{"text": "This study describes the 24-h changes in plasma prolactin levels, and dopamine (DA), serotonin (5HT), gamma-aminobutyric acid (GABA) and taurine concentration in median eminence and adenohypophysis of newborn male rabbits.Animals were kept under controlled light-dark cycles , housed in individual metal cages, and fed ad libitum with free access to tap water. On day 1 after parturition, litter size was standardized to 8\u20139 to assure similar lactation conditions during the experiment. Groups of 6\u20137 suckling male rabbits were killed by decapitation on day 11 of life at six different time points during a 24-h period.Plasma prolactin levels changed significantly throughout the day, showing a peak at the beginning of the active phase (at 01:00 h) and a second maximum during the first part of the resting phase (at 13:00 h). Median eminence DA concentration also changed significantly during the day, peaking at the same time intervals as plasma prolactin. A single maximum (at 13:00 h) was found for adenohypophysial DA concentration. Individual adenohypophysial DA concentrations correlated significantly with their respective plasma prolactin levels. A maximum in median eminence 5HT concentration occurred at 21:00 h whereas adenohypophysial 5HT peaked at 13:00 h. Median eminence 5HT concentration and circulating prolactin correlated inversely. In the median eminence, GABA concentration attained maximal values at 21:00 h, whereas it reached a maximum at 13:00 h in the pituitary gland. Median eminence GABA concentration correlated inversely with circulating prolactin. In the median eminence, taurine values varied in a bimodal way showing two maxima, at the second half of the rest span and of the activity phase, respectively. In the adenohypophysis, minimal taurine levels coincided with the major plasma prolactin peak (at 01:00 h). Circulating prolactin and adenohypophysial taurine levels correlated inversely.The correlations among the changes in the neurotransmitters analyzed and circulating prolactin levels explain the circadian secretory pattern of the hormone in newborn male rabbits. The mechanisms that regulate prolactin secretion are complex . Two majIt is well known that basal secretion of prolactin varies throughout the day, describing a characteristic pattern with maximal values close to the light-dark transition ,8. Such The rat is very immature at birth, so that newborn and suckling rats are very sensitive to manipulations that can affect adulthood -18. CircThe rabbit is probably the best-studied laboratory animal in the wild, due to its abundance, size and importance as an agricultural pest ,24. WildIn contrast to the large amount of information available on circadian rhythms in adult mammals, studies on circadian phenomena in neonates are few ,27. For This study was performed using 24 multiparous, lactating Californian \u00d7 New Zealand White crossbreed doe rabbits. Animals were housed in research facilities of the Animal Production Department. They were maintained under controlled light-dark cycles , housed in individual metal cages, fed at libitum using a commercial pellet diet  with free access to tap water. On day 1 after parturition, litter size was standardized to 8\u20139 by adding or removing kits to assure similar lactation conditions during the experiment. This study was performed according to the CEE Council Directive  for the care of experimental animals. Groups of 6\u20137 suckling male rabbits were killed by decapitation on day 11 of life at six different time points throughout a 24-hour cycle. The brains were quickly removed, and the median eminence and the anterior pituitary were taken out. Anterior pituitaries were weighed and homogenized in chilled (0\u20131\u00b0C) 2 M acetic acid. After centrifugation , the samples were either analyzed for DA and 5HT or boiled for 10 min and further centrifuged at 14000 rpm for 20 min to measure GABA and taurine.L-RP-1. Hormone was labeled with 125I by the chloroamine-T method [Staphylococcus aureus  was used to precipitate the bound fraction [Plasma prolactin levels were measured by a specific homologous RIA method  using AFT method . The volfraction . All sam2/H+ reference electrode were: conditioning electrode: -0.4 V; preoxidation electrode: +0.10; working electrode: +0.35 V. Indoleamine and catecholamine concentration was calculated from the chromatographic peak heights by using external standards and was expressed as pg/\u03bcg protein. The linearity of the detector response for DA and 5HT was tested within the concentration ranges found in median eminence and adenohypophysial supernatants.DA and 5HT concentration was measured by high pressure liquid chromatography (HPLC) using electrochemical detection , as described elsewhere . A C-18 Amino acids were isolated and analyzed by HPLC with fluorescence detection after precolumn derivatization with O-phthalaldehyde (OPA) as described elsewhere . An aliqStatistical analysis of results was performed by a one-way analysis of variance (ANOVA) followed by post-hoc Tukey-Kramer's multiple comparisons tests. Curve estimation in regression analysis was made by using SPSS software, version 10.1 . P values lower than 0.05 were considered evidence for statistical significance.Figure Figures 2 = 0.16, b0 = -123.7 and b1= 18.1 .Median eminence DA concentration changed in a bimodal way as a function of time of day, showing two maxima, coinciding with those of plasma prolactin at the active and resting phase of the diurnal cycle .As shown in Figure 2= 0.21, b0 = 25.7 and b1 = -0.22, F = 6.6, p < 0.01).Figure 2= 0.42, b0 = 11.6 and b1 = -0.11, F = 17.4, p < 0.0001).Figure The present study, performed in neonatal male rabbit pups sacrificed at 6 different time intervals during a 24-h cycle, describes for the first time significant changes in plasma prolactin levels throughout the day. In concomitant measurements of median eminence and adenohypophysial concentration of DA, 5HT, GABA and taurine, a clear daily pattern was found in almost every case. Contrasting with neonatal rats that did not display any circadian pattern of plasma prolactin , a dailyIn adult rabbits, daily patterns of prolactin secretion depend on light/dark phases . The preThe activity of several nuclei of rabbit hypothalamus increases with age and with experience of anticipatory arousal . HoweverAmong other possible neuromodulators of prolactin secretion, the arcuate nucleus receives a dense serotonergic innervation consisting of a population of brainstem neurons arising mainly from the midbrain raphe nuclei  and fromTaurine has also been implicated in the regulation of prolactin release ,13,35,36A relatively dense innervation of GABA terminals exists in the external layer of the median eminence , and theGABA acting on specific receptors in the anterior pituitary has been reported to suppress prolactin secretion ,40, althIn suckling male rabbits plasma prolactin and median eminence and anterior pituitary concentration of several neuromodulators change on a daily basis. The existence of significant correlations among several of the neurotransmitters analyzed and plasma prolactin levels may explain the circadian secretory pattern of prolactin at this age in suckling rabbits. Collectively, the present results differ from the reported absence of circadian rhythmicity of prolactin and median eminence and adenohypophysial neuromodulators in rats at a comparable age.The author(s) declare that they have no competing interests.MPA and PC carried out the experiment and the immunoassays and the analysis of catecholamines, indoleamines and amino acids. DPC and AIE designed the experiments. Also, DPC performed the statistical analysis. PR took care of the experimental animals. AIE supervised its technical implementation and drafted the manuscript. All authors read and approved the final manuscript."}
{"text": "There is accumulated evidence that plasma concentration of the sulfur-containing amino-acid homocysteine (Hcy) is a prognostic marker for cardiovascular morbidity and mortality. Both fasting levels of Hcy and post methionine loading levels are used as prognostic markers. The aim of the present study was to investigate the existence of a daily rhythm in plasma Hcy under strictly controlled nutritional and sleep-wake conditions. We also investigated if the time during which methionine loading is performed, i.e., morning or evening, had a different effect on the resultant plasma Hcy concentration.\u00ae formula).Six healthy men aged 23\u201326 years participated in 4 experiments. In the first and second experiments, the daily rhythm in Hcy as well as in other amino acids was investigated under a normal or an inverse sleep-wake cycle. In the third and fourth, Hcy concentrations were investigated after a morning and evening methionine loading. To standardize food consumption in the first two experiments, subjects received every 3 hours 150 ml of specially designed low-protein liquid food (EnsureIn both the first and second experiments there was a significant daily rhythm in Hcy concentrations with a mid-day nadir and a nocturnal peak. Strikingly different 24-h patterns were observed in methionine, leucine, isoleucine and tyrosine. In all, the 24-h curves revealed a strong influence of both the sleep-wake cycle and the feeding schedule. Methionine loading resulted in increased plasma Hcy levels during both morning and evening experiments, which were not significantly different from each other.There is a daily rhythm in plasma concentration of the amino acid Hcy, and this rhythm is independent of sleep-wake and food consumption. In view of the fact that increased Hcy concentrations may be associated with increased cardiovascular risks, these findings may have clinical implications for the health of rotating shift workers. Experimental results accumulated in recent years have revealed that plasma concentration of the sulfur-containing amino-acid homocysteine (Hcy) is a prognostic marker for cardiovascular morbidity and mortality -5. PlasmStudies conducted during the 1960s have demonstrated that plasma levels of several amino acids vary in a daily manner. Feigin, Klainer and Beisel  were theMore recently, plasma Hcy levels were also shown to vary in a daily manner in humans with an evening peak and a morning nadir . SignifiIn the present study, we further investigated the possible existence of a daily rhythm in plasma Hcy under strictly controlled nutritional and sleep-wake conditions. We also investigated if the time during which methionine loading is performed, i.e., morning or evening, had a different effect on the resultant plasma Hcy concentration.2). They were instructed to avoid alcohol and coffee beverages during the 24 hours that preceded each of the experimental periods. The study was approved by the local Human Ethics Committee, and subjects gave written informed conset before being enrolled in the first experiment. Subjects were paid for their participation.Six healthy men aged 23\u201326 years participated in 4 experiments. All were students who maintained a normal and regular sleep-wake cycle for at least three months prior to the studies. They were screened to ensure an adequate state of health by physical examination, detailed medical history and blood testing. All had a normal body weight (mean body mass index (BMI) = 23.5 \u00b1 1.6 Kg/mIn the first and second experiments, daily rhythms in Hcy as well as in other amino acids were investigated under a normal or an inverse sleep-wake cycle. In the third and fourth experiments, Hcy concentrations were investigated after morning and evening methionine loading.\u00ae formula) with the following composition: proteins , fat , carbohydrates , vitamins and minerals, in 77 ml water. No other food except for water was allowed.Subjcts were admitted to the laboratory at 1800 for a period of 24 hours, after having a normal day. A catheter was inserted into an antecubital vein and was kept patent by a drip of saline. Electrodes were attached for polysomnographic monitoring to determine sleep stages. These included EEG, EMG, EOG, respiration by respiratpry belt and nasal thermistor, and oximetry. Starting at 1900, 5-ml blood samples were drawn every hour until 1900 on the next day. Thoughout this period subjects were either in a supine or a sitting position in individual rooms where they could read, use their personal computers or watch television. From 2300 to 0800 the room lights were turned off during the sleep period. Blood samples were collected into EDTA treated tubes, immediately centrifuged at 4\u00b0C, and plasma was stored at -70\u00b0C until assay. Hourly blood sampling during sleep continued with minimal disturbance to subjects' sleep. To standardize food consumption and to provide adequate energy intake, subjects received every 3 hours 150 ml of specially designed liquid food . At the start of each methionine loading test, subjects were administered 100 mg/kg body weight methionine, mixed in fruit juice. Blood samples (5 ml) were taken into EDTA treated tubes before methionine loading, designated as time 0, and then at +2, +4, +6 and +8 hours after methionine administration. Light carbohydrate rich meals were provided at +1 and +6 hours after the methionine loading in each of the test periods.12 were also measured in all samples of all subjects using commercially available kits from Abbott. The assays were performed on an Abbott IMX analyzer that utilizes ion capture technology for folate determination and microparticle enzyme immunoassay (MEIA) technology for B12. The assays were performed according to the manufacturers' instructions and used quality control sera supplied by Abbott.Plasma amino acids levels  were measured in duplicates using a Biochrom 20 Amino-Acid analyzer  as described before . The meaRepeated measurements ANOVA was used to compare the means of the amino acids between the first two experiments. To obtain the average 24-h Hcy curves, each individual data point was replaced by a z-transformation based on the individual 24-h mean and standard deviation, before averaging across subjects. Then, each of the individual time series was subjected to Cosinor analysis to determine its amplitude and acrophase. Since Experiment 1 was perfomed during the summer (August) and Experiment 2 was performed during early winter (late November), approximately 2 months after the change from Summer daylight-saving time to Winter time, during which the clock in Israel was advanced by one hour, the 24-h curves of the first experiment were advanced by 1 hour before the analysis. Then repeated measurements ANOVA was used to determine differences in acrophase between the experiments. In the third and fourth experimens, the concentrations of Hcy at times 0, 2, 4, 6, and 8 hours after methionine loading were analysed by repeated measures ANOVA to determine if there were any significant morning-evening differences in Hcy levels.All subjects successfully completed the four experiments. In experiment 1 when they slept from 2300 to 0700, average sleep latency was 22.2 \u00b1 7.3 min, total sleep time was 407.3 \u00b1 51.8 min, and sleep efficiency was 77.7 \u00b1 9.2%. In experiment 2 when they slept from 0720 to 1500, average sleep latency was 4 \u00b1 3.1 min, total sleep time was 371.5 \u00b1 59.4 min, and sleep efficiency was 83.6 \u00b1 12.2%. In spite of the reversal of the sleep-wake cycle, the 24 h means and coefficients of variation of Hcy in the two experiments were very similar to each other, 8.82 \u03bcmol/L and 29.7% and 8.51 \u03bcmol/L and 27.7%, in experiments 1 and 2, respectively. None of the subjects had abnormal Hcy levels (>15 \u03bcmol/L) at any point across the 24 hours.Figure Strikingly different 24-h patterns were observed for the other amino acids: methionine, leucine, isoleucine and tyrosine. In all, the average z-transformed 24-h curves revealed a strong influence of both the sleep-wake cycle and the feeding schedule. Their level was notably lower during the sleep period, regardless of its timing, and increased every two hours in synchrony with the times of feeding. This pattern is exemplified in Figure 12 and folic acid. While folic acid showed a linear increase throughout the study period, the 24-h pattern of B12 was rather constant with slight elevation during the night time (data not shown).We did not find any evidence for rhythmicity in the concentrations of BAs expected, methionine loading resulted in increased plasma Hcy levels during both morning and evening experiments Figure . AnalysiThe present study demonstrated that under strictly controlled dietary conditions plasma levels of Hcy shows significant daily rhythmicity, which is independent of the 24-h cycle of sleep and wake, with a peak at around 2200 to 2400. Previously, similar rhythmicity in Hcy with an evening peak was reported in obese diabetic patients by Bremner et al  and with12 dependent while the reaction with betaine is not. In the transsulforation pathway, Hcy condenses with serine to form cystationine in an irreversible reaction catalyzed by the pyridoxal-5'-phosphate (PLP)-containing enzyme, cystationine beta synthase. Although we do not have any information as yet on the underlying mechanism responsible for the daily rhythm in plasma Hcy, it is most probably related to the balance between its rates of production and disposal. A high Hcy concentration could be due to an elevated production rate, a decreased rate of transsulforation, a decreased rate of remethylation to methionine, or any combination of these processes.Homocysteine is a non-protein sulfur containing amino acid, and an intermediate in the metabolism of the essential amino acid methionine. The metabolism of Hcy is accomplished by two major pathways, remethylation into methionine and transsulfuration to cystationine . In reme12 deficiencies, or by methylenetetrahydrofolate reductase thermolability. The variations in plasma vitamin concentrations, however, could not provide an explanation for the daily rhythms in Hcy. The 24-pattern of folate levels showed a linear increase from the beginning to the end of the study. Although the plasma concentrations of vitamin B12 varied across the 24 hours \u2013 in contrast however to what was expected if B12 were involved in the daily rhythm in Hcy, ie, increasing levels of B12 associated with decreasing levels of Hcy \u2013 the 24-h pattern in B12 was parallel to that of Hcy with a daytime nadir and a night time peak. Thus, it is unlikely that a daily rhythm in plasma vitamin concentrations can  explain the daily rhythm in Hcy.The fact that the range of the daily variations in the plasma levels of Hcy is on the same order of magnitude as those seen in mild hyperhomocysteinemia, may suggest that the two phenomena share a common underlying mechanism. Mild hyperhomocystenemia seen under fasting conditions is due to mild impairement in the methylation pathway. This may be caused by folate or BThe methionine loading test has been used to test the individual's ability to dispose of methionine through the transsulforation pathway . The facA different possibility that cannot be ruled out at this point is the involvement of the Hcy cellular export mechanism. The small amount of plasma Hcy is the result of a cellular export mechanism that is essential for keeping intracellular concentrations low to avoid potentially Hcy cytotoxic effects. Thus the daily rhythm in plasma Hcy may reflect variations in the activity of the cellular export mechanism, which result in varying levels of Hcy disposed to the plasma at different phases of the 24 hours rather than in its rate of metabolism. Further studies are needed to test this possibility.Finally, what may be the clinical implications of the present findings? We would like to suggest that the existence of a daily rhythm in Hcy concentration may have possible health-related consequences to shift workers, who were shown to be at an increased cardiovascular risk . FirstlySecondly, we do not know how the desynchronization between the circadian system and the enviornment which occurs in rotating shift workers may affect the rhythm in Hcy concentrations and its overall plasma concentration. Recently, Martins et al  reportedIn view of the fact that Hcy is a risk factor for cardiovascular morbidity, more research is needed on the possible role of hyperhomocysteinemia as a cardiovascular risk factor in shift workers.12 and folic acid. Methionine loading at 9 AM and 9 PM produced a comparable time-dependent increase in Hcy concentrations with a tendency toward a higher increase in the evening during the first 2 hours after loading. In view of the possible involvement of Hcy in cardiovascular morbidity, and of the increased cardiovascular morbidity in shift wokers, these findings may have implications to shift workers health.Our results demonstrated a daily rhythm in plasma concentrations of Hcy with a nocturnal peak that was independent of sleep-wake cycle and food consumption. There were no comparable rhythms in the concentrations of methionine, leucine, isoleucine and tyrosine, nor in the concentrations of BHcy \u2013 homocysteineEEG \u2013 ElectroencephalographyEMG \u2013 electromyographyEOG \u2013 electrooculographyEDTA \u2013 ethylanediaminetetraacetic acidCV \u2013 coefficient of variationANOVA \u2013 analysis of varianceNone declared.PL and LL co-designed the study, supervised the data collection and data analysis and wrote the paper."}
{"text": "Hyperhomocysteinemia is an important and independent risk factor for vascular disease. About 35% of patients with stroke and 47% of patients with peripheral arterial disease have elevated plasma homocysteine (HCY) concentrations. The relationship between plasma HCY and the methylentetrahydrofolate reductase (MTHFR) C677T polymorphism is still unclear, especially in regard to screening/diagnostic power.This case-control study was performed on 96 patients, who underwent surgery due to asymptomatic or symptomatic high grade stenosis of the internal carotid artery (ICA), and 96 healthy age and sex-matched, controls. Plasma HCY concentration was determined using a commercial kit for fully automated analysis . The C677T polymorphism of the MTHFR-gene was assessed by PCR.The mean plasma HCY concentration was significantly higher in the group with stenosis of ICA compared to the controls, 12.43 \u00b1 6.96 \u03bcM and 10.16 \u00b1 3.16 \u03bcM, respectively, (p < 0.05). An HCY plasma concentration of 1.5 SD above the mean value of the control group, was defined as cut-off for a pathological versus physiological plasma concentration. The sensitivity and specificity of HCY was 0.27 and 0.94, respectively. The positive predictive value was 0.82. There was no significant difference in the frequency of the MTHFR 677 CT and TT genotype between patients and controls . Carriers of the T-allele (CT and TT genotypes) have significantly higher plasma HCY concentrations than CC patients, 14.1 \u00b1 7.6 \u03bcM and 10.29 \u00b1 5.2 \u03bcM, respectively, p < 0.05. Sensitivity and specificity of the MTHFR C677T polymorphism  were 0.56 and 0.40, respectively. The positive predictive value was 0.48. There was no significant difference in plasma HCY or genotype frequency of the MTHFR C677T polymorphism between asymptomatic and symptomatic patients.Our study shows that in a population with a given pretest disease probability of 50%, the determination of plasma HCY concentration, with a positive predictive value of 0.82, is more suitable for screening of patients at risk than analysis of the MTHFR C677T polymorphism. Stroke is a frequent cause of death in the developed world with a prevalence of 1\u20135% in the general population. In Germany, there are about 160,000 new cases of stroke recorded per year, with an annual cost over 11.7 billion dollars . About 1In 1969, McCully reported an autopsy case of a 7-week-old-new-born with advanced atherosclerotic lesions and very high plasma homocysteine concentration . Plasma With respect to genetic factors, homocysteinemia may be the result of enzyme deficiency of the homocysteine intermediary metabolism. Apart from rare inherited metabolic disorders , the most common disorder investigated has been a deficiency of methylentetrahydrofolate reductase . Frosst et al.  identifiWe performed a case-control study in the patients who were admitted for surgical treatment of high grade ICA stenosis to assess the screening and/or diagnostic power of the MTHFR C677T polymorphism against plasma homocysteine concentration. This study was conducted in order to improve our knowledge on the role of the MTHFR C677T polymorphism and plasma HCY in patients with ICA stenosis, to rationalize the diagnostic work-up and to subsequently reduce unnecessary costs in routine diagnostics.The patient group consisted of 96 persons (age range 40\u201387 years) who were admitted to our hospital for surgery due to a high-grade carotid artery stenosis (at least 80%). Thirty-four patients were asymptomatic and 62 symptomatic and had already experienced TIA or stroke. The diagnosis of ICA stenosis was confirmed by doppler and duplex sonography in all patients and, additionally, by digital subtraction angiography (DAS) or magnetic resonance angiography (MRA) in some cases. All patients had a cranial computed tomography (CT) or magnetic resonance imaging (MRI) performed to evaluate preoperative brain damage. Ninety-six healthy volunteers (age range 45\u201383 years) without evidence of atherosclerosis or deep vein thrombosis represented the control group. The sex distribution was uniform in both groups, 23% (n = 22) women and 77% (n = 74) men, respectively.A careful anamnestic evaluation and physical examination were performed in all participants including evaluation of nutrition. Patients with vitamin and mineral supplementation and subjects with known disorders of B6, B12 and folate metabolism, as well as patients suffering from hematological and oncological disorders were excluded. Furthermore, subjects under continuous or recent medication, which are known to influence HCY, folic acid and vitamins B metabolism, women with hormone contraception or any other form of hormone substitution were also excluded. This study was performed according to the Helsinki declaration and was approved by the local ethical committee. A written consent has been obtained from each participant.Venous blood was obtained by puncture of the cubital vein, collected in EDTA tubes and immediately centrifuged at 2500 rpm for 10 min at 4\u00b0C. Cells were further assessed for genetic polymorphism. The plasma fraction was aliquoted for biochemical analysis. One aliquot was stored at -40\u00b0C to await analysis of homocysteine, folic acid or B12.Homocysteine plasma concentration was measured using a standard commercial diagnostic kit (AxSYM Homocystein) for the fully automated Abbott AxSYM system . Briefly, the assay included 3 analytical steps: 1) reduction of protein-bound homocysteine and other homocysteine fractions to free homocysteine using dithiothreitol, 2) enzymatic conversion using synthetic activity of S-adensylhomocysteine (SAH)-hydrolase in excess of adenosine, 3) a fluorescence polarisation immunoassay (mouse anti-SAH antibody) for determination of S-adenosylhomocysteine. Linearity of homocysteine determinations in the water and human whole plasma were proven using serial dilutions of HCY standards (range 0.6\u2013600 \u03bcM). Intra- and inter-assay variations and possible effects of freezing and thawing were also assessed. According to the results published by others and following the manufacturer's recommendations, the cut-off value for an elevated HCY concentration was set at 1.5 SD above the mean value of the control group.Folic acid and vitamine B12 plasma concentrations were assessed in one aliquot of stored plasma using standard commercial Abbott kits, the AxSYM Folate Assay and the AxSYM B12 Assay. AxSYM Folate assay is a Ion-Capture-Assay for quantitative determination of folic acid in human sera or plasma and AxSYM B12 is a microparticle enzyme intrinsic factor assay (MEIA) for quantitative determination of vitamin B12 in human serum or plasma. Both assays were conducted according to the manufacturer's instruction using AxSYM analyzer.\u00ae Roche Diagnostics GmbH, Mannheim, Germany) and hybridisation probes for genotyping of the C677T point mutation in exon 4 of the MTHFR gene in human DNA. A 233 bp fragment of the MTHFR gene is amplified from genomic DNA using specific primers and the PCR product is detected by fluorescence (Lightcycler -Red 640) using a specific pair of hybridisation probes.The MTHFR C677T polymorphism was assessed using the Lightcycler-MTHFR C677T mutation detection protocol, previously described in detail . BrieflyThe data are presented as means \u00b1 SD. Statistical significance of the results was analysed using the Student's t-test. In cases where the data distribution was not compatible with the application of Student's t-test, Wilcoxon's test of the sum of ranks was applied. Regression analysis was based on individual measurements using the Spearman's rank correlation coefficient. In addition, non-linear regression analysis was compared with the rank correlation analysis. Statistical analyses were performed using SPSS for Windows, version 6.0.1. A P-value below 0.05 (two-tailed) was assumed to indicate a significant difference.2-CVmeth2)1/2. For evaluation of the HCY plasma concentration and MTHFR C677T polymorphism, as a marker of enhanced risk of ICA stenosis, Bayes theorem was used [Within both, the patient and the control group, interindividual differences of the plasma HCY concentration were expressed as the coefficient of variation (CVobs). To obtain the real biological variability of homocysteine plasma concentration, the observed variability was corrected for methodological variability, which was assessed separately using plasma sample standards with known concentrations of homocysteine and expressed as the coefficient of variation of the method (CVmeth). A real biological coefficient of variation was calculated as CVbiol = , which may affect homocysteine distribution among protein-bound, free and mixed disulphides had no influence on the accuracy of the assay. Intra- and inter-assay variations as well as the coefficients of variation with and without freezing, were identical, yielding a coefficient of variation of the method (CVmeth) of 0.05. Descriptive statistical data for total plasma HCY and MTHFR C677T polymorphism are summarized in the Table In the control group, male subjects showed higher total plasma HCY concentrations than female subjects (10.8 \u00b1 3.35 \u03bcM vs. 9.30 \u00b1 2.03 \u03bcM p < 0.05). This gender-related significant difference in the total plasma HCY concentration was not observed in the group with stenosis of ICA. Male patients had no significantly different plasma HCY as compared to females . In the control group, HCY correlated significantly with age , while in the patient group no such a relationship with age was observed . However, in the control and the patient groups no significant correlation was found between the HCY concentration and age, when related to gender . An interesting observation was found in regard to plasma HCY and folate concentration. In both groups, a significant inverse relation between folate and plasma HCY was observed . Between patients with low and high folate concentrations (defined as < of 40 % and % > 140% of the mean plasma folate concentration), a statistical difference in the plasma HCY concentration was observed, 14.04 \u00b1 6.41 vs. 10.15 \u00b1 4.21 \u03bcM, p < 0.01, respectively. HCY in both examined groups did not show significant correlation with plasma B12 concentration, r = 0.01.The frequency distributions of the MTHFR C677T polymorphism are summarized in Table The relation between MTHFR C677T polymorphism and plasma HCY as well as plasma B12 and folate concentration in the patient group is presented in the Table For further evaluation, the patient population was stratified according to the clinical severity of ICA stenosis (TIA or stroke). Compared to asymptomatic patients, symptomatic patients had higher HCY plasma concentrations, but the difference was not statistically significant . The frequency of MTHFR 677 CT or TT genotypes did not differ between asymptomatic and symptomatic patients .To evaluate the total plasma HCY concentration and the MTHR polymorphism as a marker of ICA stenosis, Bayes theorem was used . The cutAccording to the discrepancy between recruited subjects in regard to gender distribution  a separate statistical analysis was performed.The analysis revealed that homocysteine plasma concentrations between male patients and male controls showed a significant statistical difference, 12.72 \u00b1 7.34 \u03bcM and 10.8 \u00b1 3.35 \u03bcM, p < 0.05, respectively. The sensitivity and specificity in the male subgroup compared to the whole collective were 0.26 and 0.27, 0.96 and 0.94, respectively. A positive predictive value, calculated in the male subgroup, was 0.86 compared to the 0.82 in the all subjects. Similarly, a separate analysis of the MTHFR 677T polymorphism in the male subgroup did not influence the results. Sensitivity and specificity were 0.54 and 0.38 and did not differ significantly compared to the whole group . The positive predictive value was 0.46 (0.48 in the whole group).In this study we explored the association between the MTHFR C677T polymorphism and plasma HCY concentration in patients with ICA stenosis. The main aim was to evaluate the relevance of this genetic marker in comparison to plasma HCY and to assess the screening and/or diagnostic power of the MTHFR C677T polymorphism against plasma homocysteine concentration.The study provided the following major results:1. Homocysteine plasma concentration was significantly higher in the patient group compared to the control.2. The genotype frequency of the MTHFR C677T polymorphism revealed no difference between the patient group and the group of healthy individuals.3. Patients, carrying the T-allele had significantly higher plasma HCY concentrations than CC patients.4. There was no statistically significant difference between symptomatic and asymptomatic patients in regard to plasma HCY concentration and genotype frequency of the MTHFR C677T polymorphism.5. The determination of plasma HCY concentration with a positive predictive value of 0.82 was more suitable for screening and monitoring of patients at risk than analysis of the MTHFR C677T polymorphism .In order to evaluate total plasma HCY and MTHFR C677T polymorphism as marker of ICA stenosis, this study (index test) was performed according to \"gold standard\" procedures . This reAs it is evident from Table However, higher plasma HCY concentration and CV of plasma HCY in the group of patients could not be explained by the MTHFR C677T polymorphism. A careful data evaluation showed that there was no consistent relationship between genotype frequency, vitamin status and plasma HCY. An inconsistent relation between examined determinants might be explained by the presence of some other unidentified genetic linkage or unknown risk factors, which could have an impact on the development of hyperhomocysteinemia.One possibility is that other mutations affect the MTHFR gene and have influence on the plasma HCY concentration. Van der Put et al.  for firsNevertheless, the application of Bayes theorem in our study design indicated that determination of MTHFR 677T polymorphism as screening or diagnostic tool is of minor importance.Our study showed that in a population with a given pretest disease probability of 50%, the determination of plasma HCY concentration, with a positive predictive value of 0.82, is more suitable for screening and monitoring of patients at risk than an analysis of the MTHFR C677T polymorphism.From our results we concluded that the measurement of the total plasma HCY concentration does not serve as a screening test for ICA stenosis in the general population but rather as a screening test and/or monitoring marker in certain risk groups .The author(s) declare that they have no competing interests.RL: initiated the study, designed, coordinated and drafted the manuscript.BTM: participated in the design of the study and recruited patients.RBZ: performed the statistical analysis and helped to draft the manuscript.CS: recruited patients and performed the measurement.WS: participated in the design of the study.RES: participated in the design and coordination of the study."}
{"text": "An increased concentration of plasma homocysteine (Hcy) has toxic effects on vascular endothelium. This seems to be a risk factor of cardiovascular disease, premature stroke and venous thrombosis. The risk is higher in coincidence with other factors like chronic diseases and familiar hypercholesterolemia. The aim of our study was to evaluate plasma Hcy concentration in patients with juvenile idiopathic arthritis (JIA) and its correlation with methotrexate (MTX) therapy, serum folate and B12 vitamin, and hyperlipidemia.th percentile observed in the control group.Fifty-one patients  with JIA and 52 healthy controls  were included in the study. Thirty-two patients were using weekly MTX (mean doses: 0.1\u20131 mg/kg). For statistical analysis both JIA and control groups were distributed in three subgroups according to age . The laboratory investigation included measurement of erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), plasma Hcy, serum folate, vitamin B12, triglycerides, total cholesterol, high-density lipoprotein (HDL), low-density lipoprotein (LDL) and very low-density lipoprotein (VLDL). For data analysis, we considered raised Hcy values \u2265 12.56 \u03bcmol/L, which corresponds to the 90The mean plasma Hcy concentration was 9.3 \u00b1 3.16 \u03bcmol/L in JIA patients and 8.9 \u00b1 2.42 \u03bcmol/L in healthy controls (p = 0.615). Higher concentration of Hcy was observed in the subgroup of 13 \u2013 18 years . We did not find correlation between MTX use and plasma Hcy concentration. With regard to vitamin B12 concentration, we detected normal values in both patients and controls while serum folate concentration was higher in patients (p < 0.001). With regard to the lipidogram, lower concentration of HDL was found in patients (p = 0.007) and higher levels of VLDL (p = 0.014) and triglycerides (p = 0.001) were observed in controls. We did not observe correlation among plasma Hcy concentration, clinical findings, ESR and CRP.JIA patients do not present significant increased concentration of Hcy despite the use of MTX, probably due to the folate supplementation. The mild abnormalities in the lipidogram may reflect a current concern with diet and health. Homocysteine (Hcy) is a sulphydryl amino acid derived from the essential amino acid methionine during its conversion to cysteine . Its maiHcy has many functions: threshold of the auto-oxidation of low-density lipoprotein (LDL) , promoteBoth in children and in adults increased concentration of plasma Hcy has direct and indirect toxic effects on the vascular endothelium and seems to be one more risk factor of cardiovascular disease, premature stroke and venous thrombosis , especiaJuvenile idiopathic arthritis (JIA) is a chronic inflammatory disease in which clinical manifestations may persist for decades in some patients despite adequate treatment . There aThe paucity of studies about this subject and the conflicting results published to the present date stimulated us to evaluate this metabolite in children and adolescents with JIA.A cross-sectional study involving 51 children and adolescents with JIA  selected consecutively from our outpatient Pediatric Rheumatology Unit was performed. All of them were diagnosed according to the International League of Associations for Rheumatology (ILAR) . Fifty-tAll patients were clinically evaluated by a board certified pediatric rheumatologist. We defined active JIA when the patient presented one or more joints with arthritis at the time of the study. We also measured the ESR and CRP of all patients.Patients and controls samples were identified by an unknown code by the laboratory staff. Thirty milliliters of blood were collected from fasting participants and centrifuged at 3000 rpm for 5 minutes. The plasma was separated in aliquots and immediately frozen and stored at -80\u00b0C. The time between the beginning and the end of this process did not exceed one hour.One portion of each blood sample was used to determine the total Hcy concentration, the concentration of vitamin B12 and serum folate. The leftover blood sample was used to determine the total cholesterol level (TC) and its fractions, and triglycerides (TG).th percentile of the control group).Total plasma Hcy concentration was measured according the method proposed by Pfeiffer et al, which uses the High Performance Liquid Chromatography (HPLC) with fluorimetric detection and isocratic elution . Increas\u00ae of Abbot Laboratories). Serum folate concentrations were measured by ionic capture (Imx Folate \u00ae of Abbot Laboratories).Vitamin B12 concentration was performed by an enzyme immunoassay method with micro particles , LDL, very low-density lipoprotein (VLDL), serum creatinine as well as TG were measured by the enzymatic colorimetric method.For statistical analysis both JIA and control groups were distributed into 3 subgroups according to age .th percentile of the control group.To establish a reference value (cutting point) in order to make comparisons between the groups of patients and controls, a receiver operating characteristics (ROC) curve analysis was conducted and after that, the categorization by the 9010) due to the variability and asymmetry of values, in order to obtain a normal probability distribution.Some variables like Hcy concentration, TC and its fractions, TG, vitamin B12, serum folate concentrations and serum creatinine were transformed into logarithm , the Fisher's exact test was used. The Student's t-test was used for the comparison of continuous variables. The relation between Hcy concentration and other continuous variables was analyzed by Spearman's correlation coefficient.To evaluate the relation between high and normal Hcy concentration groups of normal and high values and the other variables in each group, the logistic regression analysis with logic model was used to estimate odds ratio. Univariate and multivariate analysis were conducted using the stepwise variables selection criteria.The level of significance adopted for the statistical tests was 5%, that is, p < 0.05.The study protocol was approved by the Ethics Committee of the Universidade Federal de S\u00e3o Paulo. A consent form was obtained for each patient and control either from a parent, guardian or responsible adult before inclusion in the study.The demographic and clinical characteristics of the patients are presented in table Average serum Hcy concentration was 9.3 \u00b1 3.16 \u03bcmol/L in JIA patients and 8.9 \u00b1 2.42 \u03bcmol/L in healthy controls (p = 0.615)   Table . A lowerJIA is a chronic inflammatory disease that affects young children and adolescents. In this disease the mortality is low, and many patients have a good quality of life in their adult years. Studies with normal adults and rheumatoid arthritis patients have shown a correlation between plasma Hcy concentration and the presence of cardiovascular and thromboembolic events ,12. ThisIn this study we observed an elevated concentration of plasma Hcy in some children with JIA and also in some controls. We found a significant difference between two groups of patients: 3 to 7 year-old and 13 to 18 year-old (p < 0.001). Some studies relate age to an increase in Hcy levels, especially in children who are over 10 . In the In the present study we observed a progressive increase in the average concentration of Hcy in patients with JIA and controls related to age.There are few articles about the subject. Huemer et al  studied Hcy serum concentration can be a result of several factors including: genetic aspects ,16, age One of the main determinant factors of the Hcy concentration is folate , due to It is known that MTX takes part in Hcy metabolism increasing its plasmatic concentration . Van EdeCorticosteroids, diuretics and immunosuppressive drugs like azathioprine and cyclosporine may interfere with Hcy concentration . In our Chiang et al  reportedDyslipidemia may be found in some rheumatic diseases especially related to disease activity and corticosteroid use . Its relJIA patients do not present significant increased concentration of Hcy despite the use of MTX, probably due to the folate supplementation. The mild abnormalities in the lipidogram may reflect a current concern with diet and health.Our data is not conclusive. Multicentric studies involving a higher number of patients will help to indicate with more accuracy the significance of Hcy in patients with JIA.Hcy = homocysteineLDL = low-density lipoproteinJIA = juvenile idiopathic arthritisMTX = methotrexate (MTX)ILAR = International League of Associations for RheumatologyTC = total cholesterol levelTG = triglyceridesHPLC = High Performance Liquid ChromatographyHDL = high-density lipoproteinVLDL = very low-density lipoproteinROC = receiver operating characteristicsSLE = systemic lupus erythematosusNSAIDs = nonsteroidal anti-inflammatory drugsSD = standard deviationThe author(s) declare that they have no competing interests.MG, VDA, MOEH were involved in the development of the protocol. MG was responsible to see the patients at outpatient clinic. VDA, EMGS and LCG performed the laboratory tests. MG, CAL and MOEH carried out the literature search. MG, CAL and MOEH prepared and revised the manuscript. CAL coordinated the submission of the article. All authors participated in critical editing of the manuscript and read and approved the final version."}
{"text": "The aim of the study was to assess the plasma levels of homocysteine in patients with multiple sclerosis (MS) and to investigate whether an association with depression exists.Plasma homocysteine (Hcy), vitamin B12 and plasma folate were measured in 65 moderately disabled patients with relapsing/remitting MS (RR-MS) and 60 healthy controls. All subjects were assessed with the Beck Depression Inventory (BDI).Hcy levels were significantly increased in MS patients compared to controls . A significant correlation was found between Hcy levels and BDI scores . Plasma Hcy was not related to Extended Disability Status Scale (EDSS) score, age, disease duration or vitamin B12 and folate.Moderately disabled MS patients with elevated Hcy levels are particularly prone to develop depressive symptomatology. Further study is warranted in order to elucidate the prognostic and therapeutic implications of this novel finding. Homocysteine is a non-essential sulfur-containing amino acid derived from methionine by demethylation. Vitamins B12 and B6 as well as folate play an important role in the metabolic pathway of homocysteine . As a reAmongst neurological conditions, multiple sclerosis (MS) has been extensively investigated with regard to homocysteine metabolism, with conflicting results. Some studies demonstrated elevated plasma homocysteine (Hcy) levels in MS patients with ,7 or witWith regard to psychiatric disorders, depression has been linked in particular to increased Hcy plasma levels in the context of altered methylation reactions -13. No sAccordingly, the present study was designed in order to assess Hcy plasma levels in MS patients and investigate whether an association with depression and clinical disability or disease duration exists.et al. [A total of 65 relapsing remitting MS (RR-MS) patients with a mean age 39.2 \u00b1 8.3 years, entered the study after providing informed consent for the procedures. All patients met the criteria for clinically definite MS according to Poser et al. , were inA total of 60 healthy volunteers with a mean age of 38.2 \u00b1 7.7 years served as a control group. The demographic characteristics of MS patients and healthy controls are shown in Table After overnight fasting, blood samples were drawn from a peripheral vein and were kept on ice prior to separation (maximum 30 min after drawing). Total homocysteine (free plus protein-bound) was quantified using a sandwich enzyme immunoassay method based on a monoclonal/polyclonal antibody pair . Values higher than 15 \u03bcmol/l were considered increased according to relevant literature and manufacturer's instructions.Serum folate and B12 levels were quantified with a paramagnetic particle chemiluminescence's immunoassay .Assessment of depressive symptomatology in all subjects was performed by the Beck Depression Inventory (BDI) , a self-Statistical testing was performed by Fisher's exact test for categorical variables whereas an unpaired t test was used for comparing continuous variables. Correlations between Hcy levels and other investigated parameters were derived using Pearson correlation analysis. The level of statistical significance was set at p = 0.05. All statistical analyses were performed with SPSS version 10.0 for Windows .Plasma Hcy levels were significantly increased in MS patients compared to controls  involving monoamines and various neurotransmitters, amongst other cellular constituents. Thus, increased Hcy levels in depression are thought to reflect functional folate and/or B12 deficiency, which may ultimately cause an imbalance at the monoamine or neurotransmitter level.At the biochemical level, the rise in homocysteine levels observed in patients with depression is ascribed to failure of methylation of Hcy to methionine due to a shortage of supply of methyl groups from methyl folate or lack of the vitamin B12 cofactor for this methylation reaction . MethionThe mechanism of increased Hcy levels in MS patients, particularly those with depression, seems to be different since folate and/or B12 deficiency was not documented in the context of the present study. Irrespective of the precise pathogenetic mechanisms, however, increased Hcy may induce neuronal damage through its neurotoxic action . It is aThe clinical implications of our finding are not entirely clear. Since Hcy is associated with an atherogenic propensity, MS patients with elevated Hcy and depression might represent a subgroup of MS patients with a predisposition for atherothrombotic cerebrovascular disease. In addition, since our patients were not entered into a treatment study, it is currently unknown whether vitamin treatment combined with antidepressants is the optimal way to treat this subgroup of MS patients.In conclusion, our results suggest that moderately disabled MS patients with elevated Hcy levels are particularly prone to develop depressive symptomatology, reflected by higher BDI scores. Further studies and follow up of this subgroup of MS patients are warranted in order to elucidate the prognostic and therapeutic implications of this finding.The authors declare that they have no competing interests.NT conceived of the study, and participated in its design and coordination, carried out the statistical analysis and drafted the manuscript. MEE and VKK participated in the design of the study and drafted the manuscript. EK and MS participated in data acquisition. FB and CN carried out the immunoassays. KNF participated in the design of the study and drafted the manuscript. CS, NV and DV participated in the interpretation of data. All authors read and approved the final manuscript"}
{"text": "Cnr1, encoding CB1, causes retention of embryos in the oviduct. The role of the endocannabinoids in tubal implantation in humans is not known.Embryo retention in the Fallopian tube (FT) is thought to lead to ectopic pregnancy (EP), a considerable cause of morbidity. In mice, genetic/pharmacological silencing of cannabinoid receptor CNR1 was examined by TaqMan analysis of genomic DNA from the whole blood samples. In normal FT, CB1 mRNA was higher in luteal compared to follicular-phase (p<0.05). CB1 protein was located in smooth muscle of the wall and of endothelial vessels, and luminal epithelium of FT. In FT from women with EP, CB1 mRNA expression was low. CB1 mRNA expression was also significantly lower (p<0.05) in endometrium of women with EP compared to intrauterine pregnancies (IUP). Although of 1359G/A (rs1049353) polymorphisms of CNR1 gene suggests differential distribution of genotypes between the small, available cohorts of women with EP and those with IUP, results were not statistically significant.Timed FT biopsies (n\u200a=\u200a18) were collected from women undergoing gynecological procedures for benign conditions. Endometrial biopsies and whole blood were collected from women undergoing surgery for EP (n\u200a=\u200a11); management of miscarriage (n\u200a=\u200a6), and termination of pregnancy (n\u200a=\u200a8). Using RT-PCR and immunohistochemistry, CB1 mRNA and protein expression levels/patterns were examined in FT and endometrial biopsies. The distribution of two polymorphisms of CNR1 gene and EP, suggests a possible genetic predisposition to EP that warrants replication in a larger sample pool.CB1 mRNA shows temporal variation in expression in human FT, likely regulated by progesterone. CB1 mRNA is expressed in low levels in both the FT and endometrium of women with EP. We propose that aberrant endocannabinoid-signaling in human FT leads to EP. Furthermore, our finding of reduced mRNA expression along with a possible association between polymorphism genotypes of the  Tubal ectopic pregnancy remains a common cause of morbidity and occasional mortality Exposure to marijuana and its cannabinoid derivatives is reported to have many adverse effects on reproductive functions, including reduced fertilizing capacity of sperm, retarded development of the embryo, fetal loss and pregnancy failure Nonetheless, in the mouse oviduct, it has been shown that a finely regulated endocannabinoid tone mediated by CB1 regulates normal oviductal transport of embryos CNR1 gene encoding for CB1 . All women were aged 18\u201345 years (mean 38). Written and informed consent was obtained from all patients before sample collection. Fallopian tube biopsies, endometrial biopsies  and sera (for measurement of circulating estradiol and progesterone concentrations for endocrine staging) were collected from women undergoing gynecological procedures for benign conditions see  and womeTotal RNA was extracted from the Fallopian tube and endometrial biopsies as detailed in the manufacturers' protocol . The concentration and quality of the extracted RNA was assessed using an Agilent bioanalyser. All samples were standardised for quality control and assigned an RNA integrity number (RIN). RNA samples were considered to be of good quality when a mean RIN value of 7.5 was obtained Frozen tissue sections were fixed for 30 minutes in cold acetone at \u221220\u00b0C then allowed to air-dry for two hours. Sections were washed in TBS+0.5% Triton-X (TBSTX) for 10 minutes before blocking of non-specific endogenous peroxidase activity with 3% hydrogen peroxide  in distilled water for 10 minutes at room temperature. Following a further wash in TBSTX, a non-immune blocking solution of normal goat serum was applied for 20 minutes prior to application of cannabinoid receptor 1 antibody  diluted 1\u2236300 in normal goat serum. Sections were incubated overnight at 4\u00b0C then washed in TBSTX. For the negative control sections, the primary antibody (diluted 1\u2236300) was pre-incubated in antibody diluent for three hours at room temperature with fifty times the amount of cannabinoid receptor 1 peptide  prior to the overnight incubation. A biotinylated goat anti-rabbit secondary antibody  was applied for 30 minutes at room temperature, then washed in TBSTX before a horseradish peroxidase detection system was applied for 30 minutes . Immunoreactivity was detected using the chromagen, 3,3\u2032-diaminobenzidine  followed by counterstaining of sections with Harris's haematoxylin  and mounted in Pertex .Genomic DNA was purified from 2 ml frozen whole blood samples using the QIAamp Blood Midi Kit  as per the manufacturers' protocol. The DNA was quantified using a ND-1000 spectrophotometer .CNR1 gene were genotyped using the Applied Biosystems TaqMan SNP Genotyping Assays (C_ 1652590_10 and C_8943804_10). The recommended protocols were followed using an ABI 7500 Real Time PCR System with reaction volumes of 25 rather than 50 \u00b5l and all reagent volumes reduced by 1/2. The genotypes were compared using Likelihood Ratio and Pearson analyses.The 1359G/A (rs1049353) single nucleotide polymorphism (SNP) encoding a synonymous Thr at amino acid 453 residue and the rs806368 C/T SNP in the 3\u2032 UTR of the of the T 15.42\u00b1SEM 0.42, n\u200a=\u200a5) compared to the follicular phase  (p<0.05) (see T 19.17\u00b1SEM 0.41) (p<0.05), mimicking that of the Fallopian tube in the follicular phase  see . In Fallhase see .T 20.32\u00b1SEM 0.47, n\u200a=\u200a11) compared to the endometrium from intra-uterine pregnancies  (n\u200a=\u200a14)  in the decidualized endometrium of women with ectopic pregnancies (mean \u0394C\u200a14) see . Thus, lCB1 protein was located in the smooth muscle of the wall, the smooth muscle of the endothelial vessels and luminal epithelium of the Fallopian tube see . ExpressCNR1 SNPs (rs1049353 and rs806368) . The rs806368 SNP was not informative as all ectopic and 13/14 intra-uterine subject DNAs were TT homozygotes.The distribution of two 368) see  was comp368) see , differeCNR1, may possibly contribute to a predisposition to ectopic pregnancy.To date, study of the role of the endocannabinoids in female reproduction has mostly been limited to mice Our other finding of a temporal variation of expression of CB1 in the Fallopian tube reflects that of many genes in the endometrium suggesting a role for progesterone in the human endocannabinoid system In our study, we also show that CB1 protein is expressed primarily in the smooth muscle of the wall and blood vessels of the Fallopian tube, with some expression in the cytoplasm of the luminal epithelium. This is reassuringly consistent with murine data CB1 mRNA was expressed in low levels in both the Fallopian tube and pregnant endometrium of women with ectopic pregnancies. The most obvious difference in the endometrium of the women with ectopic compared to intra-uterine pregnancies is the absence of trophoblast. There are no published data to our knowledge to suggest that CB1 expression in the uterus is regulated by local trophoblast signals. Nevertheless, the coordinated down-regulation of embryonic CB1 and uterine AEA levels are important for both embryo activation and uterine receptivity  so it is not inconceivable that uterine CB1 expression could be under embryonic control CNR1 gene encoding CB1 warrants further investigation that also excludes the possibility that some subjects with ectopic pregnancy and reduced mRNA expression genotyped as 1359G/G homozygotes may actually be G/deletion heterozygotes. To date, the 1359G/A SNP is considered as the unique haplotype tagging SNP of the CNR1 gene but a direct role of this SNP tagging of the CNR1 gene has still to be demonstrated CNR1 gene, and indeed CB1, is important for embryo transport and successful intra-uterine implantation.However, our observation of suggestive differences in distribution of SNP alleles of the The demonstration of a potential role for CB1 in the etiology of human ectopic pregnancy is important. Cigarette smoking is a major risk factor for ectopic pregnancy and there is evidence of altered oviductal transport in rats exposed to nicotine"}
{"text": "We experimentally investigated a simple and new technique for the fabrication of micro-ridge long-period gratings (MRLPGs) based on polarization-maintaining fibers (PMFs). The cladding region of the PMFs was etched periodically using a wet etching technique resulting in the periodic formation of micro-ridges on the surface of the PMF. The PMF-based MRLPGs has two resonant peaks because of the birefringence of the PMF. The extinction ratios of two resonant peaks of the PMF-based MRLPGs were effectively improved by increasing the applied strain because of the photoelastic effect. Long-period fiber gratings (LPGs) have attracted much attention in optical communication systems and optical sensors because of their many advantages, such as low cost, ease of fabrication, and electromagnetic immunity -3. SinceT) can be written as [Mode coupling in the MRLPGs is based on the photoelastic effect. After the formation of the periodic micro-ridges in the cladding of the optical fiber, the different cross-sections between the etched and the unetched claddings can essentially induce the periodic index modulation based on the photoelastic effect when strain is applied to the optical fiber . Consequitten as pe is a photoelastic coefficient, re and ru are the radii of the etched and the unetched regions, respectively, \u03f5 is the applied strain, and l is a grating length. Since the periodic micro-ridges are structurally formed in the cladding region, the averaged cladding mode index should be considered and the structural index change in the core region is negligible [nPMF), the resonant wavelength of the PMF-based MRLPG can be written aswhere gligible . When th\u039b is a grating period, and \u03baco are the averaged self-coupling coefficients of the cladding and core modes, respectively. From Equation 2, it is evident that the resonant wavelengths should be determined by the birefringence of the PMF [where  the PMF .Figure\u00a02O3-based stress region was etched higher than that of the silica cladding [Figure\u00a0cladding ,7. The dThe periodic micro-ridges in the PMF can induce the periodic index modulation based on the photoelastic effect resulting in the mode coupling between the core and the cladding modes when strain is applied. The transmission characteristics of the PMF-based MRLPG were measured using the experimental setup as shown in Figure\u00a0Figure\u00a0We proposed and experimentally demonstrated a fabrication method for the PMF-based MRLPG using the double coating and the wet etching processes, which has the great potential for mass production. The transmission characteristics of the PMF-based MRLPG with variations in strain were measured. Two resonant peaks of the PMF-based MRLPG were observed in the transmission spectrum of the PMF-based MRLPG because of the birefringence of the PMF. The extinction ratios of two resonant peaks of the PMF-based MRLPG were enhanced by increasing the applied strain without variation in their resonant wavelengths because of the photoelastic effect. The variation of the extinction ratios of two resonant peaks at wavelengths of 1,395 and 1,471\u00a0nm were measured to be \u221210.16 and \u221214.13\u00a0dB, respectively, when the applied strain was 840 \u03bc\u03f5. We believe that the experimental results are very useful for applications to fiber optic sensors, optical switch filters, etc.The authors declare that they have no competing interests.O-JK and MS participated in the experimental fabrication. Y-GH wrote and corrected the manuscript and conceived and supervised the study. All authors read and approved the final manuscript."}
{"text": "RIP140 is a transcriptional coregulator involved in energy homeostasis and ovulation which is controlled at the transcriptional level by several nuclear receptors. We demonstrate here that RIP140 is a novel target gene of the E2F1 transcription factor. Bioinformatics analysis, gel shift assay, and chromatin immunoprecipitation demonstrate that the RIP140 promoter contains bona fide E2F response elements. In transiently transfected MCF-7 breast cancer cells, the RIP140 promoter is transactivated by overexpression of E2F1/DP1. Interestingly, RIP140 mRNA is finely regulated during cell cycle progression (5-fold increase at the G1/S and G2/M transitions). The positive regulation by E2F1 requires sequences located in the proximal region of the promoter (\u221273/+167), involves Sp1 transcription factors, and undergoes a negative feedback control by RIP140. Finally, we show that E2F1 participates in the induction of RIP140 expression during adipocyte differentiation. Altogether, this work identifies the RIP140 gene as a new transcriptional target of E2F1 which may explain some of the effect of E2F1 in both cancer and metabolic diseases. RIP140  is a nuclear protein of 1158 amino acids, initially identified as a transcription cofactor of estrogen receptors which, despite its recruitment in the presence of agonist ligands, exhibits a strong transcriptional repressive activity of various nuclear receptors  or repressors (E2F4\u20138) The present study further deciphers the role of RIP140 in the E2F signaling pathway. Our data identify the RIP140 gene as a novel transcriptional target of E2F1 that might be involved in a wide range of pathological processes regulated by this transcription factor such as cancer or metabolic diseases.3-TK-Luc) were obtained from Dr L. Fajas . The pEFc-mycRIP140 expression vectors and the plasmid containing the RIP140 promoter (RIP900) have been described previously The pcDNA3-E2F1 and 4, pCMV-DP1, pCMV-Rb expression vectors were given by Dr C. Sardet  and the pCMV-E2F2, 3, 5 and E2F6 expression vectors by Dr K. Helin . The reporter plasmids (CyclinE-luc and (E2F)www.genomatix.de). Alignment of human and mouse NRIP1 promoter sequences and identification of the evolutionary conserved transcription factor binding elements were performed using Genomatix DiAlign Program (www.genomatix.de).Localization of human 6 cells HeLa cells were grown in 100 mm culture dishes to 60% of confluence in medium containing 0.5% FCS (serum starvation) and 2 mM HU (Boehringer Mannheim) was added during 24 hr to induce cell synchronization. When cells were at 80% of confluence, medium was removed to release the block. At each time point, cells were washed, trypsinized and total RNA was extracted. Cell cycle analysis was performed using a FACs-Vatange flow cytometer . For each sample, 2.104 events were collected and the CellQuest software was used to analyze the list-mode data. ModFit software was used to determine the percentage of each G0/G1, S and G2/M phase in the population.MCF-7 and HeLa human cancer cell lines were purchased from the American Type Culture Collection and routinely maintained in the laboratory as previously described Gel shift assays were performed as previously described For ChIP analysis, MCF-7 cells (70% confluent) were cross-linked with 3,7% formaldehyde during 10 min at 37\u00b0C. The ChampionChIP One-Day Kit (SABiosciences) was then used according to the manufacturer\u2019s recommendations. Immunoprecipitations were performed using the KH95 (sc-251 SantaCruz), C-20 (sc-866 Santa-Cruz) or 2656C6a (sc-81370 Santa-Cruz) antibodies against E2F1, E2F4 and RIP140 respectively. It should be noted that although the anti-E2Fs antibody were given by the supplier as being specific, we could not eliminate with certainty the possibility that they may cross-react with other E2Fs. As a negative control, we performed IP with no antibody . Quantitative PCR was then performed using the Power SYBR Green PCR master mix, on an Applied Biosystems 7300 thermal cycler with 2 \u00b5l of material per point. Primers flanking the E2F site of the RIP140 and cyclin A2 promoters are given in MCF-7 cells were plated in 96-well plates . 24 h later, plasmid tests containing firefly luciferase reporter gene (25 ng), pRLCMVBis (25 ng per well) used as internal standard, and 25 ng each of different factors  and 200 ng each of either RIP140, pRb, p130 proteins to a total of 0.25 \u00b5g total DNA per well, were cotranfected using Jet-PEI. 48 h after transfection, cells were lysed and firefly luciferase values were measured and normalized with the Renilla luciferase activity; all triplicate point values were expressed as mean + SD.Expression plasmids for E2F1, 2, 3, 4 or DP1 were transfected in MCF-7 cells using JetPEI. After cell lysis in 25 mM Tris-HCl, pH7.8, 2 mM EDTA, 2 mM DTT, 10% Glycerol, 1% Triton, supplemented with protease inhibitors, whole cell extracts were diluted in Laemmli sample buffer 2X and resolved by SDS\u2013PAGE. Western blotting detection was performed using primary antibodies against E2Fs . To check for gel loading, we used the anti-actin (A2066 from Sigma) or anti-TBP (MA1-21516 from ThermoScientific) antibodies.Total RNA was extracted from cells as previously described \u2212/\u2212 and wild-type mouse embryonic fibroblasts (MEFs) were isolated from 13.5 days-old embryos in compliance with the French guidelines for experimental animal studies (agreement B34-172-27). Three different MEF cultures were obtained from E2F1 wild-type and knock-out embryos and grown in F12-DMEM supplemented with 10% fetal calf serum and 1.5% HEPES. For adipocyte differentiation experiments, MEFs (at passage 3) were seeded in 6-well plates. Two days after confluence, differentiation was induced by treating cells for 2 days with a cocktail containing 0.5 mM IBMX (3-isobutyl-1-methylxanthine), 10 \u00b5g/mL insulin, 1 \u00b5M dexamethasone and 1 \u00b5M BRL49653. Every two days, medium was changed with F12-DMEM, 10% serum, 1.5% HEPES, 10 \u00b5g/mL insulin and 1 \u00b5M BRL49653. Differentiated cells were visualized with Oil Red O staining (Sigma). Nuclear protein extracts were prepared using the NE-PER kit (Thermo Scientific) and 20 \u00b5g of nuclear cell extracts were analyzed by Western blotting using primary antibodies against E2F1 (sc-193 from Santa-Cruz Biotechnology) and RIP140 (H300 from Santa-Cruz Biotechnology). Total RNA was extracted using the Quick-RNA Miniprep (Zymo Research) and 1 \u00b5g was analyzed for RIP140 mRNA levels by real-time quantitative Polymerase Chain Reaction on an Applied Biosystems 7300 thermal circler. Results were corrected for RS9 mRNA levels used as a reference gene.E2F1Statistical analysis was performed using the Student t test except for We previously reported the cloning and characterization of the human RIP140 gene promoter with the identification of various response elements bona fide E2F binding sites. Using gel shift experiments, we demonstrated that E2F1 strongly interacts with oligonucleotides encompassing some of the putative binding sites . As shown in We then checked the ability of the five different sites from the human promoter to act as In order to demonstrate that the interaction of E2F1/DP1 also occurred in intact cells, we performed chromatin immunoprecipitation experiments. As shown in To demonstrate a transcriptional regulation of the RIP140 promoter by E2Fs, we transiently transfected MCF-7 breast cancer cells with the RIP900 reporter construct containing the 900 bp of the RIP140 promoter fused to the luciferase coding sequence. This construct (which encompassed the five E2F binding sites that we identified) was cotransfected with expression vectors encoding the different members of the E2F family . When coTo strengthen our results on the transiently transfected RIP140 promoter, we analyzed the regulation of the endogenous RIP140 mRNA upon overexpression of E2F1 and DP1 by transient transfection. As shown in 1 and S and between S and G2/M , we then defined the cis-acting elements required for the positive regulation by E2Fs. In a first step, we generated mutants of the RIP140 promoter with point mutations in the different E2F response elements . When weWe then analyzed reporter transactivation when a single functional E2F response element was left intact . When coDeletion analysis of the promoter confirmed these data . Indeed,E2F transcription factors are believed to act as heterodimers with DP proteins which are ubiquitously expressed i.e. the DHFR and ARF promoters. Interestingly, the negative effect observed with DP1 overexpression on the RIP140 promoter was also observed with the ARF promoter but not with the DHFR promoter  i.e. when heterodimerization was forced) but was significantly less efficient to activate transcription from the RIP140 promoter when overexpressed alone i.e. when Sp1-mediated transactivation took place  increase transcription from the RIP140 promoter through binding to the proximal promoter region. Several evidences (mutagenesis of Sp1 response elements and use of an E2F1 mutant defective for Sp1 binding) strongly supported the involvement of Sp1 transcription factors in the regulation of RIP140 by E2F1. In addition, the use of mithramycin which has been described as an inhibitor of Sp1 binding to DNA Based on in vitro and by coimmunoprecipitation via Sp1 sites et al. have shown that the great majority of E2F1 binding sites are in CpG islands (which are highly enriched in Sp1 sites) and lack the consensus binding site motif The interaction between Sp1 and E2F1 has been previously demonstrated An indirect recruitment of E2F1 is supported by our observation highlighting the repressive role of DP1 overexpression in the regulation of RIP140 promoter. This effect is also observed with the mouse RIP140 promoter  and appein vitro results clearly demonstrate that RIP140 is a direct target of E2F1. This conclusion is reinforced by our data demonstrating that the accumulation of RIP140 mRNA varies during cell cycle progression although it remains to be demonstrated whether E2Fs are involved in the two peaks of RIP140 expression observed in synchronized cells at the G1/S and G2/M transition. This is conceivable since recent data from Nevins\u2019 laboratory clearly demonstrated that E2Fs are key actors in gene regulation during the G2/M transition Altogether, our Homo sapiens, Pan troglodytes, Bos Taurus, Oryctolagus cuniculus, Mus musculus and Rattus norvegicus). As shown in Interestingly, a bioinformatic analysis was conducted on the RIP140 promoter sequence using six different species  MCF-7 cells were transiently transfected with the different human RIP140 promoter reporter plasmids  together or not (Ctrl) with expression vectors for E2F1 and DP1. Relative luciferase activities are expressed as percent of control and are the mean (\u00b1SD) of several independent experiments (n\u200a=\u200a5). (C) MCF-7 cells were transiently transfected with the human RIP900 reporter plasmids together with expression vectors for E2F1 in the presence or absence of DP1. Relative luciferase activities are expressed as percent of control and are the mean (\u00b1SD) of several independent experiments (n\u200a=\u200a10). The paired t-test was used for statistical analysis.(TIF)Click here for additional data file.Figure S2Effect of the E2F1 mutant (E132) on the human RIP140 and cyclin E promoters. (A) MCF-7 cells were transiently transfected with the human RIP140 or cyclin E promoter reporter plasmids (25 ng) together with expression vectors for E2F1wt or E132 mutant and DP1 (25 ng each). Relative luciferase activity was normalized with renilla luciferase activity as described in (TIF)Click here for additional data file.Figure S3Effect of activator E2Fs and DP1 on the murine RIP140 promoter. (A) MCF-7 cells were transiently transfected with the murine RIP140 promoter reporter plasmids (25 ng) together with expression vectors for E2F1, E2F2, E2F3 and DP1 (25 ng each). Results are expressed as described in legend of (TIF)Click here for additional data file.Figure S4Binding of E2F4 on the distal site of the RIP140 promoter. (A) Electromobility shift assay was used to analyze E2F1/DP1 or E2F4/DP1 binding on the adenoviral E2F response element (Ad2E2F) or on the E2Fa site of the RIP140 promoter (see oter see . (B) ChI(TIF)Click here for additional data file.Figure S5Conservation of the NRIP1 promoter sequence among mammals. The NRIP1 promoter regions of six mammalian species (from exon 1 b up to about 1 kbp) have been aligned using the Multalin program . Genome assembly used for each species were Homo sapiens (hg19), Pan troglodytes (panTro3), Bos taurus (bosTau6), Oryctolagus cuniculus (oryCun2), Mus musculus (mm9), and Ratus norvegicus (rn4) as indicated at the left of the aligned sequences that were extracted from the UCSC genome browser (http://genome.ucsc.edu/). Localization of putative E2F and Sp1 transcription binding sites was performed using MathInspector pattern search program from Genomatix (http://www.genomatix.de). E2F and Sp1 binding sites are shown in grey and white boxes respectively, with names above the sequence according to (TIF)Click here for additional data file.Table S1Oligonucleotide sequences. The table shows the sequences of all the oligonucleotides used in the different assays . The corresponding species (human or mouse) is indicated as well as the orientation of oligonucleotides i.e. sense/forward (fwd) or reverse (rev). The name of the target  is also presented.(TIF)Click here for additional data file."}
{"text": "Collagen detection in histological sections and its quantitative estimation by computer-aided image analysis represent important procedures to assess tissue localization and distribution of connective fibers. Different histochemical approaches have been proposed to detect and quantify collagen deposition in paraffin slices with different degrees of satisfaction. The present study was performed to compare the qualitative and quantitative efficiency of three histochemical methods available for collagen staining in paraffin sections of colon. van Gieson, Sirius Red and Sirius Red/Fast Green stainings were carried out for collagen detection and quantitative estimation by morphometric image analysis in colonic specimens from normal rats or animals with 2,4-dinitrobenzenesulfonic acid (DNBS) induced colitis. Haematoxylin/eosin staining was carried out to assess tissue morphology and histopathological lesions. Among the three investigated methods, Sirius Red/Fast Green staining allowed to best highlight well-defined red-stained collagen fibers and to obtain the highest quantitative results by morphometric image analysis in both normal and inflamed colon. Collagen fibers, which stood out against the green-stained non-collagen components, could be clearly appreciated, even in their thinner networks, within all layers of normal or inflamed colonic wall. The present study provides evidence that, as compared with Sirius Red alone or van Gieson staining, the Sirius Red/Fast Green method is the most sensitive, in terms of both qualitative and quantitative evaluation of collagen fibers, in paraffin sections of both normal and inflamed colon. Collagen is one of the major component in the adult gastro-intestinal wall, starting from the early stages of organogenesis  up to noThe purpose of the present investigation was to compare three conventional histochemical methods, suitable for collagen staining, in terms of their efficiency for qualitative and quantitative detection of collagen fibers by computer-aided morphometric image analysis in light microscopy. In particular, staining protocols, carried out by van Gieson and Sirius Red, alone or combined with Fast Green, were compared for their capability of revealing and allowing the quantification of collagen deposition in paraffin sections of colon from normal rats or with colitis induced by 2,4-dinitrobenzenesulfonic acid (DNBS).Albino male Sprague\u2014Dawley rats, 200\u2013250 g body weight, were used throughout the study. The animals were fed standard laboratory chow and tap water ad libitum, and were not employed for at least one week after their delivery to the laboratory. They were housed, three in a cage, in temperature-controlled rooms on a 12-h light cycle at 22\u201324\u00b0C and 50\u201360% humidity. All experimental protocols were approved by the Animal Care and Use Committee of the University of Pisa, and were in compliance with the national and European guidelines for handling and use of experimental animals. All efforts were made to minimize stress and suffering. Colitis was induced in accordance with the method previously described by Fornai et al. . MicroscColonic samples were immediately fixed in cold 4% neutral formalin diluted in phosphate-buffered saline at 4\u00b0C and routinely processed for paraffin embedding and cross-sectioned to obtain 3 \u03bcm-thick sections with circular layer and myenteric ganglia cut longitudinally. Before use, sections were deparaffinized, rehydrated and processed for routine haematoxylin/eosin, and histochemical staining.Tissue collagen deposition was detected by applying the following histochemical staining protocols:Colonic sections were treated with haematoxylin for 10 min, washed in tap water and incubated for 2 min in a picrofuchsia acid solution (1% acid fuchsin in acqueous saturated picric acid). Sections, dehydrated and mounted with DPX Mounting, showed collagen fibers pink-stained, nuclei and muscle black- and yellow-coloured, respectively.The slides were incubated with a 0.1% Sirius Red solution dissolved in acqueous saturated picric acid for 1 hour, washed in acidified water (0.5% hydrogen chloride), dehydrated and mounted with DPX Mounting. Collagen and non-collagen components were red- and orange-stained, respectively.Collagen fibers were detected in colonic tissues as previously reported . Brieflytunica muscularis, respectively, were quantitatively estimated for collagen fibers and cellular non-collagen proteins in double Sirius Red/Fast Green staining, within the respective colonic areas. To detect the specific threshold of different colors , a square was applied upon the color of interest and recorded by Image Analysis System \u2018L.A.S. software v.4\u2019. Positive tissue areas were automatically estimated on the basis of the total pixel number and intensity. The whole wall and tunica muscularis areas were manually circumscribed and automatically calculated. Data were expressed as percentage of \u03a3 of positive-stained area / \u03a3 of tissue area examined of whole wall or tunica muscularis in three colonic sections (5 fields/each) for each animal.Quantitative estimations of histochemical stainings were carried out independently by two blind investigators (C.S. and C.I.). Each investigator analyzed all tissue specimens under study. The respective values were then averaged and plotted in graphs in accordance with previously described criteria . BrieflyComparisons between groups were performed using the Wilcoxon signed rank test for paired data. All data are given in scatter plot graphs as mean \u00b1 SEM  and a P-value \u2264 0.05 was considered statistically significant. All statistical analysis were carried out using the Statistical Package for Social Science .tunica mucosa and submucosa  and serosa. The inflamed colon showed abundant inflammatory infiltrations with high percentage of eosinophils throughout the whole wall  have been found to underestimate collagen content . Therefotunica mucosa and submucosa, while Sirius Red revealed the presence of collagen fibers throughout the wall, highlighting also the thin collagen network within the muscle compartment. The latter observations are in line with the accurate and reliable staining characteristics displayed by Sirius Red in previous studies on the quantification of hepatic collagen [tunica muscularis, against the brilliant, green background of non-collagen components. Of note, collagen fibers stained by Sirius Red alone appeared as red areas surrounded by a lot of reddish nuances, which could not recorded by the image analysis, being the threshold set up on the red area. By contrast, the double Sirius Red/Fast Green coloration was able to stain the collagen fibers more homogeneously, yielding red areas without blending, and allowed to record overall red-stained collagen areas that were larger than those stained by Sirius Red alone. Besides the best qualitative results, the quantitative estimation of Sirius Red/Fast Green-stained sections by image analysis yielded values that outnumbered significantly those obtained by van Gieson and Sirius Red alone. Of note, the choice of a staining method, which allows to specifically stand out the collagen fibers over the tissue background, plays an important role not only for their morphological identification, but also for a better quantitative assessment as compared to Sirius Red alone. In this respect, the Fast Green dye, which selectively stains non-collagen tissue components, gives rise to a useful color contrast and visualization of red-stained collagen fibers, as well as an optimal threshold for counting the positive pixels and, therefore, to obtain the best quantitative estimation of collagen content by image analysis. Consistently with this view, the Sirius Red/Fast Green staining has been widely used for the in situ computer-aided microscopic evaluation of abnormal collagen deposition, such as in kidney [Based on these considerations, and considering the lack of comparative microscopic evaluations of histochemically stained-collagen, we deemed it interesting to perform a comparative image analysis of three known histochemical techniques for collagen detection  in terms of sensitivity to reveal and quantify collagen deposition in paraffin colonic sections. In order to verify whether the staining properties of the dyes were independent from the histologic appearance of the sample, normal colonic tissues were compared to pathologic specimens obtained from the inflamed colon were examined. In normal colonic samples, the van Gieson technique stained collagen fibers only within the collagen  or collacollagen . Under on kidney  and colon kidney \u201323. Of nn kidney , for coln kidney , lung [2n kidney  and colon kidney ,34.In the present study, a comparative analysis of the collagen-staining capability by the above mentioned techniques was carried out also on the inflamed colon from DNBS-treated rats. The morphological analysis of colitis samples disclosed features compatible with inflammatory lesions with extensive mucosal and submucosal alterations and eosinophil infiltration . In thisWith regard for the detection of collagen in tissue sections, besides the conventional histochemical staining procedures, it must be acknowledged that immunohistochemistry allows a detailed phenotypic analysis of specific connective fibers and their distribution patterns. Nevertheless, multi-antibody immuno-labelling is affected by several disadvantages and pitfalls as compared to histochemistry, such as complex and long-lasting protocols, expensive reagents, and a marked variability in staining patterns of collagen fibers in assays with different commercially available antibodies .In conclusion, the present study provides evidence that histochemical staining carried out by Sirius Red combined with Fast Green represents an excellent method for standing out collagen fibers in paraffin sections of the colon, under both normal and inflammatory conditions, being a technique more sensitive than van Gieson or Sirius Red alone in terms of both morphological and quantitative evaluations."}
{"text": "The majority of infants\u2019 breastfeeding from their HIV-infected mothers do not acquire HIV-1 infection despite exposure to cell-free virus and cell-associated virus in HIV-infected breast milk. Paradoxically, exclusive breastfeeding regardless of the HIV status of the mother has led to a significant decrease in mother-to-child transmission (MTCT) compared with non-exclusive breastfeeding. Although it remains unclear how these HIV-exposed infants remain uninfected despite repeated and prolonged exposure to HIV-1, the low rate of transmission is suggestive of a multitude of protective, short-lived bioactive innate immune factors in breast milk. Indeed, recent studies of soluble factors in breast milk shed new light on mechanisms of neonatal HIV-1 protection. This review highlights the role and significance of innate immune factors in HIV-1 susceptibility and infection. Prevention of MTCT of HIV-1 is likely due to multiple factors, including innate immune factors such as lactoferrin and elafin among many others. In pursuing this field, our lab was the first to show that soluble toll-like receptor 2 (sTLR2) directly inhibits HIV infection, integration, and inflammation. More recently, we demonstrated that sTLR2 directly binds to selective HIV-1 proteins, including p17, gp41, and p24, leading to significantly reduced NF\u03baB activation, interleukin-8 production, CCR5 expression, and HIV infection in a dose-dependent manner. Thus, a clearer understanding of soluble milk-derived innate factors with known antiviral functions may provide new therapeutic insights to reduce vertical HIV-1 transmission and will have important implications for protection against HIV-1 infection at other mucosal sites. Furthermore, innate bioactive factors identified in human milk may serve not only in protecting infants against infections and inflammation but also the elderly; thus, opening the door for novel innate immune therapeutics to protect newborns, infants, adults, and the elderly. In addition to turition  dependinturition \u201324.The past decade has shown significant progress in the prevention of mother-to-child transmission (PMTCT) of HIV globally through improved access to ARV therapies for women and infants, as well as the universal promotion of exclusive breastfeeding (EBF) when safe and sustainable alternatives are not readily available. As a result of these prevention strategies, for the first time the elimination of MTCT of HIV is considered a realistic public health goal . For exaet al.  and cell-associated virus (CAV), it seems paradoxical that with prolonged and repeated exposure to HIV during EBF can significantly decrease postnatal MTCT of HIV compared with mixed feeding or non-exclusive breastfeeding (nEBF) \u201324. Thuset al.  showed t , mucin, and soluble toll-like receptor 2 (sTLR2) -SIGN-mediated transmission of HIV from DCs to activated CD4+ T cells  \u201344  . Specifi (sTLR2) , has beereceptor . Lactofereceptor , 48. Simreceptor , which ial entry . Another T cells .Another recently identified innate factor in breast milk is Tenascin-C (TNC), which has the capability to neutralize HIV-1 virions by binding to the chemokine co-receptor binding site on the HIV-1 envelope . Like lain vitro  indirectly inhibits HIV infection tachment . Howevertachment . Converstachment . Furthertachment , thus inOver the past decade, more than two million HIV-exposed uninfected (HEU) infants were born each year. In sub-Saharan Africa, HEU infants suffer up to four times increased risk of dying in the first 2\u2009years of life and increased risk for infectious morbidity . The etiet al. concluded that EBF of HIV-exposed infants decreased the likelihood of them falling ill to pneumonia  and high complexity in human milk. More than 200 different HMOs have been identified and are unique to human milk \u201371. TogeCampylobacter jejuni, which binds to \u03b11,2-fucosylatd glycan. Although recently contested  blood group antigens  and mature breast milk (105\u2013106/ml), and mammary epithelial cells (MECs). The majority of leukocytes in breast milk have an activated phenotype  in milk from full-term mothers , and both levels correlate with postpartum MTCT of HIV , 119. Imin vitro , 120\u2013123in vitro , 124. CAin vitro  and is sin vitro , thus inin vitro , 128, whin vitro , 130. Thet al. showed that at 6\u2009months, CFV was more heavily associated with HIV transmission. Up until 6\u2009months, however, the viral load levels were analogous  that recognize highly conserved pathogen-associated molecular patterns (PAMPs). They are part of the first line of defense against pathogen invasion and trigger innate immune responses and subsequent antigen-specific adaptive immunity. The 10 TLRs in humans recognize highly conserved molecules broadly shared and also expressed by pathogens, but not found in mammals, such as dsRNA, ssRNA, flagellin, CpG DNA, and LPS either intracellularly or extracellularly.et al.  from HIV-infected patients and in latently infected cells (et al. showed that a selected group of miRNAs, including miR-28, miR-125b, miR-150, miR223, and miR-382, bound to the 3\u2032 UTR of viral mRNAs and showed that activation of resting CD4+ T cells resulted in downregulation of these miRNAs, which correlated with enhanced HIV-1 susceptibility (MicroRNAs were shown to play a critical role in innate antiviral defense \u2013178. Thied cells . Interesed cells . These stibility . Furthertibility .Other modulators of anti-HIV-1 miRNAs include cytokines and TLR ligands. For example, stimulation of TLR3 was shown to induce an anti-HIV effect in primary macrophages, partially through upregulation of miR-28, miR-125b, miR-150, and miR-382 . More reThe majority of infants\u2019 breastfeeding from their HIV-infected mothers do not acquire HIV. Indeed, EBF has been one of the most successful interventions in protecting infants in resource-limited countries from a broad range of infectious diseases, including HIV. Although the reason for this remains unclear, coordination of a number of innate immune factors in breast milk seem crucial for providing protection when infants are most vulnerable. Identification and characterization of natural immune factors that protect susceptible individuals from acquiring HIV might facilitate the production of novel innate immunotherapeutics in the near future. Given that a number of innate factors have demonstrated anti-HIV activity, and ensuing decreased MTCT, it can be concluded that innate factors are indeed a viable option to pursue as protective therapies. In addition, other factors such as sTLR2 and IL-15 have shown promising results and should be pursued to further understand their mechanisms of binding and blocking HIV-1 MTCT.Human milk is a gold mine of uncharacterized, natural innate bioactive factors that have great promise to be developed and utilized for therapy or treatment of infections and inflammatory conditions in infants as well as adults and the elderly.KR initiated the review article, contributed to the design and conductance of the study, collection of relevant literature, and writing and editing of the manuscript. BH played a key role in design and conductance of the study. She performed experiments noted in the review, analysis of the data as well as contributing to the writing and editing of the review. Similarly, X-DY carried out much of the experimentation and bench research. She also made major contributions to analysis of the data and writing of the manuscript. Both BH and X-DY spent substantial time working on our projects in Kenya and South Africa. LN and AR were students who contributed to collecting, reading, and identifying relevant literature for the review. All authors contributed to editing the review. LN is now a resident physician at McMaster University Health Sciences Centre.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Ultraconserved noncoding elements (UCNEs) constitute less than 1 Mb of vertebrate genomes and are impervious to accumulating mutations. About 4000 UCNEs exist in vertebrate genomes, each at least 200 nucleotides in length, sharing greater than 95% sequence identity between human and chicken. Despite extreme sequence conservation over 400 million years of vertebrate evolution, we show both ordered interspecies and within-species interindividual variation in DNA methylation in these regions. Here, we surveyed UCNEs with high CpG density in 56 species finding half to be intermediately methylated and the remaining near 0% or 100%. Intermediately methylated UCNEs displayed a greater range of methylation between mouse tissues. In a human population, most UCNEs showed greater variation than the LINE1 transposon, a frequently used epigenetic biomarker. Global methylation was found to be inversely correlated to hydroxymethylation across 60 vertebrates. Within UCNEs, DNA methylation is flexible, conserved between related species, and relaxed from the underlying sequence selection pressure, while remaining heritable through speciation. Nucleotides(nt)Ultraconserved noncoding elements(UCNEs)Single nucleotide polymorphism(SNP)5\u2019 Cytosine DNA methylation(5mC)5\u2019 Cytosine DNA hydroxymethylation(5hmC)Ultraconserved noncoding elements (UCNEs) are an especially unusual feature of vertebrate genomes. Of the genome, 1.2% codes for proteins and the remaining 98.8% is noncoding sequence. Interspecies comparisons reveal that 8.2% of the human genome is constrained and conserved when compared across mammals . Their dHOXD gene. Over a 7\u00a0kb range, 30 UCNEs are dispersed upstream of HOXD, a gene that has been highly conserved over the course of vertebrate evolution .The database of ultraconserved noncoding elements and genomic regulatory blocks (UCNEbase) provided sequence and nomenclature for 4351 UCNEs used in this study [All 4351 UCNEs were downloaded as fasta sequence. GC content was calculated for UCNE group and compared to the 22 autosomes + XY of the human genome. CpG frequency was calculated using a custom Perl script, applied to all UCNE sequences, and also human coding regions (CDS), human introns, and human promoters defined as 1000\u00a0nt upstream of coding regions sourced from the UCSC knownGene table of genes using human genome build GRCh/hg38. CpG density is defined as number of CpG sites / length of sequence (or x100 = CpG sites per 100 bp). The single UCNE with highest CpG density, 12.4 per 100\u00a0bp (chr1_Aida) was removed from analysis upon discovery that it was misclassified as noncoding. All UCNEs, positions, and CpG density measures can be found in Table S2. T-tests and figures were generated in R version 3.3.3.Fifty-six species were selected for pyrosequencing analysis. DNA was standardized at 200 ng/\u03bcl and converted with a Zymo Research 96-well lightning DNA conversion kit according to manufacturer's instructions.All primers were designed using Qiagen Pyromark Assay Design software version 2.0 against the human derived sequence of each UCNE. Primers were optimized for PCR by using bisulfite converted mouse DNA and tested for single-band amplification across all species. The parameters for each reaction included a thermocycler protocol of 95\u00b0C for 30 seconds, the optimal temperature for 30 seconds, and 72\u00b0C for 30 seconds repeated for 35\u201340 cycles. Primer sequence, and conditions can be found in Table S1. Conservation values were derived from UCNEbase.PCR products were quantitated for DNA methylation level on a Qiagen Pyromark Q96 ID instrument. Controls consisted of a \u201cno template control\u201d (NTC) and two wells containing bisulfite converted 100% or 0% methylated control human DNA from EpiGentek. Some sites failed assessment in some species due to species-specific mutations preventing either PCR amplification or pyrosequencing. CpG methylation values from pyrosequencing were collated under criteria that the Pyromark software defined as \u2018check\u2019 or \u2018passing\u2019, with these values retained for analysis, and discarded if \u2018failed\u2019. For mouse tissues, UCNEs were run with 6 biological replicates, 3 males and 3 females. Results were averaged over all replicates, and split by sex. Position 3 in VRK1_Siddhartha failed uniformly in mouse and was removed. Pyrosequencing for the human LINE1 was also performed on the human samples using previously developed primers . We analMissing values as seen in http://timetree.org with branch lengths based on evolutionary time scales derived from multiple publications [Phylogenetic signal as measured by Pagel's lambda (\u03bb) was calculated using the average methylation value of all CpG sites per UCNE . The R cications ."}
{"text": "The relation between inflammation, hemostasis and arterial stiffness is of pathophysiological relevance for the development of cardiovascular disease (CVD). Data investigating this interplay using stiffness index (SI) by digital photoplethysmography are not available yet. Therefore, sex-specific relation between SI and inflammatory and hemostatic biomarkers was investigated within 13,724 subjects from the population-based Gutenberg Health Study. C-reactive protein (CRP), white blood cell count (WBCC), neopterin, interleukin-18, interleukin-1 receptor antagonist (IL-1RA), fibrinogen and hematocrit were measured. Multivariable linear regression analysis with adjustment for cardiovascular risk factors, medication, and hormonal status  revealed an independent association between SI and WBCC, IL-1RA and hematocrit in both sexes, and with fibrinogen in women. There was a joint effect of increasing tertiles of SI and biomarker concentrations for future CVD risk prediction. Subjects with both SI and biomarker concentration above the median had the worst overall survival and with both below the median the best survival during a follow-up period of 6.2\u2009\u00b1\u20091.7 years, except for hematocrit. The results support the relation between inflammation, hemostasis and arterial stiffness measured by digital photoplethysmography. Markers of inflammation and hemostasis modulate the ability of SI to identify subjects at risk for future CVD or higher mortality. Recently published studies implicated a role of inflammation in the development of hypertension3. It has been further suggested that inflammation might be related to the stiffening of arteries, a condition associated with a normal ageing process or with premature vascular ageing, which occurs in hypertension and numerous metabolic disorders. Possible mechanisms between inflammation and arterial stiffness (AS) might be related to changes within the vessel wall such as e.g. inflammatory cell infiltration or vascular dysfunction4. Furthermore, various pro-inflammatory mediators and markers of oxidative stress promote an increased production of matrix metalloproteinases with subsequent degeneration of compliant elastin fibers that, in turn lead to decreased arterial compliance6. Inflammation might also induce changes in the vascular smooth muscle phenotype with enhanced expression of osteoblasts, resulting in media calcification and subsequently stiffer arteries7.High blood pressure represents one of the potent cardiovascular risk (CV) factor and a leading cause of total and CV mortality17. Most of published data were based on the measurement of carotid-femoral pulse wave velocity (cf-PWV), a widely used method for determination of AS to date18. Another interesting approach for assessment of arterial function and AS in particular might represent stiffness index (SI) by digital photoplethysmography19, which might reflect systemic AS21, rather than providing similar to central PWV information. It represents easily performable and operator independent technique, which might be used in setting, where reliable simplicity of measurement is of relevance. So far, no study exists investigating a possible relationship between SI with markers of inflammation or hemostasis, neither in the general population nor among selected patient groups. Taking into account that SI was found to be markedly lower in females compared to males in our previous investigation22, we investigated such association sex-specifically in a large population-based Gutenberg Health Study (GHS).To date several studies investigated the relation of AS with markers of inflammation and hemostasis in apparently healthy individuals with controversial resultset al.23.) and consequently no calculable SI values. In those subjects, AS was rated as \u201cvery stiff\u201d. Within the remaining 12,650 subjects, SI was determined. The clinical characteristics of eligible subjects are summarized in Table\u00a0From the overall population sample n\u2009=\u200915,010), 1,286 individuals had missing values for SI due to logistical or technical constraints; the characteristics of these persons did not differ significantly from the sample investigated (data not shown). Therefore, assessment of AS was available in 13,724 subjects  in the present population-based sample was markedly higher among male than in female participants. Stiffness index was 1.7\u2009m/s higher in men compared to women.Subjects with very stiff vessels were markedly older than subjects with measureable SI, and presented a higher cardiovascular risk profile, being more obese and having more hypertension and diabetes. Moreover, they were at an approx. 3-fold higher risk for future fatal CVD events  SCORE) and had higher biomarker concentrations in both sexes except for hematocrit (Table\u00a0When biomarkers were stratified according to sex-specific tertiles\u00a0(T) of SI, all circulating markers increased with higher tertiles of SI in both sexes except white blood cell count (WBCC) in women Table\u00a0.Table 2BOverall, linear correlations between biomarkers and SI, however, were very modest; only weak correlations (r between 0.13 and 0.15) were found with fibrinogen in both sexes and interleukin-1 receptor antagonist (IL-1RA) in men and hematocrit in women  increase) and AS are shown in Table\u00a0Smoking, followed by hypertension were the main factors determining the \u201cbiomarker \u2013 risk factors\u201d associations, as demonstrated sex-specifically in Supplemental Tables\u00a0In the next step, the combination of both, biomarkers and SI was evaluated for cardiovascular risk assessment. Increasing values of SI and biomarker (both categorized in tertiles) demonstrated an additive effect on the 10-year risk for fatal MI or stroke according to the German version of the ESC-SCORE . During the follow-up period of 6.2\u2009\u00b1\u20091.7 years, a total of 511 deaths (332 men/179 women) occurred. Stiffness index was higher at baseline in subjects with an event compared to event-free individuals . Figure\u00a0For assessing the variation of the association between SI and inflammation according to the cardiovascular risk profile, the individuals from the GHS sample n\u2009=\u200913,724) were stratified in subjects free of CVRFs and manifest CVD , those with prevalent CVRFs and/or CVD \u00a0. Functionally, CRP was proposed to have effects that may influence initiation and progression of vascular disease, including mediation of vascular dysfunction, induction of a pro-thrombotic state and cytokine release, activation of the complement system and facilitation of extracellular matrix remodeling24. Though, epidemiological data on a cross-sectional relationship between CRP and measures of AS from the literature are controversial10. Remarkably, CRP was a strong predictor of PWV in a prospective setting within longer follow-up periods of 1611 or 2012 years, whereas the investigation with a shorter follow-up time14 revealed no meaningful relationship of CRP to stiffness measures. This rather suggests a long-term effect of inflammation on AS.C-reactive protein represents the best studied biomarker of cardiometabolic disorders so far26, demonstrated the strongest association with SI in all subsamples with measurable stiffness. It was the only marker associated with SI in the physiological state of presumably healthy males. Its important role as determinant of SI is not surprising, since AS is highly related to mechanical property of blood flow27. The fact that the well-known correlates of hematocrit such as male sex, smoking and blood pressure28 were also major determinants of SI in our previous analysis22, supports a possible synergistical effect of this \u201crisk marker - risk factor\u201d clustering.Hematocrit, a well-known predictor of future cardiovascular events28, the sex difference in this association is remarkable. It was found in females only and remained also after adjusting for hormonal influence, which possibly implies an important role of other conventional CVRFs in vascular stiffening among women. Current published data on the association between fibrinogen and AS are contradictory: no association between fibrinogen and PWV was reported from participants from the Framingham Offspring Study10, 429 apparently healthy middle-aged women15 or patients with end-stage renal disease16. In contrast, a positive association between increased fibrinogen concentrations and cf-PVW was found in 229 hypertensive and 159 age-matched normotensive individuals17.While the association between fibrinogen and SI found in the present analysis is expected, due to close relation between hematocrit and fibrinogen29. Increased IL-1RA concentrations at baseline were found to be associated with an increased risk for incident CVD and type 2 diabetes mellitus30. Only one study has evaluated the role of IL-1RA in decreased arterial compliance so far and identified IL-1RA as a strong predictor of aortic PWV over 16 years11. The non-inverse association between IL-1RA and SI supports the idea of understanding this marker as counter-regulated response to interleukin 1\u03b2 (IL-1\u03b2)-mediated pro-inflammatory stimuli30. Currently, IL-1\u03b2 represents one of the substantive upstream inflammatory cytokine and major target for immunomodulation, since its inhibition has already been linked to the reduction in IL-6, CRP and fibrinogen concentration in the high vascular risk patients31. Interestingly, although IL-1\u03b2 and IL-18 belong to the same IL-1 family of cytokines and shear similar regulation by NLRP3 inflammasome32 they seem have differential impact on vasculature within the present analysis. IL-18 is considered as a potent inducer of interferon-\u03b3 (INF-\u03b3) production, thereby resulting in the enhanced expression of matrix metalloproteinases, and subsequent degeneration of compliant elastin fibers34. Several differences in IL-1\u03b2 and IL-18 signaling have been already reported35, with a potent activation of nuclear factor-kappa B by IL-1\u03b2 and only weak or even null effects on it in case of IL-1836. In distinction, IL-18/IFN-\u03b3 effects are mediated mainly through activation of JAK-STAT pathway37. Moreover, to ensure adequate cell activation, IL-18 requires a co-stimulant (most commonly IL-12) as well as the much higher concentration than IL-1\u03b2, which, in contrast, is already active in the low picomol range35. Other potential mechanism for the observed discrepancies might include induction of cyclooxygenase-2 expression by IL-1\u03b2 with subsequent production of prostaglandin E235, as a key mediator of vascular remodeling and negative regulator of IFN-\u03b3-mediated response. On the contrary, neither cyclooxygenase-2 nor other acute phase proteins such as e.g. IL-6 could be sufficiently induced by IL-1835. Thus, one might speculate that other than IFN-\u03b3-mediated effects might be detrimental for the relationship between inflammation and AS. Further indirect confirmation of this represents a fact, that neopterin, as a protein releasing upon stimulation with IFN-\u03b3, was also not associated with SI in the current study. In addition to being a marker of IFN-\u03b3 inducible inflammation, neopterin possesses potent pro-oxidative properties that might be responsible for destabilization and vulnerability of the arterial wall37. Despite their hypothetical crucial role in AS, neither IL-18 nor neopterin presented as independent determinant of SI.IL-1RA was strongly positively related with SI in both sexes even after adjustment for traditional CVRFs and various medications within the present analysis. This naturally occurring anti-inflammatory antagonist of the interleukin-1 family of pro-inflammatory cytokines is currently also applied in the treatment of various inflammatory conditionsInterestingly, the patterns of association between circulating biomarkers and AS were varying from low to higher cardiovascular risk profiles  are not as widely available compared to the methods, assessing e.g. stiffness of the large arteries, such as carotid-femoral pulse wave velocity (cf-PWV). Finally, results may not be extrapolated to other populations, ethnicities or age groups.The strengths of this study are the investigated well-characterized, population-representative, large-scale cohort sample with sufficient enough power to assess associations sex-specifically. Various traditional CVRFs were carefully assessed by measurements and not based on self-reported data only, which minimizes a possible misclassification. In contrast to other studies, several inflammatory and hemostatic markers were analyzed simultaneously.The present analysis demonstrated a direct relationship of inflammation and hemostasis with SI measured by digital photoplethysmography, which was modulated by the extent of arterial stiffening. Simultaneous evaluation of biomarkers and SI improved the assessment of the risk for future CV events or mortality. The mediation of the relation between chronic low-grade inflammation and SI by smoking and arterial hypertension supports the idea of nonpharmacological (e.g. smoking cessation) or pharmacological  interventions for improvement of arterial compliance.38. Briefly, individuals between 35 and 74 years of age were randomly selected from the local registration offices. The sample was stratified 1:1 for sex and present residence  with equal strata for decades of age. Exclusion criteria were insufficient knowledge of the German language and physical or mental inability to participate in the examinations. Participation was voluntary and written informed consent was obtained from each subject upon entry into the study. The study conduct is performed according to the principles of good clinical practice and the principles outlined in the Declaration of Helsinki. The study protocol, study documents and sampling design were approved by the local ethics committee ) and the data safety commissioner of the University Medical Center of the Johannes Gutenberg University Mainz, as well as by the steering committee of the Gutenberg Health Study.The GHS is a population-based, prospective, observational, single-center cohort study, including residents of the City of Mainz and the County Mainz-Bingen from Western Germany. Details of the study design have been reported elsewhereThe present analysis is based on baseline data of 15,010 GHS-participants enrolled from April 2007 to April 2012. The outcome investigated in the present analysis was all-cause mortality. Death was ascertained by the respective entry in the registry office and the death certificate. For all 511 subjects (332 men/179 women), who died during follow-up complete information on all variables of interest was available.et al.23), AS was categorized as \u201cvery stiff\u201d . This method is based on digital photoplethysmography, which transmits an infrared light at 940\u2009nm through the finger with the amount of absorbed light being proportional to the volume of blood in the finger pulp. The plethysmography transducer, a non-invasive finger clip, was placed on the subject\u2019s ring (or fourth) finger and 10 pulses were recorded to produce a representative pulse waveform. This waveform consists of an early systolic and a second diastolic peak. The time difference between these two peaks  was used to calculate the SI, defined as the subjects height in meter divided by PPT in seconds , where appropriate. The circulating biomarkers were further stratified into tertiles and Mann-Whitney U-test was used to analyze group differences. Correlations between biomarkers and SI were assessed by Pearson correlation coefficients.40. Kaplan\u2013Meier survival analysis was performed to evaluate the combined effect of AS (SI or presence of very stiff vessels) and biomarkers on all-cause mortality. Differences in Kaplan\u2013Meier mortality curves were assessed using the log-rank test.Linear regression analysis was performed to assess the relationship between SI and biomarkers (per one SD increase) with a logarithmic transformation of skewed variables in the model . The basic model was adjusted for age; further analyses were adjusted for traditional CVRFs such as systolic/diastolic BP, obesity, dyslipidemia, smoking, diabetes and family history of myocardial infarction (MI) or stroke and blood-pressure lowering medication  codes: C02, C03, C07, C08, C09), and additionally (in Model 3) for statin intake, antiplatelet therapy, and in females for menopausal status, and intake of oral contraceptives (OC) or hormone replacement therapy (HRT). Results are reported as \u03b2-estimates with 95% confidence intervals (CIs). Absolute and relative differences in \u03b2-estimates between crude and CVRFs-adjusted model were determined to evaluate the impact of CVRFs on \u201cSI-biomarker\u201d association. The potential additive effect of SI and biomarkers on the 10-year CVD risk was evaluated for the German version of the ESC SCORE and the updated Framingham risk scoreFinally, to evaluate the association between SI and biomarkers in dependence on cardiovascular risk, the study sample was stratified into three subgroups: Individuals without CVRF and established CVD , congestive heart failure (CHF) or stroke)  served as group with low risk; individuals with CVRFs and/or CVD  as group with intermediate risk and subjects with very stiff vessels as an equivalent of a cardiovascular high risk group . In subjects with very stiff vessels, multivariable logistic regression was applied (dependent variable was treated dichotomously as very stiff versus measurable SI). Results are reported as \u03b2-estimates or odds ratio (OR) with 95% CIs, where appropriate.http://www.r-project.org).Because of the explorative character of the analysis, a significance threshold was not defined for p-values. P values should be interpreted as a continuous measure of statistical evidence. All statistical analyses were performed using R version 3.14.2 software (Supplementary file"}
{"text": "The infiltration of Tbet+ Foxp3+ Tregs was strongly correlated with a concomitant tumor-specific and conventional type 1-oriented intratumoral T cell infiltrate. Both conventional CD4+CD25+CD127\u2013Foxp3hi Tregs and their Tbethi counterparts exhibited an activated phenotype, co-expressed high levels of CTLA4 and Helios and exhibited a maximally demethylated Foxp3 gene locus TSDR, indicating their full capacity to impede a type 1 effector T cell response. Interestingly, while the prognostic value of conventional Tregs was neutral, a high intratumoral frequency of Tbet+ Tregs was associated with prolonged disease-specific survival, most likely because their presence reflected high numbers of effector T cells. The presence of these Tbet+ Tregs may in part explain why a dense type 1-oriented immune infiltrate in OPSCC is not enough to fully control tumor growth.Regulatory T cells (Tregs) may comprise different subsets allowing them to efficiently suppress different types of effector T cells. In this study, we show that high numbers of both conventional and Tbet co-expressing Foxp3The online version of this article (10.1186/s40425-019-0497-0) contains supplementary material, which is available to authorized users. Foxp3+ regulatory T cells (Tregs) are pivotal in suppressing pathological and physiological immune responses . In cancRecent studies have shown that Tregs can adopt different transcriptional profiles allowing them to regulate specific types of effector T cells . In miceSince many head and neck cancers can be infiltrated with type 1-oriented T cells , we hypoThe authors acknowledge the reporting of Minimal Information About T-cell Assays (MIATA).ink4a IHC staining was performed on formalin-fixed paraffin-embedded (FFPE) tumor sections as described -thymidine-based proliferation assay and antigen-specific cytokine production assay as described previously . To thisAntigen-specific cytokine production was determined by cytometric bead array  according to the manufacturer\u2019s instructions. The cutoff value for cytokine production was 20\u2009pg/ml, except for IFN\u03b3 for which it was 100\u2009pg/ml. Positive cytokine production was defined as at least twice above that of the unstimulated cells. An example of such an HPV16-specific T cell reactivity test is depicted in Additional\u00a0file\u00a0Cryopreserved PBMC and/or single cell tumor samples were thawed and Treg subsets were assessed by flow cytometry as described before . Antibodsnapgene.com). Methylated CpGs were identified by the presence of a C nucleotide at the CpG position whereas demethylated CpGs were identified by a T nucleotide. The percentage of clones showing methylation at each individual CpG as well as the total average of all CpGs per population per patient was determined.Sorted Foxp3\u2013 Tconv, Foxp3+Tbet+ Treg and Foxp3+Tbet\u2013 Treg cells  were digested with Proteinase K for 4\u2009h at 50\u2009\u00b0C to obtain genomic DNA, followed by Bisulfite Conversion using the EZ DNA Methylation-Direct Kit (Zymo Research) according to the manufacturer. The Foxp3 Treg specific demethylation region (TSDR) was amplified  using pt tests were performed when appropriate. Correlation analysis were done the using Pearson\u2019s correlation test. For survival analysis, patients were grouped into two groups according to the median , after which survival was tested using Kaplan\u2013Meier method, and statistical significance of the survival distribution was analyzed by log-rank testing. All statistical tests were performed at the 0.05 significance level, and differences were considered significant when p\u2009<\u20090.05, as indicated with an asterisk . Statistical analyses were performed using GraphPad Prism 7.1 .Non-parametric Wilcoxon signed-rank or Mann\u2013Whitney tests and parametric paired or unpaired p\u2009<\u20090.0001 for all subsets). Furthermore, the numbers of stromal and intraepithelial CD8\u2013Foxp3\u2013Tbet+ (CD4), CD8+Foxp3\u2013Tbet+ and in particular CD8\u2013Foxp3+Tbet+ Treg cells were significantly correlated. This was not the case for the conventional Tregs, which were more often found in the tumor stroma  profile, and expressed high levels of the Treg-associated markers CTLA-4 and Helios. Notably, the TbethiFoxp3hi Tregs expressed higher levels of helios, CTLA-4 and Ki67 than the Tbet\u2013 Foxp3+ Tregs  but also in the Foxp3hiTbethi cells  [hiTbethi Tregs specifically accumulated in CxCa tissue and these Tregs also displayed a hypomethylated TDSR locus. Although only three out of seven CxCa tumors were HPV16-driven, a similar association between the higher levels of Foxp3hiTbethi Tregs and the detection of an HPV16-specific immune response was found  , seven fund Fig. .Fig. 4FohiTbethi cells accumulate specifically in tumors with an ongoing type 1 immune response and based on the hypomethylation of all 15 CpG islands in the TDSR region of the Foxp3 intron 1 in these T cells sorted from 3 different patients, are true regulatory T cells.Thus, Foxp3hi regulatory T cell clone 148.31, isolated from an HPV16+ cervical cancer patient with an ongoing local type 1 immune response, and for which we have shown its suppressive capacity in several different in vitro assays [Last but not least, we analyzed the expression of Tbet in CD4+Foxp3o assays . This clhi and Tbet- Tregs infiltrated OPSCC, the prognostic value of both types of Tregs in our OPSCC patient cohort was analyzed. This revealed that the total population of CD8\u2013Foxp3+ Tregs was significantly associated with improved survival Additional File 2:Figure S1. HPV16 E6/E7 specific T cell reactivity testing. Figure S2. Conventional (Tbet\u2013) and Tbet+Foxp3+ Tregs can be found in tumor and stroma of OPSCC samples. Figure S3. The correlation between the number of CD8\u2013Foxp3\u2009+\u2009Tbet+ Tregs and CD8\u2013Foxp3\u2013Tbet+ (CD4) T cells and CD8\u2009+\u2009Foxp3\u2013Tbet+ T cells is retained in IR- and IR+ OPSCC tumors. Figure S4. Gating strategy for Treg subpopulations. Figure S5. TbethiFoxp3+ Tregs express higher levels of helios, CTLA4 and Ki67. Figure S6. The levels of tumor-infiltrating Foxp3hiTbethi Tregs correlated with the levels of infiltrating CD4\u2009+\u2009Tbet+ and CD8\u2009+\u2009Tbet+ cells, as well as with levels of highly activated infiltrating CD4+ and CD8+ T cells. Figure S7. Sorting of Tregs. (PPTX3379 kb)"}
{"text": "Silver nanowires (AgNWs) have inspired many research interests due to their better properties in optical, electric, and flexible applications. One such exploitable use is as the electrical conductive fillers for print electronics. In this paper, AgNWs with mean a diameter of 80 nm and mean length of 13.49 \u03bcm were synthesized using the polyol solvothermal method. A sonication-induced scission process was used to obtain AgNWs with a length range of 7.64\u201311.21 \u03bcm. Further AgNWs inks were prepared with the as-synthesized AgNWs as conductive fillers in anhydrous ethanol. The conductive inks were coated on resin coated photographic paper substrate using the knife coating process and dried at room temperature. The effects of the number of layers of AgNWs coating, the concentration of AgNWs, and the length of AgNWs on the microstructure and electrical properties of samples were investigated by scanning electron microscopy and using the four-point probe method. The results show that the conductivity of the AgNWs coating increases with the increase in the number of layers in the AgNWs coating, concentration and length of the AgNWs.  Paper-based electronic devices have been judged by researchers to hold great promise as an environmentally friendly substrate for flexible electronics due to their inexpensive and common availability worldwide for information storage and packaging ,2,3. In With the development of flexible electronics, AgNWs have stimulated wide attention due to their unique physical and chemical properties, such as excellent electrical and thermal conductivity, malleability, and chemical stability ,10,11,12The properties of silver nanostructures are closely related to morphology and size of AgNWs ,18,19,20To realize the marketization and scale of flexible electronics, it is necessary to improve the manufacturing technology of flexible circuits. Conductive inks are the key to achieve flexible circuits. The conductive inks are coated on flexible substrates, such as fabric, paper, Polyethylene terephthalate (PET) and polyimide (PI) by silkscreen printing, inkjet printing, spraying, screen, knife-over-edge, spray coating, gravure, and slot die, to make flexible conductive pathways or transparent conductive films, which are then applied to flexible electronic products ,3,4,5,29Herein, we prepared AgNWs and obtained AgNWs with the different lengths by the sonication-induced scission method, and further the AgNWs inks were prepared with as-synthesized AgNWs as conductive fillers in anhydrous ethanol. The inks were printed on photographic paper substrate and the effects of the number of AgNWs coating and concentration and size of AgNWs on the microstructure and electrical properties of samples sintered at room temperature were discussed.Silver nitrate (\u2265 99.8%) was purchased from Guangdong Guanghua Chemical Reagent Co., Ltd. Guangdong, China; poly(vinylprrolidone)  was purchased from Guoyao Group Chemical Reagent Co., Ltd., Shanghai, China; ferric chloride hexahydrat (\u2265 99.5%) was purchased from Chengdu Kelong Chemical Co., Ltd., Chengdu, China; ethylene glycol EG, \u2265 99.7%) and ethanol absolute (\u2265 99.7%) were purchased from Tianjin Yongda Chemical Co., Ltd. Tianjin, China; resin coated (RC) photographic papers were purchased from Oracle Technology Co., Ltd. Shenzhen, China. All the chemicals were used as received.3 (0.3 mmol\u00b7L\u22121) was dissolved in 40 mL EG (0.17 mol\u00b7L\u22121) PVP and AgNO3 (0.1 mol\u00b7L\u22121) were dissolved into 40 mL of EG in turn. Then FeCl3-EG solution was dropped into the mixed solution of PVP and AgNO3 with a syringe. Please note that the mixed solution was not stirred during the dropping process, and was immediately transferred the into the reaction kettle after the completion of dropping. The reaction kettle was placed in an oven at 160 \u00b0C for 3 h. After the completion of reaction, the sample was removed and cooled down to room temperature. Then, acetone and ethanol were used to wash the product. Each washing process was repeated 3 times to remove the extra solvent and chemical agents (PVP and other reactants). The AgNWs were re-dispersed in ethanol absolute.AgNWs were grown via polyol solvothermal method. FeCl\u22121 AgNWs solution was put into the beaker filled anhydrous ethanol and sequentially underwent ultrasonication for 1\u20135 h at a power of 120 W. The ultrasonication was carried out with a bath type sonicator . AgNWs inks were prepared with as-synthesized AgNWs as conductive fillers in anhydrous ethanol. The stability of the dispersion of AgNWs inks was not good enough. AgNWs settled after being kept at room temperature for 7\u201315 days or so. However, AgNWs inks have good redispersibility which is usually achieved by ultrasonic stirring.For ultrasonication treatment, 10.80 mg\u00b7mLThe inks were coated on photographic paper substrate using the knife coating process. The effects of the number of layers of AgNW coating, the concentration of AgNW ink, and the length of AgNWs on the microstructures and electrical properties of samples dried at room temperature were investigated. A scanning electron microscope  was used to characterize the microstructure of AgNWs. The lengths of individual silver nanowires in the images were measured manually according to an image processing software . X-ray diffraction  was used to measure the phase structures. The sheet resistance of the AgNW film was measured using a 4-point probe instrument ST2253 .g of the (111) plane. The equation is as follows:\u03b1 = 4.0837 \u00c5, which is close to the reported date of \u03b1= 4.0862 \u00c5, JCPDS file 04-0783 . It indiSonication is widely applied to disperse materials in liquid media due to the ultrahigh shear rate attained during cavitation events ,31,32. HWith RC photographic paper as a substrate, the AgNWs coating was prepared by the knife coating process and heat treated at the room temperature. Schematic diagram for the steps applied to fabricate AgNW coating on the photographic paper by knife coating process was shown in \u22121) were dropped and knife coated the surface of RC photographic paper and dried at the room temperature for 15 min. \u22121. When the length of AgNWs is 7.64 \u03bcm, the sheet resistance is 196.4 \u03a9\u00b7sq\u22121. The sheet resistance increases by 12.5 times. At the conditions of the same concentration and diameter, the shorter the AgNWs are, the more AgNWs there are. Not surprisingly, the contact resistance among the AgNWs at the same coverage area increases with the increase in the number of AgNWs, leading to a sheet resistance increase.As we all know, the properties of AgNW coating are strongly dependent on the morphology, size and distribution of AgNWs on the substrate ,13,14,15\u22121. \u22121, respectively. When the layers of coating increased to six the sheet resistance of AgNW coating reduced to 0.45 \u03a9\u00b7sq\u22121. After that, the sheet resistance of AgNWs coating slightly decreased when coating layers were increased to seven. The formation of electrical conduction paths in AgNW coating is considered to contact among the AgNWs. The contact resistance at the interfaces between AgNWs is considered to be strongly influenced by the contact area. The more AgNWs, the more conductive paths are easily formed, which promotes conductivity. However, when the conductive paths in the coating are well formed, the increase of the number of AgNWs coating layers only slightly reduces contact resistance [Once the effect of the length of AgNWs on the conductivity of the coating is understood, it is necessary to study the effect of the deposition density of the AgNWs on the conductivity of coating. In order to ascertain the deposition density of the AgNWs dependence, we fabricated the AgNWs (13.49 \u03bcm) coatings with different layers. To prepare for multi-layer coating, each sample coated layer is put at room temperature for 15 min, and then coated with the next layer. The concentration of AgNW ink (0.1 mL) is 10.80 mg\u00b7mLsistance ,17. As tIn order to further analysis of the effect of the number of coating layer on the sheet resistance of AgNWs coating, we observed the microstructures of the samples, as shown in \u22121) and four coating layers, dried at room temperature for 15 min, as shown in \u22121, the sheet resistance of AgNW coating is 0.77 \u03a9\u00b7sq\u22121, which is close to that of the sample prepared with 10.80 mg\u00b7mL\u22121 AgNWs ink and six coating layers (\u22121, the sheet resistance of AgNW coating increases to 334.90 \u03a9\u00b7sq\u22121. The more AgNWs that are are added to a coating achieved percolation, the more effective conductive paths are formed, therefore the conductivity of the AgNWs coating will be improved [In order to analyze of the effect of the number of AgNWs on the conductivity of the coating, we prepared the coatings with different AgNW ink concentrations (13.20, 10.80, 8.70, 6.51. 4.32, and 2.65 mg\u00b7mLg layers . It is iimproved ,17,18. \u22121, respectively. It is clear that with the increase of concentration of AgNW ink, the thickness of coatings also increases.The microstructures of AgNW coating with different concentrations, as shown in As discussed above, the AgNW inks are viable in the application of the flexible devices. Here, the potential application of the AgNWs ink by fabricating an LED device on the AgNW electrodes was measured . One 0.5\u22121. When the length of AgNWs reduces to 7.64 \u03bcm, the sheet resistance increases to 196.4 \u03a9\u00b7sq\u22121. The sheet resistance increases by 12.5 times. When the concentration of AgNW ink is 13.20 mg\u00b7mL\u22121, the sheet resistance of AgNW coating with four layers is 0.77 \u03a9\u00b7sq\u22121, which is close to that of the sample that was prepared with 10.80 mg\u00b7mL\u22121 AgNW ink and six coating layers.AgNWs with a mean diameter of 80 nm and mean length of 13.49 \u03bcm were synthesized using the polyol solvothermal method. Then sonication-induced scission process was used to obtain AgNWs with a length range of 7.64\u201311.21 \u03bcm, and further the AgNWs inks were prepared with as-synthesized silver nanowires as conductive fillers in anhydrous ethanol. The conductive inks were coated on photographic paper substrate using the knife coating process and dried at room temperature for 15 min. We demonstrate that the conductivity and densification of AgNW coating increases with the increase in the number of AgNW coating layers, concentration and length of the AgNWs. When the length of AgNWs is 13.49 \u03bcm, the sheet resistance is 15.68 \u03a9\u00b7sq"}
{"text": "Growth in nanocoatings technology is moving towards implementing nanocoatings in many sectors of the industry due to their excellent abilities. Nanocoatings offer numerous advantages, including surface hardness, adhesive strength, long-term and/or high-temperature corrosion resistance, the enhancement of tribological properties, etc. In addition, nanocoatings can be applied in thinner and smoother thickness, which allows flexibility in equipment design, improved efficiency, lower fuel economy, lower carbon footprints, and lower maintenance and operating costs. Nanocoatings are utilised efficiently to reduce the effect of a corrosive environment. A nanocoating is a coating that either has constituents in the nanoscale, or is composed of layers that are less than 100 nm. The fine sizes of nanomaterials and the high density of their ground boundaries enable good adhesion and an excellent physical coverage of the coated surface. Yet, such fine properties might form active sites for corrosion attack. This paper reviews the corrosion behaviour of metallic, ceramic, and nanocomposite coatings on the surface of metallic substrates. It summarises the factors affecting the corrosion of these substrates, as well as the conditions where such coatings provided required protection. Corrosion is one of the major research areas that has been attracting the attention of researchers for over 150 years, since it is recognised as a problem causing degradation, failure, and serious accidents and hazards in many industrial processes and domestic systems . CorrosiCorrosion is a natural process that causes the dissolution of a material in the presence of aggressive environments. The most important factors that affect the occurrence of corrosion depend on the material and the environmental conditions. The material corrodes if it is active or adjacent to a nobler material in the galvanic series, which causes the dissolution of the first one. Specific environmental conditions make the material susceptible to corrosion, such as dissolved gases (mainly oxygen and carbon dioxide), temperature, pH, tensile stresses, and cyclic 2 stresses. Corrosion can happen in different forms, depending on the mechanism of corrosion. These can include: uniform, galvanic, crevice, pitting, environmentally-induced cracking, intergranular, dealloying, and erosion corrosion. Uniform corrosion is the form with the most incidences, and the highest tonnage of metal waste. While the others are localised corrosion, and might not consume a lot of material, they are difficult to predict and control, and might undertake an early unnoticeable failure . Unless Material selection, where the material is either relatively unreactive in the galvanic series or can form a protective oxide layer (passivate) in a particular environment; (b) Adjusting the environment conditions, such as the addition of inhibitors [Surface modifications, which is achieved by applying physical barriers such as films and coatings to reduce crevices and cracks [Cathodic protection, where the corrosion current is suppressed and is forced to flow to the metal to be protected. It is achieved by using a power source or attaching a more active (anodic) material to the structure to be protected [Corrosion prevention is performed through different techniques, and choosing the right one should be done while optimising between process cost, process performance, and corrosion effects. Corrosion can be prevented by: (a) hibitors ,9, adjushibitors , oxygen,hibitors , lowerind cracks ,13; (d) rotected . Each prCoating is the most widely used method for preventing, minimising, or controlling corrosion due to an available and possible variety of coating materials and coating processes for different conditions and applications. Coating, either of inner or outer surfaces, can be applied within different temperature ranges; it even provides an additional gain of smoother surfaces that enhances the efficiency of the interface and flow on surfaces . ApplyinRecently, nanomaterials have been introduced as an effective technique to reduce corrosion. Nanomaterials are materials that have at least one of their morphological features such as grain size, particle size, structure size, etc., in the nanoscale (less than 100 nm) . They caA nanocoating is an ultrafine microstructure where all of the constituents  are on the scale of less than 100 nm. These coatings can also be built up by layers that are thinner than 100 nm ,24. TheyNanocoating has one component that is in the nanoscale. Due to the very fine sizes of the particles used in this nanocoating, filling the spaces and blocking the corrosive elements from diffusing into the surface of the substrate will be more efficient. In addition, the high density of the nanocoatings\u2019 grain boundaries provides better adhesion properties, which will increase the lifetime of the coating . NanocoaDue to the extraordinary properties that the nanocoating possess, they are used in everyday practise such as clothing, computers, cell phones, eyeglasses, etc. In the building field, they are used in tiles, windows, flooring, walls, paints, air filters, etc. The utilisation of the nanolayer in these appliances makes them flame-retardant, wear and scratch resistant, anti-graffiti, corrosion resistant, self-cleaning, and electrically conductive. They also have good adherence, optical clarity, anti-fogging and anti-fouling properties, and are suitable as a photovoltaic material ,34,35. INanocoatings can be obtained by three general deposition methods, as shown in Each of the above-mentioned techniques of thin film deposition on the surface of the substrate affect the uniformity and surface properties such as strength, fracture toughness, and ductility . Each teNanocoatings might not function as protective surfaces in some circumstances. A nanocoating is an effective physical barrier at high-temperature applications, as the high density of their grain boundaries provide fast diffusion paths of passivated ions and better adhesion of the protective oxide layer to the substrate\u2019s surface . Yet, thUp until now, the wear/scratch resistance and corrosion behaviour of nanocoated surfaces is still under investigation; more research needs to be performed in this area. According to statistics from a ScienceDirect Journal search, research on the corrosion of nanocoatings started to gain more interest in 1998. Since then, the published papers related to nanocoating and corrosion have been increasing, but in a limited trend, as the maximum number of papers that have been published that are related to this field is around 2500 papers, as In the current paper, the corrosion behaviour of different nanocoatings is introduced by presenting some corrosion testing conducted on these nanocoatings under specific conditions. Each test can measure some corrosion parameters and help with understanding the corrosion mechanism for the tested sample. Immersion tests measure the weight loss of an immersed coupon after being exposed to aqueous solution for a certain time. It is intended to be used for long-term examinations and whenever uniform corrosion mechanism is expected to occur . On the The corrosion rate can be represented by the penetration rate, which is the thickness loss of the material per unit of time. The corrosion rate can be expressed by different units such as mpy , mm/yr, \u00b5m/yr, etc. For typical ferrous and nickel alloys, the relative corrosion resistance of a metal can be categorised according to the corrosion rate value as follows ; outstanding corrosion resistance (<0.02), excellent (0.02\u20130.1), good (0.1\u20130.5), fair (0.5\u20131), poor (1\u20135), and unacceptable (5+). Rates greater than 5 mpy to 200 mpy are usually excessive for more expensive alloys, while rates above 200 mpy are sometimes acceptable for cheaper materials  of a thicker cross-section . The corrosion behaviour of nanocoatings is affected by different factors such as the environment, the substrate, the nanocoating composition, etc. The following sections discuss these factors in detail for different kinds of nanocoatings that were categorised according to the nanocoating material: metallic, ceramic, and nanocomposite coatings. At the end, some conclusions and recommendation for future work to be done in this area are presented. Metallic nanocoating includes one or more of the pure metals such as Cadmium (Cd), Nickel (Ni), Tungsten (W), Zinc (Zn), Phosphorous (P), Cobalt (Co), Iron (Fe), Cupper (Cu), etc. Nanocoating can be of a pure metal ,42,43, oThe corrosion behaviour of metallic nanocoatings involves different factors, which contribute in an individual or combined effect. The most influential factors are introduced in the below section. Introducing metals in the nanocoating improves their physical , chemicaAlloyed metal provides superior properties compared to pure metal, even at the nanoscale. An nanocrystalline Ni\u2013W alloy has better hardness and scratch resistance compared to pure nanocrystalline W . Alloyinf) is higher for a higher P content . However, measured double-layer capacitance (Qdl) and coating capacitance (Qcoat) obtained from Bode plots   and 17.6de plots b,c,e, fosolution . The corrosion rate of the pulse\u2013current electrodeposition of nanocrystalline zinc was 60% lower than the microcrystalline electrogalvanised steel samples (EG) when tested in NaOH solution. Examinations showed a complete coverage of the nanocrystalline zinc protective film, which was attributed to the nanocrystalline structure, and enhanced both the kinetics of passivation and the stability of the passive film . Other rThis was not in agreement with the work of Aledresse and Alfantazi, which showed a better corrosion resistance of nanocrystalline cobalt (67 nm) over polycrystalline cobalt (100 \u00b5m) in alkaline media, but a higher corrosion current density. This indicates that finer grain sizes of the coating might provide defect sites at the grain boundaries and triple junctions, which makes the corrosion easier to initiate at these active sites. Nanocrystalline structures have a higher volume fraction of the intercrystalline constituents\u2014more than the polycrystalline structure\u2014and thus more active sites are available in the nanocrystalline structure . The effect of grain size was further studied for different sizes among the nanoscale. A lower or higher nanograin size of the nanomaterial is not necessarily to achieve the same effect in terms of corrosion protection, as a finer nanograin size did not had the best corrosion resistance in all of the research work. The same results of better enhancement with the increase of nanograin size was obtained by Meng et al. A bigger value of impedance and of the phase value for Q235 steel coating was observed with grain size of 50 nm compared to that of 10 nm b,c. This2 produced the lowest size of agglomerated particles, which was tested to produce good corrosion behaviour  towards more positive values compared to the steel that was only coated with CrN [On the other hand, depositing a protective nanocoating through the atomic layer deposition (ALD) method provides the advantage of having a full shield over the surface of the substrate without any pinholes or cracks compared to other depositing methods such as spray pyrolysis, chemical vapour deposition, physical vapour deposition, etc. This was due to the formation of an amorphous phase of deposited nanoparticles that produced dense and conformal films with the precise control of thickness and composition when coated by the ALD method . The samwith CrN . Althougwith CrN . 2 nanoparticles achieved an enhancement in the corrosion resistance of nano TiO2-coated carbon steel in H2SO4 solution [The corrosion protection of titania nanocoating was examined to improve coating performance by monitoring the media, size of the particles and thickness of the nanofilm. Decreasing the pH or increasing the NaCl concentration of the test environment, shifted the corrosion potential towards the more cathodic values of the coated steel . A reducsolution . Modifyisolution . Alumina thin films have unique mechanical properties and corrosion resistance; as a result, they have been implemented in many industrial fields such as surface passivation , gas difThe preparation method of alumina nanocoating was investigated for its effect on the corrosion properties of nanocoating. Ruhi et al. reported a better corrosion resistance of 9Cr-1Mo ferric steel coated with nanostructured sol-gel alumina nanocoating compared to the uncoated steel in an NaCl solution . A plasm2O3 is stable under neutral conditions, according to the Pourbaix diagram. ALD-coated substrate corroded under higher temperatures due to the type of substrate, since carbon steel caused a reduction of oxygen and introduced OH\u2013 ions, which increased the pH and initiated the dissolution of the oxide layer [The ALD method has the advantage of obtaining a controlled, smooth, and equally-coated surface. The deposition temperature with this method can be achieved at temperatures from room temperature to 500 \u00b0C. High-resolution TEM (HRTEM) images and polarisation tests showed that the best quality films in terms of density and purity are obtained when prepared under higher temperatures of 300 \u00b0C, as shown in de layer . 2-Ar plasma, which has 50 nm of Al2O3 deposited by either the thermal or plasma-enhanced ALD method, will increase the corrosion resistance as well. Such treatment increases the adhesion and reduces the porosity of the coated surface [The pre-treatment process affects the structure and the topography of the substrate, and can be performed to enhance the properties of the substrate, but it might have an adverse effect as well. The pre-treatment of carbon steel with H surface . Pre-ann surface . 2O5) is a refractory metal that exhibits attractive physical, structural, optical, and electrical properties such as high dielectric strength [Pentoxide  is another ceramic that exhibited a decrease in the corrosion resistance with the increase in acidity and temperature [Research works related to pentoxide nanocoating showed enhancement in corrosion properties. Coated Ti-6Al-4V alloy with \u03b2-Ta4V alloy . Carbon 4V alloy . Diaz et4V alloy . Moreoveperature . 2) has many applications in different fields due to its promising physical and chemical properties such as low friction coefficient, high melting point, high chemical stability, high refractive index, and dielectric constant [Zirconia  over copper films (25-\u00b5m thickness), the corrosion rates of copper in an aerated Nae nickel .Nanosized hydroxyapatite (n-HA) has been deposited on orthopaedic implant material  and characterised for its corrosion resistance in Hank solution. During corrosion testing, for n-HA coated titanium alloys, the initial open circuit potential (OCP) continued to increase until the protective air\u2013oxide film reached its protective capacity. This shows that n-HA coated titanium alloys are robust towards corrosion resistance .Nanocomposite coating is a material composed of at least two immiscible phases, which are separated by an interface region. The main component in nanocomposite coating is the matrix, in which the filler is dispersed . The matCommon nanocomposites that are used for coating are matrix-reinforced. Polymer and metallic matrices nanocomposite coatings will be discussed in the following sections. Their corrosion behaviour will be the major concern, as well as how the enhancement in different properties will affect it. In the polymer nanocomposite field, a conductive polymer nanocomposite where the host matrix used is a conductive polymer will be discussed for its importance and huge potentials in different applications. In addition, a recent type of polymer nanocomposite coating, which is waterborne, will be studied for its corrosion behaviour. In the metallic/ceramic nanocomposite section, an electroless Ni nanocomposite will be briefly discussed due to its improved characteristics over the conventional electrodeposited techniques. At the end, Polymer nanocomposite coatings have evoked a great deal of interest in the corrosion protection applications due to the extraordinary properties that they can offer. With polymers used as host matrices in various composite films, nanomaterials are incorporated in the polymer matrix as a filler or pigment. When fillers are embedded into a polymer, the resulted hybrid organic\u2013inorganic material is known as a polymer nanocomposite ,117. Usually, nanofillers are incorporated in the polymer matrix in order to increase the stiffness, strength, conductivity, and thermal resistance; they also reduce the thermal expansion, permeability, solvent attack, flammability, and fouling, and retain elongation, transparency, density, processability, cost, and chemical resistance ,120,121.Processing polymer nanocomposites is critical. Depending on the synthesis process, we may end up with either a perfect dispersion of nanofiller in the polymer matrix or with an agglomerated nanocomposite. The perfect dispersion and distribution of nanofillers in the matrix reflect the best possible enhancement in the properties. Several chemical processes are used to mix a polymer matrix with solid nanoparticles such as in situ polymerisation, emulsion polymerisation, solution intercalation, and melt intercalation ,125,126.2O3 [2 [2O3 nanoparticles were blended into the polymer, the mechanical properties were strengthened while sustaining the corrosion resistance of the polymer itself. The potentiodynamic test results in In the literature for polymer nanocomposites that coat the surface of stainless steel, different fillers are used to incorporate with polymers. MWCNT , Al2O3 [2O3 , graphen2O3 , ZrO [122O3 , and SiO2O3 [2  were add2O3 [2 . When AlAnother property that can be enhanced by the addition of nanofillers is hydrophobicity, which can return an enhancement in corrosion resistance. The introduction of GA and oleic acid (OA) to the chitosan to produce the nanocomposite coating of CS/GO-OA (oleic acid-grafted chitosan/graphene oxide), improved the corrosion protection over carbon steel in an NaCl solution. The large alkyl group of the OA resulted in the higher hydrophobicity of the coating\u2019s surface, as it is revealed by the higher surface contact angle with the water that is shown in 2/EP) was prepared and then coated over a steel sheet, as shown in 2 in the EP using FE-SEM images showed the absence of clusters\u2019 aggregation. In addition, the results showed an improvement in the adhesion strength of the interface between the coating and the metal substrate when GO and ZrO2 were incorporated with the EP. When tested for corrosion resistance in NaCl solution using EIS, the hybrid coating (GO\u2013ZrO2/EP) showed the highest resistance compared to EP, GO/EP, and ZrO2/EP coatings. The combination of the GO\u2013ZrO2 provided a physical barrier to obstruct electrolyte permeation, since they have a 2D sheet structure, high aspect ratio, and uniform dispersion and exfoliation within the EP matrix [A hybrid nanocomposite coating of graphene oxide\u2013zirconia dioxide/epoxy  nanocomposite loading in alkyd resin, together with the increase in the impact strength of the nanocomposite polymer (PANI) [2/Graphene oxide (TiO2/GO) showed better stability in seawater than the polymeric nanocomposite coating of polyvinyl alcohol/polyaniline/few-layers graphene (PVA/PANI/FLG) when both were used to coat cast-iron pipelines. Such a better corrosion performance was due to the lower population of observed pores in the ceramic nanocoating. In addition, polymeric nanocoating had higher capacitance and was able to store higher charge, which allowed faster degradation [Polymer coatings modified with nanocomposite have been tested for their anti-corrosion properties as coatings for steel protection. The PANI nanocomposite tends to enhance the resistivity of the coating with its redox behaviour and self-healing effect when it is threatened to be destroyed due to scratch or scribble ,137,138.sistance . A PANI\u2013ano TiO2 . The samano TiO2 ,137. Ther (PANI) . The cerradation .Another nanocomposite examined for corrosion properties was highly crystalline graphene integrated polyaniline (PaniGn) nanostructured composites over mild steel; it was measured for different concentrations of graphene. The results showed a decline in corrosion current of up to four orders of magnitude in HCl solution, where 1.92 wt.% graphene loading showed the best corrosion protection. It was suggested that the coating provided a physical barrier to the corrosive environment and imparted non-wetting characteristics . FurtherCurrent paint formulations contain volatile organic compounds (VOCs) as plasticisers to facilitate polymer diffusion, reduce ductility, and increase the flexibility of the paint. However, such technology showed a negative environmental impact . One of 3O4, Fe2O3, and ZnO were studied for their corrosion behaviour [2O3 were incorporated into an alkyd-based waterborne coating system in different concentrations [3O4) dispersed in waterborne epoxy acrylate-butylated melamine formaldehyde (EpAc-BMF) coatings showed a nobler reaction towards corrosion compared to a neat steel substrate [3O4 nanoparticles within the coating material provided a locking effect, and acted as a strong barrier at the coating\u2013metal interface by filling the interstitial spaces and other coating artefacts , which will not allow the penetration of corrosive ions to the coating metal interface [Polymer-based waterborne coating integrated with nanoparticles such as Feehaviour ,145,146.ubstrate . A physinterface . 2SO4 solution. Without applying any friction force, the coating maintained a stable passivation layer. However, a depassivation\u2013repassivation process was observed on the surface of the steel at the start and at the end of applying the friction force, respectively [Different types of nanoparticles were incorporated with nanocrystalline metal matrices coating such as silicon carbide, titanium dioxide, and alumina, to produce nanocomposite coatings ,154,155.ectively .2 nanoparticles were electrodeposited in composite coating with nickel over a sintered NdFeB magnet, it helped prevent the corrosive pits from growing up and accelerating the passivation process of the metal matrix as well [2O3 nanoparticles were incorporated into nickel coatings over steel, and tested for corrosion resistance in K2SO4 and NaCl solution, the results showed a nobler act for coated steel compared to bare steel. Al2O3 act as insulators on the composite surface, where a slightly better resistivity was found in NaCl solution [2O3 nanoparticles in a nickel matrix refine the nickel grain and change the preferential orientation of the composite coating [2O3 nanoparticles were found to play a key role in the corrosion behaviour study. Two types of electrodeposition techniques were used: sediment co-deposition (SCD) and adopting conventional electroplating (CEP), with different concentrations of nanoparticles. Using a CEP coating technique resulted in better corrosion resistance, which increased with the increase of Al2O3 particle concentration in the nickel matrix [In addition, when TiO as well . When Alsolution . Moreove coating . The typl matrix . 2O3 and Cr2O3 oxides layer to prevent oxygen diffusion into the bulk film at higher temperatures. However, corrosion rate values for Crx1\u2212AlxN coatings increased with an increase in the aluminium fraction, as the incorporation of Al in the CrN lattice increases the roughness and porosity [100 deposited by a multi-arc ion plating method on the surface of Ti\u20136AL\u20134V resisted the aggressive conditions of a hot corrosion test. The mechanism of layered oxidation relieved thermal stresses and avoided the peeling that was caused by growth stress during oxidation [xN nanocoating improved the charge transfer resistance of the surface of AISI420 stainless steel substrate when the substrate was examined with EIS testing in a 3.5 wt.% NaCl solution. According to XRD pattern and TEM images, the addition of Si retarded the columnar structure growth that is permeable to corrosive ions, and a dense coating with equiaxial grains was revealed [Metal nitride films are widely used as a protective layer due to their superior mechanical properties and their enhanced wear and corrosion resistances. These films are used in a binary  or ternaporosity . A 0.9 rporosity . Anotherporosity . The addporosity  and erosporosity . It was porosity . Anotherxidation . Moreoverevealed . It shouA summary for the reviewed work of this section can be found in In the metal nanocomposite coating research field, nickel had received a great amount of attention due to its ability to act as the host matrix for electroless nickel plating. Electroless nickel plating is a chemical reduction process where coating is achieved by the catalytic reduction of nickel ions using a reducing agent such as sodium hypophosphite without applying electric current. Since it is a chemical reduction process, a uniform coating thickness can be obtained, along with uniform mechanical and physical properties. This was found to be an attractive and alternate method of producing a thin and uniform deposit on the substrate when compared to conventional electroplating ,167. The2, Al2O3, SiC, and SiO2 nanoparticles into the Ni\u2013P alloy electroless coating caused an improvement in the corrosion resistance [The corrosion resistance of electroless-coated nickel phosphorous alloy is influenced by more than one factor. An increase in the corrosion resistance of the electroless nickel coating was noticed with the increase of phosphorus in the alloy. In addition, studies revealed that the incorporation of TiOsistance ,174,175.2-Ni\u2013P nanocoating over low carbon steel was reported to be significantly dependent on the type of the surfactant and its concentration [2. The using of DTAB at an optimum concentration to incorporate TiO2 in an Ni\u2013P matrix showed the lowest corrosion rate compared with bare low carbon steel, Ni\u2013P coating, and TiO2\u2013Ni\u2013P + SDS coating. The increase in corrosion resistance of the TiOntration . Sodium 2O3 nanoparticles had an adverse effect on its corrosion resistance when heat-treated [2 nanoparticles and Ni\u2013P with SiC nanoparticles, it was found to enhance corrosion resistance [In addition, heat treatment of the nanocomposite coating was found to have two opposite effects on the corrosion resistance, depending on the incorporated nanoparticles. It was reported that the nanocomposite coating of the Ni\u2013P alloy with Al-treated , while fsistance ,175. A summary for the reviewed work of this section can be found in Nanocoatings have significant potentials to offer superior enhancements in the corrosion performance of surfaces compared to micromaterial coatings. Nanocrystalline structures are superior over microstructures for corrosion enhancement due to the fine grain sizes, which provide better space filling and a higher integrity of the coated surface. Applying nanocoating onto the surface of the substrate makes it harder, tougher, and improves its adhesive properties. However, the coating thickness and composition should be designed so as not to decrease its protective characteristics towards corrosive and eroding influences.Nanocoatings act through different mechanisms to provide enhanced corrosion resistance, and in some cases, they might bring up adverse effects. The fine sizes of nanocoatings form a uniform physical barrier on the surface of the material. Furthermore, nanoparticles possess improved adhesion properties due to the high density of their grain boundaries, thus increasing the corrosion resistance of the substrate. On the other hand, the higher grain boundary fraction and uneven surface generated from the agglomeration of the fine particles can foster the chance of forming anodic sites, which will make the surface more susceptible for corrosion attack. Hence, it is important to consider all of the surrounding factors related to nanocoating and substrates, in order to achieve the expected corrosion protection. The corrosion of metallic nanocoating has been studied with respect to the effect of several factors. It should be noted that there is no factor that affects the corrosion resistance alone in one dimension, neither one can alone contribute to the corrosion behaviour of the nanocoating. Nevertheless, they all play a role in determining the corrosion performance of the nanocoating. nanocrystalline Ni and its alloy have great potential as a promising metallic nanocoating, especially in the form of the nanocrystalline Ni\u2013P alloy. A range of 14\u201317 wt.% of nickel in Zn\u2013Ni alloys was shown to have the best corrosion resistance. The addition of phosphorus improves the corrosion behaviour in neutral and acidic media, with a composition of around 9\u201311 wt.% in the alloy. In regard to the grain size, there was no trend in corrosion behaviour for different sizes of the nanoparticles encountered in the nanocoating; nanocoating composition and the acidity of the media can dominate the effect of the grain size. Pulse electrodeposition was found to provide better corrosion properties than direct current, as the former technique produces a finer surface. The concentration of additives encountered in the nanocoating should be optimised for the best corrosion properties. 2O3, doping TiO2 with nitrogen anions, or pre-etching the surface before coating it with Ta2O5 reported better corrosion resistance. Both TiO2 and Ta2O5 show high resistance towards corrosion in NaCl solutions. Comparing values of corrosion current densities for the studied ceramics nanocoatings in the present paper showed that the corrosion resistance of titanium oxide and tantalum oxide is higher than that for zirconia and alumina. Zirconia has the potential to replace toxic chromium in nanocoating applications, as zirconia nanocoated surfaces reveal to have fairly low corrosion current densities in various kinds of solutions. The corrosion behaviour of ceramic nanocoating has been studied for different kinds of oxides, and every kind was found to have specific corrosion characteristics depending on the substrate, surroundings, and nanomaterial type and characteristics. Alumina nanocoating is shown to have enhanced corrosion characteristics when it is deposited with a plasma-enhanced ALD technique compared to thermal ALD deposition. Pre-treatment processes improves the surface properties and corrosion characteristics of the coated surface. Pre-annealing the copper substrate before coating it with Al2, SiC, and SiO2 have positive corrosion behaviour when added to the Ni\u2013P matrix in a NaCl solution for electroless Ni coating, while for electrodeposition coating, Al2O3 showed a good corrosion resistance when blended in an Ni matrix. For polymer nanocomposite coating, conductivity has become a point of interest. For nanocomposite coatings, a filler of ceramic or metallic nanoparticles is dispersed in the host matrix, which enhances the physical properties of that matrix, and enables it to be used as an effective nanocoating. Corrosion protection with nanocomposite coating is achieved by building a compact barrier and preventing charge transfer such as oxygen permeability and ion transportation. In addition, nanocomposite coating improves some of the other properties that help in enhancing the corrosion behaviour of the nanocomposite, such as: cohesive and adhesive properties, hydrophobicity, agglomeration, and dispersion and distribution properties. The corrosion of nanocomposite coating is affected by the same factors as those mentioned above. In addition to those, the corrosion behaviour of nanocomposite coatings is influenced by the nanocomposite synthesis method, type, and concentration of the filler, as well as whether the coated substrate is heat-treated or not. TiOThe corrosion resistance of a material defines its stability and durability, and it is important to identify it as a part of material\u2019s performance assessment. Corrosion research provides information regarding the fundamental kinetics and mechanisms of the corrosion process. Nanocoating contains ultrafine constituents that might influence the resulting surface regarding aspects of lattice structure, grain size, porosity, intermetallic particles\u2019 distribution, surface state, etc. These constituents have very small and dense grain boundaries that make it challenging to develop new corrosion theories for their interaction with the surface. For example, smoothening the surface increases the integrity, uniformity, and fatigue performance of the ultrathin coatings, which would decrease the possibility of pit initiation at such surfaces. At the same time, having nanoparticles covering the surface provides excessive smoothness that might weaken the adherence of the coating and cause detachments of parts of the coating. In addition, lowering the surface roughness might increase the possibility for preferential intergranular corrosion, that allows the growth of a more defective and permeable coating at the triple-junction grain boundaries. These two mechanisms allows the nanomaterials to interact with the surface in two opposite directions, and it is difficult to identify which theory is applicable. In addition, due to presence of such nanomaterials on the surface of the substrate, oxide formation is affected; hence, the transition mechanism of the surface state differs, and will be difficult to detect. Surface state transition from passivation to pit initiation and then to the breakdown of the film is influenced. Depending on the initial conditions of the uncoated surface and the cleanness of the final coated surface, the new state is defined, which will affect the overall surface corrosion. Due to the nonuniform distribution of the nanoparticles on the surface of the coated substrate, ions might accumulate and create weak points of higher potential that cause pit initiation. On the other hand, an accumulated coating might physically isolate the substrate surface from electrolyte ions. Predicting the transition mechanism is challenging, and it requires deeper corrosion research."}
{"text": "This work investigating the dependence of the optoelectronic properties of AgNW-FTCFs on AgNW length provides design guidelines for development of AgNW-FTCFs.Flexible transparent conductive films (FTCFs) composed of silver nanowires (AgNWs) have become an important research direction because of their potential in flexible electronic devices. The optoelectronic properties of FTCFs composed of AgNWs of different lengths were evaluated in this study. AgNWs, with an average diameter of about 25 nm and length of 15.49\u20133.92 \u03bcm were obtained by a sonication-induced scission process. AgNW-FTCFs were prepared on polyethylene terephthalate substrates using a Meyer bar and then dried in the ambient environment. The sheet resistance, non-uniformity factor of the sheet resistance, the root mean square roughness, and haze of the FTCFs increased as the length of AgNWs decreased. The transmittance of the films increased slightly as the length of AgNWs increased. AgNWs with a length of 15.49 \u03bcm provided an AgNW-FTCF with excellent properties including haze of 0.95%, transmittance of 93.42%, and sheet resistance of 80.15 \u03a9\u2219sq As the demand for flexible and wearable electronic devices has increased over the last 20 years, the development of the flexible transparent conducting films (FTCFs) with excellent electrical conductivity, flexibility, and optical transparency has become important. At present, indium tin oxide (ITO) is a widely used material for the transparent conducting films; however, because of its intrinsic brittleness, relative rarity, and expensive deposition and post-treatment processes, ITO is not suitable for flexible device fabrication. To circumvent the shortcomings of ITO, many materials, including carbon nanotubes ,2, graphSilver nanowire (AgNW) films have excellent optical and electrical properties comparable to that of ITO and are regarded as a leading candidate for FTCFs ,6,7,8. T\u22121. Bergin et al. recently reported that the transmittance of AgNW-FTCFs with AgNWs of a given diameter is linearly to area coverage, and does not depend on the length of the AgNWs. In addition, they found that decreasing AgNWs diameter improved optoelectronic performance only for AgNWs with a diameter of less than 20 nm [Generally, it is challenging to fabricate a high-performance AgNWs film with both high transmittance and high electrical conductivity, because AgNWs are not transparent. Meanwhile, the haze of AgNW-FTCFs strongly depends on the diameter of AgNWs and is decreased by using AgNWs with a smaller diameter ,20,21. Han 20 nm . Sorel ean 20 nm . They foan 20 nm ,26,27,28Herein, we produce AgNWs with different lengths by a sonication-induced scission process and explained relationship of the length of AgNWs with ultrasonic time and then fabricate FTCFs composed of the AgNWs of different lengths. Furthermore, the influence of AgNWs length on the sheet resistance, non-uniformity factor of the sheet resistance, transmittance, haze, and root mean square roughness of AgNW-FTCFs were discussed in a systemic way. In addition, the relationship of the optoelectronic properties of film with microstructures was discussed. The uniformity of the AgNWs networks decreases with decreasing of AgNWs length. The resulting FTCF composed of 15.5 \u03bcm AgNWs has high transparency, low sheet resistance and haze and root mean square roughness, and high uniformity. We would like to point out that the AgNW-FTCFs conductive film prepared have no any additional post-treatment.\u22121) after sonication-induced scission at an ultrasonic power of 300 W for 0.5, 1.0, 1.5, 2.0, 2.5, and 3.0 h, are presented in t is the ultrasonic time and L(t) represents the average length of AgNWs at a certain t. The ultrasonic energy at constant ultrasonic power is proportional to the ultrasonic treatment time. NUF) to evaluate the standard deviation of the sheet resistance of the films from the average value as follows [n is the number of measurements of the film of different sites, and iR and NUF, the more uniform the film. According to this method, we divided film into 64 regions of the same size, measured the sheet resistance of each region and recorded the data. Conductive films consisting of AgNWs of different lengths were fabricated on polyethylene terephthalate (PET) substrates using a Meyer bar. A schematic diagram of the fabrication of an AgNW-FTCF is shown in  follows :(2)NUF=\u2211NUF of the sheet resistance of films consisting of AgNWs of different lengths. Results for the films containing AgNWs with average lengths of 5.17 and 3.92 \u03bcm are not shown in \u22121, respectively. As the length of the AgNWs decreased from 15.5 to 7.86 \u03bcm, the sheet resistance of the film increases by about 6400%. As the length of the AgNWs in the AgNW-FTCFs decreased from 15.5 to 7.86 \u03bcm, NUF rose from 0.29 to 0.52, indicating that the distribution uniformity of AgNWs on the PET surface decreased. As the distribution uniformity of AgNWs decreases, it is difficult to AgNWs to form continuous and effective conductive paths in all direction of our films were considerably smaller than those reported in the literature [terature ,33, indiTransmittance spectra and the transmittance values at a wavelength of 550 nm of the AgNW-FTCFs containing AgNWs of different lengths are depicted in SEM analysis provided an explanation for the influences of AgNW length of on the optical and electric performances of the AgNWs films. L) that are widthness in two dimensions, the critical number density (CN) of sticks required for percolation is given by Equation (3) [CN of AgNWs required to form a percolation network is inversely proportional to the square of L. Therefore, a low number density of long AgNWs can form a sparse and effective percolation network. Such a network can not only increase the light transmission, but also improve conductivity forming long percolation routes with few nanowire junctions. iR is the internal resistance of AgNW and cR is the contact resistance between AgNWs. The total resistance of the conductive film can be regarded as the sum of iR and cR, where cR can be considered equivalent to the concentrated resistance, which is the resistance produced when the current flows through a very small conductive contact point and is compressed by convergence. For network structures composed of AgNWs, the number of contact points between AgNWs obviously depends on AgNW lengths. A junction resistance always exists between AgNWs. The higher the number of contact points, the higher the junction resistance in an AgNW network. In general, a typical AgNW-FTCF shows low conductivity because the AgNWs network contains numerous contact points, which leads to high junction resistance. For films composed of long AgNWs, the junction resistance is low because of the limited number of contact points. Conversely, for film composed of short AgNWs, the junction resistance is high because of the numerous contact points. This indicates that minimizing the junction resistance was important to obtain AgNW-FTCFs with high conductivity without post-treatment. Tighter contact between crossed AgNWs resulted in higher conductivity; the long AgNWs in the network provided multiple electrical pathways from one edge of the network to the other, which meant that breaking a relatively small number of junctions would still leave alternative electrical paths from one edge of the network to the other. However, when the length of AgNWs and the distribution uniformity decrease, the discontinuous AgNWs networks are formed and the contact resistance increased considerably, resulting in a substantial decrease of electrical conductivity. In addition, for the theoretical sticks with a given length (tion (3) ,35:NC \u00d7 For a given concentration of AgNWs, decreasing the length of AgNWs increases the number, which results in increased contact resistance of their film. In addition, with the decreasing AgNW lengths, the distribution uniformity of AgNWs on the substrate surface decreased, resulting in difficulty forming an effective conductive network between AgNWs, which increased the film resistance. Meanwhile, increasing the number of AgNWs increased their deposition density on the substrate, which decreased the transmittance. The effect of AgNW length on optoelectronic properties is especially important at high transmittance (low area coverage), where there are relatively few connections between nanowires, i.e., the film is porous.FoM) is defined the ratio DC\u03c3/Op\u03c3, where Op\u03c3 (\u03bb) is the optical conductivity and DC\u03c3 is the direct current (DC) conductivity of the film, which is one of the important parameters for evaluating the optoelectronic properties of optoelectronic films. Here, we calculated FoM of the film, as shown in FoM decreased gradually. When the AgNW length decreased from 15.5 m to 7.86 m, the film FoM decreased from 67.9 to 0.86, which was reduced by about 790%. This result indicated that the AgNW length has great influence on optoelectronic properties of film. As we know that transparent conductive film as electrode to be used in optoelectronic devices, the DC\u03c3/Op\u03c3 value is at least 35, which corresponds to the resistance sheet less than 100 \u03a9 with a transmittance at 550 nm over 90%, meanwhile, DC\u03c3/Op\u03c3 values of film need over 50 and 10 when they are used in liquid crystal display and touch screen panels, respectively [In general, figure of merit (ectively . We woulRMS) values of the film with AgNW lengths of 15.5, 9.24, and 7.86 \u03bcm were 12.9, 18.4, and 22.3 nm, respectively. These RMS values are low approximately the diameter of a nanowire. The RMS values of the films increases with decreasing AgNW length, which may be related to the non-uniform distribution and high local deposition density of AgNWs.To further study the effect of AgNW length on morphology, the films with AgNW lengths of 15.5, 9.24, and 7.86 \u03bcm were analyzed by AFM as shown in \u22121 without post-treatment. This performance is acceptable for use of the film in display devices. Haze is defined as the ratio of diffuse transmittance to total transmittance according to ISO 14782 ,38. FiguAfter linear fitting of the data points plotted on a logarithmic scale, the following relationship between the haze and transmittance was found:To demonstrate the applicability of the AgNWfilms, we connected green and blue LEDs to the conductive film, as shown in \u22121. Polyethylene terephthalate (PET) substrates were purchased from Hefei Microcrystalline Materials Co., Ltd., China. Ethanol absolute (99.7%) was purchased from Jinan Liyang Chemical Co., Jinan, Ltd., China. All the chemicals were used as received. An AgNW suspension was purchased from Suzhou Gushi New Materials Co., Ltd., Suzhou, China. The suspension contained AgNWs with an average diameter and length of 25 nm and 15.49 \u03bcm, respectively, dispersed in isopropyl alcohol at a concentration of 10 mg\u2219mL\u22121 with isopropyl alcohol and then subjected to ultrasonication for 0.5\u20133 h at a power of 300 W. The ultrasonication was carried out in a bath-type sonicator . For ultrasonication treatments, the AgNWs suspension was diluted to 2 mg\u2219mL\u22121) films were then dried in the ambient environment for 15 min. AgNWs films were fabricated on PET substrates using a Mayer bar  and AgNWs suspension . The lengths of individual AgNWs visible in the images were measured manually using image processing software . For one sample, we obtained six SEM images. The lengths of individual AgNW in the SEM image were measured manually according to an image processing software. The number of AgNW measured for each sample should not be less than 80. The sheet resistances of films were characterized using a four-probe system  and optical transmittances were measured using a thin film transmittance meter . Diffuse reflectance was measured with an ultraviolet-visible spectrophotometer . Optical transmittance and sheet resistance of AgNW-FTCFs were measured at 20 different sites, from which average values were calculated. The transmission and diffuse reflectance were measuredusing a PET film as a reference. The surface morphology was analyzed via atomic force microscopy .NUF of the AgNW-FTCFs increased s by about 6400% and 178%, respectively, as the AgNWs length decreased from 15.5 to 7.86 \u03bcm. These results indicated that the distribution uniformity of AgNWs on the PET surface o decreased as the ANW length shortened. The transmittance of the film at 500 nm decreased slightly from 93.42% to 91.99% and haze increased from 0.95% to 1.03% as the AgNWs length decreased from 15.49 to 7.86 \u03bcm. RMS values of the films were low (close to the diameter of a nanowire). The film consisting of AgNWs with a length of 15.5 \u03bcm exhibited haze of 0.95%, transmittance of 93.42%, and sheet resistance of 80.15 \u03a9\u2219sq\u22121 without any additional post-treatment. These highly uniform and mechanically stable AgNW-FTCFs meet the requirement for numerous applications and could soon play a major role in the display market AgNWs with an average diameter of about 25 nm and a length of 3.92\u201315.49 \u03bcm were obtained by sonication-induced scission. AgNW-FTCFs were then prepared on PET substrates and dried in the ambient environment. The film contains AgNWs with lengths of 5.17 and 3.92 \u03bcm were non-conductive because of the poor contact between the AgNWs. The sheet resistance and"}
{"text": "The bromine ions were used as pivotal passivating agent. When the molar ratio of Br\u2212/Cl\u2212 was 1:4, the average diameter of AgNWs was as low as ~40 nm, the average length was as high as ~120 \u03bcm, and the aspect ratio reached 2500. Networks of AgNWs were fabricated using as-prepared high-quality AgNWs as conducting material and hydroxyethyl cellulose (HEC) as the adhesive polymer. As a result, a low sheet resistance down to ~3.5 \u03a9 sq\u22121 was achieved with a concomitant transmittance of 88.20% and a haze of 4.12%. The ultra-low sheet resistance of conductive film was attributed to the long and thin AgNWs being able to form a more effective network. The adhesion of the AgNWs to the substrate was 0/5B (ISO/ASTM). The insights given in this paper provide the key guidelines for bromine ion-assisted synthesis of long and thin AgNWs, and further designing low-resistance AgNW-based conductive film for optoelectronic devices.High aspect ratio silver nanowires (AgNWs) with ultra-long length and thin diameter were synthesized through bromine ion (Br With the emergence of flexible photoelectric devices and the scarcity of indium resources, great efforts have been made to develop new flexible transparent conductive films  to replace traditional indium tin oxide (ITO). Until now, conductive polymers ,2,3, silTo our knowledge, the properties of AgNW-based TCFs mainly depend on characteristics including the nanowire structure and the overall network morphology. In general, the length, diameter, and aspect ratio of nanowires are critical factors for enabling the high transparency with a low haze, low sheet resistance, and superior mechanical compliance and strength . However\u2212) as co-nucleant can effectively reduce the diameter of AgNWs, but a small AgNW length is always obtained owing to the harsh conditions. Lee et al. reported that employing NaCl and KBr as nucleants could control the diameter of AgNWs in the range of 15\u201330 nm, however the length was below 20 \u03bcm [3 and KBr as co-nucleants and achieved thin AgNWs with an average diameter of 26 nm, but only about 21 \u03bcm in length [- decreased diameter of AgNWs while increasing length, and through controlling the growth of AgNWs obtained AgNWs with a large aspect ratio [Through performing an extensive literature search and seriously comparing and summarizing the factors that affect the morphology of AgNWs in the synthetic process, it was found that, except for the reaction temperature and time, it appears that the varieties and quantities of nucleant are crucial. Search results showed that bromide ions  to form conductive ink and coated onto polyethylene glycol terephthalate (PET) to fabricate AgNW-based TCFs with a transmittance of 88.20% and a haze of 4.12% while achieving a low sheet resistance of ~3.5 \u03a9 sq3, \u226599.8%), sodium chloride  and potassium bromide  were purchased from Sinopharm Chemical Reagent Co., Ltd.  poly-vinylpyrrolidone  was acquired from Sigma Aldrich . Hydroxyethyl cellulose (HEC) was purchased from Dow . Ethylene glycol  and ethanol  were obtained from Xilong Scientific Co., Ltd. . Polyethylene glycol terephthalate (PET) was gained from Yingshang Electronic Materials Co., Ltd. . Deionized (DI) water was purified by laboratory water purification system with a resistivity of 18.2 M\u03a9\u00b7cm and a working temperature of 25 \u00b0C.All chemicals were of analytical grade and used as received without further purification. Silver nitrate . Then, 1.792 g of AgNO3 and 11.12 g of PVP were dissolved into 240 mL EG, to get transparent solution, as \u201cb\u201d solution. Later, the \u201cb\u201d solution was poured into \u201ca\u201d solution to form a light orange mixed solution. After magnetically stirring for 10 min, 400 mL of the mixture was transferred into a Teflon-lined stainless steel autoclave with a capacity of 500 mL and reacted under solvothermal conditions at 170 \u00b0C for 2.5 h. The autoclave was cooled down to room temperature in a standard atmosphere. The grayish-green product was centrifuged, and alternately washed with ethanol and DI water, dispersed in a certain amount of DI water. The solid content of AgNWs was measured to be 0.95%.As the most common reagent, KBr was chosen as the chemical auxiliary of synthesize ultra-long AgNWs. As is known, the existence of KBr will lead to uncontrollable nanoparticles. To avoid the formation of many nanoparticles, and prepare ultra-long AgNWs, while further performing the function of KBr thin AgNWs, NaCl was used to assist KBr, and collectively realize the synthesis of ultra-long AgNWs. In a typical synthetic experiment, 1:4 molar ratio of BrAgNW ink was prepared by a simple physical method. Specifically, AgNWs were dispersed into the solvent system that matched matrix resin. First, 1.0 g HEC was dissolved into 100 mL DI water to form a 1.0 wt % solution. Then, 12 mL of above solution were transferred into a beaker, and stirred at room temperature. After that, 26 mL of aqueous AgNWs dispersion liquid were immersed into the solution, and 12 mL of DI water was further added, making the solid contents of AgNWs and HEC 0.5% and 0.25%, respectively. After being stirred for about 3 h, the final ink was obtained for fabricating TCFs.The AgNW-based TCFs were fabricated on a BEVS1811/2 bar coater with a vacuum plant . The fabrication process comprised the following steps: first, the bare PET substrate was adsorbed onto the platform by vacuum. Then, a bar of 20 \u03bcm was put down to hold the substrate, and dumped the AgNW ink on substrate. The length and speed of coating were set as 10 cm and 300 mm/s, respectively, and then the start button was pressed. The bar pushed the ink to glide over the substrate. After that, the coated-film was taken down and put in an air dry oven of 130 \u00b0C and curing 5 min, and obtained a flexible transparent conductive film.\u03b8, and scanned in steps of 0.02\u00b0 (2\u03b8) from 20\u00b0 to 90\u00b0. The microstructures of the sample were observed on a FEI-Versa3D field emission scanning electron microscopy  operating at 30 KV. Before FE-SEM test, the sample was dispersed in ethanol and further dripped on silicon wafer. The transmission electron micrography  was performed on a Zeiss EM 912 \u03a9 instrument at an acceleration voltage of 120 KV, while high-resolution transmission electron microscopy (HRTEM) and fast Fourier transform (FFT) were examined on a Philips CM200-FEG microscope . Due to the very brittle structure of AgNWs, the sample used for TEM was dispersed in ethanol with no need for ultrasound treatment, and the dispersion was then dropped on carbon\u2013copper grid. The UV-vis spectra of the sample were performed on a UV-vis spectrophotometer  with a scan range from 190 nm to 900 nm. SGW-820 transmittance and haze analyzer  were employed to study the transmittance and haze of AgNW-based TCFs, and a bare PET film was used as blank test. The four-point probe (SB100A/2) was used to examine the sheet resistance of AgNW-based TCFs with a probe current of 2 mA. Tests for adhesion were conducted by a Cross-Cut Tester scratching  the PET substrate with AgNW-based TCF. Then kapton tape was stuck to the film, and then peeled off. The pattern obtained was examined visually and classified by means of a reference table. According to the standard applied, an identification number was assigned to classify the adhesion properties of the tested coating. The grade of 0/5B indicates the best adhesion.X-ray diffraction  with a copper K\u03b1 radiation (\u03bb = 1.54056 \u00c5) was used for the crystal structure and the phase identification, where the diffracted X-ray intensities were recorded as a function of 22O could be detected, indicating the high crystallinity and purity. Besides, the intensity of (111) Bragg reflection was largest, suggesting that the AgNWs grew along the (111) Bragg reflection. Its crystallite size was estimated to be about 20 nm, which was a prerequisite for the formation of thin AgNWs.The XRD pattern of the as-synthesized sample is depicted in The detailed structures of the obtained AgNWs were further observed via TEM, HRTEM and FFT. - can influence the size of the initial nucleus, and the AgBr cubes are much smaller than the AgCl [+, the Br\u2212 adsorbs on the surface of original AgNWs, and the Br- can passivate the {100} facets, limit lateral growth, and further promote the formation of thinner AgNWs [\u2212 leads to a slower release of Ag atoms contributing also to thin and high aspect ratio AgNWs [6. Due to the increase in chain length, the solution would possess a high viscosity, slowing down the growth kinetics and leading to the formation of MTPs. Furthermore, the PVP with a higher molecular would strongly adsorb on Ag nanocrystal surface, leading to a confinement to the lateral growth [The evolution of morphologies from original nucleation to high aspect ratio AgNWs was demonstrated by schematic diagram, as compared in the AgCl . Then, wer AgNWs . Next, iio AgNWs . The secl growth . The thil growth . In addition to FE-SEM and TEM, the UV-Vis absorption is another characterization method for analyzing AgNWs morphology. As is known, the UV-Vis spectra can be used to describe the morphology, as Ag nanostructures with different sizes and shapes display surface plasmon resonance (SPR) bands at different frequency ranges. For AgNWs, there are two plasmon adsorption resonances, corresponding to the transverse oscillation of electrons and the oscillation of electrons along the long axis . Figure \u22121, which was much less than previous reports [To explore potential applications, as-synthesized AgNWs was used as a conductive material to prepare conductive ink using HEC as adhesive. The inset of  reports ,39,40,41Afterwards, the optical property of as-fabricated AgNW-based TCFs was elucidated, as shown in The mechanism for the ultra-low sheet resistance was caused by ultra-long and high aspect ratio AgNWs, as schematically represented in 3 was translated into AgBr and NaCl, and was reduced into Ag via solvothermal at 170 \u00b0C. It was found that the as-synthesized AgNWs exhibited a diameter of ~40 nm, a length of ~120 \u03bcm, and aspect ratio up to 2500. The flexible transparent conductive film based on as-synthesized AgNWs exhibited ultra-low sheet resistance of ~3.5 \u03a9 sq\u22121, as well as high transmittance and low haze, strong adhesion, which were mainly attributed to long AgNWs with small diameter being able to form a more effective network. These findings not only offer a novel route to synthesize high-quality AgNWs, but also provide a promising method to prepare environmentally friendly aqueous AgNW-based conductive ink, and further obtain high-performance flexible AgNW-based TCFs.In summary, ultra-long and thin AgNWs were one-step synthesized by adding KBr as co-nucleant with a molar ratio of 1:4 of KBr/NaCl. Subsequently, AgNO"}
{"text": "Cardiovascular disease (CVD) remains the leading cause of global mortality. Individuals with disabilities are at increased risk of CVD in part due to their musculoskeletal and/or cognitive impairments that can challenge their participation in physical activities. Gait ability has been associated to several key health outcomes including morbidity. Unfortunately, there is little research done to understand how individuals with obstructed mobility  grow older. Our research team , evaluated the prevalence of CVD risk factors and age-related health outcomes associated to aging on a cohort of adults with cerebral palsy with obstructed mobility. Metabolic syndrome was identified in 17.1% of the cohort, higher than the 10% in the NHANES sample. CVD risk factors were much higher in this cohort as compared to normative population data. There was a positive correlation between mobility level, waist circumference , and waist-to-hip ratio ."}
{"text": "Background: Exposure to adverse childhood experiences (ACEs) is a risk factor for poor later life health. Here, we describe the ACE variables measured in the children of the Avon Longitudinal Study of Parents and Children (ALSPAC) study, and a method used to derive summary measures and deal with missing data in them. \u00a0\u00a0Methods: The ALSPAC data catalogue (59 608 variables) was searched in September 2017 for measures on adversity exposure between birth and 18 years. 6140\u00a0adversity questions were then screened for conforming to our ACE definitions and suitability for dichotomisation. This screening identified 541 questions on ten \u2018classic\u2019 ACEs  and nine additional ACEs . These were used to derive a binary construct for exposure to each ACE. Finally, as cumulative measures of childhood adversity, different combinations of the 19 ACE constructs were summed to give total adversity scores. An appropriate strategy for multiple imputation was developed to deal with the complex patterns of missing data.Results: The ACE constructs and ACE-scores for exposure between birth and 16 years had prevalence estimates that were comparable to previous reports .Conclusions: ACE constructs, derived using a pragmatic approach to handle the high dimensional ALSPAC data, can be used in future analyses on childhood adversity in ALSPAC children. Studies show a graded relationship between ACEs and poor outcomes, with the more ACEs a person suffers the greater their risk for many health conditions  and broader experiences of household dysfunction , although it has been argued other types of adversities  should be included5 and many ACE studies incorporate additional adversities2.Exposure to Adverse Childhood Experiences (ACE) is associated with substantial health consequences2, we also derive ACE count score measures. In this Data Note, we describe the processes used to derive the ACE measures and resources available for researchers to use in their own studies, and we provide descriptive statistics of the ACE measures.Our goal was to derive measures for childhood adversity for the children of a British birth cohort study, the Avon Longitudinal Study of Parents and Children (ALSPAC). In this cohort, a vast array of detailed adversity data has been obtained from multiple parent- and child-completed questionnaires administered throughout childhood and adolescence. Using these data presents challenges given the repeated measures, differences in measurement tools across time, and complex missing data patterns. Given the known co-occurrence of multiple forms of adversity and the potential presence of cumulative effects on healthALSPAC recruited 14,541 pregnant women resident in Avon, UK (former county covering Bristol and the surrounding areas in the South West UK) with expected dates of delivery 1st April 1991 to 31st December 1992. Each enrolled mother either returned at least one questionnaire or attended a \u201cChildren in Focus\u201d clinic by 19/07/99. Of these initial pregnancies, there were a total of 14,676 foetuses, resulting in 14,062 live births and 13,988 children who were alive at 1 year of age.7.When the oldest children were approximately 7 years of age, an attempt was made to bolster the initial sample with eligible cases who had failed to join the study originally. As a result, when considering variables collected from the age of seven onwards there are data available for more than the 14,541 pregnancies mentioned aboveThe total sample, including later enrolment phases, is 14,775 live births and 14,701 alive at 1 year of age. Note that for reasons of confidentiality questionnaire data belonging to children from triplet or quadruplet pregnancies have been removed, resulting in 14,691 eligible participants.searchable data dictionary.The mothers, their partners and the index child have been followed-up using clinics, questionnaires and links to routine data. Please note that the study website contains details of all the data that is available through a fullyWe restricted our derivation of ACE measures to the 12087 children who answered at least 10% of the 541 questions on ACE exposure between 0\u201318 years.Ethical approval for the study was obtained from the ALSPAC Law and Ethics Committee and the Local Research Ethics Committees.5, previous research on childhood adversity in ALSPAC12 and discussion between LDH and LCH on ACEs to include, we searched for ALSPAC data on 20 ACEs. Ten of the twenty ACEs are frequently used in other research3: i. sexual abuse, ii. physical abuse, iii. emotional abuse, iv. emotional neglect, v. substance abuse by the parents, vi. parents have mental illness or attempted to commit suicide, vii. violence between parents, viii. parental separation, ix. bullying and x. parent convicted of an offence, whereas the other nine ACEs were either suggested more recently5, examined in ALSPAC before9 or identified as relevant by LDH and LCH when deciding which ACEs to include: xi. bond between parent and child, xii. satisfaction with neighbourhood, xiii. social support for the parent, xiv. social support for the child, xv. physical illness of a parent, xvi. physical illness of the child, xvii. financial difficulties, xviii. low social class, xix. violence between child and partner and xx. crowded housing.Based on previous literature on ACEs12. 6487 of the 12083 questions were classified into the 20 ACEs. After careful examination of the questions and response possibilities by LCH and LDH, questions were excluded if they did not conform to our ACE definitions (see section \u2018ACE definitions\u2019) or were unsuitable for dichotomisation. Crowded housing was the only ACE that was not included due to the limited number of questions on crowding and coverage of a small age range (birth- 3 years).In September 2017, text searches ;ever sexually abused, forced to perform sexual acts or touch someone in a sexual way ;adult in family was ever physically cruel towards or hurt the child ;parent was ever emotionally cruel towards the child or often said hurtful/insulting things to the child ;child always felt excluded, misunderstood or never important to family, parents never asked or never listened when child talked about their free time (5. substance use);parent was a daily cannabis or any hard drug user, or, had an alcohol problem (6. 13) ;parent was ever diagnosed with schizophrenia or hospitalised for a psychiatric problem, or, during the first 18 years of the child\u2019s life, parent had an eating disorder (bulimia or anorexia), used medication for depression or anxiety, attempted suicide or scored above previously established cut-offs for depression  >127. parents violent towards each other);parents were ever affected by physically cruel behaviour by partner, or, ever violent towards each other, including hitting, choking, strangling, beating, shoving ;parents separated or divorced (9. bullying);child was a victim of bullying on a weekly basis (10. parent convicted);parent was convicted of a crime (11. parent-child bond)child or parent not close to each other and when growing up, child never felt loved (12. satisfaction with neighbourhood);child is not happy living in neighbourhood or would rather move, parent or child describe neighbourhood as bad ;parent never had anyone to share feelings with ;child has no friends, unhappy with number of friends or friends hardly ever support them ;parent hospitalised more than once or had cancer ;child hospitalised more than once or had a medical condition or physical disability ;very difficult to afford food or heating, or, parent was affected by becoming homeless ;highest household social class was in class V (unskilled work) or unemployed, based on mother\u2019s and her partner\u2019s occupations using the 1991 UK Office of Population Censuses and Surveys classification (classes I to V) (19. violence between child and partner);partner of child used physical force or violence, or, made them feel scared  and dividing the ACE-score into four categories . Similarly, an extended ACE-score  and a categorical extended ACE-score , with a similar distribution to the original scores, were derived.Similar to previous studiesR 3.3.1 will be supplied together with the data. We derived ACE measures for the time period 0\u201316 years, as this is a frequently used time period in previous ACE studies2, but the code can be readily adapted to different time periods between 0\u201318 years depending on a researcher\u2019s needs. However, note that questions that span a larger time window (e.g. exposure 0\u201311 years or 0\u201316 years) than the period of interest (e.g. 0\u20138 years) would be excluded from ACE construct calculations. The questions and cut offs used to derive the dataset described below are supplied inThe R code used to derive these ACE measures in14. Therefore, for multiple imputation we recommend including two types of auxiliary variables that make the missing-at-random assumption more plausible (seeACE measures were derived for participants who responded to at least 50% of the questions (ACE-derived); these participants are more affluent than the full cohort, and including only these participants in analyses will lead to lower ACE prevalence estimates and may induce selection biasible see:1. sociodemographic indicators that are associated with both missingness and many of the ACEs   or between 18\u201321 years ). However, as adversity exposure may be rare we recommend only including questions with at least 50 adversity exposed participants in your own imputation model.mice package version 2.46.0 in R3.3.1 with 30 iterations per dataset15, based on the rule of thumb that the number of imputed datasets should be at least equal to the percentage of incomplete cases  and for some variables the imputation model converged after 20 iterations16.To illustrate the use of multiple imputation using these two types of auxiliary variables, we compare prevalence estimates for the imputed ACE constructs for exposure between 0\u201316 years to the prevalence estimates in the ACE-derived group. To preserve potential interactions between gender and adversity in relation to later outcomes, males (n=6214) and females (n=5873) were imputed separately before appending the two datasets. For both males and females, 90 imputed datasets were created using the16. For instance, our multiple imputation was carried out separately for males and females to enable examination of gender interactions in the imputed data, but to examine other interactions the imputation model would have to be adapted to reflect this.Do note that the multiple imputation process will need to be re-done for any future applications because the imputation model would have to be compatible with the analysis model(s) being used, so to avoid bias the imputation model should include the exposure, outcome and any covariates, plus any interactions and non-linearities14, sociodemographic indicators  were lower in the ACE-derived group , also our most prevalent ACE, was much higher than other ACE studies but still in line with lifetime mental health prevalence estimates in the US  and Northern Ireland . The correlation  between the individual ACEs varied from low to medium with \u03d5c ranging 0 to 0.32 , and were less likely to experience emotional neglect, bullying, lack of social support, violence between child and partner and physical illnesses  .Detailed, repeated measures of childhood adversity are available in the ALSPAC study. We extracted 582 variables documenting exposure to 19 different ACEs between birth and 18 years. Overall, ACE exposure prevalence did not differ by age of reporting or data source . The remainder were coded as missing and imputed using multiple imputation. This assumes that the data are missing-at-random given the variables included in the imputation model22. Also, there is more detail in the ALSPAC data that could be exploited, for instance on the subjective impact of ACE exposure. Researchers wishing to use these more detailed data could do so, but this would necessitate further data manipulation. Finally, we relied on the questionnaire and clinical childhood adversity data, but ALSPAC also has linkage data available on looked after children9 and there is future potential of linkage to criminal convictions and cautions.In our implementation of the ACE framework, we dichotomised all ACE variables based on pre-defined cut offs to capture exposure and derived an ACE count score measure that is widely used in literature as a summary variable. A limitation to our implementation is that the summing procedure implicitly assumes that each ACE has the same direction and magnitude of effect on outcomesAlthough other software packages can be used to derive the ACE measures, together with the data we will provide the R code we used to (1) dichotomise the variables, (2) derive the ACE measures for a specific time period and (3) implement multiple imputation.Overall, we describe a pragmatic method for deriving ACE constructs using a wealth of data on a UK population-based sample. Missing data was a key issue that needed to be handled, which is why, for future analyses with these ACE measures, we advise using multiple imputation by adapting the framework detailed in this Data Note.http://www.bristol.ac.uk/alspac/researchers/research-ethics/.Ethical approval for the study was obtained from the ALSPAC Ethics and Law Committee and the Local Research Ethics Committees. A comprehensive list of research ethics committee approval references is available to download at:ALSPAC data access is through a system of managed open access. The steps below highlight how to apply for access to ALSPAC data, including access to the data and R scripts described in this data note .ALSPAC access policy  which describes the process of accessing the data and samples in detail, and outlines the costs associated with doing so.1. Please read theresearch proposals database, which lists all research projects that have been approved since April 2011.2. You may also find it useful to browse our fully searchablesubmit your research proposal for consideration by the ALSPAC Executive Committee. You will receive a response within 10 working days to advise you whether your proposal has been approved.3. Pleasealspac-data@bristol.ac.uk.If you have any questions about accessing data, please emailThe ALSPAC data management plan describes in detail the policy regarding data sharing, which is through a system of managed open access.study website.Written informed consent was obtained from the parents of participating children after receiving a full explanation of the study. Children were invited to give assent where appropriate. Study members have the right to withdraw their consent for elements of the study or from the study entirely at any time. Full details of the ALSPAC consent procedures are available of the In the last sentence of the Introduction, it would be helpful if the authors could add in additional language that helps to make clear the goals of a Data Note.\u00a0\u00a0I make this comment because, having not been familiar until now with this type of paper, later statements in the paper read a bit awkwardly without this context.\u00a0\u00a0I would therefore suggest a slight rephrasing to say something along the lines of:\u00a0\u00a0\u201cIn this Data Note, we describe the processes used to derive the ACE measures in ALSPAC, and report the results of univariate and bivariate analyses to summarize these measures and their association with social-demographic factors.\u00a0\u00a0We also provide practical guidance regarding multiple imputation strategies to employ when analyzing this ACE data as well as resources to better understand the ALSPAC data and how to access it, which we hope will be useful to both current and future users of ALSPAC data.in the cohort\u00a0were approximately 7 years of age\u201d.\u00a0\u00a0In the Methods, please clarify this statement by perhaps adding \u201cWhen the oldest children\u00a0As information about triplets and quadruplet pregnancies is noted, it would also be helpful to report the number of twins in the sample.The \u201cclassic\u201d ACES are defined in a way that makes clear the valence of the experience, whereas the \u201cadd-on\u201d items are not worded as such.\u00a0\u00a0I would consider possibly revising some of the labels where appropriate so that they are all worded negatively, consistent with the idea of these items tapping into adverse childhood experiences.1.The authors note: \u201cThe resulting 12083 questions were compared to previous articles using ALSPAC data to ensure that we had identified all relevant literature\u201d \u2013 however, only 5 papers are then cited.\u00a0\u00a0If the authors did search a more extensive set of literature, it might be helpful to future users to present a listing of those papers in the Supplemental Materials.\u00a0\u00a0I also humbly suggest the authors consider citing one of my recent papers, which not only reported on a broad set of adversities, but also included a comprehensive strategy to address data missingness through multiple imputationThe authors use the terms \u201cprospective\u201d and \u201cretrospective\u201d, which although appear straightforward, are not so.\u00a0\u00a0It would be helpful \u2013 especially for new users to this dataset \u2013 to indicate in a table footnote (such as in Table 1) how these concepts were defined.\u00a0\u00a0Does prospective capture repeated events measured relatively close in time and within one year or two years of the initial event occurrence?\u00a0Does retrospective capture cross-sectional assessments where participants are asked to report on the occurrence of an experience years or even a decade earlier?\u00a0Though I certainly could have missed it, it does not seem that the paper includes specific time points of assessment for each of the measures.\u00a0\u00a0Given all of the detailed work that was put into making this accessible, these details would help even more to assist new users in working with these data.\u00a0\u00a0The data that appears in the last table of the Supplemental Materials seems to possibly do that, though it is unclear what the authors mean by start time period and end tie period ?\u00a0\u00a0Although it would be tedious, it might be helpful to indicate more consistently the time frame that is captured through these measures in their description listed in Table 1.users at the time when data are requested from ALSPAC.\u00a0\u00a0This code is also available, per request, for existing data users\u201dUnder \u201cDerive ACE measures\u201d \u2013 I suggest a small wording change: \u201cThe R code used to derive these ACE measures in R will be supplied to\u00a0Is there a reason why EPDS scores are included both as socio-demographic factors and adversities, under \u201cMultiple Imputation\u201d?\u00a0\u00a0It would be helpful if the authors could provide more detail in the supplement regarding the multiple imputation strategy.\u00a0\u00a0The average reader will not be able to interpret a sentence like this: \u201cNote the use of passive imputation for the ACE count scores and categorical ACE score variables, which are therefore constructed from the imputed ACE constructs and not used as an auxiliary variable for the imputation of the individual ACE constructs.\u201d\u00a0\u00a0If this Data Note is meant to serve as a guide for data users, it would be helpful to provide some basic introduction or literature for reference related to the type of imputation strategies employed .\u00a0\u00a0Otherwise, I worry these important details will be lost in translation.\u00a0Relatedly, it would also be helpful to indicate how the imputed datasets were actually combined for analysis (or how point estimates were combined/averaged).Under \u201cPatterns of Missing Data\u2026\u201d, please restate to \u201cparticipants with more deprivation\u201d.\u00a0Please also note the two references in this section are unnumbered.In the \u201cDataset Validation\u201d section \u2013 or in the supplement, please provide one sentence to clarify \u201csubjective impact of ACE exposure\u201d, as this would not unclear to most users.\u00a0Relatedly, the authors note that there is a subset of children who have documented cases of maltreatment, but this data is not actually readily available .\u00a0\u00a0Consistent with the paper\u2019s focus on transparency and practicality, it might be helpful to add in one additional sentence to provide a bit more context related to this issue and soften the hopefulness of that data being as rich as it now sounds.Under \u201cData Availability\u201d section 3, would be helpful to add \u201c and what the costs are to access the data\u201d, as data user costs vary widely across datasets.\u00a0In the Supplemental\u2026What does Criterium dichotomization mean?\u00a0\u00a0How it was asked?\u00a0\u00a0Or whether it is possible to dichotomize the response?I would encourage the authors to add spaces in between the variables of the \u201cDifferences\u201d tables  or make the first column of this table wider to increase readability. \u00a0Thank you for the opportunity to review this paper, which will be a terrific addition to the literature.\u00a0\u00a0As already noted by the prior reviewers, this paper is written at the perfect level to guide future researchers in using the ALSPAC data to incorporate ACES into their work.\u00a0\u00a0I especially commend the authors for their thoroughness, and transparency, which is reflected in every element of this paper. Comments below are minor in nature and aimed at helping to strengthen this already strong paper.I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Thank you for asking me to review this paper. It is going to be extremely useful for future researchers planning on using measures of ACEs in ALSPAC. It is pitched at the right level, putting much of the detail in supplementary tables \u2013 so as not to distract from the main purpose . I appreciate the pragmatic approach to missing data taken because of issues re: lack of complete cases and high number of variables in the dataset. I commend the authors for their careful consideration to multiple imputation and the appropriate guidance given for future researchers using this data. I do have some, mostly minor, queries that I detail below.1\u00a0and Her Majesty's Government; Department for Education. Working together to safeguard children. 20152. This information can be added as an extra column in supplementary table 2. Considering these standard definitions, I query whether \u201cPartner/respondent was physically cruel to child\u201d is specific enough to be considered physical abuse. I also wonder if the authors would consider whether \u201cchild never felt loved\u201d, currently part of the parent-child bond, would be better placed as a component of neglect .I would urge the authors to consider referencing papers or government documents on the conventional definitions of some of the ACEs considered in the manuscript and how the measures used from ALSPAC compare to these definitions. See, for example Gilbert et al Lancet. 2009A footnote could be added to Table 2 explaining how mean (SE)/% is calculated for the imputed data e.g. where these calculated for each imputed dataset and then averaged across the imputed datasets?I recommend a quick re-read of the supplementary section to ensure that all the table numbers etc are accurate .How were the binary ACE measures actually created? E.g. for sexual abuse, 6 items were considered (assuming no missing data) \u2013 how were these items combined together to create the binary \u2018sexual abuse\u2019 variable.Supplementary Figure 1 is, in my view, important and a sub-section of it could be considered as a figure in the main text. Both researchers and practitioners are interested in which ACEs are correlated and which aren\u2019t .In a few places, clarity of text can be improved e.g. \u201cXix: violence between child and partner\u201d, could be re-phrased to be \u201cviolence between the child and their partner\u201d. \u00a0I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. This is a very clear and \u201cresearcher-friendly\u201d paper which will be extremely useful for future users of ALSPAC data.\u00a0 It describes a careful search within ALSPAC for variables that offer useful information for constructing both \u201cclassic\u201d Adverse Childhood Experiences variables as well as several additional ones.\u00a0 This has allowed construction of a \u201cclassic\u201d ACE scale as well as an \u201cextended\u201d ACE scale and categorical versions of both are also offered.\u00a0 Detailed information has been supplied about the way multiple imputation was used to derive more realistic ACE prevalences, since the proportion of the ALSPAC cohort with enough ACE data to construct actual ACE scores differs socio-demographically from the entire cohort.\u00a0 The supplementary material is useful and, in general, the right things are kept for supplementary files so that the paper itself flows nicely. Specific points are below \u2013 all are minor and are mainly points of clarity. Page 3: Please clarify \u201cviolence between child and partner\u201d? Reader might think \u201cmother\u2019s partner\u201d.\u00a0 Would be helpful to say \u201cviolence between child and child\u2019s partner\u201d? Becomes clearer in \u201cdefinitions\u201d but useful to mention here. Was parental death too rare to include? Might be worth mentioning. Also I notice there isn\u2019t a \u201cphysical neglect\u201d question as in the original Felitti questionnaire. Not necessarily a problem but worth mentioning early on.\u00a0 Page 4:\u00a0 When participants, in their 20s, retrospectively reported on \u201cviolent behaviour of their own partner\u201d, do you know during what age range?\u00a0 Presumably under 18 but do you know what the lowest age was?\u00a0 I guess \u2013 if this occurred largely, say, between age 14 and 18, one could argue this was not really \u201cchildhood\u201d. Page 5, second column, para 2 where you talk about categories of the extended ACE score, can you say a bit more here to justify why you picked those particular categories? This section is confusing and needs more clarification: \u201cHowever, note that questions that span a larger time window (e.g. exposure 0\u201311 years or \u00a00\u201316 years) than the period of interest (e.g. 0\u20138 years) would be excluded from ACE construct calculations.\u201d The section on multiple imputation, especially the illustration on page 6 of imputation, is likely to be very helpful for future ALSPAC-users. Page 6, second column first para: might be worth expanding this paragraph a bit by commenting more on some of results in Figure 1 supplementary material.\u00a0 You might want to mention both the highest correlations and also some very apparently uncorrelated variables such as emotional neglect.\u00a0 I think a lot of practitioners and clinicians will want to know what is correlated with what and may be surprised at some of this. I wonder if the title of your Dataset Validation section might be expanded a bit to \u201cDataset validation, strengths and limitations\u201d because you do seem to expand into general limitations here. Tiny wording points: Abstract: \u201cthe\u00a0high\u00a0dimensional\u201d \u2013 should this be \u201cthe highly dimensional\u201d? Thank you for asking me to review this very helpful paper.I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard."}
{"text": "Isoprenoids are amongst the most abundant and diverse biological molecules and are involved in a broad range of biological functions. Functional understanding of their biosynthesis is thus key in many fundamental and applicative fields, including systems biology, medicine and biotechnology. However, available methods do not yet allow accurate quantification and tracing of stable isotopes incorporation for all the isoprenoids precursors.Saccharomyces cerevisiae.We developed and validated a complete methodology for quantitative metabolomics and isotopologue profiling of isoprenoid precursors in the yeast This workflow covers all the experimental and computational steps from sample collection and preparation to data acquisition and processing. It also includes a novel quantification method based on liquid chromatography coupled to high-resolution mass spectrometry. Method validation followed the Metabolomics Standards Initiative guidelines.This workflow ensures accurate absolute quantification (RSD\u2009<\u200920%) of all mevalonate and prenyl pyrophosphates intermediates with a high sensitivity over a large linear range (from 0.1 to 50\u00a0pmol). In addition, we demonstrate that this workflow brings crucial information to design more efficient phytoene producers. Results indicate stable turnover rates of prenyl pyrophosphate intermediates in the constructed strains and provide quantitative information on the change of the biosynthetic flux of phytoene precursors.13C-metabolic flux analysis of isoprenoid biosynthesis.This methodology fills one of the last technical gaps for functional studies of isoprenoids biosynthesis and should be applicable to other eukaryotic and prokaryotic (micro)organisms after adaptation of some organism-dependent steps. This methodology also opens the way to The online version of this article (10.1007/s11306-019-1580-8) contains supplementary material, which is available to authorized users. Isoprenoids form one of the most abundant and diverse family of biological molecules on Earth , the common precursor of all isoprenoids . To test the performance of the analytical method, we constructed two strains (S023 and S037) with higher levels of isoprenoid precursors than the wild-type strain. Both had integrated one extra copy of HMG1t and ERG20 under TDH3 and PGK promoters respectively. Furthermore, in S023 and S037 the GGPP synthase from Xanthophyllomyces dendrorhous (CrtE) was expressed constitutively (TEF1p) in a centromeric plasmid. Additionally, the strain S023 also bears one integrated copy of the phytoene synthase (converts GGPP to phytoene) from Pantoea ananatis (CrtB) under the transcriptional control of the PDC1p. This strain was used to test if the GGPP pool was consumed. The genotypes of the different strains are detailed in Supporting Table S-2.All strains used in this study were derived from 4Cl (75\u00a0mM), KH2PO4 (22\u00a0mM), MgSO4 (0.4\u00a0mM) and CSM Leu\u2212  at pH 5.0 , NH600nm of 0.007 was used to inoculate 50\u00a0mL of Verduyn medium Leu\u2212 and cells were grown at 28\u00a0\u00b0C with an agitation of 220\u00a0rpm  until harvest at mid-exponential phase. To prepare the 13C internal standard used throughout this study, strain S037 was pre-cultured in 20\u00a0mL of Verduyn medium without any amino acids and 55\u00a0mM U-13C-glucose. This preculture was used to inoculate 600\u00a0mL of the same medium at an initial OD of 0.05. Cells were harvested at mid-exponential phase.For metabolomics experiments, an initial ODg, 28\u00a0\u00b0C, 5\u00a0min), and cells were resuspended in the same medium with 55\u00a0mM of U-13C-glucose  instead of unlabeled glucose. Samples were harvested at times 0, 1, 2, 5, 10, 15, 30, 45, 60, 90 and 120\u00a0min after the switch of label input.For isotope labeling experiments (ILEs), 200\u00a0mL of the same medium was inoculated at an initial OD of 0.007. When the OD was around 3, 10\u00a0mL of culture were harvested (time zero) and centrifuged (3000\u00d720 NH4HCO3 100\u00a0mM (50/50) mixture at 70\u00a0\u00b0C for 10\u00a0min. For absolute metabolite quantification 50 \u00b5L of 13C internal standard were added to each extract. Cellular extracts were cooled on ice and sonicated during 1\u00a0min. Cell debris was removed by centrifugation . Supernatants were evaporated overnight , resuspended in 200 \u03bcL of methanol: NH4OH 10\u00a0mM (7:3) at pH 9.5 and stored at \u2212\u200980\u00a0\u00b0C until analysis.Intracellular metabolites were sampled by fast filtration .4FA, pH 9.5, in water and (B) 20\u00a0mM NH4FA, pH 9.5, in 9:1 (v/v) acetonitrile\u2013water, with the following gradient: 0\u201312\u00a0min from 100% A to 100% B, 5.5\u00a0min kept with 100% B and within 0.5\u00a0min the return to the initial condition and 4\u00a0min equilibration of the column. The injection volume was 10 \u00b5L.Analysis of isoprenoids precursors was performed on a Thermo Scientific\u2122 Hypersil C18 GOLD\u2122, 3\u00a0\u00b5m, and 2.1\u2009\u00d7\u2009100\u00a0mm column. The column was kept at 25\u00a0\u00b0C and the flow rate was set to 0.3\u00a0mL/min during first 2\u00a0min and 0.4\u00a0mL/min for the rest chromatographic run. The solvent system consisted of (A) 20\u00a0mM NHMass detection was carried out in a negative electrospray ionization (ESI) mode. The settings of the mass spectrometer were as follows: spray voltage 3.2\u00a0kV, capillary and desolvation temperature were 350 and 400\u00a0\u00b0C respectively, maximum injection time 200\u00a0ms. Nitrogen was used as sheath gas (50 a.u.) and auxiliary gas (15 a.u.). The automatic gain control (AGC) was set at 106 and resolution at 70,000 from m/z 100 to 700. MS analyses were performed by targeted selected ion monitoring (tSIM) mode with 0.5\u00a0m/z isolation window for SIM and \u00b1\u200910\u00a0ppm for inclusion tolerances. tSIM MS scans the targeted masses in different time segments selected based on the retention times of the analytes. Data acquisition was performed using Thermo Scientific Xcalibur software.13C-labeled extracts from yeast were used to enable isotope-dilution mass spectrometry (IDMS) . The acetone phase was transferred to a new tube and the extraction was repeated twice. Acetone extracts were pooled, centrifuged, dried under nitrogen flux and resuspended in 100 \u03bcL of acetone for HPLC analysis.Analyses were carried out on a Thermo Scientific\u2122 Vanquish\u2122 Focused UHPLC Plus system with DAD. 5 \u00b5L of the extraction was injected in a column YMC carotenoid (100\u2009\u00d7\u20092.0\u00a0mm and 3\u00a0\u00b5m particle size) equipped with a precolumn (100\u2009\u00d7\u20092.0\u00a0mm and 3\u00a0\u00b5m particle size). The mobile phases used to separate and quantify phytoene and \u03b2-apocarotenal from the ergosterol and derivatives consisted in a mixture of A methanol/water (95:5) and B dichloromethane. The flow was 0.25\u00a0mL/min with the following gradient: 0\u20130.1\u00a0min 5% B, 0.1\u20130.5\u00a0min 20% B, 0.5\u20132\u00a0min 60% B, 2\u20135\u00a0min 80% B, 5\u20138\u00a0min 80% B and 8\u201311\u00a0min 5% B. Absorbance from 210 to 600\u00a0nm was followed during all the run with a data collection rate of 2\u00a0Hz and response time of 2\u00a0s. Phytoene was quantified by its absorbance at 286\u00a0nm and \u03b2-apocarotenal at 478\u00a0nm. Reference wavelength (600\u00a0nm) was subtracted for each of the wavelengths used for metabolite quantification.13C-ILEs, isotopologue distributions were quantified from mass fractions after correction for the presence of all naturally occurring isotopes and isotopic purity of the tracer (99%) using IsoCor v2.0.4  from the isotopologue distributions using the following formula:Mi is the proportion of the isotopologue with i13C atoms for a metabolite containing n carbon atoms. IsoCor is freely available at https://github.com/MetaSys-LISBP/IsoCor and its documentation at https://isocor.readthedocs.io.MS data were processed using TraceFinder v3.2 (ThermoFisher), with a tolerance of 5\u00a0ppm to extract exact masses. In 13C-enrichments were first fitted using the following logistic model:Labeling dynamics between metabolites and strains were compared as detailed in  were analyzed by reverse phase chromatography and detected by high-resolution mass spectrometry (HRMS) operating in negative mode. The MS acquisition method was optimized to enhance sensitivity and selectivity by using the tSIM mode. Selectivity was enhanced further by setting the resolution of the Orbitrap cell to 70,000, which was sufficient to avoid mass interference with the analytes of interest, even in complex cellular extracts. Finally, the mass scan range was limited to 600\u00a0m/z (from 100 to 700\u00a0m/z) to avoid systematic under representation of heavier isotopologues  and observed a low interference (<\u200910%). Similarly, M5P does not interfere with measurement of MEV (<\u200910%).S. cerevisiae were collected by fast filtration to ensure rapid quenching of metabolism while reducing the concentrations of glucose, amino acids and salts that would impair both chromatographic separation and MS ionization. The extraction procedure was optimized to maximize metabolite recovery (amount recovered and reproducibility). Four different extraction procedures were tested. The first one was a cold extraction, acetonitrile/methanol/water (4:4:2) at \u2212\u200920\u00a0\u00b0C during 1\u00a0h. This method has been described to be very efficient and specially for triphosphate compounds  at 70\u00a0\u00b0C during 15\u00a0min  at 70\u00a0\u00b0C during 15\u00a0min  extraction at 70\u00a0\u00b0C during 15\u00a0min  and butanol/ethanol/H2O\u2009+\u2009100\u00a0mM NH4HCO3 (4:5:11), but the first showed a better reproducibility . We also determined the optimal incubation time. Different incubation times  were tested to maximize the intensity of the MS signals and evaluate metabolite degradation . The signals were stable for all compounds and extraction times, indicating no significant degradation occurred in our conditions. Based on these results, we selected an extraction time of 10\u00a0min.With this LC\u2013MS method in hand, we then focused on optimizing the sampling procedure, which is of utmost importance to obtain a reliable picture of the metabolome  grown on U-13C-glucose as sole carbon source, and using the optimized sampling and extraction procedures. All intermediates showed a high 13C-incorporation (mean molecular 13C-enrichment\u2009>\u200998%).Finally, we implemented the isotope dilution mass spectrometry (IDMS) approach to ensure accurate absolute quantification of the different metabolites , and following the Metabolomics Standards Initiative guidelines  for all metabolites. LOD was below 0.1\u00a0pmol injected on column for most compounds, and LOQ was about 0.1\u20131.5\u00a0pmol over a range of concentration spanning two to three orders of magnitude. Intra- and inter-day assay reproducibility was below 20% for all compounds. Overall, the method was found to be highly sensitive and reproducible for all compounds tested.We evaluated the LC\u2013HRMS method by preparing and analyzing in triplicate a mixture of commercial standards (at concentrations from 0.08\u00a0nM to 10\u00a0\u00b5M) prepared in a biological matrix (a uniformly S. cerevisiae. We first optimized the pool of phytoene precursors in the wild-type (WT) metabolic chassis by constructing the strain S037, which overexpresses HMG-CoA reductase (HMG1t), FPP synthase (ERG20) and GGPP synthase (CrtE). We then constructed the strain S023 by expressing a heterologous phytoene synthase (CrtB from Pantoea ananatis) which converts GGPP into phytoene. We performed metabolomics experiments to quantify the concentration of each intermediate in the three strains, and stable isotope labeling experiments which are of greatest interest to measure metabolic fluxes and infer flux control in living cells.To demonstrate the applicability of the proposed workflow, we carried out functional investigations to guide rational design of phytoene production in Metabolomics results showed very different concentration profiles in the three strains, with a good biological reproducibility for all intermediates (average RSD of 20%)   was estimated by fitting a logistic model . More surprisingly, the dynamic 13C-enrichments profiles and T50 values of all intermediates were also very similar for the three strains (p\u2009>\u20090.05) despite significant changes in pool sizes.Fluxes in linear pathways such as the isoprenoids biosynthetic pathway cannot be resolved using well-established stationary 13C-incorporation , which support the relevance of the proposed strategy to enhance phytoene production.Integration of metabolomics and isotopic datasets may provide quantitative information on the biosynthetic flux of isoprenoid precursors. The labeling dynamics of a given metabolite reflects its turnover rate, which is roughly equivalent to the ratio of the metabolite pool size and the flux through that metabolite pool. The strong increase of pools in S037 and S023 strains compared to the WT strain are expected to slow down the transient 13C-flux models. Still, these results already demonstrate the applicability of the proposed workflow to infer flux information on this pathway in yeast. Concentrations and isotopic labeling of the prenyl pyrophosphate intermediates could also complement other biochemical datasets (e.g. proteomics or enzyme activities) to infer quantitative information on the control exerted by each reaction step on the pathway flux, and thereby drive further strain optimization strategies.Inferring absolute flux values from these data would require more sophisticated mathematical models of isoprenoids biosynthesis, such as non-stationary 13C-incorporation provides quantitative information on the biosynthetic flux of phytoene precursors in S. cerevisiae. Overall, these results illustrate the value of the present workflow during iterative construction of a phytoene producing strain in biotechnology.We presented a workflow for functional analysis of isoprenoids biosynthesis in yeast. Procedures to quench metabolism and extract metabolic intermediates were optimized and a novel method was developed to measure concentrations and isotopic profiles of isoprenoids precursors by high pressure liquid chromatography coupled to high-resolution mass spectrometry. This workflow provides accurate quantification (RSD\u2009<\u200920%) over a large linear range (from 1 to 50\u00a0pmol) and showed a high sensitivity (LOD\u2009<\u20090.1\u00a0pmol) for all compounds tested. Integration of metabolomics data with dynamic This methodology closes one of the remaining gaps for comprehensive, quantitative understanding of isoprenoids biosynthesis. Access to absolute intracellular concentrations of all intermediates in combination with the ability to quantify their isotopologue distribution will be a valuable tool for future investigations. It may also support the development of kinetic models of isoprenoids metabolism, thus opening the way to comprehensive, mechanistic understanding of the control and regulation of their biosynthesis. This workflow was designed and validated for yeast but should be applicable to other eukaryotic and prokaryotic organisms, including bacteria, plants, and mammals, after adaptation of organism-dependent steps (in particular quenching and extraction).Supplementary material 1 (PDF 775 kb)Below is the link to the electronic supplementary material."}
{"text": "Understanding the potential drivers of microbial meat contamination along the entire meat supply chain is needed to identify targets for interventions to reduce the number of meatborne bacterial outbreaks. We assessed the hygienic practices in cattle slaughterhouses (28 employees) and retail shops (127 employees) through face-to-face interviews and direct personal observations. At the slaughterhouses, stunning, de-hiding and evisceration in vertical position, carcass washing and separate storage of offal were the identified good practices. Lack of hot water baths, absence of a chilling room, infrequent hand washing, insufficiently trained staff and irregular medical check-up were practices that lead to unhygienic handling of carcasses. At the retail shops, cleaning equipment using soap and hot water (81%), storing unsold meat in refrigerators (92%), concrete floors and white painted walls and ceilings were good practices. Adjacently displaying offal and meat (39%), lack of a cold chain, wrapping meat with plastic bags and newspapers, using a plastic or wooden cutting board (57%), infrequent washing of equipment and floors, and inadequately trained employees were practices that could result in unhygienic handling of beef. Our study identified unhygienic practices both at the slaughterhouses and retail shops that can predispose the public to meatborne infections, which could be improved through training and implementation of quality control systems. The global increase in human population is associated with an increased demand for foods of animal origin . ConsequMost of the meatborne bacterial outbreaks are usually attributed to contamination along the supply chain due to poor handling practices . Food-prMeat hygiene and safety is usually less controlled in many developing countries where meat for human consumption is approved based on visual inspection, if at all, without routine microbiological testing . SeveralIn Ethiopia, there are over 300 local slaughterhouses that supply meat for local consumption with different capacities and facilities, however all with low basic hygienic standards . AlthougThis study was conducted from June 2017 to May 2018 at the two local cattle slaughterhouses  found in Bishoftu, and all 127 retail shops selling beef in Bishoftu town. The town is located in East Shoa Zone of Oromia region, Ethiopia. According to the 2007 Ethiopian census report , the totn = 127) engaged in beef handling activities were included in the survey. The purpose of the study was explained to the study participants and data were collected after obtaining full written consent from the participants. At the end of each interview, completeness and accuracy of the data were checked and ensured by the principal investigator. Ethical clearance was obtained from College of Veterinary Medicine and Agriculture of Addis Ababa University, VM/ERC/06/05/09/2017), Ministry of Science and Technology of Ethiopia (Ref no.3/10/006/2018) and the University Hospital Gent, Belgium (Ref. no. 2017/0612).Data were collected through face-to-face interviews and direct personal observation using pre-tested semi-structured questionnaires and checklists to assess the beef hygienic handling practices at slaughterhouses and beef retail shops . The quep-value of less than 0.05 was set as a significance level. The hygienic handling practices at the beef retail shops were described descriptively.The collected data were entered to Microsoft Excel spread sheet  and analysed using STATA version 15.1 . Descriptive statistics such as frequency and percentage are used to summarize the data. Fisher\u2019s exact test was used to assess the difference in the sociodemographic characteristics and hygienic handling practices of the employees between the municipal and private slaughterhouses. A n = 16) and private (n = 12) slaughterhouses. The private and the municipal slaughterhouses did not significantly differ based on the sex, age, level of education and main duty of their employees (Fisher\u2019s exact test p > 0.05). However, there was a significant difference between the slaughterhouses with respect to years of experience of the employees (Fisher\u2019s exact test p = 0.000). Employees at the municipal slaughterhouse had more years of work experience  than those working in the private one ). The combined mean age of the employees from the two slaughterhouses was 32.3 years (SD = 8.1) ranging from 19\u201350 years. Both slaughterhouses had their own veterinarian who was in charge of the supervision of slaughter process and meat inspection. Overall, the slaughter steps were similar at both slaughterhouses. The slaughtering started with the stunning of the animals by stabbing at the atlanto-occipital region using a sharp edge of knife, immediately followed by bleeding and removal of the head and the feet with the carcass in a horizontal position on the floor. The remaining slaughter steps  were performed in vertical position after manually hanging the carcass by hooks and sliding it over the rail system. Finally, the carcasses were stored and transported at room temperature.p > 0.05). The use of aprons, white coats, boots and hair covering, as well as the presence of sinks for hand washing were good practices observed at both slaughterhouses. However, none of the employees wore hand gloves during operations. We also observed lack of hot water for hand washing and dipping of knives.Both slaughterhouses reported the use of water from the municipal city supply. Hand washing was not a frequent practice during slaughter operations according to 53.6% of the respondents . There wn = 127) were males with a mean age of 25.3 years (SD = 5.9) ranging from 18 to 56 years. Most (70.1%) respondents at retail shops attended only up to primary school and 85.8% of them did not receive training on the best practices of handling meat.The sociodemographic characteristics of the study participants from the retail shops are indicated in According to the respondents, carcasses are transported from the slaughterhouses to the retail shops using closed vehicles without a cooling facility. The municipal water supply was the source of water for all retail shops. Of the retail shops, 39.4% displayed offal  and meat next to each other on the same display cabinet, 4.7% used the same knife for cutting offal and meat. Among the respondents, 85.0% of them used the same coat for the entire day; 9.0% did not wash hands before touching meat; 11.8% did not use soap for hand washing, and 2.4% collected money while handling meat. Ninety-two percent had a refrigerator for storage of leftover meat . A variable frequency of washing equipment, display cabinet, and floor was reported. In most of the retail shops (>70%) equipment, floors and the display cabinet were cleaned once per day. The majority (81.1%) of retail shops reported cleaning their equipment with soap and hot water . All respondents wore a white coat, but none of them put on gloves. In all retail shops, there were light bulbs, either concrete or tile floors and white painted walls and ceilings. However, in all shops meat was displayed at room temperature, with no covering, being exposed to dust particles and domestic flies. All shops used either plastic bags or newspapers for wrapping the meat . Among tProper meat handling practices play a significant role in ensuring meat quality and safety . KnowledIn the present study, lack of hot water baths for hand washing and dipping of knives, infrequent hand washing, insufficiently trained operational employees, lack of regular medical check-up and lack of cooling facilities were bad practices identified both at the slaughterhouses and retail shops. Hot water, which is essential for hand and knife washing to remove potential surface contaminants and to prevent further cross contamination of meat, was lacking at washing basins of both at slaughterhouses and retail shops . Even thAccording to 53.6% of the respondents at slaughterhouses hand washing was not a frequent practice during slaughter operations, and few (9.4%) employees at retail shops did not wash their hands before touching meat. This practice is not consistent with the requirements of the CAC which recommends that food handlers should wash their hands at every stage of food production to safeguard the consumer from foodborne diseases .About 40% of slaughterhouses and 85.8% of retails shops employees did not receive training on hygienic handlings of meat. Previous studies also reported that a considerable proportion of meat processing employees ,40,41 anAll employees at the slaughterhouses and 98% of the respondents at retail shops confirmed having had a medical check-up. However, when asked about the frequency of the check-up, answers were variable and not in line with the actual requirement by the Ethiopian regulatory body. Having a periodic medical check-up would partly limit the transmission of pathogens from sick or potentially carrier employees . In addiCarcasses were stored at room temperature at the slaughterhouses and transported to beef retail shops using vehicles without cooling facilities. At all retail shops, meat was displayed openly with no cooling and no cover, being exposed to dust particles and domestic flies. The meat could remain as such for hours until sold. The mean annual temperature of the study area is estimated at 20.2 \u00b0C (range: 10.9\u201329.5 \u00b0C) , which iNone of the employees in slaughterhouses and retail shops wore hand gloves during handling of meat. The use of gloves may protect the meat against contamination . In counAt the slaughterhouses, the use of aprons, white coats, boots and hair covering, as well as the presence of sinks for hand washing were good practices observed at both slaughterhouses. These practices are important to protect both the personnel and the meat from exposure to pathogens . Stunning of the animals, the hanging of carcasses over the rail system for dehiding and eviscerations, and carcass washing after eviscerations were good practices identified at the slaughterhouses. These practices are essential to ensure production of quality and safe meat and needs to be maintained at all times ,34,35,36E. coli O157 and Salmonella in cattle feces and on hides and the possibility of their transfer to carcass during slaughter operations [According to the respondent\u2019s perception, feces during evisceration, hides, handler\u2019s hands and knifes were the potential sources of carcass contamination at the slaughterhouses whereby feces as well hides were identified as the major sources by 36% of them. This was consistent with previous reports ,51. Preverations ,54,55,56At retail shops, the use of soap and water for hand and equipment washing, storing leftover meat in refrigerators, concrete/tile made floors, and white painted walls and ceilings were the identified good practices. These were in line with the basic requirements of Ethiopian proclamations and can contribute to hygienic handling of meat ,36. HoweThe use of plastic bags or newspapers were contrary to the requirements of the Ethiopian Food, Medicine and Healthcare Administration and Control Authority Proclamation (No. 661/2009) that require packaging material to be made out of substances, which are safe and suitable for their intended use, and the product to be packed in container which will safeguard its hygienic, safety, quality and food grade. Furthermore, the proclamation states that \u201cno packaging material shall be put into use unless it complies with the international and national safety and quality standards\u201d, which was lacking in the beef retails shops in Bishoftu town .In most of the retail shops (>70%) equipment, floors and the display cabinet were cleaned once per day. Unclean retail shops ceilings and white walls with observable dirty spots were noticed in 79% of the shops. Frequent and scheduled cleaning of equipment and working environments at food establishments are the basic essential requirements to ensure the continuing effective control of food hazards likely to contaminate food .In general, the observed unhygienic practices at the slaughterhouses and retail shops can be linked with lack or inadequate knowledge of basic hygienic practices ,58,59,60The study has some limitations. The study used questionnaires as a data collection tool, which relies totally on the answers of the respondents that might not necessarily correspond to the actual situation. For example, 91% of the employees at the retail shops and 46% of employees at slaughterhouses responded that they washed their hands before touching the meat and between activities during work, which was contrary to our observations. All the respondents confirmed having had a medical check-up. However, when asked about the frequency of the check-up, answers were variable and not in line with the actual requirement by the regulatory body. Combining questionnaires with personal observations reduced the study limitations in part, while of course, the presence of the study team might have induced practice changes.The study showed a combination of good and unhygienic meat handling practices in slaughterhouses and retail shops. The unhygienic handling practices potentially lead to a higher possibility for contamination and cross-contamination of the meat and may have serious public health implications. The unhygienic handling practices coupled with consumption of raw or under cooked meat which is a common habit in Ethiopia ,63 could"}
{"text": "Brain-specific SIRT6-KO mice present increased DNA damage, learning impairments, and neurodegenerative phenotypes, placing SIRT6 as a key protein in preventing neurodegeneration. In the aging brain, SIRT6 levels/activity decline, which is accentuated in Alzheimer\u2019s patients. To understand SIRT6 roles in transcript pattern changes, we analyzed transcriptomes of young WT, old WT and young SIRT6-KO mice brains, and found changes in gene expression related to healthy and pathological aging. In addition, we traced these differences in human and mouse samples of Alzheimer\u2019s and Parkinson\u2019s diseases, healthy aging and calorie restriction (CR). Our results define four gene expression categories that change with age in a pathological or non-pathological manner, which are either reversed or not by CR. We found that each of these gene expression categories is associated with specific transcription factors, thus serving as potential candidates for their category-specific regulation. One of these candidates is YY1, which we found to act together with SIRT6 regulating specific processes. We thus argue that SIRT6 has a pivotal role in preventing age-related transcriptional changes in brains. Therefore, reduced SIRT6 activity may drive pathological age-related gene expression signatures in the brain. During aging, there is an increase in the incidence of several age-related diseases including neurodegeneration, in which aging itself is the main risk factor . TechnolTo understand the molecular mechanism of aging, several genes have been studied \u2013 specifically, the Sirtuin deacylase and ADP-ribosylase gene family, which are highly conserved proteins with important roles in preventing age-related diseases \u20139. For eSince one of the driving forces of aging is the gradual accumulation of DNA damage, we speculated that brain-specific SIRT6-deficient mice could be used as a model for sporadic neurodegeneration. Indeed, this animal model presents accelerated DNA damage accumulation, learning and memory impairments, increased neuronal cell death, and the appearance of hyper-phosphorylated Tau and hyper-acetylated Tau , 21. SimTherefore, we used SIRT6 as a focusing lens to understand the changes in gene expression that could lead to pathological brain aging. Overall, we found that changes due to the lack of SIRT6 are commonly seen in aging and age-related neurodegenerative diseases. We classified the results into four main gene expression categories that change with age, either in a pathological or a non-pathological age-related manner, and groups of genes whose age-related expression changes are either or not reversed by CR. Our results underline a specific pathological signature that could be further used to predict the risk for developing a neurodegenerative disease.To characterize the aging signature of the brain, we measured gene expression in three young WT mice (21 days), three SIRT6-KO mice of the same age, and three old WT mice (22-26 month)  gene categories that are significantly changed in SIRT6KO in relation to both WT and aged mice groups. Both these comparisons only show the downregulation of significant categories, which we decided to further inspect , 1B. In NFKB were in the top 50 categories, we clustered them together as immune response   / [number of occurrences in Aging and Neurodegeneration datasets]).Confidence Scores for Pathological genes =  * [ND Score].For each of the 4 categories, the genes and their Confidence Scores can be found in For each category defined in the Results section, the list of genes was tested for enrichment of transcription factor binding sites and binding site combinations in mice and human via oPOSSUM . We ran i + ABS) to allow a simple ranking of all TFs. We then calculated the TF Prominence Score = Hit scorei * Zi, and multiplied the Prominence Scores of Human with Mouse to get the Combined Prominence Score. The TFs and their related Scores can be found in We then calculated a Normalized Z-Score for gene i = ZTFs were then ranked by their Combined Prominence Scores, and TFs from the top of the lists were manually chosen for each category to plot https://human.brain-map.org/) RNA Microarray data [SIRT6 and YY1 RNA expression data were obtained from Allen Brain Atlas (ray data . A diffehttps://human.brain-map.org/) human brain microarray data [The top 2000 probes co-expressed with either SIRT6 or YY1 were downloaded using Allen Brain Atlas . For enrichGO, all 743 genes served as input. For enrichKEGG, only 629 out of 743 were recognized.Next, the GO analysis was simplified using \u2018simplify\u2019 function with the following parameters: cutoff = 0.5, by = \"p.adjust\", select_fun = min. The top unique categories appear in the main Published SIRT6 and YY1 ChIP-seq data on H1 and K562 cell lines from the ENCODE database were obtained  \u201370. BED-Peaks were then annotated to the closest gene using ChIPseeker R package. Significance of overlapping peaks among chosen ChIP-seq data sets was found using enrichPeakOverlap function from the ChIPseeker R package . Genes that overlap among all ChIP-seq datasets were further analyzed for common pathways using ClusterProfiler R package, as previously mentioned (function: enrichKEGG). SIRT6 and YY1 ChIP-seq genes overlapping Venn diagram was generated using ggVennDiagram R package.YY1 ChIP-seq data was viewed in UCSC Genome Browser , using 'All cells were grown in DMEM , supplemented with 1% L-glutamine , 1% Penicillin/Streptomycin antibiotics mix  and 10% FBS . Incubation was in 37\u00b0 C, 5% CO2.In Vitro DNA Transfection Reagent , according to manufacturer\u2019s protocol.Transfections were conducted using PolyJet\u2122 70% confluent SH-SY5Y cultures were transfected with pCMV-Sirt6-Flag and pCMV-YY1-Flag plasmids, mock cells were used as negative controls. 24 hours after transfection, cells were collected and re-suspended in 150mM lysis buffer . Cell lysates were cleared by centrifugation at maximum speed, and the supernatant was incubated with Anti-Flag Affinity gel , during 2 hours at 4\u00b0 C under rotatory agitation. After Anti-Flag Affinity gel incubation, the samples were washed 3 times with 150mM lysis buffer, and two times with 300mM Lysis buffer (same as 150mM buffer but with 300mM KCl). Flag-purified proteins were eluted with an excess of flag peptide. Same volumes of eluted samples and input samples were analyzed by immunoblotting.Cells were plated and transfected 24 hours afterward with null-T7-RenillaLuc, hSIRT6p-FireflyLuc and either an empty or pCMV-YY1-Flag plasmids. Lysis, luciferase substrates and luminescence readings were conducted using Dual- Luciferase\u00ae Reporter Assay System , according to manufacturer\u2019s protocol.Cells were plated in 8-microchmaber slides (10k cells/chamber) and transfected 24 hours afterwards with hSIRT6p-GFP-CMV-mCherry plasmid, together with either an empty or pCMV-YY1-Flag plasmids. One chamber served as a fluorescence control (containing only the fluorescent reporter plasmid) and another chamber served as a background and autofluorescence control (non-transfected cells). They were then fixated in 2% paraformaldehyde 72h post transfections (when fluorescence in both channels was clearly visible in the control chamber). The slide was then visualized and photos were captured using Zeiss fluorescent system . Analysis was conducted using a manually adjusted automated pipeline in CellProfiler program [Cells were plated in 6-multiwell plate (200k cells/well) and transfected 24 hours afterwards with either an empty or pCMV-YY1-Flag plasmids. RNA was purified using EZ-RNA II Kit , according to manufacturer\u2019s protocol.Then, cDNA was reverse-transcribed using qScript\u00ae cDNA Synthesis Kit .cDNA levels were measured using LightCycler\u00ae 480 Probes Master . All probes in use were manufactured by IDT : human ACTB (Hs.PT.39a.22214847); human SIRT6 .anti-SIRT6 and anti-YY1 were diluted 1:1000 in 5% BSA in TTBS, with 0.02% sodium azide. Antibodies that were in use: anti-SIRT6 , anti-YY1 , anti-H3 .Supplementary FiguresSupplementary Table 1Supplementary Table 2Supplementary Table 3Supplementary Table 4Supplementary Table 5Supplementary Table 6Supplementary Table 7"}
{"text": "Extra virgin olive oil (EVOO) is suggested to be cardioprotective, partly due to its high phenolic content. We investigated the effect of extra virgin high polyphenol olive oil (HPOO) versus low polyphenol olive oil (LPOO) on blood pressure (BP) and arterial stiffness in healthy Australian adults. In a double-blind, randomized, controlled cross-over trial, 50 participants  were randomized to consume 60 mL/day of either HPOO (360 mg/kg polyphenols) or LPOO (86 mg/kg polyphenols) for three weeks. Following a two-week washout period, participants crossed over to consume the alternate oil. Anthropometric data, peripheral BP, central BP and arterial stiffness were measured at baseline and follow up. No significant differences were observed in the changes from baseline to follow up between the two treatments. However, a significant decrease in peripheral and central systolic BP (SBP) by 2.5 mmHg (95% CI: \u22124.7 to \u22120.3) and 2.7 mmHg (95% CI: \u22124.7 to \u22120.6), respectively, was observed after HPOO consumption. Neither olive oil changed diastolic BP (DBP) or measures of arterial stiffness. The reductions in SBP after HPOO consumption provide evidence for a potentially widely accessible dietary intervention to prevent cardiovascular disease in a multiethnic population. Longer intervention studies and/or higher doses of EVOO polyphenols are warranted to elucidate the potential effect on DBP and arterial stiffness. Cardiovascular disease (CVD) is the leading cause of mortality and morbidity worldwide. Established risk factors such as hypertension, dyslipidaemia, diabetes and obesity contribute to 9.7 million annual deaths related to CVD globally . The mosExtensive evidence indicates that certain dietary patterns are cardioprotective . The traThe reported cardioprotective benefits of OO have been mostly attributed to the presence of variable concentrations of bioactive compounds, including polyphenols , mainly known for their anti-inflammatory and antioxidant properties ,19,20. OOur research team recently conducted a meta-analysis of the published literature to determine the effects of HPOO consumption, compared with LPOO, on cardiovascular markers . This meThe OLIVAUS study  was cond2. Exclusion criteria included non-English-speaking individuals, pregnant or lactating women, smokers, individuals on a special type of diet for medical reasons  and/or with a high habitual OO intake (>1 tablespoon/day). Exclusion also applied if individuals were taking vitamins or antioxidant supplements as part of a regular regime and were unable to discontinue their use for the duration of the trial . Finally, study subjects taking prescribed medication  and those with diagnosed chronic diseases , gut-related diseases or any other condition that could impair adherence were also excluded.All participants were recruited in Melbourne, Australia, via social media and La Trobe University email database advertising, word of mouth and posters on campus. A standardized screening procedure was followed in order to identify eligible participants, who were required to be within the age range of 18\u201375 years and a body mass index (BMI) of 18.5\u201340 kg/mThe OLIVAUS study was a double-blind, cross-over, randomized controlled trial (RCT) aiming to evaluate the effect of extra virgin HPOO consumption on CVD risk markers in comparison with a commercially available OO which was low in polyphenols (LPOO). Prior to the main study, a pilot study was conducted with five study participants in order to test the feasibility of the study protocol and the data collection tools . EnrolleStudy participants were requested to consume a daily dose of 60 mL of either type of raw OO over 2 intervention periods of 3 weeks each, in conjunction with their habitual diet. The two types of OO varied only in their phenolic content  but did not differ with respect to the rest of their nutrient composition, including their fatty acid profile. Two washout periods, of 2 weeks each, during which study participants were instructed to avoid olives and OO consumption, preceded the first and the second intervention periods of OO administration. The intervention in the present study was designed with a daily dose of 60 mL OO, which reflects the habitual intake in populations where the cardioprotective benefits of virgin OO have been previously reported ,25,26.Participants were provided with OO bottles at the beginning of each intervention period. The OOs were supplied in dark coloured glass containers to minimise phenolic content loss due to sunlight. To ensure blinding of the researchers to the OO type, each bottle was assigned a different code number that was concealed from study participants and research team members. This was disclosed only after the completion of the statistical analyses. To assess the level of adherence to the intervention, participants were instructed to return the containers at the end of each intervention period so that the daily amount of unconsumed OO could be measured and recorded. Study participants were also instructed to keep a written record of daily OO consumed during each intervention period using a checklist provided to them. This information was recorded by research team members after the end of each intervention period. Full details of the study protocol, including a comparison of the concentrations of total polyphenols and polyphenol subclasses in each of the two types of OOs, are provided elsewhere .Socio-demographic data were collected from eligible participants during a scheduled interview at our trial clinic room located at La Trobe University. Trained researchers conducted all interviews using a standardized questionnaire. Specifically, the socio-demographic data collected during this interview included age, gender, language(s) spoken at home, level of education, ethnicity and parental country of birth. Any medications and dietary supplements taken by the study participants were also recorded.\u00ae9 software . A 3-day food diary was used to collect information on the dietary intake of study participants during two weekdays and one weekend day (preferably non-consecutive) at baseline and follow up of each intervention period. Specifically, study participants were instructed to record details on their intake of food and beverages, including information on the quantity, type/brand and cooking methods of the consumed items. The level of detail required to be recorded in the diary as well as additional strategies on how to incorporate raw, uncooked OO in their habitual diet were provided to study participants at a pre-baseline meeting by a trained nutritionist. The completed food diaries were returned and checked by the research team members for potential wrong or missing entries during the scheduled interviews with the study participants. All dietary intake data were analyzed for energy, macro- and micronutrient content using FoodWorksPhysical activity (PA) was assessed using the Active Australia Survey (AAS) questionnaire , a tool 2). Using World Health Organization (WHO) cut-off points for BMI, study participants were classified as underweight (BMI < 18.5 kg/m2), normal weight (BMI 18.5\u201324.9 kg/m2), overweight (BMI 25.0\u201329.9 kg/m2) or obese (BMI \u2265 30 kg/m2) [Anthropometric measurements were conducted four times during the study, i.e., at baseline and follow up of each intervention period. Body weight and standing height were measured with study participants in light clothing and barefoot, using a digital scale , to the closest 0.1 kg and a wall-mounted stadiometer  to the nearest 0.1 cm, respectively. Waist circumference (WC) was measured to the nearest 0.1 cm, using a flexible steel tape calibrated in cm with mm graduations  directly over the skin at the umbilicus level. Body mass index (BMI) was calculated using Quetelet\u2019s equation (weight (kg)/height (m)0 kg/m2) . FurtherBMI 25.0\u2013.9 kg/m2 Peripheral  and central (aortic) blood pressure (BP) were measured using applanation tonometry with a SphygmoCor XCEL device , at baseline and follow-up examinations at each intervention period. Following a minimum of 5 min rest in the supine position, peripheral brachial systolic BP (SBP) and diastolic BP (DBP) was measured using a blood pressure cuff affixed to the upper left arm. Three consecutive BP recordings were made and the average of the last two recordings was used for data analysis. In addition, central SBP and DBP, as well as PP measures were automatically derived via the brachial BP cuff. The BP categories recommended by the American College of Cardiology (ACC)/American Heart Association (AHA) were used to classify study participants into those with Normal BP (SBP/DBP < 120/80 mmHg), Elevated BP (SBP 120\u2013129 mmHg and DBP < 80 mmHg), Hypertension Stage I (SBP 130\u2013139 mmHg or DBP 80\u201389 mmHg) and Hypertension Stage II (SBP \u2265 140 mmHg or DBP \u2265 90 mmHg) [AIx = AP/PP \u00d7 100). PWV was measured using a tonometer to capture the carotid waveform, while a femoral cuff was placed high on the left thigh in order to capture the femoral waveform. The PWV was then calculated by dividing the distance between the carotid and femoral measurement sites by the transit time. This method is considered the gold standard technique for assessing central arterial stiffness. Measures of peripheral and central arterial stiffness, using pulse wave analysis (PWA) and pulse wave velocity (PWV), were obtained non-invasively with the SphygmoCor XCEL device . This was carried out using the standard procedure as outlined in our previous paper . PWA is Power calculations showed that a sample size of 40 was adequate to provide sufficient statistical power to detect a statistically significant between-group difference of 5% and a standard deviation (SD) of 11 in HDL-C efflux levels , with 80% power and 5% level of significance . The totn) and percentage (%) for categorical ones. All reported p values are two tailed, and the level of statistical significance is set at p < 0.05.All statistical analyses were conducted using the SPSS statistical software for Windows . For all continuous variables, the Kolmogorov\u2013Smirnov test was performed to examine the normality of their distribution. A general linear model, i.e., repeated-measures ANOVA , was used to examine the between-group differences  of mean values at each time point of measurement, the within-group changes (time effect) from baseline to follow up in each intervention arm, and the differences in the changes from baseline to follow up between the two intervention arms (treatment \u00d7 time interaction effect). Both per protocol (PP) and intention-to-treat (ITT) analyses were performed. The PP analyses were conducted in study participants who had full data from baseline to follow up in the first or the second intervention period. For the ITT analyses, multiple imputations were conducted in order to compensate for all missing values. Five imputed models derived from this process. Considering that the PP and the ITT analyses provided similar results , the results coming from the latter are presented in this article. In all statistical analyses, adjustments were made for gender and age. Data are presented either as the mean \u00b1 SD, as estimated marginal means and standard errors (SE) or as the mean change and 95% confidence interval of change (CI) for continuous variables and as frequency , from 105 interested individuals who agreed to be screened, were eligible and enrolled in the study from July 2018 through to October 2019. Seven participants discontinued the intervention, due to inability to comply (n = 4) and for personal reasons, (n = 3) and therefore 43 participants completed the study. Fifty volunteers (n = 50) and by gender. Study participants had a mean age of 38.5 \u00b1 13.9 years (the age range was between 20 and 70 years) and their mean years of education was 17.3 \u00b1 3.5. In addition, the majority of study participants were females (66%), had a tertiary education (86%) and were born in Australia (70%). No significant gender differences were observed in any of these socio-demographic characteristics. The mean BMI and WC was 24.7 \u00b1 3.5 kg/m2 and 86.9 \u00b1 11.2 cm, respectively, with no significant differences between genders. In addition, 44% of study participants were overweight and 4% were obese. Based on their WC measurements, 16% had a high cardiometabolic risk and 24% had very high risk. Although there were no significant differences between genders observed in BMI and WC, compared to females, male study participants were taller  and had a higher body weight . At baseline, the mean peripheral SBP and DBP for the cohort was 120.0 \u00b1 13.4 and 69.9 \u00b1 8.4 mmHg, respectively, while 18% of study participants were categorised as having elevated BP, 20% had Stage 1 Hypertension and 8% had Stage 2 Hypertension. Mean central SBP and DBP was 106.8 \u00b1 13.3 and 70.6 \u00b1 8.7 mmHg, respectively, mean heart rate was 61.5 \u00b1 10.2 bpm and PWV was 9.5 \u00b1 1.4 m/s. There were no significant differences between genders in any of these hemodynamic indices. The changes observed in dietary energy, macro- and micronutrient intake from baseline to follow up, as well as the differences between treatment arms are summarized in The effect of the two intervention OOs on peripheral and central BP are illustrated in Compliance to treatment was high, as reflected in the OO volume returned by participants after each intervention period. Based on the measured actual remaining OO, compliance was found to be 92% for both the LPOO and HPOO group after the first intervention period, while 92% for the LPOO group and 90% for the HPOO group after the second intervention period. Nevertheless, compliance was not found to differ significantly between the two groups .The present double-blind, cross-over, randomized controlled trial investigated the effect of daily consumption of 60 mL raw extra virgin HPOO in comparison with LPOO, each for 3 weeks, on BP and arterial stiffness in Australian adults. The key finding was that peripheral and central SBP decreased significantly by 2.5 and 2.7 mmHg, respectively, after extra virgin HPOO (phenolic content 360 mg/kg) consumption. However, no significant differences were observed between the two interventions with regards to the changes in peripheral and central SBP. No significant within-group changes or between-group differences were either observed on diastolic BP, and measures of arterial stiffness.The significant decrease reported from our study in peripheral SBP is consistent with the limited number of RCTs that have examined the effect of HPOO consumption on peripheral BP, but after providing different doses of OO, different phenolic content of the administered oil, and varying intervention duration. In this regard, Moreno-Luna et al.  describeIt is noteworthy, that other clinical trials also examining the effect of HPOO on peripheral SBP and DBP reported either significant results only for peripheral DBP or no significant findings on BP. In this regard, the EUROLIVE study demonstrated that 3 weeks of daily consumption of 25 mL EVOO, containing 366 mg/kg of polyphenols, significantly reduced peripheral DBP, but had no effect on SBP in healthy men , while aTo the best of our knowledge, this is the first study reporting a significant reduction in central SBP after consumption of HPOO. This is of importance, considering that raised central BP has been positively associated with cardiovascular risk and mortality ,35. The Dietary intake and body weight changes observed in our study deserve comment in the context of the favourable effect of HPOO on peripheral and central SBP. In this regard, the addition of 60 mL of OO in participants\u2019 habitual diet resulted in significant increases in caloric intake leading to weight gain in both intervention groups. Previous cross-sectional and prospective studies have reported that body weight gain is directly associated with increases in arterial BP in normotensive subjects , with a Further to dietary energy intake, our study also recorded the intake of macro-  and micronutrients  that have established effects on BP levels ,40,41,42To the best of our knowledge, the OLIVAUS study is the first human clinical trial to investigate the effect of OO polyphenols on measures of arterial stiffness through applanation tonometry. Stiffening of the arterial wall in the larger central arterial system represents an important CVD risk marker  and the The findings reported in our study should be interpreted in light of its strengths and limitations. The main strength of the present study is its randomized, double-blind, cross-over design that reduces interindividual variability and increases the external validity of the study findings. The use of applanation tonometry represents another strength, since it is a state-of-the-art, non-invasive method to measure BP and arterial stiffness. In addition, in a multiethnic population that is not accustomed to a high consumption of OO, our participants\u2019 compliance was overall high throughout both intervention periods. On the other hand, one of the limitations of the present study is that the sample size was calculated on the basis of the expected differences only in its primary outcome . Another limitation could be the potential effect of seasonality on the examined outcomes, due to the fact that the participants were enrolled in the study gradually . Lastly, despite the inclusion of a washout period before the initiation of the intervention and between the intervention periods, there is no guarantee that any potential carry-over effect on the examined hemodynamic markers was completely avoided. However, pairwise comparisons that examined potential carry-over effects were insignificant for all hemodynamic markers.To our knowledge, the OLIVAUS study is the first to examine the effect of OO polyphenols on peripheral and central SBP and DBP as well as on measures of arterial stiffness in Australian adults. Although there were no significant differences between OO treatments in any of the examined outcomes, there was a significant reduction in peripheral and central SBP after daily consumption of extra virgin HPOO for 3 weeks. This provides evidence for a potentially widely accessible dietary intervention that can reduce CVD risk in a multicultural context, such as in Australia. However, additional clinical trials of longer duration and use of EVOO with different phenolic content and profile are required to shed more light on the potential effect of OO polyphenols on other CVD risk markers, including DBP and arterial stiffness."}
{"text": "Background: The treatment of depression is a main strategy for suicide prevention in older adults. We aimed to calculate suicide rates by antidepressant prescription patterns in persons aged \u2265 75 years. A further aim was to estimate the contribution of antidepressants to the change in suicide rates over time.Methods: Swedish residents aged \u2265 75 years  were followed between 2007 and 2014 in a national register-based retrospective cohort study. Biannual suicide rates were calculated for those with selective serotonin reuptake inhibitor (SSRI) single use, mirtazapine single use, single use of other antidepressants and use of \u2265 2 antidepressants. The contribution of antidepressants to the change in biannual suicide rates was analyzed by decomposition analysis.Results: There were 1,277 suicides. About one third of these were on an antidepressant during their last 3 months of life. In the total cohort, the average biannual suicide rate in non-users of antidepressants was 13 per 100,000 person-years. The corresponding figure in users of antidepressants was 34 per 100,000 person-years. These rates were 25, 42 and 65 per 100,000 person-years in users of SSRI, mirtazapine and \u2265 2 antidepressants, respectively. In the total cohort, antidepressant users contributed by 26% to the estimated increase of 7 per 100,000 in biannual suicide rates. In men, biannual suicide rates increased by 11 suicides per 100,000 over the study period; antidepressant users contributed by 25% of the change. In women, those on antidepressant therapy accounted for 29% of the estimated increase of 4.4 per 100,000.Conclusion: Only one third of the oldest Swedish population who died by suicide filled an antidepressant prescription in their last 3 months of life. Higher suicide rates were observed in mirtazapine users compared to those on SSRIs. Users of antidepressants accounted for only one quarter of the increase in the suicide rate. The identification and treatment of suicidal older adults remains an area for prevention efforts. The oldest segment of the population is accountable for the highest suicide rates in many countries . DepressCurrently, over one fifth of the Swedish population aged 75 and above is prescribed antidepressants (ADs), mainly SSRIs and mirtazapine . AntidepSome previous research suggested an association between the increase in AD use and a decrease in suicide rates , 15, 16.The use of nationwide, register-based data can accrue the large sample sizes needed to examine suicide deaths with sufficient power and minimize the risk of selection bias. We aimed to investigate suicide rates in adults aged 75 years and above for the most common antidepressant prescription patterns. A further aim was to estimate the contribution of antidepressants to the change in suicide rates over time.We conducted a retrospective cohort register-based study of all Swedish residents aged 75 years and older between January 1, 2007 and December 31, 2013. Individuals had to be recorded as living in Sweden during the year prior to study entry in order to be included and were followed until December 31, 2014 or censored in case of death due to causes other than suicide.Data from various registers were linked using the personal identity number. All Swedish residents aged 75 years and older during the study period were identified from the Total Population Register at Statistics Sweden. The Swedish Prescribed Drug Register was employed to capture AD use. The register has full coverage of dispensed prescriptions in outpatient care and in residential care . It incln = 46,244), in order to reduce confounding by indication. The rationale for this was that these medications are no longer recommended for the treatment of depression in older adults in Sweden and are instead used for treatment of chronic pain  during the year that preceded the suicide and recorded the date of last refill and the specific AD prescribed . We exclnic pain .In order to ensure sufficient power, we considered categories of the prescription patterns most commonly seen in older adults in Sweden: (a) single use of SSRI, (b) single use of mirtazapine, (c) single use of other AD, and (d) use of \u2265 2 different ADs.The use of AD was considered as a time-varying exposure. In Sweden, patients may purchase up to 3 months' supply when redeeming a prescription. Alternatively, they may use the multidose system, which provides an automatic refill every 2 weeks. A person was considered as being on continuous exposure to AD treatment if she/he had \u2265 3 refills of AD \u2013 or \u2265 20 automatic refills for those using multidose \u2013 over a 12-month period. This approach ensured that AD medication covered 75% of days as a minimum. For individuals who died during the observation period, we calculated the proportion of days covered by AD during their last year of life to determine whether they should be considered to be on AD therapy.We collected data as recorded during the year participants entered the cohort. Characteristics included: sex, age group , previous episode of self-harm, residence in institution, use of other psychoactive medications  and use of cardiovascular medications (beta-blockers and statins). The selected characteristics were previously found to be associated with both antidepressant use and suicide. The use of specialized care for depression was considered as a proxy for serious depression. The relationship of the selected variables with suicide in users and non-users of antidepressant older than 75 years was previously investigated in our published study .Suicides were identified from the Cause of Death Register based on ICD-10 codes: Intentional self-harm (X60-X84), harm of undetermined intent (Y10-Y34), and sequelae of intentional self-harm and of events of undetermined intent (Y87.0 and Y87.2).t-test for continuous variables and Pearson's chi square test for categorical variables. The latter test was also employed to test for differences in proportions of individuals using other psychoactive medications among AD user groups compared with those using solely SSRI.First, we compared the baseline characteristics of users and non-users of AD using In order to distinguish random fluctuations due to small numbers from true changes, biannual suicide rates were calculated by AD use group and period for all AD users and non-users as well as for the most commonly prescription patterns.A decomposition technique was used to calculate the contribution of users of antidepressants to the change in the overall suicide rate. The decomposition technique is a method derived from demographic studies, widely used in health and behavior studies when rates of a phenomenon within the same population are compared at two different time points. This method takes into account the difference in the population composition between the time points in order to adjust for the confounding effect of population composition on the measured rates and accounts for the impact of compositional factors on the observed rates . In our As the analyses were based on existing population register data, informed consent from subjects was not required. Approval was granted by register holders. Statistics Sweden replaced the Personal identity number by a study number prior to data delivery and data were analyzed anonymously. The study was approved by the Regional Ethical Review Board in Gothenburg .A total of 1,401,349 individuals  were included in the cohort and followed for up to 8 years. This corresponds to 7,191,803 person-years . Key baseline characteristics are presented by AD use in In the total group, there were 1,277 suicides during the study period, and 70% of these occurred among men. Overall, 404 (31.6%) filled at least one AD during their final 3 months of life (28.6% of men and 38.6% of women) .In the total cohort, the average biannual suicide rates in those who were not on AD was 13 per 100,000 person-years . The corDuring the study period, in the total cohort, the percentage of person-years spent in AD treatment increased from 8.1% in 2007\u20132008 to 11.7% in 2013\u20132014 and the overall suicide rate increased from 12 to 19 suicides per 100,000 during the same period . In men,As seen in This nationwide cohort study covering Swedish residents aged 75 and above found that about one third of those who died by suicide filled an AD prescription during their final 3 months of life. Individuals who were on single AD treatment with mirtazapine, as well as those using more than one AD had higher suicide rates than those on a single SSRI. Older individuals not on AD therapy were accountable for the major share of the increase in the suicide rate during the study period while those on AD therapy made a small contribution to the overall change.Only about one third of those who died by suicide in our national cohort of individuals aged 75 and above were on AD. Considering that two-thirds of persons over 75 who die by suicide may be depressed , there iSeemingly, no previous study has calculated suicide rates by type of AD in this age group. A Canadian population-based study conducted in a general adult population found suicide rates in the range of those in our population . In our Our decomposition analysis suggests that non-users of AD contributed the most to the change increase in the suicide rate, which may in part be explained by the role of other factors affecting suicide such as social factors and other comorbidities , 34. TheThis is to our knowledge the first study to calculate nationwide suicide rates for individuals aged 75 and above treated with AD. Complete and systematically assembled register data with no loss to follow-up are some of the strengths of this study. This large national cohort provided enough power to assess rates of a rare event like suicide, allowing us to decompose the contribution of ADs to the change in the suicide rate in the Swedish population aged 75 and above. A main limitation is the lack of diagnosis-specific data from primary care as this information is not available in the National Patient Register. We could therefore not adjust for confounding by indication. This is problematic as antidepressants may have been prescribed for conditions other than depression , also associated with suicidality in older adults even in the absence of depression , 31. MorWe considered AD use as a time-varying exposure which allowed us to take into account changes in prescribing patterns that may have occurred during the 8-year study period. Our strict definition of continuous use of AD increased the likelihood that subjects had enough exposure to AD to derive therapeutic benefit. While we grouped biannual suicide rates to increase study power, the number of suicides for each specific substance (with the exception of mirtazapine) was small and did not allow for reasonable and stable estimation of suicide rates. The biannual rates in men and women should also be interpreted with caution due to small numbers. Comparison of our suicide rates with other countries should be interpreted with caution due to differences in population composition. Further, prescribing patterns may vary; some countries may still prescribe TCA for late-life depression. The results of this research may not be generalized to other countries or settings as availability of healthcare and reporting of suicide varies widely in a global perspective.Only one third of those aged 75 and above who died by suicide in this Swedish national cohort were on an antidepressant (non-tricyclic) during their last 3 months of life. Users of antidepressants accounted for only one quarter of the overall increase in the suicide rate in this age group between 2007 and 2014. Our findings, taken together with previous results demonstrating high rates of depression among older adults who die by suicide, highlight the need for intervention research to prevent suicide in this growing age group.https://scb.se/vara-tjanster/bestalla-mikrodata/, and https://www.socialstyrelsen.se/statistik-och-data/bestalla-data-och-statistik/.The data analyzed in this study is subject to the following licenses/restrictions: The datasets generated and/or analyzed during the current study are not publicly available due confidentiality but aggregated data are available from Statistics Sweden or the National Board of Health and Welfare upon request. Requests to access these datasets should be directed to The studies involving human participants were reviewed and approved by Regional Ethical Review Board in Gothenburg . Written informed consent for participation was not required for this study in accordance with the national legislation and the institutional requirements.KH, MW, and JF designed the study. KH was the guarantor, coordinated the statistical analysis, and drafted the manuscript. KH, MW, JF, and AE interpreted the data and participated to the critical revision of the manuscript. All authors had full access to all of the data  in the study and can take responsibility for the integrity of the data and the accuracy of the data analysis.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Osmotic demyelination syndrome (ODS) is characterized by loss of myelin in various parts of the central nervous system. It is mainly caused by a rapid correction of hyponatremia, although other factors that may cause rapid rise in serum osmolality can also be associated with its development. Its prognosis is poor and the recovery rate is unknown. The authors report a rare case of a patient with multiple risk factors for ODS, without hyponatremia, who developed ODS and surprisingly recovered. This case report highlights the importance of recognizing risk factors for the development of ODS, even if the main one is not present. Osmotic demyelination syndrome (ODS) is a rare condition  characteClostridium difficile, for which aggressive fluid resuscitation was needed. He was given antibiotics for the pseudomembranous colitis\u20144 days of vancomycin to which he did not respond, and he was then switched to fidaxomicin. He also developed hypokalemia which was corrected with intravenous potassium chloride (60\u2009meq a day for 5 days). Additionally, he had poor glycemic control for which insulin was instituted. Six days after this complication, he developed a slurred speech and a progressive decline in his level of consciousness throughout the course of the next two days. Neurologic examination revealed quadriplegia and, few days later, he developed a \u201clocked-in syndrome.\u201dA 55-year-old male with a history of insulin dependent type 2 diabetes mellitus was admitted to the nephrology department with anasarca. He had a nephrotic syndrome for at least 2 years caused by diabetic nephropathy and had history of nonadherence to medication. Despite the generalized edema, he was noticeably malnourished. The patient was treated with high doses of furosemide and was also given ceftriaxone for a urinary tract infection. After eight days of hospital admission, he developed hypovolemic shock caused by a pseudomembranous colitis due to 3, normal glucose and protein levels, negative Gram stain, Ziehl\u2013Neelsen stain and bacterial culture, and negative PCR for Herpes simplex virus. Electroencephalogram revealed diffuse and symmetric slow wave activity. An MRI was then performed revealing heterogeneous T1-hypointense, T2-hyperintense, and FLAIR-hyperintense areas located in the pons, cerebellar peduncles (mainly in the middle cerebellar peduncles), which were compatible with ODS (There were no electrolyte disturbances in blood analysis by the time the patient developed these symptoms . The onlwith ODS . MRI alsAcinetobacter baumannii which was resolved with meropenem. Throughout the first month of recovery, he had a continuous and persistent program of physiotherapy and partially regained his legs and arms movements. When he was discharged, he was able to stand on orthostatic position and walk with bilateral support. He continued the rehabilitation program to regain complete autonomy.Supportive treatment was given to the patient, and, unexpectedly, he started recovering from coma over the following week. During this first week, he progressively recovered his level of consciousness with an intelligible speech. He also developed, during the recovery course, a bacteremia by Adams et al. were the first to describe pontine myelinolysis in 1959 . Today, The main risk factor for ODS is rapid correction of chronic hyponatremia, particularly when it is lower than 120\u2009meq/L . CerebraFrequently, symptoms are delayed for two to six days after rapid correction of osmolality and it can present in various ways . AsymptoCT assessment of the skull base can be difficult due to beam hardening artifact. The preferable diagnostic method is MRI. Findings might be delayed up to four weeks after the initial symptoms . It reveThe most important therapy is prevention of rapid correction of hyponatremia, or in susceptible patients, prevention of rapid changes in plasma osmolality. Treatment is mainly supportive, but some case reports have shown that the use of intravenous immunoglobulin or plasmapheresis may be useful as they may remove myelotoxic substances from plasma .Overall, ODS has a poor prognosis with a high mortality rate. Patients who survive may not recover if in a coma and irreversible sequelae may persist . No clinWe reported an unusual case of CPM with no hyponatremia. After the unexpected diagnosis by MRI, we concluded that, even in the absence of the latter in our patient, the combination of multiple risk factors contributed to the development of ODS. First, he had a prolonged history of diabetes mellitus with nephrotic syndrome and poor glycemic control, which contributed to severe proteinuria and malnutrition. During the first days after admission, he was also given a high and prolonged course of diuretics to treat the anasarca. After the abrupt diarrhea that caused the hypovolemic shock and hypokalemia, he was given a large amount of fluids. From our point of view, this was the main trigger event that caused the rapid change in osmotic balance. After this event, the chronological presentation of neurologic manifestations is consistent with ODS.There are rare, but similar, cases reported of ODS without hyponatremia. Jacob et al. described a similar case in a patient with no risk factors besides aggressive fluid resuscitation after acute bleeding . BendersThis case report also emphasizes the need to always be mindfulness with the therapeutic measures we take, even when we think they are innocuous."}
{"text": "Welders demonstrate a significant prevalence of work\u2010related musculoskeletal disorders as indicated by high rates of illness\u2010related absenteeism. The aim of the study was to investigate the effects of a 24\u2010week exercise program on workload, physical performance, and overall health in welders.Seventy\u2010seven professional welders were assigned to either a control group (CG), an endurance training group (ETG), or a strength training group (STG). Both groups conducted a 24\u2010week, standardized and progressive endurance or resistance exercise training program. Before (TP1) and after training (TP2) all participants performed an experimental welding task (EWT) in order to test the hypothesis that training would reduce the relative load (%MVC) of eight skeletal muscles measured by surface electromyography. Secondary outcome measures included further EWT\u2010induced stress parameters and a series of health\u2010related outcome measures.P\u00a0<\u00a0.05 vs CG). Rate of perceived exertion and visual analogue scale were decreased, while increase of maximum EWT duration was found in participants of the ETG and STG after training (P\u00a0<\u00a0.05 vs CG). At T2, body fat (%) decreased and physical performance  increased in ETG and STG (P\u00a0<\u00a0.05).Results revealed a lower muscle load in participants of the ETG and STG for trapezius muscle at TP2 compared to T1 (Both regular endurance and strength training represent effective strategies for reducing workload and improving physical performance of welders. The results emphasize the importance of physical fitness for welders and might motivate health professionals in steel\u2010industry to offer access to exercise training programs. Since a randomization to the intervention groups was not accepted by some of the participants the investigators decided to adapt the design to a quasi\u2010experiment where the participants choose their groups themselves. Group 1 performed a 24\u2010week strength training (strength training group [STG]) which was specially designed for the demands during welding. Group 2 performed a 24\u2010week endurance training (endurance training group [ETG]) and Group 3 received no additional treatment (control group [CG]). All measurements were conducted before training (T1) and after training (T2). As main outcome measure, the relative load of trapezius muscle was chosen.2.2Seventy\u2010seven participants  completed the 24\u2010week intervention and were included into data analysis. Their age and anthropometrics are shown in Table\u00a02.3The EWT was designed to simulate the occupational workload of welders by means of a standardized laboratory experiment and was performed without electricity and no welding light to avoid interferences with the surface electromyography (SEMG) and to increase work safety, respectively. The EWT was performed in two positions: First, the participants performed EWT in a standing overhead Position (StOP) (ASME: 4F) Figure\u00a0. The pos2.4\u00ae Inc USA). Preparation and electrode  placement (middle of the muscle belly with 2\u00a0cm interelectrode distance) were consistent with the SENIAM guidelines for SEMG recordings.Surface electromyography (SEMG) was used to determine the relative muscle activity load throughout the EWT. SEMG signals were determined from shoulder\u2010neck , core (erector spinae m. at the height of lumbar vertebrae 1), and arm muscles  by a bipolar wireless eight channel system . Maximum heart rate (HRmax) was calculated at the end of all four passes. Maximum blood pressure (systolic [SBPmax]/diastolic [DBPmax]) was measured using an electronic blood pressure monitor  at the end of all four passes, too. Immediately after finishing each EWT position, the study participants rated their maximum perceived pain upward from the hips and maximum overall exertion by means of a 100\u2010mm visual analogue scale (VASmax) and Borg rating of perceived exertion scale (6\u201020) (RPEmax), respectively.2.6Body fat (%) and muscle mass (%) were analyzed by bioelectric impedance analysis (BIA) .A bicycle exercise test  was performed until exhaustion . Therefore, we measured maximum bicycle performance (maximum workload in watt [W]) and relative bicycle performance in relation to body weight (BW) (W/kg/BW) as outcome measures to quantify endurance capacity. Maximum bicycle performance (W) was calculated according to the formula: workload last stage completed (W)\u00a0+\u00a0[time of the last uncompleted stage (sec)/stage duration (sec)\u00a0\u00d7\u00a0stage increments (W)].Maximum strength tests were performed to measure muscular capacity. Peak isometric torque (Newton meter [Nm]) during elbow flexion and extension, knee flexion and extension, as well as trunk flexion and back extension were measured by the m3\u2010Diagnos analysis station (Schnell). Two trials were completed for each position, with contractions lasting 5\u00a0seconds, separated by 30\u00a0seconds rest intervals. Participants were encouraged verbally to elicit their maximal effort . Peak torque values (Nm) were recorded, and the higher of the two repetitions was used for statistical analysis.In addition, health\u2010related quality of life was assessed by the SF\u201036 questionnaire. Physical component summary (PCS) and mental component summary (MCS) were calculated.2.7The training program followed exercise guidelines for the general population from the American College of Sports Medicine.Participants of the STG performed a whole\u2010body strength training program and included a periodized variation of program variables. Precisely, during the first 12\u00a0weeks, participants performed the training in 3 sets of 20\u201025 repetitions at 55%\u201060% of their one repetition maximum (1RM). At the second 12\u00a0weeks, training was performed in 3 sets of with 10\u201015 repetitions at an intensity of 70%\u201075% of 1RM. There was a 60\u2010sec break between each set. The resistance training program considered those muscles which are stressed during welding most such as back, shoulder\u2010neck, and forearm and their antagonists, too. All participants received an introduction by a sports scientist and performed the strength training 2\u20103 times a week self\u2010depended thereafter. The exercise intensity was adapted to the individual training process as shown by additional measurements of the 1RM at weeks 8 and 16. To increase the compliance the investigator contacted the study participants by telephone at week 4, 12, and 20  walking according to their own preferences thrice a week separated by a minimum of 24\u00a0hours rest. Endurance training program was designed in a standardized and progressively way and included a periodized variation of program variables, too. In weeks 1\u201012, participants performed moderate intensity twice and vigorous intensity once. Duration of moderate intensity increased from 30\u00a0minutes each 4\u00a0weeks by 5\u00a0minutes up to 40\u00a0minutes, while vigorous intensity stayed consequently at 20\u00a0minutes. At the beginning of week 13 up to week 24, participants performed moderate intensity once and vigorous intensity twice. Duration of vigorous intensity increased from 30\u00a0minutes each 4\u00a0weeks by 5\u00a0minutes up to 40\u00a0minutes, while moderate intensity keeps consequently at 40\u00a0minutes. Therefore, training volume increased in both periods every 4\u00a0weeks by 10%. Moderate intensity was defined as 65%\u201075% of individual maximum heart rate and a vigorous intensity was defined as 75%\u201085% of individual maximum heart rate. The highest recorded heart rate at the end of the final stage of the bicycle exercise test was regarded as maximum heart rate. The participants controlled their training intensity themselves by wearing a heart rate monitor Polar\u00ae Heart Rate Monitor FT1 (Polar\u00ae Electro GmbH B\u00fcttelborn). In weeks 4, 8, 12, 6, and 20, the participants were contacted by telephone in addition to the training protocol . As all data were normally distributed (Kolmogorov\u2010Smirnov test), parametric tests could be applied for further analysis. Initial baseline measurements were analyzed by analysis of variance (ANOVA) to determine differences between the groups. To determine the interaction of group x time point and time effect a two\u2010way ANOVA with repeated measures (3\u00a0\u00d7\u00a02) was calculated. Bonferroni\u2010Holm corrected tests were used for post hoc analysis to detect differences between groups and time points. Due to the explorative nature of the investigation of all secondary outcome parameters, no adjustment of the alpha error for multiple testing has been considered. If not indicated otherwise, results are given as arithmetic mean\u00a0\u00b1\u00a0standard deviation (SD). The level of statistical significance was set at 3In total, attendance rate of ETG amounted to 77%\u00a0\u00b1\u00a025% (55\u00a0\u00b1\u00a018 of 72 training sessions) and attendance rate of STG amounted to 66%\u00a0\u00b1\u00a021% (40\u00a0\u00b1\u00a013 of 60 training sessions).3.1F1,73\u00a0=\u00a05.93; P\u00a0=\u00a0.017) but no time\u00a0\u00d7\u00a0group  in standing overhead position (StOP). Post hoc analysis showed significant reduction of muscle load between TP1 and TP2 in STG   or ETG (P\u00a0=\u00a0.30). The two\u2010way repeated\u2010measure ANOVA revealed a significant effect for time  and time\u00a0\u00d7\u00a0group  in sitting bended position (SiBP). Post hoc analysis of time effect showed significant reduction of muscle load between TP1 and TP2 in ETG  and STG  , as well as STG and CG (P\u00a0=\u00a0.048). A significant time effect for infraspinatus muscle in StOP was observed, while post hoc analysis showed no significant difference (P\u00a0=\u00a0.078). In SiBP, analysis of the erector spinae muscle revealed a significant effect for time\u00a0\u00d7\u00a0group. Post hoc analysis revealed no significant differences between groups, too . A significant time and time\u00a0\u00d7\u00a0group effect were detected for pectoralis major muscle in SiBP. The post hoc analysis showed a significant difference within STG (P\u00a0=\u00a0.012) and between STG vs CG (P\u00a0=\u00a0.003)  Figure\u00a0. There w3.2P\u00a0=\u00a0.018) and in SiBP (ETG: P\u00a0=\u00a0.030). The analysis of subjective exertion showed a significant time effect for RPEmax in StOP  and SiBP (ETG: P\u00a0\u2264\u00a0.001). Additionally, there was a time\u00a0\u00d7\u00a0group effect for RPEmax in StOP  and SiBP (ETG vs CG: P\u00a0=\u00a0.006). Furthermore, we detected a significant time effect for VASmax in StOP (STG: P\u00a0=\u00a0.012). Data analysis revealed further a significant time\u00a0\u00d7\u00a0group effect in StOP while there were no significant difference in post hoc analysis between groups. However, in SiBP there was a significant difference between ETG vs CG (P\u00a0=\u00a0.012) and STG vs CG (P\u00a0=\u00a0.015). Additionally, we found a significant time effect for EWT\u2010duration  and a time\u00a0\u00d7\u00a0group effect  in StOP  and time\u00a0\u00d7\u00a0group effect . Muscle mass (%) showed a time effect, too , but no interaction. Among the bicycle exercise test a significant time effect in maximum bicycle performance (W) , as well as relative bicycle performance (W/kg/BW) (ETG: P\u00a0=\u00a0.003) was found. Moreover, we detected significantly time\u00a0\u00d7\u00a0group effects for maximum bicycle exercise (W)  and relative bicycle exercise (W/kg/BW) (ETG vs CG P\u00a0=\u00a0.027). The results of maximum strength test revealed a significant time x group effect of trunk flexion . Additionally, there was a significant time effect  and time\u00a0\u00d7\u00a0group effect  for back extension (Table\u00a0Body fat (%) revealed a significant time effect (ETG: Due to significant group differences for PCS at baseline no ANOVA was performed.4This study indicates that both a 24\u2010week strength as well as endurance training exert beneficial effects on work\u2010related stress and on different dimensions of health and performance in professional welders. Both exercise training interventions were effective in reducing the muscle workload, the degree of subjective exertion and the perceived pain intensity after EWT. In parallel, the maximum possible duration of the welding task increased when compared to control. Within ETG maximum heart rate decreased during welding task. Results slightly differed between StOP and SiBP relating to physical response. Strength and exercise capacity increased and body fat mass decreased following both interventions compared to control. Body muscle mass increased after strength and endurance exercise program. Overall health and performance parameter were improved equally by both interventions.Regarding the MVC measures relative load of the trapezius muscle was chosen as primary outcome measure. Former studies demonstrated that the upper trapezius muscle indicated one of the highest stress during welding especially in overhead positions.Surprisingly, an increase in relative muscle load of pectoralis major m. in SiBP was found. Albeit the pectoralis m. showed the lowest load of all measured muscles during EWT. This muscle is an important synergist of stabilizing muscle groups of the shoulder, such as rotator cuff, especially of the subscapular and deltoid muscles.Interestingly, the reduced muscular load of the trapezius muscle in SiBP was also detected in ETG. It is suggested that this is a result of ameliorated physical conditions as indicated by maximum bicycle and core strength test results and reflect improved welding ergonomics in general. We further assume that the alterations in relative muscle load may result in general health benefits and contribute to a reduced risk for shoulder\u2010neck disorders among welders in long\u2010term.Altered muscle activation went along within a reduction of RPEmax and VASmax. This is not surprising, since a lower level of muscular load induces less physical exertion and muscular pain. VAS seems to be a good indicator of musculoskeletal symptoms, and also RPE is commonly used to evaluate job related strains.The various effects of a regular resistance or endurance training on physical functions and health are well evaluated. Accordingly, the loss of body fat and increases in muscle mass are known reducing factors for cardiovascular diseases. Similarly, increased endurance capacity and muscular strength represents an important factor for overall health.Beside a positive effect on welders' health and wellbeing, companies are interested in a high productivity of their staff. In order to quantify working performance, EWT duration was analyzed, too. The present results show that a longer EWT duration could be achieved after both exercise programs in StOP. Consequently, we cannot exclude a bias on other outcome measures as a longer welding duration could result in a higher degree of fatigue.Overall, the attendance rate to the training program was only moderate to poor, especially in STG. Albeit, we did not evaluate the reason for missing training sessions. From the overall feedback, we conclude that training program itself represent no barriers for attendance. Nevertheless, even two to three sessions of endurance training or one to two sessions of strength training per week seems to reduce workload, improves physical performance, and promotes overall health in welders. However, given a low attendance rate in this study, the authors would expect that a higher exercise frequency would be more effective which is in line with other studies.Anyway, this study has some limitations. First, a randomization was not applied. Consequently, a selection bias may have occurred in terms of unbalanced training experience, prevalence of MSD, and work experience over the study groups. For instance, it cannot be excluded that participants chose to take part in a training group due to their own training experience. If this were the case, training adaptation effects would be underestimated since untrained individuals have higher adaptation potentials. Furthermore, the EWT was performed under standardized laboratory conditions increasing the internal validity of this study. Anyhow, the external validity was negatively affected since welders are generally exposed to additional stressors such as weight of protective clothing, fumes, and heat but we could not imitate these extreme conditions for technical reasons. Last, information about both, attendance rate and adherence to training were derived from the participant's self\u2010report, which could bias the results.In conclusion, this study demonstrated that a regular strength or endurance training induces various objective and subjective adaptations in welders. These data emphasize the benefit of a physical training in the prevention and health promotion of welders in terms of reducing workload, increasing physical performance, and improving overall health. Regarding our main outcome measures both exercise programs seem to have similar benefits, whereby strength training seems to be a bit more favorable. Secondary measures indicated differentiated effects for each exercise type without pointing out a superiority of one exercise type. While strength training has a greater impact on the muscular activation pattern endurance training exerts positive cardiovascular effects during welding. Both interventions lead to a decrease of subjective exertion. If these programs are also able to reduce WMSD, long\u2010term illnesses and painful conditions, and prevent work\u2010related absenteeism has to be evaluated in future studies.Approval of the research protocol: This study was approved by the local ethics committee of the Justus\u2010Liebig\u2010University Giessen, Germany. Informed consent: All participants gave written informed consent before enrolment. Registry and the registration no. of the study/trial: N/A. Animal studies: N/A. Conflict of interest: The authors declare that they have no competing of interests.All listed authors have significantly contributed to this work. CP, KK, and FCM conceived and designed research. CW, CP, TR, TF, and FCM conducted the experiment. CW analyzed the data and wrote the manuscript with CP and KK. All authors read and approved the final manuscript."}
{"text": "Despite the success of immune checkpoint inhibitors (ICI) for treating a variety of solid cancers, most gastric cancer patients are resistant to ICI monotherapies. Combinations of ICI with other therapies may be able to overcome this resistance. In order to develop combination immunotherapies, immunologically well-characterized preclinical gastric cancer models are required. To this end, in the present study, we characterized two murine gastric cancer cell lines, namely, YTN2 which spontaneously regresses, and YTN16 which grows progressively. Although anti-CTLA-4 monotherapy eradicated most YTN16 tumors, these were resistant to either anti-PD-1 or anti-PD-L1 treatment. Furthermore, we identified neoantigens in YTN2 and YTN16 tumors and conducted neoantigen-based immunotherapy for these tumors. In addition, the information on neoantigens facilitates the evaluation of tumor-specific immune responses induced by the combination therapies. These immunologically well-characterized gastric cancer models will contribute to the development of novel combination immunotherapies.+ T cells successfully inhibited the YTN16 tumor growth. Targeting mutated Cdt1 had better efficacy for controlling the tumor. Therefore, mutated Cdt1 was the dominant neoantigen in these tumor cells. More mCdt1 peptides were bound to MHC class I and presented on YTN2 surface than YTN16. This might be one of the reasons why YTN2 was rejected while YTN16 grew in immune-competent mice.To develop combination immunotherapies for gastric cancers, immunologically well-characterized preclinical models are crucial. Here, we leveraged two transplantable murine gastric cancer cell lines, YTN2 and YTN16, derived from the same parental line but differing in their susceptibility to immune rejection. We established their differential sensitivity to immune checkpoint inhibitors (ICI) and identified neoantigens. Although anti-CTLA-4 mAbs eradicated YTN16 tumors in 4 of 5 mice, anti-PD-1 and anti-PD-L1 mAbs failed to eradicate YTN16 tumors. Using whole-exome and RNA sequencing, we identified two and three neoantigens in YTN2 and YTN16, respectively. MHC class I ligandome analysis detected the expression of only one of these neoantigens, mutated Cdt1, but the exact length of MHC binding peptide was determined. Dendritic cell vaccine loaded with neoepitope peptides and adoptive transfer of neoantigen-specific CD8 Gastric cancer is the fifth most frequent cancer and the fourth most common cause of cancer death worldwide . Anti-PDFor developing targeted therapies for cancer, it is common for candidate drugs to be initially evaluated using cancer cell lines in culture and xenografts in immunodeficient mice. Given that ICI therapy targets the host\u2019s immune system, immunocompetent animal models are needed to facilitate the development of new combination therapies. Because no immunologically well-characterized transplantable murine gastric cancer cell lines were available, from one tumor we established four subclones that could be transplanted into C57BL/6 mice [These earlier studies demonstrated that these gastric cancer cell lines might also be valuable for developing cancer immunotherapies. To this end, here we characterize two of these gastric cancer cell lines, YTN2 and YTN16, in terms of the expression of neoantigens derived from tumor-specific mutant proteins. Our findings may provide useful information for enhancing the development of models for novel effective immunotherapies for gastric cancers.b:Ig (H-2Db dimer), DimerXI:Recombinant Soluble Dimeric Mouse H-2Kb:Ig (H-2Kb dimer) were from BD Biosciences . FITC-conjugated anti-CD3\u03b5, PerCP/Cyanine5.5-conjugated anti-CD4, APC/Cyanine7-conjugated anti-CD8, APC-conjugated anti-IFN-\u03b3 and Pacific Blue-conjugated anti-CD45 mAbs were from BioLegend .Six-week-old female C57BL/6N mice were purchased from Japan SLC  and kept in a specific pathogen-free environment. The animal use proposal and experimental protocols were reviewed and approved by The University of Tokyo Animal Care and Use Committee (ID:P15-125) and all animal procedures were conducted in accordance with institutional guidelines. The YTN2 and YTN16 cell lines [6 YTN2 or YTN16 subcutaneously into the right flank. Anti-PD-1 (200 \u03bcg), anti-PD-L1 (200 \u03bcg), anti-CTLA-4 (100 \u03bcg), and/or anti-CD8\u03b1 (200 \u03bcg) were injected intraperitoneally. Tumor growth was monitored every 2 to 3 days with calipers, and tumor volume was calculated by the formula \u03c0/6 \u00d7 L1L2H, where L1 is the long diameter, L2 is the short diameter, and H is the height of the tumor.Mice were inoculated with 5 \u00d7 10Genomic DNA was extracted from YTN2, YTN16, LLC1, and B16F10 cell lines using Allprep DNA/RNA mini kits  according to the manufacturer\u00b4s protocols. DNA was randomly fragmented by Covaris and adapters were ligated to both ends of the fragments. DNA was then amplified by ligation-mediated PCR, purified, and hybridized to the Roche NimbleGen SeqCap EZ Exome probe . The captured library was loaded onto the HiSeq 2000 and HiSeq 4000 platforms . After trimming of adapter sequences, reads were aligned to mm10 mouse reference sequences using the Burrows\u2013Wheeler Aligner (BWA). Somatic variants were detected using SOAPsnp. Raw data were deposited in the Sequence Read Archive (SRA) database . WES data of MC38 was downloaded from the SRA database (SRR5684459).9, where Y is the number of fragments mapped to a gene; L is the length of the gene; N is the total number of mapped reads of a sample. Raw data were deposited in the Gene Expression Omnibus (GEO) database (GSE146027 and GSE184092).Total RNA was isolated using TRIzol RNA Isolation Reagent  and RNeasy mini kits (Qiagen). RNA-Seq libraries were prepared using TruSeq Stranded mRNA Library Prep (Illumina) according to the manufacturer\u2019s protocols and sequenced on NovaSeq 6000 and HiSeq X systems (Illumina). The reads were aligned to mm10 reference sequences with STAR (version 2.7.0f). The mapped reads were counted with featureCounts (version 1.6.4). Fragments per kilobase of exon per million reads mapped (FPKM) was calculated by the formula Y/LN \u00d7 1050 and eluted ligand (EL) rank to H-2Db and H-2Kb. Presentation percentiles of MHCflurry (ver.2.0.1) [50 of NetMHCpan \u2264 250 nM, EL rank of NetMHCpan \u2264 0.5 and presentation percentile of MHCflurry \u2264 0.5 were selected. Peptides were synthesized by standard solid-phase synthesis using a Syro I  as described previously [First, we selected expressed mutations as follows: FPKM \u2265 30 and RNA variant allele frequency (VAF) \u2265 0.04. Then 8-, 9-, and 10-mer epitopes containing the mutated amino acid were inspected using NetMHCpan2.8 [eviously .5 RMAS cells incubated overnight at 26 \u00b0C were mixed with titrated peptide concentrations in 0.25% BSA-containing DMEM, incubated for 30 min at room temperature, and then exposed to 37 \u00b0C for 70 min. Cells were then stained with FITC-labeled anti-Kb mAb (B8.24.3) or FITC-labeled anti-Db mAb (B22.249) and analyzed by flow cytometry. Differences between experiments were normalized by including the reference peptides in every assay.Peptide binding was measured by a stabilization assay using TAP-deficient RMAS cells ,12. Brie9 YTN2 or YTN16 cells were lysed in buffer containing 0.25% sodium deoxycholate, 0.2 mM iodoacetamide, 1 mM EDTA protease inhibitor cocktail (Sigma-Aldrich), 1 mM PMSF, and 1% octyl-\u03b2-D glucopyranoside . The peptide-MHC class I complexes were captured by affinity chromatography using purified monoclonal antibodies (clone Y-3 for Kb and 28-14-8S for Db) coupled to CNBr-activated Sepharose 4B . Peptides bound to MHC class I were eluted with a mild acid (0.2% TFA) and desalted using a Sep-Pak C18 cartridge  with 28% ACN in 0.1% TFA and ZipTip U-C18  with 50% ACN in 1% FA. Samples were dried using vacuum centrifugation and dissolved in 5% ACN in 0.1% TFA for LC-MS/MS analysis. Samples were loaded into a nano-flow LC  online-coupled to an Orbitrap mass spectrometer equipped with a nanospray ion source . The nonsynonymous mutations unique to YTN2 or YTN16 were translated in frame and the polypeptide sequences encompassing mutations with a maximum length of 61-mer amino acids were matched against a conventional protein reference database (Swiss-Prot). MS/MS data were searched against personalized custom reference databases using Sequest HT and Mascot  on the Proteome Discoverer platform (Thermo Fisher Scientific) with a tolerance of precursor and fragment ions of 10 ppm and 0.02 Da, respectively. A false discovery rate (FDR) of 0.01 was used in the Percolator node of the Proteome Discoverer version 2.2 software (Thermo Fisher Scientific) as the peptide detection threshold.Direct detection of neoantigens using mass spectrometry has been described previously . Briefly8 IFN-\u03b3-treated  YTN16 cells were treated with citrate-phosphate buffers  for 1 min at room temperature. The eluted peptides were loaded onto a Sep-Pac C18 cartridge (Waters Corporation), washed with water, eluted with 60% acetonitrile, lyophilized using a Solvent SpeedVac (Thermo Fisher Scientific), and reconstituted in the citrate-phosphate buffer. Peptides of 3000 Da were then isolated by filtration through Centricon-3 ultrafiltration devices (Merck Millipore). The resulting flowthrough was then fractionated by reverse-phase high-performance liquid chromatography (HPLC). Briefly, bulk peptides were fractionated on a YMC-Pack ODS-A column  by the following gradient from solvent A (1% acetonitrile/0.1% HCl) to solvent B (80% acetonitrile/0.1% HCl): from 0 to 5 min, 0% B; from 5 to 10 min 0\u201312.5% B; from 10 to 70 min, 12.5\u201375% B. The flow rate was maintained at 0.5 mL/min, and fractions (0.5 mL each) were collected from 15 min to 70 min. The fractions were lyophilized. For T cell assays, the lyophilized samples were reconstituted in 50 \u03bcL HBSS and 10 \u03bcL were added to 1 \u00d7 105 cells from the mutated (m) Zfp106-reactive CD8+ T cell line in 200 \u03bcL medium. After overnight culture, the supernatants were harvested and IFN-\u03b3 was evaluated using Mouse IFN-\u03b3 ELISA Ready-SET-Go kit (Thermo Fisher Scientific) according to the manufacturer\u2019s protocol.MHC class I binding peptides were eluted from viable YTN16 cells as described previously . Firstly+ T cell lines, YTN16 tumor-bearing mice were treated with anti-PD-1 and/or anti-CTLA-4 mAbs. The spleens were harvested from mice that rejected the tumor, and 5 \u00d7 106 splenocytes were stimulated with IFN-\u03b3 (10 U/mL) and 1 \u00d7 105 irradiated (100 Gy) cells from the YTN16 cell line in the presence of 100 U/mL recombinant human IL-2 . The cells were re-stimulated with YTN16 on day 7 and harvested on day 12\u201314. They were screened for reactivity to YTN16 antigens by separately culturing them (1 \u00d7 105) overnight with 11 candidate short peptides at 1 \u03bcg/mL, harvesting the supernatants, and quantifying IFN-\u03b3 production by ELISA.To generate YTN16 cell line-specific CD8+ T cell line, splenocytes from mice that had rejected YTN2 were stimulated with IFN-\u03b3-treated (10 U/mL) and 100 Gy-irradiated YTN2 cells four times weekly. For establishment of the mCdt1-reactive CD8+ T cell line, splenocytes of mice that had rejected YTN16 following treatment with anti-CTLA-4 mAb were stimulated with the 9-mer mCdt1 peptide at 1 \u03bcg/mL four times weekly. For establishment of the mScarb2-reactive CD8+ T cell line, splenocytes of mice that had rejected YTN16 after anti-CTLA-4 treatment were stimulated with IFN-\u03b3-treated (10 U/mL) and 100 Gy-irradiated YTN16 cells. Seven days later, mScarb2-H-2Db dimer+ CD8+ cells were sorted on an SH800S  and stimulated with IFN-\u03b3-treated (10 U/mL) and 100 Gy-irradiated YTN16 cells another three times weekly.For establishment of the mZfp106-reactive CD8b and H-2Kb dimers. For intracellular cytokine staining, 1 \u00d7 105 cells were stimulated with peptides, 1 \u00d7 105 YTN2 or 1 \u00d7 105 YTN16 cells in the presence of 10 \u03bcg/mL brefeldin A (Sigma-Aldrich) for 4 h. After staining dead cells with the Fixable Viability Dye eFluor 450 (Thermo Fisher Scientific) and blocking Fc receptors with anti-CD16/32 mAb, the cells were stained with mAbs for cell surface antigens, followed by fixation, permeabilization, and staining with APC-conjugated anti-IFN-\u03b3 mAb (BioLegend) using Intracellular Staining Fixation Buffer and Intracellular Staining Permeabilization Wash Buffer (10X) (BioLegend) according to the manufacturer\u2019s protocols.Tumors were cut into pieces and incubated in RPMI-1640  supplemented with 1% FBS, 10 mM HEPES, 0.2% collagenase  and 2 KU/mL DNase I (Sigma-Aldrich) for 40 min at 37 \u00b0C. All material was passed through a 70 \u03bcm cell strainer to obtain single cell suspensions. After staining dead cells using a Zombie Yellow Fixable Viability Kit (BioLegend) and blocking of Fc receptors with anti-CD16/32 mAb , the cells were stained with mAbs for cell surface antigens, H-2D+ T cells, 1 \u00d7 106 neoepitope peptide-pulsed DCs were subcutaneously injected into the flank of mice twice biweekly. Two weeks after the second vaccination, the splenocytes were stimulated with the corresponding peptides and IFN-\u03b3 production was determined by intracellular cytokine staining. For evaluation of anti-tumor effects of neoepitope peptide-pulsed DC vaccines, mice were inoculated with 5 \u00d7 106 YTN16 cells on day 0 into the right flank. Neoepitope peptide-pulsed DCs were injected into the left flank on day 5. Tumor growth was monitored every 2 to 3 days.DCs were prepared as described previously . Briefly6 YTN16 cells on day 0. On day 6, 1 \u00d7 107 neoantigen-reactive CD8+ T cells were infused intravenously. Tumor growth was monitored every 2 to 3 days.Mice were inoculated with 5 \u00d7 10Data are presented as mean \u00b1 SD. Statistical analyses were performed with Prism software . Comparison of results was carried out by one-way ANOVA testing with Dunnet\u2019s multiple comparison test.+ T cell-mediated [+ T cells using anti-CD8\u03b1 mAb prevented tumor rejection on anti-CTLA-4 antibody treatment (+ T cell responses.YTN2 and YTN16 are subclones derived from the same gastric cancer cell line established from an N-methyl-N-nitrosourea (MNU)-induced tumor [mediated . Thereforeatment c,d, indi+ T cell responses, we determined the specificity of tumor-reactive CD8+ T cells in YTN2 and YTN16 tumor-bearing mice. First, we established YTN2-reactive CD8+ T cell lines from the spleens of mice that had rejected YTN2 tumors, and YTN16-reactive CD8+ T cell lines from mice that had rejected their YTN16 tumors following treatment with anti-PD-1, anti-CTLA-4, or a combination of anti-PD-1 and anti-CTLA-4 mAbs. After two rounds of weekly in vitro stimulation with irradiated tumor cells, we obtained YTN2- and YTN16-reactive CD8+ T cell lines  were lysed and peptide-MHC class I complexes were precipitated with anti-MHC class I antibodies. The bound peptides were analyzed by tandem mass spectrometry. From YTN2 tumor cells, 424 H-2Db-binding and 228 H-2Kb-binding peptides were identified , both G1966A and T1975C mutations were found on the same reads e. Theref 10\u221211 M f. Furthe peptide f. This s+ T cells and identified three neoepitopes ). In addition, the identification of specific neoepitopes eluted from tumor MHC molecules through immunopeptidomics, or LC-MS/MS-based immunopeptidomics, confirms that the neoepitopes are processed and presented at the cell surface [+ T cells was a 10-mer peptide rather than the 9-mer peptide predicted by in silico algorithms  and pep+ T cell responses. We successfully demonstrated the neoantigen-based immunotherapy-controlled tumor growth. Identification of neoantigens enables monitoring of the dynamics of anti-tumor immune responses and helps evaluate the effect of combination immunotherapies on tumor-specific immune responses. This information will contribute to the development of novel combination immunotherapies for gastric cancer.Here, we immunologically characterized two gastric cancer cell sublines derived from the same parental line but with very different behaviors. We provided information on the efficacies of ICI treatment and neoantigen-specific CD8"}
{"text": "Origanum syriacum, Rhus coriaria, Eryngium creticum, and Cichorium intybus were among the most quoted species by informants. Sleeq (steamed leafy vegetables), Zaatar (breakfast/dinner food), and Louf (soup) were the most popular wild plant-based dishes.Wild food plants (WFPs) have been an important source of human nutrition since ancient times, and it particularly revives when conventional food is not available due to emergency situations, such as natural disasters and conflicts. The war in Syria has entered 10 years since it started in 2011, and it has caused the largest war-related crises since World War II. Nearly 60% of the Syrian population (12.4 million people) are food-insecure. WFPs are already culturally important in the region, and may be supplementing local diets during this conflict. Our study aimed to uncover the conflict\u2019s effect on the use of WFPs and to know what species are consumed by local people during the current crisis. The fieldwork was carried out between March 2020 and March 2021 in the Tartus governorate located in the coastal region of Syria. Semi-structured interviews were conducted with 50 participants (26 women and 24 men) distributed in 26 villages along the study area. We recorded the vernacular names, uses, plant parts used, modes of preparation and consumption, change in WFP use before and during the conflict, and informants\u2019 perceptions towards WFPs. We documented 75 wild food plant species used for food and drink. Almost two-thirds (64%) of informants reported an increase in their reliance on wild plants as a food source during the conflict. The species of  Food is located at the bottom of Maslow\u2019s hierarchy of human needs, where any threat to these basic needs could impact human behavior and bring emergency reactions . DespiteSince ethnobotany has been described as the science of survival , its impIn the last two decades, the world experienced an increase in its number of conflicts. Only between 2000 and 2014, there was an average of 35 active conflicts every year around the globe . Since tIn Syria, as a part of the Mediterranean basin, cooked vegetables and salads made from wild greens have been particularly important as local traditional foods since ancient times . However2 and has a population of 1,114,000 inhabitants [The study was conducted in the Tartus governorate , one of abitants . The cliabitants . The regabitants . Tartus abitants . So far, the region has been relatively quiet and safe during the Syrian conflict. Tartus is entirely under the government control; however, it witnessed several security incidents . It is fThe study was conducted between March 2020 and March 2021. The participants were chosen using a combination of purposive and convenient sampling methods ,40. We aInformants were asked to list all the wild plants they used for food and beverage preparation, their vernacular names, the parts used, and mode of preparation and consumption. Respondents were asked to report any changes in their use of WFPs prior to and during the conflict. Perceptions of informants towards WFPs were documented using open-ended questions, such as: Why do you use WFPs? Why were you using WFPs before the conflict started?Verbal consent was always obtained before each interview, and the Code of Ethics of the International Society of Ethnobiology was followed . A reseaCollected data were compared with previously published ethnobotanical studies from the Eastern Mediterranean region and adjacent countries ,25,28,43Eryngium creticum and Malva sylvestris. On the other hand, species that grew in high mountains and remote areas, such as Gundelia tournefortii, witnessed a decrease in use during conflict years due to obstacles regarding movement and security concerns. According to our informants\u2019 statements, traditional knowledge of WFPs was noticeably decreasing during the stable economic situation in pre-conflict years. However, it was revived after becoming necessary to secure food during the conflict. The majority of our study respondents (94%) used WFPs before the conflict, whereas 6% of them started to use those plants only after the conflict started a decade ago. Informants showed that WFPs have always been a part of their traditional diet. However, such meals served as complementary food before the conflict, while they became among one the main dishes in recent years. Almost two-thirds (64%) of informants reported an increase in their reliance on wild plants as a source of food during the conflict compared to the pre-conflict time. On the other hand, 34% of the informants reported a no-change status in their reliance, whereas 2% stated a decrease. The main reported reason behind the apparent increase of reliance on WFPs was the economic crisis that hit the whole country after the war, which affected the food prices and purchase power, while the reason for the minor percentage of decrease in reliance was the move from a rural to urban area. The conflict affected accessibility and WFP species selection; informants reported that during the conflict, they started to consume wild plant species that grew in anthropic sites and their surrounding orchards, such as Informants\u2019 statements show a clear difference in perceptions and reasons for using WFPs during and before the conflict. The main motives behind the use of WFPs in the pre-conflict era were represented by the tendency to eat healthy and organic food, efforts to diversify the food and taste, and enjoyment of the activity of gathering plants from the wild. On the other hand, the difficulty to afford the market food products was the main reason for WFP use during the conflict. The majority of informants (58%) reported that the natural ecosystems helped to substitute market products through the gathered plants, and consequently, to save money. The mutual perception among the local people was that some of the young generation\u2019s views on WFPs did not change during the conflict compared to the pre-conflict time. These young people, especially those who did not bear the responsibility of securing food for the household, perceived WFPs as non-prestigious food and felt ashamed to share information related to this food with their peers.Our study documented 75 wild plant species used for food and beverage preparation by the local people. One taxon was identified only down to the genus level. The total of 75 taxa belonged to 70 genera and 28 botanical families. The most-represented families were Compositae (15 species), Fabaceae (8 species), Lamiaceae (7 species), Apiaceae, and Rosaceae (5 species each). Compositae included plants that are mostly prepared as cooked vegetables. On the other hand, Lamiaceae mainly included the spices and herbs that are consumed, dried, and ground, whereas Rosaceae included the species that are consumed mostly as fresh fruits. Species mentioned only once or twice in the survey were excluded from further analysis.Origanum syriacum, Rhus coriaria, Eryngium creticum, Cichorium intybus, Micromeria myrtifolia, Allium ampeloprasum, Cirsium vulgare, Gundelia tournefortii, Scandix pecten-veneris, Malva sylvestris, Anchusa strigosa. On the other hand, the species Nasturtium officinale, Rumex acetosa, Thymus vulgaris, and Arum maculatum were used by 60\u201380% of informants. Sixty-four plant species were reported by at least 6% of informants . The folSleeq is the most popular wild plant-based dish in the study area. It is prepared from gathered wild leafy vegetables. The name Sleeq is probably derived from the word Saleeq, which in the Arabic language means boiled food; however, the dish is mainly prepared by steaming, rather than boiling. The same dish was also called Mhabbleh by some informants, which locally refers to steamed food. There is no limitation to what kind of or how many wild vegetables can be included in the preparation. The most common species used in the preparation of Sleeq are Scandix pecten-veneris, Cirsium vulgare, Allium ampeloprasum, Erodium acaule, Cichorium intybus, Anchusa strigosa, Gundelia tournefortii, Silybum marianum, Rumex acetosa, Anemone coronaria, Malva sylvestris, and Urtica dioica. Practically every wild leafy vegetable that is able to be gathered by the collectors can be included in the dish, since it is sometimes difficult to gather a sufficient amount from one species only. The young shoots are the main part used in the Sleeq. The dish is mostly prepared in a local traditional clay pan called Meqli (see the video abstract), where chopped onion is fried in olive oil, then cut wild leafy vegetables are added. Some informants add a small amount of chickpea and/or softly ground bulgur if available. Several informants reported that it is possible to use Sleeq as a topping on the dough to be prepared as pizza, with the same mentioned receipt excluding chickpea and bulgur. Sleeq is a seasonal food connected with the availability of wild leafy vegetables usually collected from January to April.Zaatar bread/pizza. The dried and ground leaves of Origanum syriacum, the main ingredient of Zaatar, are mixed with dried ground fruits of Rhus coriaria, and roasted seeds of Sesamum spp. in the following proportion: 1.0 of Origanum syriacum, 0.75 of Rhus coriaria, 1.0 of Sesamum spp. Dried fruits of Pistacia terebinthus/Pistacia atlantica and seeds of Foeniculum vulgare may be sprinkled as spices. Zaatar is usually stored dried in jars or plastic bags, and consumed over the whole year.Traditional food in many regions in Syria. It is a sour spicy dish consumed by mixing with olive oil, usually in breakfast and dinner meals, as well as in Louf is a traditional soup consumed only in some parts of the Syrian coastal mountains, especially by the Alawite and Ismaili cultural-religious groups. The soup has a sour-astringent taste with a thick texture. Arum maculatum is the main ingredient in Louf soup; its dark-green leaves are loosely cut and steamed for around half an hour. Afterwards, olive oil and bulgur are added, then the water of boiled Rhus coriaria is added after disposing of Rhus coriaria. Arum maculatum contains a high amount of calcium oxalate, which is a toxic compound [Arum maculatum is usually available from December to April. Some informants reported that they store it in glass jars in the refrigerator and consume it throughout the year.compound ; howeverCichorium intybus is boiled for around half an hour, then olive oil, crushed garlic, and a little bit of lemon juice are added . Wild vegetables are also sold in the local markets at a lower price than other cultivated vegetables; for instance, the price of 1 kg of wild leafy vegetables (Sleeq) varies between 0,28 and 0,42 USD. We observed that several informants attempted to cultivate some wild species  in their home gardens. Some people living in the cities and town centres (where access to wild plants is limited) depended on their relatives and friends in rural areas to gather WFPs for them.Changes in diet in the study area have mainly been represented by the decrease in buying market food products and increase in the use of WFPs, particularly leafy vegetables. Most commodities\u2019 prices in Syria have increased tens of times since the beginning of the conflict. However, a few products are still affordable by the majority due to the government supporting these products. Bread, which is the main part of every meal, is one of these affordable commodities at 0.06 US Dollars per 1 kg (1 USD = 3500 Syrian Pounds according to the market exchange rate of late October 2021). Olive oil is produced by the majority of people in the study area where olive orchards dominate the landscape. Vegetable prices in the market vary between 0.3 to 1.4 USD for 1 kg, and prices for 1 kg of meat range between 2.9 and 5.7 USD. Those prices are considered relatively high and commonly unaffordable compared to the average monthly salary of 149,000 SP \u2248 43 USD . Hence, Gundelia tournefortii is documented in all compared studies; this is possibly due to its pleasant taste, as our study informants reported that it is one of the most preferred WFPs. It is usually steamed in olive oil with minced meat or chickpeas. Several plant species were found to be unique to the study area, such as Arum maculatum, which is a very popular and traditional soup (Louf) in some parts of the study area. All the species that comprise the most common wild plant-based dishes are culturally important and often frequently used. Despite that some of these species are less available nowadays in the wild, they still remain highly preferred, and this is possibly due to their pleasant taste or their importance in the local culture as a main part of the traditional diet. Based on the results and our observation, the sour-astringent taste was found to be preferred by many informants, especially from Alawites and Ismailis, which was demonstrated by the high use of some wild species, such as Arum maculatum and Rhus coriaria, which were described by some informants as \u201cthe sour of Phoenicians\u201d.The total number of 75 documented WFPs in the study area represents relatively high diversity compared to the Eastern Mediterranean region. It demonstrates a richness in the wild-related food culture. Kawas et al.  documentScandix pecten-veneris, Gundelia tournefortii, and Nasturtium officinale, as well as other dark-green leafy wild vegetables, such as Arum maculatum) could play a significant role in preventing anaemia , olive oil (a significant source of unsaturated fatty acids), bulgur , and bread (a main source of carbohydrates) serves as a good source of essential nutrients for the human body. There is a deficiency of data on nutritional status in Syria, especially considering that the situation is getting worse every year with the continued conflict, economic sanctions, and conflict-related chaos and corruption. However, a report from WFP  showed a anaemia . In timey system . Some ofO. syriacum, G. tournefortii, and R. acetosa demonstrated a richness in nutrient content. More research will help determine the exact nutritional role that these WFPs play in supplementing local diets during the conflict. Understanding the perceptions of local people towards WFPs could help in planning successful promotion of some nutritive species. Furthermore, future studies should consider the sustainability of WFP use and how these plants could be protected during crises.The field study that we conducted among the local people in the coastal region of Syria showed a remarkable level of reliance on WFPs as a source of human nutrition. The study demonstrated the increased use of WFPs during the conflict compared to the pre-conflict time. Our results strengthened the findings of previous studies that ethnobotanical knowledge functions as a coping method for food shortage. We documented 75 wild plant species used in food and beverage preparation with a relatively high diversity comparing to other studies from the Eastern Mediterranean. The most common wild food-based dishes and their preparation mode were documented. Some species, such as"}
{"text": "Radio frequency fingerprinting (RFF) methods are becoming more and more popular in the context of identifying genuine transmitters and distinguishing them from malicious or non-authorized transmitters, such as spoofers and jammers. RFF approaches have been studied to a moderate-to-great extent in the context of non-GNSS transmitters, such as WiFi, IoT, or cellular transmitters, but they have not yet been addressed much in the context of GNSS transmitters. In addition, the few RFF-related works in GNSS context are based on post-correlation or navigation data and no author has yet addressed the RFF problem in GNSS with pre-correlation data. Moreover, RFF methods in any of the three domains  are still hard to be found in the context of GNSS. The goal of this paper was two-fold: first, to provide a comprehensive survey of the RFF methods applicable in the GNSS context; and secondly, to propose a novel RFF methodology for spoofing detection, with a focus on GNSS pre-correlation data, but also applicable in a wider context. In order to support our proposed methodology, we qualitatively investigated the capability of different methods to be used in the context of pre-correlation sampled GNSS data, and we present a simulation-based example, under ideal noise conditions, of how the feature down selection can be done. We are also pointing out which of the transmitter features are likely to play the biggest roles in the RFF in GNSS, and which features are likely to fail in helping RFF-based spoofing detection. The purpose of any RFF technique is to identify genuine transmitters (or transceivers) and distinguish them from malicious ones. For example, the authors in [The radio frequency fingerprinting (RFF) concept refers to the process of identifying the hardware (HW) characteristic and HW-specific features or signatures embedded in the radio frequency (RF) waves transmitted over a wireless channel ,2,3,4. Ithors in  performeEspecially in the context of global navigation satellite systems (GNSS), intentional interference such as jamming and spoofing has been on the rise in recent years and can have significant adverse effects on the navigation performance of GNSS receivers, as discussed for example in ,13,14,15Future aviation applications, and in particular unmanned aerial vehicles (UAVs), will increasingly rely on GNSS-based navigation and positioning solutions ,15. SafeThere are many authentication and anti-spoofing methods in GNSS which are not based on RFF and such methods that have been widely studied in post-correlation, and especially at navigation levels ,17,18,19A schematic block diagram of the three domains  of a typical GNSS receiver is shown in A good survey of anti-spoofing methods based on the post-correlation and navigation data in GNSS can be found for example in . HoweverOffering a thorough survey of RFF methods applied with GNSS and non-GNSS wireless data in the literature, and discussing which of these RFF methods have potential in GNSS, and in particular in GNSS with pre-correlation data. Finding good anti-spoofing methods based on pre-correlation GNSS data could have tremendous benefits for the future GNSS receivers, by being able to detect and remove non-genuine signals even before processing them further in the acquisition and tracking loops. Our survey is unique in the current literature, as the RFF methods for GNSS have to date not been widely investigated and there is a current lack of unified surveys on this;Proposing a step-by-step problem definition of RFF in the context of GNSS signals, by delving in depth in the sources of possible transmitter hardware impairments, and also discussing the possible channel and receiver\u2013hardware impairments; this problem decomposition into feature-by-feature investigation is also lacking from the current GNSS literature, to the best of our knowledge;Proposing a four-step generic RFF approach, consisting of: feature identification, feature extraction, data pre-processing, and data classification. Classical ML and transforms methods are used in this four-step methodology, but the four-step block diagram is rather novel;Presenting the mathematical models of different GNSS transmitter features, with a particular emphasis of five main identified features, namely: the power amplifier non-linearities, the digital-to-analog converters\u2019 non-linearities, the phase noises of the local oscillators, the I/Q imbalances, and the band-pass filtering at the edge of the transmitter front-end; unified mathematical methods of the transmitter HW impairments are not found in the current literature to the best of the authors\u2019 knowledge;Providing the equivalent transmitter block diagrams for GNSS and spoofers by incorporating the aforementioned five hardware effects into the models;Presenting an illustrative simulation-based analysis based under ideal conditions in order to emphasize the impact of each HW feature on the RFF performance. Three feature extractors to identify the transmitter HW impairments were used, namely the kurtosis, the Teager\u2013Kaiser energy operator (TKEO), and the spectrogram. The classification accuracies given as examples are based on support vector machines (SVM). Such a simplified analysis allows us to identify the strongest features among the five considered ones and to point out the remaining challenges to overcome to achieve the feasibility of RFF methods under more realistic GNSS scenarios;Bringing in a qualitative discussion on the existing algorithms and providing a roadmap towards further research on RFF in GNSS for interference detection and classification.As seen in the discussions above, there is still a lack of surveys of RFF methods for GNSS transmitter authentication in the current literature, particularly on surveys of GNSS authentication relying on pre-correlation signals. In this paper, we are addressing this lack, via a comprehensive study of the literature in the past two decades, as well as via theoretical insights and the preliminary analysis of algorithms. Our contributions are as follows:The rest of this paper is organized as follows: Most of the GNSS signals use the code-division multiple access (CDMA) technique, with a received signal power around A spoofing scenario is illustrated in Simplistic spoofing attacks, such as those generated by a software defined radio (SDR) GNSS generator connected to an antenna. In this type of attack, the GNSS transmitter is not synchronized to the genuine GNSS satellites, which means that there are typically jumps in the carrier-to-noise ratios (CNR) and Doppler shifts measured at the receiver and such spoofing attacks can be identified in the pseudorange domain via various consistency checks algorithms, such as those described in [ribed in ,28,29;Intermediate spoofing attacks [ attacks ,31: thesSophisticated spoofing attacks [ attacks : these aSpoofing attacks are typically split into three classes, described in detail in :SimplistSpoofing attacks adversely affect the quality of positioning, navigation and timing (PNT) services of GNSS receivers, by introducing errors in the estimated PVT. For example, as shown in , an intePre-correlation link-level methods relying on signal samples before the acquisition stage, i.e., on I/Q data. This is the case addressed in this paper. Such pre-correlation anti-spoofing methods are still very rare in the literature;Post-correlation link-level methods relying on the despread signal, at the output of the tracking stage for a single satellite. Examples can be found in [found in ,34 and tNavigation or system-level methods relying on the pseudorange signals coming from all visible satellites. These are by far the most encountered anti-spoofing methods in the current literature and a few examples can be found in [found in ,28,29  and aiming to identify, based on RF fingerprinting approaches, whether the received signal comes from a genuine GNSS transmitter or from a spoofing transmitter.four-step methodology for the RFF-based pre-correlation spoofing detection and transmitter identification, as listed below. Each of these four steps is further detailed in We are proposing a Identification of relevant features\u2014this step refers to first identifying the different RF \u2018features\u2019 created by the inherent hardware impairments in any transmitter. Several such features will be subsequently described in Feature-extraction transform\u2014this steps refers to choosing a suitable feature-extraction transform to emphasize the selected features from the previous step. Several feature-extraction transforms are addressed in Data pre-processing stage\u2014this step refers to choosing the most suitable format of saving the data at the output of the feature-extraction transform, namely as time-stamped vector data, in matrix form, as an image of certain size and number of pixels, etc. The data format selection will be influenced by the algorithms selected in the feature-classification step, as subsequently described in Feature classification\u2014this step refers to applying a selected classification methods, such as based on analytically-derived thresholds or on machine learning algorithms when training data are available, and classifying the received signal into \u2018genuine\u2019 versus \u2018non-genuine/spoofer\u2019 classes. Several feature classification approaches are discussed in The workflow of an RFF algorithm based on the aforementioned four steps is illustrated in Phase noise (PN): PN is unavoidable in any wireless transmitter, as it is introduced by the transmitter clock instabilities; atomic clocks on-board genuine GNSS transmitters are intuitively expected to have lower phase noise than the clock of spoofers and other malicious transmitters [smitters ,37,38. PPower amplifier (PA) non-linearities: non-linearities close to the saturation region for PAs  can represent an important HW feature to distinguish between different transmitters. In addition to non-linearities, possible memory effects of the PA can also create differentiating features at the transmitter. PA models are discussed in I/Q imbalance: the I/Q imbalance in a transmitter is introduced in the translation of the baseband signals to passband signals due to the facts that the phase shift is not perfectly at Digital-to-analog converter (DAC) non-linearity: signal distortions are also possibly produced by the non-linear DAC operation at each transmitter. DAC models are discussed in Band-pass filter (BPF) passband and out-of-band ripples: the transmitter BPF filter also puts its \u2018fingerprint\u2019 on the transmitted signal and can act as a smoother of the other HW features. BPF models are discussed in A first step in building the equivalent block diagrams for a GNSS transmitter (genuine or spoofer) was to identify the possible sources of hardware (HW) impairments at the transmitter side for wideband-signal transmitters, based on works in ,41,42,43Each of these identified HW impairments is further detailed in the subsequent sub-sections.Typically, the phase noises are random noises, modelled via random time waveforms the form :(1)xS\u03d5The usually adopted model for GNSS signals is to ignore everything except the white-noise PN model at te noise . Withoutte noise  where a The on-board GNSS local oscillators are atomic clocks based on rubidium/cesium clocks . TypicalA typical measure of the PN PSD is through the so-called Allan variance given by (3)\u03c3A2, such as solid state power amplifiers (SSPA) or a travel-wave tube amplifier (TWTA) , while nL. When the wideband signals pass through the power amplifier, the bandwidth of signals is not negligible compared with the inherent bandwidth of the amplifier, and therefore a frequency-dependent behaviour occurs. This behaviour is called a memory effect. Regarding the non-linear model with linear memory, the two most encountered models are the Wiener model and the Hammerstein model, as described in [There are typically two classes of models for PA non-linearities : the memribed in . We illuWiener model:s is the sample index (assuming the q-th coefficient of a finite impulse response (FIR) filter, and Hammerstein model:Due to the difficulties of estimating the coefficients for FIR filters in both the Wiener and Hammerstein model, the memory polynomial  has becoIn order to maximize the power efficiency and the lifespan of the satellite payload, the GNSS signals are usually designed to exhibit a (quasi) constant complex envelope. For instance, this is achieved by including an inter-modulation product among the signal components. For this reason, it is reasonable to expect that the PA non-linearities will not significantly distort the genuine GNSS signals. This might not hold for many spoofing signals, which may simplify the signal generation by only emulating some of the signal components and/or omit the inter-modulation product. However, it shall be noted that a spoofer usually needs to generate low-power levels, hence it is easier to ensure linearity with LPA. The fact that the spoofer needs to transmit at a lower power than the GNSS transmitters is due to the fact that spoofers are usually within the range of a few tens of meters to a few km away from the GNSS receivers, while GNSS satellites are at more than 20,000 km away from the receivers.During the baseband-to-passband conversion, the I and Q components xIBased on , the DACThe clock additive effect based on , gt\u0394n haHere, we demonstrate two examples in K is the order of the filter.The band-pass filter (BPF) is equipped at transmitters to filter out undesired non-central frequencies signals. In this work, we model BPF using a finite impulse response (FIR) filter. A general form of an FIR filter output We use the window design method for the genuine GNSS transmitter BPF and the least squares method for spoofer transmitter BPF. An example of BPFs used for a genuine GNSS transmitter versus a spoofer transmitter is shown in The equivalent block diagrams of a GNSS  satellite transmitter and of a spoofer GNSS transmitter are depicted in ock unit a appeareock unit b does noThe GNSS power amplifier is typically an HPA, while the spoofer power amplifier is typically an LPA, as discussed in N genuine GNSS transmitters and M spoofers, l-th path of the i-th channel, and l-th path of the i-th channel. Above, i-th channel. Typically, A signal h, etc.) ,54 or toh, etc.) . Howeverh, etc.)  were donh, etc.)  were forFurthermore, the receiver from Equation ). As shoThe error vector magnitude is a time-domain transform that measures how far the estimated symbols at the receiver side may deviate from the true symbols. I/Q imbalance, thermal noise, in- and out-of-band leakage, and phase noise are all causes that can degrade the EVM metric, thus EVM has the potential to be a good feature-extractor transform to capture hardware impairments from the received signals.In general, EVM is applied in the context of demodulated signals, as follows: let us assume that a symbol When the input to the EVM transform is the I/Q sampled data, one can apply the EVM as follows: Kurtosis is a measure of the Gaussian behaviour of a random variable and it is defined asAn example of a histogram for the kurtosis results of genuine GNSS transmitter and spoofer is shown in The Teager\u2013Kaiser energy operator (TKEO) is a transform which can estimate the instantaneous energy of a signal, and thus may uncover features that are distinguishable in power or energy. The TKEO transform fined as (19)TTKETKEO has been previously used in the context of RFF in GNSS in  with prom is the time sample index, the f is the frequency, and The short-time Fourier transform (STFT) Clearly, A wavelet transform decomposes an incoming signal into some \u2018coarse\u2019 and \u2018fine\u2019 coefficients, based on shifted and scaled versions of a so-called \u2018mother wavelet\u2019 function. Unlike the Fourier transform that cannot offer compact support in both the time and frequency domains, a wavelet transform can offer a compact/bounded support in both tome- and wavelet-domains. Wavelet transforms have been extensively used in watermarking and image-processing applications, and have been reported to be able to identify \u2018hidden\u2019 features; thus, they look like relevant feature extractors for RF fingerprints. Wavelet transforms, in the context of RF fingerprinting, have been previously used, for example in ,60,61. TFeature classification methods can be typically split into two main classes: (i) methods based on thresholding or the direct sorting of the outputs of the feature extraction stage; and (ii) methods based on machine learning (ML) classifiers. The second category was by far the category most encountered in RF fingerprinting, as shown previously in The threshold-based classification is also known as a traditional hypothesis testing and can be implemented through well-known algorithms such as likelihood ratio testing (LRT) or Gaussian likelihood ratio testing (GLRT) ,84. The If the feature-extraction transform outputs scalar or vector values  or by using an initial training base with genuine and spoofing signals and derive a threshold based on the training database. Another challenge in this threshold-based approach is that most of the transmitter features are \u2018hidden\u2019 and not distinguishable through classical hypothesis testing, as the probability distribution functions of Equation  would ovIn our work, we used the optimal false alarm rate from ML-based classification to calculate the detection rate. By comparing this detection rate with the optimal one from ML-based classification, we evaluate the performance of the threshold-based method.Machine learning (ML) methods have been widely used in the literature as methods of classification in RF fingerprinting approaches or for transmitter identification and authentication : As the problem we address here is a classification problem with two classes: spoofer absent .Typically, a Gaussian kernel takes best into account the irregular boundary in the I/Q GNSS datasets. As the dimensions of raw I/Q data are typically huge, some forms of dimensionality reduction can be typically employed. One such form is known under the name of PCA is a common method to pre-process data for the purpose of reducing the dimension of the target dataset before the classifications. The first few principal components implies the most dominant features existing in the dataset, whilst using PCA is an effective way to improve the classification performance.For example, The convolutional layer applies a convolution operation between the input signal matrix and a filter (or kernel) . For example, The pooling layer will reduce the number of parameters; it is essentially a sampling method. The common pooling methods are max pooling, average pooling, and sum pooling. Here, we provide an example of max pooling in The fully connected layer is the actual neural network, by using the activation function, such as the sigmoid (or logistic function), we are able to label the outputs. A common fully connected layer is made of three parts, the input layer, the hidden layer(s) , and the output layer. Convolutional neural networks (CNN), the most frequently encountered category of deep learning classifiers, have been widely applied in image identification and pattern recognition. Recently, CNN classifier has also started to be considered as a promising method for the radio identification and RFF ,87. A geOther approaches of ML-based classification less encountered in the context of RFF are: linear discriminant analysis (LDA) ,82, logiLDA is usually used to separate two or more classes or to achieve dimensionality reduction. The basic idea behind LDA is to find a projection of the input data such that the separation of classes could be maximized. This method is limited, however, by the condition that both input classes follow normal distributions. LR usually works with classes characterized by linear features and it is not well suited to non-linear features as those created by power amplifiers and digital-to-analog converters. The studies in , appliedAn in-house-based simulator was built based on Matlab 2020b version and Python 3.7.5. The Matlab modules were used to generate I/Q samples based on a GNSS and a spoofer model, each having five types of transmitter features: PA non-linearities, DAC non-linearities, I/Q imbalance, phase noises, and BPF. The parameters of genuine GNSS transmitters are typically not available in open access, as they are protected via IPR. In the absence of such GNSS exact parameters for these HW features, we adopted various models from the literature. For example, the PA non-linearities were modelled according to , and theA two-millisecond observation window of Galileo E1 band signals was used in the examples shown in this section. In order to deal better with smaller The results of the classification are presented via the confusion-matrix metric. In our simulator, each feature can be active or inactive, making the simulator flexible to be able to down select or identify the \u2018strongest\u2019 features, as well as their overall impact when they act jointly . Moreover, as seen in Unlike the typical narrowband terrestrial signals typically studied to date with RFF techniques see , the GNSBased on our literature research and the preliminary theoretical analysis, The most promising combinations, based on our preliminary analysis, are the kurtosis and thresholding combination, and the spectrogram and SVM combination. Potential good results may also be expected, based on a current literature search and theoretical analysis, from kurtosis and SVM combination, as shown in This paper presented a survey of RFF methods for spoofing mitigation in GNSS receivers. While the survey of methods and the methodology presented in here can be generally applied also in a non-GNSS context, the focus in our paper has been on GNSS pre-correlation data, as the pre-correlation anti-spoofing methods are still rare in the current literature.Addressing the impact of the signal mixtures from signals from various satellites and various frequency bands: typically, the received signal is a mixture of all satellites visible in the sky at the considered moment, and possibly, of one or several spoofing signals. One approach to look at a single signal at a time would be to first despread each signal from each identified pseudo-random code, and then apply successive or parallel interference cancellation methods to identify each signal, one by one. The errors in the estimation of the signals from various satellites would, of course, affect the quality of the re-constructed signal, and possibly, the accuracy of the RFF-based classification. Another approach would be to create huge training databases with all possible mixtures of satellites in the sky and to use those databases in the classification process;Evaluating and mitigating the impact of channel multipath and fading effects: each wireless channel (from satellite or spoofer) has its own random signature, determined by the multipath delays, Doppler spreads, and fading effects. As these effects are random in nature, they will, most likely, not provide additional \u2018features\u2019, but will have a negative impact on the strength of the transmitter features. The effect of the wireless channels upon the RFF algorithms can be further investigated via simulation- or measurement-based approaches and it remains a topic of future investigation;Understanding the impact of the receiver HW features upon the RFF methods: while the same receiver is capturing either genuine GNSS signals or a mixture of genuine signals and spoofer(s), and thus the same receiver effects are present in both situations (spoofer present or spoofer absent), the receiver also has local oscillators, ADC and filter blocks, etc., and each of them can introduce additional phase noises, non-linearities and I/Q imbalances. Intuitively, such effects will have a negative impact upon the classification accuracy compared to an ideal receiver (without any HW imperfections), but such effects need to be further analysed based on measurements or simulated data.Dealing with the negative impact of high noise levels on RFF performance, especially when dealing with low-power signals such as those in the pre-correlation domain: GNSS signals in urban scenarios, such as GNSS receivers on-board of drones flying through tall buildings, can be received at relatively low CNRs, and these low CNRs are likely to act as smoothers of the transmitter features, to the point of fading them out. It remains an open research question what the CNR threshold is above which the RFF methods with pre-correlation GNSS samples are likely to work;Validating through real-field measurements the promising RFF performance for authenticating GNSS signals.A four-step methodological approach has been proposed in One of the main contributions of our paper was presenting a step-by-step methodological approach proposed to be adopted for a designer wishing to build an RFF algorithm in a GNSS receiver. The identified transmitter HW features are likely to be reflected not only in the pre-correlation data (illustrated in our examples through the paper), but also in the post-correlation and navigation domains, thus our four-step methodology also paves the road towards more advanced RFF GNSS processing in all three domains , with a future aim to offer robust and hybrid anti-spoofing solutions. An additional contribution of this paper has been to present an ample survey of existing RFF methods in the literature used with both GNSS and non-GNSS signals and already showing promising results. As described in this last section, several challenges are still to be overcome towards the success of RFF methods, especially when relying on the low-power GNSS I/Q raw data. It is our belief that this survey bridges the missing gap between the RFF studies in the non-GNSS context and the anti-spoofing methods studied to date only at the post-correlation and navigation levels in the GNSS context. It is our intent that this paper sheds new light on how to approach an RF fingerprinting process to identify hidden transmitter features, by first decomposing the problem into the relevant transmitter features and then by selecting the most suitable pair of feature-extraction transform and classifier algorithm in order to classify the transmitters according to their features or HW impairments. While many challenges still remain in the RFF GNSS research field, it is also the authors\u2019 belief, based on our understanding of the research problem, that by combining various authentication methods, at different levels , one is more likely to obtain good results than by using a single authentication method. The simulation-based results presented here are only for some selected illustrative parameters and are useful in the context of down selecting the most important HW features of a GNSS transmitter. We saw that, even under ideal conditions such as 100 dBHz carrier-to-noise ratio, the phase noise and the DAC nonlinearities are not differentiating features, while P non-linearities, I/Q imbalances, and band-pass filters carry the potential of being good RF \u2018fingerprints\u2019. For the sake of a reduced complexity of simulations, the observation window used in our simulations was of 2 ms. Further investigative studies at a lower"}
{"text": "Colon capsule endoscopy as an alternative to colonoscopy for the diagnosis of colonic disease may serve as a less invasive and more tolerable investigation for patients. Our aim was to examine patient-reported outcomes for colon capsule endoscopy compared to conventional optical colonoscopy including preference of investigation modality, tolerability and adverse events. A systematic literature search was conducted in Web of Science, PubMed and Embase. Search results were thoroughly screened for in- and exclusion criteria. Included studies underwent assessment of transparency and completeness, after which, data for meta-analysis were extracted. Pooled estimates of patient preference were calculated and heterogeneity was examined including univariate meta-regressions. Patient-reported tolerability and adverse events were reviewed. Out of fourteen included studies, twelve had investigated patient-reported outcomes in patients who had undergone both investigations, whereas in two the patients were randomized between investigations. Pooled patient preferences were estimated to be 52% (CI 95%: 41\u201363%) for colon capsule endoscopy and 45% (CI 95%: 33\u201357%) for conventional colonoscopy: not indicating a significant difference. Procedural adverse events were rarely reported by patients for either investigation. The tolerability was high for both colon capsule endoscopy and conventional colonoscopy. Patient preferences for conventional colonoscopy and colon capsule endoscopy were not significantly different. Procedural adverse events were rare and the tolerability for colon capsule endoscopy was consistently reported higher or equal to that of conventional colonoscopy. Early-stage detection and removal of colorectal pre-cancerous polyps is an effective measure for the prevention of colorectal cancer (CRC) . To dateThe existing knowledge on patient discomfort and minor AE with CCE is scarce as patients only have renewed contact with the hospital if a subsequent COC is mandatory and, even so, patient-reported outcomes (PRO) are rarely addressed. Patient acceptance and preference towards CCE are of outermost importance for a broader clinical implementation. Hence, we find it relevant to conduct a systematic review and meta-analysis to collect and present existing data on PRO and the preference for CCE compared to COC.We conducted a systematic literature search in PubMed, Embase and Web of Science to identify all relevant citations for studies in which acceptability, tolerance or preference was expressed by the patients , after COC and CCE were performed. The primary outcome of our analyses were the preference proportions, whereas acceptability and tolerance were secondary outcomes. According to the PICO search strategy, search terms were included in three areas: investigation, comparator and outcome. The terms within each area were combined using the Boolean \u201cOR\u201d; the three areas were combined in strings using the Boolean \u201cAND\u201d. Free text search terms with truncation were included. The literature search was concluded on 12 January 2021. The complete search strings are available in full text articles;articles reporting PRO after undergoing both COC and CCE or randomized controlled trials (RCT);articles in English/Danish/Italian/French/Spanish language.Inclusion criteria were:non-RCT articles in which patients underwent either COC or CCE alone;the following article types: reviews, conference papers, case reports.Exclusion criteria were:After identification and exclusion of duplicates, references were independently screened by three authors . Each author screened two thirds of the references in title and abstract, excluding those not meeting the inclusion criteria. In case of discrepancy, the reference was included for full text evaluation. After this first step, the process was repeated on included references by evaluating full texts with the same modality.\u00ae Crohn), cleanliness and completion rates for both COC and CCE. COC procedures were considered complete when the caecum was reached; CE procedures were considered complete when the CE was excreted during the recording time or when the anal verge or the hemorrhoidal plexus were visualized. PRO and AE were also collected. Regarding PRO, the preference for COC and CCE was expressed as proportions (%). AE were limited to events related to the procedure itself, excluding those related to bowel preparation (BP).All data were extracted in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) . We collA study assessment of the included studies was performed by three independent reviewers  through the STROBE assessment tool and the Cochrane Collaboration\u2019s tool (according to the study design) ,14. STROn = 30). For Cochrane, within each bias category , the bias level was rated as low, high or unclear.For STROBE, we arbitrarily designated studies as of low-, medium- and high transparency and completeness according to the tools\u2019 outcome scores: for STROBE, the cut-offs were respectively 60% and 80% of the total maximum points  but not indicating preference were included in the denominator. Non-responders were excluded. The significance level was set at 5%, and 95% confidence intervals (CI) were calculated. All pooled estimates were calculated in random effects models using the Freeman\u2013Tukey double arcsine transformation. In sensitivity analyses, we repeated the preference proportions calculations, first, after exclusion of studies from which only a subset of the sample could be included, and second, after exclusion of studies with samples under 50 individuals. IHandbook . PotentiHandbook  were perHandbook .n = 2) studies they were randomized for either. Included studies are described in n = 10) studies reported patient preference for CCE and eight (n = 8) reported patient preference for COC. Four studies did not report patient preference but described patient-reported AE and/or tolerability.The initial literature search resulted in 1632 references. After the removal of duplicates this was reduced to 1326 and, additionally, 1274 were excluded after title and abstract screening. Full text screening was performed for 52 references and 14 were eventually included in the study  11,18,1,29,30. In = 9) studies were evaluated as having high transparency and completeness and five (n = 5) studies as medium, see Nine   for CCE 2 = 88.32% and 85.81), univariate meta-regressions were performed to identify possible sources. None of the tested variables resulted in statistically significant effects, although age mean yielded the lowest observed p-values for both CCE and COC preference analyses  moderate/severe AE  was reported in CCE from patients. More retentions could be expected as several of the included studies report retrieving capsules in the following colonoscopy if not excreted. Mild patient-reported AE from CCE included difficulty with camera ingestion and abdominal discomfort. In comparison, two (n = 2) moderate/severe AE in COC were reported from patients . Mild patient-reported AE from COC included local phlebitis due to intravenous access, abdominal pain, rectal bleeding and elevated blood pressure. In conclusion, moderate to severe procedural AE were rarely reported by patients for both CCE and COC.Very low proportions of AE (often none) were reported in the included studies. Only one (n = 13) ulcerative colitis patients rated overall tolerability for CCE and COC on a ten-point scale to be 7.9 average for both procedures, even though they rated abdominal pain 4.9 for COC and 1.0 for CCE on the same scale [Several studies reported results that were collected using visual analog scales (VAS) and/or numerical scales. Median overall rating reported from 1 (very bad) to 10 (very good) was 8 for CCE and 7 for COC in 148 individuals . On a nume scale . Similarme scale . In 31 ime scale .Our systematic review with meta-analysis shows no significant difference in patients\u2019 preference between COC and CCE. About half of the included patients, having tried both modalities, declare an equal preference for the two colonic imaging modalities. One would have expected that patient preference would sway towards CCE as it can provide a virtually painless exploration of the colon, with similar diagnostic yield and accuracy to COC in many clinical situations. Nevertheless, all that glitters is not gold: as highlighted in the results of our study, the watershed of PRO for CCE versus COC remains blurred; the stigma surrounding colonoscopy, often raising well-known barriers in the CRC screening populations, failed to show any apparent inclination towards CCE as one may have expected, concerning PRO. On the other hand, a substantial proportion of patients still preferred CCE even though COC is considered the golden standard. The reality may be that each investigation should target the patient in question and not be considered a one-test-fits-all strategy.In a recent interim analysis , we askep-value. As speculation, a slight tilt in preference towards COC in older patients may be explained by the higher pre-test probability of colorectal pathology, eventually leading to therapeutic COC after CCE anyway. Taking into consideration possible publication bias, the funnel plot for COC preference seems a bit skewed to the left , whereas for CCE it is more homogenous.In the current study, no statistically significant possible sources of heterogeneity were highlighted regarding patients\u2019 preference. The age of the patients in both CCE and COC groups was the variable with the lowest Taking into account these data, when coming to tolerability parameters, surprisingly, the tolerability was consistently reported higher for CCE. It is unclear why this does not translate to higher patient preference for the modality. One explanation may be that the patient-reported advantages for COC outweigh the drawbacks and these are therefore accepted. Moreover, patients with known disease who are familiar with COC, may be more accepting of the procedure and any level of relevant discomfort, or since the tolerability is very high for both procedures, the relative higher tolerance for CCE has no actual behavioral relevance. Moreover, if the tolerance is very high for both, the risk of two examinations following a positive CCE could be considered too much of a risk.Both examinations also require two stints of BP as the CCE report is not available immediately after excretion, enabling COC under same preparation. As BP is a documented barrier to COC and the increased cleansing regimen for CCE is a reason for preferring COC ,32, the 2 statistics indicated heterogeneous subsets of patients, and different collection methods were used in the assessments of PRO , although no statistically significant sources were identified. Finally, for some of the included studies, only a subset of patients could be included in the meta-analysis in this review as only those subsets underwent both investigations. This introduces a risk of overrepresentation of patients with positive CCE as those excluded in the present study were discharged after negative CCE. It is expected that COC is preferred in patients with pathology as they would prefer going straight to COC since it is not possible to perform a biopsy or polypectomy with CCE.This study comes with some limitations. The presence of small study effects for pooled preference proportion for COC (as backed up by the Egger\u2019s tests) introduces the risk of publication bias. The IThe preference proportions for CCE and COC were not statistically different in this meta-analysis, with an estimated 52% preferring CCE and 45% preferring COC. Procedural AE are rare in both CCE and COC. The tolerability for CCE is generally reported higher or equal to that of COC. As a reminder for future studies, it should be emphasized to include both patients with and without positive CCE/COC to be able to estimate preference proportions for the general population."}
{"text": "Membrane fusion requires R-, Qa-, Qb-, and Qc-family SNAREs that zipper into RQaQbQc coiled coils, driven by the sequestration of apolar amino acids. Zippering has been thought to provide all the force driving fusion. Sec17/\u03b1SNAP can form an oligomeric assembly with SNAREs with the Sec17 C-terminus bound to Sec18/NSF, the central region bound to SNAREs, and a crucial apolar loop near the N-terminus poised to insert into membranes. We now report that Sec17 and Sec18 can drive robust fusion without requiring zippering completion. Zippering-driven fusion is blocked by deleting the C-terminal quarter of any Q-SNARE domain or by replacing the apolar amino acids of the Qa-SNARE that face the center of the 4-SNARE coiled coils with polar residues. These blocks, singly or combined, are bypassed by Sec17 and Sec18, and SNARE-dependent fusion is restored without help from completing zippering. Sec17 (\u03b1SNAP) and SNAREs are receptors for the Sec18 (NSF) AAA ATPase  domains.The molecular interactions between Sec18/NSF, Sec17/\u03b1SNAP, and neuronal SNAREs were illuminated by determination of their structures when assembled without membrane anchors into the NSF/\u03b1SNAP/SNARE complex, also referred to as the 20S particle . The heahomotypic fusion and vacuole protein sorting) with multiple direct affinities. Two HOPS subunits bind Ypt7, anchored on each membrane  Fuse SNAREs . Howevere SNAREs . (3) A pe SNAREs . Reconste SNAREs . It has e SNAREs . Sec17 ae SNAREs . An intee SNAREs . Single-e SNAREs . HoweverComplete SNARE zippering is considered essential for SNARE-dependent fusion . We now Vacuole SNAREs  have an cis-SNARE complex assembly can occur spontaneously on these proteoliposomes, but assembly is stimulated by HOPS, allowing direct comparison of HOPS-dependent and HOPS-independent SNARE assembly  assay of vacuolar SNARE associations . The Qc-assembly . The aveassembly , purple,assembly , indicatassembly  but is nProteoliposomes with R, Qa, and Ypt7 (where indicated) were incubated with Qb-SNARE domain and Qc. Both SNARE domains were either fluorescently labeled at their N-termini , reducedSince this Sec17-induced SNARE conformational change is seen with C-terminal fluors but not with\u00a0N-terminal fluors, requires HOPS as the SNARE assembly catalyst, and requires SNAREs that can zipper, a major part of the conformational change may be zippering itself. This might be spontaneous after Sec17-induced release of HOPS from SNAREs  or be prSec17 also interacts with partially\u00a0zippered SNARE complex to promote SNARE complex stability. SNARE complex was assembled by HOPS on Ypt7/R proteoliposomes with soluble Qa, with the Qb SNARE domain labeled with a fluorophore at a cysteinyl residue upstream of the SNARE domain, and with Qc of full length (w.t.) or with the 3\u0394 C-terminal truncation, each bearing a fluorophore at its native cysteinyl residue upstream of the SNARE domain. When the complex of proteoliposomes with these fluorescent Qb and Qc had full-length SNARE domains, it was stable whether or not it included Sec17, as there was no loss of average FRET efficiency after addition of excess non-fluorescent Qc . In contSec17 can restore fusion when Qc has truncations at the C-terminal end of its SNARE domain , stimulaFusion assays were also performed with Ypt7/R proteoliposomes and each of the three Ypt7/single-anchored Q-SNARE proteoliposomes in the presence of HOPS and the other two soluble Q-SNAREs . With metrans-SNARE complexes, but Sec18 is not simply promoting Sec17 binding, since it is still needed for fusion when Sec17 is joined to an integral N-terminal membrane anchor , Sec18 (NSF), and SNAREs cooperate to promote membrane fusion. Sec17 has multiple functions: (a) It supports Sec18 association with SNARE complexes for their ATP-driven disassembly for subsequent rounds of fusion . Sec17/\u03b1While intracellular fusion reactions share many requirements, such as for SNAREs and SM protein, there are major differences as well. Synaptic vesicle fusion and other calcium-dependent secretion systems require calcium, synaptotagmin, Munc13, and complexin, none of which have their obvious counterparts in calcium-independent systems. Vacuole and endosome fusion have their SM protein as an integral subunit of the tethering complex, which is not seen in other organelles. The similarities and differences in fusion pathways at each organelle will be clarified as each is more thoroughly studied.PI3P was from Echelon , ergosterol from Sigma , fluorescent lipids from Thermo Fisher , and other lipids were from Avanti . Biobeads SM2 were from BioRad, Cy5-Streptavidin from SeraCare , biotinylated phycoerythrin from Invitrogen , and underivatized streptavidin from Thermo Fisher. Spectrapor six dialysis tubing  was from Spectrum Labs . Octyl-b-D-glucopyranoside was purchased from Anatrace .Sec17 with six acidic amino acids mutated to neutral residues, GST-Sec17 , was generated by PCR with Phusion high-fidelity DNA polymerase (NEB). The DNA fragment was cloned into BamHI- and SalI-digested pGST parallel1 vector  with an For Sec17-E34S,E35S, D38S,TCGTCGGCTGCTTCTCTTTGTGTCCAAGCAGCCACF: AGAAGCAGCCGACGAAAACTTGTATGAATCAGAACR: For Sec17 E73A, D74A, E75A,GGTAATGCAGCCGCAGCAGGAAATACCTACGTAGAF: TGCGGCTGCATTACCAGCCTTTTTCTGATAGTCAGR: GST-sQa3\u0394 with amino acyl residues 1\u2013235 and GST-sQb3\u0394 with amino acyl residues 1\u2013160 were generated by PCR with Phusion high-fidelity DNA polymerase (NEB). DNA fragments were cloned into BamHI- and SalI-digested pGST parallel1 vector  with an For GST-sQa3\u0394,AGGGCGCCATGGATCCGATGTCCTTTTTCGACATCGAF: AGTTGAGCTCGTCGACTAGATATTCTCGTCTATGGTGGR: For GST-sQb3\u0394,AGGGCGCCATGGATCCGATGAGTTCCCTATTAATAF: AGTTGAGCTCGTCGACTACAAGGTCTGTCTTGCATTTTR: To generate Qa with L238, M242, A245, L249, and A252 changed to Ala, Ser, or Gly, the pParallel1 GST vector with Qa lacking residues 228\u2013257 was generated by inverse PCR with pParallel1 GST-Qa  using PhGACCAGCATCAGAGGGACCGF: GTCTATGGTGGTTACTTGTTR: GTAACCACCATAGACGAGAATATCTCGCATGGCCATGATAACGGCCAGAATGGCAACAAACAAGGCACCAGAGGCGACCAGCATCAGAGGSequence\u00a01: CCTCTGATGCTGGTCGCCTCTGGTGCCTTGTTTGTTGCCATTCTGGCCGTTATCATGGCCATGCGAGATATTCTCGTCTATGGTGGTTACSequence\u00a02: GTAACCACCATAGACGAGAATATCTCGCATAGCCATGATAACAGCCAGAATAGCAACAAACAAAGCACCAGAAGCGACCAGCATCAGAGGSequence\u00a01: CCTCTGATGCTGGTCGCTTCTGGTGCTTTGTTTGTTGCTATTCTGGCTGTTATCATGGCTATGCGAGATATTCTCGTCTATGGTGGTTACSequence\u00a02: GTAACCACCATAGACGAGAATATCTCGCATGCCCATGATAACGCCCAGAATGCCAACAAACAAGCCACCAGAGCCGACCAGCATCAGAGGSequence\u00a01: CCTCTGATGCTGGTCGGCTCTGGTGGCTTGTTTGTTGGCATTCTGGGCGTTATCATGGGCATGCGAGATATTCTCGTCTATGGTGGTTACSequence\u00a02: Vam7 mutants with cysteines inserted at the N- and C-termini of the SNARE domain were generated by inverse PCR with the Vam7 intein vector  and PhusFor Vam7-C208S,GAAAGCGATGACATTGGTACAGCAAACATAGCTCAF: CAATGTCATCGCTTTCCTTGAGCAAGGACCTCAATR: For Vam7-C208S,M250C ,GGGCAGTGTCAAATGGTGCGCGATCAAGAACAAF: CCATTTGACACTGCCCCTGTTGCAAATCGTTATR: For Vam7-C208S,A316C ,CAACAGTTGTTGAATTCTCGAGCACCACCAF: CAACAACTGTTGTTAAAATGTCTAGCCTTCTTGTTGGCR: HOPS and prenyl-Ypt7 , Ypt7-TM2 was added to 2 mM. After prewarming (27\u00b0C for\u00a010 min) the separately GTP-exchanged proteoliposomes in a 384-well plate, fusion reactions were initiated by mixing 5 \u03bcl of each proteoliposome preparation and supplementing with other fusion factors in volumes summing to 10 \u03bcl, continuing incubation at 27\u00b0C in a Spectramax fluorescent plate reader. Fusion incubations (20 \u03bcl) in RB150  had proteoliposomes , 50 nM HOPS, the indicated concentrations of sSNAREs, 400 or 600\u00a0nM Sec17, 300\u00a0nM Sec18, 1 mM ATP or its analogs, and 3 mM MgCl2, as modified in each figure legend.Proteoliposomes were prepared by detergent dialysis from \u03b2-octylglucoside-mixed micelles for fusion assays  and SNARAssays were performed as described previously  with oneMODELLER  was usedThe MODELLER protocol consisted of an alignment step  and a modeling step (python script file modeler-input.py). The script files are shown here for synaptobrevin (nyv1):from modeller import *env\u00a0=\u00a0environaln\u00a0=\u00a0alignment(env)mdl\u00a0=\u00a0model)aln.append_modelaln.appendaln.salign,output='',align_block\u00a0=\u00a015, # no. of seqs. in first MSAalign_what='PROFILE',alignment_type='PAIRWISE',comparison_type='PSSM', # or 'MAT' (Caution: Method NOT benchmarked# for 'MAT')similarity_flag\u00a0=\u00a0True, # The score matrix is not rescaledsubstitution\u00a0=\u00a0True, # The BLOSUM62 substitution values are# multiplied to the corr. coef.#write_weights\u00a0=\u00a0True,#output_weights_file='test.mtx', # optional, to write weight matrixsmooth_prof_weight\u00a0=\u00a010.0) # For mixing data with priorsaln.editaln.writealn.writefrom modeller import *from modeller.automodel import *env\u00a0=\u00a0environa\u00a0=\u00a0automodel)a.very_fasta.starting_model\u00a0=\u00a01a.ending_model\u00a0=\u00a01a.makeThe homology models of Nyv1, Vam3, Vti1, Vam7, and Sec18, together with the crystal structure of Sec17 (PDB ID 1QQE) , were fi public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.Our editorial process produces two outputs: i) Acceptance summary:This is a very important paper that challenges the generally accepted dogma that full zippering of SNARE complexes is essential for intracellular membrane fusion. Previous work had already shown that C-terminal truncation of one SNARE arrested liposome fusion mediated by the yeast vacuolar SNARE complex and that Sec17/Sec18 could rescued fusion, but it was argued that such rescue could arise because Sec17/Sec18 restored C-terminal zippering. This paper now shows that Sec17/Sec18 rescue fusion even when three SNAREs are crippled -by truncation or mutation- to definitively prevent zippering, thus showing that Sec17/18 have a direct, positive role in membrane fusion.Decision letter after peer review:eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by Josep Rizo as Reviewing Editor and Vivek Malhotra as the Senior Editor.Thank you for submitting your article \"Sec17/Sec18 can support membrane fusion without help from completion of SNARE zippering\" for consideration by The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this letter to help you prepare a revised submission.Essential revisions:1. The paper is difficult to read, particularly for non-experts in the field, and is very long, presenting the most dramatic results that support the main conclusion in Figure 10. The data in this figure are minimally dependent on the 51 data panels  preceding this figure. The reviewers wonder how many readers will make it that far and believe that a short, crisp manuscript would better convey the main message of the paper. One possibility is to reformat the paper to a Short Report including a small number of experiments. If the authors feel that such format is too constraining, they could keep the paper as a full Article but should strive to shorten it considerably. Note that some of the data are not necessary for the story and/or are not very compelling. For instance the FRET data of Figure 3, the HOPS/Sec17 binding data of Figure 4 and the studies with antibodies of Figure 9 could be part of a future paper devoted to more in depth mechanistic studies, and the titrations of Figure 7 could be included as supplementary material or could also be presented in such future study. In revising the manuscript, the authors should also consider the recommendations for the authors listed below. Note that these recommendations were extracted (unedited) from the separate reviews and some of them may be useful for a future paper(s) describing data that were removed from this manuscript.2. The authors should discuss whether the mechanism underlying fusion in the in vitro assays presented in this paper could be operating in a cell under normal conditions or it only occurs when mutations are introduced into the SNAREs AND when Sec17/Sec18 are added above a threshold that might or might not be achieved in a cell (see point #1 of reviewer 3 below).Reviewer #1 (Recommendations for the authors):1. The authors should provide an explanation of why the observed FRET efficiency is so low even under the conditions under which SNARE complex assembly is most efficient and the donor and acceptor probes are expected to be very close. Is it due to low incorporation of the dyes on the proteins? It would be advisable to measure the FRET efficiency observed when the SNARE complex is assembled in solution, either with the proteins in the presence of detergent, or using only soluble SNARE domains. Does this lead to much more efficient FRET? If it does, why is SNARE complex formation on the liposomes much less efficient?2. The concept of 'entropic cage' does not seem appropriate for the model that the authors are proposing, as favorable interactions at the C-terminus of the SNARE domains should be pretty much abolished by the mutations to Ser or Gly plus the truncations of two SNAREs. It seems very likely that any proximity between the C-termini of the two membrane-anchored SNAREs would arise from steric constraints caused by the bound Sec17 molecules rather than by entropic contributions. Perhaps the term 'steric cage' or simply 'cage' seem more appropriate.3. Line 559: it seems likely that the persistence of fusion with the alanine mutations but not with the Ser mutations arises because there is still some hydrophobicity left, rather than because of higher helical propensity.4. In lines 133-134, the authors state that \u03b1SNAP stabilizes SNARE complexes, citing Ma et al. 2016, but a more balanced view would be provided if the authors also cite another single molecule study that reached the opposite conclusion .5. The label 'No Sec17, Sec18 or ATP' at the top of Figure 8 is confusing, as there is Sec17 anchored on the liposomes in some of the experiments of the top panels.6. Line 518: Qc3delta is not included in set 2 according to Figure 9.7. Line 447: mM should be \u03bcM.Reviewer #2 (Recommendations for the authors):1. In Figure 1C, I wonder what the point is of showing \"sticks\" in addition to \"cartoon\". To me this makes the images look fuzzy, without adding any usable information.2. In Figure 3, I'm not sure I understand why cis-SNARE complexes require Sec17 to complete the process of zippering? 3. In Figure 3C, I was surprised that HOPS stimulation is independent of Ypt7. What do the authors make of this?4. In Figure 7, is there evidence of cooperativity with respect to Sec17? Mightn't it be interesting to investigate this and perhaps determine a Hill coefficient?5. Also in Figure 7, why does Sec18 still have a dramatic stimulatory effect (compare 1000 nM curves in panels G and H) when Sec17 contains the LALA mutation (which ought to prevent Sec18 binding)?6. Figure 9A Set 4, indicating that Qc alone is sufficient to confer resistance to \u03b1Vps33, would seem to be quite informative. Would it be interesting to repeat the experiment with Qb in place of Qc?7. What might the partial resistance to \u03b1Sec18 in Figure 9, Sets 8 and 9 mean?8. The data in Figure 10 doesn't seem to agree with the data in Figure 10 \u2014figure supplement 1.Reviewer #3 (Recommendations for the authors):1. It is striking that, in the presence of Sec17, Sec18, and HOPS, SNAREs are capable of driving efficient fusion even when several C-terminal layers are deleted. While the data are overall convincing, I am wondering if the Sec17-dependent activation is utilized in the cell with wild-type SNAREs. In other words, is such a mechanism also relevant beyond the engineered system described here? To answer this question, the authors would need to isolate Sec17 or Sec18 mutants that are only defective in stimulating fusion while remaining fully functional in cis-SNARE disassembly. Then they could test if such mutants are defective in driving fusion in vivo.2. The authors stated that the presence of SNAP-25 linker interferes with the binding with the other two \u03b1-SNAP molecules. Does this mean the mechanism proposed in this work is specific to yeast vacuole fusion rather than a general principle?eLife. Your revised article has been evaluated by Vivek Malhotra (Senior Editor), Josep Rizo as Reviewing Editor and one of the referees who reviewed the original version.Thank you for resubmitting your work entitled \"Sec17/Sec18 can support membrane fusion without help from completion of SNARE zippering\" for further consideration by The manuscript has been improved but there are some remaining concerns that need to be addressed, as outlined below:1. A key issue that needs to be clarified is why does the zippering of cis-SNARE complexes depend on Sec17 ? In these experiments, the R- and Qa-SNARE are embedded in the same liposomes, and the Qb- and Qc-SNAREs lack transmembrane domains. The failure of such complexes to fully zipper makes no sense unless something prevents such zippering and the natural culprit is HOPS. The authors should briefly discuss the mechanistic implications of these findings. For example, might HOPS have a proofreading function, in which it somehow prevents cis-SNARE complexes from fully zippering (but perhaps not trans-SNARE complexes)? In any case, the authors should clearly point out from the beginning of the description of the zippering experiments of Figure 2 that they involve cis-SNARE complexes. They should also explain the relevance of cis-SNARE zippering assays to a manuscript that otherwise deals with trans-SNARE zippering/fusion.2. The use of lines and sticks in Figure 1C is visually uninterpretable and therefore unhelpful. The authors are advised to remove them although this is of course up to them. Essential revisions:1. The paper is difficult to read, particularly for non-experts in the field, and is very long, presenting the most dramatic results that support the main conclusion in Figure 10. The data in this figure are minimally dependent on the 51 data panels  preceding this figure. The reviewers wonder how many readers will make it that far and believe that a short, crisp manuscript would better convey the main message of the paper. One possibility is to reformat the paper to a Short Report including a small number of experiments. If the authors feel that such format is too constraining, they could keep the paper as a full Article but should strive to shorten it considerably. Note that some of the data are not necessary for the story and/or are not very compelling. For instance the FRET data of Figure 3, the HOPS/Sec17 binding data of Figure 4 and the studies with antibodies of Figure 9 could be part of a future paper devoted to more in depth mechanistic studies, and the titrations of Figure 7 could be included as supplementary material or could also be presented in such future study. In revising the manuscript, the authors should also consider the recommendations for the authors listed below. Note that these recommendations were extracted (unedited) from the separate reviews and some of them may be useful for a future paper(s) describing data that were removed from this manuscript.We have taken this seriously, and now have 5 data figures  instead of the 9 in the original submission. For this reason, and since the Introduction and Results are more succinct, the reader won't \"burn out\" before getting to the \"triply-crippled Q's\" Figure. The 5 data figures are essential to develop the system and show its characteristics, and the supplementary figures provide depth to our consideration of the Figures. For a paper which challenges a main shibboleth of the field, we feel it's important to develop the system fully, showing the full impact and ramifications of crippling even one Q, rather than just cherry-pick one culminating figure.2. The authors should discuss whether the mechanism underlying fusion in the in vitro assays presented in this paper could be operating in a cell under normal conditions or it only occurs when mutations are introduced into the SNAREs AND when Sec17/Sec18 are added above a threshold that might or might not be achieved in a cell (see major point #1 of reviewer 3 below).Reviewer #1 (Recommendations for the authors):1. The authors should provide an explanation of why the observed FRET efficiency is so low even under the conditions under which SNARE complex assembly is most efficient and the donor and acceptor probes are expected to be very close. Is it due to low incorporation of the dyes on the proteins? It would be advisable to measure the FRET efficiency observed when the SNARE complex is assembled in solution, either with the proteins in the presence of detergent, or using only soluble SNARE domains. Does this lead to much more efficient FRET? If it does, why is SNARE complex formation on the liposomes much less efficient?We emphasize that these are ensemble FRET experiments rather than single-molecule FRET experiments. The average FRET efficiency is modest because its denominator includes all the fluorescent Qb and Qc in a bulk reaction, even though only a small per cent enter HOPS-dependent SNARE complex. We note this now directly in the text.2. The concept of 'entropic cage' does not seem appropriate for the model that the authors are proposing, as favorable interactions at the C-terminus of the SNARE domains should be pretty much abolished by the mutations to Ser or Gly plus the truncations of two SNAREs. It seems very likely that any proximity between the C-termini of the two membrane-anchored SNAREs would arise from steric constraints caused by the bound Sec17 molecules rather than by entropic contributions. Perhaps the term 'steric cage' or simply 'cage' seem more appropriate.Thank you, we have removed this term and now describe our model in terms of an \"environment\" that Sec17 creates.3. Line 559: it seems likely that the persistence of fusion with the alanine mutations but not with the Ser mutations arises because there is still some hydrophobicity left, rather than because of higher helical propensity.A good point, which we have now added. Thanks.4. In lines 133-134, the authors state that \u03b1SNAP stabilizes SNARE complexes, citing Ma et al. 2016, but a more balanced view would be provided if the authors also cite another single molecule study that reached the opposite conclusion .Thanks, we've now added this.5. The label 'No Sec17, Sec18 or ATP' at the top of Figure 8 is confusing, as there is Sec17 anchored on the liposomes in some of the experiments of the top panels.Thanks, our mistake! We have removed \"Sec17\" from these labels; as you note, what differentiates these rows of panels is the presence or absence of Sec18 and of ATP or its analogs.6. Line 518: Qc3delta is not included in set 2 according to Figure 9.Qc3delta is not included initially, but is added along with Sec17, Sec18, and ATPgammaS at 30min., 1min after the control IgG, anti-Vps33, or anti-Sec18 were added. Each of the 8 sets has all the same components, but differ in which are added from the start and which are only added after the antibodies; we've now emphasized this in the text.7. Line 447: mM should be \u03bcM.Thank you.Reviewer #2 (Recommendations for the authors):1. In Figure 1C, I wonder what the point is of showing \"sticks\" in addition to \"cartoon\". To me this makes the images look fuzzy, without adding any usable information.We included the sidechains to emphasize that these molecules are extensively interacting rather than just being near each other.2. In Figure 3, I'm not sure I understand why cis-SNARE complexes require Sec17 to complete the process of zippering? Without Sec17, these complexes apparently don't zipper all the way most of the time; they are in a metastable partially-zippered state. Fusion without Sec17 is slow because zippering is slow/infrequent; adding Sec17 enhances zippering and enhances fusion. When Qc lacks the +4 to +8 layers, it's perhaps zippered even less, and is seen to be labile to exchange.3. In Figure 3C, I was surprised that HOPS stimulation is independent of Ypt7. What do the authors make of this?As we've noted in earlier papers , HOPS has direct affinity for SNAREs, and a strict requirement for Ypt7 is only seen at low SNARE levels . The FRET signals of SNARE complexes, by the assay in Figure 2, would have been too low had we employed the very low SNARE levels which confer strict Ypt7-dependence.4. In Figure 7, is there evidence of cooperativity with respect to Sec17? Mightn't it be interesting to investigate this and perhaps determine a Hill coefficient?We agree, but a more detailed study will be needed to determine a Hill coefficient.5. Also in Figure 7, why does Sec18 still have a dramatic stimulatory effect (compare 1000 nM curves in panels G and H) when Sec17 contains the LALA mutation (which ought to prevent Sec18 binding)?The LALA mutant blocks Sec17 stimulation of Sec18-mediated 4-SNARE complex disassembly, but hasn't been shown to block all Sec17:Sec18 binding.6. Figure 9A Set 4, indicating that Qc alone is sufficient to confer resistance to \u03b1Vps33, would seem to be quite informative. Would it be interesting to repeat the experiment with Qb in place of Qc?This is just what was done in Set 2.7. What might the partial resistance to \u03b1Sec18 in Figure 9, Sets 8 and 9 mean?We can only speculate about the reasons. For example, the partial resistance would be consistent with HOPS:4-SNARE assembly creating a very favorable binding site for Sec18, so that the SNAREs binding Sec18 yields an antibody-resistant complex about as fast as other Sec18s are captured in solution and inactivated by their antibody. Perhaps when Sec18 is added from the start without Sec17, as in Set 6, it binds to non-functional SNARE subcomplexes.8. The data in Figure 10 doesn't seem to agree with the data in Figure 10 \u2014figure supplement 1.We made a labeling error and have fixed it.Reviewer #3 (Recommendations for the authors):1. It is striking that, in the presence of Sec17, Sec18, and HOPS, SNAREs are capable of driving efficient fusion even when several C-terminal layers are deleted. While the data are overall convincing, I am wondering if the Sec17-dependent activation is utilized in the cell with wild-type SNAREs. In other words, is such a mechanism also relevant beyond the engineered system described here? To answer this question, the authors would need to isolate Sec17 or Sec18 mutants that are only defective in stimulating fusion while remaining fully functional in cis-SNARE disassembly. Then they could test if such mutants are defective in driving fusion in vivo.This is one of our long-term plans! For now though, we do point out that Schwartz et al., (2017) showed that the vacuole fragmentation phenotype from Qc3delta is cured by Sec17 overexpression. We've also added to the text that our concentrations of Sec17 and Sec18 are in the same range as published in vivo concentrations; the intracellular concentrations of Sec17 and Sec18 are 150 to 1100nM and 250-760nM, respectively .2. The authors stated that the presence of SNAP-25 linker interferes with the binding with the other two \u03b1-SNAP molecules. Does this mean the mechanism proposed in this work is specific to yeast vacuole fusion rather than a general principle?A more thorough investigation of other fusion systems will be needed to evaluate the generality of Sec17/Sec18 direct promotion of fusion. Many other Qb and Qc SNAREs are not joined as in SNAP-25, but we don't know whether or not this will correlate with whether Sec17/Sec18 stimulate fusion.We note that our model doesn't depend on the precise stoichiometry of Sec17:SNAREs. CryoEM structures of NSF/SNAP complexes suggest 2:1, 3:1, or 4: stoichiometries.The manuscript has been improved but there are some remaining concerns that need to be addressed, as outlined below:1. A key issue that needs to be clarified is why does the zippering of cis-SNARE complexes depend on Sec17 ? In these experiments, the R- and Qa-SNARE are embedded in the same liposomes, and the Qb- and Qc-SNAREs lack transmembrane domains. The failure of such complexes to fully zipper makes no sense unless something prevents such zippering and the natural culprit is HOPS. The authors should briefly discuss the mechanistic implications of these findings. For example, might HOPS have a proofreading function, in which it somehow prevents cis-SNARE complexes from fully zippering (but perhaps not trans-SNARE complexes)? In any case, the authors should clearly point out from the beginning of the description of the zippering experiments of Figure 2 that they involve cis-SNARE complexes. They should also explain the relevance of cis-SNARE zippering assays to a manuscript that otherwise deals with trans-SNARE zippering/fusion.Why does zippering need Sec17? We agree that \"...the natural culprit is HOPS\", and have added emphasis to this for clarity, now explicitly noting that \"\u2026 the enhanced FRET between the SNAREs in the presence of HOPS and Sec17  is not seen without HOPS (bar 8) or Sec17 (bar 10).\" We hadn't stated this clearly enough before.cis-SNARE complexes. We also more clearly cast the study in Figure 2 as one way to examine the interactions of HOPS, Sec17, and the SNAREs, a preamble to functional studies presented in the later figures. This is now pointed out both right before Figure 2 and in the Discussion.We now point out explicitly that the model we're examining in Figure 2 is of We now more cautiously refer throughout to Sec17/HOPS induced conformational change in the SNAREs, reflected by altered FRET, rather than just \"zippering\". We discuss why zippering is a reasonable, even likely, explanation for this conformational change.We too yearn for a physical assay of the completion of zippering of SNAREs in trans, but this is not yet feasible: trans-SNARE complexes are far less abundant than cis-complexes, engaging no more than a few per cent of the SNAREs . Furthermore, introducing two somewhat bulky fluorophores in the crowded environment at the C-termini of SNARE domains of trans-complex with HOPS, Sec17, and two tightly apposed membranes could well induce artifacts.2. The use of lines and sticks in Figure 1C is visually uninterpretable and therefore unhelpful. The authors are advised to remove them although this is of course up to them.We're removed the \"lines and sticks\" from Figure 1C, as requested."}
{"text": "Chronic total occlusion (CTO) of coronary arteries is a common finding in patients with known or suspected coronary artery disease (CAD). Although tremendous advances have been made in the interventional treatment of CTOs over the past decade, correct patient selection remains an important parameter for achieving optimal results. Non-invasive imaging can make a valuable contribution. Ischemia and viability, two major factors in this regard, can be displayed using echocardiography, single-photon emission tomography, positron emission tomography, computed tomography, and cardiac magnetic resonance imaging. Each has its own strengths and weaknesses. Although most have been studied in patients with CAD in general, there is an increasing number of studies with positive preselectional factors for patients with CTOs. The aim of this review is to provide a structured overview of the current state of pre-interventional imaging for CTOs. Chronic total occlusion (CTO) of coronary arteries is a common finding in coronary angiograms of patients with known or suspected coronary artery disease (CAD). Despite their frequency, CTOs are the most reliable predictor of an incomplete revascularization. This is the result of two major factors: (a) a lack of data from randomized controlled trials regarding a benefit on mortality and (b) the lower success rate accompanied by a higher complication rate of an interventional revascularization. Large registry studies have shown that CTO percutaneous coronary interventions (PCI) can reduce mortality \u20134. The ECurrent guidelines and position papers therefore recommend CTO PCI in the case of ongoing symptoms and viable myocardia in the CTO territory \u201310. HoweViability is by definition present in segments with preserved systolic function. In contrast, dysfunctional segments are not a priori avital. The term \u201chibernation\u201d was introduced to explain a potentially dysfunctional myocardium resulting in ischemia. Information is gained from an initial coronary angiogram where well-developed collaterals correlate with less extensive scarring, indicating a more viable myocardium , 17. A nFor the detection of a hibernating myocardium, a broad range of non-invasive imaging modalities is available. An overview is presented in Echocardiography is inexpensive and available nearly everywhere. It is the standard modality for the evaluation of global and regional cardiac function. Besides pre-interventional examinations, the bedside use of echocardiography in the catheter laboratory provides the opportunity to detect complications during interventions, such as pericardial effusions or intramural hematomas.However, the value and validity of echocardiography depend on the investigator's experience. In CAD patients, an increase in regional contractility under dobutamine stress (\u201ccontractile reserve\u201d) can show viability and improvement of regional function after revascularization \u201329. The In addition to the examination under dobutamine stress, echocardiography at rest can predict viability under certain circumstances. An end-diastolic wall thickness (EDWT) of >0.6 cm in dysfunctional segments is a marker of hibernation. In a trial involving 45 patients undergoing 2D echocardiography, DSE, and rest-redistribution thallium-201 (Tl-201) tomography before revascularization, an EDWT of >0.6 cm had 94% sensitivity and 50% specificity with a ROC curve similar to the maximum Tl-201 uptake, while DSE increased specificity to 88% . More reMyocardial perfusion scintigraphy (MPS) is a nuclear medicine technique that is used for around 50 years to assess regional left ventricular myocardial perfusion, diastolic and systolic function as well as to differentiate hibernating myocardium from transmural or non-transmural infarct. Three dimension images of myocardium are acquired after injecting radiopharmaceuticals with high first pass extraction by the myocardium using the single emission computed tomography (SPECT) technique. In majority of the centers the images are additionally corrected for attenuation correction using low dose CT images acquired simultaneously with SPECT images. As radioisotopes preferentially Technetium-99m (Tc-99m), specially in Europe and rarely Thallium-201 (Tl-201) are used . Tl-201 The rarely used Tl-201 is a potassium analog and uses the Na/K ATPase system of viable myocardial cells. Its initial myocardial uptake is proportional to blood flow and it is rapidly cleared from the blood. After that up to 4 h a re-equilibration takes place when Tl-201 concentration levels are lower in the blood. This is also called redistribution and the process is directly proportional to blood flow to the area and viable myocardial cells. If the stress and rest images show matched homogeneous normal tracer uptake there is no sign of ischemia or infarction. If the tracer uptake during stress is abnormal but with normal uptake during rest / redistribution that is a sign for ischemia. Perfusion defects on both stress and rest images usually means there is a scar. To check that area for hibernating myocardium a reinjection of Tl-201 and another image acquisition after 18\u201324 h can be carried out. If there is Tl-201 uptake, there is hibernating myocardium in this area. If there is a scar no tracer uptake can be detected , 38.The Tc-99m-labeled radiotracers are monovalent cations that enter cells through their lipophilic characteristics. Their uptake is also dependent on blood flow but as well as on electrochemical gradients of the plasma- and mitochondrial-membranes, the cellular pH and intact energy pathways. In the myocytes they are trapped mainly in the mitochondria with minimal washout and no redistribution in the blood. After the intravenous injection these tracers are first cleared by the liver and excreted through the bile. This makes it impossible to assess the myocardial uptake of the inferior wall right after injection and leads to a delay of 15\u201345 min before the start of the imaging acquisition, especially for Sestamibi. Tetrofosmin allows earlier imaging acquisition because of lower hepatic uptake. Stress and rest images can be acquired in 2-day and 1-day protocols that show no significant differences . For theThe accurate interpretation of the myocardial perfusion imaging with SPECT is crucial. Absolute quantification of perfusion is more common with PET than with SPECT. According to the literature the sensitivity and the specificity of gated myocardial SPECT studies to diagnose clinically significant CAD with Tc-99m tracers is 88.3 and 75.8%, respectively . Cutoff Visual interpretation of three vessels CAD is a challenge for nuclear cardiology field. However, with the development and standardization of protocols as well as advances in the scanner types  there is a remarkable improvement in the quantification of myocardial wall thickening, contraction, and dilatation as well as in measurement of ejection fraction. Left ventricular dilatation in stress in comparison to rest can be quantified as transient ischemic dilatation (TID). A TID value above 1.3 is generally considered to be significant and can be used for assessment of three vessels disease .However, the comparatively low spatial resolution of SPECT images compared to that of other imaging modalities is a potential disadvantage, as it can lead to overdiagnosis of subendocardial infarctions. Nevertheless, this is not a real disadvantage in the examination of patients with CTOs since transmurality is the main question in this case. There are new predefined criteria for differentiating between transmural and non-transmural infarction in SPECT images .Overall, SPECT appears to be a useful examination modality for patients with CTOs. A radiation dose of 6\u201324 mSv, depending on the protocol and tracer used (lower radiation doses for Tc-99m and higher radiation doses for Tl-201) , as wellPositron emission tomography (PET) is another nuclear medicine imaging technique that is in use for around 40 years in some specialized centers with a broader use during the last years. The main advantages of PET over SPECT are higher-quality images because of high-energy emitted photons (511 keV) with improved spatial and temporal resolution and shorter half-lives of the radioisotopes (mostly some minutes) as well as less radiation exposure , 46. By For the imaging with PET positron emitting radionuclides like Rubidium-82 (Rb-82), Oxygen-15 (O-15), Nitrogen-13 (N-13), and Flouride-18 (F-18) are used and incorporated into biochemical molecules. Rb-82 is a generator product, the other named radioisotopes are cyclotron products and for O-15 and N-13 with very short half-lives of 2 and 10 min, respectively, making an onsite cyclotron necessary. For perfusion imaging O-15 water, N-13 Ammonia, Rb-82 and F-18 Flurpiridaz are used with stress and rest imaging as in MPS. O-15 water is ideal for quantification of MBF in absolute terms. It can be seen as a one-compartment tracer kinetic model as it has no barrier effect form cellular membranes. Because of its very short half-life and poor contrast images between blood pool and the myocardium its use is limited. N-13 Ammonia is cationic and its first-pass extraction is related to blood flow for low flow rates. It reaches the cytosols via passive diffusion or active transport and is incorporated into the amino acid pool or diffuses back into the blood. Rb-82 is a potassium analog with a very short half-life of 75 s. During first-pass its extraction is not very high and builds a plateau with higher blood flow rates. F-18 Flurpiridaz is a novel PET mitochondrial complex-1 inhibitor in preparation with a half-life of 120 min. It has a high extraction rate with high flow and therefore makes absolute quantification of blood flow possible . As for For the differentiation of a perfusion defect in both stress and rest between a scar region and ischemic but viable region F-18-Fluorodeoxyglucose (FDG) is used. F-18-FDG competes with glucose for transport as well as phosphorylation by hexokinase. Once it is in the cytosol and phosphorylated it cannot be further processes by glycogen synthesis and is therefore trapped in the cell , 48. ItsIn CAD patients in general, an ischemia-driven revascularization approach guided by PET could result in a reduction in angina severity and a slight improvement in the left ventricular ejection fraction . StulijfComputed tomography (CT) angiography has traditionally been used for anatomical evaluations of the coronary tree. With the advent of new-generation scanners with dual-source imaging, 64-row scanners, and modern software techniques, plaque morphology and regional calcium burden evaluations and functional assessments have also become possible , 52.Since CTOs are found in many patients with known or suspected CAD, CT examinations can also contribute to their diagnosis. However, the distinction between a \u201ctrue\u201d CTO and subtotal stenosis constitutes a diagnostic difficulty. The distal lumen is often contrasted via collaterals, and the spatial resolution of CT is relatively low in comparison to classical angiography. Diagnostic markers such as a lesion length over 9 mm and the so-called reverse attenuation gradient sign have proven to be helpful, enabling a clear diagnosis in most cases \u201355. AparA key task of the pre-interventional examination of CTO patients is the abovementioned viability test. While cardiac CT was previously used for purely anatomical assessments of the coronary tree, it can also be used for hibernation assessments. These are based on classic measures, such as global and regional function, wall thickness, and wall thickening in systole, while assessment methods derived from CMR have not yet found their way into clinical routine. Reduced perfusion can be indicated by reduced contrast during the arterial phase. Similar to the flooding behavior of gadolinium-containing magnetic resonance imaging (MRI) contrast agents, delayed (late) enhancement with iodine-containing contrast media indicates myocardial scarring. A mismatch between underperfusion  and late enhancement indicates a potential intervention target . An addiFor the prediction of interventional recanalization success, the Computed Tomography Registry of Chronic Total Occlusion Revascularization (CT-RECTOR) score was established by analogy with angiography-based scores, such as the Japanese Multicenter CTO Registry (J-CTO) and Prospective Global Registry for the Study of Chronic Total Occlusion Intervention (PROGRESS-CTO) scores . It is cThe actual procedure can also be planned using CT angiography. Depending on factors such as good collateralization or the presence of an intensively calcified proximal cap, the access route (antegrade or retrograde) can be determined, or in the case of severe calcifications over short distances, an early switch to a stiffer wire can be decided. The anticipation of a need for rotablation or debulking devices is a potentially time-saving and patient-friendly factor . In a siCT angiography can also be used to detect in-stent restenosis in follow-up investigations. However, as it has shown a high negative predictive value but a low positive predictive value \u201368, its In summary, pre-interventional multi-slice CT is a useful additional pre-interventional diagnostic tool. If necessary, it should be combined with other examination modalities to detect hibernation. Among all diagnostic modalities, CT is the closest to integrating diagnosis, risk calculation, intervention planning, and follow-up care in one modality.Cardiovascular magnetic resonance (CMR) is the gold standard for the evaluation of the left and right ventricular volumes and function, as well as ischemia and viability. A major advantage of CMR over nuclear and CT imaging is the lack of a need for ionizing radiation and the better tolerance of gadolinium-containing contrast media compared to iodine-containing contrast media. Its spatial and temporal resolutions are good thanks to modern sequences, such as balanced steady-state free precision imaging, ECG-gating, and breath holding techniques . Image qIschemia can be visualized using adenosine perfusion CMR. Less contrasted myocardial areas under vasodilator stress indicate a myocardium at risk . In CAD Two modalities have been developed for viability assessment: low-dose dobutamine CMR (LDD-CMR) and LGE. LDD-CMR is the older method, but it has shown excellent results in predicting functional recovery after revascularization, even in direct comparison with other imaging techniques , 81. In LGE imaging is a valuable tool for distinguishing a hibernating myocardium from post-infarction scarring. Five to 15 min after the administration of a gadolinium-based contrast agent, focal deposits of gadolinium in the myocardium show a widening of the extracellular volume, indicating fibrosis and scarring, because of a delayed washout. LGE has shown a good correlation with PET examinations and excellent inter- and intra-observer agreement . In stabIn a trial involving 59 patients with successful CTO PCIs, a pre-interventional LGE extent of <50% was associated with functional recovery of the related segment . In anotFor even better workups, new techniques, such as parametric mapping, are currently under investigation. In a first study, the extracellular volume was found to be superior to LGE for functional recovery assessments .Using CMR, patients have already been examined after complex PCI in order to investigate the extent and clinical impact of a peri-interventional infarction. This revealed a relevant proportion of patients with new LGE after PCI, which in turn had a negative impact on the clinical outcome . TechniqA central point of future developments, besides a further increase in diagnostic accuracy, will be a reduction in patient exposure to contrast media or radiation. Since CMR typically works without radiation, a further improvement of CMR coronary angiography would be an obvious direction in the quest to overcome the disadvantages of CT in CTO intervention planning. CMR coronary angiography is already feasible for the evaluation of plaque morphology and composition \u201393. At tAnother goal for further improvement of interventional outcomes is the integration of imaging modalities into the actual intervention. Opolski et al. demonstrated the feasibility and safety of an augmented-reality glass that provides the interventional cardiologist with additional information from coronary CT angiography . This isAs already discussed, each modality has its own strengths and weaknesses. Therefore, fusion imaging, such as PET/CT or PET/MRI, could improve the pre-interventional workup of CTO patients. For example, a combination of morphological assessments using CT with metabolic assessments using PET could improve patient selection . In a fiIn summary, the use of non-invasive imaging for ischemia and viability assessments before interventional recanalization of a CTO is desirable. Although some imaging techniques have clear advantages over others, the selection depends mainly on regional availability and expertise. Better patient selection and prediction of interventional success should be the target of future prospective studies.JK and DB: concept and writing of the manuscript. NE and VP: writing of the SPECT and PET section, proofreading, and image examples. MK, SM, JM, NN, TS, MT, and TT: interpretation of the sources, proofreading, and image example. WR: supervision, concept, and proofreading. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Orthotopic heart transplantation (HTX) is the gold standard to treat end-stage heart failure. Numerous risk stratification tools have been developed in the past years. However, their clinical utility is limited by their poor discriminative ability. High sensitivity troponin T (hsTnT) is the most specific biomarker to detect myocardial cell injury. However, its prognostic relevance after HTX is not fully elucidated. Thus, this study evaluated the predictive value of postoperative hsTnT for 1-year survival and days alive and out of hospital (DAOH) after HTX.This retrospective cohort study included patients who underwent HTX at the University Hospital Duesseldorf, Germany between 2011 and 2021. The main exposure was hsTnT concentration at 48\u00a0h after HTX. The primary endpoints were mortality and DAOH within 1\u00a0year after surgery. Receiver operating characteristic (ROC) curve analysis, logistic regression model and linear regression with adjustment for risk index for mortality prediction after cardiac transplantation (IMPACT) were performed.Out of 231 patients screened, 212 were included into analysis . One-year mortality was 19.7% (40 patients) and median DAOH was 298\u00a0days (229\u2013322). ROC analysis revealed strongest discrimination for mortality by hsTnT at 48\u00a0h after HTX [AUC\u2009=\u20090.79 95% CI 0.71\u20130.87]. According to Youden Index, the cutoff for hsTnT at 48\u00a0h and mortality was 1640\u00a0ng/l. After adjustment for IMPACT score multivariate logistic and linear regression showed independent associations between hsTnT and mortality/DAOH with odds ratio of 8.10 [95%CI 2.99\u201321.89] and unstandardized regression coefficient of \u22121.54 [95%CI \u22122.02 to \u22121.06], respectively.Postoperative hsTnT might be suitable as an early prognostic marker after HTX and is independently associated with 1-year mortality and poor DAOH.The online version contains supplementary material available at 10.1186/s40001-022-00978-4. Numerous risk stratification tools have been developed in the past years, but their clinical use is often limited by insufficient predictive values . Recently, Devereaux et al. investigated the prognostic value of high-sensitivity troponin I (hsTnI) in patients undergoing cardiac surgery and showed that levels of hsTnI were independently associated with mortality . The hsTnT levels at 48\u00a0h after HTX showed numerically strongest discrimination for 1-year mortality regarding the AUC. Youden Index determined a cutoff of 1640\u00a0ng/L for hsTnT at 48\u00a0h after HTX  for non-events and 27.5% (95% CI 14.6\u201343.9) for events. Regarding NARI, the model was able to identify 114/1000 patients more at risk for 1-year mortality. Corresponding reclassification tables were added to the supplements. In ROC analysis the AUC for the model including troponin was significantly higher as compared to the model only including IMPACT score . The net benefit curve suggested highest net benefit for the combined use of IMPACT and hsTnT  days vs. above cutoff 278 (14\u2013308) days, p\u2009\u2264\u20090.0001]. Results for other hsTnT sampling timepoints are presented in the supplements. In a multivariable linear regression model, association of continuous hsTnT elevation (per 100\u00a0ng/L) and DAOH remained significant when adjusted for points on the IMPACT score   which is supposed to optimize the allocation of the limited donor organs. In the lung transplantation setting, a similar score already exists ) which is also used to prioritize waiting list candidates 12\u00a0years and older based on a combination of waitlist urgency and post-transplant survival. Based on the data of this study, postoperative hsTnT may also be included into such a score for early re-estimation of postoperative risk and prognosis. Further studies should focus on potential interventions depending on hsTnT values that might be able to prevent complications and finally to reduce mortality after HTX. These may include intensified monitoring or standardized protocols for strict follow-up of these patients.Strengths of the presented data include first, standardized troponin measurement at multiple time points with high data completeness; second, complete 12-month follow-up. Further, we did not only address mortality but also DOAH, a more patient-centered endpoint to quantify life impact . We are The generalizability of these findings may be hampered by the single-center design. However, characteristics such as 1-year mortality were in line with the current literature.Early hsTnT levels after HTX surgery are independently associated with poor 1-year survival and reduced DAOH. Therefore, early hsTnT concentrations might be useful for early risk reassessment to tailor postoperative therapy or decision-making in the intensive care unit.Additional file 1: Figure S1. Study Flowchart. Figure S2. Association of hsTnT levels at different timepoints above cutoff and days alive and out of hospital. Table S1. Reclassification tables of a 1-year mortality prediction model using IMPACT compared to a model using IMPACT and hsTnT."}
{"text": "Pseudo-progression and flare-up phenomena constitute a novel diagnostic challenge in the follow-up of patients treated with immune-oncology drugs. We present a case study on pulmonary flare-up after Idecabtagen Vicleucel (Ide-cel), a BCMA targeting CAR T-cell therapy, and used single-cell RNA-seq (scRNA-seq) to identify a Th17.1 driven autoimmune mechanism as the biological underpinning of this phenomenon. By integrating datasets of various lung pathological conditions, we revealed transcriptomic similarities between post CAR T pulmonary lesions and sarcoidosis. Furthermore, we explored a noninvasive PET based diagnostic approach and showed that tracers binding to CXCR4 complement FDG PET imaging in this setting, allowing discrimination between immune-mediated changes and true relapse after CAR T-cell treatment. In conclusion, our study highlights a Th17.1 driven autoimmune phenomenon after CAR T, which may be misinterpreted as disease relapse, and that imaging with multiple PET tracers and scRNA-seq could help in this diagnostic dilemma. CAR T-cell therapy is establishing itself as a new standard of care in relapsed and refractory multiple myeloma (RRMM), and the field is moving towards use of this modality in early treatment lines . For exa18F-Fluorodeoxyglucose (FDG) PET/CT imaging is increasingly used in addition to serological M-protein testing and bone marrow aspirates for staging prior to and after CAR T infusion. Whether FDG is the best tracer in this setting has yet to be determined, as the technique is being based not only on the quantification of increased glucose uptake by tumor cells but also by others such as inflammatory cells [Appreciating the high incidence of extramedullary lesions and patchy disease patterns seen in the RRMM setting, whole body ry cells . Given try cells , 5. Pseury cells , 7. OtheHere, we report on a sarcoidosis-like flare-up after anti-BCMA CAR T-cell product Ide-cel and present our strategy to discriminate between autoimmune phenomena and true relapse using multiple PET tracers along with single-cell RNA-sequencing (scRNA-seq).6 CAR T cells was infused. The patient experienced rapid-onset cytokine release syndrome (CRS) grade 1, which was successfully treated with repetitive doses of tocilizumab. Respiratory symptoms fully resolved during bridging therapy but came back 10 days after CAR T infusion. Disease assessment was performed at 3 months of follow-up revealing undetectable MRD in a bone marrow aspirate and full resolution of focal bone lesions but still disseminated FDG uptake at the lung and mediastinal lymph nodes. To narrow the differential diagnoses down, we performed a PET using 68Ga-DOTA(0)-Phe(1)-Tyr(3)-octreotide (68Ga-DOTATOC) that usually detects sarcoidosis with high sensitivity and specificity [68Ga-Pentixafor (binds to CXCR4), which is an alternative tracer to FDG in the detection of malignant plasma cells [A 61-year-old Caucasian male was diagnosed with IgA kappa MM with osteolytic bone disease, anemia, and 80% bone marrow infiltration by malignant plasma cells. In addition, biopsy-proven extramedullary disease (EMD) was found located to both lungs, explaining months of violent coughing prior to presentation. Fluorescent in situ hybridization revealed high-risk cytogenetics including t, amp(1q), and del(1p). The patient responded to induction therapy using bortezomib, cyclophosphamide, dexamethasone, but stem cell harvest was skipped due to the COVID-19 pandemic. A bortezomib based bridging therapy failed, M-protein levels increased and salvage therapy was administered using daratumumab, pomalidomide, dexamethasone to which the patient was refractory. Given the limited options at this stage, the patient was treated with the anti-BCMA CAR T-cell product ide-cel. PET imaging using multiple tracers was conducted at baseline, 3-month follow-up, and 6-month follow-up Fig.\u00a0. Baselinma cells   and genes associated with Th17 T-cells , indicative for a Th1-polarized Th17 phenotype , and IL17F were not expressed . Consequently, we termed this cluster CD8 Th17.1-like. Also CD8-positive cells with Th17-like features and plasticity towards IFNG expression have been linked to autoimmune diseases [IFNG, TNF, CSF2 (GM-CSF), CCL20, and IL26, highlighting their polyfunctional nature [IFNG, TNF, TBX21, CXCR3) and four Th17-associated  genes in individual cells. They were considered co-expressing when at least one Th1- and one Th17-associated gene was detected in a single cell, and we confirmed co-expression in the majority of Th17.1 and CD8 Th17.1-like cells. , of which none was identified as plasma cell Fig.\u00a0. Qualityand CSF2 \u201314, whilsed Fig.\u00a0. Of noteig.\u00a0Fig.\u00a0. Consequl nature , 24 , expressing high levels of SPP1, recently identified in severe COVID-19 ARDS and IPF (idiopathic pulmonary fibrosis), was absent from CART-BAL, sarcoidosis and HC BALs [While we observed aberrant T-cells in the CART-BAL dataset, the macrophage compartment in CART-BAL, sarcoidosis, and HC was mainly comprised of unremarkable tissue resident alveolar macrophages. A pro-fibrotic macrophage phenotype  and CCND2 expression of which a considerable amount was in a proliferative state , followed by high-dose melphalan and autotransplant two weeks after ERT [At 6 month follow-up, the patient was still coughing. CAR T-cell numbers in the peripheral blood declined from initially 10% to 0.05% of PBMCs, and humoral immunity started to recover. FDG PET showed the known sarcoidosis-like pulmonary changes, but also revealed a number of new soft-tissue lesions located to the musculature of both lower limbs, suspicious for extramedullary relapse. In contrast to the previous scans, these lesions were CXCR4 positive Fig.\u00a0. We biopate Fig.\u00a0. CXCR4 eion Fig.\u00a0. EPCAM eion Fig.\u00a0. We compion Fig.\u00a0. Whetherfter ERT . The patWe hypothesize that CRS after CAR T-cell infusion triggered expansion of pathogenic Th17.1 T-cells in the lung leading to sarcoidosis-like manifestations. Th1-polarized Th17 cells are key effectors of autoimmune inflammation  includinBCMA-loss [PET imaging using multiple tracers is a noninvasive approach to decode tumor heterogeneity in MM . Using tCMA-loss , 43.Finally, we report the case of a BCMA positive relapse after anti-BCMA CAR T. While antigen loss is a rare tumor-intrinsic mechanism of resistance , 43, theIn conclusion, we demonstrated a clinically relevant autoimmune phenomenon after CAR T-cell therapy that can be delineated using scRNA-seq and PET imaging.68Ga-Pentixafor, as described previously [18F-FDG and 68Ga-DOTATOC were prepared as described previously [18F-FDG, patients fasted for at least 6\u2009h with blood glucose levels below 160\u2009mg/dl at time of scan. For 68Ga-Pentixafor and 68Ga-DOTATOC PET/CT, fasting was not required. Spiral CT with or without intravenous contrast was conducted and included a field of view from the base of the skull to the proximal thighs. PET emission data were acquired in three-dimensional mode . After decay and scatter correction, PET data were then reconstructed iteratively using the algorithm provided by Siemens Esoft . Image interpretation was conducted on a visual basis and carried out by an expert reader (RAW).We used a fully automated synthesis module  to synthesize eviously . 18F-FDGeviously , 46. PETCART-BAL sample was obtained at 3-month follow-up, diluted in PBS and filtered through a 40\u2009\u03bcm mesh resulting in a single cell suspension. EMD sample was obtained at 6-month follow-up by ultrasound guided push biopsy. The biopsy was filtered with a 100\u2009\u03bcm strainer followed by tissue digestion using Collagenase A (10\u2009mg/mL), Collagenase D (10\u2009mg/mL), DNAse I (2\u2009mg/mL). Digestion was stopped with EDTA (100\u2009mM) followed by a second filtering through a 70\u2009\u03bcm mesh resulting in a single cell suspension.Obtained single cell suspensions were adjusted to a concentration of 400 cells/\u03bcl and 1000 cells/\u03bcl for CART-BAL and EMD, respectively, and loaded into the 10x Chromium controller for scRNA-seq. Following the detailed protocol provided by 10x genomics, single cell 3\u2019 reagent kit v3.1 was used for reverse transcription, cDNA amplification and library construction. Libraries were quantified using QubitTM 2.0 Fluorometer (ThermoFischer) and quality was checked by 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent). S2 flow cells were used for sequencing on a NovaSeq 6000 sequencer (Illumina). CART-BAL has been run in duplicate to obtain technical replicates.EPCAM) were removed. Quality filtering thresholds for the number of detected genes, number of detected unique RNA molecules (UMIs) and fraction of mitochondrial UMI-counts are available in Supplementary Table\u00a0Raw sequencing data was demultiplexed and quality-checked using the CellRanger v.3.1.0) \u2018mkfastq\u2019 script. Alignment and transcript quantification was performed using the CellRanger \u2018count\u2019 script against the GRCh38 (Ensembl93) human genome assembly. Ambient RNA signals were removed using SoupX to mitigate potential effects of RNA released from dead or ruptured cells . The obt.0 \u2018mkfasFor analysis of CART-BAL T-cells respective clusters  were isolated from the dataset using the subset function and the subset was reanalysed repeating basic Seurat steps (described above) based on 1000 highly variable features, the first 15 PCA-dimensions, and clustering resolution parameter set to 0.7.BAL Single-cell transcriptomes generated in this study (CART-BAL) and three previous studies, including BAL samples from four pulmonary sarcoidosis patients , three hOf note, dataset HC4 from the Liao M. et al. paper was excluded due to patient privacy restrictions. In the original study alignment was performed using a different CellRanger version and reference as desired for the integration pipeline in the present study .T-cells and monocyte/macrophage (Mono/Macro) cells were separated from the integrated dataset and reanalysed, repeating integration as described above. For T-cells and monocyte/macrophage subsets 3000 and 1000 highly variable genes, 55 and 25 first PCA-dimensions, 55 and 25 first MNN-dimensions, and clustering resolutions of 1.5 and 0.4 were used, respectively, for dimensional reduction and Louvain clustering.T-cells of a publicly available dataset including three patients suffering from cutaneous sarcoidosis were extracted after preprocessing using the common CellRanger version v3.1.0) and reference  as well as quality filtering   and fraction of mitochondrial UMI-counts are available . T-cell subpopulations were annotated upon careful assessment of expressed genes. particularly, expression of canonical lineage and cell state markers was interrogated : CCR7, TCF7, S1PR1, IL7R, SELL; naive T-cells: CCR7, TCF7, LEF1; MAIT: SLC4A10, ME1; cytotoxic lymphocytes (CTL): Granzymes, PRF1; CD4 CTL: CD4, CCL4, CCL5, PRF1; IFN-responsive: ISG15, MX1, RSAD2). Macrophage subpopulations were annotated in an analogous fashion .Major cell types were annotated based on expression of canonical marker genes  based on their average expression in all cells. Expression of genes from a given signature was calculated and subtracted by the aggregated expression of a control feature set ctrl\u2009=\u2009100) selected randomly from the bins the analysed signature genes were part of. Statistical significance was assessed by pairwise, one-sided  Wilcoxon rank-sum test (R function wilcox.test) of each group compared to the average. Signatures were retrieved from the literature. Signatures and respective sources are listed in Supplementary table\u00a000 selectDifferential expression analysis was performed using the Wilcoxon rank-sum test implementation of the Seurat function FindAllMarkers (only.pos\u2009=\u2009TRUE). Differential expression analysis results are available in Supplementary Table\u00a0EMD cells were thawed in RPMI supplemented with 10% FCS. Staining was performed in PBS at 4\u2009\u00b0C with the following antibodies: CD184/CXCR4 \u2013 PerCP/eFluor710 , CD326/EpCAM \u2013 APC , CD269/BCMA \u2013 PE , CD38- FITC , CD138 \u2013 BV510 , CD45 \u2013 BV605 , CD3 \u2013 AF700 . For dead cell exclusion, Fixable Viability Dye eFluor \u2122 780  was used. A FcGr blocking step was not performed. Events were acquired on the Attune NxT (Thermofisher). Data was analyzed with FlowJo version 10.8.0.p-value <0.05 was considered as statistically significant.The non-parametric two-sided Wilcoxon rank-sum test was used to compare gene expression values between groups of cells. A Supplementary InformationSupplementary Table 1Supplementary Table 2"}
{"text": "Adeno-associated virus (AAV) is a small ssDNA satellite virus of high interest (in recombinant form) as a safe and effective gene therapy vector. AAV\u2019s human cell entry receptor (AAVR) contains polycystic kidney disease (PKD) domains bound by AAV. Seeking understanding of the spectrum of interactions, goat AAVGo.1 is investigated, because its host is the species most distant from human with reciprocal cross-species cell susceptibility. The structure of AAVGo.1, solved by cryo-EM to 2.9\u2009\u00c5 resolution, is most similar to AAV5. Through ELISA (enzyme-linked immunosorbent assay) studies, it is shown that AAVGo.1 binds to human AAVR more strongly than do AAV2 or AAV5, and that it joins AAV5 in a class that binds exclusively to PKD domain 1 (PKD1), in contrast to other AAVs that interact primarily with PKD2. The AAVGo.1 cryo-EM structure of a complex with a PKD12 fragment of AAVR at 2.4\u2009\u00c5 resolution shows PKD1 bound with minimal change in virus structure. There are only minor conformational adaptations in AAVR, but there is a near-rigid rotation of PKD1 with maximal displacement of the receptor domain by ~1\u2009\u00c5 compared to PKD1 bound to AAV5. AAVGo.1 joins AAV5 as the second member of an emerging class of AAVs whose mode of receptor-binding is completely different from other AAVs, typified by AAV2.IMPORTANCE Adeno-associated virus (AAV) is a small ssDNA satellite parvovirus. As a recombinant vector with a protein shell encapsidating a transgene, recombinant AAV (rAAV) is a leading delivery vehicle for gene therapy, with two FDA-approved treatments and 150 clinical trials for 30 diseases. The human entry receptor AAVR has five PKD domains. To date, all serotypes, except AAV5, have interacted primarily with the second PKD domain, PKD2. Goat is the AAV host most distant from human with cross-species cell infectivity. AAVGo.1 is similar in structure to AAV5, the two forming a class with a distinct mode of receptor-binding. Within the two classes, binding interactions are mostly conserved, giving an indication of the latitude available in modulating delivery vectors. Primateectively . The Capectively , 5.motif at N-terminus with eight cysteines (MANEC), while the central extracellular portion contains five polycystic kidney disease (PKD) domains numbered 1 to 5 from N terminus to C terminus  . AAVR isterminus . The C tterminus . Experimterminus .For human AAVR, a few structural complexes with AAV are known to14. TDomain-swap mutants indicate a secondary role for PKD1 with AAV2 and other serotypes , but mulAAV gene therapy utilizes primate serotypes of which AAV5 is currently the only known representative with primarily PKD1 interactions. AAV5 was initially isolated from a human penile lesion  and is tHere, binding of AAVGo.1, AAV5, and AAV2 to domain combinations of AAVR is compared by ELISA (enzyme-linked immunosorbent assay). Then, high-resolution structures are determined by cryo-EM of AAVGo.1 alone, and in complex with a PKD12 fragment of AAVR. These are compared to corresponding structures of AAV5 to understand the diversity of interactions that are compatible with productive receptor-binding.AAVGo.1 virus-like particles  were produced using Sf9 cells and examined via transmission electron microscope TEM;  and B. ACryo-EM single particle analysis (SPA) yielded a reconstruction at 2.9\u2009\u00c5 resolution for AAVGo.1 . SharpenThe AAVGo.1 capsid has a similar protein fold and surface topology to AAV5 structures , 11, 22.AAVGo.1 and AAV5 capsid proteins have high homology (94%). All 42 amino acid differences occur in the VP3 region , and the majority of these differences are located on the exterior of the capsid . Some ofMinor structural differences are observed between AAV5 and AAVGo.1. The AAVGo.1 DE loop (VR-II), which forms the outer edge of the pore-like structure of the 5-fold axis, protrudes an additional 1.5\u2009\u00c5 compared to AAV5  to D. A y axis of AAVGo.1, similar to previous cryo-EM studies of either PKD12 or PKD1-5 bound to AAV5 .Cryo-EM single particle analysis (SPA) yielded reconstructions at 2.4\u2009\u00c5 for the PKD12 complex  that wer353 seen in both AAV5 and AAVGo.1 complexes suggests the potential for (rigid) pivoting around the binding site. Receptor pivoting has not been observed in individual AAV5 or AAVGo.1 complexes, but when comparing PKD1 as bound to AAVGo.1 or AAV5, we see an overall rotation in the receptor position  and the AAVGo.1 VR-IV loop. Contact has been observed between PKD1 Lys399 and VR-IV residues Asn442 and Asn443 of AAV5 , and the Ile349 interaction is absent in AAVGo.1  for AAVGo.1 Asp547 also affects PKD1 Arg353 binding subsite electrostatic interactions G478. AAVGo.1 residues Thr477 to Ser482 are of below-average order in the sharpened maps of AAVGo.1 alone. In the AAVR complex, the AAVGo.1 map here is somewhat more ordered. Together, these indicate that the loop is intrinsically dynamic. The double serine insertion is within the epitope of AAV5-neutralizing monoclonal antibody MAb HL2476 , and if Prior to this work, all complexes between AAV and AAVR were fundamentally similar to the AAV2 complex , 9, 12, Within what we might now characterize as a PKD1-binding clade of AAVs, structural differences in the AAVR complexes of AAV5 and AAVGo.1 are minimal. There is an overall rotation of the PKD1 domain, but otherwise differences are very subtle, consistent with modest differences in transduction efficiencies. It is plausible that the structural differences observed could account for different transduction efficiencies, but explicit associations would be somewhat speculative at this time. Many factors beyond avidity affect transduction. Furthermore, avidity is the result not only of the interactions seen, but from free energy changes in protein order or solvation upon receptor binding that are not quantifiable by cryo-EM.At a more qualitative level, it is an intriguing possibility that the avidity of the complex between human AAV5 and AAVR is not fully optimized, as suggested by tighter binding of a domesticated goat AAV. Is this due to compromise between receptor binding and immune neutralization escape? Or is evolutionary selection of high avidity limited by another uncharacterized step in the virus\u2019s life cycle where dissociation from AAVR is needed?6PKD1, His6PKD12, and His6PKD15) were expressed and purified as previously described (AAV2 (0.9\u2009mg/mL) and AAV5 (7.6\u2009mg/mL) virus-like particles (VLPs) were produced using Sf9 cells and purified as previously described , 11. AAVescribed .6PKD1, His6PKD12, or His6PKD15) and detected with anti-6\u00d7 His tag horseradish peroxidase (HRP) (Abcam number ab1187) antibody. 3,3\u20325,5\u2032-Tetramethylbenzidine (TMB) ELISA Substrate (Abcam number ab171523) was added to each well, and development was stopped using 1 M hydrochloric acid. The optical density of plates was evaluated at 450\u2009nm using a microplate reader (BioTek Synergy H1 Hybrid Multi-Mode Reader). Curves were fitted via nonlinear regression, and the 50% effective concentrations (EC50) were calculated using GraphPad Prism 8, using the 95% confidence limits as error estimates.For the PKD1 and PKD12 binding assays, ELISAs were carried out in duplicate using a modified direct ELISA protocol , 11. AAVFor the antibody binding assays, AAV5 and AAVGo.1 (50 \u03bcL at 3 \u03bcL/mL in 100\u2009mM sodium bicarbonate buffer at pH 9.6) were incubated in multiple wells of a 96-well plate  overnight on a rocking platform. The wells were then washed three times with Tween 20 Tris-buffered saline  followed by blocking with bovine serum albumin  and incubated for 1\u2009h. Unbound BSA was removed via three additional washes with TTBS. One hundred microliters of antibodies, diluted in TTBS, were added and incubated for 1\u2009h at the following final concentrations: 2\u2009\u03bcg/mL of HLA2476 , 100\u2009\u03bcg/mL of ADK5a , and 4\u2009\u03bcg/mL of ADK5b . After 1\u2009h, unbound antibodies were removed and the wells were washed three times with TTBS. One hundred microliters of a secondary HRP-conjugated, goat-derived, anti-mouse antibody  were then added at 4\u2009\u03bcg/mL and incubated for 1\u2009h. Unbound secondary antibody was removed via washing three times with TTBS. Ninety microliters of TMB ELISA substrate were then added for 5 to 10 min. The reaction was quenched with 80 \u03bcL of 1 M HCL, and the absorbance was measured at 450\u2009nm using a plate reader.AAVGo.1 and AAVGo.1-PKD12 complexes were prepared and imaged as previously described for AAV2 and AAV5 , 12. BriCryo-EM grids were screened using an FEI Tecnai F30 Twin 300\u2009kV TEM in preparation for single-particle Cryo-EM. AAVGo.1, and AAVGo.1-PKD12 complexes were imaged using an FEI Titan Krios equipped with a Gatan K3 digital camera in superresolution mode at a dose rate of 40 frames per 3.12\u2009s exposure. Automat0.143) (Relion 3.1.0 was used to process AAVGo.1 . Seven h0.143) .0.143; Relion 3.1.1 was used for the complex of PKD12 with AAVGo.1 . A total7kp3) in Coot (7kpn). The models and imaging parameters were refined using RSRef 0.5.6 (A preliminary model for AAVGo.1 was generated using the AAVGo.1 VP3 protein sequence threaded into the 2.1\u2009\u00c5 AAV5 structure (PDB ID:  in Coot . The staef 0.5.6  with a f7TI4 for AAVGo.1 and ID 7TI5 for the complex) and EMDB (ID EMD-25909 for AAVGo.1 and ID EMD-25910 for the complex).Atomic models and cryo-EM maps are available at the PDB (ID"}
{"text": "The majority of adult neural stem cells (aNSCs) are in a distinct metabolic state of reversible cell cycle exit also known as quiescence. The rate of aNSC activation determines the number of new neurons generated and directly influences the long-term maintenance of neurogenesis. Despite its relevance, it is still unclear how aNSC quiescence is regulated. Many factors contribute to this, like aNSC heterogeneity, the lack of reliable quiescence markers, the complexity of the neurogenic niches or the intricacy of the transcriptional and post-transcriptional mechanisms involved. In this perspective article I discuss possible solutions to these problems. But, first and foremost, I believe we require a model that goes beyond a simple transition toward activation. Instead, we must acknowledge the full complexity of aNSC states, which include not only activation but also differentiation and survival as behavioural outcomes. I propose a model where aNSCs dynamically transition through a cloud of highly interlinked cellular states driven by intrinsic and extrinsic cues. I also show how a new perspective enables us to integrate current results into a coherent framework leading to the formulation of new testable hypothesis. This model, like all others, is still far from perfect and will be reshaped by future findings. I believe that having a more complete view of aNSC transitions and embracing their complexity will bring us closer to understand how aNSC activity and neurogenesis are controlled throughout life. Neurogenesis is preserved in specific regions or neurogenic niches in the adult brains of most mammals . The sub-We still ignore how signal integration works in aNSCs. A variety of different signals have been involved in balancing quiescence and activation in these cells. For instance, NOTCH and BMP are pro-quiescence signals while WNT and SHH are considered pro-activation ones . Metabol-Transcriptional profiling is not an accurate readout of the position of NSCs along the quiescence to activation transition. Recent data has pointed out that unlike other cell types, the correlation between mRNA and protein content in quiescent NSCs is very poor . In addi-Quiescence-specific markers do not exist for aNSCs. Despite many genes being enriched in quiescent NSCs compared with active NSCs, none of them has been proven to be a reliable quiescence-specific marker. The main reason for this is the huge overlap in expression profile between astrocytes and aNSCs  . This pr-Adult neural stem cells are heterogeneous. SEZ NSCs are spatially heterogeneous, as they retain the regional identity that was instructed to them during development . Spatial-in vivo. The maintenance of quiescence depends on intrinsic as well as niche signals. The mere fact of dissociating the tissue for subsequent sorting and sequencing is enough to induce the activation of satellite cells, the resident quiescent cells of the muscle , we must embrace their complexity in full. Therefore, instead of the classical view of a linear transition from quiescence to activation, I propose a model where adult NSCs exist in a vast matrix of cellular states . These sin vivo (At one specific time each NSC cell occupies a defined position in the states matrix. But if we were able to follow that same NSC over time we would be able to observe it travelling (or reversibly transitioning) through different positions . NSCs inin vivo , 2022. Tin vivo  and Cellin vivo  on scRNAin vivo, would be fully possible to achieve thanks to the in vitro system. In vitro aNSC states exist in a fully defined and stable environment and are thus unlikely to be common (or even exist) in vivo. Direct manipulation of signalling and metabolism in aNSC in vitro will also allow evaluating the effects of single and combined cues on the transition of aNSCs between states. In addition, the in vitro system will enable us to determine the degree of intrinsic heterogeneity of adult NSCs in different conditions. Intrinsic heterogeneity can be driven, for instance, by oscillations in the levels of key transcription factors  and thenic NSCs .The new framework immediately prompts us to think of the heterogeneity of stem cells in a different way and allows the integration of clonal and label-retention data without the need of invoking the existence of distinct stem cell types. The clonal approaches typically used for the study of adult neurogenesis label those cells with the highest activity of a particular promoter at the time of tamoxifen administration. They will therefore label the positions in the matrix where that promoter is most active. But labelled cells might not constitute a separate lineage, as they do not necessarily need to be restricted to one single area of the matrix and could partially overlap with the high activity of other promoters also used for clonal analysis. For instance, high activity of the Gli1 promoter could happen anywhere where SHH signalling is high and is likely to overlap, at least partially, with high expression of unrelated genes such as Nestin or Ascl1. It is important to note that promoter activity and gene function do not always come hand in hand. Even less in adult NSCs, where mRNA and protein are poorly correlated. Nevertheless, the observed behavioural biases could still be linked to the function of the gene used for labelling the cells. For instance, high Ascl1 mRNA expression, although does not always lead to activation due to post-transcriptional regulation, could increase the probability of NSCs to activate. On the other hand, it is easy to imagine that resting NSCs, which recently proliferated, are likely to remain in a pro-activation zone after division. This alone will make them more likely to become activated again than dormant NSCs, which did not activate during the labelling period. Finally, cells which are very distant in the matrix might have very distinct signal transduction capabilities, both due to differential expression of signalling pathway components and different metabolic characteristics. This readily explains how NSCs respond differently to the same stimuli depending on their state .The model makes it clear that the likeliness of a NSC becoming activated depends on two things: their current state , and their signalling environment . But what I personally find most exciting about this framework is that it allows us to generate hypothesis and design specific experiments to test them. Two particularly tantalising ones are:One still unanswered question in the field is how interventions that affect neurogenesis impact the maintenance of aNSCs over long periods of time. Stimuli such as exercise, dietary changes or an enriched environment affect adult neurogenesis . Howeverin vivo is associated with the loss of their self-renewing ability  are highest in the most quiescent cells and repeated activation of DG NSCs  ability . This su ability . Such a The way we think about a subject often affects the questions we ask and due to the oversimplification associated with models, significant features could be overlooked. I believe it is time to incorporate the intricacy of stem cell behaviour into our working models, even if we still do not have enough data to fully support them. In fact, this, as any model is only meant to serve as a starting point, since it will continuously evolve through the addition of new data. Experiments, on the other hand, are independent of the model and will remain significant regardless of it. Although my focus is on aNSCs, the proposed framework will be useful for other adult and embryonic stem cell transitions, reprogramming strategies and cancer research. One interesting avenue would be to further explore the continuum of states that exist between glia and neural stem cells. Glial cells respond to injury and have the potential to generate new neurons in the adult brain. By investigating the aNSC to glia transition as well as the reactivation path of glial cells, we could identify important roadblocks for glia-to-neuron transitions . Other sThe original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.NU conceived and wrote the manuscript.The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer JE-P declared a past co-authorship with the author NU to the handling editor.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "For advanced cancer, surgery may not be possible at the site of lymph node metastasis, such as para-aortic lymph node metastasis. Systemic administration of anticancer drugs has been performed in these cases, but treatment results are still inadequate. This study investigated the efficiency of drug delivery to intra-abdominal lymph nodes by administering an anticancer drug retrogradely to lymphatic vessels in order to deliver the drug directly to the metastatic lymph nodes. Thoracic duct infusion resulted in the same concentration of paclitaxel in abdominal lymph nodes as via systemic administration, but the serum concentration was lower. The results show that thoracic infusion may achieve higher paclitaxel doses than systemic administration. Infusion of anti-cancer drugs into the thoracic duct may yield clinical benefits for patients with extensive lymphatic metastases in abdominal malignancies.Gastrointestinal cancer with massive nodal metastases is a lethal disease. In this study, using a porcine model, we infused the anti-cancer drug Paclitaxel (PTX) into thoracic ducts to examine the efficiency of drug delivery to intra-abdominal lymph nodes. We established a technical method to catheterize the thoracic duct in the necks of pigs. We then compared the pharmacokinetics of PTX administered intrathoracically with those of systemic (intravenous) infusion. Serum, liver, and spleen concentrations of PTX were significantly lower following thoracic duct (IT) infusion than after intravenous (IV) administration approximately 1\u20138 h post-infusion. However, PTX levels in abdominal lymph nodes were maintained at relatively high levels up to 24 h after IT infusion compared to after IV infusion. Concentrations of PTX in urine were much higher after IT administration than after IV administration. After IT infusion, the same concentration of PTX was obtained in abdominal lymph nodes, but the serum concentration was lower than after systemic infusion. Therefore, IT infusion may be able to achieve higher PTX doses than IV infusion. IT delivery of anti-cancer drugs into the thoracic duct may yield clinical benefits for patients with extensive lymphatic metastases in abdominal malignancies. Lymphatic metastasis usually occurs in the direction of the lymph flow. In abdominal malignancies, such as gastrointestinal or ovarian cancer, metastatic tumor cells in regional lymph nodes move to the retroperitoneal para-aortic nodes and then spread to the left neck lymph nodes (Virchow\u2019s nodes) through the thoracic duct ,2. ExtenRecently, new routes of administration have been developed for the administration of anticancer drugs. The intraperitoneal administration of Paclitaxel (PTX) has been performed for peritoneal dissemination in gastric cancer cases, producing excellent clinical results. ,12 ThereThe thoracic duct, the body\u2019s central lymphatic vessel, originates in the cisterna chyli in the retroperitoneum, ascends between the esophagus and the descending aorta in the mediastinum, and flows into the left venous angle in humans ,17. We hPTX (Taxol) was purchased from Bristol-Myers Squibb Japan . The PTX used is a commercial product, with 100 mg of PTX dissolved in 8.35 mL of polyoxyethylene castor oil and 8.35 mL of ethanol. Porcine models, comprising 4 female pigs with an average body weight of 28.2 kg (range: 20.8\u201336.0 kg), were purchased from Sanesu Breeding Co., Ltd.  and were housed individually at the Center for Development of Advanced Medical Technology (CDAMTech), Jichi Medical University. All animal handling procedures in this study complied with the Jichi Medical University Guide for Laboratory Animals, the Guide for the Care and Use of Laboratory Animals published by the U.S. National Institutes of Health , and the ARRIVE guidelines . The InsAfter the pigs were placed in a supine position under inhalation anesthesia with sevoflurane, a 15 cm longitudinal incision was made 1 cm to the left of the midline at the 1/3 level on the cranial crest, caudal side. The left anterior cervical muscle was dissected, the left external jugular vein and the left subclavian vein were ligated and dissected, and then the first rib was dissected and removed 2 cm from the sternum attachment. We then performed a laparotomy, and 2 mL of Patent Blue  were injected into the mesenteric lymph nodes of the small intestine using a fine needle. Cervical lymphatic vessels could be identified in the remaining left internal carotid artery and left subclavian artery bifurcation a few minutes after the dye injection. Discharge of the lymph was confirmed after cannulation with a 24G SURFLO needle was performed A,B. The After intravenous administration of 100 mg of hydrocorton , 30 mg of PTX  were administrated from the cannulated thoracic duct, as described above. Pigs were systematically cannulated in the left internal jugular vein with a 24G Surflo needle, into which PTX was then intravenously infused. At 1, 3, 8, 12, and 24 h post-infusion, blood and urine samples were collected and centrifuged at 2,000 rpm for 10 min at 4 \u00b0C. Supernatants were then collected, placed in cryotubes, and stored at \u221280 \u00b0C. After thawing the samples, PTX concentrations were measured with high-performance liquid chromatography\u2013mass spectrometry (LC-MS/MS).Fifty \u00b5L of each liquid sample , to which 200 \u00b5L of methanol and 20 \u00b5L of internal standard reagent  had been added, were vortexed for 30 s and then centrifuged . Supernatants were then subjected to spin filtering. Filtrates were analyzed by LC-MS/MS . Tissue samples (10 mg), to which 20 \u00b5L of internal standard reagent  and 1 mL of 0.1% formic acid\u2013MeOH had been added, were homogenized and centrifuged . Supernatants (500 \u00b5L) were transferred to other tubes, to which 200 \u00b5L of water had been added. Samples were then vortexed and centrifuged , and supernatants were analyzed.18 analytical column  was used, and the column oven and autosampler were set to 40 \u00b0C and 4 \u00b0C, respectively. Mobile phase A was 0.1% formic acid-water, and mobile phase B was acetonitrile. The flow rate was set to 0.5 mL/min, and the injection volume was 3 \u03bcL. The gradient was 40% B in 2.7 min, ramping up to 100% by 4 min, remaining at 100% until 6 min, and then decreasing over 0.5 min, followed by an equilibration step at 40% B for 1.5 min.For LC analyses, a YMC-Triart CPTX and PTX-d5 were detected in ESI positive mode. MS/MS conditions were as follows: Nebulizer gas flow (3 L/min), heating gas flow (10 L/min), interface temperature (300 \u00b0C), desolvation temperature (526 \u00b0C), heat block temperature (400 \u00b0C), and drying gas flow (10 L/min). Collision energies were 24 V, 22 V, and 21 V for PTX, and 24 V, 25 V, and 21 V for PTX-d5. PTX, and PTX-d5 were observed at m/z 854 > 286 and m/z 859 > 291, respectively. PTX concentrations of the biological samples were quantified by the area ratio with the internal standard reagent (PTX-d5) added to the samples.PTX was added to the serum at a concentration of 0.005\u20135 \u00b5g/mL to prepare an 8-point calibration curve. The accuracy and linearity of the calibration curve, carryover, diurnal variation, inter-day variation, and sample stability were confirmed. Recovery tests of PTX added to porcine serum  were performed, and accuracies were 110% for porcine serum . For uriConcentrations in various organs were measured in the early and late phases, since frequent tissue collection with such an invasive procedure could seriously affect pharmacokinetics. In late phase analysis, some organs were taken at 8, 12, and 24 h after PTX infusion. Para-aortic lymph nodes were additionally taken only at the end of the experiment. Immediately after collection, each organ was stored in its collected state in a cryotube at \u221280 \u00b0C. Later, 10 mg samples of these organs were homogenized, and PTX concentrations were measured, as described above.t-tests, and p values < 0.05 were considered statistically significant.Results were analyzed using Student\u2019s Immediately after PTX was administrated through the intrathoracic duct (IT), considerable amounts of PTX were detected in sera. However, concentrations of PTX 1 to 12 h after administration were significantly lower than those after intravenous administration (IV). The PTX concentration decreased with time, ultimately disappearing from the serum after 24 h with both IT and IV administration A. In conIn the first set of experiments, PTX accumulation in various organs was examined at 1 and 3 h post-infusion. In the lungs, liver, and spleen, PTX concentrations after IV administration were more than twice as high as after IT administration. However, there were no significant differences between the two infusion methods in terms of PTX concentrations in mesenteric lymph nodes .In the next set of experiments, we compared PTX concentrations 8, 12, and 24 h after IV and IT infusion. Although PTX concentrations were still high in the liver and spleen at 8 h, there were no differences in PTX levels in any organs between IV and IT administration after 12 h. However, 24 h after IT administration, relatively high PTX concentrations were still present in mesenteric and para-aortic lymph nodes compared to those following IV administration A,B.The thoracic duct is the main collecting vessel of the lymphatic system, and it drains lymph from the abdomen and lower extremities into the venous blood stream . Thus, tWe succeeded in cannulating the terminal thoracic duct in pig necks, and attempted to achieve the selective retrograde administration of PTX to the lymphatic system. We selected PTX because the concentration of PTX in the lymph in the thoracic duct is maintained at high levels after intraperitoneal infusion, probably due to its high molecular weight and hydrophobic properties . Using tOn the other hand, PTX concentrations in urine were considerably higher with IT than IV administration, especially at early time points. This suggests that most IT-infused PTX was retrogradely transported to the renal cortex and excreted from the kidneys, since the renal lymphatic outflow is connected to the para-aortic lymph nodes through the thoracic duct . HoweverIn summary, we established an excellent experimental model to assess the pharmacodynamics of IT-administrated drugs. Using this system, we examined the drug delivery efficiency of the IT infusion of PTX for extensive metastatic lymph nodes in the abdomen. After IT infusion, the same concentrations of PTX were obtained in abdominal lymph nodes, but with lower serum concentrations than after IV infusion. Thus, it may be possible to achieve higher PTX doses with IT than with IV administration. However, the amount of urinary excretion may present a risk of renal toxicity and requires further study. When anti-cancer drugs suitable for IT administration are found, this method may be ideal for the treatment of patients with extensive para-aortic lymph node metastases without distant metastases to other organs.Using a novel pig model, we found that the IT administration of anti-cancer drugs may offer a significant pharmacokinetic advantage and has clinical merit for patients with extensive lymph node metastases (ELM), including para-aortic lymph node metastases from abdominal malignancies."}
{"text": "Enhancing our understanding of lymphatic anatomy from the microscopic to the anatomical scale is essential to discern how the structure and function of the lymphatic system interacts with different tissues and organs within the body and contributes to health and disease. The knowledge of molecular aspects of the lymphatic network is fundamental to understand the mechanisms of disease progression and prevention. Recent advances in mapping components of the lymphatic system using state of the art single cell technologies, the identification of novel biomarkers, new clinical imaging efforts, and computational tools which attempt to identify connections between these diverse technologies hold the potential to catalyze new strategies to address lymphatic diseases such as lymphedema and lipedema. This manuscript summarizes current knowledge of the lymphatic system and identifies prevailing challenges and opportunities to advance the field of lymphatic research as discussed by the experts in the workshop. The lymphatic vasculature is comprised of a vast network of vessels in all tissues of the body that converge to transport lymph away from tissues to the blood in order to maintain extracellular fluid homeostasis and provide critical immunologic trafficking. This traditional paradigm of passive transport of lymph fluid has been updated by cellular and molecular characterization of lymphatic vascular development. Lymph production and flow is critical for removal of interstitial fluid from tissues to prevent tissue edema. Our greatly improved understanding of the function of the lymphatic vasculature has revealed new roles in health and disease.The scope of lymphatic disease research is broad and includes, but is not limited to, investigating lymphedema, lipedema, chylous leak disorders, lymphatic malformations, and protein losing enteropathies . While sYet to be Charted: Mapping the Lymphatic System Across Body Scales and Expertise Domains at the Boston Lymphatic Symposium identified major knowledge gaps in lymphatic anatomy and lymphatic biomolecular signatures as major barriers needing to be addressed to accelerate advancement of medical management of lymphatic diseases. Research opportunities and ongoing efforts to address these gaps were discussed and are presented in this report.The 2021 National Heart, Lung, and Blood Institute Workshop The lymphatic vasculature consists of a network of thin-walled, blind-ended, highly permeable initial lymphatics or lymphatic capillaries which first drain into pre-collecting lymphatic vessels, merging into larger secondary collecting lymphatics. The valves of the collecting lymphatics control the unidirectional transport of lymph back to the blood circulation. Lymph is transferred to pre-nodal collecting lymphatics, also called afferent lymphatics, leading to lymph nodes. The lymph exits lymph nodes through post-nodal collecting lymphatics, eventually draining into the thoracic duct and the right lymphatic duct, which, in turn, discharge lymph into the large veins at the base of the neck. More in-depth reviews provide a detailed understanding of the structure, anatomy, development, and embryogenic origins of the lymphatic system . DespiteThe lack of clinically relevant knowledge of the human lymphatic system, in comparison to the remainder of the vascular system, is due to several reasons. First, while lymphatic capillaries are significantly larger than blood capillaries, the remainder of the lymphatic vasculature is significantly smaller than the major arteries and thus are challenging to appreciate with the naked eye during surgery or even with existing clinical imaging methods . Second,While actual translation of omic data into significant clinical interventions is in the nascent phase, the promise of multi-omic data in driving diagnosis, prognosis, and providing targets for intervention is an area of intense study. Therefore, it is only to be expected that a tremendous effort has been placed on obtaining the biomolecular signatures of the human cardiovascular system . SurprisIn a self-perpetuating manner, the challenges of visualizing the lymphatic system either grossly or with imaging and gaps in biomolecular signatures has been further exacerbated by insufficient coverage of this topic in medical education and training . Such knTraditionally, our understanding of clinical anatomy begins in the gross anatomy laboratory. As the challenges of gross anatomic dissection of the lymphatic system have been previously described, new techniques in anatomic dissection have been recently introduced. Specifically, a microinjection technique utilizing hydrogen peroxide now allows for reliable simultaneous identification and dilation of the lymphatic channels which is accomplished when oxygen bubbles are absorbed into the lymphatic vessels . OvercomAdvances in understanding of structural and physiological characteristics of the lymphatic vasculature have guided improvements in the clinical imaging of the lymphatic system. The two main clinical lymphatic imaging techniques for the last 70\u00a0years were pedal lymphangiography and lymphoscintigraphy. However, these techniques have significant drawbacks. In order to overcome the drawbacks, a newer approach has been developed by introducing contrast (oil and water based iodinated as well as gadolinium) through a needle into the lymphatic system by accessing organs rich with lymphatic vessels such as lymph nodes or the liver. This technique is often referred to as an interstitial injection. This approach has led to the development of innovative imaging techniques utilizing fluoroscopy such as intranodal lymphangiography, liver lymphangiography, mesenteric lymphangiography as well as dynamic contrast enhanced magnetic resonance lymphangiography and computed tomography lymphangiography . These mLymphedema is the most common of all the lymphatic disorders and is considered one of the most significant cancer survivorship issues in the United States. Despite its relative prevalence, it remains unclear why certain cancer patients develop this condition following treatment while others are spared. Focusing specifically on breast cancer related lymphedema (BCRL), the top 3 risk factors include an axillary lymph node dissection, regional lymph node radiation, and a Body Mass Index (BMI) > 30. However, despite these known risk factors, only 1 in 3 women with all three risk factors will develop lymphedema. Utilizing the modern imaging technique of indocyanine green (ICG) lymphography to obtain real-time scans of the upper extremity peripheral lymphatic systems prior to axillary lymph node dissection, significant variations in the superficial lymphatic anatomy have been recently demonstrated. Anatomists had previously postulated that collateral lymphatic pathways of the upper extremity, or a pathway that avoids the axilla, may be protective against BCRL as the lymphatic flow would divert away from the axilla following dissection. Modern ICG imaging has recently confirmed the presence of two variants of a specific collateral pathway, the Mascagni\u2013Sappey (M-S) pathway, which is hypothesized to decrease an individual\u2019s risk of BCRL development . IdentifCentrally, lymphatic variants have been discovered to be the root cause of certain pulmonary disorders. Specifically, pulmonary lymphatic disorders (PLD) are a diverse group of conditions characterized by the presence of abnormal lymphatic tissue in the chest and are often accompanied by chylous leaks, such as non-traumatic chylothorax, plastic bronchitis and chyloptysis. PLD is associated with a variety of conditions including congenital heart disease, Noonan syndrome, and lymphatic malformations. The understanding of PLD has been limited due to lack of robust central lymphatic imaging. Recent development of the intranodal lymphangiography and Dynamic Contrast Enhanced MR lymphangiography demonstrated the presence of abnormal lymphatic pathways from the thoracic duct and/or retroperitoneum into lung parenchyma, termed abnormal pulmonary lymphatic flow (PLF) . The abnin vivo imaging, and knowledge management modalities.It is incumbent on the lymphatic community to update our current compendium of normal lymphatic anatomy utilizing the most modern dissection, The lymphatic system has an intricate superficial and deep vasculature. Our inability to reliably image the deep lymphatic system, and importantly, potential connections between the deep and superficial systems, remains a significant limitation in creating a map of the peripheral lymphatic system. Even the most modern imaging methods such as ICG lymphography that allows precise mapping of the superficial peripheral lymphatic system still have significant limitations such as its shallow depth of penetration of less than 2\u00a0cm . The grePromising advances in magnetic resonance lymphography and photoacoustic images may soon help bridge this crucial gap. For advancing the understanding of the lymphatic vasculature, further research not only on the anatomy, but also on lymphatic flow will be critical to understand how abnormal central lymphatic system flow, such as PLF may play a role in serious conditions, including congestive heart failure and pulmonary alveolar proteinosis.Additionally, all the information will need to be systematically incorporated and organized into a comprehensive, publicly available, updatable, online reference library of the normal lymphatic vasculature anatomy. As an initial step towards creating such a map, more than 900 entries related to lymphatic vessels and nodal stations have been extracted from the 1938 textbook by Rouvi\u00e8re and conceptually organized using a present-day approach, the \u201cMiro Map\u201d. The lymphatic vasculature map is available at a publicly accessible websiteOne of the most important parts of the efforts to map the normal human lymphatic vasculature across the scales of the human body will be to discover, catalogue, and explain the commonly shared clinical level features and the variants of the lymphatic anatomy in normal individuals. The mapping of anatomical variants remains a priority in order to better understand the foundation of several lymphatic disease pathophysiology. Taking a page from the current efforts to map the human blood vasculatureHigher resolution investigations of cellular composition, organization, and biomolecular markers of the lymphatic system are also needed to understand the basis for normal lymphatic anatomy and variants, as well for the clinical management of lymphatic conditions.While the etiology of primary lymphedema can often be clearly ascertained to genetic mutations, such as in Milroy\u2019s disease where hereditary inactivating mutations in vascular endothelial growth factor (VEGF) receptor-3 (VEGFR-3) have been implicated, the underlying factors of secondary lymphedema development are less well understood. A variety of experimental models have been employed to study lymphedema development, including surgically disconnecting the superficial and deep lymphatic vessels leading to oedema formation in the tail extremity, or in the mouse paw after popliteal lymph node dissection. While both represent acute lymphedema models that spontaneously resolve over time with little fibrosis or adipose tissue deposition, they help point to cellular and molecular mechanisms that may be at play. For instance, researchers were able to identify that prolonged T helper two biased immune responses regulates the pathology of the response by promoting tissue fibrosis, inhibiting formation of collateral lymphatics, decreasing lymphatic vessel pumping capacity, and increasing lymphatic leakiness .Lipedema is a chronic adipose tissue disorder characterized by the disproportional subcutaneous deposition of fat and is commonly misdiagnosed as lymphedema or obesity. Compared to age and BMI matched patients, lipedema patients have increased systemic levels of VEGF-C, cholesterol, and triglycerides . HoweverWe have gained an increased appreciation of the important contributions of the lymphatic vasculature to the normal function of various organs, precipitating or helping with recovery from other medical conditions. Lymphatic vessels show remarkable plasticity and heterogeneity, reflecting their functional specialization to control the tissue microenvironment . For insOver the last 10\u00a0years, the identification and characterization of venous sinus-associated lymphatic vessels embedded within the brain\u2019s dura mater that drain solutes from the cerebrospinal fluid (CSF) and central nervous system (CNS) has allowed a dramatic revision of our understanding of brain fluid dynamics and waste clearance . An inteSnta1) gene eliminates the perivascular AQP4 localization, impairment of glymphatic function and more rapid A\u03b2 deposition was observed (AQP4 gene modified risk of cognitive decline in a cohort of AD patients (Glymphatic exchange contributes to the clearance of amyloid \u00df (A\u00df) and tau , two proobserved . Lastly,patients . Althougpatients . These dSkin, the largest human organ, is the setting for a peripheral lymphatic system superhighway with highly abundant lymphatic vessel network that is spatially separated into superficial and deep vascular plexuses. Much of our understanding of the anatomic and molecular details of the dermal lymphatic vasculature comes from studies of the mouse skin where the three-dimensional architecture can be visualized using fluorescence microscopy methods. These studies have revealed a hierarchy of functionally specialized vessels; the blind-ended lymphatic capillaries that take up excess interstitial fluid, cells and macromolecules, and fluid-transporting collecting vessels. The importance of functional specialization is reflected in the unique morphological features of the different lymphatic vessel types. For example, the two types of vessels display distinct organization of cell-cell junctions . Other vin situ  by ectopic VEGF-C delivery to the infarcted heart, improves cardiac function and prevents adverse cardiac remodeling in rodent acute MI models . HoweverUnderstanding the role of lymphatics in the central nervous system is a burgeoning field with endless opportunities. Certain areas for future research would include understanding the anatomical and function linkage between distributed perivascular pathways and meningeal routes of lymphatic drainage from the cranium particularly in the human brain. Moreover, further delineation of the common or distinct signaling and physiological processes regulating sleep-active glymphatic function and meningeal lymphatic drainage is needed. The relative contribution of glymphatic-lymphatic function to the clearance of different pathogenic proteins in humans is unknown, as well as how these processes change in the setting of neurodegenerative diseases like AD. Finally, the contribution of lymphatic biology and its dysfunction to neurological and psychiatric conditions beyond neurovascular disorders and neurodegenerative diseases remains almost entirely unexplored.Notably, genes identified through single cell level analyses are likely not only markers of cell subtype identity, but functionally important and thus pointing to potential biomarkers and targets for future studies and interventions. For instance, changes in the LEC transcriptome during pathological changes, or differences between the normal LEC transcriptome from various tissues are likely to reveal state and organ-specific molecular features that could be used for targeting various parts of the lymphatic system.3. Remaining challenges for the field include accurate segmentation of irregularly shaped cells and deep knowledge of ill-defined cell types such as fibroblastic reticular cells. Fortunately, recent progress has been made on quantifying stromal cell types in human LNs by single cell RNA-sequencing and multiplexed imaging  is seeking to turn discovery into health. Many open resources are available to help advance the knowledge of normal human biology and function through the application of new technologies and to identify the underpinnings of various diseases, including lymphatic disease .3 As oA draft table of anatomical structures, cell types, and biomarkers of several lymphatic organs, but not including all of the components of the lymphatic system, has been published  and is uAdvancement of lymphatic research requires refinement of existing knowledge and application of advanced spatial mapping approaches for a greater understanding of the normal lymphatic system and connections with development of lymphatic dysfunction and disease.Working together across specialty domains and across the human body scales we hope to further expand this knowledge base for the betterment of the human condition."}
{"text": "In this report, we also build on the workshop discussion and highlight and discuss the full range of costs and unexpected challenges on resources for the delivery of stocks of hPSCs suitable for use as starting materials in the manufacture of stem cell-based medicines. The experiences of global leaders from different national resource centers highlight issues to consider in cost management and the possibilities for reducing costs while moving into the clinical application stage.This report summarizes key issues contributing to the cost of preparing human pluripotent stem cell lines for use in cell therapy manufacturing based on discussion between stem cell banking experts from ten countries at a workshop session on \u2018cost of goods\u2019 for human pluripotent stem cell banking organized by the International Stem Cell Banking Initiative (ISCBI) held at the Korea National Institutes of Health in Korea (25 The strategies adopted for the expansion and processing of cells can impact significantly on the \u2018cost of goods\u2019 (COGs) for the manufacturing process and control of these costs is a crucial element to facilitate an economically viable supply chain for advanced cell-based medicines3. Efforts to address COGs for cell-based medicines may start with increased efficiencies in the cell culture process 4. Evaluation of cost-effective manufacturing with human pluripotent stem cells (hPSCs)5 as starting materials will need to include expansion of the stem cells, their processing, and testing6. However, whilst the broad and significant challenges which arise at the creation of these crucial starting materials have been addressed by others7, the variation in COGs between different sources of hPSCs in different jurisdictions have not yet been explored in detail. It is important to note that the definitions of raw materials may vary between jurisdictions and in some cases the term \u2018starting materials\u2019 is used for components that will persist in the final product such as the hPSC line used in manufacturing or vectors that are not eliminated after an iPSC line is established.The manufacture of advanced cell-based medicines is often complex and costly and prone to the unexpected impacts on the manufacturing process and this is especially relevant for products derived from cultured cellswww.iscbi.org). The ISCBI works to find consensus on issues and best practices in pluripotent stem cell biobanking and applications9. In 2019, an ISCBI workshop was held in Korea National Institutes of Health, Osong, Korea that included a session on COGs considerations for the production of hPSCs for clinical use. ISCBI experts at this workshop also discussed the management of stem cell data and genetic testing of human pluripotent stem cell lines (hPSCs) and a summary can be obtained request from admin@iscbi.org.The International Stem Cell Banking Initiative (ISCBI), initiated in 2007, brings together a global community of around 300 professionals from 28 countries, including directors of the major pluripotent stem cell banks and experts in stem cell research, biobanking, regulation, and public policy development , indirect costs of organization overheads, non-recurring costs , and wasted batches. Here, we report case-studies of key issues arising for COGs hPSC-biobanking in five different institutions from four countries and summarize the key points considered in workshop discussion. We then go on to identify important common issues and potential solutions relating to COGs which hPSC-based product developers should include in their considerations to manage and reduce costs. Furthermore, we identify certain impacts on costs which may not be clear at the outset of cell line development, but which may influence cell development strategies.activities for which it may be most difficult to ascertain the cost in advance.the generation of cell lines that will meet regulatory requirements.the full requirements for construction of appropriate facilities, their validation, and maintenance.the demands of progression to new drug application (NDA) status.the additional and extensive regulatory and patient costs of clinical trials.During the development of stem cells to the clinical stage, researchers, clinicians, and manufacturers often face unexpected costs and hurdles to bring the products to clinical trials. Workshop delegates discussed in detail the most significant cost elements and identified a number of key cost issues not always fully addressed by early product developers including:On the basis of these discussion topics, experts including leaders in hPSC banking, cell-based therapy product development and regulation, drew on the benefit of the combined perspectives from 27 different institutes in 10 countries represented at the workshop, to highlight issues to be included in considerations for the management of the COGs of hPSC starting materials both allogenic and \u201cautologous\u201d. The workshop was led by five case-studies from four countries.10 and is supplying them as starting materials in two ways: firstly, for a number of clinical applications and secondly, by partnering with other researchers and contract manufacturing organizations (CMOs) since 2018. The total area of clean rooms and the QC area of production facilities are ~1600\u2009m2, and the maintenance cost of is ~$2.2 million (USD)/year). This cost does not include raw materials and product QC costs. KNIH experience is that the facility maintenance costs, such as the temperature, humidity, pressure, gas, and equipment monitoring, validation systems, and environmental monitoring for 24\u2009h/7 d etc., are much higher than any other costs, and the percentage of the labor cost is high .Other significant costs were associated with obtaining all the necessary documentation and traceability for donor cells, but KNIH had not yet identified generic methods to minimize the associated costs as the ease of obtaining adequate documentation varies considerably depending on the source of donated cells. However, it is important to select and fully document donor cells to ensure that they will meet the applicable regulatory requirements.In addition to these specific issues a number of learning points which enabled KNIH to address cost reduction in development of iPSC lines for clinical application were shared.A standardized and well-controlled manufacturing process will reduce the unexpected \u2018dead time\u2019 of cleanroom manufacturing facilities. The manufacturing scale of production is established from lab-scale production methods and thus, there are numerous hurdles and risks which may not be feasible to predict. However, it is vital to address the challenge of developing a scale-up system that will enable production to clinically relevant cell numbers and quality. Having achieved this, KNIH has experienced a further challenge of transferring the developed technologies into a GMP manufacturing quality management system and the requirement to translate the method into the hands of a Contract Manufacturing Organization (CMO). The latter issue in particular adds a further and significant level of complexity. Translation time for academic protocols for use in KNIH facilities had varied depending on product type, but had typically taken a minimum of 3 months. Difficulties and delays at this translational stage are very costly and the CMO staff typically require specialist training in the cell culture process. In the KNIH experience of iPSC generation the development of lab-scale processing using culture-ware and raw materials that are known to be suitable for GMP manufacture, has shortened the technology transfer time as it was not necessary to adapt the cultures to new reagents during the product development phase.7. Finding suitable donors for cells with a defined homozygous HLA type can be challenging12. In such cases, cell sources from the cord blood banks would be useful to find homozygous lines, however, their utility depends on the suitability of donor selection procedures used13. Nevertheless, staff time must still be allocated to carefully review donor traceability, documentation of donor eligibility testing and contents of the individual informed consents.Donor eligibility tests conducted to find suitable donors may take time, which can lead to unexpected delays in manufacturing, however, formal donor selection criteria can help to make this process more efficientContacting the regulatory authority at an early stage, certainly before commitment of significant resources on manufacturing facilities and the product development stage, has significantly helped KNIH to avoid delays to clinical application. For example, the regulatory authority is likely to request full and documented traceability, including the certificates of origin and certificates of analysis (CoA) of all raw- and starting-materials including the Sendai virus that is used for iPSC generation. If the iPSC lines have been generated where such traceability was not established, it will be much more difficult to demonstrate suitability of the iPSC to the regulator\u2019s satisfaction and KNIH has found that frequent discussion with the Korean regulatory authority is important before starting the manufacturing process in a GMP facility to avoid the need for costly changes to procedures and even facility adaptation, before manufacturing can commence.Qualification of the seed stock or master cell bank (MCB) has been an important step for assurance of KNIH product manufacturing. KNIH staff have focused on performance and documentation of critical quality control (QC) including cell line identity and adventitious agent testing of the MCB. This has reduced the risk of product failure and can limit delays and unexpected costs by ensuring MCB QC information is sufficient prior to initiation of the GMP manufacturing process. Currently, Korea\u2019s Regulatory Authority (MFDS) requires, amongst other testing, the submission of the results of short tandem repeat (STR) tests of the seed stock (primary cells) for both the MCB and working cell bank (WCB) for manufactured cell therapy products.Human errors in cell therapy product manufacturing and GMP-compliant seed-stock banking processes often lead to extra costs and delay product outcomes . Although such errors may be rare, they can have serious consequences, such as discarding of product batches, closure, and emergency clean-down of production areas, followed by requalification of facilities. KNIH has therefore focused on avoidance of the likelihood of human errors by ensuring that written instructions and procedures are clear and use unambiguous language. However, even more crucial is staff training which is mandatory under Korean national regulations, and only qualified staff can be involved in the manufacturing process. Natural disasters such as violent weather systems and earth-quakes can damage the integrity of facilities and back-up systems. Human viral epidemics and pandemics can also threaten adequate staffing and have incurred additional unexpected costs which have had to be managed by KNIH on a number of occasions. Electrical power failure may well cause shut-down during the manufacturing process leading to very high unexpected costs because product may be lost and instruments and environmental controls may need to be requalified and disinfected prior to restarting manufacturing processes. Therefore, risk assessment, implementing of risk management plans and establishing disaster recovery procedures are recommended by KNIH in order to prepare for expected natural disasters. Such procedures will also help to protect manufacturing from other kinds of risk to the raw materials supply chain and product safety and quality.14. In addition, Dr. Karnielli reported on a new automated and controlled CAR- T platform which can deal with the autologous manufacturing challenge. He presented a case study in which a facility wished to manufacture 20,000 doses a year. This challenge required a platform capacity to carry out 500 manipulations per day under clean room conditions for 720 patients in parallel with 55 new patients per day. Only an automated and fully controlled platform can enable such capacity and in turn assure the quality.Dr. Ohad Karnielli described attempts to make mesenchymal stromal cell (MSC) manufacture more efficient using a semi-automated bioreactor with automated real time monitoring of glucose levelsDr. Karnielli went on to describe the translation costs from R&D to GMP. Compared with the R&D development time, translation to GMP manufacturing had taken around 3x longer which meant costs for developing a GMP process were $3M minimum in the presented case. Translation of the process for GMP manufacture to a CMO could then take ~9 months and the uncertainty of the time-lines for these aspects increases costs. Cleanroom consumables could be a major cost element for cell culture processed and in Adva\u2019s experience could represent 50% of total manufacturing costs.Dr Eihachiro Kawase pointed out that it was important to consider future projected need for the number of vials and cells per vial required, and costs of validation including preservation and storage. Failure to address these aspects could lead to the necessity for repeated banking campaigns, causing delays and additional production and testing costs.At the stage of clinical studies, the development costs for the product implantation method and also for patient monitoring and financial reimbursement systems for implementation warranty could be very significant and need to be considered.Cell culture related consumables and notably media suitable for manufacture of clinical products , matrix , and ROCKi .Outsourced testing including biological safety evaluation including endotoxin testing, pathogenic microorganism contamination tests and antibiotic residues testing ).Staff costs including training which is especially challenging under Japanese law (i.e. the \u201c5 year rule\u201d), can make it difficult to retain long-serving employees.Most significant costs experienced in Dr. Kawase\u2019s hESC manufacturing facility in Kyoto had been:It had been difficult to accurately cost QC, validation, and ICH Q5A requirements for testing, however, no significant costs had emerged that had not been expected. A significant cost over time in Japanese industry\u3000had also been the requirement for maintenance fees to get governmental permission, as in Japan a special cell processing facilities were required to be replaced every 5 years.Patient viral testing: $500/patient (in-house).Plasmid for reprogramming: $2000 per round of reprogramming (Sendai vectors\u2009<$1500).Media and reagents: $25\u201330\u2009K (bulk purchase important to keep costs down).Karyology: $450/clone.Proving plasmid loss from each cell line: $1000/clone (this could be controlled to\u2009<$250 using Nanodrop technology).Oncogene screen: $1600/clone (use of non-CLIA regulated testing could keep costs to below $500)STR analysis: $220/clone.Flow cytometry: $200/clone (in-house).Sterility assays: $200\u2013500/clone (in-house).Dr. Kapil Bharti had found that the largest cost in hPSC-derived RPE was the time in GMP manufacturing and he believed that anything to reduce that would improve COGs. For Dr. Bharti\u2019s group, contracting out GMP manufacture had proven more costly than in-house provision. Validation was also a major part of the cost but QC, whilst not cheap, was not their major cost. Dr. Bharti summarized key NEI-NIH costs in the RPE manufacturing and some possible cost reductions as follows:He reflected on certain costs of patient bespoke  iPSCs that were difficult to calculate including manufacturing cell lines at a rate of only one or two at a time in early trial phases. This requires maintenance of all staff even when there is limited demand and whilst it was anticipated that this would become more consistent at fuller capacity operation, it would only be realized when moving into phase III clinical trials.Cost saving where adventitious agent testing had not been required for autologous donors.Limited cell passaging was needed for autologous cells compared to allogenic product which required cells to be expanded to greater scale for multiple patients.Dr. Bharti also discussed the costs of this kind of \u201cautologous\u201d versus allogenic approach. Autologous lines required replicated banking and testing costs for each cell line compared to a single process for an allogenic product. However, there were some benefits for autologous cells that included:Dr. Bharti explained that the current challenges for the NEI-NIH facility were in obtaining sufficient GMP cleanroom occupancy and down-time for maintenance which was a crucial issue causing delays and increased cost. He also described possible means to reduce this for example by making maintenance more efficient and less invasive and running multiple manufacturing batches together in the same facility. The latter possibility could be particularly beneficial, but would require validation. Such parallel  manufacturing would require procedural and physical protection mechanisms to keep products separate will be essential to meet GMP requirements.Another way Dr. Bharti envisaged streamlining production was to make quality system SOPs consistent for different products where possible and at the NIH facility there were 25 common protocols used for different patient products.A solution also considered beneficial by Dr. Bharti for reduced cost was to rent cleanroom space and avoid long-term costs re dead-time when there is no work to do and down-time required for maintenance.www.wicell.org), UK Stem Cell Bank (www.ukscb.org), and EBISC (www.ebisc.eu) that supply cell lines in the range of $1000 to $1500 depending on the application, however, some other banking centers such as the stem cell facility at the Korea National Institute of Health provide cell lines at no charge.Dr. Yuji Arakawa reported that manpower costs were ~50% of total cost in the CiRA facility and other significant costs were due to quality assurance (QA), maintenance, and servicing. These can be high per banking activity if outsourced, but in-house provision meant ongoing continuous costs. CiRA also found that outsourced virus testing and whole genome sequencing were costly. Cell banks were produced at 300 vials per bank which took 1 month to produce and cost $300,000 overall per batch. Dr. Arakawa noted that different sources of iPSCs varied in charge per vial and some charges varied depending on the intended use. He reported that the CiRA foundation was planning to sell iPSC stocks at $1000/vial. This was broadly consistent with other hPSC banking centers such as Wicell  the balance of cost of validation across manufacturing was as follows: 45% staff, 23\u201325% testing and 25% materials.The discussion also turned to the issue of false claims of \u201cGMP\u201d quality of equipment. This had also been covered in the discussion at previous ISCBI meetings and had been a clear concern for regulators (see notes from ISCBI Los Angeles June 2020 available on request from admin@iscbi.org).Delegates reflected on the fact that molecular interventions in manufacturing can also raise complexities regarding safety and quality control. The development of gene-edited hPSCs for therapeutics was also likely to incur additional costs for quality controls which may include as yet to be determined safety testing as already discussed in ongoing ISCBI workshops . Furthermore, the preparation of cell substrates may have impacts for downstream costs as experienced for CART cells where the viral load (i.e. copy number per cell) may need to be monitored in patients post treatment.15, that will be particularly important given the increasing implementation of new analytical methods for cell-based medicines including genome-wide clinical genetic testing.Costs for supply of vials of cells for use in manufacture were discussed for different centers and it was clear that as discussed in the case studies, there was significant variation from $1000 to 10,000 per vial and in some cases special contract conditions were understood to incur additional charges depending on factors such as stage of product development. Delegates also agreed that the cost assessment for cells intended for future manufacture should also include implementation of clinical laboratory standards. These would now include the recently established standard for clinical testing ISO151896. The history of animal cell biotechnology has shown that translation from lab scale research procedures to manufacturing is not simply a matter of increasing the size of the culture system. Many factors in the cell culture system which affect cell growth such as changes in culture vessel materials, different liquid/atmosphere surface areas for gas exchange, sheer stress from bubbles or impellers and altered mass or heat transfer dynamics in the culture medium18, all potentially impact on the efficiency of large-scale systems compared to the researcher\u2019s original protocols. In addition, the biomarkers and analytical approaches may need to be developed during product development20 so that it is difficult to calculate cost of goods for manufacturing on the basis of a research protocol yet to be translated into a GMP manufacturing process. Furthermore, the comparison of COGs in different national and institutional settings is challenging and figures for the cost of production of hPSC lines has been difficult to assess21. However, in this paper experiences from a number of centers making hPSCs for manufacturing cell-based medicines have consistently indicated that the key direct and most obvious manufacturing costs arose from the need for experienced staff, use of qualified clean-room facilities, specialist cell culture materials and testing for quality control and safety. One example of autologous CART manufacture has shown that the largest component of labor costs could be over 70% of the total manufacturing cost22, comprising mostly manufacturing processing (48%), quality control (16%), and quality assurance (16%). In this case materials were the next highest COGs element (18%) and costs of facilities (8%) and equipment (4%) seemed to represent a relatively minor element of the COGs. it is vitally important too. However, another study of a different T-cell adoptive therapy differed in that facility costs were highest , with labor and materials both significantly less (i.e. ~20% each)23. It is important to recognize that these costs arise within the manufacture of an autologous cell product with bioprocessing far less complex than for an hPSC-derivative. In one comparison of an adoptive T-cell therapy product and hPSC COGs for each appeared to have a similar profile. the COGs for the hPSC system simply assessed costs for development of a master cell bank of an hPSC line  and not an actual product23. However, this study calculated average costs for very early and late stages of preclinical development and revealed that both in the case of the hPSC bank and adoptive T cell therapy, facility costs decreased compared to labor costs as each process progressed towards clinical trial stage. Thus, the ability to directly translate labor costs and COGs in general, from reports of one product type to another and between somatic cell and pluripotent stem cell manufacturing are not straightforward even where the products are nominally very similar. For manufacturing of hPSC-based products the cell culture systems are multifaceted, generate complex mixed cell populations, are often much more prolonged (up to 300 days for batch cultures of certain hPSC derivatives) and also based on complex raw materials often not available under appropriately qualified conditions. For the hPSC banking process alone, whilst the challenge of creating a reproducible cell differentiation process is not an issue, the stability of the system during cell expansion and qualification of novel raw materials and assays can still create high COGs.COGs is a crucial element in enabling uptake of advanced hPSC-based medicines or cell therapies22, but again translation of such COGs elements between somatic and pluripotent stem cell manufacturing processes can be problematic for the reasons already stated. Furthermore, COGs evaluation between regional jurisdictions may also vary depending on the predicted equipment and facility life-span  and the specific frequency of facility and equipment requalification required. Validation is also required for various aspects of the manufacturing process and includes, but is not limited to, facilities , reagents, equipment, analytical methods, storage, and shipment. Thus, early assurance that raw materials, vectors and production cell lines would all meet regulatory requirements was crucial to avoid costly changes at a later stage. Finally, the importance and costs of qualification of the cell source  will be important to consider, especially if multiple donors are required as in haplo-banking or generation of autologous cell lines. The ISCBI workshop speakers and delegates also considered opportunities where the direct costs could be cut and concluded that avoiding commitment to ongoing manufacturing facilities by rental of clean room space or outsourcing manufacture to a CMO was attractive. However, this could also increase timelines and incur new costs due to the need to either wait for access to manufacturing slots and/or train CMO staff. Also, in relation to efficient use of cleanroom time the need to plan and prospectively manage down-time for maintenance was considered important to avoid costs due to unplanned down-time. A number of workshop presentations reflected on the use of CMOs or facility rental and some of the key pros and cons to be considered are summarized as described in Table Validation of the manufacturing process was also considered a major and necessary cost, but one which was often not obvious to early-stage product developers. As commented on by Dr. Bharti (NEI-NIH) (Case study 3 above), validation procedures for GMP manufacturing and could cost almost as much as the item being validated i.e., cost of validation of vector removal in some cases had exceeded the cost of vector manufacture. Indeed, other areas of cell manufacture such as CART therapy facility validation costs in might make up 20% of the total facility costsApproaches used under GMP to address this include planned preventative maintenance  and design features that enable maintenance from outside of the cleanroom without compromising cleanroom integrity and air quality. Examples typically used in GMP manufacturing include ceiling or wall embedded fittings permitting maintenance without lab entry and gas supplies piped and filtered through the cleanroom wall.Processing of multiple cell lines or products in the same cleanroom at the same time were also considered attractive to enhance cost efficiencies in terms of campaign progress, staff time, and reducing cleanroom occupancy time. However, this approach would also require rigorous process controls to assure separation of different cultures and products to avoid switching of process materials and cross-contamination.7 is typically most readily accommodated in-house.Outsourced testing continues to be a cost which is difficult to reduce. Care is needed to assure the quality of testing and reporting and a key prerequisite should be use of testing services subject to formal accreditation by appropriate professional bodies. Attempts to carry out in-house testing, while bringing timelines within greater control of the manufacturer, could also incur significant staff-time and training commitment. In addition, they represent an additional quality assurance burden . The decision to out-source versus in-house provision will be influenced by a number of local factors including ease with which the staff can accommodate the testing, level of quality assurance support and availability of specialist equipment and facilities. Testing which is carried out for information and is not used for cell bank or product release25. Sealed (\u201cclosed\u201d) automation systems offer both advantages of avoiding the need for high air quality cleanroom conditions and the limitations of \u2018isolator\u2019 operation. Much of the technology for aseptic connection of these devices for media supply, quality control sampling, and harvesting have been developed in industry production systems for cell culture-based vaccine and biotherapeutics. Challenges for automation may include unexpected reaction of stem cells to new environments and surfaces, altered mass transfer effects  within the bioreactors. Microcarriers and suspension systems are well advanced for manufacture of cell culture derived vaccines and biotherapeutics and are under development for culture and differentiation of pluripotent stem cells28. Furthermore, an IMI (Innovative Medicine Initiatives) - a partnership between the European Union (represented by the European Commission) and the European pharmaceutical industry  - a funded hPSC-biobanking project  is using a 4\u2009\u00d7\u200950\u2009ml volume stand-alone bioreactor system for biobanking cell expansion and differentiation a funded hPSC-biobanking project  is using a 50-ml volume stand-alone bioreactor system for biobanking cell expansion with cells in suspension or on alginate beads29. Automation systems may also have the benefit of permitting reduction in size of equipment and thus, reducing the highly expensive manufacturing space needed. In cell-based medicines the use of standard commercially available culture expansion units such as described by Dr. Karnielli (see case studies above) also provide ready scalability without the significant technology transfer and validation costs often associated with the switch to full-scale manufacturing30. Thus, combined isolator and automated culture could in principle help to optimize cost reduction. Isolator systems for standard culture modalities had been tried in many labs and had become popular. They can reduce facility costs of a cleanroom but still require the same consumables, significant staff time and quality control costs.Automation was an area where considerable benefit is perceived for the future with positive experience in the manufacture of medical devices31. Beyond quality control methods, the overall efficiency of quality assurance can in principle32 and in practice be transformed by streamlining and switching to electronic operating systems.It is also important not to forget the potential impact of automated quality control and substantial improvements have already been experienced for QC of autologous CART therapies  and in molecular analysis33. It addresses a key element of COGs reduction for cell therapies which is to optimize utility of capacity22.Typically, the cell banking process involves preparation of a large master cell bank (MCB) and then following completion of quality control and characterization, a single MCB vial is thawed and re-expanded to generate a working cell bank (WCB). The WCB is then subject to a focused set of quality control tests. However, the operational and quality control costs can be made in adjusting the fundamental approach to cell banking which might be termed a \u201ccontinuous banking\u201d process. This involves retaining some cultured cells from the batch of cultures used for a MCB and expanding them immediately without cryopreservation to the WCB passage level. This avoids time consumed in recovery of cryopreserved MCB cells and potential loss of cells and increased risk of expansion of genetic variants. However, it also means that WCB may be created before the MCB testing is completed so potentially the cost of WCB could be wasted if cells at MCB level do not pass QC. However, implementation of rapid screening for genetic stability could enable early abandonment of WCB manufacture due to the most likely QC problem of expansion of genetic variants. This approach has been tested in a number of centers including the UK Stem Cell Bank (UKSCB) and has been published by the Hadassah Medical Centre34, This involves careful screening of candidate manufacturing cell lines and/or donor tissues to ensure the cells have the appropriate ethical provenance and biological characteristics, are free from evident microbial contamination and allow the user freedom to act without adverse intellectual property issues.A further element that is crucial to avoiding wasted resources on failed batches is the implementation of a due diligence process during procurement of stem cell lines36 and particularly where bespoke genotypes are required such as homozygous HLA haplotypes12, this is an issue that will significantly impact on the cost of generating hPSC-derived medicines. In order to reduce such costs, it is wise to consider using existing donor selection systems such as health services or sharing resources with collaborators with similar needs. In conclusion, a significant number of iPSC and hESC lines are available from professional hPSC biobanks established to assure all the correct procedures for donor selection have been documented and these make a valuable first point of contact for hPSC-based product developers seeking suitable production cell lines7.Another means to reduce early commitment of resources to hPSCs is to generate a large MCB and allocate a certain proportion of vials as an early Distribution Cell Bank. Such a system has been used at the UKSCB to substantially cut early investment in cell culture  and quality control , when popularity of individual hPSC lines has yet to be determined and thus overtime, allows the biobank to focus resources on those lines that become more popular with biobank users. The KNIH case-study above reflected on the significant costs that may be associated with donor procurement and selection and this is often forgotten in discussions about costs of biobanking as it was typically a historical activity which did not involve the biobank or is not such a key issue for suitability as in the case of \u201cautologous\u201d iPSC lines used by the KNIH and NIH facilities. However, as biobanks move towards development of cell lines specifically intended for manufacture of cell-based medicinesConsideration of most costly elements such as facilities, services, and staff, depend significantly on the local methods for measuring costs. Many centers in academic institutions may only figure in additional costs of consumables, external testing etc. and do not include core staff, general use equipment and facilities  provided for other projects and overheads, which can be very different between different institutions or academia and industry. All of the latter items may not be included in published estimations of cost per vial or bank of cells and so need to be born in mind when comparing published cost of goods for use of hPSC lines.In order to proactively tackle the issue of COGs reduction it is also an important consideration to identify the various sources of influence on COGs and score the impact that these might have overall. This can enable issues with more significant potential to raise costs to be prioritized and appropriate action taken to limit or reduce COGs. Some important examples of these variables in the hPSC manufacturing chain, including cell sourcing and banking, are given in Table www.iscbi.org) who are supplying hPSCs specifically for manufacture of cell-based medicines. These centers will have already addressed the key issues for assuring the suitability of their hPSC stocks and can save significant investment of time and resources for the early stage of product development. Furthermore, the attention applied by stem cell resource centers to assure the suitability of cell lines7 will reduce the risks of failure in product development.In conclusion, figures quoted in the literature for costs of hPSC lines are influenced by many factors. We have identified some that represent significant costs common to most centers making hPSCs for manufacture of cell-based medicines. However, other factors are significantly variable depending on the nature of the stem cell bank\u2019s host organization including its core objectives, the expertize and services available in-house and how the organization manages facility costs and especially how it establishes overhead costs. Furthermore, there are costs which are less obvious to early developers , and others that are much less predictable including donor recruitment and technology transfer where CMOs are used for manufacturing. Any organization wishing to derive its own hPSC production cell lines, should consider the utility of existing resources such as those engaged in the ISCBI community ("}
{"text": "Recent reports demonstrate that SARS-CoV-2 utilizes cell surface heparan sulfate as an attachment factor to facilitate the initial interaction with host cells. Heparan sulfate interacts with the receptor binding domain of SARS-CoV-2 spike glycoprotein, and blocking this interaction can decrease cell infection. We and others reported recently that the family of compounds of 2,5-dihydroxyphenylic acid interferes with the binding of the positively charged groove in growth factor molecules to negatively charged cell surface heparan sulfate. We hypothesized that Calcium Dobesilate (CaD)\u2014calcium salt of 2,5-dihydroxyphenylic acid\u2014may also interfere with the binding of SARS-CoV-2 spike protein to heparan sulfate. Using lentiviral SARS-CoV-2 spike protein pseudotyped particles we show that CaD could significantly reduce pseudovirus uptake into endothelial cells. On the contrary, CaD did not affect cell infection with VSVG-expressing lentivirus. CaD could also prevent retention of SARS-CoV-2 spike protein in ex vivo perfused mouse kidney. Using microfluidic culture of endothelial cells under flow, we show that CaD prevents spike protein interaction with heparan sulfate glycocalyx. Since CaD has no adverse side effects and is approved in humans for other medical indications, our findings can rapidly translate into clinical studies. This form of infection is self-limiting and causes no serious threat to the infected person. However, in 20% of patients, infection with SARS-CoV-2 leads to life-threatening respiratory, cardiac, renal, and cerebral injury3\u2060. The underlying mechanisms of this severe form of the disease are not fully understood. The clinical picture in these patients resembles the systemic inflammatory response syndrome (SIRS) with a strong microvascular component7\u2060. It seems that an inflammatory endothelial response that may involve the coagulation cascade and/or the complement pathway plays a vital role9\u2060. Endothelial activation results into elevated levels of pro-inflammatory cytokines\u2014interleukin-1, interleukin-6 (IL-6) and tumor necrosis factor-\u03b1 (TNF\u03b1), chemokines and antithrombotic factors\u2014von Willebrand factor and factor VIII in these critically endangered patients10\u2060. Higher levels of acute phase reactants  are also associated with severe SARS-CoV-2 infection. Therefore, it is reasonable to assume that endothelial dysfunction contributes to COVID-19-associated vascular inflammation. Pro-inflammatory cytokines, elevated in patients with COVID-19, induce the loss of the normal antithrombotic and anti-inflammatory functions of endothelial cells, leading to coagulation dysregulation, complement and platelet activation, and leukocyte recruitment in the microvasculature9. Furthermore, recent report suggested that proteolytically released S1 domain of SARS-CoV-2 spike protein induces endothelial damage, vascular permeability and expression of PAI-1 and VEGF by lung microvascular endothelial cells12\u2060.Infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is in most patients limited to bronchoalveolar epithelial cells and associated with local bronchopulmonary symptoms14. There is still controversy existing whether SARS-CoV-2 infects the endothelium directly. Multiple reports demonstrate infection of endothelium both, in vivo and in vitro18\u2060. Whereas other investigation find no evidence for endothelial infection20\u2060. Organ-specific and regulated expression of ACE2 is important for cell infection with SARS-CoV-221\u2060. Expression of ACE2 by endothelial cells has been documented22\u2060. Some organ-specific endothelial cells such as from brain show high ACE2 levels even in normal conditions23\u2060. Another important factor that could potentially explain this controversy is the abundance of endothelial glycocalyx both in vivo and in vitro experimental systems24\u2060.These microvascular complications of SARS-CoV-2 infection are most likely responsible for the high rate of morbidity and mortality of infected patients27\u2060\u2060, influenza virus, immunodeficiency virus, and different coronaviruses (SARS-CoV-1 and MERS-CoV)29\u2060. Several viruses interact with sialic acids located on the ends of glycans found in glycolipids and glycoproteins30\u2060. Other viruses interact with heparan sulfate (HS)32\u2060. This initial attachment of the virus to HS can lead to the engagement of protein receptors on the host plasma membrane, such as ACE2, that facilitate membrane fusion or engulfment and internalization.The glycocalyx is a complex mixture of glycans and glycoproteins covering the endothelial cell surface. Viruses and other infectious organisms must transgress the glycocalyx to engage receptors that mediate viral entry into host cells. Many viral pathogens have evolved to utilize glycans as attachment factors, which facilitate the initial interaction with host cells, including alpha-, beta- and gammaherpesviruses33\u2060. These findings identify cellular HS as a necessary co-factor for SARS-CoV-2 infection and emphasize the potential for targeting spike protein\u2013HS interactions to attenuate virus infection\u2060. Further reports confirmed this observation34\u2060. Yue and colleagues35\u2060 investigated the role of heparin and HS sulfation for the binding of spike protein in details. They have also demonstrated that spike protein of highly infective G614 SARS-CoV-2 variant has higher binding to heparin and HS. Application of heparin in COVID-19 patients exerted beneficial effects via anti-coagulant and non-anticoagulant mechanisms37\u2060. On the contrary, Targosz-Korezka and colleagues have reported recently that HS glycocalyx shields endothelial cell surface and prevents SARS-CoV-2 interaction with ACE2 receptor38\u2060. Even more complexity was hypothesized by Buqaileh et al., who suggested that primary ciliary pockets\u2014membranous invagination around the primary ciliary of endothelial cells\u2014can serve as specific entry points for SARS-CoV-2 as ACE2 was concentrated at those area39\u2060. When interpreting experimental data on the role of the glycocalyx in the virus entry mechanisms, it should be kept in mind that correct physiological models must be applied.Esko and his group have recently shown that the ectodomain of the SARS-CoV-2 spike protein interacts with cell surface HS through the receptor-binding domain. Surface binding to cells and virus uptake requires the engagement of both cellular HS and ACE2, suggesting that HS acts as a co-receptor priming the virus envelope for ACE2 interaction41\u2060. We hypothesized that 2,5-DHPA might also interfere with the binding of SARS-CoV-2-HS binding.We and others recently identified a family of small molecules, 2,5-dihydroxyphenylic acid , which interfere with the binding of the positively charged groove in growth factors to negatively charged HS44\u2060, diabetic kidney damage45\u2060, and venous insufficiency46\u2060. Structure of CaD is shown in Supplementary Fig.\u00a047\u2060. However, the mechanism of action of CaD is not yet fully understood. 2,5-DHPA compound class interferes with growth factor signaling. For example, CaD binds to the heparin-binding domain of Fibroblast Growth Factor-148\u2060. We have recently shown that CaD could function similarly as a VEGF antagonist without adverse side effects41\u2060. Recent meta-analyses further demonstrated the clinical safety of CaD52\u2060.Calcium dobesilate (CaD)\u2014calcium salt of 2,5-dihydroxyphenylic acid CaD is a vasoprotective drug that demonstrated beneficial effects on vascular leakage and inflammation in diabetic retinopathyWe have developed a lentiviral expression system of luciferase- and GFP-expressing SARS-CoV-2 spike pseudotyped viral particles and studied uptake in cultured microvascular endothelial cells. We showed that CaD interferes with the binding of the spike protein to heparan sulfate and reduces pseudovirus uptake into endothelial cells. 2,5-DHPA (and possible derivatives) are potent inhibitors of SARS-CoV-2-HS binding and have the potential to prevent viral uptake and endothelial dysfunction in infected patients. Since CaD has been approved in humans for other medical indications, our findings can rapidly translate into clinical studies.First, we assessed whether kidney epithelial (HK-2) and human microvascular endothelial cells HMEC-1) can bind recombinant SARS-CoV-2 spike protein by dot blot assay  or GFP was used as reporter to quantify cell infection rate. The expression of SARS-CoV-2 spike protein in pseudoviral particles has been verified by Western blotting . Our data confirmed that CaD did not induce any cell toxicity under our experimental conditions Fig.\u00a0A. SecondE. coli, respectively. CaD exerted no significant effects on these processes receptor to increase local virus concentration and facilitate the search for higher affinity protein receptor for cell entry. Recent reports showed that various viruses use HS as the initial cell attachment site56. It is still not well understood how different spatial compositions of HS, its occupancy by ligands  and shedding can affect virus attachment and cell infection in vivo. Increased plasma content of soluble HS fragments and proteoglycans can bind viral particles and decrease the probability of finding and interaction with cell surface receptors57\u2060.Endothelial cells develop especially pronounced glycocalyx on the luminal side. We have recently demonstrated that endothelial glycocalyx thickness decreases in covid-19 critically ill patients and serum of covid-19 patients induces shedding of endothelial cell glycocalyx in vitro37\u2060. CaD has many advantages over heparin and HS mimetics. It is an approved vasoprotective drug without the adverse effects of, for example, increased coagulation; it can be applied as a nasal spray to prevent upper airways infections, or systemically through the oral route. Moreover, a recent case report of covid-19 demonstrated improvement on clinical parameters in a patient with covid-19 after CaD application58\u2060.Inhibitory effects of heparin and other HS-mimetics on the cell infection by different viral types are known and the strategy was confirmed to be efficient against experimental SARS-CoV-2 infectionOur in vitro binding assay confirmed that CaD can interfere with spike protein binding to HS. The kinetics were similar in the case of high and low molecular weight heparin. Binding of spike protein to HS was less efficient suggesting that sulfation is important for the interaction. However, we cannot exclude that lower binding was observed due to less efficient plate coating with HS.Taken together, these data inferns that CaD can be potentially used to prevent cell infection with SARS-CoV-2 and urge further research towards clinical testing of this substance for the therapy of covid-19 patients.62\u2060. Several models of possible interactions has been proposed by the model confirming our hypothesis . The following settings were used: excitation wavelength filter was 485\u00a0nm, emission wavelength filter was 535\u00a0nm. Integration time was 1000\u00a0ms. Duolink proximity ligation assay kit was purchased from Sigma  and used accordingly to the manufacturer\u2019s instructions. CY3-conjugated Sambucus Nigra Lectin  (CL-1303-1) was from Vector Laboratories, Inc. .Recombinant SARS-CoV-2 spike S1 subunit (40589-V08B1) was purchased from , full length spike protein (10549-CV) and nucleocapsid (10474-CV) proteins were purchased from R&D Systems. Antibody against spike protein (NBP2-41058) was from Novus Biologicals; antibody against spike S1 subunit was from Sino Biological (40150-R007); HS antibody (10E4) was from Amsbio. Luciferase assay was performed using Pierce Gaussia Luciferase Glow Assay Kit . CaD was purchased from Sigma . Heparin, Heparan sulfate, LMW heparin Enoxaparin, Heparinase III were from Sigma. Toxicity of CaD was assessed using Cell Counting Kit-8 . Cell proliferation was measured by using BrdU incorporation assay . The effect of CaD on pinocytosis was assessed using FITC-Dextran . Effect of CaD on phagocytosis was measured using FITC-labelled E.coli as described recentlyQiagen RNAeasy kit was used for RNA purification from the cells. TaqMan RT-PCR was performed using TaqMan Master Mix and Light Cycler96 (Roche). TaqMan assays oligonucleotides were from ThermoFisher Scientific, Waltham, MA, USA.Human dermal microvascular endothelial cells HMEC-1 were acquired from ATCC and cultured as recommended by the supplier. HUVECs were purchased from Lonza and cultured as recommended. THP-1 cells were from ATCC. HEK-Blue-hTLR4 were from Invivogene.https://molview.org/).Chemical structure of CaD was drawn using MolView online tool (E. coli\u00a0DH5\u03b1). The products were verified by sequencing .cDNA of GAPDH promoter and Gaussia Luciferase (GLuc) were derived from pEZX-LvPG04 vector  used as a template. A full-length cDNA of GAPDH promoter and GLuc were amplified using Phire Hot Start II DNA Polymerase . The sequences of all primers used are given in Supplementary Table https://www.invivogen.com/wuhan-spike-d614g-pseudotyping-vector). Second-generation lentiviral packaging construct plasmid psPAX2 (expressing HIV-gag) was acquired from Addgene (http://www.addgene.org/12260/). The work was performed under S2 biosafety level. Pseudoviral particles were produced by transforming packaging cell line HEK293T using Perfectin transfection reagent from Genlantis  as established69. HEK293T conditioned medium containing lentiviral particles was centrifuged at low speed, filtered through 45\u00a0\u00b5m pore size filter, and stored at +\u20094\u00b0\u00a0C for up to 1\u00a0week before cell infection. Expression of spike protein of SARS-CoV-2 in lentiviral pseudoparticles was confirmed by Western blotting using SARS-CoV-2 (COVID-19) spike antibody [1A9], IgG1 from Genetex . Lentivirus titer was determined using Quick Titer kit from Cell Biolabs . Lentivirus was added at the MOI 50 for 2\u00a0h where not indicated otherwise. For infection, inhibitors were added to the lentivirus containing supernatant, and the cocktail was added to the cells for 2\u00a0h. After the incubation, the medium containing the remaining lentivirus was removed, cells were washed once with a warm growth medium, a fresh medium was added and cells were incubated for 24\u00a0h before measurement of Gluc activity or microscopy.To generate pseudotyped viral particles with the SARS-CoV-2 spike protein on a lentiviral core, spike glycoprotein expression plasmid pLV-Spike V1 (SARS-CoV-2 Wuhan-Hu-1 isolate with the D614G mutation) was used (Gaussia luciferase activity was measured using Pierce\u2122 Gaussia Luciferase Glow Assay Kit (Thermofisher Scientific).33\u2060. Plates were blocked with 0.1% BSA on PBS, washed and then recombinant His-tagged spike protein (R&D Systems) was added at the concentration of 30\u00a0nM along with the indicated concentrations of CaD. Spike protein detection was performed using anti-His antibody (R&D Systems).High binding ELISA plates were coated with heparin, enoxaparin and HS as described by Clausen et al.69. Briefly, cells were seeded in the channels of polydimethylsiloxane (PDMS) microfluidic chips and allowed to adhere for 6\u00a0h. Then, medium perfusion was initiated using peristaltic pump (Watson Marlow) and teflon tubing (Diba Industries). Cells were perfused with shear stress of 16\u00a0dyn/cm2 for 5\u00a0days before further experiments. To exclude absorption of lentiviruses to the teflon tubing and PDMS, control experiments were performed. Lentivirus containing medium was perfused through the tubing and empty microfluidic chips. Then, this medium was used for cell infection and virus quantification. These experiments showed that there were no absorption of the lentivirus to chips and tubes.We applied developed by us microfluidic system described elsewhere53. Briefly, after electrophoresis the proteins were transferred to PVDF membrane using semi-dry western blotting apparatus . Chemiluminescence pictures were taken using VersaDoc gel documentation system and quantified by QuantityOne software .Western blotting was performed as described previouslyhttps://imagej.nih.gov/ij/).Cells were fixed with 2% PFA and blocked with 1% of BSA on PBS. Duolink assay was performed using kits from Sigma following the protocol suggested by the company. Confocal microscopy was then performed using Leica TCS-SP2 AOBS confocal microscope (Leica Microsystems) at the Research Core Unit for Laser Microscopy at Hannover Medical School. Quantification of the images was performed using ImageJ analysis software . Animals were euthanized humanely accordingly to Paragraph 7, Section 3 of German Animal Welfare Act. All experiments were approved by the animal protection committee of the Phenos GmbH (Tierschutzkomission der Phenos GmbH). All animals were handled in compliance with the guidelines for the care and use of animals at our institution and in accordance with the EU Directive 2010/63/EU for animal experiments. Methods are reported in accordance with ARRIVE guidelines. C57BL6N wild type male mice were purchased from Charles River Laboratories . The following groups were used with three animals per group: PBS perfusion; spike protein perfusion; spike protein with CaD perfusion. The mice were euthanized humanly and both kidneys, abdominal aorta and inferior vena cava were exposed via abdominal incision. Small vessels were cauterized with the electrosurgical pencil and cut. Proximal ends of the aorta and vena cava and the distal aorta and vena cava near bifurcation were also clotted and cut. Ureters were cut to separate both kidneys. A 7/0 ligature was preset around the aorta. The preset ligature was closed after inserting 27G catheter without core into the aorta. Kidneys were perfused with sterile saline to remove the blood.70, perfusion rate was set to 1.3\u00a0ml/min. Kidneys were perfused with PBS (Group 1); 15\u00a0\u00b5g/ml spike protein (Group 2); 15\u00a0\u00b5g/ml spike protein with 100\u00a0\u00b5M CaD (Group 3) for 30\u00a0min. Where indicated, kidneys were perfused with heparinase III 50\u00a0mU/ml for 30\u00a0min prior perfusion with spike protein or lentiviruses. Fluid flowing from the vein was absorbed back into the perfusion solution tube by another catheter connected to the peristaltic pump. Then, the kidneys were perfused with saline for 5\u00a0min, washing solution was collected in 1\u00a0ml fractions for western blotting analysis. After perfusion kidneys were cut into three parts; upper and lower parts were frozen in liquid nitrogen for biochemical experiments, the middle part was fixed in formalin for immunohistochemical staining. For His Mag sepharose pull down assay, the tissue were homogenated in 10:1 (v:w) ratio in RIPA lysis buffer and incubated for 15\u00a0min on ice. Lysates were cleared by centrifugation and used for the pull down assay.Both kidneys with catheter were moved to a dry dish, the catheter was connected to the peristaltic pump (Watson Marlow) and perfusion of the kidneys with saline was continued for 5\u00a0min. Based on reported blood flow rate in the mouse kidneyhttps://www.graphpad.com/) was used for data analysis.All data were obtained with at least three biological replications. Data are presented as mean\u2009\u00b1\u2009standard deviation (SD). Multiple comparisons were analyzed by ANOVA with Tukey post hoc test. P-values\u2009<\u20090.05 were considered statistically significant. GraphPad Prism 8.3.0 (Supplementary Information."}
{"text": "Since the COVID-19 pandemic, telehealth has been widely adopted in outpatient settings in the United States. Although telehealth visits are publicly accepted in different settings, little is known about the situation after the wide adoption of telehealth from the perspectives of adults with type 2 diabetes mellitus (T2D) and their providers.This study aims to identify barriers and facilitators of maintaining continuity of care using telehealth for patients with T2D in a diabetes specialty clinic.As the second phase of a multimethod study to understand missed appointments among adults with T2D, we conducted semistructured, individual, in-depth phone or Zoom interviews with 23 adults with T2D  and 10 providers from diabetes clinics in a tertiary academic medical center in Maryland. Interviews were audio-recorded, transcribed, and analyzed using thematic content analysis by the research team.Adults with T2D and their providers generally reported positive experiences with telehealth visits for diabetes care with some technical challenges resulting in the need for in-person visits. We identified the following 3 themes: (1) \u201cperceived benefits of telehealth visits,\u201d such as convenience, time and financial efficiencies, and independence from caregivers, benefits shared by both patients and providers; (2) \u201cperceived technological challenges of telehealth visits,\u201d such as disparities in digital health literacy, frustration caused by unstable internet connection, and difficulty sharing glucose data, challenges shared by both patients and providers; and (3) \u201cimpact of telehealth visits on the quality of diabetes care,\u201d including lack of diabetes quality measures and needs and preferences for in-person visits, shared mainly from providers\u2019 perspectives with some patient input.Telehealth is generally received positively in diabetes care with some persistent challenges that might compromise the quality of diabetes care. Telehealth technology and glucose data platforms must incorporate user experience and user-centered design to optimize telehealth use in diabetes care. Clinical practices need to consider new workflows for telehealth visits to facilitate easier follow-up scheduling and lab completion. Future research to investigate the ideal balance between in-person and telehealth visits in diabetes care is warranted to enhance the quality of diabetes care and to optimize diabetes outcomes. Policy flexibilities should also be considered to broaden access to diabetes care for all patients with T2D. It is estimated that there are more than 37 million people in the United States with diabetes mellitus, and 90% to 95% of those cases are type 2 diabetes mellitus (T2D) . WorkingTelehealth, the use of telecommunication technologies to provide health care remotely , has beeSpecific to diabetes care, the transformation from in-person to telehealth visits has the potential to democratize routine diabetes care provision, such as providing care to those with limited transportation who otherwise could not be at the clinic regularly ,16. A prHowever, some endocrinologists believed telehealth visits were more helpful for people with type 1 diabetes mellitus (T1D) compared with those with T2D because people with T1D are more closely monitored by continuous glucose monitoring (CGM) and insulin pumps . AdditioThis qualitative narrative study took place in the Johns Hopkins Diabetes Center, a multidisciplinary team  providing comprehensive diabetes care across multiple locations in the greater Baltimore area affiliated with a tertiary academic medical center in Maryland. There were no telehealth (video or phone) visits before the COVID-19 pandemic. During COVID-19, appointments at the Johns Hopkins Diabetes Center were transferred to telehealth visits on March 23, 2020, after the expansion of coverage by the Centers for Medicare & Medicaid Services . The cliIn normal circumstances, the telehealth visits at Johns Hopkins are through MyChart (Webex by Cisco). A medical assistant usually calls a day before the appointment to verify patients\u2019 physical locations to meet individual state regulations. On the day of the appointment, vital signs and medical history are verified again through a phone call after a patient completes the electronic check-in through MyChart. Before the scheduled appointment time, the link to \u201cstart your video visit\u201d appears to initiate the visit. The link for the video visit can be sent via text message if a patient does not use MyChart. A simple phone call may be used if the patient does not have devices with video capabilities .The findings for this manuscript were the second part of a multimethod study focusing on missed appointments among adults with T2D. In short, the first part of the study used electronic health records (EHRs) to examine if predictors of missed appointments differ (1) between pre-COVID-19 (January 2019 to March 2020) and COVID-19 (March 2020 to December 2020) periods and (2) by health care delivery modes  during COVID-19 among adults with T2D; more information is described elsewhere .Based on the results of the first phase, the eligibility criteria for this qualitative study included a diagnosis of T2D, age greater than 18 years, residence in the state of Maryland, and at least one appointment with either a physician or an NP marked as a no-show in the EHR in the past year at the time of recruitment (February 2022 to July 2022). Adults who met the inclusion criteria were identified from the EHR and then were contacted via emails, phone calls, or text messages. We used purposive sampling with maximum variation to include adults from different physicians and NPs with diverse characteristics  based on our quantitative results .Potential provider participants were invited through a study presentation by one of the authors (CAS) at the monthly diabetes center meeting. CAS then emailed the study information to all potential provider participants. All physicians and NPs working at the Johns Hopkins Diabetes Center were eligible to participate.The Johns Hopkins Medicine Institutional Review Board  approved the study design and procedures. Verbal consent was obtained from each participant.The study team developed a semistructured interview guide to explore perceptions among people with T2D and their providers regarding the barriers and facilitators of keeping appointments for both in-person and telehealth visits, with a focus on interpersonal relationships. The initial interview guide drafted by CAS was based on the findings of our previous quantitative study on missed appointments during the COVID-19 pandemic  and prevOne-on-one 30-minute to 45-minute phone or Zoom interviews were conducted by 2 trained interviewers (CAS and ZS) from February 2022 to July 2022 until thematic saturation was reached. In total, we contacted 52 eligible people with T2D; 28 refused , and 24 agreed to participate. Of those participants agreeing to participate, 23 completed the interview, and 1 participant was excluded due to a mislabeled T2D diagnosis on the EHR. Among 12 eligible providers, 10 (8 physicians and 2 NPs) agreed to participate and completed the interviews. All phone interviews were audio-recorded; all Zoom interviews were recorded using Zoom\u2019s recording features. Only audio recordings were saved and sent to a professional transcription vendor approved by the Johns Hopkins IRB for verbatim transcription. After verifying the accuracy and removing identifiable information, transcripts were imported into f4analyse for coding and analysis.The analysis began after the transcription of the first interview and continued throughout data collection. We conducted a thematic content analysis of the interview transcripts, a common method of analysis when coding categories are derived directly from data ,27. EachReflexivity was achieved through discussions between interviewers and written notes after the interview. Trustworthiness was maintained through team discussions and audit trail documentation; all documentation was kept using Microsoft Word. The transferability of the study was enhanced by providing a thorough description of the study method, study setting, and our processes of data collection .Details of characteristics of persons with T2D included in this study can be found in Among 10 provider participants , there were 7 female and 3 male providers, with an average service time at the institution of 7.2  years.We identified 3 themes with 13 subthemes addressing patients\u2019 and providers\u2019 perspectives on telehealth visits in T2D care see . Both paIn the following sections, we first describe the first theme, \u201cperceived benefits of telehealth visits,\u201d shared by both patients and providers, followed by the benefits noted by providers only. We then describe the second theme, \u201cperceived technological challenges of telehealth visits,\u201d shared by both patients and providers. Finally, we describe the third theme, \u201cimpact of telehealth visits on the quality of diabetes care,\u201d as perceived by both patients and providers, though mainly from providers\u2019 perspectives with some patient input. Direct quotes are presented in the following sections.The majority of persons with T2D and provider participants described positive experiences with telehealth visits due to several benefits, mainly noting increased convenience and efficiency as compared with in-person visits. We identified the following 5 subthemes: (1) diabetes care \u201cin the comfort of your home\u201d at a time of one\u2019s convenience; (2) saving money and time due to no need for transportation; (3) relief from relying on one\u2019s caregiver and less \u201cjuggling to get it in our schedule\u201d; (4) efficient visits, fewer delays, and more time with patients; and (5) a good fit for data-driven diabetes care.Regarding the first subtheme (diabetes care \u201cin the comfort of your home\u201d at a time of one\u2019s convenience), many adults with T2D specifically cited the convenience of being able to conduct telehealth visits from their homes or at a private location conducive to their schedule. Similarly, from providers\u2019 perspectives, many providers acknowledged the added convenience of telehealth visits for their patients, citing reasons largely in alignment with what patient participants mentioned:It's really convenient, I don't have to take off from work, I don't have to park. Based on the time of the day, any time prior to like 3 o'clock, the parking garage is pretty well filled up. So, it just really alleviates a lot of additional stress, and a lot of the times, I can either do it at work in a secluded area. I think it's just great, very convenient.Adult09I think the benefit of telehealth is patients who are not coming in because of either distance or they can't find the time to come in at least we have this as a resort to say, \u201cWell, if you can take 20 minutes out of your workday even at work, we can at least still see you and try to do some management.\u201d I think it's useful in that sense.Provider09Regarding the second subtheme (saving money and time due to no need for transportation), people with T2D who drive to in-person visits expressed contentment about not having to pay for parking or gas. Adults who take public transportation to attend in-person visits were satisfied with telehealth visits due to saving money and decreased wait times for both transportation as well as in the provider\u2019s office. Many providers empathized with people\u2019s economic and time constraints that often hindered in-person visit attendance. The following quotes from a person with T2D and a provider reflect the mutual understanding of the perks of being able to conduct diabetes care visits irrespective of their physical locations:Yeah, I do like the video visits. I mean, because it saves money. You know, you don't have to worry about transportation to and from. You know, you could be in the comfort of your own home.Adult18I think it (video visit) is a fantastic way to extend care to people who don't have to drive into our clinic, don't have to park, don't have to waste probably an hour to 2 hours of their day.Provider06Regarding the third subtheme (relief from relying on one\u2019s caregiver and less \u201cjuggling to get it into our schedule\u201d), several people with T2D shared their emotional burden of having to rely on their caregivers  to attend in-person visits for a variety of reasons. For them, sharing one vehicle meant that family members had to miss time from work or skip their own medical appointments to help people with T2D with transportation to in-person diabetes visits, or sometimes the adults with T2D would need to skip their visit in lieu of their caregivers. Hence, when telehealth visits were available, these adults with T2D felt content as they no longer needed to rely on others for in-person visits. This quote highlights the experience of 1 participant who had a right leg amputation:To me, it\u2019s convenient that you don't always have to go into the hospital because my fianc\u00e9e works 9 to 5, which is most of the time that appointments are, so she doesn't have to miss time from work to take me. Normally I could drive, but now with this amputation, I can't do that myself. So, they help a lot, that everything can be done right through a video call, don't actually have to be there.Adult10A provider also acknowledged the barriers of in-person visits, saying:The patients, I think, though, have more of a struggle (doing in-person visits) than we do because of transportation and coming in. If they\u2019re older and they don\u2019t drive, and yet they need to be driven there, that kind of thing.Provider04The fourth subtheme  was unique to providers. Providers described how telehealth visits can be conducted more efficiently than in-person visits, thereby reducing delays in their daily schedule and allowing them to maximize their time spent with each patient. One provider participant contrasted their use of time during in-person and telehealth visits and the beneficial impact on their daily workflow:The person has to get transportation to (the clinic), and then maybe if they have a vehicle, they have to park it. There\u2019s the process of getting signed in, and my 1:00 patient who arrives a couple minutes after 1:00, and then the medical assistant is a little busy, may not get them in the room until 1:25, which can then set my schedule behind. Whereas on telemedicine, I'm running it, I can say to a patient, if we need to wrap-up, like \u201cWe only have 5 more minutes,\u201d and I know I\u2019ll have somebody coming into the queue, who will be ready to go ahead and have their appointment. It\u2019s easier to structure the patient to the amount of time you have and also make use of that full amount of appointment time, because you immediately sign onto them, so there\u2019s no delay at all.Provider041c) measurement for the telehealth visits as compared with in-person visits, where a point-of-care HbA1c is taken. Advances in diabetes technology allow most people with diabetes to share their blood glucose data before telehealth visits.The fifth subtheme (good fit for data-driven diabetes care) was unique to providers. Most providers mentioned that diabetes care was suitable for telehealth visits as it focused more on the behavioral and cognitive perspectives. However, providers also specifically expressed the requirement of having home blood glucose data to provide optimal diabetes care and a treatment plan to their patients. This practice is particularly important in telehealth visits as most adults might not have an available glycated hemoglobin  can share their readings from home, it can be just as good and preferable from the patient\u2019s perspective.Provider02Despite the aforementioned benefits, patient and provider participants all faced some challenges related to technology during telehealth visits. To complete a successful telehealth visit in diabetes care, people with T2D needed to have a digital device, know how to get online, navigate the patient portal to the nested telehealth platform, upload their glucose data via a cloud or patient portal, and have familiarity with manipulating the video camera and volume. Any disruption could happen during this process, which could result in a suboptimal experience. We identified 3 subthemes related to technological challenges from both adults and providers and 1 subtheme unique to providers.Regarding the first subtheme , when navigating technology aspects of telehealth  throughout COVID-19, some people with T2D were proficient from the beginning, while others required additional support from staff at the diabetes clinics or other family members. For other patient participants, the repeated practices over time made them more comfortable with telehealth-related technology:I've got a desktop that we've had for some time, and my wife is a technical genius in the house, she helped me get it set up three times now, I'm an old veteran; I could do it solo now.Adult04However, 2 people with T2D specifically cited computer illiteracy as the reason for not utilizing the patient portal . In this case, they would rely on providers to contact them using alternate video platforms  without going through the patient portal. All providers acknowledged that the use of telehealth required digital health literacy and were prepared to use different ways to connect with their patients. A provider discussing the limitations of telehealth visits mentioned the following:Not everybody has a computer at home, which is a problem. Or they don\u2019t have iPhones, so, we can\u2019t do a Facetime call with them. (...) Any of these technical issues mean that we can\u2019t cover as much in that half an hour as I would if I saw them in person because you don\u2019t have those limitations in person.Provider10Both people with T2D and providers acknowledged that the lack of digital devices was a barrier to telehealth visits. At the time of the interview, 3 adults did not have a digital device with a camera capacity . Of these adults, 2 had only phone visits during the peak of COVID-19, while the other person had only in-person visits as he established care after in-person visits resumed. One person who only had experiences with phone visits stated the following:No. I don't even know how to work that (video visit), uh-uh. I just have telephone calls. I don't know how to do none of that virtual stuff. (...) I just upgraded my phone, but I'm saying I still don't know how to work it real good.Adult07Regarding the second subtheme (frustration caused by unstable internet connection), once people with T2D and providers were connected, echoing in voices and delay in transmission due to unstable internet connection were other issues that undermined the quality of conversation and sometimes caused frustration for both parties involved. As most of the allotted time was spent on nonmedical issues , people did not have enough time to ask questions, and providers were unable to properly deliver care. A provider provided the following quote when discussing the disadvantages of telehealth visits:It really comes down to the connection and the person\u2019s savvy with it. I had a lady, lives in Virginia, and she\u2019s elderly, and a friend had to drive her over the line into Maryland. So, they were in the car trying to get a connection with me, and where they were, it wasn\u2019t good connection. So, I\u2019m seeing her frozen face, she sees my frozen face, we halfway hear each other, and finally it had to degrade into a phone conversation.Provider04A person with T2D discussing this frustration in her previous telehealth experience mentioned the following:It (video visit) didn\u2019t go through. We were talking and then it kept disconnecting. The call kept dropping, so we had to wind up just texting. So, 1 out of 5, I\u2019d give it a 1.\u200a (...) I will not give it (the video visit) a try.Adult21The third subtheme (phone visits not encouraged) was unique to providers. At the time of the interview, phone visits were not encouraged due to the complexity of the reimbursement and compliance issues. Although phone visits were the least preferred method for providers to connect with their patients, it was a necessary backup when connection issues or the other abovementioned technical issues persisted.You can't bill for phone visits. (...) Or you can bill for it, but you won't get reimbursed for it. So, then why did I go to all that trouble? Then, I can just have my secretary set up a phone call, and I can just have a phone call, which will work easier, instead of doing this thing of getting onto EPIC\u2014it's a nightmare. Not good.Provider06Regarding the fourth subtheme (difficulty sharing glucose data), both people with T2D and providers mentioned the potential obstacles of sharing glucose data in telehealth visits. Depending on the devices  a person uses, sharing glucose data can be either easy or very troublesome. Patient participants with a CGM generally reported a smooth and easy process for sharing data compared with those with a traditional glucometer. However, not everyone with T2D was eligible for insurance coverage for a CGM, which is expensive for a person paying out of pocket. Many adult participants using a glucometer reported sending handwritten documents ahead of the telehealth visits or reading their daily glucose data in the past few weeks aloud during the telehealth visits. A person with T2D with experience using both glucose monitoring systems shared his experience:Before, it (sharing glucose data) was really easy. Now that I've got different insurance, it's not as easy as it was before, because before I had a CGM and it could just upload the information. So, I just uploaded the information to my dock\u200a. Now I'm back to pricking my finger (glucometer), I can't (upload my data), it (the glucometer) didn\u2019t do the same. I've got to keep a record of it myself and share it with my doctors.Adult04Sometimes, if a person did not have their glucometer with them, a provider would rely on the person\u2019s memories of their glucose trends to decide on the treatment plan. Either way, this process took extra time for providers to make sense of the glucose data  before a clinical judgment was made. Those practices specific to telehealth visits either increased the time needed by providers or limited the length of a visit to address adults\u2019 questions and concerns:I had to have them  grab their glucometer and scroll through the numbers and read to me what those were, but for a 20-minute visit, if they're doing that for more than 10 minutes, it really leaves us not much time to go over other things.Provider09The aforementioned benefits and challenges of telehealth had clinical implications for diabetes care. We identified 4 subthemes mainly from providers\u2019 perspectives with support from patient input, including \u201ca double-edged sword for care continuity,\u201d \u201cperceived incomplete visits due to no diabetes quality measures,\u201d \u201ccompromised care quality due to unavailability of glucose data and/or unpreparedness of their patients,\u201d and \u201cneeds for and preferences of in-person visits.\u201dThe first subtheme (a double-edged sword for care continuity) was unique to providers. With all the needed information on hand, telehealth visits allowed providers to offer more frequent quality diabetes care to adults with T2D who traditionally could not attend in-person visits often due to geographic barriers or other transportation-related issues:I think this model  has some advantages in that way, I mean they can touch base more frequently, they might be shorter communications, but they're more frequent as opposed to spaced out longer in-person visits.Provider07Provider participants also noticed that telehealth visits decreased missed appointments, which increased care continuity. Adults with T2D scheduling a telehealth visit received at least one extra reminder because current regulatory requirements mandated the verification of a person\u2019s location before the visit. Additionally, due to the unpredictable nature of technical issues in telehealth visits, providers were more likely to outreach to adults despite an initial absence on the telehealth platforms. Most of their patients were able to remotely engage immediately in telehealth visits when prompted by a provider\u2019s phone or video call. A provider described missed appointments and provided the following quote:I will say, with telemedicine, it\u2019s easier, because you can just call them and say \u201cHey, you have an appointment, let\u2019s just talk right now.\u201d A lot of people will say \u201cOkay, that\u2019s fine.\u201dProvider03On the other hand, the current telehealth workflow in the diabetes clinics requires adults with T2D to take the initiative to schedule their next appointment after a telehealth visit, instead of scheduling the next appointment at the front desk on the way out of the office after an in-person visit. Although it did not bother people with T2D in this study, a person described how her other health conditions delayed her scheduling the next appointment:I know I need to schedule an appointment. In fact, I was gonna call this week, but I'm getting a medical procedure, so Monday I was seeing other health care providers, so probably next week, I'll call the scheduling line and set up something or try and do it through MyChart to set up\u200a(the next appointment).Adult13The delay in scheduling the next appointment could sometimes lead to discontinuity in diabetes care because there was no follow-up mechanism at the time of the interview by the clinics after each visit. A provider discussing the impact of telehealth in diabetes care described this phenomenon:Often, I will say they fall through the cracks, because we don't have the staff to follow-up on every patient and see if they scheduled a follow-up, and so it's sort of like I tell them \u201cPlease schedule a follow-up,\u201d and I put in the order so that they'll get a prompt in MyChart, but beyond that we're not following-up to see what happens, and so they may not schedule it themselves.\u200aProvider051c, lipid panel, microalbumin) quarterly or annually [1c or other biofeedback at their in-person visits , the responsibility of completing the required lab work shifted to adults with T2D after a telehealth visit; they must remember to make an additional trip to a lab facility. Additionally, it is not feasible to assess diabetes-related complications and other physical exams via telehealth. A person weighing in on telehealth visits mentioned:Regarding the second subtheme, , both people with T2D and providers viewed being unable to complete a thorough physical evaluation as a major limitation of telehealth visits. The American Diabetes Association recommends each person with T2D undergo a physical exam  and biofeedback  good, but I can\u2019t come in getting my instant test, how \u201cboom,\u201d they give you the A1c. It was awesome. I liked that.Adult22Providers admitted the same limitation, adding this additional effort sometimes led to incomplete diabetes quality measures. Without the information, providers might not be able to provide timely treatment recommendations, which could ultimately compromise their patients\u2019 health outcomes. When comparing in-person and telehealth visits, a provider provided the following quote:We can\u2019t do a point-of-care A1c at those visits, and those are problems because we care about all of those and it impacts our decision making\u200a. (...) We try to reach out to patients who haven\u2019t had labs done in a while to try to get their labs before their (video) visit, but that\u2019s challenging because the point-of-care A1c makes it very (easy)\u2014it\u2019s a 5-minute test result.Provider10The third subtheme  was unique to providers. Although telehealth visits had the potential to enhance care continuity through proactive outreach from a provider, provider participants felt that sometimes their patient was distracted during a telehealth visit\u2014they might be driving with an intermittent internet connection, walking down the street, or having other commitments\u2014so it was difficult to assess their lifestyle management during that environment. In addition to the inattention, people with T2D might not have their glucose data ready to share, as mentioned previously. Therefore, provider participants sometimes felt that a telehealth visit could compromise the care quality. A provider discussing frustration in telehealth visits mentioned the following:There are times when telehealth visits are not productive. It really, I think, depends on patient engagement. I certainly have had patients who are taking the call while they're driving, or they forgot that they had a visit with me. So, in some ways, people take the telehealth less seriously, in which case, it's a waste of their time and so they're not ready for the visit and so sometimes they don't have labs, no glucometer data (...).Provider09Regarding the fourth subtheme (needs and preferences for in-person visits), both patient and provider participants shared the need for in-person visits. Although people with T2D in this study generally perceived that the conversations and interpersonal relationships during both telehealth and in-person visits were similar, only 5 participants noted a preference for telehealth visits; more than one-half of the participants specifically noted a preference for in-person visits because of the challenges and clinical implications discussed above:Personally, I like face-to-face with my doctors, a checkup to see how you\u2019re doing, with diabetes care. (...) It\u2019s not like I have any kind of feet issues or circulation issues, hopefully never, but it\u2019s good to go through that kind of stuff (check my feet) and just have them check that stuff, and it\u2019s hard to do that with a virtual visit.Adult20Similarly, provider participants also mentioned that adults with T2D should have an in-person visit at least once a year:I do think that patients do have to be seen at least annually, in-person, for a comprehensive foot exam, and other parts of the exam that need to be done as well. (...) What I was finding with telemedicine is that a lot of time, though the visits were great and the recommended frequency would continue, often, the labs would lag behind. Patients wouldn\u2019t feel comfortable going to get their labs done.Provider08This qualitative study outlined the perspectives of both providers and patients with T2D on the benefits and challenges of telehealth in diabetes care. Although people with T2D and their providers acknowledged the convenience and efficiency of telehealth visits for promoting care continuity in diabetes care, telehealth also had challenges that could compromise the quality of diabetes care.Consistent with previous literature , both adGiven health care systems\u2019 rapid increase in telehealth capacities since the COVID-19 pandemic , it is kSeveral temporary policy flexibilities broadened access to diabetes care during the COVID-19 pandemic ,16, inclOur study revealed concerns about glucose data availability impacting the quality of diabetes care in telehealth visits. Of the patients in this study, 70% 16/23) used insulin at the time of their interview, and glucose monitoring is integral to guiding individualized treatment plans in this population . Sharing6/23 used1c, lipid panel, microalbumin [1c and nephropathy monitoring declined and did not recover to the prepandemic volume in the primary care setting [1c measurements was also a risk factor for missed appointments in the diabetes-specific setting [Both patient and provider participants in this study acknowledged that telehealth visits promote care continuity because of convenience and efficiency, but both indicated the need for in-person visits in T2D care. Attending in-person visits allows people with T2D to check diabetes quality measures  within  setting . A gap i setting . To ensuThis study has a few limitations. All participants were from diabetes clinics within a large urban academic medical center in the mid-Atlantic region of the United States. Additionally, the study was designed to focus on missed appointments and interpersonal relationships, and thus, themes presented in this study might not apply to the people with T2D who do not miss appointments. Last, this study collected data from participants who spoke English and responded to our phone calls, text messages, or emails. Although we maximized variations in recruiting participants , the themes derived may not apply to people lacking a working phone number or who do not speak English.In summary, telehealth implementation during the COVID-19 pandemic has expanded access to diabetes care. Adults with T2D and providers generally reported positive experiences with telehealth visits, although some definite technical challenges exist. To ensure equitable access to diabetes care, legislation should provide more flexibility regarding geographic boundaries and telehealth delivery modes (audio-only versus video-audio visits). Telehealth-related technology design also needs to consider user experience and user-centered design to optimize the use of telehealth; a person-oriented telehealth workflow has the potential to address concerns about the negative effects of telehealth visits on the quality of diabetes. Future research to investigate the ideal balance between in-person and telehealth visits in diabetes care is warranted to enhance the quality of diabetes care to optimize diabetes outcomes."}
{"text": "Podarcis lilfordi) and two geckos (Tarentola mauritanica and Hemidactylus turcicus). Balearic lizards have proven to be potential community-level pollinators by interacting with many different plant species to varying degrees. Although in some plant species lizards damaged reproductive structures by feeding directly on them, legitimate visits were significantly more frequent. Intraspecific differences were found in these wall lizards and even indications of gecko\u2013flower interactions. These findings expand our knowledge not only on the magnitude of lizard\u2013plant community interactions but also in their complexity.The role of lizards as potential pollinators is increasingly recognized, especially on islands. However, there are very few studies at the community level that have also addressed intraspecific variations related to the consumption of floral resources. We pursued this objective on the island of Cabrera Gran  where there are the Balearic wall lizards (Podarcis lilfordi) with flowers of 44 plant species, 72.7% of which were unknown to date. Although florivory occurs in some of these species (35%), the majority of visits were legitimate (65%); in addition, we found intraspecific differences in the interactions related to the sex and age of lizards. Our findings support the role of Balearic wall lizards as potential pollinators across the entire plant community, and their contribution to particular plant species, for instance the endangered Cistus heterophyllus carthaginensis. This study also documents the first record of another sympatric lizard (Tarentola mauritanica) visiting flowers and contributes to the few existing records of flower interactions involving geckos in the Paleartic ecozone.The role of lizards as potential pollinators on islands has been documented for either one or a few plants in different parts of the world, but it has never been assessed for an entire plant community. Here, we quantified interaction rate by lizards and evaluated intraspecific differences in the use of flowers on Cabrera Gran  by means of visual observations, automated cameras and the analysis of pollen grain samples. Overall, we recorded interactions of the Balearic wall lizard ( Scaly reptiles (Squamata), named \u201clizards\u201d, are typically characterized as predators that consume plant matter anecdotally ,2,3, witThe interactions of lizards with flowers have been documented in continental environments ,11,12,13Lizards that interact with flowers can damage the reproductive structures by feeding directly from them , a lacertid that was originally largely distributed but is now restricted to the smaller islands. In areas where they have disappeared, the distribution of some lizard-depending plants for pollen and/or seed dispersal have undergone radical changes [The Cabrera archipelago is, today, the largest territory of the Balearic lizard ( changes . Althoug changes ), the re2, 39\u00b008\u203231\u2033 N 2\u00b056\u203245\u2033 E), from 5 April to 6 May 2022, coinciding with the flowering of a good part of the vegetal community. The data were collected throughout the entire island based on flower availability.Fieldwork was carried out on Cabrera Gran, the largest island of the archipelago  from the island of Cabrera Gran [Tarentola mauritanica, and the Turkish gecko, Hemidactylus turcicus. Although there are no records of visiting flowers by these geckos (nor of any herbivorous behavior anywhere in the world), Ficus carica seeds have been found in stomach contents of Moorish geckos precisely in this island [Of the three lizards present in the Cabrera archipelago, the predominant species is the Balearic lizard, an endemic lacertid which spreads over all habitats, from extensive pine forests to minuscule islets without vegetation cover but seasonally occupied by colonies of seabirds . The Balera Gran . In addis island ,49. ThisTo document lizard\u2013flower interactions, we used three sampling techniques: direct observation censuses, automatic cameras and pollen smears. The censuses consisted of 10 min observations, alternating different days, hours and areas, until completing 60 min per plant species, in daytime conditions of clear skies and little or no wind. In each census, we recorded the total number of flowers available, the number of flowers observed and the number of flowers visited, as well as the species, sex and age  of lizards and the type of the interaction . Individual lizards were then grouped into one of three groups  to account for intraspecific size differences that may have functional effects. Any flowering plant was censused , althougWe constructed a binary quantitative ecological network, using data from surveys and automatic cameras, to illustrate the two types of interaction, using the IR values  pooled into the three lizard groups , with the \u2018bipartite\u2019 package in R .We explored whether the frequency of legitimate visits versus florivory varies for each lizard group , using a Pearson\u2019s Chi-squared test with Yates\u2019 continuity correction (package \u2018CrossTable\u2019 of the R \u2018gmodels\u2019 library ).Plantago sp., one Apiaceae species, and four morphospecies whose identification was not possible. The most frequently visited species (higher IR) were Daucus carota, Euphorbia dendroides and Lobularia maritima, followed by Cistus monspeliensis, Lavatera arborea, Lomelosia cretica and Paronychia capitata.Through direct censuses, the analysis of recorded images, the identification of pollen samples and non-systematic observations we reported interactions between lizards and flowers of 44 plant species (n = 57), 41 of which are new to the island of Cabrera . OverallPapaver somniferum) produced a voracious attack, in other common species, such as euphorbias (Euphorbia spp.) or the jaguar (Cistus monspeliensis), a meticulous nectar-licking behavior was shown. The interaction with this last genus, not reported until now, was revealed as one of the most frequent in Cabrera. At noon, a multitude of lizards expose themselves to potential predators by climbing over the sage of this species to collect nectar and pollen with their tongues, moving from one flower to another.Lizards did not interact with all plant species in the same way; legitimate visits were more frequent  than florivory (35%). Interactions of lizards with flowers were either casual , or intentional . In any case, we considered these interactions as legitimate visits as long as there was no damage to the reproductive organs of the flower. It could also be seen that some flowers were systematically bitten while in others the contact almost always occurred with the tongue. For example, while an infrequent encounter with the opium poppy , with legitimate visits being more frequent than florivory for females (p = 0.02) and juveniles (p < 0.001). . .No direct observations of flower visits by geckos were recorded; however, one sample (n = 3) contained more than 100 pollen grains of a species that could not be identified.Balearic lizards have proven to be potential community-level pollinators by interacting with many different plant species to varying degrees. Although, in some plant species, lizards damaged reproductive structures by feeding directly on them, legitimate visits were significantly more frequent. Intraspecific differences were found in these wall lizards and even indications of gecko\u2013flower interactions. These findings expand our knowledge not only in the magnitude of lizard\u2013plant community interactions but also in their complexity.Daucus sp. and Lobularia sp. . In addition, on partially isolated rocks on steep shores, the flowers of plants such as Daucus carota attract the full attention of local lizards as they are often the only resource available in these habitats. This could, to some extent, overshadow the relevance of other plant species belonging to habitats of greater diversity and whose flowers are large and well isolated from each other, such as those of Lavatera spp. and Cistus spp.Quantitatively, the lizards have a much higher frequency of interactions in plant species with flowers that appear very close together or are grouped in inflorescences with a certain density, such as Cistus. In particular, Cistus monspeliensis is extremely abundant on the island of Cabrera and the legitimate interaction of lizards with its flowers, ignored until now, is one of the most important quantitatively. During the study, we also found the world\u2019s largest population of Cartagena rockrose (Cistus heterophyllus carthaginensis), previously undescribed in the Balearic Islands [Due to their relative abundance and generalist behavior, lizards seem to play an important ecological role in the reproduction of the plant community. A particular case is that of rockroses of the genus  Islands . It is a Islands ,54. Its Medicago arborea, Lavatera maritima and Allium subvillosum were observed, even climbing the branches or jumping directly from the ground and attacking flowers voraciously (pers. obs.). In this island, the Balearic lizard is a legitimate flower visitor of Lavatera maritima but can eat the flowers of this same species under dry conditions when other food resources are scarce [The fact that some flowers are systematically bitten, and, in others, nectar is sipped by reptiles may be due to the characteristics of the flower. The sensitivity of lizards to be guided by odors is known , as is te scarce . Thus, iDespite this appreciation, analyses showed a significantly higher frequency of legitimate visits than florivory by female and juvenile lizards . It indiSilene vulgaris flower is illustrative, introducing its snout to feed inside it, while the male with which it shared territory was not interested in it. For larger lizards, sometimes the only alternative that allows them to obtain pollen and/or nectar from flowers is to break the structures by biting. However, it can also happen that, if these structures are not attractive and the reward is minimal, the flower does not arise sufficient interest. In this regard, we cite the case of Cneorum tricoccon, whose small yellow flowers are sucked by small lizards  while the males focus their attention on the relatively large fruits. This mutualistic interaction is the most important [Males were the most florivorous group, showing no significant differences with legitimate visits. Male lizards have larger heads and therefore cannot access the floral cavities where the smallest ones  can. The case of a female lizard that repeatedly visited a mportant  althoughmportant .Lobularia maritima, only frequented by juveniles, and therefore different age classes or sexes can act as differentiated functional groups for the purposes of pollination. Juveniles can also show ethological differences associated not only with size but also with energy demand and ease of obtaining animal prey: as they are developing, they need a higher protein intake than adults and therefore have to invest more in foraging  and less in the consumption of vegetable matter including floral structures . The change in diet towards a higher vegetable fraction in adulthood is typical in generalist species of many families of lizards and is precisely positively associated with greater body size, not only because of the relative energy demand, but also because of the difficulty involved in feeding. Large prey are rarer and more difficult to obtain except for species from highly specialized predatory families, such as monitor lizards or chameleons, which can successfully capture them [We know that reptiles ,22, inclure them .This fact was also reflected in the behavior of the Balearic lizards during hunting: on multiple occasions, the lizards made unsuccessful attempts to catch large insects such as diurnal lepidoptera, while small and low-mobility insects were caught effortlessly. A great need for food not covered by the availability of arthropods for large lizard males can lead them to feed more frequently on floral structures and also to visit fewer plant species, disregarding both those in which they do not have access to nectar for their body dimensions (and the structures themselves are not attractive), such as those whose only interest for lizards is the presence of small pollinating insects.Tarentola delandii in Euphorbia lamarckii) had already been discovered on islands in the Palearctic ecozone [Phelsuma sp. in Mauritius and Reunion [Like the Balearic lizards, geckos present intraspecific variations in diet , but unl ecozone . However Reunion ,67,68,69The discovery of new interactions with flowers for the Balearic lizard\u2014a species that has received much attention so far \u2014demonstr"}
{"text": "IntroductionSyphilis is a sexually transmitted infection caused by Treponema pallidum which has protean manifestations. The cutaneous presentation of syphilis can mimic many dermatologic conditions.\u00a0Materials & methodsWith an aim to describe palmoplantar involvement in syphilis, a retrospective study of case series was done with 11 patients having palmoplantar skin lesions in syphilis within a period of two years. Only serologically confirmed cases were included.ResultsThe prevalence of palmoplantar involvement in syphilis was 47.85% and all of them except one patient  were secondary syphilis. A major proportion of cases (72.8%) studied had no history or presentation of genital lesions. Biett\u2019s collar which is an indicator of palmoplantar syphilis was seen only in 45.5% of the cases.ConclusionThe clinicians must be aware that palmoplantar skin lesions might be the only clinical presentation of syphilis and a high index of suspicion is needed to correctly diagnose and treat the condition in such a setting. Syphilis, an ancient disease caused by Treponema pallidum showed decreased incidence in the 1990s following increased awareness among the population and better screening and diagnostic tests . WHO estThe origin of syphilis has been postulated by the pre-Columbian, Columbian, and unitarian hypotheses dating back to 15,000 B.C. It has always been stigmatized, each country that was affected by the infection blamed the neighboring and enemy countries for the outbreak. The term \u2018syphilis\u2019 was coined by Girolamo Fracastoro, a medical personality in Verona. Later, Schaudinn and Hoffman discovered the etiologic agent of syphilis and named it Spirochaeta pallida, which they subsequently changed to Treponema pallidum .\u00a0Syphilis is transmitted by sexual contact , but it can also be spread congenitally 65%) by vertical transmission  between June 2021 to July 2023 were selected. Among 23 patients who were diagnosed with syphilis, 11 patients were selected based on the criteria of the study. Patients who were serologically negative for syphilis were excluded. The available data such as age, sex, duration, clinical presentation, treatment history, and results of serological tests were recorded, tabulated, and analyzed. High-risk behavior (HRB) such as substance abuse , men who have sex with men (MSM), and commercial sex workers was noted.\u00a0Nearly half of the patients diagnosed serologically with syphilis (47.82%) were found to have palmoplantar involvement. Male predominance was noted and the median age is 35 Table . The onlSyphilis, a sexually transmitted infection is classified into primary, secondary, latent, and tertiary syphilis. If the primary infection is not properly diagnosed and treated, after four to 10 weeks, the disease evolves into secondary syphilis as seen in our case series. Syphilides are eruptions of secondary syphilis presenting as asymptomatic coppery papules whose palmoplantar localization is very suggestive . Among 2Syphilis is famously known for being a great imitator, physicians must be familiar with all potential clinical forms of syphilis . A PubMeNail involvement includes nail plate changes like brittleness, splitting, fissuring, pitting, onycholysis, elkonyxis, Beau's lines, onychomadesis, and nail loss. Additionally, nail matrix change is mainly represented by syphilitic painless paronychia .On dermoscopy, an orangish background is seen which is likely due to hemosiderin deposits in the dermis because of extravasation of red blood corpuscles (RBCs) in secondary syphilis. The Biett\u2019s collar is visualized on the dermoscopy as a circular, thin, scaling edge that progresses in an outward direction and is surrounded by an erythematous halo. With dermoscopy, the evolution of syphilide is marked by the progressive extension of the Biett\u2019s collar towards the periphery until the disappearance creating a tartar-like appearance, with a remarkable attenuation of the erythema and the orange background after one week . The eliA nontreponemal test\u00a0like VDRL is a simple and inexpensive screening test that detects antibodies from two weeks till about six weeks after infection. Though the VDRL is 100% sensitive in secondary syphilis, it could become negative after treatment or false negative due to the prozone phenomenon. The prozone phenomenon was found to have less than 2% incidence in syphilis which could be corrected by serial dilution of the serum as seen in our case . Highly As per CDC guidelines, secondary syphilis should be treated by benzathine penicillin G 2.4 million units\u00a0intramuscular (IM) in a single dose regardless of HIV status. In areas of high prevalence of HIV, those persons with primary or secondary syphilis with negative HIV test results should be offered HIV PrEP and retested in three months. On follow-up, clinical and serologic evaluation should be performed at six and 12 months after treatment. Re-infection and treatment failure should be considered in patients who have signs or symptoms that persist or recur and those with at least a fourfold increase in nontreponemal test titer persisting for >2 weeks . Apart fAs seen in our study, palmoplantar skin lesions could be the only sign of syphilis as the patient may not reveal the relevant history due to the sensitive nature of the information. It is imperative that clinicians know this manifestation of syphilis for the correct diagnosis of syphilis because, from a public health perspective, the secondary stage of syphilis is highly contagious, and early detection could lead to the prevention of irreversible systemic complications and further transmission of the condition. Further, physicians should be aware of the causes of false positive and false negative results of screening tests for syphilis and should take appropriate measures to aptly diagnose the disease. Small sample size, no record of dermoscopic or histopathological features, and lack of possible clinical correlation with serological titers are the limitations of this study and are the areas of need for future research."}
{"text": "This study analyzes the mycobiome in wild and captive Sumatran orangutans.Nine orangutan feces samples from the wild and nine from captivity were divided into three repeats from 11- to 15-year-olds in good health. The Illumina platform for analysis of ITS bioinformatics was used according to the Qiime2 and CCMetagen approaches.Neurospora (31%), Penicillium (10%), Aspergillus (3%), Fusarium (3%), Candida (2%), Cutaneotrichosporon (2%), and Limonomyces (2%) are found in wild orangutans. The most prevalent genus among captivity orangutans is Aspergillus (32%), followed by fungal sp. (11%), Lasiodiplodia (18%), Devriesia (2%), and Sordariomycetes (2%). According to the Chao1 diversity index and Shannon and Simpson, there was no significant difference between wild and captive Sumatran orangutans.Wild Sumatran orangutans include 53% Ascomycota, 38% uncultured fungi, and 4% Basidiomycota. Orangutans in captivity are 57% Ascomycota, 26% uncultured fungi, and 2% Basidiomycota. Based on genus level, uncultured Neurospora is unique to wild Sumatran orangutans, although Aspergillus predominates in captive orangutans. We hypothesize that the gut mycobiome of wild orangutans will resemble that of orangutans in captivity. The excellent range of food sources in the forest does not result in the prevalence of fungi in the typical gut microbiome. Pongo spp.). Orangutans are frugivores whose primary food source is fruit and insects [Pongo abelii and Pongo tapanuliensis) and Kalimantan (Pongo pygmaeus) [Orangutans are one of Indonesia\u2019s endemic primates. Orangutans are one of Southeast Asia\u2019s few remaining giant apes  ,4. The Sygmaeus) . This isygmaeus) .Sumatran orangutans are predominantly arboreal, or tree-dwelling or tree-working, mammals. The everyday activities of orangutans consist primarily of eating, relaxing, and social interaction. They are accustomed to spending most of their time eating in the morning and afternoon. The Sumatran orangutan\u2019s eating habit involves tasting. Orangutans inhale the aroma and taste some of their food before ingesting it. If the orangutan does not like the food, it will discard it and search for other food. Orangutans engage in resting behaviors while sleeping at night and taking naps between activities. They typically construct their nests in the canopy of trees to avoid predators. Sumatran orangutans are semi-solitary animals. Typical orangutan social activity involves interactions between mother and offspring and young orangutans playing.Humans and orangutans share similar genetic and physiological traits. Orangutan research is focused on protecting forests as orangutan habitats, while orangutan health has gotten little attention . AccordiStudies have shown that fungi present in the gut microbiome of primates can control the immune responses of the host by either reducing or increasing local inflammation. Generally, fungi produce enzymes and antibiotics that aid the host\u2019s metabolism. A healthy microbial environment in the digestive system stimulates the production of intestinal villi, which enhances the efficiency of the intestinal barrier and helps protect against harmful bacterial infections and nutrient absorption ,10. HoweThis study obtained a permit and a written recommendation letter from Kementerian Lingkungan Hidup dan Kehutanan Direktorat Jenderal Konservasi Sumber Daya Alam dan Ekosistem. Nomor: SK 433/KSDAE/SET.3/KSA.2/8/2021.P. abelii) in the wild and in captivity. Randomly combining nine samples from orangutans in the wild and nine samples from orangutans in captivity yielded three replicates, each containing three samples. The orangutans to be sampled are in good health, and none of the orangutans in custody is undergoing therapy. The feces of newly defecated orangutans are collected in the middle to avoid environmental contamination, sealed in a plastic bag, and stored in a cold box until the laboratory reaches a temperature between 2\u00b0C and 10\u00b0C.The samples were gathered from healthy 11 to 15-year-old orangutans  to mountainous regions . Almost 80% of the terrain has a gradient greater than 40%. In this jungle, orangutans live naturally without human intervention in health management, diet, immunization, or worm treatment. Their diet comprises fruits gathered and ingested directly from trees, and they live from 15 to 40 m above the ground, where feces are identified. Orangutan feces were collected when the orangutans defecated early in the morning [Meanwhile, fecal samples were taken from nine Sumatran orangutans in captivity at the Indonesian Safari Park in Bogor. This 168-hectare park is between 900 and 1,800 masl and has average temperatures between 16\u00b0C and 240\u00b0C. Orangutans in captivity were never administered antibiotics. The captive orangutans in this experiment had never received antibiotic therapy before.\u00ae High-Fidelity PCR Master Mix (New England Biolabs).The Qiagen DNeasy PowerSoil Kit was used to extract the feces of wild and captive Sumatran orangutans . Following the manual\u2019s instructions, 250 mg of fecal samples were utilized to extract DNA. The internal transcribed spacer region (ITS) region was amplified by PCR using the primers ITS1F (5\u2032-CTT GGT CAT TTA GAG GAA GTAA-3\u2032) and ITS2 (5\u2032-GCT GCG TTC ATC GAT GC-3\u2032 with barcode) for 35 cycles at 95\u00b0C for 30 sec, 52\u00b0C for 30 sec, and 72\u00b0C for 30 sec . All PCRIn the process from DNA samples to the final data, each step, including sample testing, PCR, purification, library creation, and sequencing, will affect the quality and amount of the data. In contrast, the data quality would immediately affect the findings of the information analysis. Quality control is performed at each stage of the process to ensure the precision and dependability of the sequencing data.\u00ae UltraTM DNA Library Prep Kit for Illumina and quantified using Qubit and quantitative Polymerase chain reaction) would be analyzed on the Illumina platform. The Illumina NovaSeq was utilized to sequence a 150-bp at a depth of 1,100. Based on the specific barcodes of each sample, paired-end reads were assigned to them, and the barcode and primer sequences were deleted. To merge paired-end readings, FLASH (V1.2.7) was utilized [http://arb-silva.de/), and chimeric sequences were deleted [DNA libraries generated with the NEBNextutilized . Accordiutilized  quality- deleted . The Effhttp://arb-silva.de/). For each taxonomic level, provide species annotation. (Threshold:0.81) [Uparse software (Uparse v7.0.1090) evaluated sequences using all available tags . The simld:0.81) . The MUSld:0.81) . Utilizild:0.81) .Using clustering analysis and an evaluation of molecular variation to determine the commonalities between multiple specimens, a cluster tree was constructed. Principal Coordinates Analysis (PCoA) can be utilized to depict beta diversity . The BraWe employed the CCMetagen approach to increase the accuracy and speed of metagenome classifiers. Pipeline greatly outperforms other commonly used tools in recognizing bacteria and fungi and can efficiently use the entire National Center for Biotechnology Information nucleotide collection as a reference for discovering species with insufficient genome data .P. abelii) aged 11-15 years and randomly combining them into three replicates of three samples each. When collecting samples of wild orangutans, we scoured the forest for trees that provided orangutans with food. After seeing the orangutans eating, we followed them until they defecated. The read counts data reveal a maximum of 328,145 reads (Exsitu3) and a minimum of 87,574 reads (Exsitu2), both of which are from captivity Sumatran orangutans, as shown in The composition of the gut microbiota was effectively studied by collecting feces samples from nine wild and captive Sumatran orangutans (Neurospora (31%), Penicillium (10%), Aspergillus (3%), Fusarium (3%), Candida (2%), Cutaneotrichosporon (2%), and Limonomyces (2%). Aspergillus is the predominant genus among captivity orangutans (32%), followed by fungal species (11%), Lasiodiplodia (18%), Devriesia (2%), and Sordariomycetes (2%).The relative frequency of different microbial taxa in wild Sumatran orangutans is 53% Ascomycota, 38% uncultured fungi, and 4% Basidiomycota. Sumatran orangutans\u2019 captivity phyla are 57% Ascomycota, 26% uncultured fungi, and 2% Basidiomycota. Based on the results of OTU identification and taxonomic annotation According to CCMetagen, the total fungi at the genus level from the phylum Ascomycota and Basidiomycota in wild Sumatran orangutans are uncultured P. abelii), as determined by CCMetagen analysis, Neurospora, Penicillium sp. SYFz-1, cf. Limonomyces roseipellis, uncultured Fusarium, and Candida albicans were identified. In captivity, Sumatran orangutans, Penicillium sp. SYFz-1, uncultured Fusarium, cf. Limonomyces roseipellis, C. albicans, and uncultured Aspergillus were the most prevalent species (At the five species level of wild Sumatran orangutans ( species  and 3.To examine the microbial community makeup in each sample, sequences classified as the same OTUs shared 97% similarity on the Effective Tags of all samples. The rarefaction curve depicts the relationship between the number of species and the number of samples. Rarefaction can be used to verify if a sample has been sufficiently sequenced to represent its identity accurately. It can also be used to determine if a group of samples originates from the same community.p-value of 0.635 and a T-test statistic of 0.585; Shannon has a p-value of 0.798 and a T-test statistic of \u22120.386; and Simpson has a p-value of 0.891 and a T-test statistic of 0.032.According to the Chao1 diversity index, Shannon and Simpson found no significant difference between wild and captive Sumatran orangutans regarding microbial diversity. Chao1 has a p-value is 0.90. The microbial community composition of Sumatran orangutans in the wild and in captivity does not differ significantly. The cluster analysis aims to generate a tree diagram where the most comparable data points are placed on nearby branches. The investigation findings indicate that the hierarchical clusters of Exsitu1 are more comparable to Exsitu3 than Exsitu2.Beta diversity is a comprehensive comparison of microbiomes\u2019 diversity based on their diversity. Therefore, beta diversity measurements are used to evaluate the differences between microbiomes. A cluster tree was constructed using clustering analysis to examine the commonalities among multiple specimens. PCoA can be utilized to depict beta diversity. Optimizing the linear correlation between sample values is the objective of the PCoA. The distance technique employs the Bray-Curtis index and PERMANOVA to establish statistical significance in this study. According to the PERMANOVA results, the R-squared value is 0.14629, and the This study is the first to investigate the mycobiome of both wild and captive Sumatran orangutans, although the fungal aspect of gut microbiota has received less attention compared to bacteria. Despite individual variations in gut microbiota, such as age, sex, geography, diet, and health, fungal commensals in the gut play critical roles in the mammalian immune response. This research sheds light on the dietary and digestive adaptations of orangutans, as the diversity of their gut mycobiome is comparable to that of other primates. Interestingly, the diversity of the gut mycobiome of wild orangutans is similar to that of captive orangutans, despite the wider range of food sources available in the wild.The gut mycobiome plays a vital role in digesting challenging-to-digest substances such as fiber and oligosaccharides. Through fermentative metabolism, the mycobiome generates various metabolites like short- and medium-chain fatty acids and gases. It also plays a significant role in safeguarding the epithelial barrier against pathogens and boosting immunity by activating T-cell 17 immune mechanisms. Thus, maintaining mucosal homeostasis is one of the critical functions of the gut mycobiome ,25.Penicillium sp. SYFz-1, cf. Limonomyces roseipellis, uncultured Fusarium, and C. albicans. However, wild orangutans had uncultured Neurospora, while captive Sumatran orangutans had the highest levels of uncultured Aspergillus.The ITS region of fungal rRNA varies in length among different fungal species, which can introduce bias when using next-generation sequencing technology. Moreover, ITS variation may not always be sufficient to distinguish between species, and few references are available to match sequences to organisms . AlthougAspergillus, Penicillium, and Fusarium fungi in their guts. These fungus genera produce enzymes that are useful for breaking down cellulose biomass in plant diets rich in cellulose and hemicellulose [Neurospora crassa, a species in the genus Neurospora, is known for possessing regulatory genes that express cellulase genes, cellulase activity, and cellulase secretion [Sumatran orangutans consume various food items, including fruits, young leaves, flowers, honey, shoots, stems, seeds, nuts, bamboo, mushrooms, bark, termites, and ant eggs. These food items are rich in cellulose and hemicellulose, which primates cannot digest independently due to a lack of the cellulase enzyme. Therefore, they rely on their gut microbiome to produce this enzyme. Fungi found in the guts of wild and captive Sumatran orangutans are believed to aid in metabolic processes, particularly the digestion of cellulose and hemicellulose. As a result, the mycobiomes of wild and captive Sumatran orangutans were not significantly different. Similar findings have been reported in studies of Tibetan macaques and Lemurs, which also had ellulose ,29. Furtecretion .Neurospora is a type of filamentous fungus belonging to the Ascomycota phylum. The name Neurospora refers to the appearance of its spores, which have striations resembling axons. This fungus is widely used in cellular research to study aspects of eukaryotic biology, such as development and differentiation [Neurospora is a valuable model organism for studying epigenetic phenomena, as it has various genome defense and epigenetic mechanisms. Neurospora is the only organism with repeat-induced point mutations, a unique feature among fungi [Neurospora has a secondary metabolism, some gene sequences have been identified as potential candidates for secondary metabolite production [ntiation . In adding fungi . While toduction .Candida albicans has been found in both wild and captive Sumatran orangutans. While most research on the mycobiome has focused on opportunistic pathogens like C. albicans, it is actually a common fungus in the gut of healthy humans and animals, making it a typical member of the human gut microbiota [C. albicans lacks a significant reservoir in the environment, it is believed to have coevolved extensively with its host and other microbes. Although Candida can also colonize other body parts, such as the mouth, skin, and vagina, it is a frequent cause of mucosal disease in otherwise healthy individuals [crobiota \u201338. Sincividuals ,40. Howeividuals ,42 and lividuals .Candida spp. has been found to influence the gut bacterial microbiome\u2019s assembly and function through various mechanisms such as cellular contact, competition, collaboration for nutrients, and the production of secondary metabolites and antimicrobial peptides. These interactions between gut fungi, bacteria, and host immunity are essential for maintaining human immune homeostasis, which can influence overall health and disease outcomes [The mycobiome in the gastrointestinal tract, which is estimated to be around 0.1% of the total gut microbiome in humans ,44, likeoutcomes \u201347.Candida spp. In contrast, a protein-enriched diet is associated with a decreased abundance of Candida spp. and Methanobrevibacter bacteria in healthy individuals [The variability of the gut mycobiome is influenced by dietary and environmental factors and host factors such as genetics, age, sex, use of antibiotics, and antifungals. The gut mycobiome shows higher variability between individuals and instability over time than the gut bacterial microbiome. Individuals with different nutritional patterns have different gut mycobiome compositions. A carbohydrate-rich diet is associated with an increased abundance of ividuals ,48,49. OHowever, the study has limited samples of wild orangutans that reside in tall trees and has detected a population of approximately 30 wild orangutans dispersed across hundreds of hectares of forest. It is important to continue research on the mycobiome of wild orangutans and expand the sample size to gain a more comprehensive understanding of the gut microbiome in these animals. Such studies could also provide valuable insights into the role of the gut microbiome in the evolution of orangutans and their adaptation to changing environments. This information could also be used to develop strategies to support the conservation of orangutan populations, as changes in diet and habitat could affect the composition and function of their gut microbiomes, including the mycobiome.Neurospora is unique to wild Sumatran orangutans, although Aspergillus predominates in captive orangutans. We predict that the gut mycobiome of wild orangutans will be similar to that of captive orangutans. The greater diversity of food sources in the forest does not result in the presence of fungi in the normal microbiome of the gut flora. The synergistic, symbiotic, or antagonistic interactions between fungal and bacterial microbiota members should be understood.Wild Sumatran orangutans are composed of 53% Ascomycota, 38% uncultured fungi, and 4% Basidiomycota. In captivity, 57% of the orangutan phyla are Ascomycota, 26% are uncultured fungi, and 2% are Basidiomycota."}
{"text": "Funding statement. The original statement, \u201cSB was supported by an AberDoc Ph.D. scholarship from Aberystwyth University, United Kingdom,\u201d did not include the funding granted to author JS. The correct Funding statement appears below.In the published article, there was an error in the \u201cSB was supported by an AberDoc Ph.D. scholarship from Aberystwyth University, United Kingdom. JS was supported by CACMS Innovation Fund (#CI 2021A05110) from China Academy of Chinese Medical Sciences, Beijing, China.\u201dThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}