposed in . Figure 3 and exhibited multiple resonance is shown in A portable triple-band antenna was suggested for internet of things (IoT) devices in . The radVarious periodic structures of radiating surfaces were proposed for realizing WBANs. Three different types of metamaterials were developed, namely electromagnetic band gap (EBG), artificial magnetic conductor (AMC), and metamaterial compounds. A compact composite right/left-handed coaxially fed dual-band antenna was fabricated and tested for GSM and wireless applications . The AMCThe invention of multiple wireless communication techniques ushers in a new era of remote health monitoring systems that enhance the value of health services provided to patients is shown in Leaky wave antennas (LWAs) are a unique class of antennas that exhibit a highly directional radiation pattern is shown in With the smartphone market reaching saturation, a new trend is emerging in the field of personal mobile devices, known as wearable mobile devices or simply wearables . These d2. It had a rectangular slot with three parallel stubs optimized for the radiator patch, as well as a T-shaped structure inverted in the ground plane. The final prototype of the antenna had three resonance frequency bands, 2.4\u20132.9, 3.7\u20135.2, and 5.7\u20136 GHz, with a return loss of less than \u221210 dB. The paper discussed the antenna configuration and design and its simulation and experimental results. It highlighted the compactness, simple feeding technique, and uniplanar design of the antenna, which simplify the integration of the antenna into various wireless devices.A previous study  presenteA miniaturized button-shaped wearable antenna was designed for wireless signal transmission . This anThe small size of millimeter-wave antennas makes them challenging to fabricate. Many applications, such as WiGig, employ the unlicensed V band (57\u201364 GHz). However, research on wearable millimeter-wave antennas is lacking. Karthikeya et al. proposed a wearable V-band antenna  designed2 (0.0817 \u00d7 0.0817 \u03bb02 at 2.45 GHz) and maintained a good performance in the ISM band.A wearable antenna with a small feeding network was discussed in . The antIn , a dumbbAntennas employed in short-range near-field ultra-high frequency (UHF) radio frequency identification (RFID) systems are typically positioned close to the human body . This imThe design considerations for a UHF band card-type tag, which was enclosed in a packet and placed near the chest for applications on our university campus, were discussed in . The FEKRecently, body-centric wireless communications have gained considerable interest. A small and efficient planar inverted-F antenna (PIFA) that operates at 2.45 GHz for on-body communications was introduced in . The ant2. It was fed using a co-planar waveguide (CPW) [A flexible antenna operating at two frequency bands was proposed for data transmission. The antenna had a low profile and a size of 35 \u00d7 20 mmde (CPW)  and oper2. Experimental tests showed that the antenna maintained its performance when positioned near to the human body. The antenna exhibited a safe SAR of 0.297 W/kg at a 0.5 W input power, thus indicating that the antenna can be used safely in wearable devices.A compact, flexible wearable antenna composed entirely of a textile material for the 2.45 GHz ISM band was discussed in . It compAnother previous study  discusse3 and exhibited an impedance bandwidth of 15% and an efficiency of 79%. These findings indicate that the antenna holds significant potential for use in wearable systems.A small textile antenna was designed and tested for use in the ISM band at 2.4 GHz. The antenna utilized a rectangular slot/notch with a strip line inserted to form an inverted E-shape . This deA wearable microstrip antenna made from conductive textile fabric was introduced in . It was Recently, fabric and textile antenna designs have gained widespread attention owing to the growing demand for multi-frequency and multi-function antennas in smart clothing and future consumer-centric communication technologies . The modThe performance of an antenna equipped with a textile substrate and an AMC was discussed in . This st2. According to the manufacturer, the surface resistance of the fabric was below 0.05 \u03a9/sq.The biological attributes of the human body, such as tissue properties and skin layers, play a crucial role in determining the propagation of radio signals through the human body . A texti3, and it exhibited an omnidirectional radiation pattern. The study assessed the performance of the antenna in both a free space and human body surface. Owing to its compact size, this antenna may find utility in numerous applications within the smart wearable textile industry.Antennas employed for healthcare applications usually operate in multiple band frequencies. A reconfigurable patch antenna is well-suited for biomedical applications. In , a compaA planar inverted-F antenna (PIFA) is the most preferable radiating element for transmitting signals in portable wireless devices. In , the perSeveral wearable antennas that are resistant to the body coupling effect have been reported in the literature . To achiWireless technology is integral to the advancement of flexible and stretchable electronics, which has gathered attention in view of addressing the increasing demand for devices that are compact, portable, and comfortable . MicrostIn , the pro2) and operates at a resonant frequency of 4.8 GHz, with a frequency shift range of 8% under different strains. Additionally, it is compatible with 5G communications. Additionally, the sensor exhibits excellent mechanical flexibility and maintains a stable response to repetitive stimulations. It exhibits a superior strain sensitivity of 20 compared with similar antenna sensors. Its resilience to human body proximity was tested by performing cantilever motion monitoring. The antenna exhibits satisfactory stability and sensitivity. It exhibits noticeably shifted resonant frequencies while maintaining a reflection coefficient of approximately \u221225 dB, indicating its potential for applications in the fields of healthcare monitoring, construction diagnosis, and IoT.Owing to rapid advancements in wearable electronics, flexible radio-frequency wireless antenna sensors have garnered considerable interest for their various IoT applications . HoweverA smart pH measuring device can provide vital health information and has various applications in detecting infections, diagnosing diseases, and personalized medicine . HoweverInterdisciplinary research focuses on routine healthcare objects to develop sensors that can monitor human biomedical parameters in an ergonomic and environmentally sustainable manner. In , a hybri2 and an excellent salt rejection rate of 99.96% over a 24 h period were achieved.In the past few decades, considerable efforts have been spent to develop simple and cost-effective methods for preparing superhydrophobic membranes using PDMS. In , a straiAnother previous study  discusse2. The antenna uses a PDMS substrate with a dielectric constant of 2.65 and a loss tangent of 0.02. The antenna has a rectangular slot on the ground and a single circular SRR on the patch. The SRR structure assists in achieving the desired frequency notching characteristics, compact size, minimal losses, and reduced backward radiation when the antenna is used near the human body. The proposed flexible antenna showcases a stable performance and a low SAR. The antenna performance was also evaluated under various moisture and bending conditions. The simulation results are consistent with the measured data.A polymer-based flexible antenna that operates at three different frequency bands  for WLAN and WBAN applications was developed in . The antModern wearable health monitoring systems utilize multiple biosensors embedded in wireless devices . This neAnother study  focused Another study  proposedPDMS is a versatile elastomer that possesses exceptional optical, electrical, and mechanical characteristics, rendering it highly suitable for various engineering applications . Its bio2 and is composed of a simple microstrip structure with two modified arc-shaped patches as the main radiator. The antenna also includes a full ground plane on the opposite side of the substrate to prevent interference from biological tissues and back radiation towards the human body. To ensure flexibility and durability, the antenna is fabricated using conductive fabric embedded into a PDMS polymer. The simulation and experimental results reveal that the antenna exhibits promising performances in both free-space and in vitro on-body cases. This is the first UWB antenna with a full ground plane that can withstand the harsh conditions that are typically encountered with wearable applications.A new UWB antenna was developed for wearable applications in the 3.7\u201310.3 GHz band . This anA flexible UWB antenna using a PDMS substrate was proposed in . The con\u22126 1/K at different temperatures from 103 K to room temperature (RT = 298 K) to 123 K. The results show that as the temperature decreased, the failure mode of PDMS changed from ductile to brittle, with evident brittle characteristics at 123 K.The abrasive jet machining (AJM) of PDMS is either slow or impossible at room temperature because PDMS can absorb the energy of the impacting particles. In , cryogenAnother study  summariz2 was developed [3) and low manufacturing cost, this antenna is well suited for health telemetry applications. Compared with other flexible antennas, the proposed antenna demonstrates smaller dimensions, better radiation efficiency, and higher gain when placed on a human body model.eveloped . The antA modified sinusoidal half-wave dipole antenna sensor that can be used for strain sensing applications was discussed in . Figure Microwave imaging is an efficient method used to diagnose cancer in its early stage. However, the efficiency of a microwave imaging system depends on the effectiveness of the antenna used for transmitting and receiving the microwave signals. Moreover, the antenna should be flexible. Extensive research has been conducted on designing a flexible antenna and increasing its efficiency to save the lives of people. An early detection of cancer can significantly enhance the chances for recovery, potentially saving numerous lives. In India, almost 2.5 million cancer patients have been registered, with 1 lakh new cases added annually. In 2018, 7 lakh deaths occurred owing to cancer. According to the Indian Council of Medical Research, India is likely to record over 17 lakh new cancer cases with over 8 lakh deaths by 2022. Breast cancer is the most prevalent type of cancer in women. These statistics underline the necessity of developing new methodologies for the early detection of breast cancer. Currently, image processing techniques, such as mammography, magnetic resonance imaging, and ultrasound, are available for breast-cancer diagnosis. To improve the efficiency of early breast cancer detection, a portable breast cancer detection device using the microwave imaging technique can be designed and developed. It involves designing a flexible wearable metamaterial antenna operating in a UWB frequency range and machine learning techniques. In addition, a flexible wearable metamaterial antenna can be used as a wearable device to address the limitations of the current detection technologies, which involve radiations that are painful and detrimental to the human body ,95,96,97A U-shaped slot for ultra-wideband microwave imaging applications was proposed in . The ant3 and uses an FR4 substrate [A printed monopole antenna was designed with staircase steps at the edge of the feed line, as shown in ubstrate . The opeMetamaterials are remarkable engineering novelties, and they are shown in 3 was proposed and examined, and it is shown in In , a modif2 (0.2 \u03bbo \u00d7 0.2 \u03bbo) and is fed using a CPW as shown in In , a biodeIn , a smallSeveral numerical techniques were reported for antenna miniaturization based on patch antenna loading with slots, lumped elements, and shorting posts. The slots introduced are of various shapes, and the lumped elements, based on similar reactive components, are designed at the resonating frequency. The etching of various slots facilitates the reduction in the antenna size for modern wireless communication .Antenna miniaturization is accomplished by fabricating a patch structure on a dielectric substrate with a dielectric value that is higher than that of the patch. However, this drastically increases the current distribution and leads to surface wave effects, which degrade the patch antenna characteristics such as the impedance bandwidth, radiation characteristics, and radiation efficiency .Currently, UWB antennas are the most preferred antennas for non-destructive testing and microwave imaging. UWB antennas operate in the frequency range of 3.1\u201310.6 GHz, which encompasses low-frequency to very-high-frequency signals; hence, the use of UWB antennas produces images with better resolution. A device for obtaining the three-dimensional scan of a breast model was developed in . The devEmploying notch cutting in the ground plane reduces the effects at low frequencies. Impedance matching is provided for the input feed from the finite ground plane, and slots are introduced in the radiator. This prompts the antenna to radiate in the UWB frequency range . The canRecently, digital mammography has been adopted for breast cancer detection. Digital mammography is almost similar to the traditional method of film screen mammography. However, the latter involves compressing and positioning the breast organ over the mammography machine in a manner that may be painful for the patients. Digital mammography primarily aims to detect breast abnormalities. Compared to the conventional method of mammography, digital mammography provides breast images with a better resolution at lower radiation levels. However, it suffers from high false positive and negative rates. This necessitates additional examinations to confirm cancer and higher expenses for the early diagnosis of breast cancer. A flexible wearable patch antenna with a jean substrate is proposed in . This anThe conductivity of the electro-textile material and its surface impedance was measured. Furthermore, the SAR analysis was conducted. The antenna exhibited increased bandwidth and efficiency. A metamaterial antenna was fabricated using a low-cost FR4 material, and the antenna characteristics were evaluated by applying metascreens over the patch.In , the useIn , a radarConventional antennas are designed and fabricated on PCBs using substrates such as FR4, Rogers, and PTFE. If these antennas are used in wearable applications, they may obstruct and prevent reactions with the human body during cancer diagnosis . Such anCertainly, the scientific community, the technical community, and the clinical community need to work closely together to figure out solutions that synergize with one another in order to successfully develop and implement wearable antennas in the medical field. Each of these groups plays an important role in ensuring that technical breakthroughs are successfully incorporated into applications that are used in the actual world of healthcare. The authors in  illustraThe research on wearable antennas focuses on developing towards low-cost, easy-to-fabricate BAN systems for medical applications and remote monitoring. This review begins by providing an overview of the different substrate materials and techniques used for wearable antenna fabrication. Substrate materials such as polymer, graphene, PDMS, textile materials, and microfluidic materials are discussed. Substrate materials play major roles in determining the coupling between the antenna and the human body and the characteristics of the wearable antenna under wet and humid conditions. Hence, the substrate material must be chosen carefully to ensure the robustness of the antenna\u2019s characteristics against all environmental conditions.Increasing the accuracy and effectiveness of the present measurement and manufacturing processes;Releasing new yarns and conductive textiles on the market that have increased conductivity or decreased resistance;Introducing new flexible materials for clothing that can be embroidered or new suggested production methods;Introducing novel body-operated antenna sensors based on substrate materials used for various applications.The industry and the scientific community are becoming more interested in flexible wearable antenna sensors. Due to this, the following research problems and critical topics are provided for future studies in this field:For the impactful real-world application of wearable antennas, a further area of research is still required to be carried out in the field of materials science and system engineering. To enhance the performance of antennas as sensors in biomedical applications, new materials including conductive ink on textile substrates and graphene substances can be used. These novel materials are interesting components for the next generation of antenna design.Flexible wearable antennas have gathered considerable attention from both the industry and scientific communities. This may lead to some research challenges. Researchers may focus their efforts towards increasing the accuracy and effectiveness of the current measurement and manufacturing processes. Developing innovative approaches can enhance the conductivity of yarn and textile materials.Novel flexible materials can be used to fabricate wearable antennas for better performance. Future studies can focus on enhancing the performance and reliability of antennas used for medical and industrial applications. Further investigations can be conducted on textile-, microfluidic-, polymer-, and graphene-conductive-ink-based antennas to increase the performance of wearable antennas integrated to BAN systems. Advancements in wearable technology can facilitate the realization of diverse applications in the medical field."}
{"text": "Since the CubeSats have become inherently used for the Internet of space things (IoST) applications, the limited spectral band at the ultra-high frequency (UHF) and very high frequency should be efficiently utilized to be sufficient for different applications of CubeSats. Therefore, cognitive radio (CR) has been used as an enabling technology for efficient, dynamic, and flexible spectrum utilization. So, this paper proposes a low-profile antenna for cognitive radio in IoST CubeSat applications at the UHF band. The proposed antenna comprises a circularly polarized wideband (WB) semi-hexagonal slot and two narrowband (NB) frequency reconfigurable loop slots integrated into a single-layer substrate. The semi-hexagonal-shaped slot antenna is excited by two orthogonal +/\u221245\u00b0 tapered feed lines and loaded by a capacitor in order to achieve left/right-handed circular polarization in wide bandwidth from 0.57 GHz to 0.95 GHz. In addition, two NB frequency reconfigurable slot loop-based antennas are tuned over a wide frequency band from 0.6 GHz to 1.05 GH. The antenna tuning is achieved based on a varactor diode integrated into the slot loop antenna. The two NB antennas are designed as meander loops to miniaturize the physical length and point in different directions to achieve pattern diversity. The antenna design is fabricated on FR-4 substrate, and measured results have verified the simulated results. With the advanced varieties of wireless applications along with addressing the requirements of end user demands which can be varied daily, especially during disaster situations, a flexible communication system is necessary. Numerous use cases require a more global, scalable, flexible, and robust solution, such as monitoring remote areas, internet provisioning to underserved or disturbed regions, or intelligent global transport management. CubeSats are recommended to achieve global communication systems between those different services ,2,3. Cubprojects ,9,10,11.In order to solve the connection problems between multiple CubeSats, the cognitive radio (CR) offers a potential solution. In CR communication, a transceiver is able to discern between channels that are being used and those that are not. It avoids occupied channels and rapidly enters vacated ones without interference with the licensed user. Thus, CRs are a class of intelligent transceivers with increased situational awareness due to their cognitive skills. This can result in the improvement of the efficient and robust use of communication resources and low delay of data exchange in the CubeSat constellation ,9,12,13 Due to space restrictions, achieving multifunctional antennas in the CubeSat is challenging. Indeed, the antenna is the main key for the CubeSat to provide those aforementioned services (CR and IoST); so, a wideband antenna for sensing and a reconfigurable narrowband antenna for communication in low profile and compact size is mandatory. Thus, some physically changing antenna techniques such as origami folding, hinges, soft robotics, spring forces, and telescopic actuation are implemented ,21,22,23Extensive work has been undertaken to provide antennas for cognitive radio applications ,31,32,33In this paper, a simple structure-folded slot antenna design has been presented. The proposed antenna consists of three antennas; one works as wideband antenna which is fed by two feedlines to provide circular polarization, while the other two are narrowband antennas that are fed by separate feedlines in a different orientation, to achieve radiation diversity. In addition, each NB antenna has a varactor diode. The NB antennas change their frequency over the operating band of the wideband antenna. By changing the value of the loading capacitor, the antenna will achieve frequency reconfigurability. The proposed antenna with reconfigurability features in addition to wideband at UHF can be a good candidate for the Cubesate of IoST applications.The proposed antenna is designed on a The sensing antenna is a semi-hexagonal-shaped slot antenna with a perimeter 8\u00a0pF see  results To better understand the CP generation in the left- and right-hand sense, the surface current distributions are provided in The narrowband antenna is a semi-ellipse-meander-shaped slot antenna; the meander shape is employed to reduce the antenna\u2019s physical size. Similar to the sensing antenna, the NB antenna is loaded with various capacitance values from 0.84 pF to 5.08 pF. A varactor diode is connected to the antenna to reconfigure its operating frequency based on the bias voltage value, which changes the capacitor value. The proposed slot antenna has a total length of 86 mm and a width of 32 mm. Two NB antennas are printed on the same view with the sensing antenna. They are printed in two different directions to achieve pattern diversity. Five capacitance values  are used to tune the antenna\u2019s resonant frequency over the wide frequency band. 1, L2 = 1 \u03bcH), and current-limiting resistor . The varactor diode (SMV 1233) is connected to the biasing circuitry through shorting posts. RF chokes are used to separate the radiating structure from the DC power source while the reverse-biased varactor diode serves as a DC blocking capacitor to ensure that the DC biasing component and the RF radiating structure are well isolated.The biasing circuitry of the reconfigurable antenna, as shown in Next, the board is placed in an etchant solution that selectively dissolves the unprotected copper areas, leaving behind the desired circuit pattern. The etchant solution usually contains chemicals such as ferric chloride, ammonium persulfate, or cupric chloride, which react with copper to dissolve it. Once the required amount of copper has been removed, the board is rinsed with water to eliminate any residual etchant solution, and the resist is removed, revealing the final circuit pattern on the copper-coated substrate. Chemical etching is a highly reliable and widely used method that enables the production of high-quality PCBs with precise circuit features. The proposed antenna was measured for its S-parameters and radiation characteristics.The far-field radiation pattern characteristics were also performed for the proposed MIMO antenna. To calculate the antenna\u2019s performance, the peak gain and radiation efficiency values (%\u03b7) are determined for each element of the antenna. To conduct the measurement for any port, the rest of the MIMO antenna ports were terminated with a 50 \u03a9 load to avoid any reflected power. For sensing and frequency reconfigurable antennas, the peak gain values were 1.079 dBi and 0.86 dBi, respectively, while %\u03b7 varied from 80~85% to 73~78%, respectively. Anechoic chamber: The chamber is large enough to accommodate the antenna under test and other required testing equipment. The walls, ceiling, and floor of the chamber are covered with radiation-absorbing material to prevent reflections and create an environment free of external interference.Antenna positioning system: The antenna positioning system is used to precisely control the position and orientation of the antenna under test. This system typically includes a rotation stage and one or more translation stages, which allow the antenna to be positioned at various distances and angles from the measurement equipment.Signal generator: The signal generator is used to generate the RF signal that excites the antenna under test. The frequency and power level of the signal can be adjusted as needed.RF receiver: The RF receiver is used to measure the signal received by the antenna under test. The receiver is typically connected to an antenna or probe that is positioned at a fixed distance and angle from the antenna under test.Data acquisition system: The data acquisition system is used to collect and store the measurement data. This system includes a computer, software, and any necessary interfaces for controlling the measurement equipment and recording the data.Calibration equipment: The calibration equipment is used to calibrate the measurement system and ensure accurate results.The measured and simulated radiation patterns for the UWB antenna and narrowband reconfigurable antenna are shown in The patterns show omnidirectional radiation patterns in both planes for wideband antenna, indicating they are useful for UHF band communication applications. The NB antennas have omnidirectional radiation and wide-beam directive patterns, alternating in both planes which makes them useful for sensing behavior. The simulated and measured results show good agreement for both antennas in both XZ and YZ planes.ECC) is calculated to show how much antenna elements are independent in their performance. The values are found to be very low, less than 0.02, ideal for the MIMO operation. ECC values are calculated based on the radiation patterns of antenna elements as given below:ith antenna element. The diversity of the MIMO antenna in terms of envelope correlation coefficient (The proposed antenna features the benefits of sensing and communication integrated antenna, compatibility with unity CubeSat size, low profile, dual CP sensing, communication diversity, frequency reconfigurability, and UHF support. o tapered feed lines and loaded by a capacitor in order to achieve left/right-handed circular polarization in a wide bandwidth from 0.57 GHz to 0.95 GHz. The frequency reconfigurable antenna operates over a wide band from 0.6 GHz to 1.05 GH using a single varactor diode per antenna element. The two NB antennas are designed as meander loops to miniaturize the physical length and reactive loading, which further optimized it to be operated in sub-GHz bands. The antenna system is fabricated on FR-4 substrate with a dimension of 100 \u00d7 100 \u00d7 0.76 mm3. The measured results verified the simulated results and both are in good agreement. The proposed antenna design is well suited for IoST CubeSat applications.This work presents a low-profile WB and NB frequency reconfigurable antenna for IoST applications. The proposed antenna consists of a circularly polarized WB semi-hexagonal slot and two NB frequency reconfigurable loop slots integrated on the same substrate board. The semi-hexagonal-shaped slot antenna is excited by two orthogonal \u00b145"}
{"text": "Cardiovascular diseases (CVDs) are one of the leading causes of death globally. The Internet of things (IoT) enabled with industrial, scientific, and medical (ISM) bands (2.45 and 5.8\u00a0GHz) facilitates pacemakers to remotely share heart health data to medical professionals. For the first time, communication between a compact dual-band two-port multiple-input-multiple-output (MIMO) antenna (integrated inside the leadless pacemaker) and an outside-body dual-band two-port MIMO antenna in the ISM 2.45 and 5.8\u00a0GHz frequency bands is demonstrated in this work. The proposed communication system offers an attractive solution for cardiac pacemakers as it can operate on a 5G IoT platform while also being compatible with existing 4G standards. The experimental verification of the proposed MIMO antenna low-loss communication capability is also presented by comparing it to the existing single\u2013input\u2013single\u2013output communication between the leadless pacemaker and outside body monitoring device. In this direction, Medtronic\u00ae introduced the world's first remote cardiac monitoring system in 2002, which has been used by two million patients worldwide. Remote monitoring not only helps to limit in-person contact with other patients, healthcare workers, and physicians, but it also reduces exposure to various viruses, including COVID 192. Several studies using a patch antenna for a leadless pacemaker have been published in the past6. Leadless pacemaker antenna designs are classified into two types: conformal8 and flat6. The flat antennas must be placed on the PCB holder or on top of the telemetry module inside the pacemaker capsule, while the conformal antennas must be wrapped around the curvature of the pacemaker capsule. The reported antennas were operated in the medical implant communication system (MICS)/400\u00a0MHz band and the industrial, scientific, and medical (ISM)/2.45\u00a0GHz band6. Recently, in9 and10, two implantable antennas were proposed operating in single ISM 2.45\u00a0GHz band, and a multi-band antenna was proposed in11. However, due to the single antenna element, such antenna systems will not be suitable for next generation pacemakers. A leadless cardiac pacemaker (LCP) outfitted with a multiple-input-multiple-output (MIMO) antenna, as shown in Fig.\u00a012 while also having power telemetry can be achieved. When compared to a single antenna system, MIMO communication systems offer high capacity and low-loss transmission/reception without requiring additional power13.Low-cost health-care facilities are required to promote healthy ageing and reduce premature deaths from cardiovascular diseases (CVDs)15. Despite the fact that antennas in14 and15 were proposed for implantable applications, the authors did not investigate specific absorption rate (SAR), and the MIMO antenna reported in14 had poor isolation (12\u00a0dB). In16, a two-port single band (ISM 2.45\u00a0GHz) MIMO antenna with two different antenna elements was presented. In17, an implantable antenna with a partial and slotted ground plane was proposed, which operated in a single band (ISM 2.45\u00a0GHz) and had inter-element isolation of 16\u00a0dB. In18, a two-port MIMO antenna with isolation of 26\u00a0dB was reported. In19, a four-port head implantable MIMO antenna with high port isolation and sufficient gain was proposed, but the antenna size was quite large. In20 and21, implantable MIMO antennas were proposed, both of which operated in single ISM 2.45\u00a0GHz frequency band with slot loaded ground planes. In22 and23, two implantable MIMO antennas were proposed, where the MIMO antenna in22 had slotted ground with two shorting pins, whereas the MIMO antenna in23 had a complete ground plane. In the above-mentioned implantable MIMO antennas, defects or slots on the ground surface have a significant impact on the performance of the antenna. It is well understood that an antenna with a complete ground plane ensures radiation in the broadside direction with the required high front-to-back ratio, i.e., outwards from the body towards the external monitoring device.In the literature, there are few works reported on implantable MIMO antennasTo date, there has been no article in the open literature on a compact multi-band MIMO antenna system for leadless transcatheter pacemaker (TCP). In this paper, an ultra-compact two-port MIMO antenna system with dimensions of 3.4\u00a0mm\u2009\u00d7\u20096.6\u00a0mm\u2009\u00d7\u20090.254\u00a0mm is presented, which can be easily integrated with commercial pacemakers (Medtronic\u00ae Micra TCP and Nanostim\u00ae LCP).27.The proposed antenna operates in dual-frequency bands (2.45\u00a0GHz and 5.8\u00a0GHz), has a flat profile, and offers satisfactory gain in the reported bands. The proposed MIMO antenna has the smallest footprint as compared to the previously reported implantable MIMO antennas. Here, higher ISM frequency bands that are compatible with Wi-Fi and Bluetooth technologies are used in the IoT environment. In order to ensure patient safety due to the long-term use of the pacemaker, loop antenna is chosen, which confines current to the radiator and results in low radiation effects due to less interaction with biological tissues28. Furthermore, a communication system is simulated in the Ansys HFSS\u00ae software to validate far-field communication performance of the proposed MIMO antenna. For this purpose, the MIMO TCP system is implanted in the multi-layer canonical heart phantom, and the external MIMO antenna is placed at different distances in the far-field region. The proposed antenna prototype is fabricated and packed inside a ceramic alumina capsule (dimensions similar to the Medtronic's Micra TCP) along with dummy electronics  and a battery, and experimentally validated in a heart muscle gel  phantom. Also, the communication is configured for MIMO and single port antenna, and the results are compared to illustrate the advantages of MIMO over single\u2013input\u2013single\u2013output (SISO) communication.The proposed implantable MIMO antenna is simulated in the canonical model of the heart muscle after being placed at the top of the telemetry module inside the TCP system, as per\u03bb0/4 from the antenna. The heart muscles are then designed as a cuboid with dimensions of 50\u00a0mm\u2009\u00d7\u200950\u00a0mm\u2009\u00d7\u2009120\u00a0mm, and it is positioned in the center of the radiation box. In order to make the phantom more realistic, skin and fat layers of 4\u00a0mm thickness are added on top of the muscle layer, as shown in Fig.\u00a030. The housing of the leadless pacemaker system is designed in the center of the heart muscles  with dimensions of 3.4\u00a0mm\u2009\u00d7\u20096.6\u00a0mm\u2009\u00d7\u20090.254\u00a0mm at the top of the telemetry module of the TCP system. A fractal antenna design is chosen  is\u2009~\u200917\u00a0mm inside the heart muscle, but this much area is not available inside the leadless pacemaker. Therefore, the design begins with an open loop antenna on the substrate of 3.4\u00a0mm\u2009\u00d7\u20096.6\u00a0mm, which is the first stage of the Hilbert curve, as shown in Fig.\u00a0\u03bbg/2) is 5.9\u00a0mm, as shown in Fig.\u00a0At the targeted frequency of 2.45\u00a0GHz, the guided wavelength , a good isolation of\u2009>\u200922.5\u00a0dB is achieved.In step-4, a \u03c0-shaped metal strip connects the two halves of the antenna elements, as shown in Fig.\u00a0An open-loop square section is introduced at the end of each antenna element, as shown in Fig.\u00a0\u03b5r\u2009=\u20093) with a thickness of 0.762\u00a0mm. The design of both antennas and their scattering parameters are shown in Fig.\u00a0\u03bb0\u20132.45\u00a0GHz) apart. The reflection coefficients of a single-port antenna are shown in Fig.\u00a0A conventional rectangular patch antenna and a two-port MIMO antenna are designed as outside-body antennas, and fabricated on the Rogers 3003 substrate 38 is shown in Fig.\u00a0Figure\u00a011| and |S22|) of Antenna 1 and Antenna 2 and isolation (|S12| and |S21|) between antenna elements is shown in Fig.\u00a0Next, comparison of the measured and simulated reflection coefficients  and 1.22\u00a0GHz (1.73\u20132.95\u00a0GHz), respectively, and, at 5.8\u00a0GHz, the simulated and measured impedance bandwidths are 1.7\u00a0GHz (4.5\u20136.2\u00a0GHz) and 1.91 (5.00\u20136.91\u00a0GHz), respectively. As shown in Fig.\u00a0Single-port implantable antenna and outside-body antennas fabricated prototypes are shown in Fig.\u00a0\u03b8\u2009=\u20090\u02da)). The measured gain values are less than the simulated values, likely due to implantation depth variation (because of human error) in the muscle phantom during measurements. It is very common for ultra-compact implantable antennas to have low gain values due to high losses in biological tissues, as per39. Therefore, the proposed antenna has the minimum gain value when compared to the other reported implantable MIMO antennas in Table E (\u03d5\u2009=\u20090\u02da) and H (\u03d5\u2009=\u200990\u02da) planes demonstrate diversity, making the proposed antenna in an integrated approach an attractive entrant for efficient wireless communication in a lossy human body environment.The gain of the MIMO antenna in the muscle phantom is measured in an anechoic chamber, as shown in Fig.\u00a0H-plane. At 2.45\u00a0GHz, simulated and measured peak gain values are 3.79 dBi and 3.74 dBi, respectively. Radiation patterns for single-port outside-body antenna and single-port implantable antennas are shown in Figs.\u00a0H-plane at both the resonant frequencies (ISM 2.45 and 5.8\u00a0GHz), and in the E-plane, radiation pattern is eight-shaped. Simulated and measured values of the peak gains for outside-body single-port antennas are 2.8 dBi and 2.7 dBi, respectively, at 2.45\u00a0GHz frequency. Whereas, at 5.8\u00a0GHz, simulated and measured peak gains are 3.6 dBi and 3.45 dBi, respectively.A comparison of simulated and measured radiation patterns of outside-body two-port MIMO antenna at 2.45\u00a0GHz and 5.8\u00a0GHz is shown in Fig.\u00a0Single-port implantable antenna was integrated into the biocompatible ceramic alumina\u2019s capsule housing along with ICs and battery, as shown in Fig.\u00a040.The envelope correlation coefficient (ECC) of a MIMO antenna indicates how independent the antenna elements are of one another. Ideally, there should be zero correlation between the antenna elements in order to avoid undesired coupling of the power radiated by each antenna. But practically, ECC\u2009<\u20090.5 is acceptable. ECC is calculated with the help of the 3D radiation pattern, as explained in41.It can be noted from Fig.\u00a0Simulated and measured DG is close to 10\u00a0dB, as shown in Fig.\u00a042 are considered. As per the safety standards the Average SAR (ASAR) value for 1\u00a0g/10\u00a0g of human tissue in a shape of a cube cannot be greater than 1.6/2.0 W/kg. All the SAR values (1\u00a0g/10\u00a0g) correspond to the input power of 1 W. Although ASAR value should be high at high frequency, in the present case, it is low because at 5.8\u00a0GHz intensity of the current is low as compared to the 2.45\u00a0GHz and causes a low value  of SAR at high frequency, as shown in Fig.\u00a043; hence, on the basis of results, the MIMO TCP system will be safe for long-term use inside the human body.The proposed TCP MIMO antenna system is checked in terms of safety by evaluating the SAR when the prototype lies in the multilayer human heart phantom. For this purpose, the new guidelines of International Commission on Non ionizing Radiation Protection (ICNIRP) and IEEE C95.1-2019 standards12, a MIMO system was used to extend the transmission range for non-biomedical applications. The same concept is tested in this work for implantable TCP system as it is also enabled with remote monitoring, and by using the MIMO communication technology, one can achieve increased transmission range (or received power for fixed distance), hence improving the performance of the TCP system. Furthermore, with the deployment of 5G networks, there is a strong need to replace conventional single port antennas with MIMO antennas, as MIMO antennas are one of the requirements for 5G communication. Considering all of these factors, SISO and MIMO communications are established and compared in the simulation and anechoic chamber to validate the advantage of MIMO communication over SISO communication.In this section, the single-port antenna TCP communication system and MIMO antenna TCP communication system in the simulator and anechoic chamber  are explained and compared. InIn a leadless pacemaker communication system, an external device receives data wirelessly from the implanted device (TCP) and transmits it wirelessly to a healthcare professional. The implanted leadless pacemaker (transmitter) and the external device (receiver) that receives the patient's data use a single-port antenna for both transmission and reception, which is referred to as a SISO communication system, as shown in Fig.\u00a0D2/\u03bbg), where D is the largest dimension of the antenna and A single antenna pacemaker consists of a dual-band (ISM 2.45\u00a0GHz/5.8\u00a0GHz) antenna, battery, and ICs that are integrated inside a biocompatible ceramic alumina capsule housing, as shown in Fig.\u00a0S21) between the implantable TCP antenna (transmitter) and the single-port antenna (receiver) using the following formula:In the present case, the far-field distance is 5.1\u00a0mm at 2.45\u00a0GHz and 12.13\u00a0mm at 5.8\u00a0GHz. Thus, distances greater than 12\u00a0mm are in the far-field range. In this work, a distance of 20\u2013200\u00a0mm is used to compare the communication system in terms of losses or received power strength. Therefore, for the evaluation of the received power strength, distances ranging from 20 to 200\u00a0mm are taken into account, and the received power is calculated using the transmission coefficient  and ICNIRP guidelinesPR) at 20\u00a0mm distance (minimum) is \u2212\u00a042.4 dBm, while at 200\u00a0mm distance, the power received is \u2212\u00a058 dBm. Whereas, at 5.8\u00a0GHz, the maximum received power is \u2212\u00a044.2 dBm at 20\u00a0mm and \u2212\u00a057 dBm at 200\u00a0mm, as shown in Fig.\u00a0Figure\u00a0The received power measurements for single-port antenna communication are performed inside the anechoic chamber, as shown in Fig.\u00a0The TCP system is immersed in the heart muscle gel phantom and fed by 8 dBm power (at 2.45\u00a0GHz) and 11 dBm power (at 5.8\u00a0GHz) from the signal generator via a power amplifier, as shown in Fig.\u00a0R1 due to transmitting antenna T1, R1 due to transmitting antenna T2, R2 due to transmitting antenna T2, and R2 due to transmitting antenna T1. In this case, a two-port dual-band MIMO TCP antenna is used on the transmitter side, and a two-port dual-band patch antenna is used on the receiver side.Multiple antennas are used on the transmitter and receiver sides of the MIMO communication system. The proposed work has considered a (2\u2009\u00d7\u20092) MIMO antenna system, as shown in Fig.\u00a0PR can be calculated by using Eq.\u00a0 resonances, as shown in Fig.\u00a0The presented work uses a single port monopole and two-port MIMO monopole antennas as outside-body antennas to demonstrate single port/MIMO antenna communications. The omnidirectional radiation pattern of the monopole antenna makes it a good choice for outside-body communication as there is no need for alignment with the implantable antenna. Furthermore, by using a high gain omni-directional MIMO antenna array instead of a simple monopole antenna increases the communication range or reduces the losses for fixed communication distance. Also, this study found that MIMO antenna communication not only provides long range/low-loss communication for present IMDs, but it is also compatible with future IMDs on the 5G-IoT platform and can participate in real-time monitoring of human-heart for future leadless pacemakers.This paper proposes an ultra-compact MIMO antenna integrated into the leadless pacing system, which enables low-loss MIMO communication to the external MIMO antenna for remote cardiac monitoring on 5G IoT platform. Here, in order to check the low-loss capability of MIMO communication, two types of far-field communication systems are realized: one with a single-port antenna and the other with MIMO antenna in the simulator and anechoic chamber. The performance of both communication systems is compared by comparing their received power. A comparison of simulated and experimental results shows that MIMO antenna communication system receives more power than SISO communication system at both frequency bands (ISM 2.45\u00a0GHz/5.8\u00a0GHz). Hence, due to its ultra-compact size and higher far-field received power in both frequency bands, the proposed MIMO antenna communication system is suitable for remote health monitoring and wireless power transfer for commercial leadless TCP systems: Micra's TCP and Nanostim's LCP in 4G as well as in 5G IOT based remote monitoring applications."}
{"text": "The simulated antenna\u2019s input reflection coefficient (S11) results and the far-field measurements show good agreement. The fabricated prototype achieves peak gain values of 2.8, 3.8, and 4.7 dBi, respectively, and bidirectional radiation characteristics. A comparative study with other recent publications is implemented to validate the consistency of the design.A triple-band microstrip patch antenna designed for the IEEE 802.16e WiMAX, IEEE 802.11a WLAN, C-band downlink communications, and Ku-band radar recent applications is suggested in this article. The planned antenna operates at 2.45, 6, and 14\u00a0GHz resonant frequencies. The antenna fulfilled triple-band physical characteristics covering industrial, scientific, and medical (ISM) bands between (2.1\u20132.8) GHz; (5.6\u20136.5) GHz for wireless local area network (WLAN) or ultra-wideband (UWB) services; and 12.7\u201316\u00a0GHz for future two-way 5G:6G either broadcasting or mobile satellite communications. To achieve better return loss performance, parametric studies are carried out using Microwave Studio (CST MWS). The proposed antenna is designed on the FR4 as a hosting medium of total size 46\u2009\u00d7\u200938\u2009\u00d7\u20091.6 mm Nevertheless, the work on 5G has advanced to 6G and will be properly triggered over the rest of this decade. 5G Advanced will continue to improve end-to-end communication and wireless network performance, bring new efficiencies, and launch the technical foundation for 6G (the next innovation platform for mobile).1. Several demands on the antenna, such as simplicity, size miniaturization, power consumption, and inexpensive cost, are extremely important for cutting-edge wireless technologies. Numerous techniques have been considered to provide a compact antenna size; however, each of them has some limitations. The best compact-size antenna structures that have been considered recently are the micro-strip patch antennas, which can be easily united into wireless communication devices. Generally, the microstrip patch antenna is structured by a thin metal layer attached to a dielectric substrate backed with thin metals and is simply printed on the PCB's surfaces for different wireless terminal equipments2. The growth of multi-functional UWB wireless devices uses high data rates, long battery life, and small antenna sizes. These antennas should fulfill the electromagnetic compatibility (EMC) requirements by providing less exposure to electromagnetic (EM) radiation to be safe for human tissues. Moreover, micro-strip antennas play an indispensable part in UWB systems; typically, they aid in the emission of very narrow pulses, each with nearly 1\u00a0ns and 1\u00a0GHz bandwidth. UWB antennas cover two broad ranges: the lower band, which extends from 3.1 up to 5.1\u00a0GHz, and the upper band, which ranges from 5.85 up to 10.6\u00a0GHz. The leading wireless technology corporations are now on track with the upcoming wireless systems, such as beyond 5G (B5G)/6G wireless sensor technologies and beyond the 6\u00a0GHz frequency (WiFi-6E)4. GHz Wi-Fi will be frequently engraved into the history of wireless technology by the representatives of the US telecom-regulator Federal Communications Commission (FCC), which voted to utilize 6\u00a0GHz in Wi-Fi despite the 1.2\u00a0GHz spectrum6. Wi-Fi 6 diminishes the transmission and delay times of wireless networks queued for users7. High efficiency, reasonable gain values, and a small size antenna are preferred for many standards such as IEEE 802.16 (WiMAX), IEEE 802.11ac, and IEEE 802.11n (WLAN) and 5:6\u00a0GHz Wi-Fi communication devices8. Researchers presented various antenna types to meet the requirements of the most current wireless applications. The well-known microstrip antenna types are target specific, UWB, reconfigurable, dual, triple, and multiband antennas. Moreover, these antenna types have implemented many techniques, like Defected Ground Structure (DGS) and metamaterials, to achieve wideband capabilities9. In10, a micro-strip antenna containing DGS with a total size of (59.5\u2009\u00d7\u200947\u2009\u00d7\u20091.6) mm3 is presented. It achieved triple-band operation at the following resonating frequencies: 1.57, 2.45, and 3.53\u00a0GHz. A compact UWB inverted triangular antenna with dual-notch band characteristics is presented in11. It offers three operational frequency bands in the UWB range, which are between 3\u20134.17, 5.33\u20136.5, and 8.9\u201312\u00a0GHz, respectively. A compact printed UWB antenna with tri-notched characteristics at 3.5, 5.5, and 8.1\u00a0GHz with a total size of (30.2\u2009\u00d7\u200925\u2009\u00d7\u20090.762) mm3 was introduced in12. A quadruple-band notched UWB antenna was presented and fabricated in13. It has a size of 32\u00a0mm\u2009\u00d7\u200930\u00a0mm\u2009\u00d7\u20091.6\u00a0mm and its operation covers four-notched bands at 3.1\u20133.6, 4.9\u20136.1, 7.5\u20138.4, and 10.2\u201311\u00a0GHz, respectively. An UWB MIMO antenna is presented in14, composed of a chip antenna, an isolator stub, and a printed circuit board (PCB) with a partial ground plane. A chip antenna patch size of 10\u2009\u00d7\u200910\u2009\u00d7\u20090.8 mm3 embedded on FR4 dielectric substrates, besides a PCB of 30\u00a0mm\u2009\u00d7\u200930\u00a0mm, provides operation at 2.45:9\u00a0GHz and a maximum peak gain of 4.5 dBi. In15, a reconfigurable pattern monopole antenna including two pin diodes with an overall size of 32\u2009\u00d7\u200959\u2009\u00d7\u20090.8 mm3 is considered. Its operating frequency band is 3.36 to 3.6\u00a0GHz, with realized gain and efficiency of 2.13: 4.93 dBi and 62% to 82%, respectively. In16, a patch antenna that operates in UWB-MIMO applications and has (34\u00a0mm\u2009\u00d7\u200934\u00a0mm\u2009\u00d7\u20091.6\u00a0mm) total dimension with notched triple band characteristics is proposed. It covers the subsequent notched bands (3.3:3.9), (5:6), and (7.4:8.5) GHz with a radiation efficiency lower than 50% and from 75% up to 90% in the other UWB frequency bands. A sub-6\u00a0GHz 5G four-element triple-band MIMO antenna is presented in17 for wireless applications. It is designed by using FR-4 substrate to operate in the following triple bands: 3.72\u20133.82, 4.65\u20134.76, and 6.16\u20136.46\u00a0GHz, with a dimension of 16\u00a0mm\u2009\u00d7\u200916\u00a0mm\u2009\u00d7\u20091.6\u00a0mm and an average gain equal to 2.5 dBi. In18, a four port UWB-MIMO antenna constructed on an FR4 substrate with an overall size of (30\u2009\u00d7\u200930\u2009\u00d7\u20091.6 mm3) is presented. The antenna's operating frequency band is (3.1\u201312) GHz, and it achieved a maximum gain of 6.2 dBi and an efficiency of 87%. A triple-band mm-wave patch antenna is presented in19 with triple resonating frequencies at 2.4, 5.5, and 28\u00a0GHz. The antenna dimensions are 45\u2009\u00d7\u200940\u2009\u00d7\u20090.508\u00a0mm3,\u00a0and it provides gain values of 1.95, 3.76, and 7.35 dBi, respectively. A radiating MPA is introduced in20 for conventional sub-6\u00a0GHz/5G applications. It uses an Arlon-AD 300C substrate with a 52.92\u2009\u00d7\u200955.56\u2009\u00d7\u20091.2 mm3 antenna size and achieves a gain value of 7.15 dBi at a frequency of 5.65\u00a0GHz. In21, a C-shaped ring antenna integrated with the structure of an artificial magnetic conductor (AMC) and a Styrofoam layer is presented. It has a total size of 54\u2009\u00d7\u200954\u2009\u00d7\u20093.9 mm3 and operates at a 2.4\u00a0GHz resonating frequency with a 6.21\u00a0dB gain and 81% efficiency. As mentioned in22, a planner monopole antenna with a partial ground plane is designed with a total dimension of 38\u2009\u00d7\u200950.5\u2009\u00d7\u20091 mm3. It achieves operation in the ISM band from 2.075 up to 2.625\u00a0GHz with a peak gain of 7.76 dBi and an 80.12% efficiency value. An antenna array module for in-time operation at 3.5\u00a0GHz (sub-6\u00a0GHz) and 26\u00a0GHz\u00a0mm-wave frequencies is presented in23. The antenna modules are fabricated on a commercial FR-4 substrate with a total size of 154\u00a0mm\u2009\u00d7\u200966\u00a0mm\u2009\u00d7\u20090.6\u00a0mm. It achieves an input impedance matching -10\u00a0dB in the sub-6\u00a0GHz and mm-wave bands, respectively, to support the feasibility of the recent 5G smartphones.In the last few years, wireless communication parts used in 3G, 4G, and 5G networks have undergone astonishing developments. Their applications, like GPS, Wi-Fi, IR, and several others, are developing at enormous speed as well. An essential component of modern wireless communication systems is the antenna, which has displaced cables. Also, the rapid progression of multi-purpose communication devices requires operation in more than one frequency band. Correspondingly, research related to wireless communication systems is increasing, especially in dual, triple, UWB, and multiband antennas3 dimensions and then combined with a planar T.L. feeder. It is simulated by means of CST MWS, while the antenna prototype structure was developed during the design process. As a result, this antenna was able to be operated in triple-band operation with gain values reaching up to 6\u00a0dB, more than 85% radiation efficiency, and bidirectional radiation characteristics.In this study, a microstrip patch antenna has been designed to enable triple-band operations at 2.5, 6, and 14\u00a0GHz. Its double circular ring patches are etched on the upper MPA side, while a partial-rectangular DGS is embedded on the bottom side of the antenna. The whole antenna structure is fabricated using a FR4 (5880) substrate of 46\u2009\u00d7\u200938\u2009\u00d7\u20091.6 mmThe substantial features of the planned antenna have been listed as follows: (1) Simple circular radiators and a partial ground plane are loaded on a single square-shaped microstrip patch to achieve triple-band performance. (2) It provides three operational bandwidths using a simple geometrical arrangement, a T.L. feed, and a DGS for ever-changing the operation frequency to lower and upper bands without increasing the antenna size, and (3) the combination of compact size, three operating bandwidths, high efficiency, and high gain recommends future usage of\u00a0the presented antenna in upcoming wireless communication and LAN network systems. (4) the \".The paper is divided as follows: Section \"Antenna design and working principle\" describes the antenna's design and working principles, along with the analytical design equations. In Section \"Simulations resultsthe simulation results of the planned structures have been offered. Fabrication and tests are then presented in Section \"Fabrication and tests\"; finally, Sect.\u00a05 presents the conclusion.The presented circular patch micro-strip antenna, along with the rectangular arms and the DGS, are mainly designed to cover the operational requirements at 2.45, 6, and 14\u00a0GHz frequencies. The whole antenna structure is embedded on the FR4-5880 commercial substrate; its dielectric parameters are, respectively, 1.6\u00a0mm substrate thickness 'h', substrate dielectric constant of 4.4, and 0.02 loss tangent. The planned antenna is constructed of two circular radiator elements supported by four rectangular arms on the upper patch layer, while the DGS is placed on the lower side. As a result, different resonance frequencies have been fulfilled. The designed structure is excited by means of a transmission feed line (T.L.). Since we recognize the importance of mathematical modeling in engineering design, we are dedicated to sharing our antenna design by using mathematical and computer tools to address the design challenges. Mathematical modeling is the act of using equations to represent a real-world situation in mathematical terms and then utilizing those equations to both understand the problem and uncover new features.24, the design of each circular patch starts by calculating its diameter D by means of the following equations:In relation to the elementary formulas present inwhere wherein the analysis of the upper rectangular arms and the DGS starts by calculating their widths The lengths and then the substrate effective dielectric constant will be calculated by:r is the substrate relative dielectric constant.wherein, the 25:3. The double circular patches with outer diameters D2 and D4 are taking place on the upper antenna's left and right sides, supported by vertical antenna arms L2 and L4, respectively; each has an inner circular slot. The small slots were loaded on the center of each circular patch of diameters D1 and D3 to improve the performance of the antenna structures and increase the operational impedance bandwidth25. To avoid the higher order modes operation and approve the 50\u2126 microstrip line matching impedance, the metallic T.L. cut-off frequency will be given by26.The initial dimension values for the rectangular and circular patches have been set according to the above equations. Then, the antenna parameters have been parametrically studied through the CST MWS software to get the best values for matching the designed antenna around the required resonances. The overall antenna optimum design parameter values are then listed in Table r & where c = 17.where 26. The reflection of the arriving wave is lessened according to the impedance matching methodology, therefore, a microstrip feedline with optimized dimensions Wo and 2 is loaded on a similar substrate for appropriate excitation. Accordingly, the appointed substrate parameters realize up to 16\u00a0GHz operating frequencies without the higher-order modes of operation26. The patch impedance 26.The accurate selection of the substrate's width to obtain a 50 \u2126 microstrip line and keep the minimum loss in microstrip line feed is  make them more resourceful than the feed line. Nevertheless, the shift around the frequency\u2019s resonances takes place due to the effect of DGS underneath the various patches; these added resonances achieve a wider triple-band performance based on optimizing the DGS to increase the operating bandwidth around the resonating frequencies29. Figure\u00a025.As a result of the inherent analysis, good-looking surface current distribution features, and the various resonances, a straightforward perspective of the proposed antenna's performance is realized. The manufacturing process was then executed to confirm the preceding simulation results and validate the physical characteristics of the proposed design. The input reflection coefficient (S11) parameters of the fabricated antenna prototype were measured using the 50 \u2126 port of the ZVA 67 Rohde and Schwarz vector network analyzer (VNA). The test arrangement is depicted in Fig.\u00a030. Table Further inspection was done on the proposed antenna by examining the 2-D radiation characteristics at some valid frequencies and antenna gain values over the related bandwidths. The anechoic chamber is utilized during the measurement as depicted in Fig.\u00a019 in Table The radiation patterns at 2.45\u00a0GHz (first band), as depicted in Table 29. As shown Fig.\u00a031.Additionally, the simulated versus measured 2-D gain values of the fabricated antenna were verified in Fig.\u00a0The measured and simulated antenna radiation efficiency over the overall frequency range is illustrated in Fig.\u00a033. Figure\u00a0Generally, the equivalent circuit model can be done using a parallel or series RLC circuit, where the microstrip patch antenna performs a bandpass filter. The antenna attenuates all frequencies except those in the desired frequency range. As a result, the proposed antenna's input reflection coefficient (S11) has been equivalently modeled using parallel resonant circuits via the Advanced System (ADS) toolbox. The equations relating the required bandwidth and resonant frequency with R, L, and C components are completely described inIn conclusion, Table In this work, an UWB microstrip patch antenna operating in triple-band, covering 2.45, 6, and 14\u00a0GHz resonance frequencies was engineered. These frequencies have implications for modern wireless technologies, especially 5G/6G applications. The design steps of the proposed antenna are discussed in detail. It is based on reducing the overall antenna size by using circular-radiator patches besides DGS, all printed on the same substrate. The strong couplings between both driven and parasitic patches offer triple-band operation with three different frequency resonances. Moreover, this configuration experimentally achieves proper impedance matching, gain, and efficiency values. The radiation characteristic enhancements of the proposed antenna in the overall operating frequency ranges are thus fulfilled. The fabricated prototype exhibits triple-band antenna performance at the definite frequencies of input reflection coefficients more than\u2009\u2212\u200910\u00a0dB. The results show that the efficiency and gain values of the planned antenna reach up to 87% and almost 6 dBi with good bi-directional radiation characteristics."}
{"text": "A low-profile broadband dual-polarized antenna is investigated for base station applications. It consists of two orthogonal dipoles, fork-shaped feeding lines, an artificial magnetic conductor (AMC), and parasitic strips. By utilizing the Brillouin dispersion diagram, the AMC is designed as the antenna reflector. It has a wide in-phase reflection bandwidth of 54.7% (1.54\u20132.70 GHz) and a surface-wave bound range of 0\u20132.65 GHz. This design effectively reduces the antenna profile by over 50% compared to traditional antennas without an AMC. For demonstration, a prototype is fabricated for 2G/3G/LTE base station applications. Good agreement between the simulations and measurements is observed. The measured \u221210-dB impedance bandwidth of our antenna is 55.4% (1.58\u20132.79 GHz), with a stable gain of 9.5 dBi and a high isolation of more than 30 dB across the impedance passband. As a result, this antenna is an excellent candidate for miniaturized base station antenna applications. As wireless communication networks expand, base station antennas are critical components in these systems. However, they face challenges, such as large physical dimensions and limited bandwidth . Dual-po\u03bb0 [\u03bb0 [\u03bb0 represents the wavelength in free space at the center frequency). However, they can provide narrow \u221210-dB impedance bandwidths of only 15.6% [Dual-polarized planar dipole antennas have attracted considerable attention because of their wide bandwidth and pattern stability. Low-profile designs can be achieved using bowtie-shaped crossed-dipole antennas and Huygens dipole antennas, with profiles of 0.088\u03bb0 [\u03bb0 , respectly 15.6% . To enhaly 15.6% ,12. Theyly 15.6% ,12. As aly 15.6% ,14. GrooFrequency Selective Surfaces have recently obtained much attention due to their unique properties in favor of antenna performance. A frequency selective surface (FSS) is a periodic structure, typically a thin sheet or a grid, that has unique transmission and reflection properties for different electromagnetic frequencies. These surfaces are designed to either pass or block specific frequency ranges when subject to electromagnetic radiation. The FSS is useful in antenna design, such as reducing decoupling ,16 and i0 from the radiator. As a result, this characteristic enables them to reduce the antenna profile, leading to compact and low-profile antenna designs. In [\u03bb0. However, its \u221210-dB impedance bandwidth is only 15.6% (2.36\u20132.76 GHz). In [0.As a kind of FSS, the artificial magnetic conductor (AMC) is useful in addressing antenna size problems. It can replace a traditional metal conductor as a new reflector type for base station antennas. They exhibit properties of magnetic conductors with a zero-degree phase shift upon reflection. The in-phase reflection avoids the 180-degree phase change of the electromagnetic wave when it is reflected from the metal plate, thus, eliminating the need to set the reflector back at 1/4 \u03bbGHz). In , using m0 and 0.15\u03bb0. These antennas have a wide AMC bandwidth of more than 40%. However, both designs suffer from strong surface waves, leading to decreased antenna gain [Air gap technology has obtained much attention due to its ease of fabrication and high performance in antenna applications . Adding nna gain  or high nna gain . TherefoIn this paper, a low-profile broadband dual-polarized dipole antenna using a novel AMC reflector is investigated. Using the Brillouin dispersion diagram, the AMC is designed to suppress the surface-wave effect and decrease the antenna height. As a result, the proposed antenna has a high efficiency and low antenna profile. The fork-shaped lines feed the antenna without a direct connection, giving a broad impedance bandwidth. The parasitic strips reduce cross-polarization. The evolution of the proposed AMC and dipole antenna is analyzed using equivalent circuits and Smith charts. A prototype that operates in 2G/3G/LTE base station applications was designed and fabricated. The reflection coefficient, radiation pattern, antenna gain, and antenna efficiency are measured. Reasonable agreement between the measured and simulated results is obtained.\u03c6 = \u00b145\u00b0 and are represented as dipoles 1 and 2. w1 = 3.6 mm and four mirror-symmetrical etched slots. It should be mentioned that one of the dipole arms Is soldered directly to the feeding structures, while the other arm is fed via space coupling. This method is designed to obtain a wide \u221215-dB impedance matching bandwidth. The novel AMC consists of two metal layers, one substrate, and air layers. Periodic patches are its first metal layer printed on Layer 3 of Sub. 2, with the interval gap of g = 2 mm and patch width of w = 13 mm. The second metal layer is aluminum ground. Sub. 1 and Sub. 2 are FR4 substrates . Crossed dipoles are placed at a height of 5.5 mm from the AMC surface. Plastic pins are used to locate layers precisely. w = 13 mm, a substrate-layer height of dh = 1.2 mm (0.0088\u03bb0), and an air-layer height of ah = 12 mm (0.0880\u03bb). AMC1 and AMC2, which are conventional AMCs with the same patch size and gap width but different substrate-layer heights , were simulated for comparison. Generally, the in-phase reflection bandwidth is the frequency range in which the reflection phase is between \u2212\u03c0/2 and \u03c0/2. With reference to the figure, the in-phase reflection bandwidths are 9.8%, 39.4%, and 54.7% for AMC1 (4.57\u20135.04 GHz), AMC2 (1.67\u20132.49 GHz), and the proposed AMC (1.54\u20132.70 GHz), respectively. Compared with the proposed AMC, AMC1 lacks the air layer, giving a zero-phase reflection frequency of 4.82 GHz that is out of the operating bandwidth of 2G/3G/LTE. It is worth mentioning that AMC2 has almost the same zero-phase reflection frequency, however, it has a narrower in-phase bandwidth and a worse reflection coefficient than the proposed AMC. Therefore, our AMC is a good alternative to the metal ground due to its wideband. pL. Another inductance dL is created by the total substrate, including the air and the dielectric. Gaps between adjacent patches form a grid capacitance pC. As a result, the resonant frequency and bandwidth of the proposed AMC can be represented by Equations (1) and (2), which show the relationship between parameters on the resonant frequency and bandwidth coefficient.1 and AMC2, the proposed AMC has higher profiles and, thus, a larger dielectric inductance dL. Since the derivative of Equation (2) with respect to dL is positive, the bandwidth is positively related to the dielectric inductance dL. Therefore, AMC2 and the proposed AMC have a wider bandwidth. In addition, the dielectric substrate of AMC2 is thicker, which increases dielectric losses and manufacturing costs. The proposed AMC has the widest bandwidth. The surface impedance of AMC can be represented by: The proposed AMC unit can be equivalent to an LC parallel resonant circuit using the equivalent circuit analysis method (ECM) ,24, as is\u03b7 tends to infinity. The reflection coefficient of AMC can be calculated by At the parallel resonant frequency (using Equation (1)), the denominator of Equation (3) is equal to zero, and thus, the surface impedance 0 to 0.13\u03bb.Generally, a surface wave will be excited when electromagnetic waves reflect from the ground, deteriorating antenna performance. 21f in the lower-frequency band. Therefore, Dipole II has a wide \u221210-dB impedance bandwidth of 41.7% (1.67\u20132.55 GHz). This can be well-demonstrated by 11f and 23f is the same.Dipole III is obtained by adding rectangular slots on Dipole II. The introduced rectangular slots effectively make two different resonant modes close seen in c, resultLC resonator circuit (fL and fC) and a \u03c0-shaped network . Dipole III is obtained by cutting corners and opening rectangular slots in Dipole I. Dipole I can be expressed as a parallel RLC resonator circuit . The corners and rectangular slots can be expressed as a parallel RLC resonator circuit . When one loop dipole is excited, the other acts as a coupled loop resonator. Consequently, they are configured in parallel within the circuit. The adjacent gaps between two dipoles are modeled as a \u03c0-shaped network .The equivalent circuit model of Dipole III is shown in fL = 1.73 nH, fC = 0.10 pF, g1C = 3.48 pF, g11C = 0.43 pF, g12C = 4.17 pF, d1R = 99.9 \u03a9, d1L = 1.07 nH, d1C = 0.36 pF, s1R = 5.02 \u03a9, d1L = 1.07 nH, s1C = 2.23 pF, g2C = 2.45 pF, g21C = 0.43 pF, g22C = 4.17 pF, d2R = 5.24 \u03a9, d2L = 0.35 nH, d2C = 3.18 pF, s2R = 5.24 \u03a9, d2L = 0.35 nH, s2C = 2.93 pF. By utilizing the proposed equivalent circuit and circuit analysis software, we can expedite the design process of the proposed antenna, particularly when attempting to bring two resonant modes into proximity. The values of circuit parameters can be obtained by using a curve-fitting method. The extracted results are m \u00d7 m) of AMC units. With reference to AMC is employed to replace the traditional metal ground, thereby increasing the antenna gain and maintaining a low profile. Therefore, it becomes crucial to select an appropriate quantity of AMC units. This strategic selection aims to ensure that the antenna exhibits a broad, high-gain bandwidth, adequately covering the frequency ranges of 2G (1.71\u20131.92 GHz), 3G (1.88\u20132.17 GHz), and LTE (2.3\u20132.4 GHz and 2.5\u20132.69 GHz) networks. E- and H-plane radiation patterns can be obtained by the loading strips. It is worth mentioning that, using this method, the cross-polar fields in the two principal cutting planes decrease by more than 12 dB.To verify the idea, a prototype of the proposed antenna was fabricated, as shown in \u03b8 = 0\u00b0. With reference to the figure, reasonable agreement can be found between the simulated and measured results. The ripple in measurement is less than 1 dB caused by experimental imperfections. The measured gain varies between 8.3 and 10.8 dB over the frequency range (1.62\u20132.82 GHz) shown in \u03b8 < 60\u00b0) in the measurements. Results of Port 1 are only shown due to the geometric symmetry of our crossed-dipole antenna.0. In addition, four parasitic metal strips have been introduced to reduce the cross-polar field and, thus, increase the antenna gain in its high-frequency impedance passband. To verify the idea, a prototype has been simulated, fabricated, and measured. A measured overlapping bandwidth of 55.4% (1.58\u20132.79 GHz) has been obtained. Its maximum measured realized gain is 10.8 dB at 2.6 GHz. Additionally, a stable gain and radiation pattern have been observed. The prototype has a measured isolation of ~30 dB. It should be mentioned that its cross-polarization level is more than \u221210 dB over a wide range of angles (\u221260\u00b0 < \u03b8 < 60\u00b0). Finally, these advantages enable the proposed antenna to be potentially applied to the integrated design of 2G/3G/LTE base station antennas.A wideband low-profile crossed-dipole antenna with a novel AMC has been investigated. By introducing the AMC as antenna ground, the profile can be effectively decreased to 0.12\u03bb"}
{"text": "Multiple-input multiple-output (MIMO) technology has emerged as a highly promising solution for wireless communication, offering an opportunity to overcome the limitations of traffic capacity in high-speed broadband wireless network access. By utilizing multiple antennas at both the transmitting and receiving ends, the MIMO system enhances the efficiency and performance of wireless communication systems. This manuscript specifies a comprehensive review of MIMO antenna design approaches for fifth generation (5G) and beyond. With an introductory glimpse of cellular generation and the frequency spectrum for 5G, profound key enabling technologies for 5G mobile communication are presented. A detailed analysis of MIMO performance parameters in terms of envelope correlation coefficient (ECC), total active reflection coefficient (TARC), mean effective gain (MEG), and isolation is presented along with the advantages of MIMO technology over conventional SISO systems. MIMO is characterized and the performance is compared based on wideband/ultra-wideband, multiband/reconfigurable, circular polarized wideband/circular polarized ultra-wideband/circular polarized multiband, and reconfigurable categories. The design approaches of MIMO antennas for various 5G bands are discussed. It is subsequently enriched with the detailed studies of wideband (WB)/ultra-wideband (UWB), multiband, and circular polarized MIMO antennas with different design techniques. A good MIMO antenna system should be well decoupled among different ports to enhance its performance, and hence isolation among different ports is a crucial factor in designing high-performance MIMO antennas. A summary of design approaches with improved isolation is presented. The manuscript summarizes the various MIMO antenna design aspects for NR FR-1 (new radio frequency range) and NR FR-2, which will benefit researchers in the field of 5G and forthcoming cellular generations. Wireless and mobile applications have experienced significant growth, evolving from analog communication to digital communication. Modern antenna designs face challenges related to space constraints, interoperability, supporting multiple frequency bands, adhering to specific absorption rate (SAR) regulations, and accommodating hearing aid compatibility. Additionally, digital communication requires addressing issues such as variable data rates, high capacity, and scalable bandwidth at base stations and mobile devices. MIMO antenna behavior is characterized by several parameters. Far-field gain measures the intensity of radiation in the far-field region. Diversity gain quantifies the improvement in signal quality achieved through multiple antennas. The envelope correlation coefficient assesses the correlation between different antenna elements. The total active reflection coefficient measures reflections and losses in the antenna system. Mean effective gain evaluates the average gain in a particular direction. Next-generation mobile networks 5G, B5G) provide much faster connection and considerably higher data rates compared to fourth generation 4G) systems with better stability, higher channel capacity, more spectral efficiency, and lower energy consumption. International Telecommunication Union identifies new radio (NR) for International Mobile Telecommunication (IMT) NR FR-I (sub-6-GHz Band) with channels n78 (3.3\u20133.8 GHz), n-77 (3.3\u20133.8 GHz), n79 (4.4\u20135 GHz), FR-II (24.25 GHz to 52.6 GHz) with channels in FR-2 being n-258 (24.25\u201327.5 GHz), n-257 (26.5\u201329.5 GHz), n260 (37\u201340 GHz), and n261 (28.35 GHz) [G systemsG, B5G prThe massive volume of data traffic worldwide has increased manifold, so conventional antennas such as PIFA and monopoles cannot meet the demand. New multiple antenna technology with array and MIMO antenna is a promising technology to provide better channel capacity with additional bandwidth or transmission power. MIMO and m-MIMO are the next generation technology for mobile communication which groups multiple elements at the transmitter (Tx) and receiver (Rx) which provide better spectral efficiency, higher data rate, and channel capacity ,7. FigurEvolution of cellular technology 1G\u20135G:3GPP Release 15: This was the first release of the 5G standard, published in December 2017. It introduced the 5G New Radio (NR) technology and defined the initial specifications for 5G networks.3GPP Release 16: This is the second major release of the 5G standard, published in September 2020. It introduced enhancements, new features for 5G NR and the 5G core network, as well as specifications for new use cases and applications.3GPP Release 17: This is the next major release of the 5G standard, currently under development and expected to be published in 2022. It will continue to build on the capabilities and features introduced in previous releases, while also introducing new enhancements and use cases.3GPP Release 18: This is the next major release of the 5G standard, currently under development and expected to be published in 2023. It will further expand the capabilities and potential use cases for 5G technology, enabling new services and applications and enhancing the performance, security, and reliability of 5G networks. The cellular generation evolution along with the characteristics is summarized in First generation (1G) networks were analog and only supported voice calls. These networks were subject to interference and espionage because they employed frequency modulation (FM) to transmit signals. In 1979, Japan launched the first 1G network. Second generation (2G) networks were the first digital cellular networks that were developed in the early 1990s. To boost the capacity and quality of voice calling, these networks employed TDMA and CDMA technologies. Short messaging service (SMS) allows subscribers to send or receive text messages and was also deployed on 2G networks. Third generation (3G) networks were developed in the early 2000s and significantly improved network speed and data capacity. These networks enabled mobile internet access, video calling, and multimedia messaging by utilizing HSPA (High-Speed Packet Access) and WCDMA (Wideband Code-Division Multiple Access) technologies. Fourth generation (4G) networks, introduced in the late 2000s, provided faster network speeds and more data capacity than 3G networks. Long-term evolution (LTE) technology was utilized in these networks to enable faster download and upload rates, lower latency, and improved coverage. More sophisticated UE applications, such as online gaming, video streaming, and cloud computing, were also made possible by 4G networks. Fifth generation (5G) networks, which debuted in the 2010s, are the most recent iteration of cellular technology. The 5G networks employ modern radio technology including millimeter wave (mmWave) and massive MIMO to enable faster network speeds, reduced latency, and more data capacity than 4G networks. They also allow new applications such as virtual and augmented reality, smart cities, and self-driving cars. Major 3GPP (3rd generation partnership project) releases for the evolution of 5G from advanced LTE are given as follows :3GPP RelIn this survey, detailed analysis of the most widely used MIMO antenna configurations, wideband/ultrawideband MIMO antennas, multiband/reconfigurable MIMO antennas, and circularly polarized MIMO antennas is presented. A detailed comparison of the characteristics of MIMO antennas is also presented for various wideband, multiband, and circularly polarized MIMO antennas. The study highlights the different design approaches for efficient MIMO antennas for 5G systems. The compactness of handheld devices and the gadgets used in modern wireless communication pose significant challenges in terms of antenna size and mutual coupling reduction when placing multiple antennas in such scenarios. When multiple antennas are placed in close proximity, mutual coupling between them becomes a critical issue. The study highlights the different isolation or decoupling techniques used in the literature and their effectiveness in reducing mutual coupling among different ports in MIMO antennas with limitations and advantages. Firstly, the survey highlights the several techniques to design wideband/ultrawideband antennas and presents a comparative analysis based on their performance parameters such as gain efficiency, isolation, and diversity parameters of MIMO antennas. Secondly, multiband/reconfigurable antenna approaches are discussed where reconfigurability is achieved using switching action based on PIN diode and multiband using characteristic mode analysis, slots, defective ground structure, partial ground plane, or EBG (electronic bandgap structure) or other periodic structures such as FSS (frequency selective surfaces). Finally, the design approaches of the circular polarized MIMO antennas for LHCP/RHCP or bidirectional or with the polarization diversity are discussed in detail.The introduction part in In the context of 5G, the term \u201ckey enablers\u201d refers to the fundamental technologies or components that are essential for the successful establishment and functioning of 5G networks ,11,12. TMillimeter-wave (mmWave)  technoloAnother issue is that mmWave signals are more susceptible to interference from other wireless signals as well as meteorological conditions such as rain and fog. To mitigate these issues, 5G networks that use mmWave technology use advanced signal processing techniques and beamforming to focus the signals in specific directions, which improves the quality of the signal and reduces interference. Despite these challenges, mmWave technology offers significant benefits for 5G networks, including faster data transfer rates, lower latency, and increased capacity. These benefits are particularly important for applications that require high bandwidth, such as VR , AR , and HD video streaming.m-MIMO technologies are another key technology for 5G cellular communication. It makes use of multiple antennas for the transmission and reception of signals simultaneously, which increases the network\u2019s capacity and coverage. SISO, SIMO, or MISO has also been employed for the transmission and reception of signals in a traditional wireless communication system. However, with Massive MIMO technology, multiple antenna-elements are used on both sides of the transmitter and receiver system. The 16T \u00d7 16R MIMO antenna array is shown in Massive MIMO technology works by using complex signal processing algorithms to separate the different signals that are being transmitted and received by the multiple antennas. This allows telecommunication companies or regulatory bodies to efficiently use the existing spectrum and reduces interference between different signals. Massive MIMO technology not only boosts capacity and coverage but also enhances the quality of the wireless signal.With the advancement of networks and the growing need for data traffic, deploying small cells has emerged as a viable solution. These small, low-power wireless access points, operating within the licensed spectrum and managed by operators, offer improved cellular coverage and capacity. They are particularly beneficial in addressing coverage gaps, maintaining service quality, and efficiently utilizing spectrum resources. Small cells address this issue by providing additional coverage and capacity in areas where the large cell towers are not effective. Small cells can be of micro, macro, femto, or metro type. In urban areas, micro and metro type small cells offer coverage up to a few hundred meters. Pico cells provide coverage within a few tens of meters, both indoors and outdoors, primarily in public areas such as shopping malls, airports, and railway stations. Femtocells are mainly utilized in residential areas, covering a range of a few tens of meters.These small cells are installed on streetlights, utility poles, and other existing infrastructure in urban environments using a large number of access points (APs). By using small cells, 5G wireless networks can provide improved coverage and capacity in dense urban environments, which is essential for many applications such as smart cities, autonomous vehicles, and IoT devices. There are some challenges with femtocells and microcells such as management of the resources through scheduling at the edge of cell boundary, static and dynamic spectrum allocation, and frequent handover in some scenarios ,16.Network slicing is another feature of a 5G wireless network that allows many virtual networks to be formed within a single physical network, enabling telecom operators to deliver customized services to users as per the scenario shown in 5G and B5G make use of cloud computing, which has another advantage for wireless communication. It refers to delivering computing services over the cloud, including servers, storage, applications, and other resources, which can be accessed remotely by users and devices. In a 5G network, cloud computing provides numerous services and applications to users and devices, including edge computing, AI, and IoT applications. Cloud computing enables these services and applications to be delivered in a scalable, efficient, and cost-effective manner, which is essential for supporting the massive data volumes and high-performance requirements of 5G wireless networks. Cloud computing also enables AI and ML algorithms to be run on large datasets in a scalable and cost-effective manner. Machine learning provides numerous benefits, such as its capacity to analyze enormous datasets and detect patterns and trends ,20. ThisThis refers to the creation of virtual resources, such as servers, storage, and networks, that can be accessed and managed independently of the physical resources on which they are based. In a 5G network, virtualization is used to create virtualized network functions (VNFs) and virtualized network elements (VNEs), which enable operators to provide different types of services and applications in a scalable and flexible manner. Virtualization allows network functions to be run on standard hardware, rather than specialized hardware, which can reduce costs and improve scalability. Virtualization in a 5G network can support network slicing which is a key advantage. Network slicing involves creating multiple virtual networks within a single physical network, each with its own set of resources and characteristics, to support different types of services and applications. Operators can allocate resources to users on dynamic bases with a virtualization function for different services and applications in real-time, based on their changing requirements. This enables the network to be more efficient and responsive to changing traffic patterns, which can improve performance and reduce costs.Edge computing-oriented communications have emerged as promising technologies for enabling 5G/6G advancements. The rapid growth of smart devices and data traffic has driven operators to explore sustainable alternatives, such as cloud computing and virtualization, for deploying numerous base stations. Cloud-RAN (C-RAN) is an innovative RAN technology that leverages virtualization concepts, offering on-demand access to scalable computing resources from a shared pool ,20. It rCarrier aggregation involves the combination of multiple frequency bands to create a wider frequency band, which can provide higher data rates and better performance ,22. ThisThe MIMO diversity parameters, including the envelope correlation coefficient (ECC), total active reflection coefficient (TARC), channel capacity, mean effective gain (MEG), and spectral efficiency play crucial roles in the performance and effectiveness of MIMO antennas. These parameters collectively contribute to the performance, reliability, and efficiency of MIMO antennas. By optimizing these parameters, MIMO systems can achieve higher data rates, improved signal quality, enhanced system capacity, and better utilization of available wireless resources, ultimately enabling advanced wireless communication applications.In MIMO systems, evaluating the coupling between radiating elements is crucial, and ECC serves as a vital parameter for this purpose. Unlike isolation parameters, ECC considers return-loss of all ports and isolation among different ports to characterize complete antenna mutual coupling. The recommended value of ECC by the ITU should be less than or equal to 0.5 for mobile communication systems. Better performance in MIMO systems is indicated by a low ECC value, which signifies reduced coupling between radiating elements. Conversely, a higher ECC value can have an adverse effect. ECC for higher radiation efficiency greater than 90% can be obtained directly from the s-parameter and given as ,24:(1)|\u03c1To calculate ECC for an antenna with radiation efficiency below 90% involves the far-field parameters of the radiating antenna .(2)\u03c1ECCith port and ith port and TARC is a parameter of the MIMO antenna to validate the scattering parameters (s-parameters) for diversity performance. TARC employs both random signals and phase angles for diagonal and adjacent antenna ports to determine the behavior of s-parameters such as s11, s12, and s13 for particular phase combinations between the ports. TARC is calculated using the incident vector ai and reflected vector bi, which is independent and identically distributed Gaussian random variables. TARC can be calculated by ,24:(3)\u0393xgiven by :(4)[y1y2By solving the given scattering matrix for the scattering/reflected parameter, TARC can be obtained as :(5)\u0393xt=|x/Rx block diagram with MIMO channel is shown in Compared to SISO antenna systems, MIMO antennas exhibit higher channel capacity, which is a crucial performance parameter as given by ,26,27. TtB is the available total bandwidth and C is the Shannon channel capacity. The channel matrix \u201cH\u201d in the MIMO system is expressed based on the number of transmitter and receiver antennas, denoted as \u201ctm\u201d and \u201crm\u201d, respectively [As per Shannon capacity theorem, the capacity for the SISO system is given as :(6)C=Bt\u00a0ectively .(7)H=mty(t) is the received signal vector of s(t) is transmitter signal vector of n(t) spatial-temporal white noise with zero mean and variance s(k) is given as: Let given as :(8)y(t)=Case 1: Let the wireless channel be deterministic and known to the receiver, then the capacity of the MIMO system is given as :(9)C=B\u00a0lCase 2: when the transmitter does not know the channel, then the s vector may be chosen as ystem is :(10)C=B\u2211 HHH=HHH :(11)C=B\u00a0MEG refers to the combined gain of all the elements in the MIMO system, and it is typically expressed in decibels (dB). Mean effective gain is a measure of the effective gain of an antenna in a multiple-input multiple-output wireless communication network. MEG takes into account the antenna efficiency, the power patterns of the antennas, and the spatial correlation of multiple antennas used in the MIMO system .(12)MEGThe above equation requires a 3D radiation pattern of user equipment but the calculation of MEG using a 3D radiation pattern is tricky; therefore, using a 2D radiation pattern for the calculation of MEG is participable and is given in the following equation :(13)MEG=Other equations for MEG using the s-parameter can be ,29:(14)MIt is a measure of the amount of data that can be transmitted over a radio spectrum. It is generally expressed in bits per second per hertz (bps/Hz). Spectral efficiency (bits/s/Hz) is defined as han SISO .The growing range of mobile applications has led to a demand for Gigabit data rates to cater to users with different mobility levels, including both low and high-mobility scenarios. To address this requirement, traditional single antennas in mobile devices are being replaced with MIMO antennas. By implementing MIMO technology, mobile devices can deliver enhanced quality of service, offering uninterrupted signaling, high data rates, increased capacity, and improved spectral efficiency. Some of the advantages are listed below.MIMO technology allows for higher data rates compared to traditional single-input single-output systems, as multiple data streams can be transmitted simultaneously over the same frequency band. As the number of MIMO layers increases, the overall throughput of the system also increases.MIMO technology helps to improve signal quality by reducing the effects of fading, interference, and noise. As conventional SISO (single input single output), a single stream of data will be transmitted between transmitter and receiver which results in more interference and fading effects at the coverage boundary due to the large beamwidth of base station antennas shown in MIMO technology can extend the range and coverage of wireless networks by improving link quality and reducing the likelihood of signal dropouts. MIMO technology enables better spectral efficiency which allows more effective use of the available radio spectrum. This is achieved by transmitting or receiving multiple data streams simultaneously.MIMO technology is retrograde compatible with existing wireless standards, which means that it can be easily integrated into existing wireless networks without any major changes in the infrastructure.This section discusses various MIMO antenna designs such as wideband, multi-band, and circular polarized antenna configurations for FR-1 and FR-2 bands. These designs aim to achieve wide frequency coverage, support multiple frequency bands, and enable efficient circular polarization to meet the diverse requirements of wireless communication systems in these frequency ranges as shown in Wideband MIMO antennas are designed to operate across a broad frequency range, typically spanning multiple frequency bands within FR-1 and FR-2. These antennas employ various techniques to achieve wide frequency coverage, such as broadband feeding networks and radiating elements. Wideband MIMO antennas are capable of supporting multiple frequency bands simultaneously, providing enhanced spectral efficiency and compatibility with different wireless communication standards. The categorization of wideband MIMO antenna for sub-6GHz band and mmWave are shown in \u22126), diversity gain of 10 dB, and CCL of 0.005 bps/Hz were obtained. This study [In article , MIMO anis study  describeis study  has effiis study , while tis study  with twois study  for mmWais study ,36. Annuis study  4-port Mis study  was presis study  presenteis study  introducis study  consistsIn this study , the autThe study  introducReconfigurable/Multiband MIMO antennas are designed to support specific frequency bands. These antennas incorporate radiating elements or structures optimized for each desired frequency band. By utilizing frequency-selective elements, such as bandpass filters or resonant structures, multiband MIMO antennas can efficiently transmit and receive signals in each specific band. This design approach offers flexibility and compatibility with various network deployments and user equipment that may operate in different frequency bands as shown in The study  presenteThe study  describeComplimentary split ring resonator (CSRR)-based compact four port MIMO MSA in  for wireThe study  presenteIn this study , a quadbLinearly polarized antennas used in line-of-sight communication can receive signals with varying power levels. The antenna that receives the weakest signal sets the upper limit for diversity gain and subsequently affects the signal-to-noise ratio (SNR). Additionally, polarization mismatch can lead to insufficient signal gains for highly isolated antennas in both indoor and outdoor environments. However, in recent years, there has been significant research and industrial progress highlighting the importance of circularly polarized (CP) antennas in wireless applications. CP antennas can evenly distribute signal powers among receiving antennas, effectively addressing the issue of polarization mismatch. CP-MIMO (multiple-input multiple-output) antennas improve data rates, capacity, and diversity gain. Some of the circular polarization MIMO antennae with different techniques are listed below in The study in  presenteIn this section, some of the major issues and techniques of designing MIMO WB/UWB, multiband, and CP antennas are considered and compared according to their performance. This comparison provides a summary of In MIMO antennas, there are several challenges to design and integrate in the real environment. The major challenge in MIMO is mutual coupling which reduces the performance of the antenna. Closely spaced antennas give rise to electromagnetic coupling among different antenna ports, thus resulting in degraded performance. Apart from the mutual coupling, the size of the MIMO antenna in the perspective of the portable devices is also a concern to take care of carefully. Multiple antennas require more RF chains along with each antenna element, so the size and cost of the antenna are increased. Thus, techniques such as polarization diversity can be effective in such situations which can reduce the size and cost of the system to some extent. Thus, the researcher has to address different diversity in a single MIMO system carefully to achieve optimal performance. Some of the design challenges are discussed below.In MIMO antennas, multiple antennas at the transmitter and receiver sides are closely packed so resulting in mutual couplings among antenna elements. When multiple antennas are placed in close proximity, they tend to couple electromagnetic energy with each other, which can affect the performance of the MIMO antenna. Coupling can affect radiation patterns and degrade the isolation between antenna elements. There are various methods suggested in the literature to reduce mutual coupling and enhance the isolation among different ports. Parasitic elements, neutralization lines, slots/stubs, decoupling structures, defective ground structures, slot etching, metamaterials, unit cells, etc. are the most widely used isolation techniques ,88,89,90Meeting the growing need for increased mobile data volume necessitates enhanced capacities in radio mobile networks. While network densification and the integration of new frequencies are potential solutions, incorporating higher-order MIMO capabilities into existing radio networks presents an opportunity to significantly enhance peak data rates and augment overall network capacity. In conventional 2 \u00d7 2 MIMO networks, cross-polarized antennas are commonly utilized. To introduce additional, independent antennas into the system , a second cross-polar antenna can be employed . To ensuIn practice, large antenna spacings are often required to achieve significant multiplexing or diversity gain. The use of dual-polarized antennas (polarization diversity) is a promising cost- and space-effective alternative, where two spatially separated uni-polarized antennas are replaced by a single antenna structure employing orthogonal polarizations . This ca5G wireless network operates on the frequency bands sub 6 GHz and mmWave for 5G communication. Both Sub 6 and mmWave band have their pros and cons. The mmWave technology provides a higher data rate due to the large bandwidth availability but low coverage area because of more attenuation at high frequencies. The sub-6 GHz band has low attenuation loss with greater coverage area and lower data rate due to the limited bandwidth availability . Thus, iA comprehensive review of MIMO antenna design approaches has been discussed in this paper. WB/UWB characteristics were achieved through different modifications of radiating patch, ground plane and feeding network. H-P shaped, E-L shaped, annular ring, DGS, partial ground plane, and metamaterial structure were employed to achieve wideband or ultra-wideband properties. Multiband MIMO antennas can be achieved through different aspects such as characteristic mode theory, stubs and slots on radiating patch, EBG structure, SRR or CSRR, and reconfigurable patch antenna. Moreover, the CP-MIMO antenna can be designed by optimizing the radiating patch, ground plane, and feed network through different techniques. It was observed that using the spiral slot on radiating patches, circular patches, tapered edges of patches, or diagonal slots on patches leads to circular polarization. Quarter phase delay lines, plasma boxes, circular rings or defects in the ground plane, split ring resonator, or complementary split ring resonator are other promising design techniques to obtain a circularly polarized antenna. Apart from MIMO antenna design techniques for WB/UWB, multiband and CP-MIMO isolation among different ports have been the utmost priority. In this study, different MIMO configurations with decoupling structures were also presented. Some of the decoupling networks or structures are neutralization line, meander line, isolation improvement based on SRR or CSRR structures, shorting pin, parasitic elements, slots with DGS, and feeding network, which are promising techniques to reduce the isolation among the ports, leading to the design of high-performance MIMO antennas. Thus, in this review paper, different design aspects of MIMO antenna for NR FR-1 and FR-2 were studied, which will be helpful for researchers to further fulfil the demand for high data rate in 5G and B5G cellular generation."}
{"text": "In this paper, an absorbing material on a button antenna is proposed for pedestrian-to-vehicle (P2V) communication, which provides safety service to road workers on the highway or in a road environment. The button antenna is small in size and is easy to carry for carriers. This antenna is fabricated and tested in an anechoic chamber; it can achieve a maximum gain of 5.5 dBi and an absorption of 92% at 7.6 GHz. The maximum distance of measurement between the absorbing material of the button antenna and the test antenna is less than 150 m. The advantage of the button antenna is that the absorption surface is used in the radiation layer of the antenna so that the antenna can improve the radiation direction and gain. The absorption unit size is 15 \u00d7 15 \u00d7 5 mm The cooperative intelligent transport systems (C-ITS) pilot deployment project, which has the objective of developing and experimenting with innovative road CITS solutions, offers pedestrian-to-vehicle P2V) communication systems for vulnerable road user (VRU) protection V communi,5,6,7,8.3 and a measured gain of 5.5 dBi. This absorbing button antenna is suitable for short-distance communication. The structure of this paper is as follows. In the next section, the overall structure of the button antenna and its material composition are introduced. In In this paper, an absorbing material for a button antenna is proposed. It mainly solves two problems of an antenna: antenna miniaturization and high gain directional radiation. The absorption rate of the button antenna can reach 92% at 7.6 GHz. It has an overall size of 15 \u00d7 15 \u00d7 5 mm3, where the grounding and feed isolation aperture is 2 mm and the coaxial feed diameter of the antenna is 1 mm. The antenna is composed of two substrates of glass fiber epoxy (FR-4) material. The FR-4 material has the advantages of a simple structure, easy fabrication, and good physical characteristics, meaning that the antenna radiation is not constrained by its own shape, allowing it to realize a stability of radiation. The permittivity of these substrates is 4.4, with a tangential loss of 0.027 and a thickness of 1.5 mm. A coaxial feed link is used to connect the parasitic patch and radiation patch to reduce coupling and impedance matching. The parasitic patch makes the antenna reach its maximum gain with a size of 13 \u00d7 13 mm2.As shown in This section mainly designs and analyzes the absorption material properties of the button antenna. Its main innovation comes from ,31. Firsn), which are approximately equal to zero by periodic electrical boundary (PEC) and periodic magnetic boundary (PMC) simulation results, which is obtained using Equations ..\u03b5), magn \u03bc = n\u00d7z .A,,5), bothEquation . The resa height .(6)Q\u221dDThe change in the Q value can affect the gain of the whole antenna. Therefore, to improve the gain of the CRO antenna, we should first analyze the factors in the CRO structure that can affect the Q value, determine which factors have the greatest influence on Q value, and finally adopt the methods that further improve the Q value to increase the antenna gain. As shown in Equation  is estabEquation  is estabEquation  is substEquation  to obtaiEquation ; in thisThe mpedance .(8)Zri\u2223h is the height of the coil; we are assuming that it is a constant. i = 1, 2, 3) is the width of coil [i = 1, 2, 3) is the coupling distance parameter of the coil, whose corresponding reactance is i = 1, 2, 3). The effect of the coil area on the capacitance is ignored [The  of coil .(9)Zrea ignored .(12)ZimQ is the quality factor and The main contents of this section are as follows: First, we analyze the improvement of the gain of the button antenna by quality factor Q. Second, the equivalent circuit method is used to analyze the embedded microstrip lines. Finally, the effect of its quality factor and CRW structure on the gain of the button antenna is analyzed. As seen in the previous section, the largest change in the CRO structure is the quality factor Q, as shown in Equation . In thisEquation , Q is ren 0.35\u03bb0 . Q is th(1)The relationship between quations \u201317);;T1 and t(2)The impedance Equation  of the r(3)Taking the derivative of Equation , EquatioAs shown in After calculation, the following conclusion can be drawn: quations \u201323) and andT1 ise length ,41.(16)The constant ,43.(17)mpedance ,45.(22)To further improve the antenna gain, microstrip lines are continuously embedded. As shown in 2. All of the material parameters of the tissue were obtained from the values available in the CST Studio human tissues library. A 5 mm air gap was set between the antenna and the surface of the skin to mimic any worn clothes. An R&S microwave signal generator was used to test the In this section, the performance of the button antenna is evaluated on the human body. The absorptivity, S-parameters, efficiency, and radiation pattern are analyzed together with the SAR values. The scenario of the numerical model is shown in For wearable applications, the SAR value is a critical parameter. The numerical SAR distributions of the proposed antennas are shown in As shown in An absorbing material on a button antenna for P2V communication was proposed, fabricated, and measured, which provides safety service to road workers on highways or in a road environment. The maximum distance of measurement between the absorbing material of the button antenna and the test antenna is less than 150 m, which is a safe distance for traffic. This antenna can achieve a maximum gain of 5.5 dBi and absorption of 92% at 7.6 GHz. Compared with other similar antennas in"}
{"text": "In this paper, a low-cost resin-coated commercial-photo-paper substrate is used to design a printed reconfigurable multiband antenna. The two PIN diodes are used mainly to redistribute the surface current that provides reconfigurable properties to the proposed antenna. The antenna size of 40 mm \u00d7 40 mm \u00d7 0.44 mm with a partial ground, covers wireless and mobile bands ranging from 1.91 GHz to 6.75 GHz. The parametric analysis is performed to achieve optimized design parameters of the antenna. The U-shaped and C-shaped emitters are meant to function at 2.4 GHz and 5.9 GHz, respectively, while the primary emitter is designed to operate at 3.5 GHz. The proposed antenna achieved peak gain and radiation efficiency of 3.4 dBi and 90%, respectively. Simulated and measured results of the reflection coefficient, radiation pattern, gain, and efficiency show that the antenna design is in favorable agreement. Since the proposed antenna achieved wideband (1.91\u20136.75 GHz) using PIN diode configuration, using this technique the need for numerous electronic components to provide multiband frequency is avoided. The rapid growth of technology requires significant innovations to upgrade the present devices to meet the demands of present and new wireless communications and Internet of Things (IoT) applications. An antenna plays a vital role in wireless communication, so with advancement in technology the antenna needs to be modified. Antenna designs with fixed characteristics can be replaced by evolvable antennas that provide multi-band and reconfigurable characteristics that can be used for many applications . Small aIf the above mentioned substrates are replaced with a paper substrate, then the cost is reduced by a factor of ten . BesidesIn the present study, a low-cost adhesive copper-on-paper substrate is constructed as a reconfigurable antenna that can be used for IoT applications, wireless communication, and mobile bands. The antenna\u2019s main radiator is made up of a variety of smaller radiators that each support a distinct frequency band. These shapes are designed to minimize the overall size of the antenna and to have a multiple-band response. The copper material as the radiating element and the PIN diode as the switching circuits are printed on the paper substrate, which makes it convenient and smooth for the integration of antenna into the IoT device. The antenna is designed on a paper substrate with a thickness of 0.44 mm, a dielectric constant of 3.2, and a loss tangent of 0.05 for multiple applications, and providing triple-band frequency ranges 1.91\u20132.68 GHz, 3.33\u20133.75 GHz, and 5.55\u20136.75 GHz. The frequency band changes with the change in switching state of the PIN diodes. By altering their switching conditions, the PIN diodes found in the antenna construction contribute significantly to the achievement of various frequency bands. The advantage of the proposed design is using photo paper as a substrate. The realization of the multi-band antenna on a low-cost paper substrate using adhesive copper has the advantages of a small size, low profile, and simple configuration. The low profile of the antenna makes it a promising candidate for future compact and slim wireless devices.The suggested microstrip antenna is depicted in The proposed antenna, which lacks a ground plane directly beneath the substrate, presents different design considerations compared to, for instance, a patch antenna with a ground plane directly beneath it. In this context, the chosen antenna design is significantly influenced by the choice of substrate. Altering the substrate material would have a substantial impact on the antenna\u2019s performance.Changing the substrate can affect the antenna in several ways, including the following: Size and Dimensions: The physical dimensions of the antenna, including the size and shape of the radiating element, are influenced by the substrate. Changing the substrate might require adjustments to the antenna\u2019s physical design.Resonant frequency: The substrate material affects the antenna\u2019s resonant frequency. A change in the substrate can shift the operating frequency of the antenna, which may or may not align with the intended frequency band.Operating bandwidth: The choice of substrate can affect the antenna\u2019s bandwidth. A new substrate may widen or narrow the antenna\u2019s operational bandwidth.Radiation pattern: The substrate influences the radiation pattern of the antenna. Different substrates can lead to variations in the antenna\u2019s radiation characteristics, such as beamwidth and directivity.Efficiency: The substrate\u2019s dielectric properties impact the antenna\u2019s efficiency. A different substrate can lead to changes in radiation efficiency, which could be detrimental or beneficial depending on the application.So, the choice of substrate plays a crucial role in determining the antenna\u2019s electrical and mechanical characteristics. When altering the substrate, careful consideration and possible redesign are necessary to maintain or improve the antenna\u2019s performance in the desired application.S\u2019) and a low value inductor (\u2018L\u2019), form a simple RL series circuit for the ON state. It is equivalent to an RLC circuit in the OFF state because an inductor (L) is connected in parallel with a high-value resistor (RS) and a capacitor (CR). A DC bias voltage of +3 V and 0 V, respectively, can be used to turn \u201cON\u201d and \u201cOFF\u201d the PIN diodes. The diodes utilized are SMP1345-040LF diodes from Skyworks Solutions Inc., which are practical and affordable. The diode has a resistance, inductance, and capacitance of 1 \u2126, 045 nH, and 0.2 pF, respectively, in the ON state, and 3.3 k\u2126 and 0.2 pF, respectively, in the OFF state, according to the data sheet. The parametric study is then performed to optimize the design parameters of the proposed antenna and a simulation is performed using HFSS.In the parts that follow, copper foil has been utilized as a conductive medium for both simulation and fabrication. The optimized dimensions of the antenna are listed in Fabricating an antenna using two sheets of photo paper, each with a thickness of 0.22 mm, involves several steps. Below is the fabrication process:Step-1 The optimized antenna dimensions as mentioned in Step-2 The copper is subjected to wet etching. This process reveals the adhesive layer where the copper has been removed, while the opposite side remains protected by the original adhesive copper tape. In essence, the first two steps closely resemble standard photolithographic techniques. Then, the adhesive-backed copper foil is placed on a clean, flat surface with the adhesive side facing up. Carefully, the backing is peeled off the copper foil to expose the adhesive side.Step-3 A sacrificial layer is affixed to the copper side, after which the protective layer is removed. The sacrificial layer serves a crucial role in maintaining the relative distances among layout features, especially when they are not physically connected. This layer can be as simple as a sheet of paper or a plastic adhesive tape. In the former case, the exposed adhesive (where the copper has been removed) provides sufficient adhesion for attaching the sacrificial paper sheet. In the latter case, the adhesion of the sacrificial layer is deliberately chosen to be lower than that of the copper tape itself. The antenna and the ground plane of the antenna are printed on two sheets of photo papers, each with a thickness of 0.22 mm. Two sheets are used to help to reach a reasonable thickness (0.44 mm). Alignment marks have been implemented on the photo papers so that the two photo papers can be glued together with correct alignment to form a single antenna substrate.Step-4 The etched metal is transferred onto the hosting paper substrate, and ultimately, the sacrificial layer is detached. This final step also eliminates most of the exposed adhesive material, with the effect being more pronounced when a plastic adhesive tape is employed as the sacrificial layer. The SMA, PIN diodes, resistors, and capacitance are then mounted on the antenna using low-temperature solder pastes and epoxies.Step-5 The antenna\u2019s performance is tested using the appropriate testing equipment.A parametric study of an antenna can be highly sensitive to physical layout variations due to the intricate relationship between the antenna\u2019s design parameters and its performance characteristics. Here is how this sensitivity arises:Electromagnetic interactions: Antenna design parameters, such as the length, width, and spacing of elements, influence how electromagnetic waves interact with the antenna. Small changes in these dimensions can lead to significant variations in the antenna\u2019s impedance, resonance frequency, and radiation pattern.Resonance effects: Antennas are typically designed to resonate at specific frequencies. Variations in physical dimensions can result in shifts in the resonant frequency, potentially causing the antenna to operate outside of the desired frequency band.Radiation pattern: The physical layout affects the radiation pattern of the antenna. Alterations in element size and spacing can lead to changes in the directionality, gain, and beamwidth of the antenna\u2019s radiation pattern.Impedance matching: Antennas need to be impedance matched to the transmission line or circuit to ensure efficient power transfer. Physical-layout changes can impact the impedance, leading to mismatches and reduced performance.Material properties: The choice of substrate and materials also plays a role in antenna performance. Variations in substrate properties can affect the antenna\u2019s efficiency, bandwidth, and radiation characteristics.Manufacturing tolerances: Real-world fabrication processes have tolerances and variations. Small discrepancies in the manufacturing of antenna elements can accumulate and lead to sensitivity to physical layout changes.g) and feed width (Wf).The parametric investigation of S11 has been carried out by altering the ground length  by alternating between the primary radiator and the C- and U-shaped radiators using two PIN diodes. The analysis of antenna bending was conducted due to the flexible substrate used in the proposed design. The antenna under consideration demonstrated a peak gain of 3.42 dBi and an efficiency exceeding 60%. As a result, this paper\u2019s substrate antenna is well-suited for effective utilization in mobile bands and multiple wireless applications."}
{"text": "The ground plane and radiator of this antenna are adjusted in several ways to bring it within its operating constraints between the frequencies of 3.1 GHz and 10.6 GHz. This technique makes the antenna small and covers the entire ultra-wideband (UWB) frequency range. The NI USRP was used to test the proposed MIMO antenna to determine its real-time performance. Based on the computed results, we conclude that this proposed antenna has outstanding characteristics in terms of performance and is suitable for wireless ultra-wideband indoor communication and diversity utilization with a small size.A compact, four-element planar MIMO  antenna that operates in an ultra-wideband is presented for diversity application. The orthogonal position of the unit cells replicates the single antenna thrice, thereby decreasing mutual coupling. A UWB MIMO antenna measuring 35 \u00d7 35 \u00d7 1.6 mm UWB refers to an ultra-wideband with a frequency ranging from 3.1 to 10.6 GHz. The bandwidth of 7.5 GHz for UWB communications was authorized by the Federal Communications Commission (FCC) in 2002 for use in a variety of commercial applications . The antThe main and primary contribution of this paper is the thorough magnified presentation of four compact ultra-wide-bandwidth MIMO antennas with isolation between ports having more than 35 dB that satisfy the criteria and operates well between 3.1 and 10.6 GHZ. The rest of this work is structured as follows. The design process for a single antenna and four-element MIMO antennas are thoroughly described in The proposed unit-cell antenna, based on an FR4 substrate, has a microstrip feed. The FR4 substrate has a 4.3 relative permittivity  plane is constructed with a rectangle-shaped slot that is 7 \u00d7 16 The scattering characteristics (S11) of the antenna are shown in To create a multi-port antenna with good isolation, the single-cell antenna is to be duplicated and arranged such that it forms an orthogonal pattern. On a single plane, all radiating components are organized. The four-port antenna\u2019s overall dimensions are 35 \u00d7 35 \u00d7 1.6 By performing parametric analysis and optimization, the proposed antenna is structured and developed using CST Microwave Studio Software. The proposed MIMO/Diversity antenna is measured using an Anritsu MS2703 Vector Network Analyzer.Four antennas that appear to be quite close to one another are included in the monopole ultra-wideband Multiple-In Multiple-Out antenna. As a result, interference from one antenna\u2019s radiation with the others would occur.By building the redesigned ground structures, the mutual coupling is decreased, and identical antennas are positioned orthogonally. For the full bandwidth range, this antenna is designed such that it decreases mutual coupling to lower than \u221235 dB. The results of the S-Parameter simulation and measurement for the monopole ultra-wideband MIMO antenna are shown in Four antennas that appear to be quite close to one another are included in the correlation that exists between the radiating objects. This correlation is the most significant diversity characteristic of the Multiple-In Multiple-Out antenna. The degree of independence relating to the radiation patterns of two antennas is described with the help of ECC. Usually, the radiation patterns of the two antennas are completely not dependent on each other. The value of ECC must be 0; however, its real value must not be more than 0.5. The calculation of the envelope correlation coefficient is carried out by substituting the S-Parameter in Equation (2) ,20. ThroIn order to retain the dependency of the wireless communication system along with high-quality output, it is necessary to maintain the diversity gain of the monopole ultra-wideband Multiple-In Multiple-Out antenna at its maximum. Ideally, 10 dB is the best value. The diversity gain value for the suggested antenna can be derived using the formula in Equation (3) . We can ix denotes incident signals; iy denotes reflected signals. TARC represents the ratio of the incident power to the squared value of the reflected power. Equation (4) represents the TRAC ratio of the N port antenna.\u00d7 2 arrangement of the antenna is shown in Equation (5).The scattering matrix pattern of a 2 Every excitation signal\u2019s phase in the Multiple-In Multiple-Out antenna is arbitrary. Before a signal reaches a receiver, the propagation environment helps to randomize the signal phases further. As a result, the MIMO channel signal is regarded as having an independent, identical distribution with a random phase. Equations (6) and (7) can be used to express reflected signals. The sum or difference of the Gaussian random variables produces the Gaussian values .(6)y1=SThus, TARC is explained in the following Equation (9).The return loss of the entire proposed MIMO antenna is known as TARC. TARC was first proposed to assess a multiport radiator\u2019s performance. Because it takes into account mutual coupling, port matching, and the impact of the random phases of incoming signals into each antenna element, TARC has recently been found to be useful as a MIMO metric for antenna systems. This is because it describes the performance in a more realistic situation of a communications channel. TARC is the sole MIMO parameter that takes into account the unpredictable phases of incoming signals, which can have a significant impact on MIMO array behavior in certain circumstances. Over the whole working frequency band, TARC is less than \u221210 dB. The obtained TARC is shown in MEG1 and MEG2.The definition of MEG is the segregation of power received by an isotropic antenna with power obtained from a diversity antenna ,23. The MEG-1 and MEG-2 are identical due to the enhanced total performing capacity of the proposed radiator.The highest message rate at which a message may be sent across a communication channel without experiencing any losses is referred to as channel capacity loss. Equation (11)  can be uThe value of CCL value must be less than 0.4 bits/S/Hz in general. The proposed antenna\u2019s simulated and measured E-plane and H-plane radiation patterns at 3.8 GHz frequency are illustrated in With the help of this pattern, it is possible to demonstrate how the designed MIMO antenna exemplifies pattern variety in the 3.8 GHz frequency range. The Port 1 and Port 3 patterns are moved 180 degrees in relation to one another, and Ports 2 and 4 are turned 180 degrees in relation to one another. The proposed antenna\u2019s E-plane radiation pattern is shaped like a dumbbell, while the H-plane radiation pattern is omnidirectional ,26. A stThe investigation of the designed ultra-wideband MIMO compact antenna utilized the NI 2943R (USRP) and NI 802.11 framework in an indoor setting to confirm the proposed MIMO antenna\u2019s real-time transmitting and receiving capabilities. The National Instruments (NI) Universal Software Radio Peripheral (USRP) is a technology-driven RF transceiver operated for software-defined radio R&D (SDR). For communications purposes, USRP NI transceivers are capable of transmitting and receiving radio frequency signals in a number of bands. The indoor setting is composed of an antenna feed system, two NI USRPs, and a received power monitor. For verification of real-time measurements, consideration should be given to signal reception power (RSRP) parameters ,32. The To test the MIMO antenna\u2019s real-time performance, three alternative states are used.State 1: Radiators W, X, Y, and Z are considered to be the receivers, whereas radiators P, Q, R, and S are considered to be the transmitters. State 2: Antenna radiators P, Q, W, and X are considered transmitters, whereas radiators R, S, Y, and Z are considered receivers.State 3: The antenna radiators W, X, Y, and Z are considered to be transmitters, whereas P, Q, R, and S are considered to be receivers. Using the USRP 2943R, 2. The proposed MIMO antenna\u2019s real-time short-range transmission and reception were tested in an indoor setting utilizing the NI 802.11 framework. With NI USRP, the proposed compact UWB MIMO antenna\u2019s real-time performance was experimentally tested in a closed environment.The orthogonal array of the antenna elements seems to be the most practical way to reduce mutual interaction between ultra-wideband MIMO antennas, thus achieving compact dimensions. Successfully achieved mutual coupling of the suggested antenna has been below \u221235 dB. The 1.6 mm thick substrate was utilized to create a radiating antenna with a small footprint that is suited for diversity applications. The antenna\u2019s dimensions are 35 \u00d7 35 mm"}
{"text": "A low-profile, wideband, and high-gain antenna array, based on a novel double-H-shaped slot microstrip patch radiating element and robust against high temperature variations, is proposed in this work. The antenna element was designed to operate in the frequency range between 12 GHz and 18.25 GHz, with a 41.3% fractional bandwidth (FBW) and an obtained peak gain equal to 10.2 dBi. The planar array, characterized by a feed network with a flexible 1 to 16 power divider, comprised 4 \u00d7 4 antenna elements and generated a pattern with a peak gain of 19.1 dBi at 15.5 GHz. An antenna array prototype was fabricated, and the measurements showed good agreement with the numerical simulations as the manufactured antenna operated in the range of 11.4\u201317 GHz, with a 39.4% FBW, and the peak gain at 15.5 GHz was 18.7 dBi. The high-temperature simulated and experimental results, performed in a temperature chamber, demonstrated that the array performance was stable in a wide temperature range, from \u221250 \u00b0C to 150 \u00b0C. An antenna is, by definition, a sensor of EM (electromagnetic) waves; it plays an extremely important role in radar sensor , biomediMany effective methods have been proposed in the literature to increase the operation bandwidth of microstrip patch antennas. Among them, the use of parasitic patches has been considered as well as optimization of the antenna shape. More specifically, a patch antenna adopting a U-shaped slot-fed and stacked structure was proposed in , reachinOther methods have been investigated to improve the gain of the antenna element. In ,22,23, tThis study proposes a novel double-H-shaped slot microstrip patch antenna, robust against high temperature variations, as a radiating element of a low-profile, wideband, and high-gain patch antenna array. In order to test the effectiveness of the proposed design, the antenna was fabricated and the prototype measured for comparison with the numerical results. The analysis of the temperature resistance was performed in a temperature chamber between \u221250 \u00b0C and 150 \u00b0C.Accordingly, the remainder of this article is as follows. The elements of the antenna and antenna array designs are presented in r\u03b5 = 3.66, tan \u03b4 = 0.004), and a ground plane  with a double-H slot fed through a microstrip line. The second part is a coplanar radiator, which includes four parasitic patches, a ground plane  connected with the ground plane of the first part by means of metallic pin columns, and a dielectric substrate . The third part, filling the space between the two radiators, consists of air (or foam).The proposed antenna element is shown in The antenna element proposed in this paper uses a novel double-H-shaped fed slot, which allows for the generation of multiple resonant modes thanks to the adopted double patch structure. More specifically, the coplanar parasitic radiator and the patch radiation structure form a resonant cavity, which reduces the Q-factor and increases the antenna\u2019s bandwidth. As shown in In the first stage (Stage I), a patch antenna with a single H-shaped slot was considered. The resonant frequency of the microstrip patch working in the In the second stage (Stage II), two H-shaped feeding slots were considered in the ground plane. The geometrical parameters of the slot  satisfie17.7 GHz a, with 717.7 GHz b.The third stage (Stage III) showed that the antenna\u2019s bandwidth was greatly improved by adopting a stacked structure. Moreover, the peak gain increased to 8.8 dBi. The distance The last stage (Stage IV) consisted of the final design, with a bandwidth of 12 GHz to 18.25 GHz (41.3% FBW) and a peak gain of 10.2 dBi. x-axis and worked at different frequency bands. For Mode 1, the bandwidth of |MS| > 0.707 was between 12 GHz to 14.7 GHz, which can be considered as the lowest frequency part of the bandwidth in combination with the operating frequency band of the previous feed antenna. For Mode 2, the bandwidth of |MS| > 0.707 was 14.7 GHz to 20 GHz. By stimulating these two modes, the antenna can achieve a high gain in a wide band. In mode 3, the bandwidth of |MS| > 0.707 was between 14.5\u201320 GHz. The current of the parasitic patches and ground 2 was in the opposite direction along the x-axis and in the offset state. When using this mode, one needs to enhance or weaken a certain mode according to the mode of the patch radiator. The current components of the parasitic patch in mode 4 along the x and y axes were in the offset state, and it could not be used as the main radiation mode. Modes 5, 6, and 7 were unsuitable for linear polarization and high gain. The combination of modes 1, 2, and 3 of the coplanar radiator and the patch radiator enabled the overall structure to obtain a high gain and a high bandwidth.To maintain high gain over a wide bandwidth, the characteristic mode of the coplanar radiator was analyzed using HFSS to exploit the mode in order to generate a pattern with high gain. Lp  was properly tuned. As is evident from Lp = 12.5 mm.Indeed, the antenna resonated in the frequency range between 12 GHz and 18.25 GHz, with a 41.3% FBW, and the peak gain was equal to 10.2 dBi at 15.5 GHz. In order to achieve such a performance, the value of the parameter The working principle of the proposed antenna element can be described as follows. At the frequency f = 13 GHz, the radiation patch worked as shown in For the sake of comparison, In addition to the antenna element, the design of a 4 \u00d7 4 antenna array, shown in S11| values below \u221215 dB from 9 to 20 GHz. As for the array, the values of the simulated reflection coefficient and of the peak gain given in S11| < \u221210 dB) from 11.4 GHz to 17 GHz, and the maximum gain was 19.1 dBi.The simulated reflection and transmission coefficients at positions 1, 2, and 3 of The prototype of the proposed 4 In order to verify the performance of the proposed antenna in high-temperature environments, the measurement of the reflection coefficient was carried out in a high\u2013low temperature chamber, as shown in More specifically, an ESPEC (SH-642) high\u2013low temperature chamber and a vector network analyzer were used. The measurement considered nine different temperatures, namely, 20 \u00b0C, \u221220 \u00b0C, 0 \u00b0C, 40 \u00b0C, 60 \u00b0C, 80 \u00b0C, 100 \u00b0C, 130 \u00b0C, and 150 \u00b0C. The behavior of the magnitude of the reflection coefficient versus the frequency is shown in The values of the minimum frequency (M1), the maximum frequency (M2), and the bandwidth of the curves shown in According to the datasheet on the substrate material, the expected variation of the permittivity in the temperature range between \u221250 \u00b0C and 150 \u00b0C was about 3.66 \u00b1 0.05. Therefore, the impact on the magnitude of the reflection coefficients was also simulated . Like inMoreover, although the power pattern could not be measured in the high\u2013low temperature chamber, it has been simulated when changing the material property, and the results in The design of a low-profile, wide-band, and high-gain 4 \u00d7 4 antenna array based on a novel double-H-shaped slot microstrip patch radiating element, robust against high temperature variations, was presented. The corresponding prototype was fabricated, and the measurement results demonstrated that the antenna array reached a 5.6 GHz bandwidth  and a maximum gain of 18.7 dBi. The test and simulation results also indicate that the proposed antenna array had good stability in a temperature range from \u221250 \u00b0C to 150 \u00b0C, and that, therefore, the antenna has good potential to be applied in higher-temperature environments."}
{"text": "This paper describes the design steps carried out to prove the concept of a wideband monopole antenna system to be used in a wearable device conceived for the evaluation of electromagnetic field radiation. Such a device is envisaged to be integrated into protective vests worn by professional users in their working space environment as part of intelligent multi-risk protection. Initially, the main characteristics of a simple straight monopole are reviewed to serve as a reference. A modified octagonal monopole antenna element is introduced, and a two dual-linearly polarized configuration of such monopoles is designed, fabricated, and tested to be used in the frequency range of 0.7\u20133.5 GHz. The expected radiation characteristics  are confirmed experimentally. The effects of a thick lossy foam substrate layer used to mitigate the presence of the metal shield, employed in the vest lining as a Faraday cage protection, are analyzed both by simulation and experimentally. Finally, electromagnetic simulations are carried out to confirm that a system of five dual-linearly polarized monopole elements located in the chest, shoulders, back, and helmet of the user can provide an adequate estimation of the incident electromagnetic field radiation. In the last thirty years, there has been a remarkable increase in the deployment of mobile communication and Wi-Fi systems. Notably, 2G, 3G, and 4G standards represent a step forward in such an increase. With the advent of 5G, an enormous boost in the number of users and terminals, as well as in traffic, is expected . With thThis paper presents the proof-of-concept for the development of an antenna system envisaged to be integrated into protective vests worn by professional users in their working space environment as part of intelligent multi-risk protection . Such a The proof-of-concept for the development of the antenna system is divided into three steps. The first step corresponds to the design and optimization of the basic antenna element, a wideband dual-linearly polarized monopole, in free space . In the The modification was introduced in the octagonal printed planar monopole antenna element to further meander the current distribution.The compact combination of two linearly polarized monopoles was used to obtain dual-linear polarization, with acceptable mutual coupling.A foam absorber layer was used to mitigate the unwanted effects of a metal shield.The configuration of the antenna system was used to provide full coverage of the environment around the user.A method was used to estimate the amplitude of the electric field of the incident electromagnetic plane wave.It is important to highlight the following innovative features proposed and described in this paper:The paper is organized into five sections. After this introduction , SectionThe dipole antenna has been used since the 1887 Heinrich Hertz founding experiment to prove the existence of electromagnetic waves predicted by James Clerk Maxwell . It is oThe simplest printed monopole antenna configuration is shown in It is composed of a straight metal strip printed on one side of the substrate and the ground plane printed on the other side. This simple monopole will not fulfill the impedance bandwidth specifications (0.7\u20133.5 GHz). It is presented and analyzed here just to serve as a reference.s = Ws = Wg = 150 mm, Lg = 50 mm, and Wm = Wf = 3 mm. A cheap 1.6 mm thick FR4 substrate with relative permittivity \u03b5r = 4.3 and loss tangent tan\u03b4 = 0.025 was chosen. The monopole length was optimized to have the first resonance at the central frequency (f0 = 2.1 GHz) of the working frequency band 0.7\u20133.5 GHz. Lm = 25 mm = 0.175\u03bb0 was obtained. The microstrip feed line width was swept from 3.0 mm to 0.5 mm with a 0.5 mm step. This corresponds to characteristic impedances of the microstrip feed line ranging from 50.7 \u03a9 up to 110.6 \u03a9 [Initially, the following dimensions have been used: L 110.6 \u03a9 . The inp 110.6 \u03a9  are show11| = \u221210 dB reference level, which corresponds to a 10% reflected power level. With this criterion, the larger bandwidth is obtained for Wf = 1.0 mm and is about 46% (1.78\u20132.86 GHz), far from the required 133.3% or 5:1 (0.7\u20133.5 GHz), as expected.We define the impedance bandwidth using the usual |Sf = 1.0 mm configuration. The results obtained for the 2D cuts in the principal planes are shown in \u03b8 polarization component is meaningful. Especially in the H-plane, for 1.7 GHz and 2.9 GHz, the amplitude of the E\u03c6 component is similar to the E\u03b8 one, for \u03c6 \u2248 30\u00b0 . This is a specificity of the planar monopole that can be explained by the current distribution in the ground plane  is specified, a simple configuration that meets the requirements was selected. Initially, the octagonal-shaped monopole ,31 was si \u2260 Lvh) to increase flexibility in the design process. The values used for the geometrical parameters are indicated in A simple rectangular ground plane and a thin single-layer substrate configuration are used. Moreover, a coplanar waveguide (CPW) feed is utilized. The novelty of the proposed configuration corresponds to the use of right triangles on four edges of the octagonal patch to enhance meandering. The octagonal patch is not regular  because the other geometrical parameters have been optimized for that case. It can also be concluded that the design equation of the octagonal monopole applies, that is, the patch length is slightly less than a quarter of the free-space wavelength at the frequency of the first resonance  [It can be concluded that for the two ground plane widths considered, the ground plane width has a small effect on |S 100 mm) ,31.The simulated current distribution on the modified octagonal monopole, at the limits and center of the frequency band of operation, is shown in The simulated far-field 2D radiation pattern results are shown in The YZ plane radiation pattern does not change much in the whole frequency range of operation. However, on the other two principal planes, the radiation pattern is quite different at 3.5 GHz. This difference can be justified by the existence of the higher-order modes already referred to above ,41. The The gain simulated results are shown in To avoid the possibility of a complete polarization mismatch, two modified octagonal monopoles with orthogonal orientations were combined, as shown in The amplitude of the experimental S-parameters is shown in This section deals with the dual-linearly polarized monopole antenna element in the presence of a metal shield . Lossy foam is placed between the substrate, the ground plane, and the metal shield to absorb the reflections. First, the foam material is macroscopically characterized experimentally, and then the foam layer thickness is optimized.0), and therefore only \u03b5 and \u03c3 need to be measured.The absorber layer was obtained by cutting slices of the planar region of an anechoic chamber absorber panel. As the macroscopic characteristics  of the panel material are not homogenous, they need to be measured. However, the foam has normal magnetic behavior  relative electric permittivity are defined asn method , where tr\u2032 and \u03b5r\u2033 experimental results, obtained for part of the frequency band of interest, are shown in As an example, \u03b5The dual-linearly polarized monopole antenna element with an absorbing foam layer and a metal shield is shown in This antenna structure has been simulated using an absorbing layer with thicknesses of 5, 10, and 15 mm. The obtained amplitudes of the S-parameters are shown in 11| (and |S22|) below \u221210 dB except in the range of 0.70\u20130.75 GHz where it is slightly above (\u22127.3 dB at 0.7 GHz). In addition, for an absorber thickness of 10 mm, the mutual coupling is below \u221214.2 dB.An absorber thickness of 10 mm provides |S11| and |S21| experimental results are shown in 22 results (not included) generally show a good agreement with S11. The experimental results of the free-space prototype are also shown for reference. It can be verified that |S11| < \u221215.4 dB, and |S21| < \u221217.1 dB for the whole frequency band of operation. These results are substantially below (about 5 dB on average) the simulated one, especially at the lower frequencies. This is due to the less accurate characterization of the absorber in that frequency region as a pair of horn antennas is not available for such a frequency band. It can be concluded that it is feasible to use an absorber layer a few millimeters thinner.An antenna prototype with a 10 mm thick absorber layer has been fabricated and tested. The corresponding |SThe simulated radiation pattern results for each port are shown in As intended, the metal shield almost blocks the radiation to its back side. There are several physical symmetries reflected in the radiation pattern. For instance, the theta component of Port 1 in the XY plane corresponds to the phi component of Port 2 in the XZ plane, rotated 90 degrees, and vice versa. In the three principal planes, the radiation intensity level in the front hemisphere, for both polarizations, is below\u20145 dB in only one-third of the 180-degree angular region. Then, it can be concluded that the radiation pattern does not change much in most of the front hemispheres.The corresponding realized gain and radiation efficiency simulated results are shown in The gain spans the range of \u22123.4 to 0.3 dBi with an average of \u22121.7 dBi. Compared with the gain of the free-space monopole shown in  there isThe radiation efficiency decreases as frequency increases and spans the range of \u22129.9 dB (10.7%) at 3.5 GHz to \u22126.3 dB (23.6%) at 0.7 GHz. The decrease in efficiency is a natural consequence of the insertion of the absorber layer, a price to pay for the mitigation of the presence of the metal shield.The dual-linearly polarized monopole antenna element, analyzed in the previous section, is used as the basic antenna element of the envisaged antenna system used to evaluate the incident electromagnetic field.The antenna system proposed for evaluating the incident electromagnetic field is shown in Five dual-linearly polarized monopole antenna elements are spatially distributed to provide almost uniform coverage of the space around the user. Four such antennas are located on the torso , and the remaining one is located on the helmet. The torso has maximal dimensions 40 cm \u00d7 40 cm\u00d7 25 cm This simple model of the user was chosen according to the facilities that will be used to fabricate the physical phantom  needed tThe proposed antenna system was simulated using CST Studio Suite. The input reflection coefficient and gain of each antenna port have been obtained. Moreover, in receive mode, the voltage induced in each antenna port is also obtained for different directions of incidence and polarizations of an incoming plane electromagnetic wave. The port numbering is indicated in 77| = \u22127.1 dB at 3.5 GHz. As for the results shown in The simulated input reflection coefficient results are shown in To simulate the voltage induced in each port by the electromagnetic radiation present in the environment, a plane electromagnetic wave, with an electric field intensity of 1 V/m, was considered. The direction of incidence was varied in the angles \u03b8 (from 0 to 180 degrees) and \u03c6 (from 0 to 360 degrees) in 45 degrees steps. Vertical, horizontal, and 45 degrees inclined linear polarizations were studied. In the simulations, each of the 10 monopole ports was terminated with 50 \u03a9 loads, which corresponds to the ideal situation of a perfect impedance match between the receiving antenna and the receiver.As an example, the incidence from \u03b8 = 90 degrees to \u03c6 = 0 of the plane electromagnetic wave with horizontal polarization is shown in As expected, Port 5 and Port 10, corresponding to the monopoles with line of sight (LoS) and the perfect (Z) polarization match, have the highest induced voltages. The induced voltage curves tend to follow the gain curve shown in 0) can be obtained from [e is the antenna effective height, and Cp is the antenna polarization mismatch factor. Assuming a perfect antenna impedance matching the voltage over the 50 \u03a9 load (Vload) is half of V0. It is also known that [a = 50 \u03a9 is the antenna input resistance, and Z0 = 120\u03c0 \u03a9 is the characteristic impedance of the vacuum. Combining Equations (2) and (3), and assuming Cp = 1, the incident electric field amplitude can be estimated as0 is the light speed in vacuum.The equivalent Thevenin-induced unloaded antenna voltage (Vned from (2)V0=E\u00a0own that (3)he=\u03bb\u00a0Read the voltage at each of the 10 monopole antenna ports and select the highest one. Users will be instructed to move around while reading the voltages to avoid the eventual incidence of local radiation pattern minima.Obtain the monopole gain from est.Use Equation (4) to calculate EThe simplest procedure that can be used to estimate the amplitude of the electric field of the incident plane electromagnetic wave can be summarized as follows:It is assumed that there is a filtering device that selects the frequency band for each measurement. Taking into account the simplifying assumptions used, this simple procedure underestimates the amplitude of the incident electric field. A more accurate estimation can be obtained by implementing a more elaborate procedure and making use of the information available. For instance, we may use the amplitude and phase of the voltages measured at each port, obtain the direction of arrival (DoA) of the incident electromagnetic wave , and useAn antenna system based on a wideband modified planar printed octagonal monopole is proposed for integration into a system conceived for the estimation of electromagnetic field radiation in the frequency range of 0.7\u20133.5 GHz. This frequency range encompasses all the relevant mobile communication standards, namely, 2G, 3G, 4G, and most of the 5G (below 6 GHz) frequency bands. Such a system is envisaged to be integrated into protective vests worn by professional users in their working space environment as part of an intelligent multi-risk protection system.Initially, the simple straight monopole is completely characterized to serve as a reference. Then, the modified octagonal monopole with CPW feed is proposed to provide the required wideband. A dual-linearly polarized combination of such modified octagonal monopoles is proposed. The experimental macroscopic characterization of a lossy foam is described. A relatively thick layer of this foam is used to mitigate the unwanted effects of the metal shield on the dual-linearly polarized monopole antenna.Five dual-linearly polarized monopole antennas will be integrated into the user jacket, located on the chest, back, left, and right shoulders and helmet. Based on the knowledge of the monopole antenna gain, the frequency band of the operation, and the maximal induced voltage at the antenna ports, a simple procedure is proposed to estimate the amplitude of the electric field of the incident electromagnetic plane wave. As part of the tradeoff between the complexity and accuracy of the estimation procedure, other strategies may be followed.Use adequate wearable-oriented materials  .Integration into the vest .Tests with a realistic phantom .Uncertainty analysis of the procedure to estimate the amplitude of the electric field of the incident electromagnetic field.Extend the analysis up to 6.0 GHz (to include the remaining sub\u22126 GHz 5G frequency bands).Only the proof-of-concept of the antenna system is described in this paper. Therefore, no strict fulfillment of the specifications was imposed, as this is a task to be accomplished in the final stage of the development of the prototype by an industrial partner. Many topics of future work can be represented as requiring specific analysis for the evolution from the proof-of-concept to the industrial prototype, such as the following:We are completely aware that alternatives to the single modified octagonal monopole antenna element could have been adopted initially . However, we are convinced that using these other monopole geometries in the final antenna system would lead to an equivalent overall performance."}
{"text": "The outcomes of estimated and observed values are examined for MIMO inclusion factors such as DG, ECC, CCL, and MEG. The antenna\u2019s performances, including radiation efficiency and gain, are remarkable for this antenna design. The designed antenna is successfully tested in a cutting-edge laboratory. The measured outcomes are quite similar to the modeled outcomes. This antenna is ideal for WLAN and Wi-Max applications.In this article, a 4 \u00d7 4 miniaturized UWB-MIMO antenna with reduced isolation is designed and analyzed using a unique methodology known as characteristic mode analysis. To minimize the antenna\u2019s physical size and to improve the isolation, an arrangement of four symmetrical radiating elements is positioned orthogonally. The antenna dimension is 40 mm \u00d7 40 mm (0.42\u03bb It is desirable to employ this modern technology, known as Ultra-wideband communication devices, to address the needs of high data rates at low costs. Since the Federal Communications Commission (FCC) approved the unlicensed 3.1 GHz\u201310.6 GHz range for UWB applications; it has evolved into a well-known innovation in the wireless communication industry. Because they constitute an essential part of UWB communication systems, UWB antennas have consequently generated enormous scholarly and scientific attention in recent years . To overIntroducing more components causes mutual coupling to rise, which lowers MIMO\u2019s performance. Since electromagnetic interaction increases when MIMO units are put closely together and lowers MIMO performance, low mutual coupling is a crucial MIMO component. These techniques are used to initiate reducing mutual coupling: (1) an improper ground structure, (2) networks for decoupling, (3) parasitic components, 4) electromagnetic band gap (EBG), 5) lines of neutralization, and 6) meta material. To fulfill the expectations of the Internet of Things for more bandwidth and data rates, researchers have started to create UWB antennas to attain a high level of isolation in MIMO Antennas [ electrom lines of meta materations . A 4 \u00d7 4erations .3, and each radiator has a U-shaped slot. Excellent isolation and diversity measurements were attained [The 4 \u00d7 4 small antennas have 25 mm \u00d7 50 mm of surface area, and PIN diodes were utilized to turn on each radiator in the set up. An LC-shaped decoupling stub was employed for high isolation 2\u201312 GHz) across the band  GHz acro. A tiny attained  as a resattained . A two-pattained . A new tattained . A compaattained . To achiattained ,23,24,25But the above methods are not able to enhance the isolation. Therefore, we need an advanced antenna design approach that offers us great isolation and good diversity performance. A method of evaluation that is step-by-step is characteristic mode analysis. This design method is used to analyze antenna properties without using feed. The antenna structure is physically examined using CMA.The following sections compose the remaining document: In 0 \u00d7 0.44\u03bb0 \u00d7 0.0176\u03bb0), placed on a Fr-4 material with loss tangent of 0.002 and permittivity of 4.3. The Computer Simulation Technology (CST) is used to design and simulate the proposed antenna.The designed antenna radiator is in the form of a spike-shape. The four symmetrical monopoles are placed orthogonal to one other, resulting polarization diversity. The proposed spike-shaped MIMO antenna has size in the order of 40 mm \u00d7 40 mm \u00d7 1.6 mm  is used to study radiation patterns and scattering fields in perfect electric conductors. In perfect electric conductors, the antenna\u2019s input impedance and radiation pattern are proportional to the total surface current density at the feeding point . The impn is zero at all points except the feed point of the conducting antenna. The overall phase of n.The dot product of The characteristics mode analysis (CMA) is used to develop the proposed antenna. The entire design process is carried out in four design stages performed in the proposed antenna design evaluation process. The total designing process of the suggested antenna depends on CMA metrics such as (1) Eigen values, (2) characteristic angle, and (3) modal significance. These three properties exist in each characteristic mode. In this current antenna design, only the modal significance parameter was considered. The Spike-shaped 4 \u00d7 4 MIMO antenna is analyzed and investigated in four stages: antenna0 (Ant#0), antenna1 (Ant#1), antenna2 (Ant#2), and antenna3 (Ant#3) . The CM The proposed antenna was developed using a CMA method. A series of sequential procedures are used throughout the designing process. The modal current distribution in Computer Simulation Technology (CST) is demonstrated using multi-layer solver. The evaluation process of antenna in step-by-step manner is depicted in Figure 2Modal significance is used to implement the proposed antenna in CMA design. Without using any excitation signal, the entire antenna design process is carried out in four evaluation stages from Ant#0 to Ant#3. The Ant#0 is made up of four spike-shaped radiators that are printed on FR-4 substrate. Each spike radiator has a radius of 4 mm with spike bubble radius of 1 mm. The Ant#0 has no conducting ground plane and is able to generate ten characteristic modes using the multilayer solver. Only five out of ten characteristic modes (CMs) contribute bandwidth and isolation. The modal significances of Ant#0 are shown in The remaining modes, CM1, CM2, CM4, CM5, CM6, CM8, CM9, and CM10, not only covers UWB but also the X-band (8 GHz\u201312 GHz). This antenna is suitable for UWB (3.1\u201310.6 GHz) and X-band applications (8\u201312 GHz). 11). The designed antenna provides isolation of 26 dB. This isolation is good in MIMO antenna metrics. The experimental set up for measuring the isolation using VNA is shown in 21 values. The novel type of decoupling structure in the ground plane provides the excellent isolation.The proposed UWB-MIMO spike-shaped antenna has good MIMO metrics such as radiation characteristics and isolation. The CMA technique is used to design the spike-shaped antenna, resulting in improved isolation. From 3.2 GHz to 12.44 GHz, the impedance bandwidth is 9.24 GHz and it covers the bandwidth requirements for UWB and ITU bands. Four performance metrics exist in MIMO antenna systems, all of which should be acceptable ,29,30. TAnother important MIMO diversity parameter is diversity gain (DG). Generally, in MIMO antennas the DG is nearly 10 dB. Formula  illustraThe acceptable value of CCL is 0.4 bits/s/Hz. In this proposed design, CCL of 0.31 bits/s/Hz is achieved and depicted in th elements. The MEG of the intended antenna is \u22123.1 dB, as illustrated in The MEG can be expressed using Equation (8) (8)MEGi=The spike-shaped 4 \u00d7 4 UWB-MIMO antenna is designed to work in both UWB and X-band. This antenna has some better features than others previously reported in the literature ,25,31,3211) are below \u221210 dB, and isolation between both the radiating elements are far better than 26 dB. The radiation parameters include 89% radiation efficiency, 118.15% impedance bandwidth, and a 4.9 dB gain. ECC, DG, MEG, and CCL have diversity features of 0.0016, 9.962 dB, \u22123.1 dB, and 0.31 bits/s/Hz, accordingly. In a cutting-edge experiment, these findings are verified. According to its performance parameters, the developed antenna is suitable for wireless communication in the spectrum of UWB and X-band.The spike-shaped UWB-MIMO antenna operates in the 3.2 GHz\u201312.44 GHz frequency range, which includes the entire UWB (3.1 GHz\u201310.6 GHz) and X-band (8 GHz\u201312 GHz). Four spike-shaped circular patch radiators are placed orthogonally to achieve polarization diversity. The reflection coefficients (S"}
{"text": "In this paper, a novel wideband end-fire antenna, based on a spoof surface plasmon polaritons (SSPP) transmission line, is proposed. Periodically modulated corrugated metal strips are used as a transmission line for quasi-TEM conversion in the microstrip line to the state of SSPP and the best impedance matching. Due to the strong confinement of the field in the SSPP waveguide and its high transmission performance, it has been used as a transmission line. The antenna consists of SSPP waveguides for the transmission line, a metal plate on the ground as the reflector of the antenna, a metal strip director, and two half-rings to realize the radiation, reaching a wide bandwidth in the range of 4.1 to 8.1\u00a0GHz. The simulation results show that this antenna achieves a gain of 6.5 dBi, a bandwidth of 65%, and an efficiency of 97% across a wide operating frequency band, from 4.1 to 8.1\u00a0GHz. The proposed end-fire antenna has been fabricated, and the measured results agree well with the simulated results. The end-fire antenna implemented on a dielectric layer also has the advantages of high efficiency, good directivity, high gain, a wide bandwidth, easy fabrication, and a compact size. The Yagi-Uda antenna has a driving element, a reflector, and one or more directors.With recent advancements in wireless communication technology, the demand for low-profile wideband antennas is increasing. Yagi-Yoda antennas can be used for long-distance wireless communications due to their advantages, such as high gains, high bandwidths, low profiles, end-fire radiation patterns, and ease of fabrication and integration with other microwave circuits3. Moreover, the driver and director was reported that printed dipoles positioned on one side of a substrate with a high dielectric permittivity4; while the reflector was a truncated ground plane positioned on the other side of the substrate. The feeding method was geometrically complex, and needed long transmission lines4. In addition, the use of a narrowband delay line in the construction of the wideband antenna restricts the antenna's bandwidth, and creates an unbalanced operating situation5. In one study of quasi-Yagi antenna, a wide bandwidth of 44% was obtained using a simple structure and feed6; however, the asymmetrical nature of the printed quasi-Yagi antenna made the radiation pattern bad6. Also, a quasi-Yagi antenna based on a microstrip-to-slit transmission structure was presented, and it reached a bandwidth of approximately 46%7; however, that antenna had a large ground, which increased the size of the antenna7.In the literature, different designs have been reported to increase the bandwidths of planar-printed quasi-Yagi antennas. For example, a quasi-Yagi antenna based on a microstrip transmission structure was presented; and while the measured bandwidth was 48%, the structure of that antenna was complex8, which had an impedance bandwidth of 3.6 to 11.6\u00a0GHz, and a compact size8. Moreover, in another report of loop quasi -Yagi antenna, a loop Yagi-Uda antenna was used to reduce the antenna size by using the half-loop technique; and a measured bandwidth of 43.3% was obtained9. In addition, a comparison was made between two loop Yagi antennas\u2014one with a defective ground structure (DGS), and the other without10. The antenna without the DGS had a better bandwidth, front-to-back ratio (FBR) gain and directivity, but it was 52% bulkier10. Therefore, it is challenging to design antennas with both high bandwidths and simple structures.Furthermore, a compact planar printed quasi -Yagi antenna with a modified ground plane, based on a new structure of microstrip-to-slit transmission line, was proposed11. The SPPs generate both charge oscillations in the metal and evanescent electromagnetic waves in the dielectric, and despite the fact that SPs and SPPs have been found at optical frequencies, they are closely related to surface waves at radio and microwave frequencies13. In 2004, for instance, Pendry et al. demonstrated a comparable surface plasmonic phenomenon known as SSPPs at microwave frequencies14.One way to increase the bandwidth is to use SSPP structures in the design of the antennas, where SPPs are the hybrid excitations produced when the SPs are coupled with electromagnetic (EM) waves17. Recently, SSPPs have been widely used in optoelectronic technologies18, filters21, amplifiers22, antennas30, and antennas reconfigure34, due to their special properties. In one paper, the authors used a metamaterial structure to achieve end-fire radiation26; moreover, in another one, high-gain and wideband SSPPs with circular patch arrays were presented27.SSPPs are therefore good candidates for high-density integrated circuits and components at millimeter and terahertz frequencies, due to their strong field confinements at the wavelength scale, as well as their groundless structures30. Furthermore, a small aperture end-fire antenna based on odd-mode SSPPs was presente11; where SSPPs antennas were composed of dipole-unit cells, which reached bandwidths in the range of 4\u20138\u00a0GHz11. However, most of the structures presented in the literature are not suitable for practical applications, due to their high fabrication costs and complex structures. Therefore, designing an antenna with a small size and high bandwidth is challenging.In one of the recent reports of SSPP, proposed a method for designing common aperture antennas based on (SSPPs) excitations, which are similar to microwave to (SPPs) in the optical frequency region. In this paper, a common aperture antenna has been designed based on both odd and even SSPP modes27. It is shown, here, that the bandwidth, efficiency, and gain of our proposed antenna are approximately 65%, 97%, and 6.6 dBi, at the designed frequency of 6\u00a0GHz, respectively.In this paper, an SSPP-based wideband antenna with high gains is proposed, where this SSPP waveguide is made up of a single ultra-thin, corrugated metal strip and a dielectric substrate layer. Here, the SSPP is used to transmit energy, while to realize the energy radiation, a Yagi loop has been added in the end-fire direction. In comparison to other transmission lines, this SSPP-fed antenna can simultaneously preserve the signal\u2019s integrity, and it also incurs low conduction losses. To improve the directivity of the SSPP antenna, one director is also loaded at the end of the antenna. Our proposed antenna is simple, and has a better bandwidth, gain, and efficiency compared to other antennas presented in the literatureThe rest of the paper is organized as follows: Section \u201cThe configuration of our proposed wideband end-fire antenna, based on SSPP, is shown in Fig.\u00a0mentclass2pt{minimThe designed antenna consists of five parts. A metal ground sheet is used on the bottom layer of the substrate, to improve the directionality, reduce the losses, and enhance the FBR of the antenna. Two slots created in front of the ground plane are then used as the antenna\u2019s reflectors, which reflect the energy transmitted back, and this also improves the antenna\u2019s radiation. Moreover, a pair of SSPP waveguides have been used as a transmission line to excite the end-fire antenna. This is due to its advantages, including high-field confinement, low losses, controllable dispersion, and slow waves. In addition, the tapered SSPP line provides superior impedance matching to open space, thereby suppressing any end-to-end reflections.35. In this paper, the gradient corrugated grooves structure is used to match the SSPP transmission line.Different methods are used in the literature for matching the SSPP transmission line. One of these methods is using the characteristic impedance matching method26, but we have extended this concept to excite end-fire loop Yagi antennas. Thus, our proposed design increases the bandwidth and efficiency, by preserving the same dimensions while also having a simpler structure compared to26. To achieve impedance matching, corrugated grooves have been used between the input microstrip line and the SSPP waveguide, where the parameters of the corrugated metal strips are given in Table It is worth noting that the concept of an SSPP waveguide was used in referenceAs can be seen in Fig.\u00a036, meaning all of its parts contribute to the increase in radiation. According to the HWC for the end-fire radiation, the appropriate phase constant for the guided waves should be slightly larger than in the air. Yet, on the other hand, the dispersion curve needs to be under the airline, and also within a short distance. So, the dispersion curve of the unit cell has been simulated in CST software, as illustrated in Fig.\u00a0It is worth noting that the proposed antenna is based on the Hanson-Woodyard condition (HWC)Therefore, the effect of the groove depth on the impedance matching has been analyzed, to achieve an optimum value of h10 for wide bandwidths in the frequency range of 4\u20138\u00a0GHz. As shown in Fig.\u00a0The number of unit cells of the groove of the SPP transmission line have also been optimized, where a schematic of quasi-Yagi antennas with four different unit cell numbers is shown in Fig.\u00a0The results of the gain and efficiency of our proposed antenna are shown in Fig.\u00a0It is worth highlighting that the use of SSPP transmission lines has been considered, here, due to their lower losses and impedance matchings. To better understand this, the results of the reflection coefficients of the structure, both with and without the SSPP, are shown in Fig.\u00a0The distribution of the electric field for the frequency of 6\u00a0GHz with SSPP and without SSPP is plotted in Fig.\u00a0To experimentally verify the proposed wideband end-fire antenna based on an SSPP, as shown in Fig.\u00a0mentclass2pt{minimFigure\u00a0In this paper, a simple structure based on SSPPs, with a wide bandwidth, and a high efficiency and gain has been presented. Since the electromagnetic waves are strongly confined around the metal surface of this structure, the proposed antenna has low loss. Table In this paper, a compact quasi-Yagi antenna, based on an SSPP, has been designed, simulated, and fabricated. An SSPP waveguide has been used due to their ability to provide field confinement, slow waves, and low losses for the transmission line, and to obtain wide bandwidths. A high efficiency of 97%, with a wide bandwidth of 65%, and a peak gain of 6.5\u00a0dB has been obtained with the proposed antenna simulated on a Rogers Ro4350B substrate. However, due to the unavailability of this antenna has been performed on an FR-4 substrate. The bandwidth, maximum gain, and efficiency obtained from the simulation and measurement with the FR-4 substrate were approximately 61%, 6.1\u00a0dB, and 77%, respectively. Thus, based on the advantages of the SSPP transmission line, our proposed antenna with a wide bandwidth, high efficiency, and compact size, shows great potential for use in wireless communications."}
{"text": "A multi-layer beam-scanning leaky wave antenna (LWA) for remote vital sign monitoring (RVSM) at 60 GHz using a single-tone continuous-wave (CW) Doppler radar has been developed in a typical dynamic environment. The antenna\u2019s components are: a partially reflecting surface (PRS), high-impedance surfaces (HISs), and a plain dielectric slab. A dipole antenna works as a source together with these elements to produce a gain of 24 dBi, a frequency beam scanning range of  Conventional methods of monitoring vital signs, such as an electrocardiogram (ECG), pulse oximetry, and capnography, require sensors to be attached directly to the patient\u2019s body, which is either uncomfortable for the patient or not possible under certain circumstances ,5,6,7,8.The main advantages of using millimetre-wave frequencies for RVSM are (i) higher detection sensitivity due to shorter signal wavelengths, (ii) smaller form factors for more compact devices, and (iii) the ability to transmit and receive signals more precisely without interference from the environment ,9. ConveThe 60 GHz frequency band (57\u201366 GHz) has attracted RVSM interest due to its licence-free nature and its widespread use for several different wireless services. Antennas that operate in this band are particularly challenging to design and fabricate. RVSM measurements require the focus of the antenna beams, as well as enough gain to compensate for path loss in order to achieve high precision. Moreover, antenna beam steering capability is necessary to continuously monitor health with a fixed position sensor over a long period of time, especially when the person may move in practical scenarios, such as during sleep, inside a room, during transport in an ambulance, and at work ,12,13. SRecent publications ,8,9 discLeaky wave antennas (LWAs) are a special family of antennas that are able to steer their beam with frequency . They prOur study presents a multi-layer LWA used for remote vital signs detection in a typical situation in which a patient is lying on the bed and has some random movements during sleep. The non-contact detection of vital signs can be achieved using antenna beam characteristics that provide high gain (58\u201366 GHz) and wide bandwidth performance. A measured antenna bandwidth of 8 GHz and a maximum gain of 24 dBi are measured across the operating band. The proposed antennas are tested experimentally to validate their predicted detection coverage. This antenna design measures the respiratory rate (BR) and the heart rate (HR) from a distance of up to 4 m from the body of the person at five different radiation angles between This work is an improvement from the antennas already published in ,17. The This paper is organised as follows: The antenna design is described in P is selected for the HIS and PRS unit cells. The reflectance properties of PRS and HIS unit cells are determined at normal incidence. More details about this analysis technique and the relevant equations can be found in [To analyse the proposed design, we begin by applying ray optics in order to measure multiple reflections between partial reflective surfaces (PRSs) and high impedance surfaces (HISs) on the ground plane ,19. The found in ,21,22.Both PRSs and HISs are metasurface arrays made up of square patch elements and square ring elements, respectively, with a ground plane etched on a planar printed circuit board. The design process of the PRS and HIS unit cells is depicted in  antenna a. The to=1.57 mm b uses a TM along the x and y axis for both unit cell simulations. Open boundaries were established along the incident wave\u2019s Periodic boundary conditions were utilised in CST Microwave Studioailed in  to extraIn this section, a printed dipole antenna (PDA) is designed, which will serve as a primary feeding for the complete leaky wave antenna structure. A design model of this feeding dipole antenna can be seen in xy plane . Figure The full proposed multi-layer LWA design is shown in d dipole a is posid dipole b. A 3D vP\u201d can be predicted as:The height of the cavity between the PRS and the HIS ground plane, which is represented by the symbol duced in , the poiE-plane at various frequencies within the operational range, and The phase reflection coefficients of PRS and HIS as a function of frequencies are used to demonstrate LWA beam scanning. These coefficients are derived using Equation , which pfound in . The farTo prove the design concept, three additional variations of our proposed multi-layer LWA were considered, which have been demonstrated through simulations in CST Microwave Studio. Our proposed multi-layer LWA consists of a HIS-PRS cavity and a dielectric on top as in . Three vThe d in S11 a is wellThe entire antenna design, including the coaxial feed, is encased in a low-loss polytetrafluoroethylene (PTFE) so that it can be placed in the most realistic environment possible and measurements can be made. An external connection is made using a 1.85 mm flanged launcher and a GB185 glass bead. The antenna layers were fabricated using a typical low-cost PCB fabrication method. The measurement configuration for the multi-layer LWA\u2019s The measurement of the antenna was carried out in an anechoic chamber. The gain-comparison method was used to determine the realised gain of our proposed multi-layer, leaky wave antenna. This method calls for two antennas: one that serves as a receive antenna and has a known gain  and another that serves as a transmitter antenna whose gain is unknown (our proposed multi-layer LWA). The antennas were placed at a far-field distance of 1 m. The antenna gain was next calculated using Friis\u2019 equation. S-parameter stays lower than \u221210 dB. In addition, the beam scanning ranges of each of the tested antennas are the same, with a scanning range of A rotatable base connected to the computer for data acquisition was used to measure the patterns of antenna radiation. The antenna is rotated through 0\u00b0, 10\u00b0, 20\u00b0, 30\u00b0, up to 360\u00b0 and then returned to the starting position after calibrating the VNA to 0 dB insertion loss. The information is then gathered and kept on file to forecast the signal strength. E-plane and H-plane radiation patterns at 62.5 GHz are presented in E-plane radiation patterns at different frequencies is given in To validate the design concept, the measured far-field radiation patterns of the co-polar and cross-polar in the Both the measured and simulated efficiency of antennas A and B remained at approximately e 60 GHz b. For thIn this experiment, we focus only on heart rate and respiration rate measured on the chest. Our proposed leaky wave antenna with a beam scanning range of d), reflected signals from the environment and the subject, and residual phase noise. The The proposed RVSM process is shown in a block diagram in ain (FD) : 3)R(t)R(t)(2)R, and the findings are updated after a shorter time interval  . High-reIn this experiment, the target is 2 m away from the transmitter and the receiver antennas at The estimated BR signal amplitude is seen in the first peak at a frequency of about 19 (1/min), while the predicted HR signal amplitude is seen in the second peak at a frequency of about 74 (1/min). At angles of  12\u00b0 see . It is aThe HR peak is still visible at 66 GHz, and it is greater than the surrounding noise at 30\u00b0 See e. It cane object .A hospital blood pressure monitor that also records patients\u2019 heart rates on a daily basis was used to validate the results on the same individual, as shown in In order to demonstrate the antennas\u2019 range at a radial distance of 4 m, the experiment was repeated multiple times with the same subject, who sat at varying angles away from the antennas each time and had their vital signs recorded. The purpose of this was to validate the results and compare them to those obtained from a range of 2 m. The other experimental parameters are kept as previously described. Three RVSM measurements were taken at the best frequencies and beam angles for maximum detect ability, according to The proposed multi-layer LWA design with Doppler radar technology is well-suited for use as a non-contact wireless sensor for health monitoring. As the experiment has shown, the sensor can detect both breathing rate (BR) and heart rate (HR) accurately and reliably at a radial distance of up to 4 metres. The non-contact nature of the sensor means that it can be used in a variety of scenarios, including when a patient is travelling in an ambulance or when they are sleeping or in occupational settings, where workers\u2019 health can be monitored without the need for physical contact see . Additiopared to , which ipared to . HoweverThe proposed multi-layer leaky wave antenna is a highly promising technology due to its numerous advantages. It operates in the 60 GHz band, which is ideal for applications requiring high data rates, low interference, and short-high-range communication. Additionally, the antenna has a high gain and enough beam-steering range for RVSM  applications, which is essential for accurately tracking the movements of a person\u2019s body. It is manufactured using low-cost PCB (Printed Circuit Board) fabrication methods, which makes it a highly attractive option for widespread adoption. Additionally, the design has been tested and characterised through two prototypes, and good agreement has been observed between the simulations and measurements. The experiment conducted to test the antennas for respiration and heartbeat detection showed that the proposed antenna is highly effective. The antenna was tested at radial distances of 2\u20134 m and angular positions of"}
{"text": "This work presents an optically transparent and flexible MIMO antenna that features two square patch elements placed in close proximity, aiming to meet the demands of compactness, flexibility, optical transparency, and visual appeal for IoT applications and future 5G wireless communication. The design includes a simple offset fed configuration to achieve the required isolation and impedance matching. It simplifies the process of creating closely spaced transparent MIMO antenna configurations. By optimizing and analyzing this structure, the antenna achieves better isolation and diversity gain performance, even when the patch elements are positioned very close to each other. To achieve optical transparency and flexibility, the antenna uses thin polyethylene terephthalate (PET) material as a substrate, which is a thermoplastic polymer resin from the polyester family. The wired metal mesh parameters for conducting parts of the MIMO antenna and offset position of the feed are carefully optimized to achieve required optical transparency, isolation, impedance matching and radiation performance without any complex decoupling or impedance matching network. Transparent and flexible MIMO antennas serve as a key element to maintain compatibility with devices of varying shapes and sizes while minimizing their visual impact. The optical transparency may help to increase visual aesthetics of 5G-enabled base stations, smartphones, tablets and wide range of IoT devices, from environmental sensors to home automation devices. While the flexibility of the antenna design might make it suitable for integration into flexible communication modules or boards that can be adapted to various types of IoT sensor nodes and devices with different form factor.Multi-input-multi-output (MIMO) antenna systems are used to enhance spectral efficiency and channel capacities of 5G and IoT infrastructure3 for next-generation compact, transparent, and flexible 5G systems. However, a transparent and flexible MIMO antenna configuration is challenging to realize due to complex isolation techniques, such as vias and decoupling structures, which are not ideal for maintaining transparency and low-cost manufacturing processes5.These can also help to install more antennas in close proximity to enhance signal strength and data speeds6 ,7 despite having good flexibility. Furthermore, IZTO and ITO materials are not suitable for future transparent and flexible applications due to their brittleness and high levels of loss when bent, as referenced in8. Roll-to-roll production of monolayer graphene has been successfully demonstrated, boasting high transparency, electron mobility, and scalability. However, the transfer of large, high-quality graphene films remains a significant challenge, as mentioned in9 and10.During the past few years, State-of-the-art flexible and transparent MIMO antennas have been developed using advanced nanotechnology. Researchers have explored various conductive and optically transparent materials, including AgHTs (silver-coated polymers), IZTO (indium zinc thin oxide), ITO (indium tin oxide), and graphene, for their potential use in the development of transparent and flexible antennas for wearable applications. However, AgHTs suffer from high surface resistance and low radiation efficiency for antennas11, and all-solid-state supercapacitors12. However, there are only a few reported instances of stiff antennas using MMs as conductive electrodes in RF devices. There were reports of low efficiency and poor transparency in these MM antennas, as indicated in13 and14.The use of metallic mesh (MM) has been viewed as a promising technique for transparent and flexible applications owing to its superior transparency, conductivity, and malleability. The full potential of MM structures in contemporary radio frequency devices has not been completely investigated yet. In general, micro-structured MM films have found applications in solar cells, electromagnetic interference shielding15, transparent and flexible antennas are proposed, which offer good performance through the use of metallic mesh with embedded Nickel as conductive electrodes using a selective electrode position process in combination with inverted film-processing on polyethylene terephthalate (PET) substrates. A 4-element transparent flexible MIMO is presented for sub-6 GHz 5G applications in16. The researchers conducted parametric studies on antenna resonator geometry to ensure minimum fabrication errors, while maintaining high isolation levels across wide operation bandwidth. However, it is realized by carefully designing the connected ground plane lines and introducing complex slots in the substrate. Thus, developing flexible antennas with exceptional transparency and optimum efficiency is a challenging task. So, there is still need to achieve a simple and suitable solution for a transparent and flexible MIMO antenna configuration without using any decoupling structure between antenna elements, a defected ground structure or vias.InIn this study, a simple, transparent and flexible MIMO antenna with two close proximity patch antenna elements is proposed to achieve higher isolation without using any decoupling structure or complex matching network. The frequency band of the proposed MIMO antenna is centered at 4.5 GHz, which falls within the frequency range considered suitable for 5G New Radio (NR) sub-6 GHz band and IoT applications. An optically transparent square lattice of wired metal mesh is printed on a flexible transparent polyethylene terephthalate (PET) substrate to achieve transparency. A simple offset fed configuration is used to achieve higher isolation and impedance matching for the closely spaced patch antenna elements. The proposed transparent and flexible MIMO antenna is analyzed and optimized through parametric analysis and surface current distribution analysis of the square lattice of the wired metal mesh. The desired optical transparency, impedance matching, isolation, radiation performance, and diversity gain performance with flexibility are achieved and these are also verified through measurement of the fabricated prototype.To evaluate the effectiveness of a transparent MIMO antenna utilizing a wired metal mesh, a MIMO antenna operating in the 4.5 GHz band is chosen, with two patch elements located in close proximity to each other.Figure No decoupling or matching network is used to achieve isolation or impedance matching respectively, for the MIMO antenna configuration. Instead, a simple offset edge fed is used for excitation of both patch antenna elements. This simple asymmetric edge fed configuration is also suitable for development of large antenna arrays. The wired metal mesh square lattice is used in the proposed antenna to achieve approximately 83% optical transparency, with size of the square lattice denoted as mentclass2pt{minimFigure Generally, when two antennas are placed in close proximity to each other, these tend to couple or interact with each other, which can lead to poor isolation between the antennas. To overcome this issue, some decoupling structures and techniques are usually employed in literature to achieve better isolation. However, a decoupling structure between antenna elements may cause larger separation between antennas and may also increase power loss, which may limit compactness of MIMO antenna and may also reduce radiation efficiency.In this work, the offset edge fed plays a crucial role in achieving higher isolation between the patch antenna elements and good impedance matching.The fed point for both of the antennas is intentionally shifted or offset from the center of the antenna elements. By optimizing the offset position of the edge fed, higher isolation between the closely spaced patch elements as well as required impedance matching for each antenna and feed line can be achieved.A center fed conventional MIMO antenna configuration with same geometrical parameters and spacing between antenna elements as those of the proposed MIMO antenna is also analyzed to verify reason for enhanced isolation due to offset fed configuration and shown in Fig. The offset feding is used to control current distribution on each antenna element of MIMO antenna, thereby improving isolation without using any decoupling structure between antenna elements. Figure It can be seen that the offset fed configuration causes phased current distribution on each antenna element and the current distribution is asymmetric and little more concentrated towards offset fed point of antenna-1, and there is almost no current is seen on antenna-2. Similar but mirror phased current distribution is also observed on other antenna element when antenna-2 is excited, which is not shown here for brevity. The asymmetric current distribution in one antenna phased in opposite direction to that of the other antenna, which reduces the mutual coupling between closely spaced antenna elements. The degree of decoupling achieved through offset feeding depends on various parameters, including the offset distance, antenna geometry, and frequency of operation.Achieving optimal performance for multiple parameters simultaneously is a formidable task. Notably, there is still no significant work available in literature that is simultaneously focused to achieve desired optical transparency and flexibility for a MIMO antenna with closely spaced antenna elements. Optimization to achieve required transparency, flexibility, resonance frequency, impedance matching, isolation and radiation performance simultaneously, is a distinct and complex challenge because these performance metrics varies with the variation of the parameters of the square lattice of the wired metal mesh to achieve desired transparency as well.In Fig. entclass1pt{minima13:The definition of optical transparency (O.T) for square lattice of a wired metal mesh is given inAltering The The w = 0.2\u00a0mm, are selected for the square lattice to achieve optimum optical transparency of 83%, return loss of 22 dB, and isolation of 19 dB at 4.5 GHz. These optimized values strike a balance between transparency, resonance frequency, impedance matching and isolation for transparent and flexible MIMO antenna with closely spaced antenna elements.After this thorough analysis, we collectively determine the optimized values of The proposed transparent and flexible MIMO antenna has also been manufactured and tested to verify its simulated performance. Figure In addition to the previous analysis, the proposed transparent MIMO antenna is evaluated for its performance using measures such as radiation pattern, Envelope Correlation Coefficient (ECC), Channel Capacity Loss (CCL), Total Active Reflection Coefficient, and Mean Effective Gain (MEG).Figure The transparent patch antenna element demonstrates good radiation performance at 4.5 GHz, with a gain of 3.2 dB, a radiation efficiency of 61%, and total efficiency of 63%. This is quite impressive for a transparent and flexible antenna element. The 17. ECC performance of a MIMO antenna can be calculated through scattering parameters18, or through far-field patterns19. The following Equation (1919.17.Envelope Correlation Coefficient (ECC) is utilized to assess the effect of coupling between antenna elements, measuring the correlation between them in a MIMO diversity system. Higher diversity gain performance is associated with a lower ECC value that should be less than 0.5Equation  is used wing Eq.  mentione17. According to Eq. Figure while Comparative analysis of the proposed work with previous recent similar works is also presented in Table A transparent and flexible MIMO antenna design is presented in this study, featuring patch elements in close proximity, which are developed with a wired metal mesh having a square lattice to achieve optical transparency. The substrate material used is a 0.1 mm thick transparent and flexible PET material. To achieve isolation, an offset fed configuration is used, which delivers more than 19 dB measured isolation in the desired frequency band. The proposed MIMO antenna is optimized and analyzed based on the square lattice wired metal mesh parameters and the offset position of the edge fed. The proposed MIMO antenna has achieved 83% transparency and operates at 4.5 GHz. The performance of the proposed transparent and flexible MIMO antenna is evaluated based on parameters such as gain, radiation efficiency, total efficiency, envelope correlation coefficient, diversity gain, TARC, and mean effective gain. The results of the fabricated prototype measurement confirm the suitability of the proposed transparent and flexible MIMO antenna for compact applications requiring optical transparency and visual aesthetic with flexibility. The presented technique could play a crucial role in developing future smart wireless transparent and flexible devices."}
{"text": "A self-isolated multiple-input-multiple-output (MIMO) antenna in a compact shared ground structure is proposed for 5G systems. The proposed MIMO antenna consists of customized M-pattern, closely coupled members. It benefits to attain good isolation of the targeted bandwidth transversely without additional de-coupling structures. It is discovered that the arm of M-pattern antenna members can cancel out the coupling on the system and achieve sound isolation among antenna members. A relevant matching circuit model is discussed to show how the suggested theory works in principle. The mixed couplings among antenna members neutralize by modifying the antenna shape with the help of electric and magnetic coupling and surface currents. The proposed self-isolated 2-member MIMO antenna demonstrates sound isolation superior to 15\u00a0dB transversely in the frequency bands dedicated to 5G NR: n48/n78 and long-term evolution (LTE) band 42/43/48/52 (3.2\u20133.98\u00a0GHz). Moreover, the proposed 2-member design structure has a scalability advantage. It is extended into an 8-members structure, where a pair of antennas located at each side of the frame offers orthogonality. The proposed 8-members M-pattern MIMO is validated using fabricated and simulated measurements. The investigational results show that the 8-members MIMO (M-shaped) system is effective in higher order MIMO antenna design and offers more than 20\u00a0dB isolation transversely in the frequency band 5G NR n48 and LTE band 42/43/52(3.29\u20133.66\u00a0GHz). Particular of the concerning issues is the short isolation among the closely coupled antennas that are utilized in a compact device, which weakens the MIMO systems performance3. So, it is precarious and essential to discover self-deprecating and dynamic isolation methods for the MIMO system.MIMO technology is extensively employed in wireless communication systems to address the growing need for better service quality, lower latency, and higher data rates. Several antennas lay on in the system have encountered new issues in fulfilling the overhead demands14. The narrow open-ended slots and space diversity3, DGS in the ground plane4,7, the vertical ground strip with EBG structure in the top plane orthogonally arranged patch antenna5, the shorting stub6, the complementary-split\u2010ring-array (CSRA)8, loading split-ring-resonators (SRR)11, complementary slot coupled SRR12, the planar EBG structure13, 2nd order de-coupling circuit14 are applied in the MIMO antenna, which in turn leads to isolation improvement. Phase-gradient metasurfaces (PGMs) are used to deflect an antenna beam in a preferred direction15. The hybrid dispersion-engineered metamirrors for dispersion manipulation of the antenna are utilized16. Nonetheless, most overhead works increase isolation and change the antenna properties with the help of supplementary design, which could change the characteristics of the antenna. Nevertheless, these techniques upsurge the intricacy of the design pattern with a rising number of members. Although the techniques revealed above show appealing traits, they experience issues and complexities generated with the aid of supplementary systems.Numerous approaches in the previous works of MIMO antennas to increase the isolation have neutralization line, defected ground structure (DGS), metamaterial, and Electromagnetic Band Gap (EBG)25. There are techniques that works with common coupled grounding branch17, common-mode(CM) and differential-mode(DM) tunning18, using ground plane weak-field19, gap-coupled loop antennas using asymmetrically mirrored arrangement20, L-pattern branch operates as a radiating and de-coupling element21, inverted U-pattern member22, using closely paired23, couplings between a pair of coupled antennas are canceled out by proper adjustment25. The shorting legs in the PIFA pair6 are utilized to attain self-isolation in the MIMO antenna. However, one of the above works primarily employs an opposed location to de-couple the antenna members. Moreover, one paper offered a weak field concept, and one more displayed signaling to tune using CM and DM concepts to de-couple the antenna members. Looking at the self-isolation MIMO antenna system's ostensible benefits is necessary.Various self-isolation-based approaches are offered in literatureThe mixed-coupling effect using the close coupling technique is introduced and managed without additional de-coupling circuits with the neighboring members. The magnetic and electric coupling combination agreements surface current cancellation and provide self-isolation.The central concept is to equilibrium the coupling between the antenna members employing stretched arms adjusting mixed-coupling among the elements.The presented structure is compressed, likened to earlier papers because the system's tightly coupling designed structure attains the self-isolation result. The monopoles of the antenna are placed close together to offer sufficient capacitive and inductive coupling to the other element.The proposed MIMO antenna members are easily extended to more than a 2-member array due to the compactness and easily integrable of the proposed design structure.The flexible integrability of waveguide and coaxial feed is achieved easily due to compactness and self-isolation scenarios as presented in the design.g at 3.8\u00a0GHz).The MIMO antenna self-isolation characteristics deal with isolations better than 16\u00a0dB for the 2-members structure and 20\u00a0dB for the 8-members design throughout the operating band. The shortest distance among antenna members is about 0.2\u00a0mm  antenna can offer the 3.5\u00a0GHz band (3.2\u20133.98\u00a0GHz), and the 8-member MIMO (M-shaped) antenna can cover the 3.5\u00a0GHz band (3.29\u20133.66\u00a0GHz), which is directed for the approaching 5G band for sub-6\u00a0GHz range. MIMO antenna pair with a common ground to develop MIMO antenna integration levels and house the upcoming 5G systems. The mobile frame-based eight members MIMO antenna example is presented with user hand effect analysis.The self-isolated closely coupled MIMO (M-shaped) antenna member is represented in Fig.\u00a04\u00a0dB isolation of coupled antenna members offered at the center frequency. The length I5 of the T-pattern configuration adjusts the center frequency, as presented in Fig.\u00a0In the initial configuration, a T-pattern member is employed in the MIMO antenna projected as AntI, as shown in the inset of Fig.\u00a00.2\u00a0mm (0.005\u03bbg at 3.8\u00a0GHz). The customized arm of the presented structure provides sound isolation among the antenna members with the help of ground cuts I6, and I7.In the next evolution, the T-pattern structure is customized as AntII, as shown in the inset of Fig.\u00a0The passive matching circuit is used to comprehensively analyze the projected self-isolated MIMO antenna. The MIMO antenna suffers coupling owing to capacitive and inductive influences between the members. The inductive and capacitive effects occur due to the adjustment of the structure. The maximum electric field between the members offers capacitive coupling, and magnetic fields at the edge of the customized design offer inductive coupling. This effect can be manipulated deliberately and abolish the coupling between the pair of members with the same magnitude with the help of surface current. The close-coupled arm of the antenna member produces surface currents to the equilibrium of the coupling introduced by the nearby antenna member. The following section describes the self-isolated designed MIMO (M-shaped) antenna matching passive circuit to determine the appropriate configuration.28. The antenna members are represented by members L1, C1, L2, and R2. The coupling among the antenna members is presented inside the dotted red box as mutual admittance Y21,Cou, consisting of L3, C3, LM, and CM. The coupled antenna members consist of two coupling types (inductive and capacitive). The mixed inductive and capacitive coupling is represented in parallel circuit members. To cancel these couplings, conscious tuning is required. The coupling among antenna members is defined stated as CM and LM for capacitive and inductive coupling matching. In this instance, the mutual couplings CM and LM are capacitors and inductors among antenna members. The impact of the coupling influence can be analyzed using an enclosed circuit inside the red box. The mutual coupling influence of the proposed MIMO (M-shaped) antenna is confined in Fig.\u00a021,Cou the coupling admittance needs to be modified; this helps to strengthen Y21 total mutual admittance. The Y21,Cou can be signified as:The matching passive circuit is used to explain the concept of the projected MIMO antenna's structure, presented in Fig.\u00a0L3, CM, and LM adjusting can cancel out Y21,Cou at a particular frequency. The circuit component values are estimated with the help of the Keysight ADS Simulator, and circuit values are listed in Table R2 are \u03a9, L1, L2, L3, LM, are in nH, C1, C3, CM, are in pF, and Y21,Cou in mho. The Y21,Cou mutual admittance at the middle frequency of AntI, and AntII is -j4.057 and \u2013j0.908, respectively. This displays good cancellation between the self-isolated MIMO antenna. The projected MIMO antenna 3D model and the phase plots and S-parameters simulated results of the matching passive circuit are shown in Figs.\u00a0Here \u03c9 represents radian frequency. The parameters I4 differs from the self-isolated MIMO (M-shaped) antenna's central frequency. It is explicable because I4 is the size of the radiating arm of the AntII. It is also noticeable that the isolation of the members is also tuned with it as well. The arm's width also impacts the S-parameters of the MIMO (M-shaped) antenna described in Fig.\u00a0I6 and I7 also helps to adjust the isolation of the MIMO antenna. The parametric variation due to I6 and I7 are illustrated in Fig.\u00a0It is realized from Fig.\u00a0I4, W4, I5, and I3 dimensions. The closely coupled arms of the MIMO members help improve the structure's isolation by coupled surface current neutralization, as demonstrated in Fig.\u00a0The customized M-pattern MIMO system performance can be improved by appropriately choosing the The projected customized M-pattern MIMO antenna radiates at 3.8\u00a0GHz with more than 25\u00a0dB isolation. The introduced MIMO antenna radiates from 3.5-4\u00a0GHz with an isolation of more than 15\u00a0dB. After the evolution of the customized MIMO (M-shaped) antenna, the improved dimensions are shown in Fig.\u00a0Although the antenna members are tightly connected, this mixed coupled procedure enables the self-isolated characteristic of the offered MIMO antennas. An 8-member MIMO (M-shaped) antenna system is additionally validated for 5G systems, where the experimental results authenticate the viability of the projected technique.As discussed in the last segment, the 2-member MIMO antenna presents self-isolating properties with excellent isolation in compact dimension isolation using mixed-coupling. These antenna member pairs can be extended to each side of the frame using a similar structure or the customized design shown in this section.140\u00a0mm\u2009\u00d7\u200970\u00a0mm\u2009\u00d7\u20091.6\u00a0mm, while the ground size is similar to the dimension of the system with defects. A pair of closely coupled MIMO antennas are designed in the proposed system located at each side of the frame. The pair's orthogonality can help to improve the isolation among the other pairs of self-isolated MIMO antennas.The closely coupled compact self-isolated 8-member MIMO antenna member is described in Fig.\u00a00.0047\u03bbg (0.2\u00a0mm) at 3.45\u00a0GHz. The Ant1 radiates from 3.26\u20133.6\u00a0GHz, and the Ant5 radiates from 3.26\u20133.63\u00a0GHz. The minimum isolation in the projected 8-member MIMO antenna is 17\u00a0dB at 3.45\u00a0GHz.The MIMO antenna comprises dual pairs of similar M-pattern antenna members , as shown in Figs.\u00a0The radiating frequency and isolation of the MIMO (M-shaped) antenna adjust along with the dimension of the M-pattern arm and ground defects; some parametric outcomes associated with the design process are shown in Fig.\u00a0The closely-coupled improved MIMO antenna is manufactured with the help of the S63 LPKF Machine, shown in Fig.\u00a0S-parameter results of the optimized closely coupled M-pattern MIMO antenna are matched with the simulated in Fig.\u00a029. The assessed outcomes validate that the projected MIMO (M-shaped) antenna system has high efficiency and excellent isolation.The polar plots of recommended 2-member closely coupled customized M-pattern MIMO antenna are assessed at 3.65\u00a0GHz, as demonstrated in Fig.\u00a030. The 3D E-fields measured for assessing ECC, as presented in the formula in 2. The projected design ECC is demonstrated in Fig.\u00a031.ith antenna e-fields, when another antenna in the design is fitted with the matched load of 50\u2126.Consequently, the ECC of the self-isolated 2-member MIMO (M-shaped) antenna is evaluatedCloss). The maximum information rate that may reliably be transmitted through the channel characterizes the channel's capacity, matter-to-channel properties, and the radiation from the antenna. The formula shown as 3 can be used to evaluate the MIMO antenna Closs., as explained in32. Its estimate is below 0.0125 b/s/Hz, as displayed in Fig.\u00a0i, j\u2009=\u20091 or 2.The supplementary important diversity characteristic is the channel capacity loss (The 8-member tightly coupled MIMO (M-shaped) antenna is manufactured utilizing the LPKF machine, as displayed in Fig.\u00a018. The system dimension is 143.2\u00a0mm\u2009\u00d7\u200973.2\u00a0mm\u2009\u00d7\u20091.6\u00a0mm, while the ground plane size is 140\u00a0mm\u2009\u00d7\u200970\u00a0mm . The pairs of antenna members are arranged similarly to an 8-member system in mobile frame, with a depth of 1.6\u00a0mm and a height of 10\u00a0mm. The frame of the antenna considered during design is an FR4 substrate. The S-parameters simulated results of the mobile frame-based MIMO (M-shaped) antenna are presented in Fig.\u00a0Figure\u00a0The user\u2019s hand effects are analyzed foresight member mobile frame-based MIMO antenna. CST Microwave Studio, the single-handhold arrangement, examines and simulates the proposed antenna. The simulation-based user hands model's front and back views are presented in Fig.\u00a022, the projected antenna introduces a good reflection coefficient and isolation without a physical link. Other works17,21 utilize the current elimination or reorganization method to enhance the isolation with lesser bandwidth assessed to the projected design. In work19, weak field and space diversity methods achieve isolation for limited bandwidth. The asymmetrical arrangement achieves low impedance bandwidth and low isolation with better efficiency20. Coupling is terminated by nearby coupling and coupling elimination method for restricted bandwidth24.Above that, the self-isolation antenna design is compared to nearly earlier work in Table In this article, a compact and straightforward self-isolated MIMO (M-shaped) antenna is offered by putting together M-pattern members nearby. It has been established that high isolation is attained due to the closely coupled members canceling out the coupled members' surface currents. The 2-member MIMO antenna radiated a 3.2\u20133.98\u00a0GHz frequency range with 16\u00a0dB isolation, and in the frequency range of 3.5\u20133.82\u00a0GHz, more than 20\u00a0dB isolation occurred. The diversity characteristics ECC of this antenna are healthier than 0.175. The suggested M-shaped self-isolation MIMO design method can be utilized for a larger array size in MIMO. The 5G application 8-member MIMO antennas are explored in simulation and measurement to validate that. The 8-member MIMO antenna offers 20\u00a0dB isolation in the 3.29\u20133.66\u00a0GHz frequency band. The antennas can provide good return loss and isolation with decent diversity characteristics. With the rewards of self-isolation, common ground, wide bandwidth, simple structure, and high efficiency, the projected 5G smartphone arrangement of MIMO antenna design exhibit a promising future."}
{"text": "A triple-band substrate integrated waveguide (SIW) with dielectric resonator antenna (DRA) for fourth-generation (4G) and fifth-generation (5G) applications is proposed and analyzed in this paper. Loading SIW with DRA allows for a wide bandwidth, low losses, and fabrication ease. The proposed antenna can transmit and receive data independently by covering LTE Band 3 at 1.8 GHz, LTE Band 8 at 2.6 GHz, and 5G n77 at 3.7 GHz. A U-shaped cut is applied to achieve the targeted multi-resonance frequencies. The antenna obtains high bandwidths of up to 19.50% with 4.9 dBi gain and 81.0% efficiency at 1.8 GHz, 6.58% bandwidth with 4.4 dBi and 72.7% efficiency at 2.6 GHz, and 8.21% bandwidth with 6.7 dBi and 73.5% efficiency at 3.7 GHz. The simulated and measured results agree well. The proposed antenna is feasible for 4G and 5G applications. An antenna with a compact size and multiple bands is preferred in this modern era of wireless communication ,2. SubstDielectric Resonator Antennas (DRAs) are used extensively in the electromagnetic field in comparison to microstrip antennas because of their superior qualities such as higher radiation efficiency, higher gain, and greater bandwidth . SeveralIn this paper, a rectangular DRA excited by a U-shaped cut in SIW is presented for 4G and 5G applications. The U-shaped cut is -utilized to generate multi resonance frequencies. The simulation of the presented antenna is performed with the help of Ansoft HFSS version 2019. This article is structured as follows: The proposed antenna\u2019s design specifications and the development of the antenna design are covered in A 3D model view of a single port SIW with a DRA is shown in It is excited in its respective mode by the U-shaped cut configuration, which is located in the top wall of SIW and operates in  and (6) :(5)wd=w\u03b5Equation (7) is further refined by including d/ameter d .(7)WsiwThe metalized via holes are designed to create SIW. The SIW consists of two rows of metallic vias of diameter, d and separated by a distance, p. To keep energy leakage to a minimal , the valTo avoid any bandgap effects in the operating bandwidth, the following equation should be calculated :(11)p\u03bbc<One end of the SIW is short-circuited to produce standing waves inside the SIW . A microSix different antenna configurations of the single-port SIW with a DRA are investigated to resonate at 1.8 GHz, 2.6 GHz, and 3.7 GHz to cover the sub-6 GHz frequency for the 5G wireless communication system while also being backwards compatible with 4G bands. The evolutions of the proposed antenna in top view and reflection coefficient are depicted in Based on The SIW with a transverse cut is then loaded with a DRA and placed in the SIW\u2019s centre, and the antenna is denoted as \u2018ANT A\u2019 in As depicted in In y-axis need to be properly chosen as they affect the coupling of energy to the DRA element. Based on \u2018ANT D\u2019 presents the proposed antenna design as shown in The reflection coefficient between the U-shaped cut SIW antenna and the proposed antenna has been compared in In this work, the reflection coefficient of U-shaped cut is compared to Z-shaped, inverted Z-shaped, H-shaped, and inverted U-shaped is depicted in In this section, the influence of design parameters on the bandwidth response of the proposed antenna has been carried out. Parametric studies are conducted for optimal parameter selection. Firstly, the effects of U-shaped cut size and its position are studied to determine the best coupling to the DRA. x-axis, sx has a negligible effect on the bandwidth at the three frequency bands. The only difference is the shift of resonant frequency at lower frequency band when sx increases. When sx = 0 mm, the antenna resonates at 1.8 GHz sharply where the maximum electric field flows through y-axis, sy affects the reflection coefficients at the lower and upper resonant frequencies only. A decrease of sy shifts both resonance frequency of lower and higher frequency bands to lower. When the U-shaped cut is not too close to the microstrip transition where sy = \u22122 mm, it has the widest impedance bandwidth at 1.8 GHz and is resonating at 1.8 GHz and 3.7 GHz.Based on The length and width of the DRA, denoted as x1 and y1 in x-axis, x2 has a negligible effect on the reflection coefficient at the three frequency bands. However, a change in DRA position in y-axis, y2 affects the reflection coefficients at the middle resonant frequency. When y2 = \u22122 mm which is closer to the microstrip transition, it gives the best coupling of the energy for the U-shaped cut to the DRA element at 2.6 GHz. Based on The top and bottom views of the prototype of the single port SIW with a DRA are shown in All simulated radiation patterns point in broadside directions for all three frequencies except the E-plane radiation pattern at 2.6 GHz, which points at 45\u00b0, as shown in A multiband SIW with a single-element DRA is designed, fabricated, and tested. The U-shaped cut is used to enable multi-band operation at frequencies of 1.8 GHz, 2.6 GHz, and 3.7 GHz while providing a compact antenna size. The proposed antenna demonstrates a high bandwidth and a good gain at each frequency band. The simulated and measured results agree well. This research can be extended by applying Multiple-Input Multiple-Output (MIMO) technology by utilizing multiple antennas at the transmitting and receiving ends of the communication system  to comba"}
{"text": "Beam-switching is one of the paramount focuses of 28 GHz millimeter-wave 5G devices. In this paper, a one-dimensional (1D) pattern reconfigurable leaky-wave antenna (LWA) was investigated and developed for wireless terminals. In order to provide a cost-effective solution, a uniform half-width LWA was used. The 1D beam-switching LWA was designed using three feed points at three different positions; by selecting the feeds, the direction of the beam can be switched. The antenna can switch the beam in three different directions along the antenna axis, such as backward, broadside, and forward. The 1D beam-switching antenna was fabricated, and because of the wide beamwidth, the measured radiation patterns can fill 128 Increasing demand for high data throughput and reliable mobile services has motivated the development of the 5G mobile communication standard ,9,10,11.Various antennas have been reported so far for 5G millimeter-wave communications. For example, a dual, linearly polarized antenna element with four substrate layers and three films for bonding was proposed in . Then, fications . The 5\u00d75posed in . The gaiposed in , a squarposed in , a quasiposed in  for applguide in . Sixty pantennas ,40,41,42antennas ,44,45. LTo avoid the above-mentioned issues and enable a cost-effective solution for wireless terminal beam-switching antennas in the millimeter-wave frequency range, a low-cost yet effective solution is presented here. The losses associated with the switching used in this work are negligible. Firstly, a 1D beam-switching antenna was designed using a single radiating element with three feed points at three different positions. Two antennas were then placed at a right angle to achieve 2D beam switching. Both 1D and 2D beam-switching antennas were fabricated and measured. The 2D beam-switching antenna has continuous 3 dB coverage from The objective was to design a simple beam-switching antenna for 28 GHz 5G wireless terminals. It is known that a uniform leaky-wave antenna (LWA) scans the beam in the off-broadside region  of the microstrip line is 54.4 mm or 5.1As shown in tor at I a is termL = 5.1The antenna in ented in , is showL = 5.1The normalized x-z plane radiation patterns of the HW-MLWA with length  = 5.1\u03bb0 a are shoirection . With a L = 19.2 mm or 1.8For millimeter-wave wireless devices, we need a shorter antenna that takes only a small area of the printed circuit board (PCB) since a wider beam is preferred. It is observed from the surface current distribution in L = 1.8The input reflection coefficient of the LWA  in addition to point T. For this purpose, in Step 3, the two loading vias are removed, and the corresponding reflection coefficient is shown in The absence of loading vias has a very negligible effect on the y-z plane radiation patterns within the frequency range of 27\u201330 GHz. Here, we compare the radiation patterns of the antenna in the frequency range of 27\u201330 GHz with loading vias see b and witThis section presents the design of a 1D beam-switching antenna for 28 GHz 5G wireless terminals, which can point to the beam in three different directions along the antenna axis.The properties of the previous two antenna designs are incorporated into a single antenna to achieve 1D beam switching using a single radiating element.The antenna is fed at three different locations, i.e., left feed (LF), right feed (RF), and center feed (CF), as shown in The two steps of evolution of the 1D pattern reconfigurable antenna are depicted in In Step 2, an arrangement for the center feed is added to the antenna together with a trapezoidal patch, which is aligned to the free edge GU, as shown in The effect of the CF on the HPBW of the antenna in x-z and y-z planes when LF/RF is \u2018ON\u2019 is presented in When a side feed LF/RF is \u2018ON\u2019, the center feed restricts energy traveling towards the other side of the antenna see a. TherefTo validate the 1D antenna concept, a prototype was fabricated and measured. It is shown in The measured S-parameters of the 1D pattern reconfigurable antenna are shown in The measured transmission coefficients  with dimensions of 120 mm \u00d7 70 mm is shown in From the S-parameter measurements, we found excellent agreement between the predicted and measured results and, hence, for better presentation, only measured results are shown here in The measured transmission coefficients  radiating antenna was designed for the 28 GHz millimeter-wave band. Following that, an antenna was designed for radiating in the broadside direction. Using the properties of both antennas, a novel single-element LWA with three ports was developed to achieve 1D beam switching. The 1D beam-switching antenna was prototyped and tested to prove the concept. Using the three feeds, the beam can be pointed at"}
{"text": "In this study, an antenna with transparent super wideband CPW technology has been designed and built with the combination of solar panels for use in wireless communication equipment and systems that require mobile power. The transparency value of the antenna is 63.3%, which is an acceptable value for the optimal use of sunlight. The proposed antenna was designed and measured on a plexi-glass substrate with a dielectric constant of  Radio technology using the ultra wideband (UWB) has the ability to transfer data faster across small distances. UWB antennas are helpful for biomedical applications like imaging lung cancer5. Recently the use of SWB frequency range has received attention to the point that can cover and provide short and long-range data transmitting services8.Microstrip Antenna has recently attracted attention, due to its unique characteristics such as including its wide width, tiny size, straightforward construction, and ease of adaption. A range of 3.1\u201310.6\u00a0GHz was allocated to such means by (FCC) which is now familiar to ultra wideband (UWB) designers9. Furthermore, short-long-range transmission systems and the new generation of telecommunications can employ antennas with a broader bandwidth10.Super wideband (SWB) technology can be utilized for rapid sound and video transfer since it has a broad bandwidth and a large range of data capacity. Currently, this technology is employed for controlling and supervising purposes in both the private and military sectors. SWB in comparison to UWB has a bigger channel capacity, better timing accuracy, and higher image resolutionThe nominal bandwidth, which is the difference between Higher frequency (11. UWB antennas have been the subject of extensive research. Ultra-wideband (UWB) communications provide a large bandwidth with a high data rate, low transmission power with lengthened battery life and secure communications, and short pulse time modulation with reduced multipath fading. Also, UWB technology has many applications such as localization, imaging, radars, wireless body sensor networks, and short-range large bandwidth communications15. These works have focused on the microscopic SWB geometry and its use in contemporary communications. For example, In16 personal wireless UWB monopole antenna was designed for the Bandwidth of 135.2%, and the usage of 79.21%. In17 the author designed\u00a0a practical antenna that may be utilized for WIMAX/WLAN/ISM and other wireless applications with a bandwidth of 153.22% and a bandwidth fraction of 86%. In18, a monopole antenna with a Bandwidth of 3.1\u201310.6\u00a0GHz and 82.22% is the efficiency of the higher band has been designed for wireless. In19, a UWB antenna with two circles of connected lines was designed in a frequency Band of 3.85\u20130.55\u00a0GHz with a 90.1% efficiencies. Finally, in20 a monopole antenna with a zigzag shape for an access to 102% is designed to be employed in communication processes.Here 21. A slotted waveguide antenna with a radiation rate of 88% was presented. A slotted waveguide antenna with a radiation rate of 88% was presented. The proposed antenna has a small size of 30\u00a0mm\u2009\u00d7\u200935\u00a0mm, a simple geometry, and the excitation is launched through a 50\u00a0\u03a9 microstrip feed line22. The use of fractal geometry in antenna design provides a good method for achieving the desired miniaturization and multi-band properties. In this communication, a multi-band and broad-band microstrip antenna based on a new fractal geometry is presented. The proposed design is an octagonal fractal microstrip patch antenna. The results show that the proposed microstrip antenna can be used for 10\u201350\u00a0GHz frequency range, i.e., it is a super wideband microstrip antenna with 40\u00a0GHz bandwidth23. All of these antennas employ a monopole micro strip that has a UWB bandwidth of 40\u00a0GHz (50\u201310\u00a0GHz), which can easily be made by precisely constructing a microwave and solar cell combination that is useful for satellite and ground applications. For ground purposes, it has led to expanding the automatic integrated system in driver-less cars24.An antenna with line (TL) loaded, compact, ultrawideband (UWB) square slot antenna is a radiation efficiency of 79.21% has also been designed for personal wireless communication systems. The square slot is a microstrip line fed and loaded with an array of periodically perturbed TLs to achieve a UWB response from 2.1 to 11.5\u00a0GHz25 This antenna was made of an expensive luminous conductor film AGHT-4 with a minimum visible light transfer of 75%. The suggested antenna cannot be utilized in multi-band or broadband communication systems since it is only designed for a single frequency band with an impedance bandwidth of 4.3%. In26, a super-wideband antenna based on a propeller shaped printed monopole with CPW feed is presented. The enhanced bandwidth is obtained by modifying the disk of a conventional circular disk monopole to resemble a propeller. This design produces an extremely wide impedance bandwidth from 3 to 35\u00a0GHz with an impedance bandwidth ratio of 11.6:1. The gain of the proposed antenna varies from 4 to 5.2\u00a0dB. In27, a MIMO antenna with a circle ring of coating of silver-tin alloy radiation patch over a layer of plexi-glass is recommended. This antenna features a 3.7\u00a0GHz WLAN and a 2.4\u00a0GHz WIMAX. The employment of silver-tin-alloy as a radiator has a negative effect on radiation performance, in addition to the high cost and complexity of production, and the researchers have proposed a solution in the form of MIMO in this study to solve this issue. In28, a printing technique on glass is used. the mask-covered glass uniformly with the photolithography technique. Finally, due to the thickness the of the glass, no negative effects happened to the Pyrex glass while printing ink of silver. The practical accuracy of fabrication is 0.02\u00a0mm for the mask and etching mechanism. the metallic pattern screen is plated with silver on the glass.Recently a significant volume of research has been done in designing solar antennas with smaller sizes and the capability of producing DC voltage while transferring microwave signals. As an example we refer to the microstrip transparent antenna inIn this paper, we present a transparent super wide band antenna with solar-cells. At the first step we designed the antenna on a FR4 substrate. Next, transparent plexi-glass was used as a transparent substrate. In previous works, metal oxides is used for the construction of radiation part, which can interfere with the antenna radiation function. In our case, a layer of copper sheet that is precisely cut by CNC laser is used. This antenna can be used in satellite with its solar cells. It can also be utilized in vehicles glasses, wireless CCTV cameras and wherever there is a need for electrical power supply beside antenna. We will discuss this in the future.We design this antenna with CPW feeding Technology. As shown in Fig.\u00a0mentclass2pt{minimAs shown in Fig.\u00a0As a method of achieving this goal based on prior research Fig.\u00a0C, we attFigure\u00a0In figure Fig.\u00a0In this section, we use a substrate from FR4 to plexi-glass the antenna will be transparent and allow the light to pass through it. Plexi-glass has high resistance against different climates. It is cheap, and therefore a good choice to be used as a lucid substrate. We used the usual plexi-glasses available in the market, with In Fig.\u00a0In Fig.\u00a0Figures\u00a0According to the diagram in Fig.\u00a030.The efficiency of the antennas in Fig.\u00a0With respect to the availability of plexi-glass in different sizes in the market, we have used different sizes of plexi-glass 33\\documenFor calculating the correlation coefficient, we choose the wide band Gaussian pulse as the input transmitter signal for the antenna, As shown in Fig.\u00a035. In other words, if in practice the group delay is approximately constant it provides the characteristics for the acceptable PULS, Eqs.\u00a022\\documen38. Group delay waves are related to weal Bandwidth application.In Eq. , \\docume39.Two similar antennas across each other with 30\u00a0cm distance. in parts a, b and c, takes values 0, 45 and 90 degrees respectively according to Fig.\u00a0The graph showing the phase variation of Fig.\u00a0Multiple-input-multiple-output (MIMO) is a method of wireless communication systems using multiple transmission and receiving antennas. With this feature, the user can use two or more antennas to reduce the sending and receiving information delay and increase the speed of communication using the specified channel. In this section as it is shown in Fig.\u00a040. This measure can be computed using complex patterns 42. When 44. This technique is also discussed in45. MEG in46 is calculated from the results of the S parameter using Eq.\u00a0. Lower TARC values indicate better antenna performance and improved efficiency. TARC values is verified using a single phase and randomly, on the interval [0\u2013180] degree46. Figure\u00a046.TARC is defined as the square root ratio of the total reflective Power divided by the root of the total power in a multi-port antenna system51. This value is less than the standard practical 0.4 Bit/S/Hz for the antenna working frequency and this fact confirms the high throughput of the proposed antenna.MIMO antennas, for using huge amount of data in a limited channel and supplied channel capacity is the maximum data rate through which through which the signal can pass using MIMO channel. CCL is an important criterion for analyzing and verifying channel capacity functionality. The CCL parameter provides details of the wasting capacity of the systems channel along the correlation effect. CCL is calculated numerically using Eqs.\u00a0 and 21)21). The In previous researches, metal oxide has been used to make the radiating part of the antenna. Due to its low conductivity, this oxide creates interference in the operation process and radiation pattern of the antenna. In addition, the difficulty of production and costly manufacturing have been among the problems of this method. We have used copper sheet for the antenna\u2019s ground and radiating sections due to its availability, low cost, and convenience of fabrication, as well as the fact that lines with low resistance attenuate signals less than lines with high resistance. These sheets are cut by CNC laser machine with 0.02\u00a0mm precision. Since copper sheets come in a variety of thicknesses, the simulation shows that the with a thickness of 0.04\u00a0mm for a sheet, is the most suitable thickness to take into account for antenna building. Also, according to the simulation results, the thickness of Plexi-glass is considered to be 1\u00a0mm. Figure\u00a0Figure\u00a06.The proposed antenna is compared with previously reported ultra wideband (SWB) antennas in terms of electrical dimensions, operating frequency range, operating bandwidth (BW), bandwidth aspect ratio (BDR) peak gain and substrate material. Table wing Eq.\u00a0:Table 4AHere In this paper a transparent antenna with CPW structure was designed and verified for ultra-band width application and fine tuning parameters for impedance bandwidth expansion is implemented. A ground plane and radiation patch with several cuts were used for the sake of antenna transparency and impedance bandwidth. The proposed structure for the antenna reduces to BDR 2450 which represents a comparatively high BDR in comparison with the previously proposed structures. This fact confirms the wide bandwidth and compactness of the antenna. The proposed structure guarantees that the simulated frequency ranges from 2.9 to 29.2\u00a0GHz The measured frequency range of the produced sample antenna is matched with the simulated sample. The interest of the antenna ranges from 1 to 8.1\u00a0dB. The antenna efficiency is overall the working frequencies. The antennas specification is verified and checked with and without solar cells. This verification shows that solar panels have a tiny negative impact on antennas gain and have a huge positive effect on antennas bandwidth. Electrical dimensions, operating bandwidth (BW), bandwidth ratio (BWR), gain peak and beneath antenna substance were compared with the previous designs and schemas. We observed that the proposed antenna is performing optimally in comparison with other designs. Furthermore, to ensure that antenna is performing optimally we have tested and checked the antenna using a MIMO schema. At this step all of the vital parameters of the MIMO antenna such as electrical correlation coefficient (EEC), mean effective gain, diversity gain, total active reflection and channel capacity loss (CCL) is checked and the acquired appropriate/optimal values verify the optimal performance of the antenna in MIMO form. Due to these advantages, the designed antenna is applicable in wireless communication systems such as L, S, C, X, Lca, K, Ka and Q. In this article, transparent plexi-glass is used as a transparent substrate. The use of a transparent substrate, which has made the antenna transparent, and this feature has made it possible to use solar cells in the antenna. In addition to improving the performance of the antenna and the main characteristics of the antenna, the use of Plexiglas substrate has reduced construction costs by 10 times compared to other substrates. This substrate can be introduced as a cheap substrate with high resistance and high transparency. In previous papers, for the construction of the radiation part, metal oxides were used which, could interfere with the antenna radiation function. In this antenna, a layer of copper sheet that is precisely cut by a CNC laser is used. This antenna can be used in satellites with solar cells. It can be applied in vehicles glasses, Wireless CCTV cameras and wherever there is a need for an electrical power supply beside an antenna. The wideband transparent antenna has potential applications across various sectors including remote energy supply, wearable technology, and solar energy recovery. A plausible application for implementing a super wideband transparent antenna on a solar cell for self-driving cars is to enhance the vehicle's connectivity and communication systems. with regards to wearable technology, embedding the transparent antenna in clothing or other wearable devices could facilitate seamless connectivity without the need for bulky wires or antennas. This would be particularly useful in remote areas where traditional power sources are not available. Additionally, the transparency of the antenna would allow more light to pass through to the solar cell, further increasing its efficiency. This technology could be used in various applications such as in space exploration, where solar power is often used as a primary source of energy .Supplementary Information."}
{"text": "The manuscript presents a novel approach to designing and fabricating a stretchable patch antenna designed for strain sensing and the wireless communication of sensing data at the same time. The challenge lies in combining flexible and stretchable textile materials with different physical morphologies, which can hinder the adhesion among multiple layers when stacked up, resisting the overall stretchability of the antenna. The proposed antenna design overcomes this challenge by incorporating a lattice hinge pattern into the non-stretchable conductive e-textile, transforming it into a stretchable structure. The innovative design includes longitudinal cuts inserted in both the patch and the ground plane of the antenna, allowing it to stretch along in the perpendicular direction. Implementing the lattice hinge pattern over the conductive layers of the proposed patch antenna, in combination with a 2 mm thick Polydimethylsiloxane (PDMS) substrate, achieves a maximum of 25% stretchability compared to its counterpart antenna without a lattice hinge design. The stretchable textile antenna resonates around a frequency of 2.45 GHz and exhibits a linear resonant frequency shift when strained up to 25%. This characteristic makes it suitable for use as a strain sensor. Additionally, the lattice hinge design enhances the conformability and flexibility of the antenna compared to that of a solid patch antenna. The realized antenna gains in the E and H-plane are measured as 2.21 dBi and 2.34 dBi, respectively. Overall, the presented design offers a simple and effective solution for fabricating a stretchable textile patch antenna for normal use or as a sensing element, opening up possibilities for applications in the communication and sensing fields. Recent adaptations of smart systems for on-body wearable applications for human well-being, health monitoring, and observing human movements have grabbed attention ,2. FolloThe use of multifunctional devices also minimizes the problem of complex wiring, which is prone to damage and is required to acquire sensory data in wearable smart systems. Similarly, a wearable system with multifunctional devices can solve integration challenges with any garment ,21. ConsThis manuscript presents a fully textile-based, flexible, and stretchable antenna. Our proposed work focuses on fabricating a stretchable textile patch antenna for strain sensing and communication, which can be used in wearable applications. Furthermore, we present a novel and simpler method for fabricating a stretchable antenna on a non-stretchable e-textile fabric. Our research follows an adapted and simplified antenna design, making it an interesting progression. The antenna is realized using a non-stretchable turned stretchable e-textile fabric, accompanied by a transparent, flexible, and stretchable non-conductive polydimethylsiloxane (PDMS) substrate.This paper is organized as follows: In recent years, several stretchable antennas have been developed ,23,24. TVarious conductive materials have been employed to construct stretchable antennas, including Silver-Polydimethylsiloxane (Ag-PDMS) composites, metal nanowires, and liquid metal alloys. However, the poor conductivity of these materials remains a significant concern ,27,28. WTo fabricate a stretchable patch antenna, one option is to use conductive and dielectric materials that have a stretchable character. However, this way of constructing a stretchable patch antenna is difficult, as neither the conductive and dielectric materials will not be compatible in their stretchability. One will offer more stretchability than the other when sandwiched together in a patch antenna shape. Alternatively, the antenna design itself can be modified to allow for an extra amount of stretching, or a combination of both approaches can be employed. Each method of fabricating a stretchable antenna has its advantages and limitations. In recent developments, in an example where an antenna design was modified for a patch antenna to obtain stretchability, optimally patterned 3D structures such as serpentine and helical coils made from conventional non-stretchable materials like copper foil were utilized for fabricating stretchable patch antennas ,17. ThesOther recent advancements in the field of stretchable antennas include the use of serpentine structures , materials such as silver nanowires (AgNWs), and liquid metal alloys ,32,33,34Our research proposes a simpler, easy, and novel method for fabricating stretchable textile-based antennas, based on transforming plain conductive layers of a patch antenna into lattice hinge design (LHD) conductive layers. The structure of an LHD and its design parameters are shown in One significant advantage of using e-textiles with a lower surface resistivity is the reduced cost of integrating antennas into garments. Additionally, our proposed LHD-based stretchable antenna fabrication method offers minimal change in its electrical performance while providing stretchable characteristics. The distinguishing feature of our research from the existing stretchable antenna literature lies in the simpler and novel technique employed to create a fully textile stretchable antenna. This work can be further extended by exploring different design patterns to convert non-stretchable materials into stretchable ones.The selection of both conductive and non-conductive/dielectric materials for fabricating a stretchable antenna was primarily based on the factor of stretchability. In the recent literature, a variety of dielectric materials commercially available, such as Ecoflex, Solaris, and PDMS, have been utilized to fabricate stretchable antennas ,38,39,40\u00ae Technik-tex P130 +B by Statex Produktions, Bremen, Germany) was chosen because of its highly stretchable nature and lowest possible surface resistivity among the other commercially available knitted structures. This silver-plated knitted fabric is composed of 78% polyamide and 22% elastomer, with a coating of 99% pure silver. However, this fabric has a surface resistivity of 2 Ohm/square (\u03a9/sq) and a conductivity of 909 S/m, significantly lower than those of a standard copper metal sheet with a conductivity of 5.96 \u00d7 107 S/m. Both a basic patch antenna prototype (without the LHD) and an LHD patch antenna prototype were simulated and fabricated to observe their behavior upon stretching. While both antenna prototypes exhibited stretchability, the stretchability of the LHD antenna prototype was particularly better when experienced by hand. The fabricated antenna prototypes are depicted in Among the various fabric geometries, knitted structures are the most suitable for fabricating stretchable textile antennas due to their superior stretchability compared to woven and non-woven structures. This research begins with the selection of the knitted conductive materials to be used in the stretchable antenna fabrication. Initially, a commercially available, two-way, stretchable, conductive, silver-coated, knitted electrotextile  with better electrical conductivity and transformed it into an LHD for use in the stretchable antenna. A higher electrical conductivity is essential for any conductive material used in antenna fabrication, as it minimizes electrical losses and contributes to the improved EM characteristics of the antenna. \u00ae Technik-tex P130 +B and Shieldex\u00ae Kiel +30 conductive fabrics.As the selected Shieldex\u00ae, Washington, DC, USA) was prepared in a custom-made mold for fabricating the stretchable textile antenna. The PDMS was composed of two liquid components: the base and the curing agent, which were mixed in specific proportions (10:1). When the two components were thoroughly mixed, the mixture cured into a flexible and stretchable elastomer. The 10:1 mix ratio allowed for better control over the hardness and modulus, enabling improved stretchability and flexibility. With a higher Young\u2019s modulus of 1.5 MPa, PDMS demonstrated a better conformation with human skin for on-body applications and could withstand high deformations.Among a variety of dielectric materials commercially available, as mentioned above, PDMS was selected. The choice of PDMS as the dielectric antenna substrate was made as it is a transparent, stretchable, and hyperplastic polymer. It offers a higher viscosity of 3500 centipoise, which strengthens the interfacial bonding between the dielectric substrate and the e-textiles. A 2 mm thick layer of the PDMS substrate  and loss tangent (tan \u03b4) values needed to be known to simulate the final antenna prototype. To do so, an iterative process was employed, which involved changing the Er value and observing the corresponding change in the resonance frequency of the antenna at a 2.45 GHz operating frequency using CST Studio Suite 2019, an Electromagnetic and Multiphysics simulation software. During the antenna simulation, both the properties of the selected conductive and dielectric PDMS materials were defined in the CST simulator to characterize the dielectric PDMS substrate. A simple rectangular microstrip patch antenna was simulated using the specific dimensions (length and width) of the 2 mm thick PDMS dielectric substrate, with arbitrary values of Er and tan \u03b4 at the 2.45 GHz operating frequency. Subsequently, the antenna was physically fabricated. To compare the simulated results with the experimental results, the resonance frequency was measured using a Vector Network Analyzer (VNA). The difference between the resonance frequencies of the simulated and experimental antennas was initially observed. The Er value in the CST simulator was then adjusted accordingly to match the simulated and experimental resonance frequencies. Once the resonance frequencies coincided with the new Er value, it was considered to be the actual value for the PDMS substrate. The presence of substrate losses was reflected in a broader and less pronounced resonance peak in the return loss graph, with the depth of the peak indicating the level of the substrate losses. Similarly, the value of tan \u03b4 was manipulated to match the depth of both the simulated and experimental resonance frequency peaks. In this way, the dielectric PDMS substrate was characterized. The measured characteristics of the stretchable PDMS dielectric substrate at a frequency of 2.45 GHz are listed in The resonance frequency method was adopted to characterize the dielectric PDMS substrate ,41. The The microstrip patch antenna topology was chosen for its numerous advantages in wearable radio frequency applications. Planar patch antennas offer simplicity in design, lightweight construction, and easy integration into garments ,43. WhenIn wearable applications, the dimensions of the antenna play a crucial role in determining its operating resonance frequency. For the design of the LHD-based patch antenna, the length and width of the patch were calculated using the transmission line model. The physical dimensions of the antenna, particularly the patch length, were adjusted to achieve resonance at the desired frequency of 2.45 GHz during simulation.The antenna design and simulation were conducted at an operating frequency of 2.45 GHz using the CST Studio Suite. The overall dimensions of the proposed LHP stretchable antenna in this research work are listed in 3 (width \u00d7 length \u00d7 depth) using a Computer Numeric Control (CNC) machine. This mold was utilized to pour the liquid PDMS polymer, allowing it to take on the accurate shape specified above, as depicted in A mold was designed using AutoDesk Fusion, a modeling software, to shape the liquid PDMS polymer. The mold was created from high-density polyethylene with precise dimensions of 80 \u00d7 70 \u00d7 2 mm\u00ae Kiel +30 e-textile fabric using a laser cutter. Next, the liquid PDMS polymer was prepared and placed in a desiccator to remove any air bubbles. Once prepared, the PDMS was poured into a pre-prepared mold with specific dimensions and placed in a curing chamber set at a temperature of 60 \u00b0C. A few minutes into the curing process, the surface of the liquid PDMS polymer started to solidify, becoming sticky. At this stage, the pre-cut sample of the conductive ground plane was carefully placed onto the partially cured sticky surface of the PDMS polymer and left to continue curing. The PDMS polymer typically took around 50 min to fully cure at 60 \u00b0C. Once fully cured, the PDMS polymer sample, with the conductive ground plane layer adhered on one side, was peeled off from the mold. Finally, a thin layer of fresh liquid PDMS polymer was applied to the other side of the fully cured PDMS polymer, and the patch layer was deposited, leveled, and left to cure once again at 60 \u00b0C. Through these process steps, the fabrication of both solid patch antenna samples and LHP patch antenna samples was carried out. \u00ae Kiel +30 e-textile fabric facilitated better bonding with the PDMS polymer.The antenna fabrication process involved several steps. Initially, samples of the LHD for both the patch and the ground plane were cut from the ShieldexDuring the fabrication process, special attention was given to aligning the LHD links in the patch with the links in the ground plane. This alignment ensured that uniform stretchability was achieved throughout the fabricated antenna.Considering the limitations of the chosen conductive e-textiles and the fabrication method involving laser cutting, it was determined that the clearance between adjacent links in the LHD should not be less than 2.5 mm on the materials chosen for our research work. The laser cutting of the selected e-textile fabric in an LHD provided flexibility but reduced its strength when the clearance was decreased to below 2.5 mm. On the other hand, reducing the clearance between adjacent links significantly increased the flexibility and stretchability of the e-textile, albeit at the expense of its strength. The length of the lattice hinge link played a critical role in the stretchability of the antenna, with a longer link length resulting in better stretchability. During the simulation, a trade-off was observed between the length of the link and the electrical performance of the antenna at the chosen resonance frequency. The width of the link should be minimized to maximize the available area for inserting more links into the patch and ground plane. Increasing the number of links in the conductive layers of the antenna enhanced its stretchability.\u00ae Kiel +30 e-textile are depicted in \u00ae Kiel +30 e-textile fabric are shown in Furthermore, rough antenna samples were fabricated with varying thicknesses of the PDMS substrate, ranging from 1.5 mm to 3 mm. It was found that thinner substrates provided better overall stretchability but reduced the strength of the antenna when stretched, and vice versa. Therefore, a 2 mm thick PDMS substrate was finally chosen, as it sustained a reasonably good deformation during stretching. Front and back views of the fabricated solid patch antenna using the Shieldex\u00ae Kiel +30 e-textile fabric did not exhibit any stretchability, despite the stretchable nature of the PDMS substrate. However, in contrast, the experimentally fabricated LHP patch antenna using the Shieldex\u00ae Kiel +30 e-textile offered some stretchability. Additionally, the antenna showed improved flexibility when manually handled. Each antenna prototype was soldered with an SMA connector with a 50 \u03a9 characteristic impedance to provide power to the antenna through the microstrip feed line. It should be noted that the microstrip feed line in the LHP antenna was kept solid, without lattice hinge links, to ensure a robust connection to the SMA connector and enable a uniform flow of the input power.Based on the observation, the experimentally fabricated solid patch antenna using the ShieldexThe experimental characterization of the fabricated antenna prototype involved the use of a custom-made setup to evaluate its EM performance under uniaxial stretching. The EM performance of the antenna was assessed by measuring its S11 parameter at varying strain ranges. The S11 parameter represents the reflection coefficient of the antenna, indicating how well it can radiate power at a specific operating frequency. The power that was not reflected at the antenna\u2019s interface to the transmission line was either radiated or resistively dissipated. However, due to the good conductivity of the materials used, the dissipation was assumed to be very low, which will be confirmed by the radiation pattern measurements further in this paper. By measuring S11 during the stretching process, the antenna\u2019s performance under different strain conditions could be analyzed and evaluated. The radiation patterns of the fabricated antenna prototype were measured in an anechoic chamber, as depicted in To measure the S11 of the antenna at different strain ranges, uniform uniaxial tension was applied using laser-cut wooden block spacings. These block spacings represented the amount of applied strain and were placed between the main wooden clamps of the custom-made setup. By adjusting the spacing, different elongation ranges were achieved, allowing for the measurement of S11 at varying strain levels. To validate the experimental results, the antenna prototype was also simulated at varying strain levels using the CST studio suite. The simulation results were compared with the experimental measurements to assess the correlation between both the simulated and experimental results. This comprehensive characterization process helped to understand the antenna\u2019s behavior under strain and validate the effectiveness of the proposed design and fabrication methods.To see the effect of a change in the electrical properties  of the LHP stretchable patch antenna upon uniaxial stretching, the same custom-made tensile setup, as mentioned in \u00ae Kiel +30-based solid patch antenna. Both the simulated and experimental results, in terms of S11, showed resonance at the 2.45 GHz operating frequency. This indicated a good agreement between the simulated and measured data. On the other hand, \u00ae Kiel +30-based stretchable patch antenna. The reflection coefficient measurements showed dual frequency peaks at 2.18 GHz and 2.45 GHz, both in the simulated and experimental data, when the LHD was implemented.To measure the S11 of the fabricated antenna prototypes, a Vector Network Analyzer (VNA) was used. Before conducting the S11 measurements, a calibration process known as the short-open-load-through (SOLT) calibration was performed using a Keysight 85052D calibration kit. The SOLT calibration helped to establish a reference for accurate measurements by compensating for the inherent reflections and losses in the measurement setup. These results demonstrate the similarity between the simulated and experimental data, validating the accuracy of the simulation model and the successful fabrication of the stretchable patch antenna.During the design and simulation of the LHP stretchable patch antenna, it was observed that the resonance frequency shifted towards the lower end when the LHD was incorporated into the patch and ground planes of the solid antenna. This shift in resonance frequency indicated the possibility of tuning the antenna to the desired operating frequency of 2.45 GHz by changing the solid antenna into the LHD antenna. To achieve the same frequency tuning in conventional antennas, the resonance frequency can be adjusted by changing the length of the patch or the thickness of the substrate. In our research, the focus was to design and simulate the LHP stretchable patch antenna at an operating frequency of 2.45 GHz. To achieve the desired resonance frequency, the length of the newly formed LHP stretchable patch antenna was adjusted compared to the patch length of the solid antenna. The incorporation of the LHD allowed for the transformation of a solid patch antenna into a stretchable and tunable LHP antenna suitable for wearable applications.The simulations and measurements revealed two resonant frequencies, 2.18 GHz and 2.45 GHz for the LHD-based stretchable patch antenna. The current distribution on the LHD-based stretchable patch antenna is illustrated in It can be observed from The effect of applied strain on the change in the resonance frequency and reflection coefficient values for the fabricated LHP stretchable patch antenna at different levels of elongation is illustrated in \u00ae Kiel +30-based solid patch antenna at a 2.45 GHz resonance frequency in the (a) E-plane and (b) H-plane. The experimentally measured realized gains were 2.95 dBi and 2.98 dBi in the E-plane and H-plane, respectively. The illustrations shown in \u00ae Kiel +30-based LHP stretchable antenna at a 2.45 GHz resonance frequency in the (a) E-plane and (b) H-plane. The experimentally measured gains were 2.21 dBi and 2.34 dBi in the E-plane and H-plane, respectively.\u00ae Kiel +30-based LHP stretchable antenna, a slightly higher level of back radiation can be observed in both the E-plane and H-plane compared to the Shieldex\u00ae Kiel +30-based solid antenna. This is attributed to the presence of lattice hinge links in the ground plane, which reduced its overall conductive area and led to increased back radiation. However, the differences in the gains between the solid and LHP antennas were minimal, indicating that the stretchable nature of the LHP antenna did not significantly affect its radiation performance.In the radiation patterns of the Shieldex\u00ae Kiel +30-based solid patch antenna did not exhibit stretchability despite the stretchy nature of the PDMS substrate. However, it did provide a slightly higher realized gain compared to the LHP stretchable antenna. The solid antenna remains flexible and can still be used effectively in wearable applications. On the other hand, the Shieldex\u00ae Kiel +30-based LHP stretchable patch antenna compensated for this with enhanced flexibility and could stretch up to 25% in addition. The LHD significantly improved the overall flexibility and stretchability of the fabricated antenna, making it suitable for wearable applications where conformability and stretchability are desired.The Shieldex\u00ae Technik-tex P130 +B  and Shieldex\u00ae Kiel +30  in search of better stretchability and electrical performance. The former antenna exhibited enhanced stretchability but had lower electrical performance. On the other hand, the latter antenna had a better electrical performance but limited stretchability. To address this trade-off, the LHD was incorporated into the non-stretchable antenna, improving its overall stretchability without significantly compromising its electrical performance.In summary, our research aimed to design, fabricate, and characterize a multifunctional stretchable patch antenna operating at a resonance frequency of 2.45 GHz. The antenna was intended to serve as both a communication device and a strain sensor. Two antenna prototypes were fabricated using different conductive materials: Shieldex\u00ae Kiel +30 demonstrated stretchability of up to 25% under uniaxial tensile strain before it went to rupture. The antenna showed a linear trend in its resonance frequency shift as the applied strain increased up to 20% but continued to resonate without reaching a point of rupture. This characteristic makes it suitable for use as a strain sensor, in addition to its communication capabilities. The realized antenna gains at the E-plane and H-plane were measured as 2.21 dBi and 2.34 dBi, respectively.The fabricated LHD stretchable patch antenna made from ShieldexOverall, our research successfully developed a multifunctional stretchable patch antenna at a 2.45 GHz resonance frequency with strain-sensing capabilities, providing conformability, flexibility, and stretchability for wearable applications while maintaining satisfactory electrical performance."}
{"text": "The single unit of the proposed design consists of a modified L-shape rectangular radiator with Z-shape slot loaded DGS. The defected ground structure is optimized through machine learning algorithms to achieve the maximum ARBW (output) by Right Shifting (RS) and left shifting (LS) the DGS and obtaining input features. The performance metric for ANN with ADAM optimizer was found to be optimal with MSE and R2 of 0.99 and 0.82, respectively. ANNs can leverage gradient information to guide the optimization process. This enables faster convergence towards optimal solutions compared to popular GAs and PSO, which are often gradient-free optimization methods. The MIMO configuration is achieved by creating a mirror image of the single unit about the x-axis. The salient features of the proposed design are (a) Impedance bandwidth (IBW) of 3.0\u20134.2\u00a0GHz covering the n77/n78 band, (b) 3-dB axial ratio bandwidth (ARBW) of the 2.6\u20133.9\u00a0GHz (c) Port-1 is generating RHCP while Port-2 is generating LHCP, results in polarization diversity. Different diversity performance parameters  are in the optimum range confirming the proposed configuration as a suitable design for a MIMO radiator.In this communication, a planar dual port multiple input multiple output antenna of size 1.2\u03bb Various performance enhancement methodologies are discussed in the literature to cater the requirements of fifth generation wireless technologies9. Recent articles in the research literature have described a variety of MIMO antenna designs for 5G networks operating below 6 GHz23. But compared to their forerunners, these antennas either have a narrower bandwidth or higher mutual coupling. However, the antenna size may grow due to reduced mutual coupling and fewer ECCs between nearby antenna components. Therefore, these factors are crucial in the design of MIMO antennas for handheld electronics. As a result, one of the challenges of antenna design for portable devices is to include several antennas inside the device despite the limited space available while yet ensuring enough isolation. Several techniques are available in the literature to reduce the mutual coupling between the antenna elements in MIMO29.Due to the increasing number of consumers and the rapid advancement of wireless communication technology, higher throughput, and channel capacity have become crucial needs. Combining several antennas into a single portable device would prove to be a viable option, which will ultimately result in improving the caliber of the communication network and the transmission rate. As a result, the technology known as multi-input, multi-output (MIMO) plays an essential part in the center of activity for 5G research. Throughout the last few years, those working in the telecommunications industry have seen considerable change in the telecom sector. The first generation of mobile communication systems was introduced in (1G). Following the success of 1G, 2G, and 3G, the current standard is 4G. At the moment, 5G is on the verge of becoming a reality. A considerable number of countries have already shown leadership by initiating the rollout of the 5G network. Two potential spectrums might be used for wireless communication using the 5G standard. The first is the range of frequencies below 6\u00a0GHz, while the second is the range of microwave frequencies or mm-waves. Since the Sub-6\u00a0GHz spectrum is widely accessible in existing wireless communication networks and may be used for 5G without requiring extensive hardware upgrades, service providers are contemplating using this frequency band for the first 5G deployments. The sub-6\u00a0GHz band consists of n77/n78/n79: (3.3\u20134.2)/(3.3\u20133.8)/(4.4\u20135.0) GHzOn the other side broadband, circularly polarized (CP) antennas have been more in demand in recent years due to the proliferation of high-speed wireless networks. Given its ability to mitigate both polarization mismatch and multipath interference, CP antennas have garnered considerable interest. As per the conceptual definition, a CP is produced by two orthogonal resonant modes with the same amplitude and a 90-degree phase difference. Broadband CP antennas are attractive in several different wireless systems because of the need to support large data rates. In contrast to modern microstrip antennas, conventional microstrip antennas often suffer from narrow bandwidth and a high axial ratio. The challenge of creating a small antenna with a high CP bandwidth has so emerged as a significant area of study. 5G requires small CP antennas. Wireless and satellite applications employ circularly polarized antennas. Due to benefits including suppressing multi-path losses and addressing polarization mismatch of transmitter and reception antennas, CP antenna research is vital.30. Sharma et al. proposed Lasso (least absolute shrinkage and selection operator), k nearest neighbour, and artificial neural network to improve the double T-shaped monopole antenna31. Gao et al. determined the microstrip patch antenna\u2019s resonance frequency using semi-supervised learning-based Gaussian Process Regression (GPR)32. Sarkar et al. proposed a band-notch UWB slotted antenna and predicted the notch frequency using a multi-adaptive neuro-fuzzy model33. Ranjan et al. built five machine-learning models to propose a UWB-compatible CPW-fed monopole radiator. Predictions match simulations and measurements34.Wireless networks rely on antenna design. Thus, a simple antenna parameter design and optimization approach is needed. High-frequency simulations take significantly longer as technology reduces antenna size and increases antenna characteristics like frequency and complexity. Machine learning-based models are commonly utilized to overcome these difficulties. These models estimate antenna performance quickly. Antenna design may employ various machine-learning principles and methodsTo cater the present fifth-generation requirements of portable wireless communications devices, circularly polarized multiple input and multiple output antennas with high isolation, high gain, and optimum diversity performance are the best solutions. MIMO will provide high channel capacity and data rates with limited power while a circularly polarized feature of the antenna enables it to compensate for the multipath fading, and provide polarization-dependent freedom as compared to the linearly polarized antenna.In this proposed work, an ML-optimized dual port printed MIMO antenna with wide ARBW is reported for the 5G NR band of n77 (3300\u20134200\u00a0MHz) & n78 (3300\u20133800\u00a0MHz). The mirror image placement of the two antenna elements of the MIMO antenna is producing polarization diversity . The antenna has a simple design, and its excitation is provided via a 50-\u2126 feedline. The design that has been suggested is implemented on a Rogers 5880 laminate that has a thickness of 0.8\u00a0mm. The suggested design's main characteristics are as follows: (a) an impedance bandwidth (IBW) of 3.0\u20134.2\u00a0GHz covering the n77/n78 band; (b) a 3-dB axial ratio bandwidth (ARBW) of the 2.6\u20133.9\u00a0GHz; and (c) Polarization diversity as a consequence of Port-1 producing RHCP and Port-2 creating LHCP. The simulated and measured findings agreed well, indicating that the suggested design might be a good contender for 5G communication owing to its low ECC, high DG, and high isolation between the radiators. The results of optimization using machine learning are quite similar to those obtained by simulation and experimentation.3, printed on Rogers RT duroid 5880 high-frequency laminates of a thickness of 0.8\u00a0mm and relative permittivity of 2.2. The top surface of the substrate consists L-shape radiator with a rectangular stub, fed with a 50 \u03a9 transmission line while the back portion of the substrate is printed with a copper sheet engraved with a Z-shape slot working as the defected ground surface. The suggested MIMO antenna is obtained by replicating the unit cell in mirror orientation about the x-axis which as a result increases the dimension to 120\u2009\u00d7\u200960\u2009\u00d7\u20090.8 mm3.The geometrical layout and fabricated photographs of the proposed MIMO antenna are shown in Figs. 1\u2009=\u200912\u00a0mm, L2\u2009=\u20097\u00a0mm, L3\u2009=\u20096\u00a0mm, L4\u2009=\u200918\u00a0mm, L5\u2009=\u200920\u00a0mm, L6\u2009=\u200920\u00a0mm, Lf\u2009=\u200911\u00a0mm, Ls\u2009=\u200960\u00a0mm, W1\u2009=\u20094\u00a0mm, W2\u2009=\u20096.5\u00a0mm, W3\u2009=\u20096\u00a0mm, W4\u2009=\u20097.5\u00a0mm, W5\u2009=\u200929\u00a0mm, W6\u2009=\u20098\u00a0mm, W7\u2009=\u200932\u00a0mm, W8\u2009=\u200911\u00a0mm, Wf\u2009=\u20091\u00a0mm, Ws\u2009=\u2009120\u00a0mm, thickness of substrate\u2009=\u20090.8\u00a0mm.The dimensional specifications of the proposed antenna with geometrical parameters are mentioned as: L11| (dB) and Axial ratio (dB)  are presented and a comparative investigation is carried out in terms of |S1), and feed position (W1). The quarter wavelength stub is playing important role in getting the wider axial ratio bandwidth. From the perusal of Fig.\u00a01) is moving towards the higher frequency range, and a small shifting effect is observed for higher cutoff frequency  shifting is presented in Fig.\u00a01\u2009=\u20091\u00a0mm to W1\u2009=\u20095.5\u00a0mm result in a shift of the lower cutoff frequency (f1) in the lower frequency range while marginal shifting is observed in case of the higher cutoff frequency. Further, in the case of 3-dB ARBW variation, the optimum value is achieved in the case of W1\u2009=\u20094\u00a0mm only  and left shift (LS) of the Diffracted ground structure as shown in Fig.\u00a0i is the axial ratio obtained from different combinations (in the range of \u2212\u20092\u00a0mm to\u2009+\u20092\u00a0mm) of spatial movement of the DGS structure as shown in Table Further, an artificial neural network (ANN) is incorporated to improve the predicted outcome. The independent parameters X35:The objective function in CATBoost is defined as follows2 value of 0.73 indicates that the model fits the data satisfactorily.The test value in the proposed methodology is the axial ratio calculated for each Right Shift (RS) and Left Shift (LS) of the defected ground structure (DGS) as shown in Table Since the axial ratio of the antenna is dependent on the right and left shift of the DGS, therefore, for optimized axial ratio and to improve the CP performance of the antenna, the ANN algorithm is further incorporated in this work. Since ANN is unaffected by overfitting, it can be a better substitute for GBM where overfitting is constrained by using an early stopping parameter. Such a parameter improves overfitting but restricts the potential of GBM. Therefore, ANN with three different optimizers is further exploited to improve the predicted outcome.36:Stochastic gradient descent (SGD) is a popular optimization algorithm for training machine learning models, particularly in cases where computing the gradient of the loss function concerning the model parameters is computationally expensive. Instead of computing the gradient based on the entire dataset, which can be time-consuming and memory-intensive, SGD uses a single example  to compute the gradient, which makes the algorithm much faster. The stochasticity in the name refers to the fact that the algorithm uses randomness in the data to compute the gradient, rather than the full data set. In SGD the regularization hyperparameter \u03b8 updated by37:Root Mean Squared Propagation (RMSprop) is a gradient descent optimization algorithm used in machine learning. It is similar to the more popular stochastic gradient descent (SGD) algorithm, but with a different approach to the learning rate. In RMSprop, the learning rate is adaptively adjusted for each weight, rather than being kept constant as in SGD. The main idea behind RMSprop is to divide the learning rate for a weight 2 value with the same ratio of the training set and test sets. Further, it can be conferred that the RMSprop algorithm performed better in the prediction of axial ratio as compared to the SGD algorithm.38:It is common practice to use an optimization technique like ADAM (Adaptive Moment Estimation) while instructing a neural network. The technique employs moving averages of the parameters to continuously estimate the second raw moments of the gradients, and the word adaptive in the name alludes to the fact that the algorithm adjusts the learning rates of each parameter depending on the previous gradient information. The equation for ADAM is given by2 value with a ratio of the training set and test sets of 80:20 are better than SGD and RMSprop. Further, it can be conferred that the ADAM algorithm performed better in the prediction of axial ratio as compared to other ANN optimizers.Further, the performance parameter of each of the algorithms is shown in Table Figure\u00a0X) or vertical (EY)) must have the same amplitude but be rotated by 90 degrees concerning one another. Figure\u00a0X), and one vertical (EY). Strong EX and EY components are formed as a direct result of the currents that are generated on the stubs. Because the quarter wavelength stubs are oriented asymmetrically, the ground plane's current distributions are likewise altered simultaneously with this process. In the suggested radiator, a quarter wavelength stub functions as an electric dipole while an inverted Z-shape slot loaded ground plane acts as a magnetic dipole, creating orthogonal electric field components. Quarter annular stub adds \u03bb/4 to microstrip route latency. This extra route delay creates a CP wave at 3.5\u00a0GHz by shifting the phase of orthogonal electric field lines by 90 degrees (phase difference\u2009=\u20092\u03c0/\u03bb\u2009\u00d7\u2009path difference)39.To generate circular polarisation, two electric field components  and their phase difference (EX-Ey) to help you better understand the proposed antenna's circular polarization. For the impedance bandwidth of 3\u20134.2\u00a0GHz that was found, the ratio of field components is close to 1 and the phase difference is about 90\u00b0, which explains the planned antenna has a large circular polarization bandwidth.Figure\u00a0The MIMO configuration under consideration is achieved through the replication of the antenna element of the unit cell in a mirror image pattern along the x-axis. In the context of MIMO designs, the grounding sections of individual elements were interconnected to maintain uniform voltage levels across the entire antenna system.11| and |S22| plots are not in coherence for parallel orientation as compared with the mirror orientation. Similarly from Fig.\u00a0Figure\u00a0Figure\u00a011|, |S12| and axial ratio variations. By looking at Fig.\u00a040:i.The initial procedure involves orienting the proposed test antenna in the XZ plane, while maintaining a polar angle of \u03b8\u2009=\u20090\u00b0 and an azimuthal angle of \u03d5\u2009=\u20090\u00b0.ii.Determine the desired frequency interval for measuring the axial ratio.iii.At this juncture, it is recommended to rotate the horn antenna from its initial position of 0\u00b0 to a full 360\u00b0 rotation in order to attain co-polarization. Take down the dBm readings from the spectrum analyzer showing how much power the test antenna was able to receive at each angle.iv.Since circular polarization is a subset of elliptical polarization, it is clear that the two are related. Now the main axis represents the highest power level and the minor axis represents the lowest. Since power is measured in decibels (dB), you may calculate it by subtracting the lowest power (major axis) from the greatest power (minor axis). Subtracting two numbers yields the axial ratio.This section focuses on three key points: (i) comparing simulated and observed findings (ii) calculating diversity performance (iii) examining how well the proposed two-port MIMO antenna stacks up against the other antennas that have been published in the literature. Figure\u00a0Figure\u00a0Figure\u00a0i.The proposed antenna is mounted in broadside direction.ii.Standard Gain antenna on the other side (whose gain is known to us i.e. GT)iii.Now find out S21 at each frequency points which give (PR-PT).iv.Path losses are finding out by v.Find out cable loss by directly connecting the transmitting and receiving cable.In order to measure the gain of proposed antenna, Two Antenna Method is used [B]. The steps involved in the measurement of antenna gain are as follow:Now, finally used Friss Equation formula given as follow:H and EV value for different angle at specific frequency. Now, LHCP and RHCP radiation pattern is obtained by using formula mentioned in Eqs.\u00a0(41.The suggested antenna\u2019s circular polarization plots for ports 1 and 2 in left-handed (LHCP) and right-handed (RHCP) variants are shown in Fig.\u00a0 in Eqs.\u00a0 and 7)  H and EVThe different diversity performance parameters like envelope correlation coefficient (ECC), diversity gain (DG), channel capacity loss (CCL), mean effective gain (MEG) and total active reflection coefficients (TARC) are studied, investigated and calculated to understand the independency of each port and multi-channel propagation performance of the proposed MIMO antenna.42. Equations\u00a0 43.The simulated and calculated ECC values for the proposed radiator are shown in Fig.\u00a045.In wireless communication systems, the quality and dependability of a MIMO antenna may be determined by its diversity gain. Therefore, the DG of the MIMO antenna has to be high at least 10\u00a0dB) within the frequency region that is permitted. The DG is determined by using the ECC value in a calculation, and the resulting answer may be found in Eq.\u00a0 is defined as the ratio of the MIMO antenna's received power to the isotropic antenna\u2019s received power, making it a significant diversity metric for MIMO antennas. A MIMO antenna\u2019s performance improves when the ratio of MEGquations\u00a0 and 13)1/MEG2, i1, MEG2 and MEG1/MEG2 plot for the proposed radiator is mentioned in Fig.\u00a01/MEG2 is nearly equal to 0\u00a0dB.The MEG48.TARC is an additional crucial component that must be considered while determining the most efficient multiport antenna design. It illustrates the proportion of power that is reflected to the total power that is incident. For a two-port MIMO antenna the value of this parameter is determined by using the formula shown in Eq.\u00a048.14\\doc11 and S22, respectively. S12 and S21 stand for the isolation between the two ports. The calculated TARC of the proposed antenna is shown in Fig.\u00a0The reflection coefficients for ports 1 and 2 are denoted by S0 calculated at the lower cut-off frequency), axial ratio bandwidth, sense of polarisation and gain/radiation efficiency. According to the information that is provided in Table 38. When compared to the other described antennas in Table 32. Moreover, the proposed model's diversity performance parameters are optimal in comparison to those of other MIMO antennas.Table 1/MEG2\u2009\u2248\u20090\u00a0dB, and CCL\u2009<\u20090.5 bits/s/Hz of the proposed MIMO antenna is incorporated in simulated and measured form. Novelty justification of the proposed design is also presented in form of a comparative investigation in terms of different vital parameters with the previously reported antennas. Three different machine learning models are used to optimize the CP in the proposed work. The machine learning-based predicted values and simulated/ measured values are found in the agreement.In the presented work machine learning model-based optimized dual port MIMO antenna with RHCP/LHCP features are investigated for fifth generation new radio frequency range of n77(3300\u20134200\u00a0MHz) & n78 (3300\u20133800\u00a0MHz) band applications. Impedance bandwidth (IBW) of 3.0\u20134.2\u00a0GHz and 3-dB axial ratio bandwidth (ARBW) of the 2.6\u20133.9\u00a0GHz is reported for the proposed model. A detailed description of the CP mechanism attainment and polarization diversity features of the proposed antenna is discussed with the help of surface current distribution and radiation pattern plots. The pertinent information about the different diversity performance parameters such as ECC\u2009<\u20090.005, DG\u2009>\u20099.99, MEG"}
{"text": "The proposed antenna is composed of an inverted L-shaped antenna with decoupled elements to cover 4G (2000\u20132600 MHz), and a planar inverted-F antenna (PIFA) with a J-slot to cover 5G (3400\u20133600 MHz and 4800\u20135000 MHz). Furthermore, to achieve the purposes of miniaturization and decoupling, the structure adopts a feeding stub, shorting stub, and outstanding floor, additionally adding the slot to the PIFA, to generate additional frequency bands. Due to the advantages such as multiband operation, MIMO configuration for 5G communications, high isolation, and a compact structure, the proposed antenna design is attractive for 4G/5G smartphones. The antenna array is printed on an FR4 dielectric board, measuring 140 \u00d7 70 \u00d7 0.8 mm The latest smartphones generally support 5G networks, which can provide mobile phone users with voice calls and mobile data services with less delay and greater bandwidth to meet users\u2019 daily communication needs. Thus, 5G technology has been widely used in the smartphone antenna industry ,2,3. HowRecently, several MIMO antennas for mobile devices have been proposed. In ,7, an 8-In this paper, a tri-band 8-element MIMO antenna is proposed. Besides the ability to cover the 5G bands n78 and n79, it can also yield the 4G band (2000\u20132700 MHz). In addition, it can exhibit desirable impedance matching and isolation (>10 dB) across the three operating bands, and the envelope correlation coefficient (ECC) of the 8-element antennas is also calculated . HFSS is3, and the 4G antenna is located on a 15 mm long clearance area on the top, which prominently reduces the coupling between units. The 5G antennas are evenly arranged on both sides of the back panel of the mobile phone. The unit is a planar inverted F antenna, so no additional headroom is required. A new current path is constructed through the loading gap, so that the antenna can work in two frequency bands.In this paper, by optimizing parameters such as feeder width, protruding ground size, antenna spacing, and antenna width, length, and height, the parameters such as return loss, isolation, and the radiation pattern of the antenna in the working frequency band can be optimized.2. The specific size is shown in The 4G antenna consists of four parts: the feeding stub, short-circuit stub, protruding ground, and neutral line. The clearance area used is 15 \u00d7 70 mmEach antenna unit is composed of a feed stub and a short-circuit stub. The short-circuit stub generates a new resonance frequency point outside the working frequency band of the feed stub, which expands the antenna\u2019s working bandwidth. By optimizing the length of the short-circuit end stub, it can be adjusted. The width of the feeding line and the shorting line are both 1.5 mm, and the characteristic impedance of the microstrip line is 50 \u03a9 at this time.The protruding ground structure and the neutral line loaded between the antenna elements can improve the isolation between the antenna elements. Among them, the width of the protruding ground is 10 mm, and the distance between two short-circuit branches is 7 mm. The overlapping width between the short-circuited stub and the protruding floor is 1.5 mm, and the capacitive coupling generated can reduce the resonant frequency of the antenna and achieve the purpose of miniaturization.When the antenna unit has no short-circuit stubs and only monopole radiation, refer to antenna 1 in By adding a short stub, such as reference antenna 2 in Adding a neutral line and a protruding ground structure between the antenna units can improve the isolation between the antenna units: the coupling between the antenna and the protruding ground can reduce the coupling between the antenna units, and the conduction current on the neutral line can be coupled with the radiation The current is neutralized to achieve a decoupling effect.Due to the 1.5 mm wide overlap between the short stub and the salient ground, the resulting capacitive coupling shifts the resonant frequency of the short stub to a lower frequency, from 3200 MHz without a salient ground to 2100 MHz. The operating frequency of the monopole is 2500 MHz, and the added short-circuit stub can expand the bandwidth of the antenna.The electric field distribution of the antenna when it is working is shown in When the frequency is 2100 MHz, the feed stub excites the short-circuited stub through coupling, and the short-circuited stub radiates outward. Due to the short distance of the short-circuited stub, the coupling degree of the antenna reaches the maximum at the resonance frequency of the short-circuited stub at 2100 MHz. However, due to the addition of additional decoupling stubs, the maximum coupling degree is only 14.7 dB. When the operating frequency is 2500 MHz, it mainly radiates outwards from the feeding stubs, as shown in By adjusting the length of the terminal branch of the short-circuited stub, the resonant frequency of the short-circuited stub can be tuned, as shown in By adding short-circuit stubs and decoupling structures to the antenna, the working bandwidth, return loss, and coupling degree of the antenna unit are optimized. The scattering parameters of the antenna are shown in 2. There are three symmetrical 5G antenna units on each side of the metal backplane with a spacing of 23 mm, and the distance between the antenna units on both sides is 19 mm from the edge of the backplane.The MIMO antenna proposed in this chapter contains a total of six 5G antenna elements. Since the 4G antenna uses a clearance area with a length of 15 mm, the area used by the 5G antenna is 125 \u00d7 70 mmThe antenna structure is a planar inverted-F antenna loaded with slots, as shown in 2. A J-shaped slot with a length of 13.5 mm and a width of 1 mm is loaded on the plane of the PIFA antenna. The gap creates a new current path that allows the antenna to operate at two frequencies.The height of the PIFA antenna in this chapter is 5 mm, the distance between the feed point and the short-circuit point is 2.5 mm, and the plane size is 14.2 \u00d7 5 mmFrom the feed point to the open end along the J-shaped slot, a longer current loop is formed; from the feed point directly to the open end of the PIFA antenna, a shorter current loop is formed. Tuning the lengths of the two current loops separately can adjust the resonant frequency points of the high and low frequencies. For the antenna in this chapter, the stub is extended by 0.75 mm at the end of the J-shaped slot to optimize its resonant frequency, as shown in 2, and the distance between the feed point and the short-circuit point is 2.5 mm; a resonant frequency point can be generated at 4000 MHz, and the working bandwidth of the antenna is 700 MHz, which is well matched, and it is shown as Antenna 1 in The prototype of the antenna is a common PIFA antenna, the height of the antenna is 5 mm, the plane size of the antenna is 15 \u00d7 3 mmL of the open stub end in reference antenna 2. As L increases, the resonant frequency of the longer branch of the antenna moves to lower frequencies, as shown in L = 0.75 mm, the resonance frequency of the antenna shifts from 3600 MHz to 3500 MHz.Since the antenna is expected to operate at 3500 MHz, the resonant frequency of the longer branch of the antenna can be tuned by optimizing the length After optimization, the two operating frequencies of the PIFA antenna are 3400\u20133600 MHz and 4800\u20135000 MHz, which can cover the frequency bands of n79 and n78. The electric field distribution of the antenna is shown in W1 between the antenna unit and the edge of the floor, the better the radiation effect. However, the increase of W1 will make the antenna spacing W2 too small, which will increase the coupling between adjacent antenna elements. By optimizing the values of W1 and W2, the radiation performance of the PIFA antenna can be optimized and the isolation between antenna elements can reach more than 10 dB.The PIFA antenna does not require a clear space but radiates equivalently through the reflection image of the floor, so a relatively complete floor is required under the PIFA antenna. Therefore, the distance between the antenna unit and the edge of the floor will affect the radiation performance of the antenna. As shown in W1 increases, that is, when antenna 3 and antenna 5 are far away from the edge of the floor, the impedance matching and radiation performances of the antenna are optimized. However, due to the relative reduction of W2, that is, the distance between the antenna elements is reduced, the coupling between the antenna elements is too large, and the isolation is less than 10 dB. When W1 is reduced, the matching of the antenna gradually deteriorates but the isolation between elements is optimized. After a comparative analysis, the value of W1 is 19 mm and W2 is 23 mm. Currently, the matching of each antenna is good, and the isolation between units is greater than 10 dB.When Based on the above analysis, the basic structure and distribution position of the 5G antenna elements have been determined. After simulation, the scattering parameters of the six-element MIMO antenna are shown in The envelope correlation coefficient is one of the important parameters of the MIMO antenna, which reflects the diverse characteristics of MIMO. The ECC value of the low-frequency band of the antenna is required to be less than 0.5, and the ECC value of the high-frequency band is less than 0.4. The MIMO toolkit in the HFSS software can calculate the envelope correlation coefficient of the antenna according to the scattering parameters obtained by simulation. It can be seen in The cell phone antenna needs to be close to the human hand or head when it works, and the human body as a conductor has a greater influence on the radiation performance of the antenna.Through the hand or head model simulation, we can illustrate the influence of the human body on the antenna radiation performance, whether the antenna can work normally when the phone is held or talking. As in From the simulation results, the coupling between 4G antenna units is enhanced due to the reflection of the head or hand, the isolation is reduced to 12 dB, and the return loss of 4G antenna is increased. This is not because the matching of the antenna is optimized, but because the head absorbs part of the electromagnetic energy radiated outward by the antenna. The resonant frequency of the 5G antenna is slightly shifted, and the analysis shows that this is because the head is equivalent to a conductor, the frequency deviation of the PIFA antenna caused by a change in the shape of the floor below it. The isolation between the 5G antenna units is also reduced, also due to the reflection from the head or hand.Since both sides of the antenna are symmetrical, the radiation direction of one side of the antenna is shown in The proposed antenna has also been fabricated and verified in the laboratory. After completing the calibration, the scattering parameters of the antenna were measured in sequence, as shown in Due to the symmetry of the antenna on both sides, only one side of the antenna was tested, which includes the radiation patterns and gain of antennas 1 and 4. The radiation patterns of the antennas were measured and shown in The gain of the antenna is measured and shown in The performance comparison of the proposed eight-element mobile MIMO antenna with other mobile MIMO antennas is presented in 3 suits most of the smartphones. The standard parameters such as ECC and isolation still maintain an excellent level despite the burden of the wide band. The wide band also produces more gain with 5\u20136 dB, 3.5\u20136 dB, and 7\u20138 dB.The proposed antenna covers 2.0\u20132.6, 3.4\u20133.6, and 4.8\u20135.0 GHz, which is much wider than the antenna in This paper proposes an eight-element multimode mobile phone antenna consisting of two 4G antenna elements and six 5G antenna elements. Within the operating bandwidth of the antenna, the antenna elements are well matched, and the return loss of the antenna is greater than 10dB. The coupling between antenna elements is small, and the isolation between any two antenna elements is larger than 10 dB. By calculation, the envelope correlation coefficient between any two antenna elements is less than 0.1, indicating that the MIMO antenna has good diversity characteristics and small diversity gain. The simulation proves that the MIMO antenna is less affected by the human body when approaching the head and hand, and the radiation performance remains basically unchanged. The 4G antenna covers 4G mobile communication frequency bands such as B1, B38, B40, B41, and n41 frequency bands of 5G. The 5G antenna can work on the two frequencies of 3400\u20133600 MHz and 4800\u20135000 MHz, which can cover the n78 and n79 bands of 5G mobile communications, respectively, and are the two most mature frequency bands for sub-6 GHz applications."}
{"text": "In this paper, a novel ultra-wideband UWB antenna element with triple-band notches is proposed. The proposed UWB radiator element operates from 2.03 GHz up to 15.04 GHz with triple rejected bands at the WiMAX band (3.28\u20133.8 GHz), WLAN band (5.05\u20135.9 GHz), and X-band (7.78\u20138.51 GHz). In addition, the radiator supports the Bluetooth band (2.4\u20132.483 GHz). Three different techniques were utilized to obtain the triple-band notches. An alpha-shaped coupled line with a stub-loaded resonator (SLR) band stop filter was inserted along the main feeding line before the radiator to obtain a WiMAX band notch characteristic. Two identical U-shaped slots were etched on the proposed UWB radiator to achieve WLAN band notch characteristics with a very high degree of selectivity. Two identical metallic frames of an octagon-shaped electromagnetic band gap structure (EBG) were placed along the main feeding line to achieve the notch characteristic with X-band satellite communication with high sharpness edges. A novel UWB multiple-input multiple-output (MIMO) radiator is proposed. The proposed UWB-MIMO radiator was fabricated on FR-4 substrate material and measured. The isolation between every two adjacent ports was below \u221220 dB over the FCC-UWB spectrum and the Bluetooth band for the four MIMO antennas. The envelope correlation coefficient (ECC) between the proposed antennas in MIMO does not exceed 0.05. The diversity gains (DG) for all the radiators are greater than 9.98 dB. The communication link depending on ultra-wideband technology is a promising solution for numerous wireless networks, such as wireless body area networks (WBANs), Internet of Things (IoT) network systems, personal area networks (PAN), and remote sensing networks. The ultra-wideband communication network was selected because it uses a very high bandwidth radiator, which enables high-speed data transmission with low power consumption i.e., \u221244.2 dBm) . The UWB4.2 dBm .Since the UWB antenna uses an RF signal with low power and in the presence of some obstacles causing multipath fading, the multiple-input multiple-output (MIMO) network was introduced as a promising solution to solve this issue. Not only does the MIMO network system suppress multipath fading, but it also improves the network channel capacity . TherefoIn this paper, four ports of an UWB-MIMO structure were fabricated on a low-cost FR-4 substrate with relative permittivity of The article is arranged as follows. The design of a UWB antenna element is explained in h = 1.5 mm. The proposed UWB antenna element consists of three sections placed on the top layer of the dielectric substrate. The first one is a 50 C is the speed of light , one at the beginning of the WLAN band at a frequency of f = 4.94 GHz and the other one located at the end of the band at a frequency of f = 6.2 GHz. Thus, the WLAN band notch resembles a rectangular shape. This rectangular notch band improves the radiating characteristic of the antenna more than the conventional notch antenna .f = 7.29 GHz and f = 8.59 GHz, respectively. Adding the Bluetooth band to the UWB signal is very useful for establishing a communication channel between unlicensed bands for users/patients and diagnostic devices in biomedical applications.The final step in designing the proposed UWB antenna element with a triple band notch is to design a third band notch for X-band satellite communication that operates from 7.9 to 8.4 GHz. The X-band satellite communication band notch is required to be taken into account to overcome the interference between the obtained FCC-UWB signal and the X-band satellite signal. Electromagnetic band gap structure (EBG) technology is introduced to design a band stop filter to reject the licensed X-band satellite communication band over the aforementioned frequency range. A frame composed of an octagon-shaped EBG was proposed to achieve a band notch characteristic at X-band satellite communication in the UWB antenna, as shown in i is 1, 2, 3, and 4) at ports 1, 2, 3, and 4 of the UWB-MIMO antenna with the separate ground plane  configuration. It is shown that the FCC-UWB spectrum with triple band notches was obtained in addition to the Bluetooth band. On the other hand, i = 1, 2, 3, and 4) at ports 1, 2, 3, and 4 of the UWB-MIMO antenna with the common ground plane  configuration. It is noticed that the FCC-UWB spectrum with triple band notches was obtained but there is a mismatching characteristic at the Bluetooth band due to the coupling between the UWB antenna elements.Four proposed UWB antenna elements are perpendicularly placed to each other in order to design a MIMO structure, as shown in f = 2.44 GHz are shown in In order to overcome the problem mentioned above, a defective ground structure (DGS) band stop filter (BSF) was proposed and designed at the Bluetooth band . The two-port DGS-BSF was simulated in CST microwave studio, as shown in h = 1.5 mm. The proposed UWB-MIMO antenna was fabricated on FR-4 material with relative permittivity of i and port j, respectively, while i and port j.i  and port j . The suffixes i and j represent the port numbers. In the case of i = 1 and j = 2, the calculated i, respectively. j, respectively.ECC represents the envelope correlation coefficient between the radiated antennas in the MIMO configuration. There are two methods of calculating the ECC. One is obtained from the S-parameter characteristics using Equation , while tAnother important parameter in terms of diversity characteristics is the total active reflection coefficient (TARC). The total active reflection coefficient (TARC) parameter shows the active operating spectrum for the proposed MIMO radiator configuration. Equation  is used Finally, h = 1.5 mm. The UWB radiator element was proposed to operate in the FCC-UWB network. It has a bandwidth of 13.01 GHz extending from 2.03 to 15.04 GHz with triple band notches. The triple bands are the WiMAX band (3.28\u20133.8 GHz), WLAN band (5.05\u20135.9 GHz), and X-band (7.78\u20138.51 GHz). In addition to this, it supports the Bluetooth band (2.4\u20132.483 GHz). An alpha-shaped coupled line connected with a stub-loaded resonator (SLR) was proposed to achieve a band-stop characteristic at the WiMAX band. Two similar U-shaped slots etched on the radiator are utilized to obtain a band-stop characteristic WLAN band. Two unit cells of an octagon-shaped EBG structure are used to achieve a band-stop characteristic at X-band satellite communication. The three notch bands have excellent selectivity or sharpness at both the start and the end of each notch band. The UWB radiator is used in the MIMO configuration as an element. The ground planes of the four UWB radiators are connected together. Four DGS band-stop filters were placed between each ground plane and the center H-shaped ground connection to improve the matching characteristics at the Bluetooth band. In addition, high isolation characteristics were obtained at the operating band.Four ground-connected UWB-MIMO radiators were designed and fabricated on FR-4 dielectric substrate material with relative permittivity of"}
{"text": "The simulated and measured results of the antenna show good agreement, making it well-suited for 5G mmWave communication applications.A novel compact-slotted four element multiple input multiple output (MIMO) planar monopole antenna is proposed for 5G mmWave N257/N258 and N262 band applications. The antenna, with dimensions of 12 mm \u00d7 11.6 mm \u00d7 0.508 mm ( Wireless communication networks are experiencing widespread usage, leading to an increased demand for significantly higher data rates, minimal latency, and efficient spectrum utilization in portable device applications. The advent of 5G (fifth generation) mobile communication technology offers several advantages over the current 4G (fourth generation) system, including higher transmission rates, improved spectrum efficiency, and reduced latency. Notably, 5G networks boast data rates that are 10 times higher than those of 4G networks, along with enhanced device connectivity and stability. The FCC has divided the 5G frequency spectrum into three bands: a low-band, sub-6 GHz band, and mmWave band. The mmWave frequency range, extending beyond 24 GHz, provides ample spectrum availability, enabling exceptional capacity, high throughput, and remarkably low latency. Consequently, various 5G mmWave antenna models have been proposed ,4,5. ForFor 2-element MIMO antenna systems, several approaches have been developed to enhance isolation ,18,19,20This research introduces a novel compact dual-band U-shaped MIMO design for 5G mmWave systems. The suggested design comprises four U-shaped radiating elements on top of a substrate with a slotted ground on the bottom. Each radiating element of the MIMO antenna is equipped with a rectangular strip and a pair of rectangular slots to enhance its impedance performance. The first operating band at 27.1 GHz is achieved using slotted U-shaped radiating elements, while the second operating band at 48.7 GHz is created by incorporating hexagonal slots into the ground plane. Additional isolation is provided by the orthogonal positioning of the antenna elements and narrow rectangular slots in the ground. The developed antenna exhibits consistent radiation patterns, high peak gain, increased radiation efficiency, negligible envelope correlation coefficient (ECC), acceptable total active reflection coefficient (TARC), minimal channel capacity losses (CCL), and low mean effective gain (MEG) at 27.1 GHz (N257/N258) and 48.7 GHz (N262) bands. The following subsections provide a detailed explanation of the proposed MIMO antenna.2, which has a thickness of 0.508 mm and a relative permittivity of 2.2. The antenna is fed via a 50-ohm microstrip line of sizes 1.035 \u00d7 0.3 mm2. The suggested antenna is made up of four U-shaped radiating elements (R1 to R4) on top of a dielectric material and slotted ground at the bottom. Each radiating element is formed by combining the sub-elements of dimensions 2.25 \u00d7 0.8 mm2, 1.565 \u00d7 0.8 mm2, and 4.59 \u00d7 1.145 mm2. The outer dimensions of the sub-elements of a patch are denoted by 3.395 mm, 4.59 mm, and 2.71 mm. Also, to enhance the MIMO antenna\u2019s impedance performance , two rectangular slots (1.465 \u00d7 0.325 mm2 and 0.78 \u00d7 0.325 mm2) and a rectangular strip of 1.3 \u00d7 0.2 mm2 are added to each radiating patch. Using rectangular slots and a strip, first resonance was induced in the 27.1 GHz band, which covers from 25.9 GHz to 27.8 GHz as depicted in 2. Etching hexagonal slots on the ground plane results in the second operational band at 48.7 GHz from (47.1\u201349.9) GHz as shown in 2 are carved out of the ground plane to produce excellent isolation or minimal mutual coupling between the antenna elements. The rectangular slots are cut 0.1 mm from a corner of the substrate and slots are situated 5.85 mm and 5.65 mm from the substrate\u2019s edges. The orthogonal arrangement of radiating elements and the right selection of distance between the radiating elements improve the isolation. The distance between the elements is 2.775 mm and 2.475 mm, as given in The surface current distribution parameter is one of the crucial visual parameters for MIMO antenna systems. It demonstrates how the current of one element affects another in the MIMO design. 2 (C \u00d7 E mm2). Antenna #A operates at 27 GHz and 51.4 GHz which does not include the desired bands as from 2 and 0.685 \u00d7 0.8 mm2 from Antenna #A, Antenna #B is formed. Antenna #B only works at 27 GHz (N257/N258 band). To attain the second band at 48.7GHz (N262 band) in addition to the 27 GHz band, a hexagonal slot was cut from the ground plan. Moreover, to achieve impedance-matching properties at working bands, a couple of slots and a strip are used on the radiator. So, Antenna #C is adopted as the basic radiating element in the suggested MIMO antenna. The single antenna evolution stages\u2019 current distribution on the surface is given in The single-element design and evolution process is described in In this subsection, the impact of feed width on antenna impedance performance is investigated. The effect of the ground slot on impedance performance is also examined in this section. The S11 responses of the different ground slots like a hexagon, octagon, and decagon are plotted in Two approaches are used in this work to provide excellent isolation between antenna ports which include an orthogonal arrangement of U-shaped radiating elements and the use of narrow rectangular ground slots. Here, the S-parameters S21, S31, and S41 are used to analyze the effect of narrow rectangular slots on the isolation performance. To evaluate the recommended MIMO antenna\u2019s properties, a prototype was developed on a Rogers RT/duroid 5880 (tm) substrate and experimentally verified through Agilent N5224A VNA, as shown in The radiation performance of an antenna is one of the most crucial factors as it indicates the direction, strength, and nature of the radiated fields. \u22126, indicating substantial agreement in the simulated and measured values.This section analyzes the diversity performance of the suggested MIMO antenna using several metrics of performance such as the envelope correlation coefficient (ECC), diversity gain (DG), total active reflection coefficient (TARC), channel capacity loss (CCL), and mean effective gain (MEG). The MIMO antenna diversity is analyzed using the ECC ,35,36,37The diversity gain is an indicator of how well antenna diversity methods perform ,35,36,37Individual MIMO antenna S-parameters will not provide an exact analysis. The total active reflection coefficient (TARC) can be utilized to estimate the performance of MIMO systems. TARC takes into account self and mutual impedance variations . The TARThe assessment of the channel capacity loss (CCL) is also necessary for the design of MIMO antennae. The formulas in Equations (4)\u2013(6) can be used to determine this parameter as a function of the S-parameters . The CCLThe recommended MIMO antenna performance has been compared to other antennae that have been previously described in For 5G mmWave N257/N258 and N262 band applications, a miniaturized dual-band slotted four element MIMO planar monopole antenna is proposed. The antenna design consists of four U-shaped radiating elements on top of the dielectric material and a slotted ground on the bottom. To enhance the impedance performance of the MIMO antenna, a rectangular strip and a pair of rectangular slots are added to each radiating element. The first operating band at 27.1 GHz, ranging from 25.9 GHz to 27.8 GHz, is achieved using slotted U-shaped radiating elements. The second operating band at 48.7 GHz, ranging from 47.1 GHz to 49.9 GHz, is obtained by etching hexagonal slots on the ground plane. The orthogonal positioning of the radiating elements and the presence of narrow rectangular slots on the ground provide isolation of more than 27 dB. The designed antenna operates at 27 GHz (N257/N258) and 48.7 GHz (N262) bands, exhibiting stable radiation patterns, high peak gain, increased radiation efficiency, very low envelope correlation coefficient (ECC), acceptable total active reflection coefficient (TARC), negligible channel capacity losses (CCL), and low mean effective gain (MEG). The proposed antenna is modeled, manufactured, and its results are measured. The simulation and test findings demonstrate good agreement, indicating that the proposed antenna is a suitable choice for 5G mmWave N257/N258 and N262 band applications."}
{"text": "The size miniaturization of a single antenna unit is achieved through an optimized placement of slots and extended arms. The quad-antennas are then placed orthogonally to achieve antenna diversity. The antenna resonates at 3.56\u00a0GHz and 5.28\u00a0GHz having 2:1 VSWR fractional bandwidth of 1.82% and 2.12%. The proposed resonator provides 88.34% and 79.28% efficiency at lower and upper bands, respectively. The antenna is an exceptional radiator regarding MIMO diversity performance owing to high inter-element isolation. The values of envelope correlation coefficient\u2009<\u20090.05, channel capacity loss is nearly 0.1\u00a0bits/sec/Hz, and total active reflection coefficient is \u2212\u00a024.26. The full ground plane profile aids in high directivity and cross-pol isolation. The antenna exhibits a gain of 4.2\u00a0dBi and 2.8\u00a0dBi, respectively, justifying intended application requirements. There is a good coherence between simulation and experimental results. The self-decoupled antenna poses its application in 5G and WLAN Communication Applications.A four-port MIMO antenna with high isolation is presented. The antenna is primarily envisioned to cover the n48 band of Frequency Range-1 (FR-1) with TDD duplex mode. The engineered antenna has electrical dimensions of 90\u2009\u00d7\u200990\u2009\u00d7\u20091.57\u00a0mm Owing to such demand, antenna performance enhancement seeks continuous research and development2. High-speed data rate is a key demand for emerging technologies such as virtual reality, online gaming, and smart city3. The multiple antenna structural designs allow high data processing and throughputs to be available using advanced radio propagation schemes. The 5G new radio (nr) technology, a unified and capable wireless air interface, envisions improved reliability and extremely high data rate4. 5G NR supports adaptive bandwidth support, less time lag and minimal network losses. The carriers can be simultaneously aggregated over the spectrum. With 5G momentum, the communication networks shall provide end-to-end connectivity to user equipment directly connected to the 5G core communication network. Multi-network connectivity shall enable users to achieve the Gigabit per second data rate5. The 4G services do not have the potential to cater for the requirement of data traffic created through enormously demanding applications such as live video streaming, cloud services, and online gaming, to name a few6. The 5G technology is now being implemented by the majority of nations across the globe to accomplish the need to handle large data7. The centimetre and millimetre wave spectrum of 3\u2013300\u00a0GHz has been quite effectively utilized for 5G communication technology for achieving extremely high throughput in the order of some Gigabit per second. The additional benefit of targeting this frequency is that a lower spectrum is utilized in parallel for other communication applications such as ISM, Wi-Fi and WiMAX. In contrast, a higher spectrum can be available for 5G wireless communication applications.The antenna is a vital component of the communication system. The data communication requirement continuously evolves about data transmission increase8. The optimal spectrum efficiency and resource sharing in channel allocation enable more end-user devices9. The radio propagation issue of fading is addressed as each antenna faces inconsistent multipath fading and gets nullified. A wide range of multiplexing techniques exist to provide a large degree of freedom in 5G technology10. The MIMO technology significantly reduces radio propagation issues through multiple transmit and receive antennas, multiplexing techniques, and high spectrum efficiency. The MIMO antennas should be able to provide high inter-element isolation between antenna elements and gain13. The high inter-element isolation aids in achieving higher throughput from the MIMO antenna system causing better communication efficiency16. The MIMO antennas can exhibit increased channel capacity and enhanced link reliability through multipath propagation techniques. The MIMO antennas having high inter-element isolation is a key design challenge for antenna designers, especially with a closely packed device environment17. The mutual coupling between the MIMO antenna elements primarily causes E-plane radiation to deteriorate due to surface current flows in the neighbor element. However, H-plane would not get significantly affected due to magnetic coupling through the air18. In addition, the wideband antenna shall suffer higher if the mutual coupling between elements is high. It is typically suggested that the inter-element distance should be at least half-wavelength to counter issues that emerge through mutual coupling. The arrangement of antennas for MIMO shall have to deal with the tradeoff between mutual coupling and antenna radiation characteristics. A good MIMO characteristic shall need at least mutual coupling isolation of 20\u00a0dB. There are several decoupling mechanisms. A significant quantum of research is present in the literature for improving the antenna isolation characteristics22. The presented antenna does not employ any additional decoupling mechanism for improving the isolation characteristics. State-of-the-art research in MIMO antenna design has been recently reported24. The literature highlighting bandwidth and gain enhancement techniques for MIMO antenna can be found in30.The multiple-input multiple-output (MIMO) technology enables enhanced channel capacity and moderates multipath fadingA novel antenna design structure which was designed with the different iteration of the shape to achieve the desired frequency band of operation.Proposed MIMO antenna designed by engraving the single side of the PCB where the ground plane does not require the engraving process. This will reduce the overall fabrication cycle for the antenna.The values of the cross-port isolation are better than 15\u00a0dB which provides good isolation between antenna elements. Hence, due to the excellent inter-element isolation, the antenna performs very well as a radiator regarding MIMO diversity performance.This structure offers the dual band of the operation with maximum of 4.2\u00a0dBi of the gain 2.8\u00a0GHz of the bandwidth.The antenna structure and the different approach can help to design the frequency selective dual band antenna. Our antenna design approach helps to identify the resonating frequency bands between 5.2 to 5.6\u00a0GHz where the first frequency band are almost same in all the iteration.The patch antenna provides ease in integration and manufacturing. Mobile communication antennas significantly suffer from space-constrained environments. The surface mountable antennas provide viability of the placement in such conditions. The patch antennas usually suffer from less bandwidth and moderate gain issues because of the dielectric material loss at high frequencies above 1\u00a0GHz. The presented study focused on high inter-element isolation, good antenna gain and improved MIMO characteristics. A quad-element MIMO antenna is aligned orthogonally to contribute to targeted applications to achieve the desired antenna parameters. The radiating elements of planar resonators are kept in anti-parallel mode to improve diversity parameters significantly. The antenna presents its usage in NR FR-1 5G communication and WLAN applications. The novelties of the structure achieved in this manuscript are as follows:3 or the electrical dimensions of 1.06 \u03bb\u2009\u00d7\u20091.06 \u03bb\u2009\u00d7\u20090018 \u03bb at a lower frequency. The quality of a patch antenna can be increased in several different ways: by using a thick substrate, cutting a resonant slot inside the patch, using a low dielectric substrate, configuring multiple resonators in a stack, using different impedance matching and feeding methods, and by employing slot antenna geometry. Improving one attribute often worsens the other; this is especially true when it comes to antenna bandwidth and size, and therefore the careful approach to design evolution with necessary computational checks at every step is required in antenna design.The proposed quad-element MIMO antenna is designed on AD255C Rogers laminate. The AD255 has low-lossy characteristics with a loss tangent of 0.0014 and a dielectric constant 2.55. It has a very high copper peel strength of more than 10 \u00a0pli, a good coefficient of thermal expansion in order 34\u00a0ppm/\u00b0C, a strong tensile strength of 55.8\u00a0MPa and radiating element copper profile of 35\u00a0oz. The geometric design of the proposed single-unit antenna is exhibited in Fig.\u00a011 results improved, but the resonance peak did not occur in the desired wireless frequency. After considering and reviewing a mountain of literature on sliding the resonant peak by carving out the patches in microstrip patch antenna, and thus more carving out occurring like a driven element in the yagi-uda antenna, the width of the deformed rectangular patch was kept wider on the right and narrower on the left. This concept successfully produced the desired s parameters, and its resonating point was in the NR FR1 and WLAN bands. To fine-tune and optimize the design, dividing the square area into wider elements was determined to achieve optimized results in the preferable frequency band. For all four phases of the design, the bottom view of the antenna states that the full ground plane of the metal has been placed with no further modifications. Figure\u00a011 parameters.The proposed antennas have undergone four phases of development, and the fourth and final phase has been demonstrated to produce the desired results. Phase 1 consists solely of the carved-out rectangular portion for improved bandwidth and s-parameters. In the second phase, square sections were added to the bottom right corner of the carved-out rectangular patch, as optimal reflection results were not quite attained. The phase 2 S11 parameter rests in its capacity to measure the quantity of power reflected by the transmitter from the antenna. This parameter denotes the degree to which the antenna and transmission line or source impedance are matched. A low S11 value indicates a good impedance match, which means that most of the power is transmitted from the transmitter to the antenna, and very little is reflected. A high S11 value, on the other hand, signifies an impedance mismatch that results in a significant quantity of power being reflected in the transmitter. MIMO systems require a strong impedance match for efficient power transfer and signal integrity. When the S11 parameter is small, it ensures that the majority of the transmitted power is effectively radiated by the antenna instead of being squandered as reflected power. This results in increased signal strength, decreased interference, and enhanced overall system performance.In antennas, the significance of the S11 parameter aids in determining the antenna's operating bandwidth. Analyzing the S11 characteristics across a range of frequencies makes it feasible to identify the frequency bands in which the return loss is acceptable. This information facilitates the selection of appropriate frequency bands for MIMO operation and the design of filters or other components to enhance antenna performance within those frequency bands. The S11 parameter contributes to the fine-tuning of patch antenna design. Adjustments to the antenna size, substrate type, feeding structure, and other factors may be made using the S11 values to optimize performance and obtain desired features such as resonance frequency, radiation pattern, and gain, and Fig.\u00a0In addition, the S11 and frequency for all four phases is illustrated in Fig.\u00a011 is nearly 0\u00a0dB across the entire band, with one good resonance of approximately \u2212\u00a030\u00a0dB outside any of the wireless frequencies we are concentrating on. Phase 2 yields improved reflection coefficient results, but not in the desired wireless frequencies. Figure\u00a011 resonance are occurring in the desired wireless frequencies. Though a \u2212\u00a020\u00a0dB resonance is less desirable than a \u2212\u00a030\u00a0dB resonance, some of the applications in these wireless bands where moderate levels of reflections are tolerable for IoT devices, non-critical wireless communication systems, home Wi-Fi networks, low-power wireless sensor networks, and indoor communication networks so long as the system provides adequate communication quality.The relationship between SA parametric study was conducted to enhance an antenna's design and optimization processes while addressing the issue of resonant frequency and improving its performance in terms of return loss. The study examined various parameters, including slot lengths and widths, to determine their impact on the antenna's return loss and impedance bandwidth. To better understand the effects of changing parameters on the antenna\u2019s performance, only one parameter was altered at a time while keeping the others constant. Several parameters influence the resonant frequencies and matching of the antenna and Fig.\u00a0All the parameters in a patch antenna control the properties of the antenna, such as length, width, height, and permittivity. Here, a parametric study of the length and width of different slots is given as properties such as resonant frequency, input impedance, return loss, and radiation patterns were the focus of this MIMO antenna structure. The slots length and not the width heavily influence the resonant frequency, while the relationship between the length of the slot and resonant frequency can be driven as per Eq.\u00a0:1\\documeThe width of the slots affects the input impedance and radiation patterns of the antenna. It has been theorized that the wider the patch, the lower the input impedance. The slot's width predominantly determines the coupling between the slot antenna and electromagnetic radiation. A narrower slot width enhances the intensity of the electric field within the slot, resulting in a greater input impedance. It is because a narrower slot restricts the passage of currents along the slot margins, resulting in a greater concentration of electric field and a greater impedance.On the other hand, the slot length influences the antenna's resonant frequency. The length of the slot, which functions as a resonator, determines the wavelength at which the antenna emits or receives electromagnetic radiation efficiently. The antenna can be tuned to resonate at various frequencies by altering the slot length. In contrast to the slot width, the effect of slot length on input impedance is relatively minor. The relation between width and impedance for the rectangular-like patch can be approximated by given Eq.\u00a0.2\\documeInput impedance is directly associated with the return loss. The width parameter is heavily effective in improving input impedance and, thereby, return loss because when the slot width of an antenna is increased, the effective aperture of the antenna also increases. This results in the antenna capturing more electromagnetic energy, which leads to higher power reception. Consequently, the reflected power decreases, and the return loss improves. It means that increasing the slot width usually leads to a reduction in the magnitude of the reflected power and an improvement in the return loss.On the other hand, decreasing the slot width of an antenna results in a decrease in the effective aperture of the antenna, leading to lower power reception. It can cause more energy to be reflected, increasing the magnitude of the reflected power and worsening the return loss. Figure\u00a0Furthermore, modifications made to the slot width or length can have a cascading effect on other antenna parameters, such as bandwidth, radiation pattern, and efficiency. Thus, it is essential to consider all pertinent parameters and their interrelationships when designing a slot antenna to ensure optimal performance. The proposed resonator design employs the four MIMO elements placed orthogonally at the corner of the top layer, as illustrated in Fig.\u00a0A common configuration in MIMO systems involves placing four antenna elements at the four corners in an orthogonal position. Placing the antenna elements at the four corners in an orthogonal position is advantageous, enabling spatial separation and maximizing the spatial diversity gain. Positioning the antennas at different corners allows the signals to undergo varying propagation paths and fading conditions, ultimately improving the overall system performance. The orthogonal placement of the antenna elements involves arranging them so that their polarization or radiation patterns are orthogonal to each other. This arrangement allows for more independent spatial channels and reduces interference between the antenna elements.Consequently, it enables higher data rates and improves the communication reliability of the system. The proposed resonator design employs the four MIMO elements placed orthogonally at the corner of the top layer, as illustrated in Fig.\u00a0Figure\u00a0It is found that the measured results are also matched with the simulated structure and show the two similar operating bands of the resonance. There is a minute difference between simulated and measured results. There multiple reasons between simulated and measured values (a) The instrument errors, (b) fabrication tolerances and (c) ideal conditions set by software simulator while numerically computing the parameters. A few of iterations were carried out to confirm the presented results. The surface currents at targeted frequencies are shown in Fig.\u00a0Figures\u00a031. This method makes use of the S-parameters for the calculation of the ECC.In Eq.\u00a0, ECC is Calculations for ECC are shown in Fig.\u00a031 is feasible to confirm that the MEG is present. As mentioned in31, the total number of ports in the current architecture is M. The \u03b7 denotes the radiation efficiency of the present MIMO structure rad. If you want the optimum performance from the device\u2019s diversity feature across all ports, you must ensure that MEG is set to \u2212\u00a03\u00a0dB. In addition to this, the level differences between the two ports must be equal to 0\u00a0dB, as shown in Fig.\u00a0If you put two isotropic antennas at a location where there is no background noise, the total average power that those antennas will receive will either be the same as or less than the average power that a diversity antenna would receive if it is placed in a location where there is background noise (or interference). For instance, the increased performance of a MIMO antenna could be affected by external variables such as the environment in which it is placed. Applying Eq.\u00a0 as recom33. Figure\u00a0The Total Active Reflection Coefficient, which is more often referred to as simply TARC, is capable of giving an accurate evaluation of radiation performance as well as frequency response when it is applied to a large number of ports. To compute it, take the square root of the total reflected power and divide that amount by the total power that was incident on the item. This will give you the value you're looking for. The solution will be found in the result. The Total Active Reflection Coefficient, sometimes known as TARC, is a statistic that assesses how well a MIMO system bends light. This strategy considers both the random signal pairings that might take place and the mutual coupling that can take place across different networks. It is feasible to analyse the classification of reflected and incident waves using Eq.  in the p32. As shown in Fig.\u00a0In assessing the MIMO performance of the chosen THz antenna, the Channel Capacity Loss is an additional significant component that must be considered (CCL). The amount of data that can be sent across a channel at a certain speed without experiencing a substantial loss is the channel\u2019s capacity loss. To successfully signal that information has been sent, the rate must be less than 0.5 bits/second/hertz while using a MIMO system that has been created efficiently. Calculating the CCL parameter may be done using Eqs.\u00a0\u201310, as sThe antenna diversity gain (DG) provides the improvement in signal-to-noise ratio (SNR) when the MIMO antenna diversity scheme is established. In the existence of the MIMO system, the SNR is enhanced and subsequently the signal reception. This improves the reliability of the communication system. The DG can be computed from calculated values of ECC as shown in Eq.\u00a0 the valuThe antenna is compared with other antennas in the literature to show its utilization in targeted frequencies as exhibited in Table We show a four-port MIMO antenna that has a high level of isolation. The antenna's primary purpose is to cover the n48 band of Frequency Range-1 (FR-1), which operates in TDD duplex mode. After achieving the size reduction of a single antenna unit by optimizing the placement of slots and extended arms, the quad-antennas are arranged orthogonally to create antenna diversity. The antenna has resonant frequencies of 3.56\u00a0GHz and 5.28\u00a0GHz, with a 2:1 VSWR fractional bandwidth of 1.82% and 2.12%, respectively. The effectiveness of the suggested resonator is 88.34% for lower bands and 79.28% for higher bands, accordingly. Due to the excellent inter-element isolation, the antenna performs very well as a radiator regarding MIMO diversity performance. The figures for the envelope correlation coefficient are \u2212\u00a00.005, and the channel capacity loss is 0.1\u00a0bits/sec/Hz. The overall active reflection coefficient is \u2212\u00a024.26. High directivity and cross-pol isolation are both helped by the ground plane's complete profile. The antenna has a gain of 4.2\u00a0dBi and, accordingly, 2.8\u00a0dBi, which is sufficient to meet the requirements of the intended applications. Reported results in the proposed antenna strongly apply to the device used in 5G and WLAN Communication."}
{"text": "In this paper, a 12-port MIMO antenna system for 5G/WLAN applications is proposed. The proposed antenna system consists of two types of antenna modules: an L-shaped antenna module covering the C-band (3.4\u20133.6 GHz) for 5G mobile applications and a folded monopole module for the 5G/WLAN mobile application band (4.5\u20135.9 GHz). Each two antennas form a pair, six pairs in total, forming a 12 \u00d7 12 MIMO antenna array, and the elements between the antenna pairs can achieve an isolation of 11 dB or more without additional decoupling structures. Experimental results show that the antenna can cover the 3.3\u20133.6 GHz and 4.5\u20135.9 GHz bands with an overall efficiency greater than 75% and an envelope correlation coefficient less than 0.04. Finally, the one-hand holding mode and two-hand holding mode are discussed to demonstrate their stability in practical applications, and the results show that they still exhibit good radiation and MIMO performance when operating in both modes. The fifth generation of mobile communication (5G) has been officially put into commercial use, and one of its main features is the high-capacity and high-rate transmission of information . MultiplCurrently, different countries and operators use different frequency bands for 5G communication. For example, LTE band 42 (3.4\u20133.6 GHz) and LTE band 43 (3.6\u20133.8 GHz) have been certified and adopted by the European Union [However, for MIMO array antennas applied to cell phones, mutual coupling between MIMO units will be unavoidable due to the limited space of cell phones. Severe mutual coupling will lead to the degradation of isolation and seriously affect the channel capacity of MIMO systems . Since tTo meet the needs of mobile communications, there is a large body of literature on designing MIMO antennas for 5G smartphone applications ,25,26,27Based on the above status, this paper proposes a 12-port highly isolated broadband MIMO antenna system for 5G/WLAN applications. In order to support multiple communication modes and improve channel capacity, the proposed antenna system is made up of two different types of antenna modules. One is an L-shaped antenna, consisting of an L-shaped metal patch and a T-shaped slot, which covers the C-band (3.4\u20133.6 GHz) for 5G mobile applications. The second module is a folded monopole consisting of a meandering metal patch and a rectangular slot, and each antenna unit of this module covers 4.5\u20135.9 GHz used for 5G and WLAN mobile applications. Simulations (obtained by HFSS) and observations corroborate the performance of the proposed 12-port MIMO system.3, which is suitable for 5.5-inch smartphones. The metal ground (140 \u00d7 70 mm2) is printed on the back side of the FR4 substrate. The precise construction of the antenna components (Ant1 and Ant2 as examples) is depicted in The proposed 12-port antenna structure is shown in 2, as shown in Each antenna element in the L-shaped antenna module is supplied via a 50-ohm L-shaped microstrip feed line linked to the ground plane via an SMA connection. On the bottom of the substrate, a T-shaped slot radiator is etched where the printed metal floor corresponds to the L-shaped antenna. This antenna, unlike traditional closed-slit antennas, employs an etched T-shaped slit radiator with open branches. T-slits boost antenna capacitance by inserting I-shaped opening branches into the center of the U-slit. The overall size of each element of the L-shaped antenna is 3 \u00d7 8 mm2.In the folded monopole module, each antenna element consists of a rectangular ground-plane slot and a meandering metal strip. The folded monopole is printed on the FR4 substrate\u2019s top layer. Each folded monopole has six 50 vertical feed strips and six horizontal feed strips for tuning. The antenna element may be set to the required frequency range by altering the width and length of the feed strips. The entire size of the folded monopole element encompassing the high-frequency range for 5G mobile applications and the WLAN band (4.5\u20135.9 GHz), as shown in In order to study the working mechanism of the proposed antenna model, a parametric study of the individual antenna elements of the two modules was carried out using the electromagnetic simulator HFSS. Since the six antenna elements in each module have the same geometry, the parameters of Ant1 and Ant2 are used to analyze the excitation of the proposed antenna system in the low- and high-frequency bands. To verify the feasibility of the proposed antenna system, we fabricated and tested the proposed antenna model. The proposed array antenna design was investigated in depth by the simulation software HFSS version 20. To understand how the two-antenna module tuning mechanisms affect the impedance matching and operating bandwidth of individual antenna array elements, a parametric study was conducted with Ant1 and Ant2 as examples. It is worth noting that when one of the parameters is adjusted, the other parameters will remain unchanged.2 at the front of the horizontal microstrip line. In the L-shaped antenna module, unlike the conventional L-shaped metal patch, the proposed patch structure in this paper adds a small metal patch of 0.5 \u00d7 0.5 mm7 and L12. 7 on the reflection coefficient by expanding the slot width from 2 mm to 8 mm, resulting in a resonant mode at 5.0 GHz. The slot width was lowered for higher frequency bands by reducing the width of W7, which narrowed the slot width and shortened the current flow. In summary, W7 may be used to adjust the antenna element\u2019s center frequency in the appropriate frequency band. 12, another parameter that influences the resonance frequency, is altered from 3 mm to 9 mm. The resonant frequency is tuned to a higher band and the operating frequency is shifted to a higher frequency. Based on the above results, the W7 width is set to 6 mm and the L12 length is set to 12 mm, and the frequency band can be adjusted to the desired value.A parametric study was performed in the folded monopole module to investigate and analyze the effect of different lengths and widths, including WECC is one of the main indexes to evaluate the performance of the MIMO antenna array. The concept of ECC is mainly used to quantitatively describe the mutual independence of the transmitted signals between different antenna units in the MIMO antenna array: the smaller the value of ECC, the greater the mutual independence of the transmitted signals between different antenna units in the MIMO antenna array. In MIMO antenna design, the value of ECC is required to be less than 0.5 . The mosAs can be seen in In this section, a preliminary analysis of the proposed twelve-cell antenna\u2019s peak gain and overall efficiency findings is performed. The radiation efficiencies of the L-shaped antenna module and the folded monopole module (Ant1 and Ant2 as examples) are depicted in In this subsection, the directional maps (E-plane and H-plane) of the proposed 12-port antenna array with L-shaped and folded monopole elements measured at two representative frequencies (3.5 GHz for the low-frequency band and 5.5 GHz for the high-frequency band) are discussed and analyzed separately, considering the similarity of the measured radiation, with the results of Ant1 and Ant2 as representative ones. In this section, the effect of the user\u2019s hand on the performance of the proposed antenna is investigated. There are two common usage modes of embedded smartphones, namely, talk mode (SHM) and data mode (DHM). The hand configurations of the proposed antenna design in two different modes of SHM and DHM are shown in In the talk mode (SHM), the reflection coefficients of the L-shaped antenna and the folded monopole module are not significantly affected by the user\u2019s hand, as shown in The functioning of the data mode (DHM) is depicted in the figure; as shown in To highlight the advantages of the proposed antenna array, the comparison results of the same type of antennas are given in In this paper, a 12-port highly isolated broadband MIMO antenna system for 5G/WLAN applications is presented. The proposed MIMO antenna consists of an L-shaped antenna module covering the C-band (3.4\u20133.6 GHz) for 5G mobile applications and a folded monopole module covering the high band for 5G mobile applications as well as the WLAN band (4.5\u20135.9 GHz), where each antenna module consists of six identical antenna elements. In addition, the antenna pair composed of two antennas can achieve isolation higher than 11dB without adding additional decoupling facilities, obtains wideband characteristics, high isolation and low ECC, and also has good diversity performance, and therefore can be used in modern mobile terminals."}
{"text": "By stacking the DRA with a one \u00d7 three array of H-SRR unit cells, a 30 dB reduction in the mutual coupling level is attained without compromising on the antenna performance. The corresponding mutual impedance of the MIMO DRA is better than 30 dB over 5.9\u20136.1 GHz operating bandwidth. The proposed design has a DG of 10 db, ECC < 0.02, CCL < 0.02 bits/s/Hz, and an MEG of 0 dB. The overall design has a promising performance, which shows its suitability for the target wireless application.A single negative metamaterial structure with hexagonal split-ring resonators (H-SRRs) is inserted within a two-port multiple-input multiple-output (MIMO) dielectric resonator antenna (DRA) in order to achieve a reduction of mutual coupling between closed multiple antenna elements. Between closed, tightly coupled, high-profile antenna elements, the single negative magnetic inclusions (H-SRRs) are embedded. By incorporating magnetic structures within antenna elements, the mutual coupling is significantly diminished. Mutual coupling reduction is attained by inserting an array of hexagonal split-ring resonators between the inter-spacing elements. An operative approach for the reduction of the mutual coupling between two  During the last decade, with the development of communication systems, the demand of the capacity and data rates for internet and other services  has highly increased. This technological development has considerably increased the number of subscribers. To fulfill the new requirements, the concept of multiple antennas (MIMO) was proposed. The main challenge of the multiple antennas device/system is the size constraint. Electronics system design engineers are therefore focusing on the miniaturized transmitting/receiving (Tx/Rx) devices, while maintaining a high data rate, enhanced channel capacity, and better coverage of the signal . There iIn ,13,14,15aterials . For thiaterials ,9, high aterials , complematerials ,12, and aterials . The desaterials . Such staterials ,19,20,21aterials . This isaterials . In thisIn , a spira designs .Mutual coupling highly depends on the spacing between the antenna elements. Closely spaced antenna elements offer high coupling with reduced port isolation. This causes unwanted effects on antenna features like reduced ECC and low DG, TARC, and MEG. Contrary to closely spaced antenna elements, increasing the inter elements distance reduces the mutual coupling, but it causes an enlarged size and affects the radiation pattern. Within a compact device, reduction in mutual coupling in MIMO antennas is a major challenge. As the proposed design is working at a lower frequency, handling the mutual coupling at this range of frequencies is even more challenging. We need techniques which are helpful in reducing the mutual coupling while maintaining a compact size and high performance. Thorough investigation of multiple techniques reveals that the deployment of metamaterials (CSSRs and SSRs) among the antenna elements is the ultimate solution to this issue. These uniquely structured materials have the potential to highly reduce the mutual coupling while maintaining a good overall performance .The main objective of this work is to combine H-SRRs for first time with RDRA MIMO antenna elements for mutual coupling reduction. H-SSRs offer wideband response with a compact size. Previously, this technique was combined with cylindrical DRAs. It is well known that RDRA has different operating modes and shape than the cylindrical DRA. Thus, integrating H-SRR with RDRA is a real challenge. Careful design and optimization have enabled a successful deployment which results in a significant reduction in mutual coupling (from 6 dB to 30 dB).The rest of the paper is organized as follows: 1 is the center-to-center distance between the DRs. Each DR of the proposed design are excited by a coaxial probe feed, which is placed at the bottom of the ground plane. For the isolation enhancement, a metamaterial structure with three pairs of hexagonal-shaped split-ring resonator (H-SRR) is introduced between the DRs. The detailed dimensions of the proposed design are listed in The evaluation process of the MIMO DRA is depicted in In (2), In this case, the DR resonates at 5.2 GHz with good impedance bandwidth and matching. The simulated S11 are depicted in The unique characteristics of a metamaterial shield are employed in the proposed MIMO DRA presented in this section. The metamaterial structure comprises a unique unit cell (SRR) having dimensions \u201cr (3.9 mm)\u201d, \u201cg (0.5 mm)\u201d, and \u201cc (0.6 mm)\u201d, where r is the radius, g is the split width, and c is the SRR width, as shown in To achieve the optimum choice of H-SRR with improved results for the proposed design, a parametric analysis is carried out on important parameters of the SRR. Different parameters of the SRR have different effects on the performance of the proposed design. These key parameters include the width of the splits and the width of the metal of the inner sides and outer sides.As shown in Increasing the gap split decreases the capacitance, which in response increases the resonance frequency. Based on the return loss response, the width of the split is attained at 0.5 mm.The width of the SRR also plays an important role in attaining the desired resonance frequency. As shown in In this section, we present the final simulated and measured results of the proposed design, providing a comprehensive evaluation of its performance. The key parameters analyzed include reflection coefficients, mutual impedances, gain, and radiation patterns across all operating bands. The mutual impedances between the antenna ports are also examined to evaluate the level of interference and coupling between the elements.The proposed MIMO-DRA, integrated with a one \u00d7 three array of an H-SRR unit cell, is fabricated and its performance is measured. The prototype photograph of the proposed MIMO-DRA with H-SRR is depicted in The gain characteristic is a vital indicator of an antenna\u2019s performance and its ability to radiate and transmit power effectively. The gain of the proposed design across the operating bands is evaluated through simulation and measurement, as depicted in Surface current distribution is helpful in explaining the overall behavior of the proposed design. To assess the MIMO and diversity performance of the proposed antenna, key parameters such as the envelope correlation coefficient (ECC) and diversity gain are evaluated.The ECC is a crucial metric in MIMO antenna systems as it quantifies the correlation or isolation between the different branches of communication. In this study, the ECC is computed using the radiation pattern of the proposed MIMO antenna and can be expressed using Equation (7). The measured pattern is noticed at three frequencies . Then, by using Equation (7), the measured ECC at three points is noticed. The final response is drawn by curve fitting. It is generally desirable to have an ECC value below 0.5 for satisfactory MIMO performance ,23. FiguThe diversity gain (DG) is another important parameter that evaluates the enhancement provided by a MIMO system compared to a single antenna system. The DG is calculated using Equation (8), which quantifies the improvement in signal quality achieved through diversity techniques. Channel capacity loss (CCL) is another important MIMO parameter. CCL is important in showcasing the effectiveness of the proposed design throughput. The smaller the value of the CCL, the better the data transmission. A 0.4 bits/s/Hz CCL value is considered a good one for good data transmission. Equations (9)\u2013(12) explain the basic parameters which help to determine the final CCL response of the proposed design .(9)CLosMean effective gain (MEG) is another important MIMO antenna design parameter. It is the ratio between the diversity antennas\u2019 received power and the isotropic antenna\u2019s received power . It showThe total active reflection coefficient is also an important MIMO antenna parameter. It is the ratio between the square root of the total power reflected and the total power incident. It is helpful in the determination of the effective operating bandwidth of a MIMO antenna system. The TARC of a MIMO antenna system is determined with the help of the following equations :(15)TARCFor good communication, the TARC of a MIMO system should under 0 dB . Thus, aA comprehensive comparison between the proposed work and recently published studies is presented in Mutual coupling between closely placed dielectric resonator antennas on a multiple antenna system was investigated in the present work. A single-negative magnetic (MNG) H-SRR band gap decoupling structure was examined. Detailed simulation and experimental measurements were performed as well. The magnetic insertion has shown the effectiveness in terms of isolation enhancement and suppressing the displacement current. From the simulation results, a 6 dB isolation was achieved without H-SRR insertion and 27 dB additional isolation was achieved at the resonance frequency by employing the H-SRR. The isolation enhancement has resulted in a recovery of the multiple antennas pattern, which is clear from the pattern measurement performance. The computed results confirm that implementing the H-SRRs between the antennas offers an excellent coupling reduction. The benefit of the proposed design is its small electrical size (\u03bb/12) and simplicity of fabrication as compared to other meta-structures. The overall design compactness and novel decoupling structure emphasizes the significance of the proposed design for real-time wireless applications."}
{"text": "A unique high gain antenna array with a 3D-printed dielectric polarizer is proposed. The packaging of the antenna array feeding structure is eliminated by aggregating the feeding network in between the antenna elements. This has a significant advantage in maintaining neat and symmetric radiation characteristics with low cross-polarization levels. The proposed structure combines two elements in one feeding point to reduce the array distribution feeding points of a 4\u2009\u00d7\u20094 antenna array from 16 to 8 points. The proposed antenna array structure is extremely low in cost and can be used as either a linearly or circularly polarized one. The antenna array achieves a gain of 20\u00a0dBi/dBiC in both scenarios. The matching bandwidth is 4.1%, and the 3-dB Axial Ratio (AR) bandwidth is 6%. The antenna array uses a single substrate layer without the need for any vias. The proposed antenna array suits well various applications at 24\u00a0GHz, while maintaining high performance metrics, and low cost. The antenna array can be easily integrated with transceivers due to the use of printed microstrip line technology. While we can have higher speeds at mm-Wave frequencies, the realization of the physical layer becomes more challenging7. The main disadvantage of operating at higher frequencies is having a higher path loss for the wireless propagating electromagnetic waves once compared with lower RF frequencies. To compensate the path loss, one might suggest increasing the power amplifier gains in the radios. The main issue with this solution is not only that it will drain more power from the supply and cause more heating, but it will also make the devices bulky by accommodating the heat sinks and the required cooling apparatus. For mobile devices, it would be impractical as it will drain the device battery very quickly. A suggested remedy is to use high directivity antennas that will focus the energy towards the communicating entity, this will compensate for the path loss effect and relax the design requirements of the power amplifiers15.In wireless communications, the channel capacity is proportional to the available bandwidth according to Shannon\u2019s limit. The more bandwidth we have, the higher the capacity of the wireless channel is. As such, a higher data rate can be achieved. By migrating the operation to higher frequencies, such as the anticipated mm-Wave frequencies. The absolute available bandwidth would be significantly larger than the typical RF frequencies. Therefore, higher speeds of wireless communication become attainable20. The use of short-range radars for health care applications 21, automotive radar sensors, and motion detectors has become ubiquitous26. Moreover, the developments in wireless connectivity led to the invention of various internet of things technologies. The Internet of Things encompasses plenty of applications. An antenna is an integral part of any IoT communicating device. The performance of these antennas is a crucial factor for the whole system performance. Various antenna structures have been proposed in the Industrial Electronics33, IoT and Sensors literature41. In Ref.42 a patch antenna with a fence-strip resonator was realized for smart homes IoT communication. For such communication the antenna radiation pattern have to be Omni-directional. In Ref.43 a unique glasses frame antenna for IoT communication was realized. A programmable beam scanning antenna without phase shifters was proposed for IoT relay communication in Ref.24. In Ref.26 a shark-fin antenna was realized, the antenna is to be used for future railway communication systems. In Ref.23 a multiband printed smartwatch antenna was proposed, the antenna enhanced the number of frequency bands and improved the Omni-directivity. In Ref.22 a microstrip patch antenna was employed in a structural health monitoring (SHM) system to measure structural strain. In Ref.44 an electronically steerable parasitic array radiator was used in a dense wireless sensor network. In addition to that, the modelling of antennas is essential in the design process, as an example but not limited to, since the existing antenna equivalent models are inflexible because they assume rectangular antenna contour, a hybrid-equivalent surface-edge current model was proposed in Ref.45 to overcome the limitation of the existing models, these models are very useful for vehicle to everything (V2X) communication. Metasurfaces and dispersion engineering techniques can be found to be very useful for various applications as well, Metasurfaces can be utilized to manipulate the characteristics of the propagating waves effectively47.Operating at mm-Wave frequencies is useful for radar and sensing applications as well. The higher the radar frequency of operations is, the higher the resolution that can be achieved. Several works proposed the use of the 24\u00a0GHz\u00a0mm-Wave band for radar applications49. In this article we present an extremely low-cost antenna array that can be used as either linearly or circularly polarized one. The antenna array has a realized gain of 20 dBi in both scenarios. The matching bandwidth is 4.1% and the AR bandwidth is 6%. The antenna only uses a single substrate layer with no need for any vias. To switch to circular polarization operation, a 3D printed dielectric polarizer is used. The proposed antenna array suits well various applications at 24\u00a0GHz, while maintaining high-performance metrics, and extremely low cost. The antenna can be easily integrated with transceivers due to the use of printed microstrip line technology.The polarization of the antenna is usually determined by the application, for example in satellite communication systems due to the difficulty of alignment, a circular polarization is necessary to avoid any polarization mismatch loss. Radars uses a linear polarization frequently, but they can still use a circular polarization as well50. Reflectors, and lenses are well known for their ability to provide high gain51. However they are very large due to their focal length requirement, which makes them harder to integrate. Moreover, they are not considered low-profile solutions. Printed technology is well suited for highly integrated systems, and they are well known for being low profile. Planar arrays can be used to increase the gain performance. By increasing the number of elements in an antenna array, the gain increases proportionally, the rule of the thumb is that by doubling the number of elements the gain increases by 3\u00a0dB. However, the issue is that by increasing the number of elements, the associated feeding network size would increase in a proportional manner. The larger the feeding network is, the lager the incorporated loss in it. The total loss in a printed feeding structure is the sum of the dielectric, conduction, and radiation losses. Radiation loss can be reduced by minimizing the radiation produced by the feeding network, ideally a closed structure would suffice to eliminate the radiation loss completely. The dielectric loss can be reduced by using a material with a low loss tangent, ideally vacuum (air). Therefore, closed metallic waveguides are considered to be very efficient feeding structures as they eliminate both radiation and dielectric losses, however they are very expensive and harder to integrate with printed circuits due to their feeding waveguide transition requirement53. Moreover, by shifting to higher frequencies, the dimensions become smaller and harder for the milling machines to realize. Accordingly, this makes them more prone to tolerance errors, and more challenging to be realized by milling machines. Here, we show that we can maintain a decent efficiency and high gain by using printed technology, while at the same time keeping the structure unpackaged, via-less, and only using a single substrate layer. Figure\u00a050 we showed that such a printed open microstrip line stub can be used as a radiating element where the radiation from the fringing fields can be utilized. As in Fig.\u00a054.At higher frequencies, the gain of the antenna is essential to compensate for the path loss; there are several ways and various structures that can be used to achieve high gain performance metric50. To tackle this issue, the feeding network design procedure in Fig.\u00a0L as long all the lines lengths are multiple of an odd integer of the guided quarter wavelength. This procedure is very useful where it allows the use of narrow microstrip lines that can fit easily between the radiating elements. Moreover, it minimizes the whole parasitic radiation from the feeding structure due to the use of thin lines which are aggregated between the elements. Further detailed analysis of this concept and comparison cases with packaged structures can be found in Refs.56. Figure\u00a057. Packaging is a good choice; however, it is not easy to fabricate, and it is more expensive. In the suggested design, the packaging of the antenna array feeding structure is eliminated by aggregating the feeding network in between the antenna elements, this has a significant advantage in maintaining neat and symmetric radiation characteristics with a decent gain in the range of 20\u00a0dBi, further details about this technique can be found in Ref.50. Figure\u00a058).The typical procedure to design a feeding network for a 2D array is by using power dividers and quarter wavelength transformers to match the parallel combination of the antenna elements to the desired system impedance. This procedure usually results in transmission lines with different characteristic impedances. Due to the limited space between the antenna array elements, the wide microstrip lines cannot be accommodated, especially in the aggregated configuration. Moreover, very wide microstrip lines can have significant radiation loss65. For example, they can transform a linearly polarized wave to a circularly polarized one and vice versa. Figure\u00a067. The operation of the dielectric polarizer can be explained by decomposing an incident plane wave with 45\u00b0 angle into two components, parallel and perpendicular or (TE and TM components) as shown in Fig.\u00a068, consequently, the phase difference and the axial ratio can be calculated as in (7\u20138).Simply put, electromagnetic polarizers are structures that are used to transform the wave polarizationo\u2009\u00d7\u20093.6 o and the polarizer height is 1.87 o. Figure\u00a0Table xz and yz planes. The radiation pattern shows an LHCP wave in both planes with side lobe level way below \u2212\u00a014\u00a0dB. Figure\u00a011 in both cases are almost equal indicating a transparent polarizer.Figure\u00a0The 20 dBi gain, and the 90% efficiency of the antenna array in both scenarios makes the antenna very attractive for 24\u00a0GHz applications . The antenna can be used effectively in either mode (CP or LP) depending on the application requirements. While the radiation characteristics encompasses a neat directive pencil beam, the side lobe level is well reduced below \u2212\u00a014\u00a0dB in both scenarios. The solution is highly suited for integration with PCB technology. The structure is extremely low in cost where it only uses a single substrate layer with no vias.\u03b8 and E\u03d5) for the linear polarization, and  for the circular polarization. Figure\u00a0LP\u2009=\u2009E\u03b8\u00a0\u2212\u00a0E\u03d5), and the CP case is given by (\u0394CP\u2009=\u2009ELH\u00a0\u2212\u00a0ERH). As expected the circular polarization gain is independent of the azimuthal angle, which makes it immune to misalignment polarization miss match. Also the cross polarization level in the CP case fluctuates from 16.4 to 22.6\u00a0dB with the azimuthal angle (i.e. within a 6.2\u00a0dB margin). This feature of CP antennas makes it very desirable for several applications which needs an aligned line of sight wireless communication link. On the other hand, the LP antenna shows that the electric field gain depends highly on the azimuthal angle. . In the E-plane, the co-polar component is E\u03b8, and the cross-polar component is E\u03d5, and vice versa in the H-plane. Therefore, with the azimuthal misalignment the gain drops from one component and increases in the other component, and the cross polar level can vary from 29.6 to 0 to \u2212\u00a025\u00a0dB, the change in the sign represent the switch from one principle plane to the other. Despite the fact that LP antennas are prone to polarization mismatch loss, they well fit several radar applications, this is due to the fact that reflected signals from objects maintain the same polarization (i.e. Linear), and allows the use of one linear antenna for both the transmitter and receiver circuitry which are usually connected through a circulator. On the other hand, in the CP case, the reflected signals from objects flip their polarization . As such, the transmitting antenna cannot detect the reflected signal, and this will require another antenna with the opposite polarization to detect the reflected signal.It should be clear that there is a slight azimuthal misalignment of the antenna due to the visual alignment of the antenna in the chamber while performing the measurement. The misalignment is noticed from the measured cross-polarization component, which has some contribution from the co-polar in that case. That is why a peak is shown on the broadside of the cross-polarization. Figure\u00a069, an 8\u2009\u00d7\u20098 patch antenna array can only provide 18 dBi of gain.A comparison with other works is shown in Table The proposed structure only uses a single substrate which makes it extremely low in cost. It doesn\u2019t require any vias, which simplifies the fabrication process significantly. Such simplification in the fabrication is very beneficial, especially at millimeter wave frequencies where the structure/vias dimensions become very small and very susceptible to tolerance errors. Furthermore, the proposed structure uses a single substrate with a MSL feed, which makes it very easy to be integrated with transceiver circuitries. Other works as indicated in Table A low-cost antenna array operating at 24\u00a0GHz was demonstrated, the packaging of the antenna array feeding structure has been eliminated by aggregating the feeding network in between the antenna elements. The proposed antenna array had an extremely low cost and could be used as either a linearly or a circularly polarized antenna array. The antenna array had a realized gain of 20 dBi in both scenarios. The achieved matching bandwidth is 4.1% and the 3-dB axial ratio bandwidth is 6%. The antenna array only used a single substrate layer with no need for any vias. To switch to circular polarization operation, a 3D printed dielectric polarizer was used. The proposed antenna array demonstrated well suitability for various applications at 24\u00a0GHz, while maintaining high performance metrics, and extremely low cost. The antenna array could be easily integrated with transceivers due to the use of printed microstrip line technology."}
{"text": "The antenna structure incorporates three U-shaped slots in the ground plane, forming a defected ground structure. The microstrip line is exclusively present on the front side plane. The antenna is printed on a substrate made of a ceramic-filled PTFE composite with a size of 20\u00a0mm\u2009\u00d7\u200921\u00a0mm\u2009\u00d7\u20090.76\u00a0mm and a dielectric constant of 3. The proposed antenna is analyzed using the characteristic mode analysis based on the method of moment and simulated by an electromagnetic simulator based on the finite element method. A multiband antenna is fabricated and tested to validate the proposed antenna performance. The simulation and measurement results reveal that the antenna exhibits good input impedance bandwidths of S Multiband printed antennas have been the research priority with this development. Printed antennas have the advantages of low profile, low cost, lightweight features, easy manufacture, and integration with microwave monolithic integrated circuits (MMICs)4. The usage of DMS and DGS for realizing the design of a mirror stairs microstrip multiband antenna that covers the range of 2\u201317\u00a0GHz is explained in5. A printed slot antenna with defects in the ground plane that produce five bands was successfully designed in6. Different Euclidean slot forms printed on the ground plane with and without Euclidean patches were used to investigate printed slot antennas7. Two rectangular slots defected on the ground plane and five strips located inside the two slots were employed to operate at four bands  GHz in8.In the past decades, various techniques have been widely employed to design multiband printed antennas based on the defected microstrip structure (DMS), defected ground structure (DGS), meander lines, and notches. These techniques are employed to improve the performance parameters of conventional microstrip/printed antennas for multiband applications. The DGS has been the most widely employed technique in the last two decades. It is implemented by making a defect/etching on the ground plane of microstrip circuits. The defect of DGS can be non/periodic elements or a unit cell9. CMA was applied to design an antenna at 2.4\u00a0GHz based on a single meander line in the ground as DGS10. A compact and efficient broadband antenna with two rectangular slots and a reduced ground plane is presented in 11. The performance of this antenna is analyzed using CMT for various radio systems. This paper12 presents a simple compact circularly polarized slot antenna with a wide bandwidth for wireless applications. Its performance is demonstrated using CMA as well as some experimental measurements. A design of a filtering antenna for 5G FR2 band based on CMA of the radiation and feeding structures is presented. Its performance is validated by fabrication and measurements in13. In the study of14, CMT defined the feeding structures and positions for two radiating ground antennas containing simple feeding loops. In15, the CMT was employed to design a compact and wideband circularly polarized antenna predicting the feeding position. CMA was employed to improve the performance of smartwatch antennas16.Characteristic mode analysis (CMA) was recently developed from the characteristic mode theory (CMT). CMA allows a physical insight into the radiation emitted by a multiband antenna and demonstrates how to design an efficient radiating topology that offers a multiband characteristic. The CMT depends on the electric field integral equation based on the method of moment (MoM) formulationIn this work, we present a novel and compact multiband antenna that effectively covers three specific frequency bands relevant to 5G and ITU applications. Our approach incorporates CMA and DGS techniques to facilitate the design and optimization of the antenna. The proposed antenna consists of a defected copper plane with a rectangular slot and three U-shaped slots of different dimensions, creating a DGS that controls the current distributions and the modal behavior of the antenna. The CMA, based on the MoM, is applied to design and optimize the antenna\u2019s characteristics using the equations of CMT. The antenna is simulated using a finite element method (FEM) based electromagnetic simulator and provides three bands with resonance frequencies at 2.96\u00a0GHz, 6.06\u00a0GHz, and 8.03\u00a0GHz. The first and second bands are in the region of 5G sub-7GHz: (2.89\u20133.03) GHz, and (5.99\u20136.14) GHz. The third band (7.84\u20138.21) GHz is appropriate for ITU-8 GHz band communication services. This work demonstrates a novel methodology for multiband antenna design with physical insight, without a substrate, that stands in contrast to conventional antenna design methods that rely on trial-and-error approaches without a comprehensive understanding of the underlying physics. In the subsequent section, we present the key equations derived from CMT that hold particular significance. The proposed antenna undergoes examination using two distinct techniques: firstly, the CMA is employed to achieve the final design of the antenna, following a comprehensive five-step process guided by the equations of CMT. In the subsequent part, the FEM technique is utilized to conduct additional parametric investigations on the proposed antenna. Experimental results are then discussed to validate the simulated outcomes obtained from both the CMA and FEM methods. Finally, a dedicated conclusion section summarizes the findings and implications of the study.17 in 1971 and then investigated by Roger Harington18. It provides the response in terms of eigenvalues, surface current, field radiation, characteristic angle, and modal significance to search for dominant resonating modes. These modes are excitation independent and dimensions dependent. The following eigenvalue equation is used to estimate the characteristic modes of a conducting surface.n is the eigencurrent, \u03bbn is the eigenvalue of the nth characteristic mode. The complex impedance Z is defined as Z\u2009=\u2009R\u2009+\u2009jX, such that R and X are the Hermitian real and imaginary components of the matrix Z, respectively. The characteristic angle (\u03b1n) represents the phase difference between Jn and the electric field En and can be calculated byThe CMT was first proposed by Robert Garbaczn\u2009=\u20090, therefore \u03b1n must be equal to 180\u00b0; otherwise, the modes are associated with stored energy. Modal significance (MS) presents the normalized current amplitude with a range from 0 to 1 that can be calculated asResonance modes exist when \u03bbn\u2009=\u20090), the MS should be equal to 1.At resonance mode (\u03bb3 which corresponds to (0.32 \u03bbg\u2009\u00d7\u20090.30 \u03bbg\u2009\u00d7\u20090.01 \u03bbg), a dielectric constant (\u03b5r\u2009=\u20093), and tangent loss (tan \u03b4\u2009=\u20090.0013). At the top of the substrate, there is only a microstrip line of feeding length (Lf) and width (Wf). Moreover, at the substrate\u2019s bottom, there is a ground plane of the proposed antenna that involves three U-shaped defected slots. The slots are located in a rectangular shape etched with dimensions (13\u2009\u00d7\u200910) mm2. There is a middle vertical strip with a length equal to 8.5\u00a0mm and a width (W5\u2009=\u20090.6\u00a0mm), which is under and parallel to a transmission line. The narrow strip evenly divides the slots that consist of two identical U-shaped slots with length (L1\u2009=\u200910\u00a0mm) and width equal to 6.2\u00a0mm. With (W4\u2009=\u20091.5\u00a0mm), the arm slot width for the right and left U-shaped slots are kept fixed. The length (L2\u2009=\u20097.5\u00a0mm) and the width (W2\u2009=\u20097.8\u00a0mm) of the inverted third U-shaped are etched. The vertical arms of the inverted U-shaped slot have a width (W3\u2009=\u20091\u00a0mm). All parameters of the proposed printed antenna are shown in Table The proposed printed multiband antenna\u2019s geometry is demonstrated in Fig.\u00a0g/2 to realize a multiband operation for the printed antenna 19.The slot antenna is commonly employed for wideband and multiband applications aside from designing the printed slot antenna\u2019s slot length, the radiating element must be around \u03bbg) is given by:reff is the effective dielectric constant.The guide wavelength . In processing the proposed multiband antenna design, five prototypes are considered as demonstrated in Fig.\u00a02. A rectangular patch is placed in the primary rectangular slot for Antenna 1 with dimensions (10\u2009\u00d7\u20098.5) mm2 to create a U-shaped slot in Antenna 2 as shown in Fig.\u00a02, and an E-shaped slot is formed as Antenna 3 as in Fig.\u00a0Since there is no substrate material in CMA, the dielectric constant, \u03b5n\u2009=\u20090, \u03b1n must be equal to 180\u00b0 indicating that the first two modes are at (5.74 and 5.95) GHz. The existing mode will be according to the transmission line\u2019s position. The eigencurrents\u2019 profiles for Antenna 1 are an explanation for how to design the feeding line , to excite the first or the second mode  GHz as demonstrated in Fig.\u00a0The first three modes are investigated using software based on MoM to solve the characteristic modes at a specific frequency. Figure\u00a0re at 5.7 and 5.95The characteristic angles for the first six modes are shown in Fig.\u00a0The MS is calculated for the three resonance modes by using equation\u00a0(3), as demonstrated in Fig.\u00a020. Figure\u00a0A high-frequency structure simulator based on the FEM was employed to optimize the antenna\u2019s performance11) was measured by using a Rohde & Schwarz ZVB 20 Vector Network Analyzer. The top and bottom sides of the fabricated antenna are illustrated in Fig.\u00a0A novel proposed antenna was designed, fabricated, and measured. The electrical performance parameter (S11) are shown in Fig.\u00a011|\u2264\u2009\u2212\u200910\u00a0dB.The simulated and measured results of the reflection coefficient , at resonance frequencies  GHz. The resonating areas obtained in Fig.\u00a0Figure\u00a0The proposed antenna is compared with published multiband antennas and summarized in Table The simulated and measured radiation patterns of the proposed antenna for an E-plane (Y\u2013Z plane) and H-plane (X\u2013Z plane) are shown in Fig.\u00a02. This fabrication process served as a means to validate the accuracy and reliability of the simulation results. The experimental evaluation of the fabricated antenna revealed its operational capabilities across three distinct frequency bands. Specifically, the antenna operated within the frequency ranges of (2.93\u20133.07) GHz with a bandwidth of 0.14\u00a0GHz, (6.07\u20136.21) GHz with a bandwidth of 0.14\u00a0GHz, and (7.87\u20138.47) GHz with a bandwidth of 0.6\u00a0GHz. The measured results obtained from the experiments demonstrated a favorable agreement with the simulated outcomes. The successful alignment between the measured and simulated results signifies the suitability of the printed antenna for communication service applications within the 5G Sub-7\u00a0GHz and ITU-8\u00a0GHz bands. These findings highlight the potential practical applications of the designed antenna in meeting the communication demands of these specific frequency ranges.A printed antenna was specifically designed to cater to 5G multiband applications. The antenna design incorporates three U-shaped slots strategically placed as defects within the ground plane, while the transmission line is implemented on the top of the substrate. The performance of the designed antenna is analyzed and simulated through the utilization of CMA based on the method of moments and FEM (finite element method) simulators. The fabricated antenna was constructed on a RO3003 substrate, featuring dimensions of (21\u2009\u00d7\u200920) mm"}
{"text": "In this article, a microwave (MW)/millimeter wave (MMW) aperture-sharing antenna is proposed. The antenna is constructed using two orthogonal columns of grounded vias from a 3.5 GHz slot-loaded half-mode substrate-integrated waveguide (HMSIW) antenna. These vias are reused to create two sets of 1 \u00d7 4 MMW substrate-integrated dielectric resonator antenna (SIDRA) arrays. With this proposed partial structure reuse strategy, the MW antenna and MMW arrays can be integrated in a shared-aperture manner, improving space utilization and enabling dual-polarized beam steering capability in the MMW band, which is highly desirable for multiple-input multipleoutput (MIMO) applications. The integrated antenna prototype was manufactured and measured for verification. The 3.5 GHz antenna has a relative bandwidth of 3.4% (3.44\u20133.56 GHz) with a peak antenna gain of 5.34 dBi, and the 28 GHz antenna arrays cover the frequency range of 26.5\u201329.8 GHz (11.8%) and attain a measured peak antenna gain of 11.0 dBi. Specifically, the 28 GHz antenna arrays can realize dual-polarization and \u00b145\u00b0 beam steering capability. The dual-band antenna has a very compact structure, and it is applicable for 5G mobile communication terminals. New spectrum resources have been introduced in 5G to increase data capacity, mainly including the sub-6 GHz (450 MHz\u20136 GHz) and MMW bands (24.25\u201352.6 GHz) ,2,3. TheNumerous novel and creative shared-aperture designs using various technologies have been proposed. The first category is the stacked structure ,11,12,13In general, the current shared-aperture antennas still have some flaws: (1) the antenna sizes are large, making them difficult to be applied to the mobile terminals; and (2) most designs cannot support dual-polarized and wide-angle beam scanning in the MMW band.x-polarized and y-polarized arrays, respectively [\u03bb02 (\u03bb02 is the wavelength in free space at 28 GHz) and each element can be fed independently, the MMW arrays can support \u00b145\u00b0 beam steering [In light of these issues, this article suggests a 3.5 and 28 GHz aperture-sharing antenna that is based on partial structure reuse strategy. ectively . Since tsteering . To expar\u03b51 = 6.15 and a loss tangent of 0.002, while Sub2 is made of Rogers 4003C with r\u03b52 = 3.55 and tan\u03b4 = 0.0027. The coaxial probe numbered #1 excites the 3.5 GHz HMSIW antenna. The inner conductor of the probe is inserted into Via1, while the outer conductor is soldered to the ground. x- and y-directions, and the element interval is 0.51\u03bb02. Two sets of 1 \u00d7 4 \u201cH-shaped\u201d slots, which are used to feed the arrays with the microstrip line ports numbered #2~#9, are etched on the ground plane. Proper array spacing and the individual feed of each element enable the wide scanning angles of \u00b145\u00b0 for the MMW arrays. All the antenna parameters are listed in the caption of Since the proposed partial structure reuse strategy results in very little interaction between MW and MMW antennas, the two parts can be designed separately.11 mode to resonate at 3.5 GHz for potential 5G applications. 11, TM22, and TM33 modes of the full-mode SIW (FMSIW) resonant cavity at 3.5 GHz, 7.4 GHz, and 8.2 GHz. The electric field in the FMSIW resonant cavity is symmetrical at the central plane along the x-direction in 11|, which reveals three resonant modes in the 3\u20139 GHz frequency range. 11 mode at 3.5 GHz, TM22 mode at 7.1 GHz, and TM33 mode at 8 GHz, respectively.The 3.5 GHz MW antenna design can be considered first. The preliminary dimension of the antenna can be calculated according to the classical SIW antenna theory ,37 by se11 mode is thoroughly narrow because of the compact size of the antenna. The idea is to shift the higher-order mode TM22 mode downward to combine with the TM11 mode in order to increase its bandwidth. The slot-loading technique is used in the design to implement this idea. 11 mode will not be affected since the current is parallel to the slot, but the TM22 will be significantly affected (shifted down) as the current is cut by the slot (current path will be increased). Similarly, if Slot2 is further introduced, the TM22 mode will continuously be affected because the current is still cut by the slot, and the TM11 mode will also be slightly affected since a small amount of current of this mode is cut as well.The operating bandwidth of the TM22 mode decreases rapidly while the frequency of TM11 roughly remains constant with the increase in length (gL). As can be learned through gW), the frequency of the TM11 mode slightly shifts down and the frequency of TM22 continues to decrease quickly. Finally, the two modes can be merged, broadening the bandwidth from 1.3% to 3.4%.A parametric study of the slot lengths is conducted to clearly verify the validity of the proposed slot-loading technique. With reference to 11| of a single SIDRA element and the gain of a 1 \u00d7 4 array. The proposed slot-feed SIDRA structure has two resonances, which are the lower-frequency resonance from the DRA mode and the higher-frequency resonance from the feeding slot mode. The element has a relative impedance bandwidth of 12.5% (26.1\u201329.6 GHz), while the peak antenna gain of the array is 11.5 dBi. h2 of the substrate, the lower resonant mode shifts down while the higher one stays stable, which indicates that the lower resonance is affected mainly by the DRA mode. sL increases, the higher resonant frequency shifts down while the lower resonant frequency remains almost fixed. This confirms that the higher resonance is influenced mainly by the slot mode. The design of SIDRA has been well presented in . Figure x-axis polarization and y-axis polarization, respectively. Here, a 1 \u00d7 4 array along the x-axis is taken as an example to demonstrate the beam scanning characteristic. \u03c8, 2\u03c8, and 3\u03c8 are implemented in the elements. The radiation angle \u03b8 can be calculated byc is the velocity of light, d is the interval of the elements, which equals 0.51 \u03bb02. The required phase shift \u03c8 to generate the given beam position \u03b8 is calculated by Equation (1), and the relative phase shifts of \u03c8, 2\u03c8, and 3\u03c8 are assigned to each excitation port [The two sets of 1 \u00d7 4 SIDRA arrays can steer the beams along ion port . Figure ion port .r1 > 6) should be chosen due to the need for a compact size of MW antenna and the construction of MMW DRA. Considering the co-aperture of MW and MMW antennas, the thickness of the substrate should be balanced with the planar size of the MMW antenna. Then, several design steps are given as follows:Based on the above analysis, a brief design guideline can be concluded. First, a substrate with high permittivity /2 and \u03bb01 is the wavelength in the vacuum at 3.5 GHz [Determining the initial size of the MW antenna according to the following empirical formula:  3.5 GHz ,37.mL can be set to be around \u03bb02/2.Determining the initial size of the MMW antenna. The initial calculation can be performed with the classical dielectric waveguide model (DWM) for the SIDRA . The sizReplacing the grounding vias of the MW HMSIW antenna with MMW SIDRA arrays and introducing the slot-loading technique to expand the MW impedance bandwidth.Optimizing the final structure to achieve good impedance and radiation performance.The two antennas can be combined to form a shared-aperture antenna once the independent designs of MW and MMW antennas are complete. To testify the coupling between the two different bands and the two polarizations in the MMW band, the S-parameters between different feeding ports should be investigated. As is shown in Z0 = 50 \u03a9 through a g\u03bb impedance converter. The function of a resistor is to improve the isolation of the output port of the power divider, with resistance R = 2 \u00d7 Z0. The model of the resistor is a 100 \u03a9 Panasonic resistor packaged as 0402.To verify the viability of the presented concept, the co-designed antenna was fabricated as shown in 11|s in the MW band. The measured impedance bandwidth is 3.4%, covering 3.44\u20133.56 GHz. The measured and simulated peak gains are 5.34 dBi and 5.72 dBi. As described in 11|s for the MMW array are plotted in The measured, simulated gains and |SThis article proposed, simulated, and measured a compact aperture-sharing antenna operating at 3.5 and 28 GHz bands with dual-polarization and beam steering in the MMW frequency band. The slot-loading technology is introduced in the 3.5 GHz HMSIW antenna design to broaden the bandwidth with mode analysis and parametric study conducted. The reuse of the orthogonally arranged grounded vias of the HMSIW antenna enables the dual-polarized beam steering ability for 28 GHz SIDRA arrays. The measurement results indicate that the MW and MMW antennas can work independently. The proposed shared-aperture antenna could be an attractive competitor for wireless communication terminal applications."}
{"text": "As UWB technology develops and devices become smaller, miniaturization techniques for an array antenna system are required. In addition, more in-depth research is needed for UWB direction-finding techniques using channel impulse response (CIR) data. This paper proposes an ultra-wideband (UWB) antenna using a single-radiator multiple-port (SRMP) design for the direction-finding systems of smart devices. The proposed SRMP antenna was designed using a single tripod-shaped patch that can replace the array system. The tripod-shaped radiator was optimized using the edge shape design function to improve its broadband and mutual coupling characteristics. For performance verification, the proposed antenna was fabricated, and the reflection coefficient, mutual coupling, and radiation patterns were measured in a fully anechoic chamber. The proposed antenna has an operating frequency band of 6.1 GHz (from 5.8 GHz to 11.9 GHz) for port 1 and a measured mutual coupling of \u221214.8 dB at 8 GHz. The SRMP antenna has measured maximum gains of 3.5 dBi for port 1 and 2.9 dBi for port 2. To examine the direction-finding performance, the fabricated antenna was connected to a circuit module with a DW3000 chip, which is widely employed in commercial mobile UWB systems. The direction of arrival (DoA) results using the measured CIR data show root-mean-square (RMS) errors of 1.57\u00b0 and 4.58\u00b0 at distances of 30 cm and 60 cm. Recently, there has been a growing interest in ultra-wideband (UWB) localization technology at a short distance for application in indoor real-time location systems, automotive radar systems, virtual reality, and augmented reality ,2,3,4,5.In this paper, we propose a single-radiator multiple-port (SRMP) antenna for UWB direction-finding applications which is more improved with a patch-type design based on the previous publication . The prow1 and w2 and a length of l1, as shown in r\u03b5 = 4.3, tan \u03b4 = 0.018) with a radius of 1r and a height of h. The edge curve of the tripod-shaped radiator is designed with the function f(x) to obtain broadband characteristics while maintaining low mutual coupling. The design function f(x) is the quadratic polynomial expressed in Equations (1) and (2), where k is determined by w1, w2, and l1. The three ports are arranged at the edge of the tripod-shaped radiator at a distance of r2 from the center. The proposed SRMP antenna was modeled and simulated using the CST Studio Suite EM simulator [imulator . A genetzx-plane for ports 1 and 2. The maximum gain of 3.5 dBi is observed at \u03b8 = 30\u00b0 for port 1 and 2.9 dBi at \u03b8 = \u221228\u00b0 for port 2, within the small aperture size of 30.1 mm. The radiation efficiency and the envelope correlation coefficient (ECC) were also investigated for the proposed antenna. The simulated radiation efficiency of 75.9% is observed at 8 GHz for each port, and the average ECC of 0.134 is obtained between port 1 and port 2 at the target frequency range. f(x) for the upper right corner of the tripod-shaped radiator. The bandwidth characteristics were examined by varying the design function f(x) into an elliptic arc, a circular arc, and the proposed quadratic polynomial as shown in three inset figures. The tripod radiator with f(x) of the elliptic arc (dotted line) does not operate in the target frequency band. The result with f(x) of the circular arc (dashed line) has a broad bandwidth in the high-frequency band over 8.8 GHz. However, it does not achieve a reflection coefficient of less than \u221210 dB at 8 GHz. By contrast, the tripod-shaped radiator with f(x) of the quadratic polynomial (solid line), shown through Equations (1) and (2), can operate in the entire frequency band from 6 GHz to 12 GHz. Therefore, the essential design parameters of widths 1w and 2w were investigated to optimize the broadband characteristics with low mutual couplings using a single radiator without an additional component. The variations in the bandwidth according to 1w (from 4 mm to 7 mm) and 2w (from 7 mm to 10 mm) are presented, as shown in 2w is wider than 10 mm. 1w and 2w. When 1w is 4.87 mm, the results of the mutual coupling are less than \u221212 dB. As a result, the f(x) of the tripod structure is optimized with 1w of 10.1 mm and 2w of 4.87 mm. The resulting mutual couplings are less than \u221214.8 dB, while maintaining a fractional bandwidth of 76.3%. The optimized design parameters of the proposed antenna which are improved with a tripod-shaped radiator using design function f(x) are compared to previous publications as listed in To investigate the DoA estimation performance of the proposed antenna using the CIR data, the DW3000 chip, which is widely employed in commercial UWB direction-finding systems, was used. As the transmitting antenna module, a test board with a monopole chip antenna and the DW3000 provided by Qorvo was used, as shown in \u03d5 = 0\u00b0). The DoA estimation results measured at distances of 30 cm and 60 cm are indicated by the blue and red solid lines, respectively. The results are compared with the ideal result denoted by the black solid line. The square marks represent the average measured values estimated by 20 signals, while the horizontal bars show the measurement error range with the maximum and minimum values, respectively. The root-mean-square (RMS) errors between the mean of the measured results and the ideal value are 1.57\u00b0 at a distance of 30 cm and 4.58\u00b0 at a distance of 60 cm. \u03d5 = 60\u00b0), and this measurement was conducted under the same condition. RMS errors of 2.48\u00b0 and 4.72\u00b0 are observed at distances of 30 cm and 60 cm, respectively. The results demonstrate that the proposed SRMP antenna using the tripod-shaped radiator is suitable for UWB direction-finding system usage in smart devices.In this paper, we proposed an SRMP patch antenna for UWB direction-finding systems. Considering the limited mounting space of smart devices, the proposed antenna was designed using a single tripod-shaped patch that can replace the array system. The SRMP antenna was optimized using the edge shape design function of the tripod-shaped radiator to improve the broadband and mutual coupling characteristics. The proposed antenna had an operating frequency band of a bandwidth of 6.1 GHz for port 1 (from 5.8 GHz to 11.9 GHz). The simulation of \u221214.9 dB agreed well with the measurement of \u221213.3 dB at 8 GHz. In addition, the measured and simulated mutual couplings had similar results of \u221214.8 dB and \u221215.5 dB, respectively. The SRMP antenna had measured maximum gains of 3.5 dBi for port 1 and 2.9 dBi for port 2. To investigate the DoA estimation performance of the proposed antenna, the DW3000 chip, which is widely employed in commercial mobile UWB systems, was used. The proposed antenna was connected to the receiving module, and the CIR data were measured at 5\u00b0 intervals at distances of 30 cm and 60 cm. The DoA results using the measured CIR data had RMS errors of 1.57\u00b0 and 4.58\u00b0. The results demonstrated that the proposed SRMP antenna using a tripod-shaped radiator was suitable for UWB direction-finding system usage in small smart devices."}
{"text": "A high measured efficiency of 92% and a measured gain of 6.52 dB is also achieved. The suggested UWB can effectively cover several wireless applications such as WLAN, WiMAX, and C and X bands.The present study proposes a new, highly efficient fractal antenna with ultra-wideband (UWB) characteristics. The proposed patch offers a wide simulated operating band that reaches 8.3 GHz, a simulated gain that varies between 2.47 and 7.73 dB throughout the operating range, and a high simulated efficiency that comes to 98% due to the modifications made to the antenna geometry. The modifications carried out on the antenna are composed of several stages, a circular ring extracted from a circular antenna in which four rings are integrated and, in each ring, four other rings are integrated with a reduction factor of 3/8. To further improve the adaptation of the antenna, a modification of the shape of the ground plane is carried out. In order to test the simulation results, the prototype of the suggested patch was built and tested. The measurement results validate the suggested dual ultra-wideband antenna design approach, which demonstrates good compliance with the simulation. From the measured results, the suggested antenna with a compact volume of 40 \u00d7 24.5 \u00d7 1.6 mm Patch antennas have increased in popularity dramatically since the 1970s due to advances in microelectronics technology in the areas of miniaturization and electronic integration. In aeronautical, aerospace, and military contexts, antennas that are compact, lightweight, affordable, highly effective, and easy to install are critical requirements. These low-profile antennas are necessary to fulfill these needs.In contemporary communication systems, printed antennas, which are also referred to as patch antennas or microstrip antennas, are extensively utilized. This is because commercial wireless applications face the same limitations that were once encountered in earlier times due to the proliferation of telecommunications. There exists a plethora of antenna types. In addition, wireless communication devices require more and more frequency bands due to the increasing requirements for wireless services. Since these devices are also intended to be smaller in size for real estate purposes, antennas need to reduce their size and operate in more than one frequency band while maintaining their performance.Multiband and broadband antennas are two types of antennas that are commonly utilized in different communication systems. A multiband antenna is specifically designed to function on multiple frequency bands, making them ideal for wireless communication systems such as cellular networks. These antennas can support various frequency bands, which enables simultaneous transmission of both voice and data. Conversely, broadband antennas are designed to operate over an extensive range of frequencies, utilizing broadband elements like spiral or log-periodic antennas to cover a broad frequency range. This type of antenna is typically used in radar systems that require the detection of signals over a wide frequency range. In conclusion, multiband antennas operate over several frequency bands, while broadband antennas function across a wide frequency range. Both types of antennas offer unique advantages and are utilized in various communication and sensing systems.An antenna for ultra-wideband (UWB) is a type of antenna that is designed to work efficiently over a wide range of frequencies, typically from a few hundred megahertz to several gigahertz. UWB antennas can come in various forms, such as monopoles, dipoles, patch antennas, and horn antennas. Some popular UWB antenna designs include the planar inverted F antenna (PIFA), the tapered slot antenna (TSA), and the printed monopole antenna.To meet the demands of contemporary wireless communication systems, antennas with a low profile, compact size, multiband, and wideband features are greatly desired. Over the past ten years, most modern wire-free communication systems have been developed remarkably swiftly. In order to achieve high-speed broadband connections with minimal power consumption, radio networks use ultra-wideband (UWB) telecommunications technology. UWB was first designed for use with commercial radars. The two primary uses of UWB technology are in consumer electronics and wireless personal area networks (WPANs). Since its early successes in the mid-2000s, wireless UWB technology has emerged as a skill with a small number of smart structures, including the fields of medical engineering, wireless communications, and radar . Owing tDue to its broad bandwidth, high data rate capabilities, power efficiency, interference-free transmissions, effective spectrum usage, secure communication system, and straightforward circuitry for implementation, UWB technology has attracted a lot of interest during the past 10 years . The Fed3 to construct an octagonal UWB fractal antenna. By using an RT5880 substrate and a CPW feed, Niamat et al.  and [6.00\u20136.60] with bandwidths of 0.2 and 0.60 GHz, respectively. The structure of the antenna has evolved in Iteration 1 to improve the results and fulfill the intended applications. The operating bands of Iteration 1 are considerably improved. However, in this stage, the antenna operates on three impedance bandwidths of 0.49, 0.74, and 0.66 GHz with a gain that reaches 4.97 dB. Thus, in the next iteration, the antenna design is modified by the introduction of four annals. The antenna of Iteration 2 has a dual-band operation with a wide bandwidth that reaches 4.35 GHz. However, the frequency band (2.70\u20137.05 GHz) centered on 3.14 GHz is not well suited (low loss return). Then, in the penultimate iteration, the geometry of the second iteration was modified by integrating four new rings into each ring. The new shape enables wideband operation from 2.67 to 7.18 GHz as well as a good match with a gain of up to 6.94 dB. However, the antenna presented in this iteration does not meet the X-band requirement. Thus, to further improve the antenna matching and widen the operating band to cover the Band X requirements, the patch is further evolved to Iteration 4, which gives the desired proposed UWB antenna with an increased operating bandwidth that will cover all frequency bands for the planned wireless communication applications. In the simulation of this iteration, the antenna has a UWB characteristic that covers the frequency band (2.70\u201311.0 GHz) with a gain that exceeds 7.7 dB. Due to this amelioration, the suggested antenna can effectively cover a variety of wireless communication applications, as listed in This section is dedicated to the study of the effects of certain structural parameters through the HFSS simulator. The ideal dimensional specifications of the proposed patch have an impact on the performance of the antenna. The change in these parameters results in significant variations in antenna performance. The appropriate dimensions of the proposed patch can be determined using parametric studies so that it can work effectively with the best attributes.The effect of the Wp on the characteristic of the reflection coefficient, keeping all other dimension parameters unchanged, is illustrated in The ground plane slot position effects on the S11 parameters of the fractal patch antenna are shown in This section examines the variations in the width \u201cEp\u201d of the ground plane slot. This is another important design factor to see how it affects the reflection coefficient properties of the suggested patch. To properly comprehend how the UWB patch functions, HFSS software was used for antenna design and optimization. After that process, the suggested optimal patch is manufactured and measured to confirm the simulated results. The front and back views of the prototype, as well as the measurement setup in the anechoic chamber, are depicted in The S11 of the prototype patch is measured with the use of the vector network analyzer. The radiation properties study of the suggested patch in terms of peak gain, radiation efficiency, and the radiation pattern is presented in this section. The measurement results are used to confirm the simulation results. The radiation parameters of the patch are realized in an anechoic chamber, as shown in The simulated and measured 2D radiation patterns in the E and H planes at 3.17, 5.82, 7.86, and 9.16 GHz are displayed in Group delay and time domain characteristics are two different measures of an antenna\u2019s performance in the time domain.The analysis of the behavior of an antenna in the time domain is known as the antenna time domain study, and it is crucial to comprehend the transient and dynamic behavior of an antenna ,37,38. TThe study of the antenna time domain plays a critical role in understanding how an antenna behaves when transmitting or receiving signals that change over time. By examining the antenna\u2019s time\u2013domain behavior, engineers can tailor its design to meet specific requirements, such as radar, wireless communication, or satellite communication.Furthermore, time\u2013domain analysis can help detect potential issues with the antenna\u2019s performance, such as impedance mismatches, noise, or interference. This knowledge can then be used to enhance the antenna\u2019s design and performance, resulting in improved signal quality, increased efficiency, and reduced interference.In summary, studying the antenna time domain is a vital component of antenna engineering, as it provides valuable insights into the antenna\u2019s behavior, leading to optimized design and performance for specific applications.In order to demonstrate the time\u2013domain performance of the antenna, a pair of identical antennas are positioned in front of each other, with one serving as the transmitter and the other as the receiver, and their faces directed towards each other. These antennas are positioned at a distance of five times the wavelength of the lowest operating frequency to establish a far-field environment. The time domain response of the proposed antenna is depicted in In other words, the time\u2013domain characteristics describe how an antenna reacts to changes in the input signals over time, while the group delay describes how the antenna affects the phase of the different frequency components of the signal as they pass through it. Group delay is depicted in 3, an impedance bandwidth of 8.3 GHz, and a high gain of 6.25 dB.3. A fractal ring resonator and a ground plane made up of a rectangular part and a half-disk part with a rectangular slot are used to create the UWB operation. The manufactured prototype\u2019s measured results and simulated results match up reasonably well. The proposed antenna operates at measured bandwidths of 7.33 GHz (2.83\u201310.16 GHz). Additionally, it reports a maximum measured radiation efficiency of roughly 92% and a measured peak gain of 6.52 dB. The developed patch is lightweight, small in size, and has good radiation parameters that enable it to compete in a variety of wireless communication applications, including WLAN, Wi-MAX, Wi-Fi, ITU, C band, and radiolocation, among others.In this paper, a UWB fractal monopole patch is designed and analyzed for wireless communication applications. With the aid of HFSS software, the proposed antenna\u2019s structure was designed and examined. The developed antenna only needs a tiny area of 40 \u00d7 24.5 \u00d7 1.6 mm"}
{"text": "A single antenna unit is 15 \u00d7 3 \u00d7 3.1 mm3 . The arrangement of the antennas in the six-antenna units is parallel, with a 3 mm separation between adjacent antennas. The antenna structure comprises of an inverted L-shaped feed branch and two inverted L-shaped short-circuit branches integrated into part of the metal frame. The proposed array can form multiple resonance paths, achieving dual-band operation at 3300\u20133600 MHz and 4800\u20135000 MHz. The measured isolation of this twelve-antenna system within the operating frequency band is over 10 dB, and the measured antenna efficiency is greater than 36%. Therefore, the system is suitable for use in smartphones with high screen-to-body ratios and metal frames.In this paper, a twelve-antenna system is designed for 5G smartphones with metal frames. The system is compact and operates on dual bands within the sub-6 GHz frequency range using multiple-input multiple-output (MIMO) technology. Two sets of six-antenna units are included in the system, arranged in a diagonal mirror-image configuration, and positioned at the center of the circuit board\u2019s longer edges. The profile height of each of the six-antenna units is only 3 mm, and the overall array dimensions are 105 \u00d7 3 \u00d7 3.1 mm Rapid advances in communication technology have resulted in wireless communications becoming an indispensable aspect of daily life. In fifth generation 5G) mobile communications, multiple-input multiple-output (MIMO) technology is used to achieve high-speed transmission with multiple antennas. The most commonly used mobile communications devices are slim and have metallic cases, large screens, and narrow bezels. Therefore, the available space for antennas is shrinking. Correspondingly, antennas used in mobile communication devices are becoming increasingly compact with lower profiles. Designing multiple-antenna configurations within limited space to avoid excessive interference while achieving high efficiency and channel independence has become an increasingly urgent and challenging problem. Although several smartphone antenna designs using MIMO antenna arrays have been proposed in the literature ,4,5,6,7,G mobile Smartphones with metal frames are considered to have pleasing textures and aesthetics. Moreover, they are durable and can effectively dissipate heat. Some studies ,16,17,18To design decoupling mechanisms or achieve impedance matching, integrated metal-frame MIMO antennas for smartphones have been connected with components such as capacitors or inductors ,16,17,18The development of a 12 \u00d7 12 MIMO antenna for smartphones was able to improve the transmission rate, capacity, anti-interference ability, coverage, and positioning accuracy of wireless communication systems, thereby improving the performance and user experience of wireless communication ,22,23,24An antenna configuration must be compact, should be effective in a metal frame, and should achieve high throughput by using multiple antennas. We therefore propose a compact configuration for a 5G dual-band 12 \u00d7 12 MIMO antenna system that is integrated with the metal frame on a smartphone. The first feature of the proposed compact antenna design is a distance between two elements of only 3 mm. Both sides of each element have short-circuit branches, which reduces the impact of the ground plane current on adjacent antennas. Therefore, the proposed antenna design can achieve good isolation without decoupling elements and has narrow spacing between elements of only 3 mm. The second feature is the structural design of an inverted L-shaped feeding branch and two inverted L-shaped short-circuiting branches in the clearance area. Because the length of the inverted L-shaped feeding branch and the configuration of the two inverted L-shaped short-circuiting branches were adjusted, the operating frequency bands were impedance matched at 3300\u20133600 MHz and 4800\u20135000 MHz. The third feature is that the profile height of the antenna is only 3 mm, enabling it to fit in a narrow frame. The resonance path covers part of the metal frame, and the opening position of the metal frame is used to excite the low and high-frequency resonance paths. The proposed antenna system has an envelope correlation coefficient (ECC) of less than 0.38 and an isolation greater than 10 dB without any isolation components, and its efficiency is greater than 36%.This paper is structured in the following manner. We first present the design details of the MIMO antenna system in the following section. The design mechanism and parametric analyses are discussed in 3. The system circuit board is positioned at the center of the metal frame. The board comprises an FR4 glass fiber substrate with the dimensions of 84.2 \u00d7 164.2 \u00d7 0.8 mm3. The metal frame consists of a 0.4 mm thick copper-coated FR4 glass fiber substrate with a 7 mm width. The FR4 substrate has a relative dielectric constant of 4.4 and a loss tangent of 0.02. The dual-band MIMO twelve-antenna units  are arranged into two sets of six-antenna units, which are diagonally and mirror-symmetrically arranged on both sides of the system circuit board and centered on the long side edge at a distance of 30 mm from the short edges of the phone. The profile height of each antenna element is only 3 mm, and the dimensions of the antenna elements are 105 \u00d7 3 \u00d7 3.1 mm3. All six-antenna units have the same structure and size and are arranged in parallel at a distance of 3 mm from their neighbors.This design not only integrates part of the metal frame as part of the antenna resonance path but also uses a specifically designed short-circuit branch on both sides of each antenna structure, which is coupled with the opening position of the metal frame, to excite the low and high-frequency resonance paths on both sides. By arranging the six-antenna elements of each unit in a parallel and codirectional manner with 3 mm spacing, we isolate the low and high-frequency resonance paths between adjacent antennas. Additionally, regardless of whether the low and high-frequency modes are excited, the short-circuit branches can attract a ground plane current, which effectively reduces the flow of the current to adjacent antennas. This design achieves good isolation performance with a spacing of only 3 mm between the antennas without requiring isolation components.3, and the antennas are configured on the system circuit. Each antenna has a clearance zone without a ground plane with a size of 15 \u00d7 3 mm2. The clearance zone features a reversed L-shaped feed branch and two reversed L-shaped short-circuit branches. It is integrated with the upper metal frame to form multiple resonant paths for dual-frequency band sub-6-GHz operation . The metal frame has a 1 mm opening above the clearance zone at 4 mm and 10 mm from the left and right ground planes, respectively. This antenna structure has both low and high-frequency resonance modes covering the dual-frequency band operation of 3300\u20133600 MHz and 4800\u20135000 MHz. The low-frequency resonance is enhanced by the dual-coupled loop path formed by the feeding strip  and high-frequency band (4900 MHz). To further understand the contribution of each mode, we analyze the proposed structure and two other designs denoted Case 1 and Case 2. Case 1 is the proposed antenna structure without shorting strip 1  increases. This result demonstrates that the left loop path contributes to the high-frequency mode. Finally, parameter analysis for the end length d of the inverted L-shaped feeding branch is conducted. d values. Increasing d from 4.4 to 6.4 mm leads to a substantial downshift in both the low and high-frequency resonant modes. Therefore, the feeding strip path contributes to both resonant modes.For MIMO operations, certain performance parameters such as the ECC, mean effective gain (MEG), diversity gain (DG), and total active reflection coefficient (TARC) may also be of interest and can be examined. The ECC is a critical metric for evaluating MIMO antenna systems. Generally, an ECC of less than 0.5 is satisfactory for practical applications. Next, TARC is the square root of the incident power obtained from all excitations minus the radiant power, divided by the incident power. To maintain clarity and avoid a cluttered appearance, E is the expectation concerning different channel realizations, I is the identity matrix, det is the determinant, s is the signal-to-noise ratio (SNR), tn is the number of transmit antennas, H is the wireless channel matrix, and \u2020 is the Hermitian transpose of the matrix.The ergodic channel capacity refers to the average capacity observed in a multipath Rayleigh fading environment. In cases where a transmitter lacks channel state information (CSI) and its power is evenly distributed among each transmit antenna unit, the ergodic channel capacity can be calculated using the following formula :(1)C=E{lTo further investigate the isolation performance of the MIMO twelve-antenna unit, the surface current distribution between the two sets of six-antenna units and their ground planes is analyzed. The two sets of six-antenna units are configured in a diagonal mirror-image configuration. For clarity, only the surface current distribution of the first set of six-antenna when excited is presented. To emphasize the benefits of our suggested MIMO antennas, we have incorporated a comparative analysis of MIMO antennas from the existing literature. The proposed compactly configured a dual-band MIMO twelve-antenna system with a metal frame comprising two sets of six-antenna units arranged in a diagonal mirror-image configuration at the edges of the two longer sides of a phone. The profile height of each of six-antenna module is only 3 mm. The design has no isolation components but is able to achieve favorable isolation and ECC performance with only 3 mm spacing between adjacent antennas. In the designing of the sub-6GHz 5G antenna element, a metal-frame design was integrated with an inverted L-shaped feed branch and two inverted L-shaped short branch structures to form multiple resonant paths, which enabled dual-band operation in the 3300\u20133600 and 4800\u20135000 MHz 5G frequency bands. The antenna structure is simple and can be closely integrated with the metal environment. The isolation performance values for this MIMO twelve-antenna system are all above 10 dB, and the measured far-field radiation pattern ECC values are all less than 0.38. The low-frequency efficiency is 36\u201362%, and the high-frequency efficiency is 46\u201363%. This design is suitable for large-screen smartphones with a high screen-to-body ratio and metal frame."}
{"text": "Then, a four-element antenna is designed to meet the requirements for another application; here, each element is placed orthogonally to each other, and the isolation is improved through loading a cross-shaped branch in the middle of these elements. The size is 0.57\u03bb \u00d7 0.57\u03bb \u00d7 0.013\u03bb. Both antenna samples are tested to verify the design. Measurement results show that the working bandwidth is 2.45\u201314.88 GHz and 2.14\u201314.95 GHz, the isolation is greater than 17 and 20 dB, and the peak gain is 5.7 and 5.9 dBi for the two- and four-element MIMO antenna, respectively. Compared to the references, the designed antennas have a wider bandwidth and a higher gain and radiation efficiency. They are well-suited for diverse wireless applications.Ultra-wideband (UWB) technology is widely used in many communication scenarios. However, narrowband systems can easily interfere with the UWB system, which generates multipath fading. In order to solve these interferences and meet the design requirements of high isolation of multiple-input multiple-output (MIMO) antennas, two MIMO antennas with double-notch structures are designed. Firstly, two U-shaped slots are etched on the radiating patch and feeder to achieve notch characteristics in WiMAX and ITU bands. Using this antenna element, a two-element antenna is put symmetrically in parallel, and two rectangular branches are loaded to improve the isolation. The size is 0.57 Since the application of ultra-wideband (UWB) frequency was proposed, it has become the focus of many engineers of wireless communication technology. Due to the high transmission rate and low power consumption, UWB technology has been widely used in the fields of ground-penetrating radar ,2, wirelThe disadvantages of the UWB system are that it is difficult to achieve long-distance transmission in the case of limited power, and that it is easy to produce inter-code crosstalk, which reduces the signal transmission efficiency and quality of the UWB system. In order to solve these problems, multiple-input multiple-output (MIMO) technology was introduced, which can increase the channel capacity and improve the transmission quality by means of using multiple antenna elements in the transmitter and receiver . The com2. The design is not suitable for handheld devices. In [In , a UWB dices. In , a UWB MIn this approach, we use a UWB antenna, but the interferences of the WiMAX and ITU bands must be filtered. Therefore, a UWB antenna with two-notched characteristics is investigated. A U-shaped slot was etched on the radiation patch to get the WiMAX band notch, and an inverted U-shaped slot was etched on the feeder line to get the ITU band notch. Adjusting its size, we obtained a bandwidth from 2.1 to 14.55 GHz of the antenna with stopbands of 3.28\u20133.75 GHz and 7.98\u20138.58 GHz. This design meets the requirements for the IEEE 802.16 standard. To adapt the system for higher-quality transmission, a combination of UWB technology and MIMO antenna technology is also studied. So, to use the designed antenna element, we consider the MIMO application. The two-element UWB antenna mentioned above is put in parallel style. Two rectangular branches (RBs) are added between them, which can achieve 17 dB of isolation. The notched bands were not affected. This style is only used in the one-input one-output case. In order to adapt it to real MIMO application scenarios, a four-element UWB antenna is also designed and is put into orthogonal style. Then, a cross-shaped rectangular patch is used as an isolation component. The isolation can reach 20 dB between each antenna element. The notched bands, WiMAX and ITU, were not changed. The simulation and measurement results show that the two proposed MIMO antennas have good performance while being compact in size. They can be widely used in various wireless communication systems such as automotive applications, wireless diversity applications, and portable mobile devices.The rest of the content is organized as follows. A two-element and a more compact four-element orthogonal MIMO antenna are proposed with two-notched characteristics at the WiMAX and ITU bands. The total antenna structure design with its geometric specifications is introduced in A single UWB antenna element design is based on a circular monopole antenna and the structuring of the antenna is conducted in three steps. The monopole antenna has the advantages of simple structure, easy installation and operation, small size, light weight and low cost. mW to meet the impedance matching of 50 \u03a9. In this paper, U-shaped slots are etched on the radiation patch of the antenna element to realize the notch of WiMAX band, and inverted U-shaped slots are etched on the feeder of the antenna element to obtain the notch of ITU band. To obtain the notch property, the most important thing to calculate is the total length of the etched slot. The total length of the slot can be estimated using Formulas (1) and (2):nf is the center frequency of notch; c is the speed of light; L is the length of the slot; e\u03b5 is the equivalent permittivity; r\u03b5 is the dielectric constant of the dielectric substrate. According to Formulas (1) and (2), the length of the U-shaped slot is about 26 mm when the center frequency is 3.5 GHz, and the length of the inverted U-shaped slot is about 11 mm when the center frequency is 8.3 GHz. After simulating and optimizing with the electromagnetic simulation software High Frequency Structure Simulator (HFSS), it is found that when the length of the U-shaped slot is 25.8 mm and the length of the inverted U-shaped slot is 11.8 mm, the stopband characteristics are the best, which can completely cover the WiMAX and ITU bands, respectively.One MIMO antenna consists of two elements and the other of four elements, as shown in The antenna elements of the two-element MIMO antenna are placed symmetrically, and two RBs are loaded between the antenna elements. The two RBs can generate two new current paths, reduce the coupling current between the ports, and improve the isolation between the antenna elements. The four antenna elements of the four-element MIMO antenna are placed orthogonal to each other, and the antenna elements have different polarization modes, resulting in a mismatch of polarization between adjacent antenna elements, thus improving the isolation degree between antenna elements. In order to further improve the isolation degree of the four-element MIMO antenna, a cross-shaped branch is added in the center of the dielectric substrate. The geometric dimensions of the two MIMO antennas are shown in S|-parameter simulation curve corresponding to the UWB MIMO antenna when no notch structures and different numbers of notch structures are introduced, respectively.In order to avoid the interference problem of the narrowband communication system, U-shaped slots in the radiation patch of the UWB antenna and inverted U-shaped slots in the feeder are used to generate notch properties. In order to verify the mutual independence of the two notch structures, The non-notch curve in the figure represents the reflection coefficient of the UWB MIMO antenna without a notch structure. It can be seen that the working bandwidth of the antenna is 2.12\u201314.73 GHz, which can cover the UWB band. When only the U-shaped slot is loaded, the working bandwidth of the antenna changes to 2.05\u201314.54 GHz, and the notch appears in the band of 3.28\u20133.75 GHz, which just covers the WiMAX band. When only the inverted U-shaped slot is loaded, the working bandwidth changes to 2.25\u201314.78 GHz, and the notch appears in the band of 8.01\u20138.61 GHz, which just covers the ITU band. When the two slots are etched on the antenna, the working bandwidth changes to 2.02\u201314.74 GHz, and the notch are generated in the 3.28\u20133.75 GHz and 7.99\u20138.58 GHz bands, respectively. The change in the parameters of each slot only has an effect on the corresponding notch band, and has little effect on the other parameters of the antenna and the notch band, so the two notch structures can play a relatively independent role.L3 increases from 6.8 mm to 7.2 mm and other parameters remain unchanged, the center frequency of the notch band 3.28\u20133.75 GHz changes significantly, decreasing from 3.6 GHz to 3.5 GHz. When L3 = 7.0 mm, the stopband bandwidth of the antenna just covers the WiMAX band. H1 increases from 20.4 mm to 20.8 mm, the center frequency of the 3.28\u20133.75 GHz notch band does not change significantly, but the stopband bandwidth gradually increases. It can be seen from the above analysis that the notch band can be controlled flexibly through adjusting the length and position of the slot.In order to study the influence of U-shaped slot and inverted U-shaped slot on the notch characteristics, the key dimensions of the two kinds of notch structures were parameterized and simulated. As shown in L4 of the inverted U-shaped slot. As shown in L4 increases from 4.7 mm to 5.1 mm, the notch band 3.28\u20133.75 GHz does not change significantly, and the center frequency gradually decreases. Through optimizing the key parameters of the two notch structures, it can be seen that the U-shaped slot mainly affects the notch band at 3.28\u20133.75 GHz, and the inverted U-shaped slot mainly affects the notch band at 7.99\u20138.58 GHz, with little mutual interference.In order to understand the principle of antenna notches, the antenna was further analyzed. Taking the element antenna as an example, the surface current distribution was simulated and analyzed. In order to study the influence of RBs on MIMO antennas and the decoupling effect, two-element MIMO antennas without and with RBs are simulated and analyzed, and the parameters of RBs are scanned and analyzed.S|-parameters before and after antenna loading RBs: (a) represents |S11|, (b) represents |S21|. As can be seen from S11| of the antenna changed little and remained below \u221210 dB in the UWB band, and the antenna did not exhibit an impedance mismatch phenomenon.In order to further study the influence of isolation structure on antenna performance, the key dimensions of isolation structure are simulated and optimized. Port 1 is set as the excitation port.S|-parameters corresponding to different L6 values, where (a) represents |S11| and (b) represents |S21|. As can be seen from Figure (b), with the increase of L6, the degree of isolation between the two antenna elements also increases, resulting in a better decoupling effect. As can be seen from figure (a), the change of L6 has little effect on the overall antenna impedance matching, but it has some effect on the range of the notch band. When L6 = 20 mm, the notch band just covers the WiMAX band. In summary, when L6 = 20 mm, the antenna can not only have high isolation, but also accurately cover the WiMAX band, and its isolation is higher than 15 dB, which meets the basic design requirements of a MIMO antenna and has a good decoupling effect.Through simulation and optimization, it is found that other dimensions of isolation branches have little influence on antenna impedance matching, and have no significant effect on the improvement of isolation degree, so it will not be analyzed and described.In order to more directly reflect the function of RBs, S11| of each antenna element is equal, while the isolation degree between antenna elements meet |ijS| = |jiS| . In order to more conveniently study the variation of the |S|-parameters of this MIMO antenna, only the |S|-parameters of port 1 can be studied. S|-parameters of the four-element MIMO antenna. It can be seen from the figure that the working bandwidth of the antenna is 2.17\u201314.71 GHz, in which the notch band of the U-shaped slot is 3.26\u20133.79 GHz, and the notch band of the inverted U-shaped slot is 7.93\u20138.51 GHz. When port 1 is excited, the isolation degree between port 1 and port 2 and between port 1 and port 4 is higher than 23 dB, and the isolation degree between port 1 and port 3 is higher than 15 dB in the working bandwidth. It can be proved that the orthogonal placement of antenna elements can reduce the coupling between antenna elements and obtain a good polarization diversity effect. Since the isolation between port 1 and port 3 just meets the basic design requirements, considering that the addition of antenna elements will increase the instability of antenna operation, it is necessary to further improve the isolation between port 1 and port 3.Increasing the number of MIMO antenna elements will increase the difficulty of decoupling. Therefore, each element of the four-element MIMO antenna is placed orthogonally first. The orthogonal placement of antenna elements will lead to the polarization mismatch of adjacent antennas, thus improving the isolation degree between antenna elements. Due to the four-element MIMO antenna having a symmetrical structure, the |S|-parameters of the four-element MIMO antenna after loading the cross-shaped branch. As can be seen from In order to further improve the isolation degree between the antenna elements of the four-element MIMO antenna, the center of the dielectric substrate is loaded with a cross-shaped branch for decoupling. In order to study the influence of cross-shaped branch on antenna performance, the key parameters of the cross-shaped branch are scanned and optimized. \u03b8 of the cross-shaped branch has a great influence on the notch band of the four-element MIMO antenna, and the length of the cross branch has a significant effect on improving the isolation between port 1 and port 3. The \u03b8 was set as 10\u201330 deg, and the step size was set as 2 deg. S11| with different \u03b8 values. It can be seen from the figure that when \u03b8 increases from 10 to 30 deg, the center frequency of the notch band corresponding to the U-shaped slot gradually increases, while that corresponding to the notch band corresponding to the inverted U-shaped slot gradually decreases. When \u03b8 = 20 deg, the two notch bands exactly cover the WiMAX and ITU band. The L7 is set from 10 to 16 mm, and the step is set to 1 mm. |S31| corresponding to different values of L7 is shown in L7 increases, the isolation between port 1 and port 3 gradually increases. However, with the change in the value of L7, the accuracy of the notch band will be slightly affected. When L7 = 13 mm, the antenna has a high isolation degree and the notch band can achieve accurate coverage.Through simulation analysis, it is found that the rotation angle In order to more directly reflect the effect of orthogonal placement of antenna elements and the isolation effect after loading the cross-shaped branch, S|-parameter and far-field radiation pattern, as shown in In order to verify the performance of the two MIMO antennas designed, the antennas are manufactured according to the data in S|-parameters, due to the symmetry of the antenna unit, only consider the |S|-parameters of port 1. As can be seen from the figure, the measured working bandwidth of the antenna is 2.45\u201314.88 GHz, which can cover the UWB band. The notch band corresponding to the U-shaped slot is 3.26\u20133.75 GHz, and the notch band corresponding to the inverted U-shaped slot is 7.96\u20138.65 GHz, which can cover the WiMAX and ITU band, respectively. The measured isolation between two antenna ports is higher than 18 dB. Through comparing the simulation results and the measured results in S|-parameters are roughly consistent with the simulated |S|-parameters. However, due to the errors caused by antenna machining, the welding process, and network analysis instruments, the measured and simulated values have a small difference.S|-parameters of the four-element UWB MIMO antenna; due to the symmetry of the antenna element, only consider the |S|-parameters of port 1. As can be seen from the figure, the measured working bandwidth of the antenna is 2.14\u201314.95 GHz, which can cover the UWB band. The notch band corresponding to the U-shaped slot is 3.02\u20133.99 GHz, and the notch band corresponding to the inverted U-shaped slot is 7.56\u20138.58 GHz. The bandwidth of the two notch bands becomes wider. However, WiMAX and ITU bands can still be covered separately. The measured isolation degree between each antenna port is higher than 20 dB, which proves that the isolation degree between antenna elements is high and they can maintain independent normal operation. Through comparing the simulation results and the measured results in S|-parameters are roughly consistent with the simulated |S|-parameters, which proves that the antenna has good performance.The E-plane co-polarizations of the four sample frequencies have two main beams, and the cross-polarizations are small. Furthermore, the differences between the co-polarizations and the cross-polarizations are larger than 15 dB, which shows good radiation patterns in the E-plane. It can be also observed in The E-plane cross-polarizations are small. Furthermore, the differences between the co-polarizations and the cross-polarizations are larger than 16 dB, which shows good radiation patterns in the E-plane. It can be also observed from The envelope correlation coefficient (ECC), diversity gain (DG), total active reflection coefficient (TARC), mean effective gain (MEG), and channel capacity loss (CCL) are important parameters for validating the capability and performance of MIMO antennas.The ECC is used to measure the correlation between the channels of MIMO antenna elements. It refers to the correlation between different signal amplitudes received by the antenna. For MIMO antennas, a smaller ECC means weaker channel correlation and better system performance. In general engineering applications, if the ECC is less than 0.5 , it can Diversity gain (DG) is another important parameter for measuring the performance of MIMO antenna . The ideThe measured and simulated DG of the two proposed MIMO antennas are shown in b represents the reflected signal, a represents the incident signal, N depicts the number of elements in the MIMO system, and S denotes the scattering parameter. Through deriving the formula, the TARC of the MIMO system can be calculated using the S-parameter [The TARC provides the reflected-incident power ratio, which is related to the coupling between the ports . For an arameter . The TARIn order for the MlMO antenna to work well, the TARC value must be below \u221210 dB . Figure iMEG is calculated using Formula (8). Similarly, ijMEG is calculated using Formula (9), and the data details are shown in In a multipath fading environment, the MEG can be used to measure the total efficiency of the MIMO system, the total gain, and the effect produced by the propagation environment . It is giMEG of the two proposed MIMO antennas is lower than 6 dB in the whole operating band, and the ijMEG is lower than 3 dB. It can be proved that the two proposed MIMO antennas perform well over the whole operating band.It can be seen that the The correlation between the elements in MIMO channel systems produces a capacity loss . For higThe CCL values of the two proposed MIMO antennas are shown in inP is the power entering the antenna, rP is the radiated power of the antenna, and dP is the lost power of the antenna.As an energy conversion device, an antenna converts high-frequency current energy into electromagnetic wave energy or electromagnetic wave energy into high-frequency current energy. However, due to various losses in the transmission process, such as antenna dielectric loss, copper loss, and component loss, the input antenna power can only be partially converted into electromagnetic wave energy. The efficiency of the antenna is used to characterize the degree of such conversion. The calculation method is shown in Formula (13):The measured radiation efficiency of the two proposed MIMO antennas is shown in As the proposed antenna is wideband, so its time-domain characterization becomes important . In ordeThe group delay of the antenna in the above two directions is shown in The transmission coefficients of the antenna in both directions were simulated, as shown in In order to further verify the effectiveness of this design, the experimental results of the designed antenna are compared with those of the references. The comparative experimental results include antenna size, antenna impedance bandwidth, relative impedance bandwidth, number of MIMO antenna units, notch band, isolation, peak gain, and ECC. The details for each comparison item are shown in ijMEG below 3 dB, and CCL below 0.4 bit/s/Hz, which can be widely used in UWB communication systems.Two compact UWB\u2013MIMO antennas with high isolation have been checked. One is a two-element MIMO antenna located parallel with an impedance bandwidth from 2.45\u201314.88 GHz, which is loaded with two RBs to achieve an isolation higher than 17 dB in the passband range. The other is a four-element MIMO antenna located at quadrature with an impedance bandwidth from 2.14\u201314.95 GHz. Through placing the antenna elements orthogonally and loading the cross branches, the antenna has an isolation degree of more than 20 dB in the passband range. Both can suppress the interference of WiMAX and ITU bands to UWB communication and are simple in structure and easy to process. At the same time, they have stable gain, much lower ECC (<0.02), DG close to 10 dB, TRAC below 10 dB,"}
{"text": "In this manuscript, we have numerically investigated and experimentally verified the six-element split ring resonator and circular patch-shaped multiple input, multiple output antenna operating in the 1\u201325 GHz band. MIMO antennas are analyzed in terms of several physical parameters, such as reflectance, gain, directivity, VSWR, and electric field distribution. The parameters of the MIMO antenna, for instance, the envelope correlation coefficient (ECC), channel capacity loss (CCL), the total active reflection coefficient (TARC), directivity gain (DG), and mean effective gain (MEG), are also investigated for identification of a suitable range of these parameters for multichannel transmission capacity. Ultrawideband operation at 10.83 GHz is possible for the theoretically designed and practically executed antenna with the return loss and gain values of \u221219 dB and \u221228 dBi, respectively. Overall, the antenna offers minimum return loss values of \u221232.74 dB for the operating band of 1.92 to 9.81 GHz with a bandwidth of 6.89 GHz. The antennas are also investigated in terms of a continuous ground patch and a scattered rectangular patch. The proposed results are highly applicable for the ultrawideband operating MIMO antenna application in satellite communication with C/X/Ku/K bands.  MIMO  antennas have emerged as an effective solution to enhance the wireless communication system\u2019s capacity and reliability . They arIn this manuscript, we have numerically investigated and experimentally verified the design of a six-element split-ring resonator and circular patch-shaped multi-input, multi-output antenna in the 1\u201325 GHz frequency range. MIMO antennas are analyzed in terms of several physical parameters, such as reflectance, gain, directivity, VSWR, and electric field distribution. In order to determine whether or not this antenna is suitable for multichannel transmission, we have also provided additional MIMO antenna characteristics, including envelope correlation coefficient, total active reflection coefficient, channel capacity loss, mean effective gain and diversity gain. This manuscript is majorly divided into three subdivisions. The first segments include the design and specification of all five stages of the proposed antenna. The second segment consists of measurement and simulation results and discussions of the proposed antenna. Finally, the last segment demonstrates the influence of the various antenna characteristics in a situation where numerous ports are excited simultaneously.2. We have performed numerical analysis on five distinct antenna designs that contain the radiation patch elements either on a split ring resonator or in a circular patch shape of the structure. In all the antenna designs, the ground is either continuous for all patches in the shape of a rectangle, or individual rectangular copper patches are placed over the individual MIMO elements, which can be seen in The schematic of the six-element, split-ring resonator-shaped MIMO antenna is depicted in ij, where i and j refer to 1, 2, 3, 4, 5, and 6, are <\u221210 dB and other S parameters S12, S13, \u2026 are also <\u221210 dB. These conditions are satisfied for the identification of the overall resonating band where the co-port and cross-port reflectance values are <10% for the effective radiation. We have calculated the reflectance response of all five types of antennas by applying the excitation at all antenna ports. The reflectance response achieved through the numerical study is depicted in ij < \u221210 dB are satisfied. In Design 1 of the antenna, we observed the three operating bands with bandwidth values of 7.88 GHz, 5.17 GHz, and 5.46 GHz. This antenna covers an overall area of 74% of the 1\u201325 GHz band in the frequency spectrum for radiation conversion. The reflection coefficient\u2019s minimum value is observed at \u221234.51 dB. The maximum peak gain observed is 12.64 GHz with a return loss of \u221216.11 dB and a band of 5.46 GHz. We can observe similar types of antenna operating bandwidth, peak gain, and bandwidth for all the antennas in The bands derived from this calculation are shown in We have fabricated the proposed structures, and the measurement results for the proposed structure are shown in The split ring resonator shape provides advantages over a normalized patch structure in terms of compact size, metamaterial effect, broadband response, and flexibility of operation. The results shown in Additionally, the gain over the frequency range of 1\u201325 GHz is presented as the second antenna parameter for identifying the antenna\u2019s efficient operation. Gain values for each suggested antenna design have been computed and shown in Different electric field distributions for two-port and three-port excitation are shown in ECC is calculated using the electric field\u2019s magnitude in Equation (1). The ECC solid angle components are indicated by ith and jth. It is time-consuming and labor-intensive to evaluate ECC using far-field radiation characteristics. Equation (2) demonstrates an alternate way of calculating ECC with the help of S-parameters, as described in .(1)\u03c1ij=The results of the ECC calculations for antenna Design 5 are shown in For a given channel, the diversity gain  may be cTwo isotropic antennas combined average power in the absence of noise is less than or equal to the noise-averaged power delivered to a diversity antenna, as measured by the mean error gain (MEG) parameter (or interference). It demonstrates how environmental factors influence the enhanced performance of a MIMO antenna. The MEG may be validated by using Equation (4), which is based on the equation proposed in . In thisIn cases where more than one port is being utilized, the total active reflection coefficient (TARC) provides the most precise measurement of radiation performance and frequency response. This is because TARC is the most trustworthy metric. The mathematical expression for determining this value is as follows:   . Using a metric called the total active reflection coefficient (TARC), researchers may determine how effective a MIMO system is at re-directing light. This methodology was developed in the 1990s. This tactic takes into consideration both the reciprocal coupling that exists on the network as well as the random pairings of signals that exist on the network. In this example, we see how the properties of both incident and reflected waves may be described using Equation (5). It suggests that one way to find out the answer to this question is by solving Equation (6) using S-parameters . In While assessing the GHz antenna\u2019s MIMO performance, it\u2019s also important to take into account the channel capacity loss (CCL). The greatest data transfer rate that may be achieved across a given channel without incurring a discernible quality loss is determined by the channel\u2019s capacity loss. Rates below 0.5 bits/s/Hz are required to show that information may be sent without corruption using a well-planned MIMO system. The CCL parameter may be determined with the help of Equations (7)\u2013(9), which can be found in . As can Our analysis involved a comparative table of the radiation element of the antenna between our computed results and those previously published, such as S parameter isolation, peak gain, bandwidth, and antenna area. The comparative analysis with other antennas is shown in We have identified a few advantages and disadvantages from our previously published results ,10,35 anSimplicity: A 1 \u00d7 2 MIMO structure involves one transmit antenna and two receive antennas. It is a relatively simple configuration compared to higher-order MIMO structures, such as 2 \u00d7 3, in terms of hardware complexity, implementation, and cost.Lower System Complexity: With fewer antennas involved, a 1 \u00d7 2 MIMO system typically has lower system complexity in terms of signal processing, antenna design, and RF (radio frequency) front-end requirements. This can result in easier system design and reduced complexity in terms of implementation and deployment.Lower Power Consumption: Due to its lower system complexity, a 1 \u00d7 2 MIMO structure may require less power consumption compared to higher-order MIMO configurations, which can be beneficial in scenarios where power efficiency is a concern, such as in battery-powered devices or energy-constrained environments.Advantages of 1 \u00d7 2 MIMO:Higher Spatial Diversity: A 2 \u00d7 3 MIMO structure provides higher spatial diversity compared to a 1 \u00d7 2 MIMO structure. With two transmit antennas and three receive antennas, it can leverage multiple spatial paths for communication, leading to improved performance in terms of signal quality, reliability, and robustness against fading and interference.Increased Capacity: A 2 \u00d7 3 MIMO system can potentially offer higher capacity compared to a 1 \u00d7 2 MIMO system, as it can support the transmission of more data streams simultaneously. This can result in higher data rates and increased throughput, which can be advantageous in high-data-rate communication scenarios.Enhanced Performance: With more antennas involved, a 2 \u00d7 3 MIMO system can offer improved performance in terms of link quality, coverage area, and interference mitigation. It can provide better signal strength, extended coverage, and increased resilience against channel impairments, leading to more reliable and robust communication.Flexibility in Spatial Multiplexing: A 2 \u00d7 3 MIMO system can support higher-order spatial multiplexing, which refers to the simultaneous transmission of multiple data streams on the same frequency band. This allows for more flexibility in terms of data transmission and can enable higher capacity and improved spectral efficiency.Advantages of 2 \u00d7 3 MIMO:We can identify from the key points above that the advantages of a 1 \u00d7 2 MIMO versus a 2 \u00d7 3 MIMO structure depend on the specific requirements of the communication system and the trade-offs between system complexity, performance, and capacity. While a 1 \u00d7 2 MIMO structure offers simplicity and lower system complexity, a 2 \u00d7 3 MIMO structure provides higher spatial diversity, increased capacity, and enhanced performance. The choice between the two would depend on the specific application, deployment scenario, and performance requirements of the wireless communication system.This manuscript explores the use of a six-element split ring resonator with a circular patch-shaped multi-input multi-output (MIMO) antenna in the 1 to 25 GHz band and provides experimental verification of the computational results. Reflectance, gain, directivity, VSWR, and electric field distribution are only a few of the physical factors that are taken into account while analyzing MIMO antennas. The proposed antenna offers the multichannel MIMO antenna values of TARC (<\u22125 dB), ECC (0 to 0.15), CCL (0\u20131 bits/s/Hz), MEG (\u22121 to 1 dB), and DG (10 dB) for effective communication. The suggested antenna has a return loss of \u221219 dB and a gain of \u221228 dBi, making it suitable for ultra-wideband (10.83 GHz) applications. The antenna\u2019s lowest return loss is \u221232.74 dB over its 6.89 GHz bandwidth operational range of 1.92 to 9.81 GHz. Both the continuous ground patch and the dispersed rectangular patch properties of the antennas are explored. The proposed antenna can be used for the multichannel satellite communication application with the C, X, Ku, and K bands."}
{"text": "The relative bandwidth is 2.98%, which satisfies the standard of wide-band patch antennas.This paper proposed a right-handed circularly polarized (RHCP) micro-strip antenna for multi-navigation system applications. The size of the antenna is 70 mm \u00d7 70 mm \u00d7 2 mm, which is fabricated on an FR4 substrate. A meandering technique on a patch layer and asymmetrical defected ground structures (DGS) are employed to achieve the purpose of miniaturization and increase the bandwidth of the axial ratio. The prototype of this antenna is fabricated according to simulations where the bandwidth of return loss, bandwidth of axial ratio, and radio pattern are further testified. The bandwidth of return loss (S With the development of the civil aviation industry, aircraft are favored for efficiency in medium- and long-distance travel. Air safety is always the critical issue in transportation. With the increasingly dense air routes, which contain both passenger and cargo traffic, high-accuracy tracking and location of aircraft has become the focus of research ,2,3. TheAn antenna is a critical component of airborne equipment. Within the corresponding operating frequency band of targeted navigation systems, an antenna serves as the transceiver of navigation information that would be applied for real-time positioning ,9. SinceUp to now, three polarization modes of antennas have been proposed, namely linear polarization, elliptical polarization, and circular polarization. Recent research has shown that circularly polarized waves will benefit from their strong ability to resist multi-path interference and polarization mismatches affected by various environmental factors. They can also be converted into linear polarized waves as needed ,12,13. IIn the design of navigation antennas at present, in addition to the requirements of wide operating frequency band and gain, it is also necessary to take the installation environment into account. For example, antennas work with other complex avionics, and it is significant to reduce the size to improve the portability ,16. Amon11) and axial ratio (AR) is the limit of the micro-strip antenna [At present, the narrow bandwidth of both return loss . All the design indicators are satisfied after parameter optimizing. In section four, the antenna is tested by a vector network analyzer and microwave anechoic chamber. Comparisons of simulation and experimental results are given, which prove that the antenna meets the design requirements.In this paper, the designed wideband RHCP micro-strip antenna is proposed, which would be available for aircraft tracking in B1I and B1C for BDS-3, L1 of GPS, L1 of SBAS as well as E1 of Galileo. In section two, the principles of the meandering technique and DGS are introduced, which provide the theoretical support for broadening the band width of Sf denotes the resonant frequency, c is the speed of light, L refers to the length of the antenna patch, and r\u03b5 is the relative dielectric constant of the dielectric substrate.The resonant frequency of the antenna can be retrieved as given by Equation (1),f will be affected by both dielectric constant and patch length. However, this will inevitably increase the risk of occurrence of both wave loss and the shortening of frequency bands. Therefore, our work will focus on structure optimization by applying meandering technology and defect ground structure to broaden the bandwidth of both the return loss and the axial ratio of antennas.From Equation (1), it can be observed that The meandering technique shown in gL and capacitors gC and pC in \u03c91 and \u03c92 refer to central frequency and cutoff frequency, and rB and pB are the electromagnetic induction intensity generated by gR and pR, respectively.Recently, more attention has been paid to DGS for performance enhancement of CP antennas. When the electrons move in the periodic potential field formed by the high-impedance surface, an electronic band structure will be generated due to the Bragg scattering , and theStep 1: Determine the basic parameters of the proposed micro-strip antenna patches. The step will be carried out according to the Equations (4)\u2013(8) given in Step 2: According to the meandering technique, T-shaped and F-shaped gaps are added to adjust the current direction to generate the current that can flow counterclockwise and produce right-handed circularly polarized electromagnetic waves. At the same time, a square gap in the center of the patch is employed to increase the forward gain of the antenna. By means of the gap structure, the enhancement of the surface current path will then reduce the patch size of the antenna.Step 3: Design a defective structure by introducing two L-shaped slots on the diagonal of the same side of the coaxial feed, aiming at forming a high-impedance surface and expanding the axial bandwidth.Step 4: Scan the main parameters that would potentially affect the performance of antenna to determine the size of all antenna parameters.The main design steps of the antenna proposed in this article are as follows:In the S-band and below, the FR4 material has the ability to act as an antenna dielectric substrate. To be precise, FR4 material is a glass fiber mixed with epoxy resin. The heat resistance of this material can reach 300 degrees, the operating frequency is about a few GHz, and the nominal value of the permittivity is about 4.4. FR4 material has nearly zero water absorption and can maintain its working performance in both dry and wet conditions, making it suitable for installation on aircraft. At the same time, its price is much lower than the dielectric substrate material of high-frequency boards, which meets the requirements of industry to reduce production costs.Step 1: Complete the preliminary design of the patch antenna using the nominal value of FR4 material;11 and AR distributions, respectively;Step 2: Perform simulations to the designed antenna and extract corresponding S11 and AR of the designed antenna using vector network analyzer;Step 3: Measure the SStep 4: Compare the simulation results of the antenna with the measured results to obtain the deviation distribution. Afterward, the values of FR4 in the simulation are adjusted within a certain range to obtain a series of simulated distributions under different values;r\u03b5 of FR4 is calculated and set as 4.52;Step 5: Perform least squares analysis on simulated and measured distributions. At this point, the dielectric constant with the smallest least squares estimation value is closest to the true value. In the design of process, permittivity Step 6: Perform antenna design and optimization with the permittivity of FR4 extracted from Step 5.At present, the nominal permittivity value of FR4 material is generally employed for antenna simulations as 4.4. However, due to the deviation of the dielectric substrate material selected by the manufacturer and the inevitable processing errors varying from 4.2 to 4.6, there will be significant differences between the simulated and measurement results of the antenna. This will lead to serious effects on the reliability of the antenna design. To reduce the impact of FR4 parameters on antenna design accuracy, we propose a feedforward optimization method that corrects the estimated value of FR4 through the deviation between sampled simulation and measured results. The critical correction steps are as follows:R denotes the radius of patch, f is the center frequency of working band, h refers to the thickness of antenna, and r\u03b5 is the permittivity of substrate.In the recent implementations of micro-strip antenna, the features of patch could be generally summarized as circle and square one, respectively. Circular patch antennas possess more characteristics for structure design and more easily generate circularly polarized waves. In addition, circular patch antennas will generate higher radiation and lower losses. The radius of circle patch can be formulated given by Equation (3),f, r\u03b5, and h equal 5.8 GHz, 4.4, and 2 mm, respectively. In the same condition, the length of square micro-strip antenna only measures 3.14 mm. This proves that square micro-strip antennas perform better in terms of miniaturization. Compared with circle patch antenna, the square micro-strip antennas now are proven as the reasonable choice in combination with other electronic components, especially in some complex environments such as airborne systems. Moreover, the square patches are easier to produce than the circle ones, saving production costs and resources. Therefore, a square structure will be employed in the design of our antenna, and corresponding simulations as well as analysis will be carried out to improve the effectiveness of our design.Based on this structure, Si et al.  have proWT is printed on the substrate  of the antenna. According to [WT can be calculated according to the equations that follow.According to the analysis above, the circular polarized antenna serving the BDS-3 system is developed and designed with corresponding geometrical configurations as given in rding to , the lenL can be preliminarily defined as Equation (4),c refers to the velocity of light, f is the resonant frequency of antenna, and r\u03b5 is the permittivity of FR4. Height of the antenna h is set as 2 mm. Then, the effective permittivity of antenna could be defined as Equation (5),ref\u03b5 denotes the effective permittivity. Here, we introduce the length extension of patch given by Equation (6),L refers to length extension. From Equation (4), we can obtain effective length as shown in Equation (7),efL refers to the effective length. The actual length WT could be calculated as Equation (8),The initial length of patch WT is calculated as 45.5 mm according to Equation (8).In this work, p \u00d7 q is embedded along the x axis. In this patch, a single probe feed is implemented at  and works for exciting right-handed CP radiation. By using the theory of the meandering technique, one T-shaped structure is added to each edge of the square patch, as given by On the patch of the antenna, a narrow slot with dimensions of As shown in As shown in In order to improve antenna performance, especially AR, DGS is designed on the ground of the antenna. 11 and AR can be adjusted by changing parameter values.The geometry of the antenna is further optimized based on the analysis of simulated bandwidth retrieved from software HFSS. As given by 11 and AR shift to a high-frequency band with the increase in parameter dw. 11 and AR move down with the increase in db. In 11 moves up with increase in p, while in pg. In X1g increases, the axis ratio moves downwards to the high frequency, and the effect on S11 is not significant within the operating frequency band.11 and AR as a whole by changing parameters dw and db. Parameter p can be used for changing S11 separately, while pg and X1g are for AR.It is practical to adjust S11 and AR are given in 11 and AR are from 1.540 GHz to 1.612 GHz and 1.554 GHz to 1.601 GHz, which indicate the working band of the design is the second one.The antenna after validation is modeled and processed based on PCB printing. (1)Since the dielectric substrate material is FR4, its dielectric constant is 4.2 to 4.6, the dielectric constant of FR4 material used by the manufacturer cannot be guaranteed to be identical with the set value of 4.52 in thesofware HFSS (version 19.2). And the dielectric constant of the substrate material has a large effect on the resonant frequency of the antenna, which causes the difference between the simulation and the actual measurement.(2)In the manufacture of the antenna, high manufacturing accuracy is required due to the use of a loaded seam and defective ground structure. Manufacturing errors within the process allowable errors can also cause errors in the test results of the antenna\u2019s performance.(3)When welding the coaxial feed probe, the corner of the L-shaped slot of the defective ground structure is inevitably blocked by the SM joint, resulting in a deviation in the measured results.(4)The unavoidable presence of non-insulating materials in the measurement environment would impact the measurement reliability.11 and AR retrieved from experiments, the operating band is 0.047 GHz. The relative band width (RBW) is defined by Equation (9),Hf and Lf are the are the highest and lowest values of the operating band.According to the bandwidths of SRBW of this design is calculated as 2.98%, which is greater than 1% and satisfies the definition of a wideband patch antenna. The following table shows a comparison between the proposed antenna and other designs.Although there exist some deviations between the measurement results and the theoretical values, our proposed concept for micro-strip antenna design still has significant advantages compared to the existing methods in refs ,33,34,3511 and radiation patterns. The performance of the antenna and quality of our work are validated according to the comparisons between simulated and measured results. The relative bandwidth of the antenna is determined as 2.98%. The suggested antenna also possesses high application potential compatible with L1 of GPS, L1 of SBAS, and E1 of Galileo.In this work, a circularly polarized antenna is proposed for BDS-3 applications. By means of the meandering technique, the geometry of the antenna is obtained as 7 mm \u00d7 7 mm \u00d7 2 mm. Afterward, rectangular-shaped and L-shaped DGS are introduced to broaden the bandwidth of the axial ratio of the antenna. After a series of optimizations, the bandwidth of return loss and axial ratio of antenna can be retrieved as 1.540 GHz to 1.612 GHz and 1.554 GHz to 1.601 GHz. The suggested antenna is fabricated and experiments are carried out on analysis of S"}
{"text": "A wideband low-profile radiating G-shaped strip on a flexible substrate is proposed to operate as biomedical antenna for off-body communication. The antenna is designed to produce circular polarization over the frequency range 5\u20136 GHz to communicate with WiMAX/WLAN antennas. Furthermore, it is designed to produce linear polarization over the frequency range 6\u201319 GHz for communication with the on-body biosensor antennas. It is shown that an inverted G-shaped strip produces circular polarization (CP) of the opposite sense to that produced by G-shaped strip over the frequency range 5\u20136 GHz. The antenna design is explained and its performance is investigated through simulation, as well as experimental measurements. This antenna can be viewed as composed of a semicircular strip terminated with a horizontal extension at its lower end and terminated with a small circular patch through a corner-shaped strip extension at its upper end to form the shape of \u201cG\u201d or inverted \u201cG\u201d. The purpose of the corner-shaped extension and the circular patch termination is to match the antenna impedance to 50  Recently, a lot of research work has been focused on the wideband flexible antennas for biomedical applications ,4,5,6,7.The proposed antenna is designed to communicate not only with the biosensors on the body but also with the surrounding medical apparatus attached to the body in a health care system and, also, to communicate with the WLAN access points. To allow better mobility of the patient and the attached medical equipment, this antenna is designed to operate near body and not stuck to the body, as shown in Polarization is a critical and significant feature of antennas in modern wireless communication technology . The oriLately, different antenna types have been employed to attain circular polarization, including patch antennas, slot antennas, and spiral antennas ,17,18,19The flexibility of a circularly polarized (CP) antenna\u2019s substrate can significantly impact its performance . When thThe proposed G-shaped and inverted G-shaped printed strip CP antennas are designed on a low-loss flexible Roger RO3003The WiMAX/WLAN antennas may have arbitrary polarization depending on their orientation as shown in The G-shaped and inverted G-shaped strip antennas are designed to operate over the frequency band (5\u201319 GHz). The main issue of the proposed antenna design is to fulfill the requirements of the dual function to produce dual polarization (circular/linear) over a wide frequency band with good impedance matching and high radiation efficiency. The G-shaped radiating strip is a turn-like antenna, i.e., it is similar to a helix or spiral of one turn. Therefore, it can produce both circular and linear polarization by adjusting its dimensions relative to the wavelength. The frequency band 5\u20136 GHz is actually the unique frequency band that is commonly dedicated for WiMAX and WLAN applications together. Therefore, the frequency band 5\u20136 GHz is selected for circular polarization. The CST\u00ae Studio Suite 3D EM simulator (CST-MWS) is used to design the antenna and evaluate its performance. The geometry of the inverted G-shaped antenna is presented in L followed by vertical strip extension of length L to form a right-angle corner-shaped extension that is terminated by a small circular patch of radius R. At its lower end, the semicircular strip is terminated with a horizontal strip extension of length L and width W, as shown in D and D, respectively. The antenna is excited through a CPW feeding line. The CPW has a length of L, the width of its central strip is W, and the width of each side slot is S. The characteristic impedance of the CPW is obtained based on W and S that are calculated using the CPW design equations [L. The antenna and the CPW feeder are printed on a flexible Rogers RO3003. The best dimensions of the proposed antenna are shown in Both the G-shaped and inverted G-shaped antennas can be viewed as composed of semicircular strip connected, at its upper end, to horizontal strip extension of length quations ,45. The The proposed antenna design has evolved in three main steps as presented in The first step is a trial to produce circular polarization by using a semicircular strip radiator with small horizontal extensions at the end points of the circular arc, as shown in the geometry of Antenna#1. From the curves of In the next step of the antenna design, the end points of the radiating strip are further extended to obtain the geometry of Antenna#2. This step of the design results in a great improvement of the impedance matching bandwidth as shown in The G-shaped antenna being proposed consists of five parts, (i) the semicircular strip, (ii) the vertical extension of the central strip of the CPW region, (iii) the horizontal extension at the lower end of the semicircular strip, (iv) the corner extension at the upper end of the semicircular strip, and (v) the small circular patch that terminates the corner extension of the semicircular patch. It is required to obtain the widest impedance matching and 3dB-AR bandwidth and to enhance the radiation efficiency. For this purpose, A thorough investigation of various parameters has been conducted to determine the optimal dimensions of the antenna. The effects of various dimensional parameters on D and D, respectively, are depicted in the present section. The effects of changing the outer diameters D on D leads to a decrease in the lower and higher frequency bands and the entire impedance matching band is shifted towards the left. However, D = 16.6 mm.The effects of changing the outer and inner diameters, D, of the semicircular strip on the impedance matching and 3dB-AR bandwidths are presented in D decreases the lower frequency at which the impedance bandwidth matches whereas the higher frequency seems to insensitive to such changes of D. The proposed antenna performs optimally in terms of the 3dB-AR bandwidth when D = 11.2 mm, as illustrated in On the other hand, the effects of changing the inner diameter, L and L, respectively, of the corner-shaped extension of the curved strip on the reflection coefficient magnitude and the AR are investigated in the present section. The effects of changing vertical length, L, on the frequency response of the reflection coefficient magnitude, L. On the other hand, the AR seems to be strongly dependent on L, as shown in L = 6 mm gives the best 3dB-AR bandwidth.The effects of changing the vertical and horizontal dimensions, L, on the frequency response of the reflection coefficient magnitude, L. On the other hand, the AR seems to be strongly dependent on L as shown in L = 6.4 mm gives the best 3dB-AR bandwidth.The effects of changing horizontal length, R, of the small circular patch termination of the G-shaped strip antenna on the frequency dependence of the magnitude of the reflection coefficient, R. On the other hand, the AR seems to be strongly dependent on R as shown in R = 1.9 mm gives the best 3dB-AR bandwidth.The impact of altering the radius, L of the CPW central strip extension on the magnitude of the reflection coefficient, L. However, the widest bandwidth is obtained by setting L = 7.2 mm. This value of L results in a 3dB-AR frequency range covering 5 GHz to 6 GHz as shown in The impact of altering the length The parametric sweeps presented in Owing to its flexible structure, the proposed antenna shall preserve its high performance even while being subjected to bend strains (to some extents) in the different directions.For studying the effects of the bend stresses on the characteristics of the proposed antenna, it is subjected to different bend angles The frequency dependence of the reflection coefficient, The frequency dependence of the axial ratio for different values of the longitudinal bend angle, The frequency dependence of the reflection coefficient, The frequency dependence of the axial ratio for different values of the transverse bend angle, The dependence of the percent impedance matching bandwidth on both the longitudinal and transverse bend angles, The dependence of the percent bandwidth of 3dB-AR on both the longitudinal and transverse bend angles, Thus, it can be concluded that the proposed antenna preserves the impedance matching bandwidth and the 3dB-AR bandwidth for longitudinal and transverse bend angles less than The way that the proposed inverted G-shaped strip antenna produces circular polarization can be demonstrated by showing the surface current distribution on the semi-circle strip radiator, as depicted in It is shown that the surface current on the inverted-G-shaped antenna is circulating in the counter clockwise direction, thereby producing RHCP in the +ve z-direction. As the dielectric substrate is very thin relative to the wavelength  can be expressed as followsLet The power accepted by the AUT excitation port can be expressed as follows:Let The far field radiation pattern can be expressed as followsEmploying , the farThe normalized radiation pattern can be evaluated as follows:The power density at the reference-gain antenna when the AUT is directed at follows.PR=\u03c1Substituting from  into 1010, the pMaking use of , 3), an, an3), aThus, the AUT antenna gain, Substituting from  into 1313, the fNote that  side of  are know side of  can be uThe realized antenna gain of the AUT can be expressed as follows:The power received by the reference-gain horn antenna can be obtained by calculating the following double integralThe total power radiated by the AUT can be calculated using the following double integral.Dividing both sides of  by P0, tSubstituting from  into 1818, the fThe radiation efficiency of the AUT can be expressed as follows.The expression  can be rMaking use of  and 19)19), the In this section, the antenna fabrication is described, and the experimental assessment of the antenna performance are presented and compared to the simulation results.For experimental investigations, both the G-shaped and inverted G-shaped antennas are fabricated. The antenna prototypes are presented in To measure the reflection coefficient magnitude, The antenna is designed to produce circular polarization over the frequency range 5\u20136 GHz (for the 5GHz band of the WLAN/WiMAX applications) with left-hand sense in the directions of one half-space and right-hand polarization in the opposite directions of the other half-space. On the other hand, it is designed to produce linear polarization over the frequency range 6\u201319 GHz. This makes the proposed antenna more able to operate in the applications requiring wideband with varying polarization characteristics.The frequency bands allocated for the WiMAX and WLAN applications are listed in the in The dependence of the maximum gain generated by the inverted G-shaped antenna on the frequency is shown in The results of the simulation and experimental testing of the radiation efficiency of the inverted G-shaped antenna, which were conducted over the frequency range of (4\u201320 GHz), are presented in The measured far field radiation patterns of the circularly polarized components E-left and E-right generated by the inverted G-shaped antenna have been added and compared to those obtained by simulation in the plane It is shown that the radiated field of the inverted G-shaped antenna is dominated by RHCP component in upper half-space (+ve z-direction) and LHCP component in the lower half of the space (-ve z-direction).The measured far field radiation patterns of the total electric field (Linearly Polarized) produced by the inverted G-shaped in the plane To demonstrate the contribution of the present work in the context of the published work with similar interest, some performance measures of the proposed G-shaped antenna are provided in By comparison with the other antennas listed in On the other hand, the proposed antenna can use the remaining part of the operational band (6\u201319 GHz) for high data rate and wideband communication with the on-body (and in-body) biosensor antennas attached to (or implantable in) the patient body through linear polarization. During this mode of operation, the alignment between the proposed antenna and the biosensor antennas can be easily maintained. Regarding the above requirements  can be uniquely satisfied by the antenna proposed in the present work when compared to the other antennas listed in A wideband low-profile G-shaped strip antenna on a flexible substrate has been proposed for biomedical for the application of WBAN to work as off-body communication. The antenna produces circular polarization over the frequency band 5\u20136 GHz to communicate with WiMAX/WLAN antennas and to produce linear polarization over the frequency band 6\u201319 GHz for communication with the biosensor antennas. It has been shown that an inverted G-shaped strip produces CP of the opposite sense to that produced by G-shaped strip over the frequency range 5\u20136 GHz. The antenna structure is composed of a semicircular strip terminated with a horizontal extension at its lower end and terminated with a small circular patch through a corner-shaped strip extension at its upper end to form the shape of \u201cG\u201d or inverted \u201cG\u201d. The corner-shaped extension and the circular patch termination has been added to the antenna geometry for impedance matching over the entire frequency band (5\u201319 GHz) and to improve the circular polarization over the frequency band (5\u20136 GHz). The antenna has been fed through a CPW to allow the fabrication on only one face of the flexible dielectric substrate. The dimensions of the antenna as well as the CPW have been optimized to obtain the best performance regarding the impedance matching bandwidth, 3dB-AR bandwidth, radiation efficiency, and maximum gain. The results have shown that the achieved 3dB-AR bandwidth is"}
{"text": "The demand for vehicular antennas increases in tandem with the need for multiple features in automobiles. The development of optically transparent antenna (OTA) has made it possible to deploy antennas on delicate surfaces such as glass. Earlier studies on OTA demonstrated its viability using materials such as transparent conducting oxides (TCO) and conductive polymers. A tri-band OTA is proposed in this paper for vehicular applications. The antenna operates at 1.8\u00a0GHz, 2.4\u00a0GHz and 3.39\u201312\u00a0GHz bands, covering automotive/wireless applications such as GSM, Bluetooth, Wi-Fi, vehicular communication and electronic toll collection. The proposed OTA is developed on soda lime glass, and the material TCO is used for the radiator and the ground plane. The antenna prototype is tested on windshield and in an anechoic chamber, the gain and efficiency are found to be greater than 1\u00a0dBi and 80%, respectively. Furthermore, a machine learning technique for vehicle classification is proposed, which could help in electronic toll collection, automatic vehicle identifier, and parking management applications. The presented algorithm achieves 80% classification accuracy with a minimum window size. Therefore, significance has to be given to maintain balance among size, weight, and need for the applications. The multiband approach in a single antenna not only reduces the number of antennas required, it also lessens the system complexity, cost, and overall device size.For futuristic electronic communication, multiband, multiservice antennas are necessary elements. In addition to the integration of multiple bands, the applications also demand for lightweight, low-profile, inexpensive and compact sized antennas. The size of the antenna increases as multiple bands are incorporated in the design2. The antenna developed on the transparent substrates including glass can be used on windshield. It does not affect the aesthetic appearance and technical functionality of the vehicle. A challenging part of optically transparent antenna (OTA) design is to achieve improved gain and efficiency. The OTA is developed using transparent substrates such as soda lime glass, plexiglass, Perspex, quartz, and borosilicate glass. Transparent conducting oxide (TCO) like fluorine doped tin oxide (FTO), indium doped tin oxide (ITO), silver tin oxide (AgHT), and other films like MMMC are used as conducting layer in the OTA. Decreasing the thickness of the film reduces the efficiency3, whereas increasing the thickness affects the transparency. The thin-film transparent conductors also include surface losses, ground losses, and skin-depth losses, which induces low efficiency and reduces the conductivity of the OTA4. In5, a polyamide substrate transparent antenna with 86% optical transmittance is proposed. The antenna resonates for a bandwidth of 5.18\u20135.32\u00a0GHz, and offers a peak gain of 1.9\u00a0dBi and maximum efficiency of 65.87%. Many transparent substrates are used to develop OTA, and, in6, cellulose acetate is used to develop the substrate with a transparent film of ITO. It provides a peak gain of 5.4\u00a0dBi and the overall size of the antenna is 50\u00a0mm\u2009\u00d7\u200951\u00a0mm. The graphene is used to develop the conducting film on a substrate in7. Graphene has low sheet resistance, which increases gain, and a good flexibility and environmental stability. The reported antenna is designed on a glass substrate with an overall size of 60\u00a0\u00b5m\u2009\u00d7\u2009100\u00a0\u00b5m and provides an efficiency of 67%.Also, area required for placing the prototype in the systems such as automobiles, satellites, mobile phones, and wearable electronics is to be considered. The antenna for automobiles can be mounted on the roof, mirror, trunk, and windshield of the vehicle8, a multilayer conducting film with layers of IZTO/Ag/IZTO and polyimide substrate is used. The peak gain and efficiency of the antenna are 1.84\u00a0dBi and 54% respectively. In9, a high transparent antenna with optical transparency of 88% is developed with borosilicate glass substrate and ITO film. The antenna radiates for UWB with a peak gain of 3 dBi. But, the efficiency of the antenna is low\u2009~\u200927%. The fabrication of the OTA can be done using many methods like dc sputtering and chemical vapor deposition, and in10 the antenna is fabricated using inkjet printing. The prototype is bendable with PDMS substrate and ITO film. The antenna resonates at 2.4\u00a0GHz with 5.75\u00a0dBi. In11, a 300\u00a0mm\u2009\u00d7\u2009300\u00a0mm corning glass of good transparency is used to design the antenna with AgCl film. The proposed antenna offers 60% efficiency and peak gain of 5.5\u00a0dBi. The OTA with borosilicate substrate is developed in12 with fluorine doped tin oxide film. The proposed antenna offers transparency greater than 50% and resonate over 5\u00a0GHz. Antenna with acryl substrate with three types of films  is developed and compared in13. The study showed that the antenna developed with multilayer film (IZTO/Ag/IZTO) showed low efficiency of 7.76% and negative gain of \u2212\u00a04.23\u00a0dB, but transparency greater than 80%. Wired metal mesh (WMM) and micro metal mesh (\u00b5MM) are used as transparent conductive film in14 to fabricate radiating patch of the antenna with acrylic substrate. An optical transparency of 80% is achieved with 49% efficiency, and the overall size of the antenna is 50\u00a0mm\u2009\u00d7\u200950\u00a0mm. (1) In15, a two-port MIMO antenna is designed, where the antenna elements are placed vertically to achieve vertical polarization. In16, a two-port OTA is designed on soda lime glass, and the antenna elements are placed in vertical orientation with single polarization vector. In17, a four-port MIMO antenna is designed using AgHT-8 and plexiglass materials. The antenna operates in the frequency range of 0.69\u20132.82\u00a0GHz, and the antenna elements are placed horizontally to provide horizontal polarization vector. The MIMO antennas reported in the literature provides only single polarization vector and operates at single frequency.The transparent antenna can be developed with multilayer film to increase efficiency. InIn this work, a four-port optically transparent antenna is designed for automotive applications. The antenna is dual-polarized with tri-band resonances. The ITO coated soda lime glass substrate is chosen due to its affordability and availability, and wet chemical etching method is opted for easy fabrication. The overall size of the proposed MIMO antenna is 55\u00a0mm\u2009\u00d7\u200955\u00a0mm.The OTA is developed with TCO like tin oxide, indium oxide, zinc oxide, and cadmium oxide. These oxides are further doped with dopants like fluorine, indium, gallium, aluminum, silver, and so on. These oxides conduct when doped with the appropriate dopants. For better conductivity, the optical absorptions should be less than 104/cm and optical energy gap should be more than 3\u00a0eV.19. The surface resistance is calculated by Eq.\u00a0. For additional resonance of 2.4\u00a0GHz, the surface current of the radiator is observed, and an inverted L-slot is introduced (Antenna 3). The 1.8\u00a0GHz is achieved by incorporating a bent stub in the radiator (Antenna 4). The added stubs create impedance mismatch over the UWB, which is further compensated by loading a slot (Antenna 5) in the radiator and a defect in the ground (Antenna 6). The inverted L-shaped slot has a resonant length of 0.11\u03bb0. The isolation is greater than 15\u00a0dB over the operating frequency range. Good isolation is achieved with minimum element spacing. A connected ground structure is used to ensure a common reference voltage. Polarization diversity with dual polarization is achieved when the antennas are placed perpendicular to each other. The measured reflection coefficients and mutual coupling of the MIMO are shown in Fig. Vehicular applications demand an antenna array as there is a need to receive signals from all directions. The single element shown in Fig.\u00a0The soda lime glass of thickness of 1.1\u00a0mm coated with ITO on both sides of the glass is used. The thickness of the ITO film is 200\u00a0nm. Wet chemical etching is followed to pattern the required antenna design on the substrate. The etching process requires first cleaning the ITO-coated glass with deionized water. Then the required pattern is prepared as a mask using the etch-resistant tape (Kapton tape). The masking is placed on the ITO-coated glass, and the masked ITO is immersed in the HCL: H2O (1:1) solution. The setup is undisturbed for a few minutes. The etching rate varies with the change in HCL concentration. The HCL molecules remove the ITO from the unmasked area, and the required pattern is obtained in the ITO glass. After this process, the patterned glass is exposed to sunlight for about 1\u00a0min and cleaned with deionized water. Since hot soldering can melt the layer of ITO material in the substrate, conductive silver epoxy adhesive is used to solder the connector to the antenna. The wet chemical etching of the patterned ITO glass is shown in Fig.\u00a0Figure\u00a022. The ECC is calculated using far-field and S-parameter, as given in Eqs.\u00a0, diversity gain (DG), total active reflection coefficient (TARC), and channel capacity loss (CCL) are calculated. ECC is a crucial performance parameter that assesses the effectiveness of diversity in the MIMO system in Eqs.\u00a0 and 6),,22. The 24. Equation\u00a0Equation\u00a0 shows th25. TARC is calculated using Eq.\u00a0, electronic toll collection (ETC), parking management, fleet management, and advanced driving assisting system (ADAS). For the classification of vehicles, two input parameters are used: frequency and reflection coefficients. The reflection coefficients of different vehicles (auto (three wheeler), car, and truck) are obtained by placing the antenna in the corresponding vehicle. The machine learning method reduces the dimensionality of the features using linear discriminant analysis (LDA). The trained multilayer perceptron (MLP) has given the projected feature obtained from the LDA. The system performance is tested for the vehicle classification using the MLP classifier. The required training set is obtained by placing the antenna in the windshield of vehicle, and it is tested on the set of values obtained by placing the antenna in the sidemirror of the vehicles. For classification, maximum sample size of 30,000 and minimum of 3000 is chosen (see Table 47. The columns of a confusion matrix are normally the same categories as those established by a ground survey, and the cell values are the number of observations attributed to each grouping of categories. One dimension of a confusion matrix is indexed by the actual class of an object, and the other is indexed by the predicted class of the classifier. The confusion matrix for the vehicle classification is shown in Table A concept from machine learning called a confusion matrix contains data on both actual and anticipated classifications made by a classification systemTo determine a classification model's performance metrics, the confusion matrix is analyzed with some metrics. Precision describes the percentage of all favorable predictions that come true. Precision is the proportion of recovered instances that are relevant, also known as positive predictive value.Sensitivity, probability of detection, and true positive rate are other names for recall. It relates to the percentage of real positives that are appropriately identified.Specificity, often known as the real negative rate, is the percentage of actual negatives that are correctly identified as such. Recall's opposite is specificity.The accuracy of a test is assessed using the F1 score (see Table The negative predictive value in machine learning is the proportion of anticipated negatives that actually happen.The proposed OTA antenna operates for tri-band frequencies covering 1.8\u00a0GHz, 2.4\u00a0GHz, and 3.39\u201312\u00a0GHz for GSM, Bluetooth, Wi-Fi, and vehicle to vehicle communication applications. The transparent antenna is developed using the wet chemical etching process. The MIMO antenna with four elements placed orthogonally provides dual polarization. The antenna prototype is tested in the anechoic chamber and the gain and efficiency are found to be greater than 1 dBi and 80%, respectively. The diversity parameter values are within the acceptable limit. The antenna prototype is mounted in the windshield of a vehicle and study shows that there is no effect on the antenna performance. Machine learning for the classification of vehicles in different scenarios is proposed, and required parameters are studied, which provide classification accuracy of 80% for minimum window size. Hence, the proposed antenna is suitable for vehicular applications."}
{"text": "In this article, we propose a light weight, low profile Multiple Input Multiple Output (MIMO) antenna system for compact 5th Generation (5G) mmwave devices. Using a RO5880 substrate that is incredibly thin, the suggested antenna is made up of circular rings stacked vertically and horizontally on top of one another. The single element antenna board has dimensions of 12 \u00d7 12 \u00d7 0.254 mm In the modern world, wireless communication is impacting countless areas , unmanned transportation systems, smart grid concepts in power transmission and distribution, digital banking systems, smart home HDTV through effective satellite communication systems), and these technologies are providing great significance in improving human lives ,2,3. AntMIMO antennas are extremely beneficial in densely populated areas where Line of Sight (LOS) communication is impossible. The signal may be in-phase or out-of-phase when it arrives at the receiver via multi-path in these circumstances, causing multi-path fading. The MIMO antenna, which is coupled with a combiner to increase the mean signal-to-noise (SNR) ratio and produce diversity gain, reduces the multi-path problem. There are four types of diversity combiners: switching, equal gain combining (EGC), maximum ratio combining, and selection combining (MRC). The branch with the highest SNR is chosen at any point in time in selection combining. The signal from the branch that meets the minimal threshold value is chosen by the switched combiner. The co-phased branch signals are added by EGC. Each branch in MRC has its phase weights applied so that the result is the sum of all of the SNR ratios. MIMO antennas when initially employed, boost spatial variety in order to combat channel fading. The information is being considered in a Rayleigh fading environment, where it is sent by antennas that take various routes to independently reach receiving antenna. The highest diversity increase in this scenario is referred to as Spatial Diversity. When separate information is delivered over antennas, the data rate is increased, which is known as Spatial Multiplexing. MIMO antennas have given wireless communication a new direction and are now particularly desirable for 5G applications. Higher data rate, low latency and with better system stability are the characteristics which make 5G a potential candidate for future wireless communication systems. Designing a MIMO antenna system is a complex task since modern communication devices are desired to be compact and slim. A wide scale placement of a 5G network requires the preparation of antenna infrastructure and the execution of new technical clarifications . The miltenna in  providestenna in ,11,12,13tenna in . Additio dBi. In  was desi dBi. In ,16.In , for upcFour different random array types were contrasted in . SpecifiIn order to enhance the isolation among the radiating elements, several approaches are considered. These techniques include isolating structures insertion such as neutralization lines (NL), Defected Ground Structures (DGS), Electromagnetic Bandgap Structures (EBG) and Artificial Magnetic Conductors (AMC) ,20,21. AAn innovative EBG design and a hair-pin-shaped DGS are used in combination in  to achieThis research presents a simple planar monopole MIMO antenna system arranged in linear manner. The proposed MIMO antenna exhibits dual wide-band characteristics covering two mmwave 5G alloted resonances of 28 and 38 GHz, respectively. The four element linear MIMO system satisfies the MIMO performance parameters and also gives high gain of 11 dBi. The paper is organized as follows. The impedance matching of the proposed olympeak antenna in evolution stage is shown in The surface current patterns at two resonances of 28 and 38 GHz are shown in The effect of the ground plane notch etched at the top mid-section of the copper ground plane is given in The radiation and total efficiency of the antenna is >82% in the operating band. The peak gain is noted to be 4.9 dBi while on 28 GHz its 4.2 dBi with radiation and total efficiency of 94 and 95%, respectively.The performance parameters of the antenna mentioned above are shown in The proposed olympeak antenna is transformed into a four element MIMO antenna system. The MIMO elements are transformed into a linear element, having 12 mm distance among each element centre to centre. The distance among the MIMO elements is kept at 1.2 The MIMO simulated s-parameters are shown in The proposed olympeak MIMO antenna system is fabricated, and using in-house facilities, the measurements have been taken from the developed prototype. The fabricated prototype is shown in The measured and simulated s-parameters are superimposed on the plots in The antenna is so thin and flexible that it requires a delicate mechanical balance to keep steady during the measurement. It is seen from the plots in The array is symmetric from the center. The radiation patterns of the left two elements are identical to the right two elements in the array. Therefore, analyzing only half of the array would be adequate to obtain an idea for the overall array. We will present the results of Antenna 1 and Antenna 2 when the antennas are sequentially numbered from left to right. The simulated and measured radiation patterns of Antenna 1 and Antenna 2 at two principle planes of Phi = 90 and Theta = 90, at two resonating bands are shown in The MIMO performance of the proposed antenna systems were evaluated. These parameters included Enveloper Correlation Coefficient (ECC), Diversity Gain (DG) and Mean Effective Gain (MEG).The Envelope Correlation Coefficient reveals the degree of radiation pattern independence between two antennas. Therefore, the two radiating structures would have a correlation of 0 if one was totally horizontally polarized and the other was completely vertically polarised. The ECC of these antennas would also be zero if one antenna exclusively radiated energy towards the sky and the other just radiated energy towards the earth. Therefore, Envelope Correlation Coefficient considers the polarization, shape, and even the relative phase of the fields between the two antennas of the antennas. The ECC is evaluated using far field characteristics of proposed antenna using Equation  27,28,2,228,29. i-th antenna and j-th antenna. r is the cross-polar ratio which can be expressed as Equation  fading conditions with high channel capacity, channel aggregation and a higher number of users. On the other hand, new portable gadgets are becoming lighter and thinner, while requiring powerful processing capabilities. This work presented a four-port MIMO antenna system with high performance characteristics. The proposed antenna was shaped in a hybrid Olympic sign, hence it was named as Olympeak antenna. The total unit size of the proposed antenna was 12 \u00d7 14 \u00d7 0.254 mm"}
{"text": "A monopole antenna operated at 2.45\u00a0GHz and embedded with artificial magnetic conductor (AMC) for wearable communication systems is investigated in this article. The proposed antenna is composed of a metalized loop radiator with a coplanar waveguide microstrip feedline which is affixed on a cotton fabric material substrate. As well, a cotton-based AMC surface is utilized to eliminate the body\u2019s absorbed radiation and enhance the gain of the antenna. It is composed of 5\u2009\u00d7\u20095 array unit cells etched with I-shaped slots. Using this configuration, simulations show that the specific absorption rate (SAR) level was significantly reduced. Considering flat and rounded body parts, it was found that the SAR values averaged over 10\u00a0g at a distance of 1\u00a0mm away from the tissues model were only 0.18\u00a0W/kg and 0.371\u00a0W/kg, respectively. Additionally, the antenna gain was improved up to 7.2\u00a0dBi with an average radiation efficiency of 72%. Detailed analysis with experimental measurements of the cotton-based antenna for different operation scenarios is introduced. The measured data show a good correlation with the electromagnetic simulation results. In WBANs systems, wearable antennas are vital components used for communication near the human body6. This challenging role is reflected in the considerations that take when designing such types of antennas. One of these considerations is the influence on the antenna resonance behavior due to the loading effect of the high permittivity body tissue8. On the other hand, in antenna design choosing flexible materials have to be considered to be utilized close to the rounded parts of the human body. Several kinds of wearable antennas based on flexible materials are studied and investigated by researchers such as textile9, flexible substrate10, dielectric resonators11, polyimide12, polydimethylsiloxane13, paper14, and Kapton15. Among these materials, textiles are preferred due to their lightweight and high flexibility in integration with clothing16. However, the implementation process of wearable antennas using textile fabrics as substrates is more difficult compared to the use of conventional substrates17.Nowadays, WBANs are applied in healthcare and medical applications19. In the literature, several techniques have been reported to reduce the body's absorbed radiation and, consequently, minimize the SAR level36. One of the common techniques is using a reflector below the antenna. Different structures have been utilized as reflectors such as high impedance surfaces (HISs)20, electromagnetic bandgap (EBG) structures26, and artificial magnetic conductor (AMC) surfaces36. These structures can increase the antenna gain and help significantly reduce its overall profile compared to the use of a traditional perfect electric conductor (PEC) structure.As wearable antennas operate near the human body, their radiation can cause damage to body tissues. This effect is examined by evaluating the SAR level by considering a specific part of the human body. To reduce the health risks introduced by the wearable antennas, the SAR values should be below the regulated level36. In27, a flexible reconfigurable antenna backed with an AMC surface that worked at 2.4/3.3\u00a0GHz was introduced. Considering a human leg model, the evaluated SAR values do not exceed 0.29\u00a0W/kg for both operating bands with increasing in the antenna gain by 3.6 and 2.4\u00a0dB, respectively. In28, a Yagi\u2013Uda antenna built on a latex substrate and combined with an AMC surface was presented to operate at 2.4\u00a0GHz. Single- and double-layered AMC surfaces were used to minimize the peak SAR level to 0.714\u00a0W/kg and increase the peak gain up to 1.8\u00a0dBi. In30, the performance of a wearable antenna over an AMC surface based on using a stretch conductive fabric was investigated. The design enabled the antenna to cover both WiFi and the 4G long-term evolution (LTE) frequency bands.Among the reported reflector structures, AMC surfaces have been widely used for backing wearable antennas32. The integrated geometrical configuration reduced the SAR value and improved the gain to 0.0721\u00a0W/kg and 2.42\u00a0dBi, respectively. In33, a flexible AMC surface was used as a reflector. It provides stable performance and reduction in SAR level. In the reported study, the effect of crumpling of the integrated antenna was analyzed. In34, a flexible antenna backed with an AMC ground plan and operates at 2.4 for telemedicine applications is reported. Utilizing the AMC plane provides a 3.7\u00a0dB increase in gain, in addition to a 64% reduction in SAR value. A design of compact wearable antennas resonated around 2.65\u00a0GHz is reported in35. The backward radiation was reduced using a metasurface recognized as an AMC plane and modeled with a CRLH transmission line operated at negative modes. The peak SAR value of the proposed antenna is 1.25\u00a0W/kg for a 5\u00a0mm gap from the human body with a real gain of 0.82\u00a0dBi. A dual-band 1.57/2.45\u00a0GHz wearable antenna with AMC structures is discussed in36. The antenna has a SAR level lower than 0.12\u00a0W/kg and a gain value of about 1.9\u00a0dBi at the two bands.A textile antenna with AMC surface for WLAN/WBAN applications was reported inThe proposed antenna is fabricated on textile material to achieve lightweight and high flexibility when integrated with clothing.x-axis and the y-axis.The deformation of the integrated antenna was analyzed in free space as well as when it was placed in the vicinity of the human body, indicating its good suitability for operation when bent at both the The integrated antenna has a realized gain of 7.2\u00a0dBi with average radiation and total efficiency of 72% and 60%, respectively.The integrated antenna has a low SAR level averaged over 10\u00a0g at a distance of 1\u00a0mm away from the tissues model where only 0.18\u00a0W/kg and 0.371\u00a0W/kg, respectively.In this work, a design of a cotton-based wearable antenna over an AMC surface is proposed for\u00a02.45\u00a0GHz applications. The integrated antenna adopts cotton fabric as a substrate to ease integration into clothes. In the CST Microwave Studio, the performance and radiation results demonstrated that the antenna provides excellent on-body performance and achieved SAR values below the regulated limit. Detailed discussions on antenna designs with comparative analysis with recent relevant work were presented. Based on the numerical model, the proposed antenna and the AMC surface were fabricated, integrated, and tested. Good agreements between simulated results and measured data were observed. In the end, we can conclude the contributions of the work as,\u03b5r\u2009=\u20091.7. A metallic layer is manually attached to the fabric-base substrate to form the antenna radiator and ground plane. As illustrated in the figure, Antenna 1 consists of an L-shaped radiator fed by a 50\u2126 co-planar waveguide (CPW) line as the first step of the design. With this configuration, a weak resonance around 3.1\u00a0GHz is achieved, as shown in Fig.\u00a0The design steps of the proposed wearable monopole antenna are depicted in Fig.\u00a02. The geometrical configuration of the proposed unit cell and its equivalent circuit are depicted in Fig.\u00a0g is modeled as Lground, Cd, Cslot, LP, and Cg, respectively38. The optimized lumped element values are displayed in the caption of Fig.\u00a0Ld and width, Wd of the I-shaped slot on the phase response is illustrated in Fig.\u00a0Ld, while it shifted down with the increase of the Wd. The optimized values of the Ld and Wd are 13 and 22.3\u00a0mm, respectively. The surface current density distribution at 2.45\u00a0GHz is examined in Fig.\u00a0To eliminate the body's absorbed radiation and enhance the antenna gain, the proposed antenna is placed on an AMC surface to reduce the overall profile of the entire structure compared to the use of the PEC surface. Such surfaces operate as inductor\u2013capacitor (L\u2013C) tank circuit at the resonance frequency and achieve HIS. The proposed AMC surface is designed to achieve in-phase reflection at the antenna\u2019s resonance frequency of 2.45\u00a0GHz. It was built on a double-compacted layer of cotton fabric with a thickness of 1.8\u00a0mm. It consists of 25 square patch unit cells (5\u2009\u00d7\u20095 array) with I-shaped slots, which occupy a whole area of 122.5\u2009\u00d7\u2009122.5\u00a0mmh\u2009=\u20093, 5, and 7\u00a0mm on the antenna performance in terms of |S11| response and peak gain, respectively. The corresponding effects of varying the AMC array size are shown in Fig.\u00a0In this section, the performance of the single-band wearable antenna over the designed AMC surface is investigated. Two significant parameters that affect the antenna\u2019s performance were subjected to study, the spacing of the AMC surface below the antenna and its array size. Parametric studies were carried out to adopt these parameters. Figure\u00a0x-axis (in the L direction) and the y-axis (in the W direction). Five different curvature radii along each of the x-axis (Rx) and y-axis (Ry), namely 40, 50, 60, 70, and 80\u00a0mm were separately studied. These values are reasonable representations of curvature radii of various rounded positions of the adult human body. The simulated |S11| responses versus frequency for both bending scenarios are displayed in Fig.\u00a0In practical applications, the wearable antenna is expected to be bent during the operation. To ensure the reliability of the designed antenna for such a scenario, the integrated antenna was subjected to structural bend along both the In this section, the performance of the proposed wearable antenna backed by the designed AMC surface is investigated when considered for operation in the vicinity of human tissues at a distance of 1\u00a0mm. To simulate the antenna performance, the Hugo voxel-based body model presented in CST Microwave Suite was used. The Hugo model is an inhomogeneous human model built from 32 tissues. Each tissue has material properties that reflect the anatomical human tissue properties. In this study, the Hugo model allows the determination of the loading effect of the human body on antenna performance and a detailed analysis of the SAR distributions.11| response and radiation characteristics. Figure\u00a011| responses evaluated in free space in comparison to that of body loading for a flat back and rounded arm of radius 50\u00a0mm, respectively. The corresponding far-field radiation patterns are illustrated in Fig.\u00a0The antenna characteristics for flat and rounded body loading were studied. The evaluation was performed in terms of |SRy\u2009=\u200950\u00a0mm) when attached to the human arm. The radiation efficiency is almost stable and varies from 70 to 72% for all cases. As well the total efficiency is almost stable and varies around 60% for all cases.Figure\u00a019. The SAR level is expressed as26:\u03c1 is the mass density of the tissue in kg/m3, and E is the total RMS electric field strength in V/m.The SAR level is used to evaluate the amount of RF (radio frequency) energy absorbed by the human body. The Council of the European Union recommended a SAR value of 2\u00a0W/kg averaged over 10\u00a0g of tissuesThe SAR distribution of the proposed wearable antenna system is evaluated, considering flat (human back) and rounded body (a human arm of radius 50\u00a0mm) models. Figure\u00a011| responses of the proposed antenna is given in Fig.\u00a0Ry\u2009=\u200950\u00a0mm, corresponding to the approximate size of an adult human arm. It can be seen from Fig.\u00a0In order to examine the practical performance of the proposed wearable antenna system, prototypes were fabricated and subjected to measurement. The proposed antenna and the AMC surface were etched on a conductive layer of 0.035\u00a0mm thickness glued to a single layer and a double-compacted layer of cotton fabrics, respectively. The prototype performances were measured through an Agilent N9918A vector network analyzer, where a 50-\u2126 SMA (SubMiniature A) connector was used to feed the antenna. A comparison of simulated and measured |Sx\u2013z plane and y\u2013z plane at the operating frequency of 2.45\u00a0GHz is shown in Fig.\u00a0For free space measurements, the radiation characteristics of the fabricated antenna prototypes for the four different design cases aforementioned before were assessed in an anechoic chamber StarLab 18 as shown in Fig.\u00a011| responses along with the simulated ones are shown in Fig.\u00a0For real human on-body measurements, a prototype of the antenna backed with the AMC surface was placed close to an adult\u2019s back and arm. The measured |STable \u03b5r\u2009=\u20091.7) with a small overall size of 30\u00a0mm\u2009\u00d7\u200936\u00a0mm\u2009\u00d7\u20090.9\u00a0mm. To mitigate the body coupling effect, an AMC surface was integrated behind the antenna. The structural deformation of the integrated antenna was analyzed in free space as well as when it was placed in the vicinity of the human body, indicating its good suitability for operation when bent at both the x-axis and the y-axis. Further investigation, the SAR evaluation in the Voxel-based human body model considering flat and rounded body parts indicates that the integrated antenna provided average SAR values below the critical rate. The proposed design also features a directional pattern with respect to the on-body with high radiation characteristics, which makes it attractive for potential wearable applications.In this work, a cotton-based wearable antenna convenient to be integrated with clothing was developed for 2.45\u00a0GHz wearable applications. The antenna was printed on a 0.9\u00a0mm pure cotton fabric ("}
{"text": "According to the measurements in the anechoic chamber, antenna gains with the values of 2.3 dBic and 1.1 dBic are obtained for the 870 MHz and 920 MHz, respectively. Finally, the antenna is integrated into a 3U CubeSat that was launched by a Soyuz launch vehicle in September 2020. The terrestrial-to-space communication link was measured, and the antenna performance was confirmed in a real-life scenario.This article presents a multi-band right-hand circularly polarized antenna designed for the Cube Satellite (CubeSat). Based on a quadrifilar structure, the antenna provides circular polarization radiation suitable for satellite communication. Moreover, the antenna is designed and fabricated using two 1.6 mm thickness FR4-Epoxy boards connected by metal pins. In order to improve the robustness, a ceramic spacer is placed in the centerboard, and four screws are added at the corners to fix the antenna to the CubeSat structure. These additional parts reduce antenna damage caused by vibrations in the launch vehicle lift-off stage. The proposal has a dimension of 77 \u00d7 77 \u00d7 10 mm Typical applications of this system are mentioned, such as communication, Earth observation, and space exploration [The development of the new space industry is disrupting the space market by making satellite fabrication and launch more affordable. Especially miniature satellites, such as the so-called CubeSat , enable loration ,3,4. In In the recent decade, several highly sensitive modulations known as low-power wide-area networks (LP-WAN) have been proposed to enable connectivity from small terminals to space ,6. With A CubeSat includes a communication subsystem for satellite\u2013ground links. The quality of connectivity strongly depends on the antenna system\u2019s performance integrated inside the satellite. Antenna design is a challenge for researchers due to the limitations of size, mass, operating frequency, and required bandwidth. In ,14,15,163 and an axial ratio bandwidth of 18.75%. An antenna is designed on low-loss Rogers substrates and provides an omnidirectional radiation pattern with a maximum gain of 8 dBic.Regarding operating frequency, antennas operating in a band higher than 1 GHz are often preferred due to their small size and ability to support broadband communications. A wideband patch antenna has been reported that can cover 1.6 to 2.7 GHz with a maximum gain of 8.5 dBi . Due to On the other hand, directional antennas have also been extensively studied ,24,25,262 and realized a gain of \u22121.8 dB. Another study proposed a slot-based antenna that supports the MIMO scheme mentioned in [2. However, this antenna requires a large clearance area, so mounting it on satellites will be pretty tricky. To solve this problem, by analyzing the characteristic mode of the satellite structure, the paper [Differently from the previous examples, sub-GHz bands enable longer transmission distances thanks to the lower path loss and easier obstacle penetration. In article , an omniioned in . Due to he paper  presentshe paper , a propoDesigning the antenna with a compact size to be compatible with CubeSat integration and operation at low frequencies with specific properties in polarization and pattern is a considerable challenge. In , two freLacuna Space is a satellite IoT network provider founded in 2017 . Lacuna This article presents a low-profile, miniature, and multi-band antenna for 3U CubeSat that supports terrestrial ISM bands with right-hand circular polarization. The antenna is designed based on the combination of a broadband power splitter structure and inverted-F antenna elements (IFA) to obtain the directional radiation pattern. In addition, the proposed design provides bandwidth expansion thanks to coupling with a shorted parasitic element. A CubeSat-suitable robust structure is archived using the plastic bumper as the spacing. The antenna is manufactured, mounted on the satellite frame, and then measured in the chamber to validate the concept. Finally, the antenna was integrated within LS3 Lacuna Space CubeSat, launched in September 2020, then commissioned, and used for in-flight experiments in February 2021.As mentioned above, the satellites supporting UHF communication need to cover multiple bands for different geographical areas. When the satellite reaches different areas, it will adjust its transmission and reception frequencies to the bands allowed in those regions, such as 868 MHZ in Europe, 915 MHz in the Americas, and 915 MHz and 923 MHz in Asia. Therefore, antennas used for satellites need to have multi-frequency band features to ensure worldwide continuous operation. In addition, to optimize transmission quality and to reduce the interference caused by ground-based systems, a high gain with circular polarization and a wide beamwidth radiation pattern are required. For these reasons, Lacuna Space decided to use right-hand circular polarization (RHCP) for uplink and downlink communications.2 and 10 mm in height. The radio frequency connector was placed on the bottom layer of the bottom substrate. Based on the literature, a single resonance quadrifilar structure with such a form factor limitation would reach a 30 MHz frequency bandwidth. In order to extend the frequency band operation, a reconfigurable solution based on digital tunable capacitors or pin diodes was considered too risky. In order to provide a passive dual-band antenna, parasitic elements have been extensively used with an inverted F antenna [To integrate the radiation structure on the 1U face of the 3U CubeSat, the maximal dimensions of the structure were 77 \u00d7 77 mm antenna . Then, t antenna , two thiInverted F antenna radiating elements are designed using the bottom substrate as a ground plane. The dual-band characteristic is obtained by adding a parasitic element placed in the inner part of the structure and connected to the ground. Several configurations of the driven and parasitic elements were investigated to find out the best topology to maximize frequency bandwidth and gain. Parametric simulations show that the driven element must be placed on the edge of the structure, with the driven element placed at 8mm in the center of the structure. The parasitic element shorting pin is aligned with the feeding element shorting pin. The width and length of the driven and parasitic elements are carefully optimized to maximize the performance in both bands.As shown in Four 8 mm diameter holes are inserted into the top substrate to enable the screwing of the antenna structure to the 3U frame. The M3 metallic screws are also used for grounding purposes on the CubeSat metallic structure. The 3D and top view layouts are shown in Surface currents at 870 MHz and 920 MHz are presented in As described in the previous section, the radiating structure is composed of four independent IFAs with sequential rotation. To radiate right-hand circular polarization, each element must be fed equally with a sequential phase shift of 0ented in . This soIn order to miniaturize the circuit, the proposed feeding network consists of a balun and two hybrid couplers, as shown in tructure .The proposed design is illustrated in Ansys HFSS software is used to simulate the proposed antenna system; then, the design concept could be confirmed. In the next section, two different cases are presented in order to understand the effect of the 3U satellite structure on antenna performance. The case of \u201cwithout structure\u201d refers to the antenna alone, as shown in The gain achieved on the broad side versus the frequency is presented in Without the CubeSat structure, the realized gain radiation patterns at 870 MHz and 920 MHz are presented in The proposed concept is manufactured and assembled using two FR4 dual-layer substrates (The measured reflection coefficients of the antenna without and with the structure are presented in For the antenna alone, the radiation patterns of the real gain at 870 MHz and 920 MHz are shown in These measurement results validate the performance of the proposed structure for the targeted application.A picture of the antenna integrated within the 3U structure is shown in  antenna  and an eThe proposed structure was validated in space, and the non-deployable passive antenna was demonstrated to be able to cover multiple bands in the UHF frequency with a 3U CubeSat configuration. It should be noted that the antenna\u2019s performance could be further enhanced using a lower-loss substrate. Due to the limited development time, we selected the FR-4 material to benefit from the space qualification and reduced production time. From a 3D electromagnetic solver simulation with a Rogers 4350b substrate (tan A multi-band right-hand circularly polarized antenna integrated into a three-unit CubeSat has been designed, simulated, and measured. A dual substrate solution based on FR4 material has been manufactured to validate the simulation model. After integration into a 3U CubeSat structure, the antenna provides an RHCP configuration with aperture beamwidths of 134 \u00b0C and 144 \u00b0C at 870 MHz and 920 MHz, respectively. The proposed antenna has been successfully tested in flight with a communication range greater than 1200 km from an LEO CubeSat to a low-power terrestrial receiver."}
{"text": "We designed a mesoscopic dielectric cuboid antenna connected to a flangeless WR-3.4 open-ended waveguide, and the antenna characteristics at 300 GHz were examined through simulations and experiments. Simulations confirmed that the flangeless design eliminated the flange-induced ripples in the radiation pattern, whose shape varied with frequency, and that the antenna operated in the full bandwidth of the WR-3.4 waveguide (220\u2013330 GHz). Prototypes were then fabricated based on the simulation findings. A prototype with an antenna aperture area of 1.5 mm  In particular, the 300 GHz band is being studied and developed actively worldwide. The development of high-gain antennas is important for 300 GHz wireless communication applications because of the proportional increase in free-space propagation loss with the square of frequency. In general, a trade-off exists between the physical aperture area and gain of an antenna; smaller antennas have lower gains. Therefore, achieving high-speed wireless communication in the 300 GHz band for mobile terminals requires a balance between antenna size and gain, so compact high-gain antennas should be designed.Because of its wide frequency bandwidth, the terahertz band is being considered not only for the backhaul and fronthaul of future high-speed, high-capacity mobile communication systems (beyond 5G/6G)13. A step-corrugated horn antenna with dimensions of 3.2 mm 3. Dielectric resonator antennas (DRAs) made of high-dielectric-constant materials for the 300 GHz band have been investigated, and they are drawing attention as alternative on-chip options to planar antennas18, although antennas with resonant structures exhibit narrowband operation around their resonance frequencies. An approach to achieving wideband DRA operation was proposed where multiple higher-order dielectric resonator modes and cavity mode are simultaneously excited; the peak antenna gain was 8.6 dBi at 290 GHz, with a 3-dB gain bandwidth of 55 GHz (270\u2013325 GHz)10. However, even with such frequency bandwidth extension, the potential operating bandwidth limitation due to the resonant structure of DRAs may hinder the complete utilization of the extensive frequency bandwidth of the terahertz band. A dielectric rod waveguide antenna (DRWA) is a surface-wave antenna that operates without using resonance. It has good directivity in the end-fire direction, and its characteristics have been studied analytically and experimentally, including those in the millimeter-wave and terahertz bands30. The maximum gain and minimum half-power beamwidth (HPBW) can be achieved by DRWAs by following Zucker\u2019s design rules27. However, the length of the rod must be several tens of wavelengths to obtain sufficient gain for short-range communication, which requires considerable space when mounting such an antenna on a device. In12, a DRWA with a 20 mm radiation taper was verified; the 29, a DRWA with a 16 dBi gain and Various types of compact antennas operating in the 300 GHz band have been proposed32. A DCA controls the wavefront using a wavelength-scale dielectric cube. Inherent broadband operation is possible because this antenna does not use resonance. We also demonstrated 17.5 Gbps wireless transmission in the 300 GHz band using a DCA sized 1.2 mm 32. However, these DCAs fabricated and demonstrated in the 300 GHz band were designed with waveguide flanges behind them, which caused ripples in the radiation pattern, especially in the E-plane. Moreover, the maximum gain direction varied with the operation frequency, which degraded the frequency characteristics of the antenna gain in a certain radiation direction. This is a critical problem for terahertz wireless communication systems using wide frequency bands based on frequency multiplexing methods, such as orthogonal frequency division multiplexing (OFDM).Recently, we developed and proposed a mesoscopic dielectric cuboid antenna (DCA) and demonstrated its operation experimentallyThis paper investigates the effect of cuboid dimensions on the characteristics of a DCA connected to a flangeless WR-3.4 waveguide . Simulations show that the flangeless design eliminates the ripples in the radiation pattern. The maximum antenna gain is reduced, even though the gain degradation can be recovered by slightly extending the antenna length. We also find an optimal antenna length for a given antenna aperture area. This optimal length resulted in the maximum antenna gain and a radiation pattern with a high rotational symmetry of the main lobe and a low side-lobe level (SLL). Based on the simulation results, we fabricated three DCA prototypes with different dimensions and measured their basic characteristics, namely, their antenna gains, radiation patterns, and c), as shown in Fig. 33. The phase velocity of an electromagnetic wave in a dielectric is slower than that in free space; therefore, the shape of the wavefront can be changed to generate a photonic jet36. This effect enables the conversion of the spherical waves radiated by the waveguide into planar waves to realize high antenna gains.The proposed DCA for the 300 GHz band has a cuboidal radiating part . These results suggest that the waveguide flange significantly affects the radiation characteristics of the DCA and the use of an OEWG can reduce this impact.Fig. In this section, we show the dependence of the gain and radiation pattern of the DCA on its physical dimensions and discuss the radiation efficiency of the DCA based on the simulations. Moreover, we examine the effect of applying a matching taper to the connection between the DCA and the waveguide and optimize this matching taper to realize WR-3.4 full-band operation (220\u2013330 GHz).a and b) and the length of the connecting part (c). Fig. a at various b. We set a and b affect the gain, and an optimal dimension is observed from the perspective of the gain. For example, when a beyond this value decreases the gain instead of further improving it. As the value of b increases, the value of a that gives the maximum gain for a given b also increases, indicating that increasing the DCA gain requires a larger antenna volume. When First, we examine the dependence of the antenna gain and radiation pattern of the DCA on its physical dimensions at 300 GHz. For simplicity, we use a simplified OEWG model, just a straight waveguide with a wall thickness of 0.1 mm. The DCA has three dimensional parameters: the lengths of the cuboid  for a given a. The radiation patterns of both the E- and H-planes have shoulders at approximately b increases from 1.4 mm, the gain increases, and the position of the side lobe in the E-plane pattern becomes closer to the center, resulting in unimodal main-lobe patterns in both the E- and H-planes. At b range, the main lobes in the E- and H-plane patterns are almost identical; i.e., the radiation patterns have high rotational symmetry. In the E- and H-plane patterns, the first side lobes appear at 33 and 35 degrees from the main lobes, with SLLs of b increases from 2.35 mm, the SLLs increase. As shown in Fig. a varies from 1 to 2.2 mm when b is fixed at 2.35 mm. The radiation patterns for the representative dimensions are also shown. For both small  works simply as a waveguide filled with dielectric and does not play a significant role in return loss reduction. Without the matching taper, Finally, we examine the frequency characteristic of We fabricated three prototypes and measured the frequency characteristics of the antenna gain and mentclasspt{minima32 (b, the antenna volume reduced from 1.96 to 1.70 mmDCA1 was designed to obtain approximately the same antenna gain as that in32 with a waveguide flange. As seen in Fig. b characteristic. Based on the simulations, b was set to 1.7 mm for the maximum gain at DCA2 was designed to obtain the maximum antenna gain with the same aperture area (DCA3 was designed to achieve higher gains while maintaining a compact antenna size. We set We measured the antenna characteristics by inserting the DCA directly into the OEWG (Fig. 32, the antenna gain of DCA1 at 300 GHz was 14.6 dBi, which was almost the same as that of the DCA with the waveguide flange. Although DCA2 had the same aperture area as the DCA with the waveguide flange in32, its antenna gain was 16.1 dBi, which was 1.1 dB higher than that of the DCA with a waveguide flange; this antenna gain was obtained at 300 GHz by increasing b from 1.36 to 1.70 mm. DCA3 had an antenna gain of 17.2 dBi at 300 GHz, and the 3-dB bandwidth covered the entire WR-3.4 waveguide bandwidth. The aperture efficiency A is the physical aperture area of the antenna, and G is the antenna gain. DCA3 had a high aperture efficiency of mentclasspt{minimaWe designed a DCA connected to a WR-3.4 OEWG and performed simulations and experiments to confirm their characteristics in the 300 GHz band. For a given DCA aperture dimension, a specific DCA length achieved the maximum antenna gain, a main lobe with good rotational symmetry, and low SLLs. Based on these findings, a DCA prototype with an antenna aperture area of 1.5 mm"}
{"text": "The proposed antenna can be easily printed on a piece of flexible tattoo paper and transformed onto a PDMS substrate, making the entire antenna structure conform to the human body for achieving a better user experience. Here, a layer of frequency selective surface (FSS) is inserted in between the antenna and human tissue, which has successfully reduced the loading effects of the tissue, with 13.8\u00a0dB improvement on the antenna gain. Also, the operating frequency of the rectenna is not affected much by deformation. To maximize the RF-DC conversion efficiency, a matching loop, a matching stub, and two coupled lines are integrated with the antenna for tuning the rectenna so that a wide bandwidth (~\u200924%) can be achieved without the use of any external matching networks. Measurement results show that the proposed rectenna can achieve a maximum conversion efficiency of 59.0% with an input power of 5.75\u00a0\u03bcW/cm2 and can even exceed 40% for a low input power of 1.0\u00a0\u03bcW/cm2 with a 20\u00a0k\u03a9 resistive load, while many other reported rectennas can only achieve a high PCE at a high power density level, which is not always practical for a wearable antenna.This paper presents a 35.0\u2009\u00d7\u200935.0\u2009\u00d7\u20092.7\u00a0mm However, one main limiting factor of most commercialized wearable electronics is their power supplies2. Most of these electronic devices are battery-operated, but unfortunately, the battery itself has limited lifespan and its bulk size does not scale down as fast as electronics3. Nowadays, with the rapid development of 5G technology, where beamforming techniques are massively used, microwave wireless power transfer (WPT) has become an attractive solution to resolve the power charging problem4.Wearable electronics have attracted much interest in recent years due to their wide applications in our daily life. They can be applied on many places such as smartwatches, smart clothing, and real-time health monitoring devices6. Wearable antenna also can be made by electroplating thin metal foils such as copper7 and gold8 on elastic dielectric substrates as well as inkjet-printing conductive nanoparticle inks9 onto flexible substrates. Soft fabrics are chosen for wearable antennas due to their good conformality, flexibility, and low cost10. Despite these excellent features, woven fabric may have a dielectric loss as high as 8.5\u00a0dB/m11. Also, gain reduction has been observed in the embroidery antenna reported in Ref.5 due to the higher resistance of the conductive yarn. Inkjet-printed antennas that are generated using the conductive nanoparticle ink on flexible substrates, such as Kapton and PET, are also reported in Refs.12. Despite these conductive nanoparticle inks can provide high conductivity, they can only be printed on specific substrates and carrier mediums13. For example, the self-sintering silver ink reported in Ref.12 can only achieve a low resistance with the use of commercial printing sheets. This will surely limit the compatibility of conductive nanoparticle ink since the radiation efficiency of the antenna is much affected by the dielectric loss of the substrate and the conductivity of the conductive ink trace14. Also, precise deposition of the conductive ink on the substrate requires a complex process, making the fabrication become a slow and non-scalable process15. A wearable antenna that was fabricated using electroplating thin metal foils such as copper and gold on elastic dielectric substrates was also reported in Refs.8. However, these antennas are not able to withstand tensile strain16. Therefore, there is a desire to have a compact, flexible, stable, conformal, and easy-to-make microwave antenna for wearable applications.Flexible microwave antennas that are made of fabric materials have been broadly reported for wearable applications in recent years17, loop antenna18, patch antenna11, and fractal antenna19. Unfortunately, most of the reported rectennas, such as the one with an off-center fed dipole antenna 17, a dual-band rectangular loop antenna 18, and a microstrip patch antenna 11, have a large footprint. In practice, to achieve better user experience, the wearable antennas are required to be compact, low profile, and lightweight20. However, very few of the reported solutions can meet the above-mentioned criteria. Besides that, a rectenna always requires the use of either impedance transforming/matching networks, resistance compression networks, or frequency selective networks, such as those reported in Refs.23, which will surely introduce additional losses and further increase the circuit complexity23. A compact fractal loop antenna reported in Ref.19 was incorporated with an in-loop ground plane (ILGP) so that it can provide sufficient impedance for matching with the rectifying circuit. However, again, it requires the use of a balun and multiple vias for the integration, which has increased the complexity of the circuit design process. Designing a compact and highly efficient 50\u00a0\u03a9 rectenna that does not need a matching network remains a challenge for microwave WPT.For microwave WPT, it involves a rectenna that has an antenna to receive the microwave power and a rectifier to convert it to DC power. Different types of rectennas have been reported, including those made of dipole antenna24. In our work, a tattoo-polymer 3\u00a0\u00d7\u00a03 frequency selective surface (FSS) is integrated with the antenna to isolate it from the lossy human body. Both the antenna and FSS here can be rapidly and easily fabricated using the commercial tattoo paper and liquid metal alloy. The \u201cAg-In-Ga\u201d traces in our antenna structure are coated with silver epoxy and liquid metal for achieving a higher conductivity (3.8\u00a0\u00d7\u00a0106\u00a0S/cm). Our method has provided an alternative solution for the crucial problem frequently encountered by most fabric antennas, whose conductivities are usually low due to the limitation posed by embroidery density5. Different from the state-of-the-art rectennas23, here, a matching loop, a matching stub, and two coupled lines are employed for tuning the antenna impedance so that it can achieve a broad-band impedance matching with the rectifying circuit. The complexity of the antenna structure is simple as it does not require the use of any external matching networks. Finally, as our antenna is having 50\u00a0\u2126 impedance, it can integrate easily with the commercialized rectifiers, such as that demonstrated in Ref.25.In this paper, a compact, conformal, and easy-to-make tattoo-polymer loop antenna is presented for designing a highly efficient rectenna. As human body is very lossy, it can cause the antenna\u2019s radiation performance to deteriorate significantly. Degradation in the radiation pattern can result in transmission errors3, as schematized in Fig. 26 of all the layers are given in Supplementary Table 14. Finally, the tattoo antenna and the FSS were transferred to the PDMS substrate  through the hydroprinting process. The PDMS is selected to be the structural support of the antenna due to its higher flexibility, lower cost, and easier fabrication, as compared with other polymer substrates27. The total profile of the proposed tattoo-polymer antenna is 2.70\u00a0mm, which is thinner than most of the state-of-the-art EBG/FSS-backed wearable antennas, as summarized in Supplementary Table S232. Description of the detailed fabrication processes can be found in Refs.33. The final designs of the antenna and FSS are shown in Fig. In order to simulate the proposed tattoo-polymer antenna, we have employed a multilayer tissue model (Syndaver) comprising skin, fat, and muscle layers with an overall dimension of 20\u00a0\u00d7\u00a09\u00a0\u00d7\u00a011\u00a0mm19, it is usually very challenging to miniaturize its footprint as the circumference of a typical loop resonator is required to be in the multiple of its operating wavelength. Our proposed antenna is employed for designing a compact rectenna that can operate in the Wi-Fi range (2.40\u20132.48\u00a0GHz). Here, the octagonal loop is more preferred than the conventional square loop. This is because the 90\u00b0 sharp bends of the square loop tend to generate stray radiation, and it can degrade the performance of the antenna34. To lower down its resonant frequency, here, two coupled lines are loaded to the loop antenna. A matching loop is appended to the loop for optimizing the antenna impedance, which will be discussed in detail shortly. The design procedure starts with simulating the reflection coefficient of a simple octagonal loop without the two coupled lines in free space. With reference to Fig. \u03bb\u00a0=\u00a096.15\u00a0mm), which corresponds well to the perimeter of one circumference (101.15\u00a0mm). With the inclusion of the two coupled lines (L6\u00a0=\u00a011.00\u00a0mm), as can be seen from the same figure, the resonant frequency has shifted down to 2.94\u00a0GHz. After performing the simulation in free space, which can be done in a faster manner, the antenna is now attached to the human tissue model for further optimization. Due to the loading effect of the high-dielectric lossy tissue35, the resonant frequency of the antenna has further shifted down to 1.86\u00a0GHz, which has caused poor impedance matching. It shows that the tissue layer has deteriorated the impedance performance of the antenna significantly due to its high loss. Then, a 3\u00a0\u00d7\u00a03 FSS layer is inserted in between the loop resonator and the human tissue as an isolator. With the inclusion of the FSS and PDMS substrates, the antenna is fine-tuned so that it operates at 2.40 GHz with good impedance matching, as shown in Fig.\u00a0\u03bb2.4GHz) in Ref.18 and the fractal loop  in Ref.19, the circumference of our octagonal loop antenna  is 21.8% and 56.1% smaller than the former and the latter, indicating that ours is more compact.Although the loop antenna has been employed for harvesting energy36. To solve this problem, our antenna is integrated with a matching loop, a matching stub, and two coupled lines for tuning the antenna impedance for matching with the 50\u00a0\u03a9 rectifier. By tuning the lengths of the matching loop (M1) and the matching stub (L7), good impedance matching can be easily realized over a wide bandwidth, as shown in Fig. Since the antenna is to be used for WPT, it is very important for the tattoo-polymer antenna to have a good impedance matching with the RF-to-DC rectifier circuit for maximizing the RF power transfer. Although matching circuits and filtering networks can be introduced for improving the impedance matching, they can increase the complexity and size of the antenna system37, the ring FSS has low back radiation when it is integrated with a dipole. First, the FSS element is placed on the human tissue model and simulated inside a unit cell for finite structure, which is available in the CST MWS software, as shown in Fig. z and \u2212\u00a0z directions. With reference to the same figure, two magnetic walls (Ht\u00a0=\u00a00) are set in perpendicular to the x direction, while two electric walls (Et\u00a0=\u00a00) are vertically defined in the y direction. Figure R\u00a0=\u00a05\u00a0mm (0.042\u03bb2.4GHz), 4\u00a0mm (0.032\u03bb2.4GHz), and 3\u00a0mm (0.025\u03bb2.4GHz)] in the phase range of 180\u00b0 to \u2212\u00a0180\u00b0 with respect to frequency. The reflection phase is obtained by de-embedding the reference plane to the surface of the element. A reflection phase of ~\u00a00\u00b0 is observed near to the operating frequency of 2.40\u00a0GHz38 for the case R\u00a0=\u00a00.025\u03bb2.4GHz. This is to make sure that the reflected wave is in phase with the incident wave on the tissue model39. The corresponding transmission and reflection coefficients are also simulated and shown in Fig. R\u00a0=\u00a00.025\u03bb2.4GHz, the reflection and transmission coefficients are found to be \u2212\u00a030.7\u00a0dB and \u2212\u00a07.45\u00a0dB, respectively, which correspond to 0.029 and 0.424 at the operating frequency of 2.40\u00a0GHz. For the calculated insertion loss 1\u00a0\u2212\u00a0|S11|2\u00a0\u2212\u00a0|S22|2\u00a0=\u00a00.82, it is observed that the human tissue is extremely lossy due to its high insertion loss.In this section, the design procedure of the FSS is discussed. The ring-shaped FSS is selected because it has a simple structure. According to a study presented in Ref.35. Here, the SAR simulation is conducted by establishing a multilayer biological human tissue model using the CST software. Then, the tattoo-polymer antenna is placed right above the biological tissue with a separation distance of 5\u00a0mm28. The input power to the antenna is set to be 100\u00a0mW at 2.40\u00a0GHz, and the SAR is calculated according to the IEEE C 95.1 standards. The SAR values are simulated by averaging over the sampled volumes of 1\u00a0g and 10\u00a0g. By comparing Fig. 40 and the EBG-backed planar inverted-F antenna in Ref.41, the SARs of our FSS-integrated octagonal loop antenna are 64.0% and 27.6% lower than those in Refs.41 by referencing the volume of 1\u00a0g tissue sample (USA Standards); while they are 34% and 42% lower than the reported wearable antennas in Refs.42 with 10\u00a0g tissue sample volume (European Standards), indicating that our FSS-integrated octagonal loop antenna has achieved a lower SAR with a more compact size. The details of the comparison are summarized in Supplementary Table Since the proposed tattoo-polymer antenna is designed for wearable applications, the specific absorption rate (SAR) is an important factor to be considered as it is required to be placed near to human body43, as depicted in Fig. 26. Figure\u00a0The tattoo-polymer antenna was integrated with the FSS and fabricated, and experiment was carried out using a differential probeyz-plane, xz-plane, and xy-plane) of the integrated tattoo-polymer at 2.40\u00a0GHz when it is placed on the artificial skin layer. For comparison purpose, the radiation patterns of the loop antenna on tissue without FSS . A considerable gain improvement (13.8\u00a0dB) in the boresight can be achieved by integrating the loop antenna with the FSS structure. It shows that the FSS layer has successfully isolated the antenna from the skin, and it has improved the radiation performance significantly.Supplementary Figure 38. Therefore, it is crucial to ensure that the operating frequency of a wearable antenna remains stable even when it undergoes deformation. An experiment was performed based on the structure shown in Fig. In practical applications, a wearable antenna needs to be worn on the human body, which may result in bending or deformation. The resonant frequency and impedance matching of the antenna are susceptible to changes due to structural deformation11|) was measured in Fig. The impact of the backing objects on the antenna performance was also investigated in practical scenarios. The FSS-integrated tattoo-polymer antenna was placed on hand, chest, and leg of a male volunteer as depicted in Fig. S  at 2.45 GHz, using the experimental setup depicted in Fig DC over a 20\u00a0k\u03a9 load. It is observed that the output voltage of the proposed antenna is linear, and the optimal load does not vary with different power densities. It implies that the proposed design does not require the maximum power point tracking (MPPT) capability to maintain its maximum PCE11, which is a very desirable feature. After selecting the optimal load (20\u00a0k\u2126), a frequency sweep is performed from 1.0 and 3.0\u00a0GHz at different power densities (S) for measuring the bandwidth of the antenna. Figure\u00a0S. Figure\u00a0.1\u00a0<\u00a0S\u00a0<\u00a05.5\u00a0\u03bcW/cm2 with the optimal load (20\u00a0k\u03a9). It is observed that the PCE of the rectenna exceeds 40% from 1.0\u00a0\u03bcW/cm2 onwards, indicating that it is suitable to be used for low power levels as well. As proof of concept, a commercialized digital watch was connected to the output of the proposed rectenna, as shown in Figs. The wireless power performance of the proposed tattoo-polymer antenna was evaluated by conducting a load sweep from 0 to 100\u00a0k\u03a9 at three fixed power densities, 44. This is because our antenna does not need the use of external matching circuits and long transmission lines, which can introduce additional insertion loss. With reference to the table, similar level of PCE was achievable for the wearable rectennas in Refs.19. A resistance compress matching network was employed in Ref.11 so that a higher DC voltage sensitivity and a better PCE could be achieved. While in Ref.19, an in-loop ground plane (ILGP) was engaged to adjust a loop antenna\u2019s impedance to \u2053\u00a050\u00a0\u03a9 for attaining a high PCE (61%). The ILGP structure was connected to the loop antenna through a metallic via. For both, however, the employment of these additional external circuits will surely increase the antenna complexity. In contrast, our proposed antenna structure is rather simple as it does not require the use of any external matching networks. Besides that, many other rectennas, which are proposed for WPT and energy harvesting (EH), have put emphasis on maximizing the PCE. However, high PCE was often achievable only at high power density levels (more than 100\u00a0\u03bcW/cm2)45. For example, Falkenstein et al. reported a dual linearly polarized patch antenna with total efficiencies over 50% for a high power density of 25\u2013200\u00a0\u03bcW/cm246. Harouni et al. reported a 2.45\u00a0GHz compact dual-circularly polarized rectenna with PCE\u00a0=\u00a063% for a high power density of 525\u00a0\u03bcW/cm247. Also, high PCEs of 84.4% and 82.7% at 2.45 and 5.80\u00a0GHz, respectively, were achieved by the CPS dipole dual-frequency antenna reported by Suh48. Although the reported rectennas have reasonably better PCE at a higher power density, practically, the RF/microwave power available in an ambient environment is usually very low. For example, based on the London RF survey measurement reported by Pinuela49, the average power density of the Wi-Fi (2.40\u20132.50 GHz) is only 0.89\u00a0nW/cm2 in most of the underground stations. The power density was found to be in the range of 0.0017\u20130.8594\u00a0\u03bcW/cm2 for the European Union (EU) telecommunication spectrum of 10 MHz\u20136 GHz under long-term RF EMF measurements50. Therefore, it is important that a rectenna can operate and maintain a high efficiency under an ultralow power density. By comparing with the reported rectennas in Refs.50, our proposed rectenna can achieve higher efficiencies of 8.5% and 7.5%, respectively, with lower power densities of 125% and 110%, indicating that our proposed rectenna can achieve a higher sensitivity.The proposed rectenna is compared with the state-of-the-art low-power rectennas, as shown in Supplementary Table 51, an organic pulse oximetry sensor (minimum power consumption\u00a0=\u00a024.0\u00a0\u03bcW)52, and a biomedical electrocardiogram (minimum power consumption\u00a0=\u00a075.0\u00a0nW)53. Based on the results shown in Fig. 4. Although the prospect is promising, the application of the tattoo-polymer antenna to microwave WPT is still in the nascent stages. Many crucial issues, such as wear resistance and long-term durability, are yet to be explored. Further improvements on the rectenna\u2019s maximum output power and PCE are always needed to power up a wider range of electronic devices with a power consumption in the range of mW. Therefore, future efforts will focus on further characterization of the device durability and WPT output power of the proposed tattoo-polymer antenna, which includes encapsulation with a Tegaderm film to improve the wear resistance as well as enhancement in the output power through a commercialized booster module or array unit.In summary, this work has presented the design and measurement of a compact tattoo-polymer FSS-integrated loop antenna for on-body wireless power transfer with high PCE, which is operating well under low power levels, and it is intrinsically matched to 50\u00a0\u03a9 without needing any external matching circuits. Proof of concept demonstration shows that WPT can be achieved through the proposed rectenna by harvesting energies from the microwave/RF sources such as the Wi-Fi router and mobile hotspot. Recent advances in the ultralow-power electronics have led to several reported wearable devices with power consumption as low as nW to \u03bcW, such as a pressure sensor (minimum power consumption\u00a0=\u00a010.0\u00a0\u03bcW)2. The efficiency is found to be able to exceed 40% even for a low input power of 1.0\u00a0\u03bcW/cm2. It shows that our proposed rectenna can operate well under low power levels.A wearable tattoo-polymer FSS-integrated loop antenna has been proposed for wireless power transfer. Both the antenna and FSS can be easily printed on a piece of tattoo paper. The footprint and profile of the proposed antenna are smaller than most of the state-of-the-art wearable antennas. The FSS layer has successfully improved the radiation performance of the loop antenna on human body in the boresight, with a significant gain improvement of ~\u00a013.8\u00a0dB. Also, the FSS can improve the SAR as much as 75.5% on the biological tissue. Bending test has been performed on the proposed wearable antenna, where the resonant frequency and impedance bandwidth are found to be very stable. The antenna performance is not affected much by its own structural deformation. For wireless power transfer, the FSS-integrated antenna was bonded with a 50\u00a0\u2126 6-stage voltage multiplier. It has been observed from experiments that a maximum efficiency of 59.0% is achievable with an input power of 5.75\u00a0\u03bcW/cm28. The effects of backing loading objects are analyzed for realistic scenarios. The FSS-integrated tattoo-polymer was placed on the hand, chest, and leg, as shown in Fig. The proposed FSS-integrated tattoo-polymer was placed on a man-made curvature created by wrapping artificial skin around cylindrical polystyrene foam of diameters 70\u00a0mm, 100\u00a0mm, and 120\u00a0mm to produce various degrees of structural deformation as depicted in Fig. 44 to match the antenna impedance of 50\u00a0\u03a9. Fig. Aeff)47, as indicated by Eq.  was utilized to transmit a continuous wave at 2.45\u00a0GHz (with power ranging from 0 to 30\u00a0dBm) using a horn antenna as the source. The tattoo-polymer antenna, placed 1.80\u00a0m away from the source, was connected to a variable resistive load through its DC output. To meet the minimum Fraunhofer far-field criteria, a distance of 1.20\u00a0m was maintained between the horn antenna and the proposed antenna. A 6-stage voltage multiplier, designed using BAT15-03W diodes (low barrier Schottky diodes), was utilized to convert the harvested microwave energy into a DC voltage. The rectifier circuit, fabricated on a flexible PCB, was modified from Ref.Supplementary Information."}
{"text": "It also has the highest gain  compared to other antennas in the literature. In addition, the SAR values for the proposed antenna are well below the safety limits prescribed by IEEE Std C95.1-1999, with SAR values of 0.409 W/Kg for 0.8 GHz, 0.534 W/Kg for 1.43 GHz, 0.529 W/Kg for 3.5 GHz, and 0.665 W/Kg for 5.5 GHz when the applied input power is 10 mW. Overall, the proposed antenna in this study demonstrates superior performance compared to existing tri-band implantable antennas in terms of size, bandwidth, gain, and SAR values.This study aims to design a compact antenna structure suitable for implantable devices, with a broad frequency range covering various bands such as the Industrial Scientific and Medical band , the Wireless Medical Telemetry Service (WMTS) band, a subset of the unlicensed 3.5\u20134.5 GHz ultra-wideband (UWB) that is free of interference, and various Wi-Fi spectra . The antenna supports both low and high frequencies for efficient data transfer and is compatible with various communication technologies. The antenna features an asynchronous-meandered radiator, a parasitic patch, and an open-ended square ring-shaped ground plane. The antenna is deployed deep inside the muscle layer of a rectangular phantom below the skin and fat layer at a depth of 7 mm for numerical simulation. Furthermore, the antenna is deployed in a cylindrical phantom and bent to check the suitability for different organs. A prototype of the antenna is created, and its reflection coefficient and radiation patterns are measured in fresh pork tissue. The proposed antenna is considered a suitable candidate for implantable technology compared to other designs reported in the literature. It can be observed that the proposed antenna in this study has the smallest volume (75 mm Due to the rapid development of low-power, miniaturized electronic devices and sensors, there is growing interest in implantable medical devices (IMDs) among researchers. IMDs have potential applications in neural stimulation, therapeutic medication, diagnosis and treatment of ailments, deep body communication, and drug delivery devices with high accuracy ,5,6,7,8.Antenna design and performance enhancement techniques are receiving significant research interest due to the numerous factors and challenges involved in designing antennas for implantable devices as compared to free space antennas. The performance of implantable antennas is affected by the behavior of electromagnetic radiation in the highly diverse electrical properties of human tissues, which have heterogeneous permittivity and conductivity based on water content. The major challenges include the coupling of electromagnetic radiation with body tissues due to high conductivity, dielectric constant, and heterogeneous tissue layers, resulting in frequency and impedance detuning effect, signal degradation, poor gain and radiation efficiency, and tissue heating ,10. As aLimited space for integrated circuits and antenna structures designed for implants is another issue. Consequently, antenna electrical dimensions are inversely proportional to resonance frequency and other radiation characteristics. Therefore, active techniques are needed to miniaturize the antenna while maintaining performance in practical in-body applications ,12. ReseNarrowband antennas are not ideal for implantable devices because their resonance frequency is affected by the varying electromagnetic properties of human tissues . WidebanAccording to the above discussion of the most related works with this study, the main contribution of this study is the design of a triple-band implantable antenna with wide bandwidth performance that operates at ISM, WMTS, UWB, and Wi-Fi frequencies, making it suitable for commercial applications. The design incorporates a parasitic resonator and an asynchronous-meandered radiator with an open-ended square ring defected ground. The design is analyzed using a simplified three-layered human tissue model in CST Microwave Studio Suite. A prototype is fabricated and tested by implanting it into pork tissue, and numerical simulations are used to calculate the specific absorption rate (SAR) to determine the allowable input power. The proposed structure has incorporated the following advantages over the state-of-the-art literature.The proposed structure is a compact antenna with simple and planar configurations. Existing structures are designed using multiple layers, shoring pins, and PIFA technology, making the antenna thicker and more complex.Most Tri-band antennas are designed to resonate at ISM and WMTS bands, whereas the literature shows that the Ultra-wideband spectrum has significant advantages for Intra-body communication. Triple-band resonance was selected to make the antenna suitable for commercial body area network applications.The antenna has flexible characteristics, robust to structural deformation, size and shape of the tissue.Wider impedance bandwidth to sustain the frequency detuning effect caused by the heterogeneous body tissue effect in real-time scenarios.Broadside radiation characteristics with better gain for reliable communication link and low specific absorption rates.The paper is structured as follows: r\u03b5 = 38 and \u03c3 = 1.46 s/m), fat (r\u03b5 = 5.2 and \u03c3 = 0.10 s/m) and muscle (r\u03b5 = 52.7 and \u03c3 = 1.8 s/m) layers is designed. According to the in-body deployment location, it may be required to bend the structure for the specific tissue. Thus, antenna performance is also observed for bending. Numerical modelling of tissue: As the proposed structure is designed for implantable application, and a numerical model for the heterogeneous body tissue layers is created. It has three layers: the innermost layer is muscle tissue with a thickness of 20 mm, the middle layer is fat tissue with a 5 mm thickness, and the top layer is skin tissue with a 2 mm thickness. The human body can have different thicknesses of tissues depending upon body type, body fat or mass index, and different organs. In our model, average values for tissue thickness are considered ,37. Elecr\u03b5 value of 10.2 and \u03b4 = 0.0022. The planar size of the structure is 10 mm \u00d7 10 mm, which is equivalent to (0.029 \u03bbo \u00d7 0.029 \u03bbo), where \u03bbo represents the free-space wavelength at 0.868 GHz (lowest resonance frequency). To use the antenna inside the body tissue, the radiator and ground are covered with the dielectric material layers (RO 3010). It insulates the conducting part of the antenna from lossy tissue layers and also contributes to lowering the resonance frequency. Design evaluation of the proposed structure for attaining wider bandwidth is explained in three steps. Antenna Geometry and Design Process: Configuration and geometry of the designed tri-band patch antenna is depicted in To facilitate a better understanding of how to determine the structure of antennas, we will introduce a mathematical model. This model incorporates Equations (1)\u2013(3), which represent the fundamental free space formulas. Furthermore, to analyze the impact of bio tissues, we have combined these equations with Equations (4)\u2013(7). The details are as follows:rf), resulting in an approximate value of 0.843 GHz, close to the simulated resonance frequency.To achieve a lower frequency of 0.86 GHz, we initially utilized a meandered patch to miniaturize the antenna. The meandered path was incorporated to increase the length of the radiator, thereby extending the electric current path and reducing the resonance frequency . Equatioc represents the speed of light, which is approximately 3 \u00d7 108 m/s. The length of the resonating path, denoted as W is the antenna dimension of meandered path and values are listed in In the aforementioned equations, the symbol Considering that the operating environment for the antenna is a complex heterogeneous medium, the dielectric constant of the antenna varies within the layered bio tissue phantom. To account for this, we calculate the equivalent dielectric constant of the antenna, which incorporates the substrate and bio layers. This calculation is carried out using Equations (4)\u2013(7).r\u03b51, r\u03b52, r\u03b53 and r\u03b54. Additionally, the parameters d1, d2, d3 and d4 represent the distances between the boundaries of each layer. These distances can be calculated using the methods described in references [n = 1, 2\u20264, representing number of substrate layers; w15 is the feed line width, w is the width of the antenna, and The relative permittivity of the antenna substrate and the tissue layers surrounding the antenna substrate are denoted as ferences ,40.(5)dS11| plot for the design steps is represented in S11| above 10 dB indicates the good impedance matching of the antenna, which makes the antenna efficient in terms of radiating the maximum power. S11 = 0 shows no power is radiated from the antenna. In the proposed design, S11 is above 0 at the resonance bands, making the antenna suitable in terms of radiating. To justify the step-wise impedance matching, the VSWR plot is shown in S11|, and VSWR.Further, in step1, an open-end slotted ground is used to improve the impedance matching. Thus, with the coupling between multiple slots of an asynchronous-meandered radiator and open-ended square loop-type ground, the multiple resonance bands are achieved in step1. The |s11| is above 10 due to good impedance matching, making the VSWR value less than two. It is studied from the literature that wider impedance bandwidth can be achieved by combining the resonance modes [fo is the fundamental resonance frequency at 0.8 GHz. In step1, the resonating modes are excited at fo = 0.8 GHz, 2fo = 1.6 GHz, 4fo =3.2 GHz, 5fo = 4.0 GHz, and 7fo = 5.6 GHz. Higher modes (4fo to 7fo) are in close proximity to each other and merged. Thus, wider impedance bandwidth from 3.03 GHz to 7.06 GHz is achieved.In the first step, three resonance frequencies with bandwidths of 130 MHz (0.81\u20130.94 GHz), 190 MHz (1.56\u20131.75 GHz) and 4.03 GHz (3.03\u20137.06 GHz) were attained. Over the resonance bandwidth |ce modes ,42,43. SIt can be found that the reflection coefficient values of the lowest and middle band are 15 dB and 17 dB, respectively. Also, as middle resonance band is not at the desired frequency (1427 MHz to 1432 MHz) for the WMTS band. According to the in-body application, it has been studied in the literature that antenna impedance reduces and frequency may detune due to complex multi-layered body tissue structures. Electrical properties and depth of different tissues vary from person to person as well as for different organs. Therefore, to avoid this issue in practical situations and to tune the middle resonance frequency, the structure is modified in step 2.In the second step, the length of the radiator is increased by adding a three-slot meandered element with the radiator to attain the resonance at the WMTS band. This modification has a significant impact on antenna performance. The middle band is tuned at desired range as well as the reflection coefficient value for the lower and middle bands also improved and shifted to 36 dB and 34 dB. It ensures the improvement of impedance matching. However, the upper UWB spectrum is not affected by this modification. Surface current distribution for step1 and step2 at 0.88 GHz and 1.46 GHz is shown in fo is excited at 2.7 GHz and merged with the resonance mode at 4fo; it widens the bandwidth toward a lower cut-off frequency of the upper band (|S11| plot of step3). In this way, the combination of various modes has contributed to the impedance bandwidth from 2.6 GHz to 6.3 GHz. The length of the parasitic resonator is optimized from both edges. Parametric analysis of the reflection coefficient for the lengths of the left and right edges is shown in In the third step, an inverted U-shaped parasitic resonator is placed around the radiator. Due to capacitive coupling between the radiator and parasitic resonator, the mode at 3S11| parameter above 0 dB in The significance of impedance matching by adding the parasitic resonator is shown in Consequently, a compact triple-band antenna via the embedment of open-ended square ring ground, parasitic resonator and meandered patch establishes the required features for biotelemetry systems.Furthermore, the surface current plot for various frequencies of the antenna is shown in To ensure the accuracy of the simulated results, an antenna prototype was fabricated, and its performance parameters were measured. The antenna was inserted into animal tissue for implant application, and images of the prototype and measurement setup can be found in In the numerical simulation, the antenna is placed within the muscle layer and is effectively isolated from the surrounding tissue by the dielectric layers positioned above and below it. Among the skin and fat tissues, the muscle layer possesses the maximum implant depth, highest dielectric constant (52.7), and conductivity (1.74 S/m). As a result, the muscle tissue has the most significant influence on the antenna\u2019s performance. To achieve a good agreement between the simulated and measured results, pork was employed as it exhibits tissue-equivalent properties. This choice of material enhances the alignment between the simulated and measured outcomes. It is worth noting that variations in simulation and measurement setups have been observed in the existing literature ,14,22,26x-axis, as shown in In order to analyze the stability of antenna performance against the shape of the implant tissue, the antenna is deployed in the skin layer of the cylindrical phantom and numerically simulated; further, the antenna is also bent along the For all of the operating conditions, the antenna has covered the bandwidth for various valuable communication standards, including ISM bands , WMTS band (1427\u20131432 MHz), and interference-free subset of the unlicensed 3.5\u20134.5 GHz ultra-wideband (UWB), as well as Wi-Fi frequencies at 3.6/4.9/5/5.9/6 GHz. These findings demonstrate the potential of the antenna for a wide range of communication applications.The performance of an antenna designed for in-body communication must be carefully evaluated to ensure reliable communication links and avoid any harmful effects on body tissues. One key factor in determining the effectiveness of such an antenna is its radiation pattern. To this end, When the antenna is placed below the skin layer in the cylindrical phantom and bent across the radius of 30 mm, both the gain and efficiency reduce. The middle band has the maximum deviation of 1.67% in efficiency and 9 dB in gain. These values provide important information for determining the overall performance of the antenna and its suitability for various communication applications.In sum, the proposed antenna exhibits a radiation pattern that is well-suited for in-body communication applications and is validated through both experimental and numerical simulations. The gain and radiation efficiency plots provide further evidence of the antenna\u2019s effectiveness across different frequencies. These findings represent a significant contribution to the development of implantable devices and pave the way for further advancements in this field.The specific absorption rate is a safety parameter used to measure the amount of heat absorbed by the tissue. The IEEE Std C95.1-1999 sets a SAR limit of 1.6 W/Kg over 1 g of tissue. x-axis at the radius of 30 mm. This analysis confirms the reliability of using the antenna inside different body organs. The antenna shows stable resonance frequencies with a slight reductions in bandwidth at the upper band. Gain and efficiency parameters are also stable over the entire bandwidth.3) and widest bandwidth . It also has the highest gain  compared to other antennas in the literature. In addition, the SAR values for the proposed antenna are well below the safety limits prescribed by IEEE Std C95.1-1999, with SAR values of 0.409 W/Kg for 0.8 GHz, 0.534 W/Kg for 1.43 GHz, 0.529 W/Kg for 3.5 GHz, and 0.665 W/Kg for 5.5 GHz when the applied input power is 10 mW. Overall, the proposed antenna in this study demonstrates superior performance compared to existing tri-band implantable antennas in terms of size, bandwidth, gain, and SAR values.Finally, 3 and the widest bandwidth of 181.8% for 0.86 GHz, 9.58% for 1.43 GHz, and 285.7% for the UWB subset and Wi-Fi. It also has the highest gain, with values of \u221226 dBi for ISM, \u221214 dBi for WMTS, and \u221214.2 dBi for the UWB subset and Wi-Fi. Furthermore, the SAR values of the proposed antenna are well within the safety limits prescribed by IEEE Std C95.1-1999, with SAR values of 0.409 W/Kg for 0.8 GHz, 0.534 W/Kg for 1.43 GHz, 0.529 W/Kg for 3.5 GHz, and 0.665 W/Kg for 5.5 GHz when the applied input power is 10 mW. Overall, this antenna demonstrates superior performance in terms of size, bandwidth, gain, structural deformation, and SAR values, making it a promising candidate for implantable medical devices.This study presented a compact and efficient implantable antenna operating at triple bands. The proposed antenna employs a combination of a multi-open-end slotted meandered radiator, a parasitic patch, and a square ring-shaped ground to excite multiple resonant modes for various biotelemetry applications. The proposed antenna in this study has several notable advantages over other antennas in the literature. It has the smallest volume of 75 mm"}
{"text": "Millimeter wave (mm-Wave) wireless communication systems require high gain antennas to overcome path loss effects and thereby enhance system coverage. This paper presents the design and analysis of an antenna array for high gain performance of future mm-wave 5G communication systems. The proposed antenna is based on planar microstrip technology and fabricated on 0.254\u00a0mm thick dielectric substrate (Rogers-5880) having a relative permittivity of 2.2 and loss tangent of 0.0009. The single radiating element used to construct the antenna array is a microstrip patch that has a configuration resembling a two-pronged fork. The single radiator has a realized gain of 7.6 dBi. To achieve the gain required by 5G base stations, a 64-element array antenna design is proposed which has a bore side gain of 21.2 dBi at 37.2\u00a0GHz. The 8\u2009\u00d7\u20098, 8\u2009\u00d7\u200916, and 8\u2009\u00d7\u200932 antenna array designs described here were simulated and optimized using CST Microwave Studio, which is a 3D full-wave electromagnetic solver. The overall characteristics of the array in terms of reflection-coefficient and radiation patterns makes the proposed design suitable for mm-Wave 5G and other communication systems. At the present the overflow of data has primarily been attributed to streaming video but the emergence of new unforeseen applications like holographic tv will introduce even more demand on bandwidth2. To support good user experience, the 5G network will also have to reach unique levels of flexibility and intelligence; spectrum regulation will need to be reviewed and enhanced, energy and cost efficiencies will become even more serious concerns4.The fifth generation (5G) technology standard for broadband cellular networks is needed to accommodate the exponential growth in the wireless data traffic driven by the proliferation of smart devices and live streaming. With advancement in technology, it is anticipated that the 5G wireless system will need to cope with a huge amount of data traffic resulting from high-resolution video streaming, tactile Internet, IoT based remote monitoring, real-time control applications and connected devices and vehicles. Billions of devices will be connected to the global IP network which will be a challenge and will require a lot of bandwidth5. The prominent frequency bands for the 5G mm-Wave based cellular communication are 24\u201328\u00a0GHz, 37\u201340\u00a0GHz, and 64\u201371\u00a0GHz7. This will inevitably raise new challenges10 including the free space path loss and hardware impairments. The amount of array gain required to compensate free space path loss becomes higher with the increase in frequency and the impact of atmospheric absorption due to carbon dioxide, oxygen and rain/fog/snow attenuation will impact significantly on service coverage compared to existing broadband mobile systems. Consequently, the number of antennas required needs to be increased. This increases the associated electronics with each antenna elements making the overall array very expensive compared to its lower frequency counterpart11.The current 5G wireless communication system is not equipped to meet this explosive growth in traffic demand hence the need for 5G systems to operate at millimeter-waves to acquire much larger bandwidth to accommodate the intense data traffic. The frequency bands below 20\u00a0GHz are highly congested, so a shift to higher part of the frequency spectrum is inevitable16. At this frequency band the atmospheric losses are effectively minimal17. This should to some extent ease the design of 5G mm-Wave systems to achieve specifications of high bandwidth and data rate requirements. Reported in5 is an antenna operating at 38\u00a0GHz, i.e., one of the 5G, which could handle the atmospheric attenuations challenge at mm-wave transmission. The peak gain of the antenna is 10 dBi. An array antenna comprising four elements is reported in12 which operates at the 38\u00a0GHz band. This antenna array is shown to have a gain of greater than 12 dBi, which is sufficient for the 5G mobile systems. Similarly, the antenna presented in13 operates over the 5G mm-Wave band, i.e., 37\u201340\u00a0GHz. The array configuration exhibits gain of up to 12 dBi. Antenna array in14 covering the 37\u201339\u00a0GHz band has a maximum gain of 8.81 dBi. The concept of metasurface would be helpful for the design of base station antennas operating over 5G mm-Wave spectrum17. Metasurface is used to enhance the antenna\u2019s performances in18 but the maximum gain is limited to 8.91 dBi. The antenna presented in19 can cover the band from 37.1 to 38.1\u00a0GHz, but no gain enhancement is implemented to handle the atmosphere attenuations challenge. Likewise, an array structure is implemented in24 for the similar antenna element presented in18 to improve the gain. But still, maximum gain of nearly 12 dBi is achieved which is not sufficient for base station communication. Thus, the antenna element design presented in24 is considered in this work to develop such an array structure which could provide enough gain for the base station communication.A lot of work has been done recently in developing antennas for 5G wireless systems covering the frequency band 37\u201340\u00a0GHzThe antennas mentioned above are dedicated for the 5G mobile devices but cannot be adopted for base station applications because of their low gain. Consequently, in this work, we propose a novel antenna array suitable for 5G mm-wave base station applications. Each radiating structure in the antenna array consists of a 2\u2009\u00d7\u20092 array. This configuration is used to boost the overall gain of the array at the mm-wave band. The gain of the proposed 8\u2009\u00d7\u200932 antenna array is more than 20 dBi at 37.2\u00a0GHz, which is suitable for application in future 5G mm-Wave base stations.24. This antenna configuration was chosen for its impedance matching characteristic compared to the conventional rectangular patch antenna24. However, it has a smaller effective aperture size than a conventional rectangular patch antenna operating at the same center frequency and hence a lower gain. The antenna was designed to resonate at 37.2\u00a0GHz. The antenna is constructed on a Rogers 5880 dielectric substrate with a relative permittivity of 2.2, a thickness of 0.254\u00a0mm, and loss tangent of 0.0009. The size of the substrate used is 10\u2009\u00d7\u20096 mm2. The dimensions of the antenna are listed in Table The geometry of the antenna used in the design the 5G mm-Wave arrays, i.e., 8\u2009\u00d7\u20098, 8\u2009\u00d7\u200916, and 8\u2009\u00d7\u200932, is shown in Fig.\u00a02.The proposed antenna was used to implement an 8\u2009\u00d7\u20098 antenna array, shown in Fig.\u00a02. The dimensions of the 8\u2009\u00d7\u20098 array is given in Table The 8\u2009\u00d7\u20098 array was extended to 8\u2009\u00d7\u200916 array, which consisted of 32 antenna elements. This was achieved by using a power divider to split the input signal into two equal phase output signals that are applied to the two 8\u2009\u00d7\u20098 array, as shown in Fig.\u00a02. The dimensions of the F-parameters annotated in Fig.\u00a0The 8\u2009\u00d7\u200916 array was extended to 8\u2009\u00d7\u200932 array using the above principles, as shown in Fig.\u00a02 however this increases to 30\u2009\u00d7\u2009110 mm2 for a 8\u2009\u00d7\u200932 array. The 8\u2009\u00d7\u200932 operates at the 5G mm-Wave band. The fabricated prototype of the 8\u2009\u00d7\u200932 array is shown in Fig.\u00a0The simulated reflection coefficient of the single element antenna and the three antenna arrays, i.e., 8\u2009\u00d7\u20098, 8\u2009\u00d7\u200916 and 8\u2009\u00d7\u200932, are shown in Fig.\u00a0The radiation patterns of the proposed antenna and the three arrays of different matrix size using the antenn are compared in Fig.\u00a021 a dual band 5G multiple input multiple output (MIMO) antenna is reported that operates at 28\u00a0GHz and 38\u00a0GHz. The sub-array in21 consists of four gap-coupled microstrip slotted dual band patch antennas with corporate microstrip feed network. This sub-array exhibits a realized gain of 12 dBi at 28\u00a0GHz and 13\u00a0dB at 38\u00a0GHz. The antenna array in22 is based on stacked square ring patch arrangement. This antenna has a sharp roll-off and a filter like response between the operating bands due to the strongly coupled resonators. The antenna operates from 24.25 to 29.5\u00a0GHz and 37 to 40\u00a0GHz. This antenna array has a realized gain of between 5 and 6 dBi. In23 the authors have created an antenna array by stacking multiple split-ring resonators that interact with each other via aperture coupling. This antenna array operates from 24.25 to 29.5\u00a0GHz and has a realized gain between 5 to 6 dBi.Over recent years numerous mm-wave antenna array designs have been investigated. Table 24 consists of a two-antenna array combination where each antenna array consists of four elements which are arranged orthogonally with respect to each other. The antenna array has a gain of 12.8 dBi at 37\u00a0GHz. The 29\u00a0GHz magneto electric (ME) dipole array in26 is realized by the method of connecting and cutting patches. In27 a printed ridge gap waveguide 4\u2009\u00d7\u20094 Butler matrix is shown to operate over the frequency range from 26.9 to 33.3\u00a0GHz with gain variation from 10.2 to 11.35 dBi. The array element in the broadband end-fire antenna in28 consists of a horizontally oriented printed electric dipole and a vertically aligned tapered slot radiator, where the two orthogonal radiated electric-field components are excited simultaneously. A parasitic director is introduced near the printed dipole to compensate for the gain degradation of the dipole element at higher frequencies.The MIMO antenna array in29 the 8\u2009\u00d7\u20098 antenna array consists of a block of metallic array antenna sitting directly on the top surface of a printed circuit board (pcb) with electrical connections between them. The metallic array antenna is a metallic structure with 64 units of antenna radiating elements surrounded by a ring of metallic wall. The pcb provides the feeding mechanism for all 64 units of antenna radiating elements on the metallic array antenna. This antenna has a gain of 23.95 dBi at 26\u00a0GHz. The 8\u2009\u00d7\u20098 element antenna array reported in30 uses a stacked multilayered pcb. It uses 16 commercial quad-core transmitter and receiver integrated circuits to independently control the phase and amplitude at each radiating element. The array designed at 39\u00a0GHz frequency band has a gain of 22 dBi. Reported in31 is an 8\u2009\u00d7\u20098 aperture-coupled microstrip patch antenna array. It constructed from two substrate layers that are separated with an air gap. The patch antenna on the top layer is excited through a ground slot implemented on the top of the bottom substrate layer with a feedline on the bottom layer. This array is designed to operate over the 22\u201327\u00a0GHz frequency band with 22 dBi gain.In32. The 8\u2009\u00d7\u200932 antenna array in32 consists of a square patch antenna designed to operate at 35\u00a0GHz. The antenna array is reported to have a gain of 25.7 dBi. Although the gain in32 is higher than the proposed 8\u2009\u00d7\u200932 antenna array however it has a much larger size by a factor of 3.6.The work reported on 8\u2009\u00d7\u200932 patch antenna arrays is scarce however the authors managed to find one paperResults presented in the paper show the feasibility of a novel patch antenna configuration in the design of high-gain antenna arrays for application in future 5G mm-Wave base stations. The gain provided by the proposed singular antenna is 7.6 dBi. Although, this gain is suitable for mobile communication devices but it is not sufficient to overcome path loss and atmospheric loss experienced my millimeter wave signals at the 5G base station. Hence, a 64-element array antenna was implemented using the proposed antenna. This antenna array is shown to have a bore side gain of 21.2 dBi at 37.2\u00a0GHz, an angular width of 4.1 degrees and side lobe levels less than \u2212\u200910\u00a0dB. This antenna has a significantly smaller form factor than 8\u2009\u00d7\u200932 antenna array reported to date.All of the figures, materials, and data within the manuscript are original and owned by authors."}
{"text": "As the Internet of Things (IOT) becomes more widely used in our everyday lives, an increasing number of wireless communication devices are required, meaning that an increasing number of signals are transmitted and received through antennas. Thus, the performance of antennas plays an important role in IOT applications, and increasing the efficiency of antenna design has become a crucial topic. Antenna designers have often optimized antennas by using an EM simulation tool. Although this method is feasible, a great deal of time is often spent on designing the antenna. To improve the efficiency of antenna optimization, this paper proposes a design of experiments (DOE) method for antenna optimization. The antenna length and area in each direction were the experimental parameters, and the response variables were antenna gain and return loss. Response surface methodology was used to obtain optimal parameters for the layout of the antenna. Finally, we utilized antenna simulation software to verify the optimal parameters for antenna optimization, showing how the DOE method can increase the efficiency of antenna optimization. The antenna optimized by DOE was implemented, and its measured results show that the antenna gain and return loss were 2.65 dBi and 11.2 dB, respectively. In IOT applications, many wireless communication modules are used. The antenna is a wireless communication module and an essential circuit component. Antenna characteristics are directly related to circuit applications and application scenarios, and therefore, antennas often must be customized. Consequently, antenna design efficiency has a direct relationship with the time to market of a product and thus is highly influential in product development.To increase the efficiency of antenna design, extensive research has been conducted on antenna synthesis and design optimization. GA and the method of moments were used to design a broadband patch antenna, increasing the antenna by 20% . In anotChen and Ku  stated tIn this study, a design of experiments (DOE) method is proposed to improve the efficiency of antenna optimization. Some layout parameters of the patch antenna are analyzed with RSM to optimize antenna gain and input return loss performances. The results show that the estimation of antenna performance with DOE to optimize an antenna is more efficient than optimization with the EM simulation tool. Performance of the antenna optimized by DOE was evaluated, and the measured results show that the antenna gain and return loss were 2.65 dBi and 11.2 dB, respectively.This research focused on the gain of a patch antenna. The aim was to shorten the time spent developing the antenna. We used the experimental design method to identify crucial factors and determine the scope of their influence, and thus find the optimal factor configuration and gain value so that the reflection loss is less than \u221210 dB. We then used antenna simulation software to verify the results. Traditionally, antenna design has involved using computer-aided engineering simulation software and the finite element method to simulate the electromagnetic field, and the characteristics of the radiation field of the designed antenna are then obtained. However, this method is excessively time-consuming, reducing the efficiency of antenna design. To shorten the development time and increase efficiency, this study (i) used a systematic experimental design method to determine the important factors and the scope of their influence, in addition to performing factor programming experiments, (ii) used RSM to determine the optimal factor combination, and (iii) employed antenna simulation software to verify that the identified combination of factors is optimal.In an antenna, radio waves begin at the internal feed. They then pass through the conductor between the chip and ground excitation from the radio frequency electromagnetic field, and then proceed through the patch around the ground surface and the gap to the outside. The size of the conductor and ground surface can be adjusted to achieve the target resonant frequency band.Rectangular metal radiation surface: located in the top layer in the middle of the rectangle, it sends and receives signals.Insulating substrate: located in the middle layer, it consists of insulation material with a dielectric constant of 4.4 .Ground metal surface: located in the bottom layer; for copper, the area must be larger than the rectangular metal surface.Coaxial probe: a small round coaxial conductor, where the metal surface is connected to the ground and the internal surface is connected to the metal surface. This feed is within the volume of the feed surface, and the energy through the feed surface flows into the antenna.Shorting pins: usually connected to two media, they may gain but contribute to an increase in bandwidth.A microstrip antenna is situated in a thin substrate with a thin layer of metal as a ground surface. Photolithography corrosion can be used to shape the metal patch, which acts as a radiating surface, and then a microstrip line with a coaxial probe is used for the patch feed. Microstrip antennas can be circular, rectangular, or ring-shaped. This study used a rectangular microstrip antenna, with the following characteristics :RectanguTwo antenna design parameters we used as the design parameters for optimization of antenna gain and reflection loss.Antenna gain can be used to measure the antenna\u2019s directivity, which refers to the capacity of the antenna to transmit signals in a specified direction. Usually, the greater the effective area of the antenna is, the higher is the gain. Gain is measured in dBi units.Reflection loss concerns the feedback component of the feedback signal. The antenna reflection loss should be as small as possible, and at least \u221210 db. The smaller the reflection loss is, the greater is the signal input, and thus, the greater the radiation power.The Advanced Design System  was used for antenna design simulation . KeysighMinitab 18 statistical software was used to execute the experimental design using RSM. RSM supplements the prediction model by combining mathematical and statistical methods so that the experimental area can be adjusted according to the experimental scope to determine the ideal response value.First, we determine the variables that are influential to the system, and then we select an appropriate level as the initial value of the experiment. A two-level factorial experiment is performed initially. Many parameters often must be considered in the design of an antenna, and the responses are usually affected by the main effect and low-order interaction. A two-factor interaction is therefore appropriate for the model . The forWhere If the first-order regression model is appropriate, the steepest ascent method is used to search an area where the optimal response value should be located. The purpose of this method is to search for the best point.At this point, the curvature of the real response surface increases, which means that the first-order model of the best solution can no longer be applied and the second-order model must be used. In general, the central composite design (CCD) is employed as the second-order model because it is very efficient.For the CCD, a k-factor experiment with a  example . After aAfter accepting the second-order regression model, we can begin the analysis using RSM. The second-order function can be represented by the matrix shown in Formula (3) to identify the stationary point. The stationary point may be the maximum, minimum, or saddle point. According to the extreme theorem, if the solution of function (4) at the extreme value of the differential is 0, we can obtain Formula (5). If the characteristic root is negative, the stationary point has the maximum value; if it is positive, the stationary point has the minimum value; otherwise, the stationary point is the saddle point:iy is converted to the desirability function di, where 0 \u2264 id \u2264 1. When the response value iy reaches the target, di is equal to 1. If it exceeds the acceptable area, then id is equal to 0. The overall desirability function is D = /m1, where m is the number of responses, iy.RSM often involves multiple response values; therefore, the desirability function can be used to obtain multiple response optimizations. The desirability function can identify the best objective function of a single response value through mathematical transformation based on the upper and lower bounds of the response variable and its target value . Each reThe next section describes the application of the antenna design. Factor experiments were performed to conduct the initial fitting, and RSM was employed to identify the stationary point. Finally, the response value was optimized to find the optimal combination of parameters.The shape of the antenna is shown in 6-1) were performed.The first experimental measurement was based on the current size of the antenna, and we defined the maximum range within which the factors can increase or decrease as the upper and lower limits of two levels. These are shown in Minitab 18 statistical software was used to conduct the regression analysis, in conjunction with backward elimination. First, all antenna design parameters were entered into the regression model. The smallest explanatory antenna design parameters were then excluded until all significant changes were removed.In the preliminary experiments on the gain model, factor A was deleted from the model, indicating that this was not a significant factor in terms of gain. Additionally, we tested the RL model. No factor was deleted; therefore, every factor was significant in this regression model.To find the optimal combination of antenna design parameters, main-effect graphs were drawn. The main effects of the six factors on gain were identified. Factor A was not significant; factor B, D, E, and F were the smaller the better, and factor C was the larger the better. Regarding the main effects on RL, factors B, D, and E were the larger the better, whereas factors C and F exhibited no significant effects.The preceding analysis indicates that factors B, D, and E exhibited opposite trends with regard to gain and RL responses. Factor C was the larger the better for gain, but for RL, it exhibited no significant trend. Conversely, factor F was the smaller the better for gain, but for RL, it exhibited no significant trend. These results were employed as benchmarks that enabled us to adjust the factorial range in subsequent experiments.Because the preliminary experiment was not ideal, we adjusted several factors and their ranges for the second trial, as shown in We used background elimination to conduct the regression analysis. We found that all factors were significant in the model for gain. The R-sq was 66%, indicating that the model was appropriate. The formula is presented as follows:All factors were significant in the model of RL. The R-sq was 93.21%, indicating that the model was appropriate. The formula is presented as follows:The objective of this study was to maximize gain and reduce RL to less than \u221210 dB. Therefore, in the response optimizer in MINITAB, the target of gain was set as the maximum, and the target of RL was set as the minimum. The target was to achieve maximum gain with an RL less than \u221210. Using Minitab 18 statistical software, we found that the overall desirability function of the prediction model was 0.9271, the desirability function for gain was 0.87864, and that for RL was 0.97823. According to the model, the optimal response values are a gain of 10.6203 and an RL of \u221227.0495. In these conditions, factor A is 4.5, factor B is \u22121.5, factor D is \u22120.4, factor E is \u22120.1, factor C is fixed at 0.9, and factor F is fixed at \u22122.4.Minitab18 was then used to generate a set of feasible solutions in order to determine the values for practical needs. Antenna simulation software was used to verify this set of data, and the results in Using the ADS electromagnetic field simulation software for analysis, the antenna reflection loss and gain characteristics were obtained. As shown by the dotted lines in Based on the optimized design of the antenna structure shown in The AMS-8600 antenna measurement system was used to measure the gain performance of the antenna, The findings of this study show how the experimental design method works to increase the effectiveness of antenna design. Using Minitab 18 statistical software, the ideal characteristics of the antenna were identified by setting the target of gain as the maximum and the target of reflection loss as the minimum. The results were then verified using software for antenna simulation, and the fabrication and measurement of the antenna provided additional confirmation. The simulation results and the measured reflection coefficient and gain agreed very closely, proving the accuracy of the optimization technique. Even though parasitic effects caused the measured gain to deviate slightly from the simulation, the results still offer important information about the antenna\u2019s functionality. Overall, the method described in this study can be used to design different kinds of antennas, offering a useful and effective way to maximize antenna performance.In this paper, we propose a method for improving the efficiency of antenna design. Using the experimental design method, which involved setting the size of the antenna and the antenna design parameters, we quickly determined the optimal characteristics of the antenna, and then demonstrated the feasibility of this method using simulation software. In this research, an E-type plate antenna was used as an example, and the antenna was designed at 5.8 GHz. The measured reflection coefficient was 11.2 dB and the measured gain was 2.65 dBi. This method can therefore be applied to antenna design to improve efficiency."}
{"text": "This article presents an ultra-wideband (UWB) monopole antenna with triple band notch characteristics. The proposed antenna consists of an octagonal patch, fed with a 50 \u03a9 line, which occupies a compact size of 40 mm \u00d7 29 mm  and resonances at a relatively low frequency (2.94 GHz). Specifically, an L-shaped stub, an inverted C-shaped slot, and a pair of U-shaped resonating structures are introduced into the design, which allow antenna to generate three band notches at 3.22\u20133.83 GHz, 4.49\u20135.05 GHz and 7.49\u20138.02 GHz, corresponding to WiMAX band, Indian national satellite (INSAT) band, and X-band satellite frequencies, respectively. In the center of the notched band, the antenna has lower efficiency and gain, essentially indicating that the antenna has good interference rejection performance. To evaluate its performance, the proposed antenna has been fabricated and measured, and the relevant functional parameters, such as S-parameters, voltage standing wave ratio (VSWR) and radiation property, have been studied. Ultra-wideband (UWB) technology has great potential for application in wireless communication because of its extremely low transmission power and high data rate . In receOver the years, researchers have proposed various methods to design the band-notched UWB antennas ,10,11,12The following are the novel discoveries and contributions of this work:1. The controllable triple-notch frequencies are achieved at the WiMAX, INSAT and X-band satellite frequency bands.2. The proposed antenna integrates multiple forms of notch structures with different shapes and techniques.In this work, a planar UWB monopole antenna is designed, fabricated and tested. The dimensions of the stub and slot are varied to achieve the desired stopband center frequency. Furthermore, three different band-notched designs are provided for illustration, along with a description of the design concept. Lastly, the details of antenna measurement and simulation results are presented, which demonstrate a successful band-rejection capability for all three proposed band-notched designs. Above all, the proposed antenna can be a potential option for specific devices operating in WiFi 6E band.r = 4.4) with a thickness of 1.6 mm. Moreover, a 50 \u03a9 microstrip-line was fed by an SMA connector. The geometry and configuration of the proposed antenna have been designed and optimized using HFSS 18.0, as shown in The proposed antenna is fabricated on a common and low-cost FR4 substrate Qi=fiThe details of all the stages of the design evolution process are given below:Step-1 includes an octagonal radiation element with a rectangular ground structure a. This af + Lp + L1 \u2212 Ws. Here, L-shaped stub acts as an open-circuit transmission line that shorts the antenna at the relevant frequency. Thus, the effective transmission path of current is changed [Step-2 introduces an L-shaped stub at the upper left corner of the octagonal patch b. The di changed , causingBased on the design of step-2, an inverted C-shaped slot is etched onto the center of the octagonal patch, which defines step-3 c. At cerThe specifics of the rejection bands for the design of each stage have been listed in c is the speed of light, f is the notched center frequency, eff\u03b5 is the effective dielectric constant.An approximate size of the notch structure can be assumed as :(4)L=c2fNext, a transverse U-shaped resonator is placed symmetrically on both sides of the feed line to shield the antenna from X-band system interference, which is step-4 d. Here, s, the corresponding notched band becomes smaller, while the operational band remains unchanged. Similarly, by adjusting the size of inverted C-shaped slot opening, the entire second notch band can be shifted from a low frequency to a high frequency. Moreover, as the L3 increases, the range of the notch band becomes wider and the center frequency of the notch band shifts down. The dimension of Lf effects the phase of the antenna, while L1 and W1 determine the area of the radiation patch. When they increase or decrease, the resonant frequency shifts significantly in the range of 5.2\u22127.4 GHz and 8.1\u221211.0 GHz. Accordingly, it can be concluded that, with the proposed design approach, the notched frequency bands can be easily achieved and controlled to meet the practical requirements by merely adjusting the dimensions and locations of the resonating elements. Meanwhile, it is worthwhile noting that changing the parameters of resonators (notch elements) affects only the notch bands, and the return loss in the rest of the UWB frequency band remains virtually unchanged.Next, the effects of different geometrical parameters of the proposed antenna on the band notch characteristics are studied, as portrayed in To validate the proposed antenna design, an ultra-wideband antenna was successfully fabricated and tested according to the dimensions listed in Furthermore, radiation patterns are plotted in In this work, a compact planar monopole ultra-wideband antenna with anti-interference characteristics has been presented for UWB applications. Interestingly, the proposed antenna provides a wide impedance bandwidth, ranging from 2.70 GHz to 11.06 GHz. In addition, there was a discussion of three rejection bands around 3.22~3.83, 4.49~5.05 and 7.18~7.84 GHz for the applications of the WiMAX, INSAT and X-band. These were created by introducing an L-shaped stub in the radiation patch, a pair of U-shaped parasitic elements beside the feed line, and an etched inverted C-shaped slot. Additionally, the designed antenna had a simple structure and easy fabrication process. The antenna also possessed an acceptable peak gain and efficiency, demonstrating that the proposed antenna was certainly applicable in miniaturized devices for the the operation of UWB communication systems."}
{"text": "S11 \u2264 \u221210 dB was achieved by regulating the radiator and the partial ground that was placed on the second side of the antenna substrate. The CP was achieved when excited two modes with the same amplitude and a 90\u00b0 phase difference. This could be generated by regulating the slots\u2019 dimensions in the ground plane. Moreover, a quadrilateral-shaped parasitic strip placed on the second side with the partial ground was utilized to extend the 3 dB axial ratio (AR) bandwidth. The suggested structure is simulated, prototyped, and measured to confirm the desired requirements with a total size of 30 \u00d7 32 mm2 (0.4 \u00d7 0.42 \u03bb0 at 4 GHz). The tested outcomes have a bandwidth of S11 \u2264 \u221210 dB (81.25%)  and a 3 dB axial ratio (AR) bandwidth (30.7%) . The antenna\u2019s different parameters are discussed, which recommend the suggested antenna to be used in UWB, sub 6 GHz, and WLAN wireless applications.A circularly polarized (CP) and wide-band monopole antenna with a miniaturized size is suggested in this study. The suggested structure is composed of a U-shaped radiator on the front side, a partial ground plane with two rectangle slots, and a quadrilateral-shaped parasitic strip on the back side of the FR4 substrate. A wide-band operation with  Recently, wireless communication systems of a small and compact size that operate in a wide-band operation need compact and wide-band antennas that can be easily integrated with them ,2. CP anIn modern wireless systems, for example, wide-band circular polarization (CP) antennas, radio frequency identification (RFID), and global positioning systems (GPSs) are recommended and utilized. Recently, wireless systems have been operated at different frequency bands. Therefore, wide-band CP antennas are considered a good choice to reduce the system\u2019s complexity and price ,7,8. MicMicrostrip antennas have several advantages, such as low price, simple design, small size, ease of integration, and simplicity in CP realization. Therefore, the microstrip antenna is used in several communication systems. However, conventional CP antennas are produced with a small 3 dB axial ratio with a large size, which cannot be suitable for wide-band systems ,10. For 2 and peak gain of 3.6 dB. Additionally, the ground plane is modified to increase the 3 dB AR bandwidth to 53.92% from 4.28 to 7.44 GHz. The antenna has a simple structure with a wide-band 3 dB AR bandwidth and is utilized for WLAN communication.In , a paras2 and a peak gain of 11.2 dB. Additionally, the antenna has a 3 dB AR bandwidth from 1.5 to 7.5 GHz (133.33%). While the AR in [The UWB CP operation generated using a sequential phase feed is investigated in . It is c2 and a peak gain of 6.55 dB. Additionally, the ground plane is modified to increase the 3 dB AR bandwidth to 104.7% from 2.05 to 6.55 GHz. The antenna has a simple structure with a wide-band 3 dB AR bandwidth and is utilized for WLAN communication; however, it has a large size.In , a broad2 and a peak gain of 2.2 dB. The antenna has a simple structure with a narrow 3 dB AR from 1.572 to 1.578 GHz (0.4%). The antenna has a narrow band of 3 dB AR bandwidth with a large size. A 3D with complex structure microstrip antenna is introduced in [2 and a peak gain of 4.3 dB. The antenna has a 3 dB AR bandwidth of 3%. The antenna has a complex structure with a large size.A microstrip antenna utilizing a fractal-defected ground structure is discussed in . The antduced in . An L-sh2. The antenna has a peak gain of 7.2 dB. Additionally, the antenna has a 3 dB AR bandwidth of 27.5% from 4.55 to 6 GHz. The antenna has a complex structure and it is utilized for WLAN communication. A slot antenna with a CPW feed is introduced in [2 and a peak gain of 3.8 dB. Additionally, the antenna has a 3 dB AR bandwidth of 58.6% from 2.85 to 5.21 GHz. The antenna has a simple structure with a large size and it is utilized for WLAN communication.In , a microduced in . The ant2 and a peak gain of 4.8 dB. Additionally, it has a 3 dB AR bandwidth of 4% from 4.25 to 5.95 GHz. The antenna has a simple structure with a large size and works for wireless communication. Parasitic strips are investigated in [2 and a peak gain of 2.9 dB. Additionally, it has a 3 dB AR bandwidth of 4% from 2.25 to 2.35 GHz. The antenna has a simple structure with a large size and works for satellite communication.Moreover, some modifications are utilized in the monopole antenna to increase the 3 dB AR bandwidth. Lumped capacitors are used in . An invegated in ,18. A Y-gated in . The ant2 and a peak gain of 2.45 dB. Additionally, it has a 3 dB AR bandwidth of 32% from 1.42 to 1.97 GHz. The antenna has a simple structure with a large size and works for satellite communication. A parasitic open-loop resonator is added to a rectangular monopole antenna to generate the CP operation. The antenna is operated from 1.48 to 4.24 GHz (96.5%). The 1 mm FR4 substrate is utilized in the design. The antenna has a size of 50 \u00d7 55 mm2 and a peak gain of 3.5 dB. Additionally, the ground plane is modified to increase the 3 dB AR bandwidth to 63.3% from 2.05 to 3.95 GHz. The antenna has a simple structure with a wideband 3 dB AR bandwidth and a large size.A slot antenna with an L-shape is suggested in . An L-sh11 \u2264 \u221210 dB (81.25%)  and a 3 dB axial ratio (AR) bandwidth (30.7%) . The designed antenna keeps the same features as a common turnstile antenna, such as simplicity, low cost, compact, low profile, and broadband CP antenna. All simulated results are extracted utilizing CST software. The suggested antenna can be used in UWB, sub 6 GHz, and WLAN wireless applications.A wide-band CP antenna is introduced in this work. A U-shaped radiator on the front side, a partial ground plane with two rectangle slots, and a quadrilateral-shaped parasitic strip on the back side are utilized to produce the CP feature. The CP is achieved when we excited two modes with the same amplitude and a 90\u00b0 phase difference. This can be generated by regulating the slot\u2019s dimensions and adding a quadrilateral-shaped parasitic strip to the ground plane. The tested outcomes have a bandwidth of SThe paper is organized as follows: (I) The literature review is introduced. (II) The configuration of the antenna is investigated. (III) The simulation and measurement outcomes are provided. (IV) The conclusion is presented.3 and \u03b5r = 4.4, tan \u03b4 = 0.025 was used as a substrate. The suggested antenna was connected to a 50 \u2126 microstrip feed line with an optimal position to enhance the matching of the antenna. An L-shaped connected to a C-shaped mirror to compose a suggested U-shaped radiator was added to the front side. Moreover, a partial ground plane with two rectangle slots and a quadrilateral-shaped parasitic strip was added to the back side of the substrate. The two rectangle slots were cut from the edge of the ground plane to achieve CP modes at high frequencies. The wide CP generation was achieved by adding a quadrilateral strip to the bottom of the substrate, as illustrated in The proposed wide-band CP monopole antenna with the complete geometrical configuration is shown in The suggested structure was passed through four stages to achieve the desired final design. The four-step antenna design procedure is illustrated in The CP radiation can be obtained by achieving two orthogonal modes with equal amplitudes and a 90\u00b0 phase difference. However, the conventional monopole antenna, as shown in Finally, in Ant. #4, the back side of the structure was added with a quadrilateral shape, as shown in The CP generation behavior could be understood by displaying the antenna distribution current at different orthogonal phases at 5.8 GHz, as presented in L4 on the antenna\u2019s performance. By increasing the length of L4 from 1.45 to 7.45 mm, the antenna was operated from 4 to 9 GHz with a good impedance bandwidth as shown in L4 = 1.45 mm, the 3 dB AR bandwidth was extended from 4.48 to 4.8 GHz. Additionally, when L4 = 4.45 mm, the 3 dB AR bandwidth was extended from 4.48 to 6.11 GHz. Finally; when L4 = 7.45 mm, the 3 dB AR bandwidth was extended from 4.7 to 5.5 GHz. The length of L4 was chosen to be 4.45 mm.From the previous section, it can be noticed that the dimension of the quadrilateral-shaped strip can affect the 3 dB AR. Therefore, a parametric study was utilized to show its effect. L4 = 4.45, the antenna was operated from 4 to 9 GHz with a good impedance bandwidth as illustrated in W6 = 2 mm, the 3 dB AR bandwidth was extended from 4.48 to 6 GHz. Moreover, when W6 = 2.5 mm, the 3 dB AR bandwidth was extended from 4.48 to 6.11 GHz. Finally, when W6 = 3 mm, the 3 dB AR bandwidth was extended from 4.48 to 5 GHz and from 5.6 to 6.2 GHz. The length of W6 was chosen to be 2.5 mm. Finally, by elaborating on the parametric study outcomes, the final dimensions achieved the desired bandwidth from 4 to 9 GHz and satisfied the 3 dB AR bandwidth from 4.48 to 6.11 GHz.Furthermore, 3, and \u03b5r = 4.4, tan \u03b4 = 0.025 were used in the fabrication. Additionally, it was tested using a vector network analyzer (R&S ZVA 67) to show the reflection coefficient S11, as shown in S11 \u2264 \u221210 dB, while the simulated outcomes illustrate that the antenna is operated from 4 to 9 GHz. The two results display good matching between them, with some slight deviations between them due to the fabrication tolerance and SMA soldering process.The photolithography method was utilized in the fabrication process. xz (\u03c6 = 0\u00b0) and yz (\u03c6 = 90\u00b0) planes. The co- and cross-polarization results at 5.5 and 5.8 GHz are shown in The setup of the far-field results was conducted inside an anechoic chamber, as illustrated in The gain of the antenna was measured, as illustrated in Finally, the suggested design was compared with others to evaluate the novelty of the work, as presented in 0 at 4 GHz).A miniaturized size and wide-band CP monopole antenna was suggested, fabricated, and tested. The suggested antenna was 30 mm \u00d7 32 mm  and an AR bandwidth of 30.7% . Based on the achieved outcomes, it can be suggested that the antenna is considered a good choice for several wireless systems, such as UWB, sub 6 GHz, and WLAN applications.A U-shaped radiator on the front side, a partial ground plane with two rectangle slots, and a quadrilateral-shaped parasitic strip on the back side were utilized to produce the CP feature. The CP was achieved when we excited two modes with the same amplitude and a 90\u00b0 phase difference. This could be generated by regulating the slot\u2019s dimensions and adding a quadrilateral-shaped parasitic strip to the ground plane. The antenna\u2019s different parameters were discussed and investigated. The tested outcomes had a bandwidth of"}
{"text": "This paper presents novel approaches for reducing the mass of the classical short backfire (SBF) antenna by using additive manufacturing and structural perforations. We first investigated techniques to create a 3D-printed structure with a conductive coating material. This approach resulted in a significant mass reduction (70%) compared with the conventional metallic structure. We performed parametric simulation studies to investigate the effects of the manufacturing process and showed that there was practically no difference in the performance. The largest source of error was the surface roughness and the conductivity of the metal paint. In a second design, we created perforations in the structure to further reduce the mass. We performed parametric studies to optimize mass reduction and to characterize the effects of the perforations and the surface roughness introduced during the 3D-printing process on the antenna. Antenna prototypes were fabricated and tested. The masses of the perforated 3D printed antenna were approximately 30% and 20% of the original aluminum design, respectively . The good agreement among the original design, simulation, and measurements demonstrated the effectiveness of the approach. In caseeflector . Drones Traditional SBF, reflector, and horn antennas can range from 500 g  to 8 kg The first approach to reducing the SBF antenna\u2019s mass involved fabricating the antenna using additive manufacturing techniques, also known as 3D printing. Over the last few years, antenna and electromagnetic constructions have been printed using various 3D-printing methods, including photonic polymerization, stereo lithography, micro stereo lithography, Polyjet printing, and fused deposition modeling (FDM). Each technique provides advantages and disadvantages that are best suited to producing various types of antennas. For instance, the FDM technique, which extrudes filament materials from a heated nozzle, is typically the most affordable 3D-printing process while also offering the advantages of a large selection of filaments and the ability to print with many materials at once. Laser or UV light is used in the stereolithography (SLA) and polymerization technique to cure resin components into the desired 3D shape. Therefore, they can attain a resolution significantly higher than that of FDM, making them suitable for producing smaller structures. Because the materials used in these printers are essentially a light-curable resin, they cannot be altered to the same degree as FDM filaments .For most metallic antennas, such as the SBF antenna, a conductive surface is usually required to interface with the input port. Poor conductors, which are suitable for 3D printed electrical circuits, are not appropriate for antenna applications since the losses negatively influence radiation efficiency. To fabricate metallic antennas, specialist metal 3D printers that can directly print metallic materials such as aluminum, steel, titanium, and cobalt through direct metal laser sintering (DMLS) provide a good option ,10. An aThe perforation technique is another method used for the weight reduction of reflector and horn antennas. This technique has been achieved in the literature by either creating holes/slots in the antenna ,14,15,16The work presented in this paper aims to reduce the weight of SBF antennas while meeting the operation specifications of a C-band remote sensing system. This is done by implementing an improved aluminum SBF antenna prototype using the 3D-printing technique in the first candidate design. The perforation technique was applied to the second antenna to further reduce the overall weight. A simulation study was completed to characterize the performance, and a prototype was fabricated using a 3D printer to verify the concepts.The proposed SBF antenna designs are based on the improved SBF antenna presented in  and show0 = 54.54 mm in free space. The antenna is expected to have a minimum impedance bandwidth of 500 MHz and a minimum gain of 14 dBi within the frequency band of operation to perform efficiently. In this study, the antennas presented were designed to weigh less than 50% of the aluminum prototype.Based on previous research on conventional reflector antennas, we looked for ways to reduce the mass of the SBF antenna by using lighter materials, such as thermoplastics, for the design process. Designing with thermoplastic cannot be easily done when using conventional milling fabrication and often requires a 3D-printing fabrication process. Polylactic acid (PLA) and acrylonitrile butadiene styrene (ABS) were used as the 3D printer filaments for building the antenna prototypes presented in this manuscript because of their low cost and strong mechanical characteristics. The metal coating was applied using the aerosol spray technique with the MG Chemicals Super Shield nickel conductive coating and the MG Chemicals Super Shield Silver Conductive Paint. These methods and materials were chosen because of their cost-effective and fast application process. They have also been reported to produce excellent results .Because 3D printing is a layer-by-layer process, surface roughness is introduced and can be detrimental to the performance of high-frequency antennas. Consequently, it is crucial to simulate the effects of different surface roughness values on the performance of the SBF antenna. The body of the antenna was modeled in HFSS using a material with a relative permittivity of 2.8 and a loss tangent of 0.005 to roughly approximate the properties of the ABS plastic for the simulation of the 3D-printed SBF antenna. . To simu11 results of the aluminum and the 3D-printed prototype for SR values of 0.6 \u03a9/sq, 3 \u03a9/sq, and 10 \u03a9/sq. From this figure, we can see that the impedance bandwidth of the SBF antenna increased with the surface resistance. The 10 dB impedance bandwidth of the aluminum was calculated to be 1.8 GHz (37.5%), while those of the 3D-printed antenna were 1.84 GHz (38.5%), 1.86 GHz (39%), and 1.92 GHz (40%) for SR values of 0.6 \u03a9/sq, 3 \u03a9/sq, and 10 \u03a9/sq, respectively. This increase in impedance bandwidth with increasing roughness is supported by the equations given in [Surface impedance increases with surface roughness while decreasing with the metal layer\u2019s conductivity and thickness . Given tgiven in , showingThe peak realized gain results were calculated for several surface impedance values. The summary of the results is given in The simulated worst-case cross-polarization ratio curves for the aluminum and 3D-printed antenna designs are given in 11); on the other hand, the gain decreased as the surface roughness and resistance increased. It was, therefore, important to keep it as low as possible by polishing the antenna before metallization and using a highly conductive metal spray. Comparing the weight of the ABS plastic (1.0 g/cm3) to that of the aluminum metal (2.7 g/cm3), the greatest advantage of the 3D-printing fabrication process compared to the conventional method is a 70% reduction in mass.In this section, the effects of surface roughness and resistance on the performance of the 3D-printed SBF antenna are studied and compared with the performance of the aluminum SBF antenna. We noticed that the increased surface roughness and resistance introduced by the 3D-printing and metallization processes did not have a significant effect on the reflection coefficient (S0 = 54.54 mm) in order to achieve weight reduction. Because the diameter of the holes is less than \u03bb0, the transmitted EM wave does not radiate from these holes; hence, they do not significantly affect the performance of the antenna. Numerical analysis of the unperforated SBF antenna was implemented using HFSS (ANSYS Electronics Desktop 2021 R2\u00a9) in the previous section. An interesting phenomenon observed during the analysis was that most of the current density was concentrated in the main reflector, while the rim had a much lower current density. By taking advantage of this current distribution, portions of the rim were removed without disturbing the performance.The perforation technique is a relatively simple concept that involves purposefully creating a series of sub-wavelength slots in the antenna, meaning that the slots are significantly smaller than the antenna\u2019s wavelength  were simulated to investigate their effects on the performance of the antenna, such as those on the gain, impedance bandwidth, and cross-polarization ratio.A plot of the peak gain and the impedance bandwidth as a function of the radius of perforation at an operating frequency of 5.5 GHz is given in 11 result for the perforated antenna (radius = 1 mm to 5 mm) is compared with that of the unperforated antenna in The SSimulation studies on the perforated SBF antenna showed that increasing the size of the perforations minimally decreased the impedance bandwidth. This was because of the surface current redistribution and impedance change around the waveguide aperture caused by the discontinuities introduced by the perforations. The peak gain at 5.5 GHz stayed almost the same for increasing perforation size, which is what was expected for perforation sizes that were significantly smaller than one wavelength. The gain of the antenna did not significantly change because the current distributions at the upper rim and aperture were not substantially affected. Consequently, the radiation pattern was not drastically changed either. As a result of the higher current density associated with this design, it was important to reduce the surface resistance caused by the 3D-printing and metallization processes to avoid extreme gain loss. Compared to the unperforated prototype, the removal of portions of the antenna\u2019s rim in addition to the use of lightweight plastics for fabrication resulted in an 80% overall reduction in the antenna\u2019s mass.The simulated E-plane and H-plane radiation patterns (\u03b8 = \u2212180\u2013180\u00b0) for the unperforated, nickel-coated, and silver-coated perforated SBF antennas are given in The Airwolf Axiom 3D printer was used to fabricate the 3D-printed prototypes at the University of Manitoba\u2019s machine shop. The 3D-printing technique used fused deposition modeling (FDM). To make sure that the antenna was operating at optimum performance, the first post-processing step involved polishing the surface of the 3D-printed antenna by sanding it. Since the plastic was not conductive, the last step involved metallizing the model using a conductive metal spray paint. The entire antenna surface was covered by several layers of paint to achieve a good conductive and reflective surface.3) was used as the thermoplastic filament. After the antenna was printed, it was sprayed by hand using the MG Chemicals Super Shield Nickel Conductive Coating. The thickness of the metal coating was measured to be approximately 0.3 mm, which was much thicker than the skin depth of nickel at 5.5 GHz (0.07246 \u03bcm). A piece of foam material (30 mm thick) with an approximate dielectric constant of 1.05 was placed inside the main reflector cavity to position the sub-reflector at the required height. The fabricated solid 3D-printed antenna is shown in 11) of the 3D-printed antennas were measured using a Keysight PNA Network Analyzer (N5224B), and the measured far-field results were obtained in the Compact Antenna Test Range of the University of Manitoba. The S11 performance measurement of the waveguide adaptor (WR-159) was found to have complex impedances for frequencies below 5.2 GHz, which resulted in multiple oscillations that resulted in characteristic differences between the simulation and measurements , two copper tape strips were adhered to the aperture of the waveguide. This improved the impedance match by creating an inductive iris, and this approach was also applied to the 3D-printed antenna to obtain a similar result. The measured S11 plots for the aluminum SBF antenna and the simulated and measured S11 results for the solid 3D-printed prototype are provided in 11 results of the aluminum and the solid 3D-printed SBF antennas; the measured impedance bandwidths were 1.35 GHz (27.3%) and 1.38 GHz (27.7%), respectively.The measured dimensions for both the unperforated and perforated 3D printed antennas have been provided in The simulated and measured radiation pattern results for the 3D-printed SBF antenna are shown in Comparing the measured peak gain for the 3D-printed SBF antenna (15 dBi) to that of the aluminum prototype, which was measured to be 15.7 dB ,26,27. H\u22126 \u2126\u00b7m) and superior EMI/RFI shielding, two perforated SBF antenna prototypes were 3D printed. The fabricated perforated 3D-printed SBF antennas are shown in For the fabrication of the perforated SBF antenna, a perforation radius of 4.5 mm was used. The PLA thermoplastic filament was the preferred material for the perforated antenna, as printing with ABS plastic resulted in many deformities and much stringing around the perforated areas. Stringing occurs when tiny plastic strings are left on a 3D-printed model. This happens mostly when the extruder temperature is too high, since it can cause the filament to overheat and ooze out of the nozzle. In the case of an ABS filament that has a higher melting point of 200 \u00b0C, this can be particularly problematic. To reduce the stringing problem, PLA with a lower melting point of 173 \u00b0C was used, and it produced a better finish. We also decided to compare the performance of two different metal paints: silver (Ag) and nickel (Ni) conductive paints. To compare the performance of the nickel conductive paint with the silver conductive paint with a lower resistivity (1.2 \u00d7 1011) results for both the nickel- and silver-coated protypes are given in 11 values for the nickel and silver prototypes were obtained using SR values of 1 \u03a9/sq and 0.1 \u03a9/sq, respectively. The measured S11 values of the nickel-coated and silver antennas were in very close agreement, as they had the same impedance bandwidth of 1.52 GHz (31.5%). This showed that using the silver paint instead of the nickel paint did not significantly affect the reflection coefficient of the perforated SBF antenna.The two antenna prototypes were connected to the waveguide feed and measured using the network analyzer. The measured and simulated  was fabricated. The simulated and measured results of the 3D-printed antenna were in close agreement with the results of the aluminum prototype for both S11 and radiation patterns. There was a 0.7 dB drop in the measured gain for the 3D-printed antenna compared to the aluminum prototype. This gain loss can be attributed to surface roughness and the lower conductivity of the metal coating. Employing the additive manufacturing technique in the design of the SBF antenna led to a significant reduction in the weight of approximately 70%.To further reduce the mass of the antenna, holes were introduced into the 3D-printed SBF antenna structure, resulting in a perforated SBF antenna design. From the simulation studies, we observed that the performance of the antenna did not change significantly with perforations that were much smaller than a wavelength. Two prototypes of this design were fabricated and coated using silver and nickel metal paints to compare their performances. The antennas were tested, and all performance metrics were achieved at 5.5 GHz. The silver paint was found to increase the gain of the perforated SBF antenna from 14.1 dBi (gain obtained for the nickel coating) to 15.2 dBi (1.1 dB increase in gain). While the silver paint increased the gain of the antenna, the financial cost was about 10 times the cost of the nickel paint for the same quantity. Therefore, the nickel paint was more cost effective than the silver paint. According to the results obtained, using both the perforation and 3D-printing techniques reduced the mass of the antenna by 80% while still meeting the design requirements, with a minimal gain loss of 0.5 dB .In future work, we aim to address the surface roughness issues by using LiDAR to measure and evaluate the precise surface roughness values of the 3D-printed surface and investigate the use of chemicals such as acetone for polishing the antenna. We also plan to conduct more research on advanced metallization techniques such as electroplating and jet metal processing. By reducing the surface roughness introduced by the 3D-printing process and obtaining uniform and precise metal deposition, we hope to further improve the gain of the 3D-printed antenna and get the performance as close as possible to that of the aluminum prototype. We also plan to carry out more optimization studies on the perforated antenna design, such as optimally packing the circular holes in a lattice-type structure and investigating combinations of multiple perforation sizes."}
{"text": "This paper presents a multiple-input-multiple-output (MIMO) antenna array with low-profile and flexible characteristics. Multiple microstrip patches are arranged in the E-plane configuration and decoupled by shorted quarter-wavelength stubs. The antenna has a small element spacing of 0.032 \u03bb, where \u03bb is a free-space wavelength at the center frequency. To demonstrate the feasibility of the proposed concept, a 1 \u00d7 4 MIMO array prototype is fabricated. The measured results on the fabricated prototype demonstrate that the MIMO antenna has good operation features at 4.8 GHz with a reflection coefficient of less than \u201310 dB and an isolation of better than 20 dB. Besides, good radiation patterns and broadside gain of around 4.5 dBi are also attained. The antenna also works in the bending mode and has the capability of extending to large-scale MIMO arrays. Such attractive features prove the utility of the proposed antenna in various modern electronic devices. Multiple-input-multiple-output (MIMO) antenna has achieved extensive research as an effective solution for 5G wireless communication services since it can increase the channel capacity without additional spectrum and alleviate the multipath fading problem , 2. AmonThere are various decoupling structures reported in the literature for mutual coupling reduction. They can be roughly divided into four categories. The first type is the counteraction scheme, which creates additional coupling paths between the MIMO elements to counteract the original coupling paths. This can be achieved with the aid of neutralization lines , 6, paraIt is worth noting that although high isolation can be achieved, most of the above-mentioned MIMO antennas are not suitable for flexible wireless systems, which are rapidly increasing. Nowadays, flexible antennas are in great demand for on-body and off-body communication, wearable sensing systems, radio frequency identification (RFID), and wireless body area networks (WBAN) , 22. TheIn this paper, a low-profile and flexible MIMO antenna is presented for operation at the N79-5G frequency band. The MIMO array consists of multiple microstrip patch elements arranged in the E-plane configuration. For mutual coupling reduction, the shorted quarter-wavelength stubs are inserted between the radiating patches. This contributes to producing a perpendicular mode on the non-exited element, rather than a similar operating mode as the excited element. The antenna is first designed and investigated with a two-element array. Then, further increment in the number of MIMO elements is considered. Finally, a four-element MIMO antenna array is fabricated and tested to validate the design concept. The measurements demonstrate the capability of working in both normal and bending modes of the proposed antenna. In comparison with the reported decoupling networks for microstrip patch antenna, the proposed decoupling structure has several advantages including high isolation improvement with small element spacing, applicable for multi-element MIMO array as well as its flexible capability.\u03a9 SMA connectors are connected to the patches. To suppress the mutual coupling, a quarter-wavelength shorted stub is located between the MIMO elements. The antenna is designed on the ROGER-5880 substrate with a dielectric constant of 2.2. The optimized dimensions are as follows: Ls = 80, Ws = 60, H = 0.5, Lp = 20.3, Wp = 20.6, lf = 3.6, d = 2.0, rv = 0.2, l = 12.0, w = 0.8 (unit: mm).Assume that there are two antennas working in transmitting and receiving modes . If the TM01 is the dominant mode on the non-excited patch. Accordingly, the MIMO array with the shorted stub will perform better isolation than the other. A further demonstration can be observed in According to this theory, the mutual coupling in the MIMO system can be suppressed if the MIMO elements work in orthogonal modes. The optimization process of the proposed 2-element MIMO antenna can be divided into three main steps: operating frequency, impedance matching, and isolation. In general, these performance characteristics can be controlled independently.First of all, the resonance frequency of the proposed MIMO antenna can be controlled by tuning the length of the microstrip patch, Lp. Next, the matching performance is considered. The simulated S-parameter results for different values of lf are illustrated in l and rv. It can be seen that the effect of these parameters on the matching performance is minor. The |S11| resonance is stable around 4.8 GHz. In contrast, the isolation value is considerably affected. In the |S21| profile, the lowest |S21| peak shifts downwards with the increase of l and the decrease of rv. With proper values of l and rv, the isolation at 4.8 GHz will achieve the best performance.Finally, the isolation optimization is investigated. Figs Various decoupling structures have been reported for patch antenna arrays. However, these proposals are merely capable of alleviating mutual coupling between two adjacent elements. They might not work with multiple-port MIMO systems. In view of this point, a four-element patch array is further designed to demonstrate the decoupling capacity of the proposed decoupling structure in the MIMO patch antenna.According to the investigation on 2- and 4-element MIMO antenna, the design procedure for an arbitrary N-element MIMO array can be summarized as follows:Step 0: Choose the proper substrate materials that are thin and flexible.Two microstrip patches are arranged in the E-plane coupled configuration;Lp) is chosen about half-effective wavelength at the desired frequency band;The length of the patch (lf) is within the patch (lf < Lp/2);The feeding position  as the decoupling network is positioned between the MIMO elements;The ground stub . For the far-field test, when one port is excited, the other is terminated with a 50-\u03a9 load. As observed, the simulated and measured gain values are almost similar. The antenna has a maximum gain of 4.7 dBi within the operating band from 4.75 to 4.83 GHz. The radiation patterns at 4.8 GHz of the proposed antenna are plotted in Due to the symmetrical antenna geometry, the far-field performances are only characterized by Port-1 excitation. i, j are port numbers, and R, T are the reflection and transmission coefficients. \u03a9 is the solid angle of the far-field radiation patterns The MIMO performances of the proposed MIMO array are evaluated through several important parameters including the envelope correlation coefficient (ECC) and the diversity gain (DG). The ECC and DG are calculated based on the S-parameter Eqs The comprehensive comparison among microstrip patch MIMO antenna arrays is summarized and given in The proposed MIMO antenna is modeled on the thin substrate, the proposed antennas are expected to work effectively when mounting on curved surfaces. For measurement shown in The measured S-parameter results of the fabricated MIMO array in bending conditions are presented in This paper presents a flexible MIMO antenna array with multiple ports. An array of microstrip patch antennas are arranged in the E-plane configuration with edge-to-edge element spacing of 0.032\u03bb. In order to suppress the mutual coupling, shorted quarter-wavelength stubs are positioned between the MIMO elements. A 1 \u00d7 4 MIMO array prototype is fabricated and tested to validate the feasibility of the proposed concept. The measured operating BW of about 1.6% with isolation of greater than 15 dB. At the center frequency of 4.8 GHz, the isolations among MIMO elements are always better than 20 dB. The MIMO array has also been demonstrated to work effectively in the bending mode. The proposed antenna can be a potential candidate in various modern electronic devices working in the 4.8 GHz N79-5G frequency band."}
{"text": "Hence, in total, the design incorporates four pairs of horizontally and vertically polarized resonators. The elements have compact profiles and resonate at 3.6\u00a0GHz, the main candidate bands of the sub-6\u00a0GHz 5G spectrum. In addition, despite the absence of decoupling structures, adjacent elements demonstrate high isolation. To the best of the authors\u2019 knowledge, it is the first type of smartphone antenna design using dual-polarized self-complementary antennas that could possess anti-interference and diversity properties. In addition to exhibiting desirable radiation coverage, the presented smartphone antenna also supports dual polarizations on different sides of the printed circuit board (PCB). It also exhibits good isolation, high-gain patterns, improved radiation coverage, low ECC/TARC, and sufficient channel capacity. The introduced antenna design was manufactured on a standard smartphone board and its main characteristics were experimentally measured. Simulations and measurement results are generally in good agreement with each other. Moreover, the presented antenna system delivers low SAR with adequate efficiency when it comes to the appearance of the user. Hence, the design could be adapted to 5G hand-portable devices. As an additional feature, a new ultra-compact phased array millimeter-wave antenna with super-wide bandwidth and end-fire radiation is being introduced for integration into the MIMO antenna systems. As a result, the proposed antenna system design with improved radiation and multi-standard operation is a good candidate for future multi-mode 5G cellular applications.This paper introduces a multi-input multiple-output (MIMO) antenna array system that provides improved radiation diversity for multi-standard/multi-mode 5G communications. The introduced MIMO design contains four pairs of miniaturized self-complementary antennas (SCAs) fed by pairs of independently coupled structures which are symmetrically located at the edge corners of the smartphone mainboard with an overall size of 75\u2009\u00d7\u2009150 (mm In order to acquire the main themes of 5G networks, MIMO systems with an increased number of radiation elements must be considered for future wireless networks3. MIMO technology with multiple antennas can significantly amend the reliability function5. It has been extensively used in 4G LTE and is expected to be widely used in 5G. MIMO technology not only can significantly improve the system reliability but also increase channel capacity without requiring extra power at both the transmitter and receiver ends7. The use of diversity schemes in MIMO antenna configuration is also considered to be a crucial component of combating fading and enhancing the reliability of wireless links by sending the same signals with uncorrelated antennas8.The current generation (4G) wireless cellular systems are unable to meet future wireless communications requirements for high data rates. For these reasons, the 5th generation (5G) of wireless communications or mobile networks has been developed to address these challenges. It offers a variety of enhanced services for the internet of things (IoT), machine-to-machine (M2M), mobile broadband, massive MIMO, and ultra-reliable communications10. In addition, due to the limited available space on these devices such as smartphone boards, low-cost and compact planar microstrip antennas are an appropriate choice for cellular applications11. For sub 6 GHz 5G applications There have been many developments in smartphone antennas in recent years21. However, either these antenna arrays use resonators with single polarization, or they take up significant space on the mainboard. As smartphone PCBs are restricted in terms of antenna size, self-complementary antennas (SCAs) could be suitable for use in antennas, due to their compact size, simple structure, and ease of integration23. In addition, the SCA results in the geometry remaining unchanged when the metal and slot spaces are switched in a planar antenna24. We present here a new eight-port/four-antenna antenna array with miniaturized SCA radiators. In the single-element, the dual-polarized radiator has a self-complimentary structure and has been fed by independent coupled coaxial probes. The elements are highly miniaturized and resonate at 3.6 GHz. CST software package is used to design the antenna system25. Several unique characteristics distinguish this antenna from those reported in the literature, such as good isolation, high-gain patterns, excellent radiation coverage, low ECC/TARC, and sufficient channel capacity. Additionally, the proposed MIMO design is implemented, and its characteristics are analyzed. In order to verify the accuracy of the designed antenna performance, measurement results were carried out and the results were compared to electromagnetic simulations. Detailed descriptions of the double-fed SC resonator design and its array design are given.In hand-portable smart devices, high-efficiency and low-profile antennas that offer sufficient bandwidth and mutual coupling characteristics are very suitable26. In MM-Wave communications, phased array antennas with beam-steerable radiations are highly desirable since they enhance the radiation and connectivity of the systems. For smartphones, compact antennas can be used to form a linear phased array with high gain and directional radiation beams on the edges of the PCBs28. Moreover, end-fire antennas are more suitable for achieving the required full radiation coverage than conventional antennas, such as patch, slot, or monopole antennas29. Therefore, in addition to the proposed 3.6 GHz MIMO antenna, we have proposed a new mm-wave antenna package to operate at MM-Wave frequencies. The array consists of eight loop resonators arranged in a linear pattern, which can easily be integrated into smartphone antennas. The following sections present the design details, single-element performance, fundamental characteristics of the MIMO antenna system, and the suggested MM-Wave phased array, respectively.Apart from sub 6 GHz frequencies, the MM-Wave spectrum is also expected to be supported by 5G smartphones2. Figure\u00a02: its parameters (in mm) are listed in Table Figure\u00a0The double-fed antenna element is depicted in Fig. 30. The antenna configuration is flexible and different feeding techniques such as aperture coupling, microstrip line, and coaxial feedings can be applied. However, based on simulations, the employed feeding technique, which combines the coaxial and coupling feeds, offers a better performance in terms of impedance matching, bandwidth, and isolation. Moreover, since the elements are placed at the corners, the employed feeding technique is more appropriate to reduce the occupied space in the mainboard31.Figure L2). The S11 results of the dual-polarized SCA with various sizes of L2 are shown in Fig. 11 results of the SCA with various values of Lf are represented in Fig. 11 results of changing substrate thickness (h): increasing the substrate thickness allows good impedance matching with a wider bandwidth. The proposed design has also the potential to be used for 4G applications. The S-parameters for different types of substrates are shown in Fig. 32. A prototype antenna has been fabricated and tested. The fabricated sample and its measured S parameters are shown in Fig. The frequency response of the SCA can be easily changed and tuned to the desired band, by changing the design parameters. An important parameter to consider relates to the arm of the petal-ring structure  at 3.6\u00a0GHz. In addition, as shown in Fig.\u00a0nm). Based on the simulation, sufficient efficiency properties were obtained, as shown in Fig.\u00a0The S-parameters for the antenna array shown in Fig.\u00a034. To have a better view, an illustration of the radiation patterns and gain values of the elements are given in Fig.\u00a035. Therefore, the MIMO array design could be robust to the various holding positions of 5G smartphones.The broadside radiations of a single-element radiator with different polarizations are plotted in Fig.\u00a0nn/Smn): well-defined results are obtained for SCA resonators. Additionally, the measurements are in good agreement with the simulations, indicating sufficient\u2009\u2212\u200910\u00a0dB bandwidth and low couplings. A very slight variation was observed, possibly due to the errors in prototyping, feeding of antennas, and experimental setup. In addition, the S21 characteristics differ slightly from single antennas because of the large ground plane of the main design.A prototype of the proposed MIMO design has been developed and tested. The photos of the prototype sample (front/back layers with connectors) are shown in Fig.\u00a0As the antenna pair\u2019s performances were identical, radiations from the adjacent SCA radiators (Antennas 1 and 2) at 3.6\u00a0GHz were measured and plotted in Fig.\u00a036. It is worth mentioning that these parameters have been computed using the below formula:ECC (envelope correlation coefficient) and TARC  properties of the presented array are examined in order to verify its capability in MIMO operation and considered in the following37. In addition, for further investigation of the MIMO performance across the band of interest, the computed channel capacity (CC) is also studied38. The CCL and CC are defined as follows:scale is the channel matrix.Figures\u00a0Figures 39. Based on the results shown, the proposed antenna design exhibits adequate performance. A careful investigation reveals that the resonators partially surrounded by the hand phantom suffer the greatest radiation losses. In most cases, this is due to the nature of the tissue, since it usually absorbs radiation power41. The specific absorption rate (SAR) distribution for the elements (including Antennas 3 and 7) is investigated and shown in Fig.\u00a0This Part of this study discusses the user effects as it pertains to antenna performance and SAR levels in appearances of hands and head phantoms. Figure\u00a0nn, reflection coefficient (S11 to S88) results of the MIMO smartphone array structure in the presence of various integrated components  are represented in Fig.\u00a0The SThe performance comparison between the introduced MIMO antenna and the reported design in the literature is represented in Table f\u2009=\u20098.7, Lf\u2009=\u20090.8, W1\u2009=\u20091, L1\u2009=\u20090.85, W2\u2009=\u20093, L2\u2009=\u20098, W3\u2009=\u20090.85, d\u2009=\u20090.6. The schematic for the modified design is shown in Fig.\u00a0nn and better than\u2009\u2212\u200910\u00a0dB Smn at 3.6\u00a0GHz, which is the 5G band. However, as seen in Fig.\u00a042.This section examines the performance of dual-polarized MIMO antennas with a full ground (GND). Modifying the configurations and increasing the sizes of dual-polarized patch radiators without complementary slots in the ground plane enables the proposed smartphone antenna to operate at 3.6\u00a0GHz. In this case, it is necessary to modify the parameter values of a single-element patch-ring resonator as follows (in mm): W\u2009=\u200914.5, L\u2009=\u200914.5, Wa\u2009\u00d7\u2009La which can be implemented in the same Rogers substrate material. The configuration of the single-element and its frequency bandwidth are shown in Fig.\u00a0nn (S11 to S88) and Smn (S21 to S81) have been provided in Fig.\u00a0In this section, a low-profile MM-Wave phased array with super wideband function is suggested to be incorporated in a shared board of the discussed MIMO smartphone antenna system. It contains eight end-fire loop resonators with a very compact size of WThe simulated efficiency results of the single element and the phased array are represented in Fig.\u00a0Figure\u00a043. Therefore, the suggested phased array can be used in various portable devices because of its numerous promising features, including highly miniaturized profile, super-wide bandwidth, well-defined end-fire radiation, wide beam steering capability, as well as sufficient efficiency/gain levels.The 3D radiation behaviour of the suggested phased array placed at the top and side edges of the smartphone mainboard with at 30\u00a0GHz are represented in Figs. An eight-resonator MIMO array design formed by employing dual-polarized/self-complementary structures is reported, at the 3.6 GHz 5G band. It is simply constructed on a smartphone board but meanwhile realizes satisfactory properties. Suitable input-impedance characteristics, mutual coupling, and diversity radiations are achieved. As compared with recently reported designs, the proposed smartphone antenna provides improved radiation coverage, less ECC/TARC results, and higher gain/efficiency characteristics. Additionally, it has a planar structure without any ohmic losses, making it an ideal candidate for 5G handheld devices. Meanwhile, the calculated channel capacity and its loss is about 40 and 0.5 bps/Hz for the desired frequency. Simulation and experimental results showed quite good agreement. By appropriately placing the proposed miniaturized resonators, high gain levels and pattern diversity can be achieved. Moreover, a new super-wideband/low-profile MM-wave phased array is suggested to be incorporated in a shared board of the smartphone antenna system. Its critical parameters  have been examined and sufficient results have been obtained. The suggested MIMO antenna systems can be used in multi-mode/multi-standard 5G cellular communications."}
{"text": "In this research, a multiband patch antenna design based on the superposition of multiple modes at the same resonant frequency is presented. The concept of the contribution of lower order modes (LOMs) with the higher order dominant modes (HODMs) is investigated using characteristic mode analysis (CMA). In order to provide similar broadside radiations in three bands, the radiating capability of the LOMs is enhanced in the resonant frequencies of HODMs. These HODMs when excited alone provide null in the broadside radiations of the antenna. Using a single feed, enhancement in the broadside radiations of the antenna is achieved with the superposition of multiple modes at the same resonant frequency. Based on the proposed concept two antennas have been designed and fabricated. The antenna provides stable and enhanced radiations. simulated and measured results are in good agreement. These antennas find application in many applications including communication systems, base station antennas, 5G communications, satellite communication etc. Modern communication devices need an antenna to be low-cost, multiband, and smaller in size. Various techniques to achieve multiband antenna operation have been reported in the literature, where additional modes within a band of interest are introduced by using: fractals10, split ring resonators5, U-slots, vias and varactor diodes14, use of dual-feed and more than one radiating element14, slot meandered patch15 and V-shaped antenna configuration16, mobile handset antennas18, metamaterial loaded antenna19, and slotted ground20. Patch antenna provides attributes of low cost, compactness, and conformability, making it a suitable candidate for modern antenna systems. However, the patch antenna suffers from the nulls in the radiations and grating lobes due to the undesired radiations offered by the higher order modes24, consequently making it very difficult to achieve desirable radiations in multiple bands of an antenna. Multiband and dual-band antennas with nulls in the radiations cannot be used in applications where broadside radiations are required in all bands26. To achieve broadside radiations in the second band, slots are incorporated along the radiating edges of the rectangular patch to perturb 21. A slight dip in the radiations of 24, is removed by introducing slots in22 which provided current perturbations, thereby making perturbed 27. Higher order 28. Patch and monopole modes in a shared aperture are also used to excite two modes for dual-band operation29.With the advent of modern wireless communication32. This attribute makes it an excellent antenna analysis tool to identify radiating modes inherent to the structure. Various efforts have been made by the researchers to design dual-band and triple-band antennas using characteristic mode analysis (CMA), including multiband MIMO antennas36, fractal shaped dual-band antenna37, U-slot loaded triple-band antenna13, loading triangular slot38, vias39 and metasurfaces39 to introduce additional modes within a band of interest.Lately, the theory of characteristic modes (TCM) gained popularity in solving antenna design problems. TCM provides complete information about radiating modes of an arbitrarily shaped PEC structure in the range of frequencies under consideration41 is based upon the removal of higher order modes (HOMs) using CMA to enhance antenna radiations. In40 an unwanted HOM is suppressed to enhance the realized gain of the antenna by using a metasurface in front of the antenna array, in41 suppression of HOMs is carried out by inserting vias and slots in the unit cells of a metasurface structure to improve performance of the antenna in terms of radiations. Nevertheless, very few publications are related to the pattern enhancement by manipulation of HOMs in CMA. To the author\u2019s knowledge, none of the published work is related to the suppression or contribution of LOMs along with DMs to enhance antenna radiations. This work presents the intentional excitation and superposition of multiple LOMs with the HODMs to remove radiation nulls in the higher bands. The significance of the LOMs is enhanced beyond their resonant frequencies, and the superposition of non-significant LOMs with the HODMs at the same frequency is carried out to enhance antenna radiations. It is found that the excitation of multiple modes at the same resonance provides more control over shaping the antenna\u2019s radiation characteristics. The proposed technique is applied to the Partial Koch fractal structure reported in42, which suffers from the null in the radiations in the second band. Current authors introduced pi-shaped slots on the surface of the structure as reported in43, however, perturbations produced by the slots only removed radiations nulls in the H-plane of the second band. To show the problem of radiation nulls, and provide the superiority of the proposed technique, a multiband antenna using the excitation of DMs in their respective bands is also presented.For the multiband antenna operation using CMA, multiple radiating characteristic modes (CMs) are required to be excited in the band of interest. The number of CMs is directly proportional to the size of a radiator; hence density of modes increases with the increase in frequency. The radiation patterns of an antenna are shaped by the radiations of DMs, consequently, for a multiband antenna with usable broadside radiations, dominant modes (DMs) within the band should provide usable radiations. Furthermore, coupling of undesired modes with the source also deteriorates the radiation performance of the antenna in higher bands. Some of the latest reported research work by Chen et al.32. Eigenvalue is given by:30, as given byTCM provides complete information about the resonant behavior and radiating mechanism of an arbitrary shaped conducting structure. Deep physical insight into the radiating mechanism is provided in terms of modal currents and parameters such as eigenvalue 31, represents the contribution of a mode to the total antenna radiations when an external source is applied, given by:13. Each mode at its resonant frequency contributes maximum towards the total current and radiations of the antenna and is called DM. The Resonant frequency of the mode is determined from the MS graph, a mode is resonant and called a DM at the MS peak. 31.29 are given by:Closeness of the modes to the resonant frequencies in the limit defined by CMA values Amount of the coupling of the mode to the source.MSentclass1pt{minimaExcitation of only DMs for multiband antenna operation. In this approach, only one mode is excited in each band, so the currents and radiations of the antenna are shaped only by DM in each respective band.Excitation and superposition of multiple modes at the same resonant frequency. In this approach, multiple modes are excited, therefore resultant antenna currents and radiations are the superposition of LOMs and DMs that are excited simultaneously at the same resonant frequency (superposition-based approach).A flowchart explaining both methodologies is also provided.To highlight the performance benefit of the proposed technique, we have presented the antenna design using the two techniques. The following two approaches are outlined in this section A flowchart for the procedure to design a multiband antenna with the excitation of DMs is provided in Fig. A flowchart for the proposed technique which uses the superposition of DMs and LOMs is provided in Fig. 42 provided in Fig. 43, moreover it provides a large number of modes within the band. Simulations are performed with patch, lossless substrate  are shown in Fig. In this section, a design procedure based on the superposition of multiple modes at the same resonant frequency is provided, and as design example two antennas are presented. Currents of LOMs are combined with the HODMs to remove the current nulls, and superposition of subsequent radiations to provide enhancement in broadside radiations of the antenna in the second and third bands is achieved. Feed point location is identified using currents of both LOMs and HODMs. Antennas are designed by using the procedure outlined in Fig. Table To improve antenna performance in the second band, the superposition of LOMs and DMs as provided in Table Similarly, to improve antenna performance in the third band, superposition of mode 1, 3 & 5 of Antenna 1(b) and mode 2, 4 & 5 of Antenna 2(b) is carried out at 5.10\u00a0GHz as shown in Fig. To reveal the radiating mechanism of the antenna with excitation of multiple modes at the same resonant frequency, parametric analysis of the Partial Koch antenna at different air gap heights Progression of the radiating behavior of LOMs with the increase in air gap heights 2D rectangular modal directivity comparison graph of Antenna 1(b) & Antenna 2(b) is provided in Fig. To excite the required modes simultaneously at the same resonant frequency, a high current density region that is common among all DMs and LOMs is chosen as the feed point, and CMA of the antenna with the source is carried out in the frequency range of 2\u20137 GHz. Simulations are performed with infinite ground plane conditions, the substrate used is lossless Rogers Duroid 5870 with permittivity of 2.33, the thickness of the substrate used is 1.5\u00a0mm, and an air gap of 4.5\u00a0mm is used between the substrate and ground plane, and coaxial probe is used. From the MWCs in Fig. Parametric analysis of Antenna 1(b) and Antenna 2(b) is performed with the same conditions as provided before. The analysis includes optimization of reflection coefficients of both antennas in three bands. Simulated reflection coefficients of Antenna 1(b) and Antenna 2(b) at different air gap heights Fabricated prototypes of Antenna 1(b) and Antenna 2(b), and measured reflection coefficients are provided in Fig. A comparison of simulated 2D normalized gain patterns of Antenna 1(a) Fig.  and AnteTo compare the proposed technique with the other methods, a performance comparison is provided in Table A procedure is proposed to design antenna using MC of LOMs at the resonant frequencies of HODMs for multiband antenna operation with improved radiation performance and control. The radiating capability of modes having poor radiations is enhanced beyond their resonance to shape the broadside radiations of antenna in multiple bands. The carefully chosen feed point is identified to excite desired modes with the required contributions. As a proof of concept, this technique is utilized to design a multiband patch antenna with stable and enhanced radiations. The concept is verified by achieving stable and enhanced radiations in all bands, also null in the radiations of the second and third bands is successfully removed. Close agreement is observed between simulated and measured results. The proposed procedure proves that multiband behavior with improved radiations can be achieved by properly using the MC of LOMs in the resonant frequencies of HODMs. Required results are achieved without any modifications in the structure of the patch or designing complex feed structure."}
{"text": "This article presents a quad-element MIMO antenna designed for multiband operation. The prototype of the design is fabricated and utilizes a vector network analyzer (VNA-AV3672D) to measure the S-parameters. The proposed antenna is capable of operating across three broad frequency bands: 3\u201315.5 GHz, encompassing the C band (4\u20138 GHz), X band (8\u201312.4 GHz), and a significant portion of the Ku band (12.4\u201315.5 GHz). Additionally, it covers two mm-wave bands, specifically 26.4\u201334.3 GHz and 36.1\u201348.9 GHz, which corresponds to 86% of the Ka-band (27\u201340 GHz). To enhance its performance, the design incorporates a partial ground plane and a top patch featuring a dual-sided reverse 3-stage stair and a straight stick symmetrically placed at the bottom. The introduction of a defected ground structure (DGS) on the ground plane serves to provide a wideband response. The DGS on the ground plane plays a crucial role in improving the electromagnetic interaction between the grounding surface and the top patch, contributing to the wideband characteristics of the antenna. The dimensions of the proposed MIMO antenna are 31.7 mm \u00d7 31.7 mm \u00d7 1.6 mm. Furthermore, the article delves into the assessment of various performance metrics related to antenna diversity, such as ECC, DG, TARC, MEG, CCL, and channel capacity, with corresponding values of 0.11, 8.87 dB, \u22126.6 dB, \u00b13 dB, 0.32 bits/sec/Hz, and 18.44 bits/sec/Hz, respectively. Additionally, the equivalent circuit analysis of the MIMO system is explored in the article. It\u2019s worth noting that the measured results exhibit a strong level of agreement with the simulated results, indicating the reliability of the proposed design. The MIMO antenna\u2019s ability to exhibit multiband response, good diversity performance, and consistent channel capacity across various frequency bands renders it highly suitable for integration into multi-band wireless devices. The developed MIMO system should be applicable on n77/n78/n79 5G NR (3.3\u20135 GHz); WLAN (4.9\u20135.725 GHz); Wi-Fi (5.15\u20135.85 GHz); LTE5537.5 (5.15\u20135.925 GHz); WiMAX (5.25\u20135.85 GHz); WLAN (5.725\u20135.875 GHz); long-distance radio telecommunication ; satellite, radar, space communications and terrestrial broadband ; and various satellite communications . Multiple input multiple output (MIMO) antenna technology is an indispensable option for wireless transmissions to meet more data needs and increase spectral efficiency. MIMO antenna configurations for 4G will also be an important system for enabling 5G . This 5 This article consists of three sections. The first section covers the details of antenna geometry. The second section covers the detailed analysis of different diversity characteristics parameters like ECC, DG, The proposed antenna element has a dual-side three-stage stair and a straight stick on the top of the stair. The partial ground plane has a small rectangle microstrip line just beneath the feed line. The introduction of a DGS on the ground plane serves to provide a wideband response. The DGS on the ground plane plays a crucial role in improving the electromagnetic interaction between the grounding surface and the top patch, contributing to the wideband characteristics of the antenna . This DGThe size of the single-element antenna is 14.7 mm \u00d7 12 mm \u00d7 1.6 mm. In this design, the following design variables are considered, which are \u201ca\u201d, \u201cb\u201d, \u201cc\u201d and \u201cd\u201d. For optimized performance of the antenna, the design variables a, b, c, and d are considered as 1.5 mm, 2.1 mm, 3 mm, and 2.3 mm, respectively. The top and bottom views of the proposed antenna element are shown in Furthermore, the conceptual equivalent circuit model for the proposed antenna was developed a. The inThe real (resistive part) and imaginary (reactance part) parts of the input impedance of the proposed MIMO antenna system are depicted in The optimized values of lumped components are shown in The developed MIMO system should be applicable on n77/n78/n79 5G NR (3.3\u20135 GHz); WLAN (4.9\u20135.725 GHz); Wi-Fi (5.15\u20135.85 GHz); LTE5537.5 (5.15\u20135.925 GHz); WiMAX (5.25\u20135.85 GHz); WLAN (5.725\u20135.875 GHz); long-distance radio telecommunication ; satellite, radar, space communications and terrestrial broadband ; and various satellite communications . As mm-wave has a high carrier frequency, the signal baud rate could carry more data, resulting in a high data rate (bits/s/Hz) and a reduction in the buffering time in delivering high-quality videos . The mm-The developed MIMO antenna covers a 37\u201340 GHz frequency band, which has been reported in ,35,36. TThe interfacial current distributions at a frequency of 11.1 GHz, 31.6 GHz, 37.8 GHz, and 46.7 GHz are illustrated in L is the perimeter of the patch. In this article, Considering the \u2018m\u2019 number of null points that exist over the perimeter of the patch, then the guided wavelength , 26.4\u201334.3 GHz (% bandwidth of 32.45), and 36.1\u201348.9 GHz (% bandwidth of 32.74). Over the entire frequency bands in OFB1, OFB2, and OFB3 the simulated minimum values of port isolation are 15.7 dB, 23.2 dB, and 23.2 dB, respectively; however, the measured minimum values of port isolation are 15 dB, 22 dB, and 22.3 dB, respectively. The simulated and measured S-parameter is depicted in i\u2019 is excited, and j\u2019 is excited. The solid angle is denoted by the symbol \u2126. The value of the ECC that is closest to zero implies that the MIMO antenna system has strong isolation and excellent diversity gain. Equation (5)  is used The degree of the improvement of the MIMO system is determined by diversity gain (DG). ECC can acquire the DG  calculatThe simulated and measured ECC and DG over the frequency bands OFB1, OFB2, and OFB3 are depicted in The simulated ECC and DG over the frequency bands OFB1, OFB2, and OFB3 are better than , , and , respectively, whereas the measured ECC and DG over the frequency bands OFB1, OFB2, and OFB3 are better than , , , respectively.XZ plane. At the frequency 11.1 GHz, 31.6 GHz, 37.8 GHz, and 46.7 GHz, the co-polar major lobe direction of Ant1-Ant4 are XZ plane. Such complementary radiation pattern qualities enable a low value of ECC between antennas and are also useful in producing self-isolated MIMO antenna systems. In Based on the observations, it is discovered that the radiation patterns of  and  are complementary to each other in the The mean effective gain (MEG) is a key measure for characterizing the performance of MIMO diversity. It compares the power received by the isotropic antenna to the power gained by the diversity antenna in a fade environment. The MEG of tion (7) .(7)MEGiThe typical value of TARC is characterized as the square root of the overall reflected power divided by overall incident power. TARC provides a valid estimation of MIMO antenna efficiency since it contains information about the mutual coupling effect. The TARC for the N unit MIMO antenna setup can be computed using Equation (8) .(8)TARCThe value of TARC is calculated with the assumption of An additional fundamental diversity attribute measure that may be used to assess MIMO performance is CCL, which shows the greatest rate at which data can be delivered without experiencing significant losses. Equation (9) ,50 can bErgodic channel capacity (CC), which is determined under the presumption of zero ECC among the transmitting antennas, is the most efficient diversity characteristics metric for a MIMO system. Equation (10) is used to evaluate the channel matrix \u201cH\u201d.ained in .Further the The variables used in Equation (11) are ion (12) ,53 is usHere, the variables in Equation (12), The ideal CC for 4 \u00d7 4 MIMO and 2 \u00d7 2 MIMO are 22.2 bps/Hz and 11.3 bps/Hz at SNR = 20 dB, respectively; whereas, for 4 \u00d7 4 MIMO and 2 \u00d7 2 MIMO, the ideal CC is 10.94 bps/Hz and 5.53 bps/Hz at SNR = 10 dB, respectively. The CC should be at least 60% of the ideal value for a MIMO antenna to work well. The simulated CC over the operating frequency bands OFB1, OFB2, and OFB3 is 4.53\u20138.95 bps/Hz, 7.46\u20138.70 bps/Hz, and 7.20\u20138.18 bps/Hz, respectively, at SNR = 10 dB, whereas the CC at SNR = 20 dB is 12.60\u201319.57 bps/Hz, 17.46\u201319.21 bps/Hz, and 17.20\u201318.56 bps/Hz, respectively. The measured CC over the operating frequency bands OFB1, OFB2, and OFB3 is 4.35\u20138.62 bps/Hz, 6.89\u20138.68 bps/Hz, 7.02\u20138.01 bps/Hz, respectively, at SNR = 10 dB; whereas, the CC at SNR = 20 dB is 12.13\u201319.13 bps/Hz, 16.55\u201319.18 bps/Hz, and 16.92\u201318.44 bps/Hz, respectively. The channel capacity versus frequency plot is depicted in Since the proposed antenna is wideband in nature, it is important to check its time domain characterization. Important time domain characteristics like group delay, phase response, and isolation analysis by keeping the antenna in face-to-face (FTF) and side-to-side (STS) orientation are studied. The two similar antennas are placed in two different configurations maintaining 300 mm, which are depicted in In order to discuss the time-domain analysis, the fidelity factor of antenna and system fidelity factor play a crucial role. The antenna fidelity factor (FF) is obtained by calculating the cross-correlation of the radiated E-field and the input signal; however, the system fidelity factor (SFF) is calculated by the cross-correlation between the transmitted pulse and the received pulse. The simulated value of FF and SFF are calculated in two different orientations (face to face and side by side), by keeping the proposed antenna 300 mm apart. Here the Gaussian sine pulse is given as input to the Tx port in order to find the FF and SFF. The obtained value of FF and SFF is presented in The antenna\u2019s compact dimensions impact its transient behavior, and the level of pulse distortion is considered acceptable , whiThe proposed design operates on three wide bands that cover bands 3\u201315.5 GHz and two mm-wave bands . The minimum port isolation and ECC over the bands 3\u201315.5 GHz, 26.4\u201334.3 GHz, and 36.1\u201348.9 GHz are observed as ,  and , respectively. The diversity performance of the MIMO antenna is performed by analyzing diversity gain, average efficiency, total interference ratio, channel capacity loss, and ergodic channel capacity. The MEG and TARC in all operating bands  are less than 0.2 dB and \u22124.1 dB, respectively. The CCL in all operating bands is less than 0.3 bps/Hz and the range of CC in operating bands 3\u201315.5 GHz, 26.4\u201334.3 GHz, and 36.1\u201348.9 GHz are 12.13\u201319.13 bps/Hz, 16.55\u201319.18 bps/Hz, and 16.92\u201318.44 bps/Hz, respectively. The simulated time-domain analysis in two different orientations, which are face to face (FTF) and side to side (STS), are studied. In both orientations, the group delays (GD) lie between 1010 and 1085 ps, and the S21 magnitude is less than \u221275 dB in all operating bands. The S21 phase provides linear characterization in all operating bands. The simulated values of FF and SFF are  and  in FTF and STS orientations, respectively. In all operating bands, the measured values provide good agreement with respect to the simulation ones, which indicates a good candidate for operation in all investigated bands."}
{"text": "This article investigates the inverse design of a reconfigurable multi-band patch antenna based on graphene for terahertz applications to operate frequency range (2\u20135THz). In the first step, this article evaluates the dependence of the antenna radiation characteristics on its geometric parameters and the graphene properties. The simulation results show that it is possible to achieve up to 8.8 dB gain, 13 frequency bands, and 360 In wireless communication, the need for multi-band antennas has increased due to a reduction in the number of antennas, a reduction in the complexity and cost of the system, and providing the possibility of integration with other circuits of the structure5.Nowadays, the terahertz band is used in wireless telecommunications6, patch antennas9 ultra-broadband absorbers10, and photoconductive antennas11 has been reported. In12, a dual-band antenna with an average gain of 2.45 dB is designed by creating two circle strips on the graphene. In13, a three-band frequency reconfigurable antenna has been proposed for a slotted patch graphene antenna. In14, a three-band antenna is implemented with a series feed circle graphene patch with a gain close to 10 dB. In15, a four-band antenna has been reported for a four L-shaped stub graphene patch antenna. Generally, for graphene antennas, it is possible to change the number of operating frequency bands by the variation of graphene chemical potential, similar to17 in which a four-band and three-band graphene antenna has been designed with the gain of 2.58 dB and 9.51 dB, respectively.On the other hand, the use of graphene has been very impressive in recent years in the field of Nano-electronic and THz devices due to its high conductivity and the changeability of the conductivity by tuning the bias voltage. The use of graphene in THz imaging19, design of metasurfaces22 and metamaterials25, design of photonic structures27,beamforming29, design of antennas32.Making less computational time of resources with an acceptable result is of substantial importance in electromagnetic applications. In this regard, the machine learning approach has recently demonstrated outstanding performance compared to the computational and iterative methods in dealing with electromagnetic problems. Deep learning (DL) is a subset of machine learning (ML) with more robust computing capabilities, which is based on neural networks (NNs) and can learn the nexus between inputs and outputs. After learning, the designed model based on trained data can show a reasonable prediction as outputs for various given inputs in a fraction of a second. By taking advantage of this, DL was a suitable technique for inverse scattering problems33. Usually, these DNN architectures include multiple networks to handle a specific part of the problem and have high structural complexity. Some of these techniques are used to solve the one-to-many issue. The one-to-many issue is a challenging problem in machine learning, which refers to a situation in which a single input is associated with multiple outputs. A tandem architecture is presented in34 by bringing together forward modeling and inverse design. The approach demonstrated in this model overcomes the one-to-many issue better than the inverse design model for the designing of nanophotonic structures. Then to overcome the limited generalization ability of23, a probabilistic graphic model introduced as an all-inclusive explanation for metamaterial design.The deep neural network (DNN) architecture has been evolving over the years with new techniques and advancements. We can mention some recent techniques that applied in electromagnetic fields35. Second, by giving the antenna dimensions as input, the antenna radiation will be estimated as output in real-time so DL and ML can speed up the antenna simulation directly31. And third, the most widely used method is the inverse design of the antenna using DL. The required radiation pattern characteristics are provided as input, and the DNN\u2019s output estimates the antenna parameters. In this case, depending on the circumstances, the antenna parameters may be fully adjustable or non-adjustable32. Although in29 a We have classified using the neural networks in antenna design into three approaches. First, NNs and ML enhance some radiation properties by optimizing the antenna parameters and can not control antenna radiation patterns in real-timeIn this article, an inverse design of reconfigurable graphene circular patch antenna at THz frequencies is proposed and surveyed to the realization of an intelligent antenna for 6G wireless communication. Also, for the first time we apply a chemical potential of graphene as a reconfigurable component in the output of DNN to control the radiation properties in real-time. The antenna parameters are divided into two groups, graphene and antenna parameters. After the analysis, we generated a data set and filtered it with two specific conditions. Then, a DNN model is presented, that can accurately predict the values of the graphene properties and antenna parameters for the desired S-parameters and radiation pattern of the antenna.For this, in Sect. \u201cThe flow chart of the activity steps is plotted in Fig. mentclass2pt{minimThe structure of the antenna along with its parameters is plotted in Fig. mentclass2pt{minimeV to 0.8 eV, the operation frequencies of the antenna have been shifted while the radiation pattern at the 2.34 THz frequency remains relatively constant. In this simulation, ps, eV to 1.3 eV, the return loss of the antenna remains relatively constant while the beam direction has been tilted about 30 degrees at the 3.21 THz frequency. In this simulation, ps, Due to the use of graphene in the patch and ground of the structure, a reconfigurable radiation pattern or a reconfigurable operating bandwidth is the inherent property of the structure. As shown in Fig. eV), relaxation time (ps), substrate thickness  has been used to calculate the difference between the real value and the value estimated by the model, as given in equation (The loss and accuracy diagrams of the proposed model have been sketched in Fig. For evaluation of the proposed model, we have provided two arbitrary samples whose specifications are given in Figure In this article, a planar graphene antenna was investigated and its radiation characteristics for different substrate thicknesses and graphene characteristics including chemical potential and relaxation time have been extracted by full-wave FEM simulations. Then, these parameters were examined as the design inputs and it was shown that in the proposed structure, by choosing the appropriate values for the input, the number of bands and their resonance frequencies, antenna gain and main lobe directions can be set. The simulations have been performed in the [2\u20135] THz frequency band and it has been shown that the maximum gain of 8.8dB and up to 13 frequency bands can be achieved. Due to the complexity of the design and in the following, a deep neural network has been used to provide a design solution. This network is trained based on the categorized simulation results and the network parameters are determined in such a way that the most accurate matching between the estimated and simulated parameters has been achieved for minimum input data. In the end, it has been shown that the optimal radiation parameters can be estimated with an error of less than 3%. This feature can be used to design antennas in various applications. In the simulations, we encountered one-to-many issues. In fact, the analysis of the simulation results shows that for the antenna parameters of ["}
{"text": "The experimental investigations reveal that the reported design adequately retains its performance while operating in close proximity to human beings. The presented Specific Absorption Rate (SAR) analysis reveals 0.297 W/kg calculated at 0.5 W input power, which certifies that the proposed antenna is safe for use in wearable devices.A compact, conformal, all-textile wearable antenna is proposed in this paper for the 2.45 GHz ISM  band. The integrated design consists of a monopole radiator backed by a 2 \u00d7 1 Electromagnetic Band Gap (EBG) array, resulting in a small form factor suitable for wristband applications. An EBG unit cell is optimized to work in the desired operating band, the results of which are further explored to achieve bandwidth maximization via floating EBG ground. A monopole radiator is made to work in association with the EBG layer to produce the resonance in the ISM band with plausible radiation characteristics. The fabricated design is tested for free space performance analysis and subjected to human body loading. The proposed antenna design achieves bandwidth of 2.39 GHz to 2.54 GHz with a compact footprint of 35.4 \u00d7 82.4 mm The developments in body area network (BAN) devices have been fueled by the rise in the demand for IoT (Internet of Things) connected devices. Wearable devices have accelerated the digital transformation of several sectors, including health monitoring, tracking, rescue operations, and gaming ,2. WearaCurrent technological solutions are not entirely enough to fulfill the demands of pervasive health monitoring in coming era. There is a great demand to scale up the research towards reliable wireless connectivity, smart sensors, wearable devices, and wireless implants . With adWearable technology has the potential to revolutionize the lifestyle of the common man. Its tendency to simultaneously become faster and smaller holds out the prospect of a future orbiting around wearables. The trend of consumer preferences reveals an ever-increasing demand for wearable health monitoring devices. Users find self-tracking devices helpful in keeping them engaged with their health . HoweverDesigning high performance antennas is very simple, provided that ideal conditions are applied. A bulky antenna structure operating in an environment where no interferences exist is all that is needed. Efficient antenna design is obtained when the size is about half the wavelength. This means that an antenna of almost 8 cm is required for the 1900 MHz Global System for Mobile Communications (GSM) band. There should be no interfering electronics nearby when this antenna is operating. This is obviously not possible; hence, researchers continue working to optimize antennas in size and performance as per the required application.Wearable antennas have become more common in recent years due to their appealing qualities and potential to provide wireless environments and communication while being lightweight, tiny, affordable, and customized. Maintaining the uniformity of features in various environments is one of the main problems encountered in the wearable antenna development, covering aspects such as temperature, humidity, proximity to people and their clothing, wash cycles, etc. . BecauseSeveral articles have presented textile wearable antennas ,17,18 anDesigning antenna for on-body operation is challenging from various aspects. The antenna should be compact and conformal to offer a good user experience. Daily life activities should not be interrupted by wireless data transmission. Furthermore, human tissues have high permittivity, which allows for near-field coupling with the body . An anteA fabric antenna for wearable applications that is low-profile, small, conformal, and has HIS was presented in . BecauseThe development of the antenna design proposed in this work was carried out with the aim of obtaining a compact footprint and reduced geometrical complications to ensure good fabrication on textiles while ensuring that the design is able to offer maximum user comfort. These objectives were met by designing the integrated antenna on a denim substrate with a compact footprint. An EBG unit cell is set to operate in the ISM band, with a 2 \u00d7 1 EBG array is selected for the sake of a miniaturized configuration. When the number of unit cells is limited by size constraints, the usual approach of placing an EBG array behind an antenna operating at the same frequency ends with inferior performance in terms of bandwidth and radiation efficiency. For this reason, a novel approach utilizing a 2 \u00d7 1 metasurface with a floating ground plane is adopted. This approach allows for a more compact structure with enhanced performance. A similar kind of a wearable antenna was presented in  for the Because the ground plane of the EBG structure is displaced, the design methodology is quite different from the conventional approach , which bX1, Y2, and Y3. The resonance frequency is recorded in the zero-degree reflection phase, and is required to be set at 2.45 GHz. It is observed that by increasing or decreasing the values of the design variables the resonance frequency is moved to either a higher or lower spectrum. However, there is very little impact on the bandwidth. Therefore, the bandwidth offered by the unit cell is mainly controlled by the Uh parameter. The other design parameters control the shifting of the resonance frequency.With the objective of reducing the number of adjustable variables in the design, a simple slotted-square EBG unit cell was tuned to operate in the desired band using a denim substrate  and EBG ground plane displacement (d) is shown in d by 0.2 mm causes a frequency shift to a higher spectrum and reduces impedance matching. These values are optimized to achieve the desired resonance frequency with optimum band coverage.With the developed compact 2 \u00d7 1 EBG surface, a planar monopole antenna is placed above it at a close distance. The spacing allows for electromagnetic coupling; thus, the EBG surface plays a role in controlling the emitted radiations as well. The antenna dimensions are optimized to produce resonance at 2.45 GHz. The final integrated design with dimensions is presented in In this section, we present the simulation and experimental analysis of the proposed wearable antenna. The prototype development involves conductive fabric and readily available denim fabric, achieving an all-textile solution to wearable devices.The accuracy and manufacturing efficiency of low-cost wearable antenna designs are determined by fabrication procedures. Wet-etching, screen printing, ink-jet printing, and embroidery processes are the most widely used ways of wearable fabrication reported in the literature ,42,43. TThe fabricated antenna is shown in The antenna prototype was experimentally analyzed for the performance parameters of reflection coefficient shown in , gain s, and radFree space measurement results predict admirable performance of the proposed wearable antenna. However, it is important to analyze the performance variations in the wristband case. The fact that the human body consists of lossy tissues affects the antenna\u2019s efficacy. The electrical properties of human organs are distinct, making them suitable EM (electromagnetic) energy absorbing materials. Thus, the radiated energy of the antenna is subject to being partially absorbed by the user\u2019s body. The amount of this effect depends on several parameters, including the distance between the antenna and the user and the radiation characteristics of the antenna. The EM wave loses energy upon interaction with a dielectric medium. The human body is a non-homogenous dielectric medium that is characterized by the There are different ways to develop a human body model in a simulation tool to observe on-body performance. There are human anatomical models available in EM simulation tools, such as the voxel phantom model, which can accurately describe the human anatomy. These models are more rigorous and realistic than the multilayered phantom model; however, they require substantial computational resources. For analysis based on simulations, we constructed a multi-layered phantom model in the simulation tool. The dielectric constant, loss tangent, and mass density of each layer were defined as per the reported data from the literature. The model shown in The human body-loaded antenna performance parameters of the reflection coefficient (in decibel), gain, and radiation pattern are depicted in In addition to the above-mentioned analysis, the presented design operation was further investigated by mounting the antenna over the wrist of the body. The recorded results are presented in When the human body is exposed to EM radiation, one result is elevated body temperature . RegulatIn addition to the requirements of enhanced performance parameters of wearable antennas, arguably one of the most critical concerns for any device operating close to the human body is its impact on human health. This matter is assessed by SAR analysis, which indicates the amount of radiation absorbed by human tissues. The standard limitations are to be followed by all wearable devices. Thus, the SAR value should be less than 1.6 W/kg for 1 g of tissue, a limit set by the FCC. SAR dissemination is calculated for the diverse layers of human tissues. It is obvious from A comparison between the proposed wearable antenna and works published previously in the literature is provided in In this paper, we propose a novel flexible wearable antenna exploiting a floating-ground based EBG to enhance antenna performance. The achieved bandwidth is able to account for possible band shifting under bending or human body loading effects. The antenna was fabricated using Shieldex Nora Dell metallized fabric over a denim substrate layer. Cutting, pasting, and alignment of the design was carried out using A Silhouette Cameo machine. The computed overall far-field properties of the antenna indicate good performance with adequate gain and efficiency. An SAR analysis is presented, and the results validate the appropriateness of the suggested embedded design for wearable devices."}
{"text": "Developing a compact circularly polarized (CP) antenna with good radiation characteristics for handheld radio frequency identification (RFID) readers is a very challenging task. Many compact CP antennas have been reported in the open literature, but most suffer from critical drawbacks of low gain and/or high back radiation. This paper presents a metasurface (MS) based CP antenna with compact size, high gain, and high front-to-back ratio characteristics. The compact size of the proposed design is achieved by using a 2 \u00d7 2 unit-cell MS, while the CP realization is accomplished through a coupling between the MS and a Y-shaped patch as a primary CP source. The final antenna has compact overall dimensions of 0.45\u03bb \u00d7 0.45\u03bb \u00d7 0.02\u03bb, where \u03bb is the guided wavelength at the center frequency. The operating bandwidth is about 2.0% (2.43\u20132.48 GHz) and the broadside gain is about 6.3 dBi. Besides, the front-to-back ratio (FBR) defined by the difference gain levels between the forward and backward directions is about 18 dB. Compared with the related compact CP antennas in the literature, the proposed design has the advantages of high gain and high FBR, making it suitable for compact RFID readers. Radio Frequency Identification (RFID) is a wireless communication system consisting of two components: tags and readers . This kiTheoretically, CP radiation can be achieved when the antenna is excited by two orthogonal electric fields with equal amplitude and phase difference of 90\u00b0. In \u20136, multiVarious techniques have been developed to minimize the CP antenna for RFID applications. In , a singlThe motivation of this paper is to design a compact directional CP antenna with high gain and high FBR. To achieve this, the antenna realization is as follows:To achieve compact and directional beam antenna, microstrip patch and MS-based antenna are considered.To achieve high gain, the MS-based antenna is a better option than the patch antenna. This is due to the large radiating aperture of the MS in comparison with the patch.To achieve high FBR or small back radiation, the MS-based antenna has more advantages than the patch antenna. For the patch, the back radiation is caused by the diffraction of the surface wave at the edges of the ground plane. Smaller ground plane results in higher back radiation. In contrast, the electromagnetic waves are confined between the MS layer and the ground plane layer for the MS-based antenna. This contributes to reducing back radiation.Accordingly, the proposed antenna is based on a 2 \u00d7 2 unit-cell metasurface (MS) and fed by a Y-shaped patch as a CP source. To demonstrate the feasibility of the proposed concept, measurements are implemented on a fabricated antenna prototype. The measured data show an operating bandwidth (BW) of 2.0% (2.43\u20132.48 GHz). The antenna with a compact size of 0.45\u03bb x 0.45\u03bb x 0.02\u03bb can achieve a high gain radiation of 6.4 dBi and a high FBR of 18 dB.x- and y-direction are identical, Zx = Zy. Thus, the CP operation can be achieved when a CP source  is used to excite this kind of MS. In the second case, the unit cell has an asymmetric structure. To have CP operation, this kind of MS is commonly excited by a linear source, for example, the vertical polarization in E1 and E2. By controlling the truncated corners, the impedances Z1 and Z2 can be equal in magnitude and 900 out of phase. Consequently, CP realization can be accomplished.The MS-based antenna is one kind of MS application that employed the resonant modes of finite MS. Various MS antennas have been developed for wideband, low profile, or circular polarization applications \u201324. In tIn this paper, a symmetric MS is utilized. The characteristic mode analysis (CMA) is utilized to predict the modal behaviors and operation characteristics of the MS , 26. To They are identical in modal significance.The current distributions are orthogonal arrangements.The broadside directivities are similar.Note that many MS-based CP antennas have been reported in the literature \u201330. HoweThe configuration of the proposed compact CP antenna is presented in S11|, AR, and realized gain of these two designs. Around 2.45 GHz, both antennas show good impedance matching with |S11| of less than \u201310 dB and good CP radiation with an axial ratio (AR) of lower than 3 dB. However, the antenna gain observes a strong difference. For the conventional CP patch antenna, surface wave diffraction at the edges of the ground plane increases the back radiation. For the proposed structure, the electromagnetic waves radiated by the MS at its resonant frequency are confined into the MS through the magnetic coupling effect. When the MS is illuminated by the primary source, the radiated field is spread over a larger radiating aperture than the conventional design. Therefore, the antenna\u2019s gain in the forward direction increases. The back radiation is also further suppressed, leading to high FBR.To demonstrate the effectiveness of the utilized concept, the performances of the proposed MS-based antenna and the conventional CP patch are compared. For a fair comparison, the conventional CP square patch with truncated corners is designed on a Taconic RF-35 substrate with similar overall dimensions to the MS-based antenna. The CP realization of the proposed antenna can be verified based on the simulated current distributions on the CP source and the MS at 2.45 GHz. W0. S11| and AR characteristics for different values of W0. The data indicate that changing W0 significantly affects the operating frequency band. Both impedance matching and AR bands shift upwards when decreasing W0.Since the MS is the primary radiating aperture of the proposed antenna, the operating band is theoretically determined by the size of the unit cell, S11| and AR results against the variation of the patch\u2019s length, l1. As observed, the AR is significantly affected by l1. Meanwhile, the impedance performance is almost stable with the variation of l1.Due to the symmetrical MS, the CP radiation of the proposed antenna is realized by the CP source Y-shaped patch. Thus, the CP operation is optimized through the dimensions of this patch. w2, and the feeding position, G. The effect of w2 and G on |S11| and AR performance is presented in Figs w2 and G have a minor effect on AR performance. The 3-dB AR BW remains unchanged with different values of these parameters. On the other hand, the impact on the matching performance is remarkable. The antenna shows good impedance matching with proper values of w2 and G.The impedance matching is strongly determined by the width, To demonstrate the effectiveness and feasibility of the proposed antenna, a prototype of the antenna was fabricated and measured. The reflection coefficient is measured by a Vector Network Analyzer and the radiation features are implemented in the far-field microwave anechoic chamber.S11| smaller than -10 dB covers a frequency band from 2.30 to 2.57 GHz. x \u2212 z and y \u2212 z. The measured results show that the proposed antenna has a good radiation pattern, which is quite symmetric around the broadside direction. The FBR is better than 18 dB and the cross-polarization is 20 dB less than the co-polarization.Finally, a comparison of the proposed design with several representative published studies is summarized and tabulated in A compact CP antenna with high gain and high FBR for RFID readers is presented and investigated in this paper. The proposed design is based on the 2 x 2 unit-cell MS and the Y-shaped patch as the primary CP radiating source. The proposed antenna with compact dimensions of 0.45\u03bb x 0.45\u03bb x 0.02\u03bb achieves an operating BW of 2.0% (2.43\u20142.48 GHz). A high broadside gain of 6.3 dBi and a high FBR of 18 dB are also accomplished. In comparison with other related works, the antenna has the advantages of high gain and high FBR while having similar overall dimensions. The proposed antenna can be a good candidate for compact RFID readers."}
{"text": "This paper proposes a graded effective refractive indexes (GRIN) dielectric lens for 5G applications. The inhomogeneous holes in the dielectric plate are perforated to provide GRIN in the proposed lens. The constructed lens employs a collection of slabs that correspond to the specified graded effective refractive index. The thickness and the whole lens dimensions are optimized based on designing a compact lens with optimum lens antenna performance . A wideband (WB) microstrip patch antenna is designed to be operated over the entire band of interest from 26 GHz to 30.5 GHz. For the 5G mm-wave band of operation, the behavior of the proposed lens along with a microstrip patch antenna is analyzed at 28 GHz for various performance parameters, including impedance matching bandwidth, 3 dB beamwidth, maximum gain, and sidelobe level. It has been observed that the antenna exhibits good performance over the entire band of interest in terms of gain, 3 dB beamwidth, and sidelobe level. The numerical simulation results are validated using two different simulation solvers. The proposed unique and innovative configuration is well-suited for 5G high gain antenna solutions with a low-cost and lightweight antenna structure. The need for high data rates led to the use of millimeter-wave (MM-wave) bands in fifth-generation (5G) mobile systems . The devFor spherical lenses, the beam moving along the main axis is focused on a focal point . So, wheA compatible WB antenna is also necessary for the proposed lens design to operate over a wide impedance bandwidth. In the literature, several techniques have been reported to increase the bandwidth of printed antennas at the millimeter-wave (mm-wave) band. However, such techniques added complexity to the antenna structure. For example, the technique used in  relies oIn , multi-lIn this paper, a widening-band antenna with a GRIN 2D dielectric lens is designed for 5G applications. This lens is made by drilling holes in a flat dielectric in an uneven pattern to obtain an effective refractive index that is similar to that of the Luneburg lens. A compatible WB antenna is designed to work with the designed lens over a wide impedance bandwidth. The antenna dimensions and the thickness and overall dimensions of the lens are optimized with the goal of creating a compact lens antenna with optimal performance .In this work, a microstrip patch antenna is designed to cover a wideband (WB) frequency span to cover the 5G mm-wave standards. For 5G mm-wave applications, the lens must work over a wide frequency range. This means that it needs a WB feeding mechanism. Since the proposed lens design is WB by nature, the feeding mechanism must also be WB-compatible. The optimized integrated lens and patch antenna setup works well over the targeted band, with high gain values and stable performance over the whole band of operation.r = 2.2, and loss tangent tan\u03b4 = 0.0009. The PCB board used has dimensions of 12.7 \u00d7 52.5 mm2 and a thickness of 0.64 mm. The rectangular patch size is 15.6 \u00d7 2.9 mm2 on the top layer. Two circular slots are etched out of 2.5 mm. The bottom layer of the PCB board serves as a reference ground plane for the rectangular patch. The proposed patch antenna is fed via a microstrip line of 1.4 mm width. As shown in To achieve a wide range of impedance, the patch was optimized without any slots by choosing the right patch size. Parametric sweeps are performed to analyze the effect of the width and length of the patch antenna. Both slots are identical and positioned symmetrically around the antenna\u2019s center and they are far away from each other by 4.2 mm. To achieve wideband impedance matching and minimize return loss, the input impedance of the antenna is set to 50 ohms by optimizing the width and length of the feeding microstrip line. As per our findings, the slots created an extra resonant mode at the lower frequency end, which helped in widening the operating bandwidth. The final optimized dimensions resulted in an increased effective bandwidth of the patch in the range of 26\u201330.5 GHz.z-axis and propagating along the +y-axis, as shown in The antenna port is excited by a Gaussian pulse, polarized along the r = 6.3). For normal incident plane waves on the slab, the relationships between the complex refractive index . The thickness of the unit cell is 1.57 mm (0.1493 \u03bb). The reason for the selection of the value of 1.57 is the commercial availability of Rogers TMM 6 (\u03b5rameters  are giveFor passive materials, the real value of When the lens is added to the microstrip patch antenna as shown in  dBi see  to 20 dBcies see  shows hoA comparison of several key metrics of the proposed dielectric slab-based lens antenna with previously published results is shown in In this work, a GRIN dielectric lens has been proposed to meet the high-gain requirements of 5G applications. The proposed design is based on the effective refractive index of a hole-type unit cell. An WB antenna is also designed to be compatible with the lens operation over a wide impedance bandwidth. The proposed integrated patch along with the lens is tested for its performance using a numerical full-wave simulator. The patch-lens system demonstrated a gain of 20 dBi, HPBW of The proposed lens antenna system provides several benefits, such as improved performance, compactness, and low-profile design. It also has the potential to be extended to other frequency bands and applications, making it a versatile and cost-effective solution for wireless communication systems."}
{"text": "These SAR values were observed to be significantly lower than the 1.6 W/Kg threshold set by the Federal Communication Commission (FCC). Moreover, the performance of the antenna was evaluated by simulating various deformation tests.The proposed paper presents a flexible antenna that is capable of operating in several frequency bands, namely 2.45 GHz, 5.8 GHz, and 8 GHz. The first two frequency bands are frequently utilized in industrial, scientific, and medical (ISM) as well as wireless local area network (WLAN) applications, whereas the third frequency band is associated with X-band applications. The antenna, with dimensions of 52 mm \u00d7 40 mm (0.79 \u03bb \u00d7 0.61 \u03bb), was designed using a 1.8 mm thick flexible kapton polyimide substrate with a permittivity of 3.5. Using CST Studio Suite, full-wave electromagnetic simulations were conducted, and the proposed design achieved a reflection coefficient below \u221210 dB for the intended frequency bands. Additionally, the proposed antenna achieves an efficiency value of up to 83% and appropriate values of gain in the desired frequency bands. In order to quantify the specific absorption rate (SAR), simulations were conducted by mounting the proposed antenna on a three-layered phantom. The SAR Wearable antennas are gaining popularity in body-centric communication (BCC). The BCC defines three main realms of communication: on-body, off-body, and in-body communication, based on how wireless devices are connected. This categorization aligns with the IEEE 802.15 standardization group [The choice of materials is a crucial factor in designing wearable antennas. Ideally, wearable antennas should be lightweight, low profile, compact, user friendly, and low maintenance. They should also be able to withstand mechanical stresses and deformations. Various materials have been used as antenna substrates due to their favorable electrical, chemical, and mechanical properties for the human body, including textiles , silk 44, nylon Due to the interaction of a wearable antenna with the human body, the gain, efficiency, bandwidth, and driving impedance of the wearable antenna is notably affected. Additionally, a part of the electromagnetic radiation from the antenna penetrates the skin layer and interacts with tissue yielding in heating effect. This is quantified as SAR measured in W/Kg. A low value of SAR is desirable to have minimum side effects as defined by FCC. Various approaches have been adopted by researchers to minimize SAR. Authors in ,11,12 usThe advancement of wireless technology has enabled numerous systems to function across multiple frequency bands. Examples of such systems include satellite navigation, wireless LANs, and ultrawideband (UWB) systems . TherefoThis study, therefore, proposes a multiband wearable antenna that uses flexible kapton polyimide material as a substrate. The antenna is capable of operating in wireless body area networks (WBAN), WLAN, and X-bands. To investigate the specific absorption rate (SAR), we used a three-layer phantom composed of skin, fat, and muscle. Our results show that the achieved SAR values are below the threshold set by the FCC .This paper is organized into several sections. During the past three decades, planar antennas, specifically microstrip antennas, have gained widespread usage. Despite having a narrow bandwidth, researchers have directed their attention towards microstrip patch antennas due to their distinct benefits, such as low manufacturing costs, light weight, and ease of production.The miniaturization of microstrip antennas has emerged as a significant area of interest among antenna designers in recent decades. Typically, the length of a conventional antenna that operates at a given frequency is on the order of half the wavelength of that frequency. However, this length is practically not suitable for several applications such as radio frequency identification (RFID), and the internet of things (IoT) .The miniaturization of antennas with multiband capabilities is an active research area, particularly for wireless devices that require compact and efficient antenna systems. There are several techniques that researchers are exploring to achieve this goal, such as using metamaterials, reconfigurable antennas, and fractal geometries ,29. AddiThe antenna design presented in this study is derived from a typical fork antenna design. The overall design evolution is presented in L, LR, LE, and LF are the lengths of the stubs, horizontal strip, and feed line, respectively, while WL, WR, WE, and WF are their corresponding widths. WS is the spacing between the stubs. Lg represents the length of the ground plane.By changing various parameters of the antenna design, some useful insights can be comprehended. The return loss of the antenna is investigated by changing the length of the ground plane, as depicted in The length of the stubs plays a crucial role in the frequency response of the antenna. Modifying the length of the stubs causes a shift in the center of resonating frequencies, providing frequency-tuning capabilities for the proposed antenna. As depicted in The addition of a horizontal stub to the radiating patch results in the modification of the return loss characteristics of the antenna. This stub was introduced to provide band-pass filtering characteristics to the antenna radiation by creating specific current paths that facilitate efficient radiation in the desired frequency bands. This effect is demonstrated in The dimensions of the feed line are a crucial consideration in antenna design as they impact impedance matching. In our design, a wider feed-line width leads to a lower matching impedance, while a narrower one results in a higher matching impedance. The feed-line width of 2 mm is found to be optimal, as shown in This section presents the simulation results of various performance parameters of the proposed antenna.In order to validate the functionality of the proposed design, the antenna was designed and simulated using the HFSS computational package, which is based on the finite element method (FEM). The comparison of the results is shown in The efficiency and gain of the proposed antenna were computed using both CST and HFSS simulation software. The results, as illustrated in FBR is a measure of the directional performance of an antenna. It describes the ratio of the power radiated in the forward direction compared to the power radiated in the opposite, or backward, direction. A higher FBR ratio indicates that the antenna radiates more power in the desired direction and less power in the opposite direction, which is often desirable in antenna applications. The FBR characteristics of the antenna were simulated using both CST and HFSS, as shown in 11 parameter, which indicates the level of impedance matching that the antenna can achieve. In our case, the antenna demonstrates high impedance matching at 8.0 GHz.In this section, we will discuss the impedance bandwidth offered by the antenna at its resonance bands. A body-worn antenna may undergo different deformations and distortions in real-life scenarios which can affect its performance. Here we present some cases.When an external force is applied to an antenna, it may experience compression, primarily affecting its substrate. To investigate the effects of substrate thickness on antenna properties, we reduced it from 1.8 mm to 1.35 mm and observed a shift in the return loss of the antenna towards the right, as demonstrated in To assess the versatility of the proposed antenna design, we evaluated its performance with substrates other than kapton polyimide. In this experiment, we replaced the substrate with materials of the same thickness, such as nylon, PDMS, and photopaper. Interestingly, we observed that the return loss characteristics deviated to a lesser extent, with resonances almost aligning with the target frequency bands, as illustrated in To evaluate the antenna\u2019s performance in terms of reflection coefficient, gain, and radiation pattern under bending conditions, we developed a three-layered cylindrical phantom using CST. The reflection coefficient of the antenna was analyzed under phantom loading conditions by varying the diameter of the inner cylinder from 50 to 100 mm, simulating changes in the size of the muscle layer. The thickness of the fat layer was kept constant at 2 mm, while the skin layer had a thickness of 1 mm. The tissue layers were assigned frequency-dependent dielectric properties, as specified in In another test, the antenna\u2019s gain was measured at a distance of 3 mm from the skin layer, and the results were plotted as a function of angular distribution in the E-plane, as shown in In body-worn communication, the distance between the antenna and the body can alter the antenna\u2019s radiation-pattern characteristics. To explore this effect, we positioned the antenna at distances of 2, 3, and 5 mm from the skin layer and recorded the corresponding radiation patterns for the operating frequencies, as presented in The performance of the antenna can deteriorate in wet conditions, such as rainy or sweaty environments. To assess its resilience to wet conditions, we added a 1 mm thick layer above the antenna, fully covering its top layer, and filled it with water. We used three different permittivity values of water  to simulate various levels of salt in the water. The results of this test are presented in In practical body-worn communication scenarios, antennas are often placed on garments and exposed to free space. However, if the antenna is covered with body-worn fabrics made of cotton, silk, jeans, etc., its performance can be affected. To study this, a selection of ten body-worn fabrics was chosen, and the variation in return loss was measured with the antenna placed underneath a 1 mm thick layer. The results, shown in 21 parameter. This was accomplished first by configuring a pair of antennas in various positions in free space and then by mounting the antennas on the body.The transmission losses of the proposed wearable antenna can be investigated by evaluating the S21 parameter was then evaluated for three configurations. The results achieved are shown in These positions are defined as front to front, back to back, and side to side with 100 mm of separation. The result for the free-space case is presented in The specific absorption rate (SAR) in W/Kg given by Equation (1) is used to quantify the antenna radiation absorbed by human tissue. A lower SAR value is preferable as per the guidelines set by the FCC.3), respectively [3, 909.4 Kg/m3, and 1060 Kg/m3 respectively. The antenna used in the model was positioned 3 mm away from the skin layer. SAR values were calculated for two different phantom shapes: a flat phantom with dimensions of 180 \u00d7 160 \u00d7 53 mm3 and a cylindrical phantom with a radius of 90 mm. The tissue layers were assigned frequency-dependent dielectric properties, and the second-order Debye\u2019s model is used for dispersion fitting [Here ectively ,32,33. A fitting . The inp1g are demonstrated in 1g is well below the FCC limit of 1.6 W/Kg.The simulation results obtained for SARThere is rich literature available on the design of new antennas for wearable applications. However, a more suitable comparison for the proposed antenna would be with other antennas that use kapton polyimide as the substrate material. The authors introduced a flexible multiband antenna capable of functioning in ISM, WLAN, and X-bands. The proposed antenna was designed on the flexible substrate of kapton polyimide material  with a size of 52 mm \u00d7 40 mm (0.79 \u03bb \u00d7 0.61 \u03bb). The reflection coefficient of the antenna is significantly lower than \u221210 dB for all resonant frequency bands which reflects good impedance-matching characteristics. Appropriate gain values are achieved for the resonance bands with maximum efficiency of 83%. Various simulation tests were conducted to evaluate the antenna\u2019s performance, and it was found that the SAR values were kept to a minimum. Overall, the antenna performed adequately for the target frequency bands."}
{"text": "The simulated and measured results show good agreement, indicating the effectiveness of the UWB-MIMO antenna for wireless communication and portable systems.This study introduces a monopole 4 \u00d7 4 Ultra-Wide-Band (UWB) Multiple-Input Multiple-Output (MIMO) antenna system with a novel structure and outstanding performance. The proposed design has triple-notched characteristics due to CSRR etching and a C-shaped curve. The notching occurs in 4.5 GHz, 5.5 GHz, and 8.8 GHz frequencies in the C-band, WLAN band, and satellite network, respectively. Complementary Split-Ring Resonators (CSRR) are etched at the feed line and ground plane, and a C-shaped curve is used to reduce interference between the ultra-wide band and narrowband. The mutual coupling of CSRR enables the MIMO architecture to achieve high isolation and polarisation diversity. With prototype dimensions of (60.4 \u00d7 60.4) mm The demand for high data rates in reliable communication has driven advancements in RF and microwave engineering, particularly in the field of wireless communication, which is widely acknowledged as one of the most significant contributions to the technology world. This technological revolution has resulted in the widespread use of digital data. To meet these increasing expectations, Ultra-Wide-Band (UWB) technology was introduced, offering improved communication accuracy, speed, and efficiency of data transmissions. The appeal of UWB technology has grown over the past few decades due to its desirable features such as accuracy, high data rates, and cost-effectiveness. The Federal Communications Commission (FCC) defines UWB within the frequency range of 3.1\u201310.6 GHz . UWB tecDespite these advancements, challenges remain in terms of antenna size, multiple notching, and additional elements for coupling reduction. In this paper, we present a 4 \u00d7 4 crescent-shaped monopole UWB-MIMO antenna system that addresses these size and notching challenges and reduces coupling without the need for additional elements. The proposed system achieves multiple notches for C-band, WLAN, and satellite networks through the etching of Complementary Split-Ring Resonators on the patch elements, ground side, and C-shaped structures. The MIMO antenna system is arranged in an orthogonal configuration to achieve pattern diversity and polarization diversity. The proposed design covers a bandwidth from 2 GHz to 13 GHz. The notching characteristic enables the mitigation of coexisting sub-bands in the UWB region, reducing interference without the complexity of additional circuits. Moreover, the proposed design achieves high isolation in the MIMO system through the mutual coupling of Complementary Split-Ring Resonators, resulting in a miniaturized design. The multitasking of CSRR makes the article novel and differentiable. This miniaturized design is particularly suitable for wireless communication. The multitasking of CSRR is organized in the manuscript as follows: In The UWB design achieves a bandwidth of 2 GHz to 13 GHz by feeding a rectangular patch with a ground plane.Notching characteristics are introduced in the UWB frequency range by placing a CSRR at the feeding point of the patch and another CSRR in the ground plane. Additionally, a curve shape is employed to create a notch for the satellite network band. The CSRR in the feeding line rejects the C-band, while the CSRR in the ground plane rejects the WLAN bands. Both CSRR elements increase the coupling effects and filter high-traffic bands.The 4 \u00d7 4 MIMO configuration is achieved by arranging the monopole antennas in an orthogonal configuration, providing pattern diversity and polarization diversity.High isolation within the MIMO system is achieved by utilizing the mutual coupling of CSRR elements at the patch and ground plane, effectively reducing coupling in the MIMO design system.A monopole UWB-MIMO antenna system with triple notching features for C-band, WLAN, and satellite networks is presented. The notching characteristic is achieved by etching Complementary Split-Ring Resonators (CSRR) at the patch elements and ground side, and the third notch is achieved with the C-shape. The 4 \u00d7 4 MIMO antenna system is arranged orthogonally to achieve pattern and polarisation diversity. Because of the symmetric positioning of the antenna port components, as well as the mutual coupling of Complementary Split-Ring Resonators, which block the RF signal between the port elements, the MIMO antenna obtained good isolation. In this article, the etching of CSRR achieves both notching qualities and excellent isolation in the MIMO system. The proposed antenna is fabricated on an FR-4 substrate with a dielectric constant of 4.4, loss tangent of 0.02, and a thickness of 1.6 mm. The geometry and dimensions of the monopole, 4 \u00d7 4 MIMO, CSRR, and Arch shape or C-shape are illustrated in Interference poses challenges in wireless communication reliability. To address this issue in UWB technology, a notching approach is proposed. The UWB frequency range, designated by the FCC, spans from 3 GHz to 10 GHz. However, WLANs, WiMAX, and satellite links utilize different portions of the radio spectrum, resulting in potential interference when heavily utilized. Interactions between the UWB and occupied narrow bands lead to interference. To mitigate this interference, various parasitic slots are introduced at specific positions, and CSRR elements are incorporated into the final design to reduce interference between the UWB and narrow bands.To enhance performance and mitigate interference in the designated UWB frequency range, a notch in the C-band is introduced. By etching a square-shaped CSRR onto the patch\u2019s feed line, the desired notching characteristic for the C-band is achieved. The CSRR length can be adjusted to fine-tune the notch. Equation  providesFurthermore, when a CSRR is placed at the ground plane, it enables the attainment of a WLAN notch band characteristic. This notching characteristic effectively eliminates crosstalk between the narrow WLAN band and the UWB bands, which experience a high volume of data transfer. The corresponding wavelength of the CSRR, as determined by Equation , is calcSatellite networks often face disruptions in communication rates due to the significant amount of data being transferred among users. By placing a C-shaped (curve-shaped) element in the patch\u2019s center, a notching band can be created for the satellite network. The notch at the satellite network was introduced by the C-shaped curve, which also reduced interference. For the satellite network, the notch frequency was introduced at an estimated arc length of 2.8 mm as shown in The notching characteristics at the C, WLAN, and satellite networks are shown in The simulated and measured results are in good agreement. The simulated gain can go from \u22128 to 5 dB. Gain improves at in-band frequencies and degrades in notch-frequency ranges. As a result, we may say that the in-band frequency has high gain and low signal suppression, while the notched band has low gain and strong signal suppression. The gain of the antenna is represented in The resonant behavior of the system can be elucidated by examining the surface current distribution on the top and bottom metallic layers, as illustrated in The provided monopole, crescent-shaped, 4 \u00d7 4 MIMO antenna exhibits a circular configuration in The inter-antenna correlation is evaluated using the envelope correlation coefficient (ECC) of the UWB MIMO antenna\u2019s diversity parameter. In a MIMO system, low correlation between antennas is desirable, and therefore the ECC (envelope correlation coefficient) value should be close to or at its minimal value, which is zero. In the case of the MIMO antenna system under investigation, it is crucial for the ECC to remain below a certain threshold throughout the entire operating frequency range. Specifically, the ECC should be less than or equal to 0.5 to ensure satisfactory performance and can be calculated using Equation .(2)ECC=The equation establishes a relationship between the Diversity Gain (DG) and envelope correlation coefficient (ECC). When there is a higher degree of correlation among the antennas, the signal power generated by the MIMO system diminishes, leading to reduced reliability of the communication link. As depicted in Figure, the correlation between the antennas is relatively weak, and the design yields the strongest signal. The ECC value is low, while the DG value approaches 10 dB across the entire frequency range. Mean Effective Gain (MEG) represents the power received by an antenna. To ensure good diversity performance, the MEG threshold should be below MEG < 3 dB. Due to the MIMO antenna system\u2019s excellent isolation, a low MEG value can be achieved. The provided Equation  can be uIn this article, a small-sized crescent monopole UWB MIMO antenna is presented, which demonstrates triple notching characteristics at the C-band, WLAN band, and satellite band frequencies of 4.5 GHz, 5.5 GHz, and 8.8 GHz, respectively. The implementation of Complementary Split-Ring Resonators (CSRRs) in the feeding line of the patch for C-band notching and on the ground plane for WLAN band notching, along with a curved C-shaped structure on the top of the patch for satellite network notching, successfully achieves the desired notching properties. The orthogonal positioning of the MIMO antenna system enables high isolation, pattern diversity, and polarization diversity. The diversity parameters, including ECC < 0.5, DG \u2265 10, TARC < 0, and CCl < 0.4 bits/s/Hz, are achieved, indicating improved performance. The incorporation of CSRRs in this study effectively achieves notching and high isolation for the system. The simulated and measured results are in good agreement, validating the proposed monopole crescent-shaped UWB-MIMO antenna. Overall, the presented antenna design, with its small size and desirable characteristics, is well suited for wireless communication, portable system devices, and WLAN systems."}
{"text": "The patch was supported by the FR4 dielectric, which had a permittivity of 4.4 and tan \u03b4 = 0.02. A 50 \u2126 microstrip line fed this antenna. The antenna was designed by the HFSS program, and after that, the simulated results were validated using the measured results. The measurement results confirm that the suggested antenna achieves dual-band frequencies ranging from 2.30 to 4.10 GHz, and from 6.10 GHz to 10.0 GHz, resonating at 2.8, 3.51, 6.53, and 9.37 GHz, respectively, for various applications including commercial, scholarly, and medical applications. Moreover, the antenna\u2019s ability to operate within the frequency range of 3.1\u201310.6 GHz is in accordance with the FCC guidelines for the use of UWB antennas in breast cancer detection. Over the operational bands, the gain varied between 2 and 9 dB, and an efficiency of 92% was attained. A good agreement between the simulation and the measured results was found.In this paper, a compact dual-wideband fractal antenna is created for Bluetooth, WiMAX, WLAN, C, and X band applications. The proposed antenna consists of a circularly shaped resonator that contains square slots and a ground plane where a gap line is incorporated to increase the gain and bandwidth with a small volume of 40 \u00d7 34 \u00d7 1.6 mm Globally, wireless communications are expanding rapidly. Given the speed of installation of wireless networks compared to that of building wired infrastructure to cover a specific area, wireless equipment is becoming more affordable and simpler to use ,2. MicroIn response to the need for compact and high-performance antennas, antenna designers have developed a new type of patch antenna that incorporates fractal geometries. Fractal geometries are composed of numerous segments that are precisely alike but with varying size scales. This concept was first introduced in 1983, and antenna designers are now utilizing it to create antennas that outperform traditional patch antennas. By combining fractal shapes with patch antennas, a multiband frequency antenna with high gain can be achieved. The incorporation of capacitive and inductive loads onto the patch surface enhances the antenna\u2019s frequency operation, resulting in a wider bandwidth and a multiband response.The need for wider bandwidth, multiband, and low-profile antennas is rapidly increasing, with both the commercial and military fields requiring multifunctional communication systems that can operate at multiple frequency bands.The literature describes many strategies for creating multiband operations to accommodate developmental requirements ,32,33,34Fractals are recursive in nature ,20. The 3 reduced dimensions.A number of applications, including Wi-Fi, biomedical applications, C band, radar, satellite communication, and wireless computer networks, are covered by the work mentioned by Anita Garhwal and others . In orde3. The reconfigurable antenna is employed by the researchers of  GHz, 1.06  GHz, 0.39  GHz, and 2.09  GHzIn the fourth iteration, the ground was modified by a rectangular slit with a 1 mm thickness, and this modification offers two operating bands,  GHz and  GHz. In the proposed antenna, a \u2018\u2018L\u201d shape is welded on the partial ground that gives two wide bands with impedances of 1.84  GHz and 3.9  GHz, as shown in This patch is applicable to the WLAN, C, and X bands, Bluetooth, and WiMAX. To clarify, the proposed antenna was designed to operate within the frequency ranges typically associated with C and X bands. While the frequency range of 2.30 GHz to 4.10 GHz technically falls under the S-Band, it is sometimes referred to as the lower C-Band (3.7\u20133.98 GHz). Additionally, the frequency range of 6.10 GHz to 10.0 GHz partially falls within the IEEE-defined C-Band range and is also considered part of the X-Band. Therefore, while the antenna may not cover the entire spectrum of C and X bands, it is compatible with many applications within these frequency ranges. It is concluded that during the antenna\u2019s evolution, the S-parameter curves are improved. The antenna evolution results are presented in The suggested antenna has was the subject of comprehensive study to optimize its design and it was found that its current design offers the best bandwidth performance. Through a parametric study, multiple design options were considered and their effectiveness was tested to arrive at this conclusion. Therefore, the current design appears to be the most efficient and effective option for achieving the desired bandwidth.The proposed fractal antenna has a wideband operation and improved gain. These parameters were reached through a parametric study using HFSS electromagnetic solver high-frequency structure simulator. By changing just one parameter while holding the other parameters constant, the suggested antenna performance was tested.A.Effect of the rayon, RThe antenna patch radius is crucial in determining how much the resonant frequencies vary. B.Effect of the position of Lg1To further improve the performance of the antenna, a slit in the ground plane was inserted. The change in slot position in the partial ground has a significant effect on the wideband operation of the monopole antenna. A decrease in bandwidth is observed when shifting from the suggested value of \u2018Lg1\u2019, as shown in C.Effect of the position Lg12 was used to fabricate the suggested fractal antenna to validate the simulation results. The antenna was designed and optimized using the HFSS software 17.2, which is based on the finite element approach (FEM). An FR4 substrate of the optimal size of 40 \u00d7 34 mmUsing a vector network analyzer, the suggested antenna reflection coefficient was measured. The proposed prototype antenna covers the range of frequencies from 2.26 to 4.10 GHz and from 6.10 to 10 GHz with an impedance bandwidth of 1.84 and 3.90 GHz successively, and with reflection coefficients of \u221228.38 dB, \u221227.62 dB, \u221221.94 dB, and \u221217.45 dB, respectively. The suggested antenna matches the bandwidth requirements of several wireless protocols, such as WiMAX , WLAN (2.4\u20132.484 and 5.15\u20135.825 GHz), C band (6\u20138 GHz), and X band (8\u201310 GHz).An anechoic chamber, such as that seen in The comparison between the measured and simulated radiation efficiency of the antenna is presented in 2 but a small bandwidth. The authors of  GHz and the bandwidth of 3.9 GHz  GHz is for the second band, with four resonant frequencies of 2.8 GHz, 3.51 GHz, 6.53 GHz and 9.37 GHz. In the operational band, this antenna can achieve a radiation efficiency of 92% and a peak gain of 9 dB.To effectively cover WLAN, C band, X band, Wi-Fi, Bluetooth, and WiMAX applications, this work presents the design and fabrication of an innovative ultra-wideband patch antenna. This antenna has compact dimensions of 40 \u00d7 34 \u00d7 1.6 mm"}
{"text": "The operating bandwidth of the proposed UWB antenna extended from 3 GHz to 25 GHz at \u22126 dB reflection coefficient (VSWR \u2264 3) and extended from both 3.5 to 12 GHz, from 16 up to 22 GHz at \u221210 dB impedance bandwidth (VSWR \u2264 2). This was used to harvest RF energy from most of the wireless communication bands. In addition, the proposed antenna integrates with the rectifier circuit to create the rectenna system. Moreover, to implement the shunt half-wave rectifier (SHWR) circuit, a planar Ag/ZnO Schottky diode uses a diode area of 1 \u00d7 1 mm2. The proposed diode is investigated and designed, and its S-parameter is measured for use in the circuit rectifier design. The proposed rectifier has a total area of 40 \u00d7 9 mm2 and operates at different resonant frequencies, namely 3.5 GHz, 6 GHz, 8 GHz, 10 GHz and 18 GHz, with a good agreement between simulation and measurement. The maximum measured output DC voltage of the rectenna circuit is 600 mV with a maximum measured efficiency of 25% at 3.5 GHz, with an input power level of 0 dBm at a rectifier load of 300 \u2126.This paper presents a single-substrate microstrip rectenna for dedicated radio frequency energy harvesting applications. The proposed configuration of the rectenna circuit is composed of a clipart moon-shaped cut in order to improve the antenna impedance bandwidth. The curvature of the ground plane is modified with a simple U-shaped slot etched into it to improve the antenna bandwidth by changing the current distribution; therefore, this affects the inductance and capacitance embedded into the ground plane. The linear polarized ultra-wide bandwidth (UWB) antenna is achieved by using 50 \u2126 microstrip line and build on Roger 3003 substrate with an area of 32 \u00d7 31 mm The progress of portable electronic devices in this modern era depends mainly on wireless data transmission technology. This technology has evolved from designing an external antenna to an internal antenna in advanced electronic devices, which requires necessary changes in the shape and performance of the antenna . These a2 and operates in wideband frequency range extending from 3 GHz to 10 GHz and from 16 GHz to 20 GHz. The shunt half-wave rectifier (SHWR) topology shown in In this paper, a complete multiband rectenna is designed and fabricated using an in situ synthesized Ag/ZnO planar Schottky diode. First, a low-profile linear-polarized UWB monopole harvest antenna was designed with the working frequency to cover most wireless communication, with a lower sub-band of 5G and UWB ranging from 2.5 GHz to 25 GHz. A metallic patch radiator in the form of a clipart moon-shaped cut with a semi-circular ground plane along with a U-shaped stub provides good impedance matching. The proposed UWB antenna has a bandwidth of 20 GHz and a peak gain of 5.1 dBi, with omnidirectional characteristics in most of the working bands. Two 3D electromagnetic software were designed and simulated the proposed antenna using computer simulation technology (CST) and Ansys high-frequency structure simulator (HFSS). The genetic algorithm optimization in HFSS version 15 is used to optimize the rectenna dimensions. A planar Schottky diode (PSD) consists of an n-type semiconductor ZnO with an Ag electrode and is synthesized using ADS 2008 (Advanced Design System free version), with both DC and RF performance used for the rectifier design. The synthesized PSD has a current density of 0.1 mA/cmThe design of the proposed monopole antenna is discussed in this section in terms of design procedure, current distribution, fabrication, measured results, and the radiation pattern.3. The antenna could be easily integrated on the same substrate with a rectifier circuit to assist in the RF energy harvesting applications of the mobile device. r\u03b5 = 3, and thicknesses of h and tan \u03c3, as shown in oW and a length of oL. The ground plane has a rectangular shape with an etched rectangular slot and a curved shape at the top. The antenna\u2019s dimensions are carefully chosen and optimized using both Microwave Studio CST version 2022 and HFSS version 15, and the dimensions values of the designed antenna as marked in The proposed antenna is a compact printed antenna with overall dimensions of 32 \u00d7 31 \u00d7 1.575 mmoW, oL), which is 50 \u03a9, and two exclusive non-central circular patches with inner cuts for obtaining the required frequency band-shape slot on the top and a semicircular ground plane with a rectangular truncation on the bottom.This section displays and discusses the design steps of the developed antenna. The detailed structure of the linear polarized UWB monopole antenna is shown in h, w are the hight and width of the transmission line.The effective dielectric constant  and (3), according to the standard formula ,9.rfD1 is the outer dimension of the clipart moon shaped, , as shown in The second step of the design antenna (2) is the etching of small circles, which has an important effect on the impedance bandwidth, as shown in For the third design step, a U-shaped slot is etched under the 50 \u03a9 feed transmission line, as shown in The final design step of the proposed monopole is achieved using a modified ground plane to increase the electrical length by etching a semi-circular defective ground structure in the ground plane. The current distribution is perturbed by inserting an elliptical slot in the radiator, which yields the creation of a novel wideband around 15 GHz and enhances the impedance bandwidth of the final shape to extend from 2.5 GHz to 22 GHz, as shown in The simulated surface current distribution of the proposed antenna at different resonant frequencies is shown in 11| and voltage standing wave ratio (VSWR) of the proposed monopole antenna versus frequency with optimal design are shown in The proposed monopole antenna is a fabricated and manufactured prototype of the proposed UWB antenna as shown in In this section, the far-field radiation patterns and gain at some matched frequencies could be achieved. The photo of the measure radiation pattern setup is custom-made in the electronics Research Institute, Microstrip Lab, and shown in The comparison between simulation and measurement of the gain and radiation efficiency of the proposed UWB antenna is shown in The antenna radiation efficiency is measured over the operating bands using the Wheeler cap method ,15 at th2. The proposed diode consists of Ag/ZnO layers supported on a copper layer with the scotch barrier at the Ag/ZnO junction. In this paper, a ZnO n-type semiconductor with an Ag electrode is used to implement PSD for multiband operation with total dimensions of 1 \u00d7 1 mm2.The Schottky diode consists of one layer of a p-type or n-type semiconductor positioned between two metal sides: one represents the electrode which allows charge injection in one direction, while it is blocked in the other . Among t2. A wideband transmission line (WBTL) is first designed using the ratio of the width to length of the WBTL equal to 3 mm/20 mm with 0.25 mm separation and it is implemented on Rogers 3003 substrate. The measured WBTL reflection coefficient is less than \u221220 dBm in the frequency range from 2 GHz to 25 GHz; the proposed diode is then applied on it to investigate the performance of the fabricated diode.The PSD is first fabricated on the same substrate as Rogers (RO3003) and characterized using the design of the rectifier circuit. The device is implemented using nano electronics fabrication, similar to ZnO n-type semiconductor nanoparticle ink  and commercial silver paste Ag electrode with size 1 \u00d7 1 mm11| measured with one side of the WBTL is connected to the ground to obtain the device S-parameter shunt connection performance. To investigate the PSD diode performance, its I/V characteristics are measured using the Keithely 4200 SCS (semiconductor characterization system), as shown in 2, and a maximum current density 0.1 mA/cm2 with an IOn/IOff current ratio equal to four. This is due to the usage of commercial grades of Ag and copper tape; applying a scientific-grade material can improve diode performance. The S-parameter performance of the diode is shown in 2, as shown in C1 = C2 = 2pF, whereas the resistive load could be changed with no effect on the S-parameter.A single matching circuit is designed for multiband operation; this reduces the efficiency compared with the single-frequency matching circuit, but shows a good impact of reduction on the rectifier area. To determine the optimum load used of the rectifier operation, simulations for RF-DC conversion are carried out at different load resistances; then, the RF input signal is applied to the rectifier at different operation frequencies of 3.5 GHz, 6 GHz, 10 GHz, and 18 GHz. The output DC voltage and conversion efficiency simulations for three resistive load values, 300 \u2126, 1 k\u2126, and 5 k\u2126, are shown in dcV is measured. dcV is measured and then used in Equations (4) and (5) to calculate the DC output power DCP and efficiency \u03b7 as:loadR = 300 \u2126 and inP represents the RF input power.A load of 300 \u2126 is used for rectifier implementation, and the rectifier is connected to the antenna and complete rectenna DC output voltage inP) sweep from \u221210 dBm to 10 dBm is applied to the horn and electromagnetic power is radiated to antenna. Output DC from the rectifier is measured using an AVO meter. An input power (2. A shunt half-wave rectifier with an Ag/ZnO PSD is proposed. The PSD has a current density of 0.1 mA/cm2 and has a wideband frequency extending from 3 to 10 GHz and from 16 to 20 GHz, with an area of 1 \u00d7 1 mm2; the measured S-parameters of the PSD are used to design the SHWR rectifier. The proposed multiband rectifier operates at 3.5 GHz, 6 GHz, 8 GHz, 10 GHz, and 18 GHz and has an O/P DC voltage of 400 mV at 0 dBm I/P RF signal, with a total area of 40 \u00d7 9 mm2. The complete rectenna has an O/P DC voltage of 250 mV and 0.21 mW DC power at zero dBm received signal, which can be used for powered portable electronics and tiny sensors with a maximum efficiency of 25% at 3.5 GHz. Aside from its simple fabrication technique and multiband of operation, it is a good choice for RF energy-harvesting modules at different wireless communication applications for battery-less electronics applications.This paper presented the design and implementation of multiband rectenna for RF energy harvesting applications. An UWB moon-shaped cut-printed monopole antenna was designed with a defected curvature ground plane and U-shaped slot to improve the antenna bandwidth by changing the inductance and capacitance in the ground plane. The proposed UWB antenna is fed by a 50 \u2126 transmission line and built on RO 3003 substrate with an area of 32 \u00d7 31 mm"}
{"text": "A wideband dual-reflector 3D-printed antenna is proposed to operate in the mm-Wave band. The design is based on a Cassegrain reflector optics but including a dielectric piece for merging the feeding system and the support structure of the subreflector. The operational principle of this antenna is presented, as well as the design parameters. Then, a prototype to operate at Ka-band is manufactured combining a 3D-printed technique using PLA as printable material and a spray to coating the antenna, providing a low-cost affordable solution. The different pieces of the antenna are evaluated, and the antenna is also measured in a spherical compact range. An excellent agreement between simulations and measurements is obtained, resulting in a  However, the boost of wireless communications has been reached with the development of the next generation of mobile communications, namely the current fifth generation (5G) or the so-called beyond 5G (B5G) and 6G. These generations demand high energy efficiencies together with high data rate systems to enhance the capacity of communications. Those new specifications require to use large bandwidth or multiple bands, and these three generations intend to use frequencies within the (sub)millimeter band of the spectrum. Several regions, such as Europe, EEUU, or Japan have booked bands centered at 28 and 39\u00a0GHz (FR2), or even plan to work in higher frequencies up to 200\u00a0GHz, to provide high-speed wireless cellular networks3.Wireless technologies have increased their interest throughout the last decade owing to applications such as microwave imaging (MWI)5. These constellations use small platforms, small-geo satellites for geostationary orbits or mega-constellations of CubeSat7 in the lower orbit to provide the telecommunication services. As it is well-known space industry demand the highest performance on their devices, pushing the research community to do their best. Thus, spaceborne antennas are characterized for being always on the edge of technology, reaching the tightest performance in terms of beam shaping, efficiency, or reliability8.In this line, space industry has increased their interest in the development of new solutions based on Low and Medium Earth Orbit satellite constellations to provide 5G global broadband telecommunication service10. In its classical configuration the reflector is illuminated by a primary feed, which needs a feed chain system . However, there are more complex configurations based on dual-reflector topologies, being the most popular the Cassegrain. In this case, the primary feed illuminates the subreflector surface, whose reflection provides the incident field onto the main reflector. This configuration typically improves the gain or radiation efficiency, as well as the radiation performance, such as sidelobe level (SLL), ohmic losses or the noise figure when are compared with single reflectors. The main drawback is the need of supporting structures to hold the subreflector, which increase the blockage losses11. Different structures have been proposed in the literature to obtain self-supported subreflectors, being the most common approach the hat-feed reflectors14. These solutions provide a good trade-off between compact structures and aperture efficiency due to the corrugations used in the metallic hat.Satellite communications usually require high-gain antennas, being parabolic reflector the most popular solution15.Additive manufacturing (AM) has brought a revolution to many engineering areas, having a deep impact on industry. AM should not be only about changing manufacturing process or taking the advantages of new materials. AM is a matter of enabling powerful new concepts or designs which are not affordable by traditional manufacturing, and it can have a noticeable impact on spaceborne antennas. It is applicable to several materials, ranging from polymers or composites to ceramics, or even metals. It fits well for reaching complex design in single-piece (monolithic) structures, which decrease the weight and volume of devices18, namely, to manufacture a dielectric skeleton of the reflector surface using any of the classical 3D techniques, such as SLA or FDM. Then, the skeleton is metallized using vacuum metallization, conductive coating, or electroplating. A further step was introduced in19, which presents a dual-reflector antenna with a novel dielectric self-supported subreflector in Cassegrain configuration. This work proposes an innovative technique to avoid supporting struts taking AM as key factor to manufacture the antenna.AM has been also applied to reflector antennasThis work presents a dual-reflector Cassegrain at Ka-band as a broadband high gain solution to operate between The proposed Cassegrain antenna is made up of a main parabolic reflector, a hyperbolic structure that behaves as a subreflector, and a primary feed as Fig.\u00a011.On this basis, the feed of the proposed antenna is based on a standard waveguide WR28 that works as a feed for the antenna as well as supporting structure. It is connected to a Dielectric Rectangular Waveguide (DRW) by an H-plane linear taper. The DRW is gradually widened in a conical shape as Fig.\u00a019. Two important factors must be underlined here. First, the focal point The details of the design process of each element of the self-supported primary feed and subreflector are further described in20, so that the length 21. For the shortest length the DRW plus taper is matched within the whole desired band, nearly reaching and The resulting antenna optics achieves a well-focused reflector and subreflector, whose outgoing rays are parallel at the antenna aperture despite the dielectric used for propagating the wave. The design parameters, depicted in Fig.\u00a0The antenna is designed at the lower frequency 20 is used for the DRW, cone, and main paraboloid. The metallic surfaces, paraboloid main reflector, hyperboloid subreflector and feeding waveguide are defined as PEC. The planes The antenna optics of Table The effect of the roughness has been also evaluated in full-wave simulations. To do so, two new simulations are carried out considering 22, was applied to the hyperbolic (subreflector) and parabolic (main reflector) surfaces to create a reflecting surface. The manufactured and assembled antenna, after coating it, is shown in Fig.\u00a0The antenna defined by the geometry of Table 21.The manufactured wideband antenna was measured at facilities of the University of Oviedo to evaluate its performance and compare the results with the full-wave simulations. First, the return loss of the antenna was analyzed over Ka-band. The results of Fig.\u00a0Then, the antenna was measured in the anechoic chamber to get its radiation pattern, Fig.\u00a0First, the antenna performance is evaluated at the centered frequencies of the 5G-FR2 band, In addition to dual-band performance, an overall good agreement between simulations and measurements is obtained, and the antenna exhibits stability in beamwidth, gain and pointing direction for the entire Ka-band, see Fig.\u00a0The 3D radiation pattern has been also measured in the anechoic chamber from The antenna gain has been simulated considering lossy and lossless conditions for PLA to evaluate the impact of using this material at mm-Wave frequencies. However, the metallic surfaces are defined as PEC and therefore this effect is not considered in the simulations. As shown in Fig.\u00a0A 3D-printed wideband antenna operating within Ka-band covering the FR2 band is proposed in this work to exploit the increasing interest in mm-Wave communications. A technique based on Cassegrain optics is applied to design the antenna at"}
{"text": "The proposed design characterizes an impedance bandwidth starting from 2.8 to 12.1 GHz (124.1%). Each of the four elements of the proposed MIMO antenna configuration consists of a monopole antenna with PG  that has a slot at its center. The corner of each patch (radiator) and ground slot are rounded for impedance matching. Each unit cell is in an orthogonal orientation, forming a quad-port MIMO antenna system. For reference, the partial ground of each unit cell is connected meticulously with the others. The simulated results of the proposed quad-port MIMO antenna design were configured and validated by fabrication and testing. The proposed Quad-port MIMO design has a 6.57 dBi peak gain and 97% radiation efficiency. The proposed design has good isolation below 15 dB in the lower frequency range and below 20 dB in the higher frequency range. The design has a measured ECC (Envelop Correlation Co-efficient) of 0.03 and DG (Diversity Gain) of 10 dB. The value of TARC  over the entire operating band is less than 10 dB. Moreover, the design maintained CCL (Channel Capacity Loss) < 0.4 bits/sec/Hz and MEG (Mean Effective Gain) < 3 dB. Based on the obtained results, the proposed design is suitable for the intended high data rate UWB wireless communication portable devices.In this article, a compact 4-port UWB (Ultra-Wide Band) MIMO (Multiple Input Multiple Output) antenna is proposed. A low profile FR-4 substrate is used as a dielectric material with the dimensions of 58 \u00d7 58 mm The wireless communication industry is currently experiencing a tremendous growth in the area of Radio Frequency (RF) and antenna design. Researchers are trying to find new ways to design antennas with high data rates and low power consumption. Ultra-wideband (UWB) MIMO (Multiple Input Multiple Output) antenna design is an ultimate choice for short-range wireless applications ,2,3. For2 dimensions. The operating bandwidth of the design is 3.2\u201312 GHz with 4 dBi peak gain. The mutual impedance among the antenna elements is 22 dB without using any decoupling mechanism. Although the design is compact with good performance, the drawback is its complex geometry, which makes the fabrication and testing difficult. A compact 4-port slotted MIMO antenna of rectangular shape is reported in [2. The operating bands of the reported design are 3.25\u20133.75 GHz, 5.08\u20135.90 GHz, and 7.06\u20137.95 GHz with a gain varying between 1.4 and 4.6 dBi. Isolation of 22 dB and TARC > \u221210 dB is achieved using 4-staircase-shaped decoupling techniques. The overall design has a complex structure and decoupling technique. In [2. A Y-shaped slot is introduced at the bottom of the MIMO antenna for isolation enhancement, which results in 15 dB isolation at lower frequencies of the UWB spectrum. A gain varying between 2.55 and 3.58 dBi is achieved over the operating band. The reported design has two elements with complex structures and low port isolation. Another 2-port UWB-MIMO antenna of rectangular shape using CSRR (complementary Split Ring resonator) is reported in [3 with an overall gain between 2 and 5.2 dBi, and 15 dB isolation among ports is achieved. The reported antenna has a band notched with a T-shaped stub in the ground plane. The results of the proposed design show that the designed antenna is not in the UWB frequency range. Moreover, the design exhibits low isolation, which reduces its usefulness for real-time applications. In [3, achieving a 70% efficiency and 15 dB port isolation. The drawback of the reported design is low isolation and a disconnected ground. A planner 4-port UWB-MIMO antenna using a 3 \u00d7 3 EBG (Electromagnetic Band Gap) array structure is reported in [3. The reported design resonates at 3\u201316.2 GHz with a sharp band notch at 4.6 GHz. This design has 17.5 dB isolation with larger dimensions and a disconnected ground. In [2. The antenna has an overall bandwidth of 2.2\u20136.28 GHz, covering LTE (2.2\u20133.8 GHz), Bluetooth (2.4 GHz), WLAN , WiMAX (2.3\u20135.7 GHz), and ISM (2.4/5.2/5.8) bands. However, the reported design has achieved a 4 dBi peak gain and 14 dB port isolation. Larger dimensions and low port isolation reduce the usefulness of the reported design. A 2-port UWB-MIMO antenna with elliptical-shaped radiators is reported in [2. The proposed system operates at 3.1\u201310.6 GHz with low impedance matching and port isolation. Each of the aforementioned designs makes a compromise between size and achieved results. Some of them are compact in size with low gain and port isolation. Some designs show relatively high performance but are larger in size with complex decoupling techniques, which reduces their usefulness.In , a step-orted in . The antique. In , a 2-pororted in . This anions. In , a quad-orted in . The totound. In , a 4-eleorted in . The rep(i)MIMO antennas are helpful in enhancing the data rate without the provision of additional bandwidth.(ii)Achieving high performance, high port isolation, and a compact size without additional structure with the design is challenging.From the literature review, we obtained the following useful information:The proposed design has a partial ground with a rectangular slot to offer a wide band with better impedance matching.Cross-shaped strips above the substrate are symmetrically added among the MIMO elements to enhance the ports\u2019 isolation and impedance bandwidth.The designed antenna is very compact in term of electrical and physical size.A high efficiency and Gain is achieved over the entire operating band.High isolation has been maintained over the operating band with a novel decoupling technique.The scientific novelty of the proposed design is driven by the design simplicity and achieved results. The proposed design has a simple structure without the incorporation of complex techniques or additional structures like metamaterials or metallic vias for the decoupling, bandwidth, and gain enhancement. In this work, a compact four-port UWB-MIMO antenna operating at 2.8\u201312 GHz is reported. The proposed design has a connected ground and a simple decoupling technique. The main contributions of the proposed work are as follows:The rest of the article is structured as follows: The suggested antenna design is discussed in S and LS are the width and length of the substrate, respectively. LP and WP are the length and width of the single patch element, respectively. LF and WF are the length and width of the single antenna element feedline, respectively. Notably, all MPAs have a uniform featured gap of 19 mm. L and SW. To provide the same common reference for the input signal with effective isolation performance between MIMO antenna elements, a whirligig structure was introduced meticulously at the bottom of the substrate. For port isolation, bandwidth enhancement, and mutual impedance matching improvement, two hook-shaped strips of 1 mm width were uniformly placed between the MIMO elements. The dimensions of the hook-shaped structure are characterized by LU and WU. This technique extends the operating band to a lower frequency range, thus making the design compact by reducing the electrical length. All numerical simulations were carried out using CST (Computer Simulation Technology) Microwave Studio 2021. The proposed 4-port UWB-MIMO antenna incorporates four single-unit cell microstrip patch antennas (MPA). As depicted in The detailed evaluation steps of the proposed design are shown in The proposed design starts with the design of a single-antenna element. The unit cell design is based on certain important parameters, which include the variation in the ground plane slot length and width, impact of rounding the radiator and ground slot edges, and impact of the cross hook-shaped strips. Variation in these parameters highly influences the impedance matching and operating bandwidth. A detailed parametric study is discussed below.L\u201d improves the impedance matching and enhances the operating bandwidth. At the ground length of 14 mm, the maximum operating band is achieved. At this length, not only is the bandwidth at its maximum, but there is good impedance matching of the whole operating band. Further increasing the ground length deteriorates the impedance matching at higher frequencies, thus reducing the overall bandwidth.The parametric study starts by analyzing the impact of the ground plane on the reflection coefficients, as depicted in W\u201d improves the impedance matching and operating bandwidth. At the value of 4 mm, the design attains a good impedance matching and bandwidth. Further increasing the ground slot width reduces the impedance matching; thus, a slot width of 4 mm is finally selected. The impact of slot length \u201cSL\u201d on the reflection coefficients is seen in L) has an impact on the operating band and impedance matching. By increasing slot length, the impedance bandwidth improves throughout the operating band. A slot length of 5 mm is finalized. Any further increase in the slot length reduces the operating bandwidth and decreases the impedance matching.The width of the ground slot is another important parameter that impacts the operating bandwidth and impedance matching. Rounding the edges of the radiator and ground slot also impacts the impedance matching. Gradually increasing the curve increases the impedance matching. With the curve of a 2 mm radius, a good impedance matching for an overall operating band is achieved, as shown in The cross hook-shaped strips were placed symmetrically among the MIMO antenna elements. The length and width of the cross hook-shaped patches impact both the reflection coefficients and mutual impedances. The final simulation and measurement results of the proposed design are presented in this section. These results provide details of the proposed design performance. The main performance parameters are reflection coefficients, isolation co-efficient, current distribution, far-field radiation pattern, and gain of the design.With the help of the CST Microwaves Studio 2021 software, the proposed UWB-MIMO system was meticulously designed, simulated, and analyzed. To accurately describe and evaluate the antenna system\u2019s performance, this robust electromagnetic tool was utilized. In order to verify the accuracy of the simulated results, the design was fabricated and experimental measurements were conducted. For the accurate measurement of the antenna far-field pattern, an anechoic chamber was utilized, which eliminates external reflections and interference. A Vector Network Analyzer (VNA) was used to carry out these measurements, which allows for the accurate characterization of the key parameters, including reflection coefficient and gain. During the testing process of the suggested design, Port-1 was connected with input, are other ports were terminated with 50 \u03a9 impedance to ensure proper impedance matching, allowing for reliable and consistent measurements.As indicated in The current distribution provides insight into behavior and operating modes at the target resonance frequencies of the proposed antenna. XY-plane) and magnetic (H) (XZ-plane) far-field radiation patterns at the achieved resonance frequencies are shown in The proposed design\u2019s electrical (E) , diversity gain (DG), channel capacity loss (CCL), mean effective gain (MEG), and total active reflection coefficient (TARC) were analyzed to evaluate the MIMO and diversity performance of the proposed antenna.\u03b8P and \u03c6P are the angular power in elevation and azimuth directions, respectively [ECC measures the correlation or isolation between the various branches of communication; the ECC is a key parameter in MIMO antenna systems. In this study, the suggested MIMO antenna\u2019s far-field patterns were used to compute the ECC, which is represented using Equation (1) . In Equaectively . A suitaectively . The simAnother key variable used to compare the usefulness of MIMO antenna systems to single-antenna systems is diversity gain (DG). Equation (2) is used to calculate DG and measures the strategies to increase the signal quality . In EquaChanel Capacity Loss (CCL) is another vital MIMO antenna parameter. The effectiveness of the suggested design throughput can be demonstrated with the help of CCL. The better the data transfer, the lower the CCL value should be. A desirable CCL value for data transmission is 0.4 bits/s/Hz . EquatioAnother key component in the design of MIMO antennas is mean effective gain (MEG). It is the amount of power received when comparing diversity antennas to isotropic antennas. It demonstrates how the antenna can absorb electromagnetic radiation in a multi-path environment. Using Equations (6) and (7), MEG is calculated . In EquaikS) and phase angle (\u0275).Another key factor of the MIMO antenna is the Total Active Reflection Coefficient (TARC). It is the proportion between the square root of the total power incident and reflected. It is useful in finding out the operational bandwidth of MIMO antenna systems. For a MIMO antenna system, the TARC is determined using Equation (8). In Equation (8), the TARC is determined using the S-parameters (A MIMO antenna system\u2019s TARC should be below \u221210 dB. Therefore, any TARC value below \u221210 dB is seen to be optimal for improved communication. Group delay is another important parameter of UWB antenna design performance. It describes the amount of delay introduced in frequencies while passing through different components of the devices. A large group delay shows the distortion in the transmitted signal. The group delay of the proposed design was determined in two orientations. A novel 4-port UWB-MIMO antenna was successfully designed, simulated, and fabricated. The suggested UWB-MIMO antenna system demonstrates outstanding performance for wireless applications. The antenna elements were arranged symmetrically in an orthogonal manner for good diversity polarization. Two different techniques were introduced to enhance the performance. For the provision of the same reference signal, a whirligig structure was introduced in the ground plane. The impedance matching at lower frequencies and port isolation were effectively enhanced by incorporating an inverted cross hook-shaped strip on the top of a substrate. The UWB-MIMO design demonstrates excellent diversity parameters, including a maximum DG of 10 dB, an ECC of 0.003, TARC less than \u221210 db, MEG better than \u22123 Db, CCL less than 0.4 bits/s/Hz, and over 20 dB port isolation. The fabricated prototype measurements are in close agreement with the simulated results, verifying the robustness and viability of the UWB-MIMO antenna design."}
{"text": "The antenna with a total dimension of 80 mm \u00d7 50 mm \u00d7 0.6 mm (0.12In this study, a novel reconfigurable triple-band monopole antenna for LoRa IoT applications is fabricated on an FR-4 substrate. The proposed antenna is designed to function at three distinct LoRa frequency bands: 433 MHz, 868 MHz, and 915 MHz covering the LoRa bands in Europe, America, and Asia. The antenna is reconfigurable by using a PIN diode switching mechanism, which allows for the selection of the desired operating frequency band based on the state of the diodes. The antenna is designed using CST MWS The Internet of Things (IoT) is a fast-growing network that globally interconnects objects, supporting various input/output devices, actuators, and sensors for real-time data collection, control, analysis, and sharing using standard communication protocols. The IoT has had a great influence on our daily lives and has evolved from machine-to-machine communication to connecting people, objects, data, and services. It is considered a key enabler of Cyberphysical Systems (CPSs), which use IoT to link the physical and virtual worlds .One of the critical challenges in IoT is developing communication protocols that meet the energy efficiency, wide signal coverage, energy conservation, affordability, and prolonged battery duration requirements of IoT devices. Low-Power Wide-Area Network (LPWAN) technology is a solution that meets these requirements and has LoRa as one of its major contenders. LoRa is a patented radio modulation technology that utilizes unlicensed frequency bands below 1 GHz and is suitable for IoT applications because of its availability globally and lower cost. The aim of LoRa is to enable IoT devices to communicate over long ranges with improved network capacity, secured data transmission, reduced device cost, and low power consumption ,3,4,5,6.Owing to regulatory requirements, the operating frequency bands for LoRa in the ISM bands differ according to regions and countries. For example, within the band of 410\u2013441 MHz in China, about 32 channels were defined for LoRa applications . In EuroRobust and sophisticated communication protocols and efficient hardware are vital to accomplishing an efficient communication network. Communication devices use antennas to transmit and receive signals; therefore, an antenna is an integral part of LoRa IoT devices ,12,13,14Conventional LoRa modules are equipped with a single whip antenna operating at a fixed frequency. On the other hand, modern IoT devices communicate over multiple frequency bands. The device will be cumbersome if several single-frequency resonant antennas are used. Hence, there is a need for a single multiband antenna for IoT communication to extend network capacity . It shouReconfigurable antennas are a better choice to overcome these challenges. The concept of reconfigurability in antenna design refers to its capability to adjust its characteristics, such as polarization, radiation pattern or resonant frequency. A reconfigurable frequency antenna can switch its operating frequency to a chosen band. Therefore, the frequency spectrum can be efficiently utilized ,18.The modern printed circuit technology enables easy manufacture of Microstrip Patch Antennas (MPAs), which are also lightweight and mechanically robust. Moreover, these antennas can be integrated with both planar and non-planar surfaces ,20,21. IThere have been a number of documented antenna designs ,40,41,42In , a minia3 using HFSS and Grey Wolf Optimizer (GWO).In , an FR-43 designed to support three antennas operating at four frequency bands was presented in [An IoT terminal with a dimension of 300 \u00d7 30 \u00d7 0.8 mmented in . The ter2 and is switched electronically to achieve four patterns. With a single-slot radiator, the antenna achieved a peak gain greater than 0.5 dB, whereas a gain of 1.6 dB was achieved in the monopole configuration. This antenna has compact and reconfigurable characteristics but is fixed to only one LoRa frequency.A reconfigurable pattern antenna at 868 MHz was reported in . The ant2. It has covered all the LoRa bands in the sub-1 GHz: 915 MHz, 868 MHz, and 433 MHz, with a peak gain of 2.56 dB. This antenna is compact but cannot be tuned to suppress or select a particular LoRa frequency band.A compact wideband double leaf-shaped MPA was reported in . The antThis work presents a compact, novel, triple-band frequency reconfigurable monopole antenna for LoRa IoT applications on commercially available and cheaper FR-4 material. The antenna with a dimension of 80 mm \u00d7 50 mm \u00d7 0.6 mm can be tuned using two (2) RF (Radio Frequency) PIN diodes (D1 and D2) placed strategically in the branches of the antenna. Switching these diodes enables the antenna to operate at 915 MHz, 868 MHz, and 433 MHz, depending on the state of the diodes. These covered the LoRa frequencies across the globe. Meandered radiating monopoles and partial ground plane are employed to achieve compact size and impedance matching of the antenna. To the best of our knowledge, this is the first compact reconfigurable antenna that covered all the LoRa frequencies.The subsequent sections of this paper have been organized as follows: The endless demand for compact and low-cost wireless IoT systems has increased the necessity for miniaturized, compact, and portable antennas. Such compact antennas should fit easily into every small space for IoT applications. Here, the proposed antenna\u2019s methodology, basic structure, theory, design, and reconfiguration mechanism are presented.The geometry of the proposed antenna is shown in \u00ae software environment. The detailed dimensions of the antenna parameters in millimetres are presented in c = speed of light in vacuum and To make the antenna integrable in emerging IoT devices, standard credit card dimensions of 85.6 mm \u00d7 53.98 mm are targeted to be the size of the proposed antenna. The type and characteristics of the substrate were chosen to make the antenna planar, cheaper, and easy to fabricate. The substrate has ented in ,44. A moBy folding the monopole conductors back and forth to form a meandered-line antenna as shown in branches 1 and 2 of Frequency reconfigurability in an antenna refers to the ability to alter the path that current follows on the antenna\u2019s surface, thereby allowing for a shift in resonance to the desired frequency band. Instead of using multiple antennas operating at different frequencies, a reconfigurable frequency antenna can achieve the same function and simultaneously reduce cost and save space. Various techniques and methods are used to achieve frequency reconfiguration, including switches or slots on an antenna\u2019s radiating elements. Electronic switches used for reconfiguration in antenna include Field-Effect-Transistors (FET), Varactor diodes, Micro-Electromechanical Systems (MEMS), PIN diodes, etc. PIN diodes have received much attention for use as a switch in antenna due to their low cost, moderate isolation, less complicated biasing circuitry, and ease of integration with the antenna elements ,46. In tIt is evident from This section presents a discussion and analysis of the performance of the proposed antenna, with a focus on the return loss , triple band reconfigurable monopole antenna for LoRa IoT applications was presented. By utilizing two PIN diodes (D1 and D2) to switch the antenna to different modes, resonance at 433 MHz, 868 MHz, and 915 MHz was achieved, depending on the states of the diodes. When D1 is turned ON, and D2 is turned OFF, the antenna operates in the 433 MHz band, which is the designated frequency for LoRa in Europe. Conversely, when D1 is turned OFF, and D2 is turned ON, the antenna operates in the 868 MHz band, which is also used in Europe for LoRa applications. When both diodes are turned ON, the antenna operates in the 915 MHz band, the designated frequency band for LoRa in North America and some Asian countries. To keep the cost of the antenna low for LoRa IoT applications, the substrate and reconfiguration mechanisms chosen were cost-effective. Additionally, the antenna was miniaturized to have a dimension smaller than the size of a standard \u201ccredit card\u201d. With a peak gain of 2 dBi and a radiation efficiency above 90%, this proposed antenna is novel in terms of size and performance for LoRa IoT applications. The antenna was prototyped and tested to validate its performance, and the results of measurements are in good agreement with those of simulation.In this paper, a novel compact (80 \u00d7 50 \u00d7 0.6 mm"}
{"text": "In this work, a highly miniaturized microstrip antenna array based on two elements is proposed for multiple inputs multiple outputs (MIMO) application systems at sub-6 GHz frequency bands. The antenna is structured from a meander line in conjugate with an interdigital capacitor when excited through the monopole basic antenna. The proposed antenna elements are separated with a Minkowski factor-shaped metamaterial (MTM) column to achieve a separation distance (D) of 0.08\u03bb at 3 GHz when printed on an FR-4 substrate. Later on, the antenna performance in terms of bandwidth and gain is controlled using a photonic process based on optical active switches based on light-dependent resistances (LDR). Therefore, the reconfiguration complexity with such a technique can be eliminated significantly without the need for a biasing circuit. The antenna design was conducted through several parametric studies to arrive at the optimal design that realizes the frequency bandwidth between 3 and 5.5 GHz with a maximum gain of about 4.5 dBi when all LDR terminals are off. For a wireless channel performance study-based massive MIMO environment, the proposed antenna is suitable to be configured in arrays of 64 \u00d7 64 elements. From this study, it was found the maximum bit error rate (BER) does not exceed 0.15 with a channel capacity (CC) of 2 Gbps. For validation, the antenna was fabricated based on two elements and tested experimentally. Finally, it was revealed that the measured results agree very well with simulations after comparing the theoretical calculations with the measured data. Recently, microstrip antennas were introduced in many wireless communication networks including 5G systems for their desired properties, including a low profile and inexpensive fabrication costs . NeverthLater, several studies were applied to design an antenna that supports more than one application; for instance, in  an anten2 when printed on an FR4 substrate of 1 mm thickness.This antenna array is designed from two antenna elements printed on the same substrate for MIMO system design. Each antenna element is structured from three main parts: a printed monopole, an interdigital capacitor array, and a meander line. The proposed antenna is fed with CPW to eliminate the ground plane on the same patch side as well as ensure harmonics generation by accumulating the electrical charge on the ground plane . TherefoFor the MIMO configuration, the authors applied the design of two elements that are mounted on the same substrate with the same direction, as shown in It is important to note that the introduction of the meander line has the effect of producing a frequency band that is distinct from the band emitted by the monopole, as will be demonstrated later. To regulate the mobility of the antenna surface current, an LDR switch is used to link the planned meander line to the antenna ground plane. The key benefit of including the interdigital capacitor in the design is that it may be used to balance the monopole antenna structure\u2019s induction effect and match the electromagnetic aperture coupling to the free space impedance. As will be demonstrated later , this woAs shown in In terms of mathematics, the suggested unit cell was examined from various orientation angles at normal and tangential electric field incidences. Yet, in this inquiry, the planned unit cell iteration was raised from the first to the fourth with a single step. This was done to make sure that the performance of the suggested unit cell is improved by the iteration effects. As a result, the suggested unit cell is situated inside a fictitious waveguide to track the S-parameter spectra at the targeted frequency range. With the application of two electrical and two magnetic barriers to the virtual waveguide, the effective medium theory is invoked in this simulation process. A similar procedure is used to simulate the creation of transverse electromagnetic modes as a plane wave .12 and S11 spectra, are shown in Now, after inserting the proposed unit cell with different orientations and different iterations, the calculated S-parameters, in terms of S11 spectra are investigated with respect to varying the separation distance between the monopole and the ground plane (Xg). Therefore, the considered distance Xg was changed from 1 to 5 mm with a step of 1 mm with respect to monitoring S11 spectra as shown in In this section, the proposed monopole element performance in terms S11 spectra with respect to varying the ground plane length (Yg).Now, to investigate the effects of increasing the ground plane length on the antenna frequency resonance, the authors considered Xg = 3 mm, but the ground plane length was changed from 8 to 5 mm with a step of 1 mm. It was observed that with decreasing the ground plane length, there was a significant decay in the antenna second mode frequency resonance. Therefore, it is concluded the ground plane length (Yg) is better to be 5 mm for our applications. Reducing the length to less than 5 mm is not very desired during the fabrication process due to soldering limitations . The cal11 spectra. Therefore, the monopole width (Xm) was changed from 1 to 5 mm. It was found that the observable variation in the term of S11 spectra is specific to bandwidth, matching, and frequency resonance, as depicted in For further analysis, the authors studied the effects of varying the monopole width on the antenna S11 and gain spectra. Therefore, the proposed IDC iteration number was changed from the first to the fourth degree. The effects of that on S11 and gain spectra are shown in C is the capacitance per unit length (l) with respect to the finger width (W), A1 (the interior) and A2 (the two exteriors) are the capacitances per unit length of the fingers, and N is the number of fingers and can be expressed in microns. For infinite substrate thickness (or no ground plane), A1 = 4.409 \u00d7 10\u22126 pF/mm and A2 = 9.92 \u00d7 10\u22126 pF/mm.Since the introduction of the IDC structure to the proposed antenna could cause a significant performance change, the authors applied a study to evaluate the antenna SNow, the antenna gain spectra over the entire frequency band of interest are discussed with respect to the same IDC iteration variation as shown in 11 and gain spectra variation. As shown in The authors introduced a meander line to examine the effects of coupling between the ground plane and the antenna parts. Such coupling is due to the effects of the electrical field fringing from the antenna edges . The effNow, the antenna gain was found to increase when increasing the turn number, as seen in 11 spectra are insignificantly affected by increasing D. This is a usual response because the fact of changing S11 spectra is relative to varying the antenna elements\u2019 dimensions [12 spectra, the manner of the antenna mutual coupling variation is different; it is increased with decreasing the distance between the antenna elements, as shown in Now, the proposed antenna was designed to be configured as an array with two elements, as shown in mensions . However12 below \u221220 dB, as seen in r) over the frequency bands of interest. Therefore, the propagated surface current toward the array center is a decayed mode with a significant attention factor [Our philosophy in this research was to reduce the antenna element size within a miniaturized array configuration by adding MTM defects. Such an addition can be implemented to minimize the separation distance ultimately to 6 mm with coupling effects in terms of Sn factor .12 reduction is achieved when four-unit cells are introduced to the proposed array, as seen in 12 below \u221220 dB and S11 \u2264 \u221210 dB. It is concluded from these results that the proposed metamaterial array behaves as a stop-band filter to reject most of the frequencies within the frequency band of interest, as discussed later.Now, the proposed antenna array is introduced to a metamaterial unit cell column in the back panel to eliminate the mutual coupling between the antenna edges. In our design, we introduced the proposed unit cell parametrically, from one to four with the step of the one-unit cell, to minimize the mutual coupling altimetry. Therefore, it is observed from the evaluated S-parameters results, in We next evaluated the antenna TRAC using the effective antenna gain for the optimal antenna performance with different signal phase excitations at Port 2 of 0\u00b0, 30\u00b0, 60\u00b0, and 90\u00b0. The obtained results are depicted in The antenna radiation efficiency was evaluated for both cases of with and without MTM introduction. The calculated results are presented in The proposed antenna array was designed for reconfigurable MIMO systems based on sub-6 GHz to suit the applications of 5G networks. Therefore, it is very obvious that such systems require antenna terminals of configurable performance . In our 11 and S12 spectra in 12 spectra are usually a measure of coupling between the adjacent antennas that has no response to LDR-switching scenarios. This observation was discussed earlier in [Our target was to control the surface current on the antenna element by controlling the real impedance at a certain point, in which most of the charge accumulation could accrue . It is wrlier in .2. The proposed antenna S-parameters were measured using an HP vector network analyzer.Now, to validate the proposed antenna array performance experimentally, the proposed array was fabricated using a chemical wet etching process. As seen in The measured antenna radiation patterns were considered at 3.5, 4, 4.5, 5, and 5.5 GHz inside an RF chamber. This process was invocated after calibrating all processes in the channel using the through calibration technique, and open, short, and 50 \u2126 load. The obtained result from the experimental measurements was evaluated for only two switching scenarios; when all LDR terminals are on and off only. The obtained results are shown in Below, the antenna radiation measurements are presented in The antenna performance in terms of correlation and diversity envelopes was evaluated experimentally to be compared with the simulated results in To realize the effects of using the proposed MTM on the proposed antenna performance, a comparison study is summarized at the end of the discussions to focus on the role of the proposed MTM unit cell. In Now, to present a complete picture of the proposed antenna array performance, the authors evaluated the channel capacity (CC) and the bit error rate (BER) under the assumption of constructing an antenna array of 64 \u00d7 64 elements, theoretically only; for such an assumption, we tried to perform an analytical validation of such antenna feasibility for massive MIMO systems. The calculated CC and BER are based on measured results from the antenna elements in terms of gain, bandwidth, and mutual coupling. The channel is affected by white Gaussian noise and the transmitted power was changed from \u221220 to 20 dBm. In such circumstances, the maximum bit error rate was found to be about 0.15, and the channel capacity was found to reach 2 Gbps. The obtained results are presented in erfc is the complementary error function, bE is the bit energy, oN is noise power, and BW is the available bandwidth.The evaluated BER and CC were calculated using the following mathematical expressions :BER=erfcIn those calculations, a digital modulation schema based on quadrature-amplitude modulation (QAM) with an effective coverage was applied to indicate the effects of that on BER. The considered BER in this case is defined as the number of acceptable errors at the prepared tolerates. In such a case, typically, it is a number between 0.1 and 0.000001. This ratio is very much affected by the signal-to-noise ratio (SNR), which is measured in dB. It was found from the results in Finally, the proposed antenna array performance was compared with the published results in the literature in terms of antenna bandwidth, gain, size, reconfigurability, and substrate type. It was observed that the proposed antenna array shows a maximum-size reduction with excellent configuration technique and performance in comparison with the previous one listed in In this paper, the authors designed a miniaturized antenna array for MIMO applications. The proposed antenna parameters were optimized to fit the applications of sub-6 5G networks in terms of mutual coupling reduction, bandwidth enhancements, and gain increase. Therefore, the authors applied in the proposed design several techniques to realize a highly miniaturized antenna array with excellent reconfiguration mechanisms. For this, a monopole fundamental antenna element is conjugated with a meander line and interdigital capacitor to increase the antenna radiation efficiency with low surface wave retardation. In such a manner, fitting the proposed antenna element in a single array could be an excellent addition to MIMO systems by minimizing the separation distance between them using a metamaterial structure. The proposed metamaterial was found to realize a significant mutual reduction of almost \u221220 dB over the frequency band from 3 up to 5.5 GHz with a separation distance of 0.08 \u03bb. This antenna array was tested with different configuration scenarios by adding four LDR switches to each antenna element through the meander line and the ground plane. We realized that such a reconfiguration process takes advantage of low complexity without including wiring or biasing systems. It was found that when exposed to a massive MIMO environment in the proposed antenna array, acceptable BER and CC can be achieved after making the antenna size theoretically 64\u00d764 elements. It is concluded from this study that the proposed antenna array is a very suitable candidate for 5G massive MIMO systems at the sub-6 GHz frequency band. Finally, for validation, an experimental study was applied to the proposed array to test the antenna performance in terms of S-parameters and radiation patterns."}
{"text": "This paper presents a single-fed, single-layer, dual-band antenna with a large frequency ratio of 4.74:1 for vehicle-to-vehicle communication. The antenna consists of a 28 GHz inset-fed rectangular patch embedded into a 5.9 GHz patch antenna for dual-band operation. The designed dual-band antenna operates from 5.81 to 5.99 GHz  and 27.9 to 30.1 GHz (5G millimeter-wave (mm-wave) band). Furthermore, the upper band patch was modified by inserting slots near the inset feed line to achieve an instantaneous bandwidth of 4.5 GHz. The antenna was fabricated and measured. The manufactured prototype operates simultaneously from 5.8 to 6.05 GHz and from 26.8 to 31.3 GHz. Notably, the designed dual-band antenna offers a high peak gain of 7.7 dBi in the DSRC band and 6.38 dBi in the 5G mm-wave band. Vehicle-to-Vehicle communication V2V) is the future of the Intelligent Transportation System . The FedV is the Multiband systems use separate antennas, each operating at a specific band, or a single antenna structure resonating at various bands. Examples of dual-band single-fed planar antennas include patch antennas ,4, co-plA simple way to realize dual-band antennas with a large frequency ratio is to integrate two different frequency antennas on the same aperture ,8,9,10. Indeed, designing a single-layer single-port dual-band antenna with a large frequency ratio is daunting due to the large difference in antenna dimensions. In ref. , a multiIn ref. , a microIn , a stackIn this paper, a low-profile, dual-band antenna with an integrated inset-fed upper band patch and a coupled-fed lower band patch antenna is presented, as depicted in The paper is organized as follows: The dual-band antenna is designed for the Rogers RT/Duroid 5800LZ with thickness t = 1.27 mm, dielectric constant The dual-band antenna was designed and simulated using a full-wave simulator. The surface current distribution of the designed dual-band antenna at the operating frequencies is first analyzed for a better understanding. First, the current distribution at 28 GHz (phase = 0) is examined, as shown in The simulated S11 (dB) of the dual-band antenna see a shows aA parametric study was carried out to further analyze the patch lengths\u2019 effect on the operating frequencies. The bandwidth of the upper band patch can be further improved by adding parallel slits near the inset feed line, as shown in Antenna II operates from 5.8 GHz to 5.95 GHz and 26.8 GHz to 31.3 GHz, as shown in As shown in The designed dual-band antenna with enhanced bandwidth (Design II) was fabricated and measured. The fabricated antenna prototype is shown in The measured radiation pattern of the dual-band antenna with enhanced bandwidth at 5.9 GHz is presented in The measured radiation pattern of the fabricated antenna at 28 GHz is displayed in This section compares the implemented dual-band antenna with other dual-band antennas with a large frequency ratio, as shown in Frequency tunability: This antenna design proposes a frequency-tunable dual-band patch antenna with a high-frequency ratio that can be tuned between 5.9 GHz and 28 GHz.Reduced harmonics between the two bands: The design was optimized for a frequency that included the width and length parameters for the lower band patch. By optimizing the upper patch (lower band patch) design for 5.9 GHz, it was found that the higher-order harmonics at frequencies above 5.9 GHz were reduced because of the lack of proper coupling. Therefore, optimizing the design of the upper patch is a tool that can be used to reduce the effects of harmonics and higher-order modes that could occur at other frequencies.Bandwidth improvement at the upper band: slits introduced additional resonance for the small patch. As a result, the additional resonances were well-coupled to the patch resonance, enhancing antenna bandwidth. In our design, the bandwidth at the upper-frequency band is improved from 8% to 16% by adding parallel slots near the inset-feed line.High gain at both bands: The designed dual-band antenna offers a high peak gain of 7.7 dBi in the DSRC band and 6.38 dBi in the mm-wave band. Both antennas radiate in the boresight direction.; andSingle-layer structure, simple design, and low-cost PCB fabrication.This paper presents a single-layer, single-feed, dual-band antenna with enhanced bandwidth. The designed antenna consists of an inset-fed 28 GHz patch embedded into the 5.9 GHz patch to provide dual-band operation. Furthermore, the bandwidth at the upper-frequency band is improved from 8% to 16% by adding parallel slots near the inset-feed line. The fabricated antenna operates from 5.8 GHz to 6.05 GHz and 26.8 GHz to 31.3 GHz, covering the DSRC and 5G mm-wave bands. Overall, the designed dual-band antenna offers the following:The FCC is modernizing the 5.9 GHz frequency to improve Wi-Fi and automotive safety. The 28 GHz band, within the Ka-band, is utilized by the satellite industry. Both frequencies are also relevant to implementing 5G networks, covering the FR1 and FR2 bands. These frequencies play a crucial role in advancing wireless communication, satellite services, and the development of high-speed connectivity."}
{"text": "This inventive design features a truncated corner monopole accompanied by branched stubs fed by a coplanar waveguide. The stubs, varying in length, serve as quarter-wavelength monopoles, facilitating multi-band functionality at 2.45, 3.5, and 5.8 GHz. Given the antenna\u2019s intended applications in flexible devices and body-centric networks, the conformability of the proposed design is investigated. Furthermore, an in-depth analysis of the Specific Absorption Rate (SAR) is conducted using a four-layered human tissue model. Notably, the SAR values for the proposed geometry at 2.45, 3.5, and 5.8 GHz stand at 1.48, 1.26, and 1.1 W/kg for 1 g of tissue, and 1.52, 1.41, and 0.62 W/kg for 10 g of tissue, respectively. Remarkably, these values comfortably adhere to both FCC and European Union standards, as they remain substantially beneath the threshold values of 1.6 W/kg and 2 W/kg for 1 g and 10 g tissues, respectively. The radiation characteristics and performance of the antenna in flat and different bending configurations validate the suitability of the antenna for flexible devices and body-centric wireless communications.A conformal tri-band antenna tailored for flexible devices and body-centric wireless communications operating at the key frequency bands is proposed. The antenna is printed on a thin Rogers RT 5880 substrate, merely 0.254 mm thick, with an overall geometrical dimension of 15 \u00d7 20 \u00d7 0.254 mm Wearable and flexible electronics have gained significant attention in recent years in the industrial and academic worlds as they provide wide support for personal, Internet of Medical Things (IoMT), sports, military, and other applications ,2,3. IoMIn recent years, microstrip patch antennas have drawn considerable attention from researchers for wearable applications owing to their characteristics of light weight, low profile, ease of integration with electronic circuits, and less design complexity. Lately, several patch antenna designs have been reported in the literature for wearable devices covering the ISM  band ,13,14,15The rapid development of wireless technology requires communication systems to operate over multiple frequency bands supporting diverse applications. However, as compared to single-band and UWB antennas, it is challenging to design multiband antennas, as they require a specific impedance bandwidth within the desired frequency bands. Considering the importance of multiband antennas, several recent works reported wearable antennas operating at multiple frequency bands and utilized various substrates and design methodologies ,22,23,24x- and y-axis ascertains good performance of the antenna, which proves the suitability of the proposed antenna for wearable devices.It is observed that the flexible antennas discussed above for wearable devices operating at dual- and triple-frequency bands have large dimensions as well as complex and multilayered structural designs. It is desirable that body-worn antennas are simple and compact in size. The large size of these antennas hinders their application for several body-worn devices. Considering the limitations exhibited by the works reported earlier, this work proposes a simple, compact, and flexible CPW-fed patch antenna for on-body and off-body wearable devices. This proposed antenna is realized on Rogers RT 5880 flexible substrate with 0.254 mm thickness and operates over the triple bands of 2.45/3.5/5.8 GHz for the ISM and WiMAX frequency bands. As body-worn antennas operate in close proximity to the human body, it is necessary to analyze the effects of electromagnetic wave exposure on the human body. For this purpose, a Specific Absorption Rate (SAR) analysis is also carried out for the proposed antenna, which demonstrates that SAR values meet the standards set by the FCC and European Union of a maximum acceptable SAR range of 1.6 W/kg for 1 g of tissue and 2 W/kg for 10 g of tissue. Also, a conformal analysis in both The design and simulation analysis of the proposed antenna were conducted using CST Studio. The proposed tri-band flexible antenna was modeled using the Rogers RT 5880 with a 0.254 mm thick substrate with dielectric constant of 2.2 and loss tangent of 0.0009. The antenna\u2019s geometry was constructed on the topside of the substrate using standard copper cladding. A CPW-fed rectangular patch was modified using two semicircular slots etched from the top-right and bottom-left corner of the patch. Afterwards, a meandered line stub was loaded at the top-right corner to achieve the lowest band of 2.45 GHz while another stub was loaded at the middle of the patch to achieve a resonance of around 3.5 GHz. Impedance mismatch occurred due to the incorporation of the stubs, which was mitigated by optimizing the various dimensions of the antenna. The final design along with its optimized dimensions are shown in SL) for any desired frequency (df) can be estimated by using the following relationship:c denotes the light speed in free space, t denotes the fraction of free-space wavelength at the central frequency, while HS refers to the thickness of the substrate material, while WS represents the width of the substrate.The design methodology adopted to develop the proposed work is illustrated in The total physical length of the inserted stub is 30 mm which corresponds to the quarter wavelength at the resonating frequency of 2.45 GHz. The shift in lowest resonance as well as the impedance mismatching at the higher resonance needed further optimization to cover the targeted bands and to achieve the desired results. For this purpose, a parametric sweep was carried out by tunning the total length of both stubs one by one, as shown in Likewise, the parametric analysis of the shorter stub shows that changing the overall length of the stub resulted in a slight shift in the middle resonance from 3.5 GHz towards higher frequencies along with a decreased impedance-matching performance at the highest resonance. Meanwhile, the 2.45 GHz band remained unaffected while tuning the shorter stub, as illustrated in 11| < \u221210 dB impedance bandwidths of 2.37\u20132.5 GHz, 3.37\u20133.65 GHz, 5.2\u20137.7 GHz, respectively, as depicted in In this way, the antenna is optimized for the targeted band spectrum of 2.45 GHz, 3.5 GHz, and 5.8 GHz having |Sx- and y-axis, at two radii of 10 and 20 mm, as shown by the simulation setup in 11| results for bent configurations at different axes and radii in As the proposed antenna is targeted to wearable devices supporting body-worn applications, it is therefore compulsory to verify the performance of the antenna in different conformal conditions . ConsideIn order to validate the results of the proposed antenna, experimental investigations were performed on the fabricated prototype, as illustrated in 11| results due to the fact that the simulation model was excited using a 3D SMA-connector. The proposed antenna offers three resonances around 2.45, 3.5, and 5.8 GHz having an |S11| < \u201310 dB impedance bandwidth of 2.37\u20132.5 GHz, 3.37\u20133.65 GHz, and 5.2\u20137.7 GHz, which correspond to the percentage bandwidths of 5.3%, 8%, and 43%, respectively. It is important to note here that the proposed work covers the band spectrums of ISM-band (2.45/5.8 GHz), 5G sub-6-GHz (3.5 GHz), WLAN (2.4/3.6/4.9/5/5.9/6 GHz), Wi-Fi (2.4/5 GHz), and Wi-Fi 6E (6 GHz). Thus, this makes the proposed work a potential candidate for heterogenous applications requiring a multi-band antenna of compact size.A strong correlation is observed between the estimated and measured |SThe far-field behavior of the proposed tri-band antenna is observed at the selected frequencies of 2.45 GHz, 3.5 GHz, and 5.8 GHz, as depicted in The gain of the proposed antenna was also measured in an RF-isolated chamber by placing the antenna in front of a reference wideband horn antenna with standard spacing of 2 m, as shown in y- and x-axis, as depicted in To analyze the performance of the antenna for wearable devices, a conformability test was also carried out. The antenna was bent along pieces of Styrofoam having radii of 10 mm and 20 mm in both the 3. The antenna as placed with a gap between it and the tissue model, and the order of the layers along with their respective thicknesses are illustrated in As wearable devices work close to the human body, the absorption of electromagnetic radiation by human tissue is hazardous. In order to ensure the safety of individuals, there are established standards for regulating the exposure of human tissues to electromagnetic (EM) radiation. These standards have been set forth by reputable organizations such as the International Commission on Non-Ionizing Radiation Protection (ICNIRP), the Institute of Electrical and Electronics Engineers (IEEE), and the Federal Communication Commission (FCC). These organizations play a crucial role in defining and enforcing guidelines to minimize the potential health risks associated with EM radiation exposure, thereby safeguarding human well-being. According to these regulatory bodies, human exposure at lower frequencies is evaluated in terms of SAR. The permittivity and conductivity of the various layers are provided in In The flexible antenna proposed in this work is compared with recently published wearable antennas to further elucidate the merits of the proposed antenna. This comparison is summarized in 3. The primary goal of this antenna is to serve flexible and wearable devices within body area networks. To ensure its compatibility with such applications, the antenna\u2019s flexibility is assessed through bending tests along both the x and y axes, at various radii. Additionally, an SAR analysis is conducted using a four-layered human tissue model to ensure safety. The obtained SAR values for the proposed antenna design at frequencies of 2.45 GHz, 3.5 GHz, and 5.8 GHz are determined as follows: 1.48 W/kg, 1.26 W/kg, and 1.1 W/kg for 1 g of tissue, and 1.52 W/kg, 1.41 W/kg, and 0.62 W/kg for 10 g of tissue, respectively. Importantly, all these values remain below the safety thresholds established by the FCC and European Union, which are 1.6 W/kg and 2 W/kg for 1 g and 10 g of tissue, respectively. Furthermore, the antenna\u2019s radiation characteristics and performance are evaluated both in its flat and in various bending configurations. These assessments confirm the antenna\u2019s suitability for wearable wireless communication devices, underscoring its effectiveness and real-world performance.This paper introduces a compact and flexible antenna capable of operating in three frequency bands: 2.45 GHz, 3.5 GHz, and 5.8 GHz. These bands are significant for ISM  and WiMAX applications. The antenna design incorporates a slotted rectangular patch configuration with a coplanar waveguide feedline. It is fabricated on a 0.254 mm thick Rogers RT 5880 substrate, with overall dimensions measuring 15 \u00d7 20 \u00d7 0.254 mm"}
{"text": "A wideband superdirective array, composed of a two-element circular monopole configuration, is introduced. The monopoles are placed in close proximity, facing each other on a metal ground. To ensure good matching at high frequencies, two pairs of elliptical patches are added to the sides of the monopoles, enhancing the surface current of the circular patch for wideband performance. To achieve equal amplitude excitation and the desired phase difference, a wideband power divider with a phase shifter is designed to feed the antenna array. Simulation and measurement results demonstrate that the proposed wideband antenna array, operating within the frequency range of 2.94\u20137.93 GHz, exhibits a maximum directivity of 8.36\u201310 dBi, with an antenna efficiency ranging from 47.86 to 83.18% across the bandwidth. The proposed array has the advantages of miniaturization, high directivity and wideband operation and can be widely used in various portable wireless communication systems, including WLAN (5.05\u20135.9 GHz), ISM (5.725\u20135.875 GHz), 5G communication (3.3\u20133.8 GHz), etc. Superdirective antenna arrays can be designed to achieve higher levels of directivity compared to conventional antenna arrays, improving communication distance and quality [Communication performance is limited by fading channel and spectrum resources ,2,3. For quality ,9,10. Es quality ,12.Although many superdirective antennas/antenna arrays have been reported, a tradeoff can be gained among antenna/array size, gain/directivity and bandwidth. For example, the superdirective antenna/antenna arrays in ,14,15,16In this study, a two-element, closely spaced superdirective antenna array loaded with parallel elliptic-shaped patches is designed for wideband operation. The circular monopole provides wideband impedance characteristics at 3.04\u20135.82 GHz (within the low-frequency band). To further expand the bandwidth, two pairs of parallel elliptic-shaped patches are added to the monopoles. These loaded patches enhance the surface current of the circular patch at high-order modes, enabling resonance at higher-frequency bands. Additionally, a wideband power divider with a phase shifter is designed to achieve the desired excitation. Through careful optimization of the spacing and phase difference between elements, the proposed antenna array achieves a high directivity of 8.36\u201310 dBi across a wider frequency bandwidth of 2.94\u20137.93 GHz. Compared to the state-of-the-art designs, our design exhibits miniaturization, high directivity and wideband operation and can be widely used in various portable wireless communication systems, including WLAN (5.05\u20135.9 GHz), ISM (5.725\u20135.875 GHz), 5G communication (3.3\u20133.8 GHz), etc.The superdirective microstrip antenna is arrayed as shown in To achieve high directivity over a wide bandwidth, the antenna impedance with different spacing between the elements is investigated, as displayed in The phase difference between the two elements is studied while the amplitude of the excitations is kept constant over the impedance bandwidth. It can be seen from It is well known that radiation properties and impedance bandwidth can be improved by loading arms or plates . AccordiThe simulated reflection coefficient |S11| of the two-element monopole array with and without loaded patches for different values of element spacing S is shown in To feed the superdirective array, a wideband Wilkinson power divider with a phase shifter printed on the same TP substrate with a thickness of 1 mm is designed for the desired excitation, as shown in 2 of the loaded patches, as shown in 2. Despite the frequency shift, the overall trend remains basically the same. Although a discrepancy in the reflection coefficients exists between the simulation and measurement, the simulation results are in reasonable agreement with the experiments. The radiation performances of the wideband superdirective array are measured in the anechoic chamber. The simulated and measured radiation patterns are shown in The proposed superdirective array with loaded patches is fabricated as shown in The antenna array with a feeding network can work at the broadband of 2.94\u20137.93 GHz (|S11| < \u221210 dB) while maintaining a good radiation pattern in the frequency band below 7 GHz. It is worth noting that |S11| is the amplitude rather than the phase. With the introduction of a close-spaced array, the phase difference \u0394\u03a6 of the feeding network at the two ports changes and is different from that without an antenna array, especially at 7 GHz. To investigate this, we simulated the surface current distribution of the feeding network with and without the monopole array, as displayed in 2 + 2ka, where k is the wave number and a is the radius of the smallest sphere that encloses the antenna. The measured directivity of the antenna array is higher than the Harrington normal directivity limit when the frequency is lower than 4.87 GHz with a bandwidth of 49.42%, indicating that superdirectivity characteristics are obtained by the proposed array.The measured maximum directivity of 8.36\u201310 dBi and antenna efficiency of 47.86\u201383.18%, which are slightly lower than those in the simulation  over the wide frequency operation, but the tendency of the two results is basically consistent. Regarding the decrease in the antenna efficiency at 7 GHz, it may be caused by the appearing grating lobe with the additional feeding network. The normal directivity as defined by Harrington [The design guidelines of the proposed broadband superdirective antenna array are summarized as follows.Step 1: Wideband array element design. To achieve broadband, a circular monopole with wideband characteristics is chosen as the array element, as displayed in Step 2: Broadband superdirective array design. The two monopole elements are arrayed face to face, as shown in Step 3: Wideband feeding network design for the broadband array. A power divider with a phase shifter is designed to feed the broadband superdirective array for the same amplitude and different \u0394\u03a6. Then, the superdirective array with the feeding network is established, as shown in The performance of this work is fair compared with some recently published wideband superdirective antenna arrays, as listed in In this study, we have presented a wideband superdirective monopole array. To achieve the desired excitation, a wideband power divider and phase shifter with a T-shaped open stub is used to feed the broadband array. By incorporating elliptic-shaped patches, we are able to further expand the bandwidth of the antenna array, achieving good matching across the frequency range of 2.94\u20137.93 GHz  while maintaining high directivity and good antenna efficiency. Overall, the proposed array has the advantages of wide bandwidth, high directivity and good efficiency, and it can be widely used for mobile devices, sensors and small-sized communication devices."}
{"text": "The antenna\u2019s key characteristics are compact size, wide-band sub-GHz operation, dual sense CP, polarization bandwidth reconfigurability and good MIMO performance. Thus, it is a suitable candidate to be utilized in CubeSats applications in sub-GHz bands.In this letter, a compact, planar circularly polarized (CP) sub-GHz slot-based multiple-input-multiple-output (MIMO) antenna with dual sense CP along with polarization bandwidth reconfigurability is presented. The pentagonal reactively loaded slot is fed by two folded tapered feedlines to achieve CP. The antenna offers left-hand-circular polarization (RHCP) with the as well as right hand circular polarization (LHCP). The antenna exhibit linearly polarization (LP) by exciting two ports simultaneously. Moreover, the antenna CP resonance can be reconfigured by varying the capacitance of the varactor diode. The antenna has a wide \u221210 dB operating frequency band from 578\u2013929 MHz. while the axial ratio (AR) bandwidth ranges from 490\u2013810 MHz. Moreover, the two elements MIMO are optimized and placed on compact dimensions 100 \u00d7 100 \u00d7 0.76 mm Slit-slot and microstrip patch-based antennas offer bidirectional CP radiation, where the rotating senses of CP in the front and back sides are presented in9.Circular polarized (CP) antenna offers many advantages over the linearly polarized (LP) antennas due to their decreased polarization mismatch losses, and ability to provide freedom of antenna orientation. Therefore CP antennas are desired for satellite applications, WiMax, WLAN, RFID-tags, and 5G applications. Several efforts have been put in the literature to design CP antennas10. The CP senses can be reconfigured in single port antennas by switching the states of at least two p-i-n diodes16 and MEMS17. These kinds of antennas need additional complex biasing circuitry to control the diode, which increases the cost and reduces the antenna efficiency and CP bandwidth. Alternatively, CP sense reconfigurable antennas utilizing dual-ports have also been presented due to their wide-band characteristics20.Moreover, various methods have been employed to achieve polarization reconfigurable antennas that offer right-handed circular polarization (RHCP) and left-handed circular polarization (LHCP). The ability to operate with both senses (RHCP and LHCP) enables frequency reuse and doubles the capacity of the communication system23. In these designs, varactor and p-i-n diodes are utilized to achieve continuous frequency-polarization agility. At the same time, the switching between three polarization states and tunable working frequency bands are accomplished by microfluidic injection in24.Most importantly, if the antenna can be switched between two senses of CP (RHCP and LHCP) and LP, as well as the operating frequency, it will allow the user to roam to virtually any existing communication network system. Therefore, some works have been reported to designing the frequency and polarization reconfigurable antennas27, they do not offer polarization bandwidth reconfigurability. Additionally, multiple-input-multiple-output (MIMO) configurations are essential for high data rates with seamless connectivity. None of the aforementioned CP antenna with reconfigurability has MIMO capabilities. The proposed polarization bandwidth reconfigurable antenna is compared with state-of-the-art CP antennas. The proposed design is compared with other reference CP designs as shown in Table It is worth noting that most of the CP antenna designs as discussed are operating at frequency bands above 1 GHz band. The design of CP antenna with the features of frequency-polarization reconfigurability with wide-band and compact size characteristics is always challenging at the sub-GHz spectrum. Although many CP antennas have been presented at the sub-GHz band for RFID tags, the internet of things, CubeSat, and several other applicationsCP antennas have several advantages in sub-GHz wireless communication systems, particularly in CubeSat applications. These antennas improve signal propagation, reduce the impact of orientation, mitigate polarization mismatch, and find use in RFID, IoT, and satellite communication systems. The proposed antenna design is suitable for CubeSats operating in sub-GHz bands with CP characteristics. CP antennas are beneficial for satellite communication systems in the sub-GHz frequency range as they enhance signal reception and transmission, compensating for polarization mismatch caused by satellite orientation and ground station antennas. The specific frequency range of 578 to 929 MHz is mentioned as a potential range where circularly polarized antennas are commonly used. This range includes VHF and UHF bands, which are utilized by CubeSats, wireless microphone systems, UHF RFID systems, and certain satellite communication systems. Circularly polarized antennas help maintain consistent signal quality and improve performance in these applications.This letter focuses on the design of compact circularly polarized antenna for CubeSat applications. Most of the sub-GHz antenna for CubeSat operation are 3D structure which needs additional deployment mechanism. Thus, adding more complexity to the CubeSat design. However, the proposed antenna is low profile and planar and doesn\u2019t need any additional deployment structure.This work is based on dual-port slot-based antenna with multiple polarization . A single antenna structure is being utilized to obtain 3 different types of CP at sub-GHz operation.The proposed antenna design is optimized in MIMO configuration with good MIMO performance metrics.The proposed antenna design has the 3-dB axial ratio (AR) bandwidth that can be tuned from 490\u2013810 MHz by utilizing a single varactor diode. This is the prominent feature of the antenna design to provide switching flexibility between narrow-band and wide-band CP operation in wide-band antennas structure.The 2-element MIMO antenna offers a good isolation within a compact size and stable radiation patterns.To the best of the author\u2019s knowledge, this design is the first of its kind that combines the advantages of compact size (100 mm \u00d7 100 mm \u00d7 0.76 mm), polarization bandwidth reconfigurability, narrow & wide bands CP configuration, and MIMO operation at sub-GHz bands.The distinguishing features as described above show the uniqueness and appropriateness of the proposed antenna design to be utilized in CubeSat applications operating at sub-GHz bands.This letter focuses on the design of a dual-port slot-based MIMO antenna with multiple polarization  along with polarization bandwidth reconfigurable MIMO antenna. The novelty and unique features of the proposed antenna design are given below: The schematic diagram of the proposed dual-feed single-element antenna is shown in Fig. The single element was then rotated along the axis with 360-degree for the MIMO configuration while keeping the parameters same of the antenna, as shown in Fig. For the proposed antenna design, a sub-GHz band communications was selected due to its numerous advantages. The slot-based antenna design are quite popular due to its ease of manufacturing, integration with other circuit components, planar structure, wide-band attributes, and omni-directional radiation patterns, all of which are well suited for the proposed antenna design.The proposed slot has been configured in a meandering closed loop pattern to achieve compact size, resembling a non-uniform pentagonal shape as depicted in Fig. Furthermore, a parametric analysis are performed to enhance performance in terms of size reduction and bandwidth expansion. The slot antenna is coupled with a capacitor (Cap), as shown in Fig. The E-field distribution on the antenna for two ports is investigated to explain the CP mechanism of the MIMO antenna Fig. . For porTo understand the circular polarization (CP) mechanism of the MIMO antenna with two ports, the distribution of the electric field (E-field) on the antenna is thoroughly investigated. This investigation aims to analyze the behavior of the E-field and its impact on the radiation characteristics of the antenna. Figure In contrast, when port-2 is excited, the E-field exhibits a counter-clockwise rotation. This counter-clockwise rotation of the E-field generates left-hand circularly polarized (LHCP) radiation. LHCP polarization involves the rotation of the electric field vector in a left-handed circular pattern as the wave propagates. One crucial observation made during this investigation is that during the excitation of ports 1 and 2, there is a negligible effect on antenna 2. In other words, no significant E-field is detected on antenna 2 when both ports 1 and 2 are excited simultaneously. This negligible effect leads to a high level of isolation between the MIMO elements. Isolation is an essential characteristic in MIMO (Multiple-Input Multiple-Output) systems, as it ensures that the signals transmitted from one antenna element do not interfere with the signals received by the other elements. The high isolation achieved in this MIMO antenna configuration helps minimize cross-interference and improves the overall performance and reliability of the system.By investigating the E-field distribution and the resulting polarization characteristics of the MIMO antenna, a comprehensive understanding of the CP mechanism is obtained. This knowledge is valuable for designing and optimizing MIMO antenna systems in various applications, such as wireless communications, radar systems, and satellite communications, where efficient signal transmission and reception are essential.iiThe simulated and measured . The antenna gives RHCP when port-1 (left port) is excited, while it gives LHCP when port-2 (right port) is excited. The simulated AR as a function of the frequency is shown in Fig. The proposed antenna design is capable of radiating in three different polarization modes: LP, RHCP, and LHCP. Unlike other antennas, this design doesn\u2019t require any switching circuitry like p-i-n diodes or MEMS to switch between polarization modes. Typically, polarization reconfigurable antennas use switching mechanisms involving active components, which adds complexity and requires additional circuitry and control mechanisms.In this antenna\u2019s case, LP radiation is achieved by simultaneously feeding both ports (port-1 and port-2) with the desired signals. This results in LP radiation with an Axial Ratio (AR) value exceeding 40 dB. The Axial Ratio measures the circular polarization of the antenna\u2019s radiation, with lower values indicating better circular polarization. By configuring the feeding of the antenna ports appropriately, LP radiation is achieved without the need for switching circuits. This sets it apart from other antennas that rely on additional components for polarization switching.Overall, this antenna design offers the advantage of radiating in different polarization modes  without the complexity and potential drawbacks of switching circuitry. It provides versatility in terms of polarization selection and bandwidth reconfiguration, making it suitable for various applications.The antenna also has the additional advantage of AR bandwidth reconfigurability. The central frequency of the AR can be tuned by varying the capacitance of the diode. The resonance of AR can be shifted from 490 to 810 MHz by changing the capacitance values of varactor diode As shown in Fig. The gain of the antenna for port-1 and port-2 (LHCP and RHCP gain) plots are shown in Fig. The radiation patterns for each polarization scenario are also shown in Fig. The proposed MIMO antenna is also investigated for co-pol and cross-pol patterns at 650 MHz as shown in Fig. The proposed antenna design exhibited omni-directional radiation patterns and providing 360-degree coverage pattern in the azimuth plane, thus enabling communication with multiple ground stations without requiring precise pointing or alignment. This can be particularly beneficial for CubeSats operating in low earth orbit, due to limited resources or maneuvering capabilities.The diversity of the MIMO antenna in terms of envelope correlation coefficient (ECC) is calculated to show how much antenna elements are independent in their performance. The values are found to be very low, less than 0.02, ideal for the MIMO operation.24 do not offer sub-GHz operation and only a few designs24 offer frequency reconfigurability. Although most of the antennas are offering polarization reconfigurability, none of them have the extra advantages of the MIMO configuration. Thus, the proposed antenna outperforms its competitor designs with its operating capability in the sub-GHz band, polarization bandwidth reconfigurability, and MIMO configuration in a single design.The proposed polarization-frequency reconfigurable antenna is compared with state-of-the-art antennas in terms of their typical functionalities. Most of the antennasA low-profile 2-elements MIMO antenna at sub-GHz with polarization-frequency agility is presented. The primary single-element antenna consists of a pentagonal slotline having a varactor diode in its center to obtain a compact antenna design. The unique capacitive loaded slot-line with the folded feedlines gives a broadband impedance bandwidth of 46.58% (578 \u00a0 929 MHz), and a 3dB AR bandwidth from 490 to 810 MHz. The proposed dual-feed antenna offers RHCP as well as LHCP radiations. Additionally, the AR bandwidth can be reconfigured by varying the capacitance of the varactor diode. The AR can be tuned over the operating bandwidth of 490 to 810 MHz. Furthermore, the antenna gives a high RHCP and LHCP gain of 1.079 dBi, and 1.078 dBi, respectively. The two-element MIMO antenna is realized on compact board size of 100 mm \u00d7 100 mm. The attractive features of this design are compact size and wide operating bandwidth in the sub-GHz band, polarization-bandwidth reconfigurability, and good isolation."}
{"text": "High isolation (>15 dB) was attained with thorough testing without employing a decoupling scheme in the design. Laboratory measurements resulted in a peak gain of 3.49 dBi and an efficiency of around 80% in the entire operating band. The evaluation of the presented MIMO multiband antenna was carried out in terms of the envelope correlation coefficient (ECC), diversity gain (DG), total active reflection coefficient (TARC), and Channel Capacity Loss (CCL). The measured ECC was less than 0.04, and the DG was well above 9.50. The observed TARC was also lower than \u221210 dB, and the CCL was below 0.4 bits/s/Hz in the entire operating band. The presented MIMO multiband antenna was analyzed and simulated using CST Studio Suite 2020.This research work presents a compact design of a Multiple-Input Multiple-Output (MIMO) multiband antenna along with high-isolation characteristics. The presented antenna was designed for 3.50 GHz, 5.50 GHz, and 6.50 GHz frequencies for 5G cellular, 5G WiFi, and WiFi-6, respectively. The fabrication of the aforementioned design was undertaken using FR-4 (1.6 mm thickness) substrate material with a loss tangent and relative permittivity of about 0.025 and 4.30, respectively. The two-element MIMO multiband antenna was miniaturized to 16 \u00d7 28 \u00d7 1.6 mm In MIMO antennas, it is critical to maintain high isolation between the radiating elements for good radiation performance of the MIMO system. A simple approach to achieve isolation of less than \u221210 dB using ferrite skin was presented in [In today\u2019s wireless communication technology and 5G era, in which wireless devices are evolving at a very fast pace, the improvement of data transmission with large capacity and link reliability is greatly needed . Researcented in . It was ented in  for WiMAented in , in whicented in . An AI-bented in . An overented in . A novelented in . In thisented in . A detaiented in . The perented in . A novelented in . A widebented in .The research efforts in this paper demonstrate a compact multiband 2 \u00d7 1 MIMO antenna that operates at 3.50 GHz, 5.50 GHz, and 6.50 GHz, catering to 5G, WLAN, and WiFi-6 devices, respectively. Initially, a single antenna element was introduced, and subsequently, the design was replicated orthogonally for a 2 \u00d7 1 MIMO configuration. The notable features of this antenna include its higher gain, enhanced radiation efficiency, superior isolation, improved diversity performance, and reduced antenna size in comparison with the antennae in the existing literature. The primary objective behind the design of the proposed MIMO antenna was to offer a compact design with simplified fabrication, suitable for devices operating within the 5G frequency bands that require compact antennas.3, and it was fabricated on an FR4 (1.6 mm thickness) substrate (\u03b5r = 4.30 and tan(\u03b4) = 0.025). It was fed through microstrip lines of distinct lengths and widths to achieve good multiband characteristics. On the back side of the substrate, there was a partial ground structure and a flipped L-shaped strip, which provided a wide impedance bandwidth for the 6.5 GHz frequency. Its simulated reflection coefficient (S11) along with the design steps are presented in In this section, a single element of the MIMO multiband antenna design is explained. Its geometry is presented in Firstly, a simple 5G-shaped strip with a modified G-shape (embedded within it) along with a microstrip feeding line was designed on the uppermost side, and a partial or semi-ground structure was etched on the lowermost side of the substrate. The 5G-shaped strip was tuned to radiate at 3.5 GHz. At its optimized version, the reflection coefficient for the 3.5 GHz band was well below \u221210 dB. In step 2, an inverted L-shaped strip was added to acquire the categorization of a dual-band, i.e., 3.50 GHz and 5.50 GHz. The feeding structure was modified for a better impedance bandwidth (<\u221210 dB); these modifications shifted the 3.5 GHz dip, which was rectified in step 3. For the proposed antenna design, two L-shaped strips were added, one at the bottom side of the substrate and the other at the bottom edge of the 5G-shaped strip. The microstrip feeding structure was tailored and resulted in triple band characteristics .6 = 3.1 mm and W11 = 7 mm resulted in variations, as presented in 7 was evaluated at different values, as shown in 7 = 4.9 mm. The L-shaped strip, which was embedded to obtain the 6.5 GHz frequency band, made the other design parameters more sensitive to any change, as can be seen in 4, its finest value was observed to be L4 = 1.1 mm. Moreover, L14 and W15 were fine-tuned at 8.8 mm and 6.5 mm, respectively, to obtain a wide impedance bandwidth at the same frequency, as presented in 11) of simulated and laboratory-measured single-element antennas is illustrated in The physical dimensions of the presented MIMO multiband antenna design are tabulated below in To design a two-element MIMO multiband antenna, a single-element antenna was duplicated and marked as Ant 1 and Ant 2, as depicted in 2. Furthermore, Ant 2 was shifted into three different locations\u2014the top  was observed when Ant 2 was placed in the bottom position.In the MIMO design, the minimum distance between the centers of two antennas should be \u03bb/2 in order to obtain good isolation, but this distance would make the physical area of the MIMO design too large for a compact antenna design. The best possible alternative for this problem is to place the second element in a different orientation. An optimal distance D1 of 3.3 mm was set, which gave us the total dimensions of our proposed MIMO antenna, which were 16 \u00d7 28 mm\u2014the top a, center\u2014the top b, and bo\u2014the top c positioThe simulated maximum surface current density at the resonance frequencies of a two-element multiband MIMO antenna at port 1 is depicted in 12 and reflection coefficient S11 of the presented MIMO multiband antenna are shown in 12) were below \u221215 dB, and the presented antenna showed good isolation in the entire operating band. This was achieved because of the inherent property of polarization diversity.The laboratory-measured and simulated isolation coefficient SThe radiation pattern of the antenna was measured by utilizing an anechoic chamber, as illustrated in i and j indicate port numbers. DG is an important aspect that certifies the diversity performance of MIMO systems. It is calculated using the following equation [The diversity performance of the proposed two-element MIMO multiband antenna was assessed with the help of the parameters DG (diversity gain), ECC (envelope correlation coefficient), and TARC . It considers the radiation pattern, its polarization, and the antenna element\u2019s relative phase. The ECC between two antenna elements in a MIMO is calculated with the help of the following mathematical model ,20:(1)ECequation ,22:(2)DGIn i denotes an incident wave and bi denotes a reflected wave. It is evident in For calculating TARC, the laboratory-measured S-parameters of a two-element MIMO multiband antenna were used in the following mathematical relationship ,24:(3)TAThe channel capacity loss (CCL) is another essential diversity parameter that defines the maximum attainable limit of the communication transmission rate. The CCL of the proposed MIMO antenna was measured using Equation (4) from :(4)ClossIts simulation results were compared with the measured results shown in 3. The laboratory-measured findings are in good agreement with simulated results, indicating that the presented antenna is suitable for 5G, WLAN, and WiFi-6 applications.This research effort presents a compact MIMO multiband antenna. The initial design architecture comprised a single element consisting of a 5G-shaped microstrip, two L-shaped strips, and a partial/semi-ground structure designed to radiate on the 3.50 GHz, 5.50 GHz, and 6.50 GHz frequency bands. For the MIMO, a duplicate design was placed in an orthogonal position with respect to the first element. The peak gain was recorded at 3.49 dB at 5.50 GHz, and the radiation efficiency was above 80% throughout the operating bands. ECC was observed below 0.04, DG was higher than 9.5 dB, and TARC was below \u221210 dB in all the bands of operation. In the presented research effort, the MIMO multiband antenna was miniaturized to a size of 16 \u00d7 28 \u00d7 1.6 mm"}
{"text": "The article represents the design of two port-based printed MIMO antenna structures that have the advantages of low profile, simple structure, good isolation, peak gain, directive gain, and reflection coefficient. The performance characteristics are observed for the four design structures by cropping the patch region, loading the slits near the hexagonal-shaped patch, and adding and removing the slots in the ground area. The antenna provides a least reflection coefficient of \u221239.44 dB, a maximum electric field of patch region of 33.3 V/cm, a total gain of 5.23 dB, and good values of total active reflection coefficient and diversity gain. The proposed design provides nine bands\u2019 response, a peak bandwidth of 2.54 GHz, and a peak bandwidth of 26.127 dB. The four proposed structures are fabricated using a low-profile material to support mass production. The comparison among simulated and fabricated structures is included to check the authenticity of the work. The performance assessment of the proposed design with other published articles is carried out for the performance observation. The suggested technique is analyzed over the wideband of frequency region 1 GHz to 14 GHz. The multiple band responses make the proposed work suitable for wireless applications in S/C/X/Ka bands. The use of wireless communication technology and the ongoing quest for small portable devices have undergone remarkable development during the last decade. There is potential for new wireless systems to enable a wide variety of applications and numerous users simultaneously. However, the need for an enhanced data rate is severely hampered by the limited bandwidths available due to spectral congestion. Therefore, technologies that may be used in wireless devices to perform antenna operating at several frequency bands are in high demand .The ability to send data rapidly gives it a lot of leeway when it comes to using the spectrum, which might be helpful for mobile computing devices in the future. The broad bandwidth and rapid data transfer speeds are ideal for various applications such as short-range radars, surveillance devices, and medical imaging ,3,4. WidIn addition, the metamaterial property helps to achieve better antenna performance. For MIMO technology to function, it is essential that the antenna components used by the transmitter and receiver be independent of one another. In order to measure the performance of an antenna array in MIMO systems, numerous metrics have been proposed in .The miniaturization of the MIMO structure has been shown to reduce the isolation between antenna components in . The decIn , the antThere is a need for high-gain, low-cost, multiband antenna to be designed, which can operate over a wide range with multiple bands. This manuscript presents the 1 \u00d7 2 MIMO antenna, which is analyzed for the L, S, C, and X frequency bands. The main objective of the proposed work is to achieve the multiband response with healthy gain and sufficient wideband response to target multiple applications for S, C, X, and Ka bands. The presented manuscript represents the novel concept of the addition of complementary split rings and slots in the patch area and the ground region. The modification in the patch structure and ground structure helps to achieve the targeted goals. The presented work shows the path to achieving a broad bandwidth, lower E.C.C., and good gain using the low-profile substrate material, which helps to achieve satellite communication applications. 2. The lumped port was applied to the structure for the excitation. The patch and ground layers were designed by considering them as copper material. The thickness of the patch and ground layers was 0.35 mm. The substrate height was 1.6 mm. The substrate material was chosen to be FR-4 epoxy, as it is inexpensive and easy to fabricate. FR4 has dielectric constant of 4.4 [Four designs were considered to analyze the reflection/transmission coefficient: peak gain, directivity, electric fields, and radiation patterns. t of 4.4 . The novThe proposed MIMO antenna design incorporates CSRR metamaterial, which offers unique electromagnetic properties, such as negative permeability and permittivity. This integration enables the antenna to exhibit enhanced performance characteristics, including improved bandwidth and radiation efficiency.The antenna design incorporates a defected ground structure to mitigate surface wave propagation and improve the isolation between antenna elements.The proposed MIMO antenna design achieves a low profile and compact form factor, making it suitable for various space-constrained applications. In addition, the antenna\u2019s reduced size and planar structure contribute to its versatility and ease of integration into modern wireless communication devices.The antenna design offers wideband operation across the S/C/X/Ka frequency bands, covering various communication applications. In addition, the CSRR metamaterial and DGS implementation contribute to the achieved broad operating bandwidths, ensuring compatibility with multiple frequency bands.A sufficient reflection coefficient, more than 1 GHz of bandwidth, and a healthy gain are achieved for all of the proposed designs.Design and fabrication were carried out using FR4 dielectric material to check the reliability of the structure. The FR4-based low-profile material was used to achieve targeted goals, which helped with cost reduction.The four design structures were analyzed based on modifying the DGS and slit around the patch region to check the performance of different forms.The proposed design is compared with the other existing methods to identify the improvement in the structure.The simulated and measured results are compared to judge tolerance among them. Lower tolerance among both results is observed.Overall, the proposed antenna design exhibits excellent characteristics for MIMO applications. It demonstrates low mutual coupling between antenna elements, high isolation, good radiation efficiency, healthy gain, and proper diversity parameters. These attributes contribute to enhanced channel capacity, increased data rates, and improved system performance in MIMO systems.The different antenna structures were examined by inserting CSRR in the patch with slits outside of the patch and defective ground structure. The insertion of a CSRR in a patch antenna can have several effects on the performance of a MIMO antenna, as follows: The CSRR can alter the resonant frequency of the patch antenna. Due to a unique metamaterial property, it is possible to shift the resonant frequency of the patch antenna to a desired frequency. This adjustment can be beneficial in achieving better frequency selectivity and matching with other antennas in the MIMO system. The CSRR can widen the bandwidth. By introducing the CSRR, the effective electrical length of the antenna structure can be modified, resulting in a broader frequency bandwidth. This expanded bandwidth can be advantageous for MIMO systems that require simultaneous operation over multiple frequency bands. In MIMO antenna systems, mutual coupling between the individual antennas can degrade performance by interfering with signal transmission and reception. The CSRR can help to reduce mutual coupling between the antennas by creating isolation between them. It can act as a decoupling element, decreasing the coupling effects and improving the isolation between the antennas. The insertion of a CSRR can alter the radiation pattern of the patch antenna. The CSRR can affect the current distribution and electric field distribution on the patch, leading to changes in the radiation characteristics. Properly designed CSRR structures can be used to shape the radiation pattern and improve the antenna\u2019s performance in terms of gain, directivity, and radiation efficiency. MIMO systems often benefit from polarization diversity, where different antennas are designed to transmit and receive signals with different polarizations. The CSRR can help to enhance the polarization diversity of the patch antenna by modifying its polarization properties. By carefully designing the CSRR, it is possible to achieve improved polarization isolation and better performance in terms of cross-polarization discrimination.The incorporation of a defective ground structure (DGS) in a antenna can have several effects on its performance, as follows: Cross-polarization refers to the undesired reception or transmission of signals with a polarization orthogonal to the desired polarization. DGSs can help to suppress cross-polarization in MIMO antennas. By introducing appropriate DGS patterns or slots in the ground plane, the radiation characteristics and polarization properties of the antenna can be controlled, leading to improved polarization isolation and reduced cross-polarization. DGSs can be used to shape and control the radiation pattern of MIMO antennas. By incorporating specific DGSs, such as slots or patches, in the ground plane, the current distribution and electromagnetic field distribution on the antenna can be manipulated. This enables control over the antenna\u2019s radiation pattern, beam steering, and directivity, which can be advantageous in MIMO systems to optimize coverage, increase gain, or mitigate interference. DGSs can help to mitigate interference from external sources or neighboring antennas by introducing appropriate DGSs.Using structures in the ground plane, such as slots or fractal patterns, it is possible to suppress the effects of nearby interfering signals or electromagnetic noise, improving the signal quality and overall performance of the MIMO system.The antenna design technique is analyzed in four essential parts in order to explain the working concept of the planned MIMO antenna. Electromagnetic isolation: In a MIMO system, each antenna element should ideally radiate and receive signals independently without interfering with each other. However, due to the close proximity of multiple antennas, there can be coupling between them, resulting in interference and the degradation of system performance. By introducing DGSs in the ground plane, the coupling between the antenna elements can be minimized. The DGS creates an electromagnetic barrier between the antennas, reducing the mutual coupling and enhancing isolation.Surface wave suppression: DGSs can also suppress surface waves propagating on the ground plane. Surface waves can lead to increased coupling between antennas and reduce isolation. By incorporating DGSs in the ground plane, the surface waves can be attenuated, reducing their impact on the antenna elements and minimizing the coupling between them.Impedance matching: DGSs can be designed to provide additional degrees of freedom in tuning the impedance of the antenna elements. By appropriately designing the shape and size of DGSs, the impedance seen by each antenna element can be adjusted. This helps in achieving a better impedance match between the antenna elements, minimizing reflections and optimizing the overall system performance.Enhanced radiation efficiency: The presence of DGSs in the ground plane can also improve the radiation efficiency of the antenna elements. By reducing the coupling and surface wave effects, the energy that would otherwise be lost in coupling or surface wave propagation is efficiently radiated by the antennas. This leads to improved overall system performance and better signal quality.DS-2 has two hexagonal-shaped MIMO structures without a circular shape. Two slits are also placed on the outer side of the hexagonal-shaped patch region. Two arrays of lines and one plane region are available in the diffracted ground region. DS-3 has two hexagonal-shaped MIMO structures with a circular-shaped portion engraved in the patch area. There are not any slits in the outer place of the hexagonal-shaped patch region. Two arrays of lines and one plane region are available in the diffracted ground region. DS-4 has two hexagonal-shaped MIMO structures with one circular-shaped portion engraved in the patch area. In addition, there are slots available in the outer place of the hexagonal-shaped patch region. The ground region is simple without array lines. The DGS is a technique used in the design of antennas and R.F. circuits to reduce electromagnetic coupling and improve isolation between antenna elements in MIMO systems. The DGS in the ground plane helps in reducing coupling in MIMO antennas through the following mechanisms:The fabrication of the proposed structures is carried out for analysis purposes, and indifferent proposed structures are shown in W of the patch is calculated using Equation (1) [C0 is the light speed, W is the patch width, \ud835\udc52\ud835\udc53\ud835\udc53) is determined using Equation (2).The circular-shaped ring is cut in the hexagonal-shaped patch area. The width tion (1) .(1)W=C0L. The change is calculated using the following Equation (3).h is the substrate\u2019s height. The exact dimension of the patch can be calculated using Equation (4).The fringing effect changes the effective area of the patch. Therefore, variation in the area is represented by \u039411 of \u221218 dB and the second band is shown at 8 GHz with an S11 of \u221221 dB.Each design was numerically analyzed using the full-wave higher-frequency structural simulator (HFSS). A variety of performance metrics such as return loss, radiation pattern, total gain plot, field distribution, gain for the different frequencies, directivity, TARC, and directivity gain were analyzed. The reflection and transmittance response must be analyzed for the high-frequency antenna structure . The ini11 is less than \u221210 dB in the range of 1 to 2.485 GHz. The second band provides the S11 of \u221217.507 dB at 10.5 GHz; this band is observed in the range of 3.165 GHz to 3.825 GHz. Therefore, a peak bandwidth of 2.485 GHz is attained in this configuration. The MIMO structure\u2019s unusual form primarily aids in attaining higher isolation (<\u221228 dB) during measurement as per DS-1. Two bands of reflection response are observed in 11 of \u221223.172 dB at 4.5 GHz; this band is observed in the range of 4.15 GHz to 4.775 GHz. The third band is shown in the range of 5.145 GHz to 6.19 GHz with an S11 of \u221216.572 dB at 5.5 GHz. The fourth band is shown in the range of 10.215 GHz to 11.05 GHz with an S11 of \u221231.457 dB at 10.5 GHz. Finally, the fifth band is shown in the range of 13.76 GHz to 14 GHz with an S11 of \u221210.69 dB at 13.9 GHz. In this mode, a maximum bandwidth of 1.045 GHz is achieved.DS-2 shows the five bands with less than \u221210 dB value. The first band represents reflection coefficients of \u221210.16 dB at 3 GHz; this band is observed in the range of 3.005 GHz to 3.14 GHz. The second band provides an SDS-3 shows the eight bands of reflection coefficients with less than \u221210 dB value. The first band represents reflection coefficients of \u221223.425 dB at 3 GHz; this band is observed in the range of 1 GHz to 3.54 GHz. The second band represents reflection coefficients of \u221239.44 dB at 3.8 GHz; this band is observed in the range of 3.69 GHz to 3.865 GHz. The third band represents reflection coefficients of \u221215.075 dB at 5.2 GHz; this band is observed in the range of 5.19 GHz to 5.52 GHz. The fourth band represents reflection coefficients of \u221225.319 dB at 6.5 GHz; this band is observed in the range of 6.325 GHz to 6.675 GHz. The fifth band represents reflection coefficients of \u221221.620 dB at 7.8 GHz; this band is observed in the range of 7.555 GHz to 7.915 GHz. The sixth band represents reflection coefficients of \u221210.147 dB at 8.9 GHz; this band is observed in the range of 8.765 GHz to 8.985 GHz. The seventh band represents reflection coefficients of \u221215.075 dB at 5.3 GHz; this band is observed in the range of 5.19 GHz to 5.52 GHz. The eighth band represents reflection coefficients of \u221215.497 dB at 10 GHz; this band is observed in the range of 9.86 GHz to 11.215 GHz. The ninth band represents reflection coefficients of \u221210.759 dB at 13.8 GHz; this band is observed in the range of 13.655 GHz to 14 GHz. Therefore, in this mode, a maximum bandwidth of 2.54 GHz is achieved. 11 of \u221214.420 dB at 3.1 GHz; this band is observed in the range of 3.065 GHz to 3.215 GHz. The second band represents an S11 of \u221220.308 dB at 3.55 GHz; this is observed in the range of 3.485 GHz to 5.655 GHz. The third band represents an S11 of \u221216.715 dB at 7.6 GHz; this band is observed in the range of 7.2 GHz to 7.97 GHz. The fourth band represents reflection coefficients of \u221219.805 dB at 11.8 GHz; this band is observed in the range of 9.45 GHz to 11.8 GHz. The fifth band represents reflection coefficients of \u221213.914 dB at 12.57 GHz; this band is observed in the range of 12.55 GHz to 12.585 GHz. In this mode, a maximum bandwidth of 2.35 GHz is achieved.DS-4 shows the five bands of reflection coefficients with less than \u221210 dB value. For example, the first band represents an SThe radiation pattern for the simulation and measurement of the proposed antenna structure is represented in The three-dimensional total gain plot of the proposed MIMO structures is presented in The gain over the 1 to 14 GHz span is presented in The directivity and \u22123 dB down directivity plots of the proposed four structures are shown in The value of ECC should be zero. The isolation between the individual antenna nodes improves as the ECC increases. Using the scattering parameter, the ECC can be calculated as per Equation (5). The simulated result represents the ECC response of the proposed DS:1, DS:2, DS:3, and DS:4, as represented in The improvement in the SNR of a multiple element system over a one element system is referred to as diversity gain (DG). The DG is calculated using the following Equation (6).The diversity gain of the planned four design structures is illustrated in The power received by a diversity antenna relative to that received by an isotropic antenna is the definition of a fading environment. The mean effective gain (MEG) is determined by solving Equation (7).A high gain is a need for any respectable MIMO system. The proper MEG response indicates that its diversity performance has been enhanced. Evaluating TARC is the best way to assess radiation performance and frequency response. TARC considers both mutual coupling and accidental signal pairings between ports. The waves that are reflected and incident are used to form Equations (8) and (9), which may be used to obtain the value in terms of the S parameters/The measured and simulated MEG response of the proposed MIMO antenna is represented in j and aj stand for reflected and incident waves, respectively. Channel capacity loss (CLL) is another crucial factor to consider while assessing the projected antenna\u2019s MIMO performance. CCL specifies the maximum possible data transfer rate that suffers significant degradation. To prove lossless data transmission, a well implemented MIMO system should achieve a rate of 0.5 bits/s/Hz. Simply said, CCL alerts the user to the point at which further communication cannot be conducted without risk. CCL may be computed using either Equation (10) or Equation (11), respectively.In the above equations, the phase of the incident wave is \u03b8. bHere, the main goal behind these four phases is to achieve a higher gain, which was achieved using the proposed MIMO structures. The simulated and measured channel capacity loss response for all of the proposed design structures is represented in The TARC values for the proposed four MIMO antennas are shown in The comparison of the presented MIMO structure with the other structures is shown in 11 less than \u221210 dB is attained in DS-3. The maximum electric field of 33.3 V/cm was attained in DS-3. Overall, the addition of slots around the patch area and DGS improves the performance of the antenna. The presented design targeted multiple wireless communication applications for the range of 1 GHz to 14 GHz. Therefore, the presented design structure has potential applications in satellite communication, vehicle speed monitoring, the military, and other 5G/6G applications requiring high data rate transmission.An FR4, substrate-based, two-port, loaded MIMO antenna has been proposed. Four types of design structures have been analyzed by cropping the patch region, loading the slits near the hexagonal-shaped patch, and adding/removing the slots in the ground area. The proposed design was analyzed in terms of peak gain, DG, reflection coefficient, total gain, electric field, directivity, and E-field pattern. The proposed structure provides an isolation of 35 dB, DG of 10 dB, and peak gain of 20.44 dB. The reflection response of \u221239.44 dB with the nine band responses having an S"}
{"text": "S \u00d7 LS = 12 mm \u00d7 9 mm. Three designs of two-port MIMO configurations are derived from the reference unit element antenna. In the first design, the antenna element is placed parallel to the reference antenna, while in the second design, the element is placed orthogonal to the reference element of the antenna. In the third design, the antenna elements are adjusted to be opposite each other. In this study, we analyze the isolation between the MIMO elements with different arrangements of the elements. The MIMO configurations have dimensions of 15 mm \u00d7 26 mm for two of the cases and 15 mm \u00d7 28.75 mm for the third case. All three MIMO antennas are made using similar materials and have the same specifications as the single element antenna. Other significant MIMO parameters, including the envelope correlation coefficient (ECC), diversity gain (DG), channel capacity loss (CCL), and mean effective gain (MEG), are also researched. Additionally, the paper includes a table summarizing the assessment of this work in comparison to relevant literature. The results of this study indicate that the proposed antenna is well-suited for future millimeter wave applications operating at 28 GHz.In this paper, a compact and simplified geometry monopole antenna with high gain and wideband is introduced. The presented antenna incorporates a microstrip feedline and a circular patch with two circular rings of stubs, which are inserted into the reference circular patch antenna to enhance the bandwidth and return loss. Roger RT/Duroid 6002 is used as the material for the antenna, and has overall dimensions of W The recent advancements in communication systems  have brought about numerous changes and revisions. These changes have been made to meet the requirements, which are a basic necessity for operating over future wireless communication spectrum ,2. TheseHigh gain and wideband antenna have gained increasing attention in recent years due to the evolving demands in communication systems ,9. DevicThe implementation of multiple-input multiple-out (MIMO) antenna technology increases the capacity and reduces interference ,16. SomeIt is mentioned in  that a tEtching slots from the ground plane can also increase an antenna\u2019s bandwidth and gain if it has a defective ground structure (DGS) . In 27]27], a wiA compact sized 24 mm \u00d7 20 mm, wideband 33\u201344 GHz, and transparent antenna is reported in . The antFor 28 GHz applications, a two-port MIMO antenna is suggested in . The antCompact design with low structural complexity;Analysis of the MIMO antenna under various element orientation;Low mutual coupling and ECC from all three MIMO designs;High gain antenna without using additional layers.Three sections make up the remaining portion of this study. The unit element of an antenna is examined in the second section, along with its findings. The three scenarios of the recommended MIMO antenna are examined in The suggested antenna\u2019s layout is illustrated in 3 and R4. This procedure significantly reduced the antenna\u2019s return loss, enabling wideband operation. The resulting antenna, shown in The three steps of the design evaluation for the antenna are illustrated in 11 parameter of the recommended antenna single element is given in 11 < \u221210 dB). The proposed design offers two resonant frequencies around 28 GHz and 31.75 GHz with a return loss of 28 dB. From the figure it can also be seen that the S11 plot generated from the software and tested is quite similar with minor distortions. Additionally, The comparison between the predicted and tested SThe suggested antenna\u2019s radiation pattern at specific frequencies of 28 GHz and 32 GHz is shown in The gain vs. frequency plot of this design is provided in This section studies and discusses the idea for the antenna\u2019s two-port MIMO architecture. In order to analyze the MIMO characteristics of closely spaced elements, three separate scenarios are used. In the first scenario, both parts are positioned side by side. One MIMO antenna component is orthogonal to the other in the second scenario. The element is parallel but positioned on the opposite side in the third instance. The hardware prototypes are fabricated and tested for all aforementioned cases. To measure the reflection and transmission coefficient of the antenna, a vector network analyzer (VNA), 220 ZVA by Rohde & Schwarz, is used. To measure the far field, the antenna is placed in a newly designed shielded millimeter-wave anechoic chamber and we utilize a multi probe array technique, which provides accurate result for a spanning angle of 180\u00b0 .1 = 4.75 mm between the second element and the reference element. The entire size of the MIMO antenna in this instance is MXI \u00d7 MY1 = 15 mm \u00d7 26 mm. The same substrates and other design criteria were employed for one element only. To validate the simulated results of the antenna, the hardware prototype is created.In In R\u03c8 refers to the below matrix for receiving antenna correlation.Our study uses the MIMO parameters, including the ECC, DG, CCL, and MEG. To examine the performance of single unit element in MIMO configuration, ECC is studied. DG is the study of losses in the form of transmission, and CCL is the examination of correlation losses in MIMO systems. The MEG is analyzed to study the power received in a fading area. The mathematical equations below, which are used to calculate these MIMO parameters, are well explained in ,38,39,40The ECC and DG of the suggested parallel element placed design are shown in 2 = 4 mm. The entire size of the MIMO antenna in this instance is MX2 \u00d7 MY2 = 15 mm \u00d7 28.75 mm. The same substrates and other design criteria were employed for one element only. To validate the simulated results of the antenna, the hardware prototype is created.In Similarly to the above antenna presented in 3 = 5.2 mm. The MIMO antenna in this example has the same overall size as the antenna in the previous scenario, which is MX3 \u00d7 MY3 = 15 mm \u00d7 26 mm. The location of the antenna with the reference antenna is the only distinction between cases 3 and 1. To validate the simulated results of the antenna, the hardware prototype is created. In As in the previous two designs, the important MIMO parameters of this antenna are also analyzed. In For 5G applications, a wideband, small, simple, high gain, and high radiation efficiency antenna is suggested in this research. For 28 GHz applications, a circular patch antenna was first developed. Later, to acquire the wideband, circular rings are placed into the antenna. The antenna provides a high gain of 11.25 dBi and a wide band of 8.25 GHz. Afterward, three MIMO antenna were adopted from initial reference antenna. The aim when designing a MIMO antenna under various arrangements of elements is to analyze and study the performance of the antenna. It is studied and concluded from the results that the antenna offers wideband and acceptable value of isolation in all three cases. The results in terms of MIMO parameters are also acceptable values, as the antenna offers ECC around 0.001, DG 9.9 dB, CCL 0.001 bits/Hz/sec, and MEG around 6.38 dB. The performance of MIMO antenna defined in three cases is concluded in"}
{"text": "The envisioned application is collision avoidance in aid to visually impaired people at a medium-long distance.Three metasurfaces (MTS) are designed to be combined with a series end-fed 1 \u00d7 10 array antenna with a modified Dolph-Chebyshev distribution for imaging applications in the millimeter frequency range, 24.05\u201324.25 GHz. A reduction in secondary lobes and an increase in FTBR can be achieved while preserving gain, radiation efficiency, SLL and size using an MTS\u2013array combination. Moreover, as a result of each single-layer MTS\u2013array combination, operation bandwidth is widened, with gain and radiation efficiency enhancement. The overall devices\u2019 size is 86.8 \u00d7 12 \u00d7 0.762 mm In recent years, the literature has been enriched with plenty of research works using metamaterials, especially metasurfaces for various applications, such as RCS reduction, antenna enhancement, wavefront transformation and unconventional waveguiding and scattering ,7,8,9,10Moreover, the use of increasingly higher frequencies, such as millimeter-wave frequencies, is spreading, due to the large bandwidths that can be allocated, with corresponding advantages in throughput for 5G and other applications, such as radar.The aim of this work is to investigate whether it is possible to improve all the properties of an antenna at once, both its impedance-matching bandwidth and its radiation properties, without increasing its overall size, using metasurface-based techniques. This approach contrasts with the traditional methods carried out so far, in which either artificial magnetic conductors (AMCs) are used under the antenna at some distance (or replacing the ground plane of the antenna) increasing the thickness, or EBGs with numerous cells surrounding the initial antenna (increasing its size), or employing frequency selective surfaces, polarizers or partially reflecting surfaces over the antenna at some distance to modify its radiation pattern, always increasing the thickness. All of the above methods increase the cost and complicate the antenna manufacturing process. In addition, these techniques improve only some of the antenna parameters, but not all at once (or considerably improve some at the expense of certain deterioration of others). Other recent works including  focus onAnother important aspect to highlight is that most of the works that involve the combination of an antenna with a metasurface, usually derive in a modification of some of the dimensions of the metallization of the antenna to achieve that the antenna\u2013metasurface assembly works conveniently, even when a certain distance is left between both. Therefore, the comparison of the antenna alone with the metasurface\u2013antenna combination loses rigor, since it is not the same antenna. Consequently, the conclusions drawn from the point of view of the usefulness of the metasurfaces or the physical phenomena involved are more than debatable, even if an operational device is achieved.Concerning the state-of-the-art on wearable antennas with metasurfaces, there have been significant advances for biomedical applications , as wellThe aim of this work is to design an antenna with improved performance for a specific radar application in the millimeter frequency range, specifically in the ISM band from 24.05 GHz to 24.25 GHz, due to the suitability of such frequencies for high-resolution detection in foggy, smoky and dusty environments. It is intended for use in a collision-avoidance-based system to assist visually impaired people and therefore must be compact and lightweight, efficient and radiate as little as possible in the direction of the human body (which translates into a high front-to-back ratio). The antenna has a major impact on radar performance. A compromise solution between range and coverage area has to be adopted. In addition, it must have an appropriate directivity to be able to detect obstacles at the intended distance and it also influences the angle determination of the target.Regarding the design and analysis of the metasurface to be combined with the antenna, it is not only intended to be operative in the frequency band of interest (24.05 GHz to 24.25 GHz), but also to analyze its complete angular stability, that is, taking into account both the variation of the electric field polarization angle, Phi, from 0 to 90 degrees, and the angle of oblique incidence, Theta, from 0 to 60 degrees, both for TE- and TM-polarized incident plane waves. It should be noted that most angular stability studies only consider the Phi = 0 case, leaving relevant cases unanalyzed, which is not convenient when intending to combine metasurface with antennas. The angular stability in TM can be improved by reducing the thickness of the metasurface dielectric, although this reduces the operating bandwidth, so a compromise must be found between both parameters, as well as considering the availability of commercial substrates.The paper is organized as follows: first, r = 3.0 and tan \u03b4 = 0.0013) [A recently published series end-fed 1 \u00d7 10 array antenna on polypropylene  will be  0.0013)  is used 11(dB) results obtained in simulation for the optimized array antenna design, the operation bandwidth with suitable impedance matching is 23.98\u201324.42 GHz, being optimal in the intended 24.05 GHz to 24.25 GHz ISM band. The radiation characteristics of the antenna obtained in simulation, in terms of peak realized gain (G), peak directivity (D), radiation efficiency (\u03b7) and front-to-back ratio (FTBR), are indicated in From the SPhi0\u00b0 = \u221216 dB, HPBWPhi0\u00b0 = 12\u00b0, SLLPhi90\u00b0 = \u221228 dB and HPBWPhi90\u00b0 = 64\u00b0. All of these results are suitable for the envisioned collision-avoidance application. However, while this antenna can be said to meet the requirements in the commercial 24 GHz band, and there is scarce margin for improvement within it (perhaps try to increase somewhat radiating efficiency and FTBR and reduce secondary lobes), it is well known that if the operational bandwidth of the antenna is widened, this results in a higher resolution and improvement in the detection of obstacles, which is the main objective of this application. Therefore, by using a wider bandwidth radar transceiver, end-user performance would be improved. Thus, if it is possible to widen the antenna\u2019s operating frequency band while preserving (or even improving) the characteristics of the radiation pattern, without increasing the size and neither complicating nor making manufacturing more expensive, it would be a significant achievement for the aim pursued.In addition to the high G (>14.0 dBi) and D (>14.5 dB) levels achieved in the whole band, it is noteworthy the levels of both the high radiation efficiency (>90%) and the FTBR (>20 dB), which are critical in a wearable application. The side-lobe level (SLL) and the half-power beam width (HPBW) at the center frequency of the band (24.15 GHz) are SLLThree high-impedance metasurfaces (MTS)  are desiIt can be observed that under normal incidence, MTSsquare resonates at 23.66 GHz, very close to the antenna\u2019s operating frequency band, with in-phase operation from 20.07 GHz to 27.32 GHz, whereas MTS and MTSsquare-scaled resonate at a higher frequency, 26.58 GHz, with in-phase reflection operation from 20.07 GHz to 30.9 GHz, therefore still exhibiting in-phase reflection and increasing surface impedance in the antenna\u2019s operating band. The three metasurfaces can be considered high-impedance surfaces (HIS) in view of their surface impedance shown in The angular stability of the metasurfaces has been analyzed. The incidence angle \u03b8 is varied from 0\u00b0 to 60\u00b0 in steps of 15\u00b0 for each polarization angle of the incident electric field \u03c6 which is, in turn, varied from 0\u00b0 to 90\u00b0 in steps of 15\u00b0. The metasurfaces are arranged around the antenna, as shown in The current distribution at the center frequency of operation (24.15 GHz) for the array antenna alone and combined with the metasurfaces and the metallic parasite is shown in Analyzing the effect of the aforementioned combinations with regard to the frequency band with proper impedance matching, it can be seen in As for the radiation properties within the 24.05\u201324.25 GHz frequency band and given in The most significant advantage comes from the fact that the highlighted increase in bandwidth is accompanied by an improvement in gain and radiation efficiency, and preservation of the radiation pattern shape and the FTBR (which is improved in some cases).As an advantageous example of the inclusion of a metasurface, it can be observed in Conventional micromachining is used to fabricate the prototypes, and an SMA connector operating up to 26 GHz is soldered by hand to feed them (see The measured reflection coefficient for the fabricated antennas is depicted in The radiation pattern cuts for Phi = 0\u00b0 and Phi = 90\u00b0 at the center frequency of the band (24.15 GHz) were measured in an anechoic chamber see , and theFairly good agreement is achieved between simulation and measurement results, especially for the CP components. The resulting HPBW level is almost identical to the one obtained in simulation for both Phi = 0\u00b0 and Phi = 90\u00b0 cuts, whereas the SLL slightly worsens in measurement for Phi = 0\u00b0. All the antennas under analysis exhibit an asymmetry in the Phi = 0\u00b0 plane due to the feeding method, which is already observed in the simulation results. This makes Phi = 0\u00b0 pattern cut more sensitive to everything that is actually located in the feeding part of the antenna. In the measurement results, both the tilt and the regrowth of the side lobes observable on one side of said pattern cut are attributable to the effect of the connector and especially of the bend (right-angled adapter or 90-degree bend) between the cable and the connector, which are not considered in the simulation. Both the connector and the bend enlarge the effective length of the antenna and modify the current distribution at its input. In addition, the movement of the cable when rotating the positioner to measure said pattern cut further contributes to modify the current distribution and exerts mechanical tension pulling the antenna, which may cause slight differences in positioning between antennas.Again, it should be noted that the connector was soldered by hand on each antenna. Both the cable and the connector can severely perturb the current distribution on the small antenna and be also responsible for the observed XP levels in measurement.The gain transfer method, which involves inter-comparison of the array antenna prototype (antenna under test (AUT)) with a Flann Microwave Standard horn 20240-25 (probe antenna of known characteristics), was used to conduct the measurements of the peak realized gain. It has to be taken into account that, in addition to the aforementioned effects of the cable and the connector, the gain measurement can be disturbed by other effects : multipaThe most significant finding of this work is that the operating bandwidth of an antenna can be widened, without degrading or even improving its radiation characteristics, without the need to increase its size, using metasurfaces with a reduced number of unit cells.To explain the broadening of the impedance-matching bandwidth, the impedances of the antenna and the metasurfaces have been analyzed. The reactance of the antenna alone  are obtained and analyzed for further insight into the antennas under analysis.In view of the results shown in The Ey level is slightly higher for the MTSsquare-scaled\u2013array, which agrees with a higher value of the cross-polar component observed in the radiation pattern of r =3) should be considered. Otherwise, the values of impedance-matching bandwidth and antenna dimensions will not be comparable. Neither would be those radiation parameters affected by potential surface wave propagation, which increases for high \u03b5r (and even more so the thicker the substrate). Therefore, the range will be limited to \u03b5r values between 2.9 and 3.66.To assess the relevance of the antennas presented in this work, a comparison with other state-of-the-art antennas operating in the 24 GHz radar band is presented in terms of size, bandwidth and radiation properties see . There aIt is also noteworthy that most of the works in the literature do not provide the results of radiation efficiency and FTBR.r values or as close as possible to that of the antennas presented in this work [r values, which are slightly higher than 3 and lower than 3.6, [r. Finally, Refs. [r, making them less advantageous in terms of compactness. It should be clarified that [Regarding the antennas on substrates with identical \u03b5his work ,44,45,46his work  shows a his work  for the han 3.6, ,48,49,50han 3.6, ,48,50, ay, Refs. ,52,53, wied that  uses a 1Provided that millimeter-wave energy penetrates the stratum corneum easily but is rapidly absorbed within the deeper epidermis and dermis and does not propagate further into the body  and thatIt has been proven that the operating bandwidth of an antenna can be widened, without degrading or even improving its radiation characteristics, while maintaining both its size as well as its ease and cost of manufacturing, using metasurfaces with a reduced number of unit cells. It has been shown that a metallic parasite of the same size and located at the same distance does not provide the same performance, but rather degrades the antenna. An explanation has been given for the phenomena that make these improvements possible.3.Three metasurfaces (MTS) have been designed and combined with a series end-fed 1 \u00d7 10 array antenna with a modified Dolph-Chebyshev distribution. As a result, three fully operational prototypes for imaging applications in the millimeter frequency range 24.05\u201324.25 GHz have been obtained, with an overall size of 86.8 \u00d7 12 \u00d7 0.762 mm"}
{"text": "This paper presents the design and realization of a simple and low-profile, four-port multiple-input-multiple-output (MIMO) antenna operating in a mm-wave band supporting 5G communication technologies. As part of the design methodology, the initial stage involved the development of a conventional monopole patch antenna optimized for operation at 26 GHz, which was matched to a 50 \u2126 stepped feed line. Afterward, a square-shaped defected ground structure (DGS) with semi-circle slots on the edges was placed on the ground to improve the isolation, and the circular and rectangular slots were incorporated as DGSs to optimize the antenna impedance bandwidth. Etching semi-circular-shaped slots on the ground plane achieved more than 34.2 dB isolation in the 26 GHz operating band. In addition, an arrangement of four symmetrical radiating elements was positioned orthogonally to minimize the antenna\u2019s physical size and improve the isolation. The proposed MIMO antenna\u2019s overall dimension was 25 \u00d7 25 mm Wireless communication systems have become essential in various areas, such as health, agriculture, finance, education, the Internet of Things, media, and entertainment ,2,3,4,5.The usage of MIMO antennas in mm-wave applications is particularly valuable due to their low cost, low profile, and compact size. The appropriate design of four-port MIMO antennas can result in strong isolation levels and optimal radiation characteristics, which are crucial for achieving high-performance wireless communication systems. The proposed antenna was designed with a stepped line feed, rectangular and circular slots implemented as defected ground structures for achieving wider bandwidth, as well as optimal radiation characteristics. Moreover, it has been determined that the optimal radiation characteristics of the antenna can be achieved by incorporating semi-circular slots at the edges of the ground surface of the antenna elements, and by employing an orthogonal arrangement of the four antenna elements to achieve a strong isolation of at least 34.2 dB.The unit cell of the proposed antenna comprises DGS and an antenna radiator, developed in three steps, incorporating various geometrical shapes, such as rectangular and circular slots, and the design steps of the unit cell illustrated in PThe width  as another key component. Optimizing the diversity gain is crucial for achieving a high-performance MIMO antenna system. If the envelope correlation coefficient (ECC) exceeds 0.5, the system fails to provide the diversity gain, potentially degrading the system\u2019s performance. A value of |ECC| \u2264 0.3 is considered sufficient to achieve the diversity gain [The envelope correlation coefficient (ECC), diversity gain (DG), and total active reflection coefficient (TARC) are metrics that provide crucial information about the antenna\u2019s ability to provide stable, high-quality, and diverse signals, thereby ensuring optimal system performance. Although MIMO antenna systems can theoretically increase a system\u2019s capacity, the system\u2019s performance can be negatively impacted if the signals received at different antenna elements are correlated . ECC meaity gain . The DG ity gain .(10)DG=The total active reflection coefficient (TARC) is an important parameter to consider when designing a MIMO communication system. TARC is calculated by taking the ratio of the square root of the total reflected power to the total power in the system, and is estimated by using arbitrary signal combinations and measuring excessive couplings between antenna ports. It is crucial that the TARC value does not exceed 0 dB, as this could lead to distorted received results and erroneous data transmission. The voltage standing wave ratio (VSWR) is an essential metric that indicates the degree of impedance matching between the antenna and transmission line. It is defined as the ratio of the amplitudes of the forward and reflected waves along the transmission line. When the VSWR value is equal to 1, it signifies that all power is transferred to the antenna with no reflection, thereby ensuring optimal antenna performance. The simulated VSWR value of the antenna is 1.2; indicating that the impedance of the antenna matches the transmission line\u2019s impedance, allowing maximum power to be transferred from the source to the antenna.Another critical metric in the antenna design is directivity gain, which is the ratio of the radiation intensity of an antenna in a particular direction to the average radiation intensity of the antenna over all directions. Antennas with higher directivity gains are more efficient, allowing for better transmission of signals over longer distances or reception of weaker signals. Therefore, the directivity gain is a key factor to consider when designing and optimizing antennas for various applications, particularly in wireless communication systems. In recent years, 5G technology has gained critical significance as a communication service. This is largely due to its ability to provide higher multi-Gbps peak data speeds, ultra-low latency, increased network capacity, heightened availability, greater reliability, and a more uniform user experience for a larger number of users. Moreover, there is a growing trend towards the development of lighter and thinner portable gadgets that demand powerful processing capabilities. This manuscript presents a novel, compact, and low-profile 4-port MIMO antenna design for millimeter-wave applications operating at 26 GHz. The antenna has dimensions of 25 \u00d7 25 \u00d7 0.787 mm"}