{"text": "Not all devices that measure the same property do it in the same way\u2014a clock might use a spring system or it might be digitally synchronized to a transmitted signal. Although both have the same goal of reporting accurate time, each is subject to different errors. Sometimes even the same device uses different systems to measure the same property. A relatively simple device like a camera will use one sensor system to capture light intensity for an image and a second sensor to capture light intensity for making automatic adjustments of aperture and flash. It does not seem outlandish, therefore, that the brain might also have developed multiple sensory systems to achieve different goals. Indeed, an influential hypothesis has argued that people use two separate visual processing systems in much the same way as a camera\u2014one for creating our perception of the world and another for guiding our actions within it.One line of evidence supporting this dual hypothesis comes from an illusion known as Roelofs effect. Usually, people are pretty good at judging the location of even a small object. But if the small object is surrounded by a large frame and the frame itself is not centered in front of the person who is judging it, the viewer will perceive the object as shifted in a direction opposite that of the frame. This may not in itself be surprising, but the same person who perceives an offset of the object where none exists is nonetheless able to grasp it without difficulties.PLoS Biology, Paul Dassonville and his colleagues reexamine the seeming dissociation of visual analysis for perception and action, and call it into question. Through a careful quantitative analysis of the conditions under which the Roelofs effect occurs, they find that it traces not to an illusory perception of the object location but to an illusory perception of self. The large frame, presented under experimental conditions in which subjects sit in darkness without access to a normal rich sensory environment, actually causes people to incorrectly perceive their own centers as rotated towards the frame and therefore to conclude that the small object is offset with respect to themselves. This may seem like a subtle distinction, and yet, since it is the observer's frame of reference that is altered, that same distorted frame of reference will be used to guide movement. Thus, the error in movement planning should cancel the error in perception, and people should have no trouble reaching for the object despite their misperception, which is indeed what is observed.In this issue of Others have questioned the hypothesis that two separable neural systems process the visual world for perception and action, but this study removes one of the strongest pieces of evidence in its favor with a precise alternative explanation. No two brains may see the world identically, but the authors suggest that it may be time to concede that a single brain, at least, has the same world view."}
{"text": "In Finland, dental services are provided by a public (PDS) and a private sector. In the past, children, young adults and special needs groups were entitled to care and treatment from the public dental services (PDS). A major reform in 2001 \u2013 2002 opened the PDS and extended subsidies for private dental services to all adults. It aimed to increase equity by improving adults' access to oral health care and reducing cost barriers. The aim of this study was to assess the impacts of the reform on the utilization of publicly funded and private dental services, numbers and distribution of personnel and costs in 2000 and in 2004, before and after the oral health care reform. An evaluation was made of how the health political goals of the reform: integrating oral health care into general health care, improving adults' access to care and lowering cost barriers had been fulfilled during the study period.National registers were used as data sources for the study. Use of dental services, personnel resources and costs in 2000 (before the reform) and in 2004 (after the reform) were compared.In 2000, when access to publicly subsidised dental services was restricted to those born in 1956 or later, every third adult used the PDS or subsidised private services. By 2004, when subsidies had been extended to the whole adult population, this increased to almost every second adult. The PDS reported having seen 118 076 more adult patients in 2004 than in 2000. The private sector had the same number of patients but 542 656 of them had not previously been entitled to partial reimbursement of fees.The use of both public and subsidised private services increased most in big cities and urban municipalities where access to the PDS had been poor and the number of private practitioners was high. The PDS employed more dentists (6.5%) and the number of private practitioners fell by 6.9%. The total dental care expenditure (PDS plus private) increased by 21% during the study period. Private patients who had previously not been entitled to reimbursements seemed to gain most from the reform.The results of this study indicate that implementation of a substantial reform, that changes the traditionally defined tasks of the public and private sectors in an established oral health care provision system, proceeds slowly, is expensive and probably requires more stringent steering than was the case in Finland 2001 \u2013 2004. However, the equity and fairness of the oral health care provision system improved and access to services and cost-sharing improved slightly. Finland has two parallel systems for delivering dental care. They are the Public Dental Service (PDS) and private services. The PDS was established in 1972 to ensure the provision of dental services in sparsely populated areas  and an improved national economy.Against this background, the aims of this study were to assess the impact of the oral health care reform, introduced in 2001\u20132002, on the utilization of publicly funded and private dental services, numbers of oral health care personnel and costs at both regional and national levels in 2000 and 2004, before and after the oral health care reform, using available data. The study also included an evaluation of how the health political goals of the reform: integrating oral health care into general health care, improving adults' access to care and lowering cost barriers had been fulfilled during the study period.In Finland, data for oral health care provided, oral healthcare workforce numbers and costs are reported at both municipal and national levels and then recorded in national registers -7, whichThe PDS and NHI data were classified according to the size and extent of urbanisation  and by g\u2022 the ten biggest cities (population over 75 000),\u2022 other urban municipalities (with at least 90% of population living in urban settlements or the population of the largest settlement with at least 15 000 inhabitants),\u2022 semi-urban municipalities (with 60\u201390% of the population in urban settlements and the population of the largest settlement of 4 000 \u2013 15 000 inhabitants)\u2022 rural municipalities.Geographically the data were divided into 5 groups corresponding with the University hospital regions Figure . Data onComparisons were made between the PDS and private services in 2000 and in 2004, regarding numbers of patients, numbers of care providers ,7 and chIn 2000, when access to publicly subsidised dental services for adults was restricted to those born in 1956 or later, every third adult had used the PDS or subsidised private services  was highest in East Finland and lowest in South Finland (p < 0.001). After the reform, the use of services was significantly lower in the North (p < 0.001) than in the other regions (p < 0.001) Figure . In all The utilisation of the PDS increased most in big cities and other urban municipalities (2.6 \u2013 2.9%-units) where previously use had been lowest Table . The useThe total number of working-age dentists (under 63 years) fell by 247 (5.3%) from 2000 to 2004. The PDS employed 131 dentists (6.5%) more and the private sector 143 dentists (6.9%) fewer after the reform. Population per dentist ratio increased from 1076 to 1146. The number of dental hygienists increased from 1022 to 1262 (23%) and population per dental hygienist ratio decreased from 5040 to 4122. No big changes occurred in the numbers of dental assistants and technicians.The regional differences in the distribution of dentists did not change between 2000 and 2004. Thus in both 2002 and 2004, 66\u201368% of the public dentists and 80% of the private dentists worked in the three southernmost University hospital regions Figure . The popThe total dental care expenditure (PDS plus private services) increased by 21% from 2000 to 2004 (from EUR 584 million to EUR 708 million)  and municipalities (80%) did not change. In the private sector the National Health Insurance financed a bigger part of the costs  and the patients' personal payments (out of pocket costs) decreased from 85% to 74% over the four year period.Patients' payments were the largest source of oral health care funding before the reform in 2000, accounting for 55% of total cost of oral care. After the reform, in 2004, patients funded slightly less than half of the costs of all oral care (49%). Local authorities funded 37% of the costs in 2000 and 38% in 2004 through municipal tax revenues and the state support to the municipalities. The NHI funded the remaining balance of 8% in 2000 and 13% in 2004  higher than public fees. The results of a questionnaire study conducted in 2004, suggested that the increase in use of subsidized dental services was greatest in amongst those with a middle level of education . Before Routine register data was used in this study. As dentists' remuneration in the PDS is partly based on these data and private patients' reimbursements by the NHI are fully based on recorded treatment, data on utilisation of dental services can be considered to be comprehensive in both sectors. One limitation was that because fewer than half of the adults treated in the private sector who were entitled to reimbursements only for reimbursable treatments, the total number of patients treated in the private sector had to be estimated. In 2000, fewer than half of the adults were entitled to such reimbursements whereas in 2004, all adults were entitled to reimbursements (except those who received a prosthetic care in the private sector). However, as few adults were likely to have received prosthesis without prior clinical examination or other treatments, which were eligible for partial reimbursement, a very small number would not have been recorded in the registers in 2004. A further potential complication in our estimates was that the PDS does not separate costs for the treatment of children and those for adults.The oral health care reform was considered politically so important that the Parliament passed the changes more rapidly than proposed by the Ministry of Social Affairs and Health which supervises the health care provision system. In a period of two years (2001 to 2002) 2.1 million adults (40.9% of the population), who had previously not been eligible, became eligible for Public Dental Services or subsidised private care. During the four years covered in this study, there was little guidance for the PDS on how to proceed with the implementation of the reform. According to the chief dentists in the PDS, the main priorities were recruiting new dentists and hygienists and delegating to dental hygienists tasks previously done mainly by dentists . HoweverThis study shows that there was a small increase in the supply of oral care services between 2000 and 2004. However, the mean number of patients seen in one year by a dentist in the PDS decreased from 863 to 840. On the other hand, the numbers of dental hygienists increased and they provided a greater proportion of children's treatments in the PDS than before . In the The chief dentists in the PDS complained that their dental staff did not support the speed of the reform. In particular, the changes required in work routines were often opposed locally . There wA special survey conducted on treatments provided in the PDS in 2003 showed that a third of the adult patients had made emergency visits to a dentist . This mai.e. the public sector catering for children, younger adults and special needs groups and the private sector for well-off middle-aged or older adults [The reform considerably increased the total running costs of oral health care. However, it should be noted that reducing costs and increasing efficiency were not primary goals of the reform. In 2004, the public sector saw 842 947 children and 964 214 adults  at a lower cost than the private sector which saw just over one million adults. The traditional distribution of the patients (r adults ), probabThe average rise in prices in the private sector between 2000 and 2004 was about 20% and the total NHI support for basic care provided by the private sector rose by 26% . Thus, iIn most OECD countries, considerable inequities exist in general health care . The FinThe results of this study indicate that implementation of a substantial reform, that changes the traditionally defined tasks of the public and private sectors in an established oral health care provision system, proceeds slowly, is expensive and probably requires more stringent steering than was the case in Finland 2001 \u2013 2004. However, the equity and fairness of the oral health care provision system improved and access to services and cost-sharing improved slightly.The author(s) declare that they have no competing interests.TeN: Principal investigator, collected data, performed statistical analyses, and wrote the manuscript.EW: Main supervisor, designed the study, and wrote the manuscript.TaN: Participated in the design of the study, collected data, and performed statistical analyses.All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
{"text": "Occasionally infection of an algal cell by an individual particle fails and the viral DNA is dynamically ejected from the capsid. This shows that the release of the DNA generates a force, which can aid in the transfer of the genome into the host in a successful infection. Imaging of ejected viral DNA indicates that it is intimately associated with proteins in a periodic fashion. The bulk of the protein particles detected by atomic force microscopy have a size of \u223c60 kDa and two proteins (A278L and A282L) of about this size are among 6 basic putative DNA binding proteins found in a proteomic analysis of DNA binding proteins packaged in the virion. A combination of fluorescence images of ejected DNA and a bioinformatics analysis of the DNA reveal periodic patterns in the viral DNA. The periodic distribution of GC rich regions in the genome provides potential binding sites for basic proteins. This DNA/protein aggregation could be responsible for the periodic concentration of fluorescently labeled DNA observed in ejected viral DNA. Collectively the data indicate that the large chlorella viruses have a DNA packaging strategy that differs from bacteriophages; it involves proteins and share similarities to that of chromatin structure in eukaryotes.Chlorella viruses have icosahedral capsids with an internal membrane enclosing their large dsDNA genomes and associated proteins. Their genomes are packaged in the particles with a predicted DNA density of ca. 0.2 bp nm Phycodnaviridae have a long evolutionary history possibly dating back to the time when eukaryotes arose from prokaryotes Chloroviruses in the family PBCV-1 virions, the prototype chlorovirus, are large icosahedral particles  that have an internal lipid bilayered membrane C. variabilis to initiate infection. The PBCV-1 spike first contacts the host cell wall + channel (named Kcv) predicted to be located in the internal membrane of the virus, followed by rapid release of K+ from the cell + and associated water fluxes from the host reduce its turgor pressure, which may aid ejection of viral DNA and virion-associated proteins into the host PBCV-1 infection resembles infection by tailed bacteriophages because its genome must cross the cell wall (and membrane) of its host \u22123. This value approaches the maximal theoretical density for DNA packaging and the DNA is almost at crystalline density inside the phage head \u22123\u22123.A property that all NCLDVs including the chloroviruses share with dsDNA bacteriophages and other DNA viruses is that they package a dsDNA genome into a geometrically confined capsid. An example of DNA packaging is the 48.5 kb genome of bacteriophage \u03bb. Its extended linear form of 16.5 \u00b5m DNA packaging density has implications for virus infection. Experiments and theoretical calculations indicate that the high DNA packaging density in phages generates enormous internal pressure in the particles ranging up to 50 bars PBCV-1 is unique among the NCLDVs in that it uncoats its DNA at the cell surface and leaves an empty capsid on the outside of the cell wall, similar to many tailed bacteriophages. Consequently, PBCV-1 may use similar mechanical forces to eject its genome into its host cell as phages PolyomaviridaePapillomaviridaeAdenoviridae, Asfarviridae, Baculoviridae) express small arginine rich protamine-like proteins with putative DNA condensation functions Phage DNA packaging depends primarily on two parameters, the function of motor proteins and cations. Dense packaging of DNA requires that 90% of its charge is neutralized Currently little information is available on the mode of DNA packaging in the large chloroviruses. At least in the case of PBCV-1, and presumably the other chloroviruses, DNA neutralization may also employ proteins because PBCV-1 virions contain 148 different viral-encoded proteins , some of which have been described as DNA-binding proteins C. variabilis cells with a high m.o.i. . Under these conditions it occurs as if the DNA is released from the virus particle but not able to enter the host; as a consequence the particle is dynamically catapulted away from the host cell leaving an unraveled, quasi-linear DNA polymer tethered to the cell. In some images it is possible to see the capsid at the end of the DNA thread projected away from the host (data not shown). The reason for the release of DNA into the medium is not known. However we know from other studies that usually only one virus infects the host cell, while the remaining viruses are excluded Phage DNA release is often triggered by an interaction between phage tails and host receptor. This interaction causes the DNA to rapidly expand and the DNA catapults out of the capsid This release of DNA into the medium must be fast because it is possible to detect isolated DNA molecules already within 5 min post infection. C. variabilis cell with the typical hole in the wall, which a virus digests in the course of infection. From this location two linear structures project away from the host in an angular fashion. The projecting structures are most likely unfolded viral DNA because the half width of their cross section is <10 nm. The combination of electron microscopic and fluorescent images suggests that PBCV-1 DNA might not in all cases enter its host initially by either of its termini. This scenario would suggest that packaging of the DNA in the virion differs from ejection because it is unlikely that DNA packaging begins in the middle of the genome.Frequently we observed two DNA strands under the same conditions, which projected away from the host at a common point of origin . This phClose scrutiny of the fluorescently labeled ejected PBCV-1 DNA suggests it is structured. The images indicate: i) a non-uniform distribution of DNA and ii) loops in the DNA polymer. Images of ejected DNA at higher magnifications indicate that the fluorescence associated with the DNA exhibits distinct maxima. In regions where the fluorescence signal was well resolved the intensity maxima were quasi periodic . In thisThe structured pattern seen with PBCV-1 DNA does not occur in fully ejected DNA from phages \u03bb or T5; the phage DNAs fluoresce homogeneously along the axis of the extended polymer In addition to these periodic domains of concentrated DNA, we occasionally detected another higher order organization in the PBCV-1 DNA strands ; in thisCollectively, the data suggest that PBCV-1 DNA is stored inside the capsid in an ordered fashion. This structure includes a periodic formation of folds and on a larger scale a formation of loop structures. These loop structures probably open up during the ejection and are hence observed only in rare cases.To obtain more information on PBCV-1 DNA structure we viewed the isolated DNA by AFM. For these experiments PBCV-1 particles were osmotically shocked and subsequently transferred with the emerging content onto fresh mica for imaging. This procedure separates proteins that are tightly bound to DNA from those that are free. Association of DNA with proteins was reported in a previous AFM study on ruptured PBCV-1 particles A comparison between images of PBCV-1 DNA shows that proteins associated with DNA in AFM images produce a different periodic pattern than the fluorescence images. The reason for this difference in DNA/protein association is probably related to the isolation method. The image in 3 (435 measurements) and 66.4\u00b10.09 nm3 (652 measurements), respectively. Measurements of 711 randomly chosen protein particles associated with the disrupted virus produced a mean volume of 60.3\u00b10.09 nm3. These experiments suggest that the PBCV-1 DNA particles are associated with a protein(s) in the range of ca. 60 kDa. The resolution of the images does not allow one to distinguish between monomers of a 60 kDa protein or multimers of smaller proteins.To estimate the size of the proteins associated with PBCV-1 DNA, we imaged the volume of a large number of DNA associated protein particles ; this isTo estimate the ratio of proteins that associate with DNA from the virus particles, we measured the length of the DNA molecule versus the number of total proteins in 5 images e.g., . For thi\u221210) and one match in the decoy database occurred with a protein score of 48 (cutoff of 43). From the spectra, 9 viral proteins were identified with a significance of p<0.05  and estimated the most abundant proteins in the particle using the exponentially modified protein abundance index (emPAI) algorithm The periodic pattern of isolated DNA bands reported in According to the distribution of Fourier-amplitudes , the mosThis protocol has an additional advantage because it can conceptually reveal periodicities of much larger motifs; e.g., consider the simple case of two motifs separated by some variable genomic region. Separately these two motifs would each exhibit the same periodicity. If we analyze the data averaged over all motifs, however, we also reveal the \u201csynchronization\u201d of the motifs along the chain and therefore the correlated periodicity.To verify our results and to demonstrate the robustness of our protocol we repeated the analysis using a strict criterion: an exact match between the motif without wildcard characters and the genomic fragment. As mentioned in the The present results suggest that chlorovirus PBCV-1, like their eukaryotic hosts, neutralize their DNA with DNA binding proteins. The data are consistent with a model in which the viral genome has an inherent pattern with periodically spaced GC rich regions, which provide interactive sites for DNA binding proteins. DNA is presumably wound around the respective basic proteins for neutralization and packaging. The interaction results in the isolated DNA containing periodic thickenings; a higher order of organization may also involve small loops, which contribute to packaging DNA and/or gene regulation. The robust aggregation of the DNA with proteins also favors a stable structure for the virus DNA when it is ejected into the cytosol of the host, where the cation concentration is reduced Chlorella NC64A (recently named Chlorella variabilisC. variabilis cells were inoculated in MBBM containing 30 \u00b5M DAPI with the fluorescently labelled PBCV-1 at a multiplicity of infection (m.o.i) of \u223c100 10 PFU/ml) was incubated for 1 h in 0.5 M KCl solution and then rapidly transferred to 60 mM KCl. For microscopic imaging experiments, the DNA was then labelled by adding 30 \u00b5M DAPI to this solution. For other experiments, we transferred the particles to fresh mica for atomic force microscopy (AFM) imaging or kept the diluted solution for 1 h before separating the soluble proteins from the released DNA according to PBCV-1 particles and ejected fluorescently-labelled DNA were imaged on a Zeiss Axioskop 40\u2122epifluorescence microscope. Samples were excited at 358 nm and fluorescence detected through a 461 nm filter. The images were recorded with a sensitive electron multiplying charged coupled device and a digital camera Andor LUCA\u2122.Images of ejected DNA were obtained with an AFM  using a cantilever  with a <10 nm tip. Fifty \u00b5l of a solution containing PBCV-1 particles or viral DNA (10 ng/\u00b5l), which was released from the capsids by osmotic shock, were incubated for 5 min on a smooth mica surface. The preparation was washed twice with 1 ml distilled water and dried by high air pressure . For imaging, the tapping mode was used which reduces sample exposure. The volume of particles was analysed using the particle analysing tool Image Processing Software, Image Metrology A/S with standard settings.N, where N is the motif length. Any periodic or semi-periodic structures in this data are revealed by Fourier analysis as peaks in the Fourier components. We restricted our analysis to small motifs because of computational constraints. Therefore, we could not detect signals for larger motifs directly, e.g., two binding motifs connected by a highly variable region. This prompted us to not look for one particular motif with the most pronounced peak in the Fourier spectrum. Instead, we counted how often a particular length scale appeared, averaged over all motifs. This protocol has an additional advantage because it also reveals periodicities of much larger motifs; e.g., consider the simple case of two motifs separated by some variable genomic region. Separately these two motifs would exhibit the same periodicity. If we analyze the data averaged over all motifs, however, we also uncover the \u201csynchronization\u201d of the motifs along the chain and therefore the correlated periodicity. We also analyzed the motifs that contributed most, for their relative content of nucleotide types.The experimental results indicated that one or more DNA binding proteins were involved in organizing the viral DNA in nearly equidistant units; if so, the mechanism would most likely require periodic binding motifs in the DNA. To identify protein-binding domains in PBCV-1 DNA we analyzed its genome sequence for periodic signals using our own code C. variabilis and PBCV-1 virus. Additional search parameters were set to monoisotopic mass, charge 1+, maximum of 1 missed cleavage, peptide tolerance of 0.3 m/z and p<0.05. The root mean square (RMS) errors on the peptide mass matches ranged from 21\u2013102 ppm. As a control, all searches were repeated using the decoy database generated by the Mascot Server software, using the same settings. In some cases, high energy CID MS/MS sequencing of the peptides was employed (using the same samples and instrumentation) to confirm protein identification.In a further analysis we separated DNA bound proteins from the re-suspended pellet by SDS PAGE. Peptide map fingerprinting (PMF) of proteins from SDS-PAGE gel slices was performed using standard procedures, with treatment of the proteins with dithiothreitol and iodoacetamide followed by trypsin digestion. Peptides eluted from the gels were purified on ZipTip C18 columns (Millipore) and applied to a stainless steel target together with \u03b1-cyano-4-hydroxycinnamic acid as a matrix. The peptides were analyzed in a reflectron mode using a Shimadzu Biotech Axima Performance MALDI-TOF mass spectrometer. Calibration was via nearest neighbor external standards, using 8 peptides (Sigma Aldrich) with m/z from 757.4 to 3657.9. Mass lists from the individual PMF spectra were submitted to an in-house Mascot Server PMF search engine using the NCBInr database. The taxonomy was limited to The virus was purified essentially as described previously Nobserved/Nobservable\u22121). We assumed the major capsid protein (A430L) is present in 1440 copies per virion for these calculations and other protein abundances were estimated from this value.Virion proteins were evaluated essentially as described Bioinformatics Analysis S1Application of Fast-Fourier-Transformation (FFT) protocol for detecting potential periodicities of binding motifs in the genome of dsDNA virus PBCV-1.(DOC)Click here for additional data file."}
{"text": "The monotonicity of the solutions of a class of nonlinear fractional differential equations is studied first, and the existing results were extended. Then we discuss monotonicity, concavity, and convexity of fractional derivative of some functions and derive corresponding criteria. Several examples are provided to illustrate the applications of our results. Fractional calculus is a generalization of the traditional integer order calculus. Recently, fractional differential equations have received increasing attention since behavior of many physical systems can be properly described as fractional differential systems. Most of the present works focused on the existence, uniqueness, and stability of solutions for fractional differential equations, controllability and observability for fractional differential systems, numerical methods for fractional dynamical systems, and so on see the monographs \u20134 and thIt is well known that the monotonicity, the concavity, and the convexity of a function play an important role in studying the sensitivity analysis for variational inequalities, variational inclusions, and complementarity. Since fractional derivative of a function is usually not an elementary function, its properties are more complicated than those of integer order derivative of the function. The focal point of this paper is to investigate the monotonicity, the concavity, and the convexity of fractional derivative of some functions.Now we recall some definitions and lemmas which will be used later. For more detail, see \u20134. a, b] of \u211d, the fractional order integral of a function f \u2208 L1 of order \u03b1 \u2208 \u211d+ is defined byGiven an interval  can be written asRiemann-Liouville's derivative of order f is defined on the interval  and fn)((t) \u2208 L1. The Caputo's fractional derivative of order \u03b1 with lower limit a for f is defined asn \u2212 1 < \u03b1 \u2264 n.Suppose that a function \u03b1 \u2264 1, it holds thatParticularly, when 0 < \u03b1. Namely,Re(\u03b1) denotes the real parts of \u03b1.There exists a link between Riemann-Liouville and Caputo's fractional derivative of order \u03b1 < 1, it holds thatParticularly, for 0 < f :  \u2192 \u211d with  \u2282 \u211d is said to be convex if whenever t1 \u2208 , t2 \u2208 , and \u03b8 \u2208 , the inequalityA function RLDt0\u03b1f(t) and CDt0\u03b1f(t). Summarizing this paper forms the content of The rest of this paper is organized as follows. \u03b1 < 1. The paper  and u(t0) \u2265 0, then the solutions u(t) of  of  are nonng) \u2265 0 and (d/dt)g) \u2265 0 on , then the solution u(t) of  of  is nondeg) \u2264 0 and (d/dt)g) \u2264 0 on , then the solution u(t) of  of  is not iAssume that 0 < tions of  exist.Ifg) \u2265 0, it holds that (1/\u0393(\u03b1))\u222bt0t(t \u2212 s)\u03b1\u22121g)ds \u2265 0. Noting u(t0) \u2265 0, we have u(t) \u2265 0.The conclusion of (1) is obvious. In fact,  is equivd/dt)g) \u2265 0 on  and g) \u2265 0, thus t0, t1]. Hence u(t) is nondecreasing on , and (2) holds.Now we prove the validity of (2) and (3). First, by the definition of the Caputo's derivative, it holds from  that(10Similar to the proof of (2), we can prove that (3) holds. This completes the proof.g = \u03bbu, then (CDt0\u03b1u(t) = \u03bbu. The solution u(t) of CDt0\u03b1u(t) = \u03bbu isu(t0) \u2265 0, thenLemma\u2009\u20092.4 in  is a par\u03bbu, then  is CDt\u03b1 < 1. Consider the fractional differential equationt > 0, we have t + sint \u2265 0 and (t + sint)\u2032 = 1 \u2212 cos\u2061t \u2265 0. By u(t) is nondecreasing in t for t \u2265 0. Assume that 0 < \u03b1 < 1. Consider the fractional differential equationg) = \u22122, then g) < 0 and t \u2265 t0. By f(t) is not increasing. In fact, by computation we get t0, \u221e), thus f(t) is decreasing. Assume that 0 < The following fractional comparison principle is an improvement of Lemma\u2009\u20096.1 in  and Theo\u03b1 < 1 and CDt0\u03b1f(t) \u2265 CDt0\u03b1g(t) on interval . Suppose further that f(t0) \u2265 g(t0), then f(t) \u2265 g(t) on .Suppose that 0 < CDt0\u03b1f(t) \u2212 CDt0\u03b1g(t) = m(t), t \u2208 . ThenIt0\u03b1 on both sides of (m(t) \u2265 0, thus It0\u03b1(m(t)) \u2265 0. Then we havef(t) \u2265 g(t) on , and the proof is completed.Set 1]. ThenCDt0\u03b1. Theorem\u2009\u20092.6 in  such that f(t0) \u2264 0, t0, t1], then RLDt0\u03b1f(t) is nondecreasing on ; f(t0) \u2265 0, t0, t1], then RLDt0\u03b1f(t) is not increasing on ; f(t0) > 0, t0, t1] and \u03b2 \u2208  such that RLDt0\u03b1f(t) is not increasing on  and is not decreasing on ; f(t0) < 0, \u03b7 \u2208  such that RLDt0\u03b1f(t) is nondecreasing on  and RLDt0\u03b1f(t) is not increasing on .Assume that 0 < d/dt)(RLDt0\u03b1f(t)) \u2265 0 on . Thus RLDt0\u03b1f(t) is nondecreasing on . By assumptions in (2), it follows that RLDt0\u03b1f(t) is not increasing in t on . Consequently, the conclusions of (1) and (2) are true.Using formula , we havef(t0) > 0 and t \u2192 t0. By the fact that \u03b41 > 0 such that (d/dt)(RLDt0\u03b1f(t)) \u2264 0 on . On the other hand, when \u03b2 \u2208  such that (d/dt)(RLDt0\u03b1f(t)) \u2264 0 on  and (d/dt)(RLDt0\u03b1f(t)) \u2265 0 on . Therefore, the conclusion of (3) is valid.Let us prove (3). Noting formula ,(24)ddtThe proof of (4) is similar to that of (3). This completes the proof. CDt0\u03b1f(t). Now we are to investigate the monotonicity of the function \u03b1 < 1. If there exists an interval  such that t0, t1] and CDt0\u03b1f(t) is nondecreasing on . If t0, t1] and CDt0\u03b1f(t) is not increasing on . Assume that 0 < t0, t1] and d/dt)(CDt0\u03b1f(t)) \u2265 0 in t on . Hence, CDt0\u03b1f(t) is nondecreasing on interval . If d/dt)(CDt0\u03b1f(t)) \u2264 0. Hence, CDt0\u03b1f(t) is not increasing on . The proof is completed. Set The following examples illustrate applications of Theorems \u03b1 < 1. Consider RLDt0\u03b1f(t), where f(t) = et, for all t0 \u2208 \u211d. Since \u03b2 > t0 such that RLDt0\u03b1(et) is decreasing on  and is increasing on . Since (sint)\u2032\u2032 \u2264 0 for t \u2208  and (sint)\u2032|t=\u03c0/2 = 0, by CD\u03c00.5\u03b1sint is decreasing on . By similar argument, CD\u03c01.5\u03b1sint is increasing on t \u2208 . Since CDt0\u03b1sint = (1/\u0393(1 \u2212 \u03b1))\u222bt0t(t \u2212 \u03c4)\u03b1\u2212cos\u2061\u03c4d, thus (1/\u0393(1\u2009\u2212\u2009\u03b1))\u222b\u03c00.5t(t\u2009\u2212\u2009\u03c4)\u03b1\u2212cos\u2061\u03c4d\u03c4 is decreasing on  and (1/\u0393(1 \u2212 \u03b1))\u222b\u03c01.5t(t \u2212 \u03c4)\u03b1\u2212cos\u2061\u03c4d\u03c4 is increasing on t \u2208 .Assume that 0 < \u03b1 < 1. Consider CDt0\u03b1f(t); here t0 = 1 and f(t) = t \u2212 t2. Obviously, t \u2208 , CDt0\u03b1f(t) is not increasing on .Assume that 0 < RLDt0\u03b1f(t) and CDt0\u03b1f(t). By formula  \u2265 0 on , f(t0) > 0, then RLDt0\u03b1f(t) is concave on . If f\u2032\u2032\u2032(t) \u2264 0 on , f(t0) \u2264 0, then RLDt0\u03b1f(t) is convex on . Assume that 0 < CDt0\u03b1f(t). The next theorem is on the convexity and the concavity of \u03b1 < 1. If there exists an interval  such that f\u2032\u2032\u2032(t) \u2265 0 on , CDt0\u03b1f(t) is concave on . If f\u2032\u2032\u2032(t) \u2264 0 on , CDt0\u03b1f(t) is convex on . Assume that 0 < f\u2032\u2032\u2032(t) \u2265 0 on , d2/dt2)(CDt0\u03b1f(t)) \u2265 0 on . Hence, CDt0\u03b1f(t) is concave in t on . If f\u2032\u2032\u2032(t) \u2264 0, on , d2/dt2)(CDt0\u03b1f(t)) \u2264 0 on . Therefore CDt0\u03b1f(t) is convex in t on . By formula , we have\u03b1 < 1. Consider the fractional differential equation CDt0\u03b1f(t); here t0 < 0 and f(t) = t \u2212 t2. Obviously, f\u2032\u2032\u2032(t) = 0. For all t0 < 0, it holds that f\u2032\u2032\u2032(t) = 0 on . Then by CDt0\u03b1(t \u2212 t2) is convex on . Assume that 0 < RLDt0\u03b1f(t), where f(t) = et, t0 \u2208 \u211d. Obviously, Theorems RLDt0\u03b1et. Now we employ the method which is used in the proof of t \u2208 . Thus (d2/dt2)(RLDt0\u03b1et) > 0 on  and (d2/dt2)(RLDt0\u03b1et) \u2265 0 on  and is concave on [\u03b2, +\u221e). Consider the concavity and convexity of the function proof of d2dt2 and CDt0\u03b1f(t). Based on the relation between the Riemann-Liouville fractional derivative and the Caputo's derivative, we obtain the criteria on the monotonicity, the concavity, and the convexity of the functions RLDt0\u03b1f(t) and CDt0\u03b1f(t). In the meantime, five examples are given to illustrate the applications of our criteria.The main part of this paper is to study the monotonicity, the concavity, and the convexity of the functions"}
{"text": "Macleaya cordata extract is of great scientific and practical interest to researchers, due to its antimicrobial and anti-inflammatory responses within experimental animals. This study was designed to determine the diarrhea score and innate immunity of growing piglets after they had received Macleaya cordata extract supplements. A total of 240 growing pigs were randomly assigned to one of three dietary treatments, with 8 replicates per treatment and 10 piglets per replicate. All pigs received a basal diet containing similar amounts of nutrients. The three treatments were a control (no additive), an antibiotic (200\u2009mg/kg colistin), and the Macleaya cordata extract supplement group (40\u2009mg/kg Macleaya cordata extract). The diarrhea score was calculated after D 28. The jejunal samples were obtained from five piglets selected randomly from each treatment on D 28. In comparison with the control group, the dietary Macleaya cordata extract and colistin group demonstrated a substantially decreased diarrhea score. The introduction of Macleaya cordata extract supplements to the diet significantly increased volumes of ZO-1 and claudin-1, particularly in comparison with the pigs in the control group (P < 0.05). The findings indicate that Macleaya cordata extract does enhance intestinal barrier function in growing piglets and that it could be used as a viable substitute for antibiotics. In recent years, there has been an increased focus on reducing or eliminating the use subtherapeutic antibiotics within livestock diets. For this reason, there has been a concerted effort to identify alternative effective therapies that could serve as a substitute for antibiotics in pig diets. The aim is to maintain acceptable performance levels and ensure food safety for consumers . The medMacleaya cordata extract is believed to be an effective natural appetiser in swine, bovine, poultry, and even fish nutrition [ Macleaya cordata extract is blended from intact aerial parts and a fraction of quaternary benzo[c]phenanthridine alkaloids (QBAs), primarily sanguinarine (SG) and chelerythrine (CH), and standardised to 1.5%\u2009w/w SG phenanthridine alkaloid, is synthesised from dihydrosanguinarine, via the activities of dihydrobenzophenanthridine oxidase . It has  Fumaria varieties. It is a quaternary benzo[c]phenanthridine alkaloid. According to studies, it mostly exhibits tumour resistant, microbe resistant, and inflammation resistant qualities. Plus, the substance is a powerful disruptor when it comes to PKC (or protein kinase C). As such, the prospective utilisation of CHE, as a form of inflammation resistance, has been the topic of much debate. Its qualities are linked to its capacity to engage with DNA and proteins [Chelerythrine can be found within the greater celandine plant and a number of additional poppyproteins . This isproteins . Macleaya cordata extracts might stimulate the immune system and, as a consequence, decrease the incidence of diarrhea in growing piglets. Thus, the objective of the study was to evaluate the impact of Macleaya cordata extract, as a dietary supplement, on diarrhea scores and the expression of tight junction proteins.For this study, we hypothesised that dietary supplementation withAll of the procedures used in this study have been approved by the Institute of Subtropical Agriculture, the Chinese Academy of Sciences Animal Care and Use Committees. A total of 240 (Yorkshire \u00d7 Landrace) \u00d7 Duroc  pigs were obtained from a commercial swine herd in Guangdong, China. 240 piglets were assigned, in completely random design (but based on their BW), to 24 pens. The pens each contained a total of ten piglets. The process was carried out according to the experimental animal allotment program created by Kim et al. . All pen Macleaya cordata extract group . The Macleaya cordata extract was kindly provided by Phytobiotics Futterzusatzstoffe GmbH, Eltville, in Germany and Micolta Bioresource Inc., in Changsha, China. The pigs had unlimited access to feed and water throughout the entirety of the study.All piglets were fed the same basal diet, with a similar amount of nutrients . This diOn days 7, 21, and 28 of treatment, 10\u2009mL of blood was collected in plastic uncoated tubes between 8:00 and 10:00 a.m. After collection, these blood samples were centrifuged at 8000\u2009\u00d7g for 10 min at 4\u00b0C, with sera collected and frozen at \u221220\u00b0C until further analyses.To evaluate diarrhea incidence, faecal consistency scores  were determined for each pen. These scores were collected by a trained individual, but who had no prior knowledge of the dietary treatments provided. The incidence of diarrhea was calculated by dividing the total number of pigs with diarrhea by the total number of all experimental pigs. The rate ratios were then calculated. On day 28 of the experiment, a number of the pigs (1 pig/pen) were killed. 1 sample of jejunal mucosa was collected in a sterile sample bag and stored at \u221220\u00b0C until analysis.\u03b3-calculating instrument GC-300  was also used as part of this equipment. Recommendations from the maker were followed at all times.The serum volumes of IgM and IgG were calculated according to readings from the 1251 Radio Immunoassay Analysing tool . A The volume of serum D-lactate and DAO were calculated using Beckman Cx4 Chemistry Analyser  with a kit . Recommendations from the maker were followed at all times. All changes to or within the serum diamine oxidase were calculated with assay equipment.\u03b1 (TNF-\u03b1) within serum was calculated via the use of a Porcine TNF-\u03b1 Colorimetric ELISA tool . 50\u2009\u03bcL of regular plus dilute solution (or 100\u2009\u03bcL of the sample) was introduced to microplate wells. The wells had already been pretreated with capture antibody, as well as biotinylated antibody reagent. Identification relied on the utilisation of horseradish peroxidase, a stop solution of 0.18\u2009N H2SO4, and TMB substrate. The identification parameter for TNF-\u03b1 was 5\u2009pg/mL. Merging was detected at 450 and 540\u2009nm, with the use of the KC4 data evaluation programme and an ELISA plate tool.The proportion of tumour necrosis factor-\u03b2-actin functioned as an interior control because it expressed no dissimilarities across the populations. The significance of the protein display was represented by the ratio of the densitometry units of \u03b2-actin and tight junction protein. For a short time, all protein was removed, according to the advice provided by a protein removal tool . The mucosa proteins within the intestines were isolated with a polyacrylamide substance . They were then introduced to polyvinylidene difluoride membranes. These membranes were kept secure and protected for twelve hours, at a temperature of 4\u00b0C, after the introduction of the first antibodies. After the introduction of the secondary antibody, they were kept at 25\u00b0C, for 120 minutes. The first antibodies  were sourced from Santa Cruz Biotechnology . The secondary antibodies used were goat anti-rabbit IgG-HRP and rabbit anti-goat IgG-HRP .The tight junction protein displays of occludin, claudin-1, and zonula occludens-1 (ZO-1) were calculated with the use of western blotting. Western blot testing was carried out via the use of a sophisticated chemiluminescence identification tool . The results were captured with the ChemiScope 3400 device . They were evaluated with the use of Quantity One equipment . The To evaluate and verify the results, an analysis of variance (or ANOVA) method was used for basic classification and order of a completely randomized design. Before ANOVA, the evenness of its variance was checked using the Bartlett technique. Then, the regularity of the information was tested using the Kolmogorov-Smirnov method. At certain points, a Duncan multiple range method  was utilised to calculate dissimilarities across mean values. Macleaya cordata extract on the serum biochemical parameters and volume of antibodies in the growing pigs on days 7, 14, and 28 after the start of the study.P < 0.05) in pigs from the MC group, when compared with the other 2 groups. The serum concentrations of D-lactate, DAO, IgM, and TNF-\u03b1 did not exhibit any substantial or notable differences (P > 0.05) across the treatments, on day 7 after the launch of the study.On day 7, the concentration of IgG was higher (P < 0.05) across the treatments. There was a lower concentration in pigs from the AB group. The other serum parameters for the pigs remained the same (P > 0.05), due to the impact of dietary supplementation with Macleaya cordata extract (P < 0.05). The other parameters exhibited no notable changes (P < 0.05), as a consequence of the experimental treatments.On day 14, the serum concentration of D-lactate was the only parameter that showed a significant difference ( extract . On day P < 0.05), in comparison with those in the NC and AB groups. Also, ZO-1 protein increased significantly (P < 0.05), in comparison with that of the NC group. Thus, the dietary supplementation of Macleaya cordata extract and antibiotics substantially increased the expression of Claudin-1 (P < 0.05), particularly when compared with that of the NC group. Escherichia coli and others pathogenic bacteria inside the gut after weaning. This leads to a loss of water and electrolytes, via the semiliquid faeces [Diarrheal syndrome occurs primarily because of an increase ind faeces . Accordid faeces  and Kongd faeces , the supAs Newton et al.  explain,There is a relationship between intestinal pH, microflora population, and diarrhea incidence in pigs . This is Macleaya cordata extract also has other important characteristics, such as its anti-inflammatory effect and immunomodulatory properties [ Macleaya cordata extract, provided as a natural supplement to growing pigs, could be a viable substitute for feed antibiotics.Crucially,operties , 8, 9, wP < 0.05) of IgG in pigs of MC group ), perhaps because of a higher immunological stability in the pigs. However, other studies on medicinal plant additives have shown a variability in the serum concentration of IgG in pigs [P < 0.05 = in pigs from MC group). IgM is the first to be synthesised, as a response to infection [ Macleaya cordata extract, we observed a healthy response in growing pigs (It should be noted that this serum antibody (IgG) did not increase ( in pigs , 17. Inting pigs . AccordiWhen it comes to sustaining and protecting the translocation of bacteria in the intestines, an undamaged intestinal barrier is very important. It stops allergenic and toxic substances from making their way inside the gut and becoming a danger , 20. D-L\u03b2-actin and occludin [ Macleaya cordata to the diet, as an additional supplement, boosts volumes of ZO-1 and Claudin-1 proteins.The intestinal barrier is tightly controlled by a carefully arranged piece of the epithelial junctional complex. It is usually called \u201cthe tight junction\u201d . The poroccludin . It alsooccludin . For thi Macleaya cordata extracts to the diet, as an additional supplement, can increase resistance to intestinal damage, to some degree. This is achieved, throughout the growing stage, via increases in the volume and generation of claudin-1 and ZO-1. A number of earlier studies, on animals, had already made it clear that intestinal strength is closely linked to claudin-1 and ZO-1 volumes [ E. coli [The experiment shows that introducing volumes . Accordi volumes , fluctua E. coli . It happ E. coli . For all E. coli  and, eve Macleaya cordata extract supplements caused a reduction in faecal dysfunction. This result was underscored by larger volumes of claudin-1 and ZO-1. Consequently, the fortifying impact of Macleaya cordata supplements may be, to some degree, linked with the enhancement of intestinal barrier strength, particularly when it comes to treating conditions like diarrhea.To summarise, boosting the diet with"}
{"text": "Keratin (K) 19-positive hepatocellular carcinoma (HCC) is well known to have a higher malignant potential than K19-negative HCC: However, the molecular mechanisms involved in K19-mediated progression of HCC remain unclear. We attempted to clarify whether K19 directly affects cell survival and invasiveness in association with cellular senescence or epithelial-mesenchymal transition (EMT) in K19-positive HCC.K19 in the human HCC cell lines, HepG2, HuH-7, and PLC/PRF/5. Finally, we investigated HCC invasion, proliferation, and angiogenesis using K19-positive HCC specimens.K19 expression was analysed in 136 HCC surgical specimens. The relationship of K19 with clinicopathological factors and survival was analysed. Further, the effect of K19 on cell proliferation, invasion, and angiogenesis was examined by silencing K19 silencing suppressed cell growth by inducting apoptosis or upregulating p16 and p27, resulting in cellular senescence. In addition, transfection with K19 siRNA upregulated E-cadherin gene expression, significantly inhibited the invasive capacity of the cells, downregulated angiogenesis-related molecules such as vasohibin-1 (VASH1) and fibroblast growth factor 1 (FGFR1), and upregulated vasohibin-2 (VASH2). K19-positive HCC specimens exhibited a high MIB-1 labelling index, decreased E-cadherin expression, and high microvessel density around cancer foci.Analysis of HCC surgical specimens revealed that K19-positive HCC exhibited higher invasiveness, metastatic potential, and poorer prognosis. In vitro experiments using the human HCC cell lines revealed that K19 directly promotes cancer cell survival, invasion, and angiogenesis, resulting in HCC progression and poor clinical outcome. K19 may therefore be a novel drug target for the treatment of K19-positive HCC.The online version of this article (doi:10.1186/s12885-016-2949-y) contains supplementary material, which is available to authorized users. Liver cancer is the second leading cause of cancer death in men worldwide. In 2012, the incidence of liver cancer was estimated at 782,500 and 745,500 deaths were associated with this disease . In prevThe mechanisms responsible for the increased malignancy of K19-positive HCC compared to conventional K19-negative HCC have been previously explored in the study by Govaere et al. . In the Tissue specimens were collected from 136 patients with HCC who underwent primary curative hepatectomy at the Nara Medical University Hospital, during the period between 2007 and 2012. No other treatments were given before resection. There were 103 men and 33 women with an age range of 29 to 84 (mean 69) years. Of the 136 HCC cases, 33 (24.3%) were positive for hepatitis B virus surface antigen (HBsAg), 62 (45.6%) were positive for hepatitis C virus antibody (HCVAb), and 43 (31.6%) were negative for both HBsAg and HCVAb. The follow-up period from surgical treatment until death due to HCC (16 cases) or the end of this study was 30 to 2550\u00a0days (mean 1100\u00a0days).Tissues were fixed in 10% formalin, embedded in paraffin, cut into 3\u00a0\u03bcm sections, and mounted on silane-coated slides. One section from each tissue was stained with hematoxylin and eosin for histological examination. The diagnosis of HCC was based on WHO criteria . RecurreImmunohistochemical study was performed on paraffin sections using a BOND MAX Automated Immunohistochemistry Vision Biosystem . For antigen retrieval step, Bond Epitope Retrieval Solution 1   was used. Antibodies for immunohistochemistry are listed in Table\u00a0The human HCC cell lines, HepG2, HuH-7, and PLC/PRF/5 were purchased from Japanese Collection of Research Bioresources Cell Bank  and cultured in RPMI supplemented with 10% FBS.5 cells per well in 6-cm plates, and transfected with 100\u00a0nmol/L control RNA  or human K19 siRNAs using Lipofectamine RNAiMAX , in accordance with the manufacturer's protocol. After culturing for the indicated time, the samples were removed and homogenized.The cells were seeded at 10Template cDNA was synthesised from 1\u00a0\u03bcg of total RNA using Primer Script RT reagent Kit . The quantitative real-time PCR detection was performed using a SYBR\u00ae Premix Ex Taq kit (Takara). The amount of actin mRNA in each sample was used to standardise the quantity of each mRNA. The sequences of the primers used for PCR are shown in Table\u00a0For the cell proliferation assay, the methane thiosulfonate (MTS) reagent was used as previously described \u201314. All In vitro invasion assays were performed using Matrigel invasion chambers  as previously described . InvadinCells were fixed at 70% confluence and then incubated at 37\u00a0\u00b0C overnight with staining solution containing X-gal substrate . Cells were then observed under a microscope for the presence of blue stain .Liquid based cytology (LBC) was used to prepare the cell lines for apoptosis assay by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate-biotin nick end labelling (TUNEL) using the ApopTag in situ apoptosis detection kit  . We idenp\u2009<\u20090.05.Differences in continuous variables were analysed using ANOVA or nonparametric tests . All the experimental results were analysed using the 1-way analysis of variance and Tukey\u2019s post-hoc test. The 2-tailed student\u2019s t-test was used to compare 2 data points. The survival curves were calculated by the Kaplan-Meier method, and the differences between curves were analysed by the log-rank test. Multivariate analysis for overall survival was performed using a Cox regression model with forward stepwise selection. The results were considered to be statistically significant if p\u2009=\u20090.002). Among the organs, metastasis to lung was most frequently observed in this study (p\u2009=\u20090.003). There was no significant difference between K19 expression and HBV or HCV infection. The non-HBV/non-HCV group and other pathological parameters such as microvascular invasion and fibrous stroma were not statistically correlated with K19 expression.Out of the total 136 HCC cases, 12\u00a0K19-positive HCC cases (8.8%) were examined in the present study Fig.\u00a0. Resultsp\u2009<\u20090.01)  unless the data were analysed during an early phase  Fig.\u00a0. In contase Fig.\u00a0. The mulK19 expression was successfully suppressed by transfection with K19 siRNA, followed by 72-h incubation   Fig.\u00a0. In cont01) Fig.\u00a0. The Ki-01) Fig.\u00a0. These pIn the current study, we demonstrated that K19 promoted HCC invasion, proliferation, and angiogenesis, using in vitro experiments and immunohistochemistry. Survival analysis revealed that patients with K19-positive HCC had significantly poorer overall survival than did patients with K19-negative HCC, although K19 expression was not an independent predictor in the multivariate analysis for overall survival. In previous reports, K19-positive HCC demonstrated higher invasiveness, greater metastatic potential, and poorer prognosis than did conventional HCC. Moreover, K19-positive HCC specimens examined had greater vessel invasion, poor differentiation, greater infiltrative growth, and more extrahepatic metastasis than did K19-negative HCC specimens , 8. AlthK19 knockout mice were viable, fertile, and appear normal [The keratins, which are intermediate filament proteins, play several important roles within the cell. For instance, they maintain the mechanical stability and integrity of epithelial cells, as well as participate in several intracellular signalling pathways involved in coping with cell stress . K19 is r normal . In the p53, p16INK4a and p15INK4. p16 is well known to induce cell quiescence, which is tightly associated with cell differentiation. Thus, K19 could inhibit HCC cell differentiation by regulating p16. Apoptosis was induced by K19 knockdown in vitro; however, the TUNEL assay did not indicate a significant difference in apoptosis induction between K19-positive and K19-negative HCC areas. The percentage of Ki-67-positive cells was statistically higher in K19-positive HCC areas than in K19-negative areas. Considered together with the in vitro data, K19 appears to promote HCC cell proliferation, and its suppression effectively inhibits tumour growth via induction of cytotoxicity.Ozturk et al.  reportedK19 knockdown in HCC cell line resulted in reduced invasive ability. We found that K19 promotes cancer invasion in HepG2 cells through the downregulation of E-cadherin gene expression. Gene expression of snail, N-cadherin, and vimentin was not affected by K19 knockdown. Kim et al. [Recently, Govaere et al.  reportedm et al.  reportedm et al. . The mecK19 upregulated FGFR1 and VASH1 and downregulated VASH2 in HCC cells. Moreover, immunochemical analysis showed increased blood vessels in K19-positive HCC. FGFR1 is a receptor tyrosine kinase that activates endothelial-cell proliferation and migration [K19 may enhance tumour angiogenesis by regulating FGFR1, VASH1, and VASH2 in HCC. Yoneda et al. [We showed here that igration . Thus, iigration . Recent igration , 26. Sevigration , 28. VASa et al.  reportedK19 enhanced angiogenesis by affecting the expression of angiogenesis-related genes such as VASH1, VASH2, and FGFR1. Thus, K19 directly promotes cancer cell survival, invasion, and angiogenesis. K19 could be a new target molecule for the development of therapies against K19-positive HCC.Our findings clearly indicate that K19 has a direct role in promoting HCC cell survival and invasion by inhibiting senescence and apoptosis and downregulating E-cadherin gene expression, respectively. In addition,"}
{"text": "Neglected for several decades, nutrition is now firmly on the development agenda. Important landmarks are the initiation of the Scaling Up Nutrition movement in 2010; the adoption by the World Health Assembly of the Comprehensive Implementation Plan for Maternal, Infant and Young Child Nutrition in 2014; and the World Health Organization\u2019s (WHO) Global Action Plan for the Prevention and Control of Noncommunicable Diseases for 2013\u20132020. Public health nutrition has to meet multiple new challenges, including the shift from the millennium development goals to the sustainable development goals (SDGs), together with growing issues such as climate change, globalization, urbanization, socioeconomic disparities, migration and wars.http://wphna.org), and a full report has been published elsewhere.Despite some progress, efforts to alleviate malnutrition, whether under- or overnutrition, are hampered by countries\u2019 lack of capacity in public health nutrition, including an insufficient and poorly qualified workforce. This paper highlights current issues and challenges in public health nutrition in low- and middle-income countries and shares recommendations for the development of this workforce. It is primarily based on the work of the World Public Health Nutrition Association capacity-building taskforce, while also drawing on relevant data from published material. Background documents are available on the Association\u2019s website  within their meagre health workforce expenditures. The complexity of nutrition as a discipline and practice tends to be overlooked; doctors, nurses and community health workers need specific preparationAnother issue is that in lower-income countries undernutrition is a higher priority for interventions than nutrition-related chronic diseases. The latter are currently escalating in these countries. Both food system changes, at the level of production, processing and distribution, and behaviour change communication are needed to reorient the nutrition transition, and nutritionists have a major role to play in this regard. Studies on nutrition workforce capacity conducted in West Africa confirm this, and also highlighted the severe shortage of trained nutrition professionals (except in Nigeria and Ghana).How can we build this public health nutrition workforce? Several initiatives have been taken to assess and strengthen the capacity of nutrition workforces. However, substantive action is still needed with the support of WHO and other actors, as shown in the recommendations . The IntBox\u00a01More nutritionists need to be trained at the undergraduate level to carry out the bulk of nutrition intervention work.A core of specialized nutritionists qualified in public health nutrition at masters level needs to be formed in every country to work at national and district levels.More and up-to-date public health nutrition has to be integrated into the curriculum of medical and nursing studies, as well as in the training programmes of nutritionists.In-service training in nutrition and in the management of nutrition programmes is required for scaling-up nutrition efforts. This calls for initial in-service training of available staff, supervisors and trainers.Hybrid training programmes, which combine distance training and periodic in-person sessions with tutors and peers, are a cost-effective approach for pre-service and in-service training as well as for continuous education of nutrition professionals.Competency standards for nutrition job descriptions, and curricula and accreditation schemes, should be developed and harmonized at the regional level, with international support.Development of a national nutrition workforce should be an integral component of national nutrition and workforce development plans, with adequate funding secured by governments and other relevant actors including nongovernmental organizations.The nutrition workforce is best portrayed as a pyramid, representing the numbers, level of training and occupational profiles at various levels . The basAlthough it requires sustained efforts, training can be regarded as the easy part of nutrition workforce development in low- and middle-income countries. The core technical and horizontal skills that public health nutritionists (masters level) need to acquire in the areas of intervention management, capacity-building and research have been proposed, along with assessment indicators.The underlying causes of malnutrition, and hence sustained solutions to the problem, lie to a large extent in the non-health sectors. Nutrition therefore has to be addressed not only by other health professionals, but also by agriculture and education professionals and field workers, who need to integrate relevant nutrition tasks into their professional activities (such as orienting food production towards meeting the population\u2019s nutrition requirements or teaching healthy eating to schoolchildren;"}
{"text": "The provision of nutrition care by doctors is important in promoting healthy dietary habits, and such interventions can lead to reductions in disease morbidity, mortality, and medical costs. However, medical students and doctors report inadequate nutrition education and preparedness during their training at school. Previous studies investigating the inadequacy of nutrition education have not sufficiently evaluated the perspectives of students. In this study, students\u2019 perspectives on doctors\u2019 role in nutrition care, perceived barriers, and strategies to improve nutrition educational experiences are explored.A total of 23 undergraduate clinical level medical students at the 5th to final year in the School of Medicine and Health Sciences of the University for Development Studies in Ghana were purposefully selected to participate in semi-structured individual interviews. Students expressed their opinions and experiences regarding the inadequacy of nutrition education in the curriculum. Each interview was audio-recorded and later transcribed verbatim. Using the constant comparison method, key themes were identified from the data and analysis was done simultaneously with data collection.Students opined that doctors have an important role to play in providing nutrition care to their patients. However, they felt their nutrition education was inadequate due to lack of priority for nutrition education, lack of faculty to provide nutrition education, poor application of nutrition science to clinical practice and poor collaboration with nutrition professionals. Students opined that their nutrition educational experiences will be improved if the following strategies were implemented: adoption of innovative teaching and learning\u00a0strategies, early and comprehensive incorporation of nutrition as a theme throughout the curriculum, increasing awareness on the importance of nutrition education, reviewing and revision of the curriculum to incorporate nutrition, and involving nutrition/dietician specialists in medical education.Though students considered nutrition care as an important role for doctors they felt incapacitated by non-prioritisation of nutrition education, lack of faculty for teaching of nutrition education, poor application of nutrition science and poor collaboration with nutrition professionals. Incorporation of nutrition as a theme in medical education, improving collaboration, advocacy and creating enabling environments for nutrition education could address some of the barriers to nutrition education. There is ample evidence that nutrition interventions can decrease morbidity, mortality, human suffering, and medical costs \u20134. GivenIndeed, there is an unfilled role for medical education in preparing doctors to provide nutrition care to patients . SeveralSeveral barriers to inadequate nutrition education have been reported largely in the form of symposiums, commentaries, essays and special articles , 22\u201325. This is an important issue to investigate, as students are likely to bring unique and valuable perspectives on the inadequacy of nutrition education in their curriculum. Their views should be considered in efforts to improve nutrition education in the medical curriculum.What are the roles of doctors in the provision of nutrition care in the general practice setting?Why is nutrition education inadequate in the medical curriculum?How could nutrition education be improved in the medical curriculum?The study therefore aimed to explore students\u2019 perceptions of doctors\u2019 role in nutrition care, and barriers that prevent effective nutrition education and strategies that could potentially increase the effectiveness of nutrition education in the medical curriculum. The following research questions were investigatedOur research was informed by two closely related theories : social Our research is within the constructivists\u2019 research paradigm. In constructivism, knowledge is socially constructed and realities are generated by the interaction of social, cultural and interpersonal factors , 33. AccWe adopted a purposive sampling to select the study participants. All participants were selected from the University for Development Studies, School of Medicine and Health Sciences (UDS-SMHS), which runs a problem-based undergraduate medical curriculum. In the first 3 years, students are taken through the basic sciences using system-based blocks. The next year focuses on the learning of pathology and patho-physiology of diseases. Although students have some early patient encounters, the first 4 years are usually non-clinical . In preparing students to qualify as doctors, the remaining 3 years focus on the clinical application of principles learned in the preclinical years and the creation of opportunities for students to learn from real patients at the hospital through departmental clinical rotations. The UDS-SMHS also runs a community-based education and service (COBES) programme in which students live, learn and provide service in rural communities of Ghana for a period of 4\u00a0weeks per year during year 2 to 4. It is during the preclinical years that majority of nutrition education is learned.Our participants were therefore clinical level students, who had covered over 50% of the curriculum. Our choice of participants and sampling procedure was informed by our aim to select participants who will provide rich information , 37 regaVM contacted all prospective participants through face-to-face meetings after usual lectures. During such meetings, the purpose of the study was explained and participants were also informed that the interview will be audio-recorded. They were assured of the confidentiality of the recordings. Participation was voluntary and both written and verbal informed consent was obtained from all participants who agreed to participate in the study. The institutional review board of the Navrongo Health Research Institute approved the research protocol.All data was collected using semi-structured individual interviews. Semi-structured interviews are frequently used in healthcare and provide the researcher the opportunity to have guidance on areas to explore while allowing for some flexibility to enable discovery or elaboration , 39. AllThe questions were evaluated by all members of the team who have varying levels of experience in qualitative research, medical education and nutrition. We pilot tested the semi-structured interviews on a group of 8 students to ensure clarity and understanding of the questions. During this process participants provided feedback regarding the structure of the questions and also identified areas that needed clarification. AA observed these pilot interview sessions, providing the opportunity to train and give feedback. The data generated from the pilot sessions were not included into the main data analysis.All interviews were transcribed verbatim without identifying information by a trained research assistant, and entered into MAXQDA (version 12), a qualitative data analysis software. All subsequent data analyses were conducted using a comparative strategy , 42. CodTwenty-three students participated in semi-structured interviews lasting 10 to 20\u00a0min each during the study period, July to September, 2015. This number was arrived at after the point of saturation and further data collection and/or analysis was unnecessary. Table\u00a0Four main themes emerged from the data: role of doctors in nutrition care, adequacy of nutrition education, barriers to nutrition education, and strategies to increase and improve nutrition education. Illustrative quotes are provided to substantiate each of these themes. Statements represent the views of students and not the authors.The majority of the students felt that doctors had an important role to play in providing nutrition care to patients although they recognised that nutritionists and dieticians were trained to perform such functions. They considered the role of the doctor to be one that is supportive or complementary to that of the nutritionist/dietician. The main roles identified by the students are shown in list 1.List 1: Roles doctors could play in nutrition careNutrition advice/educationSupporting patients to follow healthful dietsCollaborating with nutritionists/dieticiansMonitoring progress of nutrition careNutrition diagnosisReferring patients to nutritionistsAdvocating for nutrition care\u201cThey [doctors] should also play a part in the health education of the patient. So when they see a patient of any kind they have to advise them on their nutrition, diet and other behaviours that affect their nutrition and all of that.\u201dStudents believed that the doctor should be the first to provide basic nutrition care and refer the patient to a nutritionist/dietician for specialised care if need be.\u201cWhen they [patients] come to the hospital, the doctor has the first encounter with them. The doctor could begin to provide nutrition care based on his/her minimal knowledge in nutrition. Then afterwards if he/she sees that there is still more to be done, then he/she can refer the patient to the nutritionist or the dietician who are specially trained to provide nutrition care.\u201dIn order to assess whether medical students considered themselves to be responsible for the nutrition care of their patients when they become doctors, they were asked a hypothetical question about how they will react if a diabetic patient sought dietary advice from them in the general practice setting. All of the students said they will feel obligated and enthusiastic to provide such dietary advice to the patient.\u201cOh I will feel happy to assist the patient. As such I will tell the patient the causes of diabetes and what to do to avoid [prevent] it. I will advise the patient to avoid excessive intake of sugar.\u201d\u201cWell I think it is the right thing to find out how they [patients] manage their nutrition based on their condition. But looking at the kind of training that we [students] also have, you realize that much attention is not given to nutrition. So if a patient should ask me at this moment about nutritional status or let\u2019s say about their nutritional situation, I might not feel adequate enough to answer.\u201dIn addition, almost all the students considered the quality and quantity of their nutrition education to be inadequate.Although students felt that nutrition care was important and felt obligated to provide it to patients, majority of them felt unconfident in their ability to provide such care to their patients.\u201cFor me I think\u2026 even though we have done something very little concerning nutrition, it is as if we [students] have not done anything. We [students] have been given very little training when it comes to nutrition.\u201dIt is thus unsurprising that students felt they required further education in nutrition although they were in the senior years of their medical education.\u201cI think there is more to be done because we [students] have not really had more lectures on it. We [students] have not been taken through a lot on nutrition; it is just a little bit of everything like small, small, small. So I think it would be better if we [students] are given more education on nutrition before we are able to come out.\u201dIn order to gain more knowledge and skills in nutrition some students undertook self-directed learning and also consulted nutrition departments at the hospital on their own volition to acquire knowledge and skills in nutrition care.\u201cBecause we [students] realized that our nutrition education was inadequate, when we [students] came here we had to go to the nutrition department to kind of like talk to them to take us through how they managed their [nutrition department] malnutrition cases\u201d.Students identified a number of barriers contributing to the inadequacy in their nutrition education. These barriers were classified into three subthemes: personal, interpersonal and environmental barriers as shown in Table\u00a0Most students felt that the application of nutrition science to clinical practice was poor in most of the already limited nutrition lectures they received, especially during their preclinical training. The apparent lack of application of nutrition science to clinical practice made it difficult for them to appreciate the relationship between nutrition and health and to apply nutrition during their clinical training.\u201cThough at the preclinical level we [students] were given a little bit knowledge about nutrition it was not practical. It was like kind of raw information. You come here [clinical training] then you realize that there is no correlation. Not correlation as such but here [clinical training] you realize that it demands you to apply.\u201d\u201cthe practical aspect of nutrition education has not really been taught or we are not exposed to it\u201d.Another student adds that Another important barrier identified by the students was the perception of faculty and curricula planners that nutrition care may not be the responsibility of doctors and as such did not see the need to include adequate content of nutrition education into the curriculum. According to the students, faculty and curricula planners considered nutrition care to be the role of nutritionists and thus the medical curriculum should concentrate on how to treat diseases.\u201cMay be the authorities\u2019 feel it\u2019s not an essential part of medical training. I don\u2019t know but that is the way I see it\u201d.\u201cMay be the focus of the whole medical training is more on treating diseases.\u201d\u201cI think because there are nutritionist who are specially trained to provide nutrition care\u201d.Students were concerned that their nutrition education did not involve nutrition professionals thus presenting limited opportunities to collaborate to learn about nutrition. The poor collaboration made it difficult for them to appreciate the role of nutrition care in improving the clinical outcomes of patients and also do not foster inter-professional training to promote multidisciplinary care required in patient care.\u201cIf there can be more integration. For instance when we [students] have cases that are nutrition related, it is still being managed by medical professionals and doctors. I mean once in a while dieticians come but it is like off record or something. So if those who are directly involved in the nutrition sector can be integrated more. May be it will help. But right now they are separated, nutrition is on one side and medicine is on the other. So maybe if there is a problem that will be the area it is.\u201dStudents identified that nutrition professional were not involved in their training because they were not available i.e. they were in short supply.Majority of the students felt that the medical curriculum concentrates largely on anatomy, physiology and pathology with a little attention for nutrition. The students felt strongly that nutrition has not been given the needed attention and priority that it deserved.\u201cLike we have anatomy, physiology and the other basic sciences incorporated, we don\u2019t actually have a course on nutrition incorporated into the courses that we do. I think that is the major issue\u201d.\u201cIt\u2019s also because nutrition is not a priority in the medical program and hence have been given less attention.\u201dAccording to the students, the lack of priority for nutrition education has resulted in the limited contact hours allocated for nutrition, inadequate content for nutrition in the medical curriculum and poor integration of nutrition education as a theme throughout the entire medical curriculum.Students were also concerned about the lack of trained faculty to provide nutrition education.\u201cMay be it could also be that we don\u2019t have the people around to actually, I mean teach us or take us through nutrition.\u201d\u201cI think sometimes the lecturers may not be available to give a lecture on that [nutrition].\u201dA number of students also felt that faculty does not have the needed knowledge and skills to provide students with the required nutrition education.\u201cMay be I think it is\u2026.Because those taking you, they themselves they don\u2019t have the clinical knowledge. It is like they just read raw nutrition [theoretical aspect of nutrition] and that\u2019s how they also passed it on to you.\u201dHaving recognized the inadequacy of their nutrition education and the contributing barriers, students provided several important and insightful recommendations that could improve nutrition education.To increase the contact hours and nutrition content in the curriculum students suggested that more lecture topics on nutrition should be included into the curriculum.\u201cNot really as in a full course but may be some few lectures in nutrition. I don\u2019t think we need so much but some few things that you need on the job that to help you, that is very important. I think that aspect could be incorporated into the training, it will help.\u201dOthers also suggested that nutrition training could be improved by incorporating nutrition topics into their tutorials to promote self-directed learning.\u201cI think that we can also introduce them into our tutorial topics because sometimes for most of the students tutorials really help. You read a lot before you come so you can introduce some of them into our tutorial topics\u201d.Concerning the promotion of self-directed learning and to cater for the overcrowded curriculum, students suggested that articles on nutrition could be given to them to read to promote their understanding of nutrition concepts. The self-study time for students could also be increased to grant students the opportunity to read further on nutrition. In addition, students suggested the organization of symposiums on nutrition in which research papers in nutrition could be presented in order to increase their interest and understanding of nutrition.\u201cWell it\u2019s very dicey because there is time issue and stuff. But if we could get articles or make symposiums where we can teach nutrition courses and make it lively because nutrition is kind of like difficult. So if we make it motivational they will be able to come out and get the knowledge about nutrition so that they can educate the people.\u201dAs evidenced by the following code, students felt that their knowledge and skills in nutrition could be improved if nutrition as a theme was incorporated early in their training and maintained throughout the entire curriculum.\u201cLooking at the early [preclinical] aspect of the training, they can incorporate nutrition subjects there, nutritional modules or topics and things like that especially at the very early aspects of it. So that people [students] will take interest in that and probably might grow their knowledge as they go along the PBL training.\u201dSome students opined that nutrition education will be improved if those in charge were educated on the importance and need for nutrition education. Students believed that if faculty and curriculum planners could be convinced of the fact that nutrition is an important role of the doctor, this might change their perception regarding nutrition and increase attention and priority for nutrition. An increase in attention and priority for nutrition education may result in an increase in the content and contact hours for nutrition.\u201cI think if they can realize that it is also very very important then they can increase the amount of time that is spent on that [nutrition education]\u201d.Students believed that for nutrition education to be improved there is the need for faculty and curriculum planners to review the entire curriculum to identify students nutrition educational needs and how and where those needs could be met and incorporated into the curriculum. Students recognised that such revisions could not be effected during their time in the medical school but could be beneficial to those in the succeeding years in medical school.\u201cThat is what I previously stated that they should revise our curriculum and find a place to put nutrition so that at least we [students] will have knowledge about it. At least at this level I should have had enough knowledge about nutrition. So if they put it there those following us can benefit. Right now if they can add it to our curriculum, I think it will be enough.\u201dClinical sessions in which nutritionists/dieticians will present nutrition casesOpportunities to consult nutritionist/dieticians for relevant nutrition topics/contentIncluding the nutrition department into clinical rotationsSeminars and lectures presented by nutritionists/dieticiansStudents opined that nutritionists or dieticians should be actively involved in their training. This should take the following forms:\u201cIt [nutrition education] should be added to the medical school\u2019s curriculum and we [students] should actually...ehmm if they have a nutrition department, we should actually be exposed to nutrition\u201d \u201cEven in the hospital we [students] can have nutritionist being involved in our training on the ward especially when we [students] are managing patients so that we can have more time with the nutritionist\u201d.Undergraduate clinical level medical students believed medical doctors have a responsibility to provide nutrition care to their patients in the general practice setting. They believe doctors\u2019 role regarding nutrition care should be one of identifying patients in need of nutrition care, providing first line nutrition management, advocating nutrition care for patients, referring patients to nutritionists/dieticians for specialist care and reinforcing nutrition care provided by nutritionists/dieticians. These students felt their current nutrition education was inadequate due to barriers such as lack of priority for nutrition education, poor application of nutrition to clinical practice, an already overcrowded medical curriculum, lack of faculty trained in nutrition and poor collaboration with nutrition professionals in the teaching and learning of nutrition. Students recognised the need to increase awareness on the relevance and need for nutrition education in the medical curriculum among faculty and curriculum planners and to undertake a revision of the medical curriculum to identify nutrition educational needs and avenues to meet such needs as well as recognising the need to involve nutritionists/dieticians in their training.Student\u2019s views that medical doctors have an important role to play regarding nutrition care are similar to those expressed by medical educators, practicing doctors , 44 and Consistent with previous findings, students were concerned that their nutrition education was inadequate , 45\u201350.Although an already overcrowded curriculum and inadequate contact hours/content for nutrition education were frequently described as barriers to effective nutrition education, some of the students believed that this was more an issue of low priority and attention for nutrition education. According to these students if nutrition was considered an important responsibility of the medical doctor, faculty and curriculum planners will find avenues within the curriculum to include nutrition. There is thus the need to increase faculty and curriculum planners\u2019 awareness on the relevance and need for nutrition education in the medical curriculum.Students\u2019 suggestion of integrating nutrition as a theme throughout the entire curriculum to cater for barriers such as inadequate contact hours/content for nutrition and overcrowded curriculum is consistent with best practices for improving nutrition education , 51. IntFundamental to the feasibility of integrating nutrition as a theme throughout the medical curriculum is the need to undertake a review of the entire curriculum. This provides opportunities to look into the formal and informal/hidden curriculum to identify gaps and avenues to integrate nutrition education and improve the learning environment , 54.Given that multidisciplinary teaching is a key focus of education guidelines for future health professionals  it is coThe students suggestion of providing them with nutrition articles and the organisation of nutrition symposiums and seminars to address the barriers of overcrowded and inadequate curriculum are widely accepted\u00a0innovative teaching and learning strategies of improving nutrition education , 61. TheThe lack of faculty for nutrition education is an important barrier that has been identified in previous findings , 8, 24. This is the first study to qualitatively explore students\u2019 perceptions of nutrition education, barriers and strategies as far as we know. It adds to the existing literature that nutrition education is inadequate and several barriers are contributing to the current situation. Also, the findings identify a number of strategies that could be relied upon to improve nutrition education. An important novelty of the methods of this study is the reliance on students\u2019 perspectives that hitherto may not be considered as obvious sources of information regarding this topic. The students provided important barriers and strategies that are comparable to those reported by medical educators and practicing doctors. It is yet additional evidence supporting the widely accepted recognition of students as important stakeholders of the curriculum who could be relied upon to improve the learning environment.This study is not without limitations. Our adoption of non-probability and convenience sampling may result in the recruitment of students with an interest in nutrition, generating a potential source of sampling bias. However, this potential bias can be described as a strength rather than a limitation in qualitative research that propagates for the collection of data from individuals considered as rich sources of information . We recrThe findings of this study provide data that could inform the planning and design of educational interventions to improve nutrition education. Future studies should investigate whether the removal of the identified barriers could result in improved nutrition education. It will be important for studies to evaluate the effectiveness of the strategies suggested by the students to improve nutrition education in the medical curriculum. In addition, future studies should investigate the influence of improved nutrition education on nutrition practice behaviour in the clinical setting.Students perceived nutrition care to be an important role and responsibility of medical doctors. They considered their current nutrition education to be inadequate due to personal, interpersonal and environmental barriers. A number of important strategies have been suggested by these students including incorporation of nutrition as a theme in the medical curriculum, collaboration, and advocacy and creating enabling environments for nutrition education."}
{"text": "Early Childhood Education and Care (ECEC) settings have a pivotal role in shaping children\u2019s dietary food habits by providing the contextual environment within which they develop these behaviours. This study examines systematic reviews for (1) the effectiveness of interventions to promote healthy eating in children aged 2\u20135 years attending centre-based childcare; (2) intervention characteristics which are associated with promoting healthy eating and; (3) recommendations for child-health policies and practices. An Umbrella review of systematic reviews was undertaken using a standardized search strategy in ten databases. Twelve systematic reviews were examined using validated critical appraisal and data extraction tools. Children\u2019s dietary food intake and food choices were significantly influenced. Interventions to prevent obesity did not significantly change children\u2019s anthropometric measures or had mixed results. Evidence was more convincing if interventions were multi-component, addressed physical activity and diet, targeted individual-level and environmental-level determinants and engaged parents. Positive outcomes were mostly facilitated by researchers/external experts and these results were not replicated when implemented in centres by ECEC providers without this support. The translation of expert-led interventions into practice warrants further exploration of implementation drivers and barriers. Based on the evidence reviewed, recommendations are made to inform child-health directed practices and policies. Good nutrition in early childhood is essential to ensure children reach their growth and developmental potential . FurtherConsiderable public health effort and research have been directed towards nutrition interventions in the home and the school setting ,14. HoweAlthough the home is still the primary influence ,22, centUmbrella reviews are becoming relatively common ,32 as a The primary aims of this Umbrella review are to examine previously published systematic reviews to determine (1) the effectiveness of interventions to promote healthy eating in children aged 2\u20135 years attending centre-based childcare; (2) intervention characteristics which are associated with successfully promoting healthy eating in pre-schoolers; and (3) recommendations for child-health directed policies and practices.To identify possible systematic reviews the online bibliographic databases Medline, Emcare , PsycINFO , Embase , CINAHL , Health Technology Assessment Database, ERIC, Scopus, Web of Science Core Collection, Joanna Briggs Institute (JBI) Evidence-Based Practice Database of Systematic Reviews and Cochrane Database of Systematic Reviews were searched for reviews published between January 2000 and September 2017. The search strategy is available as The following reviews were excluded: (1) studies with infants or studies where the children were attending compulsory schooling usually six years or older; (2) studies treating children for obesity or a clinical related condition; (3) studies using school, the home or settings which are not registered childcare; (4) studies in which dietary behaviour or dietary-related outcomes were secondary outcomes and not separately reported; (5) studies focused on low-income countries. Although the search strategy did not limit studies to particular countries, only systematic reviews relating to high-income countries as defined by the OECD (2017) were included because the childcare arrangements and practices are similar. An a priori protocol for the Umbrella review was registered with PROSPERO (CRD42017078749). To assess the methodological quality of the reviews and to determine the extent to which reviews had addressed the possibility of bias in the design, conduct and analysis, the Johanna Briggs Institute (JBI) Critical Appraisal Checklist for Systematic Reviews and Research Syntheses was used . This vaTo guide the extraction and synthesis of data from the selected studies and minimize the risk of author bias, a standardized tool, the JBI Data Extraction Form for Systematic Reviews and Research Synthesis  was emplp < 0.0005).The study selection process is summarised in Twelve systematic reviews were included in the final review and the quality assessment ratings are tabulated in Most of the primary studies in all of the reviews were randomised control trials (RCT) or cluster-RCT followed by case-control trials or quasi-experimental studies . ConcernThere was considerable heterogeneity between primary studies which precluded pooling of the data and meta-analysis or any systematic reviews undertaking Grading of Recommendations Assessment, Development and Evaluation (GRADE) . HeterogStudy findings favoured dietary effectiveness in most of the included reviews . AssesseSeven reviews focused on obesity-prevention and obesogenic behaviours (including diet-related behaviours). Despite reporting significant effects on BMI and other measures of adiposity for some primary studies, review authors concluded overall that diet-related interventions did not have a consistently positive impact . Two other reviews reported no significant changes in weight status . Ling, Robbins et al. (2016) and Zhou, Emerson et al. (2014) reported that the primary studies which significantly affected weight outcomes were multi-component interventions which addressed both dietary and physical activity behaviours. Mikkelsen, Husby et al. (2014) reported that single component interventions did not have a significant effect on children\u2019s fruit and vegetable intake but five of six multi-component interventions did. Actively involved and engaged parents were also associated with consistently positive impacts on children\u2019s weight status .More positive outcomes were seen in reviews assessing interventions directed at both environmental- and individual-level determinants of healthy eating behaviours. Most effective were multi-level interventions targeting environmental-level determinants including implementation support ,55,58,61Three reviews reported that the strongest effects came from interventions targeting environmental-level determinants. Bell and Golley (2015) examined 13 primary studies, with 12 reporting significant improvement in the food provided in centres (through food policy and changes in educators\u2019 practices), the nutritional quality of menus and parental food provision of lunchboxes. Primary studies on interventions focusing on environmental-level factors reported positive outcomes including food and nutrition policies and the food environment, however few of these studies also reported on whether children\u2019s dietary intake had changed as a result . Wolfendn = 15). Six primary studies attributed high parental engagement to the successful achievement of their primary outcome to effect changes in children\u2019s weight .Half of the reviews reported an association between parental involvement and engagement, and achievement of objectives in ECEC interventions ,54,55,58Positive outcomes for healthy eating behaviours were mostly reported for interventions delivered by researchers or external experts ,52,55,56Eight reviews reported the number of included primary studies which used a theoretical framework ,57,58,61Most of the dietary-related interventions targeted educators\u2019 behaviours and practices and included nutrition education and training sessions . EducatiEffective interventions involving children included interactive educational activities as part of the childcare curriculum ,54,57,58Active parental involvement included participation in any intervention component such as receiving written material, receiving regular newsletters, attending education sessions or workshops, completing homework tasks, participating in curriculum planning or participating in interactive hands-on activities such as cooking, growing vegetables or similar activities, with their children ,54,58,60Recommendations for practice and policy  includedSummarised recommendations for future research  includedThis Umbrella review investigated the effectiveness of interventions to promote healthy eating in children aged 2\u20135 years attending centre-based childcare. The aim was to also identify characteristics of successful interventions and list and summarise the most frequent recommendations for policy, practice and research. Overall, 12 systematic reviews of acceptable methodological quality were included examining 101 primary studies.Despite the considerable heterogeneity, the review findings supported the proposition that interventions to promote healthy eating in children aged 2\u20135 years attending centre-based childcare are effective. Successful interventions were multi-component, multi-level targeting both environmental and individual-level determinants of healthy eating behaviours. Multi-component interventions included educational strategies, changes to the centre-environment and policy. These findings are consistent with the conclusions of other Umbrella reviews for other settings ,66,67,68A common recommendation in the reviews was to underpin intervention design with theoretical frameworks and effective behavioural change theories, ideally components of Social Cognitive Theory  alongsidThe translation of changes in educators\u2019 knowledge, practices and centre environment to children\u2019s dietary behaviours was however not consistently observed ,54. MoreMore studies assessing the dietary-related outcomes from involving and engaging with parents are required. Even small levels of parental involvement were associated with better weight status outcomes ,53,54,55More research is needed to understand the interactions between educators and parents and the impact of collaborative parental engagement. With many children spending time in childcare and the premise that all food preferences are learnt, educators\u2019 roles are crucial as very young children are dependent upon them not only to provide food but also to guide and shape their food preferences and dietary habits . QualitaThe impact of nutrition-related strategies to build the capacity of children is also an evidence gap. Findings emphasized the importance of targeting children with interactive education and hands-on experiences which are age-appropriate ,52. ThisThe impact of nutrition-related interventions and practices on children from low socio-economic areas is of particular interest. Many of the primary studies were directed at centres in low socio-economic areas or centres with a high proportion of children from disadvantaged families. The outcomes suggest that interventions supporting these populations could help reduce health inequalities . This obMissing from this Umbrella review was evidence of the sustainability of dietary-related interventions as few primary studies were implemented for more than a year and/or outcomes measured after the intervention. The recommended duration is at least one year, ideally 1\u20132 years ,58. NotaAlthough the more comprehensive the intervention, the more likely it is to be successful, comprehensiveness may affect feasibility and fidelity negatively and warrants further exploration. Ward, Welker et al. (2016) found an inverse relationship between comprehensiveness and positive outcomes. Furthermore, in an Umbrella review investigating community-based interventions promoting healthy eating and physical activity, multi-component interventions were not correlated with positive outcomes . MoreoveLastly, reviewers recommended that cost-effective studies be undertaken ,56,61. LBased on the data reported in the 12 reviews, reviewers cautioned that many primary studies were rated as weak or having insufficient information to permit evaluation. The actual effect of the intervention may therefore be smaller than the effects reported because of the low quality of reporting  and geneSome of the challenges identified by Pollock et al. (2017) and Ballard & Montgomery (2017) in their critique of the robustness of Umbrella reviews were encountered in this study. These challenges included primary studies overlapping between reviews and appearing in more than one review, and a mismatch between the scope of the systematic review being examined and the research question of the Umbrella review. Seven of the 12 reviews had a remit for obesity prevention rather than healthy eating as a primary outcome. Furthermore, the heterogeneity of the reviews and the assessment of insufficient information in three reviews precluded an evaluation of the quality of the research through the use of GRADE. This was compounded by the difficulty for the systematic reviews to apply GRADE or a meta-analysis for the same reason. To address these challenges, the primary studies which appeared in more than one review were identified and the extent of overlap considered. Moreover, in the data extraction stage, within these accepted reviews, only primary studies which met the scope of the Umbrella review were included, strengthening confidence in the findings. Mapping the overlapping primary studies reassured the authors that the search strategies were through and demonstrated consistency between reviewers. To further ensure methodological strength, the scope of the Umbrella review was limited to only those reviews where diet-related behaviours and measures were reported separately, PRISMA guided the search strategy and two validated tools were used to assess the quality and risk of bias of the reviews and to standardize data extraction . The conInterventions promoting healthy eating positively influence children\u2019s dietary food patterns. Although environmental-level and individual-level determinants of healthy eating are impacted by centre-based interventions, these effects are not consistently translated to changes in children\u2019s diet-related behaviours or anthropometrics as a measure of preventing obesity. Positive outcomes can be further strengthened with parental involvement and engagement, and multi-level, multi-component strategies are recommended. Comprehensiveness may, however, affected feasibility and fidelity negatively when enacted by end-users; therefore studies on existing interventions implemented by end-users are recommended. Meta-analysis and stronger study designs are called for but are often not feasible in the real world of childcare. Therefore the translation of research or expert-led interventions into practice warrants further qualitative exploration of implementation drivers and barriers with end-users. This understanding and end-user involvement may contribute to the sustainability of interventions which is rarely reported.The summarised findings and recommendations from this Umbrella review can inform child-health directed policies and practices. Based on the evidence, public health effort is warranted to support healthy eating interventions and practices in centre-based childcare. By incorporating multi-level and multi-component interventions into routine practices and extending this across the home and childcare setting, healthy food preferences and dietary-related behaviours can be influenced. More successful interventions require high levels of parental engagement, the use of behaviour change strategies and a focus on building the capacity of educators, children and parents."}
{"text": "The few studies that have examined the relationship between midlife cardiovascular disease risk and longer-term costs have differentiated risk using a small number of risk categories. In this paper, we illustrate the advantages of a continuous-valued score to examine the relationship between risk and longer-term costs: the Framingham 10-year coronary heart disease risk score.Our study cohort consisted of 1333 Second Generation Framingham Heart Study participants enrolled in fee-for-service Medicare for at least 8 quarters and who had a risk score assessment between age 40 and 50 years. We used generalized linear models to examine the relationships between quarterly Medicare costs and risk scores.Using risk categories defined by the Framingham score, the cost differences between a low and high risk group were 40% to over 200% greater than differences in comparable studies using a small number of risk categories. A continuous-valued score facilitates comparison of the cost consequences of impacting risk score changes. For example, an intervention that is able to reduce a person\u2019s score change between midlife and later-life from the 75th percentile to the 25th percentile would result in almost a 20% reduction in longer-term costs. In contrast, an intervention that is able to reduce a person\u2019s midlife score from the 75th percentile to the 25th percentile would result in a 38% reduction in costs.A continuous-valued risk score has advantages compared to defining risk based on a small number of risk categories. The American Heart Association reports that 92.1 million adults (>1 in 3) have cardiovascular disease (CVD)[et al. analyzed costs that occurred over an 11-year period beginning about 13 years on average after risk assessment [et al. examined costs that occurred up to 23 years after risk assessment [et al., expanding and extending analysis of the Daviglus et al. cohort, analyzed average annual costs that occurred on average beginning 14 years after risk assessment and extended over a 26-year period [Despite the importance of CVD, very few papers have examined the economic implications of CVD risk profiles \u20138 and nosessment ; and Allr period . UnderstThe Framingham Heart Study (FHS) has been invaluable in identifying risk factors for CVD and has contributed to a wide range of interventions to reduce risk and improve population health . Recentlet al. [et al. [et al. [Daviglus et al. , Willis  [et al.  and Alle [et al.  grouped et al. [The CMS data included Medicare enrollment information and expenditures (referred to as Medicare costs) between 2000 and 2008 for 3849 Framingham Heart Study participants: 740 from the Original Framingham cohort, 2796 from the Second Generation cohort, 61 from the Third Generation cohort, and the rest from special cohorts. Risk scores were calculated from exams done between 1971 and 2007. Midlife CHD risk score  and sufficient cost data were available only for the Second Generation participants, and so our initial sample was 2796. From this sample, we excluded 672 people who were continuously enrolled in a Medicare managed care program (since cost data were unavailable for them), and those who had not bought into Medicare Part B (since they were likely still working and had other insurance); 67 participants who were under age 65 years but eligible for Medicare because of disability; 15 participants who had only 2 quarters of cost data in the last 6 months of their life; following the approach of Daviglus We required at least 8 quarters of cost data to allow averaging of any post-Medicare eligibility spending \u201cbump\u201d at age 65 years . Also, for the many people in our data set whose first Medicare costs were after age 65 years (age at time of first costs was 68 years or older for 50% of the participants), we did not have prior enrollment information. These may have been people on a spouse policy or in a Medicare managed care program that changed to fee-for-service because of increased flexibility to obtain various types of treatment. The 8 quarter criterion allowed the costs to be averaged over a long enough period to reduce the impact of any initial eligibility increase in spending. The higher average quarterly costs of those without 8 quarters of data  suggestsWe used the Framingham CHD 10-year risk prediction score  as a wayIn our main analyses, we used the midlife score, which was the risk score assessed at the exam between age 40 and 50 years that was closest to age 45 years. As a sensitivity analysis, we considered a wider age range, 35\u201355 years, to define midlife. We also considered a \u201clater-life\u201d score, defined as the risk score assessed closest to but before age 65 years. From the 2 risk scores, we created \u201cscore change\u201d, defined as \u201clater-life risk score minus midlife risk score\u201d in order to examine the extent to which people who were more successful in limiting the natural increase in risk score due to aging had lower costs.CMS cost data between year 2000 and 2008 included the following payments: inpatient, institutional outpatient facility (outpatient file), distinct physician office (carrier file), nursing home, home health care, and hospice. We adjusted the cost data for inflation using the Medical Care Consumer Price Index with 2000 as the base year . Also, bFor descriptive purposes, we reported percentages for binary variables, and mean, standard deviations and percentiles for continuous variables. We ran generalized linear models (GLMs) with a gamma distribution and log link, and used robust standard errors. Based on the results of the Park test, as a sensitivity analysis, we also ran models with a Poisson distribution. The dependent variable was \u201caverage quarterly cost\u201d. To reduce the impact of outliers, we top-coded the cost data by replacing any quarterly costs more than 3 standard deviations from the mean with a value equal to 3 standard deviations above the mean. Twenty six cases were top-code to a value of $13,880. As noted above, for all models, we included age at year 2000 as an independent variable. We ran models with the following additional independent variables: Model 1: midlife CHD risk score; Model 2: midlife CHD risk score components\u2014sex, age at midlife exam, average systolic blood pressure, average diastolic blood pressure, total cholesterol, high-density lipoprotein cholesterol, smoking status (yes/no), and diabetes mellitus (yes/no); and Model 3: midlife risk score and \u201clater-life risk score minus midlife risk score\u201d. We converted the coefficient for each variable into the percentage change in expected quarterly costs per one unit increase in the variable. For continuous variables, one unit corresponds to one standard deviation (SD); for binary variables, one unit equals one. The percentage change is calculated as exp \u2212 1. As a summary statistic of model performance, we reported the correlation between predicted and actual quarterly costs and a 95% confidence interval, which was estimated from 600 bootstrap replications.p < 0.05 in a two-tailed test. Analyses were done between 2013 and 2016. The Framingham Heart Study was reviewed by the Boston University Medical Campus Institutional Review Board (IRB) and all participants signed informed consents. The study reported here, which did not require additional informed consents, was approved by the Boston University Charles River Campus IRB, protocol number 3171E on April 29, 2013.We conducted our analyses using Stata Statistical Software: Release 13, StataCorp, College Station, Texas. A variable was considered statistically significant if For the main exclusion reasons, average midlife risk score was not statistically significantly different for those in fee-for-service compared to those in managed care or without Medicare Part B (672 participants); or for those with at least 8 quarters of cost data compared to those without 8 quarters of data (314 participants), though for the latter comparison, average quarterly costs were significantly higher for those with less data see . The midWe reported the descriptive statistics on risk scores calculated from the components, as well as costs and the time participants were followed in i.e., the percentage change in quarterly costs for a one SD change in the variable) is the same as in Model 1. For the binary variables, the coefficient is the percentage increase in quarterly costs when the value of the variable changes from 0 to 1. Only 4 of the 8 risk score component variables were statistically significant: age, HDL cholesterol level, current smoking and diabetes. The impact of diabetes, which has a coefficient of 109.8, indicates that compared to somebody without diabetes, someone with diabetes has quarterly costs that are almost 110% higher. The correlation between predicted and actual costs was slightly higher than when the risk score components were used as the independent variables, but the 95% confidence intervals for the correlations were wide and the differences were not statistically significant.Model 2 shows results when the risk factors that comprise the CHD score were included as separate variables. Interpretation of coefficients associated with the continuous variables  was associated with a 12.2% increase in average quarterly costs. Someone of average age at 2000 with an average midlife risk score and whose change score was at the 75th percentile had predicted quarterly costs of $2431, 20% more expensive than someone whose change score was at the 25th percentile (which was 6 points lower).i.e., Model 1), as shown in We estimated the average quarterly cost and average midlife risk scores for cases in different percentiles of the distribution of predicted costs from the model with age at 2000 and midlife risk score  and higher average quarterly costs ($2634 vs. $2535). Using Model 1, the increase in average quarterly costs associated with a one unit increase in midlife score (3.84 points) was 28.2% . However, almost all of the increase (1.6% of the 2.0%) is because \u201cone unit\u201d (the SD) is larger. Using the Poisson distribution instead of the gamma distribution had no substantive impact on results.In sensitivity analyses, when we expanded the definition of mid-life from age 40\u201350 to age 35\u201355 years, the eligible cohort increased from 1333 to 1472. The expanded cohort was somewhat less healthy, with a midlife risk score of 3.19 [et al. (2017)[et al. Over 25,000 study participants were placed into one of four risk categories (% of participants in each category are shown in parentheses): favorable levels on all risk factors (6% of the sample), one or more elevated risk factors (19%), 1 high risk factor (40%) and 2 or more high risk factors (35%). Median annual costs for those in the highest risk group were about $5500 higher than those in the lowest risk group. The difference in average quarterly costs of someone in the 10% of our sample with lowest risk compared to someone in the 40% of the sample with highest risk was $1936 [As noted, there have been two studies examining future costs occurring many years after CVD risk assessment. Daviglus l. (1998) analyzedl. (2017) expandedk factor 0% and 2 For organizations that manage population health, a continuous-valued risk score allows flexibility in identifying risk groups , have not found significant impacts, similar to findings from rigorously designed nonrandomized studies. He went on to note the need to \u201cinnovate, test and evaluate novel designs\u201d (p 1463) and suggested the potential value of more targeted approaches that focus on those individuals with elevated risk. As illustrated above, a continuous-valued risk score like the Framingham risk score facilitates identifying these particularly high-risk groups. One increasingly used approach to encourage behavior change is to offer financial incentives. However, as implied by the title of a recent JAMA Viewpoint article by Thirumurthy et al. [The challenge is how to design programs to most effectively impact risk behaviors. In a recent randomized controlled trial of a workplace wellness program, Song and Baicker  found thy et al. \u2014\u201cThe uncThere are limitations to our study. Though throughout the paper the discussion focuses on cardiovascular risk factors, we used the Framingham Coronary Heart Disease 10-year risk score. The reason for this is that the Framingham database available to us did not contain certain variables necessary to calculate the Framingham CVD risk score . Nonetheless, the risk factors in both scores are largely similar. If anything, it is likely a continuous-valued CVD risk score would have provided even better risk group differentiation than that found using the CHD score.The sample size in our study was relatively small and included mostly whites from a largely middle class community in New England. Also, we examined a relatively healthy sample at both midlife, as shown by the lower midlife risk score for most of the inclusion criteria, and at later-life, since the latter group excluded individuals that developed CHD between their midlife and later-life score. Although midlife scores were similar for those in fee-for-service Medicare and those not, their resource utilization patterns were not necessarily similar. The generalizability of results to those not in Medicare fee for service is thus uncertain. Finally, like all observational studies, we cannot rule out residual confounding and have not established a causal relationship between risk scores and costs.Our study confirmed the longer-term Medicare costs of unfavorable CVD risk factor levels at midlife. However, it also illustrated the advantages of a continuous-valued risk score as opposed to categorizing people into a small number of categories based on the presence of combinations of risk factors. With the Framingham score, we were able to better differentiate high and low risk groups with larger cost differences; determine the higher costs associated with increasing risk, thus providing a basis for more appropriately targeting interventions of different intensity for those in different risk groups; and, most important, associate a risk change score with longer-term costs and thus demonstrate the potential cost savings of interventions that limited the increase in risk score between midlife and later-life.supplemetal"}
{"text": "Rodents are widespread animal models in spinal cord injury (SCI) research. They have contributed to obtaining important information. However, some treatments only tested in rodents did not prove efficient in clinical trials. This is probably a result of significant differences in the physiology, anatomy, and complexity between humans and rodents. To bridge this gap in a better way, a few research groups use pig models for SCI. Here we report the development of an apparatus to perform biomechanically reproducible SCI in large animals, including pigs. We present the iterative process of engineering, starting with a weight-drop system to ultimately produce a spring-load impactor. This device allows a graded combination of a contusion and a compression injury. We further engineered a device to entrap the spinal cord and prevent it from escaping at the moment of the impact. In addition, it provides identical resistance around the cord, thereby, optimizing the inter-animal reproducibility. We also present other tools to straighten the vertebral column and to ease the surgery. Sensors mounted on the impactor provide information to assess the inter-animal reproducibility of the impacts. Further evaluation of the injury strength using neurophysiological recordings, MRI scans, and histology shows consistency between impacts. We conclude that this apparatus provides biomechanically reproducible spinal cord injuries in pigs. SCI often results in devastating neurological deficits with a major impact on the quality of life. The worldwide incidence of traumatic SCI varies substantially between different reports: It ranges from 3.6 to 1,009 patients per one million inhabitants . MoreoveIn the last few decades, the scientific community has exerted substantial efforts to overcome the consequences of SCI. An increasing number of promising therapeutic approaches have been developed in animal models, predominately in rats or mice , 7. RodeSince there is no commercially available impactor to generate SCI in large animals, we describe the development of an apparatus to perform biomechanically reproducible SCI in pigs weighing 25\u201350 kg. We show the iterative steps in this development, particularly focusing on the reliability and versatility of the contusion/compression device and the different surgical aspects. The multimodal sensors, the electrophysiology recordings, and the postoperative and post-mortem analyses show that our system generates reproducible acute injuries. The development of a reliable apparatus and the implementation of a surgical protocol is an essential step toward the establishment of a completely characterized animal model.in vivo experiments to determine the reproducibility of impacts. In complement to the spring-load impactor we developed tools to ensure reproducibility of the impacts and to ease the surgery.We developed two different impacting systems. During Phase 1 of the study, we produced a weight-drop impactor inspired by the early work of Allen , and itsThe animal experiments were approved by the Norwegian Animal Research Authority . The FELASA guidelines were followed. In compliance with these regulations, all efforts were made to minimize the number of animals used and their suffering. All surgical procedures were supervised by veterinarians. The experiments were performed on 20 male or female domestic pigs that weighed between 25 and 50 kg  The pigs used for this study had a genetic background composed of 50% Norwegian land pig, 25% Norwegian Yorkshire, and 25% Duroc. In addition, seven pig cadavers were used to test the instrument prototypes.All instruments engineered for this study were produced at a local workshop facility. The sketching was performed using the 3D CAD design software .For Phase 1, the weight-drop impactor is composed of guiding pipes of different lengths , in whicFor Phase 2, the spring-load impactor  is builtThe lock/release mechanism is performed through a stopper bar that keeps the piston in place when armed  contains two large rubber bands to support the pig. They are fitted on T-shaped elements. Their position may be adjusted in both the rostro-caudal and left-right axes by a system of rails and screw-locks . If desired, they may be positioned further apart to leave the abdominal region free \u2014this requires the use of additional lateral adjustable supports to avoid lordosis of the vertebral column . They are composed of rods terminated by a large plastic disc to disperse the pressure. To avoid skin sores, gel pads are positioned between the disc and the skin of the pig. In a later stage of engineering, we replaced these lateral supports by a suspension system (further described below). Since the table is constructed of an aluminum bracket with rails, it enables the possibility to affix multiple elements, such as an articulated arm, to support the impactor.For a better positioning of the pig, we produced an operating table inspired by previous descriptions , 27. It Figure 7); it is composed of a link element  mounted on a rod fitted onto pedicle screws. Two plates (one straight plate and one bended plate) are attached to the link and glided under the spinal cord to enclose it . Flexion of the vertebral column during the impact is prevented by the fusion of three adjacent segments with pedicle screws and titanium rods . To obtain a plain contact between the dura and the piston, we straightened the vertebral column with a suspension system . It is composed of a stand attached to the pig-operating table with screws . Suspension rods terminated by a hook can be positioned and affixed to the stand by a locking system . As detailed below, the suspension rods are hooked to surgical implants to exert a vertical pull on the vertebral column .The reproducibility of the biomechanical parameters of the impacts depends on several variables. In this study, we addressed four main factors: (1) the resistance of the surface underneath the spinal cord; (2) the capacity of the spinal cord to \u201cescape\u201d the impact by sliding to the side; (3) the absorption of energy by flexion of the spinal column during the impact; and (4) the angle between the piston and the spinal cord. To gain control over (1) and (2), we engineered a support system that encloses the ventral and lateral aspects of the spinal cord  diluted in 0.1 M phosphate buffered saline (PBS). The load sensor measured the impact force, while the movement of the plunger was recorded at 5,630 Hz with a NX3-S1 high-speed video camera  fitted with a macro objective . For the analyses of these recordings, we used ImageJ  and the e impact . For eacFor Phase 2, the spring-load impactor, we performed a series of impacts (10 impacts for each setting) on surgical gel pads . The tension adjustment screw was set to a specific number of turns. This number of turns is correlated with the compression distance  measuredFor Pigs 1\u201312, we used anatomical landmarks\u2014e.g., the scapula and counting of the ribs to identify the thoracic level. From Pig 13 onwards, we performed preoperative X-ray  and inserted a 22 G needle in the paravertebral musculature as a landmark. Once the level was confirmed, the needle was removed and the skin labeled with a permanent marker.TCO2, SpO2, and body temperature, were monitored using a multi-parameter monitor . In addition, the anesthetic depth was continuously monitored. It should be noted that the temperature at the start of the surgery was 38 \u00b1 0.9. In all the pigs, it rose along with the surgery by 0.98 degrees \u00b1 0.77.All anesthetic procedures were supervised by a trained veterinary anesthetist. For premedication, the pigs received an intramuscular injection of ketamine 10 mg/kg, midazolam 1.0 mg/kg, and dexmedetomidine 15 \u03bcg/kg prior to the catheterization of the auricular vein. After preoxygenation, anesthesia was induced with propofol intravenously to effect. After endotracheal intubation, intermittent positive pressure ventilation was initiated. Anesthesia was maintained with propofol 5\u201310 mg/kg/h, ketamine 5 mg/kg/h, and dexmedetomidine 4\u20138 \u03bcg/kg/h. Three to five minutes prior to the SCI, a bolus of rocuronium 1.2 mg/kg was injected intravenously to prevent any spontaneous movement. Physiological parameters, including heart rate, ECG, invasive arterial blood pressure, EFor somatosensory evoked potentials (SSEP) recordings, we stimulated the median and tibial nerves on each side using 13-mm subdermal needle electrodes 27 G, . SSEP were acquired from SCI 5\u201312 and 17\u201319 with an ISI IOM system portable . The cranial electrodes were subdermal needles  or screwThe surgery was performed by a trained neurosurgeon. The pig was placed in a prone position on the operating table. Under deep anesthesia, a 10-cm posterior midline incision was made between T8 and T12. Mobilization of the paravertebral muscles was performed with electrocautery, while diathermy was used to control haemostasis. The spinous processes, transverse processes, and the laminae of T9-11 were exposed.For Phase 1 experiments (SCI 1-9), we removed two spinous processes T10 and 11, but the lamina remained intact. The laminae were flattened with a high-speed diamante drill  to enable the positioning of the lamina plate . We remoFor Phase 2 of our study (SCI 10\u201320), we developed the spring-load impactor system . This sy10A\u2013C). Two titanium rods were attached and secured to the pedicle screws. A link element designed for this purpose . With the help of anatomical landmarks, we inserted pedicle screws in T11 and T12 on the left side and in T11 and T13 on the right side of the pig , 10A\u2013C.  purpose  was moun purpose . Nerve r purpose . The spr purpose . One min purpose . The susin vivo MRI scans (SCI 1\u20137), an active drain  was positioned, haemostasis was checked, and the muscle and skin were sutured using Monosyn sutures . The pig was disconnected from the automated ventilator and connected to a manual ventilation system for its transportation to the MRI facility. Anesthesia was maintained by propofol in combination with ketamine and vital parameters were monitored. T1 and T2-weighted images were acquired with a 3 T Philips MR Imaging DD 005. We also performed two CT scans (BrightSpeed S system) to confirm the laminectomy level and the screw positioning (SCI 18 and 19).For While the pig was deeply anesthetized, the laminectomy was extended to four levels. A neuromuscular blocker (Rocuronium 1.2 mg/kg) was injected (i.v.) to prevent any uncontrolled movement. The thoracic roots were inspected and no macroscopic damage was detected. Furthermore, the roots were cut and the spinal cord was transected at the rostral and caudal borders of the laminectomy. It was subsequently immersed in ice-cold PBS and maintained at 4\u00b0C until further dissection and tissue fixation were performed. The pig was euthanized by an i.v. injection of potassium chloride.http://free-d.versailles.inra.fr). For quantifying the volume of bleeding, MRI images were converted to 8-bits images and the threshold (0\u201360) was applied before pixel counting was done.The dura was removed and all rootlets were cut. The spinal cord was immersion fixed in 4% (w/v) paraformaldehyde-PBS for 5 days at 4\u00b0C. Two to four days prior to high-resolution MRI scanning, the spinal cord was rinsed in PBS, incubated in 1% (v/v) gadolinium  diluted in PBS, and maintained at 4\u00b0C, as previously reported for non-human primate spinal cords . Prior tFor histology, the spinal cord was embedded in paraffin , sectioned at 5\u20137 \u03bcm, mounted on positively charged slides, and then, processed for labeling with 0.1% (w/v) luxol fast blue diluted in 95% ethanol and 0.5% (v/v) glacial acetic acid for 2 h at 60\u00b0C. The differentiation was performed using 0.05% (w/v) of lithium carbonate, freshly dissolved in water, followed by a step in 70% ethanol. The sections were rinsed in water, incubated in absolute ethanol and xylene and coverslipped using Eukitt (Sigma-Aldrich).U-test (significance at p < 0.05). The calculations were performed using Libreoffice Calc (https://www.libreoffice.org/) or OriginPro 9.2 .The data presented indicate mean values (\u03bc) with error bars that represent the standard deviation (\u03c3). In the text, the coefficient of variation (CV) given as a percentage: CV = (\u03c3/\u03bc) \u00d7 100 is used to assess the dispersion of the data. Statistical comparison of the mean was done with the Mann\u2013Whitney The system was tested on 10% gelatin because its surface has similar properties as the spinal cord. Such properties include consistency and deformation. However, there are several difficulties in using gelatin. If the layer is too thin, the plunger perforates the gelatin and hits the bottom of the dish. Also, the force value recorded is too high and unreliable. Thus, it is necessary to use a thick layer. However, the thickness also determines the amount of energy absorbed. It is, therefore, crucial to use a standard thickness for all impacts. In addition, a specific area of gelatin and its surrounding area may only be used once because it is damaged by the impact.p < 0.001, p < 0.001. In line with this, the CV were low, with 6.3% for the 44-cm, 5.4% for the 34-cm, and 4.8% for the 24-cm pipes. In contrast, the values for the displacement, speed, and duration data were relatively close to each other and in some case overlapped between the different pipes. When comparing these values for the 44 and 34-cm pipes or for the 34 and 24-cm pipes, there was no significant difference (p > 0.05). However, there was a significant difference (p < 0.01) between the displacement values from the 24-cm  and 44-cm  pipes. Similar results were obtained for the impact speed for the 24-cm  and 44-cm pipes . These mean speed values were significantly different at p < 0.001. The mean impact duration for the 24-cm pipe was 10.5 ms and CV 16.8%; it was 7.9 ms and CV 5.3% for the 44-cm pipe. These mean speed values were significantly different at p < 0.05. A radar plot for each impact shows the relationship among the force, displacement, speed, and duration . For convenience, we defined this value to be 100% and expressed further volume values in p < 0.025) reduction in these volumes was identified at the epicenter of the injury with a volume of white matter at 10% (CV 126%) and a volume of gray matter at 0.05% (CV 125.7%). At the epicenter, the CV exhibited substantial variations between the different samples. However, these volumes are so small compared to the uninjured tissue that such variations are almost irrelevant.Post-mortem high-resolution 9.4 T MRI  scans (SCI 14\u201317) indicated a severe and broad damage area in which tissue destruction coexists with multiple intramedullary bleedings . This fi3 with a CV that represented a variation of 15.4%. The cumulative loss of the gray matter was 31.8 mm3 with CV at 28.2%.The mean cumulative tissue loss  for the Substantial intra-spinal bleeding is observed not only at the injury area, but also in the perilesional zone . Pixel aSeveral types of SCI have been experimented in pigs and may be categorized as follows: (1) compression injuries using clips \u201340 or coin vivo. We encountered several issues. Variations in the thickness and wideness of the lamina created problems in positioning the lamina plate. Even with different plate sizes, the variation in the distance between the lamina and the dura was a recurrent problem to place the plunger in a proper position (midline and surface of dura). Hence, our concept of the lamina plate that was intended to rigidify the vertebral column and guide the plunger was riddled with difficulties. This was worsened by the opacity of the metallic pipe which denies visual control over the plunger. It also created difficulties to record some of the impact biomechanical parameters with a high-speed camera. An attempt to use a transparent plastic pipe was not successful because of frictions, which influenced the impact reproducibility. A glass pipe might have solved this issue. However, working with glass presented other problems for our local workshop and therefore this idea was abandoned. However, the weaknesses of this system included the reproducibility of the impact (discussed below) and the implementation of a static compression, following the initial impact to mimic traumatic SCI in a better way. Lee et al.  easy handling (2) reproducible impacts, (3) adjustable impact strength, (4) the possibility to apply a static compression following the initial impact, (5) better characterization of the impact with more sensor feedback, and (6) visual control for the positioning of the impactor tip on the dura. The pipe and the weight were replaced by a piston system driven by the mechanical power of an expansion spring. This approach presented multiple advantages: It is a one-piece impactor, which is easier to handle. Moreover, it does not require any assembly during the surgical procedure. Nothing prevents the visual control of the position of the piston tip on the surface of the dura. The system is suitable for use with a high-speed camera. Although for the sake of simplicity and precision, we preferred a laser displacement sensor. In addition, the spring-driven impactor can produce multiple grades of injury strength because of the adjustment screw. This is in contrast to the weight-drop system in which the impact strength depends on the length of the pipe. This was a restriction on the choice of the injury grade. An additional advantage of the spring-load impactor is that it provides a simple solution to combine a dynamic impact with a prolonged static compression. This static compression may be adjusted to a desired force or displacement after the impact. It is also possible to perform a sole stepwise spinal cord compression injury by positioning the impactor on the dura and adjusting the screw until the desired compression force or displacement is obtained. In addition, it is possible to vary the duration of the static compression to influence the injury severity and the balance between the contusion and compression components. It is also possible to mix strong contusion with weak static compression or vice versa. This versatility is an advantage for testing the robustness of a treatment. Initially, it is natural to study a defined experimental treatment with a defined injury characteristic. However, another important step would be to test the treatment in a variety of situations to characterize its indication/limits. For example, it has been suggested that the neuroprotection provided by hypothermia is more pronounced for compression with a certain degree of ischemia than for contusion injuries \u201355. ThisThus, the functionality and versatility of this spring-load impactor makes it an excellent tool to generate different graded SCI in large animal models with characteristics superior to those of our original weight-drop impactor.in vivo. This is critical for SCI models, particularly for demonstrating the efficacy of a preclinical treatment. In addition, a high degree of reproducibility contributes to animal welfare because it reduces the number of animals necessary for significant findings. Furthermore, experiments performed in large animals are long, expensive, and require more human resources. It is, therefore, difficult to compensate for varying degrees of injury with a larger number of animals. In line with a recent study that shows substantial differences between in vivo and ex vivo impact characteristics  may influence the impact strength. A variable is the cushion effect of the CSF. Pigs and other larger mammals have a larger CSF space than rodents , 57. FurOverall, we showed that these standardization efforts were successful, although they globally increased the complexity of the procedure. However, for experimentations on a large animal model for spinal cord injury it is necessary to work with a trained surgeon. It can be a neurosurgeon, an orthopedic surgeon, a trauma surgeon, and a veterinarian trained in spine surgery. In these circumstances, the additional steps we presented do not present any obstacle.in vivo. It is the first step toward the establishment of a complete animal model. The characterization of the biomechanical properties of the impact provides important information about the generation of the injury. In addition, SSEP and MRI are useful tools that, together with the impact properties, present a comprehensible initial characterization of the injury. However, they only show a snapshot of the situation, and the development of the secondary injury will likely aggravate the functional outcome. Therefore, further experiments on chronic animals using different longitudinal outcome measurements, such as motor behavior, electromyogram recordings, and the study of autonomic dysfunction, will be necessary to obtain a full characterization of the model. We will also need to evaluate the stability of the column because of the surgical procedure. It is possible that we would have to leave the implants to avoid kyphosis in a chronic animal. In fact, this may present the advantage to better model the situation of traumatic SCI in humans. However, such a study is beyond the scope of this paper that only focuses on the development of tools and surgical procedures to generate injuries that are as reproducible as possible. However, this may be the most important step toward the generation of a reliable model. The injury we reported here is strong. With the development of the secondary injury process, it is possible that the severity of this trauma will be beyond any possible repair. So, further experiments will also be necessary to identify the appropriate injury strength that can be used for assessing treatment effects. This will be possible because our impactor can be adjusted to provide multiple injury strength.This study, describes the engineering of an apparatus and the establishment of surgical procedures that result in the generation of reproducible spinal cord impacts MZ and J-LB initiated the study, designed the experiments, and designed the different apparatus. MZ performed the surgical procedures. AL, VB, and HH established and performed the anesthesia procedures and the monitoring of vital parameters. EK and J-LB performed intra-operative electrophysiology. LZ and J-LB performed MRI scans. MZ and J-LB wrote the paper, prepared the figures, and revised critically manuscript. All authors read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Tetraspanins are a class of evolutionarily conserved transmembrane proteins with 33 members identified in mammals that have the ability to organize specific membrane domains, named tetraspanin-enriched microdomains (TEMs). Despite the relative abundance of different tetraspanins in the CNS, few studies have explored their role at synapses. Here, we investigate the function of TSPAN5, a member of the tetraspanin superfamily for which mRNA transcripts are found at high levels in the mouse brain. We demonstrate that TSPAN5 is localized in dendritic spines of pyramidal excitatory neurons and that TSPAN5 knockdown induces a dramatic decrease in spine number because of defects in the spine maturation process. Moreover, we show that TSPAN5 interacts with the postsynaptic adhesion molecule neuroligin-1, promoting its correct surface clustering. We propose that membrane compartmentalization by tetraspanins represents an additional mechanism for regulating excitatory synapses.  \u2022TSPAN5 is expressed in pyramidal neurons and localizes mainly to dendritic spines\u2022TSPAN5 interacts with neuroligin-1 and promotes its clustering\u2022TSPAN5-neuroligin-1 complex is fundamental for dendritic spine maturation Moretto et\u00a0al. demonstrate that TSPAN5 controls the maturation of dendritic spines by promoting the clustering of neuroligin-1. These findings provide proof of principle that compartmentalization of transmembrane proteins through tetraspanins can represent an additional level of regulation of synapse formation and function. Tetraspanins are a class of transmembrane proteins evolutionarily conserved in metazoans. They share a common structure: four transmembrane domains (TMs), a small extracellular loop (SEL) and a large extracellular loop (LEL), and intracellular N and C termini . TetraspThe role of these proteins in membrane domain assembly and in cell-cell adhesion supports a possible function in synapse formation and activity.TSPAN5 belongs to the C8 subgroup of tetraspanins, characterized by eight cysteine residues forming disulfide bridges key for proper protein folding. Structure-function studies found TSPAN5 to act in cell fusion during osteoclastogenesis  and reguTspan5 mRNA in mice revealed highest expression in the brain  clustering without strongly affecting excitatory synapse density or functionality.Dendritic spines, small dendritic protrusions where the postsynaptic compartment of excitatory synapses is formed, are typically sorted by morphology as thin, stubby, and mushroom. Their maturation process is complex and still debated, but \u201cmushroom\u201d spines are considered the final mature morphological subtype .NLG1, a major adhesion molecule of excitatory synapses , has rolOur data reveal TSPAN5 as a regulator of synapse organization and support the role for membrane compartmentalization of NLG1 in this process.TSPAN5 has not been studied in neurons; thus, we confirmed its expression in mouse brain lysates obtained with strong detergents (Triton X-100 and NP40) . At later stages, TSPAN5 localizes to filopodia and immature dendritic spines  markers  or a bicistronic construct carrying Sh-TSPAN5 and human TSPAN5-GFP cDNA resistant to Sh-TSPAN5 (rescue). In Sh-TSPAN5-transduced neurons, a significant reduction of TSPAN5 expression was observed. The rescue significantly restored TSPAN5 levels, with partial cleavage splitting TSPAN5-GFP fusion protein (Tspan5 mRNA. No changes were found on other tetraspanin transcripts (TSPAN7 and CD81) , shRNA targeting  protein F. We vernd CD81) G. TSPAN5nd CD81) H.To evaluate the role of TSPAN5 in dendritic spine formation, we transfected cultured rat hippocampal neurons before synaptogenesis (DIV 5) for analysis at different maturation stages. At DIV 12 A, we detAt DIV 14, synaptogenesis is prominent ; here weWe confirmed the excitatory nature of analyzed neurons by immunostaining for the excitatory marker CamKII-\u03b1  Figure\u00a0J.We further studied TSPAN5 and neuronal function by performing an immunostaining for the excitatory postsynaptic marker PSD-95 and the presynaptic marker VGluT1 on mature neurons (DIV\u00a018) transfected before synaptogenesis with the scrambled, Sh-TSPAN5, or rescue construct A. Surpriin\u00a0vitro and in\u00a0vivo . Upon TSPAN5 modulation, the frequency and amplitude of mEPSCs were not significantly changed C and 3D,We also tested presynaptic function by exposing transfected neurons to high sucrose concentration (1 M) to trigger presynaptic vesicle release . No chanFurthermore, upon TSPAN5 knockdown, the density of the VGlut1 puncta was reduced, while their average size increased D, suggesBecause tetraspanins are known to form TEMs, we wondered if TSPAN5 can organize similar structures in neurons and whether TEMs are involved in dendritic spine maturation.TEMs present a characteristic lipidic composition  that detTo investigate if these domains are key for dendritic spine formation, we examined the presence in TEMs of NLG1 and the AMPAR subunit GluA2, two crucial players in dendritic spine formation and excitatory synapses function, respectively . Both prHowever, this method is not specific for TEMs, as digitonin precipitates all cholesterol-enriched domains , which can be found in dendritic spines .Thus, we performed co-immunoprecipitation experiments in RIPA lysates from adult rat hippocampi and cortices, confirming the association of TSPAN5 with NLG1 A. We didImportantly, this interaction is not mediated by indirect association between different tetraspanins in TEMs, because the experiments were performed in the presence of Triton X-100 and NP40 in the lysis buffer .To map the TSPAN5-NLG1 interaction, we analyzed the main functional domains of tetraspanins, the surface exposed LEL and the C terminus (Ct), exposed to the cytosol B.We produced GST-LEL or GST-Ct fusion proteins C for pul139LQ141 and N165IYF168 regions  together with AP-NLG1 and BirA-ER. The AP tag, on the extracellular side of NLG1, is biotinylated by the enzyme BirA-ER in the ER . We usedWe also verified the involvement of the TSPAN5 Ct in NLG1 binding. When the Ct was truncated (\u0394C), there was little precipitation of TSPAN5 compared with wild-type TSPAN5 D, and noWe also analyzed the region of NLG1 interacting with TSPAN5. We transfected HEK293 cells with TSPAN5-GFP and with HA-tagged wild-type NLG1, or NLG1 mutants with either the extracellular cholinesterase-homology region replaced with that of human acetylcholinesterase   Figure\u00a0A. As expThe proportion of mushroom spines did not change between scrambled- and Sh-TSPAN5-transfected neurons A, supporWe validated this with a HA-tagged NLG1 SWAP mutant B. As expTo verify the importance of TSPAN5-NLG1 interaction, we compared dendritic spines of neurons transfected with scrambled, Sh-TSPAN5 or rescue constructs, expressing either wild-type TSPAN5 (rescue) or the DLQ or NIYF mutants C. First,The TSPAN5 mutants, unable to interact with NLG1, did not\u00a0rescue TSPAN5 knockdown-mediated loss of dendritic spines B. FurtheSimilar results were obtained when we examined the morphology of the remaining spines. Neurons transfected with\u00a0the DLQ mutant had fewer mushroom spines compared with scrambled-transfected neurons but higher than the Sh-TSPAN5-transfected neurons with a co-occurring increase in stubby spines. The NIYF-transfected neurons instead exhibited spine morphology similar to the Sh-TSPAN5 condition C.in\u00a0vivo, we analyzed dendritic spines in brain slices from adult mice  that had undergone in utero electroporation of these constructs at embryonic day (E) 13.5. We first validated the shRNA for TSPAN5 in mouse neuronal cultures  in which the four cysteines  in the juxta-membrane region were mutated to alanines  or not (non-clustered condition)  FiguresE.We verified that adding clustered neurexin1\u03b2-Fc increased the average size of surface HA-NLG1/neurexin1\u03b2-Fc puncta without affecting dendritic spine density E.We found that non-clustered Sh-TSPAN5-transfected neurons still had a reduced proportion of mushroom spines compared with non-clustered scrambled-transfected neurons E and 6F.Overall, our data indicate that TSPAN5 is a regulator of NLG1 clustering. We found this process to control dendritic spine maturation without affecting the general assembly of postsynaptic compartments. Our findings are a proof of principle that compartmentalization of transmembrane proteins through tetraspanins is an extra level of regulation of dendritic spine formation.135DD137 and N165IYF168. Together with our data, this shows that the R135DD137 and D139LQ141 sequences specifically regulate the association of TSPAN5 LEL with ADAM-10 and NLG1, respectively. In contrast, the N165IYF168 motif is involved in multiple TSPAN5 interactions. TSPAN5-ADAM-10 interaction regulates the intracellular trafficking of the protease and the cleavage of specific targets , and another is shared with ADAM-10 (NIYF) . The modTSPAN5 has a vital role in NLG1 clustering, trapping it in TEMs and regulating its surface mobility. This phenomenon is NLG1 specific, as there was no change in N-cadherin mobility upon TSPAN5 modulation. Interestingly, super-resolution analyses have shown that the average dimension of TEMs (between 90 and 190\u00a0nm)  and NLG1Moreover, the defects in surface mobility of the GluA2 subunit of AMPARs upon TSPAN5 knockdown suggest that reducing NLG1 clustering impairs recruitment of other postsynaptic components . AlternaOur data found that TSPAN5 regulates dendritic spine maturation more than formation. Moreover, TSPAN5 downregulation did not affect the total number of excitatory synapses, because of an increase in shaft synapses.in\u00a0vitro and in\u00a0vivo that modulation of proteins involved in dendritic spine morphology, such as EphrinB3, nArgBP2 and Neurobeachin can lead to changes in the number of shaft excitatory synapses with no dramatic effect on mEPSCs   similar NLG1 has been shown to have a specific regulatory role on NMDAR-mediated currents , but theOur work does not exclude other processes underlying dendritic spine defects upon TSPAN5 knockdown; however, TSPAN5 silencing in neurons in which NLG1 was decreased or replaced with the NLG1 SWAP mutant defective for TSPAN5 association failed to affect the proportion of mushroom spines. Interestingly, a significant effect was seen on dendritic spine density and in the proportion of thin and stubby spines, suggestive of other TSPAN5 functions  . StudyinFinally, the effects on dendritic spine maturation caused by TSPAN5 knockdown can be rescued by forcing NLG1 clustering. This finding strengthens the hypothesis that TSPAN5 promotes NLG1 clustering and that this pathway is vital for dendritic spine maturation.maria.passafaro@in.cnr.it).Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Maria Passafaro  on the care and use of animals and following the guidelines of the UCL-Institute of Neurology Genetic Manipulation and Ethic Committees under license from the UK Home Office in accordance with the Animals (Scientific Procedures) Act 1986 (Amended Regulations 2012). Animal procedures were approved by the Italian Ministry of Health (Protocol Number N\u00b0 100/2016) and by the France Ministry of Agriculture (N\u00b0 742/2014) for primary cultures from rat embryos and for In utero electroporation (Iacuc 799).2. Transfected cells used for streptavidin pulldown experiments were grown for 48\u00a0h in Neurobasal (GIBCO) medium supplemented with 2% B27 (prepared as in HEK293 or HeLa (Thermo Fisher Scientific) cells were grown in DMEM (GIBCO), supplemented with 10% FBS (GIBCO), 1% L-glutamine (Invitrogen), 0.1% gentamycin (Invitrogen) incubated at 37 \u00b0C with 5% COThe 293FT cell line used to generate the lentiviruses was grown in DMEM supplemented with 10% FBS, 1% L-glutamine, 0.1% gentamycin and 0.1% G418 (Invitrogen).\u22121 poly-D-lysine (Sigma Aldrich) at 75,000 per well and grown in Neurobasal medium supplemented with 2% B27   into pLVpSICOR was obtained from Addgene #11579 and modified by substitution of the CMV promoter with a human ubiquitin C (UBC) promoter in restriction sites NotI/NheI. The Sh-TSPAN5 sequence was inserted at the HpaI/XhoI sites and human TSPAN5 cDNA was subcloned from TSPAN5-GFP (Dr Rubinstein) and inserted upstream of the EGFP sequence at sites NheI/AgeI. Please note that the human TSPAN5 nucleotidic sequence differs from that of rat in the site of the ShRNA thus allowing to use it as shRNA-resistant sequence.The same procedure was used to produce the DLQ, NIYF and PLM pSICOR constructs by subcloning from TSPAN5-DLQ-GFP, TSPAN5-NIYF-GFP and TSPAN5-PLM-GFP .pSICOR-mCherry was obtained from Addgene #21907 and Scrambled or ShRNA sequences were inserted in the HpaI/XhoI sites and the cDNA of human wild-type TSPAN5, DLQ and NIYF mutants were inserted in NheI/AgeI sites.TSPAN5-RFP was produced by PCR and inserted in tDimer-RFP vector in the EcoRI site.pGEX-4T-1 constructs were produced by PCR from TSPAN5-GFP, TSPAN5-RDD-GFP, TSPAN5-DID-GFP, TSPAN5-DLQ-GFP and TSPAN5-NIYF-GFP (Dr Rubinstein) and by insertion at the BamHI/EcoRI sites.2 in H20 (200\u00a0\u03bcl per well). One volume of HEBS buffer  was added to the DNA and thoroughly mixed to produce air bubbles. The mix was added to the cells and left for 5\u00a0h before washing and changing the medium.HEK293 cells were transfected with the calcium phosphate method. Briefly, DNA (2\u00a0\u03bcg x 6-well) was mixed with 130mM CaClDIV5 rat or mouse hippocampal neurons were transfected with Lipofectamine 2000 (Invitrogen) or infected with lentiviral particles produced as previously described .2 (Sigma Aldrich) and 1\u00a0mM MgCl2 (Sigma Aldrich) at 37\u00b0C. Neurons were then exposed to PBS supplemented with 0.1mM CaCl2 and 1\u00a0mM MgCl2 with and without BS3 crosslinker  at 4\u00b0C for 10\u00a0min. Neurons were then rapidly washed first with TBS supplemented with 0.1\u00a0mM CaCl2 and 1\u00a0mM MgCl2 plus 50\u00a0mM glycine (Sigma Aldrich) at 4\u00b0C and then with TBS supplemented with 0.1\u00a0mM CaCl2 and 1\u00a0mM MgCl2 at 4\u00b0C prior to lysis with BS3 buffer . 3X Laemmli sample buffer was then added and the samples analyzed by SDS-PAGE and western blotting.The experiments were carried out according to Hippocampi and cortices were collected from adult Wistar rats and homogenized with glass-teflon potter in homogenization buffer . The total homogenate was centrifuged at 1,000\u00a0g for 10\u00a0min at 4\u00b0C. The pellet P1 corresponds to the nuclear fraction. The supernatant S1 was centrifuged at 10,000\u00a0g for 15\u00a0min at 4\u00b0C. The resulting pellet (P2) corresponds to crude synaptosomal fraction while the supernatant (S2) contains cytosolic components and light membranes. The P2 fraction was resuspended in homogenization buffer and centrifuged again at 10,000\u00a0g for 15\u00a0min at 4\u00b0C to wash the synaptosomes. Crude synaptosomes were loaded on top of a discontinuous sucrose gradient  and centrifuged at 150,000\u00a0g at 4\u00b0C for 2h. Purified synaptosomes were collected between 1 and 1.2\u00a0M sucrose layers. The fractions were all resuspended in homogenization buffer. 3X sample buffer was then added and the samples analyzed by SDS-PAGE and western blot by loading the same amount of proteins.For immunoprecipitation experiments, hippocampi and cortices were dissected from adult rat brain, pooled together and lysed in RIPA buffer  in teflon-glass potter, rotated for 1h at 4\u00b0C and centrifuged at 10,000\u00a0g for 30\u00a0min at 4 \u00b0C. Supernatants were incubated with antibodies at 4 \u00b0C overnight. Protein A-agarose beads  were incubated with the supernatants at 4 \u00b0C for 2 h. Beads were washed three times with RIPA buffer, resuspended in 3X sample buffer and analyzed by SDS\u2013PAGE followed by western blotting.For streptavidin-precipitation experiments, transfected HEK293 cells were lysed in RIPA buffer , rotated for 1h at 4\u00b0C and centrifuged at 10,000\u00a0g for 30\u00a0min at 4 \u00b0C. Supernatants were incubated with streptavidin immobilized on agarose beads (Thermo Scientific) for 3\u00a0h at 4\u00b0C. The beads were first precipitated by centrifugation at 4,000 RPM for 5\u00a0min at 4\u00b0C, washed three times with RIPA buffer and then resuspended in 3X sample buffer and analyzed by SDS\u2013PAGE followed by western blotting.For GFP-Trap precipitation, transfected HEK293 cells were lysed in RIPA buffer , rotated for 1\u00a0h at 4\u00b0C and centrifuged at 10,000\u00a0g for 30\u00a0min at 4 \u00b0C. The supernatants were first incubated with GFP-Trap magnetic beads (ChromoTek) for 1\u00a0h at 4\u00b0C and then precipitated by magnetic separation and washed three times with RIPA buffer, resuspended in 3X sample buffer and analyzed by SDS\u2013PAGE followed by western blotting.E.\u00a0coli and inducing recombinant protein expression by adding IPTG  for 2 h. Bacteria were pelleted, resuspended in lysis buffer  and rotated for 1\u00a0h at 4\u00b0C. Lysed bacteria were inserted into a dialysis membrane (cutoff 13kDa) and dialyzed for 1\u00a0h at 4\u00b0C in dialysis buffer I . The membrane was then moved to dialysis buffer II  overnight at 4\u00b0C. Membranes were dialyzed with new dialysis buffer II for 3\u00a0h at 4\u00b0C. Lysates were then collected and centrifuged at 10,000\u00a0g for 30\u00a0min at 4\u00b0C. The supernatant was incubated with glutathione Sepharose beads (Thermo Scientific) overnight at 4\u00b0C and then washed with dialysis buffer II.GST-fusion proteins were prepared by growing transformed BL21 Hippocampi and cortices dissected from adult rat brains were pooled together, lysed in RIPA buffer by homogenization in a teflon-glass potter, rotated for 1\u00a0h at 4\u00b0C and then centrifuged at 10,000\u00a0g for 30\u00a0min at 4 \u00b0C. Supernatants were incubated with glutathione Sepharose beads for 3\u00a0h at 4\u00b0C and then washed and resuspended in 3X sample buffer and analyzed by SDS-PAGE followed by western blotting.Proteins were transferred from the acrylamide gel onto the nitrocellulose  or PVDF membranes. Membranes were incubated with the primary antibodies  at room temperature for 2\u20133\u00a0h or overnight at 4\u00b0C in TBS Tween-20 (0.1%), milk (5%). After washing, the blots were incubated at room temperature for 1\u00a0h with horseradish peroxidase-conjugated \u03b1-rabbit, \u03b1-mouse or \u03b1-rat antibodies  in TBS Tween-20 (0.1%), milk (5%). Immunoreactive bands on blots were visualized by enhanced chemiluminescence .Mouse hippocampal cultures were prepared as reported previously . To moduFor each condition, 1.5 ug of extracted mRNA was used to synthetize cDNA using SuperScript VILO cDNA Synthesis Kit (Thermo Fisher).The target sequences of TSPAN5, TSPAN7, CD81 and \u03b1-actin (endogenous control) were amplified from 60\u00a0ng of cDNA in the\u00a0presence of\u00a0SYBR Green PCR Master Mix (Applied Biosystems) using Applied Biosystems 7000 Real-Time thermocycler. Primer sequences were as follows: mouse TSPAN5 Fw (AACAACATCAGAGCCTACAGAG), mouse TSPAN5 Rev (GGTTCCAATCATCAGCTCCA), TSPAN7 Fw (ACCAGTTTTATGGAGACTAACATGG), TSPAN7 Rv (AGCAGCATGCCAATCAACT), CD81 Fw (TGATGATGTTTGTAGGCTTCCT), CD81 Rv (CTCACAGGCAAACAGGATCA), \u03b1-actin Fw (AGATGACCCAGATCATGTTTGAGA), \u03b1-actin Rev (CCTCGTAGATGGGCACAGTGT)Each sample was run in triplicate, and the results were calculated using the \u0394\u0394CT method to allow the normalization of each sample to the internal standard and comparison with the calibrator of each experiment.ARs blocker bicuculline (20\u00a0\u03bcM) to isolate mIPSCs and mEPSCs respectively. The composition of the intracellular solution was 126\u00a0mM K-gluconate, 4\u00a0mM NaCl, 1\u00a0mM EGTA, 1\u00a0mM MgSO4, 0.5\u00a0mM CaCl2, 3\u00a0mM ATP , 0.1\u00a0mM GTP , 10\u00a0mM glucose, 10\u00a0mM HEPES-KOH . Mixed AMPA/NMDA-mEPSCs were recorded in absence of Mg2+ to reduce Mg2+ block of NMDARs. Pure AMPAR mediated currents were isolated by perfusing neurons for at least 6\u00a0minutes with an NMDAR blocker (100\u00a0\u03bcM APV) to estimate the time when the AMPAR component of mixed AMPA/NMDA-mEPSCs decays. This allowed the measure of the NMDAR component of mixed AMPA/NMDA-mEPSCs. Specifically, the AMPAR component of mixed events were measured at the peak of the current while the NMDAR component were measured in a window between 10-20\u00a0ms after the AMPAR peak (adapted from N-ethyl bromide (QX-314 5\u00a0mM).Miniature excitatory or inhibitory post-synaptic currents (mIPSCs/mEPSCs) were recorded in the presence of the voltage-dependent sodium channels blocker (500\u00a0\u03bcM lidocaine). Additional blockers were added including the broad-spectrum glutamatergic blocker kynurenic acid (3\u00a0mM) and the GABAThe readily releasable pool (RRP) size was evaluated by perfusing neurons for 5\u00a0s with KRH supplemented with 1\u00a0M sucrose as previously described .Recordings were performed with a Multiclamp 700B amplifier . Pipette resistance was 2\u20133 M\u03a9 and series resistance always below 20 M\u03a9. mEPSCs and RRP size were recorded at a holding potential of \u221270\u00a0mV, filtered at 2 kHz, and digitized at 20 kHz using Clampex 10.1 software . Analysis was performed offline with Clampfit 10.1 software  using a threshold crossing principle. Cells with noisy or unstable baselines were discarded.2 and 1\u00a0mM MgCl2 and fixed in paraformaldehyde /sucrose  for 10\u00a0min at room temperature or in methanol (Sigma Aldrich) for 10\u00a0min at 4\u00b0C and incubated with primary antibodies  in GDB1X solution  for 2\u00a0h at room temperature.Cultured hippocampal neurons were washed in PBS supplemented with 0.1\u00a0mM CaCl2 and 1\u00a0mM MgCl2 and fixed in paraformaldehyde / sucrose  for 10\u00a0min at room temperature and then blocked for 1\u00a0h with blocking solution  followed by 3\u00a0h incubation with \u03b1-pan neurexin-1 (1:250) in primary antibody solution .For neurexin staining neurons were washed in PBS supplemented with 0.1\u00a0mM CaCl2 and 1\u00a0mM MgCl2 and paraformaldehyde fixation.For surface staining, antibodies  were applied to neurons for 10\u00a0min at room temperature followed by a washing step in PBS supplemented with 0.1\u00a0mM CaCl42-, pH 7.4) the coverslips were incubated with secondary antibodies  in GDB1X solution for 1h at room temperature.After three washes with high salt buffer .Fluorescence images were acquired with an LSM510 Meta confocal microscope  and a 63X oil-immersion objective  with sequential acquisition setting, at 1,024 X 1,024 pixels resolution. Images were Z series projections of approximately 6\u201310 images, each averaged four times and taken at depth intervals of 0.75\u00a0\u03bcm.Dendritic spines were counted on all GFP positive neuronal dendritic arbor excluding the soma and classified with NeuronStudio software (NeuronStudio\u00a9) according to the following parameters: General parameters for spine identification: Length > 0.2\u00a0\u03bcm and\u00a0< 3.0\u00a0\u03bcm, Max Width 3.0\u00a0\u03bcm, Stubby spines size > 10 voxels, Non Stubby spines size > 5 voxels. For spine types classifications the following logical tests were used: if Neck Ratio (head/neck diameter) > 1.100 then a spine was classified as Thin  or Mushroom . A spine is classified as Stubby if it fails at any of the precedent logical tests.Sholl analysis was performed with the NeuronStudio software using concentric circles with 3\u00a0\u03bcm radius.Puncta or clusters were calculated with Fiji software thresholding images at intensity equal to 3 X StDev of the signals.For For NLG1 clustering was induced by application of clustered neurexin1\u03b2-Fc. Purified neurexin1\u03b2 -Fc  were preNon-clustered or clustered neurexin1\u03b2 -Fc were applied to DIV12 neurons in media and left for two days.2 and 1\u00a0mM MgCl2 to surface stain both HA-tagged-NLG1 and neurexin1\u03b2-Fc.\u03b1-HA and \u03b1-human Fc-Alexa647 were applied for 10\u00a0min at room temperature in PBS supplemented with 0.1\u00a0mM CaClNeurons were then fixed with paraformaldehyde (4%)/sucrose (4%) for 10\u00a0min at room temperature, washed and stained with a secondary-Alexa568 antibody to detect \u03b1-HA signal.After imaging as above, both the Alexa568 and Alexa647 signals were thresholded for intensity equal to three times the StDev of the signals. Only puncta positive for both channels were considered in the analysis.All procedures were approved by the Italian Ministry of Health and the San Raffaele Scientific Institute Animal Care and Use Committee in accordance with the relevant guidelines and regulations. Electroporation in utero was employed to deliver the expression vectors to the ventricular RGCs of CD1 mouse embryos as previously described . BrieflyAnimals with GFP and tdTomato positive signals in the brain were aged to P30 and then anesthetized with 10\u00a0mg/ml Avertin and intracardially perfused with 4% paraformaldehyde/ 4% sucrose. Brains were collected, 150\u00a0\u03bcm thick slices were cut with a vibratome (Leica) and mounted on polylysine-covered coverglass (VWR) with FluoroMount (Sigma Aldrich).Secondary dendrites of around 60\u03bcm from GFP and tdTomato positive pyramidal cortical neurons were imaged with a Z-projection of 0.35\u00a0\u03bcm steps with the confocal ZEISS LSM 800 microscope mounting a 63X oil immersion objective at 1024X1024 pixels resolution. Dendritic spines were counted manually from secondary branches of the apical dendrite of layer III pyramidal neurons in the lateral somatosensory cortex.Transfected rat hippocampal cultured neurons were imaged either with monomeric streptavidin coupled to Atto-594  to imageBriefly, coverslips were mounted in an open Inox chamber (Life imaging services) and the growth medium was replaced by Tyrode solution  containing 1% globulin-free BSA (Sigma). A Nikon Ti-E Eclipse inverted microscope equipped with an EMCCD camera  and an apochromatic (APO) total internal reflection fluorescence (TIRF) 100X/1.49 numerical aperture (NA) oil objective was used for imaging. GFP positive neurons were selected and low concentrations of Atto 594-conjugated mSA (1\u00a0nM) or Atto 647- conjugated \u03b1-GluA2 antibody were added to isolate single molecules. A four-color laser bench  was connected through an optical fiber to the TIRF illumination arm of the microscope. Laser powers were controlled through acousto-optical tunable filters driven by the Metamorph software . Atto 594 and Atto 647 were excited with the 561- and 642-nm laser lines through a four-band beam splitter . Samples were imaged by oblique laser illumination, allowing the excitation of individual Atto-conjugated ligands bound to the cell surface, without illuminating ligands in solution. Atto 594 and 647 fluorescence was collected using FF01-617/73 and FF01-676/29\u00a0nm emission filters (SemRock), respectively, placed on a filter wheel (Suter). Stacks of 4,000 consecutive frames were obtained from each cell, with an integration time of 20\u00a0ms. Acquisitions were steered using the Metamorph software (Molecular Devices) in a streaming mode at 50\u00a0Hz.Images were analyzed with a custom Metamorph macro based on wavelet segmentation for localization and simulated annealing algorithms for tracking, previously described . Super-rmEOS-tagged N-Cadherin was generated as previously described . HippocaPrimary cultured neurons were surface-labeled with 100\u00a0nM of mStrav-Alexa647 in Tyrode solution for 10\u00a0min, rinsed, and fixed with pure methanol 8\u00a0min at \u221220\u00b0C. Neurons were permeabilized using 0.2% Triton X-100 (Sigma) for 5\u00a0min, rinsed, blocked using 0.1% BSA (Sigma) in PBS for one hour, then immunolabeled for TSPAN5 (1:50), and incubated with Alexa 532 conjugated anti-rabbit secondary antibody (Jackson Immunoresearch). dSTORM imaging of cultured neurons was performed using an inverted motorized microscope  equipped with a x100 1.49NA PL-APO objective and a perfect focus system, allowing long acquisition in oblique illumination mode, 1W 532 and 647 laser lines. Both the ensemble and single-molecule fluorescence were collected by using a quad-band dichroic filter . The fluorescence was collected using a sensitive EMCCD . 100-nm fluorescent beads  adhered to the surface of the coverslips were used as registration markers. Single-molecule localization and reconstruction was performed with automatic feedback control of the lasers using WaveTracer module, enabling optimal single-molecule density during the acquisition . The acqBiorender.com).The graphical abstract was prepared using the BioRender software (All statistical analyses were done with GraphPad Prism 6 software.Two-tailed unpaired t test was performed to assess statistical significance between two independent groups A. One-waStatistical details of the experiments can be found in the Western blots were repeated at least three times from three independent experiments. Imaging experiments on cultured neurons were done on at least three independent cultures.This study did not generate any datasets or code."}
{"text": "The impact of chronic cadmium exposure and slow accumulation on the occurrence and development of diabetes is controversial for human populations. Islets of Langerhans play a prominent role in the etiology of the disease, including by their ability to secrete insulin. Conversion of glucose increase into insulin secretion involves mitochondria. A rat model of pancreatic \u03b2-cells was exposed to largely sub-lethal levels of cadmium cations applied for the longest possible time. Cadmium entered cells at concentrations far below those inducing cell death and accumulated by factors reaching several hundred folds the basal level. The mitochondria reorganized in response to the challenge by favoring fission as measured by increased circularity at cadmium levels already ten-fold below the median lethal dose. However, the energy charge and respiratory flux devoted to adenosine triphosphate synthesis were only affected at the onset of cellular death. The present data indicate that mitochondria participate in the adaptation of \u03b2-cells to even a moderate cadmium burden without losing functionality, but their impairment in the long run may contribute to cellular dysfunction, when viability and \u03b2-cells mass are affected as observed in diabetes. At the end of the treatment, cells were washed with PBS and brought in suspension by incubation with 0.25% trypsin/EDTA in PBS without calcium and magnesium. Cells were pelleted at 150\u00d7 g for 5 min, the pellet was rinsed with PBS, and suspended at 106 cells/mL in 50 mM HEPES, 0.7 M NaCl, 12.5 mM CaCl2, pH 7.4. The suspension was labeled with Fluoprobe 488-annexin V (Interchim) then 1 \u03bcg/mL propidium iodide (PI) for 15 min at room temperature in the dark. The stained cells were detected by flow cytometry with a LSR Fortessa\u2122 cell analyzer  using the 488 nm sapphire laser and 532 nm compass laser for Fluoprobe 488 and PI, respectively. The corresponding fluorescence emission was measured with a 525/50 nm and 585/15 nm band-pass filters, respectively. Live cells are not labeled in this assay, whereas preapoptotic ones bind annexin V, necrotic ones accumulate PI, and doubly labeled cells are the dead ones. As an alternative method to the above labeling of cells, viability was also measured with the Cell Titer 96\u00ae AQueous One Solution Cell Proliferation Assay  in 96 well plates until adherence, then cadmium was added at different concentrations as explained above. The number of cells able to reduce the MTS tetrazolium compound was determined by recording the absorbance at 490 nm with a multi-well plate reader .To assess viability, INS-1 cells were exposed to CdCl2 for 96 h as described above. In wells in which mitochondria were labeled without nuclear staining, the cell-permeable fluorescent probe MitoTracker Red CMXRos  was added at 200 nM for 30 min at 37 \u00b0C. Cells were fixed in fresh 4% paraformaldehyde for 10 min at ambient temperature, washed twice with PBS, then cells were permeabilized using 0.2% Triton X-100 in PBS for 15 min, rinsed thrice, and blocked with PBS-Tween (1 mg/mL) BSA 5% (PBS-T BSA) for 1 h at 37 \u00b0C. Mitochondria were alternatively labeled with the primary antibody  raised in rabbit against mitochondrial aconitase (the product of the ACO2 gene) as an alternative to MitoTracker staining. The mAb was diluted 200 fold in PBS-T BSA and cells were incubated overnight at 4 \u00b0C. The cells were then rinsed thrice with PBS, and the primary antibody was reacted for 4 h at room temperature in the dark with the labeled secondary one  diluted 200 fold in PBS-T BSA. Before the end of the latter incubation, nuclear staining was performed with PI (1 mg/mL) for 20 min at 4 \u00b0C. Culture chambers were removed, and slides were mounted and sealed before microscopic observation.In immunofluorescence (IF) experiments, INS-1 cells were inoculated at 5000 cells/well on culture slides with detachable culture chambers  until adherence. They were treated with different concentrations of CdClA Leica TCS SP8 inverted laser scanning confocal microscope  equipped with a 40\u00d7 Oil immersion objective was used to collect images. Laser excitation was 488 nm for Hylite Fluor 488, 552 nm for MitoTracker Red CMXRos and PI, with fluorescence emission at 500\u2013550 nm, 575\u2013630 nm, and 605\u2013685 nm, respectively. The Mitotracker probe was used to cross check the images recorded by labeling aconitase: both sets of images qualitatively agreed and, since the latter were of better quality than the former, only wells in which aconitase was detected were analyzed in details. Several fields were recorded for each slide and quantitative analysis with the Image J (imagej.nih.gov) and Volocity  computer programs was carried out on all of them as follows. In a first step, tophat filtering was applied to the images recorded with the mitochondrial channel (aconitase fluorescence) in Image J to remove noise and to obtain a precise definition of the mitochondrial morphology. The filtered images were then analyzed with the Volocity software which provides morphological parameters like perimeter, area, skeletal length and diameter for each identified object. Each analyzed Cd-treatment group corresponded to tens of cells, and hundreds or thousands of mitochondrial objects. From these data, the circularity shape factor was calculated, as Equation (1).w:v) HClO4-EDTA 6.25 mM. The recovered mixture was strongly mixed and centrifuged at 12,000\u00d7 g for 5 min at 4 \u00b0C. The supernatant was neutralized at pH 7 with MOPS-KOH buffer 0.3 M and centrifuged 2 min at 12,000\u00d7 g. Aliquots (75 \u03bcL) of the supernatant were then mixed with 15 \u03bcL of HCl 1 M and 35 \u03bcL of 28 mM pyrophosphate buffer pH 5.75. Thirty \u00b5l of the mixture were analyzed on a Polaris 5 C18-A, Agilent S (250 \u00d7 4.6 mm) column equilibrated in pyrophosphate buffer pH 5.75 at 1 mL/min. The retention times of ATP, adenosine diphosphate (ADP) and adenosine monophosphate (AMP) are approximately 6, 7 and 12 min, respectively, as determined by UV absorption at 254 nm.To measure the cellular content in adenosine nucleotides, cells were rinsed with PBS after the cadmium treatment as described above. Cellular perchlorate extracts were prepared with 750 \u03bcL of cold 2.5%  with 2.8 or 16.7 mM of glucose at ca. 4 \u00d7 106 cells/mL. These glucose concentrations were chosen at the lower and higher ends of the sigmoid response of \u03b2-cells to glucose. Cellular respiration was measured and, when required, 1 \u03bcg/mL oligomycin was added. The fraction of O2 consumption used for producing ATP was calculated as Equation (2).The oxygen consumption rates of INS-1 cells were measured with a temperature-controlled Hansatech oxygraph equipped with a Clark electrode and monitored with the 6 cells). Dihydroethidium (DHE) at the final concentration of 5 \u03bcM was added to the cell suspension which was then incubated 30 min in the dark at 37 \u00b0C, and cells were analyzed for fluorescence with a LSR Fortessa\u2122 cell analyzer .To estimate the level of oxidative species present inside cells at the end of the exposure period to cadmium, INS-1 cells were grown and treated with CdCl2 as above  for 96 hTo measure the concentration of cadmium inside cells, the latter were harvested, rinsed and dry pellets were kept at \u221280 \u00b0C before measurements. The latter were carried out by Inductively-coupled plasma-mass spectrometry (ICP-MS) as described in details elsewhere . An aliqp < 0.05 status were recorded.The implemented statistical tests were adjusted to the design of the different experiments, the nature of the measured parameters, and the kind of comparison to be made. The Kruskal\u2013Wallis test or One Way Analysis of Variance, depending on the data distributions, were applied to the parameters tested to vary with the cadmium exposure group. For microscopic image analysis, the Dunn\u2019s test was used to compare each group to the one which was not exposed to cadmium. The difference of rank means, the Q test statistic, and the Since the aim of the present study is to probe the sensitivity of the INS-1 cell line upon long-term exposure to sub-lethal concentrations of cadmium, these \u03b2-cells were kept for the maximal amount of time in culture in the presence of cadmium before analysis. It was observed that a given batch of cells could not sustain growth for more than ca. 4 days before reaching high density for those not exposed or dying for the most exposed ones, i.e., without applying the stress associated with passage in suspension. Hence, 4 days was the time limit set for the following experiments. The analysis of viability after 72 h indicated that the proportion of viable cells was not significantly altered below 2.5 \u03bcM . By furtFrom the above, it was decided that only cadmium concentrations well below the median lethal dose would be worth considering in an effort to mimic chronic low-level exposure. Therefore, further data were obtained by exposing cells to concentrations up to 2 or 2.5 \u03bcM, for 96 and 72 h, respectively, these upper points being taken as limits corresponding to the onset of cell death, of less than 15% in each case.Despite the sub-lethal cadmium concentrations used in the experimental setup defined in The visualization of mitochondria by immunofluorescence staining showed that the aspect of the mitochondrial network changed after exposure of cells to doses of cadmium for 96 h . The conThe microscopic images were treated as described in the Material and Methods section. Two parameters, circularity and skeletal length, were selected for analysis, and the results of comparisons between cadmium treatment groups and control INS-1 cells are shown in One of the main functions of mitochondria is to convert energy in the form of ATP. It was thus of interest to examine whether the reorganization of the mitochondrial network observed in 2. Islets of Langerhans produce insulin in response to variations of glucose concentrations, and mitochondria are responsible for increased ATP production under these conditions. The latter was thus measured in response to increased glucose concentrations (The ATP/(ADP + AMP) ratio under standard growth conditions a was foutrations b. High  ratio as a function of cadmium exposure, is statistically significant only at the onset of cell death, i.e., at a 3 day-dose of 2.5 \u03bcM a. This rt change a. This st change a is note2 consumption devoted to ATP production which first increases as a function of cadmium exposure to reach significance at 1 \u03bcM, and then partly collapses at 2.5 \u03bcM  that eventually could become significant at higher cadmium concentrations. In this respect, mitochondrial dysfunction cannot be considered as an early sign of cadmium poisoning of \u03b2-cells, and any biomarker related to mitochondrial integrity is unlikely to provide a reliable and sensitive probe of mild exposure to cadmium.Changes of mitochondrial morphology and function in \u03b2-cells have already been correlated with apoptosis ,29. But These data are another illustration of one of the ways cells try to adapt to an environmental stress . It is lBut long-life provision of cadmium to pancreatic \u03b2-cells is likely to eventually lead to dysfunction, including of their mitochondria. The data reported herein apply to a simple cell model that has been exposed for a relatively short time as compared to the conditions that apply to long-lived animals, humans in particular. This is an obvious and important limitation of this work. However, the data suggest that non-invasive detection of cadmium in islets of Langerhans may provide a useful marker for subjects at risk of developing diabetes. Methods to detect cadmium in vivo are developing , and the"}
{"text": "Reduced gene diversity, particularly in genes involved in immunity, may have important functional consequences. In fact, it has been suggested that reduced diversity in immune genes may have contributed to Neandertal extinction. We therefore explored gene diversity in different human groups, and at different time points on the Neandertal lineage, with a particular focus on the diversity of genes involved in innate immunity and genes of the Major Histocompatibility Complex (MHC).Genome-wide analyses of two Neandertals and a Denisovan have shown that these archaic humans had lower genetic heterozygosity than present-day people. A similar reduction in genetic diversity of protein-coding genes (We find that the two Neandertals and a Denisovan have similar gene diversity, all significantly lower than any present-day human. This is true across gene categories, with no gene set showing an excess decrease in diversity compared with the genome-wide average. Innate immune-related genes show a similar reduction in diversity to other genes, both in present-day and archaic humans. There is also no observable decrease in gene diversity over time in Neandertals, suggesting that there may have been no ongoing reduction in gene diversity in later Neandertals, although this needs confirmation with a larger sample size. In both archaic and present-day humans, genes with the highest levels of diversity are enriched for MHC-related functions. In fact, in archaic humans the MHC genes show evidence of having retained more diversity than genes involved only in the innate immune system. Ne)  .\u22125, similar to that previously reported for the \u223c120,000-year-old Altai Neandertal (\u22125)  . This lotal (\u22125) . GeneticIt has been suggested that lack of functional variation in immune-related genes\u2014especially in genes related to the innate immune system which is known to serve as a first defense mechanism against pathogen detection\u2014, some of which are targets of long-term balancing selection , could hHere, we leverage existing high-quality whole-genome data from three archaic humans to test for evidence of a specific reduction of gene diversity in archaic humans that would be expected under the DPRH. We focus on comparing genetic diversity between archaic and present-day humans, and over time in the Neandertal lineage in a comprehensive set of 1,548 innate immunity genes defined by N\u2009=\u200917,505). We extracted the sequences that pass these filters for each individual from the whole genome VCF files and excluded genes with <2,000 callable sites from the analysis . Data processing was done using Tabix . We updated this gene list with recent InnateDB entries following our filtering scheme. This resulted in a set of 1,548 innate immunity genes. We additionally investigated the following subsets of this innate-immune gene list separately: Toll-like receptorsignalingpathway , innate immune response in mucosa , defense response , defense response to bacterium , defense response to Gram-negative bacterium , defense response to Gram-positive bacterium , defense response to fungus , defense response to virus , as well as the MHC genes (N\u2009=\u200914). We then defined a hand-curated set of autosomal protein-coding background genes without any reported immune function to use as a background set  for whibl genes ) as wellWe performed a gene ontology (GO) enrichment analysis to explore whether any particular functional groups of genes (GO categories) are overrepresented among the genes with the highest  or lowest (bottom-5% tail of the same distribution) SNP/FD ratios in the three archaics, or a set of three representative present-day humans . In this analysis, we only considered genes that pass our above-mentioned filters in the test individuals, and averaged the SNP/FD ratio over those individuals for each gene. For GO enrichment analyses, we used the R package \u201cGOfuncR\u201d . In the We estimated gene diversity per individual by calculating SNP/FD ratios in five present-day individuals from African populations , and nine present-day individuals from non-African populations . In agreement with previous observations, we consistently found significantly higher diversity in African individuals than in individuals from non-African populations . All thrNext, we tested whether genes of the innate immune system showed a similar reduction in Neandertals (when compared with present-day humans) as non-immune genes. To further investigate a putative specific reduction in innate immune gene diversity, we investigated normalized immune gene diversity by dividing mean SNP/FD ratios in immune genes by mean SNPD/FD ratios in a set of non-immune-related background genes . This further suggests that immune gene diversity did not decrease over time. We note that differences in the branch lengths leading to each of the archaic humans, which reflect the differences in ages of the specimens , do not have a substantial effect on our analyses as we do not observe a strong positive correlation between the age of archaic individuals and the normalized gene diversity .2-values of lower 95% confidence intervals\u2009>\u20090). Interestingly, MHC diversity is \u223c47-fold higher than the background genes in archaic humans (95% CI: 32\u201376-fold) but only \u223c7-fold higher than background genes in present-day humans (95% CI: 5\u20139-fold). This higher diversity in the MHC observed in archaics compared with present-day humans is driven largely by the MHC class II genes . B2M is part of the class I MHC (light-chain) but\u2014unlike the other MHC genes\u2014is located on chromosome 15. It is known to be nonpolymorphic in humans  show a highly significant enrichment only of GO categories related to the MHC in both the archaic and present-day humans after correcting for multiple testing  It could be caused by the old TMRCA in the MHC region  and the arger Ne . A possion rates . This ison rates . TheoretFuture sequencing of additional high-coverage archaic genomes that sample the geographic and temporal distribution of Neandertals will allow questions about the effects of gene diversity on Neandertal fitness to be addressed in greater detail.Genome Biology and Evolution online.Supplementary DataClick here for additional data file."}
{"text": "Streptococcus equi subspecies zooepidemicus was previously reported as an important swine pathogen only in Asia. Here we report the isolation and whole genome characterization of S. equi subsp. zooepidemicus associated with a sudden death outbreak in pigs in Canada. Historically described as a commensal of the swine upper respiratory tract,  Streptococcus equi subspecies zooepidemicus is considered a commensal and opportunistic pathogen of several warm-blooded hosts, including humans, horses, canines, and swine. It is a gram-positive, \u03b2-hemolytic coccus belonging to the Lancefield group C and can cause severe disease characterized by pneumonia, septicemia, and meningitis  in a large vertically integrated swine system in Manitoba, Canada. This outbreak increased the cumulative death in the 3 affected sow herds by >1,000 animals over a 12-week period. The abortion rate during this time was \u00bb11\u00d7 normal. The sows were often described as apparently healthy during morning checks. However, over the course of hours, infected sows would become unwilling to stand, develop fever and lethargy, then die with no other apparent clinical signs. Other sows would abort and then go on to develop similar symptoms. Stress factors, such as mixing groups of sows and the presence of other sick animals, appeared to exacerbate outbreaks within pens. Mycoplasma hyopneumoniae, simian immunodeficiency virus A, and porcine circovirus types 2 and 3; results were negative for each. Animals were electronically fed a commercial grade, nutritionally balanced diet and had ad libitum access to water. Gross postmortem examination of multiple animals, either euthanized or recently deceased, revealed rhinitis ; pulmonary edema; gall bladder edema; and hemorrhagic lymphadenopathy (tan-colored to hemorrhagic), consisting of submandibular, cervical neck, and bronchial lymph nodes. These signs, taken together, suggest sepsis. We used real-time PCR to test all of the dead sows for porcine reproductive and respiratory syndrome virus, S. equi subsp. zooepidemicus in liver, kidney, heart, brain, lung, spleen, and submandibular lymph nodes. Isolate identification was confirmed by 2 different veterinary diagnostic laboratories. We found isolates SAMN13058951, SAMN13058952, SAMN13058953, SAMN13058954, SAMN13058955, SAMN13058956, and SAMN13058957 resistant to lincomycin, neomycin, and tetracycline and susceptible to ampicillin, ceftiofur, penicillin, and tilmicosin in a Kirby-Bauer disk diffusion assay. In parallel, we observed gram-positive cocci in imprints from heart and submandibular lymph nodes. After aerobic bacterial culture followed by matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) mass spectrometry for identification of isolates revealed varying levels of https://www.qiagen.com), quantified by Nanodrop (3300) and PicoGreen , then processed it for sequencing using a Illumina Nextera XT library prep kit . We performed sequencing using MiSeq Nano V2, 2\u00d7250 paired-end (Illumina). Samples yielded an average of 149,017 high quality reads, suggesting 50\u00d7 coverage. We conducted genome assembly, annotation, and downstream analyses using the PATRIC package , rpoB (rifampin-resistant), S10p (tetracycline-resistant), kasA (triclosan-resistant), PgsA, LiaR, LiaS (daptomycin-resistant), folA, Dft (trimethoprim-resistant), folP (sulfadiazine-resistant), and FabK (triclosan-resistant). Virulence factors found, including the previously described szm, szp, lmb, fbpZ, skc, and has operons and mga regulon (All isolates were similar to previously published  genomes , demonstS. equi subsp. zooepidemicus sequence type 194 as a cause of death in pigs in Canada and possibly other regions of North America. This specific sequence type seems to be particularly virulent to pigs, for reasons that remain unexplained. Given the clinical presentation described here, this pathogen requires special attention and should no longer be overlooked when conducting diagnostic investigations, despite its historically accepted status as a commensal organism. Taken together, these findings suggest the emergence of"}
{"text": "Die mit der COVID-19-Pandemie einhergehenden Kontaktbeschr\u00e4nkungen haben viele Unternehmen dazu veranlasst, ihren Besch\u00e4ftigten aus Gr\u00fcnden des Infektionsschutzes das Arbeiten aus dem Homeoffice zu erm\u00f6glichen.In dieser Literatur\u00fcbersicht wird der Frage nachgegangen, inwiefern die Aus\u00fcbung der beruflichen T\u00e4tigkeit im Homeoffice gesundheitsf\u00f6rdernd gestaltet werden kann.Arbeitspl\u00e4tzen im Homeoffice liegen dieselben Richtlinien wie f\u00fcr B\u00fcro- und Bildschirmarbeitspl\u00e4tze zugrunde. Um negative psychische und physische Beanspruchungsfolgen zu vermeiden, wird die ergonomische Arbeitsplatzgestaltung empfohlen. Au\u00dferdem kommt der Arbeitszeitgestaltung  eine hohe Bedeutung f\u00fcr eine gesundheitsf\u00f6rdernde Arbeitsweise im Homeoffice zu.Wichtige Bausteine f\u00fcr gesundheitsf\u00f6rdernde Arbeitsgestaltung sind die zeitliche, r\u00e4umliche und insbesondere mentale Trennung von Arbeits- und Privatleben. Bei der gesundheitsf\u00f6rdernden Arbeitsplatzgestaltung im Homeoffice sind Besch\u00e4ftigte und ihre individuellen Bed\u00fcrfnisse zu ber\u00fccksichtigen. Die Verantwortung der Realisierung gesundheitsf\u00f6rdernder Arbeitsgestaltung liegt durch die ad-hoc-Umstellung in der Pandemie jedoch zumeist allein bei den Besch\u00e4ftigten. Die COVID-19-Pandemie  f\u00fchrte dazu, im Sinne des Infektionsschutzes, viele Besch\u00e4ftigte kurzfristig ins Homeoffice zu entsenden . Im KontBasierend auf dem Beschluss der Bundesregierung vom 15.\u00a0April 2020 \u201eBeschr\u00e4nkungen des \u00f6ffentlichen Lebens zur Eind\u00e4mmung der COVID-19-Epidemie\u201c  haben viDie Einrichtung eines ergonomischen Arbeitsplatzes im Homeoffice stellt indes eine ma\u00dfgebende Herausforderung unter den aktuellen Umst\u00e4nden der COVID-19-Pandemie dar.Neue Arbeitssituation im Homeoffice unterliegt besonderem AugenmerkWissenschaftliche Ergebnisse deuten darauf hin, dass die \u00dcberlagerung von Berufs- und Privatleben von verschiedenen psychischen Belastungsfaktoren und Ressourcen gekennzeichnet ist . H\u00e4ufig Vor dem Hintergrund dieser Herausforderungen behandelt dieser \u00dcbersichtsartikel die gesundheitsf\u00f6rdernde Arbeitsgestaltung im Homeoffice in Zeiten der COVID-19-Pandemie unter besonderer Ber\u00fccksichtigung der Themenfelder (ergonomische) Arbeitsplatzgestaltung, Arbeitszeitgestaltung und Regeneration. Zugrunde liegen in erster Linie wissenschaftliche Studien, die die gesundheitsf\u00f6rdernde Arbeitsgestaltung im Homeoffice fokussieren, anhand einer explorativen Literaturrecherche in wissenschaftlichen Datenbanken, u.\u202fa. PubMed und PsychINFO, recherchiert. Au\u00dferdem wird sich auf die geltenden gesetzlichen Normen und Verordnungen gest\u00fctzt. Unter Arbeitsgestaltung wird in diesem \u00dcbersichtsartikel die Gestaltung von ergonomischen Arbeitspl\u00e4tzen, Arbeits- und Erholungszeit gefasst. Nach der Beschreibung m\u00f6glicher Herausforderungen werden praktische Umsetzungsempfehlungen f\u00fcr Arbeitgeber und Besch\u00e4ftigte formuliert.Um psychische und physische Beanspruchungsfolgen zu vermeiden, muss die Arbeitsplatzgestaltung an die individuellen Bed\u00fcrfnisse der Besch\u00e4ftigten angepasst werden. Zur Reduzierung m\u00f6glicher negativer Beanspruchungsfolgen k\u00f6nnen die Belastungen in ihrer Auspr\u00e4gung u.\u202fa. durch technische (ergonomische), organisatorische und personenbezogene Ma\u00dfnahmen f\u00fcr die Neu- bzw. Umgestaltung des Arbeitsplatzes im Homeoffice vermindert werden Dar\u00fcber hinaus k\u00f6nnen regelm\u00e4\u00dfige Blicke in die Ferne die Augen bei l\u00e4ngerer Bildschirmt\u00e4tigkeit entspannen . Ein WecDie kurzfristige Umstellung der Arbeitsausf\u00fchrung in das Homeoffice w\u00e4hrend der COVID-19-Pandemie kann vielen Besch\u00e4ftigten die Umsetzung ergonomischer Arbeitsplatzgestaltung erschweren , 30. InsDie im Homeoffice vorliegenden flexiblen und selbst zu gestaltenden Arbeitsbedingungen erfordern insbesondere Selbstmanagement- und Arbeitsgestaltungskompetenzen, wie z.\u202fB. Selbstf\u00fchrung und die Eigenverantwortung \u00fcber die Strukturierung von Arbeitsaufgaben sowie Motivierungsstrategien . Eine daUnfreiwillige Arbeitsunterbrechungen k\u00f6nnen die Arbeitsproduktivit\u00e4t hingegen vermindern  und ebenDie Umst\u00e4nde der COVID-19-Pandemie bergen dar\u00fcber hinaus weitere Herausforderungen in der Arbeitszeitgestaltung, denen sich insbesondere Eltern stellen mussten. Da Schulen und Kindertagesst\u00e4tten zeitweise geschlossen waren, mussten im Homeoffice t\u00e4tige Eltern ggf. zus\u00e4tzlich ihre Kinder zu Hause betreuen und versorgen . Auch f\u00fcDie Gestaltung von Ruhepausen und -zeiten (Pausen w\u00e4hrend und Regeneration nach der Arbeit) obliegt durch die besondere Arbeitssituation im Homeoffice einem besonderen Augenmerk. Die eigenverantwortliche Arbeitszeitgestaltung im Homeoffice birgt die Gefahr, dass \u00fcber die regul\u00e4ren Zeiten hinaus gearbeitet wird. Dies kann f\u00fcr Besch\u00e4ftigte im Homeoffice psychisch belastend sein . Im FallDie Realisierung einer gesundheitsf\u00f6rdernden Pausenorganisation obliegt laut \u00a7\u00a03 ArbSchG als eine Grundpflicht dem Arbeitgeber. Gem\u00e4\u00df \u00a7\u00a015 des ArbSchG sind Besch\u00e4ftigte entsprechend dazu verpflichtet, die gesetzlich verpflichtenden Pausenzeiten  einzuhalten . Ein potHomeoffice-T\u00e4tigkeit erfordert SelbstmanagementkompetenzenHierf\u00fcr k\u00f6nnen unterst\u00fctzende Methoden wie die Pomodoro-Technik  angewandNeben der physischen Distanzierung von der Arbeit, welche im Homeoffice ma\u00dfgeblich erschwert sein kann, ist hierbei auch das mentale Abschalten von der Arbeit (sog. Detachment) von gro\u00dfer Relevanz. Arbeitsbezogene Belastungsfaktoren k\u00f6nnen mit geringem Detachment kombiniert zur Entstehung negativer Beanspruchungsfolgen beitragen. Studienergebnisse zeigen, dass Detachment psychische Arbeitsbelastungswirkungen und m\u00f6glichen negativen Beanspruchungsfolgen (wie beispielsweise Erm\u00fcdung) abpuffern kann . Durch dGrunds\u00e4tzlich sollten Arbeitgeber in der aktuellen Situation eine besonders beratende Funktion f\u00fcr Besch\u00e4ftigte in Bezug auf ergonomische Arbeitsplatzgestaltung im Homeoffice einnehmen. W\u00e4hrend der T\u00e4tigkeit im Homeoffice kann eine wechselnde K\u00f6rperhaltung (sitzend/stehend) hilfreich sein . Die VerDie COVID-19-Pandemie stellt seit Anfang des Jahres 2020 eine aktuelle Public-Health-Herausforderung dar, welche auch die Arbeitswelt und ihre Besch\u00e4ftigten vor anspruchsvolle Aufgaben stellt.F\u00fcr die individuelle Gesundheit der Besch\u00e4ftigten ist eine Kompetenzerweiterung, z.\u202fB. hinsichtlich der ergonomischen Arbeitsplatzgestaltung und Selbstorganisation, begleitet von guter F\u00fchrungsarbeit, vorteilhaft, um in der neuen Arbeitssituation in der Pandemie gesundheitsf\u00f6rdernd arbeiten zu k\u00f6nnen.Eine entsprechende Organisations- und F\u00fchrungskultur, welche die gesundheitlichen Bedarfe der Besch\u00e4ftigten ber\u00fccksichtigt sowie ihre Arbeitssicherheit und Gesundheit verst\u00e4rkt in den Vordergrund stellt, ist unabdingbar.Betriebliche Abl\u00e4ufe, welche Aufkl\u00e4rung und Edukation miteinbeziehen, bergen gro\u00dfes Potenzial, die Gesundheit der Besch\u00e4ftigten auch im Homeoffice langfristig und nachhaltig zu f\u00f6rdern und zu erhalten."}
{"text": "This paper analyzes, through computational simulations, which spectral filters increase the number of discernible colors (NODC) of subjects with normal color vision, as well as red\u2013green anomalous trichromats and dichromats. The filters are selected from a set of filters in which we have modeled spectral transmittances. With the selected filters we have carried out simulations performed using the spectral reflectances captured either by a hyperspectral camera or by a spectrometer. We have also studied the effects of these filters on color coordinates. Finally, we have simulated the results of two widely used color blindness tests: Ishihara and Farnsworth\u2013Munsell 100 Hue (FM100). In these analyses the selected filters are compared with the commercial filters from EnChroma and VINO companies. The results show that the increase in NODC with the selected filters is not relevant. The simulation results show that none of these chosen filters help color vision deficiency (CVD) subjects to pass the set of color blindness tests studied. These results obtained using standard colorimetry support the hypothesis that the use of color filters does not cause CVDs to have a perception similar to that of a normal observer. The study of color vision deficiencies (CVDs) has recently gained attention from social networks due to the appearance of companies that have developed what they call \"aids\" for subjects with CVD. Approximately 1 in 12 men and 1 in 200 women have some type of CVD ).Subjects whose color vision anomaly is between moderate and severe may suffer limitations in their daily lives, such as not distinguishing the degree of cooking of meat, the maturity of certain fruits and vegetables, the color of certain indicative lights (LEDs), different colors on maps, etc. For this reason, in most countries, these subjects are automatically excluded from certain jobs such as being an airplane pilot, firefighter, train driver, air traffic controller, etc. . Although genetic therapy experiments in mice and primates have been carried out , there aOn the other hand, passive aid is of interest, such as filters that can be worn in glasses or contact lenses. Despite the lack of scientific evidence on the improvement of color vision in CVD observers using any type of filters, companies manufacturing them  for different types of observers, as well as the effect that these filters have on color coordinates. At this point we would like to clarify that, as defined in Other authors have done work in this regard. Linhares et al.  investigMoreland et al. studied the effect of filters by simulations in . In thisMar\u00edn Franch and Foster  used infPastilha et al.  evaluateMasuda and Nascimento  studied In this study, we have investigated three types of filters: band-pass and notch whose transmittances have been simulated, and the two commercial models studied in previous research, from EnChroma  and VINOIn this study the spectral information was limited within the range from 400 nm to 700 nm (visible range), and sampled every 1 nm through linear interpolation. Three reflectance sets were used, each of them corresponding to three different types of objects or scenes. Simulations were carried out using D65 as illuminant following CIE  recommendations for the use of CIELAB color space . This isL*, a*, b* distribution in CIELAB color space.In order to select which filters, amongst the 90,922 simulated, maximized the NODC for each observer, a reduced but diverse hyperspectral reflectance set was used. This set was composed of the reflectances present in four popular color atlases: Munsell (1269 samples) , NCS , and each of them single and double. These types were considered since the existing passive aids usually feature this spectral shape. The filters were simulated using Gaussian functions (for the band-pass ones), and their complementary functions (for the notch ones). In the following sub-sections, we explain what each of these types of filters is like. Since increasing the width of a Gaussian function involves reducing the slope of its flanks, the rise and descent flank of a 10 nm bandwidth (FWHM) Gaussian function was used. These rise and descent flanks are separated more or less depending on the simulated band-pass or notch width of the filters. Thus, the simulated transmittances were more selective than normal width Gaussian functions but their spectral shapes are smoother than the step function, and hence more realistic. The pass-band for each filter (range between a rise flank and a descent flank) was considered with a maximum transmittance of 1. These filters block all wavelengths but those belonging to a specific spectral range . We simulated filters with central wavelengths varying from 400 nm to 700 nm, with a 10 nm step. Moreover, for each central wavelength, we simulated filters where the FWHM bandwidth varies from 10 to 100 nm in 10 steps. This was a total of 310 band-pass filters . In order to simulate them, all transmittances from the band-pass filters previously calculated were subtracted from the unity transmittance. Thus, another 310 notch filters were simulated R, which multiplied by the spectral radiance of the illuminant illum(\u03bb)SPD, and by the spectral transmittance of the filter T(\u03bb), yields the color signal color(\u03bb)L, as shown in Equation (1).The initial data for simulations were: the spectral reflectance L*, a*, b*, abC* y abh. The reference white used for both unfiltered and filtered conditions was the same in order to be able to directly compare results between unfiltered and filtered cases.As mentioned in We need to clarify here that the most correct way to proceed would be to build a personalized set of transformations and functions to be used in colorimetry for each observer  using as a starting point the color-matching functions of each type of observer. However, this approach, besides being considerably complex, is still an open problem and there is no clear way to see it done in practical terms. Hence, standard colorimetry was used for CVD observers as it is usually done in the literature ,12,14,18L\u2019) and deutan (M\u2019) observers are calculated via the following Equations (2) and (3):L and M are the cone responses from a normal trichromat observer and parameter d represents the amount in which the responses from normal cones are combined to obtain the response from the anomalous cone. Thus, d is not directly related to the severity regarded as the spectral separation between L and M curves. However, this spectral separation is related to the increase of the chromatic discrimination threshold, as shown in [L and M maxima corresponds to a moderate/severe CVD condition. For this reason, we calculated the value of d corresponding to this spectral separation of 3 nm , using the cone response curves in [d.Once the tristimulus values were calculated for the D1 set and the normal observer, the tristimulus values for different CVD observers (type and severity) were simulated. There are several models in the literature for doing this ,16,17,19shown in , where turves in . Figure d = 1. In this study we have simulated five types of observers: observers with normal color vision, anomalous trichromat observers (protan07 and deutan09), and anomalous dichromat observers (protan10 and deutan10).To simulate dichromat subjects in an extreme case we use the severity parameter with a value of XYZ tristimulus values for the D1 samples and the five different observers simulated both with and without filters, we needed a metric evaluation in order to compare the performance of each filter for each observer. To do so we considered the number of discernible colors (NODC).After calculating abE > 1) [L*, a*, b* color space in cubes of 1 unit sides, and count in how many of them there is at least one sample [If we assume that two colors are discernible when their CIELAB space color difference is above 1 unit (\u0394Eab > 1) , we can e sample . This mee sample , this isThis section is divided into two sub-sections. In the first, the NODC for all the simulated filters is computed, and the filter that maximizes NODC for database D1 is determined. In the second sub-section, the effect of the filters that maximize NODC on color coordinates, sRGB rendering of the scenes, and the Ishihara and FM-100 simulations are explained.The NODC has been computed for the five types of observers and the 90,922 filters, using the database D1. For each observer, the filter that maximizes NODC has been chosen see . Table 1The relative variation of NODC for dataset D1 (\u0394NODC) was small in all cases, on average 1.76% higher for dichromats than for anomalous trichromats. These relative variation data were similar to those reported by Linhares et al. . The facFor all observers, it should be noted that there were more filters that produced an increase in the NODC, even with minimal differences with respect to the selected filters. In For dichromats there was a higher relative number of filters that produce an increase in NODC, in comparison with anomalous trichromats. Neither of the two commercial filters studied produced an increase in NODC for any of the observers see . The samL*, a*, b* and the perceptual attributes Chroma (abC*) and hue (abh) were determined using datasets D1 and D2. Moreover, the shift caused by the filter on the color distributions of L*, a*, b* was also analyzed for both datasets. Once the filters that maximized NODC were selected for each simulated observer, the change that these filters produce on average on the color coordinates L*, a*, b* average shifts caused by the selected filters are shown for both datasets and each observer. The increments were computed by taking the unfiltered condition as reference.In As expected, lightness (L*) decreased when a filter was introduced since the filter partially absorbs the incident light and no lightness or chromatic adaptations were considered. The trends found for the a* and b* coordinates were similar for both datasets and each observer. This can be explained by considering that the filter shifts the color coordinates in the same direction for both datasets. For different observers, however, the shifts differed because the selected filters were different and the shifts introduced were not in the same direction.ab and hab shifts, different trends were found regarding the sign of the shift for both datasets. If the L*, a*, b* distributions were examined with and without the filter , without (red) and with the selected filter for each observer (blue). The distributions for the two commercial filters EnChroma and VINO are also shown for all observers. In The filters produced a shift in the a*, b* coordinates in all cases. This shift made it impossible for the normal observers to perform correctly when using the VINO filter. The reason for this was that the position of the center of the ring formed by the test samples in the a*-b* chart changed in the filtered condition. Hence, since the new center was not close to the origin, sorting by hue no longer produced correct results, because the reference for sorting the samples was the a* positive axis and in the filtered ring, there could be more than one sample with the same hue angle. For CVD observers, even the unfiltered sample ring was not centered in the origin, reflecting that they were unable to perform the sorting task correctly for either filtered or the unfiltered conditions. Only the normal observers with the EnChroma filter were able to perform correctly because the shift caused by the filter was not enough to disrupt the sorting process.In The FM100 evaluation parameters for the normal observers did not change when the selected filter was introduced, so the filter did not alter the ability of the normal subject to correctly sort the FM100 samples. Regarding the CVD simulated observers, SQR values increased slightly for the deutan type observers, and they increased considerably for the protan type observers. The filter was thus worsening the performance to a higher degree for the protan type subjects. As shown in In this study, simulations were carried out to determine which spectral filter maximizes the number of discernible colors (NOCD) for normal observers, as well as four different types of red\u2013green CVD observers . Simulations were carried out using standard colorimetry for both normal and CVD observers. For this purpose, a set of 90,920 simulated filters (composed of single and double band-pass and notch filters) were studied, together with two measured commercial filters released as passive aids for CVD observers by the VINO and EnChroma companies.Results on the choice of filters showed that, in all cases, the type of filter that maximized the NODC was a double notch, except for the protanope dichromats which was a double band-pass. Nonetheless, variations in NODC were small (maximum of 2.84%), and oscillated around 0% when different reflectance datasets were used. Moreover, both the EnChroma Cx-65 and VINO O2 Oxy-Iso commercial filters were shown to decrease the NODC for all studied observers and reflectance datasets. In this regard, the single band-pass filters did not yield any NODC increase either.sRGB renderings from D2 and D3 were carried out for the five types of observers, both with and without a filter. In case of dataset D3: Ishihara, the chosen filters were shown not to include any improvement, which lead CVD observers to fail this test even when using these filters. On the other hand, results from FM100 test using these filters showed that CVD observers were unable to pass this test either, or even get close to the filterless performance of normal observers. FM100 seems to be the most reliable test for evaluating the efficacy of colored filters in color perception. Regarding the commercial filters, the EnChroma filter did not improve the performance of either the Ishihara test or the FM100 test, whilst the VINO filter helped CVD observers recognize the numbers in the Ishihara test but did not allow any observer  to pass the FM100 test.These results, assuming the limitations of using standard colorimetry for CVD observers, support the hypothesis that, even though some filters may slightly increase the number of discernible colors, they can never allow CVD observers to perceive colors more similarly to normal observers. Even normal observers can stop perceiving colors correctly when using some of these filters, and they become unable to pass the FM100 test. In the future, if new personalized colorimetry frameworks are developed, especially for CVD observers, it would be very interesting to compare the results obtained to quantify the effects of these filters with the ones presented in this article."}
{"text": "Data stewardship is an essential driver of research and clinical practice. Data collection, storage, access, sharing, and analytics are dependent on the proper and consistent use of data management principles among the investigators. Since 2016, the FAIR  guiding principles for research data management have been resonating in scientific communities. Enabling data to be findable, accessible, interoperable, and reusable is currently believed to strengthen data sharing, reduce duplicated efforts, and move toward harmonization of data from heterogeneous unconnected data silos. FAIR initiatives and implementation trends are rising in different facets of scientific domains. It is important to understand the concepts and implementation practices of the FAIR data principles as applied to human health data by studying the flourishing initiatives and implementation lessons relevant to improved health research, particularly for data sharing during the coronavirus pandemic.This paper aims to conduct a scoping review to identify concepts, approaches, implementation experiences, and lessons learned in FAIR initiatives in the health data domain.The Arksey and O\u2019Malley stage-based methodological framework for scoping reviews will be used for this review. PubMed, Web of Science, and Google Scholar will be searched to access relevant primary and grey publications. Articles written in English and published from 2014 onwards with FAIR principle concepts or practices in the health domain will be included. Duplication among the 3 data sources will be removed using a reference management software. The articles will then be exported to a systematic review management software. At least two independent authors will review the eligibility of each article based on defined inclusion and exclusion criteria. A pretested charting tool will be used to extract relevant information from the full-text papers. Qualitative thematic synthesis analysis methods will be employed by coding and developing themes. Themes will be derived from the research questions and contents in the included papers.The results will be reported using the PRISMA-ScR  reporting guidelines. We anticipate finalizing the manuscript for this work in 2021.We believe comprehensive information about the FAIR data principles, initiatives, implementation practices, and lessons learned in the FAIRification process in the health domain is paramount to supporting both evidence-based clinical practice and research transparency in the era of big data and open research publishing.PRR1-10.2196/22505 Advancement in information communication technology is impacting the health ecosystem\u2019s technological and analytical capabilities to store, curate, share, and analyze data from standard and nonstandard sources . In the Digitalization brings opportunities and concerns in health care data processing. Despite many potential benefits, it also poses potential threats, such as breaches of privacy, disinformation and misinformation, and cyberattacks . There iThe European GDPR is the most recent data regulatory framework as of September 2020 and has implications on the ethical sharing of research data . As the Boeckhout et al  highlighBeyan et al  have shoThe need for good data stewardship among different stakeholders in scientific research is the basis on which the FAIR data principles  were coined in 2014 by the FORCE11 (The Future of Research Communication and e-Scholarship) community ,19. ThesIn 2020, Vesteghem et al  outlinedThe aims for conducting this work are to (1) provide an overview of applications of the FAIR data principles that are focused on health data research and (2) map out the existing evidence accordingly.This scoping review will adopt the framework outlined by Arksey and O\u2019Malley . The autWe have already conducted a pilot overview of the existing literature as an informal desk review and literature exploration. This overview included published works in PubMed, Google Scholar, and Web of Science. The medical and public health research librarian used the FAIR data principles\u2019 keywords to match medical subject headings (MeSH) used to tag PubMed peer-reviewed literature, along with combinations of terms used in clinical research, public health, health care, pharmacology, and patient data. As part of the ongoing evidence synthesis from medical and human health research journal articles that used FAIR data markup, the bibliographies of key papers were scrutinized for other complementary publications, and those articles were added to the PubMed collections shared with the authors. Further, as the key FAIR data and health articles inspired new citations, often authored by similar consortia of writers or networks of researchers, the newer citing articles were added to the stage 1 collection to demonstrate possible progress in the field of shared or open medical data. Recurrent alerts were set up to capture newly published literature on PubMed, Google Scholar, and Web of Science . White pOur informal desk review has shown that many approaches used in the implementation of the FAIR data principles are applied to the life sciences domain . We haveAs we intend to conduct this exploratory review in an iterative manner, further refinement of the research questions may become necessary. Close examination of key references in bibliographies and citing articles to gauge the impact of shared data on ensuing research and health practice will be followed as part of the secondary analysis. All proposed refinements of the research questions and search methods will be scrutinized by the authors prior to approval. We will also provide comprehensive provenance information on changes in the protocol to be fully transparent.The general objective of this protocol is to conduct a scoping review to identify concepts, approaches, implementation experience, and lessons learned from the FAIR data principle initiatives in the health domain. The following research questions (RQs) have been formulated to meet the objective of the scoping review:RQ 1: What approaches are being used or piloted in the implementation of the FAIR data principles in the health data domain since the conception of these principles in 2014?RQ 2: What are the challenges and risks regarding the approaches used in the practical implementation of the FAIR data principles in the health data domain?RQ 3: What are the suggested concepts and approaches to mitigating the concerns of the implementation of the FAIR data principles in the health data domain?RQ 4: Which are the active public and private research and service networks involved in the implementation of the FAIR data principles in the health data domain?RQ 5: What are the reported outcomes for data sharing, data reuse, and research publication after the implementation of the FAIR data principles in the health data domain?With the aid of an experienced research librarian, at least two researchers will identify relevant studies from 3 primary electronic databases: PubMed, Web of Science, and Google Scholar. In addition to those, relevant grey literature from existing networks, relevant organizations, and conferences as well as the reference lists from potential papers will be searched. The keywords for the scoping review search strategies have been categorized tentatively to terms related to the FAIR data principles, data sharing, and health. Although refinement of the selected MeSH \u200bterms are possible, open terms have been proposed for the construction of the search strategy of this protocol. The Boolean operators \u201cAND\u201d and \u201cOR\u201d will be used to guide the search strategy. The following descriptors and keywords and their combinations were used to construct the strategies: \u201copen science,\u201d \u201cdata collection,\u201d \u201cdata provenance,\u201d \u201copen access publishing,\u201d \u201cdata*,\u201d \u201drepositor*,\u201c \u201dregistr*,\u201c \u201dpharma*,\u201c \u201dhealth*,\u201c \u201dresearch,\u201c \u201dbiomedical research,\u201c \u201ddata management,\u201c \u201cFAIR data principles,\u201d \u201cFAIR principles,\u201d \u201cFAIR guiding principles,\u201d \u201cData steward*,\u201d \u201cData management systems,\u201d \u201cfindable,\u201d \u201cfindability,\u201d \u201caccess,\u201d \u201caccessibility,\u201d \u201cinteroperable,\u201d \u201cinteroperability,\u201d \u201creusable,\u201d \u201creusability\u201d .The PRISMA-ScR  reporting guidelines will be used for reporting the findings . The opeAs an inclusion criterion, we will consider literature published between January 1, 2014, and December 31, 2020. The start date in 2014 is chosen due to the fact that FAIR concept initiatives and official publications became first available in that year. Moreover, to be included as a potential paper, the literature needs to be published in English and include the scope of FAIR principle applications in the health domain . Literature published before 2014, in a language other than English, and in domain areas other than health or the operational definition of health will be excluded. All search results from online databases and grey literature sources will be exported to a reference management software to eliminate duplications. Unique search results will be exported to a screening tool to facilitate an independent screening process for the potential papers.Rayyan software (Qatar Computing Research Institute) has been chosen as the primary screening and data extraction tool to expedite the initial screening of abstracts and titles using a semiautomated process while incorporating a high level of usability. This software supports research teams in the easier exploration of literature searches within a shorter time as well as in sharing and comparing individual researchers\u2019 decisions to include or exclude studies . AccordiA data-charting form will be used by the reviewers to determine which variables to extract. The form is flexible for continuous updating in an iterative manner during the data-charting process, but any changes will be tracked. The descriptive analytical approach, as described by Arksey and O\u2019Malley , will beThis scoping review focuses on the range of data curated and the health data research content identified. Quantitative assessment is limited to a count of the number of sources reporting a particular FAIR thematic issue or recommendation. After charting the relevant data from the studies in spreadsheets, the results will be collated and described using summary statistics, charts, figures, and common tools for analytical reinterpretation of the literature . MappingOur PubMed preliminary search has yielded 360 results . The seaThis scoping review will provide insight on the initiatives, concepts, and implementation practices of FAIR data principles in health data stewardship. More specifically, it will allow for the exploration of (1) approaches being used or piloted for the implementation of the FAIR data principles in the health domain since the conception of these principles in 2014; (2) challenges, risks, lessons learned, and the suggested concepts and approaches to mitigate the concerns of implementation of the FAIR data principles in the health domain; (3) active research and service networks involved in the implementation of the FAIR data principles in the health domain; and (4) the reported outcomes for data sharing, data reuse, and research publication after the implementation of the FAIR data principles in the health domain. We anticipate increases in data repositories demanding FAIR data markup suitable for artificial intelligence extraction of statistics. We also anticipate a greater demand for the implementation of the FAIR principles in light of the ongoing COVID-19 pandemic as well as more open research activities by public and private research and service networks involved in the implementation of the FAIR data principles in the health domain. An example of such an initiative is the Research Data Alliance .The results will be used to generate recommendations on how to integrate the FAIR principles in health research, and we will generate different knowledge dissemination materials to share project results with various stakeholders, partners, associations, and networks who may benefit from this work.The findings of this proposed work may be used to help identify the types of available evidence that support the incorporation of FAIR data principles in health. The results will also help to clarify key concepts in the scientific literature and serve as an introduction to how research on FAIR practices is conducted. This methodological framework will help us identify the overall state of research activities that explore initiatives, concepts, and implementation practices of FAIR data principles in health data stewardship. The outcome of this review can be used to further determine areas of research based on current gaps in the literature. Conducting this scoping review will also help determine the practicality and relevance of a full systematic review on the same issues by assessing the availability of literature. Similarly, gaps that still exist in the uptake and implementation of the FAIR principles in health research will also be identified as areas of further research. This work will be of interest to various stakeholders, including health and academic institutions, publishers, researchers, and funding agencies. In the wake of the COVID-19 pandemic, it is extremely critical that health data stewardship is practiced in a FAIR manner to facilitate the globally coordinated response . As thisOnce complete, this work will be published in a peer-reviewed journal, and the results will also be presented at appropriate forums or conferences. Ethical approval is not required, as only secondary data from published sources will be included in the scoping review and the public is not invited to participate in this work."}
{"text": "MCA1 and MCA2 genes, and the growth of hypocotyls of mca mutants, under hypergravity conditions in the dark. An MCA1 promoter::GUS fusion reporter gene construct (MCA1p::GUS) and MCA2p::GUS were expressed almost universally in etiolated seedlings. Under hypergravity conditions, the expression levels of both genes increased compared with that under the 1 g condition, and remained higher, especially in the basal supporting region. On the other hand, mca-null and MCA-overexpressing seedlings showed normal growth under the 1 g condition. Hypergravity suppressed elongation growth of hypocotyls, but this effect was reduced in hypocotyls of mca-null mutants compared with the wild type. In contrast, MCA-overexpressing seedlings were hypersensitive to increased gravity; suppression of elongation growth was detected at a lower gravity level than that in the wild type. These results suggest that MCAs are involved in the perception of gravity signals in plants, and may be responsible for resistance to hypergravity.Plants respond to and resist gravitational acceleration, but the mechanism of signal perception in the response is unknown. We studied the role of MCA (mid1-complementing activity) proteins in gravity perception by analyzing the expression of the  Plants are exposed to a variety of mechanical stresses such as wind and gravity, and they have developed efficient mechanisms to respond to these stressors over evolutionary time, in particular after their emergence on land. We have previously studied the mechanisms of plant responses to gravitational acceleration, mainly with basipetal hypergravity produced by centrifugation ,2. Hyperg, and hypergravity did not affect these factors when the gadolinium ions were present [The mechanism of gravity signal perception in the response of plants to hypergravity has been examined. Gadolinium ions, blockers of mechanosensitive ion channels ,11, null present . These r present . Howevermid1 mutant, which lacks a putative Ca2+-permeable mechanosensitive channel [2+ influx in yeast cells and Arabidopsis seedlings [2+ concentration [Xenopus laevis oocytes [2+ and cold tolerance [MCA1 and MCA2 genes, and the growth of etiolated hypocotyls of mca mutants, under hypergravity conditions.Candidates for the mechanosensitive ion channels have been reported in Arabidopsis; MCA (mid1-complementing activity) proteins are one such candidate. The amino acid sequences of the MCA1 At4g35920) and MCA2 At2g17780) proteins share 73% homology and partially complement the yeast  channel ,16. Both channel ,17. Mult780 prote channel . MCA1 aneedlings ,16, a hyntration ,18, and  oocytes . Both pr and MCA2MCA1 and MCA2 in etiolated seedlings grown at 300 g were analyzed using an MCA1 promoter::GUS fusion reporter gene construct (MCA1p::GUS) and MCA2p::GUS. MCA1p::GUS was expressed in the cotyledons and hypocotyls, regardless of age or gravitational conditions  was normal in the dark at 1 g  in the MCA1- and MCA2-overexpressing mutants  [g hypergravity on growth and the cell wall were restored when the plant materials were transferred to 1 g conditions, and were completely nullified by the presence of gadolinium ions, as mentioned above. These results indicate that hypergravity at 300 g is not an extraordinary stimulus for plants, and that the plant response to this magnitude of gravity stress is within the normal physiological limits. However, the role of MCAs in the perception of gravity signals at 1 g has yet to be determined. For this purpose, analyses under true microgravity conditions in space may be most effective as the control; a space experiment termed plant gravity sensing (PI: H. Tatsumi) is now underway.Here, we analyzed changes in the expression of mca1-null, mca2-null, mca1-null mca2-null, MCA1-overexpressing, MCA2-overexpressing, MCA1p::GUS, and MCA2p::GUS were used in this study. The details of these lines have been previously described [w/v) agar in a 50 ml centrifuge tube, incubated at 4 \u00b0C in the dark for 4 days, and then exposed to light  at 23 \u00b0C for 1 day to induce germination. After germination, the seeds were incubated at 25 \u00b0C in the dark for 1 day. Hypergravity experiments were conducted as reported previously [g  at 25 \u00b0C for 1 day in the dark. After treatment, the lengths of the hypocotyls were measured using a scale. The suppression ratio was calculated as a ratio (percentage) of the difference between the elongation under 1 g and the hypergravity conditions to the 1 g value. Because the lengths of hypocotyls at 1 g were different from line to line, the elongation growth data were compared between the 1 g and hypergravity treatments in each line and analyzed with Student\u2019s t-test , 0.1 M sodium phosphate buffer, pH 7.0, 0.5 mM potassium ferrocyanide, and 0.5 mM potassium ferricyanide) after infiltration with a vacuum pump for 1 h. The stained seedlings were fixed in a mixed solution (ethanol: acetic acid = 3:1) for 5 h, washed stepwise with 70%, 50%, and 20% ethanol for 10 min each, and cleared overnight at 4 \u00b0C with a cleaning solution . Quantification of the GUS-staining intensity of each region of the hypocotyl was performed using ImageJ, as reported previously [t-test.Seedlings were fixed in 90% acetone in the dark for 1 h and washed twice with 0.1 M sodium phosphate buffer, pH 7.0. The seedlings were then incubated at 37 \u00b0C for 20 h with X-Gluc buffer (0.5. mg mLeviously . The GUSg gravity by space experiments.MCA1 and MCA2 are at least partly involved in gravity perception when Arabidopsis hypocotyls are exposed to hypergravity. These genes may be responsible for gravity signal perception in the gravity resistance of plants. Future studies should examine the involvement of MCA proteins in plants\u2019 resistance to 1"}
{"text": "RFI) or residual feed intake and body weight gain (RIG) exhibit differences in thermography, blood, and ruminal parameters. Thirty-two Gyr heifer calves were enrolled in a 63-d trial and classified into 2 feed efficiency (FE) groups based on RFI and RIG (mean \u00b1 0.5 SD). The groups were classified as high efficiency (HE) RFI , HE RIG , low efficiency (LE) RFI , and LE RIG . The amount of whole milk provided for each calf was calculated based on their metabolic weight at birth (42% x BW0.75). The liquid diet was divided into two meals at 0700 and 1400 h. The total solid diet (TSD) was composed of 92% concentrate and 8% of Tifton 85 hay chopped in 5-cm lengths, as fed. Intake was measured daily. Blood concentrations of insulin, beta hydroxybutyrate, urea, and glucose, and ruminal pH, N-NH3, and volatile fatty acids (VFA) were evaluated at 14, 28, 42, 56, and 70 days of age. Thermal images of the calves were taken with an infrared camera  on d 56 (\u00b13) at 0600 h, before the morning feeding. Total VFA concentration and propionate as % of total VFA were 24.2% and 22.2% lower in HE RFI compared to LE RFI calves, respectively. On the other hand, acetate as % of total VFA was 10.6% greater in HE RFI than LE RFI calves. Blood urea concentration tended to be greater in LE RFI than HE RFI calves. High efficiency HE RIG tended to have 6.8% greater acetate and 15.4% lower propionate as % of total VFA than LE RIG. Blood insulin concentration was greater and blood glucose tended to be greater for LE RIG than HE RIG group. Low efficiency RIG group had greater left rib, left flank, and anus surface temperature measured by infrared thermography than the HE RIG group. Differences in ruminal fermentation do not seem to be associated with pre-weaning calves efficiency, while differences in protein metabolism seem to affect RFI during this phase. Infrared thermography appears to be correlated to RIG in pre-weaning heifer calves.The objective of this study was to evaluate whether pre-weaning heifer calves divergent for residual feed intake ( FE) is essential to increasing profitability [RFI) is a FE index calculated as the difference between actual and expected animal feed intake, at a certain level of production [In milk production systems, feed corresponds to 50% of the total cost of production ; therefotability . Feed eftability . More spoduction . The indoduction .Some studies linked RFI during lactation with RFI during the growth phase, indicating that RFI may be a lifetime trait ,8. UnderRIG) was proposed as an alternative index to select efficiently growing animals. In a companion paper [The selection of slow-growing animals can be a problem associated with RFI ; thus, ron paper , we detaTo our knowledge, no research has been conducted to evaluate the possible differences in ruminal and blood metabolites in groups divergent for FE indexes in pre-weaning dairy calves. Moreover, while research conducted by our investigative group concluded that thermography may have the potential to be used for screening phenotypical divergence in calves classified for residual body weight gain , no compThis study was approved by the Ethics Committee of Embrapa Dairy Cattle (number: 7194210316). The study was conducted at the Farm of Embrapa Dairy Cattle, located in Coronel Pacheco, Minas Gerais, Brazil.As stated above, the data presented in this paper is part of a study that classified calves into high and low feed efficiency groups using two feed efficiency indexes (RFI and RIG). A detailed description of methods, diets composition, performance data, calculation of indexes, and group classifications are provided in . Brieflyth to the 77th day of age divided into 2 equal meals offered at 0700 and 1400 h in nipple buckets . On the 78th day of age, milk supply was reduced by half, and the heifer calves were weaned on the 81st day of age. Water and total solid diet  were offered ad libitum in buckets . Milk samples were collected twice daily (morning and afternoon) and analyzed for total solids, crude protein, lactose, and fat. The solid diet was provided since the first day of life and composed of 92% starter  and 8% Tifton 85 (Cynodon spp.) hay chopped in 5-cm lengths, as fed. Samples of the TSD were collected 3 times a week, and composited and homogenized weekly.The amount of milk offered for each calf was 42% of their metabolic weight at birth. The mean weight of calves at birth was 25.2 \u00b1 3.2 kg (mean \u00b1 SD). Consequently, the daily milk supply was 4.7 \u00b1 0.46 L. Calves received transition milk until 3 days of age, and whole milk from the 4Individual refusals were collected daily and were composited weekly. Milk, TSD, and water intake were measured individually. Daily intakes of milk, TSD, and water were calculated by the difference between offers and refusals. Feed and water were weighed using a bench scale  and a portable scale , respectively. Body weight was recorded before the morning meal on days 3 and 7 after birth, and weekly from day 8 onward.th to the 77th day of age to calculate the indexes based on 63 days of observation [ADG) of each animal. Mean daily feed intake was calculated for each animal over the trial period and corrected for DM. The average metabolic weight (BW0.75) was calculated using the BW at the 46th day of age, which was the middle of the test period.Solid feed was offered since the first day of life, but feed efficiency evaluations started with 14 d of age since there was no expressive solid intake before this age. Intake and performance were evaluated from the 14ervation . The gro0.75, and ADG were used to estimate RFI and residual body weight gain (RG) using linear regressions [0.75, \u03b22 is the regression coefficient for ADG (RFI) or DMI (RG), and ej is the error term for calf j. In the present study, RG was not used as an FE index. The RG calculation was performed to estimate RIG. To calculate RIG, the residues for RFI and RG were added as [Dry matter intake, BWressions , where Radded as :RIG=[RFHE) and low efficiency (LE) for RFI and RIG. HE indicated RFI < 0.5 SD below the mean (n = 9) and RIG > 0.5 SD above the mean (n = 10), while LE indicated RFI > 0.5 SD above the mean (n = 10) and RIG < 0.5 SD below the mean (n = 11). The remaining animals were classified as intermediate and were not included in subsequent analyses.Based on these indexes, the animals were classified into four groups: high efficiency (BHB), urea, and glucose, blood samples were taken at 14, 28, 42, 56, and 70 days of age; to determine the concentration of insulin, blood samples were taken at 28, 42, 56, and 70 days of age. All blood samples were taken via venipuncture of the jugular vein, 3 h after the morning meal. Tubes without anticoagulant for insulin, BHB, and urea, and with fluoride EDTA for glucose  were used. The tubes were stored on ice until centrifugation at 1,800 \u00d7 G for 10 min at room temperature (22\u201325\u00b0C).To determine the concentration of beta hydroxybutyrate . Insulin was analyzed using a Bovine ELISA kit . The coefficients of inter- and intra-assay variation were 11.2% and 9.1%, respectively. BHB determination was performed using an enzyme kinetic kit . All readings were performed on an EON microplate spectrophotometer .Ruminal fluid samples were collected at 14, 28, 42, 56, and 70 days of age using an esophageal tube, 3 h after morning feeding. The liquid was double filtered through cheesecloth, and pH was measured .3 determination, 5 mL of filtered ruminal liquid was acidified with 1 mL of sulfuric acid (500 mL/L) and stored at \u221220\u00b0C until further analysis. Analyses were performed after distillation of Kjeldahl with magnesium oxide and calcium chloride according to method 920.03 [VFA) determination, 1 mL of 20% metaphosphoric acid was added to 10 mL of filtered ruminal liquid and stored at \u221220\u00b0C. Samples were defrosted at room temperature (22\u201325\u00b0C) and centrifuged at 13,000 rpm for 10 minutes. The samples were analyzed by high performance liquid chromatography .For N-NHd 920.03 . For volThermal images of the calves were taken with an infrared camera  on day 56 (\u00b13) at 0600 h, before the morning feeding. The standard distance between thermograph and the target anatomical region was 0.5-m. The FLIR T420 default settings values for emissivity (0.98) and reflectance temperature (20\u00baC) recommended for animal skin or watery surface (eye) were used . All theTo establish a constant area of evaluation, a figure was drawn on the image surface, and it was then dragged to the region of the skin located in the chosen area . Only thijk is the dependent variable, \u03b20 is the intercept, \u03b21Aij is the regression coefficient for the covariate initial BW, \u03b22Bij is the regression coefficient for the covariate total serum protein, Gi is the fixed effect of efficiency group (RFI or RIG), Mk is the fixed effect of repeated measure (day or week), GMik is the fixed effect of interaction between group and repeated measure, \u03b4ij is the random error between animals within treatment, and \u03b5ijk is the random error between measurements within animals. The best covariance structure for repeated measures was chosen by the lower corrected Akaike information criteria (AICc). For significative interaction between group and repeated measure, the differences among groups within measures were evaluated using the SLICE statement. For thermography data, the effects of repeated measures and its interaction with treatment were not included in the model and one random error term was used. Significance of the effects was declared at P \u2264 0.05, and tendency was accepted when 0.05 \u2264 P \u2264 0.10.Statistical analysis was performed using SAS software . To evaluate the effects of efficiency in the groups, the MIXED procedure was used, according to the model:P < 0.01). The HE RFI consumed 8.9% less than the LE RFI group. Total intake was 0.76 and 0.84 kg/d for the HE and LE RFI groups, respectively . Average daily gain was 0.60 and 0.59 kg/d for the HE and LE RFI groups, respectively , and body weight was 48.2 and 46.6 for the HE and LE RFI groups, respectively  [Average RFI for the HE group was \u22120.052 kg/d, and for the LE group, it was 0.049 kg/d  were observed for ruminal pH, N-NH3 concentration (%), and proportion of butyrate (%VFA) between HE and LE RFI groups (P = 0.001) for LE than HE RFI group. In addition, propionate (%VFA) was greater in the LE RFI group (P = 0.002), while acetate (% VFA) was lower for this group (P = 0.01).No statistical differences . Low efficiency RFI group had greater ruminal VFA concentrations at 28 and 42 d of age in comparison to HE RFI group . Acetate concentration was lower in the LE RFI group at 28 and 42 d of age, while propionate concentration was greater in the LE than in the HE RFI group at 28, 42, and 56 d of age  (P = 0.06) to be greater in LE than HE RFI group.Blood BHB, glucose, and insulin concentrations did not differ between RFI groups ( > 0.22) . Blood uP = 0.048) between flank temperature and RFI was observed . Average daily gain was 0.60 and 0.55 kg/d for the HE and LE RFI groups, respectively , and body weight was 47.8 and 46.3 for the HE and LE RFI groups, respectively  [The average RIG for the HE group was 0.080 kg/d, and for the LE group, it was \u22120.077 kg/d. The HE RIG group had an 8.6% greater ADG than the LE RIG group . Total i< 0.001) .P = 0.08) and a lower proportion of propionate (%VFA) (P = 0.06) concentrations in HE RIG compared to LE RIG group.No differences in ruminal parameters between the HE and LE RIG groups were observed , except P = 0.02) for LE than for HE RIG group (P = 0.06) to be greater in the LE RIG group compared to the HE RIG group, but no differences in BHB and urea between RIG groups were observed. In addition, a treatment \u00d7 week interaction for blood insulin concentration was observed (P = 0.001). Insulin was greater in LE compared to HE RIG animals at 56 days of age (Blood insulin concentration was greater (IG group . Blood gs of age .P = 0.03) left rib, left flank, and anus surface temperature measured by infrared thermography compared to the HE RIG group (P = 0.005) and rib temperature  with RIG were observed.The LE RIG group had greater  exhibit differences in thermography, blood, and ruminal parameters. Clear evidence of differences in these parameters when using RFI or RIG as indexes for calves was observed for proportions of acetate and propionate in rumen VFA, blood glucose, insulin and urea depending on the FE index evaluated. The results also indicated differences in body surface temperatures when the calves were classified based on RIG but not RFI. Results from the current study indicates divergences on physiological basis underlying RFI and RIG and opens the perspective for future studies on a better understanding of how these differences affect productive traits of lactating dairy animals. Complementary results on performance body measurements, digestibility, energy partitioning, and nitrogen partitioning were described by .Residual feed intake is defined as the difference between observed and expected feed intake based on the requirement to support both maintenance and growth . High-ef3 between RFI groups were observed. Other studies that also used esophageal tube did not find differences in ruminal pH between HE RFI and LE RFI [No differences in pH and N-NHd LE RFI ,18, demoIn the present study, calves with greater solid intake (LE RFI group) also had greater total VFA (\u03bcmol/mL). Similar results were also observed in LE RFI animals under feedlot conditions fed a grain-based diet . Since rDifferences in ruminal fermentation do not seem to be associated with pre-weaning calves' efficiency. A possible reason why HE RFI group kept the same ADG eating less and with lower VFA concentration may be related to more efficient post-ruminal digestion and absorption of nutrients in that group. Data from the same study presented in companion paper already published , showed P < 0.10) for greater insulin in the LE RFI groups [Blood concentration of metabolites and hormones can be a useful tool to understand differences in metabolism. Several RFI studies have evaluated blood parameters to understand differences in feed efficiency and tried to detect potential physiological markers for FE ,23. In tI groups  or a weaI groups .In young ruminants, the main contribution to the plasma concentration of butyrate is related to its production in the rumen . TherefoLow-efficiency RFI group tended to have greater blood urea concentrations in comparison to the HE RFI group. An association between greater concentrations of blood urea and LE RFI has been previously reported in the literature ,27. ThisPrevious studies reported correlations between heat production and skin surface temperature measured by infrared thermography ,30. SincResidual feed intake and body weight gain were proposed to be an intermediary index between RFI and RG . Hence, As discussed above for RFI, changes in VFA concentration and percentage of each VFA followed intake parameters. The tendency to greater availability of fermentable substrate in rumen appears to be responsible for the tendency of greater molar concentrations of VFA in LE RIG compared to HE RIG group. In addition, the tendency to greater ruminal propionate  and acetate  proportion in LE RIG compared to HE RIG may be related to differences in passage rate between the groups.The LE RIG group had greater blood insulin concentration at 56 d of age and tended to have greater glucose concentration. The secretion of insulin depends on the rate of nutrient absorption in the small intestine, feed composition, and neuroendocrine signaling to the pancreas . Low-effAs mentioned before, one of our hypotheses was that HE RIG animals would dissipate less heat through the skin, reflecting lower heat production due to a possible more efficient metabolism. Although LE RIG animals had a greater left rib, left flank, and anus surface temperatures compared to HE RIG measured by infrared thermography, no differences in heat production measured by respiration chamber, presented in the companion paper , betweenThese results do not corroborate with our initial hypothesis that skin surface temperature would reflect differences in heat production between HE and LE RFI groups; however, moderate correlations between surface temperature in some regions and RIG were observed. It is not clear which mechanism links greater efficiency and lower skin surface in RIG groups. Thus, more research is needed to investigate the relationship between RIG and skin surface temperature measured by thermography.Total ruminal VFA concentration and the proportions of acetate and propionate  were greater in the LE RFI and RFI groups. Therefore, ruminal fermentation does not seem to be associated with pre-weaning heifer calves FE. Blood urea concentration was greater in the LE RFI group, suggesting protein metabolism as a possible key point determining differences in FE in pre-weaning dairy calves. Infrared thermography seems to be correlated to RIG but not to RFI; however, the mechanism linking skin surface temperature to RIG is not clear. This study indicates differences in physiological basis underlying RFI and RIG; therefore, more research needs to be conducted to better understand how these differences can affect the productivity of lactating cows and which index has better potential to improve the selection of more efficient animals.S1 Database(XLSX)Click here for additional data file."}
{"text": "Lactobacillus fermentum CQPC04. The in vivo results indicated that L. fermentum CQPC04-fermented soy milk enhanced the organ index of the liver and spleen, and improved the pathological morphology of the liver, spleen, and skin. L. fermentum CQPC04-fermented soy milk increased the enzymatic activity of glutathione peroxidase (GSH-Px), total superoxide dismutase (T-SOD), and catalase (CAT), increased glutathione (GSH), but decreased the levels of nitric oxide (NO) and malondialdehyde (MDA) in serum, liver, and brain tissues of oxidative aging mice. The above mentioned fermented soy milk also increased the levels of collagen I (Col I), hyaluronic acid (HA), and collagen III (Col III), and decreased the levels of advanced glycation End products (AGEs) and hydrogen peroxide (H2O2). The RT-qPCR results showed that L. fermentum CQPC04-fermented soy milk upregulated the mRNA expression of nuclear factor erythroid 2?related factor (Nrf2), heme oxygenase-1 (HMOX1), quinone oxido-reductase 1 (Nqo1), neuronal nitric oxide synthase (NOS1), endothelial nitric oxide synthase (NOS3), Cu/Zn\u2013superoxide dismutase (Cu/Zn-SOD), Mn\u2013superoxide dismutase (Mn-SOD), and CAT, but downregulated the expression of inducible nitric oxide synthase (NOS2) and glutamate cysteine ligase modifier subunit (Gclm) in liver and spleen tissues. Lastly, the fermented soy milk also increased the gene expression of Cu/Zn-SOD, Mn-SOD, CAT, GSH-Px, matrix metalloproteinases 1 (TIMP1), and matrix metalloproteinases 2 (TIMP2), and decreased the expression of matrix metalloproteinase 2 (MMP2) and matrix metalloproteinase 9 (MMP9) in skin tissue. In conclusion, L. fermentum CQPC04-fermented soy milk was able to satisfactorily delay oxidative aging effects, and its mechanism may be related to the increase in free soy isoflavones and peptides.The aim of this study is to evaluate the changes in soy isoflavones and peptides in soy milk after lactic acid bacterial fermentation, and explore the positive effects of fermented soy milk on an oxidative aging mouse model induced with D-galactose. We found that free soybean isoflavones and peptides increased after soy milk was fermented by  The United Nations (UN) predicted that there would be an average annual increase rate of 2.5% in the elderly population from 1990 to 2020, and over the same period, the proportion of the world's aging population has risen from 6.6% in 1995 to 9.3% in 2020  (ABTS), 2,2-diphenyl-1-picryl-hydrazyl-hydrate (DPPH), and hydroxyl  under accession number CGMCC 14493, and this strain was originally isolated from pickles in Chongqing, China by our group.ad libitum. All of the experiments were was performed according to 2010/63/EU directive and national standard of the people's Republic of China (GB/T 35892-2018) laboratory animal-guidelines for ethical review of animal welfare and institutional rules considering animal experiments. At the same time, the study protocol was approved by the Ethics Committee of Chongqing Collaborative Innovation Center for Functional Food .Fifty 7-week-old female ICR mice were purchased from Chongqing Byrness Weil Biotech Ltd. . The mice were maintained in a room at constant temperature and humidity  with 12 h of light and 12 h of darkness, and they were allowed to ingest standard mouse chow and water L. fer mentum CQPC04 with a viability count of 1.0 \u00d7 105 CFU/mL was added to sterilized soy milk, and then put in a constant temperature incubator  for fermentation, the fermentation condition is 37\u00b0C, 12 h. The final viability count in the fermented soy milk was 1.3 \u00d7 108 CFU/mL.According to a previous method with modification , L. fer The soy isoflavones in soy milk were analyzed by HPLC . Based on a previously published method with slight adjustments , 15 mL oAccording to a previously described protocol , the proL. fermentum CQPC04-fermented soy milk group , and (v) D-galactose + non-fermented soy milk group . The groups and their specific treatments for the entire experimental period are presented in After adaptive feeding for 1 week, fifty female Kunming mice were equally distributed into five groups, consisting of the (i) normal group, (ii) D-galactose group , (iii) D-galactose + vitamin C group , (iv) D-galactose + All mice were fasted with water for 16 h and depilated on the back before being euthanized by severing the spinal cord. Whole blood was collected and centrifuged at 4,000 rpm for 10 min at 4\u00b0C to obtain the upper serum. Then, the liver, spleen, and whole brain were weighed to calculate the organ indexes. The organ indexes were determined by the following formula: C (%) = (m1/m2) \u00d7 100, in which C represents the organ index, m1 denotes the organ weight, and m2 denotes the body weight of the mice.Soybean-sized pieces of tissue of the liver, spleen, and skin were harvested and fixed in 10% paraformaldehyde solution for 48 h. Then all of the above tissues were delivered to Wuhan Sevicebio Biotechnology Co., Ltd.  for pathological detection. Lastly, an upright microscope  was used to observe the morphology of the tissues and obtain photographs.The levels of GSH-Px, GSH, T-SOD, MDA, NO, and CAT in serum were directly determined using conventional biochemical kits and following the manufacturer's instructions . In addition, it was necessary to pre-treat the mouse liver and brain tissues before measuring the above indicators, which consisted of homogenizing one gram of tissue and 9 mL of physiological saline with a tissue homogenizer , centrifuging the homogenate at 12,000 rpm for 10 min at 4\u00b0C, and collecting the supernatant as the measurement sample for the above indicators.The skin pretreatment method used was same as that described in Section Measurement of Oxidative Indicators. The amount of hydrogen peroxide in the skin was determined using conventional biochemical kit , and Col I, AGEs, Col III, and hyaluronic acid levels were measured by the enzyme-linked immunosorbent assay (ELISA) kits .\u0394CT\u2212\u0394, in which \u03b2-actin was chosen as the internal reference marker . Then, the mRNA was reverse transcribed into cDNA using a cDNA kit . Finally, RT-qPCR (reverse transcription-quantitative polymerase chain reaction) was performed, and a real-time fluorescence quantitative PCR instrument  was used to detect the mRNA expression of target genes. All primers were from Invitrogen , and their sequences are listed in e marker .p < 0.05 indicates statistical significance.Graph Pad Prism 7.0 and SPASS 17.0 software were used to calculate and analyze results, and the results presented as the mean \u00b1 standard deviation . L. fermentum CQPC04 (p < 0.05). The above results indicate that fermentation with L. fermentum CQPC04 can convert the macromolecular proteins in soy milk into small-molecule peptides.The peptide content and protein profiles are two useful indicators that can reflect the changes in the protein in soy milk before and after fermentation . From FiL. fermentum CQPC04-fermented soy milk, in which the organ indexes in the D-gal + CQPC04 group increased more than those in the other two groups and were similar to those of the normal group.There is usually degeneration or atrophy of organs during aging. As shown in L. fermentum CQPC04-fermented soy milk groups all displayed an increase in the percentage of white pulp to varying degrees. Moreover, the most white pulp was observed in the D-gal + CQPC04 group, which is similar to the normal group.The histological features of the spleen sections stained with H&E are presented in L. fermentum CQPC04-fermented soy milk, in which there was a more pronounced effect from the L. fermentum CQPC04-fermented soy milk as compared to the other groups.The aging of the skin is the most visible and obvious manifestation of organismal aging. H&E, Masson, and toluidine blue stains are usually used to observe pathological features of the skin. In the D-gal group, the skin dermis thickness  and collp < 0.05), which indicated a decrease in the anti-oxidative capacity of the mice. It is worth noting that L. fermentum CQPC04-fermented soy milk notably enhanced the levels of GSH-Px, T-SOD, GSH, and CAT, and reduced MDA and NO (p < 0.05). Additionally, there was no obvious difference in these indicators between the normal group and the D-gal + CQPC04 group (p > 0.05).Anti-oxidant enzymes, MDA, GSH, and NO can reflect the oxidative stress levels of aging mice induced by D-galactose. L. fermentum CQPC04-fermented soy milk on D-galactose-induced aging mice, we measured the amounts of AGEs, hyaluronic acid, Col I, hydrogen peroxide, and Col III in skin tissues .The RT-qPCR results indicate that the expression trend of related genes in the liver and spleen is consistent . The expCu/Zn-SOD, Mn-SOD, CAT, GSH-Px, tissue inhibitor of metalloproteinase (TIMP)1, and TIMP2 was the lowest, while that of matrix metalloproteinase (MMP)2 and MMP9 was the highest in the D-gal group. Compared with the D-gal group, the expression levels of Cu/Zn-SOD, Mn-SOD, CAT, GSH-Px, TIMP1, and TIMP2 increased, but MMP2 and MMP9 decreased in the D-gal + VC, D-gal + NO, and D-gal + CQPC04 groups. It is worth noting that the mouse skin in the D-gal + CQPC04 group possessed the highest mRNA expression levels of Cu/Zn-SOD, Mn-SOD, CAT, GSH-Px, TIMP1, and TIMP2, and the lowest expression levels of MMP2 and MMP9 except for the normal group, which demonstrated that L. fermentum CQPC04-fermented soy milk reduced the oxidant aging of skin and decreased the degradation of collagen fibers.Antioxidant enzymes and matrix metalloproteinases are important indicators that can be used to evaluate the degree of skin aging. As shown in L. fermentum CQPC04 to ferment soy milk and evaluated the changes in isoflavones and peptides, as well as explored the antioxidant effect of this fermented soy milk due to its antioxidant action.Soy milk fermented with lactic acid bacteria is beneficial to human health because of the bioactive components in the milk that play important roles. Studies have proved that using lactic acid bacteria to ferment soy milk can convert the conjugated isoflavones and proteins into aglycone isoflavones and bioactive peptides, respectively, which increases the bioavailability of these substances in the human intestinal tract . At presL. plantarum CQPC02 (7.59 \u03bcg/mL) were obviously higher than those of non-fermented soymilk (4.01 \u03bcg/mL) and fermented soymilk with Lactobacillus bulgaricus (4.05 \u03bcg/mL)  . Anotheroflavone . Our expL. fermentum CQPC04-fermented soy milk, and resulted in the high organ index of the liver and spleen, a return to the normal structure of the liver, spleen, and skin, as well as increased collagen fibers and few mast cells in the skin.With increasing age or as the aging process accelerates, the body's organs and tissues will gradually undergo changes such as atrophy and functional degradation. Our study found that the organ indexes of the liver and spleen was significantly decreased, and the histopathological morphology of the liver, spleen, and skin was damaged to varying degrees in mice, which showed that the anti-oxidative aging model was successfully established . In contL. sakei K040706, which is from traditional Korean fermented soybean paste, increased the spleen indices of cyclophosphamide-induced immunosuppressed mice   . A previing mice .2O2 will cause cytotoxicity to the skin, and lower amounts of HA can lead to reduced moisture, the presence of roughness and wrinkles, and a loss of skin elasticity  and also complied with the 2010/63/EU directive.XZho and H-hD performed the majority of the experiments and wrote the manuscript. MJ, CZ, and YD contributed to the data analysis. XZha and XL designed and supervised the study and checked the final manuscript. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "General linear models were used to study the associations between origin and mental health, comparing Ethiopian and FSU origin with native-Israeli. Ethiopian and FSU mothers were more likely to report on somatic symptoms, compared with native-Israeli women. Ethiopian origin was negatively and significantly associated with anxiety in all three interviews . FSU origin was negatively associated with depression after birth , and negatively associated with anxiety after birth and one-year postpartum . Stressful life events were significantly associated with all mental disorders in the three time points of interviews. Our findings suggest that immigrants tend to express higher mental distress with somatic symptoms. Additional tools are needed for mental distress screening among immigrants.We conducted a prospective study, aimed to study whether the prevalence of mental disorders after birth differs by country of origin. Parturient mothers of Ethiopian origin, Former-USSR (FSU) origin, or nonimmigrant, native-Israeli origin ( Postpartum depression (PPD) is the most studied mental disorder in women after delivery. It is considered the most common complication women experience after delivery, affecting about 13% of mothers worldwide (range: 10\u201325% across countries) . Over thRates of prenatal and postpartum depression were found to be especially high among immigrant populations in several countries ,13,14. AOne of the major problems in assessing the prevalence of PPD and anxiety across cultural settings relates to differences in definitions and expression of symptoms. Some studies have suggested that patients from non-Western cultures or developing countries are more likely to report somatic symptoms and deny psychological symptoms, especially if they are from Asian, African, and Hispanic cultures ,26. EthiOur hypothesis was that manifestations of postpartum mental disorders differ between immigrants and native-born in Israel according to different mental scales. Therefore, we aimed to study the different manifestations of mental disorders in parturient women from three origin groups, namely women of Ethiopian origin (ETH), Former Soviet Union origin (FSU) and native Israeli-born (INB) in a prospective study designed in three waves. Our assumption was that immigrant groups would have an increased prevalence of PPD, anxiety and somatic symptoms, and that there may be a different expression of mental morbidity after delivery among immigrants.We conducted a three-step study of mothers. Mothers were recruited after birth in 3 different hospitals in Israel  between April and December 2017 and were followed for one year. The study included women older than 18 years who were capable of understanding and completing questionnaires  in the postpartum period. The study population included 964 mothers: 484 Israeli-Native-born mothers, 264 Former-USSR origin mothers (212 first generation and 52 second generation immigrants) and 216 Ethiopian origin mothers (191 first generation and 25 second generation immigrants). After delivery, participating women answered an anonymized self-administered questionnaire that included questions about socioeconomic conditions, age, smoking habits, alcohol consumption, living with a spouse and type of delivery. Six to eight weeks after delivery and again after twelve months, the women were re-interviewed by phone. Anxiety and depression were assessed by completing the General Anxiety Disorder 7 Item Scale (GAD-7) and the Edinburgh Postnatal Depression Scale (EPDS), respectively. Seven questions from the SRQ-F questionnaire (the Revised Self-Reporting Questionnaire for Ethiopian origin population) were selected based on experts\u2019 opinion, who built the original SRQ questionnaire and assisted us in selecting the most relevant questions for our research. The questionnaires were used in all 3 stages of the study (SRQ-7).p = 0.007) and low education . No significant differences were found in EPDS, GAD-7 and SRQ-7 scores, between those lost to follow-up and participants in the second interview (not shown). Between the first and second interview, 433 (44.9%) participants were lost to follow-up, and additional 118 (12.2%) participants were lost to follow-up between the second and third interview. Loss to follow-up was associated with low income  ,33 and GGAD-7 is a screening instrument which indicates the presence of symptoms of anxiety referred to in the DSM-IV . The queSome studies reported about challenges in screening of PPD and anxiety in specific populations since the different dialects within countries also raises the possibility of idiosyncratic elements, and individual ways of interpreting maternal depression. Several studies found psychological symptoms manifest differently from culture to culture ,50,51. TThe Self-Reporting Questionnaire (SRQ), developed by WHO experts, was designed for screening psychiatric illness, especially in developing countries, regardless of cultural context . This quIn this study, we used the GAD-7 EPDS and SRQ-7 questionnaires, for identifying anxiety, depression, and somatic disorders among mothers.Origin was defined by the women\u2019s or their mothers\u2019 country of birth (Israeli-Native-Born (INB), Ethiopian Jew (ETH), and Former-USSR Jew (FSU)). Information on a broad range of variables was collected at study intake, 6\u20138 weeks postpartum and at 12 months postpartum (concurrent variables). Socio-demographic, family history and pregnancy variables measured at study intake included maternal age , religiosity , marital status , maternal years of education (<13 vs. \u226513), income , smoking during pregnancy (yes vs. no), obstetric history including conception (spontaneous vs. fertility treatment), birth type , parity , gestational age , birth weight , gender, multigestation (yes vs. no), breastfeeding at 6\u20138 weeks (yes vs. no), and stressful life events in the previous year  .Descriptive characteristics of the study population were presented and compared by origin groups using one-way ANOVA and chi-square tests, as appropriate. Medians of EPDS and GAD-7 scores were presented, and distributions were compared by SRQ-7 as a dichotomous score (0 vs. \u22651), using Mann\u2013Whitney test. The associations between origin and the study scales of mental disorders as continuous variables were assessed using generalized linear models where univariate models were followed by multivariable models, controlling for variables that were significantly associated with the outcomes in univariate models . p-values.Statistical analysis was performed with IBM SPSS Statistics for Windows, Version 25.0 . We present regression coefficients \u03b2 and The study protocol was approved by the Institutional Review Board of the Israeli Ministry of Health, IRB #34, 2016, Hillel-Yaffe Medical Center, IRB #102, 2016, Shamir Medical Center, IRB #267, 2016, and Kaplan Medical Center, IRB #77, 2017. p < 0.001). The largest gap between the groups was observed in maternal education; only 33% of ETH had >12 years of education, whereas more than 62% of both other groups had more than 12 years of education. Similarly, ETH women were more likely to come from a household with lower than the average income . Among married women, low spousal support was reported by 9.5% of ETH women, compared with 4.5% among FSU women and 3.6% among INB women. ETH women had less prenatal care during pregnancy, with 12.7% having none or partial perinatal care, compared with 9.9% among INB and 5.0% among FSU, and higher prevalence of late (>40 week) deliveries . Additionally, ETH women had the highest rates of cesarean and instrumental births (35.4%) compared to INB (29.4%) and FSU women (29.9%).Taken together across the study population, as shown in Prevalence rates of positive scores of all three mental disorders by origin in the three time points of the study are presented in The overlap of prevalent cases in positive EPDS, GAD-7 and SRQ-7 at each interview is presented in p = 0.001; \u03b2 = \u22120.678, p = 0.020; and \u03b2 = \u22121.072, p = 0.007; right after birth, 6\u20138 weeks, and 12 months postpartum, respectively). FSU origin was negatively associated with EPDS after birth , and negatively associated with GAD-7, 12 months postpartum . In contrast, Ethiopian and FSU origin were positively associated with SRQ-7 scores after birth . Other factors that were associated with SRQ-7 included maternal age of 18\u201324 years, compared with 35+ years for high score of SRQ-7 after birth . Low education (<12 years) was associated with SRQ-7 scores in all three stages of the study . Stressful life events were consistently strongly associated with all mental states at all three stages of the study . The associations with SRQ-7 tended to be somewhat weaker . When a variable of sense of racism was entered into the models, it was found to be a significant risk factor for SRQ-7, but its presence weakened the association between origin and SRQ-7 (not shown).Studying the associations between origin and EPDS, GAD-7, and SRQ-7 scores , EthiopiThe present study aimed to investigate the association between migration and mental disorders postpartum. The main finding of this study is that compared to nonimmigrant mothers, mothers of both immigrant groups were more likely to report on somatic symptoms. In this study, we present the prevalence of somatization that was found to vary across the immigrant groups, depending on maternal age, educational level, and life events, in the different three time points of interview. In our first hypothesis, PPD, anxiety and somatic symptoms would be significantly associated with origin and migration because of the stress that has been associated with migration or due to being from an immigrant family and its consequences ,15,17. MIn our study, the overall prevalence of positive EPDS score \u2265 10) 6\u20138 weeks postpartum was 4.7%, which is identical to the prevalence found in a study of Mother and Child Health Clinics in Israel from 2014\u20132015 , and sim0 6\u20138 weeOur findings of the associations between psychosomatic symptoms, EPDS and GAD-7 scores are consistent with worldwide literature and suggest that among immigrants in Western countries, somatization is a manifestation of other mental disorders ,26,30. EDepression is an emotional disorder whose expression differs between the Western and non-Western world . ReportsDepression, anxiety and somatoform disorders are the most prevalent disorders in primary care settings . Indeed,Our findings suggest that somatic symptoms are probably a core component of the depressive syndrome; our results show a strong association of somatization with depression and with anxiety, and that they add another dimension not fully appreciated by the other scales. These results are consistent with other studies, which found that in over 50% of cases, comorbidities existed between depression, anxiety and somatization ,68. StudWe examined the course of variation in the rate of mental disorders throughout the postpartum year. To avoid selection bias, we examined rates of depression among women who participated in the second phase of the study compared with women lost to follow-up and we found similar depression rates . In our study, the rate of mental disorders was the highest after birth, with a subsequent decline in the rate of disorders in the different origin groups. Few studies considered the variation of PPD rates, yet there is no consensus about the course of PPD during the first year postpartum. Although some studies reported remission of PPD in the first year postpartum ,76, otheThe present study found that the most persistent variable associated with all postnatal mental disorders was stressful life events in the past year. Our results are consistent with numerous epidemiological studies ,80,81 whOur study\u2019s limitations include the lack of information on maternal mental state while pregnant which can influence postpartum mental health ,83 and lOur study has several strengths. First, the present study is among the first to examine the validity of psychosomatic symptoms across cultural groups. Furthermore, our findings support a vast literature illuminating cultural-based differences in expression of mental psychopathology ,92. CrosIn conclusion, although psychological distress has been observed to be higher among immigrants than among native populations, little is known about the prevalence, number, and severity of somatic symptoms associated with psychological distress in the immigrant population. The findings presented here, based on a unique database representing Jewish Israeli-, FSU- and Ethiopia-born women in Israel, extend our knowledge in the field. The findings of the study raise the question of whether screening tests used to detect depression at MCHC and in the HMO clinics are adapted to Israeli mothers in general and immigrant mothers, or whether a cultural adjustment is needed to improve and more accurately identify mental disorders among Israeli populations. Somatization is a challenge for health professionals due to its vague nature. In this regard, clinical management of immigrant patients should include further efforts to address emotional distress, with special attention to cultural differences. In addition, more research is needed to explore this potential relationship between psychosomatic symptoms and depression/anxiety further."}
{"text": "Cytomegalovirus (CMV) is the most common cause of congenital infection, with a wide spectrum of clinical manifestations and different grade of severity. We report the case of a male baby born at term with an early prenatal diagnosis of severe intracranial hemorrhage (ICH), with no other evident risk factors. Urine and blood sample were tested for CMV-DNA, and diagnosis of congenital CMV infection was established. This case describes intracranial hemorrhage as uncommon although possible sign of early fetal CMV infection. Considering that pathogenic factors cannot be defined in 25 % of term neonates with ICH, this case report highlights the importance of CMV screening in pregnant women and in term infants with prenatal ICH of unknown origin. CMV is the most common cause of congenital infection with a wide spectrum of manifestations. Approximately 10 % of neonates with congenital CMV (cCMV) infection are symptomatic at birth with clinical manifestations including jaundice, petechiae, purpura, hepatosplenomegaly, microcephaly and neurological symptoms, including intracerebral calcifications , sensorineural hearing loss, cerebellar and hippocampal hypoplasia, cortical dysplasia  and retinitis. Neurodevelopmental impairment in childhood is common . IntraveMR was born at 38 weeks of gestational age (GA) from elective cesarean section. At birth: weight 2350 g (5\u221210\u00b0 pt), length 45 cm (5\u00b0 pt), head circumference 31 cm (<5\u00b0 pc). Doppler flow at obstetric ultrasounds was regular. Placenta normal in shape and perfusion. The Apgar score was 8 at 1st min., 9 at 5th min.At beginning of pregnancy, the mother was diagnosed as immune to rubella and she was negative for toxoplasmosis specific antibodies (IgG and IgM) throughout all the pregnancy. Only one determination of serological status for CMV at 11th week of GA was available(IgG positive and IgM negative). A maternal febrile episode in peri-conceptive period was reported. No maternal trauma reported in early pregnancy. Parents were not consanguineous and there was no family history of any bleeding disorders or stroke. No maternal use of cocaine or warfarin or anticonvulsant was reported.A prenatal diagnosis of ICH was suspected during an ultrasound performed at 20th week of GA and it was confirmed at 25th week of GA through a fetal brain Magnetic Resonance Imaging (MRI) scan .The prenBecause of these prenatal findings, immediately after birth the neonate was admitted in our Neonatal Intensive Care Unit for further evaluations.At birth physical examination revealed micro-purpuric elements on face and upper thorax, microcephaly, mild upper limbs muscular hypertonicity, abnormal deep tendon reflexes , jaundice.Laboratory evaluations were performed, including complete blood cell count, coagulative profile and liver and kidney function tests. Examinations for suspected congenital coagulopathy causing cerebral bleeding were performed : all these exams resulted normal. Moreover, gene sequencing for MTHFR/Leiden Factor polymorphism resulted wild type. Screening for metabolic diseases at birth was negative.Cranial ultrasound performed on first day of life showed left cerebral hemisphere prevailing on the right, a poroencephaly (2.3 cm of diameter) on the right side with \u201cex vacuo\u201d ventricle enlargement  till Silvian fissure. A germinolytic cyst on the left side and hyperechoic spots in the left peritrigonal parenchyma were found. Corpus callosum was poorly visible in its anterior portion. Third and fourth ventricles were normal-sized .Fig. 2CeA postnatal MRI scan confirmed the previous finding. It showed poroencephaly in the right fronto-temporal and insular zone with \u201cex vacuo\u201d ventricle enlargement, reduced volume of the right cerebral hemisphere, with striatum nucleus and thalamus partially involvement with wallerian degeneration of the corticospinal bundle. MR angiography did not show arterial and venous malformations nor thrombosis. An abnormal development of the middle-lower right frontal cortex was highlighted, which showed a polylobate appearance due to reduced furrows width and increased number of turns confirming the micropolygyria extended up to the right parietal lobe .Fig. 3CeThe electroencephalogram showed cortical abnormal activity in frontal-temporal-parietal cortex.Abdomen and cardiac ultrasound examinations, audiological (TEOAE) and ophthalmological evaluation were performed and all were normal.3 and 449 copies/ mm3 in blood. Therefore, the patient received diagnosis of congenital CMV infection and it was classified as a severe symptomatic one because of central nervous system involvement . According to current guidelines on the 15th day of life he started antiviral treatment with oral valganciclovir  for 6 months.Considering the micropolygyria at MRI scan, on the fifth day of life we searched for CMV DNA in body fluid and we detected in urine 10.273.900 copies/mmDischarged at the 17th day of life, the patient was admitted in our outpatient program for perinatal infectious diseases. No side effects were reported as consequence of the antiviral therapy. Evoked auditory brainstem response and ophthalmological evaluations were performed and resulted normal. Neurological examination at three months of age underlined persistence of neurological impairment more evident at the left side and he was admitted to physio-kinesiotherapy and neuro developmental follow up. At 18 month of life he presented global delay in development with pyramidal signs in the left hemisome. In particular he achieved head and trunk control and from the supine position he reached the prone and vice versa; with double support he maintained the standing position and took a few steps. His language were characterized by lallation and some simple bisyllabic phonemes. The EEG trace showed anomalies with potential epileptiform significance on the right hemisphere without critical episodes so that he did not start antiepileptic therapy.Intracranial hemorrhage is a rare complication of cCMV infection. Two different hypotheses have been advanced to explain this condition.One hypothesis considers CMV as cause of direct neuronal damage, due to its neurotropic nature, especially in early gestational age, resulting in cortical dysplasia and hippocampus and cerebellum hypoplasia.A second hypothesis considers CMV as cause of vasculitis that can affect blood vessels of the central nervous system, triggering thrombotic or hemorrhagic processes, even in absence of apparent coagulopathy ,9. This Suksumek et al.  reportedOur case, apparently very similar to this one, differs however for the earlier gestational age at CMV infection. In fact, the intracranial hemorrhage in utero was suspected at 20th week of GA and the earlier infection is in line with the finding of micropolygyria, microcephaly with global growth retardation and the severe neurological impairment showed since birth. The two cases may share the common origin but the early onset in our case lead to a different and more severe clinical picture. Moreover, in our case there was a very complex cerebral picture not only consequence of an intraventricular hemorrhage. In fact, cerebral fetal damage did not probably originate from the germinal matrix, related for example to the immaturity of its vessels, because it would have been restricted to the germinal matrix or at least extent into the lateral ventricles. We speculated that our patient suffered from a complex ischemic-hemorrhagic phenomenon in utero caused by CMV infection, which covered a wide area of parenchyma, including also but not only germinal matrix, where neural precursors originate. In prenatal MRI, an abnormal signal pattern in sub plate was reported and it may correlate with an anomalous cortical organization, which results in the micropolygyria in the same areas detected in the post-natal MRI.Maternal history may suggest a very early infection in the first trimester or a reinfection  in the eParents of neonate received a full prenatal counseling on ICH diagnosis otherwise, they decided to continue pregnancy and asked for the full medical care for the neonate.In conclusion, in our patient, diagnosis of fetal ICH forerun the diagnosis of congenital CMV. ICH affects 0.5/1000 of symptomatic term infants and in 25 % of these cases, pathogenic factors cannot be defined. This case report highlights the importance of testing pregnant women and neonate for CMV infection in case of unexplained fetal intracranial bleeding as a possible etiology.Conceptualization: LC, FR.Supervision. LC, FR.Writing and editing: LC, CCoppola, MV, SS.Data Collection: VE, CColinet, CP.Review: LC, MV, SS.Not applicable.The parents of the neonate gave as consent for publication of the clinical history and images.No funding to declare.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "The PD-L1/PD-1 immune checkpoint axis is the strongest T cell exhaustion inducer. As immune dysfunction occurs during obesity, we analyzed the impact of obesity on PD-L1/PD-1 expression in white adipose tissue (WAT) in mice and in human white adipocytes. We found that PD-L1 was overexpressed in WAT of diet-induced obese mice and was associated with increased expression of PD-1 in visceral but not subcutaneous WAT. Human in vitro cocultures with adipose-tissue-derived mesenchymal stem cells (ASC) and mononuclear cells demonstrated that the presence of ASC harvested from obese WAT (i) enhanced PD-L1 expression as compared with ASC from lean WAT, (ii) decreased Th1 cell cytokine secretion, and (iii) resulted in decreased cytolytic activity towards adipocytes. Moreover, (iv) the implication of PD-L1 in obese ASC-mediated T cell dysfunction was demonstrated through PD-L1 blockade. Finally, (v) conditioned media gathered from these cocultures enhanced PD-L1 expression in freshly differentiated adipocytes, depending on IFN\u03b3. Altogether, our results suggest that PD-L1 is overexpressed in the WAT of obese individuals during IFN\u03b3 secretion, leading to T cell dysfunction and notably reduced cytolytic activity. Such a mechanism could shed light on why adipose-tissue-infiltrating viruses, such as SARS-CoV-2, can worsen disease in obese individuals.  Effective responses to intracellular pathogens or tumors are usually dependent on Natural killer (NK) cells and/or T cells, especially CD8+ cytotoxic T cells. NK cell killing can be regulated by killer cell inhibitory receptors (KIR) after being bound to HLA class I molecules . Exhaust2 is an independent risk factor for severe forms of COVID-19, as demonstrated in several clinical departments including ours, where 25% of hospitalized patients and 35% of ICU patients below the age of 70 were found to be obese [Obesity with a BMI of >30 Kg/mbe obese ,14. Indebe obese . Besidesbe obese . Indeed,be obese ,18. Moren = 5\u20136/group). One group was fed a standard diet  and another was fed a high-fat/high-sucrose diet . Food was given three times a week. Body weight was recorded weekly.All procedures were performed with the approval of the Regional Committee of Ethics for Animal Experiments (CECCAP), registered under number C2EA15 by the French Ministry of Higher Education and Research, in accordance with European directive 2010/63. The experimental protocol received the number 2018061411298503. Four-week-old C57Bl/6J male mice  were randomly housed, two per cage, at 21 \u00b0C with a normal light/dark cycle, free access to water, and a standard chow diet  for a one-week acclimatization. Next, mice were randomly assigned to four different groups , plasma levels of insulin , leptin, and adiponectin  were measured.2), or visceral surgery from lean controls with the approval of the Committee for the Protection of Human Subjects of the \u201cHospices Civils de Lyon\u201d number 12/111 and with the patient\u2019s consent, according to ethical principles for medical research involving human subjects, as described in the World Medical Association\u2019s Helsinki Declaration. AT samples (50\u2013100 mg) were mechanically dissected and incubated in 2 g/L of collagenase type Ia solution  in DMEM:F12 medium (50/50 vol/vol)  for 40 min at 37 \u00b0C by mixing. Isolation of ASC was performed as previously reported [Subcutaneous or visceral AT samples were isolated from residues of bariatric surgery from obese subjects  were obtained from healthy human blood donors. MNC were separated from blood through Ficoll-Histopaque density gradient centrifugation (Sigma-Aldrich) and stored in liquid nitrogen.ASC were harvested and seeded in 24-well plates  for 24 h in RPMI supplemented with 10% FCS. Then, 24 h later, MNC were added in the presence or absence of phytohemagglutinin . ASC/MNC ratios of 1:5 were used. For mRNA analyses, the culture period was 24 h, whereas it was 48 h when conditioning media were collected. In that latter case, IL-17A neutralizing antibodies  at 50 \u03bcg/mL or IFN\u03b3-neutralizing antibodies  at 50 \u03bcg/mL were eventually added from the beginning of cultures. For blocking experiments, ASC/MNC cocultures were treated with PD-L1 neutralizing antibodies  at 1 or 10 \u03bcg/mL, or with irrelevant polyclonal goat IgG  at 10 \u03bcg/mL, or Secukinumab at 50 \u03bcg/mL.Total RNA was extracted from cocultures using the Tri Isolation ReagentTM  and frozen at \u201380 \u00b0C, and RT-qPCR was performed from reversely transcribed RNA into cDNA, as previously described . mRNA waFluorescein isothiocyanate (FITC)\u2013, phycoerythrin (PE)- Allophycocyanin (APC)-, and Alexa-fluor- directly conjugated anti-human antibodies were used to stain the various cells tested: CD14 , CD73 , CD8 , CD274 , CD279 , and Granzyme B . Analyses were performed using a LSR II 3 lasers cytofluorometer and Diva software . For Granyme B intracellular staining, cells were permeabilized using the BD Cytofix/Cytoperm permeabilizing kit , and cells were analyzed 6 h after interaction with adipocytes. Ob-ASC were differentiated into AD as previously described .ATs were fixed in formaldehyde 3.7% after isolation from bariatric surgery. They were then embedded in paraffin before being cut with the microtome MICROT002 and mounted onto microscope slides for analysis, after staining with anti-human PD-L1  at 1:50 dilution.p was <0.05.Statistical analyses were performed using one-way ANOVA with or without repeated measures, or mixed-effects analyses , followed by post hoc Fisher\u2019s LSD tests. In some experiments, two-tailed unpaired t-tests were used. Prism software was employed for analysis . Differences were considered as statistically significant when Whereas blood T cells from obese individuals or mice have been shown to overexpress the PD-1 checkpoint , here wePDL1 mRNA expression levels, but the co-presence of ASC resulted in potentiating the expression of PDL1 mRNA, whether ASC were issued from lean or obese donors. However, ob-ASC upregulated PDL1 mRNA expression at a statistically significant higher level than lean ASC. In addition, a two-way ANOVA test demonstrated (i) that both the body mass index (BMI) and the activation status were statistically significant independent factors, (ii) as well as the interaction between these two factors  from obese individuals (ob-ASC), rather than from lean individuals, can promote inflammation through Th17 cell and monocyte cell activation , we then factors A. Then, Because PD-1 needs to be linked by PD-L1 to exert its inhibitory effect on T cells, we then investigated whether the presence of obese ASC could also upregulate its expression. As shown in IL1\u0392 and IL6 mRNA expression levels were not modified, thus demonstrating a specific PD-L1 inhibitory effect on T cell functions. The specificity of the anti-PD-L1 effects was supported by further experiments comparing IL-17 and PD-L1 blockade  collected from ob-ASC and MNC cocultures could propagate exhaustion. Therefore, we cultured freshly differentiated adipocytes from ob-ASC with CM harvested from PHA-activated cocultures. We observed a strong upregulation of the expression of re model , we thenpression A. To valpression B.Brown adipocytes and differentiated 3T3 cell lines have been shown to express PD-L1 ,28. AddiIL2 mRNA expression (IL-2 is a cytokine that plays a major role in the maturation of precytotoxic T cells into cytotoxic T cells (CTL) in order to allow them to subsequently exert their cytotoxic function . We havepression . Of intepression , thus suPD-1 was also found to be upregulated following activation of MNC with PHA . HoweverAltogether, these data lead us to suggest that increased expression of PD-L1 on adipocytes and of PD-1 on T cells may trigger exhaustion and inhibit T cell functions, in particular IL-2 secretion and subsequent CTL function. This could be of high importance in situations where viruses infiltrate WAT. Infection with SARS-CoV-2 could represent one such situation, as AT is known to express ACE2, a receptor for the spike protein of SARS-CoV-2 . InteresThis study was performed first in vivo in animals and then in in vitro coculture assays with human ASC and MNC. These assays have been used to investigate the mechanisms leading to increased expression of immune checkpoints, as observed in vivo. Although these coculture assays have been previously used to demonstrate the role of ASC, Th17 cells, and monocytes in initiating inflammation among AT from obese individuals , they haIn this study, we analyzed the impact of obesity on immune checkpoint expression in WAT, using a mouse model of diet-induced obesity. We observed that PD-L1 is overexpressed in WAT of obese mice, and is associated with increased expression of PD-1 in visceral WAT as compared with lean mice. Using human in vitro cocultures with ASC from obese individuals and MNC, we also observed an overexpression of PD-L1 with respect to cocultures with ASC from nonobese individuals, Moreover, conditioned media harvested from these cocultures enhanced PD-L1 expression in freshly differentiated adipocytes, depending on the presence of IFN\u03b3. As adipocytes differentiated from obese ASC impaired cytotoxic activity, our results suggest that PD-L1 overexpression may occur in the visceral WAT of obese individuals under IFN\u03b3 secretion and may lead to T cell dysfunction, notably decreased cytolytic activity. Such a mechanism could shed some light on why adipose tissue-infiltrating viruses such as SARS-CoV-2 can worsen disease in obese individuals."}
{"text": "To better understand the impact of ICP22 binding to CD80 on HSV-1 infectivity and pathogenicity, we mapped the region of ICP22 required to bind the CD80 promoter to a 40-amino-acid (aa) region of ICP22. We constructed a recombinant HSV-1 expressing a truncated form of ICP22 that lacks these 40 aa, which does not bind to the CD80 promoter (KOS-ICP22\u039440) and retains the ability to replicate efficiently in rabbit skin cells, in contrast to ICP22-null virus. The replication of this recombinant virus in vitro and in vivo was higher than that of the ICP22-null virus, but virus replication kinetics were lower than those of the wild-type (WT) control virus. Similar to ICP22-null virus, the KOS-ICP22\u039440 mutant virus increased CD80 expression in dendritic cells (DCs) and interferon gamma (IFN-\u03b3) expression in CD8+ T cells but not CD4+ T cells in infected mouse corneas. In contrast to the significantly reduced virus replication in the eyes of ocularly infected mice, the levels of latency reactivation were similar between KOS-ICP22\u039440 virus and WT virus. Thus, blocking ICP22 binding to the CD80 promoter using a recombinant virus expressing a truncated ICP22 that lacks CD80 promoter binding appears to reduce virus replication and enhance CD8+IFN-\u03b3+ infiltrates in corneas of infected mice, with no effect on latency reactivation.Previously, we reported that herpes simplex virus type 1 (HSV-1) ICP22 binds to the CD80 promoter and suppresses its expression IMPORTANCE Direct binding of HSV-1 ICP22 to the CD80 promoter downregulates the expression of the costimulatory molecule CD80 but not CD86. In this study, we fine mapped the region of ICP22 required for binding to the CD80 promoter and constructed a recombinant virus containing a deletion in ICP22 that failed to bind to the CD80 promoter. This recombinant virus replicated less efficiently in vitro and in vivo than did the WT control virus, although CD80-expressing CD11c+ cells and IFN-\u03b3-expressing CD8+ T cells were increased. Interestingly, the levels of latency and reactivation in the two viruses were similar despite lower virus replication in the eyes of infected mice. Therefore, blocking the interaction of ICP22 with the CD80 promoter could be used to temper the immune response. Followce used 813. Full  signals .ICP22 gene failed to suppress CD80 expression despite significantly reducing virus replication both in vitro and in vivo, leading to enhanced eye disease  HSV-1 suppresses the expression of the costimulatory molecule CD80, but not CD86, in corneas of ocularly infected mice . A varie16\u201322\u2013 disease . TherefoICP22 gene, but not any of the other HSV-1 genes, represses CD80 expression by removing the ability of the ICP22 protein to directly bind to the CD80 promoter   function of CD8, thus blocking cell lysis.HSV-1 carries at least 85 genes , and HSVpromoter . The abiing (CS) . We haveing (CS) . Becausein vitro and in vivo. We now have defined the amino acids required for ICP22 binding to the CD80 promoter and have deleted these amino acids in a recombinant virus . Our results show that (i) in contrast to the parental virus and similar to WT KOS, KOS-ICP22\u039440 virus grew in rabbit skin (RS) cells; (ii) in contrast to WT KOS, KOS-ICP22\u039440 virus expresses a truncated form of ICP22; (iii) in contrast to WT KOS, KOS-ICP22\u039440 virus did not suppress the expression of CD80 on dendritic cells in the corneas of infected mice; (iv) KOS-ICP22\u039440 virus replication is intermediate to those of ICP22-null and WT viruses both in vitro and in the eyes of ocularly infected mice; (v) levels of CD8+ interferon gamma-positive (IFN-\u03b3+), but not CD4+IFN-\u03b3+, cells increased in the corneas of KOS-ICP22\u039440-infected mice compared with mice infected with the WT control virus; and (vi) latency reactivation of KOS-ICP22\u039440 and WT KOS was similar for both viruses.Since the complete deletion of ICP22 increases CD80 and CD8 expression in corneas of infected mice, leading to increased eye disease , the curin vitro and in vivo (ICP22 gene construct with two in-frame copies of a FLAG tag at the 3\u2032 end (We have demonstrated that ICP22 binds to the CD80 promoter and that this binding suppresses CD80 expression  in vivo . Our pree 3\u2032 end  to assese 3\u2032 end . To extee 3\u2032 end . These fe 3\u2032 end .pGL4-EV (control plasmid) or pGL4-CD80p DNA was transfected into HEK 293 (293) cells. The cells were also cotransfected with plasmids expressing ICP22 fragment A, B, or C, and their effect on CD80 promoter activity was determined by measuring luciferase activity 48 h later as we described previously . The effTo further map the suppressive region of ICP22 within fragment C, we created three new ICP22 fragments by dividing fragment C into three fragments: D  (40 aa),P\u2009<\u20090.05). Thus, the deletion of aa 290 to 369 eliminated the suppression of the CD80 promoter by ICP22 and is consistent with the suppressive region of ICP22 being within aa 290 to 369. To further map this activity based on fragment G and overlapping fragments E and F (P\u2009<\u20090.0001). These results suggest that the region of ICP22 that suppresses CD80 promoter activity is located within ICP22 aa 305 to 345.Based on fragments E and F, we created an ICP22 construct lacking 79 aa of ICP22 from aa 290 to aa 369 having an ATG, a 2\u00d7 FLAG tag, and a termination codon . In cont E and F , we crea E and F . This co E and F , ICP22-Hin vitro and in vivo. D22 recombinant virus lacking the entire ICP22 gene was derived from the parental HSV-1 KOS strain (in vitro and in vivo (ICP22 gene with a deletion of 40 aa (aa 305 to 345) within ICP22 (pICP22\u039440). This plasmid also contained 463\u2009bp of KOS sequence upstream of the ICP22 ATG and 554\u2009bp of KOS sequence downstream of the ICP22 termination codon. We used D22 as the parental virus to generate KOS-ICP22\u039440 recombinant virus by cotransfecting pICP22\u039440 DNA and D22 DNA into RS cells as we described previously . Human embryonic kidney (HEK) 293 cells were infected with HSV-1 WT KOS, D22 having a complete deletion of ICP22, or KOS-ICP22\u039440 having a recombinant ICP22 with a 40-aa deletion or were mock infected. As expected, neither mock nor D22 expressed a detectable ICP22 product , 36, 413P\u2009>\u20090.05) (P\u2009<\u20090.001) (P\u2009<\u20090.05) (P\u2009<\u20090.001)  (\u2009>\u20090.05) , but by <\u20090.001) . At 1 PF\u2009<\u20090.05) , 24\u2009h an<\u20090.001) . Similarin vivo, BALB/c mice were infected ocularly with 2\u2009\u00d7\u2009105 PFU/eye of the KOS-ICP22\u039440 mutant virus, WT KOS, or D22. Previously, we showed that D22 replicated at significantly lower levels in mouse eyes than WT KOS (P\u2009<\u20090.01) (P\u2009<\u20090.001)  . Similar<\u20090.001) . These red above  and may 5 PFU/eye of KOS-ICP22\u039440 or KOS virus. Individual TG from 18 to 20 infected mice were harvested on day 28 p.i., and latency levels were determined by real-time PCR or quantitative reverse transcription-PCR (qRT-PCR) based on HSV-1 latency-associated transcript (LAT) expression as described in Materials and Methods. Unlike the lower viral replication in the eyes of KOS-ICP22\u039440-infected than in WT KOS-infected mice (P > 0.05)  . This is > 0.05) .5 PFU/eye of HSV-1 KOS-ICP22\u039440 and KOS after corneal scarification. Virus reactivation was analyzed by explanting individual TG from 10 infected mice on day 28 p.i. as described in Materials and Methods. As with latency levels, mice infected with KOS-ICP22\u039440 or KOS virus had similar reactivation times (P\u2009>\u20090.05)  . Howeverin vitro and in vivo and that a recombinant HSV-1 lacking ICP22 upregulated CD80 and IFN-\u03b3 expression in the corneas of ocularly infected mice  analysis revealed that CD80 expression in DCs was higher in KOS-ICP22\u039440-infected mice than in KOS-infected mice (2.19% versus 0.99%) (+CD80+ expression in the corneas of infected mice than in mice infected with WT KOS virus (P < 0.05)  (+IFN-\u03b3+ cells in the corneas of infected mice than in those from WT KOS virus-infected mice (P < 0.05)  (P > 0.05)  . The exp < 0.05) . The pers 2.67%) , and res < 0.05) . The pers 0.18%)  and were > 0.05) . Thus, aing CD80 , 38.in vitro and in vivo, and (iii) compare the immunogenicities of this recombinant virus and the WT virus relative to primary HSV-1 infection, immune infiltrates in the eye, and latency reactivation in ocularly infected mice.Our previous studies demonstrated that (i) HSV-1 ICP22 downregulates the expression of CD80 but not that of CD86, in the presence or absence of anti-HSV-1 antibodies ; (ii) a in vitro and in vivo. ICP22 is one of the five HSV-1 immediate early genes, and the initial steps of replication begin with these five ICP proteins  play any role in CD80 suppression.In this study, we demonstrated that KOS-ICP22\u039440 virus significantly enhanced the expression of CD80 by CD11c in the corneas of ocularly infected mice relative to WT virus. These results are consistent with our previous study showing that infection of mice with WT virus suppressed CD80 expression in DCs , while t disease , 38. Furscarring . These rin vitro and in vivo, mice infected with this virus had levels of latency and reactivation similar to those of the WT virus. This is likely a consequence of immune escape due to a lack of ICP22 binding to the CD80 promoter. The lack of a correlation between viral load, latency, and reactivation is probably due to higher CD80 expression levels. However, the positive correlation between latency and reactivation is consistent with our previous studies  were used.Triply plaque-purified WT KOS , D22 , and KOS-ICP22\u039440 viruses were used in this study and grown as we described previously . The D22eviously , 33. Rabeviously . Cells wICP22 gene with a 40-aa deletion corresponding to aa 305 to 345 of ICP22. This construct also contained 463\u2009bp of KOS sequences upstream of the ICP22 ATG and 554\u2009bp downstream of the ICP22 termination codon. The resulting plasmid, designated pICP22\u039440, contains 1,152\u2009bp of the truncated ICP22 gene bounded by 463- and 554-bp adjacent regions of ICP22 sequences.The truncated ICP22 plasmid was constructed using sequences of HSV-1 strain KOS . We syntICP22 gene was completely deleted. D22 virus grows in Vero cells but not in RS cells (ICP22 gene by PCR using ICP22 forward (GCGCCACCTGATACGCGACTG) and reverse (CGACCGCAGACAGCCAGGGC) primers. The PCR product length for WT ICP22 was 458\u2009bp, and that for truncated ICP22 was 338\u2009bp. All selected plaques were verified as having 338-bp amplified products, and a single plaque chosen for purification was designated KOS-ICP22\u039440.The parental virus for the KOS-ICP22\u039440 construct was D22, a mutant of the HSV-1 KOS strain in which the RS cells . KOS-ICPRS cells . BrieflyICP22 gene  and two copies of FLAG sequences inserted into the BamHI site of pcDNA3.1. We also synthesized ICP22 fragments corresponding to different regions of ICP22 . Using a dual-luciferase reporter system , two individual reporters were introduced simultaneously to determine responses within the same cells. Sample preparation was conducted as described by the manufacturer (Promega). Cells were washed with phosphate-buffered saline (PBS) and lysed in lysis buffer, and the collected supernatants were transferred to 96-well plates. The luminometer  was primed with luciferase and Stop & Glow reagents. Assays were conducted in replicates of 10, and means \u00b1 standard errors of the means (SEM) were calculated from three separate experiments (n\u2009=\u200930).Transfection experiments were conducted using 293 cells and Gene Porter 2  as we described previously . BrieflyRS cell monolayers at 70 to 80% confluence were infected with 0.1 or 1 PFU/cell of WT KOS or KOS-ICP22\u039440. Virus was harvested at 24 and 48\u2009h postinfection by two cycles of freeze-thawing of the cell monolayers with medium. Virus titers were determined by standard plaque assays on Vero and RS cells.5 PFU/eye of HSV-1 strain KOS, KOS-ICP22\u039440, or D22 with corneal scarification as we described previously . The amplicon length for the LAT primer set is 81\u2009bp, corresponding to LAT nucleotides (nt) 119553 to 119634. Relative LAT RNA copy numbers were calculated using standard curves generated from the pGem5317 plasmid as we described previously  buffer, and centrifuged in microcentrifuge tubes at 14,000\u2009rpm for 15\u2009min. The supernatant of each lysate was transferred to a new tube and kept on ice. Lysate protein concentrations were measured using a reducing-agent-compatible bicinchoninic acid (BCA) protein assay kit . We loaded 40\u2009\u03bcg of the total whole-cell lysate onto each lane of a 10% SDS-PAGE gel for electrophoresis. The blot was probed overnight using primary anti-ICP22 at 1:5,000, rabbit polyclonal antibody 413 , and \u03b2-actin monoclonal rabbit antibody at 1:5,000 . For detection, a secondary anti-rabbit IgG horseradish peroxidase (HRP)-linked antibody was diluted at 1:4,000  and incubated for 2\u2009h. Polyvinylidene difluoride (PVDF) membranes  were washed three times with 1\u00d7 Tris-buffered saline\u2013Tween (TBS-T) and developed using Signalfire ECL .5 PFU/eye of KOS-ICP22\u039440 or WT KOS virus. Corneas from three mice were combined, and single-cell corneal suspensions were prepared as we described previously  using GraphPad v9 . Results were considered statistically significant if the P value was <0.05.Data were analyzed by Student\u2019s"}
{"text": "To evaluate objective criteria of Magnetic Resonance Imaging (MRI) of Placenta Accreta Spectrum disorder (PAS) analyzing interobserver agreement and to derive a model including imaging and clinical variables to predict PAS.A retrospective review including patients submitted to MRI with suspicious findings of PAS on ultrasound. Exclusion criteria were lack of pathology or surgical information and missing or poor-quality MRI. Two radiologists analyzed six MRI features, and significant clinical data were also recorded. PAS confirmed on pathology or during intraoperative findings were considered positive for the primary outcome. Variables were tested through logistic regression models.Final study included 96 patients with a mean age of 33 years and 73.0% of previous C-sections. All MRI features were significantly associated with PAS for both readers. After logistic regression fit, including MRI signs with a moderate or higher interobserver agreement, intraplacental T2 dark band was the most significant radiologic criteria, and ROC analysis resulted in an AUC\u00a0=\u00a00.782. After including the most relevant clinical data (previous C-section) to the model, the ROC analysis improved to an AUC\u00a0=\u00a00.893.Simplified objective criteria on MRI, including intraplacental T2 dark band associated with clinical information of previous C-sections, had the highest accuracy and was used for a predictive model of PAS. The Placenta Accreta Spectrum disorder (PAS) encompasses previous terms such as morbidly adherent placenta, placental invasion, and abnormally invasive place,The most common risk factors for PAS are prior cesarean delivery and placenta previa, with rising incidence in the past years.,3 MoreovUltrasound is the most widely used method for the diagnosis during the prenatal period given wide availability and relatively low-cost method and has a good accuracy mainly for the anterior uterine wall evaluation. Besides that, ultrasound allows a longitudinal assessment of women at risk for PAS increasing its possibility to reach the final diagnosis.[17]Several studies have evaluated MRI criteria associated with PAS; however, most articles evaluated isolated criteria, had smaller sample sizes, or did not have pathological and surgical confirmation., 24, 25 The Institutional Review Board (IRB) approved this retrospective study and granted a waiver of consent. This is a tertiary hospital, and the obstetric department is a reference for high-risk patients. Patients that are diagnosticated by ultrasound with placenta previa and have the suspicion of PAS are routinely sent to MRI. Therefore, the authors included in the study pregnant women who performed aj MRI under those circumstances during the period from July 2008 to December 2017. At last, the authors had a total of 110 patients, but 14 patients were not included in the analysis for different reasons, such as an anatomopathological study of the placenta not available (n\u00a0=\u00a02), surgical description not available (n\u00a0=\u00a03), MRI images not available (n\u00a0=\u00a02) and low-quality MRI images (n\u00a0=\u00a07) .Fig. 1FlThe following clinical data were also recorded: maternal age, gestational age at MRI, gestational age at delivery, the time between MRI and delivery, ethnic group, parity, previous C-sections, abortions, history of curettage, and other uterine surgeries. PAS confirmed on the pathology of surgical specimen and/or signs of PAS during intraoperative findings were considered as positive for the primary outcome .Table 1CAll MRI examinations were performed on a 1.5T unit  with body array coils, including axial, coronal, and sagittal T2-weighted Single Shot Fast Spin-Echo (SS-FSE); axial, coronal, and sagittal balanced steady-state free precession (Fast Imaging Employing Steady-State Acquisition \u2013 FIESTA); axial and sagittal fat-suppressed ultra-fast spoiled gradient-echo T1-weighted (LAVA) without intravenous contrast media.The parameters for SS-FSE images were Repetition Time (TR)/Echo Time (TE), 650\u201316000 / 50\u201390 msec; Flip Angles (FA), 90; Field of View (FOV), 120\u2013480 mm; slice thickness, 4.5 mm. For balanced \u2012 steady-state free-precession \u2012 FIESTA images, they were TR/TE, 3800\u20136000/ 50\u201390 msec; FA\u00a0=\u00a090; FOV, 120\u2013480 mm; slice thickness, 4.5 mm, and for T1 LAVA images, they were: TR/TE, 200\u2013230 / 1.8\u201211 msec; FA\u00a0=\u00a080; FOV, 340\u2013380 mm; slice thickness, 4.5 mm.Two board-certified blinded radiologists with different levels of expertise  retrospectively analyzed the exams on a Likert scale1- Intraplacental abnormal vascularity: tortuous enlarged flow voids observed on T2 and corresponding high signal on FIESTA, indicating vascular flow\u00a0- 5: > 6mm\u00a0- 4: 5-6 mm\u00a0- 3: 3-4 mm\u00a0- 2: 1-2 mm\u00a0- 1: absentIntraplacental T2 dark band: wedge-shaped areas of low signal intensity on T2-weighted images and FIESTA (19) , Fig. 4.\u00a0- 5: > 20 mm\u00a0- 4: 15-20 mm\u00a0- 3: 10-14 mm\u00a0- 2: < 10 mm\u00a0- 1: absent2- Placental bulge: focal bulging of the uterine contour.,19,24,27\u00a0- 5: clear loss of myometrial congruency or invasion of adjacent organs\u00a0- 4: focal bulges\u00a0- 3: disruption of the normal pear shape of the uterus with the lower uterine segment being wider than the fundus\u00a0- 2: slight irregularities on uterine contours\u00a0- 1: normal contours3- Placental protrusion sign: placenta pushing inferior to the internal os.[21]\u00a0- 5: > 15 mm\u00a0- 4: 11-15 mm\u00a0- 3: 6-10 mm\u00a0- 2: < 5 mm\u00a0- 1: absent4- Myometrial thinning: focal thinning and indistinctness of the myometrium and loss of thin dark uteroplacental interface on T2-weighted images.,28,295- Heterogeneous placenta: marked heterogeneous intensity within the placenta .18,30, , 32Fig. The MRI signs used for evaluation were:The surgical description had three outcomes: normal discharge of the placenta, focal attachment , and hysterectomy. Only hysterectomy was considered positive for PAS. For pathological analyses, there were five outcomes: normal placenta, focal acretism, accreta, increta and percreta. Normal placenta and focal acretism were considered negative for pathological PAS.t-Student test for parametrical variables.Descriptive analyses of the data were performed by using absolute and relative frequencies, central tendency, and dispersion measures. The comparison between the groups of PAS and no PAS was made with a Mann-Whitney test for non-parametrical variables and The interobserver variability of all MRI signs was assessed using the Kappa (\u03ba) value. A \u03ba-value of \u2264 0.20 was interpreted as slight agreement, 0.21\u20130.40 fair agreement, 0.41\u20130.60 as moderate agreement, 0.61\u20130.80 as substantial agreement, and \u2265 0.81 as almost perfect agreement.[33]For the development of the predictor model, both readers reassessed the discordant criteria and reviewed it in consensus. This strategy was made to extract the best possible information from the MRI and build the best predictor model possible. To identify which MRI signs and clinical variables were most significant, analyses through multiple binary logistic regression models were made in other to identify its coefficients, Odds Ratios (OR), and their respective 95% Confidence Intervals (95% CI). The significant variables (p < 0.005) were tested on the multiple modeling and those which presented a value of p < 0.20 by the Stepwise technique.Receiver Operating Characteristic (ROC) analysis was used for evaluation of the diagnostic performance using only the most significant MRI sign and using the most significant MRI sign combined with the most significant clinical data for PAS. The areas under the ROC Curves (AUC) were estimated nonparametrically for non-ordinal score assessments.Analyses were conducted using statistical software .The final sample of 96 patients was divided into two groups according to anatomopathological study and/or surgical descriptions: patients with PAS (n=42) and patients without PAS (n=54) .For all the clinical variables analyzed, only parity and previous C-sections showed significant differences between the PAS and no PAS groups. All other variables: abortions, curettage, maternal age, gestational age at MRI, gestational age at delivery, and time interval between MRI and delivery showed no significant differences between the PAS and no PAS groups .Table 2AAll MRI signs  showed significant differences between the PAS and no PAS groups for both reader A and reader B .Table 3MThe Sensitivity (SEN), Specificity (SPE), Positive Predictive Value (PPV), and Negative Predictive Value (NPV) for each MRI sign are shown in .Concordance coefficient values are shown in . IntraplInitially, in other to create a reproducible predictor model, the authors excluded the MRI signs that showed a slight agreement  and fair agreement  in the interobserver analysis.The remaining MRI signs  and the most relevant clinical sign (previous C-section) were analyzed using a multiple binary logistic regression model. The most significant clinical variable in isolation was the presence of a previous C-section with an OR\u00a0=\u00a03.35 (95% CI 1.88\u20125.97), and the most significant MRI sign was intraplacental T2 dark band with an OR\u00a0=\u00a012.67 (95% CI 3.97\u201240.45) as shown in The result of ROC analyses for the prediction of PAS using only the most significant MRI sign  and using the most significant MRI sign combined with the most significant clinical data (previous C-sections) are shown in Finally, the authors derived a predictor model for the estimated PAS probability according to the number of previous C-sections for patients that had or not the presence of the intraplacental T2 dark band sign .The analysis in the present study has confirmed that MRI signs of PAS  were associated with the presence of PAS for both inexperienced and experienced radiologists as observed in previously published studies.The authors have also evaluated the interobserver variability of MRI analyses of experienced and less experienced radiologists, knowing that the previous experience of the radiologist improves the diagnostic performance, as shown by Ghezzi et\u00a0al.[34]Regarding clinical variables, they can be important risk factors for the development of PAS, mainly in relation to the previous C-section, as previously shown.The predictive model, including only MRI sing , had great accuracy (AUC\u00a0=\u00a00.782), which was further improved (AUC\u00a0=\u00a00.893) when adding previous C-sections. These results demonstrate that this model can be useful for obstetricians to evaluate the estimated probability of PAS on delivery very easily so that they can properly manage it in advance and are not surprised with a potential high-risk procedure.There are some limitations of the present study. To begin with, it was performed in a tertiary hospital with high-risk patients selected from abnormal ultrasound, inducing selection bias. Moreover, radiologists in the study were well trained for this rare condition, given the particularity of the hospital, and may not reflect standard radiology practice. Some of the advantages of the study are its high number of patients included compared with previous studies and the use of a gold standard combining surgical description and pathological analyses. According to the sample, the results must be analyzed carefully. The reduced sample size contributes to reproducibility issues, including false positives and false negatives. However, the model was analyzed considering the number of outcomes to avoid an overfitting model.Simplified objective criteria on MRI  combined with clinical data (previous C-sections) contributed to the creation of a predictive model, which the authors believe can facilitate and improve the diagnostic accuracy by providing a more objective result for the MRI report. Besides, it allows a higher uniformization of the analyses between radiologists with different levels of expertise and facilitates information to obstetricians. Based on these findings, the authors suggest the application of this model in prospective studies in order to elucidate external validation issues.Rodrigo Pamplona Polizio: Conceptualization, methodology, data collecting, writing-original draft.Fernando Ide Yamauchi: Conceptualization, methodology, data collecting, review the final version.Renata Franco Pimentel Mendes: Data collecting, review the final version.Stela Verzinhasse Peres: Formal analysis.Mario Macoto Kondo: Review the final version.Rossana Pulcineli Vieira Francisco: Conceptualization, metodology, writing-review & editing.The authors declare no conflicts of interest."}
{"text": "These test kits and on-mobile DIC were used for the on-site determination of nutrients in the Pak Bang and Bang Yai canals, the main canals in Phuket, Thailand. The concentrations of nitrite, nitrate, and phosphate were undetectable to 0.60 mg L\u22121, undetectable to 2.98 mg L\u22121, and undetectable to 0.52 mg L\u22121, respectively.Portable colorimetric hydrogel test kits are newly developed for the on-site detection of nitrite, nitrate, and phosphate in water. Griess-doped hydrogel was prepared at the bottom of a 1.5 mL plastic tube for nitrite detection, a nitrate reduction film based on zinc powder was placed on the inner lid of a second 1.5 mL plastic tube for use in conjunction with the Griess-doped hydrogel for nitrate detection, and a molybdenum blue-based reagent was entrapped within a poly hydrogel matrix placed at the bottom of a third 1.5 mL plastic tube to detect phosphate. These test kits are usable with on-mobile digital image colorimetry (DIC) for the on-site determination of nutrients with good analytical performance. The detection limits were 0.02, 0.04, and 0.14 mg L Water pollution is a major challenge that humanity is facing. Specifically, nutrient pollution caused by excess nitrogen and phosphorus in the water can have diverse, extensive effects on public health, environments, and economies. Nitrogen and phosphorus are the most important and abundant nutrients that occur naturally in aquatic ecosystems. However, substances from human activities, such as fertilizers, wastewater, automobile exhaust, and animal waste, introduce excess amounts of these nutrients into the ecosystem faster than it can adapt. This results in their overabundance, leading to increased primary production of biomass, oxygen depletion, and toxic algal blooms (eutrophication) . Eutroph2\u2212) and nitrate (NO3\u2212) are nitrogen nutrients that are integral parts of the nitrogen cycle in the environment, whereas phosphates are the most common phosphorus nutrients. Nitrite is an important indicator of water quality, and it is generally found in surface water at low concentrations (0.07 mg L\u22121 NO2\u2212\u2013N) because it oxidizes to nitrate easily. Orthophosphates are the most stable phosphates, and they can exist in a variety of species, such as orthophosphate/phosphate (PO43\u2212), hydrogen phosphate (HPO42\u2212), dihydrogen phosphate (H2PO4\u2212), and phosphoric acid (H3PO4), based on different pH values [\u22121 to 0.03 mg L\u22121 [\u22121 [\u22121, respectively [Nitrite  Griess and molybdenum blue-based reagents were entrapped within a poly (PVA) matrix to fabricate small, portable test kits in 1.5 mL plastic tubes for nitrite and phosphate, respectively. For nitrate detection, zinc powder was entrapped within a tapioca starch film to fabricate a nitrate reduction film on the inner lid of the 1.5 mL plastic tube containing the Griess-doped PVA nitrite test kit. This film reduces nitrate to nitrite, which is then subjected to a colorimetric reaction with the Griess-doped PVA nitrite test kit at the bottom of the tube. These test kits will make the colorimetric testing of these nutrients easier and more portable while eliminating any risk from hazardous chemicals. They are also environmentally friendly methods since PVA and tapioca starch are biodegradable polymers. Digital image colorimetry (DIC) based on a smartphone application (on-mobile DIC) was used in conjunction with the developed hydrogel test kits to eliminate the need for a spectrophotometer ,9. This The in-tube hydrogel test kits for nitrite a and nitw/v ammonium molybdate, 10 mL 4.5 M sulfuric acid, and 1 mL 1.25% w/v potassium antimony tartrate) and the 20% ascorbic solution was determined. The findings showed that 3:1 provided the darkest color product with the lowest RGB intensities  was also optimized from 5% to 15%, and a 10% w/v PVA solution provided the darkest color product  was then optimized, and results indicated that 0.25 mL provided the darkest color product with good characteristics (w/v PVA solution was mixed with 0.25 mL molybdenum blue-based reagent to prepare the polymer mixture for phosphate detection. The amount of the cross-linker (EGDE) was also optimized by adding it (1 to 10 \u00b5L) into the obtained polymer mixture (1.25 mL), and 2.5 \u00b5L was selected as the optimal value because it yielded the darkest color product and good hydrogel characteristics  and chemical cross-linking (use of EGDE as a cross-linker), as done in our previous studies ,19 but m\u22121 was attributed to the O\u2013H stretching from sulfuric acid and/or ascorbic acid; this may have overlapped with the O\u2013H stretching from the PVA, which appeared as a broad absorption peak at 3268 cm\u22121 in the blank hydrogel (PVA and EGDE without reagent) [\u22121 [\u22121, a slight shift from that of the blank hydrogel  [\u22121 [\u22121. The peak at 1676 cm\u22121 was assigned to the C=C stretching from ascorbic acid [\u22121 might be attributed to the vibration of enol hydroxy [\u22121 might be attributed to the Sb\u2013O from potassium antimony tartrate [The characterization of the hydrogel test kit for phosphate was investigated. The scanning electron microscopy (SEM) images of the test kit revealed a homogeneous entrapment of the molybdenum blue-based reagent within the hydrogel matrix a,b. The reagent) . It may ent) [\u22121 . A stret910 cm\u22121 ). The st910 cm\u22121  was obse990 cm\u22121 , may havm\u22121 [\u22121)  and/or C[\u22121) [\u22121 ) and thubic acid ,24, whertartrate .Pink-violet products were obtained from nitrite and nitrate testing, whereas blue products were obtained from phosphate testing . They weR, IG, and IB) of the blue products (2.5 mg L\u22121) for \u22123.4%, \u22122.3%, and +0.9%, respectively. Moreover, the hydrogel test kit for nitrite can be frozen (\u221220 \u00b0C) for three months, and the nitrate reduction films can be stored in a desiccator (25 \u00b0C) for six months [The blue products darkened with increasing reaction time a, and 10x months . Therefo\u22121) to pH 1 to 12 using HCl and NaOH before testing. The results  were obtained from the analysis of the color products  and red (IR), which agrees with a previous report [B was higher than IG and IR because of the higher reflection of blue light  and limit of quantification (LOQ) (0.07 mg L\u22121) for nitrite analysis were lower than those of nitrate . These are lower than the concentration limits in surface water recommended by the WHO of 3 and 50 mg L\u22121 for nitrite and nitrate, respectively [\u22121, equivalent to 0.05 and 0.15 mg PO4\u2013P L\u22121, respectively. This LOD is lower than the maximum concentration of total phosphorus in discharge from municipal wastewater treatment plants in Thailand (2 mg L\u22121 [4\u2013P in flowing water by the US EPA (\u22640.1 mg L\u22121) [\u22121, [4\u2013P in streams at points where they discharge into lakes or reservoirs (\u22640.05 mg L\u22121) [\u22121) against the concentration quantified by the IR calibration graph was +3.0%, whereas +3.0% and \u22124.8% RE were obtained from the IG calibration graphs for nitrite and nitrate, respectively. These results indicate the excellent accuracy of the developed method. A good intraday precision (0.70% to 1.52% relative standard deviation (RSD)) was also obtained from testing 12 hydrogel test kits for phosphate, whereas the interday precision from nine test kits over three days was in the range of 0.70% to 1.69% RSD. The performance of the developed method was similar to that in other reports  ,38 and m mg L\u22121) ,38. The  reports , but it \u22121 were tested with the hydrogel test kits for phosphate. No color product was observed from any of the ions (\u22121) to investigate the tolerance ratios. The results in \u22121) using seawater sampled from the Andaman Sea (far from human activity) instead of ultrapure water. The sensitivity of the IR standard graph from seawater was different from that obtained using ultrapure water by \u22123.83%, indicating that the seawater matrix exerted little effect. Ascorbic acid and formic acid were also tested with nitrate, nitrite, and phosphate test kits, and no color products were observed. Phosphate (5 mg L\u22121) can tolerate ascorbic acid and formic acid at high concentrations  can tolerate formic acid at 10,000 mg L\u22121, but at lower concentrations for ascorbic acid (25 mg L\u22121).Various ions at ~10,000 mg Lthe ions , indicat\u22121, undetectable to 2.98 mg L\u22121, and undetectable to 0.52 mg L\u22121, respectively , whereas a mean phosphate concentration of 0.50 \u00b1 0.03 mg L\u22121  was found by the developed method at sampling points P12 and P14. The higher mean concentration of the developed method was due to its LOQ of 0.47 mg L\u22121, which means that the method cannot quantify phosphate in the range of the standard method (0.30 to 0.42 mg L\u22121). The nutrient pollution index (NPI) was calculated by the sum of the nitrate, nitrite, and phosphate indices [iC is the mean concentration of nutrients in water and iMAC is the maximum allowable concentration of nutrients in surface water recommended by the WHO , moderate (1 \u2264 NPI \u2264 3), considerable (3 < NPI \u2264 6), or very high (NPI > 6) [NPI of the Bang Yai canal (0.21) was lower than that of the Pak Bang canal (0.25), but both values indicated an absence of pollution, similar to the NPI of 0.27 at sampling points P10 to P15.The nitrate concentration was commonly higher than that of nitrite; this may have been due to the oxidation of nitrite to nitrate. It was also higher than that of phosphate, as in other reports ,46, and ectively . The higectively . Polluti\u22121, >99% hydrolyzed), zinc powder, and EGDE (98%) were from Sigma-Aldrich . Tapioca starch  was bought from a supermarket; a spectrophotometer showed that it had 27% amylose content, which accorded with the Thai agricultural standard TAS 4000-2003 . All standard solutions were prepared with ultrapure water from a water purification system .Sodium nitrate, sodium nitrite, ammonium heptamolybdate tetrahydrate, and potassium antimony tartrate were purchased from Carlo Erba . Disodium hydrogen phosphate and phosphoric acid (85%) were from Ajax Finechem , and sulfuric acid was obtained from J.T. Baker . NED and ascorbic acid were bought from Fisher Scientific , and sulfanilamide was purchased from Panreac . PVA  or molybdenum blue-based reagent (0.25 mL) was mixed with 1 mL of the PVA solution, the mixture was stirred for a few minutes, 2.5 \u03bcL EGDE was added, and the mixture was stirred for another minute. Each polymer mixture (100 \u03bcL) was transferred into the bottom of a 1.5 mL plastic tube and kept in a freezer for 24 h, and the result was the hydrogel test kits. Blank hydrogel test kits were also prepared using the same procedure but without the reagents.The hydrogel test kits for nitrite, nitrate, and phosphate detection were developed by entrapping Griess and molybdenum blue-based reagents within PVA hydrogel matrices. Each PVA solution was prepared by dissolving PVA granules (1 g) in ultrapure water (10 mL) at 120 \u00b0C and stirring the mixture for 30 min. The clear, viscous solution was cooled at room temperature before adding either the Griess or molybdenum blue-based reagent, and then a cross-linker (EGDE). The Griess reagent was prepared by dissolving 0.3 g sulfanilamide, 45 mg NED, and 1.5 mL 85% phosphoric acid in 10 mL ultrapure water. The molybdenum blue-based reagent was prepared by mixing 4 mL 10% The nitrate reduction film was prepared per our previous report . TapiocaThe morphology of the hydrogel test kit for phosphate was investigated using scanning electron microscopy , and the functional groups were investigated using Fourier-transform infrared (FTIR) spectrophotometry  with the KBr pellet method.\u22121) were prepared by diluting stock solutions (500 mg L\u22121) with ultrapure water. For colorimetric testing, the standard solutions (~1.5 mL) were added to the plastic tubes containing the hydrogel test kits and left for 10 min. Three replications were conducted at each standard concentration of nitrate, nitrite, and phosphate. DIC based on a custom-built smartphone application was then applied for quantitative analysis. The colorimetric product was placed in a sample holder inside a custom-built RGB analysis box (8.5 \u00d7 9.5 \u00d7 6.25 inches) modified from previous works [R, IG, and IB values of the color products against the standard concentrations.Standard solutions of sodium nitrate, sodium nitrite, and disodium hydrogen phosphate  against their established calibration curves and recovery percentage from real spiked samples.System performance parameters were investigated: the linear range, correlation coefficient, sensitivity, LOD, and LOQ. The LOD and LOQ were calculated based on the International Council for Harmonisation (ICH) harmonized tripartite guideline , whereasSurface water and seawater samples were randomly obtained from the Pak Bang canal, Bang Yai canal, and estuaries of both canals. A total of 135 grab samples were collected from 15 sampling points from the Pak Bang canal  of these colorimetric products can be analyzed using a custom-built smartphone application and used to quantify these nutrients with good analytical performance. The relationships between IG and the nitrite and nitrate concentrations were linear in the range of 0.1 to 1 mg L\u22121, with a good correlation coefficient (R > 0.99), similar to that of the relationship between IR and the phosphate concentration in the range of 0.25 to 5 mg L\u22121. The obtained LODs for these nutrients were lower than the maximum allowable concentration of nutrients in surface water recommended by the WHO; they were accurate (<4.8% RE) and precise (<1.85% RSD). These test kits and on-mobile DIC were then used for the on-site determination of nutrients in the Pak Bang and Bang Yai canals, which are the main canals in Phuket, Thailand. The nitrite, nitrate, and phosphate concentrations ranged from undetectable to 0.60 mg L\u22121, undetectable to 2.98 mg L\u22121, and undetectable to 0.52 mg L\u22121, respectively, which are under the limits set by the WHO standard. The NPIs of both canals indicated an absence of pollution.In-tube hydrogel test kits were used in conjunction with on-mobile DIC for on-site analysis of nutrients in surface water and seawater in Phuket, Thailand. Pink-violet products were obtained from nitrite testing using Griess-doped hydrogel test kits. A reduction film based on zinc powder was used to reduce nitrate to nitrite before testing the resultant nitrite with a Griess-doped hydrogel test kit for nitrate testing. Blue products were obtained from phosphate testing with a molybdenum blue-doped hydrogel test kit. The RGB intensities (I"}
{"text": "CACNA1C gene\u2013encoding for the major Ca2+ channel of the heart\u2013may exhibit a variety of clinical manifestations. These include typical or atypical Timothy syndromes (TS) which are associated with multiple organ manifestations, and cardiac involvement in form of malignant arrhythmias, QTc prolongation, or AV block. \u201cCardiac only\u201d Timothy syndrome (COTS) shows no extracardiac manifestation, whereas some CACNA1C gene mutations are associated with QTc prolongation alone .Mutations in the CACNA1C gene mutation associated syndromes, including TS, COTS and isolated LQT8 via major databases published from 2004 through 2019 was performed. Detailed patient-level phenotypic and genotypic characteristics, as well as long-term outcome measures were collected and compared between pre-specified patient groups, defined both on phenotype and genotype.A systematic search of the literature reporting cases of CACNA1C exon 8/8A vs. non-exon 8/8A mutation carriers. TS showed a high degree of genetic homogeneity, as the p.Gly406Arg mutation either in exon 8 or exon 8A alone was responsible for 70% of the cases.A total of 59 TS, 6 COTS, and 20 isolated LQT8 index cases were identified. Apart of syndactyly or baldness, there were no major differences regarding clinical manifestations or outcome measures between TS subtypes, either defining TS subtypes on the genotype or based on the phenotype. Both subtypes were characterized by an extreme degree of QTc prolongation (median \u2265600 ms) which were reflected in high major adverse cardiac event rate. On the other hand, there were marked differences between TS, COTS, and isolated LQT8. Timothy syndrome was characterized by a much earlier disease onset, much more pronounced QTc prolongation and much higher mortality rate than COTS or isolated LQT8. Similar differences were observed comparing CACNA1C gene show important clinical differences. Timothy syndrome is associated with the most severe clinical phenotype and with the highest risk of morbidity and mortality. However, distinguishing TS subtypes, in any form, are not supported by our data.Clinical phenotypes associated with mutations in the https://www.crd.york.ac.uk/prospero/], identifier [CRD42020184737].[ The channel has several subunits, including the \u03b11C-subunit, responsible for voltage sensing, for conduction pore formation, and for the gating mechanism. The fully functional channel complex is comprised of an additional intracellular \u03b2 subunit and an extracellular \u03b12\u03b4 subunit. The \u03b11C subunit has 4 domains (I\u2013IV), each with six transmembrane-spanning segments (S1\u2013S6). S1\u2013S4 are the voltage-sensitive subunits, whereas S5\u2013S6 are the selectivity filter. When the membrane is depolarized, the S4 domain approaches the cytoplasmic ends of the S5 and S6 helices and the conduction pore opens. Changes in L-type calcium channel function  can affect cardiac myocyte contractility and arrhythmogenicity. The channel is expressed in many tissues of the body , which is characterized by QTc prolongation, AV-block, congenital heart defects, facial dysmorphisms, episodic hypoglycemia and neurologic symptoms including developmental delays, possible autism, seizures, and intellectual disability. The most distinctive morphological hallmark of TS1 is syndactyly, in contrast to atypical Timothy syndrome  patients, who have no syndactyly but carry many of the other multisystemic manifestations of the disease  (Carriers of exon 8A p.Gly406Arg 2)CACNA1C mutations [formerly categorized as Timothy syndrome subtype 2 (TS2) in the strictest sense] (Carriers of exon 8 p.Gly406Arg 3)CACNA1C mutations  (Carriers of exon 8 p.Gly406Arg and pGly402Ser  report] .4)CACNA1C mutations .Carriers of all exon 8 5)CACNA1C mutations.Carriers of non-exon 8/8A According to reported phenotypic manifestations patients were divided into the following three groups:1)TS . Two subgroups, i.e., typical TS (defined as patients with syndactyly) and atypical TS (defined as patients without syndactyly) were also analyzed separately.2)Cardiac only TS .3)Isolated long-QT syndrome 8 .Proven mosaic TS cases, reported as such, present in very small numbers in the reported publications, were not considered, taking the very specific genetic constellation of these cases into consideration.For all the comparator groups two sets of comparisons were made: (i) including index patients only  (ii) including all affected patients .CACNA1C mutations. All the mutations were re-evaluated in ClinVar1 and Varsome.2As many of the considered publications were published before the standards for the interpretation of sequence variants were issued by the American College of Medical Genetics and Genomics and the Association for Molecular Pathology (ACMG/AMP) in 2015,  we reassU-test or the Kruskal\u2013Wallis test was used to detect differences between groups. A p < 0.05 value was considered as statistically significant. All calculation was made by IBM SPSS statistical software .For descriptive statistics the number of cases and percentage were calculated for each group in case of categorical and median and interquartile range in case of continuous variables. The differences between groups in case of. categorical variables were examined using the Chi-square test and Fisher\u2019s exact test. For continuous outcomes, because of the origin of the data, non-parametric methods, such as Mann\u2013Whitney Excluding reports on mosaic patients, \u201323 a totOut of the 134 patients, there were 85 index patients and 49 additional family members. Out of the 85 index patients 59 suffered from TS, 6 from COTS and 20 from isolated LQT8, respectively. In the entire patient population (index patients and relatives), there were 60 patients with TS, 15 patients with COTS and 59 patients with isolated LQT8 .CACNA1C mutations were extracted from the reports , 6 pts. with exon 8 p.Gly406Arg mutations, 12 pts. with exon 8 p.Gly406Arg/p.Gly402Ser mutations and 16 pts. with exon 8 mutations . In further five patients  it was not unequivocally reported and was impossible to determine whether the patients carried the p.Gly406Arg mutation in exon 8 or in exon 8A. \u201328 Tabl.p = 0.019) and more pts. were diagnosed in the first year of life .The detailed comparison of the groups is presented in Marked QTc prolongation (>500 ms) was present in all the patients, except two patients with exon 8 mutation. The degree of QTc prolongation (maximum QTc) was similar in the groups . There was no difference in the utilization of pacemaker/ICD implantation or of left cervical sympathectomy. MACE rate was high (67\u201383%) but was not different in the groups.The detailed comparison of the groups is presented in There was one additional family member with exon 8 mutation. His inclusion did not alter any of the statistical comparisons.There were 52 index patients with exon 8/8A and 33 index patients with non-exon 8/8A mutations. Exon 8/8A mutations almost all clustered at codon 402 (7 cases), 405 (2 cases), and 406 (42 cases), while the most frequently affected codons in non-exon 8/8A mutation carriers were codon 518 (three cases with p.Arg518Cys mutations and one case with p.Arg518His mutation), codon 857 (one case with p.Pro857Leu and p.Pro857Arg mutations each), codon 858 (four cases with p.Arg858His mutation), codon 1166  and codon 1473 (two cases with p.Ala1473Gly mutation) .The detailed comparison of the two groups is presented in p < 0.001). Extra-cardiac manifestations  were significantly more frequent in patients with exon 8/8A mutations. As TS was the overwhelmingly prevalent phenotype in patients with exon 8/8A mutations, the major phenotypic characteristics of TS were all significantly more frequent in patients with exon 8/8A mutations. QTc prolongation was present in all the 52 patients with exon 8/8A mutations, while it was seen in only in 79% of the patients with non-exon 8/8A mutations (p = 0.0025). The degree of QTc prolongation (maximum QTc) was much more pronounced in patients with exon 8/8A mutations  and the rate of pts. with >500 ms QTc prolongation was much higher . AV block was also observed in significantly more cases in patients with exon 8/8A mutations . There was no difference in the utilization of pacemaker/ICD implantation or of left cervical sympathectomy. There was a marked difference in terms of outcome, as much higher number of pts. with exon 8/8A mutations died  or experienced MACE .The predominant phenotype associated with exon 8/8A mutations was TS in 49 patients (96%), COTS in 1 patient (2%) and isolated LQT8 in 2 patient (2%), while with non-exon 8/8A mutations it was TS in 10 patients (29%), COTS in 5 patients (15%) and isolated LQT8 in 18 patients (56%) (Out of the 85 index patients there were 59 (69%) with TS, 6 (7%) with COTS and 20 (24%) with the isolated LQT8 phenotype.As detailed previously, exon 8 or 8A mutations, affecting codons 402, 405 and 406 made up the majority of the genotypes in patients with TS . Most mutations leading to COTS affected codon 518 in 4/6 patients (67%). Mutations causing isolated LQT8 scattered through the gene with only one codon having affected in more than one patient  .p < 0.001). In addition, significantly much more pts. with TS were diagnosed at birth or in the first year of life. The degree of QTc prolongation was much more prominent in patients with TS than in patients with COTS or with isolated LQT8  and the number of pts. with >500 ms QTc prolongation was much higher . There was no significant difference regarding PM/ICD/AED implantation or utilization of left cervical sympathectomy among the groups. There was a marked difference in terms of outcome, as a much higher number of pts. with TS died, as compared with COTS, or isolated LQT8  or experienced MACE .The detailed comparison of the three groups is presented in There was one additional family member with exon 8/8A mutations  and additional 48 family members with non-exon 8/8A mutations , and there was one additional family member with TS , 9 family members with COTS  and 39 family members with isolated LQT8 .As family members in every group usually exhibited a milder phenotype, all the statistical differences, observed between the index patient groups regarding disease and outcome parameters, remained statistically different, even at a higher significance level. Furthermore, the difference in age at death or at the time of MACE became statistically different, as patient with exon 8/8A mutations or patients with TS died at an earlier age and had MACE at an earlier age. Data are presented in CACNA1C gene mutation associated Timothy syndrome, \u201ccardiac only\u201d Timothy syndrome, isolated long QT syndrome 8 and provided data that these disease forms exhibit major differences regarding clinical manifestations and outcome. These differences can be defined either based on the genotype or the phenotype.In our systemic review we examined CACNA1C should be classified as TS1, and when the next TS disease gene is discovered, it can be classified as TS2  which is reflected in the similarly high MACE rate. All the above probably makes the distinction between TS1 and TS2 obsolete, at least with regard to clinical outcome, and may make the use of the descriptive terms \u201cclassical TS\u201d (with syndactyly) and \u201cnon-classical TS\u201d (without syndactyly) more appropriate, as it emphasizes that the two are similar diseases with comparable clinical outcomes.On the other hand, there are important differences between TS, COTS and isolated LQT8. Based on the phenotype, Timothy syndrome is characterized by a much earlier disease onset, much more pronounced QTc prolongation and much higher mortality than \u201ccardiac only\u201d Timothy syndrome or isolated LQT8. Although phenotypic differences are the basis for the categorization of these disease forms, this is the first time that differences in ECG parameters or in the clinical outcome have been demonstrated. The degree of QTc prolongation is often extreme in TS (>600 ms), and it is >500 ms in >90% of TS patients, while it is only mildly prolonged (<500 ms) in COTS or LQTS. This might be the primary reason for the higher rate of clinical complications, either death or MACE. Similar observations were made by Landstrom et al. based on 28 independent probands . Based oDifferences, like those outlined above, can be encountered if comparisons are made based on the genotype, i.e., between carriers of exon 8/8A mutations vs. non-exon 8/8A mutations. As exon 8/8A mutations are responsible for 83% of TS cases and only 17% of COTS and 10% of isolated LQT8, similar differences can be observed that was seen among TS, COTS and isolated LQT8. These include that disease onset is at much a younger age, phenotypic characteristics of TS are more prevalent, QTc prolongation is much more pronounced and clinical outcome is much more severe in patients with exon 8/8A mutations.Additionally, the results of our systemic review demonstrated that TS is a rather homogenous disease genetically, as the p.Gly406Arg mutation either in exon 8 or exon 8A alone is responsible for 70% of the cases, and mutations affecting codons 402\u2013407 is responsible for 85% of TS cases. The strongest relationship was seen between mutation p.Gly406Arg in exon 8A and \u201cclassical\u201d TS, which is present in 93.5% of the patients. COTS and isolated LQT8 are more heterogenous in this regard having their causative mutations more scattered through the gene.CACNA1C gene mutations alone are not sufficient to explain the above differences in phenotypic expression. CACNA1C mutations may result in channel dysfunction in different ways . One poogenesis .CACNA1C protein. The transcript profile of the CACNA1C gene was reported to be substantially more complex than appreciated by Clark et al., as they identified 38 novel exons and 241 novel transcripts (CACNA1C channels (Another explanation could involve the many different isoforms of the nscripts . Importachannels . A low lchannels .CACNA1C gene mutation associated Timothy syndrome, \u201ccardiac only\u201d Timothy syndrome, and isolated long QT syndrome 8 exhibit major differences regarding clinical manifestations and outcome. These differences can be defined either based on the genotype or on the phenotype. Among the phenotypes Timothy syndrome shows the most severe clinical manifestations with much earlier disease onset, much more pronounced QTc prolongation and a much higher mortality than \u201ccardiac only\u201d Timothy syndrome or isolated LQT8. However, distinguishing TS subtypes, in any form, are not supported by our data.This current comprehensive systematic review demonstrates that Implications for practice include that a high degree of surveillance is warranted if these diseases, especially TS is identified because of the high rate of adverse cardiac events. Genotyping of the patients help to stratify the risk of the patients as exon 8/8A mutations carry higher risk.Implications for research include the need for establishing a prospective world-wide registry to fully explore the phenotypic spectrum and clinical outcome of these diseases.This systematic review harbors all the intrinsic shortcomings of a retrospective study. Given the retrospective nature of the study, clinical information on every aspect of multiorgan involvement in the reported cases was not available. Although all efforts have been done to collect all the cases reported in the literature the study cohorts are still relatively small that limits our ability to draw definitive conclusions. Also, the timespan of the reports encompasses 15 years, from 2004 to 2019, which makes the comparison of individual reports difficult in terms of treatment and outcome over time.The original contributions presented in this study are included in the article/All authors listed have made a substantial, direct, intellectual contribution to the work, and approved it for publication."}
{"text": "Metabolic factors have been shown to be associated to severe radiographic knee osteoarthritis (RKOA). However, more knowledge is needed in early clinical knee osteoarthritis (KOA). The aim was to study associations between metabolic factors and radiographic knee osteoarthritis (OA) in individuals with knee pain. A second aim was to study associations between metabolic factors and RKOA in those with normal BMI and in those overweight/obese, respectively.This cross-sectional study included 282 individuals with knee pain (without cruciate ligament injury) and aged 30\u201367 years, and 70% women. Waist circumference, body mass index (BMI), proportion of fat and visceral fat area (VFA) were assessed. RKOA was defined as Ahlb\u00e4ck grade 1 in at least one knee. Fasting blood samples were taken and triglycerides, cholesterol  and high density lipoprotein (HDL)), C-reactive protein (CRP), glucose, HbA1C were analysed. Metabolic syndrome was defined in accordance with the International Diabetes Federation (IDF). Associations were analysed by logistic regression.Individuals with RKOA were older, had higher BMI, higher VFA, larger waist circumference and had increased total cholesterol, triglycerides and LDL-cholesterol, but not fasting glucose. There was no difference between the group with RKOA vs. non-radiographic group regarding the presence of metabolic syndrome. In a subgroup analysis of individuals with normal BMI (n\u2009=\u2009126), those with RKOA had higher VFA, more central obesity, higher levels of CRP and total cholesterol, compared with individuals without RKOA. In individuals with obesity, age was the only outcome associated to RKOA.There were clear associations between metabolic factors and RKOA in individuals with knee pain, also in those with normal BMI. In individuals with obesity age was the only variable associated to RKOA.clinicalTrials.gov Identifier: NCT04928170. Osteoarthritis (OA) is a group of diseases with various pathophysiological mechanisms, where metabolic, traumatic and age-related phenotypes seem to be significant , 2.The pathophysiological mechanisms in the metabolic phenotype involve factors that are mainly linked to obesity. Obesity affects the weight-bearing joints through increased load and chronic mechanical stress, which induces chondrocytes by mechanoreceptors to synthesize proinflammatory and cartilage-degrading mediators , 4. HoweMost studies of metabolic factors in knee OA (KOA) have been investigated in individuals with severe radiographic knee osteoarthritis RKOA. It is suggested that knee pain should be considered as the first sign of what eventually will become RKOA . The hypThe aim of this cross-sectional study was to investigate associations between metabolic factors and RKOA in individuals with knee pain. A second aim was to study associations between metabolic factors and RKOA in those with normal BMI and in those with obesity, respectively.This cross-sectional study present baseline data from an ongoing five-year longitudinal study, the Halland osteoarthritis cohort (HALLOA), n\u2009=\u2009306. The HALLOA cohort profile has been published . The inc2; normal 18.5\u201324.9\u00a0kg/m2; overweight 25.0-29.9\u00a0kg/m2 and obese\u2009>\u200930.0\u00a0kg/m2). The two groups BMI\u2009<\u200925\u00a0kg/m2 and BMI\u2009\u2265\u200925\u00a0kg/m2, representing those under-/ normal weight as well as overweight/obese was also used. Proportion of fat and visceral fat area (VFA) were assessed by Inbody 770 (Biospace South Korea), which has an intercorrelation coefficient of 0.88-1.00, compared to dual-energy x-ray absorptiometry [2 [Waist circumference was manually assessed with a measuring tape (cm) around the waist, at the height of the navel. Central obesity was classified as waist circumference\u2009\u2265\u200994\u00a0cm in men and \u2265\u200980\u00a0cm in women . The heitiometry , 22. Raimetry [2 . Blood pmetry [2 .Fasting plasma glucose (mmol/L), triglycerides (TG) (mmol/L), total cholesterol (mmol/L), HDL-cholesterol and LDL-cholesterol (mmol/L), HbA1c (mmol/mol) and C-reactive protein (CRP)\u2009>\u20091.0\u00a0mg/L were measured from venous blood, in accordance with the current laboratory standards at Halland County Hospital in Halmstad, Sweden. CRP below 1.0\u00a0mg/L was further analysed with a sensitive CRP ELISA method (Abnova). Raised glucose was classified as fasting plasma glucose\u2009\u2265\u20095.6 mmol/L, or previously diagnosed type II diabetes . Raised The radiographs were obtained in a skyline view of patellofemoral (PF) joints, and posteroanterior radiographs of both tibiofemoral (TF) joints were obtained in weightbearing position with flexed knees. RKOA was defined in accordance with Ahlb\u00e4ck , i.e. AhTo test the differences between groups, the Student\u2019s t-test and the chi-squared test were used where appropriate. Spearman\u2019s rank correlation coefficient was used to assess the relationships between continuous variables. The missing data have not been replaced. All missing data are addressed in the tables. The statistical power was estimated with known prevalence of MetS (14\u201350%) in previous OA studies, which will give a statistical power of 80% for detecting differences at a 5% significance level in this study. The significance tests were two-tailed and conducted at the 0.05 level of significance.The associations between outcome factors and RKOA were calculated by univariate logistic regression analyses. Variables associated with RKOA with a significance level of p\u2009\u2264\u20090.25 were separately included in a model adjusting for age and sex [Statistical analyses were performed using SPSS version 21.0 statistical software .A detailed description of the included individuals is shown in Table\u00a0The group with RKOA (n\u2009=\u200963) were on average older, had higher VFA, central obesity, higher total cholesterol and LDL-cholesterol and were more likely to have raised TG, than the group without RKOA. No differences were seen for CRP levels, glucose levels and there was no difference in proportion of MetS between the groups, Table\u00a0In a univariate logistic regression, age, BMI, VFA, waist circumference, central obesity, proportion of fat, raised TG and LDL-cholesterol were associated with RKOA, Table\u00a02, n\u2009=\u2009126), 16% had RKOA, 20% had raised fasting glucose, and 58% had central obesity. Those who had RKOA (n\u2009=\u200920) were older, had a higher rate of raised VFA, central obesity and total cholesterol, compared with those who did not fulfil the criteria for RKOA (n\u2009=\u2009106), Table\u00a0Of those with normal BMI  in this study group, as was to be expected. Obesity is a risk factor for knee OA [There was a high prevalence of individuals with central obesity, increased VFA and overweight/obese  . One thiAbout two thirds of the participants had raised blood pressure, with no differences between those with and without RKOA, which is in line with previous studies of individuals with radiological knee OA , 39. In One third of the individuals in the present study had raised fasting glucose levels, according to the IDF criteria; however, only one of the included individuals had treatment for diabetes (type II). The cut-off for raised fasting glucose in Sweden is 6.0\u00a0mol/L and the cut-off for raised fasting glucose in the IDF criteria is 5.6 mmol/L, which could explain why most of the participants were untreated for their raised fasting glucose. The mean value of fasting glucose in the present study is in the upper part of the normal range in Sweden (4.0\u20136.0 mmol/L). In the present study, fasting glucose levels were not associated with RKOA, as reported in other studies , 44. OneIn the group with normal BMI, those with RKOA had higher level of CRP. CRP was also associated with RKOA in the univariate model and showed a borderline significance in the multivariate logistic regression. The increased inflammation measured by serum CRP is probably caused both by synovial inflammation and inflammation due to obesity \u201348. The Lipids were increased in those with RKOA in the present study and total cholesterol, LDL-cholesterol and triglyceride levels were associated with RKOA. Dyslipidaemia has been reported in previous studies and has been suggested to be involved in the pathogenesis of OA , 12, 50.In individuals with overweight/obesity, 28% had RKOA. There were no differences in metabolic factors between the groups with and without RKOA. This finding could be explained by the fact that dyslipidaemia and diabetes type II are linked to obesity and both groups were overweight or obese , 52. BecOne fifth of participants in the present study had RKOA, and most had not had a radiographic examination of their knees before study start. The rareness of the studied cohort, still early in the disease course and with a high risk of developing knee OA, will be accentuated in longitudinal follow-up studies.A limitation in this study was that magnetic resonance imaging (MRI) was not assessed to evaluate the knees, which could have affected the result. The radiographs were scored according to Ahlb\u00e4ck and not to Kellgren and Lawrence, which is more common. In this study, the aim was to get a cut off for RKOA and Ahlb\u00e4ck grade I is comparable to Kellgren & Lawrence grade II . The useMetabolic factors were associated with RKOA, in this study, also in those with normal BMI. For individuals with normal BMI, increased load and mechanical stress is probably not the main cause of their RKOA; instead, metabolic factors could be of importance. The associations between metabolic risk factors and development of RKOA in individuals with knee pain, especially in those with normal BMI, needs to be assessed in longitudinal studies, with a focus on pathophysiological mechanisms."}
{"text": "Exercise may trigger bronchoconstriction, especially in a group of athletes in whom bronchospasm during exercise is reported to occur more frequently than in nonathletes. The aim of this study was to determine the prevalence and environmental risk factors contributing to exercise-induced bronchoconstriction (EIB) in adolescent athletes. A prospective study was conducted among a group of 101 adolescent athletes who underwent spirometry, exercise challenge, fractional exhaled nitric oxide (FeNO) measurements, and allergy assessment. The study group was divided into three subgroups of athletes based on the most common sports environments: swimmers, \u201cindoor\u201d athletes, and \u201coutdoor\u201d athletes. The clinical evaluation demonstrated a high frequency of EIB in the study group. Moreover, a large proportion of the athletes in whom EIB was observed reported no pre-existing symptoms suggestive of bronchospasm or asthma. Among patients without a previous diagnosis of asthma, clinical evaluation confirmed 22% with positive exercise challenges, compared with 77% of adolescents with negative test results. Moreover, among the athletes with a history of asthma, 39% had positive exercise challenges. Both EIB and asthma are common conditions that affect adolescent athletes. Physicians should pay particular attention to this group, as the symptoms can lead to under- and overdiagnosis. It is widely known that physical exercise has a beneficial effect on children\u2019s development. Furthermore, a lack of physical activity can lead to asthma development, particularly in children . HoweverThe prevalence of EIB in adult athletes varies between 30% and 70% . Among tSeveral theories describe the development of bronchoconstriction during exercise. These include thermal, osmotic, neural, epithelial damage, and inflammatory theories. When analyzing the first two mechanisms, it is believed that, during exercise, there is an increase in evaporation and a \u201cdrying\u201d of the airway mucosa. This leads to an ionic disturbance of the mucosal barrier and the release of inflammatory mediators from nearby epithelial cells, which subsequently lyse, causing a potentially strong bronchoconstrictive effect. Upon the termination of exercise activity, the subsequent warming of the respiratory tract leads to secondary hyperemia, increased mucus secretion, and the swelling of the mucous membranes. Parasympathetic fibers, which mainly innervate the respiratory tract, according to Gawlik et al., may also be stimulated by high-intensity exercise which contributes to increased muscle tone and the subsequent EIB development. Epithelial damage also affects the development of EIB, and this is often observed in athletes. Repeated hyperventilation, combined with the inhalation of harmful pollutants from the environment, has a significant detrimental impact on the airway epithelium. This can be especially observed in swimmers who are exposed to chlorine compounds or in endurance winter sports athletes exposed to cold air ,8.EIB is influenced by environmental factors, such as air temperature and humidity. Children living in urban environments are 1.6 times more likely to experience EIB compared with those living in rural areas . The higThis is a prospective study, conducted at the Department of Pediatrics and Allergology, at the Korczak Pediatric Center in Lodz, Poland, from March 2019 to January 2022. The study included a group of Polish Caucasian children who were athletes in sports schools and clubs located in the Lodz metropolitan area. Adolescents enrolled in the research were recruited to the study by a physician during a visit to a sports facility. Some of the participants were existing patients of our outpatient clinic. The following sports were eligible for the study: football, horse riding, tennis, dance, athletics, cycling, martial arts, gymnastics, floorball, basketball, volleyball, handball, and swimming. Enrolled patients trained a minimum of four times per week for approximately 90 min per day. Exclusion criteria included: diagnosis of chronic respiratory system disease other than asthma, lack of cooperation during the lung tests, and the presence of contraindications to performing the planned tests (set according to the Polish Society of Allergology). The study was approved by the Medical Ethical Committee of the Medical University of Lodz (No. RNN/303/17/KE).Each participant partook in two study visits. During the first visit, with written consent from parents/legal guardians and children, patients were qualified for the study. Participants were interviewed and examined by an on-site allergist. Caregivers filled a questionnaire requesting demographic data and past medical history. Children who received treatment for asthma were asked to withhold long-acting beta-2 mimetics (LABA) for a period of 24 h before the next visit. During the second visit, each patient received a skin prick test (or serum-specific immunoglobulin E (IgE) test), spirometry, pulmonary resistance test, a measurement of fractional exhaled nitric oxide (FeNO) concentration, and a standardized exercise challenge.All pulmonary function tests were performed using a Master Screen unit , as described elsewhere, in accordance with the American Thoracic Society and European Respiratory Society (ATS/ERS) guidelines . During An electronically controlled treadmill  was used for exercise tests on all athletes. During the challenge, the following parameters were monitored: heart rate, test room temperature (a requirement was set at less than 25 \u00b0C), and room humidity (less than 50%). Heart rate monitoring was performed by a pulse meter device, a built-in feature of the treadmill.The treadmill test lasted for 8 min with the incline of the treadmill set at 3\u00b0. The test consisted of a two-minute burn-up exercise  until stabilization of 95% of the calculated maximum heart rate was achieved. This speed was maintained for another 6 min, at which point the level of exercise was decreased. At 20 and 5 min before exercise, and at 1, 3, 6, 10, 15, and 20 min after exercise, a spirometry procedure identical to the aforementioned spirometry test was performed. The analyzed parameter was the percentage of FEV1. The exercise test was performed according to the recommendations for provocative tests in allergy by the ATS/ERS. The diagnosis of EIB was made on the basis of an FEV1 decrease from the baseline of equal to or more than 10% ,12. All 2O) was maintained by monitoring a visual display in order to eliminate contamination from nasal FeNO. Dead space and nasal FeNO  and FeNO from the lower respiratory tract  were automatically recorded by using the manufacturer\u2019s software. Three FeNO measurements of the plateau phase were obtained, with less than 10% variation. The mean value of three successive, reproducible recordings was retained for statistical analysis. The recommendations used for the analysis were based on the study by Buchvold et al. [The fractional exhaled nitric oxide (FeNO) measurements were performed according to the ATS/ERS recommendations, with a chemiluminescence analyzer  and defined in parts per billion (ppb) . The anad et al. .Skin prick tests with airborne allergens  were performed on all patients. Alternatively, blood tests ) against airborne allergens were assessed. The material was obtained after sampling 10 mL of peripheral blood. The type of test depended on patients\u2019 cooperation.At the end of the tests, each athlete underwent a physical examination. Two doses of salbutamol were administered if the patient exhibited cough, wheezing, or shortness of breath. Children who required further medical diagnosis and treatment were admitted to the hospital.p > 0.1 was considered to indicate normal distribution. The median instead of the mean was used for comparison in all cases in regard to distribution other than normal. Nonparametric tests were used for the skewed distributions. U Mann\u2013Whitney and chi-squared tests with or without the Yates correction and the two-tailed exact Fischer\u2019s test were applied to determine the differences between the two groups according to the type of data. A comparison between multiple groups was performed with a nonparametric analysis of variance ; if ANOVA yielded a significant difference, this was followed by between-group multiple comparisons with a nonparametric post hoc test. For all tests, p < 0.05 was deemed significant, although we also present results with 0.05 < p < 0.1 in the Kruskal\u2013Wallis nonparametric analysis section.Statistical analyses were performed using Statistica software . The distribution of the data was assessed with the Shapiro\u2013Wilk test, and In this study, 39 girls and 62 boys  adolescent athletes, aged 12\u201318 years, were included. There were no statistically significant results concerning EIB between the female and male gender. All the details of patient characteristics are shown in p = 0.04815). Moreover, in these groups, 21% of athletes from outdoor activities, 42% from indoor activities, and 14% of swimmers (p = 0.03605) had positive and very close-to-positive results for EIB. Prior to the study, 7 soccer players (18%) observed dyspnea during or after exercise, in comparison with 28 other patients (45%) (p = 0.00979). All the details concerning this division are included in When dividing patients into groups, namely athletes performing \u201coutdoor\u201d activities, those performing \u201cindoor\u201d activities, and swimmers , symptomp = 0.01548). A diagnosis of EIB was confirmed in 28% (n = 28) of adolescent athletes: 61% without asthma and 39% with asthma. All the data concerning asthma, symptoms, the diagnosis of EIB, and treatment are summarized in Asthma was diagnosed in 24 athletes. While analyzing individual sports, only four soccer players (10%) had a previous history of asthma (p = 0.0295). Furthermore, a similar pattern was observed for forced vital capacity (FVC) (p = 0.0257)  . Pulmonap = 0.0588). All the details concerning FeNO in athletes are included in Among all the examined athletes, 89 (88%) had significantly elevated fractional exhaled nitric oxide values. In this group, we did not detect the presence of atopy in 40 (45%) adolescents (p = 0.004021), trees (0.017704) (measurements were performed outside of the pollen season), and mold allergens (0.007743). In patients with a history of asthma, 4 athletes (10%) were found to have no atopy, compared with 20 athletes (33%) who were allergic to at least one allergen (p = 0.00898) and 17 (37%) with polyvalent atopy (0.00894). A similar analysis was performed for patients with positive exercise challenges without asthma: The results revealed that 12 athletes (30%) had no atopy, and 16 patients (26%) were allergic to at least one allergen; however, these results were not statistically significant (p = 0.85185).During the analysis of atopy in the patients, higher \u0394FEV1 values were achieved by athletes diagnosed with atopy to grass , and nonallergenic factors  may affect the epithelium of the respiratory tract, potentially leading to the formation of EIB. The results of 40 nonatopic athletes in whom FeNO was elevated support the above statement. On this basis, we argue that nonallergic factors can also induce inflammation, including the well-known biomarker FeNO. This contradicts a large amount of scientific research, according to which higher FeNO levels are related to atopy. However, it is worth noting that FeNO levels are affected by other factors, such as age, sex, height, current smoking status, and diet .Although exercise is indicated in the prevention of asthma, it is emphasized that excessive airway stress can damage the airway epithelium, leading to chronic inflammation and bronchoconstriction . ParticuOur study revealed that indoor athletes achieved lower spirometry parameters compared with other athletes. Moreover, athletes practicing outdoor activities achieved better results; within this group, 21% had positive EIB results in comparison to 42% of indoor athletes. Additionally, a history of dyspnea during training was reported by 21% of outdoor athletes, compared with 47% of indoor athletes and 38% of swimmers.According to Ventura et al., the prevalence of asthma in soccer players was lower than the prevalence in other elite athletes . Their sVentura et al. suggested that the type of sport may influence the incidence of asthma, which has so far been observed more frequently in endurance athletes, e.g., long-distance runners or swimmers . It is cSome authors note the benefits of athletes completing questionnaires to help diagnose EIB. This approach comes with certain limitations, as athletes occasionally confuse EIB symptoms with the body\u2019s normal response to exercise . BurnettOn the other hand, our study revealed that 45% of athletes who reported symptoms of EIB had a negative exercise challenge, among which 15% observed cough prior to study inclusion, and 27% reported dyspnea during or after exercise. As previous studies indicate, there is a need to consider alternative causes of EIB symptoms, such as exhaustion, exercise-induced laryngeal dysfunction, and exercise-induced hyperventilation . This waThe observation of the EIB phenomenon in athletes raises the question of who may develop asthma. The typical symptoms of EIB are wheezing, shortness of breath, cough, and tightness in the chest. Patients with asthma also experience such symptoms, raising the question of whether to consider an isolated case of EIB or asthma. According to the definition by the Joint Task Force on Practice Parameters in Allergy and Immunology, EIB is related to transient bronchoconstriction during or after exercise. EIB may or may not be related to asthma attacks, a relation previously termed exercise-induced asthma (EIA) . For thiAccording to Aggarwal et al., the prevalence of EIB in patients with asthma is approximately 90% . Our patFeNO measurement is considered to be an effective, noninvasive tool to assess eosinophilic airway inflammation. In our observations, this parameter reached the lowest values among outdoor athletes, compared with higher values in athletes training indoor activities. Among the examined adolescents, FeNO values for swimmers had intermediate results. It is important to remember that the pattern of inflammation in swimmers is neutrophilic; consequently, the role of FeNO in this group is ambiguous .In our research, FeNO levels in athletes with confirmed EIB were higher than those in adolescents in whom EIB was not yet confirmed. This result was not statistically significant, with a resulting smaller sample of respondents than initially assumed. According to Errson et al., among the group of EIB-confirmed adolescent athletes, FeNO was not related to the disease. This leads us to consider that the mechanisms of EIB in athletes and the general population are different .Our study revealed that the greater the decline in FEV1 during an exercise test in adolescent athletes, the greater the levels of atopy to grass, trees, and mold. According to Goossens et al., among young athletes, the prevalence of atopy is elevated . In a TuBased on the analysis of our collected data, we argue that, during exercise, factors such as inhaling cold air are the trigger for bronchospasm rather than airborne allergens. In the case of year-round mold allergens, one must consider whether these are responsible for inferior test results in indoor athletes.During our study, no reversibility test was performed to confirm asthma; this will be the subject of a future study. The less-than-optimal sample size of 101 patients was due to limitations incurred during the SARS-CoV2 pandemic. Another limitation was that patients on permanent medication were not reassessed for whether these existing treatments were indeed appropriate. Furthermore, the authors intended to identify environmental risk factors that promote EIB, but due to the pandemic, such opportunities were greatly restricted. Nonetheless, our study confidently analyzed the results from athletes in different disciplines and environments. We evaluated several factors that potentially contribute to the development of EIB. Our efforts seek to help physicians more properly diagnose suspected patients with EIB.Our research provided significant evidence that EIB is a common phenomenon among adolescent athletes. Our first \u201ctake-home\u201d message is that not every athlete may report or be aware of symptoms of bronchospasm. This may lead to underdiagnosis and result in improper treatment. Secondly, we wish to draw attention to unsuitable conditions for adolescent athletes during training and highlight typical symptoms, such as cough and dyspnea. These factors may indicate EIB development. Our study concludes with two open questions: Could EIB-positive athletes develop asthma in the future? What treatment strategies should be employed in such patients?"}
{"text": "Previous research has indicated that facial attractiveness may provide cues to the functioning of the immune system. Mating with individuals who have a more effective immune system could lead to a higher reproductive success. Our main aim was to test a possible association between immunoreactivity (stimulated by vaccination) and perceived facial attractiveness and healthiness. We experimentally activated the immune system of healthy men using vaccination against hepatitis A/B and meningococcus and measured levels of specific antibodies (markers of immune system reactivity) before and 30\u00a0days after the vaccination. Further, 1\u00a0day before the vaccination, we collected their facial photographs that were judged by females for attractiveness, healthiness, and facial skin patches for healthiness. In view of its proposed connection with the functioning of the immune system, we also measured skin colouration  and we assessed its role in attractiveness and healthiness judgements. Moreover, we measured the levels of steroid hormones (testosterone and cortisol) and the percentage of adipose tissue, because both are known to have immunomodulatory properties and are related to perceived facial attractiveness and healthiness. We found no significant associations between antibody levels induced by vaccination and perceived facial attractiveness, facial healthiness, or skin healthiness. We also found no significant connections between steroid hormone levels, the amount of adipose tissue, rated characteristics, and antibody levels, except for a small negative effect of cortisol levels on perceived facial healthiness. Higher\u00a0forehead redness was perceived as less attractive and less healthy and higher\u00a0cheek patch redness was perceived as less healthy, but no significant association was found between antibody levels and facial colouration. Overall, our results suggest that perceived facial attractiveness, healthiness, and skin patch healthiness provide limited cues to immunoreactivity, and perceived characteristics seem to be related only to cortisol levels and facial colouration. It is often claimed that facial attractiveness provides cues to various aspects of individuals\u2019 quality, such as immunocompetence3. Selection of partners with a more effective immune system is expected to lead to a higher reproductive success by passing increased pathogen resistance onto the offspring (indirect benefits). Moreover, healthier individuals can provide better parental care and are less likely to transmit any infections to their partners (direct benefits)4.Mate preferences are often based on physical appearance, whereby facial attractiveness seems to play an especially significant role6. Several recent studies employed direct immunity function measures, such as inflammation markers or levels of cytokines or antibodies. In a sample of South African men, Phalane et al.7 tested the relationship between facial attractiveness ratings and responsiveness of the immune system upon activation by an injection of bacterial lipopolysaccharide (LPS). Immune system response was assessed by levels of C-reactive protein, which is an inflammation marker, and by the levels of cytokines, which are peptides that stimulate the immune response. This study found a positive correlation between facial attractiveness ratings and the levels of cytokines, specifically interleukins (IL)-2, 4, 6, 8, and 10, granulocyte\u2013macrophage colony-stimulating factor (GM-CSF), interferon \u03b3 (IFN-\u03b3), and tumour necrosis factor \u03b1 (TFN-\u03b1)7. Other studies employed vaccinations to elicit and measure immune system reactivity. A stronger response to the vaccine (assessed via higher antibody levels) indicates a better protection against infection8. Overall, though, the results of these studies are inconclusive. Faces of men with higher levels of hepatitis B antibodies were rated as more attractive9 but this did not hold of women10. In contrast, other study reported a negative, though nonsignificant, association between facial attractiveness and immune system reactivity in men11.Previous research into the putative relationship between facial attractiveness and individual's quality that was conducted using self-reported past and current health and attractiveness ratings of facial photographs delivered mixed results15. Studies tend to focus on facial skin colouration in the CIE L*a*b* colour space17. Higher skin redness (a*) is linked to increased skin blood perfusion and oxygenation16, which are in turn positively associated with physical fitness19 as well as good cardiovascular20 and pulmonary health18. Skin yellowness (b*) is influenced by carotenoids, which are pigments acquired from food, mainly fruits and vegetables. Owing to their antioxidant properties21, carotenoids can contribute to disease resistance as they can destroy free radicals and reduce oxidative stress, both of which are harmful to the immune system23. It has been shown that facial skin with higher redness and yellowness is perceived as more attractive and healthier24. Moreover, Phalane et al.7 reported an association between skin yellowness and a marginally higher immune system response (higher levels of inspected cytokines) after LPS stimulation. On the other hand, Foo et al.25 found that higher skin yellowness is positively associated only with perceived health (and only in men) and not with direct immune function measures25. Skin lightness (L*) is determined by the distribution pattern of melanosomes in keratinocytes and the amount of melanin it contains26. Higher melanin levels (resulting in a darker skin hue) can provide a better protection against sunlight27 but can also contribute to vitamin D deficiency28. It has been found that melatonin can have an effect on the synthesis of melanin29, which is in turn believed to affect the periodicity of immune response as well as cytokine production31. In women, lighter skin is associated with higher perceived attractiveness and youth34 , because with increasing age skin tends to become darker36. In men, some research shows that darker complexion may be preferred37.It has been suggested that facial skin colouration plays an important role in perceived facial attractiveness and health40 but evidence to that effect is rather mixed41. It has thus been proposed that glucocorticoids, such as cortisol, mediate the association between testosterone and the immune system\u00a0functioning43. Although a short-term elevation of cortisol levels can boost an acute immune system response, prolonged exposure may weaken the response, thereby increasing susceptibility to diseases44. Some support for the mediating effect of cortisol comes from Rantala et al.9 who found that immunoreactivity was stronger in men with higher testosterone and simultaneously lower cortisol levels, while immunoreactivity was also positively linked to facial attractiveness. Similarly, women with lower cortisol levels were perceived as more attractive45 .The association between functioning of the immune system and perceived facial attractiveness might be also modulated by testosterone and cortisol. It has been suggested that testosterone has an immunosuppressive effect50. In perception studies, body fat levels affect attractiveness ratings, whereby both overweight and excessively thin individuals are perceived as less attractive51. Moreover, portrait photographs of individuals with elevated levels of leptin\u2014a hormone produced by the adipose tissue that has a negative effect on health\u2014were also perceived as less attractive52.Another key factor affecting both attractiveness and immunity is adiposity. Obesity contributes to an altered immune function and reduced immunocompetence because it is associated with changes in leucocyte counts, reduced antibody production, impaired wound healing, a higher risk of infections, and even a higher mortality rateOverall, evidence pertaining to links between the quality of the immune system and facial attractiveness is ambiguous. Many previous studies investigated only a limited number of relationships between variables and relied on indirect measures of immune system functioning. In Study 1, we therefore focused on the relationship between immune system reactivity and perceived facial attractiveness. To measure the reactivity of the immune system, we experimentally activated the immune system by vaccination against both viral  and bacterial (meningococcus) infections, because the two in conjunction should stimulate a wider range of components of the immune system than either would. We used differences in antibody levels before and after vaccination as a proxy for reactivity of the immune system. In Study 2, we investigated associations between immune system reactivity and perceived skin patch healthiness to examine human ability to judge characteristics from limited amount of information. Finally, in Study 3 we focused on the relationship between immune system reactivity and perceived healthiness of the face. Moreover, we measured testosterone and cortisol levels and recorded body composition, because all these factors have immunomodulatory properties and are linked to both perceived facial attractiveness and healthiness. We also measured facial skin colouration  to assess its role in attractiveness and healthiness judgements and its connection to the immunoreactivity.53, face, and voice as perceived by opposite-sex individuals. The present article focuses on associations between immune system reactivity and perceived facial attractiveness, healthiness, and skin healthiness. All procedures were conducted in accordance with the Helsinki Declaration and the study was approved by the Institutional Review Board of Charles University . Due to the nature of this study, we have collaborated with medical personnel. The study was preregistered prior to data analyses (https://osf.io/69zgc). Before entering the study, all participants were informed about its goals and expressed their consent with participation by signing an informed consent form.Data used for this study are part of a larger project which investigates possible associations between reactivity of the immune system and attractiveness of human body odour54).We have collected data from 21 men . Requirements for participating in the study were the following: age 18\u201340\u00a0years, good general health, no current use of any medication, non-smokers, and not being vaccinated against hepatitis A, B, or the meningococcus in the past 10\u00a0years  and leaflets at university halls of the Faculty of Science, Faculty of Humanities, and Faculty of Physical Education and Sports . Participants were vaccinated free of charge and received a reimbursement of 400 CZK (approx. \u20ac15) for participation in the whole project as a compensation for their time and potential inconvenience. Targets were the same for all studies described in the present article (Studies 1\u20133).55, that is, such values do not indicate currently ongoing infection. After the blood collection, the vaccines against hepatitis A/B (Twinrix) and meningococcus (Menveo) were administered. We selected vaccines against both viral and bacterial infections to stimulate different components of the immune system . The second blood collection and second photograph acquisition took place 14\u00a0days after vaccination, at a time point when one should expect the highest antibody response56. For the current investigation, only photographs taken before the vaccination were used. The last blood collection took place 30\u00a0days after vaccination, at a point when a second dose of vaccine against hepatitis (Twinrix) is recommended57. Vaccination and first blood collection were performed by a physician, while the remaining two blood samples were collected by phlebotomists at the Prevedig laboratory (https://www.prevedig.cz/) where all samples were subsequently analysed. The procedure and time of blood collections were standardised across participants. To avoid diurnal fluctuations58 sampling was conducted at 7\u20138 a.m. We measured and recorded body composition of the participants. Participants also completed questionnaires about their health status during the study and about possible factors that may have influenced their skin colour 60. This procedure took place on Q4 2017 to minimise possible effects of a suntan.One day before vaccination, we acquired standardised portrait photographs of the participants. On the day of the vaccination, each participant completed a questionnaire on their medical history and their general health status was examined by a physician to ensure they were eligible for application of the vaccines and not suffering from any current illness or infection. This was followed by the first blood collection (5\u00a0ml of venous blood) to assess the basal levels of antibodies (specific immunoglobulins G\u2014IgG and immunoglobulins M\u2014IgM) and C-reactive protein (CRP), which is a marker of inflammation. In none of the participants did the pre-vaccination CRP levels exceed 5.5\u00a0mg/l; values below this threshold are considered clinically normalNeisseria meningitis serogroups A, C, Y, and W-135). They can be administered together and are widely used in the Czech Republic. Both were applied intramuscularly, each in one arm.To induce an immune system response, we used the Twinrix Adult vaccine against hepatitis A/B and a Menveo vaccine against meningococcus  were measured by the Diasorin\u00ae Liaison\u2014chemiluminescence immunoassay (CLIA), where a fully automated immunological analyser performs the full processing of samples. We used the corresponding Human S100 CLIA kits. This analysis is based on a radioimmunoassay, where the antigen and paramagnetic microparticle solid phase binds with fluorescent-labelled antibodies and after oxidation\u2013reduction reaction, excessive energy is released in the form of photonsAntibodies against hepatitis B (Anti-Hbs) were measured based on the same principle as Anti-HAV. It turned out, however, that large percentage of targets either had high levels of Anti-Hbs at the baseline (N\u2009=\u20097) or did not respond to vaccination (N\u2009=\u20095). For this reason, the Anti-Hbs were excluded from further analyses.62. Sufficient response is at least 1:4\u00a0titres (the dilution of the serum where antibodies still react with the antigens) and ideally even higher63. As above, the final photometric measurement and evaluation were conducted by the analyser.Antibodies against the meningococcus (Anti-Mnk) were measured by the fully automated Diasorin\u00ae ETI-Max 3000\u2014enzyme immunoassay (ELISA), one of the basic methods of determination of serum antibodies. The method is based on a reaction between an antigen on a special board and antibodies in the patient\u2019s serum. Then secondary antibodies are added, which are specially labelled and bind to the primary antibodies with the antigen. A chromogenic substrate, which is added last, causes a colour response that is measured by spectrophotometer64. The final photometric measurement and evaluation were done by the automatised analyser.Total testosterone levels were measured by chemiluminescence (CLIA) in a fully automatised analyser Beckman Coulter DxI 800 Immunoassay System. The CLIA principle is described above. In this case, the energy is released by a reaction between testosterone, polyclonal anti-testosterone antibodies, and a tracerCortisol levels were measured by an electrochemiluminescence immunoassay method in a fully automatised analyser Beckman Coulter DxI 800 Immunoassay System. First, one incubates a sample in which specific anti-cortisol antibodies labelled with ruthenium chelate bind to cortisol. This complex is captured on the surface of an electrode where the electric charge causes a chemiluminescent emission of photons. The emitted light is measured by a spectrophotometer, but the measurement and evaluation are likewise done by the analyser.65.Acquisition of photographs took place at the Human Ethology perception lab in a purpose-built photographic booth in order to prevent potential changes in ambient illumination and colour reflections66 (Nikon AF-S NIKKOR 85\u00a0mm f/1.8G) into 14-bit uncompressed raw files (.NEF) and Adobe RGB colour space. The camera was mounted in a portrait orientation directly on a light stand that also carried a strobe light. A single 400Ws studio strobe (Menik MD-400Ws) was used and equipped with a white reflective umbrella light diffuser  mounted onto a 175\u00a0cm high light stand tilted 10\u00b0 downwards toward the booth. Correct and uniform exposure across the entire scene was checked before each session with a digital light meter (Sekonic L-308S). Colour calibration was performed using X-Rite Color Checker Passport colour targets and a white balance patch photographed at the beginning of each session. For further details of the photo acquisition procedure, see T\u0159ebick\u00fd et al.65.Portrait photographs were taken with a 24-megapixel full-frame  digital SLR camera Nikon D610 equipped with a 85\u00a0mm fixed focal length lensParticipants were photographed wearing provided white T-shirts and without any adornments or glasses. They had varying amount of facial hair ranging from clean-shaven to a full beard (in two participants), but most targets had a comparable style of short stubble. Participants were seated on a barstool 0.5\u00a0m from a plain white background. They were asked to sit straight with hands hanging freely alongside their bodies, look directly into the camera, and adopt a neutral expression. The camera  was positioned 125\u00a0cm from the participant and its height adjusted individually for each target to centre his head in the middle of the frame [distance between the camera and the participant was checked with a digital laser rangefinder (Bosch PLR 15)]. This setting of camera distance, focal length, and sensor size yielded a 35\u2009\u00d7\u200953\u00a0cm field of view (23.85\u00b0 angle of view).Image processing was carried out in Adobe Lightroom Classic CC (version 2017) and Adobe Photoshop CC 2015. We converted the images into DNG raw files and created DNG colour calibration profiles (using the X-Rite Color Checker Passport Lightroom plugin). Then we applied the profiles to all photographs. The calibrated images were exported into 16-bit Adobe RGB TIFF files in their actual size (35\u2009\u00d7\u200953\u00a0cm) with a 168 PPI resolution. We manually checked the exposure (using the eye-drop tool on the background above the participants\u2019 heads) and corrected the exposition on 85% value of every channel in the RGB colour space if necessary. Horizontal and vertical position of each participant in the image was adjusted using the Lightroom Transform tool . Then we batch-cropped to fit the heads on 27\u2033 monitors in 1:1 size.In the next step, we removed any possible disturbing creases or shadows in the background. Finally, we converted the photographs into an sRGB colour space and exported them into an 8-bit JPEG format  for the rating.67.Facial skin colour was measured in vivo with a spectrophotometer Ocean Optics Flame-S with optical resolution of 2\u00a0nm using a standard D65 illuminant. Integrating Sphere ISP-R was used to spatially integrate the radiant flux in scatter transmission and diffuse reflectance sample measurements. The spectrophotometer was calibrated using the WS-1 Diffuse Reflectance Standard. All measurements were taken on three patches of targets\u2019 faces  and expressed also in CIE\u00a0L*a*b* colour space68. We measured the largest available area per stimulus while avoiding freckles, blemishes, and hair whenever possible. Facial skin colour values obtained from the spectrophotometer and from the facial photographs in our sample correlated positively . To facilitate a comparison with previous studies, we decided to use in further analyses in the main text facial skin colour measurements from the photographs. The results of analyses using spectrophotometer can be found in the Supplementary Materials\u2014Tables We have also measured facial skin colour from the calibrated pre-vaccination facial photographs using ImageJ software (v 1.51) and Color Transformer 2 MatLab package. We measured the skin colour in CIE L*a*b* colour space and recorded the values for facial redness (a*), yellowness (b*), and lightness (L*) in three places of the face 69).We cropped skin patches from the obtained facial photographs in Adobe Photoshop CC 2015. The area of skin patches (89\u2009\u00d7\u200989px) and location from which they were acquired (left cheek and forehead) were standardised while making sure that the resulting patch did not include any facial features , hair, or birthmarks. The resulting skin patches  were enlarged by 300% for subsequent presentation , oral invitations, and posters in university halls of the Faculty of Science, Faculty of Humanities, and the Faculty of Physical Education and Sport . In Study 1, facial photographs were rated by 88 females aged 18\u201340  during Q1 2018. The raters received a reimbursement of 200 CZK (app. \u20ac8) as a compensation for their participation in the whole project .In Study 2, the obtained photographs and skin patches were rated by 62 females aged 18\u201340  during Q1 2019. The raters received a reimbursement of 50 CZK (app. \u20ac2) as a compensation for their time.In Study 3, the photographs were rated by 66 females aged 18\u201340  during Q4 2019. They received a reimbursement of 150 CZK (app. \u20ac6) as a compensation for their participation in a larger rating session unrelated to the current investigation.None of the raters in the three studies used hormonal contraception.53. Exposure to a higher number of odour samples increases the risk of olfactory adaptation and can therefore affect rating, which is why the rating sessions were conducted on two separate days to accommodate a larger number of raters. From the total of 88 raters, 43 took part on the first day and 45 on the second day, which corresponds to the number of raters per photograph (depending on which day the photograph was presented). Randomly selected half of pre-vaccination samples was presented on the first rating day and half of post-vaccination photographs was presented on day two and vice versa. All raters were assessing photographs only once within a single day.Study 1 was part of a larger project that also included the rating of voice recordings and body odour samplesStudy 2 was carried out\u00a0using same rating procedure to eliminate any possible effects of a different data collection design. Of the 62 raters, 32 rated the first half of the randomly selected stimuli and 30 the second half of the stimuli. For Study 3, the procedure was identical and of the 66 raters, 31 took part on the first data collection day, 35 on the second day.All rating (Study 1\u20133) took place in the Human Ethology perception lab under standardised conditions across all raters and rating days . The rating was conducted using Qualtrics survey suite  on two desktop computers of identical configuration with colour and brightness calibrated (by X-Rite i1Display Pro probe) LCD monitors  turned to a vertical position to accommodate life-sized facial images.70. Photographs were presented in randomised order.The raters were seated 115\u00a0cm from the screen with eyes at a height of 125\u00a0cm (measured from the floor to the outer corner of the eye). This is a height and distance comparable to that from which the portrait photographs were taken, whereby raters were positioned into the same centre of projection and eye level. This setup approximates the common interpersonal distanceIn Study 1, all facial photographs (N\u2009=\u200921) were rated for attractiveness on a 7-point verbally anchored scale. In Study 2, participants rated portrait photographs (N\u2009=\u200921) on a 7-point verbally anchored scale for attractiveness again to check the robustness of acquired ratings. They also rated skin patches from left cheek (N\u2009=\u200921) and forehead (N\u2009=\u200918) on a 7-point verbally anchored scale regarding their healthiness. Due to a low number of forehead patches (hair in the images), we use only cheek patches in analysis below. In Study 3, portrait photographs (N\u2009=\u200921) were rated on a 7-point verbally anchored scale regarding healthiness.After rendering their rating assessments (Study 1\u20133), raters completed a questionnaire about their basic demographics .To determine the consistency of raters\u2019 assessments, we performed an intra-class correlation (ICC) analysis for each group rating the same set of samples using IBM SPPSS Statistics (v 23). All remaining statistical analyses were performed in jamovi (v 1.6.15).71. Further, we used the Spearman\u2019s rank correlation to test the association between levels of antibodies and targets\u2019 age.To explore relationships between variables, ratings of facial attractiveness from Study 1 and 2, and facial healthiness from Study 3, we used Spearman\u2019s rank correlation coefficient because the data deviated from normal distribution. We set \u03c1\u2009\u2265\u20090.8 as a value at which we would consider the two variables highly correlated. In such case, only one of the variables would be used for subsequent analysesWe used a one-way analysis of variance (ANOVA) with Tukey post-hoc test to test for differences and Spearman\u2019s rank correlation coefficient for strength of associations between separate colour measurements from the right and left cheek and the forehead.To examine the relationship between perceived facial attractiveness (Study 1), perceived skin patch healthiness (Study 2), perceived facial healthiness (Study 3), and differences in antibody levels (pre-vaccination subtracted from 30\u00a0days post-vaccination), we specified three separate linear mixed-effects models (LMMs) using the GAMLj module in jamovi. The rated characteristics  were entered as dependent variables, while differences in antibodies against hepatitis A (Anti-Hav) and meningococcus (Anti-Mnk) were entered as predictors. To control for variability in targets and raters, we entered the targets\u2019 and raters\u2019 IDs as random effects \u2009+\u2009(1|ID_donor)). We employed analogous models to assess the relationships between the rated characteristics , steroid hormones levels, and the percentage of adipose tissue, and to assess the relationship between the rated characteristics  and forehead and cheek lightness, redness, and yellowness. To explore a possible relationship between targets\u2019 age and perceived facial attractiveness and healthiness, we ran analogous separate linear mixed-effects models, with the rated characteristic entered as a dependent variable and age as the predictor.To test the association between differences in antibody levels (pre-vaccination and 30\u00a0days post-vaccination), basal levels of steroid hormones (testosterone and cortisol), and the percentage of adipose tissue, we employed general linear models (GLM) using the GAMLj jamovi module. In both models, we entered specific antibodies (Anti-HAV or Anti-Mnk) as dependent variables and steroid hormones and percentage of adipose tissue as predictors ). Analogous tests were carried out to investigate the relationship between antibody levels (pre- and 30\u00a0days post-vaccination) and forehead and cheek lightness, redness, and yellowness. For information about model residuals, see Supplementary Materials 72 to estimate observed power using the SimR package73 in R . Further, based on simulated data , we plotted Power curves showing the sensitivity to detect observed effects with \u03b1\u2009=\u20090.05. The results of observed power, Power curve plots, and the R script are available in the Supplementary Materials We performed a simulation-based power analysis for each fixed-effect predictor in our LMMsDescriptive statistics for targets\u2019 basic demographic data, rated characteristics, differences between pre- and 30\u00a0days post-vaccination antibody levels, steroid hormone levels, the percentage of adipose tissue, and colour measurements are presented in Table We found high level of agreement between raters in all rated characteristics (ICC above 0.864). For further details, see Table p\u2009<\u20090.001). In all subsequent analyses, we therefore use attractiveness ratings from Study 1.Ratings of facial attractiveness collected in Study 1 and 2 were strongly positively and statistically significantly correlated . The value of \u03c1 did not, however, reach the pre-set level of 0.8, and we therefore analyse perceived facial attractiveness and healthiness separately.Ratings of perceived facial attractiveness (Study 1) and perceived healthiness (Study 3) were also positively and statistically significantly correlated  did not show a statistically significant association . The relationship between perceived facial healthiness and targets\u2019 age  was likewise not statistically significant . Further, we found no statistically significant relationship between antibody levels and targets\u2019 age . In subsequent analyses, we therefore did not control for age.Linear mixed-effects model testing the relationship between targets\u2019 age and perceived facial attractiveness (Rp\u2009<\u20090.001), redness , and yellowness  were strongly positively and statistically significantly associated. We thus continue to use only L* a* b* measures from the left cheek in further analyses because we presented the left cheek patches to participants in Study 2 for patch healthiness ratings.Left and right cheek measures of skin lightness , redness , and yellowness  from the left cheek and forehead were also positively and statistically significantly correlated. The \u03c1s did not, however, reach the predefined level (0.8) and we therefore use the left cheek and forehead measures in further analyses separately. For further details, see Table Skin lightness  and statistically significantly less red (a*) and less yellow (b*) than skin on either cheek (for skin yellowness (b*), there was a statistically significant result for forehead and left cheek only). The two cheeks did not differ significantly in either L*, a*, or b* measures  was not predicted by levels of specific antibodies. For details, see Table Linear mixed-effects models show that perceived facial attractiveness . For detailed results, see Table  Neither redness, yellowness, nor lightness of the forehead or left cheek predicted elevations in any of the specific antibodies . For details, see Table Running a linear mixed-effects model, we found that neither the levels of cortisol or testosterone, nor the percentage of adipose tissue predicted perceived facial attractiveness  and Anti-Mnk . For detailed results, see Table In a GLM analysis, neither the levels of testosterone or cortisol, nor the percentage of adipose tissue predicted elevations in any of the specific antibodies Anti-HAV , forehead redness was the only statistically significant predictor with a negative slope ; see Table In a linear mixed-effects model testing the influence of skin colour on perceived facial attractiveness  was not predicted by levels of specific antibodies , cheek redness negatively predicted perceived cheek patch healthiness. For detailed information, see Table A linear mixed-effects model shows that perceived cheek patch healthiness  was not predicted by levels of specific antibodies , forehead redness negatively predicted  perceived facial healthiness  testing the association between cortisol, testosterone, adipose tissue percentage, and facial healthiness shows that only cortisol levels marginally negatively predicted  perceived facial healthiness. For details, see Table A linear mixed-effects model  and perceived attractiveness and healthiness. We found no statistically significant associations between experimentally elicited levels of antibodies against hepatitis A (Anti-HAV) or meningococcus (Anti-Mnk) and perceived facial attractiveness, healthiness, or healthiness of skin patches. Moreover, we observed no statistically significant associations between the levels of antibodies and testosterone, cortisol, or adipose tissue, which are all variables often associated with immune function. Adipose tissue and testosterone and cortisol levels also showed no connection with perceived facial attractiveness. Notably, we found a small negative effect of cortisol levels on perceived facial healthiness. Further, we found that higher\u00a0forehead redness was perceived as less attractive and healthy when individuals assessed portrait photographs, and for cheek patches, higher\u00a0cheek redness was perceived as less healthy. No systematic\u00a0relationship was found between measures of facial skin colouration and Anti-HAV and Anti-Mnk antibodies.7 or elevated immune system response to vaccination against hepatitis B 9. Although the 95% confidence intervals of our results regarding the association between Anti-HAV, Anti-Mnk, and perceived facial attractiveness  do partially overlap with results of some studies that found significant relation between perceived facial attractiveness and hepatitis B antibodies levels after vaccination9, our results are more in line with the studies by Skrinda et al.11 and Rantala et al.10 who found no support for significant associations between hepatitis B antibody levels after vaccination and perceived attractiveness in men  and women , respectively. Overall, as noted at the outset, empirical evidence regarding an association between immunocompetence and facial attractiveness remains equivocal75.We examined possible relationships between immunoreactivity and facial attractiveness and healthiness because it has often been claimed that attractive traits are related to underlying qualities of individuals. Previous studies indeed reported a positive link between male facial attractiveness and either cytokine levels after stimulation with LPS 76. Moreover, we inspected both immunoreactivity and facial colouration. Unlike some previous studies50, we excluded hepatitis B antibodies from our analyses because several participants showed high levels of the relevant antibodies already in the baseline measurement, while others did not react to the vaccine.The strength of our study lies in using vaccines against both viral (hepatitis A and B) and bacterial (meningococcus) diseases. This way, we aimed to stimulate a wider array of immune system components because, for example, the advantage of heterozygotic individuals is the greatest when they fight against multiple pathogens at once77. Excessively strong (hypersensitivity) or inappropriate  immunity response is not beneficial and can ultimately negatively affect individual fitness. Moreover, by focusing solely on antibody levels, one can only arrive at generalised and limited information about the function of the immune system. Investigation of differences of the immune response in its humoral and cellular components and of the trade-offs between them might provide a more nuanced insight.In general, the use of vaccination to stimulate immunoreactivity has some limitations. For the purpose of this study, we treated a higher level of antibodies as a proxy to higher disease resistance. This is, however, something of a simplification because higher immunoreactivity is not always adaptive78 focused on innate immunity and measured salivary immune function  alongside oxidative stress and semen quality. Using principal component analyses, they obtained two factors: PC1\u2014bacterial-killing capacity and overall bacterial immunity and PC2\u2014bacterial suppression capacity and lysozyme activity. Contrary to expectations, no connection was found between the selected physiological measures of immune function, attractiveness  and number of sexual partners 78. Phalane et al.7, on the other hand, found a positive relationship between cytokine levels (after stimulation of the immune system with LPS)  and male facial attractiveness but not the CRP 7. Cai et al.79 employed as a marker of immune function salivary immunoglobulin A (IgA), which acts as a defence against microbial invasion. They found no connection between IgA and female facial attractiveness 79.Recent studies employed several methods of measuring the functioning of the immune system and arrived at rather diverse results, making our null results no exception. Foo et al.80. It has been demonstrated that people can assess health and attractiveness even from limited information such as skin patch and their ratings correspond to their ratings of the whole face69. In our study, we therefore used cheek skin patches to limit possible effects of confounding factors . We also investigated relationships between perceived healthiness of the skin patch and direct measures of immune system function. And yet, we found no associations between perceived skin healthiness and levels of specific antibodies.It has been proposed that facial skin provides information about the functioning of the immune system and about health40. Although the results of some studies do support the hypothesis of immunosuppressive effects of sex hormones81, the overall pattern in literature is rather mixed . It has been suggested that glucocorticoids contribute to this complex picture because they modulate immune system response as well as the expression of secondary sexual characteristics, and they may interact with testosterone45. In our study, we found no significant effects of either testosterone or cortisol on antibody levels. This finding is consistent with the results of Nowak et al.82, who found no influence of testosterone on the effectiveness of immune system using the influenza vaccine. In contrast, though, in vitro studies did find an immunosuppressive effect of testosterone on a spontaneous production of IgG in mononuclear cells of human peripheral blood84. Rantala et al.9, however, showed that the immune system\u2019s reactivity was higher in males with higher testosterone levels who simultaneously exhibited lower cortisol levels and, moreover, these males were perceived as more attractive by women. In our study, we found none of the expected associations between testosterone and the rated characteristics. We found only a weak negative association between cortisol and perceived healthiness, but not attractiveness. Interestingly, another study showed a negative association between attractiveness  and cortisol levels45.Previous studies reported that testosterone and cortisol have an effect on both the functioning of the immune system and perceived facial attractiveness and healthiness, and might thus work as mediators between the functioning of the immune system and perceived facial characteristics. According to the hypothesis of immunocompetence handicap, androgens exert immunosuppressive effects and only high-quality individuals (including their immunity) can produce and maintain a high level of testosterone and afford the physiological costs of lowered immunosuppression45. This suggests that one should exercise caution when selecting specific characteristics to be rated for individual studies.Additionally, we found that the two scales of facial attractiveness and healthiness are positively correlated but the magnitude of this association is not strong enough to treat the two as interchangeable. It is thus possible that facial attractiveness and healthiness stand for two separate perceptual qualities. This idea finds further support both in the negative association between cortisol levels and perceived facial healthiness reported in our study and in the negative association between cortisol levels and perceived attractiveness in a study by Moore et al.48 Moreover, the faces of obese and overweight individuals are perceived as less attractive51. Adiposity thus seems to underlie the relationship between immune response and attractiveness50. In our study, we did not find any significant relationship between perceived facial attractiveness or healthiness and antibody levels or body fat percentage. One possible explanation might be that participants in our sample had a generally lower body fat percentage (mean\u2009=\u200917.5%): only two participants fell in the obese category with body fat percentage over 25% (threshold recommended by the American Council on Exercise). Our sample, where variability of body fat percentage was relatively low, may have been thus ill-suited to detecting the negative effect of increased adiposity. On the other hand, other studies detected a negative effect of higher weight (expressed by BMI) on immune function even within the range of average body weight variation85.It has been reported that higher adiposity contributes to reduced immunocompetence, and possibly impaired immune function accompanied by changes in leukocyte counts, lower antibody production, as well as worse wound healing and higher risk of infections7. Furthermore, yellower skin was preferred alongside lighter skin, but it is well possible that this preference for lighter skin is due to the yellow carotenoid colouration being more visible in lighter skin hues7. In our study, however, we found no statistically significant associations between skin yellowness and perceived characteristics. A number of other studies  employed manipulation of skin colour in photographs, while we used natural portrait images. This may have resulted in a lower variability in our sample, thus potentially reducing the likelihood of observing the effect. Still, we found that both perceived facial attractiveness and healthiness were negatively predicted by higher\u00a0forehead redness and cheek skin healthiness was negatively predicted by higher\u00a0cheek redness. Although higher redness has been previously linked to higher perceived attractiveness and health17, the relationship need not be linear: it is possible that some level of redness may affect perceived attractiveness positively, but above a certain threshold it has a negative effect on perceived attractiveness16. We propose that higher (forehead) redness levels might be perceptually linked to dermatoses, such as rosacea86, acne, or other imperfections which are generally perceived as less attractive80.A number of previous studies reported associations between skin colour, facial appearance, and immune response. South African men with a higher cytokine response to stimulation (induced by LPS) had yellower, more \u2018carotenoid\u2019 skin colour87, we used facial skin colour measurements from the cheek and the forehead separately, as majority of colour measurements between those areas differed and were only moderately associated. Cheeks and forehead differ in the amount of subcutaneous fat and therefore also in blood perfusion, which might account for slight differences in colouration. Accordingly, it has been found that the variation of colour in different parts of the face matters, whereby for instance periorbital luminance, cheek redness, and overall yellowness of the face predict perceived health88. To some extent, though, the differences in the skin colour of various parts of the face in our sample might be also due to the methods we used for acquisition of facial photographs from which we measured the values of facial colours. Our aim was to simulate naturally occurring daylight conditions with a diffuse strobe light positioned above the participant\u2019s head pointing downwards. In this setup, though, the light source was positioned relatively close. Due to inverse-square law of loss of light over distance, it may have reflected on the forehead, causing it to appear brighter than the cheeks, and it may have produced highlights responsible for the observed colour differences between forehead and cheeks. Further, we tried to limit any potential effects of bright spots and light reflections by patting participants\u2019 foreheads with napkins and we waited for some time before taking the photographs to avoid any skin redness caused by this process. Still, some brighter areas may have appeared and caused specular highlights, thus affecting the measurements.Unlike various studies which measured skin colour from both cheeks and the forehead and averaged them into one value for facial skin lightness, redness, or yellowness89), which resulted in wide confidence intervals of the effect sizes and a low power to observe the reported effects (in most cases below 50%). Based on our Power curve analysis, even a sample size of 100 targets would not yield a higher power .Aside from the limitations discussed above, the main limitation of the present study is the small sample size of targets  as well as anti-vaccination biases which may have discouraged some individuals from participation10 and our results are based only on a male sample. Future investigations should thus include both men and women as targets and raters to better understand the complex relations between attractiveness and immunity and its role in intersexual selection.Previous research has also suggested that immunoreactivity and cues to various aspects of immune system functioning may differ between the sexesWe investigated the relationship between functioning of the immune system and perceived facial attractiveness, healthiness, skin patch healthiness, and potential influence of skin colour. We employed measurements of antibodies after application of two different vaccines as markers of reactivity of the immune system and recorded the levels of steroid hormones (cortisol and testosterone) as well as the percentage of adipose tissue due to their immunomodulatory properties and connection to facial attractiveness. We found no significant relationships between reactivity of the immune system and perceived facial attractiveness, healthiness, and skin patch healthiness. We did, however, observe a small negative effect of cortisol on perceived facial healthiness. Moreover, steroid hormones and adipose tissue showed no relationship to either the immune response after vaccination or skin colouration. Finally, higher\u00a0forehead redness from portrait photographs was perceived as both less attractive and healthy and higher\u00a0cheek redness from skin patches was perceived as less healthy. Our results thus suggest that facial attractiveness and healthiness provide a limited amount of cues to immune system functioning and perceived characteristics seem to be related only to certain hormone levels and facial colour.Despite some limitations, we believe that our study is a valuable contribution to research on the role of visual cues in assessments of functioning of the immune systems of individuals, and that it can serve as an entry for future meta-analysis aimed at disentangling the conflicting results of various existing studies. Future studies might also investigate the activation of different components of the immune system, such as humoral and cellular immunity, and focus on acquiring larger samples.Supplementary Information 1.Supplementary Information 2.Supplementary Information 3.Supplementary Information 4.Supplementary Information 5.Supplementary Information 6.Supplementary Information 7.Supplementary Information 8.Supplementary Information 9.Supplementary Information 10."}
{"text": "HIV rapid testing services is one among key interventions in the controlling of HIV/AIDS. Despite availability of quality standards, the quality of HIV rapid testing services remains questionable since non-laboratory testers are allowed to conduct testing while they are not specialized in providing testing services.To evaluate the compliance to the quality standards of HIV rapid testing services provided by non-laboratory testers in Makete District, TanzaniaAn explanatory descriptive study employing quantitative approach of data collection was used. An observation of 23 non-laboratory testers performing HIV rapid tests, observation of HIV testing points and documents review was done in 23 testing points to collect data. Data were analyzed using a programmed excel sheet and a three-point scale was used to determine the level of compliance to quality standards.Analysis shows that out of 23 testing points visited, the level of compliance to quality standards was lower for 22 (95.6%) testing points and moderate in 1 (4.4%) testing point. None of the testing point was highly complied to quality standards for HIV rapid testing services.The quality of HIV rapid testing services provided by non-laboratory testers is below the established quality standards for HIV rapid testing services. HIV rapid testing services is among key interventions in the controlling of HIV/AIDS since it provides chances to access HIV care, treatment, prevention, and support services.5Several studies have been conducted to evaluate the quality of HIV rapid testing services. An auditing study conducted in Caribbean and African countries, which involved 968 HIV testing points demonstrated that 20% of the testing points scored level 0; 46% of the testing points scored level 1; 31% of the testing points scored level 2; while 3% of the testing points scored level 3 and none of the testing point that had high level of compliance to quality standards such that none of the testing points scored level 4.6Furthermore a study conducted in 102 private health facilities in Kampala Uganda to evaluate the quality of HIV rapid testing services demonstrated that the quality of HIV rapid testing services is below the recommended quality standards.7Tanzania has also adopted the WHO quality standards for the implementation of HIV rapid testing services.The study was conducted at Makete District Council in Njombe Region, Southern Tanzania. HIV Records for 2016/2017 show that Njombe Region has the highest HIV prevalence (11.4%) in Tanzania.Purposive sampling technique was used to select both public and private health facilities where by all HIV rapid testing points were studied and non-laboratory testers who provided services on the day of the study were observed when performing actual HIV rapid tests.An on-site checklist for document review and observation adopted from WHO by the Tanzania Ministry of Health was used to collect quantitative data. The main areas of observations included: personnel training and certification; physical facility; safety; pretesting phase; testing phase; documentation and records as well as external quality assessment.Ethical clearance to conduct this study was obtained from Research and Ethics Committee (REC) of Muhimbili University of Health and Allied Sciences (MUHAS). Permission to conduct the study was requested from the District Medical Officer of Makete District and officer in charges of the respective health facilities. Study participants were informed about the purpose of the study, procedures, risk and benefits for them to participate in the study. Informed written consent was obtained from each study participant after agreeing to participate in the study.Data were collected manually and entered into excel sheets and they were cleaned and validated. All descriptive data were analyzed using programmed excel sheets and data were presented in frequency tables of numbers, percentages  and level of compliance to quality standards for HIV rapid testing service. Summation of each response of the open ended question in each quality standard was used to determine the average compliance for each quality standard. A three-point scae  was used to determine the level of compliance to all quality standards for HIV rapid testing services for each testing points whereas testing points scored level 4 (score of 90% or higher) were defined as highly complied to quality standards; level 3 (score of 80% \u2013 89%) were defined as moderately complied to quality standards; level 2 (60% \u2013 79%), level 1 (40% \u2013 59%) and level 0 (less than 40%) were defined as lower complied to quality standards.Most of the HIV testers (34.8%) worked on wards, Reproductive and Child Health section (21.7%) and Care and Treatment Centre (13%). The majority of the testers (52%) were from the district level health facilities while about 22% of them were from dispensaries. Majority of the testers (78%) worked in the government health facilities and the remaining 22% worked in private health facilities. Most of testers were women (78.3%) while 21.7% were men. All testers (100%) had ordinary level of secondary education whereas among them 69.6% testers had certificate level of education and 30.4% had diploma level of education. Only one study participant (4.4%) was clinical officer, 30.4% were enrolled nurses and 34.8% were Medical attendants while 30.4% were assistant nursing officers.Evaluation results show that out of 23 testing points visited, the level of compliance to the quality standard was lower for 22 (95.6%) testing points. Two (2) testing points (8.7%) scored level zero, 13 (56.5%) testing points scored level one and 7 (30.4%) scored level two. The level of compliance to HIV rapid testing quality standards was moderate in 1 (4.4%) testing point. None of the testing point had high level of compliance to the HIV rapid testing quality standards, meaning that no testing point attained level four. Average compliance for each quality standard was also determined by observing how non-laboratory testers and testing points operations comply with such standards. These standards include: personnel training and certification; physical facility, safety, pretesting phase, testing phase, documentation and records as well as external quality assessment. The average compliance to personnel training and certification quality standards was 15% whereas: only 9 (39%) out of 23 non laboratory testers that provided HIV rapid testing services on the day of the study received comprehensive training on HIV rapid testing using the nationally approved curriculum; only 2 (9%) non-laboratory testers were trained on external quality assessment (EQA)/proficiency testing (PT) process; only 5 (22%) non-laboratory testers were trained on safety and waste management procedures and practices. No any non - laboratory tester has been certified or licensed through a national certification program to perform HIV rapid testing services.Average compliance to physical facility quality standards was 65% whereas: 16 (66%) testing points have designated area for providing HIV rapid testing services; 11 (48%) testing points were clean and organized for testing; 22 (96%) of testing points had sufficient lighting; none of the testing points store test kits in temperature-controlled environment and there was no device to monitor temperature in all visited testing points and 18 (78%) testing points had sufficient and secure storage space for test kits and other testing consumables.Average compliance to safety standards was 56% whereas: only 2 (9%) testing points had SOPs to manage spills of blood and other body fluids; only 4 (17%) testing points had SOPs to address accidental exposure to potentially infectious body fluids through a needle stick injury, splash or other sharps injury; all 23 (100%) testing points had personal protective equipment (PPE) and testers properly used PPEs through the testing process; 13 (57%) testing points had hand-washing facilities such as water and liquid soap. Only 6 (26%) testing points handled properly waste materials such as sharps, infectious and non-infectious waste and only 13 (56%) testing points disinfect working area with the appropriate disinfectant such as chlorine.The average compliance to pre testing phase standards was 63% whereas: only 9 (39%) testing points had national guidelines for HIV testing services; all 23 (100%) testing points use national algorithm and approved HIV rapid kits; expired HIV rapid test kits such as uni-gold were available in 9 (39.1%) testing points; only 4 (17%) testing points had a standard process for stock management; only 4 (17%) testing points had posted job aides on client sample collection; 19 (82%) testing points had sufficient supplies for client sample collection and in only 9 (39%) testing points, client's identifiers were recorded in the HIV testing register and on test devices as per national guidelinesThe average compliance for testing phase standards was 53% whereas: only 5 (54%) testing points had SOPs on HIV testing procedures and posted at the testing area; timers were available and used routinely in only 1 (4.3%) testing point; sample collection devices such as capillary tube, loop, disposable and pipettes were used accurately in 22 (95%); testing procedures such as correct use of buffer and reading of results on time were adequately followed in 16 (70%) testing points and positive and negative quality control specimens were routinely used in 13 (57%) testing points. Retest for verification was done in 4 (67%) health facilities out of 6 health facilities visited.Average compliance to documentation and records standards was 92% whereas: 20 (87%) testing points had standardized register for documentation, which contain key elements in the registers such as client demographics, kit names, lot numbers, expiration dates and tester name. The final HIV results were recorded correctly in 16 (70%) testing points; client documents and records were securely kept throughout all phases of the testing process in 22 (95%) testing points.Average compliance to External Quality Assessment was 40% whereas: 11 (48%) testing points were enrolled in Proficiency Testing (PT) program; out of 11 testing points enrolled into PT program, only 4 (36%) testing points implement corrective action in case of unsatisfactory PT results; 21 (91%) testing points received periodic supervisory visit and written supervision report was available in only 1 (5%) testing point.This study has shown that the level of compliance to the quality standards for HIV rapid testing is below the recommended standards. Majority of observed HIV testing points scored level one and none of the testing point was highly complied to quality standards, meaning that no testing points scored level four. The results of this study are similar with the study conducted in Kampala Uganda to assess the quality of HIV counseling and testing services, which demonstrated that the quality of HIV testing services is below the recommended standards.13In this study, the highest average compliance score was seen on documentation and records followed by physical facility that included availability of conducive designated areas for provision of HIV rapid testing services and the lowest average compliance score was seen on personnel training and certification, followed by External Quality Assessment, testing phase, safety and pre testing phase. In addition, this study revealed that availability of new National HIV register that require all key elements to be documented in one register has contributed to improved documentation and record keeping for different data hence results into higher score for documentation and records quality standards. Furthermore, this study shows that most of the non-laboratory testers did not receive comprehensive training to perform HIV rapid testing services and none of them were certified/licensed to perform HIV rapid test through the National Certification Program. This situation has resulted into the lower score for the personnel training and certification quality standards, which was below the recommended quality standards for HIV rapid testing services, which requires that services should be provided by testers who received comprehensive training as well as evaluated for their competence and certified to provide testing services.7In this study we observed low compliance to the quality standards for External Quality Assessment (EQA) and about half of the testing points were enrolled into proficiency testing program and most of the testers were not trained to perform samples for proficiency testing. A study conducted in South Africa to evaluate the quality management system for HIV rapid testing services reported similar findings indicating that the compliance to EQA standards was low and only two clinics out of eleven clinics were enrolled into proficiency testing program. 6In this study, non-adherence to testing procedures including the use of small volume of buffer and non-adherence on time to read result whereby timers were not used during testing were observed. Similar findings were reported in a study conducted in Zambia National Reference Hospital in which the use of inadequate volume of specimen and use of incorrect volume of buffer leading into poor quality of test results was reported.11Our study has shown that a few testing points had guidelines for HIV testing services and Standard Operating Procedures (SOPs). These guidelines and SOPs are important documents for providing guidance and procedures needed to be followed during testing hence lack of guidelines and SOPs compromises the quality of HIV rapid testing services.19Some of the testing points were temporarily closed during data collection period due to lack of trained testers to provide service, and probably such testing points could have useful information regarding the practice of implementation of HIV rapid testing services in studied facilities. Furthermore, due to resource constrains only six facilities were studied, which might have limited the data collected. However, we believe that this study provides valuable insights regarding the quality of HIV rapid testing services provided by non-laboratory testers in the rural setting district in Tanzania.The quality of HIV rapid testing services provided by non-laboratory testers in Makete District is below the established quality standards set for provision of HIV rapid testing services. Most of the non-laboratory testers were not trained, evaluated for their competencies and were not certified or licensed to provide HIV rapid testing services. Some of HIV rapid testing points do not have Guidelines and SOPs that guide provision of HIV rapid testing services, which compromises the quality of HIV testing services. The Ministry of Health and Management of the health facilities should invest more efforts in training and strengthening of certification of non-laboratory testers, increasing enrolment of testing points into proficiency testing and strengthening supervision of testing points in order to improve compliance to quality standards."}
{"text": "Here, we assessed the effects of imbalanced NKCC1 and KCC2 on \u03b3-aminobutyric acidergic (GABAergic) neurotransmission in certain brain regions involved in human focal cortical dysplasia (FCD).Altered expression patterns of NaWe sought to map a micro-macro neuronal network to better understand the epileptogenesis mechanism. In patients with FCD, we resected cortical tissue from the seizure the onset zone (SOZ) and the non-seizure onset zone (non-SOZ) inside the epileptogenic zone (EZ). Additionally, we resected non-epileptic neocortical tissue from the patients with mesial temporal lobe epilepsy (MTLE) as control. All of tissues were analyzed using perforated patch recordings. NKCC1 and KCC2 co-transporters expression and distribution were analyzed by immunohistochemistry and western blotting.Results revealed that depolarized GABAergic signals were observed in pyramidal neurons in the SOZ and non-SOZ groups compared with the control group. The total number of pyramidal neurons showing GABAergic spontaneous postsynaptic currents was 11/14, 7/17, and 0/12 in the SOZ, non-SOZ, and control groups, respectively. The depolarizing GABAergic response was significantly dampened by the specific NKCC1 inhibitor bumetanide (BUM). Patients with FCD exhibited higher expression and internalized distribution of KCC2, particularly in the SOZ group.Our results provide evidence of a potential neurocircuit underpinning SOZ epileptogenesis and non-SOZ seizure susceptibility. Imbalanced function of NKCC1 and KCC2 may affect chloride ion homeostasis in neurons and alter GABAergic inhibitory action, thereby contributing to epileptogenesis in FCDs. Maintaining chloride ion homeostasis in the neurons may represent a new avenue for the development of novel anti-seizure medications (ASMs). Focal cortical dysplasia (FCD) is a common cause of refractory epilepsy . HistoloA receptor agonists; this remains a clinical challenge. Recent studies have demonstrated that the Na+-K+-2Cl\u2013 (NKCC1) and K+-Cl\u2013 (KCC2) cotransporters alter GABAergic inhibitory function by regulating intracellular chloride concentration ([Cl\u2013]i) (GABA) and prominent GABAA receptor (GABAAR)-mediated spontaneous and evoked depolarizing responses in pediatric patients with severe FCD exhibiting epilepsy. \u2013]i caused by whole-cell recordings or the lack of intracellular recordings.Epilepsy results from an imbalance between excitatory and inhibitory synaptic transmission in the brain . Previou([Cl\u2013]i) . Histolo([Cl\u2013]i) . In addi([Cl\u2013]i) . This suAt the macroscopic level, based on electrocorticography (ECoG) data This study sought to compare the detailed electrophysiological characterization of GABAergic neurotransmission in pyramidal neurons in the SOZ and non-SOZ inside the EZ of patients with FCD with non-epileptic temporal neocortex and to correlate these features with the patterns of NKCC1 and KCC2. We probed whether depolarizing GABAergic action caused by the imbalanced function of NKCC1 and KCC2 cotransporters would perturb chloride ion homeostasis in neurons and contribute to the generation and propagation of epilepsy in patients with FCD.In this study, 30 patients with intractable epilepsy were enrolled at Xuanwu Hospital of Capital Medical University from June 2018 to December 2019. Following a standardized preoperative evaluation, all patients underwent surgery to remove the EZ. Neocortical tissues were obtained from 20 patients with FCD and epilepsy. In addition, 10 patients with mesial temporal lobe epilepsy (MTLE) were chosen as the control group because of their relatively non-epileptic neocortical tissue, as suggested by previous studies . The temEach patient recruited in the study underwent standardized preoperative evaluation procedures to delineate the EZ and locate the SOZ, including detailed clinical history, neurological examinations, video-electroencephalographic recordings (vEEG), neuropsychological examinations, and neuroimaging studies, etc. Neuroimaging studies include high-resolution magnetic resonance imaging , magnetoencephalography, and 18-fluorodeoxyglucose positron emission tomography (FDG-PET). As mentioned above, Given that the brain tissue is taken during surgery, the surgeon cannot cut off the blood supply in order to keep the brain tissue alive before collecting the brain tissue. When we collected the first two samples (SOZ and non-SOZ) from the first patient, it was shown that collecting two brain tissues at the same time would cause more serious bleeding which did inevitable damages to the patient. Therefore, from the second patient, we adopted a double-blind and random sampling method, and each patient randomly collected one piece of brain tissue. All patients with FCD were confirmed by a postoperative histological examination . In summ2 and 5% CO2) cutting solution containing 220 mM sucrose, 2.5 mM KCl, 1.25 mM NaH2PO4, 25 mM NaHCO3, 0.5 mM CaCl2, 7 mM MgCl2, and 10 mM D-glucose , and transferred to our electrophysiological laboratory within 5\u201310 min. Subsequently, meninges and blood clots were gently removed, and 400 \u03bcm neocortical transverse slices were cut using a vibratome  and incubated in oxygenated (95% O2 and 5% CO2) artificial cerebrospinal fluid (ACSF) containing (in mM) 125 NaCl, 2.5 KCl, 1.25 NaH2PO4, 26 NaHCO3, 2 CaCl2, 2 MgCl2, and 10 D-glucose  at room temperature for at least 1 h before recording.After being obtained in the operating room, neocortical tissues were immediately placed into an ice-cooled and oxygenated . Gramicidin was stocked at an initial concentration of 16 mg/ml and then diluted with pipette solution to reach a final concentration of 80 \u03bcg/ml. The electrode tip and barrel were backfilled with pipette solution and gramicidin-containing pipette solution, respectively. Following the formation of a tight seal and after the series resistance (Rs) decreased and stabilized at 30\u2013110 M\u03a9, we started recording. Recordings were ended when a rapid decrease in Rs and a \u201cleak-like\u201d current were observed, indicating that the cell had entered the conventional whole-cell configuration by rupture of the membrane seal. The resistance and capacitance of the pipette have been compensated. Liquid junction potential was not corrected.Following incubation, the brain slices were submerged in a recording chamber perfused with oxygenated ACSF at a rate of 2\u20132.5 mL/min at room temperature. Perforated patch-clamp recordings were performed on pyramidal neurons in the neocortex and viewed under an infrared differential interference contrast microscope with a Nikon 40 water immersion lens . Recordings were performed in layers III and IV in the non-SOZ and control groups. In the SOZ group, in which the lamina was not clearly defined, layers III and IV were generally located according to the non-SOZ lamina in the middle region of the dysplastic cortex . Pyramidm), membrane conductance, and firing properties to identify pyramidal neurons in the current-clamp mode. Next, we recorded spontaneous excitatory postsynaptic currents (sEPSCs) for 3 min at a holding potential of \u221270 mV in the voltage-clamp mode. Subsequently, we acquired pharmacologically isolated GABAergic sPSCs by applying 6-cyano-7-nitroquinoxaline-2,3-dione  and DL-2-amino-5-phosphonopentanoic acid  to block \u03b1-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) and N-methyl-D-aspartate (NMDA) receptors. BUM (10 \u03bcM) was then added to assess its effects on GABAergic sPSCs. The sEPSCs were automatically detected at amplitude adjusted above the root 2 mean square noise level using Clampfit 10.5 . Cumulative amplitudes were calculated by summating amplitudes of all events within 180 s periods.We first recorded the resting membrane potential  from a pipette resting 10 \u201320 \u03bcm above the slice at the position of the recorded soma. The system enabled quick fluid changes with a speed of 1 ml/min and a diameter of about 20 \u03bcm for its tip. Voltage ramps \u221280 to + 10 mV over 100 ms applied from a holding potential of \u221270 mV in the absence and presence of GABA were used to determine EGABA. The membrane voltage at which the current traces, obtained in the presence and absence of GABA, crossed was measured as the apparent EGABA. Then, voltage ramps were repeated following the addition of BUM (10 \u03bcM). The membrane voltage at which the current traces, obtained in the presence and absence of BUM, crossed was measured as the apparent EBUM. In addition, the driving force for GABA production (DFGABA = EGABA\u2013Vm) was measured.In this study, to probe the EThe brain tissue was fixed in 10% formalin and embedded in paraffin. Paraffin-embedded tissues were sectioned at 6 \u03bcm and heated in a microwave oven (60\u00b0C for 60 min). The sections were thereafter deparaffinized in xylene and rehydrated sequentially in graded concentrations of alcohol. Sections from the SOZ, non-SOZ, and control groups were probed with an anti-KCC2 antibody  overnight at 4\u00b0C. The slides were then incubated with horseradish peroxidase-conjugated secondary antibodies at room temperature for 1 h. Immunolabeling was visualized using the avidin-biotin conjugation method and 3,3\u2032-diaminobenzidine. The sections were next counterstained with hematoxylin.Brain slices were post-fixed with 10% formalin, washed three times with PBS, incubated for 30 min with 0.3% Triton, and then blocked with 1% goat serum for 1 h to avoid binding of non-specific antibodies. Sections were then incubated at 4\u00b0C overnight with the following primary antibodies: anti-NKCC1 , anti-NeuN . Secondary antibodies conjugated to Alexa Fluor 488 or 594  were applied for 1.5 h at room temperature. Slides were mounted with Fluoroshield containing DAPI  and observed with a confocal microscope .Total protein was quantified using a BCA Protein Assay Kit . Samples were electrophoresed on 5 and 10% Tris\u2013HCl gels, transferred onto polyvinylidene difluoride membranes, and incubated with primary antibodies . GAPDH  was used as the reference protein. Horseradish peroxidase-conjugated secondary antibodies  were used to bind the primary antibodies. The bands were visualized using a two-channel infrared (IR) scanner . Densitometric analysis of the protein signals was carried out using the ImageJ software . The target protein levels were normalized to internal control.t-test or one-way ANOVA with post-hoc tests. Results were expressed as mean \u00b1 standard error of the mean (SEM), with significance set at p < 0.05. For the skewed distribution, analysis was carried out using the non-parametric Kruskal\u2013Wallis test followed by Dunn\u2019s multiple comparisons or Mann\u2013Whitney U-test. Results were expressed as medians and interquartile range (IQR), with significance set at p < 0.05.All data distributions were assessed with the Shapiro\u2013Wilk test. For the normal distribution, data were analyzed using Student\u2019s n = 9), temporal (n = 10), or posterior quadrants (n = 1).First, we analyzed the clinical characteristics of the patients included in this study. No significant differences in the mean duration of epilepsy were observed across the groups. Briefly, the male/female ratio of patients with FCD exhibiting epilepsy enrolled in the study was 1:1, the mean duration of epilepsy being 13.5 \u00b1 1.8 years and the average age at surgery being 22.9 \u00b1 2.1 years old. The EZ in the FCD was localized in frontal , input resistance (RN), or membrane time constant  and non-SOZ group . However, no significant difference was observed between the SOZ and non-SOZ groups. The median amplitude of sEPSCs on pyramidal neurons was not significantly different among the three groups. The decay time was smaller in the non-SOZ group  than in the control group  and the SOZ group . In addition, no significant differences in the sEPSC rise time were observed across the groups  with picrotoxin at a holding potential close to RMP in patients with tuberous sclerosis . We normalized GABAAR-mediated sPSCs before and after the application of BUM (10 \u03bcM). BUM reduced GABAAR-mediated sPSCs frequency  and cumulative amplitude  in FCD patients  than in the non-SOZ . There was no significant difference in the frequency of GABAAR-mediated sPSCs , the amplitude of GABAAR-mediated sPSCs  and the cumulative amplitude of GABAAR-mediated sPSCs  in the pyramidal neurons of between SOZ and non-SOZ groups  was significantly shifted to more positive values compared to that in the control group  and non-SOZ group  was more positive than RMP  in the SOZ group. In contrast, no significant differences were observed between EGABA and RMP in the non-SOZ  and control groups . DFGABA was significantly higher in the SOZ group than in the control group , but EGABA shifted to more negative values in the SOZ group (\u221252.9 vs. \u221275.0 mV) (Entersect . The ave75.0 mV) .In addition to the electrophysiological results indicated significant depolarizing GABAergic signaling in neurons in the SOZ group, we assessed the neuronal expression of NKCC1 and KCC2 in the three groups . As prevDiffuse neuropil staining for KCC2 was observed in the FCD cortical tissue as well as in the control temporal neocortex. The neurons in the SOZ showed that KCC2 was internalized into the cells and that its distribution on the cell membrane was significantly reduced. However, there was no obvious KCC2 cell internalization in the non-SOZ and control groups. Histological analyses revealed cytoplasmic KCC2 accumulation in neurons in the SOZ group, whereas cytoplasmic KCC2 staining was absent in the non-SOZ and control groups . A westeGABA in the SOZ than in the non-SOZ, which may explain the macroscopic differences between the SOZ and non-SOZ in patients with FCD. In addition, we revealed that depolarizing GABAergic neurotransmission in FCD patients, which can be reversed by BUM, is related to the imbalanced function of NKCC1 and KCC2 in the SOZ. This is the first comparative study of depolarizing GABAergic signals in the SOZ, non-SOZ, and non-epileptic cortical regions. Our findings provide important evidence of a potential neurocircuit underlying SOZ epileptogenesis and non-SOZ seizure susceptibility. These results also point to a possible mechanism for epileptogenesis in FCD at the cellular and microcircuit levels, highlighting a novel therapeutic avenue for patients with FCD and epilepsy.xIn this study, we assessed the electrophysiological characteristics and depolarizing synaptic activity of pyramidal neurons in patients with FCD and epilepsy. In particular, we probed the effects of imbalanced function of NKCC1 and KCC2 on GABAergic signaling in pyramidal neurons inside the SOZ, non-SOZ within the EZ of the patients with FCD, and non-epileptic neocortex in patients with MTLE (control). We sought to establish a relationship between macroscopic epileptogenesis and microscopic cell-to-cell communication to better understand the epileptogenic network of FCD through a micro-macro neuro-electrophysiology lens. We observed depolarizing GABAergic signaling in pyramidal neurons located in the SOZ and non-SOZ of the FCD, but not in the control group. Although there is no significant difference between SOZ and non-SOZ in terms of frequency and intensity of depolarizing GABAergic responses at this microscopic level, however, there were more neurons with depolarizing GABAergic responses and higher EAccurate delineation of the EZ is critical to determining which patients with refractory epilepsy are appropriate candidates for surgical intervention . Althoug\u2013 transporters and highest EGABA compared to the subiculum and hippocampal proper in patients with MTLE, which indicates relatively balanced NKCC1 and KCC2 level  temporal neocortical tissue lies far from the EZ and is not characterized by any obvious structural aberration ; (2) temC2 level ; and (3)in vitro. In contrast, mainly inhibitory GABA actions was shown in the immature hippocampus and neocortex in vivo (in vitro preparations is currently highly debated (A activation and GABAAR-mediated synaptic transmission changes from inhibitory to excitatory effects caused by altered NKCC1 and KCC2 (AR-mediated postsynaptic responses, depolarized EGABA in pyramidal neurons at the single-cell level, and corresponding changes in NKCC1 and KCC2 in the SOZ and non-SOZ of patients with FCD exhibiting epilepsy, when compared to those obtained from non-epileptic human temporal neocortex from patients with MTLE. Moreover, we found several differences in GABA activity between the SOZ and non-SOZ groups in the EZ of patients with FCD, highlighting the importance of depolarizing GABA within a seizure network.The recruitment of glutamatergic neurons is a fundamental component of seizures . As 80%  in vivo . It is t debated . Furtherand KCC2 . In our in vivo, which has been shown to impair neuronal network formation (\u2013, which are modulated by the extrusion of Cl\u2013 by KCC2. Thus, the loss of KCC2 function results in the neuronal accumulation of Cl\u2013, shifting the direction of ion flow through GABA receptors from hyperpolarizing to depolarizing (In our study, consistent with previous studies, we observed that KCC2 expression was downregulated and internalized in the EZ of patients with FCD, especially in the SOZ . Althougormation . Moreovelarizing .\u2013 inward. We found that the imbalanced function of NKCC1 and KCC2 in the EZ resulted in depolarization of GABA receptor function and may underpin the hyperexcitability of FCD brain regions. Compared with the control group, SOZ and non-SOZ of patients with FCD showed depolarizing GABA response on pyramidal neurons. Although there were no significant differences in terms of the frequency and intensity of the depolarizing GABA response across the SOZ and non-SOZ groups, fewer neurons with depolarizing GABAergic responses and higher EGABA were shown in the SOZ than in the non-SOZ of FCD patients. The migration of seizures from one side to the other requires the presence of dynamic depolarizing GABA in the network (The change of GABA function in the SOZ can strongly affect the microcircuit connection and neuronal network, as well as activate and silence individual neurons. In support of the critical role of KCC2 in postnatal GABAergic inhibition,  network . Therefo network . AlthougAR-mediated postsynaptic responses in cortical slices of patients with FCD and epilepsy at the individual cell level. However, the use of BUM as a potential new antiepileptic drug warrant further examination. Future studies should examine BUM derivatives as novel ASMs. In addition to NKCC1, an inhibitor of KCC2 should be explored for its effect on depolarizing GABA responses.In our study, we focused on the depolarizing GABA synaptic activity caused by the imbalance of NKCC1 and KCC2 and aimed to build a micro-macro neuronal network to determine the relationship between depolarizing GABA and epileptogenesis in FCD. We observed depolarizing GABAergic signaling among pyramidal neurons in both the SOZ and non-SOZ of the patients with FCD, with a higher number of responsive neurons in the SOZ group. Thus, we speculated that abnormal GABAergic activity might influence epileptogenesis in the SOZ group and seizure susceptibility in the non-SOZ group. The microscopic recordings within areas of macroscopic evaluation and definition, that is, SOZ and non-SOZ, also pointed to the importance and potential of mapping epileptic activities at multiple scales. In addition, given the effects of BUM, the maintenance of chloride homeostasis in neurons could represent an alternative avenue for developing ASMs. Previous studies have reported that BUM exerted significant seizure control effects in adult patients with temporal lobe epilepsy . In our This study had several inevitable limitations. First, although we found the specific NKCC1 inhibitor BUM significantly reduced the depolarizing GABAergic response, it is hard to figure out why BUM functions as a result from functional upregulation of NKCC1 or decreased expression of KCC2 in FCD. To solve this issue, we think that the single-channel recording and the specific and available blocker of KCC2 is in urgent need. Second, it remained difficult to obtain SOZ and non-SOZ from the same patient with FCD to avoid excess injury and protect important functional brain areas during surgery. Finally, the size of our cohort was relatively small, and we did not take a deeper look into the differences across variable FCD subtypes and neuronal subgroups. In the future, a larger cohort of patients should be recruited to assess the potentially different GABAergic functions across FCD subtypes and other types of neurons, such as interneurons.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by the Medical Ethics Committee of Xuanwu Hospital, Capital Medical University. Written informed consent to participate in this study was provided by the participants\u2019 legal guardian/next of kin.GZ and XFY: supervision and conceptualization. RL: methodology and writing \u2013 original draft. YX, HZ, JW, HLL, and LC: writing \u2013 review and editing. DL: visualization. TY, XMY, CX, YP, and LZ: provide clinical patient data, tissue specimens, and pathological examination. HHL: review and edit the manuscript. All authors contributed to the article and approved the submitted version."}
{"text": "The benign aggressive tumour known as a giant cell tumour of bone (GCTB) frequently affects the knee bones.\u00a0Patients suffering from GCTB present with pain, swelling, joint effusion, loss of ability to bear weight on the involved extremity and a restriction in the range of motion of the afflicted joint may also exist, depending on the tumour's size. GCTB makes up 20% of benign skeletal tumours and 5% of all primary bone tumours. Although it has an equal distribution of the sexes, the majority reveal a higher frequency among women. Eighty per cent\u00a0of GCTB instances were recorded in patients between the ages of 20 and 50 during the third decade. The femur, tibia\u00a0and radius are where GCTB is most frequently discovered. Lesions can be rated using the Campanacci grading method based on the plain radiograph's results. Plain radiography, CT and MRI are used to diagnose the tumour. Surgery is the only curative treatment which is determined by the Campanacci grade and the tumour's location. Recurrence of GCTB is observed in about 25% of patients, with curettage being associated with rates as high as 50%. We evaluated the GCTB-related articles and summarised the developments in diagnosis, treatment and reducing risk of recurrence. Giant cell tumour of bone (GCTB), first described in 1818, is a benign primary bone tumour marked by multinuclear giant cells and has a high propensity to return locally after treatment . NeoplasIt is uncommon for GCT to involve the metatarsal bone in patients with underdeveloped skeletons . It is aEpidemiologyGCT makes up 20% of benign skeletal tumours and 5% of all primary bone tumours. Southern India and China, where GCT accounts for 20% of all primary bone tumours, have an especially high prevalence. Although some studies have claimed an equal distribution of the sexes, the majority reveal a higher frequency among women. Eighty per cent\u00a0of GCT affects patients between the ages of 20 and 50 during the third decade when the prevalence of the condition increases. Less than 3% of cases include children under the age of 14, and only 13% involve patients over the age of 50. Most lesions (75%-90%) form in long bones, with the knee accounting for the bulk of cases (50%-65%) . Paget dSiteAlthough GCTB can develop anywhere in the skeleton, it usually manifests as an extension of the metaphysis into the epiphysis in long bones . The disGrading systemThe tumour often shows up as an irregular region of bone loss on conventional radiography. In cases of a higher grade, the cortex may thin and perforate. Lesions can be rated using the Campanacci grading method based on the plain radiograph's results. Lesions of Grade I are limited to the bone. Grade II lesions are those that feature an enlargement of the cortex but no perforation and Grade III lesions are those that have soft tissue extension and cortical perforation . The difSymptomsPain is the most typical GCTB-presenting symptom. Additional symptoms include swelling, joint effusion, and a restriction in the range of motion of the afflicted joint may also exist, depending on the tumour's size. Some symptoms, including neurological symptoms in GCTB of the axial skeleton, are specific to the location of the tumour. When the cortex of weight-bearing bones thins, patients may even present with pathological fractures .ImagingA physical examination is done after getting a patient's medical history. Plain radiography, computed tomography (CT), and magnetic resonance imaging (MRI) are used to assess the main tumour. While plain radiography and CT are helpful for assessing the tumour's bone component, MRI is better suited for evaluating the tumour's intramedullary and soft tissue expansion. Finding pulmonary metastases, which may exist in a very tiny proportion of patients, requires the use of a chest radiograph. To find more skeletal illness areas, bone scans are helpful . The \"doAmong all medical imaging techniques, MRI is the most crucial since it enables disease diagnosis, disease severity evaluation, and therapy planning. In up to 67% of cases, the preoperative MRI not only identifies the condition but also matches the postoperative findings . For theDiagnosisGiant cells are found in many benign and malignant bone lesions, hence it is important to correlate clinical, imaging, and pathologic data when diagnosing GCTs in order to rule out other lesions with a similar histologic pattern . In GCTBTreatmentAt this time, proper surgery is the only curative treatment for GCTB. In general, the sort of surgery that would be suitable is determined by the Campanacci grade and the tumour's location . Curettage and adjuvant therapy are preferred for Campanacci grade 1 or 2 tumours (which do not extend beyond the cortex), but tumours with soft tissue extension (Campanacci grade 3) are treated with extensive local excision due to their high risk of recurrence . AlthougRiskWith the use of local adjuvant therapy, the high risk of recurrence associated with intralesional surgery can be reduced to about 30%. The Scandinavian Sarcoma Group demonstrated in their retrospective analysis that the likelihood of recurrence was decreased from 61 to 22% when cement rather than bone graft was used to fill the surgical void . HoweverHistologyGCTB has a friable look and a dark brown to reddish colour. The histological appearance of GCTB traditionally exhibits a stroma of mononuclear spindle cells and monocytes in the foreground and several big multinucleated giant cells in the background . Neoplasa. Primary malignant GCTB, pre-denosumab: Undifferentiated pleomorphic sarcoma is indicated by the proliferation of atypical spindle and pleomorphic cells developing in fascicles; GCTB is indicated by the proliferation of ovoid to spindle bland-appearing cells with scattered reactive multinucleated osteoclast-like large cells.b. Secondary malignant GCTB, pre-denosumab: GCTB-like histological characteristics coexisted with an unusual spindle cell proliferation that invaded between the host bone trabeculae, which was a sign of a high-grade, undifferentiated spindle cell sarcoma .According to available data, benign GCT of bone has three different cell types:Type I cells have the ability to multiply, resemble interstitial fibroblasts, and produce collagen. The tumour component of GCT is probably this cell population. The mesenchymal stem cells from which type I cells may have been formed share some characteristics with type I cells; however, type I cells also have characteristics that may indicate an early differentiation of mesenchymal stem cells into osteoblasts.Type II cells can be recruited from the peripheral bloodstream and are also interstitial, but they resemble the monocyte/macrophage family. By fusing with one another or by nuclear multiplication without cell division, these cells are regarded to be the forerunners of the multinucleated giant cells. Giant cells lack the monocyte/macrophage lineage surface receptors that are expressed by type II cells.The multinucleated large cells are type III cells. They morphologically resemble osteoclasts and share many of their traits. They have bone resorption enzymes such as type II carbonic anhydrase and tartrate-resistant acid phosphatase. The majority of the unique osteoclast antigens are shown by GCT large cells. There are calcitonin and vitronectin cell receptors, and matrix metalloproteinases (MMPs) are expressed .Tumour markersSerum acid phosphatase has been studied for its potential utility in GCT as a tumour marker. According to one study, half of the cases had high acid phosphatase levels, while the other half had levels that were normal. Acid phosphatase concentrations were higher in those with larger GCT lesions. However, postoperatively, serum acid phosphatase levels significantly dropped in both populations. In spite of these findings, acid phosphatase is not a reliable screening indicator for sufficient resection or local recurrence. The tumour marker creatine kinase isoenzyme BB (CK-BB) is also being studied in GCT. In order to regenerate adenosine triphosphate, this enzyme catalyses the reversible transfer of phosphate from phosphocreatine to adenosine phosphate. It is hardly ever discovered in the serum of healthy people. Patients with brain traumas, stomach cancer, prostate cancer, and particular forms of osteopetrosis have seen it most frequently. Patients with osteosarcoma, aneurysmal bone cysts, malignant fibrous histiocytomas, or common osteolytic entities do not have increased levels. Patients with GCT have high CK-BB levels at the time of diagnosis, and two weeks following excision, their CK-BB levels recover to normal. In spite of these findings, CK-BB does not serve as a reliable screening indicator for sufficient resection or local recurrence .Latest advancementDenosumab may be administered as neoadjuvant chemotherapy in GCTB patients where surgical resection is the preferred main treatment option in order to facilitate tumour excision. To achieve a greater tumour resection margin, pre-operative denosumab is administered to inhibit tumour osteolysis, raise bone mineral density, increase marginal sclerosis, and reconstitute the articular surface . AdditioThe article provides more clarity\u00a0about GCTB which is a benign aggressive tumour. The Campanacci grading method is the most frequently mentioned classification method. Major imaging technique like plain radiography, MRI and CT role in the diagnosis of GCTB has also been explained. Due to the development of these imaging techniques, it has become easy for doctors to diagnose GCTB.\u00a0The article also explained different treatment procedures that are required to be followed based on the Campanacci grading system and the tumour's location. The risk factors involved in its treatment and chances of recurrence after treatment have also been assessed. The role of denosumab is also explained. Types of cells found in benign GCTB and histological characteristics of cancer in GCTB have also been discussed in this article."}
{"text": "The Dictator chooses either fair or competitive allocation while selecting the competitive allocation is irrelevant to increasing the Dictator\u2019s payoffs. The Recipient decides whether to accept the Dictator\u2019s decision or receive sure but low rewards. We found that Recipients with high-level paranoid thinking expected their opponent to select competitive allocation more than those with low levels, even when selecting it was costly for Dictators. Paranoid thinking was not associated with selecting sure rewards or competitive allocations. The results suggest that paranoia reflects the belief that others have a competitive intention but is not related to avoidance behavior against perceived threats and unilateral attacks.Paranoid thinking, that others are hostile, can be seen even in the general population. Paranoia is considered the expectation that others are competitors who aim to maximize the differences in payoffs rather than maximize their own payoffs. This study examined whether paranoia reflects the irrational belief that others have a competitive intention and is associated with avoiding perceived competition. We recruited 884 US residents  Paranoia is an unfounded concern that others have intentions to harm . Paranoie.g., desire to reduce Recipients\u2019 payoff) or self-interest . Previous studies have demonstrated that recipients with higher paranoid thinking tend to attribute unfair Dictator\u2019s decisions to harmful intent, although the attribution of self-interest does not differ between paranoia levels   plays a Recent studies have provided evidence that paranoia is the tendency to infer the intentions of others as harmful rather than self-interested . In othee.g., $0.5) and decide whether to attack their partner or not. If neither of them chooses to attack during the allotted time, both receive the initial money . If one of them attacks the partner first, they must pay a small cost . In contrast, the attacked partner loses a larger amount of money . Attacks in the PSG are against maximizing their own payoffs; therefore, there is no reason for people with an individualistic orientation to engage in an attack. People who believe that others are rational would not choose to attack them. However, preemptive attacks can occur driven by the fear that others may have a competitive orientation. Indeed, the PSG experiment observed people who engaged in preemptive attacks because they were driven by fear .Previous studies have used DG to examine the connection between paranoid thinking and attribution of the Dictator\u2019s selfish behavior . However by fear . A previ by fear  showed tThe purpose of the present study is to examine in detail whether paranoia reflects the belief that others are competitors and is associated with behavior that avoids perceived competitive intention. Although the motivations behind attacking behavior in PSG have been demonstrated to be mainly driven by defensive aggression , logicale.g., both the Dictator and the Recipient receive $0.5), and the other is a competitive one. According to the options used in the method for classifying SVOs . In the costly condition, if the Dictator chooses the competitive option, their earnings become less than those when choosing the fair option . In both conditions, for Dictators, choosing the competitive option is irrelevant to maximizing their payoff. After the Dictator has made their decision, the Recipient decides whether to receive the money according to the Dictator\u2019s decision or choose an avoidance option. If the Recipient chooses the avoidance option, they can receive a fixed amount of money . This amount is higher than when the Dictator has chosen the competitive option but lower than when they have chosen the fair option . Moreover, our DG reflects a situation in which the reasons for the Dictator\u2019s unfair behavior are more likely to be attributed to competitive orientation rather than individualism. By observing the behavior of the Recipients, we expect to rigorously examine the link between the supposition of competitiveness and avoidance of perceived harm in paranoia.In the non-costly condition, choosing the avoidance option would reflect the belief that others were competitors rather than prosocials who cared about the interests of others. Furthermore, the costly condition is a situation in which choosing a competitive distribution is inconsistent with maximizing self-interest. Therefore, in the costly condition, selecting the avoidance option would imply a strong belief that others\u2019 orientations were competitive rather than individualistic. Thus, participants who believe that general people behave as competitors may choose the avoidance option in this game, and such a belief may be observed among those with higher paranoid thinking. A questionnaire survey indicated an association between persecution delusions and self-reported experiences of avoiding threats . Howeverhttps://osf.io/9s5tf/?view_only=9c62cf2b64324b47a48869a94fcbd8ea):We examined the following pre-registered predictions concerning the Recipients\u2019 behavior . For recruitment, we used the MTurk toolkit and randomly recruited participants from the \u201cCloudResearch-Approved Participants\u201d pool provided by CloudResearch (www.cloudresearch.com)  . This porch.com) : the numwww.qualtrics.com).We recruited participants for a pre-survey to measure their paranoia scores. Seven days after completing the data collection for paranoia scores, we invited the same participants to participate in the DG. After sending the invitations, we stopped data collection when the number of participants in the DG dropped below two per day, according to the pre-registered plan to collect the data. In the DG, we set the conditions as between-subject factors, and participants were randomly assigned to either the costly or non-costly condition. Questionnaire forms for the pre-survey and the DG were developed using Qualtrics  years, ranging from 18 to 78 years. We gathered 478 Dictators; 243 were assigned to costly conditions and 235 to non-costly conditions. We gathered 406 Recipients; 206 were assigned to costly conditions and 200 to non-costly conditions.Finally, we collected a total of 884 participants . The mean age of the participants was 39.72  . The R-GAfter completing the R-GPTS, participants were asked about their gender  and age. Each participant was paid 0.60 United States dollars (USD) as a reward for participating in the pre-survey.Participants were paid 0.60 USD as remuneration to participate in the experiment. Additionally, they could receive earnings in the DG as bonuses. The instructions for the DG are provided in the First, the participants were provided with instructions for the DG. In the instruction, the Dictator and the Recipient were referred to as \u201cPlayer 1\u201d and \u201cPlayer 2,\u201d respectively. Participants were told that they were randomly paired with another participant and assigned to either the Dictator or the Recipient. Money was allocated only once between the two.The Dictator decided the allocation by selecting one of the two options that an experimenter prepared. Referring to \u201cdecomposed games\u201d used for measuring SVO , we presi.e., the avoidance option: referred to as option Y) without being informed of the actual decision by their partner. We instructed the Recipients that the Dictators had not been informed that the Recipients would make the decision. After collecting all data on the Recipients, each Recipient was paid a bonus based on the outcome of the game. Those who chose to receive the money allocated by the Dictator were randomly paired with one of the Dictators and received the money according to their partner\u2019s decision. Those who chose the avoidance option received 0.30 USD.The Recipients were informed of the two allocation options presented to the Dictator according to their assigned condition and that they took their decisions by selecting either the fair or competitive options. Recipients decided to choose either \u201cto receive the money according to the Dictator\u2019s decision\u201d (referred to as option X) or \u201cto receive 0.30 USD for sure\u201d  using a slider measure from 0% to 100% in increments of 1% . Subsequently, according to methods implemented in previous studies , they alThis research was approved by the Ethics Committee for Human Psychological Research at Teikyo University (No. 627) and was performed per relevant guidelines. Before participating in this study, all participants read a consent form, and informed consent was obtained. They were informed that participation in the study was voluntary and agreed to participate by anonymously checking a box on the consent form page. They could withdraw from participating in the study by closing the web page, even after agreeing to participate.R version 4.2.2  was usedi.e., mean). Thus, the slope of the paranoia score in each model indicates the average effect on the response variable across the two conditions. We also estimated the condition-specific effects of the paranoia score on the response variables from the inferred parameters in the models.We used regression models when testing pre-registered predictions and conducting unplanned analyses. In the regression models, we added paranoia score, condition , participants\u2019 gender , and age as predictors. We also added an interaction term between the paranoia score and condition as a predictor. The addition of the interaction term results in a slight deviation from the pre-registered analysis plans; however, it is intended to conduct more robust analyses to test whether the paranoia score has different effects depending on the conditions. Binary predictors were centered by subtracting from their mean, and continuous predictors were standardized. This coding allowed us to interpret the coefficient of each predictor as the average effect on the outcome when all other predictors were zero  and performed ordinal regression models rather than linear models because of the skewness of the distributions. We also reported the results using linear regression models instead of ordinal regression models in the According to previous studies , when wei.e., intervals) of the parameters in the models. For each model, we reported the posterior mean, standard deviation, and 95% credible intervals (CI) of the parameters. If the 95% CI does not overlap zero, it is similar to the significant effect at the 5% level in the statistical null hypothesis test with the frequentist statistics. A \u201cbrms\u201d package was used to conduct the Bayesian regression analyses (We estimated the coefficients of the regression models using Bayesian estimation with Markov Chain Monte Carlo (MCMC) simulations. The Bayesian estimation inferred the posterior distributions .The average paranoia score of the Dictators was 6.01 , whereas that of the Recipients was 6.47 . p = 0.25).We found that 1.65% (4/243) and 3.40% (8/235) of Dictators chose the competitive options in the costly and the non-costly conditions, respectively. We found no significant difference in the frequency of competitors between the two conditions (Fisher\u2019s exact test: p = 0.19).Moreover, we found that 25.73% (53/206) and 32.0% (64/200) of Recipients selected the avoidance option in the costly and non-costly conditions, respectively. There was no significant difference in the frequency of Recipients who chose the avoidance option between the two conditions  as predictors.We performed an exploratory analysis to find the factors affecting the probability of the Recipient choosing the avoidance option using all the obtained variables. We performed a logistic regression using the Recipients\u2019 decisions as a response variable. We used the paranoia score, condition, the interaction term between the paranoia score and the condition, gender, age, and post-experimental questionnaire items  did not affect the Recipients\u2019 decisions.We examined whether paranoid thinking was associated with the belief that others were competitors who aimed to maximize the difference in payoffs. In our DG, Dictators choose either fair or competitive allocation, while selecting competitive allocation does not increase their payoffs. The proportion of Dictators who chose competitive allocation was low. Nevertheless, most Recipients estimated a large number of competitors, even in the costly condition in which Dictators must incur costs if they choose the competitive allocation. Moreover, participants with high-level paranoid ideations were more likely to expect others to choose a competitive distribution and assume that others had harmful intentions than those with low-level ideations. The results suggest that overestimation of others\u2019 competitive orientation could be observed as a common propensity among the general population. In addition, the current study indicated a strong association between paranoid thinking and the supposition of others\u2019 harmful or competitive intentions in uncertain situations.However, we could not find an effect of paranoid thinking on enhancing behavior to avoid competitive allocations. The exploratory analysis revealed that the expectation of the Dictator\u2019s competitiveness and the supposition of the Dictator\u2019s harmful intention independently influenced the increase in avoidance behavior. A recent study reported no association between paranoid thinking and betrayal aversion : that isHowever, previous findings have indicated a relationship between paranoia and reactions to perceived threats. Paranoid thinking is associated with defection or distrust in economic games . Paranoii.e., payoff-maximizing) has been highlighted  to earn as much money as possible. The motivation to avoid perceived threats may counteract the desire to earn more payoffs. Therefore, this study may have found no association between paranoia and avoidance behavior. Other psychological variables reflecting a self-interested orientation, such as the participant\u2019s own SVO, should be considered control variables.The lack of an association between avoidance and paranoid thinking in this study may also be attributed to other confounded variables. For example, the relationship between paranoia and the pursuit of self-interest in economic games  by observing the Dictator\u2019s behavior. A previous study showed that people rarely engage in a preemptive strike when they can unilaterally reduce others\u2019 payoffs . This study also strengthens the argument that pre-existing paranoid thinking represents a default lower threshold for detecting social threats, rather than strong reactivity or insensitivity to social contexts.We found no interaction between the paranoia scores and the conditions of the Dictator\u2019s costs in selecting a competitive allocation. On a similar note, previous studies using economic games have confirmed the lack of interaction between pre-measured paranoia and experimental manipulations; participants with a higher level of paranoia are more likely to attribute others\u2019 intentions as harmful than those with a lower level, irrespective of experimental conditions . PreviouAvoiding perceived threats leads to a repetitive cycle of persistent paranoid beliefs by preventing the processing of evidence that their belief is without foundation . ExploriThis study has some limitations. First, other potential mental health factors associated with paranoia should be controlled. Several mental health problems, such as depression, worry, and anxiety, are associated with paranoid thinking . Furthervia experiences. In addition, As previously mentioned, the need to measure SVOs of self was one of the limitations of the current study. A recent study showed the possibility that paranoia is associated with one\u2019s own SVOs and predictions of others\u2019 SVOs . Barnby,Paranoia has been observed to have a continuous propensity in a general non-clinical sample. The findings of this study also suggest that the general belief that others have a competitive orientation can be observed. Recently, the evolutionary foundation of paranoia as a normal psychological function has been discussed . AlthougIn this study, we examined whether paranoid thinking was associated with the supposition that others have competitive intentions using a modified DG. Although the Dictators who chose the competitive allocation option were rarely observed, some Recipients overestimated the other\u2019s competitive intentions and avoided the Dictator\u2019s allocations. Recipients with high-level paranoid thinking were more likely to anticipate that others would choose a competitive allocation and have harmful intentions, even if selecting the competitive option was costly for the Dictators. However, paranoid thinking did not strongly affect behavior to avoid competitive allocation. These results suggest that paranoid thinking acts as a function of detecting others\u2019 competitive intentions, although the avoidance of perceived threats is not a general strategy in paranoia.10.7717/peerj.15003/supp-1Supplemental Information 1Click here for additional data file."}
{"text": "Potamopyrgus antipodarum, reproduces parthenogenetically in its invaded range, and a few distinct clonal genotypes have been identified in North America. Much of the spread of the snail in North America has been the result of unintentional overland transport by recreational water users. Thus, desiccation tolerance may play an important role in the invasion success of this species. The primary goal of these experiments is to determine if variation in desiccation tolerance exists between populations of this species. Here we compared multiple multi-locus genotypes (MLGs) and populations within those genotypes with regard to their desiccation tolerance. We conducted three experiments. The first compared the survival rate over time of snails from three populations and two MLGs with regard to their ability to survive being completely removed from water. The second experiment examined different size classes of snails from the same population, and the third experiment compared four different populations and two MLGs genotypes with respect to their survival rate over time when removed from water but being kept in moist conditions. We found larger snails tolerate desiccation longer than smaller snails with snails between 4 and 4.6 mm surviving at a rate of more than 50% after 12 h while smaller snails survived at a less than 5% rate after 12 h. We also found significant variation both between and within MLGs in their survival rate when completely removed from water and dried with the MLG from the western US having a more than 50% greater survival probability than the eastern MLGs at both 18 and 24 h out of water. When removed from water and kept moist all MLGs had a near 100% survival rate at 60 days at 7 \u00b0C, and most survived at a greater than 90% rate at 60 days at 17 \u00b0C, while no MLG\u2019s survived past 30 days at 27 \u00b0C. The results demonstrate that variation for desiccation tolerance exists between populations of this invader which could influence the invasiveness of different populations.Traits in species that influence invasion success may vary in populations across its invaded range. The aquatic New Zealand mud snail,  Variation in traits may exist within and between populations of an invasive species . This vaPotamopyrgus antipodarum is an incredibly successful invader ,  invader  endemic  invader , Europe  invader , Asia , US1-WY , and US2-O29  were used in experiment 1, US1-PA was used in experiment 2, and US1-PA, US1-MD , US1-NJ , and US2-Syr  were used in experiment 3. All populations are invasive in North America, and a map of the locations of each population can be seen in \u00ae and containing 3 ppt (parts per thousand) seawater, since these snails have been found to grow faster in dilute seawater than in freshwater  or between time of exposure . To expose the snails to air, the snails were removed from water and placed on a paper towel. They were blot-dried with another paper towel and then placed into an empty 50 ml plastic cup. The cups were placed on plastic trays, that could each hold up to 20 cups, with rows of each population on each tray. Separate trays were used for each treatment, and the trays were placed on a lab bench in the center of the lab. Placing all of the snails used for each treatment on the same trays did create a confounding variable. However, we did this to minimize errors that could be made in the execution of the experiment, and the trays were arranged in a way so that all of the cups were within 1 m of each other, and no differences in temperature or humidity were found between tray positions. The snails in the 0 h treatment were then immediately returned to water. The snails from the other treatments were returned to water at the appropriate time. It was determined that the snail was alive after being returned to water if the snail was observed to move. The snails retreated into their shells when out of the water. If alive, once reintroduced to water, the snails will eventually emerge from their shells and begin to crawl around. Mortality was assessed after 1 week.This experiment was conducted in July of 2017 using three invasive populations, two populations of the US1 MLG (US1-WY and US1-PA) and one US2 population (US2-O29) . The snails were taken from multiple containers of each population. We exposed snails from each population to air in the lab at a relative humidity of 19\u201324% with a constant temperature of 18 \u00b0C for one of six time periods: 0, 9, 18, 24, 36, or 48 h. A total of 30 snails in groups of 10 between 4 and 5 mm in length of the US1-WY and US1-PA snails were exposed in each time period, and a total of 27 of the US2-O29 (in groups of nine) were exposed in each time period (the difference was due to having fewer numbers of suitable sized snails from the US2-O29 population). The snails were selected to not differ in length between population  or temperature treatment . To expose the snails to moist conditions, we removed them from water and then put 10 snails at a time on a Scott\u00ae brand Multifold dry paper towel. The towel was then folded into approximately a 5 cm \u00d7 5 cm square so that the snails were in the center, and there were at least three layers of towel around the group of snails. A total of 6 ml of dechlorinated tap water treated with Amquel\u00ae was added to each towel to make it moist. This amount was chosen because 6 ml resulted in a saturated towel without excess water. Then for each temperature treatment all of the towels were placed together in a sealed 15 cm \u00d7 15 cm \u00d7 5 cm plastic box. The box was then placed in the appropriate temperature. The boxes were placed in a refrigerator for 7 \u00b0C, in a Styrofoam cooler covered with a lid for 17 \u00b0C, or in a covered warm water bath for 27 \u00b0C. A total of 30 snails (three replicates of 10) from each population were exposed to each temperature at each time interval, resulting in a total of 210 snails of each population being exposed to each temperature, thirty at each time period. For the 7 \u00b0C treatment, snails were assessed for survival at 0, 25, 40, 45, 50, 56, and 60 days. For the 17 \u00b0C treatment survival was assessed at 0, 10, 21, 30, 40, 50, and 60 days, and for the 27 \u00b0C treatment survival was assessed at 0, 10, 16, 22, 27, 30, and 36 days after wrapping the snails. These intervals were chosen based on preliminary experiments. Snails exposed for 0 days were immediately removed from the paper towel and re-exposed to water. Mortality was assessed in the same manner as in both earlier experiments.This experiment was conducted in the summer of 2019 using four different invasive populations, three populations of the US1 MLG  and one US2 population (US2-Syr). These populations were used because we had more of these snails reared in the lab than other populations, and only these could give us the sample sizes that we desired. The snails used ranged in size from 4 to 5 mm in length, and the snails did not differ in length between population  , suggesting that survival rate decreased with increasing temperature. Comparing populations within temperatures found significant differences between several populations . Thus, if snails are attached to items that are removed from water and stored in a cold area , it is quite possible that they may be able to survive for several months.We found that when snails were removed from water but kept moist, mortality increased over time at a greater rate as the temperature was increased from 7 \u00b0C to 27 \u00b0C. This is perhaps not surprising given that the metabolic rates of the animals increase with increasing temperature. The fact that there was almost no mortality at 7 \u00b0C for any population is consistent with the fact that these snails typically respond to cold temperatures by retreating into their shells and may overwinter this way . , thus US1-PA had the smallest sample size . While it makes sense that fungal growth would have a greater effect on the warmer treatments, since the temperatures were not properly replicated, we cannot be sure if the effect of the fungus was affected by temperature.P. antipodarum to desiccation in a moist environment created in a closed petri dish with a filter paper saturated with water. He found 100% mortality by 52 days with 90% mortality by about 30 days. Survival rates were higher in the present experiment. This could be due to the differences in how the experiments were conducted. P. antipodarum from water in leaf litter, artificial sediment, and clay. They found that the snails survived less than 3 days in the leaf litter, but there was greater than 20% survival after 4 days in both sediment and clay demonstrating that the material that the snails are transported in can influence the survival rate.P. antipodarum resist desiccation longer than smaller individuals. In addition, the results of experiment 2 are consistent with The results suggest that to control the spread of the snail, individuals should understand that the snails can live out of water for at least several hours, and if kept moist and cool, they could live for months. While some populations exhibit greater desiccation tolerance than others, all populations can survive for a time that allows for effective dispersal whether by animal  or humans if equipment, gear, and clothing are not sufficiently decontaminated. Water users should avoid wearing or using the same gear in multiple locations without efforts to decontaminate them when they are in an area known to be infested by NZMS.These experiments show evidence of variation in desiccation tolerance between populations of an aquatic invader suggesting that this trait is malleable in invasive NZMS populations. The fact that there are differences between populations of the same multi-locus genotype suggests that characterizing the traits of an invader should be done by examining populations from multiple locations, and populations from different locations should not be assumed to have the same traits including tolerances to biotic and abiotic stressors.10.7717/peerj.15732/supp-1Supplemental Information 1Click here for additional data file."}
{"text": "Dear Editor,We are writing to comment on Da\u011fdelen et al.'s study on the measurement of the optic nerve sheath diameter (ONSD) in patients with idiopathic intracranial hypertension.Ocular ultrasonography is considered to be the least invasive diagnostic method to detect intracranial hypertension, even in an emergency setting.In their paper, the authors utilized the B-scan technique, with the probe placed in the superolateral of the globe, with the upper eyelid closed. The B-scan technique is very sensitive in detecting small optic nerve calcifications, such as in cases of optic nerve drusen,Other problems are related to the performance of the examination through closed eyelids, which makes impossible the recognition of gaze position and leads to Bell's phenomenon, with an upward and outward movement of the eye when an attempt to close the eyes is made. The consequence is the acquisition of images of optic nerve in different positions and measurements of sheath diameter stretched differently, thus not comparable.Moreover, with the eyelids closed, there is a decrease of the image quality score due to the sound attenuation produced by the lids, making the results even more unpredictable.For this reason, we suggest performing ocular ultrasonography with open eyelids, using methylcellulose and anesthetic drops.However, the best way to perform the examination is with a standardized A scan. It permits the unequivocal measurement of the ONSD with its hyperreflective spikes from the interface between the arachnoid and subarachnoid fluids, thus making the blooming effect harmless.There are a few other points that, in our opinion, deserve to be discussed.The case group is meaningfully heterogeneous: in fact, some of the patients (57.4%) were treated with acetazolamide, while the remaining (42.6%) were not.The authors found a negative correlation between ONSD and age, and a positive correlation between ONSD and body mass index (BMI).Unfortunately, both case and control groups are significantly different in age and BMI, making the comparison ineffective.We are afraid that all these problems could make the results of this study non significative."}
{"text": "Continuous cropping obstacles have become a serious factor restricting sustainable development in modern agriculture, while companion planting is one of the most common and effective methods for solving this problem. Here, we monitored the effects of companion planting on soil fertility and the microbial community distribution pattern in pepper monoculture and companion plantings. Soil microbial communities were analyzed using high-throughput sequencing technology. Companion plants included garlic (T1), oat (T2), cabbage (T3), celery (T4), and white clover (T5). The results showed that compared with the monoculture system, companion planting significantly increased the activities of soil urease (except for T5) and sucrase, but decreased catalase activity. In addition, T2 significantly improved microbial diversity (Shannon index) while T1 resulted in a decrease of bacterial OTUs and an increase of fungal OTUs. Companion planting also significantly changed soil microbial community structures and compositions. Correlation analysis showed that soil enzyme activities were closely correlated with bacterial and fungal community structures. Moreover, the companion system weakened the complexity of microbial networks. These findings indicated that companion plants can provide nutrition to microbes and weaken the competition among them, which offers a theoretical basis and data for further research into methods for reducing continuous cropping obstacles in agriculture. Capsicum of the Solanaceae family, is a widely cultivated vegetable in Ningxia, China. At present, improving the yield and quality of pepper has become a topic of interest as it is rich in capsaicin, ascorbic acid, vitamin C, and other nutrients, and exerts antibacterial and antioxidant functions [Pepper, a plant in the genus unctions . In receunctions , 3. ThesAs an effective way to solve continuous cropping obstacles, companion planting is not only one of the most common planting methods in modern agriculture, but also an important biological control measure . Compani5A large number of studies have shown that using the principle of allelopathy between plants and reasonably arranging companion plants or intercropping not only improves the yield and quality of vegetables, but also effectively reduces diseases and pests and improves the soil ecological environment to reduce the occurrence of continuous cropping obstacles , 11. Cowet al. found that alfalfa/mulberry intercropping not only enriched the diversity of bacteria [Proteobacteria, Actinomycetes and Firmicutes in mulberry intercropping, and Proteobacteria, Bacteroidetes, and Blastomonas in alfalfa intercropping were significantly higher than those in monoculture. Improving plant diversity directly increases the content and diversity of soil available carbon sources for microorganisms, which in turn increases their number, diversity, and activity, thereby inhibiting the invasion and reproduction of pathogenic bacteria [et al. reported that mustard and sesame as green manure can improve the disease resistance of cucumber Fusarium wilt by changing bacterial community composition in cucumber rhizosphere soil [Fusarium oxysporum and other fungi decreased after watermelon/upland rice intercropping, which significantly inhibited watermelon wilt disease [et al. also found that cucumber/onion intercropping significantly improved soil bacterial diversity in cucumber rhizosphere soil [Soil microorganisms, as the crucial source of soil enzymes, are involved in soil biochemical reactions and cause beneficial changes in soil enzyme activities. Meanwhile, intercropping utilizes the relationship between biodiversity and ecosystem function; for example, the increase in biodiversity is related to the increase in plant primary productivity . Cucumbebacteria , but alsbacteria , 20. Jinere soil . Their r disease . Zhou etere soil . Additioere soil . Furtherere soil . Contactere soil , 27, forere soil . TherefoGiven the above, it is also imperative to determine whether soil rhizosphere microbes of companion plants are different from those of individually cultivated plants. Therefore, this study employed high-throughput amplicon sequencing technology to characterize and compare various soil representative enzymes and microbial compositions, as well as their symbiotic network in pepper monoculture and several companion planting systems.Pepper  was the main crop in this study, and companion crops included garlic, oat, cabbage, celery and white clover, which can be used to control pepper continuous cropping diseases, according to previous research. The fertilizers used were special organic fertilizers for fruits and vegetables . The test soil was collected from a field under continuous cropping for 9 years in Xinji Township, Pengyang County, Ningxia Province, China. The soil properties were as follows: pH 8.53, total salt 3.22 g/kg, total nitrogen 0.12 g/kg, total P 0.89 g/kg, total K 39 g/kg, alkali-hydrolysed N 48 mg/kg, available P 40.66 mg/kg, available K 291 mg/kg, and organic matter 12.44 g/kg.i.e., 6 plots) were set for each treatment, which were randomly arranged and placed in the greenhouse for routine management. No chemical fertilizer was used during the trial period, but regular quantitative watering and manual weeding were carried out. After 50 days of companion treatment, the pepper rhizosphere soil was collected by the peeling separation method, and soil samples under the same treatment were mixed and divided into two parts, which were placed at 4\u00b0C and -80\u00b0C for enzyme activity determination and soil DNA extraction, respectively.The experiment was carried out at the Gongpeng Pepper Core Test Base in April, 2020, Xinji Township, Pengyang County, China. The test soil was mixed with organic fertilizer (v/10:1) and evenly loaded into 50 cm \u00d7 29 cm basins. Six treatments were set up: pepper monoculture , companion garlic (T1), companion oat (T2), companion cabbage (T3), companion celery (T4), and companion clover (T5). After sprouting, pepper was sown in seed trays and planted in pots at the 4-leaf stage, and each pot had 1 plant. Five days after colonization, the seeds of companion plants were planted in a semicircle approximately 5 cm away from the pepper plant and according to the sowing amount, seed germination rate, and emergence time studied by predecessors. Six replicates  [Urease was determined by indophenol blue colorimetry, with urea as the substrate. After culture, the urease enzyme product ammonia (ignoring the ammonia nitrogen loss caused by nitrification) reacts with phenol and sodium hypochlorite in alkaline medium to produce blue indophenol. Catalase belongs to the haemoglobin enzyme family and contains iron, and it can also catalyze the decomposition of hydrogen peroxide into water and molecular oxygen; therefore, the enzyme activity can be determined according to the consumption of Hic acid) .2), 5\u00a2-GATGAAGAACGYAGYRAA-3\u00a2 and P2 (ITS4), 5\u00a2-TCCTCCGCTTATTGATATGC-3\u00a2. After amplicon purification and quantification, an Illumina NovaSeq 6000 platform was used for paired-end sequencing (PE250). The raw reads were deposited in the NCBI Sequence Read Archive (SRA) database (Accession Number: PRJCA010600).Soil DNA extraction was performed by using the HiPure Soil DNA Kit  according to the manufacturer\u2019s instructions. After genomic DNA extraction, the bacterial 16S rRNA gene V3-V4 region was amplified using the primer pair P1 (341 F), 5\u00a2-CCTACGGGNGGCWGCAG-3\u00a2 and P2 (806R), 5\u00a2-GGACTACHV GGGTATCTAAT-3\u00a2, while the fungal ITS2 gene region was amplified using the primer pair P1 (ITS3_KYOhttp://rdp.cme.msu.edu/) was used to analyze the taxonomy of each bacterial and fungal gene sequence against the Silva database (version 132) and Unite database (version 8.0) with a confidence threshold of 80% [http://circos.ca/). The linear discriminant analysis effect size (LEfSe) method was used to identify the most differentially abundant biomarker taxa among groups [p < 0.05) were retained for the visualization of networks using Gephi software [Analysis of the raw data was conducted using FASTP (V 0.18.0), including read filtering and splicing,  and FLASd of 80% , 34. A cg groups . Alpha-dg groups . To charsoftware -38. Genep-value of < 0.05 was considered statistically significant.One-way analysis of variance (ANOVA) with Duncan\u2019s test was selected to analyze the differences in soil enzyme activities and \u03b1-diversity indices among all treatments. Analysis of similarity (ANOSIM) was performed to test whether the differences between groups were significantly greater than that within groups. Redundancy analysis (RDA) was performed to present the correlations between soil enzymes and microbial community structures using the vegan package in R with 999 permutations. Spearman correlation analysis was performed using IBM SPSS Statistics (v 25.0) . A p < 0.05), while soil catalase activity was significantly reduced (p < 0.05), and no significant differences were observed in the CK and T3 treatments.The soil enzyme activities of pepper in monoculture and five companion systems are shown in A total of 3,435,240 16S rRNA and 3,690,816 ITS quality sequences were obtained from all monoculture and companion soil samples, and the sequences were grouped into 4,825 bacterial and 542 fungal OTUs. The rarefaction curves  for all p < 0.05). For fungi, the T1 and T3 treatments significantly increased the number of OTUs, and T2 treatment resulted in an increase in the Shannon index compared to CK (p > 0.05), while fungal observed OTUs  and Shannon indices  had significant positive correlations with urease and sucrase activities   .Proteobacteria, Acidobacteria, Planctomycetes, Gemmatimonadetes, Actinobacteria, Bacteroidetes, Chloroflexi, Verrucomicrobia, Patescibacteria, and Firmicutes . The taxonomical classification showed that 137 bacterial genera were detected at the genus level. Sphingomonas, RB41, Lysobacter, Dongia, MND1, Acidibacter, Pseudoxanthomonas, Arenimonas, Altererythrobacter, and Ellin6055 were found to be the top 10 dominant bacterial genera . Only the relative abundance of RB41 had no significant difference in all treatments. In addition, 45 bacterial biomarkers were identified at the phylum, class, order, family, genus and species levels (LDA(log10) score > 3.5)  .Kotlabaea, Cladorrhinum, Coprinellus, Madurella, Schizothecium, Tetracladium, Pseudogymnoascus, Podospora, Scedosporium, and Mortierella were the top 10 dominant fungal genera  score > 3.5)  .p < 0.05). Compared to CK, the numbers of nodes and edges in the five companion planting networks decreased, indicating that companion planting reduced the relationships among microorganisms, thus weakening the symbiotic patterns of the microbial community. In addition, the average degrees and clustering coefficients in the T3 and T5 treatments were lower than those of the control (CK), while the opposite results were observed in the T4 network. The network diameter in all companion treatments decreased compared to CK. Moreover, significant differences were also observed in the topological structure characteristics of the symbiosis network between control and companion planting treatments. Overall, companion planting treatments affected the network complexity of the microbial community. Additionally, there were differences in the keystone taxa in the microbial networks between the control and five companion planting treatments (Microbial co-occurrence network analysis was conducted to explore the co-occurrence patterns among bacteria and fungi at the genus level in soil. As shown in eatments . There wSoil biological activity, referring to the transformation, release, and fixation of soil nutrients, is an important indicator to assess soil fertility and health status . HoweverSoil enzymes are involved in soil biochemical processes and play key roles in the occurrence, transformation, and availability of soil nutrients. They can reflect soil biological activity and biochemical reaction intensity, and are also sensitive to external environmental changes. Moreover, soil enzyme activities are important biological indicators of soil fertility, quality and health ; for exaSoil microbial diversity plays an important role in maintaining multiple functions in terrestrial ecosystems , and theProteobacteria, Acidobacteria, Planctomycetes, Gemmatimonadetes, Actinobacteria, Bacteroidetes, Chloroflexi, Verrucomicrobia, Patescibacteria, and Firmicutes (Proteobacteria was the dominant phylum in most studies [Proteobacteria and Chloroflexi, which was inconsistent with the results of previous intercropping studies [Proteobacteria feed on different stubborn carbon sources and strongly impact soil microbial community structures by providing functional capacity for the carbon cycle and more available nutrients for plant growth [Fusarium was not the dominant fungus in this study, indicating that companion planting improves soil resistance and reduces its pathogenicity [Intercropping has been shown to change soil microbial community compositions . Changesrmicutes , suggest studies , 58, whi studies . In this studies . The reat growth , 60. As t growth , 62. Ourt growth . Ascomyct growth . Ascomyct growth . In addigenicity . These rgenicity . Meanwhigenicity .et al. [Network analysis can be used to determine the interactions of microbial taxa in a niche and the keystone species that have the greatest impact on the microbial community . A symbiet al.  found thIn this study, RDA plots showed that soil enzyme activities were significantly correlated with soil microbial community structures, including urease, catalase, and sucrase . In addiTo sum up, soil microbial community distribution patterns of pepper monoculture and companion plantings were compared using high-throughput sequencing technology. The results showed that companion planting significantly increased soil urease and sucrase activities, but decreased catalase activity compared to the monoculture system. In addition, companion planting improved the microbial diversity in pepper continuous cropping soil, and significantly changed soil microbial community structures and compositions. Soil enzyme activities were also found to be significantly correlated with microbial community structures. Moreover, the companion system reduced the complexity of microbial community networks, which may result in the provision of microbial nutrition and weaken the competition among microorganisms. These results should provide a theoretical basis and data for further research on reducing continuous cropping obstacles in agriculture.http://jmb.or.kr.Supplementary data for this paper are available on-line only at"}