{"text": "Batrachochytrium dendrobatidis was identified from sick and dead frogs. Since then, several lines of evidence suggest that B. dendrobatidis may be involved in frog declines: the fungus has been found on frogs in afflicted areas; lab studies show that it's highly pathogenic to some frog species; and pathological evidence links it to host mortality. But with little information about the prevalence of this fungal infection in wild frogs, or how the disease impacts frogs in the wild, the causal role of this chytrid fungus remains unclear.Amphibian declines have reached crisis proportions in various parts of the world. In many areas, habitat loss is the likely culprit. But when mass die-offs suddenly occurred in relatively undisturbed habitats, the cause was far less obvious. Fourteen species suffered either extinctions or major declines in the pristine rainforests of Queensland, Australia, between 1979 and 1993. It was suggested in 1996 that some unknown disease had spread through the populations, but no pathogen was discovered until 1998, when the fungus B. dendrobatidis on frogs in their natural habitat, Richard Retallick et al. focused on six species living in the high-elevation rainforest streams of Eungella National Park in Queensland, Australia, where frog losses were \u201cparticularly catastrophic.\u201d Two species vanished between 1985 and 1986: the Eungella Gastric-Brooding Frog (Rheobatrachus vitellinus), which is now thought extinct, and the Eungella Torrent Frog (Taudactylus eungellensis), which later reappeared in a few small populations. Other local frog species escaped this period relatively unscathed.To evaluate the effects of B. dendrobatidis had yet to be identified, but Retallick retained the toe tips, and the authors tested the toes for disease in 2002\u20132003. Fungal infections were found in two species\u2014T. eungellensis and Litoria wilcoxii/jungguy ; the other four species were infection-free. L. wilcoxii/jungguy did not decline to any great extent during the 1985\u20131986 die-off.Retallick captured frogs from six sites from 1994 to 1998, clipped one or two toe tips from each frog to age and identify them, and then released the frogs back into the wild. At the time, T. eungellensis frogs was greatest at three particular sites, which showed peak infections during cooler months. Prevalence of infection was highest during winter and spring, but did not vary from year to year, suggesting that the infection is now endemic. Fungal infections were found in 27.7% of L. wilcoxii/jungguy frogs, with no evidence that prevalence differed among sites, seasons, or individuals . The probability of recapture was significantly lower for frogs that were already infected when first captured. While this might suggest a correlation between infection and death, it's impossible to distinguish death from simple failure to recapture the animal. On further analysis, McCallum and colleagues found no evidence that survival differed between infected and uninfected frogs, suggesting that this potentially devastating amphibian disease now coexists with the frogs, with little effect on their populations.The proportion of infected T. eungellensis, a rainforest frog listed as endangered, \u201cnow persist with stable infections of B. dendrobatidis.\u201d While these findings do not exonerate the fungus as the agent of mass declines, they do rule out the possibility that the fungus caused the decline, then vanished from the area, allowing frog populations to recover. The authors allow that it's possible that B. dendrobatidis did not cause the initial T. eungellensis declines. Or alternately, the fungus could have emerged as a novel pathogen in the ecosystem, causing massive casualties before some form of evolutionary response took hold. Surviving frog populations may have evolved resistance to the pathogen, for example, or less virulent strains of the fungus may have evolved. If it turns out that frog populations can develop resistance to the chytrid fungus, the researchers point out, then a conservation program of captive breeding and selecting for resistance could potentially thwart the extinction of these, and other, critically endangered frogs. A critical next step, then, is to determine whether frogs and fungus do coevolve.These results, the authors conclude, \u201cshow unequivocally\u201d that remaining populations of"}
{"text": "Batrachochytrium dendrobatidis has been implicated in the decline and extinction of numerous frog species worldwide. In Queensland, Australia, it has been proposed as the cause of the decline or apparent extinction of at least 14 high-elevation rainforest frog species. One of these, Taudactylus eungellensis, disappeared from rainforest streams in Eungella National Park in 1985\u20131986, but a few remnant populations were subsequently discovered. Here, we report the analysis of B. dendrobatidis infections in toe tips of T. eungellensis and sympatric species collected in a mark-recapture study between 1994 and 1998. This longitudinal study of the fungus in individually marked frogs sheds new light on the effect of this threatening infectious process in field, as distinct from laboratory, conditions. We found a seasonal peak of infection in the cooler months, with no evidence of interannual variation. The overall prevalence of infection was 18% in T. eungellensis and 28% in Litoria wilcoxii/jungguy, a sympatric frog that appeared not to decline in 1985\u20131986. No infection was found in any of the other sympatric species. Most importantly, we found no consistent evidence of lower survival in T. eungellensis that were infected at the time of first capture, compared with uninfected individuals. These results refute the hypothesis that remnant populations of T. eungellensis recovered after a B. dendrobatidis epidemic because the pathogen had disappeared. They show that populations of T. eungellensis now persist with stable, endemic infections of B. dendrobatidis.The chytrid fungus  Recapture experiments provide evidence that some amphibian species can now persist with infections of the pathogenic chytrid fungus and suggests, for example, that frogs and fungus might be coevolving Lauranctil 1998  and was til 1998 . B. denddeclines , althougdeclines  had direB. dendrobatidis infection on toe tips collected between 1994 and 1998 from six species of frogs at Eungella National Park in east-central Queensland, Australia ((Rheobatrachus vitellinus) disappeared suddenly from relatively undisturbed rainforest streams, and it is now considered to be extinct ((Taudactylus eungellensis) also disappeared, but it was later found to have persisted in a few small populations  of the 474 toes assessed. Four species showed no sign of infection, while we detected infections on 58 (18.4%) of 316 toes of T. eungellensis and 13 (34%) of 47 toes of frogs identified at the time as Litoria lesueuri . The most parsimonious model  included each of these predictors but no interaction terms.Using a logistic model with season , species, and site as predictor variables, we found significant effects of each variable on infection, corrected for the effects of the other variables . A significantly smaller proportion was infected at Rawson Creek (10.5%) than at Dooloomai Falls (26.7%) or Tree Fern Creek (25.0%). There was a marginally significant difference overall in the infection levels among males, females, and subadults . However, when site was included in the model, any suggestion of a difference in infection level between males, females, or subadults disappeared. When we separated the main T. eungellensis populations, it was apparent that the difference in prevalence between those categories was influenced by the population at Tree Fern Creek, where 46% of males (n = 13) and no females or subadults were infected  differeinfected . When weT. eungellensis varied significantly among seasons , but not among years . Further, there was no evidence that the pattern of seasonal variation in infection changed among years . Infection was most prevalent (37.8%) during the winter months (1 June to 31 August) and least prevalent (11.3%) during the summer months (1 December to 28/29 February). Comparing the two sites with the largest sample sizes, Dooloomai Falls and Rawson Creek, there was no evidence that they had differing seasonal patterns of infection , although the level of infection overall was much higher at Dooloomai Falls . Infection levels were much higher in winter and spring combined than in summer and autumn , and there was no evidence of infection levels differing between winter and spring or between summer and autumn . The seasonal changes in infection at the two sites are shown in At these three sites, levels of infection among B. dendrobatidis was detected in 13 of the 47 L. wilcoxii/jungguy examined, giving an estimated prevalence of 27.7%, with a 95% confidence interval ranging from 15.6% to 42.6%. There was no evidence that prevalence of infection differed among males, females, and subadults ; among sites ; or among seasons  (each of the above \u0394dev terms is corrected for the other terms in the model).L. wilcoxii/jungguy and T. eungellensis was hampered by the fact that prevalence of infection on T. eungellensis differed between sites, and that the sampled populations of the two frog species had largely disjunct distributions. When the data were pooled over all sites, there was insufficient evidence to reject a null hypothesis of equal prevalence in the two species, whether the effects of season were allowed for  or not .Comparing the prevalence of infection between L. wilcoxii/jungguy and T. eungellensis recaptured at any stage later in the study, grouped by their infection status at first capture. A logistic model with recapture as the response and species and infection status as predictors produced no evidence that the effect of B. dendrobatidis infection on recapture probability differed between the species . In both species, the probability of recapture was significantly lower for infected frogs than for uninfected frogs , correcting for the substantially higher overall recapture rate of T. eungellensis relative to L. wilcoxii/jungguy.B. dendrobatidis may affect survival, but confounds the probability of recapturing a frog that is present at a site with the probability that a frog is still present at the site. The more sophisticated analysis that follows separates these two components, although it cannot distinguish between death and permanent emigration from the site. For brevity, we refer to continued presence at the site as \u201csurvival.\u201dThis simple analysis suggests that Investigating mark\u2013recapture data for both Rawson Creek and Dooloomai Falls, we found that the best model (on the basis of minimizing the AIC) for which there were sufficient data to estimate almost all parameters had the probability of recapture varying with time but not group , and the survival probability differing between the groups but constant through time. However, further analysis in both cases showed that there was no evidence that survival differed between infected and uninfected frogs: At both sites, the group effect was due to survival being highest in females, intermediate in males, and lowest in subadults ; Table 4T. eungellensis, a rainforest frog that almost disappeared as a result of major die-offs in the Eungella area in the mid 1980s, now persist with stable infections of B. dendrobatidis. This does not imply that this pathogen cannot have been responsible for the decline. One hypothesis that can be discarded, however, is that B. dendrobatidis drove frog populations to low levels, consequently became locally extinct itself, and that frog populations subsequently recovered or stabilised in the absence of the pathogen. Two other hypotheses are consistent with our observed results.Our results show unequivocally that remnant populations of B. dendrobatidis was not responsible for the initial decline of T. eungellensis populations. These populations declined more than a decade before this chytrid was formally identified, and the declines occurred over a very short period , our results show that infection with B. dendrobatidis did not inevitably lead to rapid death in T. eungellensis.Our mark\u2013recapture analysis did not find consistent evidence that captured . TogetheL. wilcoxii/jungguy appears not to have declined at the same time as T. eungellensis and R. vitellinus and, in our data, it has a high prevalence of infection. It therefore is a candidate reservoir host. Whether the prevalence of B. dendrobatidis differs between the sibling species L. wilcoxii and L. jungguy at sites where they are sympatric would be an interesting question, but cannot be answered from our study. The L. lesueuri complex has a widespread distribution throughout streams on the east coast of Australia  were histologically prepared in transverse sections stained with Ehrlich's haematoxylin for skeletochronological assessment . For both mark\u2013recapture and analysis of prevalence, we grouped the data into 3-mo austral seasons . Mark\u2013recapture modelling of survival requires that several assumptions be satisfied. Most critically, every marked individual present in the population at a given time has the same probability of recapture as all other members of its group, and the same probability of surviving to the next time interval. We used a parametric bootstrap (With the software MARK , we usedootstrap  to test ootstrap . Since t"}
{"text": "SOX9 cause campomelic dysplasia, a severe skeletal dysmorphology syndrome in humans characterized by a generalized hypoplasia of endochondral bones. To obtain insights into the logic used by SOX9 to control a network of target genes in chondrocytes, we performed a ChIP-on-chip experiment using SOX9 antibodies.Our previous work has provided strong evidence that the transcription factor SOX9 is completely needed for chondrogenic differentiation and cartilage formation acting as a \u201cmaster switch\u201d in this differentiation. Heterozygous mutations in Col2a1, Col11a2, Aggrecan and Cdrap as well as in genes for specific transcription factors and signaling molecules. Our results also showed SOX9 interaction sites in genes that code for proteins that enhance the transcriptional activity of SOX9. Interestingly, a strong SOX9 signal was also observed in genes such as Col1a1 and Osx, whose expression is strongly down regulated in chondrocytes but is high in osteoblasts. In the Col2a1 gene, in addition to an interaction site on a previously identified enhancer in intron 1, another strong interaction site was seen in intron 6. This site is free of nucleosomes specifically in chondrocytes suggesting an important role of this site on Col2a1 transcription regulation by SOX9.The ChIP DNA was hybridized to a microarray, which covered 80 genes, many of which are involved in chondrocyte differentiation. Hybridization peaks were detected in a series of cartilage extracellular matrix (ECM) genes including Our results provide a broad understanding of the strategies used by a \u201cmaster\u201d transcription factor of differentiation in control of the genetic program of chondrocytes. Sox9 cause Campomelic Dysplasia (CD), a generalized disease of cartilage characterized by hypoplasia of endochondral bones Sox9 gene at various times during mouse limb development also demonstrated that SOX9 is necessary for mesenchymal condensations, for the commitment to the chondrocyte fate at the time when the chondrocyte and osteoblast lineages segregate from a common progenitor, and for the overt differentiation of these cells into chondrocytes. SOX9 thus acts as a master regulator of chondrocyte differentiation Col2a1 revealed that this site appears to be depleted of nucleosomes.The transcription factor SOX9 plays a critical role in cell fate decisions of a discrete number of cell types Col2a1, Col11a1, Matrilin-1, Aggrecan, Syndecan-3, Cdrap, Fibromodulin and Prelp were also highly expressed in RCS cells. On the other hand, the Col1a1 gene was expressed at high level in Rat-2 cells but was not expressed in RCS cells. These results in addition to the previously reported data As chromatin source for ChIP-on-chip experiments, we used rat chondrosarcoma cells (RCS cells), because these cells display many chondrogenic characteristics including secretion of specific cartilage ECM proteins and high contents of SOX9, SOX5 and SOX6 AdamTS 5MMP9 and 13Cathepsin BSox9, Sox5 and Sox6, and in cartilage development such as PrxPGC-1\u03b1TCF4Lef1\u03b2-cateninStat1TIP60Runx2Osterix (Osx)MyoDMyogeninIntegrins \u03b111BMP2 and 4NogginChordinTGF\u03b23WntsPatchedIhhShhSmoothenedVEGFCtgfEgf and EgfrIgf1 and Igf2rPTHrPGrb10TNF \u03b1IL1\u03b1PKC and p38Fgfr3PKANcam\u03b1-CateninCD44Because the sheared chromatin fragments had a size between 1 and 1.5 kb, the peaks of hybridization were relatively broad. To be counted as SOX9 interaction sites the peaks had to have similar heights at identical locations on both the forward and reverse DNA strand lanes. A so called smoothened lane was generated by subtracting the corresponding non-specific IgG hybridization signals from each SOX9 signal followed by averaging the two subtracted signals. Overall, except for a few genes discussed below, peaks, which on the \u201csmoothened\u201d lane had a cut off above the base 2 logarithm of 1.5 were further examined.Col2a1. The center of the peak located in intron 1 corresponds to a previously identified chondrocyte-specific enhancer in this gene Col2a1. Two SOX9 interaction sites were also identified in the Col11a2 gene. The centers of these hybridization peaks, one located in the promoter and the other in intron 1, correspond to previously characterized chondrocyte-specific enhancers bona fide specific SOX9 interaction sites. A total of 55 peaks with a cut off >log2 1.5 were identified in 30 genes. These genes and the locations of these peaks within these genes are listed in Col2a1 and Col11a2Col9a2Syndecan-3AggrecanEpiphycanChondroadherinBiglycan2 1.5 cut off, are, however, also likely to be direct targets of SOX9 and are likely to be part of the genetic program of chondrocytes controlled by SOX9. These genes are listed in a separate section of Col1a1 gene, which is not expressed in chondrocytes but is prominently expressed in mesenchymal precursors and in osteoblasts contains two SOX9 interaction peaks. Similarly the genes for Osx and Runx2, transcription factors required for osteoblast differentiation, contain distinct SOX9 interaction sites. One possible hypothesis is that at these sites in chondrocytes SOX9 might be part of repressor complexes. MyoD and Myogenin genes, which are master transcription factors for myoblast differentiation and are not expressed in chondrocytes. Other genes in this group include MMP13, those for several small leucine-rich proteoglycans, also the Wnt 3a, 5a, 7a, 9, Ihh and Shh genes. One surprise is that no clear SOX9-interaction site was found in the Sox6 gene, which together with Sox5, is required for overt chondrocyte differentiation and requires SOX9 for expression Col2a1, Col11a1, Col11a2 and Cdrap. The reason we chose these sites is that by analyzing the sites by EMSA, we could validate that the ChIP-on-chip peaks revealed true SOX9 binding sites. We chose the other sites based on potential SOX9 binding sequences within the peaks of hybridization. The potential SOX9 binding sites in most of these genes diverged from the consensus binding sites, WWCAAWG(N)nCWTTGWW  and SOX9 was indeed bound to each of these sequences. By comparing the mobility of SOX9-DNA complexes with that of a binding site in an enhancer in intron 1 of Col2a1, we concluded that SOX9 was mainly binding as a dimer to each of the peak sequences. We also asked whether the species conservation of sequences and the AT or GC content in the 610 bp centered on the hybridization peaks were different from 610 bp sequences surrounding random potential SOX9 binding sites outside the peaks. The conservation scores were higher in peaks than in non-peak DNA sequences  for 11 of these sites . These eequences . The AT equences .Col2a1, a peak was identified in intron 6  that expresses neither Col2a1 nor Sox9 , because these cells display many chondrogenic characteristics including secretion of specific cartilage ECM proteins and high contents of SOX9, SOX5 and SOX6 see  [19]. InSox5 and Sox6 in chondrocytes Sox5 contains several SOX9 interaction sites located in the promoter, introns 1 and 2. In contrast, we did not detect SOX9 interaction sites in the Sox6 gene. This suggests either that the Sox6 gene is not a direct target of SOX9 or that the SOX9 interaction sites are located outside the Sox6 DNA segments that were printed on the array. Our experiments detected interaction sites for SOX9 in the Sox9 gene located in introns 1 and 2. Although our previous results have indicated that chondrocyte-specific regulatory segments of Sox9 were still active even when the Sox9 gene was partially deleted, it is nevertheless possible that the SOX9 binding sites in introns 1 and 2 have an autoregulatory role in the transcriptional control of SOX9 in combination with other transcription factors. In Sertoli cells SOX9 binds to the promoter region of Sox9 but our results did not detect a SOX9 interaction sites in the chromatin of this segment in chondrocytes Sox9 is equally highly expressed. Through this receptor and via PKA, PTHrP stimulates the phosphorylation of SOX9 Bmp4 gene itself showed also a SOX9 interaction site. In addition to the genes specifically expressed in chondrocytes such as cartilage ECM genes, SOX9 interaction sites were also detected in ubiquitously expressed genes such as those for the transcription factors Tip60, Stat1 and Lef1, and for the ERK1, ERK2 and PKA signaling molecules. Thus in chondrocytes SOX9 also appeared to interact with a number of genes that are more broadly expressed. For example, we showed recently that Tip60 up-regulated expression of Col2a1, a direct target of SOX9 Tip60 promoter and up-regulated this promoter . Thus SOX9 interacts with the gene for a coactivator, which cooperates with SOX9 in activating a downstream target of SOX9. Previous experiments have shown that both ERK1 and ERK2 signaling in response to FGF increases SOX9 expression Col1a1 gene, which is not expressed in chondrocytes and in RCS cells, showed two clear interaction sites one in intron1, the other immediately 3\u2032 to the gene. One possible hypothesis is that SOX9, which is known to be a transcriptional activator, might also be able to become part of a negative transcriptional complex and that in chondrocytes SOX9 may have a role in silencing genes that are active in Sox9-expressing osteochondroprogenitor cells as well as in osteoblasts. The SOX9 interaction sites in the genes for RUNX2 Our previous results have shown that in the absence of SOX9 there is no expression of Col2a1 gene is one that has been most intensively characterized so far in terms of response to SOX9. In this gene, SOX9 has been shown to bind to a sequence in a chondrocyte-specific enhancer in intron 1 and consequently to induce the activity of this enhancer. As shown here a ChIP-on-chip peak was clearly centered on this binding site in intron 1. In addition to this peak, another peak was detected in intron 6 of Col2a1. The binding of SOX9 at this site was validated by EMSA and ChIP-qPCR. Intron 6 increases the activity of a reporter containing the Col2a1 promoter and the enhancer of intron1, and the deletion of a short segment containing the SOX9 binding site in intron 6 from this reporter decreased its activity suggesting that this SOX9 binding site functions as a positive regulatory site in Col2a1. The 3\u2032 sequence of a 48bp of intron 6 contained an inverted repeat sequence similar to the inverted repeat sequence in the 3\u2032segment of the 48bp in intron 1 (Col2a1 gene in vivo still remains to be clarified.EMSA of a sample of SOX9 interaction sites confirmed that SOX9 was able to bind to specific sites found in the hybridization peaks of our ChIP-on-chip experiment. These sequences often diverged from the consensus dimeric binding sites WWCAAWGX(N)CWTTGWW (W\u200a=\u200aA or T) by several mismatches. Among the many genes having SOX9 binding sites, the intron 1 . The 3\u2032 Saccharomyces cerevisiaeCol2a1 and Sox9 genes were not actively transcribed, did form nucleosome structures  were obtained from American Type Culture Collection (ATCC). Rat chondrosarcoma (RCS) cells were gifted from Dr. James H. Kimura, Henry Ford Hospital, Detroit, Michigan ChIP was performed according to the previously described method 32P-dCTP using Klenow fragment, and then EMSA was performed using recombinant human SOX9 proteins expressed in E.coli as described previously The probes used in EMSA shown in Suppl. Col2a1 intron 1 and intron 6 were cloned into pBluescript vector and then multimerized as previously described Renilla luciferase plasmid) using Fugene 6, The luciferase and \u03b2-galactosidase activities were obtained by use of a dual luciferase assay system (Promega Co. Ltd) and a Tropix Galacto Reaction kit (Applied Biosystems), respectively. Each value in the reporter assay was presented as the fold increase in Firefly luciferase activity units or \u03b2-galactosidase activity units per Renilla luciferase activity units from three independent experiments, each performed in triplicate.Oligonucleotides of 48 base pair fragments of both Table S1List of Primers for EMSA(0.05 MB DOC)Click here for additional data file.Table S2List of Primers for qPCR(0.08 MB DOC)Click here for additional data file.Table S3List of Primers for (0.05 MB DOC)Click here for additional data file.Figure S12y.mRNA expression levels in RCS cells compared to Rat-2 fibroblast cells. Total RNA was extracted from logarithmically growing RCS cells or Rat-2 cells using Trizol reagent (Invitrogen) according to the manufacturer's protocol. cDNA was prepared from the RNA using AMV reverse transcriptase followed by qPCR with specific primer for each RNA  using SY(1.56 MB TIF)Click here for additional data file.Figure S2Sequence conservation of peaks. By use of the program, Multiz9way, obtained from UCSC genome browser, the evolutionary conservation was measured in nine vertebrates including rat, human, mouse, dog, cow, opossum, chicken, frog and zebrafish. In order to calculate the conservation scores, 72 regions out of 76 peaks that contain the consensus inverted repeat, WWCAAWG(N)nCWTTGWW  with a space (n) of 3 to 6. These regions also conserved a core inverted repeat sequence, AANG(N)nCNTT, and had a maximum of 2 mismatches in each half of the consensus repeat. 76 non-peak regions containing such repeat were also chosen. Note that such sequences are frequently found in both peak and non-peak regions of the genome. A two-sample t-Test showed that p-value was 0.01864. Readers interested in the detailed sequences that were used to compose this figure should contact the corresponding author.(1.56 MB TIF)Click here for additional data file.Figure S3\u22129.Box plot showing AT content of peak and non-peak regions. We compared AT or GC content in 610 bp sequences centered on the hybridization peaks were compared to 610 bp sequences surrounding random potential SOX9 binding sites outside the peaks. The bold horizontal lines show the mean of the data. Mean of AT content in peak regions was 46.7%, and mean AT content in non-peak regions was 53.8%. By Student's t-Test, p-value was measured at 3.425\u00d710(1.56 MB TIF)Click here for additional data file.Figure S4Col2a1 on ChIP-on-chip microarray by ChIP-qPCR. The DNA obtained from ChIP of sheared chromatin of RCS cells with SOX9 antibodies was used as the template in real time qPCR to amplify a segment of intron 6 of Col2a1. A segment of intron 1 of Col2a1 previously identified as containing a functional SOX9 binding sites and another segment located 3\u2032 to the Col2a1 gene served as positive and negative controls, respectively. Error bars represent standard deviations. The sequence of each probe is shown in Validation of SOX9 binding sites in (1.56 MB TIF)Click here for additional data file.Figure S5Col2a1 minimal promoter (89bp) followed by the firefly luciferase gene (Luc4) Renilla luciferase construct, to normalize for transfection efficiency.Functional analysis of the SOX9 binding site in intron 6. Five tandem repeats of the 48bp in intron1, the 48bp in intron6 or the segment conjugated each other were inserted in 5\u2032 to the (1.56 MB TIF)Click here for additional data file.Figure S6Col2a1 gene of three different species are aligned. The inverted repeat of the rat SOX9 binding site is underlined. The bases in red are the bases that are not identical to the corresponding human sequence. The sequence of the binding sites between rat and mouse are completely conserved. The sequence of the binding site of the human is not identical to the rat sequence. B. An EMSA assay was performed to test whether SOX9 was binding to the human intron 6 sequence. The sequence of each probe is shown in Conservation of the SOX9 binding site in intron 6 among different species. The sequences of Sox9 binding sites in intron 6 of (1.56 MB TIF)Click here for additional data file.Figure S7CTGGGTTTCTGTAAAGAAGGCCTTCAGCTATCTGA Mutant; CGAAAAGGAAAACAGCTATCTGACTGGGTTTCTGT The ability of this mutated fragment to bind Sox9 was demonstrated as shown in Col2a1 intron 1), lane 2; SOX9 binding site of Col2a1 intron 6, lane 3; mutant SOX9 binding site of Col2a1 intron 6. B. Luciferase reporter assay of Chimera B and mutant Chimera B constructs. By use of this mutant fragment, the mutant Chimera B (Effect of mutation on the enhancer activity of Chimera B shown in himera B  construc(1.56 MB TIF)Click here for additional data file.Figure S8nd peak of Col2a1 gene in primary chondrocyte. Binding of H3 and Sox9 in Col2a1 gene of mouse rib chondrocyte primary culture and human lymphoblast, Reh cells, was demonstrated by ChIP-qPCR The mouse chondrocytes were cultured as shown previously st peak and 2nd peak correspond to the peaks in intron 1 and intron 6 of rat Col2a1 gene, respectively. Expression of Col2a1 and Sox9 was detected in primary chondrocyte cells but not in Reh cells by RT-qPCR method shown in Col2a1 gene is highly conserved in the human Col2a1 gene.Depletion of histone H3 in 2(1.56 MB TIF)Click here for additional data file."}
{"text": "Although the addition of bevacizumab significantly improves the efficacy of chemotherapy for advanced breast cancer, regulatory concerns still exist with regard to the magnitude of the benefits and the overall safety profile.A literature-based meta-analysis to quantify the magnitude of benefit and safety of adding bevacizumab to chemotherapy for advanced breast cancer patients was conducted. Meta-regression and sensitivity analyses were also performed to identify additional predictors of outcome and to assess the influence of trial design.st line , with a 1-yr absolute difference (AD) of 8.4% . A non-significant trend was found in overall survival (OS), and in PFS for 2nd line. Responses were improved with the addition of bevacizumab, without interaction between 1st line  and 2nd line . The most important toxicity was hypertension, accounting for a significant AD of 4.5% against bevacizumab . Other significant, although less clinically meaningful, adverse events were proteinuria, neurotoxicity, febrile neutropenia, and bleeding. At the meta-regression analysis for 1st-line, more than 3 metastatic sites (p = 0.032), no adjuvant chemotherapy (p = 0.00013), negative hormonal receptor status (p = 0.009), and prior anthracyclines-exposure (p = 0.019), did significantly affect PFS.Five trials  were gathered. A significant interaction according to treatment line was found for progression-free survival ; PFS was significantly improved for 1st-line chemotherapy significantly improves PFS, and overall activity. Hypertension should be weighted with the overall benefit on the individual basis.Although with heterogeneity, the addition of bevacizumab to 1 AboutDespite numerous advances in early diagnosis and treatment in local and systemic, metastatic breast cancer remains an incurable disease and the main objective of therapy is both the prolongation of survival and the improvement of associated symptoms , with particular reference to delay the onset of symptoms, improvement in progression-free survival , and improvement of quality of life .Metastatic breast cancer is a heterogeneous disease whose evolution is difficult to predict. Choosing the best treatment must necessarily be based to balance different aspects of patient characteristics, the disease characteristics and possible adjuvant treatment received . As a fuAngiogenesis represents an important step in the pathogenesis, invasion, progression and development of metastatic phenotype of breast cancer and is regulated by pro-angiogenic factors such as vascular endothelial growth factor (VEGF). High exAlthough bevacizumab showed modest benefits as single agent, numerous preclinical studies have demonstrated synergy between anti-angiogenic therapy and chemotherapy . The addIn order to explore the magnitude of the benefit of adding Bevacizumab to chemotherapy for metastatic breast cancer with particular attention to safety, we conducted a meta-analysis.The analysis was conducted following 4 steps: definition of the outcomes , definition of the trial selection criteria, definition of the search strategy, and a detailed description of the statistical methods used ,18.The combination of chemotherapy and Bevacizumab (Beva) was considered as the experimental arm and chemotherapy as the standard comparator. Analysis was conducted in order to find significant differences in primary and secondary outcomes. Primary outcomes for the magnitude of the benefit analysis were both the Progression Free Survival (PFS: time between randomization and progression or death from any cause) and the overall survival (OS: time between randomization and death for any cause). Secondary end-points were: overall response rate (ORR), and grade 3-4 toxicities.th, 2010. Updates of Randomized Clinical Trials (RCTs) were gathered through Medline (PubMed: http://www.ncbi.nlm.nih.gov/PubMed), ASCO , ESMO , FECS , and SABCS  website searches. Key-words used for searching were: advanced/metastatic breast cancer; chemotherapy; Bevacizumab; randomized; randomized; meta-analysis; meta-regression; pooled analysis; phase III; comprehensive review, systematic review. In addition to computer browsing, review and original papers were also scanned in the reference section to look for missing trials. Furthermore, lectures at major meetings  having 'advanced or metastatic breast cancer' as the topic were checked. No language restrictions were applied.Deadline for trial publication and/or presentation was June 30All prospective phase III RCTs published in peer-reviewed journals or presented at the ASCO, ECCO, ESMO and ASTRO meetings until June 2010, in which patients with advanced or metastatic breast cancer were prospectively randomized to chemotherapy with or without Bevacizumab were gathered, regardless of treatment lines.Hazard Ratios (HR) for PFS and OS and the number of events for secondary end-points were extracted; the last trial's available update was considered as the original source. All data were reviewed and separately computed by four investigators .HRs were extracted from each single trial for primary end-points ,20, and Five trials 3,841 patients) were identified , with an absolute benefit of 8.4%, corresponding to 12 patients to be treated for one to benefit, although with significant heterogeneity (p = 0.0001) , with specific regards to the lack of significant benefit in OS, and the toxicity profile. Moreover, the regulatory panel withheld the indication for breast cancer, and the final decision is still pending. The main question raised up by the regulatory committee refers to the eventual amount of benefit related to the addition of Bevacizumab. For this reason, a cumulative analysis specifically designed to weight that became mandatory.The addition of Bevacizumab to chemotherapy is considered one of the most viable treatment options in patients with HER-2 negative metastatic breast cancer, as distinct randomized studies so far presented and published consistently showed that this association resulted in significantly improved overall response rate and PFS. Notably, the therapeutic benefit was observed in all subgroup examined. Nevertheless, the issue of adding Bevacizumab to 1st line Bevacizumab is 32%, and 12 patients are needed to treat in order to see one patient who significantly benefit. This amount of benefit well compares with the benefits of other important therapeutic choices such as the addition of taxanes for the 1st line treatment of metastatic breast cancer, where the advantage in terms of relative risk is about 10%.The data presented herein show a statistically significant advantage in terms of either progression-free and responses, with an overall absolute benefit of 8% Table . The relFrom a global perspective, the hazard ratios for PFS obtained in the current analysis compare well with those obtained in other studies that have investigated the addition of another drug in the taxane-based chemotherapy. In the study of Albain et al , the addTaking into account the different approaches to treatment such as chemotherapy combination versus single agent therapy for first line treatment of metastatic patients with breast cancer, the HR for taxanes based combinations compared with control arm was 0.92 for PFS . Also wiWith regard to the concerns regarding the interpretation of those trials providing a significant  benefit in intermediate end-points (such as PFS) without any advantage in late-outcomes (such as OS), a recent original work has been published, trying to weight the impact of the post-progression survival  . To thisTwo meta-analysis analyzed the effect of the addition of Bevacizumab to chemotherapy in metastatic breast cancer ,33 in ovAt the last ESMO meeting, a meta-analysis of 530 elderly patients (older than 65 years) enrolled in the randomized trials ECOG 2100, AVADO and RIBBON-1, was presented . AlthougAnother relevant issue that emerges from our analysis is that the prior exposure to treatments containing taxanes does not affect the efficacy of bevacizumab Table . Indeed,With regard to serious adverse events, the main significant toxicity against the addition of bevacizumab was hypertension Table ; this reRecently, other anti-angiogenesis drugs have been studied in randomized trials for locally advanced or metastatic breast cancer -39. In tMore concerning data with regard to the overall safety profile of bevacizumab have been recently released ,42: in tOur data in context with the other exploring the safety-efficacy balance of the addition of bevacizumab to chemotherapy for advanced breast cancer do strengthen the need of a deep analysis of the correlation between adverse events and deaths on one side, and the maximization of the efficacy by restricting the drug to those patients who will really benefit. The latest approach is far to be understood, although positive hints with regard to polymorphisms analyses are encouraging. Bevacizumab, from a clinical practice standpoint, slightly increases the efficacy of chemotherapy in HER-2 negative advanced breast cancer, although a close follow-up monitoring for adverse events must be adopted.The authors declare that they have no competing interests.FCu, EB, VV, PC, MM and SG conceived the analysis, and supervised the calculations; FCu, EB, IS, and DG performed the calculations in a blinded fashion; VV, FB, AF, PC, MM, CN, MR, PP, and GF participated in the trials recruitment and selection process; FCu, EB, VV, FP, AF and MM drafted and revised the manuscript; EB, PC, MM, MA, DG and FC did coordinate the overall study process and did provide the funding. All authors read and approved the final manuscript."}
{"text": "We have shown that it is possible to tune, up to complete suppression, the photoluminescence superlinear dependence on the excitation density in quantum dot samples at high temperatures by annealing treatments. The effect has been attributed to the reduction of the defectivity of the material induced by annealing. Self-assembled semiconductor quantum dots (QDs) are zero-dimensional structures, being solid state systems with an atomic-like density of states. QDs are currently deeply investigated for their potentiality as building blocks for novel optoelectronic devices and for quantum information technologies. Several promising applications were recently developed in these fields, such as single photon sources for quantum cryptography, lasersSemiconductor QDs are known to efficiently capture the carriers generated by optical absorption. The electron hole pairs created in the barrier region rapidly relax to the QD ground state from where they radiatively recombine. The role of non-radiative channels on temperature dependence of the QD recombination efficiency has been analyzed in many details and with different experimental techniques-8. It isIL) on the excitation power density (Pexc) at high T that is sometimes observed in QD samples , which i0.3Ga0.7As barrier layer at 580\u00b0C by conventional MBE, the substrate temperature is lowered to 200\u00b0C and the As valve closed to deplete As pressure in the growth chamber. At this temperature and in the absence of As, only a flux of Ga atoms equivalent to 3.75 ML/s (where we indicate as 1 ML of Ga the amount of atoms necessary to obtain 1 monolayer of GaAs in the presence of As) is supplied at 0.5 ML/s rate. Due to the As-rich surface reconstruction, the initially deposited 1.75 ML/s are incorporated into the As terminated surface, resulting in the appearance of a Ga-stabilized surface, and the remaining 2 ML/s gives rise to the formation of tiny Ga droplets on the substrate. Following the deposition of the droplets, and maintaining the substrate temperature at 200\u00b0C, the As valve is opened to supply a molecular beam flux equivalent to 2 \u00d7 10\u22124 Torr beam on the surface. This growth step causes the complete arsenization of the Ga contained in the droplets, as demonstrated by the complete change of reflection high energy electron diffraction pattern from halo to spotty. A growth interruption of 10 min at 350\u00b0C under a constant As flux is then performed. This step did not introduce any change in the QD morphology[0.3Ga0.7As barrier layer of 50 nm is grown by migration-enhanced epitaxy (MEE)[\u03bbexc = 532 nm). The excitation power density is 10 W/cm2. The spectra are measured by a grating monochromator operating with a Peltier cooled CCD camera.A single GaAs/AlGaAs QD sample is grown by DE in a conventional molecular beam epitaxy (MBE) system provided with an As-valved cell. After the growth of the Alrphology. The AFMxy (MEE) at 350\u00b0CT = 15 K show a broad emission band located between the GaAs and the Al0.3Ga0.3As energy gaps at 1.72 eV  implies that the internal quantum efficiency increases with raising the excitation power. This could be understood easily if we consider that the value of the efficiency is limited to 1. In the case of efficiency equal to 1, all the absorbed photons are re-emitted, so the ratio between the incoming and emitted photons is constant and the dependence between IL and Pexc must be linear. On the other hand, in the case of samples where non-radiative recombination channels are present, the efficiency is reduced to values < 1. The increase of photogenerated carriers saturates the non-radiative recombination channels in the barrier, leading to a superlinear behavior and then \u03b1 > 1. Therefore, the superlinearity of the QD emission intensity on the excitation power density could stem from the saturation of temperature-activated trap states, which affect the carrier diffusion in the barrier[IL on Pexc superlinerity. This can be appreciated in Figure\u03b1 exponent at T = 190 K are reported. Clearly, \u03b1 is in inverse relation with the PL yield, thus supporting the interpretation of the PL superlinarity as stemming from defect-related effects.The observed dependence of the  barrier. RTA tre\u03b1 exponent at high temperatures makes it possible to evaluate the quality of the QDs and of the surrounding barrier material by simple PL measurements. A linear dependence of IL on Pexc demonstrates the absence of temperature-activated non-radiative decay in the material.This has also an interesting applicative counterpart. The measurement of the In conclusion, we have shown that it is possible to tune, up to complete suppression, the PL superlinear dependence on the excitation density in QD samples at high temperatures by RTA treatments. The effect has been attributed to the reduction of the defectivity of the material induced by the annealing. This rules out possible explanation of the superlinear behavior as stemming from intrinsic carrier dynamics effects.Both authors declare that they have no competing interests.SS proposed and guided the overall project. SB performed material growth, AFM and PL measurements. Both authors read and approved the final manuscript."}
{"text": "An optimal life satisfaction (LS) is considered an important long-term outcome after a traumatic brain injury (TBI). It is, however, not clear to what extent a single instrument captures all aspects of LS, and different instruments may be needed to comprehensively describe LS. The aim of this study was to compare self-ratings of life satisfaction after a TBI with two commonly used instruments.Life Satisfaction Questionnaire (LiSat-11), comprising eleven items and Satisfaction With Life Scale (SWLS), comprising five items, were administered to 67 individuals (51 men and 16 women). Secondary analysis of data collected as part of a survey of individuals with TBI 6 to 15\u00a0years post TBI.p\u2009<\u20090.001). The total score in SWLS had the strongest correlation with items in LiSat-11. All items in LiSat-11, except \u2018Family life\u2019 and \u2018Partner relationship\u2019, were moderately to strongly correlated with items in SWLS. The item \u2018Partner relationship\u2019 in LiSat-11 did not correlate with any of the items in SWLS or the total score. The item \u2018If I could live my life over, I would change nothing\u2019 in SWLS had the weakest correlations with items in LiSat-11. Items \u2018Vocation\u2019 and \u2018Leisure\u2019 in LISat-11 were most strongly correlated with items in SWLS, whereas the item \u2018ADL\u2019 in LiSat-11 was more weakly correlated with items in SWLS.Item 1 in LiSat-11 (\u2018Life as a whole\u2019) and the total SWLS score was strongly correlated (Spearman\u2019s rho\u2009=\u20090.66; The strength of the relationships implies that the two instruments assess similar but not identical aspects of LS and therefore complement each other when it is rated. A high level of life satisfaction (LS) is considered an important outcome of rehabilitation and a long-term endpoint after a traumatic brain injury (TBI). LS is defined as an individual\u2019s contentment with life. It is commonly referred to as the degree of an individual\u2019s subjective appraisal if his or her aspirations or goals and achievements have been accomplished , 2.Two internationally validated instruments assessing LS after TBI are the Life Satisfaction Questionnaire (LiSat-11)  and the The aim of this study was to compare ratings of LS using the two instruments LiSat-11 and SWLS in individuals with TBI. This is a secondary analysis of data on LS, using LiSat-11  and SWLSParticipants were obtained from a sample of 332 individuals with a computed tomography (CT) verified TBI and brain injury symptoms who had been transferred to the only Neurosurgical Clinic in the region for neurosurgical care during the period 1 January 1992 to 31 December 2001 . From thThe LiSat-11 (11-item Life Satisfaction Questionnaire) , 5 assesThe SWLS  provides a global measure of satisfaction with life as an overall summation of a person\u2019s LS . It consAll analyses were performed using IBM SPSS statistics 22.0 software .In Table\u00a0p\u2009<\u20090.001 to p\u2009<\u20090.05); Spearman\u2019s rho\u2009=\u20090.27 to 0.67) between 34 of the 55 items in LiSat-11. The item \u2018Partner relationship\u2019 was not significantly correlated with any of the other items in LiSat-11, and the item \u2018Family life\u2019 was significantly correlated with only 3 of the 11 items. All 5 items in SWLS were significantly correlated p\u2009<\u20090.01 to p\u2009<\u20090.001; Spearman\u2019s rho\u2009=\u20090.35 to 0.81).There were significant correlations (p\u2009<\u20090.001). Overall, the total score in SWLS had the strongest correlation with items in LiSat-11. Generally, all items in LiSat-11, except \u2018Family life\u2019 and \u2018Partner relationship\u2019, were moderately to strongly correlated with items in SWLS. The item \u2018Partner relationship\u2019 in LiSat-11 did not correlate with any of the items in SWLS or the total score. Item \u2018If I could live my life over, I would change nothing\u2019 in SWLS had the weakest correlations with items in LiSat-11. Items \u2018Vocation\u2019 and \u2018Leisure\u2019 were most strongly correlated with the items in SWLS, whereas the item \u2018ADL\u2019 in LiSat-11 was more weakly correlated with items in SWLS.In Table\u00a0Life satisfaction is often emphasized in modern rehabilitation and in outcome research of lifelong disabilities, such as TBI. Different instruments are available to assess LS, but as LS is multifaceted, it can be assumed that one instrument alone does not capture all aspects of LS. Consequently, there is a need for an in-depth knowledge of how different LS instruments are related. This study is, to the best of our knowledge, the first study that has pursued a face-to-face comparison of two commonly used instruments assessing LS in people with TBI. Overall, we found a moderate correlation between most items in the two instruments, which indicates that they measure similar but not the same aspects of LS.p\u2009<\u20090.001). They can both be considered to represent some form of global measure of satisfaction with life. One previous study has found a good convergent validity with other LS instruments in people with spinal cord injury [As expected, Item 1 in LiSat-11 (\u2018Life as a whole\u2019) and the total SWLS score were strongly related  generally had the lowest correlation with items in LiSat-11. This was noted in the review of SWLS , where tThe items \u2018Vocation\u2019 and \u2018Leisure\u2019 in LiSat-11 were generally strongly correlated with items 1 to 4 in SWLS. In fact, satisfaction with \u2018Vocation\u2019 was the item most strongly correlated with a specific item in SWLS (Item 2). This supports previous studies that reported that people with TBI who are in gainful employment, regardless of the severity of their injury, are more satisfied with life than those who have a disability pension . SimilarThe results of this study have some general implications for clinical research and give rise to some aspects that need to be more carefully addressed. One is the content of the items in relation to the overarching research question. In situations where the purpose is to evaluate changes over time or effects of rehabilitation interventions, the global measure of SWLS can be considered together with item 1 in LiSat-11. On the other hand, if the purpose is to explore domains that are vital aspects of one\u2019s LS and compare those, the LiSat-11 may be a better instrument.One limitation to this study is the relatively small and selected sample. Therefore, the results cannot be generalised to all people with TBI. It is known that cognitive impairments can affect the ability to respond to LS questionnaires. Thus, some of those with a severe TBI may have had difficulties to rate their life situation. Although none of the participants raised any concerns during the ratings, the inferences of this study should be treated with some caution.In conclusion, we found significant correlations between most items in the two LS instruments. The strength of the relationships implies that they assess similar but not identical aspects. The two instruments can be used simultaneously and complement each other and thereby cover life satisfaction in a broader sense."}
{"text": "Egretta eulophotes). Using a full length DNA and cDNA produced by PCR and RACE methods, these two MHC class I loci were characterized in the genome of the Chinese egret and were also found to be expressed in liver and blood. Both new genes showed the expected eight exons and were similar to two copies of the minimal essential MHC complex of chicken. In genetic diversity, 14 alleles (8 for UAA and 6 for UBA) in the MHC class I gene exon 3 were found in 60 individuals using locus-specific primers and showed little polymorphism. Only three potential amino acid residues were detected under positive selection in potential peptide-binding regions (PBRs) by Bayesian analysis. These new results provide the fundamental basis for further studies to elucidate the molecular mechanisms and significance of MHC molecular adaptation in vulnerable Chinese egret and other ardeids, finding that have not been previously reported.The genes of major histocompatibility complex (MHC) are important to vertebrate immune system. In this study, two new MHC class I genes, designated as Egeu-UAA and Egeu-UBA, were discovered in the vulnerable Chinese egret ( The major histocompatibility complex (MHC) is a gene complex that encodes for cell-surface proteins responsible for the recognition and presentation of foreign antigens to T-lymphocytes, and which triggers the adaptive branch of the immune system . The MHCThe MHC is known to be a complicated gene group in vertebrates, both in terms of allelic diversity and gene number . NumerouDespite continuing investigation of avian MHC class I genes, and an increasing interest in their use as markers of adaptive genetic variation in evolutionary ecology research \u201315, manyEgretta eulophotes) is listed as a vulnerable species with an estimated global population of 2600\u20133400 individuals [Egretta eulophotes), (2) design locus-specific primers to survey the variation in PBR-encoding exons for all loci and (3) gain insights into the selection pressures acting on PBR and non-PBR regions within the third exon of MHC class I loci in the Chinese egret.The Chinese egret . The scientific license for access to the study site was issued by the Administration Department of Xiamen Egret Natural Reserve (XMENR-1005). Blood samples (~0.5mL) were collected from 60 nestlings (aged around 15 days) of Blood samples of 60 nestlings were collected from 35 nests at Riyu Islet  in Fujian Province of China, where a total of 50 nests of the Chinese egret were found. The blood samples were frozen at \u221280\u00b0C until DNA extraction. Total genomic DNA was isolated using the Universal Genomic DNA Extraction Kit Ver. 3.0 (TaKaRa), and total RNA was extracted using Trizol  from the blood and liver of one individual Chinese egret that died at this Islet, respectively . One \u03bcg CGCTACAACCAGASCRRSG and MHCI-ex4R: GGGTAGAAGCCGTGAGCRC [2), 0.2 mM of each dNTP, 0.4 \u03bcM of each primer, 0.7 U of Taq polymerase (TaKaRa), 100 ng of genomic DNA. The conditions for PCR amplification were a denaturing step at 94\u00b0C for 3 min, followed by 35 cycles at 94\u00b0C for 30 s, 55\u00b0C for 30 s, 72\u00b0C for 2 min, and a final extension at 72\u00b0C for 10 min.A fragment from exon 2 to exon 4 of MHC class I genes in Chinese egret was first amplified with degenerate primers MHCI-ex2F: GTGAGCRC . PCR reaCGTGGTCCGAGTGTCG 13sp2: GACCCTGACCTTGTCCTGC) and 5\u2019 RACE (15sp1: GGTACTTGTCCTTCTCCTCCG 15sp2: CCAGGTGTAGTAGGTGCCATC) respectively, using Oligo 6.0 (Molecular Biology Insights). PCR reactions followed the protocols and applications as specified in the kit. A 730bp and an 810bp segments were obtained from 3\u2019 RACE and 5\u2019 RACE, respectively. After removing their overlapping region, a 1380bp long intact gene fragment of MHC class I was obtained.The 3\u2019 and 5\u2019 rapid amplification strategy of cDNA ends (RACE)  was usedCAGAACTCTGCCCGGAGACGG and 13utrR AGCGTGCACAGGGAGCAGAAATCAG were designed to amplify the complete DNA sequence of the MHC class I gene. PCR reactions were carried out on a Biometra T gradient thermocycler in a final volume of 50 \u03bcL containing 1\u00d7 LA PCR buffer II, 2.5 mM MgCl2, 0.4 mM dNTP, 0.5 \u03bcM of each primer, and 2 U TaKaRa, LA Taq. PCR conditions included an initial denaturation step at 95\u00b0C for 2 min, 35 cycles of denaturation at 98\u00b0C for 10 s, extension at 68\u00b0C for 15 min, and a final extension at 72\u00b0C for 10 min.According to the complete cDNA sequence, two primers, 15utrF Escherichia coli DH5\u03b1. The genes of over 3000 bp were sequenced by using Primer Walking method from both sides respectively. In this Primer Walking method, after a shorter stretch (about 800bp) had been sequenced using M13F or M13R, a new primer was generated from the end of what had been already sequenced and the process was continued until the sequence was overlapped. Ten positive colonies of each band were selected to sequence bidirectionally on an automatic sequencer  using universal M13 sequencing primers and BigDye version 3 (Applied Biosystems).All PCR products were purified using the Agarose Gel DNA Purification Kit Ver. 2.0 (TaKaRa), then ligated into pMD 18-T vector (TaKaRa) and transformed into CATCCCCGTGGCAGTCGAGA and UBAF: AATCCCATCTCCTTGTCCCATCTTCC). These were combined with the reverse primer 13exR: CGTAGCTCACGTATTTCCTCAGCCAC to amplify the two loci, respectively. PCR was carried out in a 20 \u03bcL reaction mixture containing 1 \u03bcL genomic DNA, 0.7 U of Taq polymerase (TaKaRa), 1.5 mM MgCl2, 200 \u03bcM of each dNTP and 0.4 \u03bcM of each primer, for 25 cycles at 94\u00b0C for 30 s, 60\u00b0C for 30 s and 72\u00b0C for 1min. Second, to obtain suitable length fragments for SSCP genotyping and scanning of the variation in exon 3 of each locus, a second round PCR was carried out using the primer 13exF: ACTGAAGGCCCAGGGCTGC and 13exR was used to amplify the entire exon 3 in each locus. The reaction conditions for the second round PCR were identical with those described for the first round. The PCR products from the first round were diluted 100-fold and used as the template. The amplicons were separated by SSCP analyses as described by Fain [To detect polymorphism within the MHC class I genes in wild populations of the Chinese egret, 60 nestlings on the Riyu Islet were genotyped by semi-nested PCR combined with single strand conformation polymorphism (SSCP). First, two forward locus-specific primers in intron 2 were designed and designated as UAAF and UBAF  and non-synonymous (dN) substitutions were calculated for both the 18 possible PBRs as defined by Bjorkman and Saper [S) and nonsynonymous (dN) substitutions per site according to the Nei\u2013Gojobori method with Jukes\u2013Cantor correction for multiple substitutions [The complete DNA and cDNA sequences for MHC class I genes, derived from the Chinese egret, and were aligned using the DNAMAN software package . Exons and introns were distinguished using the GenScan Program . DNA frand Saper , 34, anditutions . Populatitutions . The proitutions  was usedGT/AG) and polyadenylation recognition sequences (AATAAA or ATTAAA) were present in all sequences.In this study, DNA sequences of two different MHC class I genes were isolated from one individual Chinese egret, and the sequences were highly similar over large stretches. They could be distinguished, however, by the divergent intron 2. The exon sizes were similar to those found in other birds , S2 Fig.Based on the Egeu-UAA and Egeu-UBA sequences, two forward locus-specific primers were designed on intron 2 for each locus, respectively. These two sequences were then combined with the universal primers to amplify the exon 3, as described above. Single locus genotyping of MHC class I was carried out on 60 nestlings. The SSCP results showed one or two alleles per individual at each locus , confirmIn this study, our sample size was appropriate for the analyses of allele frequency and Hardy-Weinberg Equilibrium because 60 samples were sufficient to represent the full genetic variation present in this islet population. According to the optimal sampling strategy of Marshall et al  and Sj\u00f6gN/dS) was analyzed in predicted peptide-binding region (PBR) sites, and non-PBR sites for each gene separately [N/dS ratio of 1.23 and 1.30 respectively. The ratios were not significantly different than 1, indicating that strong selection was not acting on these two loci in the Chinese egret  suggested that Egeu-UAA locus was under positive selection. These findings suggest that Egeu-UAA represents a major class I gene in the Chinese egret. In contrast to the greater sequence variation of Egeu-UAA, Egeu-UBA showed extremely limited variation and no evidence of positive selection on exon 3, suggesting that this locus may represent a minor MHC class I gene. Moreover, CODEML analyses revealed only 3 residues with posterior probabilities of positive selection (P\u22650.95) in Egeu-UAA exon 3, which is a finding significantly difference with most previous research results [Tympanuchus cupido) [The \u201cMajor \u201cclass I genes with high sequence variation and high expression levels across tissue types have been described for some bird species such as the chicken, duck, red-billed gull and crested ibis , 48\u201350.  results , 51. Thi cupido)  and seve cupido) . A possiS1 FigTotal RNA is extracted from the liver and blood. The PCR products are amplified from liver and blood cDNA using primer MHCI-ex2F and MHCI-ex4R. M stands for marker DL2000(Takara).(TIF)Click here for additional data file.S2 FigThe sequences from the MHC class I loci in crested ibis (Nini) and red-billed gull (Lasc) are compared; an mRNA sequence is used to mark the location of the exons (Nini-UCA1M and Lasc-UAAM), respectively. Sequence alignment and the differences between loci in intron 2 from each species are depicted in the genomic plot. The red box is used to mark the position in full length DNA sequence. DNAMAN is used to align the sequences. Sequence sources are: crested Ibis (KP182409 KP182408) and red billed gull (HM008713 HM008714 HM008715 HM008716 HM015819).(TIF)Click here for additional data file.S3 Fig(TIF)Click here for additional data file.S1 TableThe typing results for the first 15 individuals of the UAA locus are shown in (XLS)Click here for additional data file."}
{"text": "In order to better assist medical professionals, this study aimed to develop and compare the performance of three models\u2014a multivariate logistic regression (LR) model, an artificial neural network (ANN) model, and a decision tree (DT) model\u2014to predict the prognosis of patients with advanced schistosomiasis residing in the Hubei province.Schistosomiasis surveillance data were collected from a previous study based on a Hubei population sample including 4136 advanced schistosomiasis cases. The predictive models use LR, ANN, and DT methods. From each of the three groups, 70% of the cases (2896 cases) were used as training data for the predictive models. The remaining 30% of the cases (1240 cases) were used as validation groups for performance comparisons between the three models. Prediction performance was evaluated using area under the receiver operating characteristic curve (AUC), sensitivity, specificity, and accuracy. Univariate analysis indicated that 16 risk factors were significantly associated with a patient\u2019s outcome of prognosis. In the training group, the mean AUC was 0.8276 for LR, 0.9267 for ANN, and 0.8229 for DT. In the validation group, the mean AUC was 0.8349 for LR, 0.8318 for ANN, and 0.8148 for DT. The three models yielded similar results in terms of accuracy, sensitivity, and specificity.Predictive models for advanced schistosomiasis prognosis, respectively using LR, ANN and DT models were proved to be effective approaches based on our dataset. The ANN model outperformed the LR and DT models in terms of AUC. Worldwide, approximately 240 million individuals are infected with schistosomiasis, a parasitic neglected tropical disease that continues to be a significant cause of morbidity and mortality, especially in China. Effective tools that can accurately predict the prognosis of patients with advanced schistosomiasis would aid in the treatment and management of the disease. To this end, we constructed and compared the performance of three predictive models\u2014an artificial neural network (ANN) model, a logistic regression (LR) model and a decision tree (DT) model\u2014in their ability to predict the prognosis of patients with advanced schistosomiasis. We found that while all three models proved effective, the ANN model outperformed the LR and DT models in terms of AUC and sensitivity. Yet, to achieve the highest level of prediction accuracy and to better assist medical professionals, we recommend comparing the performance of the three predictive models to select the optimal one, which will be better than select a model at random. The findings of this study not only provide valuable information on the construction of effective predictive models for the prognosis of advanced schistosomiasis, but also offer new methodology for clinically determining patient diagnosis and prognosis. Approximately 240 million individuals are infected worldwide by schistosomiasis, with an estimated 3.31 million disability-adjusted life years lost as a result of the disease . The thiOncomelania hupensis, which is the only intermediate host of Schistosoma japonicum. Moreover, Hubei has the highest rates of schistosomiasis transmission in China ,where X =  denotes the vector of independent variables. An \u2018entry\u2019 approach was used to construct the LR model using the 16 variables. The LR model was built using the training dataset and tested using the validation data.For the categorical dependent variables, a LR model was conducted to identify the risk factors of various diseases by using patient demographic characteristics and other disease parameters. The LR model formula calculates the probability of a given disease, y . If the subject suffers from the disease, the conditional probability is represented as p(y = 1\u2223X) = p(X), and the formula of the LR model is expressed as log [(p(x) \u22231\u2212 p(x)] = \u03b2The model-based clinical data interpretation system C4.5 algorithm for the prognosis of advanced schistosomiasis is shown in The AUC was used to compare the prediction performance of the three data mining models. The classification accuracy referred to the fraction of cases classified correctly. Sensitivity referred to the proportion of positive cases that were classified as positive. Specificity referred to the proportion of negative cases that were classified as negative. The formulas are shown as follows, where TP, FP, TN, FN represent true positives, false positives, true negatives, and false negatives, respectively. The AUC value of ANN can be interpretedFor the training and validation group, the ROC curves for the ANN, LR, and DT models are shown in Figs Table 2. We evaluate the differences in order to see whether there was significance. AUC value could be shown as the normalized Mann\u2013Whitney U statistics. Concerning the normalization denominator is universal for all models, we could thus show the superiority by the AUC value from nonparametric test perspective. Specifically, given the true label of each sample, the larger AUC value, the lager Mann\u2013Whitney U statistics, the better classified capability of the model. We additionally conduct two pairwise tests for AUC values to substantiate the superiority.The performance comparison of the three models in the two groups is listed in For ANN and DT, the result shows the difference is significant. .For ANN and LR, we obtain the similar result as following.Advanced schistosomiasis, resulting from either repeated infection or acute infection without chemotherapy, is the most severe form of schistosomiasis and clinically presents with portal hypertension , periporData mining systems aim to extract implicit, previously unknown and potentially valuable relationships and patterns from large amounts of data to provide clear and useful information through advanced processes of selecting, exploring, and modeling , 28. RecOne of the most attractive features of ANN is the system\u2019s ability to apply machine learning, also referred to as training. ANNs can continuously adjust parameters, such as connection weights, and store the sample set as a connection weight matrix under circumstance of external environment stimulation, such as the input of the sample set. When the ANN accepts the input again, the system can provide the appropriate output. In the present study, there were many neurons in the model and the sample size had rigorous requirements. Therefore, only the variables that were selected by single factor analysis and closely related to the prognosis of advanced schistosomiasis were used as input variables. A good predictive model can distinguish population at high risk from the one at low risk, which is so called discrimination. Discrimination is generally expressed as the area under the ROC curve, referred to as AUC. The higher the AUC value, the better the model can discriminate between high and low risk groups. Due to the serious adverse prognosis of advanced schistosomiasis patients, the sensitivity of the predictive model should be as high as possible in order to avoid false negatives on condition that the discrimination of the model is fine (e.g. AUC\u22650.75).Mann\u2013Whitney U test.Data from the designated training set was then used to evaluate the ANN model, and the prediction accuracy of the ANN model was 0.8660, which was better than the LR model  and the DT model (0.8194). The AUC of the ANN, LR, and DT models was 0.9267, 0.8276, and 0.8229, respectively, which indicates that the ANN model had the best prediction performance by In comparison to the LR and DT models, the ANN model had the best fitting effect for the relationship between advanced schistosomiasis and pathogenic factors. Schistosomiasis\u2019 pathogenesis of disease is a complicated process influenced by multiple factors; thus, the use of traditional LR models to predict the development of disease is significantly limited by the inability to determine effects of multiple co-linearity between the independent variables. DT models can be easily applied to discrete values, but when there are more attribute values, the effect may be poor . While ADespite its limitations, the LR model has been widely adopted because it offers other advantages , 38. LR In comparison to LR models, DT models can not only detect statistically significant risk factors, the model can also intuitively compare the intensity of various risk factors on the prognosis of patients with advanced schistosomiasis , 43. TheANN simulates the function and structure of biological neural network to establish non-linear mathematical models with strong fault tolerance, adaptiveness, nonlinear comprehensive reasoning ability, and the powerful ability to solve co-linearity and interactions between variables , 48. AltThe advantages and disadvantages between these models on the implementation of them in the medical practice are noteworthy. A study that used ANN models and generalized additive models (GAM) to estimate glomerular filtration rate (GFR) in patients with chronic kidney disease found that the advantage of ANN is obvious only when multiple variables added to the model, especially the multicollinearity existed . ANN is The present study constructed three predictive models\u2014the ANN model, the LR model, and the DT model\u2014to predict advanced schistosomiasis prognosis. While each of the predictive models proved effective and had their own advantages, the ANN model outperformed the LR and DT models in terms of AUC and sensitivity. However, to achieve the highest level of prediction accuracy and better assist medical professionals, the three predictive models should be applied after model comparison.S1 Table(XLS)Click here for additional data file.S2 Table(XLS)Click here for additional data file.S1 Dataset(ZIP)Click here for additional data file.S2 Dataset(ZIP)Click here for additional data file."}
{"text": "In 2012, 12 medical schools were opened in Ethiopia to tackle the significant shortage of doctors. This included Aksum School of Medicine situated in Aksum, a rural town in Northern Ethiopia. The new Innovative Medical Curriculum (NIMC) is a four-year programme designed by the Ethiopian Federal Ministries of Health and Education. The curriculum is designed to train biomedical science graduates to become doctors in 4\u00a0years, with a focus on the healthcare needs of rural people living in poverty.This research was conducted at Aksum School of Medicine and included two hospitals . This study focused on medical students during their clinical years across multiple specialities (61 Clerkship 1 students and 13 Clerkship 2 students). We used primarily qualitative research methods supplemented with quantitative measures. There were 3 stages of data collection over a 1\u00a0month period, this included qualitative group interviews, direct observation of students in a clinical setting and direct observation of skills sessions followed by a questionnaire on the sessions. We analysed the data by reconstructing the student experience and comparing it with the NIMC.The proposed typical week set out in the NIMC tended to differ from the real clinical experience of these students. Through qualitative group interview and direct observation of teaching, the main theme that was consistent throughout was the lack of doctors with specialist postgraduate training. Clinical need often took priority over education. However, students enjoyed taking early responsibility and gaining practical experience. Through direct observation of skills sessions and short questionnaires, these sessions were highly valuable to the students and they felt confident in carrying out the taught procedures in the future.The combination of poorly resourced hospitals and lack of specialist doctors provides a challenging environment for medical students to learn. However, it is a unique clinical experience that is rarely seen in developed countries and facilitates the acquirement of skills from an early stage. Supervision and specialist input is fundamental in enabling students to learn and this is a key area that was lacking in the students\u2019 clinical experience. Ethiopia is a country with a severe shortage of doctors especially in the rural areas . AccordiAksum is a town in Tigray, Northern Ethiopia with an estimated population of 66,800 people . Aksum UThe four-year curriculum is split into two pre-clinical years and two clinical or clerkship years, known as Clerkship 1 (C1) and Clerkship 2 (C2) . The research included 61 C1 students and 13 C2 students.Qualitative group interviewsDirect observation of students in a clinical settingDirect observation of skills sessions followed by a student questionnaire on the sessionsThere were 3 stages of data collection, which we completed over a 1\u00a0month period:We completed Stages 1 and 2 over a 2-week period. Stage 1 consisted of eight structured group interviews, involving 2\u20134 participants per interview. We conducted the interviews using a convenience sample of available students in the clinical area. We used this method as it allowed the students to decide if they wished to participate, any students who wanted to participate were included in the study. It was not possible to pre-arrange interviews with the students due to network and power outages which sometimes lasted multiple days making communication and organisation of meetings very difficult.We used an interview guide that covered the students\u2019 experience in Ophthalmology, Dermatology, Obstetrics and Gynaecology and Surgery. CM and MT developed the guide after discussion with senior faculty members from Aksum University and review of the NIMC. We asked the students to describe their current clinical experience, including details of their attachment and their average day. We also asked what they felt worked well on their attachment and areas that could be improved. The lead researcher (CM) attended both hospitals  alternating sites over a two-week period to carry out the structured group interviews alongside a General Practitioner from Aksum (MT). CM and MT conducted these interviews together in the morning after locating the medical students in the relevant departments within the hospital. The morning was the time when the highest number of students were present. The lead researcher (CM) collected the data through note taking. The Aksum GP was known to the students which enabled a strong rapport and trust to be built during the interview.We obtained verbal consent prior to interviewing the students and all data was anonymised to maintain confidentiality. We retained a written register of the students who verbally consented. We offered the students the choice of participating and we explained that it would not affect their training in any way if they chose not to participate. We also obtained verbal consent from the consultant in charge of each department prior to direct observation and interviews. All interviews and teaching sessions were conducted in English, which is the same language the students are taught in. In Stage 2, CM observed a selection of students, based on convenience sampling, in the clinical environment. This involved both hospital wards and outpatient clinics. CM made observational notes to compare with the described student experience in the NIMC. We obtained ethical approval from both Aksum University and Queen Mary University of London. All researchers had received training in collecting qualitative data.\u2003How useful did you find the teaching?\u2003Did you feel the teaching was right for your level?\u2003How confident would you be in using the skills you learnt in the session?\u2003Was the session well organised?\u2003What other aspects of this topic would you like to see included?Two medical students (RB & KS) carried out Stage 3 of data collection. This involved direct observation of skills sessions using a structured observation teaching form, followed by an evaluation of the students\u2019 experience using a cross-sectional survey. We anonymised the survey to maintain the students\u2019 confidentiality. We (RB & KS) collected data by observational note keeping. A debrief was undertaken after each session. The researchers (RB & KS) then compared the notes, collaborated findings and any differences were discussed. Both medical students (RB & KS) were present at all skill sessions. The survey consisted of the following 5 questions :The lead researcher (CM) collated the observational notes from the three researchers who had taken notes  into a written document. This data included qualitative group interviews, direct observation of teaching and direct observation of skills sessions. The lead researcher (CM) developed deductive codes which were derived from the interview guide, these included \u2018positive experience\u2019, \u2018areas for improvement\u2019 and \u2018structure\u2019. CM then developed inductive codes from further reading and analysis of the data. These included \u2018supervision\u2019, \u2018teaching\u2019, \u2018level of responsibility\u2019 and \u2018workplace dynamics\u2019. Coding of the data allowed common themes to be identified. The lead researcher (CM) then placed the data into different categories, consisting of headings and subheadings which involved the year and speciality of the medical students. CM then mapped the data to the NIMC. We categorised the data in this way as it allowed conclusions to be drawn and recommendations to be made to the faculty leadership and individual departments. Using the Likert-type scale, researchers RB and KS collated the results from the cross-sectional survey into a simple bar chart. An experienced qualitative researcher (TCB) checked the data analysis and coding framework. This helped to ensure reliability in the data analysis and credibility of the coding. TCB identified any discrepancies in the coding and revisions were made.The main theme that was consistent throughout was the lack of doctors with specialist postgraduate training. Students enjoyed being taught by specialists when available, however, there were different levels of engagement across the different specialities. This was often due to clinical need taking priority over education and specialists having to leave to attend emergencies, particularly in the case of Surgery and Obstetrics. There was often poor access to basic teaching materials such as ophthalmoscopes and specialist textbooks. However, students enjoyed taking early responsibility and gaining practical experience, for example delivering babies and performing minor surgical procedures. The proposed typical week set out in the NIMC for C1 and C2 students  and Ophthalmology (31) at Aksum Referral Hospital. The students were split into two groups and then into further subgroups of approximately 8, each student spent 3\u00a0weeks on Ophthalmology and 3\u00a0weeks on Dermatology. Aksum Referral Hospital had just recently opened and all clinical exposure was outpatient based. There was one specialist Ophthalmologist and one specialist Dermatologist. An average day would involve teaching by the specialist in the morning, via a PowerPoint presentation that was then followed by a clinic. Groups had to have at least 1\u00a0day per week away from the clinical environment due to there being only one specialist in each department and 61 students.From direct observation, the ophthalmology clinic consisted of the ophthalmologist, specialist nurse and medical students. There was one ophthalmoscope in the department used by the specialist and a slit lamp; the students used a torch and goggles to examine the eyes. Jointly the students would take a very brief history from the patient with the nurse. There appeared to be a good relationship between the specialist nurse and the students, allowing the students time to examine the patients. The students would then observe the ophthalmologist who at times gave teaching. The relationship between the students and ophthalmologist appeared strained, primarily due to the clinical work load. From observation, it was clear that the students were being exposed to a wide variety of ocular pathology with advanced clinical signs. During the interviews the students spoke about the lack of hard copy Ophthalmology textbooks in the library and their reliance on a limited Internet connection for resources. They also spoke about their desire to learn how to use equipment such as an ophthalmoscope.The dermatology clinic comprised of the dermatologist and the medical students. From direct observation, approximately 8 students stood around the patient and the students were asked to take a history from the patient, formulate differential diagnoses and consider appropriate investigations. Possible management plans were then discussed with the students. From observation, the dermatologist appeared highly motivated with a passion for teaching. The dermatologist ensured all students were involved in the teaching and reading materials were given prior to the clinic. Much like Ophthalmology, when interviewing the students, they spoke about limited access to textbooks and difficulty accessing online resources. However, they enjoyed seeing a wide variety of dermatological conditions and were very positive in regards to the dermatologist.Thirteen students were on the Emergency Surgery and Lifesaving skills module at St Mary\u2019s District Hospital Aksum. This is a 12-week module made up of 6\u00a0weeks of Surgery (6 students) and 6\u00a0weeks of Obstetrics and Gynaecology (7 students) and is the final module before they sit their final qualifying exam. The students were split into two groups and rotated after 6\u00a0weeks.There was one general surgeon covering the entire hospital and the different surgical subspecialties. The students\u2019 surgical rotation was split into 2\u00a0weeks of theatre and 4\u00a0weeks of ward work. Theatre involved assisting in major surgery, involving all sub surgical sub-specialities, which included plastics, vascular, orthopaedics and paediatric surgery. They also undertook minor procedures unsupervised, such as draining abscesses. From direct observation on the wards the students would clerk patients, prescribe medications, consent patients for surgery and manage uncomplicated patients. From group interview the students sometimes felt overwhelmed by the responsibility given to them and the number of unwell patients. They also found the working conditions hard, these included no running water in the hospital and lack of basic medical supplies. However, as they were in their final year, they felt this responsibility and experience was important in preparing them for their internship year.The responsibility given to these final year medical students was significant. There was one specialist across the entire department. The students were running their own clinics and admitting, managing, prescribing medications and discharging patients (see Table\u00a0The skills sessions consisted of 60-min-long tutorials, delivered by two senior clinicians from the obstetrics department, to groups of 15 students. The sessions were conducted in a well-equipped skills lab. The content of the session would be oriented to lecture based teaching that had been delivered by residents in the same week. For example, on a week discussing termination of pregnancy, the skills session was to familiarise students with manual vacuum aspiration. These topics would also be selected based on feedback from previous students who had struggled with this area in their assessments. The initial skills session would act more as an interactive tutorial, establishing the students\u2019 prior knowledge and introducing them to the equipment generally, before being followed by a supervised practice session.These skills sessions were well received by the students who mostly had little or no prior experience of the procedure being taught Fig.\u00a0. The intMedical student comments were also broadly positive about the session stating that it was \u201cnecessary\u201d and should be \u201ccontinued\u201d while also seeking further opportunity to practice, either in the skills lab or on patients.The combination of poorly resourced hospitals and lack of specialist doctors provides a difficult environment for medical students to learn. A shortage of specialist doctors is a huge problem across Ethiopia, especially in rural areas such as Aksum. Supervision is fundamental in enabling students to learn and progress into safe clinicians  and thisFurthermore, Fig.\u00a0A common theme that should be discussed is the different levels of engagement from the specialist doctors. Each department had only one specialist which placed enormous strain on these doctors. St Mary\u2019s, a 150 bed district general hospital in Aksum is estimated to serve 1.5 million people. The burden of disease in Ethiopia measured in terms of premature death is estimated at 350 disability adjusted life years lost per 1000 population, which is the highest in Sub-Saharan Africa . The comHigh levels of responsibility and a huge disease burden can be advantageous to a medical student\u2019s education. Exposure to tropical diseases such as Leishmaniasis and patients consistently presenting at extremely advanced stages of disease is a unique experience that is rarely seen in developed countries. This allows Aksum medical students to continue to develop their history and examination skills and formulate diagnoses without becoming dependent on investigations. The Aksum students enjoyed gaining practical experience which involved delivering babies and performing minor surgical operations. A study carried out in Tanzania found that clinicians felt clerkship students should be performing procedures such as a lumbar puncture under minimal supervision . AllowinIt does appear that the curriculum undergoes some degree of tailoring to knowledge gaps identified in assessment, as evidenced by the skills sessions. The fact that these sessions were engaging, interactive and resulted in the students having a high level of confidence in their ability to perform the taught practical skills, are all examples of good educational practice. The development of confidence in practical procedures is hugely important for when these skills are transferred into a clinical setting, especially if the students are performing skills with limited supervision. Students\u2019 positive comments in feedback further illustrates the value of this practice. Further collection of feedback and tailoring of the curriculum to the students\u2019 needs should be encouraged .A limitation of this study is the fact that convenience sampling was used, which may not be representative of the whole cohort of students. Only 13 C2 students were involved in this study due to the remaining C2 students being placed at hospitals outside of Aksum; these hospitals were not accessible by public transport. To ensure the data is fully representative further research could be conducted in these hospitals. Further research could also explore different specialties that were not covered in this study. Another limitation to the data collection is that the interviews were not directly recorded and transcribed due to the lack of available equipment in Ethiopia.Access to basic teaching materials for specialities such as Ophthalmology and Dermatology are very important in the students\u2019 learning and their absence was a common theme highlighted by the students. This was the first time that Aksum Referral Hospital had Dermatology and Ophthalmology teaching clinics for the students as the hospital had recently opened and these departments were the first to become operational. The medical school recruited the patients for the clinic by organising a campaign in the week prior to the clinic. This involved an individual with a \u2018megaphone\u2019 driving up and down the main road in Aksum inviting anyone who had any eye or skin problems to come to the hospital. This again demonstrates the creativity of the medical school in organising and delivering the curriculum. As more departments open this will provide invaluable learning opportunities across different specialities for the medical students. It is important that Ophthalmology and Dermatology resources including textbooks are available for the students to help consolidate their learning. Investing in equipment such as ophthalmoscopes and teaching the students how to use them will provide them with important skills that they can apply in hospitals throughout Ethiopia .A recent study looking at how medical students contribute to healthcare in Sub-Saharan Africa showed students are valuable resources in the health facilities . They haClinical medical students at Aksum University have high levels of experience, expertise and responsibility. However, there is a need for more senior supervision across the field to maximise the students\u2019 clinical experience and to optimise patient care. The implementation of the NIMC is an important area that should continue to be reviewed regularly, not only in Aksum but across all medical schools throughout Ethiopia."}
{"text": "Supplemental Digital Content is available in the text This review aims to evaluate the effectiveness and safety of acupuncture treatment for reducing opioid consumption in patients with chronic pain.We will search the following electronic databases from their inception to November 2019: MEDLINE, EMBASE, the Cochrane Central Register of Controlled Trials, the Cumulative Index to Nursing and Allied Health Literature, the Allied and Complementary Medicine Database, the China National Knowledge Infrastructure (a Chinese database), the Japan Science and Technology Information Aggregator (a Japanese database), and five Korean databases . Randomized controlled trials comparing acupuncture to no treatment, sham acupuncture, and other active interventions for the reduction of opioid consumption in chronic pain patients will be included. The risk of bias will be assessed using the Cochrane risk of bias tool. The primary outcomes will include the prescribed or consumed dose of opioids and withdrawal symptoms related to opioid reduction. A meta-analysis will be performed to estimate a pooled effect, if possible.This study may provide important practical guidance for patients, practitioners, and health-policy makers regarding the use of acupuncture in opioid taper support programs.The results will be disseminated through a peer-reviewed journal or conference presentations.Trial registration number: PROSPERO 2019: CRD42019143486 As a result, the prescription of opioids has increased over the last 2 decades, especially in the United States, United Kingdom, and Australia, for patients with high-impact chronic pain as well as acute postoperate and cancer pain. Among the 25.3 million patients with chronic pain in the Unites States, opioids were prescribed for more than 240 million times in 2015. However, many studies have revealed limited evidence opioid use for long-term pain relief in chronic-pain conditions. Moreover, addiction and overuse of opioids leads to considerable adverse effects, such as bladder dysfunction, sedation, immune suppression, and even death.Chronic pain, defined as pain lasting more than 3 months, is one of the most common reasons for long-term medication prescription and affects about 20% to 50% of adults worldwide.1.2 In addition to pain reduction, acupuncture treatment is a promising adjunct to facilitate the reduction or tapering of pain medications, including opioids, in patients with chronic pain. It may also be used to treat opioid use disorder, which may involve opioid cravings, anxiety, depression, or insomnia.Acupuncture is defined as an intervention that stimulates specific points  using dry needles with some kind of manipulation . Recently, a rigorous meta-analysis of data from 20,827 individuals showed that acupuncture is effective for nonspecific chronic musculoskeletal pain when compared to a sham control, and the treatment effects persisted over time.1.3 Acupuncture may also facilitate opioid tapering by reducing adverse events related to opioid use or withdrawal.,10 In addition, it may reduce pain intensity and symptoms associated with comorbidities of chronic pain.Although the mechanism of acupuncture treatment for reducing opioid consumption remains unclear, some studies have shown that acupuncture increased the \u03bc-opioid receptor binding ability, which could lead patients to demand lower doses of opioids.1.4 and avoid medication dependence. Although one Cochrane review focused on interventions for the reduction of prescribed opioid use, only 1 acupuncture study was included due to a limited search that did not include Korean or Chinese databases. A systematic review focusing on acupuncture was recently published, but it evaluated only clinical symptoms related to opioid use or withdrawal, not the reduction of prescribed opioids. Therefore, a review with an up-to-date systematic search is needed to evaluate acupuncture for the reduction of opioid consumption; this will help us determine whether acupuncture is an effective treatment option for opioid taper support programs.Long-term use of opioids in patients with chronic musculoskeletal pain is known to provide limited pain relief, and the potential side effects may lead to opioid-related death from addiction and overdose. Non-pharmacologic interventions, such as acupuncture have been proposed as alternatives to cope with these problems, address chronic pain,1.5The objective of this systematic review is to evaluate the benefits and harms of acupuncture treatment for the reduction of opioid consumption in patients with chronic pain in comparison to no treatment, sham acupuncture, or other therapies such as pharmacological, physiological, educational, or psychological interventions.22.1http://www.crd.york.ac.uk/ PROSPERO) on October 2019. If protocol amendments occur, we will update the changes in the PROSPERO and disclose them in the publications for the results of this study.The protocol of this review has been prospectively registered  of acupuncture treatment for the reduction of opioid use will be included in the review. Non-randomized controlled trials, observational studies, qualitative studies, and laboratory studies will be excluded. Language will not be a restriction for study eligibility.2.2.2Data from all adult patients taking opioid medication for non-cancer pain for more than 2 months will be included; there will be no dose limitation. The diagnosis criteria and classification of pain conditions will not be limited and will include various musculoskeletal, mono- or poly-neuropathic, visceral, or head pain.2.2.3Acupuncture treatment is defined in 2 components:(1)needling with various types of stimulation (2)specific points .Trials examining acupuncture treatment involving the above 2 components will be included in this review. However, trials including non-penetrating stimulation  will not be included. Only trials in which acupuncture treatment was compared with other forms of acupuncture methods will be excluded. If the acupuncture group simultaneously received acupuncture and other multidisciplinary treatments for pain management or opioid tapering, only trials in which the same program was administered to the both groups will be included.The control will be considered as no treatment, sham acupuncture, or other opioid taper support programs including pharmacological, physiological, educational, or psychological interventions.2.2.4Primary outcomes1.Opioid dose (prescribed or consumed): If possible, all opioid doses will be converted into morphine milligram equivalents.2.Withdrawal symptoms related to opioid reductionSecondary outcomes1.Pain intensity2.Psychological measurements3.Physical measurements4.Quality of life (QoL)5.Clinical global improvement in symptoms6.Retention of treatments7.Adverse events related to acupuncture treatment2.32.3.1The Cochrane Library, 2019, Issue 11), the Cumulative Index to Nursing and Allied Health Literature , the Allied and Complementary Medicine Database , the China National Knowledge Infrastructure , the Japan Science and Technology Information Aggregator Electronic , and five Korean databases .The following 12 databases will be searched from inception to November 2019: MEDLINE (1946 to November 2019), EMBASE (1980 to November 2019), the Cochrane Central Register of Controlled Trials , opioid use , and acupuncture . The special search strategies for MEDLINE are presented online in Appendix 1.2.42.4.1http://www.prisma-statement.org).Two researchers (SL and DHJ) will independently screen potentially eligible articles by reading the titles and abstracts. The researchers will independently select and check their decisions according to predefined criteria on a standard eligibility form. Any disagreement regarding the selection of article will be resolved through discussion, and if a disagreement remains, a third researcher will resolve the disagreement. The flow process will be summarized in a Preferred Reporting Items for Systematic Reviews and Meta-Analysis (PRISMA)-compliant flow chart (2.4.2Two researchers (SL and DHJ) will independently read the full text of the selected articles and extract data using a standard data extraction form. This data will include author, year of publication, country, study design, sample size, participants, condition, acupuncture intervention, control intervention, outcome measures, main results, and adverse events. Discrepancies regarding the extracted data will be resolved through discussion or consultation between the researchers. When data in an article is insufficient or unclear, the researchers will contact the first or corresponding author via email to request additional information.2.4.3Two researchers (SL and DHJ) will independently conduct the quality assessment using the tool for assessing risk of bias based on the Cochrane Handbook for Systematic Reviews of Interventions. The following seven domains will be assessed:(1)random sequence generation;(2)allocation concealment;(3)blinding of participants;(4)blinding of outcome assessors;(5)incomplete outcome data;(6)selective outcome reporting; and(7)other sources of bias .The risk of bias will be categorized into 3 levels: low, high, and unclear risk of bias. Any discrepancies in the assessment will be resolved through discussion between the researchers.2.4.4For continuous data, the mean difference (MD) will be presented with 95% confidence intervals (CIs). If the scales measuring the continuous outcomes among the studies in the analysis do not correspond, the standardized mean difference (SMD) will be used. For dichotomous data, the risk ratio (RR) with 95% CIs will be used to measure the treatment effect. Ordinal data will be converted to dichotomous data if the data needs to be pooled. For example, assessments of global improvement graded as \u2018recovery\u2019, \u2018markedly effective\u2019 \u2018effective\u2019, and \u2018ineffective\u2019 will be dichotomized into \u2018improved\u2019 or \u2018not improved\u2019. A patient who achieves more than 50% reduction in opioid consumption will be defined as \u2018responder\u2019, and their data will be analyzed as dichotomous data.2.4.5When an outcome variable is assessed repeatedly (at more than 2 follow-up time points after post-treatment), only the last assessment will be chosen for the main analysis.2.4.6For missing or incomplete data, we will attempt to contact the first or corresponding authors to request the additional data. If this is not possible, only the available data will be analyzed, and the potential impact of the missing data will be addressed in the discussion.2.4.7P\u200a<\u200a.10 will be used to determine the presentation of heterogeneity. The I2 statistic will also be used to summarize heterogeneity among the trials; I2 of 0% to 40% might not be important, 30% to 60% may represent moderate heterogeneity, 50% to 90% may represent substantial heterogeneity, and 75% to 100% may represent considerable heterogeneity.First, heterogeneity will be judged by visual inspection of the forest plot; then, a chi-square test with a significance level of 2.4.8 If asymmetry is identified in the funnel plot, Egger linear regression method will be performed.When more than 10 trials are available, a funnel plot will be used to detect reporting bias.2.4.9 When a trial includes more than two acupuncture treatments with different stimulation methods  or points , meta-analysis could be performed carefully with consideration of whether the data of different acupuncture treatments could be combined into 1 merged acupuncture treatment. On the contrary, when a trial has more than 2 control interventions , the data of the acupuncture treatment will be split equally and compared with each control intervention separately.The meta-analysis will be performed using Review Manager software . A random effects model will be planned to pool data, as considerable clinical heterogeneity involving conditions, acupuncture regimens, and control interventions is expected in the studies included in the review. However, the data will not be pooled when considerable heterogeneity is detected without explanation for the clinical and methodological diversity.2.4.10When sufficient data are available, subgroup analysis will be performed according to the following:1.Style of acupuncture stimulation 2.Type of control intervention 2.4.11When appropriate, sensitivity analysis will be performed to identify whether the results of the review are robust after removing the trials with high risk of bias.2.4.12The main outcomes (primary outcomes and adverse events) will be summarized in the \u201cSummary of findings\u201d tables. The quality of evidence in the main outcomes will be assessed using the Grading of Recommendations Assessment, Development and Evaluation (GRADE) approach  with GRADE software. The quality of evidence will be categorized using the following four levels: high, moderate, low, and very low quality.2.5As this is a systematic review, ethical approval and informed consent were not necessary. The results of this review will be disseminated through conference presentations and peer-reviewed journal articles.3This is the study protocol of a systematic review and meta-analysis on the use of acupuncture treatment for reduction of opioid consumption in patients with chronic pain.,17 Furthermore, a recent systematic review showed that conventional acupuncture or transcutaneous electric acupoint stimulation reduced consumption of opioid analgesics, especially on the first day after surgery. Though, in the last several years, the long-term abuse of opioid therapy has been coined an opioid crisis and recognized as one of the most challenging problems of public health, research for reducing long-term opioid consumption is not well known. Recently, various federal regulatory and professional organizations have started to encourage the use of multidisciplinary approaches, including nonpharmacologic interventions, to reduce long-term opioid consumption and opioid use disorder. In this context, acupuncture treatment, which is already supported by rigorous evidence for chronic pain, has received attention as the most promising treatment option for this strategy.,21 Zheng and colleagues presented the possibility of using electroacupuncture to reduce opioid consumption in patients with chronic musculoskeletal pain through conducting sham-controlled clinical trials.,10 However, to determine the role of acupuncture in the multidisciplinary approach used in opioid taper support programs, there must be comprehensive evidence of acupuncture for the reduction of opioid consumption.Many studies have shown that perioperative acupuncture treatment effectively reduces acute opioid consumption after surgery.Therefore, we will conduct a systematic review searching all relevant literature, without any language restrictions, in the Korean, Chinese, and Japanese databases to include any relevant trials of acupuncture for the reduction of opioid consumption in patients with chronic pain. The results of this systematic review will be useful for patients, practitioners, and health policy-makers who wish to include acupuncture among the multidisciplinary treatment options available in opioid taper support programs. Moreover, this review will be constructive for researchers planning further clinical trials.The author would like to thank Professor Kun Hyung Kim and Jung Won Kang for encouraging suggestions and helpful comments.Conceptualization: Seunghoon LeeFunding acquisition: Seunghoon LeeMethodology and project administration: Seunghoon LeeWriting : Seunghoon LeeWriting (review and editing): Dae-Hyun Jo, Seunghoon LeeSeunghoon Lee orcid: 0000-0003-0088-2296."}
{"text": "Enterobacteriaceae. We found that the deletion of either of the orf35 and orf36 genes, which are dispensable for conjugative transfer, increased the plasmid mobilization efficiency. Real-time quantitative PCR (RT-qPCR) analysis suggested the involvement of orf35 and orf36 in regulating the expression of transfer genes. We also revised the host range of pCTX-M3 by showing that its conjugative transfer system has a much broader host range than its replicon.Horizontal gene transfer is responsible for rapid changes in bacterial genomes, and the conjugative transfer of plasmids has a great impact on the plasticity of bacteria. Here, we present a deletion analysis of the conjugative transfer system genes of the pCTX-M3 plasmid of the IncM group, which is responsible for the dissemination of antibiotic resistance genes in  Citrobacter freundii, is classified in the IVB subfamily and in the MPFI group, as are the conjugation systems of IncI1 group plasmids. Although the majority of the conjugative genes of the IncM and IncI1 plasmids display conserved synteny, there are several differences. Here, we present a deletion analysis of 27 genes in the conjugative transfer regions of pCTX-M3. Notably, the deletion of either of two genes dispensable for conjugative transfer, namely, orf35 and orf36, resulted in an increased plasmid mobilization efficiency. Transcriptional analysis of the orf35 and orf36 deletion mutants suggested an involvement of these genes in regulating the expression of conjugative transfer genes. We also revised the host range of the pCTX-M3 replicon by finding that this replicon is unable to support replication in Agrobacterium tumefaciens, Ralstonia eutropha, and Pseudomonas putida, though its conjugation system is capable of introducing plasmids bearing oriTpCTX-M3 into these bacteria, which are representatives of Alpha-, Beta-, and Gammaproteobacteria, respectively. Thus, the conjugative transfer system of pCTX-M3 has a much broader host range than its replicon.Plasmid conjugative transfer systems comprise type IV secretion systems (T4SS) coupled to DNA processing and replication. The T4SSs are divided into two phylogenetic subfamilies, namely, IVA and IVB, or on the basis of the phylogeny of the VirB4 ATPase, into eight groups. The conjugation system of the IncM group plasmid pCTX-M3, from IMPORTANCE Horizontal gene transfer is responsible for rapid changes in bacterial genomes, and the conjugative transfer of plasmids has a great impact on the plasticity of bacteria. Here, we present a deletion analysis of the conjugative transfer system genes of the pCTX-M3 plasmid of the IncM group, which is responsible for the dissemination of antibiotic resistance genes in Enterobacteriaceae. We found that the deletion of either of the orf35 and orf36 genes, which are dispensable for conjugative transfer, increased the plasmid mobilization efficiency. Real-time quantitative PCR (RT-qPCR) analysis suggested the involvement of orf35 and orf36 in regulating the expression of transfer genes. We also revised the host range of pCTX-M3 by showing that its conjugative transfer system has a much broader host range than its replicon. The DNA processing functions are provided by the DNA transfer and replication (Dtr) system, also called the relaxosome complex (Agrobacterium tumefaciens VirB/D4 secretion system and the conjugation systems of the IncF and IncP plasmids are classified as type IVA (T4ASS) (Legionella pneumophila (Dot/Icm) and in other important pathogens  is transferred from a donor to a recipient cell after physical contact between the cells is established. The process may be regarded as a combination of DNA processing functions coupled to a type IV secretion system  , 3, wherathogens . The majAgrobacterium tumefaciens VirB/D4 secretion system responsible for transfer DNA (T-DNA) transfer to plant cells during infection. This T4SS consists of 11 proteins (VirB1 to VirB11) and the coupling protein VirD4 , a member of the IncM incompatibility group  (oriTColIb-P9 (from the IncI1 plasmid ColIb-P9), and plasmids with oriTpCTX-M3 can be mobilized by a ColIb-P9-derived plasmid  ; howeverolIb-P9) . The pCT plasmid ; both oftra and trb genes potentially involved in pCTX-M3 conjugative transfer. We found that the deletion of either of the orf35 and orf36 genes, both of which are dispensable for pCTX-M3 transfer, increases the mobilization efficiency of oriTpCTX-M3-bearing plasmids into E. coli and A. tumefaciens. The deletion of these genes also affected the transcription of other conjugative transfer genes. In addition, we verified the host range of the pCTX-M3 conjugation system and found that the host range of its replicon, reported previously to comprise Alpha-, Beta-, and Gammaproteobacteria . Ho. Hotra apensable . Moreovee operon  (14).tra and trb regions. For this purpose, a collection of 27 derivatives with a deletion in each of the genes in the tra and trb regions, as well as orf35 from the pCTX-M3 leading region and orf46, which is located downstream of trbC, was constructed  by replacing a given gene with the cat gene  from E. coli BW25113 cells to the recipient E. coli JE2571Rifr cells, both in liquid and on filters, was determined . For the majority of the pCTX-M3 derivatives, the complementation fully or at least partially restored the conjugation efficiency (10\u22124 to 10\u22121 per donor cell). However, for the nikB, traM, traN, traU, traW, and traY deletion derivatives, the presence of the complementing gene rescued the conjugation efficiency only to levels less than 10\u22125; for traP and pri, the complementation had no detectable effect , abolished conjugative transfer; however, nikB can be complemented well  transfer efficiency or, for traY, 10\u00d7 lower than the WT transfer efficiency . The transcript levels of all these genes were at least 10-fold higher than those found in the strain bearing pCTX-M3  to undergo conjugative transfer was tested after complementation with a plasmid bearing the corresponding gene . The results obtained for the pri deletion in pCTX-M3 differ from those for the sog deletion in R64, where the deletion resulted in only a small drop in the transfer efficiency, from 10\u22122 to 10\u22123 , which generates RNA primers for plasmid replication, and the shorter SogS (844 aa), which is a product of translational reinitiation within the sog reading frame  and a putative 689-aa protein comprising the C-terminal moiety of the primase. The high level of the pri transcript  of L. pneumophila, which acts as a type IV coupling protein (T4CP)  . In the n (T4CP) . The DottraN gene of both R64 . The deletion of these genes completely abolishes the conjugative transfer of pCTX-M3 and R64  of L. pneumophila and with VirB8 of A. tumefaciens (traU gene encodes a putative ATPase that is a homologue of DotO (IcmB) of L. pneumophila . Surprisingly, pCTX-M3orf36::cat was approximately 5 times more effective than the WT plasmid . The protein product of orf35 of pCTX-M3 exhibits 44% amino acid sequence similarity with that of yggA, the first gene in the leading region of R64 , whose involvement in mobilization has not been studied.To identify the pCTX-M3 genes affecting the mobilization efficiency of plasmids bearing fr cells . The helA. tumefaciens as the recipient, E. coli carrying pCTX-M3orf35::cat or pCTX-M3orf36::cat was >100- or 10-fold more efficient, respectively, as a pToriT donor than was E. coli bearing pCTX-M3 or pCTX-M3orf46::cat .With f46::cat . Howeverorf35 and orf36 on plasmid mobilization, the deletions of these genes were complemented with appropriate plasmids, namely, pALorf35 and pALorf36, respectively. The pABBoriT plasmid was mobilized to an E. coli recipient from E. coli DH5\u03b1 donors. The helper plasmids pCS, pC35S, and pC36S, which were derived from pCTX-M3, pCTX-M3orf35::cat, and pCTX-M3orf36::cat, respectively, and lack kanamycin resistance, were generated for use with the Kmr pABBoriT plasmid  plasmid pToriT, which contains oriTpCTX-M3, into A. tumefaciens (10\u22124 transconjugants per donor after 30 min of mating).Earlier studies  have demy mating . HoweverA. tumefaciens is inconsistent with previous results  as the donor and E. coli, A. tumefaciens, Ralstonia eutropha, and Pseudomonas putida as recipients. In such a system, the transfer of pCTX-M3 during mating reflects the host range of both its conjugation system and the IncM replicon, while the transfer of pToriT, the mobilizable broad-host-range plasmid containing oriTpCTX-M3, reflects the host range of the conjugation system of pCTX-M3 only. Transconjugants carrying pCTX-M3 were selected on plates containing gentamicin and rifampin, while those with pToriT were selected on plates with tetracycline and rifampin  or with kanamycin and rifampin (A. tumefaciens and P. putida). As shown in A. tumefaciens and R. eutropha  and, with a lower efficiency, also into P. putida (3 \u00d7 10\u22126 per donor cell). In contrast, pCTX-M3 transconjugants were obtained only in the E. coli recipient. Thus, pCTX-M3 itself, when transferred, cannot be established in A. tumefaciens, R. eutropha, or P. putida. These results indicate that the host ranges of the pCTX-M3 conjugative transfer system and its replicon differ markedly; the former shows a broad range comprising Alpha-, Beta-, and Gammaproteobacteria, and the latter is restricted to Enterobacteriaceae. A similar observation concerning the differences between the host ranges of the conjugation system and the replicon has been reported previously for the narrow-host-range mobilizable Klebsiella pneumoniae plasmids pIGMS31 and pIGMS32  conjugation system (P. putida plasmid NAH7 of the IncP-9 group (with the MPFT system) (The finding that pCTX-M3 is not transferred into  results  showing  pIGMS32 . These pn system . In addi system) .I group, it differs from the one encoded by IncI1 plasmids. Therefore, it would be valuable to reevaluate the mobilization host range of MPFI systems. It has been shown that ssDNA transiently generated during conjugative transfer triggers the SOS response in recipient cells unless the plasmid codes for an anti-SOS factor  or on agar-solidified LB plates (E. coli and P. putida) or 28\u00b0C (A. tumefaciens and R. eutropha). When required, antibiotics were added to the medium at the following final concentrations (\u03bcg/ml): ampicillin, 100; chloramphenicol, 20; gentamicin, 50; kanamycin, 50; rifampin, 100; tetracycline, 20 or 6 (for pToriT selection).The strains used in this work are listed in B plates  at eithePlasmid DNA was isolated by alkaline lysis using Plasmid Mini or Plasmid Midi kits  according to the manufacturer's instructions. DNA cloning was performed according to standard protocols . All thetra and trb regions were constructed through lambda Red-mediated recombination  cells were electrotransformed with these DpnI-treated PCR products and were selected on LB agar plates with chloramphenicol at 37\u00b0C . Single colonies were isolated by the streak plate method at 37\u00b0C, and the correct integration of the cat gene into the target gene was verified by PCR (35 cycles) with the primer pairs listed in Table S3 and S4. The integration of cat in the four longest genes  was further analyzed by multiplex PCR with three primers (see Table S5): (i) catReVer, which anneals to the cat gene, (ii) a primer located upstream of the deleted gene , and (iii) a primer that anneals to the gene to be deleted . The primers were designed so that the expected products were smaller than 1 kb and enabled discrimination between the native pCTX-M3 and the appropriate mutant plasmid. All mutated plasmids were verified by sequencing with the catU142 primer. The loss of pKD46 was checked by multiplex PCR with the repKD46F and repKD46R primers, which were designed to amplify the repA101 (thermosensitive replication) gene fragment, and with the TEMfor and TnTEMrev primers  as an internal PCR control (see Table S4). The constructed plasmid derivatives are listed in Table S1.The plasmids that were constructed and used in this study are listed in bination . First, cat gene was eliminated from six pCTX-M3 derivatives, namely, pCTX-M3nikB::cat, pCTX-M3pri::cat, pCTX-M3traP::cat, pCTX-M3traU::cat, pCTX-M3traW::cat, and pCTX-M3traY::cat, using pCP20, which encodes FLP recombinase, as a helper plasmid. In this process, the strain DH5\u03b1(pCP20) was electrotransformed with the appropriate pCTX-M3 derivative, and transformants were selected on LB agar with gentamicin at 28\u00b0C. Then, the transformants were streaked in parallel on LB with both chloramphenicol and gentamicin and were grown at 37\u00b0C. After colony purification, the clones that were chloramphenicol sensitive and gentamicin resistant were verified by PCR with the primers listed in Tables S3 and S5. The loss of pCP20 was verified by PCR with the repKD46F and repKD46R primers. The plasmids were then introduced into the BW25113 strain.The tra and trb regions for use in the complementation experiments (Table S1), specific genes were amplified by PCR using Pfu DNA polymerase  with the primers listed in Table S6 and were cloned into the pMT5 or pAL3 vectors, as described in Table S1. Genes which, probably due to the harmful effects of high-level expression, were not able to be cloned into the multicopy plasmid pMT5 (oriVpMB1), were cloned into the low-copy-number vector pAL3 (oriVP15A). Only the pALpri plasmid was constructed without a PCR amplification step, as indicated in Table S1. The cloned genes were verified by sequencing (primers listed in Tables S3 and S4). The expression of the complementing genes cloned into the pAL3 and pMT5 vectors is driven by the lactose operon promoter (Plac).To construct the plasmids carrying individual genes from the oriTpCTX-M3 were obtained by cloning the oriT sequence into appropriate plasmids, as described in Plasmids bearing orf35::cat, and pCTX-M3orf36::cat, respectively, with SalI and the recircularization of the largest DNA fragment. Thus, these plasmids are devoid of all resistance genes except the blaTEM-1 and blaCTX-M-3 genes present in pCTX-M3.The plasmids pCS, pC35S, and pC36S  were obtTaq or Pfu DNA polymerase with the supplied buffers (Thermo Fisher Scientific), deoxynucleoside triphosphate (dNTP) mixture, template DNA , and the appropriate primer pairs listed in Tables S2 to S6, according to the manufacturer's recommendations.PCR was performed in a Veriti thermal cycler  using DreamThe sequencing was performed in the DNA Sequencing and Oligonucleotide Synthesis Laboratory at the Institute of Biochemistry and Biophysics, Polish Academy of Sciences, using a dye terminator sequencing kit and an automated sequencer .600] of 0.8 to 1) using a GeneJET RNA purification kit (Thermo Fisher Scientific) according to the manufacturer's protocol. RNA quality and integrity were checked by agarose gel electrophoresis, and the concentration was estimated using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific). Three biological replicates were analyzed.RNA was isolated from cells of BW25113 strains bearing a specific pCTX-M3 deletion derivative alone or in combination with a plasmid carrying an appropriate complementing gene in the late exponential phase of growth  and target genes are listed in Table S7. Real-time PCR was carried out using Real-Time 2\u00d7HS-PCR master mix SYBR (A&A Biotechnology) in a final volume of 10 \u03bcl in the LightCycler 480 system  with an initial denaturation at 95\u00b0C for 5 min followed by 40 cycles of amplification (95\u00b0C for 10 s and 50\u00b0C for 10 s). The relative gene expression in the deletion strains was calculated and normalized to the value obtained for a strain carrying the native pCTX-M3 plasmid (Reverse transcription was performed with random hexamer primers using the Maxima First Strand cDNA synthesis kit for RT-qPCR with dsDNase (Thermo Fisher Scientific). The specific qPCR primers used to amplify the reference (the  plasmid .8 CFU ml\u22121) were grown in LB to stationary phase; the cultures were then washed twice with LB medium, and the donor strain was resuspended in a volume of LB equal to the initial volume of the culture, while the recipient strain was resuspended in one-fourth of the initial culture volume. Then, 0.5 ml of the donor and recipient suspensions was mixed and filtered through a sterile Millipore HA 0.45-\u03bcm filter . The filter was incubated on an LB plate for 30 min at 37\u00b0C (E. coli) or 28\u00b0C (A. tumefaciens and E. coli). For the pCTX-M3 host range tests, the filter was incubated on an LB plate for 24 h at 37\u00b0C (P. putida and E. coli) or 28\u00b0C (A. tumefaciens and R. eutropha). Bacteria were washed from the filter with 1 ml of a sterile 0.85% NaCl solution. Conjugation was stopped by vigorously vortexing the mating mixture for 30 s and then placing it on ice. Serial dilutions of the mixture of donor, recipient, and transconjugant cells were plated on LB agar supplemented with the appropriate selection antibiotics. As a control, the donor and recipient cells were plated on LB supplemented with antibiotics for transconjugant selection. Mating in liquid was performed as described above but without the use of the filter: the mating mix was incubated for 30 min at 37\u00b0C, and conjugation was stopped by vortexing for 30 s. The conjugative transfer efficiency is equivalent to the number of transconjugants per donor cell.Cultures of the donor and recipient strains (approximately 10http://blast.ncbi.nlm.nih.gov/Blast.cgi) to search against the NCBI \u201cnr\u201d (nonredundant) DNA or protein database with standard parameters; no filters or masks were applied. The molecular weight and theoretical pI were calculated with the use of the ProtParam tool of Expasy (http://web.expasy.org/protparam/) (http://myhits.isb-sib.ch/cgi-bin/motif_scan). SignalP v.2.0  was used to search for signal peptides, TMPred (http://www.ch.embnet.org/software/TMPRED_form.html) was used to determine the presence of transmembrane helices (TMH) (http://www.cbs.dtu.dk/services/LipoP/) was used to predict lipid attachment motifs  . Motifs es (TMH) , and Lipt motifs .t test . P values of <0.05 were considered statistically significant.Data concerning the plasmid conjugative transfer frequencies are presented as the means \u00b1 standard deviations (SDs). The differences between the mobilization efficiencies of pToriT by the different plasmids  were tes"}
{"text": "Lactobacillusreuteri and the microbial composition were investigated. Basic and acidic hydrolysis were tested for an exhaustive recovery of bound phenols: the acidic hydrolysis gave best yields. Methyl ferulate and neocarlinoside were identified for the first time in wheat. The inhibitory power of the extracts of several batches were investigated on PTP1B enzyme. The product was not able to inhibit the enzyme, otherwise, for the first time, a complete inhibition was observed for schaftoside, a major C-flavonoid of wheat. The microbial composition was assessed identifying Lactobacillus, Enterococcus, and Pediococcus as the main bacterial species. The fermented wheat was a suitable substrate for the grown of L. reuteri, recognized for its health properties in the human gut. The proposed method for phenols is easier compared to those based on strong basic hydrolysis; our results assessed the bound phenols as the major fraction, differently from that suggested by the literature for fermented cereals.Fermented cereals, staple foods in Asia and Africa, are recently receiving a growing interest in Western countries. The object of this work is the characterization of a fermented wheat used as a food ingredient and dietary supplement. To this aim, the phenolic composition, the activity on protein tyrosine phosphatase 1B (PTP1B), an enzyme overexpressed in type-II diabetes, the in vitro prebiotic properties on  Cereal fermentation is an ancient technique applied to improve food texture, shelf-life, digestibility, and food preservation, as well as able to remove anti-nutritional factors and toxins. It is a widely applied practice in Asian and African cultures where cereals, as staple crops, are processed before consumption. In recent years, there has been renewed interest in fermented foods in Europe, especially for the supposed health benefits linked to these foods . The ferTriticum aestivum), used as food ingredient and food supplement, is Lisosan\u00ae G. The production is from the wholegrain, grounded, added with water and a sourdough starter, than mixed to initiate the fermentation process, the whole product is recovered after three days, and dried. Recently, Lisosan\u00ae G has been object of in vivo and ex vivo studies, but few data are available on its composition. A protective activity was observed on Wistar rats fed with different dosages of Lisosan\u00ae G before the use of cisplatin as nephrotoxic, neurotoxic and ototoxic agent \u2212 ion, showed again the losses of 90 and 120 mass units, respectively. From MS3 experiments it was possible to confirm that the common fragment ion at 353 m/z is originated from the 563 m/z (after two successive losses of 120 and 90 mass units). According to literature [11 as isoschaftoside and 13 as schaftoside.The profiles at 210 nm, a non-selective wavelength, confirm the exclusive presence of flavonoid compounds. The mass spectra of compounds 9 and 10  showed ti et al. , these lin wheat , as a plterature ,16, it wC-glycosilated flavonoids are reported in 15 was identified as ferulic acid as also confirmed by the MS2 spectrum of its deprotonated molecular ion showing the species at 178 m/z, corresponding to the loss of a methyl group, and 134 m/z from the successive loss of carbon dioxide (59 mass units).The spectral data in positive and negative ion mode for the pool of \u00ae G were 38 mg/100 g (S) was firstly tested and compared with a softer condition with 0.1 M NaOH (Method B). HPLC-DAD analysis highlighted that the former procedure induced a partial degradation of the phenolic compounds when compared with the weaker basic hydrolysis: the use of 4 M NaOH led to the degradation of methyl ferulate converted in ferulic acid, and of compounds 9 and 10  and methyl ferulate (19), while the acidic hydrolysis (19), a compound previously detected in rice [\u00ae G with Method B (0.1 M NaOH in methanol); as expected, the formation of methyl ferulate was not observed and it was possible to conclude that this ester is not an artefact of the extraction process, but is naturally present in Lisosan\u00ae G. Observing the profile obtained from the basic extraction (Method BF) of the solid residue of Lisosan\u00ae G remaining after recovery of the free phenols, it was possible to assess that C-glycosylated flavonoids (9\u201313) were only present in free form (S) led to a partial degradation of the compounds of interest (some minor C-flavonoids) and reduced the total phenolic recovery, in comparison to the other applied methods  guaranteed a better recovery (up to 60% higher) in terms of total phenols  maintained almost the same amount of the C-glycosylated flavonoids (compounds 9\u201311 and 13) extracted with the simple procedure for free phenols (\u00ae G batches for the following reasons: (i) the quantitative data from the methods A were almost the same obtained applying the basic procedure B, but in the latter case applying a four times higher extractive ratio, (ii) the phenolic compounds are chemically stable in acidic media differently to what can happen in the basic media, in which the more hydroxylated flavonoids can go toward a partial degradation, and (iii) the same acid procedure applied to other cereals (data not shown) gave again the highest recovery in terms of total phenols.The basic hydrolysis (B) and the acidic procedure (A) applied to LG1) was the richest in terms of total phenolic content; the LG2 and LG3 resulted very similar otherwise the LG4 was the poorest  at a final concentration of 125 mg/mL and schaftoside, as main flavonoid, at a final concentration of 0.15 mg/mL, were tested adding different amount of extracts . Analogously to what observed for the schaftoside, the results in \u00ae G extracts reduced the inhibitory activity of the molecule alone. In light with these findings, we can conclude that Lisosan\u00ae G contains unknown molecules that impede the interaction with the enzyme. These results agrees with recent evidence that confirmed the presence of different allosteric sites on the enzyme surface involved in the regulation of the enzyme activity [The choice of testing schaftoside was also due to the inhibitory activity already showed by flavonoids on PTP1B enzyme as reported by literature . The resf 6.4 \u00b5M a. Considactivity . Furtheractivity . FurtherBacteriological analysis firstly excluded the presence of microbial contaminants typical of food specimens, such as coliforms and staphylococci .Next-generation sequencing was chosen as suitable tool to perform the qualitative characterization of bacterial composition. The 16S rRNA gene sequencing was applied to identify the microbial composition of Lisosan\u00ae G (Lactobacillus (45.4%), Enterococcus (28%), and Pediococcus (17%) as the main bacterial genera.Since the microbial composition of Lisosan G is unknown, quantification of specific bacterial species of interest by Real-Time PCR or q-PCR was not applied. sosan\u00ae G  with LacLactobacillus fermentum, Enterococcus faecium, and Pediococcus acidiliacti. Generally, numerous fermenting bacteria, especially lactic acid bacteria (LAB), have been identified in sourdoughs, including Lactobacillus and Pediococcus spp. In addition to acidification, the proteolytic activity of LAB allows release of compounds which can promote growth or inhibition and metabolic activities of other microorganisms, as well as organoleptic characteristics. Enterococcus genus includes known probiotic strains and was considered a good candidate for co-culture in food fermentation processes [By BLAST alignment we found that the best hits for species identification (99% of identity) were rocesses .Lactobacillus reuteri is a common component of the microbiota of human and animal intestine and it is widely used in probiotic formulations targeted to infants and adults to reduce the incidence and severity of diarrhea, prevent colics and necrotic enterocolitis, and maintain a functional mucosal barrier [\u00ae G was capable of stimulating the growth of L. reuteri DSM 17938 by more than 1 Log (from 6.7 to 7.8) after 48 h of incubation; even if growth was significantly lower (p < 0.05) with respect to that on glucose. The ability to increase the growth of this microorganism is certainly of interest for this fermented matrix characterized by the presence of probiotic strains and phenolic compounds potentially able to exert growth inhibition of harmful bacteria. The reason for the lack of difference in growth potential when Lisosan\u00ae G was tested at different concentrations (0.5 and 1%) may also be related to the copresence of different molecules and a broad spectrum of action of this complex product. The beneficial effects of Lisosan\u00ae G on human health have already been demonstrated, but prebiotic effects have not been described yet.  barrier . As show\u00ae G , a food supplement obtained from lysed fine bran and germ of organic wheat grains (Triticum aestivum), were provided by Agrisan Srl Company, Larciano . All solvents used were analytical HPLC grade from Sigma Aldrich . Water was ultrapure , ferulic acid (purity \u2265 99%), and apigenin (purity \u2265 95%) were purchased from Extrasynthese .Four batches of LisosanFree phenols. Lisosan\u00ae G, LG1, (250 mg) was extracted with EtOH/H2O 80:20 v/v under magnetic stirring in ultrasonic bath for about 15 min. The extract was centrifuged at 5000 rpm for 10 min. Ten mL of the supernatant were evaporated to dryness and the residue re-dissolved in 1.5 mL of acidified H2O (1% HCOOH). The same extraction was performed with H2O acidified with 1% HCOOH.Bound and total phenols. An acidic hydrolysis (method A) and three different basic hydrolyses  were applied on the fermented wheat as reported below. All the hydrolyses were carried out by the help of an ultrasonic bath (40 MHz). Method BF: 1 g of the sample was extracted with 25 mL of NaOH 0.1 M in MeOH/H2O 7:3 v/v, sonicated for 1 h at 60 \u00b0C. The pH was adjusted to neutrality with acetic acid and the solution centrifuged at 5000 rpm for 10 min to recover the supernatant. The same procedure was applied to the solid residue recovered after the extraction of free phenols. Method B was the same of method BF with only a difference on the solvent-dry sample ratio:1 g of Lisosan\u00ae G was extracted in 100 mL NaOH 0.1 M in MeOH/H2O 7:3 v/v. Method BS: 1 g of the sample was extracted in 25 mL of MeOH/H20 7:3 v/v with NaOH 4 M, sonicated for 1 h at 60 \u00b0C. The pH was adjusted to neutrality with CH3COOH and the solution diluted to a final volume of 50 mL with MeOH/H20 7:3 v/v; the sample was then centrifuged at 5000 rpm for 10 min to recover the supernatant. Method A was an acidic hydrolysis performed on the four batches (LG1\u2013LG4) using the mixture MeOH/H2SO4 9:1 v/v: 1 g of Lisosan\u00ae G was extracted in 25 mL, sonicated for 2 h at 60 \u00b0C, and then centrifuged at 5000 rpm for 10 min to recover the supernatant.\u00ae G (LG1) were almost completely dissolved in 150 mL of HCOOH (1%) under magnetic stirring for 15 min at 60 \u00b0C. After centrifugation , the supernatant was dried under vacuum and re-dissolved in 6 mL of distilled water obtaining the total Lisosan\u00ae G extract. This extract was fractionated by semipreparative HPLC using a Hewlett Packard 1050 series and a Polaris RP-C18 Ether column ; 12 fractions were recovered after 30 injections of 100 \u00b5L. Elution was carried out at a flow rate of 4 mL min\u22121 with CH3CN as solvent A and H2O (0.1% HCOOH) as solvent B. A linear elution gradient was employed: solvent A was increased from 0% to 10% in 10 min, from 10% to 15% in 10 min, from 15% to 30% in 10 min, from 30% to 100% in 5 min with a final plateau of 10 min. Total time of analysis was 45 min, equilibration time 10 min. The collection was carried out monitoring the chromatogram at 280 nm up to 15 min, successively 350 nm was the wavelength selected to detect and recover the flavonoids. The fractions were dried, re-dissolved in 1 mL of water, and controlled by analytical HPLC-DAD and MSn analysis.About 700 mg of Lisosan\u00ae G (250 mg) was dissolved in 50 mL of acidified H2O (1% HCOOH), after a magnetic stirring of 15 min. The extracts were then evaporated to dryness and re-dissolved in 2 mL of water. These extracts (LG1\u2013LG4), the pure schaftoside (at concentration 2.7 \u00b5M), and the pure myricetin (at concentration 0.5 \u00b5M) were evaluated as inhibitors of the enzyme PTP1B. Furthermore, the IC50 was also determined for the schaftoside. Enzymatic assays were carried out using human recombinant PTP1B and p-nitrophenylphosphate (pNPP) as reference substrate. According to Paoli et al. [\u22121 cm\u22121). The net hydrolysis rate was determined subtracting the value of spontaneous hydrolysis rate of pNPP from each sample. The inhibitory power of LG extracts and schaftoside standard was tested adding different amount of extracts (10 and 50 \u00b5L/mL) for each assay. Then, the percentage of inhibition was calculated normalizing the absorbance values obtained for assays carried out in the presence of inhibitor versus the control test. All the results were expressed as a mean of three independent experiments. All four batches were treated as follow: the maximum amount of Lisosan\u00ae G 0 mg was 1 batch was tested in McConkey III medium  and in Mannitol salt medium . Lisosan\u00ae G (500 mg) were directly plated on the two different media and, after incubation for 24\u201348 h, presence of potential microbial contaminants were evaluated.In order to exclude the presence of bacterial contaminants of food specimens, such as coliforms and staphylococci, LG1 batch, library of 16S rRNA gene amplicons was prepared by IGA Technology Services  through amplification of the V3\u2013V4 hypervariable region. The standard protocol was followed according to the 16S metagenomic sequencing library preparation guide from Illumina . Pooled V3\u2013V4 amplicon libraries were sequenced using the Illumina MiSeq platform. Sequence data are available at European Bioinformatics Insitute-EMBL-EBI database [http://compmetagen.github.io/micca/, San Diego, CA, USA), as reported by Di Paola et al. [E-value) was used to select significant BLAST hits, keeping only outcomes with the lowest E-value .By LGdatabase , under ta et al. . A totalL. reuteri DSM 17938). The lyophilized strain was re-vitalized in the Man Rogosa Sharpe (MRS) medium  supplemented with 0.05% cysteine and incubated in anaerobic chamber at 37 \u00b0C for 24 h. The MRS medium composition was modified to perform the growth experiment with Lisosan\u00ae G in order to eliminate glucose and reduce the concentration of potential growth factors, as described in Khatib et al. [\u00ae G, LG1 batch, at 0.5% and 1% (w/v) in m-MRS. A positive growth control was performed using m-MRS with 0.5% (w/v) glucose and a negative control in m-MRS with no added carbon source. The medium containing Lisosan\u00ae G as potential carbon source was prepared as follows: the m-MRS ingredients were weighed and the medium autoclaved at 120 \u00b0C for 15 min. Lisosan\u00ae G was then added, the solution stirred at 80 \u00b0C and then autoclaved again at 102 \u00b0C for 10 min. The strain was grown overnight in MRS, centrifuged, washed in saline (0.9% NaCl), and re-suspended in saline to obtain an absorbance of 0.7 mAu at 600 nm. This suspension was used to inoculate at 2% (v/v) the flasks containing the m-MRS medium plus Lisosan\u00ae G or glucose or the negative control with no carbon source. The tubes were incubated at 37 \u00b0C in anaerobic conditions for 48 h and a 1 mL culture was sampled from each flask, serially diluted, and inoculated on MRS agar plates for viable bacterial counts at pre-established times . Upon incubation, the number of colonies, corresponding to the number of viable cells, were counted and expressed as CFU mL\u22121. The number was transformed into a log10 value (log CFU mL\u22121).The strain used was obtained from the German Collection of Microorganisms and Cell Cultures  and analyzed using a HP 1200L liquid chromatograph equipped with a DAD detector  using a Poroshell 120, EC-C18 column . The solvents for the mobile phase were (A) CH3CN and (B) 0.1% formic acid/water; the multi-step linear solvent gradient was: 0\u20135 min 0\u201310% A; 5\u201310 min 10\u201315% A; 10\u201320 min 15\u201330% A; 20\u201325 min 30\u201335% A; 25\u201328 min 35\u201340% A; 28\u201331 min 40\u201345% A; 31\u201342 min 100% A; 42\u201347 min 100\u20130% A; equilibration time 5 min; flow rate 0.4 mL min\u22121; injection volume 10 \u03bcL. The following wavelengths were simultaneously selected: 240 nm, 280 nm, 330 nm, 350 nm.The extracts from Lisosann on a LTQ-Orbitrap . Each fraction was taken to dryness by evaporation under vacuum and re-suspended in a CH3CN/H2O mixture, containing 0.1% formic acid. This solution was infused by syringe into the ESI interface of the instrument. Sheath and auxiliary gas flow rates were 10 and 2 (arbitrary units), respectively; capillary voltage and tube lens voltages, as the collision energy and wideband activation voltage in MSn experiments, were optimized for each compound of interest during the infusion. The mass spectrometer was calibrated with the standard mixture indicated by the producer immediately before the acquisition of the samples, both in positive and in negative ion mode.The isolated fractions by semipreparative HPLC were analyzed by direct infusion in ESI-HRMS and MSR2 = 1, linearity range 0\u20130.21 \u00b5g), while the flavonoid content was determined using a five-point calibration curve of apigenin at 350 nm .The phenolic acids were evaluated using a five-point calibration curve of ferulic acid at 330 nm, . Statistical analysis of data from PTP1B was performed using the Student t-tests, using OriginPro 2018  The differences between the groups were considered significant when p < 0.05.Each experiment was performed in triplicate, and the results were expressed as the mean values \u00b1 SD; the EXCEL software  in-house routines were applied. Significance in the prebiotic properties experiment was calculated within each evaluation time with a \u00ae G. Contrary to what reported in literature, the bound phenols remained high (more than 80%), although Lisosan\u00ae G was obtained after a fermentation process, usually described as able to increase hydrolytic processes and to strongly reduce the aliquot of bound phenols in cereals. Again, despite some data in the literature, the acidic hydrolysis was able to extract the highest amount of cinnamic derivatives, without degradation of the pool of C-glycosylated flavonoids. It was demonstrated that applying both soft basic and acidic hydrolysis on the whole flour it was possible to recover free and bound phenols through only one extractive step with higher yields compared to those obtained with the stronger basic hydrolysis suggested in the literature to date. Regarding the microbial characterization, it showed the presence of bacterial genera with fermentative capability such as Lactobacillus, Pediococcus, and Enterococcus, generally recognized as safe and used in the production of fermented food. The proteolytic activity of these bacteria can contribute to the release of compounds, as phenols, growth of beneficial bacteria as L. reuteri, and inhibition of harmful bacteria. For the first time, a prebiotic effect on L. reuteri strain, widely used in probiotic formulation targeted to infants, was highlighted. This fermented wheat resulted not able to inhibit the PTP1B enzyme in vitro, otherwise the pure schaftoside, a main C-flavonoid of Lisosan\u00ae G, showed a strong inhibition power. Schaftoside was tested for the first time on PTP1B enzyme and was active as inhibitor at \u00b5M concentration (13.5 \u00b5M). Our findings open new perspectives to investigate on the role played by this C-glycosylated flavonoid and its analogous, typically present in wheat and in other cereals. Further studies are desirable to clarify the mechanism linked to the action of schaftoside and to test also other similar C-flavonoids on PTP1B enzyme. The International Diabetes Federation announced that the global population of diabetics in 2015 was close to 400 million, and this number could rise to 600 million in 2040. In this context, research on new functional foods that can help stem the onset of this disease in the near future is recognized as strategic. Overall, our results provide further insights on the nutraceutical potential of this fermented food, whose beneficial effects were previously demonstrated by recent in vivo and ex vivo experiments.This work improves knowledge on the composition and properties of this fermented grain, and it is the first report to focus on the content of free and bound phenolic compounds in Lisosan"}
{"text": "ObjectiveTo assess the efficacy of awareness campaign aimed at Hepatitis B and C in a rural community in Rawalpindi, Pakistan.MethodsThis is a cross-sectional study conducted on patients from a primary health care facility in Rawalpindi. The duration of the study was three months (April 2019 to June 2019). Patients who were registered at the facility were included after consent had been obtained. The data was collected through a self-constructed questionnaire. The data obtained was analyzed on IBM's statistical package for the social sciences (SPSS) version 21 .ResultsOut of 35 participants, 16 (46%) were males and 19 (54%) were females. The mean age of the participants was 43.82 \u00b1 19.56 years. The mean number of people in the house was 7.54 \u00b1 3.88. Twenty nine (84%) participants were married while six (16%) participants were not. A majority of the participants had good prior knowledge about Hepatitis B and C. However, a few confusions remained about the mode of transmission, the vector for transmission if any and vaccination protocols. The campaign proved to reinforce many concepts and clear potential confusions of the participants.ConclusionsThis attempt at improving awareness proved to be fruitful. There is a dire need to ensure that multiple activities are organized so that the burden of the disease may be reduced. There will be a strong network of communication for flow of information if the activities occur regularly and in a focused manner. Hepatitis B virus has infected over 240 million people worldwide with about half of the cases progressing to a chronic phase . SimilarHepatitis B virus (HBV) has a complex mechanism of liver injury in terms of liver damage and viral control and these factors are primarily responsible for the delayed diagnosis and subsequent progression to chronic illness. Hepatitis C virus (HCV) on the other hand has a multitude of genotypes . The mosThe route of transmission of both these viruses are more or less similar and therefore, awareness campaigns and public health awareness measures deal with both of the infections as a combined entity . The disA common misconception centers on the myth that these viruses are transmitted by insect vectors, such as mosquitoes. A few cases have been reported of drug abusers being infected with diseases due to insect vectors but hepatitis continues to be the exception.The objective of the study was to assess the efficacy of a public health awareness activity centered on a rural community at a Primary Health Care facility in Rawalpindi, Pakistan.We conducted a cross-sectional study on a small community who were enrolled at a primary health care facility\u00a0from April 2019 to June 2019. Patients who were willing to participate in the study were included. Patients who were not present on the days of the study were not included in the study.The data collection was divided into two parts. The first part of data collection was the administration of a\u00a0self-constructed questionnaire prior to providing the patients information about Hepatitis B and C. This questionnaire was developed with the help of a prior questionnaire and advice from public health education experts . There wThe responses, apart from demographic details, were all scored. Each correct answer scored one point and each wrong answer scored zero point. The \"Do not know\" response was considered a wrong answer and scored zero point.The questionnaire was distributed to all participants. All the participants were given 20 minutes to complete the questionnaire. After the data collection, all the students were given a seminar on Hepatitis B and C. A question and answer session was held after the seminar to address any queries regarding Hepatitis B and C. The same questionnaire was administered at the end of the study period for post-awareness responses.The data obtained was analyzed on IBM's statistical package for the social sciences (SPSS) version 21 .\u00a0Descriptive statistics were used to analyze and describe the data. Frequencies and percentages were calculated for qualitative variables like gender. Mean and standard deviation (SD) were calculated for quantitative variables like age.Out of 35 participants, 16 (46%) were males and 19 (54%) were females. The mean age of the participants was 43.82\u00b119.56 years. The mean monthly household income was 26114 \u00b1 12538 rupees. The mean number of people in the house was 7.54 \u00b1 3.88. Twenty nine (84%) participants were married while six (16%) participants were not. The pre-awareness and post-awareness scores were then calculated. Table Table Table This is the first study in which efficacy of an awareness activity has been investigated as opposed to prior knowledge of the people or the general prevalence of disease , 15. TheThe awareness campaign corrected the misconception that any kind of physical contact with a patient is responsible for transmitting the disease, as shown by the paired samples t-test. Many studies have detailed that exchanged of bodily fluids, for example blood, semen, vaginal secretions, as the only form of physical contact through which HBV and HCV can spread .Another misconception that the campaign corrected was the myth that carriers of the disease can marry each other, as shown by the results of the study. A study conducted in China  explainsBy the end of the activity, participants also realized that insects are responsible for spread of diseases, like dengue  and malaThere are a few limitations to the study. This is a survey and statistical analysis could not be done in detail as opposed to other study designs. The study population was focused on one community and so, has to include other communities as well. The format of the campaign was discussion based. Therefore, any participant who did not raise questions during the discussion, unfortunately, could not gain a lot from the activity.Several attempts should be made to organize multiple activities on different levels of health care setup to ensure that the objective could be met. Additionally, instead of a discussion based format, it would be more appropriate if the format included more pictorial aids.The campaign provided a great degree of information regarding HBV and HCV but there is a dire need to expand such attempts so that the vulnerable population making up the majority of the nation can be protected."}
{"text": "Microsurgery is a specialized area of surgery that demands training and research at every step. As a useful material for training, experimental methods are important for this purpose. However, ethical and economic considerations have forced scientists to seek alternative training materials. Therefore, in this study we aimed to use embalmed human ca-daver tissue, which are similar to live structures.The superior thyroid artery of a Modified Larssen Solution (MLS)-preserved cadaver was laid on saline-soaked gauze. Cannulas were fixed on both sides with silk sutures. One milliliter of saline was injected into the vessel lumen and allowed to drain from the other side. During this procedure, it was observed that the tissue caliber and turgor were suf-ficient to mimic the pulse. Subsequently, an incision was made in the middle of the artery. Adventisectomy was per-formed, and it was observed that the adventitia dissects and pierces identically to living tissues . AnastomThere is very limited information about the use of cadaver-embalming techniques in microsurgical education. One of the best representatives of this topic is a study by Wolff et al. , which uLarssen Solution was first introduced by Sampaio and modified by Guimaraes Da Silva.  It was pMLS has been reported as a feasible technique for laparoscopic and instrumentation training . Another"}
{"text": "N = 137) showed that an adapted brief version of prolonged exposure (PE) to the fearful memory of the event and situations, provided in the immediate aftermath after trauma (<72 h after a traumatic event), was effective in reducing early PTSD symptoms in rape victims. The aims of the present study were to adapt the brief PE protocol to a Swedish context and investigate its feasibility and delivery in 10 executive patients recruited at the Emergency Clinic for Rape Victims in Stockholm. Ten participants were provided with three sessions of early PE with overall successful results in terms of session attendance, home-work compliance, and also symptom reduction of PTSD and depressive symptoms. However, only a fraction of the screened patients at the Emergency Clinic (5.2%) were eligible to be included in the study, where the majority (40%) were excluded due to the time criteria of 72 h. In this article, we will present detailed results of the intervention and elaborate on how to increase feasibility of preventive interventions for rape victims. In the current form, providing PE with the strict time criteria was not feasible in the clinical setting that constitutes the Emergency Department for rape.Rape is the most common trauma leading to post-traumatic stress disorder (PTSD) among women, with a conditioned prevalence of up to 50%. PTSD is considered to be a lethal condition associated with increased risk of suicide, drug- and alcohol dependence, neurological- and vascular problems, as well as sick leave. Given the scope of this problem, novel and swiftly delivered interventions for this large vulnerable population are clearly warranted. One previous trial conducted in the United States ( Sexual assault, including sexual abuse, rape, intimate partner, and sexual violence, is a global public health concern affecting an estimated 12% of women around the world . In a reAmong women who have been exposed to rape, as much as 19\u201350% develop PTSD . Rape maN = 124) indicated that this brief video intervention could significantly reduce both marijuana misuse at 6 weeks follow-up (N = 140) by the same research group found that women with a pre-assault history of high marijuana use who were randomized to the video intervention had lower marijuana misuse scores from baseline to the 6-months follow-up (N = 164) where women randomized to the video condition had fewer anxiety symptoms at the 2-month follow-up but no main effects were found on PTSD symptoms (N = 154) compared to treatment as usual and an active control condition (pleasant imagery and relaxation instruction). Results showed that the video intervention had some efficacy in reducing substance use in rape victims with a history of sexual assault . Results showed that PE was especially effective in reducing symptoms of post-traumatic stress among the subsample of rape victims  with a medium effect size (d = 0.7) at 12 weeks. A more recent study did not replicate these promising findings when comparing the three session protocol against one session and assessment only . The clinic is one of the largest sexual assault centers in Europe with an intake of about 800 patients each year. Medical care, forensic examination, and psychological help are offered to patients in Stockholm county over 13 years who seek help within 1 month after the rape. Neither medical nor psychological help render any fee for the patient but is solely financed by the Stockholm county. The study was approved by the Regional Ethical Review Board in Stockholm, Sweden (ID:2016/2194\u201331).Eligible participants were patients of at least 18 years of age attending at the Emergency Clinic for Rape Victims at Stockholm South Hospital, Sweden, within 72 h  after experiencing a traumatic event meeting the DSM-5 criterion A for PTSD  and who had memories from the event. Exclusion criteria were (i) ongoing suicidal ideation or attempted suicide within the last 2 months, (ii) ongoing self-harm behavior, (iii) ongoing intoxication, (iv) other serious psychiatric comorbidity (ongoing psychotic symptoms or manic episode), (v) low cognitive capacity, (vi) not fluent in Swedish, and (vii) subjected to ongoing violence or threat.Recruitment was conducted in two steps. Each morning, a clinical psychologist or licensed psychotherapist did a pre-selection screening in the medical records of newly arrived patients. Eligible patients were asked to participate in the study at a routine appointment with either a clinical psychologist or a licensed psychotherapist. Patients who did not come to the routine appointment were instead reached by telephone. Patients signed informed consent at the assessment appointment and also completed the baseline battery consisting of Immediate Stress Reaction Checklist ISRC;  and BeckThe Posttraumatic Stress Disorder Checklist PCL-5; , a 20-itIn addition to the outcome measures above, we exploratory investigated if it is possible for rape victims to daily record the number of intrusive memories during treatment. This was done using a daily pen and paper diary where the participant was instructed to tick a box for the day and corresponding time period (morning/afternoon/evening/night) or indicate zero in the absence of intrusive memories. The diary was translated into Swedish by the first author and has been used in previous trials testing early provided psychological interventions .Prolonged exposure is based on The PE treatment protocol was translated to Swedish by the first author in a previous trial after it was generously made available by the study authors of the The participants were provided with the first PE session within 72 h after the rape. During the first PE session, participants were provided with a rationale of the PE treatment and the function of avoidance behaviors as maintaining symptoms of post-traumatic stress. Subsequently imaginal exposure, where the patient was instructed to revisit the memory of the rape for 20\u201330 min  and recounting the rape in present tense, was conducted together with the therapist. In order to address erroneous trauma-related cognitions, open-ended questions were used after the imaginal exposure. A voice recorder was used to record the imaginal exposure on which the patient was instructed to listen to the recording each day as homework. A technique to decrease arousal symptoms in the patient\u2019s daily life, breathing retraining, was also taught to the patient. Subsequently, two additional 60-min sessions were provided to the participants. The aim of these two sessions was to review the homework assignments and conduct additional therapist-led imaginal exposure.A total of 191 patients underwent the pre-selection screening for eligibility of which 118 (61.7%) were immediately excluded due to the following reasons: >72 h had passed since the rape , not fluent in Swedish , <18 years of age , and male gender .Seventy-three patients remained for the next phase of screening, using the digital medical records from the forensic examination. Nineteen patients  were not able to schedule an appointment with the therapist within the stipulated time frame for inclusion . Another nine patients  could not be scheduled within 72 h due to lack of available appointments in either the clinical psychologist or psychotherapists schedule. Ten additional patients  were excluded because they had no memory of the rape, and two patients (1%) were too physically ill and needed somatic care. Fourteen patients  had other serious psychiatric comorbidity and were thus excluded, and seven additional patients  did not want to be reached by the clinic personnel after the forensic examination. A total of 12 patients  were asked to participate in the study of which two patients declined further participation in the study.Mean time from the traumatic event (rape) to the start of PE was 52.1 h (SD = 11.1). Baseline characteristics for the included participants are presented in Three of the included participants dropped out from the study after the second PE session. No reason for dropping out was given in two cases. The third participant stated being exposed to another traumatic event as a reason. Seven participants were provided with the full treatment protocol. Adherence to the treatment protocol was excellent, and all PE sessions were provided according to treatment protocol. Homework compliance was high in these seven participants, ranging from 85% completion between session 2 and 3 and 100% between session 1 and 2.Data attrition was high at the 2-month follow-up; only six of the ten (60%) enrolled participants completed the CAPS-5 interview with the independent clinician. Data attrition was also high on the daily intrusion diary from session 1 to 3 where only three of ten (30%) participants had daily registrations the full treatment period.The mean score on the PCL-5 was 49.9 points (SD = 9.5) at post-treatment (end of session 3) which had reduced to 38.8 points (SD = 14.5) at the 2-month follow-up. The corresponding number for the BDI was 21.6 points (SD = 7.1) at post-treatment and 18.3 points (SD = 9.9) at the 2-month follow-up.The mean score on the CAPS-5 was 28.3 points (SD = 13.7) at the 2-month follow-up where three participants also received a diagnosis of PTSD and were offered standard PE treatment for PTSD. The mean ISI score was 12 points (SD = 4.48), the mean MSPSS point was 68 points (SD = 11.11), and the mean WHODAS score was 19.5 points (SD = 3.70) at the 2-month follow-up. No serious adverse events that could be attributed to the treatment were reported during the treatment or at the 2-month follow-up.In this study, we hypothesized that a brief PE intervention provided in the early aftermath of rape would be a feasible and acceptable early psychological treatment for PTSD in regular Swedish care. Our hypotheses were partly supported: Of the 10 included individuals, seven participants completed the full PE protocol, and these individuals had high degree of treatment adherence. Additionally, results indicated clinically meaningful reductions in PTSD symptoms in these individuals. However, it is important to point out that the treated sample consisted of only a fraction (5.2%) of the total intake at the clinic during the study period.As much as 40% of the screened sample was excluded due to the time criteria of 72 h. One well-reported factor in the literature is that only a small proportion of rape victims seek help from mental health professionals in the early aftermath of trauma  and therTen percent of the screened sample was not fluent in Swedish and therefore excluded. Translator assisted trauma focused CBT for PTSD has proven to be effective , and oneAbout one-quarter of the screened sample was excluded due to the age criteria (at least 18 years old). Previous research indicate female adolescents as victims of sexual assault in a higher, disproportionately degree . AdolescThe Emergency Clinic for Rape Victims did only provide care to female rape victims during the main execution phase of this study which unfortunately excluded an additional 10% of the screened sample. About 4\u201310% of all reported rapes include a male victim , and stuTwelve (6.2%) patients were finally asked to participate in the study, and two of these individuals declined participation. Of the 10 included participants, three participants dropped out of treatment. Homework assignment completion rate was high among the seven participants that underwent the full treatment, between 85 and 100%. One important challenge for future research is how to overcome the degree of data loss found in this study (40% of the included participants did not show up at the 2-month follow-up assessment). As previously discussed, digital innovations  may provide solutions to some of these problems. Several studies have shown promising results of smart phone assessments for several mental health problems  as well The study comes with limitations. One major limitation is that the lack of a control group to control for spontaneous fluctuations. Although the treated participants on average had a clinical meaningful decline in PTSD symptoms, this symptom reduction may as well be explained by natural recovery. However, it is important to stress that the aim of this study was merely to assess feasibility and delivery of the PE protocol. Future studies should consequently use a parallel group design to investigate efficacy of this treatment with extended time criteria. Another limitation in this study was that the independent assessor was not blinded to the aim study hypothesis and time-point, and thus, the mean scores on the CAPS-5 should be interpreted with caution. We also used a \u201csupervision on demand\u201d approach which means that we did not make a systematic control for treatment fidelity of the intervention. Future research may want to investigate this issue in more detail and to investigate possible therapist drifts when providing early PE interventions. The low rate of eligible patients to recruit also poses a major limitation. Comparing these figures with previous studies on early interventions after trauma shows that a low rate of eligibility and recruitment is unfortunately common stressing the need for the field overall of finding ways around it .To summarize, early provided PE seems to be an acceptable and deliverable intervention for rape victims. However, of the 191 screened patients, we were only able to include 10 participants (5.2% of the screened sample) in the study. The main reason for this was an inability to recruit participants in the stipulated time window for this study of 72 h. We suggest an alternative approach which includes offering the first intervention session when the patients present irrespective of time since rape and also to develop remotely delivered interventions. Complementary interventions, delivered through other formats , that are easily accessible \u2013 irrespective of gender, language barriers, and geographical distances \u2013 are clearly needed in order to swiftly reach the millions of rape victims around the globe.The raw data supporting the conclusions of this article will be made available by the authors upon request given that the request comply with Swedish and EU laws regulating protection of identifiable data.The studies involving human participants were reviewed and approved by the Regional Ethical Review Board in Stockholm, Sweden (ID:2016/2194\u201331). The patients/participants provided their written informed consent to participate in this study.KL and LN conducted the data collection. MB and EA performed the data analysis and interpretation, and first draft of the article. All authors contributed to the study design and writing of the article, and read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "The coronavirus disease 2019 (COVID-19) pandemic is likely to lead to a significant increase in mental health disorders among healthcare workers (HCW).We evaluated the rates of anxiety, depressive and post-traumatic stress disorder (PTSD) symptoms in a population of HCW in the UK.An electronic survey was conducted between the 5 June 2020 and 31 July 2020 of all hospital HCW in the West Midlands, UK using clinically validated questionnaires: the 4-item Patient Health Questionnaire(PHQ-4) and the Impact of Event Scale-Revised (IES-R). Univariate analyses and adjusted logistic regression analyses were performed to estimate the strengths in associations between 24 independent variables and anxiety, depressive or PTSD symptoms.P < 0.001), depression  and PTSD . The availability of adequate personal protective equipment (PPE), well-being support and lower exposure to moral dilemmas at work demonstrated significant negative associations with these symptoms (P \u2264 0.001).There were 2638 eligible participants who completed the survey . The rates of clinically significant symptoms of anxiety, depression and PTSD were 34.3%, 31.2% and 24.5%, respectively. In adjusted analysis a history of mental health conditions was associated with clinically significant symptoms of anxiety (odds ratio (OR) = 2.3, 95% CI 1.9\u20132.7, We report higher rates of clinically significant mental health symptoms among hospital HCW following the initial COVID-19 pandemic peak in the UK. Those with a history of mental health conditions were most at risk. Adequate PPE availability, access to well-being support and reduced exposure to moral dilemmas may protect hospital HCW from mental health symptoms. As of August 2020, the UK had recorded the fifth highest number of deaths from COVID-19 worldwide.19 This region also observed a high incidence of COVID-19 cases and a high mortality rate.20 The study was approved by the UK Health Research Authority . Research Ethics Committee approval was not required for this study and this was confirmed by the HRA. Site-specific approval was obtained from each of the research and development departments of all participating acute general (n\u00a0=\u00a07) and mental health (n\u00a0=\u00a03) NHS hospital Trusts. Informed consent was obtained from all participants and recorded electronically at the start of the study.A cross-sectional survey of HCW employed in ten NHS acute general and mental health hospitals set in the West Midlands, UK was conducted between the 5 June 2020 and the 31 July 2020. The county has an ethnically and socioeconomically diverse population.Eligible participants included all staff who worked or volunteered on-site at one of the participating hospitals for over 50% of their working week during the initial peak of the COVID-19 pandemic in the UK. For this study, the latter was defined as the 23 March 2020 to the 23 May 2020. Staff who were on any type of leave for over 50% of the time during this period and those working from home or based in the community were not eligible to take part in this study. Eligible participants were invited to complete a confidential, voluntary electronic survey using the SurveyMonkey  online survey administration and management platform. The survey was approximately 15 minutes long. It was distributed to participants via email, newsletters, posters, flyers and social media platforms to maximise reach and encourage participation.The survey collected self-reported data on 24 independent variables . These i22 The Impact of Event Scale-Revised (IES-R) score was used to assess symptoms of PTSD.23The 4-item Patient Health Questionnaire (PHQ-4) was used to assess symptoms of anxiety and depression.21 The corresponding figures for the depression subscale were 83% and 90%, respectively, for major depressive disorder.22 The sensitivity and specificity of the IES-R has been reported as 91% and 82%, respectively, for a diagnosis of PTSD, where the cut-off score was\u00a0\u226533.23 In this study, we used a score of \u22653 for each subscale of the PHQ-4 as the threshold score to detect the presence of clinically significant symptoms of anxiety and depression, and a score of \u00a0\u226533 on the IES-R as the threshold score to detect the presence of clinically significant symptoms of PTSD.The psychometric properties of the PHQ-4 were acceptable as a screening tool. Studies have reported a sensitivity of 86% and specificity of 83% for generalised anxiety disorder on the anxiety subscale for scores \u22653.2-tests to assess the significance of association. Adjusted analysis using binary logistic regression modelling was performed to obtain odds ratios (ORs) and 95% CIs.Data were collated using Microsoft Excel  and summarised as median (interquartile range) for non-normal data, and as proportions (percentage) for categorical data. Statistical analysis was performed using SPSS V.25 . The rates of mental health symptoms were calculated. For the categorical survey responses that were returned as \u2018prefer not to say\u2019 or \u2018unsure,\u2019 where combined analysis with the other responses was not possible, these were treated as missing data during statistical analysis. Univariate (unadjusted) analysis of measurements was performed for 24 predetermined, independent exposure variables using \u03c7P-value of less than 0.05 was assigned as the level of statistical significance.The regression analysis was conducted separately for each dependent variable , depressive  and PTSD (IES-R \u2265\u00a033) symptoms), against all 24 measured independent variables to identify factors demonstrating a significant association for each symptom group. Multicollinearity of the 24 independent variables was assessed by calculating their variance inflation factors (VIFs). A n\u00a0=\u00a02096, 79.5%) were women and 19.9% (n\u00a0=\u00a0524) were men  respondents did not disclose their gender. Nearly a fifth  belonged to Black, Asian and minority ethnic (BAME) groups. The majority  were in a relationship and nearly half  had dependents. In total, 84.0% (n\u00a0=\u00a02216) of participants were UK residents since childhood, the remainder emigrated as adults.A total of 2706 participants completed the survey of whom only 2638 met the eligibility criteria. Their median age was 42 years (interquartile range (IQR)\u00a0=\u00a032\u201351). The majority  reported a history of mental health conditions and 78.2% (n\u00a0=\u00a0769) of these participants were prescribed medication or psychological therapies. Approximately a quarter  reported a history of physical illness. Smokers accounted for 11.4% (n\u00a0=\u00a0301) of the sample and 65.4% (n\u00a0=\u00a01725) consumed alcohol.Around two-fifths , followed by doctors . Many staff  performing various other roles within the hospitals also took part in the survey (Supplementary Table 1 available at https://doi.org/10.1192/bjo.2020.150).Most respondents were nurses  had worked in healthcare for 10 years or less. The majority worked in acute general hospitals  and the remainder at mental health hospitals . A minority  were uncertain of their hospital type. Staff were based on in-patient wards , on intensive therapy units , in emergency departments  and other locations within their respective hospitals . The majority of participants  reported that they undertook patient-facing duties .A third of participants  reported that adequate PPE was available at their workplace , were unsure  or preferred not to comment . The majority were aware of well-being measures implemented by their employer  but only 15.4% (n\u00a0=\u00a0405) accessed any form of psychological support during the study period. A third  of participants were redeployed as a result of the pandemic and 38.5% (n\u00a0=\u00a01015) reported increased working hours. In addition, 51.2% (n\u00a0=\u00a01351) reported morally uncomfortable changes in the way they worked.Just over a half , this was either confirmed on polymerase chain reaction testing of nasopharyngeal swabs (n\u00a0=\u00a0277), diagnosed by a clinician (n\u00a0=\u00a047) or self-diagnosed based on symptoms and Public Health England guidance (n\u00a0=\u00a0396). Approximately a fifth of staff  also reported that a cohabitant had developed COVID-19 during the period in question. Only 17.1% (n\u00a0=\u00a0452) reported an admission to hospital with COVID-19 for self, or a close family member or friend.Of those who reported a diagnosis of COVID-19 (n\u00a0=\u00a0906) scored \u22653; on the depression subscale of the PHQ-4, 31.2% (n\u00a0=\u00a0824) scored \u22653 and 24.5% (n\u00a0=\u00a0647) scored \u226533 on the IES-R .On the anxiety subscale of the PHQ-4, 34.3%  for each of the dependent variables: anxiety, depression and PTSD symptoms using the clinically significant thresholds previously stated. All 24 independent variables considered in the univariate analysis were included in the regression analysis. An assessment of multicollinearity of the 24 independent variables revealed all the VIFs to be less than 2 (maximum 1.6), indicating the validity of including all these independent variables in the logistic regression modelling.P\u00a0\u2264\u00a00.001)  .Table 3P\u00a0<\u00a00.001). Doctors and nurses were 20% less likely to report anxiety compared with other hospital HCW . Furthermore, those who reported adequate PPE availability, well-being support availability and where no morally uncomfortable changes took place, were around 50% less likely to have anxiety symptoms . A history of mental health conditions had the strongest association, with two and half times greater odds of hospital HCW reporting depressive symptoms . There was an almost twofold increase in odds of depressive symptoms when the participant was based in an acute general hospital compared with a mental health setting . On the other hand, alcohol consumers were 20% less likely to experience these symptoms . Furthermore, staff with adequate PPE availability, adequate well-being support and those who did not report morally uncomfortable changes in the way they worked were up to 50% less likely to report depressive symptoms . Several exposures were associated with increased likelihood of clinically significant PTSD symptoms: female gender, history of physical illness, smoking, being based on in-patient wards, in emergency departments or on ITUs, redeployment and admission to hospital for self, a close family or friend with COVID-19 . There were no significant associations between the remaining exposures and PTSD symptoms (Supplementary Table 2).There were 30\u201350% less odds of clinically significant PTSD symptoms when there were adequate PPE and well-being support available  reported a baseline rate of clinically significant PTSD symptoms  among 15\u201316% of HCW from the UK.7 Differences could be attributed to a multitude of factors including cultural, political and socioeconomic variations across the two study populations.The higher rates of mental health symptoms identified in the current study might be associated with working in a hospital setting during the COVID-19 pandemic. Nevertheless, the rates of symptoms of anxiety and depression among HCW in this study is lower compared with data from China that reported rates of anxiety of 40.6%; of depression of 50.4%, of sleep disturbance of 34% and of distress of 71.5%.In our adjusted analysis a previous history of mental health conditions consistently demonstrated odds of greater than two in participants reporting clinically significant symptoms of anxiety, depression and PTSD. In contrast, the availability of adequate PPE, access to well-being support and not experiencing morally uncomfortable changes in the way they worked were all significantly negatively associated with participants reporting these symptoms.Younger participants aged 40 or under demonstrated greater odds of reporting clinically significant anxiety symptoms. Smoking was associated with depression and PTSD symptoms but not anxiety. Female gender and a hospital admission for self, or a close family member or a friend were associated with anxiety and PTSD symptoms but not depression. Several other exposures were associated with PTSD symptoms but not anxiety or depression .Our findings may prompt healthcare employers to focus their attention on the provision of specific interventions that may protect HCW against an adverse impact on mental health during crises such as the COVID-19 pandemic. These may include the provision of greater access to well-being support for staff, ensuring the availability of adequate PPE and protection from exposure to moral dilemmas in the workplace.Furthermore, careful workforce planning to mitigate the adverse effects of redeployment and minimising the risk of viral infection may reduce the risk of staff experiencing PTSD symptoms. Attention should also be given to staff at greater risk such as those with a history of mental health conditions, female staff and smokers. Special consideration and additional support in the workplace could also be considered for younger employees, redeployed staff members and those working in potentially high-risk areas There were some unexpected findings in this analysis. One such finding was the protective effect working as a doctor or a nurse had on participants reporting clinically significant symptoms of anxiety and PTSD. This could be attributed to factors such as training, experience and coping mechanisms or resilience from previous working practices in stressful healthcare environments. Furthermore, there was no statistically significant increase in odds of self-reported mental health symptoms among staff undertaking patient-facing duties compared with staff in other roles. Therefore, it is important to ensure support is available to staff in all job roles who may potentially be at risk and not just front-line clinical staff.We also observed reduced odds of clinically significant symptoms of depression and PTSD reported by participants who consumed any amount of alcohol. The clinical significance and relevance of the latter association are unknown.There were some limitations in our study. The time elapsed between traumatic exposure and the onset of symptoms is key to making a diagnosis of PTSD. However, the aim of the study was not to make diagnoses of mental health disorders but to screen the target population for the presence of clinically concerning symptoms. The survey was conducted relatively close to the duration of the UK's COVID-19 pandemic peak. The elevated scores on the IES-R may be representative of an acute stress reaction that usually resolves within a few months. Further follow-up of these participants is required to ascertain the persistence of symptoms \u2013 a planned analysis by our study group. Our data is from a cross-sectional survey. Therefore, causal inferences cannot be made. Furthermore, the data were collected through a self-report questionnaire, which is at risk of responder bias.There were also several strengths. This study is one of the first in the UK to report on the mental health impact on hospital staff of working during the COVID-19 pandemic. These findings may be generalisable to the wider UK population of hospital employees given the relatively large sample size and representative demographic sample (Supplementary Table 3).In conclusion, during the COVID-19 pandemic, there were higher rates of common mental health symptoms in hospital HCW in the UK, especially among those with a history of mental health conditions. Occupational interventions such as adequate PPE and well-being support availability, and reduced exposure to moral dilemmas appear to protect hospital HCW against these symptoms."}
{"text": "Donkeys originally evolved as a desert animal, and unlike the horse (which flees or runs away from danger), the donkey fights to avert danger. Hence, donkeys are more stoic and tend to express fear, pain, and discomfort in more subtle ways than horses. For owners and practitioners, it can prove to be challenging to identify donkeys in a state of pain or discomfort until the animal has reached an advanced degree of disease, at which point veterinary intervention may be too late. This study aims to identify signs of pain from both facial and body parameters in donkeys undergoing a surgical procedure. Scores were based on noted signs of discomfort/pain from the observed body language of the face, such as the eyes, ears, nose, nostrils, and muzzle, along with their overall body appearance. The study demonstrated that developing a scoring system donkey grimace scale proved to be accurate in identifying discomfort related to pain. However, the accuracy of the scale can be influenced by the observers\u2019 gender, level of donkey knowledge, and experience.p < 0.001), affected observers\u2019 ability to accurately score images. The study suggests that the most significant indicators of pain in donkeys are overall appearance and abnormal body stance provided their sensitivity, specificity and accuracy values of 63.18%, 62.07%, and 62.60%, respectively.The objectives of this study were to establish a donkey ethogram, followed by a donkey grimace scale to be applied to donkeys pre- and post-castration and to test if there was a notable difference in scores based on observer knowledge, gender, and experience, which could reveal possible discomfort/pain. Nine healthy male adult donkeys were surgically castrated. Fifty-four photos were selected from frontal, lateral, and body views taken pre- and post-castration. Observers ranging from minimal to extensive knowledge and levels of experience based on education and hours/month spent with donkeys scored six photos/donkey on a scale of 0\u20132 . Scores were based on body language and facial parameters: Ears down, ears back, eye white showing, glazed look, orbital tightening, eyes round shape, nostril tension, eyes narrow shape, muzzle tension, and abnormal stance and overall perception of the animal being in pain. Level of experience and knowledge, as well as gender significantly ( The misconception that donkeys do not feel pain to the degree that horses do, by suggesting donkeys have a higher level of pain tolerance, combined with a difficulty to identify indicators of pain in donkeys , has likAnimal pain has been described as \u201can aversive sensory experience that elicits protective motor actions, results in avoidance and may modify species-specific traits of behavior, including social behavior\u201d . Since aAs donkeys become increasingly popular as companion animals along with the use of donkeys for draft animals and growing use for production , there is a growing need to understand more about their behavior related to their overall well-being from both an owner and veterinary perspective. Previous studies have yielded facial expression ethograms  and compNine adult male standard donkeys , ranging from 2 to 10 years old were photographed pre- and post-castration. All donkeys were clinically evaluated by the attending veterinarian  and his team. Any donkey not deemed healthy based on physiological parameters and overall appearance did not undergo castration. The evaluation of pain based on the evidence reported by Dyson et al. , who sugDonkeys were acclimated to the farm and arrived 10 days before surgery and housed in a group in paddocks with shelter, ad libitum hay, and free access to water. All donkeys were part of a private donkey rescue.A total of 270 photographs were initially taken for the present study. All photos were taken with an Apple mini iPad . The photos were identified depending on whether they were taken pre- or post-castration. Five photos were taken of each donkey from the following positions: One frontal photograph, one lateral photograph from the right side, one lateral photograph from the left side, one body photograph from the right side and one body photograph from the left. Each donkey was photographed 48 h, 24 h, 0 h before surgery and 8 h, 24 h and 48 h post-surgery on the farm. Fifty-four photos were randomly selected (27 pre- and 27 post-castration) to build the materials used for the surveys as suggested by Dalla Costa et al. , seekingDonkeys were anesthetized beginning in the morning by a standard xylazine/ketamine protocol : xylazinTwelve observers  with ages ranging from 20 to 70 years volunteered to participate in the donkey ethogram training and castration image survey. Those who volunteered had various levels of donkey experience and knowledge and included veterinarians, veterinary students, researchers, and donkey owners or were a combination of the aforementioned descriptors. All levels of knowledge and experience were equally represented in their frequency in the sample. All observers were then placed into categories based on the amount of time they spent with donkeys (interaction); minimal (<4 h/month), intermediate (4\u20136 h/month), and extensive (>6 h/month), and knowledge: Minimal , moderate , and extensive knowledge . Observer sample distributed across knowledge and experience levels as follows\u201433.3% of the observers presented minimal interaction with donkeys and minimal knowledge, 25% of the observers presented intermediate interaction with donkeys and moderate knowledge, and 41.7% of the observers presented extensive interaction with donkeys and extensive knowledge. The observers in the sample were chosen seeking an almost-equal representation of sexes, interaction and knowledge levels, to prevent the bias derived from the potential overrepresentation of some categories over the rest.An ethogram displaying key body language often used to evaluate pain in other animals was developed to train observers to evaluate this body language for signs of change Refer to . Each obThe survey included 54 photographs taken with an Apple mini iPad, six pictures per donkey: Lateral, frontal head, and lateral body view (one pre and post castration photograph/view). Each observer took the survey once per day on their own device , for three consecutive days to ensure intraobserver reliability. Photographs were presented in a digital form and survey to the observers in the same order on each consecutive day. Observers were blinded to the treatment of each donkey photograph, meaning the observer did not know whether each picture was pre-castration or post-castration. The database comprised of 18,072 scores.Observers were asked to score eleven parameters per photograph of each of the nine donkeys. The observer responded with a score ranging from 0 to 2  for each of the body language and facial parameters: Ears down, ears back, eye white showing, glazed look, orbital tightening, eyes round shape, nostril tension, eyes narrow shape, muzzle tension, and abnormal stance . The obsInterobserver reliability was assessed at two levels. First, the measurements of every observer were compared for days one to three, and second, measurements of scores across the total panel for the summation of all three days were compared. Intraobserver reliability was tested by comparing the responses of the same observer over three consecutive days scoring the survey. The intraclass correlation coefficient of the Reliability Analysis procedure of the Scale package in SPSS Statistics, Version 25.0, IBM Corp., Armonk, NY, USA, (2017) was used to assess inter (across observers) and intraobserver (for the observations of the same observer across the different days) reliability. Responses were then classified as successful or not, depending on whether the observers had identified signs of discomfort related to pain or not compared to pre-castration images ,21. Per p > 0.01), a nonparametric approach was considered. Frequency analysis and Pearson\u2019s Chi-squared were performed to test for differences in the probability of success to identify pain signs  across factors: Castration status, observer gender, donkey knowledge, donkey interaction, body language. Frequency analysis and Pearson\u2019s Chi-squared were performed using the Crosstab task from the descriptive statistics procedure in SPSS Statistics, Version 25.0, IBM Corp. (2017). Pearson\u2019s chi-square test is used to determine whether there is a statistically significant difference between the expected frequencies and the observed frequencies in one or more categories of a contingency table [Before testing for the probability of success to identify signs of pain, Kolmogorov-Smirnov  and Levecy table , with eacy table ). As stacy table , when saOverall sensitivity, specificity, and accuracy were computed to determine the efficacy of the technique to report a comprehensive, accurate assessment of pain-related body language signs across body areas and on the whole, as a way to identify potential body language which should be considered better predictors for pain-related conditions versus those which may report misleading information. Sensitivity is the percentage of donkeys\u2019 post castration being identified as in pain. Specificity is the percentage of donkeys pre castration being identified as not in pain. Accuracy is the likelihood of detecting either a true positive or true negative .The study was reviewed and approved by the University of California Davis\u2019 Institutional Animal Care and Use Committee, but no protocol number was given, since only observations were being conducted by the research team. Castrations were scheduled and performed by a veterinary nongovernmental organization on-farm (in the field) independent of the study. No additional permission was needed following the recommendations of Royal Decree-Law 53/2013 and its credited entity, the Ethics Committee of Animal Experimentation from the University of C\u00f3rdoba, given the application of the protocols present in this study followed the premises cited in the 5th section of its 2nd article, as the animals assessed were used for credited zootechnical use.All observers showed a Cronbach\u2019s \u03b1 parameter above 0.70 (average measures), suggesting that each observer reliably scored across all test days. Reliability coefficients  above 0.85 are generally regarded as high and those between 0.65 and 0.85 as moderate. The total panel across all three days reported a Cronbach\u2019s \u03b1 parameter above 0.90 (average measures), suggesting total panel reliably scored across days. It was likely for the panel to score the same for the same photo on the three repeated sessions. Additionally, interobserver reliability for the whole panel was tested, and the value of 0.97 (average measures) suggests agreement between observers was excellent. Hence, any of the members is valid, reliable, and provides consistent enough measures to be considered independently.p < 0.001) difference between female and male observers in their ability to correctly identify signs of pain after castration (2). Partial eta squared (\u03b7p2) was 0.08, which meant that the effect of gender accounted for 8% of the differences in knowledge plus associated error variance. Sample size and possible factor combinations were not sufficient to justify the performance of univariate follow-up statistical analyses to determine whether significant differences could be ascribed to the interaction between knowledge and gender\u2014however, these factors separately, as some of the categories, could be misrepresented. The study of the interaction between knowledge and gender may imply the multiplication of the number of possibilities within the interaction factor. Hence, instead of considering two variables (knowledge and gender) with two  and three levels , respectively, we would be considering one variable (knowledge level-gender) with six levels . Then, in the context of our sample and to maintain the balance in the representativity of each possibility, clustering both variables under an interaction term may reduce the frequency of cases across levels to two cases per level. This offers lower chances to compare than in a case in which the variables of knowledge level and gender are considered separately [There was a significant  were found for the distribution of the intensity of signs identified by the observers between pre castration and post castration images , therefore the subtle signs of pain may go unnoticed. Even when the disease or condition becomes chronic, the signs may remain unnoticed, due to the donkey having become habituated to the discomfort. This study began to define signs of discomfort related to pain in an acute phase versus chronic, in hopes of providing a tool to assist practitioners and owners in noticing these subtle behavioral changes and ultimately lead to providing treatment for pain ,34,35,36The ability to recognize signs of pain in this study was significantly dependent on gender , experieResults of the present study indicated that observers with more donkey experience and knowledge are less likely to miss indicators of pain . This is likely because by spending more time observing donkeys, one may become more skilled at noticing behavioral deviations from \u201cnormal\u201d, and therefore, be more likely to pick up on subtle signs. These results suggest that practitioners and owners can become more successful at identifying when a donkey is painful by spending more time observing and becoming familiar with donkey behavior in general. Previous studies examining donkey behavior have confirmed that because donkeys demonstrate different clinical signs of pain/illness when compared to horses, previous knowledge and an understanding of the donkey can be crucial to correct examination, diagnosis and medical treatment of the donkey ,21,35,36Practitioners and owners should be aware of differences between donkey and horse medication dosages, and appropriate donkey dosages should be administered ,21,35,36The ability to recognize subtle body language signals may prove to be challenging to those who have limited experience working with donkeys. Observing the overall body posture and reactions of donkeys may improve our chances of recognizing pain in donkeys. This indicates the importance of observing more than just the face of the donkey to identify signs of pain. Facial indicators, such as ears, eyes, and nostrils, may be more easily influenced by external factors, such as other donkeys and the environment of the donkeys, thus it is important to look at the donkey as a whole for signs of behavior related to pain. Gender, experience or interaction with donkeys, and knowledge level of observers impacted the observer\u2019s ability to correctly score a post castration donkey as painful. Female observers were more likely than male observers to provide a higher score for post castration pictures and were less likely to score a false-positive. By spending more time observing donkeys, one may become more skilled at noticing behavioral deviations from \u201cnormal\u201d, and therefore, be more likely to pick up on subtle signs. Conclusively, identifying the appearance of a normal donkey may assist in decreasing the number of donkeys that go untreated, due to the subtleness of their behavioral pain indicators, as the biggest obstacle of treating pain in donkeys may be identifying the pain in the first place."}
{"text": "Subsequently, they were treated daily with either placebo or MZe786 for six days, when the heart tissue was harvested to assess cardiac mitochondrial activity. Here, we show that the loss of HO-1 disturbed cardiac mitochondrial respiration and reduced mitochondrial biogenesis. The overexpression of sFlt-1 resulted in the inhibition of the cardiac mitochondrial activity in Hmox1+/\u2212 mice. The present study demonstrates that the hydrogen sulfide (H2S) releasing molecule, MZe786, rescues mitochondrial activity by stimulating cardiac mitochondrial biogenesis and antioxidant defense in Hmox1\u2212/\u2212 mice and in Hmox1+/\u2212 mice exposed to a high sFlt-1 environment.Hypertensive disorder in pregnancy is a major cause of maternal and perinatal mortality worldwide. Women who have had preeclampsia are at three to four times higher risk in later life of developing high blood pressure and heart disease. Soluble Flt-1 (sFlt-1) is elevated in preeclampsia and may remain high postpartum in women with a history of preeclampsia. Heme oxygenase-1 (Hmox1/HO-1) exerts protective effects against oxidative stimuli and is compromised in the placenta of pregnant women with preeclampsia. We hypothesized that sFlt-1 inhibits cardiac mitochondrial activity in HO-1 deficient mice. HO-1 haplo-insufficient mice (Hmox1 Preeclampsia is a pregnancy-related complication that affects more than 10 million women a year and is the leading cause of maternal and perinatal morbidity and mortality worldwide ,3. It isIn the last decade, the hypothesis that preeclampsia arises due to \u201cincrease in the level of endogenous soluble Flt-1 (sFlt-1) that may antagonize the beneficial effects of vascular endothelial growth factor (VEGF)\u201d  has been2S) belongs to a family of labile biological mediators called gasotransmitters. It is synthesized by numerous mammalian tissues by three enzymes\u2014cystathionine \u03b3-lyase (CSE), cystathionine \u03b2-synthetase (CBS), and 3-mercaptopyruvate sulfurtransferase (3-MST) [2S inhibited oxidative stress through cysteine S-thiol to scavenge free radicals in the atherosclerosis mouse model [2S has also been shown to promote vasodilatation [2S and other gasotransmitters, such as HO-1 by-product, carbon monoxide (CO), was suggested to modulate vascular function. H2S may have a role in the control of CO bioavailability under specific pathophysiological conditions [2S donor increased HO-1 and its by-product CO [2S in volume overload-induced Chronic Heart Failure (CHF) in rats and demonstrated that H2S may play a protective role in volume overload-induced CHF by upregulating HO-1 [Hydrogen sulfide (H (3-MST) . Many re (3-MST) ,32. H2S se model  and actise model . H2S haslatation , exhibitlatation , protectlatation , and stilatation . Interplnditions . Human moduct CO . Anothering HO-1 .2S-releasing molecule, which protects the gastric mucosa from its anti-cyclooxygenase activity [2S release helps to rebalance the redox system as a result of increased H2S/gluthathione (GSH) formation, increased HO-1 promoter activity and reduced 8-isoprostane. MZe786 has also been shown to improve endothelial function in animal models of ischemia-reperfusion injury, possibly by modulating levels of glutathione and homosysteine [MZe786 is a novel synthesis Hactivity . H2S relsysteine ,44. +/\u2212 mice. We further tested whether a hydrogen sulfide-releasing molecule, MZe786, could rescue sFlt-1-induced mitochondrial dysfunction in the heart of Hmox1\u2212/\u2212 mice. We have previously demonstrated using serum obtained from women with preeclampsia that increased levels of sFlt-1 leads to metabolic perturbations accountable for mitochondrial dysfunction in cultured endothelial cells. Furthermore, sFlt-1 exacerbated mitochondrial reactive oxygen species formation and mitochondrial membrane potential dissipation . As the Recombinant adenovirus-encoding mouse sFlt-1 (Ad-sFlt-1) under the control of the CMV promoter was a gift from Professor Richard Mulligan  and adenovirus containing the CMV promoter without an insert (Ad-CMV) was purchased from Vector Biolabs, Pennsylvania, USA and stored at \u221280 \u00b0C. All animal experiments were carried out using procedures approved by the Aston University Ethical Review Committee in compliance with the UK Home Office License Number 3003453 in accordance with the \u201cGuidance on the operation of Animals\u201d under the United Kingdom Animals (Scientific Procedures) Act 1986.2S-releasing dithio-thione moiety, synthesized by Professor Anna Sparatore. The drug was prepared in a drug carrier (0.5% carboxymethyl cellulose in PBS) fresh every day.MZe786  phenyl ester; chemical structure of MZe786, as shown +/\u2212) mice were originally obtained from Professor Anupam Agarwal . Female wildtype (Hmox1+/+), Hmox1+/\u2212, or knockout (Hmox1\u2212/\u2212) mice between the ages of twelve to twenty weeks were used. Mice lacking HO-1  received the drug carrier or 50 mg/kg of MZe786 treatment via gavage for six days before the heart was harvested for analysis. Animals were injected with 0.5 \u00d7 109 PFU/mL Ad-sFlt-1 or empty vector (Ad-CMV) via the tail vein. Dose titration studies were used to determine the non-toxic dose of Ad-sFlt-1 and 0.5 \u00d7 109 PFU increased sFlt-1 expression without inducing any toxic effect in mice. Mice were euthanized via cervical dislocation and the heart was harvested.Heterozygous Hmox1  and centrifuged at 10,000\u00d7 g for 6 min at 4 \u00b0C. The pellet was re-suspended in 1.2 mL 15% Percoll in BSA-free MIM. In a separate tube, a gradient of Percoll was prepared by adding 1.2 mL 24% Percoll followed by 1.5 mL 40% Percoll (prepared in BSA-free MIM) added to the bottom of the tube. Next, the pellet was slowly layered on top of the 24% Percoll. A visible layer (mitochondria) was observed between the 24 and 40% Percoll layers after centrifuging the tube at 30,000\u00d7 g for 8 min at 4 \u00b0C. The mitochondrial layer was collected using a 5 mL syringe needle and transferred to a new tube containing 2 mL BSA-free MIM and centrifuged at 16,000\u00d7 g for 10 min at 4 \u00b0C. The pellet was transferred to a separate tube containing 5 mL BSA-free MIM and centrifuged at 7000\u00d7 g for 10 min at 4 \u00b0C, after which the final pellet was collected and re-suspended in 50 \u03bcL BSA-free MIM. The total protein content was determined using the Bradford Assay Reagent .Mitochondria were isolated from mouse hearts by homogenization and density gradient centrifugation using a method adapted from Sakamuri et al. . Mice we2, 10 mM KH2PO4, 0.2% (w/v) fatty acid-free BSA, pH 7.4).Mitochondrial respiration was assessed using an XF24 Extracellular Flux Analyzer  using a method adapted from Boutagy et al. . In prepg for 10 min at 4 \u00b0C to allow mitochondria to attach to the plate bottom. Then, 450 \u03bcL of pre-warmed MAM-containing substrate was added to the respective wells. Finally, the microplates were incubated for 10 min at 37 \u00b0C in a non-CO2 incubator before the measurement of mitochondrial respiration was started. Once in the XF24 Analyzer, oxygen consumption rates were calculated by plotting oxygen concentration (pmol O2) vs. time (min). Mitochondrial oxygen consumption was measured after the sequential injections of ADP 1 mM, 2 \u03bcM oligomycin (ATP synthase inhibitor), FCCP 4 \u03bcM, and antimycin A 4 \u03bcM. Oxygen consumption rates measured after ADP injections are representative of the maximal coupled respiration, or state 3. To determine the oxygen consumption rate following the ATP/ADP ratio approaching equilibrium, we measured the rates of oxygen consumption after oligomycin injection (state 4o). For these parameters, states 3 and 4o were used to quantify the behavior of mitochondria by calculating the RCR, calculated by dividing the respiration determined in state 3 by that in state 4o [To effectively determine the mitochondrial activity in response to complex I and II substrates, MAM was supplemented with either: (a) 10 mM pyruvate/2 mM malate; (b) 10 mM succinate/2 \u03bcM rotenone; (c) 40 \u03bcM palmitoyl-L-carnitine/2 mM malate. MAM containing only substrate was loaded to blank wells A1, C3, B4, and D6. After plating the mitochondria, the microplate was centrifuged at 2000\u00d7 \u00ae 480 SYBR\u00ae Green I Master  and its specific primers. RT-PCR was performed using the following run conditions: Pre-incubation (1 cycle); amplification (45 cycles); melting curve (1 cycle); cooling (1 cycle). Relative gene expression was calculated using the 2\u2212\u0394\u0394CT method. A comparison of ND1 DNA expression, relative to HK2 DNA expression, provided a measure of the mtDNA copy number to nDNA copy number ratio (mtDNA/nDNA) [RNA was extracted from heart tissue using the RNeasy mini-kit  and quantified using the Nanodrop ND 1000 spectrophotometer . RNA was converted to cDNA using the EvoScript Universal cDNA Master  as indicated by the manufacturers\u2019 guidelines. The relative expressions of mouse genes\u2014PGC1-\u03b1, thioredoxin (Txn1), glutaredoxin (Glrx), hexokinase 2 (HK2), and ND1\u2014were quantified by real-time PCR on a Lightcycler 480  using the LightCyclerNA/nDNA) .p < 0.05, p < 0.01, and p < 0.001 were considered statistically significant.Data were plotted as means \u00b1 SEM. Statistical analysis was performed using Kruskal\u2013Wallis with Dunn\u2019s post hoc test, using GraphPad Prism software . Values of \u2212/\u2212 mice. Using a XF24 Seahorse Analyzer, we evaluated the capacity of mitochondria for substrate oxidation by calculating the mitochondrial respiratory control ratio (RCR). The RCR is defined as the respiration in state 3 divided by that in state 4o [HO-1 has been proposed to exert cytoprotective effects over oxidative stress-mediated hypertrophy, fibrosis, and metabolic dysregulation in heart tissue . From a state 4o . \u2212/\u2212 mice displayed a significant reduction in the calculated RCR when compared to Hmox1+/+ (p = 0.003). The administration of MZe786 to Hmox1\u2212/\u2212 mice showed a significant restoration in this parameter in comparison to Hmox1\u2212/\u2212 cardiac mitochondria (p = 0.0159), as shown in \u2212/\u2212 mice for the oxidation of palmitoyl-L-carnitine. Our results show a significant compromise in fatty acid oxidation in the absence of HO-1, as shown in +/+ (p = 0.004). Similar to pyruvate-dependent complex I activity, MZe786 was able to improve the oxidation of palmitoyl-L-carnitine in comparison to Hmox1\u2212/\u2212 mice (p = 0.03). Correspondingly, we explored the ability of cardiac mitochondria for the oxidation of succinate (complex II substrate) in the presence of rotenone (complex I inhibitor). State 3 and state 4o respiration was used to calculate the RCR, as shown in \u2212/\u2212 mitochondria are less able to respire using succinate as a substrate (p = 0.0034). Interestingly, MZe786 protected complex II-driven OXPHOS improved the calculated RCR when compared to Hmox1\u2212/\u2212 hearts (p = 0.01), as shown in First, we measured the ability of cardiac mitochondria for the oxidation of pyruvate and palmitoyl-L-carnitine at the mitochondrial complex I in the presence of malate (complex II inhibitor) by calculating the RCR. Oxygen consumption rates representative of state 3 and state 4o respiration were used to calculate the RCR, as shown in Once we established that the loss of HO-1 leads to signs of mitochondrial dysfunction in the heart, we sought to evaluate the role of MZe786 in the restoration of the cardiac mitochondrial function. As previously reported, peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1-\u03b1) plays a key role in cardiac metabolism by enhancing the mitochondrial biogenesis signal ,54 and pp = 0.0013). MZe786 significantly increased PGC1-\u03b1 transcription when compared to wild type (p = 0.0014) and Hmox1\u2212/\u2212 (p = 0.0006) hearts, as shown in p = 0.011), while MZe786 significantly enhanced the mtDNA/nDNA in Hmox1\u2212/\u2212 when compared to both Hmox1+/+ and Hmox1\u2212/\u2212 hearts (p < 0.0001), as shown in The loss of HO-1 significantly reduced the gene expression of PGC1-\u03b1 in cardiac tissue in comparison to their wild type counterparts (\u2212/\u2212 in comparison to Hmox1+/+ hearts (p = 0.12). The administration of MZe786 significantly stimulated Txn1 gene expression when compared to Hmox1+/+ (p = 0.02) and Hmox1\u2212/\u2212 (p = 0.007) cardiac tissue, as shown in \u2212/\u2212 hearts (p = 0.007), while MZe786 was able to restore its expression (p = 0.002). There was no significant difference between cardiac Glxr gene expression the in wild type compared to MZe786-treated Hmox1\u2212/\u2212 mice (p = 0.14), as shown in We next focused on the ability of MZe786 to stimulate antioxidant gene expression in the absence of HO-1. Our results showed a slight reduction in thioredoxin (Txn1) gene expression in Hmox1+/\u2212, single Hmox1 allele) has been associated with the dysregulation of angiogenic balance, leading to signs of fetal growth restriction and preeclampsia [+/\u2212 mice and evaluated the respiratory efficiency in mitochondria isolated from heart tissue using an XF24 Seahorse Analyzer. Haploinsufficiency of Hmox1 . In Ad-sFlt-1 mice treated with MZe786, we evidenced the significant restoration of the pyruvate-dependent RCR in comparison to the Ad-sFlt-1 injected mice (p = 0.0043). No significant difference was evidenced between the Ad-CMV and Ad-sFlt-1 + MZe786 treated mice (p = 0.9), as shown in p = 0.19). MZe786 enhanced the respiratory efficiency in cardiac mitochondria from Ad-sFlt-1 in comparison to Ad-sFlt-1 counterparts (p = 0.01). No difference was evidenced when comparing Ad-CMV with Ad-sFlt-1 + MZe786 treated mice (p = 0.9), as shown in p = 0.03). MZe786 improved the respiratory efficiency in Ad-sFlt-1 injected Hmox1+/\u2212 mice (p = 0.004) while no statistical difference was observed when compared to Ad-CMV (p = 0.9), as shown in +/\u2212, suggesting that the fatty acid-driven mitochondrial function might play a key role in sustaining the energetic demands in Hmox1+/\u2212 hearts. Therefore, events dysregulating this metabolic pathway might lead to mitochondrial dysfunction in environments of reduced HO-1. To evaluate the capacity of Hmox1+/\u2212 mice in comparison to Ad-CMV (p = 0.0034). Mice injected with Ad-sFl-1 and administered with MZe786 were able to significantly increase PGC1-\u03b1 transcription in comparison to those that were given Ad-sFlt-1 alone (p = 0.019). The expression of cardiac PGC1-\u03b1 was not different when Ad-CMV and Ad-sFlt-1 + MZe786 mice were compared (p = 0.24), as shown in p < 0.0001), while MZe786 enhanced the cardiac mtDNA/nDNA in Ad-sFlt-1 + MZe786 treated mice (p < 0.0001). No statistical difference in the cardiac mitochondrial content was observed when Ad-CMV and Ad-sFlt-1 + MZe786 treated mice were compared (p = 0.43), as shown in Since MZe786 were shown to improve the mitochondrial biogenesis signal and antioxidant defense in Hmox1 knockout hearts, we explored whether MZe786 would exert similar effects in environments of high sFlt-1 and the partial loss of Hmox1. PGC1-\u03b1 gene expression was significantly reduced in heart tissue from Ad-sFlt-1-injected Hmox1+/\u2212 mice showed the reduced transcription of antioxidant genes Txn1 and Glrx  when compared to their wild type counterparts. The administration of MZe786 significantly stimulated Txn1 and Glrx gene expression in the hearts from Ad-sFlt-1-injected Hmox1+/\u2212 mice . No statistical difference between Txn1 and Glrx gene expression was observed when compared to Ad-CMV , as shown in Finally, we observed that cardiac tissue from Ad-sFlt-1-injected Hmox1Several studies have demonstrated that the risk of developing cardiovascular disease is significantly higher in women with a history of preeclampsia ,58,59. ITwo decades ago, we demonstrated that HO-1 protein expression is reduced in placentas from pregnancies complicated with preeclampsia . More reThe myocardial tissue has the ability to metabolize different substrates such as fatty acids, amino acids, glucose, lactate, and ketone bodies, depends on the bioavailability of substrates in the cardiac environment . Typical\u2212/\u2212 mice. In the case of pyruvate, it has been shown that its metabolism requires mitochondrial import mediated by the carrier-regulated process [In response to complex I substrates, pyruvate and palmitoyl-L-carnitine, we evidenced a reduced respiratory capacity in Hmox1 process . Likewis process . Interes process . Our res+/\u2212 mice further evidenced the role of sFlt-1 to impair the cardiac mitochondrial activity in a reduced HO-1 setting. In these experiments, non-pregnant females were exposed to high sFlt-1. As Akhter and colleagues previously reported, circulating levels of sFlt-1 remain higher in women post preeclampsia even one year after delivery (25). The administration of sFlt-1 to non-pregnant animals results in high blood pressure, proteinuria, and endotheliosis, characteristics of preeclampsia [The delivery of sFlt-1 to Hmox1clampsia . Therefo+/\u2212 mice. This was accompanied by reduced PGC1-\u03b1 gene transcription and mitochondrial content in comparison to the control. These observed effects were consequently attributable to sFlt-1-induced damage to the mitochondria. We recently demonstrated that sFlt-1, dose-dependently disturbs the endothelial cellular bioenergetics and promotes mitochondrial specific reactive oxygen species production [The efficiency of the cardiac mitochondrial activity was significantly impaired in sFlt-1-treated Hmox1oduction . Likewisoduction . Based o2S, and carbon monoxide, the gaseous product of HO-1. H2S may have a role in increasing the expression of HO-1 and, subsequently, the CO level, therefore excreting protective effect. A proposed mechanism for this involves the Keap1/Nrf2 pathway. The persulfidation of Keap1 Cys151 by the reaction of H2S with oxidized Cys151 by H2S-derived HS\u00b7 leads to the dissociation and nuclear translocation of Nrf2, ultimately resulting in an increased HO-1 protein level [2S, which is produced in endothelial cells and participates in the fine regulation of endothelial integrity and functions [2S bioavailability was suggested to be a novel indicator of endothelial dysfunction progression and is manifested in different forms in multiple pathologies, including preeclampsia [2S bioavailability, may benefit diseases with unmet medical needs.Hydrogen sulfide donors have been demonstrated to exert protective effects on the cardiac oxidative metabolism in different scenarios of cardiovascular disease ,74,75,76in level ,77,78. Eunctions ,80. DistThis study shows that the hydrogen sulfide releasing molecule, MZe786, protects cardiac mitochondrial efficiency through complexes I- and II-driven OXPHOS and improves antioxidant gene transcription in low HO-1 settings. As previously shown, exogenous hydrogen sulfide donors sustain the mitochondrial membrane potential, inhibit apoptosis, and suppress reactive oxygen species generation in a model of cardiac hypertrophy in mice . FurtherInterestingly, hydrogen sulfide-induced cardio-protection has been linked to enhanced antioxidant defenses via the upregulation of reduced glutathione levels  and Trx-+/+ mice. Similarly, the partial loss of Hmox1 reduced the mitochondrial capacity in comparison to the total loss of HO-1, even though the reduction in the respiratory efficiency was less pronounced. These observations suggest that HO-1 is necessary to support the cardiac mitochondrial function. Although, one allele provides protection, as demonstrated by the cardiac mitochondrial function, in high sFlt-1, this protection is abrogated. MZe786 also improved the respiratory capacity in these low HO-1 and high sFlt-1 environments, allowing for the protection of the mitochondrial activity in response to mitochondrial substrates, pyruvate, palmitoyl-L-carnitine, and succinate. Together, these observations demonstrate that MZe786 can provide beneficial effects on the cardiac metabolism, allowing for the restoration of the mitochondrial activity and providing antioxidant-enhanced protection.Our study shows that MZe786 improved mitochondrial capacity when the high sFlt-1 environment was accompanied by the partial or complete loss of HO-1 function in animal models. Although the total deficiency of Hmox1 resulted in a marked reduction in mitochondrial oxidative capacity, MZe786 improved the respiratory efficiency and restored antioxidant defenses to levels similar to the Hmox1Here, we provide first-time evidence demonstrating that the hydrogen sulfide-releasing molecule, MZe786, enhances cardiac mitochondrial activity and protects the antioxidant capacity in a reduced HO-1 and high sFlt-1 environment, mimicking the molecular impairments encountered in preeclampsia. Our results provide new insights into the molecular mechanisms associated with long-term cardiovascular disease observed in in women post preeclampsia and suggest MZe786 as an effective therapeutic molecule to relieve the sFlt-1-induced mitochondrial damage in the heart.Deficiency in HO-1 disturbed the mitochondrial activity and these effects were associated with reduced mitochondrial content and suppressed the antioxidant capacity. This suggests that the loss of HO-1 may impair the cardiac tissue ability to sustain metabolic demands through the mitochondria and to respond to oxidative stress-induced damage. In these settings, MZe786 was shown to protect the antioxidant capacity and mitochondrial function, suggesting that this molecule may be beneficial in protecting cardiac tissue against events leading to impairments in the antioxidant capacity of the heart. Consequently, the partial deficiency of HO-1 in a high sFlt-1 environment provided a more realistic setting, mimicking the preeclampsia-like molecular defects in the heart. Soluble Flt-1 impaired the mitochondrial activity and suppressed antioxidant gene transcription in the cardiac tissue. The administration of MZe786 protected the mitochondrial activity and upregulated the antioxidant genes. Our results suggest that MZe786 protects the heart from sFlt-1-induced mitochondrial damage in an environment of low HO-1 via the upregulation of key antioxidant genes and by exerting protective effects on the mitochondrial activity in the hearts."}
{"text": "In contrast, feed supplementation with 2% OMW, compared with the control diet, produced no noteworthy increase in BWG or the feed conversion rate (FCR). Antibiotic addition, on the other hand, increased serum cholesterol (p \u2264 0.05). After 42 days, neither OMW nor antibiotic addition affected organ mass. In contrast, antibiotic addition reduced the small intestine percentage, crypt depth and villus height (p \u2264 0.05). The Newcastle disease vaccine (NDV) antibody titer improved after feed supplementation with 1% OMW comparing with the control and antibiotic diet group. Furthermore, OMW supplementation decreased the heterophil-to-lymphocyte H/L ratio (p \u2264 0.05). The use of OMW led to a reduction in the malondialdehyde (MDA) content of the breast and liver and an increase in glutathione peroxidase. It helped to reduce glutathione, glutathione reductase, and glutathione S-transferase. In conclusion, the impact of OMW were dose-dependent, and the use of 1% OMW in broiler diets enhanced their growth and immunity. Nonetheless, supplementation with 2% OMW produced conflicting results.Oyster mushroom waste (OMW) is a by-product of the agriculture industry with valuable antimicrobial, antioxidant, antifungal, and prebiotic properties. This by-product might be a useful alternative to antibiotic growth stimulators in poultry nutrition. The purpose of this research was to test the impact of OMW on the immune responses and on the morphology of intestine of broiler chickens. Four dietary therapies with five replicas of 15 birds in each, totalling 300 day- Ross 308 broiler chickens, were utilized in this study. Control chickens were fed a mixed diet that included a maize-soybean meal complemented by 1 and 2% OMW in addition to the basal diet. Furthermore, Enramycin (125 g/kg) was added to the control diet as an antibiotic. Throughout this experiment, performance was studied as well as the immune response to the Newcastle Disease Virus (NDV) and intestinal morphological traits. A substantial surge was noted in body weight gain (BWG) and feed intake (FI) of chickens after the addition of 1% OMW ( Antibiotics have historically been used as promotors of growth in poultry feed and as treatment for contaminated chickens. For decades, conventional artificial nutritional additives, like antibiotic growth promoters, antioxidants, antifungal agents, and anti-parasitic agents are used in poultry feed . HoweverWorldwide, feed supplies for animal nutrition are in shortage, the problem get even difficult after COVID-19 due to many consequence negative effects on crop cultivation, harvest and production as well as trade. Hence, the use of agro-industry as feedstuffs in animal nutrition represents an important source of protein, vitamins, minerals and antioxidants and visible solution \u20135. This Pleurotus ostreatus stem waste is abundantly available due to rise in the mushroom's cultivation. The stems are treated as agricultural by-product, although they have medicinal and nutritive values. The popularity of mushrooms for human consumption has also lead to environmental pollution  stem waste as a phytogenic feed additive and substitute for antibiotics in broilers diets. In general, there have been insufficient studies in the examination of the health status and performance in broilers due to the efficiency of mushroom waste. For long term, antibiotics have been overused in the industry of poultry to raise production efficiency and health status has resulted in hazards effects on human health. This work investigates medicinal mushrooms usage in poultry feed dispose of antibiotics, without impacting optimal efficiency. Biologically active substances are found in many medicinal mushrooms like glycoproteins, polysaccharides, and other polymers that may function as preferable nutritional supplements in chickens as well as immunomodulating agents. The aim of the research was, therefore, to test the effectiveness of Pleurotus ostreatus oyster mushroom waste (OMW) in broiler chickens on growth output, serum cholesterol, immune status, and antibody response.ollution \u20139. Howevficiency . The weificiency . GastroiThe experimental protocol of the present work was approved by King Abdulaziz University, Jeddah, Saudi Arabia. The University recommend that animal protections, welfare, rights, and minimum stress levels, and avoided any suffering or harm to creatures according to Royal Decree number M59 in 14/9/1431H.An overall number of 300 unsexed 1-day old chicks were assigned to be fed four different experimental treatments randomly (Ross 308). Five duplicated pens with 15 birds in each pen with a ratio of 1:1 for each treatment were chosen. All birds in this study were raised on a commercial poultry farm and kept in-floor pens that have litters made of wood shreds. A totally randomized design was used in this experiment, following are the dietary treatments:  1% OMW cPleurotus osteratus) and mushroom growth plan rejections. Mushroom waste was prepared from the base of the stem of the mushroom. After harvesting, the mushrooms were weighed, placed in net bags, air/sun-dried, and eventually, the OMW was collected. After the sun drying, when a substantial volume of water was lost, OMW was further exposed to oven drying to eliminate water thoroughly. Upon drying in the oven, mushrooms were held at a consistent temperature of 60\u00b0C, and once the samples showed a steady weight, the process was stopped.Mushroom waste consisted mainly of oyster mushroom stem base , total triglycerides (TG), and high- and very-low-density lipoprotein cholesterol (HDL-C and VLDL-C). A spectrophotometer was used to measure serum lipids. Biochemical analysis of serum samples was performed using commercial diagnostic kits , and VLDL-C determination was carried out by dividing TC by 5.The H/L ratio was calculated from a blood sampling obtained on day 42. In this procedure, heparin-containing syringes were used to prevent the development of blood clots. Greenwald, May, and Giemsa dyes were used to stain blood smears . Under oBirds used in this experiment were vaccinated individually using an eyedropper with Newcastle Disease Virus (NDV) commercial vaccine at 6-day age, and in drinking water at the ages of 16 and 26 days. Also, three chickens from each treatment were bled at the age of 42 days to obtain serum for NDV antibody measurement. As defined , antibodThree chickens at age of 42 days, were selected from every pen, then were slaughtered according to the Islamic  method . Organs The measurement of villus height (micrometers) started from villus's edge until the villus-crypt junction, while depth of the crypt was measured starting at the base until the transition area amongst the crypt and villus. Tissues of the liver, breast, and thigh muscle were collected after slaughter by eliminating the connective tissue, skin, and fat. Specimens were packed in vacuum at \u221240\u00b0C to prepare them for processing. With regarding to measuring the antioxidant, tissues were defrosted than processed for five days at 4\u00b0C. Afterward, they were subjected to antioxidant activity and the oxidation of lipid in storage at 0 and 5 d. In this experiment, many antioxidants were measured (reduced glutathione (GSH), glutathione reductase (GR), glutathione peroxidase (GSH-Px), glutathione S-transferase (GST), and malondialdehyde (MDA).Using the approaches of , glutathp \u2264 0.05.One Way 2008 SAS statistical model was utilized in this study to analyse the variance in data appropriate for a completely randomized model were analyzed according to SAS Institute . Using tModel:p \u2264 0.05). However, supplementing broiler with 1% OMW resulted in greater BWG than the control and other treatments. In contrast, BW was not different when fed 2% OMW compared with the control. Supplementation with 1% OMW resulted in a noteworthy surge in FI (p \u2264 0.05) during overall times, whereas no effect of 2% OMW was observed. There was no effect of Enramycin on FI relative to the control (p \u2264 0.05). The improvement in FI seen in chickens fed the diet supplemented with 1% OMW could be the explanation for the significant increase observed in broiler BW. However, this increase may also be attributed to the presence of oligosaccharides in the cell walls of mushrooms  FCR comparing with control conditions. However, for the entire experimental period, 2% OMW did not affect this ratio (p \u2264 0.05). In comparison with the control, Enramycin was found to considerably increased LBW, ADFI, and ADG, and improved FCR. Antibiotics effectively boost growth efficiency by altering the gastrointestinal microbiota (in particular by destroying pathogens), thus reducing inflammation of the intestinal mucosa  stem waste supplementation (1 and 2%), TC decreased relative to the control. At both levels of OMW supplementation, TC was recorded to be (p < 0.05) which is lower than antibiotic-supplemented groups and the control groups. In this study, no substantial change was witnessed in low-density lipoprotein cholesterol (LDL-C) nor TG.The data in Moreover, no statistically significant differences were found for blood total protein, total albumin, globulin, or urea nitrogen concentrations at day 42 between treatment groups and control . UltimatAgaricus blazei) powder has been shown to reduce TC, yet it had no influence on serum TG in broilers (Pleurotus ostreatus), TC was reduced, yet other serum lipids were not affected  in OMW diets comparing to those fed with the antibiotic and control diets. The optimal responses for antibody titer were found in broiler fed 1% OMW (P < 0.05) in OMW and antibiotic groups illustrated greater (p < 0.05) serum immunoglobulin (IgG and IgM) levels than the control and group  in pullet-fed diets of oyster mushroom waste (p < 0.05) comparing to the antibiotic-fed and control diets in the pullet of experiment. Bai et al. . The physiological stress indicator is the ratio of heterophils to lymphocytes as the number of heterophils increases in moderately stressful settings (settings . Since tsettings  presentep \u2264 0.05) relative to control birds at 42 days of age, even though OMWs did not affect (p \u2264 0.05).p \u2264 0.05) decline these indices in the ileum. Given the variations in villus height and crypt depth of the jejunum, no significant effect of OMW was observed on the ratio of villus height to crypt depth, although this ratio was amplified in the ileum (p \u2264 0.05). The safety and health of the gut and improved absorption ability of the intestines were attributed and correlated to the higher villus height and lower crypt depth. In this analysis, the high fiber content of mushroom may have led to structural and body alternations in the small intestines of birds, but no impact the ratio of villus height to crypt depth was noticed. Gross and Siegel  displays antioxidant characters as a functional dietary supplement and food. However, Agaricus brasiliensis is considered a possible auxiliary to treat patients suffering from rheumatoid arthritis because of their ability to alleviate oxidative stress  or TNF-\u03b1-activated cells. Brugnari et al. (Pleurotus ostreatoroseus (Agaricomycetes) mushroom. Kumar et al. (Nowadays, the characteristics of antioxidant for various medicinal mushrooms are well understood. Few earlier researchers indicated that the antioxidant functions of the polysaccharides and oligosaccharides present in medicinal mushrooms . Butylatons role . A reseaons role  showed te stress . Muszynse stress  reportedi et al.  also notr et al.  found thData from the relevant literature showed inconsistent outcomes on the impact of natural dietary antioxidants and their antioxidant enzyme activity. , 56\u201388 PCollectively this research suggests that feeding oyster mushroom waste at a 1% level could have positive impacts on improving the performance, the humoral immune response to disease vaccines, and delayed poultry meat lipid oxidative rancidity and being more effective than 2% inclusion or antibiotic-supplemented-groups. Besides, the use of oyster mushroom waste in animal nutrition could decrease the environmental pollution. More studies are required to recognize the optimum inclusion level of oyster mushroom waste on performance enhancement and to detect the inner mechanisms of metabolic rate of lipid with oyster mushroom waste in broilers. Alternative feed resources and locally produced feeds may be useful tool for animal nutrition after COVID-19 outbreak due to expected decrease in feedstuffs for animal nutrition and increase the severity of competition between animal and human with absolute primacy given to fulfill human requirements.All datasets generated for this study are included in the article/supplementary material.The animal study was reviewed and approved by Animal Production Research Institute. Written informed consent was obtained from the owners for the participation of their animals in this study. King Abdulaziz University, Jeddah, Saudi Arabia, approved the experimental procedures, which protect animal welfare, rights, and stress levels, and avoided any suffering or harm to creatures according to Royal Decree number M59 in 14/9/1431H.KA set up the field work, design the experiments, and first draft of the manuscript. RH, MS, and MA contributed to the experimental setup and analyzing statistics, interpretation of results, and proofreading of the manuscript. All authors approved the final version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "The concept of reductive radical-polar crossover (RRPCO) reactions has recently emerged as a valuable and powerful tool to overcome limitations of both radical and traditional polar chemistry. The concept of reductive radical-polar crossover (RRPCO) reactions has recently emerged as a valuable and powerful tool to overcome limitations of both radical and traditional polar chemistry. Especially in case of additions to carbonyl compounds, the synergy of radical and polar pathways is of great advantage since it enables the use of traditional carbonyl electrophiles in radical reactions. The most recent and synthetically important transformations following this line are summarised in the first part of this review. The second part deals with transformations, in which the concept of RRPCO promotes the usage of alkyl halides as electrophiles in radical reactions. SCE),One of the most studied and fundamental transformations of organic chemistry is the addition of nucleophiles to carbonyls for the synthesis of alcohols. This transformation can be performed in a multitude of ways with high levels of diastereo- and enantioselectivity. While these reactions have been extensively developed in polar chemistry, radical pathways for this transformation remain underexplored. The development of such radical reactions would enable a wider variety of nucleophiles to be used, and hence generate valuable new product motifs. Furthermore, in combination with visible-light-mediated photochemistry, radical chemistry could be used to promote elusive transformations with high levels of functional group tolerance.pathways . In the via C\u2013C-\u03b2-scission. Here, Glorius et al. showed that this obstacle could be overcome by adding alkyl radicals to protonated carbonyls to form alkoxy radical cations intermediates, which are less prone to C\u2013C-\u03b2-scission and can be more easily reduced than alkoxy radicals  . In this2.2.12(dtbbpy)][PF6]; ppy: 2-phenylpyridine, dtbbpy: 4,4\u2032-di-tert-butyl-2,2\u2032-bipyridine) was used to generate trifluoromethyl radicals, which were added to substituted styrenes to form benzyl radicals. These stabilised benzyl radical intermediates were then reduced by the photocatalyst to form carbanions, which were trapped with carbon dioxide to deliver the carboxylic acid products. Evidence for the presence of an anionic species in this reaction was obtained by trapping with deuterium oxide instead of carbon dioxide. Furthermore, thermodynamic considerations of the two electron transfer steps by redox potential comparison also supported this mechanistic proposal. This challenging dicarbofunctionalization reaction highlighted the ability of this powerful synergy between radical and polar chemistry to generate valuable building blocks from simple reagents.Whilst the groups of Ryu and Sonoda were the first to describe the RRPCO concept in the 1990's,iv)-mediated ligand-to-metal charge transfer. Owing to the instability of such radicals, a C\u2013C-\u03b2-scission generates a more stabilised alkyl radical. At this point, the photocatalyst-induced RRPCO takes place, which is followed by a nucleophilic addition of the generated anion to the pendant aldehyde moiety. Lactone formation is caused after ester hydrolysis, delivering the bridged product motifs. Once again, the interplay of radical and polar pathways results in the formation of complex products from simple starting materials in a single step.In 2018, the group of Zhiwei Zuo reported on a dual cerium- and photoredox-catalysed bridged lactone formation starting from cycloalkanols and Michael acceptors .9 At firvia two consecutive reductions of an imine intermediate by the excited state photocatalyst. This anion then adds to carbon dioxide to form the \u03b1-amino acid product. The existence of a carbanion intermediate was suggested by deuteration experiments and trapping with other electrophiles, such as carbon disulfide or isothiocyanates. The high regioselectivity for the \u03b1-carboxylation in this transformation is remarkable and is complementary to classical carboxylations of enamides that typically proceed in the \u03b2-position.In 2018, the group of Da-Gang Yu reported a highly chemo- and regioselective visible-light-mediated carboxylation of enamides and imines for the synthesis of \u03b1,\u03b1-disubstituted \u03b1-amino acids .10 An \u03b1-d7 did not cause any deuteration, contradicting a putative hydrogen atom transfer (HAT) step. In conclusion, this cross-electrophile coupling underlines the high potential of RRPCO, overcoming traditional philicity limitations.Later in 2018, the group of Yu also disclosed an elegant external-reductant-free cross-electrophile coupling between tetraalkylammonium salts and carbonyls .11 Mechavia 4CzIPN -1,3-dicyanobenzene)-mediated oxidation of benzyl carboxylates followed by rapid decarboxylation. The stabilised benzylic radical is converted to an anion through electron transfer from the reduced photocatalyst. After the RRPCO, nucleophilic addition to aliphatic aldehydes and ketones takes place, generating alcohols as products. Again, deuterium incorporation by addition of deuterium oxide signifies the intermediary formation of anions. The successful addition to aliphatic carbonyl compounds instead of aromatic ones reveals the improvement gained through RRPCO in comparison to radical chemistry alone, where to date only aromatic carbonyls could be used as acceptors.The group of K\u00f6nig reported on a similar transformation .12 Here,via oxidation and subsequent deprotonation of a thiol HAT catalyst. The thiyl radical then abstracts a benzylic H atom to generate a benzylic radical and reform the thiol catalyst. As in the previous reaction, the stabilised benzylic radical is then converted to an anion by electron transfer from the reduced photocatalyst and subsequently adds into carbon dioxide to give the carboxylic acid products. The authors not only showed a broad substrate scope but further demonstrated the utility of their protocol by preparing four drug molecules in single steps. Interestingly, even if multiple benzylic C\u2013H sites were present in the molecule, the monocarboxylated products were obtained selectively. This powerful C\u2013H carboxylation clearly underlines the power of RRPCO to convert simple starting materials to high-value products.The group of K\u00f6nig has since reported on an elegant carboxylation of benzylic C\u2013H bonds by merging HAT catalysis with RRPCO .13 First2.2et al. employed the RRPCO concept during their studies of the synthesis of the paxilline indoloterpenoids -nodulisporic acid C and further developed an intermolecular version, which allowed a 14-step total synthesis of the terpenoid forskolin.15iii)-alkyl complex. This species transmetallates to a Cr(iii)-alkyl complex enabled by a Cr(ii) complex. This step is considered as the RRPCO step, since this step is only possible beginning from a chromium(ii) species, indicating that an alkyl radical is captured by the chromium(ii) complex to form the Cr(iii)-alkyl species. The in situ formed Cr(iii)-alkyl complex is able to add to carbonyls, in this case aliphatic and aromatic aldehydes, to afford alcohols as products.In 2018, Shenvi and co-workers reported on a branch-selective addition of olefins to aliphatic aldehydes by using a complex mixture consisting of a cobalt catalyst, chromium trichloride, phenylsilane as a superstoichiometric reductant and 1-fluoro-2,4,6-trimethylpyridinium tetrafluoroborate as a substoichiometric oxidant .16 The Cvia the RRPCO pathway (ii) species to the RAE. Following the principle of RRPCO, this radical is captured by the excess chromium(ii) salt to form a Cr(iii)-alkyl complex. This nucleophilic species is consequently able to add to aliphatic and aromatic aldehydes as electrophiles. The presence of trimethylsilyl (TMS) chloride in the reaction mixture lead to the isolation of TMS-protected alcohols. Baran and co-workers expanded the scope of the starting materials of traditional alkyl-Nozaki\u2013Hiyama\u2013Kishi reactions to RAE or carboxylic acids.In 2019, Baran and co-workers were able to facilitate a decarboxylative Nozaki\u2013Hiyama\u2013Kishi reaction  pathway .17 They 2.3ii) salts in enabling reactions following the RRPCO principle. Nevertheless, the requirement of stoichiometric chromium salts to obtain the desired reactivity is unfortunate, since chromium salts are widely considered to be physiologically hazardous and in case of chromium(ii) expensive and oxygen-sensitive. Furthermore, in enantioselective reactions, (over-)stoichiometric quantities of chiral ligands would be needed, limiting the practicability of such protocols.ii)- and Ir-photocatalytic ([Ir(dF(CF3)ppy)2(dtbbpy)][PF6]; dF(CF3)ppy: 2--5-trifluoromethylpyridine) system (iii)-allyl precursor in this reaction, which represents the first of example of a Nozaki\u2013Hiyama\u2013Kishi reaction based upon a C\u2013H functionalization. Mechanistically, the reaction proceeds via oxidation of the allyl compound by the excited photocatalyst, which is followed by rapid proton-abstraction to give an allylic radical. This species undergoes the RRPCO through radical addition to the Cr-catalyst, forming a Cr(iii)-allyl complex. Nucleophilic addition to the aldehyde is facilitated by the Zimmerman-Traxler transition state, thereby providing high diastereomeric ratios of the branched anti-products. Finally, reduction of the chromium(iii) species by the reduced photocatalyst closes both catalytic cycles. This example constitutes a rare case of a highly diastereoselective radical reaction and underlines the great potential of RRPCO pathways.The protocols of Shenvi and Baran clearly show the power of chromium system .19 Both,In 2019, Kanai and co-workers then extended the dual chromium- and photocatalytic system through the addition of chiral ligands to foster an asymmetric allylation of aldehydes .20 The m3.The principle of RRPCO was also used to enable nucleophilic substitution reactions using alkyl halides as electrophiles. The Molander group was the first to apply this concept in the context of visible-light photoredox catalysis in 2018. In this work, they described the facile cyclopropanation of alkenes using iodomethyl silicates Aggarwal and co-workers also showed the utility of RRPCO processes in two transformations, a cyclopropanation  and a cy4.e.g. a chromium(ii) species. Importantly, these transformations allow complex molecules to be assembled in a fast step-economic fashion that would not be possible using either radical or polar chemistry alone. Furthermore, RRPCO enables highly challenging diastereo- or enantioselective radical transformations to be realized. To date, RRPCO reactions have been carried out using carbonyl compounds or alkyl halides/tosylates as electrophiles. Since this field of RRPCO is still in its infancy,Reductive radical-polar crossover reactions are initially radical reactions that are converted into traditional nucleophilic reactions by means of a single electron reduction. This reduction is either promoted by a photoredox catalyst or a redox active metal, There are no conflicts to declare."}
{"text": "Myopic macular degeneration (MMD) is a primary cause of blindness and visual impairment in many parts of the world. A review of clinical practice guidelines (CPGs) for intervention selection are required with the increasing demand for MMD management in clinical practice as well as in national health services. Therefore, we aim to systematically review CPGs for MMD and assist the recommendations development of the Package of Eye Care Interventions (PECI) program of the World Health Organization.A systematic review of CPGs published on MMD between 2010 and April 2020 was conducted. Guidelines were evaluated using the Appraisal of Guidelines for Research and Evaluation II (AGREE II) tool. Cochrane systematic reviews were also included when the evidence from included CPGs were inadequate or contradict.After applying exclusion criteria and conducting the quality appraisal, two CPGs were finally included. The average of the AGREE II ratings for the identified Guidelines were 56 and 63 respectively (7 for each item). To provide further information on interventions for MMD, one Cochrane review on MMD was additionally identified and included in the study. Intravitreal anti-vascular endothelial growth factor (anti-VEGF) drugs were recommended for patients with myopic choroidal neovascularization (mCNV) as first-line therapy to improve vision and reduce central macular thickness, and ranibizumab showed significant effectiveness compared to photodynamic therapy (PDT). PDT was recommended to be performed in those resistant to the treatment by one CPG but lacked of adequate description and support. Data extracted from the Cochrane systematic reviews indicated that anti-VEGF therapy for mCNV had significant effectiveness in improving visual acuity and reducing CMT compared to PDT with moderate to low certainty of evidence. Ranibizumab and bevacizumab were considered as equally effective with moderate certainty.The outcomes of this review suggest that high quality clinical practice guidelines for MMD management are limited. Intravitreal injection of anti-VEGF agents was recommended as an effective intervention to treat myopic CNV as the first-line treatment, while there was inadequate guidance for the application of PDT in myopic CNV management. The use of other interventions for MMD were not recommended at this time and additional evidence is called for. Myopic macular degeneration (MMD), also known as degenerative myopia or pathological myopia, is an important cause of blindness and visual impairment in many parts of the world, especially in areas with a high prevalence of myopia ,2. It isVarious treatment strategies for MMD have been explored in the last few decades, including macular surgical management,-14 laserGiven the increasing need for eye care, the World Health Organization (WHO) has highlighted the role of eye care in contributing to the Sustainable Development Goals (SDGs), and is developing an evidence-based Package of Eye Care Interventions (PECI). The methodology for the development of the PECI has been previously published. In briefThe systematic review of CPGs is following the procedures reported in the methodology paper previously . ExclusiA systematic literature search of academic databases  and guideline databases (as listed in Appendix S1 of the All the titles and abstracts of articles identified from the literature searches were screened independently by two authors (G.L and S.S). Abstrackr, a semi-automated online citation screening program, was utilized where possible . ConcernTwo authors (Y.C and X.H) independently evaluate the quality of the included CPGs using \u201cAppraisal of Guidelines for Research and Evaluation\u201d (AGREE II) . Items 4Following evaluation with the AGREE II tool, guidelines were excluded if the average rating of the two authors for items 4, 7, 8, 12 or 22 was less than 3, or the total rating for all 9 items was below 45. Final selection of a maximum of 5 CPGs according to the following criteria: 1) quality 2) publication time and 3) comprehensiveness  with the agreement of the whole study group.Information related to the recommendation, including type of recommendation, dosage, target population, the strength of recommendation and the quality of the evidence supporting the recommendation, were extracted by one author (Y.C or X.H) and re-reviewed by another author. Disagreements were discussed and resolved by the two researchers and a third author (S.K.). The process was repeated for all the Guidelines until agreement on the recommended eye care interventions was reached.With respect to the published protocol no changes were performed. The quality check and the methodological support for this study have been provided by WHO/CEV.When the evidence from included CPGs were inadequate or contradict, Cochrane Systematic Reviews (CSRs) were sought. The Information Specialist for CEV identified CSRs published in the last 10 years by searching the Cochrane library using the term \u201cmyopic macular degeneration. The following search limits were defined for the search strategy in the Cochrane library: 1) Content type: Cochrane Reviews, 2) Cochrane Library publication date: last 10 years, 3) Search word variations: Yes. The search was run on 23 July 2020 and retrieved 7 CSRs. The CEV Information Specialist pre-screened the results and forwarded PDFs of two CSRs that were potentially relevant for inclusion in the review.Two members of the group (Y.C and X.H) independently performed title and abstract screening. Systematic reviews were excluded if they were older than 10 years or the review was not an intervention or diagnostic test accuracy review that was specifically related to the target eye condition. After comparing the decisions of both researchers, only those CSRs where there was agreement between both authors (Y.C and X.H) were included.After combining all searches from academic and guideline databases and professional association webpages, 3778 CPGs were identified and underwent independent title and abstract screening. A total of 3575 CPGs met the exclusion criteria and 179 were duplicates, leaving a total of 34 CPGs that were considered potentially relevant and were retrieved to undergo full-text screening and quality appraisal. Of the identified 34 guidelines, we excluded 32 Guidelines for the following reasons: 29 because the content was not relevant to MMD after full-text screening , 3 becauAfter conducting quality appraisal on the remaining CPGs, and checking for quality, publication time and comprehensiveness, we finally included the following guidelines: \u201cIntravitreal injection of anti-vascular endothelial growth factor agents for ocular vascular diseases; Clinical practice guideline\u201d(2018)  developeThe included CPG developed by Nikkhah et al. recommended intravitreal anti-VEGF drugs for patients with myopic choroidal neovascularization (mCNV) to improve vision and to reduce central macular thickness. Intravitreal bevacizumab was recommended to be the first-line injection for these patients, and photodynamic therapy (PDT) performed in those resistant to the treatment. The evidence for the recommendations came from 1 meta-analysis, 1 RCT and 1 review, and the evidence level was graded as high. The CPG also recommended that highly myopic patients aged less than 50 years should have funduscopy to ensure early detection of MMD. For older patients with risk factors of CNV recurrence , periodic examinations are recommended, but the evidence level of this recommendation was low since it was only supported by case series. In the NICE CPG, intravitreal ranibizumab is recommended as an option for mCNV, and concluded that ranibizumab is a treatment with clinical effectiveness for visual impairment caused by mCNV, supported by 3 RCTs. But the long-term improvement (after 3 months) in BCVA brought by ranibizumab is uncertain. The recommendations and quality of evidence are summarized in To complement the evidence from the CPG, all Cochrane reviews on the topic area were also checked. In total one Cochrane review on MMD was identified, \u201cAnti-vascular endothelial growth factor for choroidal neovascularisation in people with pathological myopia (Review)\u201d (2016) . In the An overall view of the strength of recommendation and quality of evidence given in each Guideline is reported in The current study reviewed CPGs and Cochrane systemic reviews for MMD, with the aim of providing evidence on eye care interventions for MMD to aid in the development of the PECI. A total of 2 CPGs and 1 Cochrane systemic review were included after a standard screening process. Anti-VEGF therapy was recommended to improve the vision in patients with myopic CNV, among which ranibizumab showed greater effectiveness compared with PDT, while PDT was suggested to use in resistant cases with no solid evidence. Overall, current high-quality CPGs and meta-analysis can provide some guidance for the management of myopic CNV, but the types of interventions involved are limited.In recent years, anti-VEGF agents have been introduced and rapidly become an important therapy in the treatment of ocular vascular diseases, including age-related macular degeneration, diabetic macular edema, retinal vein occlusion and mCNV -24,66-70Among the available treatments for mCNV, PDT with verteporfin has a long history as an established and approved treatment and has been shown to achieve satisfying short-term outcome in improving vision of mCNV patients -19,77-81Despite the increasing demands for clinical management of MMD and other complications of pathological myopia, this study found few high-quality CPG. The CPG developed by Nikkhah et al provided clinical recommendations for 5 different ocular vascular diseases and evidence levels of each intervention, but presented a lack of details in terms of clinical effectiveness, cost-effectiveness, and technology of implementation. NICE, as a large government agency that develops guidelines, has only one comprehensive CPG for MMD. Though one Cochrane systemic review has been added to the current study, in total only recommendations on, and evidence for, two interventions were identified. The amount of benefit with surgical technology, including submacular surgery or macular translocation for mCNV, corticosteroid injection and combined therapy remains unclear. In an excluded CPG written by Cheung et al, a detailed recommendation of interventions were provided, that anti-VEGF therapy was considered as the first-line treatment with Class I recommendation, vPDT and intravitreal TA+ vPDT were Class IIa recommendation, macular surgery, laser photocoagulation and intravitreal TA + anti-VEGF therapy were Class IIb recommendation . Our maiThere are some inherent limitations in this study. Based on the criteria for identifying guidelines to inform the development of the PECI, only two guidelines were included. Though there have been enough evidence supporting ophthalmologists to use anti-VEGF as first-line therapy for mCNV, guidance is still insufficient for those who have contradictions, specific conditions or failure in taking anti-VEGF therapy. Second, MMD is most prevalent in countries where English is not the primary language. Given the language barrier in publications, some guidelines for MMD may have been omitted in the current analysis. Future study with larger searching database are required to provide better-quality data to help establish the best management strategy for MMD. Third, to assure the objectivity of the results, three papers providing assessment on more than one intervention for MMD were excluded due to possible conflicts of interest. The efficacy and utility of alternative treatments could not be assessed adequately.There are limited clinical practice guidelines for MMD management met the inclusion criteria of PECI development. Based on existing evidence, intravitreal injection of anti-VEGF agents is suggested to be an effective therapy for myopic CNV and should be the first-line treatment. The application of PDT for mCNV in clinical practice is still lack of adequate guidance. The use of other interventions for MMD is not recommended at this time and further solid evidence is called for."}
{"text": "Graph theoretical analysis allowed for the identification of acute and chronic network changes and revealed preserved small world topology before and after seizure onset. The most prominent acute change in network organization during seizures was the segregation of cortical regions from the remaining brain. Stronger connections between thalamic with limbic regions compared with preseizure state indicated network regularization during seizures. When comparing between strains, intrathalamic connections were prominent in NEC, on local level represented by higher thalamic strengths and hub scores. Subtle differences were observed for retrosplenial cortex (RS), forming more connections beyond cortex in epileptic rats, and showing a tendency to lateralization during seizures. A potential role of RS as hub between subcortical and cortical regions in epilepsy was supported by increased numbers of parvalbumin-positive (PV+) interneurons together with enhanced inhibitory synaptic activity and neuronal excitability in pyramidal neurons. By combining multimodal fMRI data, graph theoretical methods, and electrophysiological recordings, we identified the RS as promising target for modulation of seizure activity and/or comorbidities.Resting state-fMRI was performed to explore brain networks in Genetic Absence Epilepsy Rats from Strasbourg and in nonepileptic controls (NEC) during monitoring of the brain state by simultaneous optical Ca Absence epilepsy is a nonconvulsive form of epilepsy, accounting for 10\u201317% of all pediatric epilepsies . AlthougAbsence epilepsy is a network disease. The central element in the pathology and specifically in initiation, maintenance, and termination of the characteristic spike-and-wave discharges (SWDs) is the cortico-thalamo-cortical circuitry . CombineIn animal models of absence epilepsy, similar brain network components as in humans are involved . ActivatHere, we acquired rs-fMRI data from GAERS before and during seizures, and from NEC. GAERS  represenWe applied graph theoretical analysis of rs-fMRI data to characterize brain networks and to identify potential acute and chronic network changes in this absence epilepsy model.n\u2009=\u200925), and NEC (n\u2009=\u200920) from the breeding facility of the Institute of Physiology I, University of M\u00fcnster . Adult GAERS exhibit frequently occurring absence seizures with a prevalence of 100% (Experiments were performed in line with ARRIVE guide lines with adult (>3\u00a0months), female GAERS . During the experiment, breathing rate, expiratory CO2, and rectal temperature were monitored and kept in physiological ranges. Rs-fMRI data were acquired at 9.4\u00a0T (Bruker Biospin MRI GmbH) using a gradientecho echo planar imaging sequence (GE-EPI) with TR 1\u00a0s, TE 18\u00a0ms, resolution 0.32\u2009\u00d7\u20090.35\u00a0mm2, slice thickness 1.2\u00a0mm, 9 contiguous slices, and 30-min scan time per data set.For rs-fMRI and simultaneous Can\u2009=\u200913), one or two rs-fMRI measurements were performed under Neurolept anesthesia before seizures\u2019 onset (preseizure state). SWD onset was identified in Ca2+-recordings (n\u2009=\u20097) underwent the same procedure and 30-min rs-fMRI data were acquired ~90\u00a0min after switching to Neurolept. Complete data sets (rs-fMRI and Ca2+-recordings) from three different groups were used for analysis: GAERS preseizure: number of animals n\u2009=\u20099, number of data sets N\u2009=\u200912; GAERS seizure: n\u2009=\u20098, N\u2009=\u200914; NEC: n\u2009=\u20097, N\u2009=\u200917 . The first 15\u00a0min of raw data were used. In case any shift in rat head position was detected, continuous 15-min epochs with stable translation (<0.2\u00a0mm) and rotation (<0.3\u00b0) parameters were selected from 30-min data sets. For data quality assurance, a cortical mask in slice 6 was used to estimate temporal SNR  in the NEC control group . At this density, all networks were fully connected. We determined clustering coefficient, shortest path length, degree, strength, and hub score for each node and data set. The degree specifies the number of connections associated with one node. The strength is the sum of link weights of a node. A high hub score index indicates the importance of brain regions with above average high number of connections (degree), a high level of betweeness centrality, and short average path length  edges in total  were transcardially perfused with 4% (w/v) phosphate-buffered paraformaldehyde (PFA). After removing from the skull, brains were fixed overnight in 4% PFA and later in 30% (w/v) sucrose for 48\u201372\u00a0h. Immunohistochemical staining was performed on free-floating 40-\u03bcm-thick coronal sections. First, sections were rinsed three times (10\u00a0min) in phosphate-buffered saline (PBS). Then, slices were incubated for 2\u00a0h in PBS supplemented with normal goat serum (10% [v/v]), Triton-X100 (0.3% [w/v]), and bovine serum albumin (3% [w/v]). Finally, sections were incubated overnight at 4\u00a0\u00b0C in primary antibodies: monoclonal mouse anti-parvalbumin  and monoclonal mouse anti-neuronal nuclear protein . After incubation with one of the primary antibodies, sections were washed three times for 10\u00a0min in PBS and then transferred to the secondary antibody solution  for 2\u00a0h. In the last step, sections were washed three times for 10\u00a0min in PBS and mounted with a mounting medium containing the nuclear marker 4\u2032,6-diamidino-2-phenylindole  for confocal microscopy (Nikon eC1plus) equipped with \u00d710 objective (Leica). DAPI staining was used to define boundaries and layers of the granular RS; 40-\u03bcm-thick slices were scanned with 2-\u03bcm Z-stack steps and then combined together as one picture. Cells were counted in a 960\u2009\u00d7\u2009760\u00a0\u03bcm field of view in 3 slices from each animal with ImageJ .Female rats  and GAERS (n\u2009=\u200912) ranging in age from postnatal day P105\u2013P120. After decapitation, the skull cap was surgically removed caudal to Bregma and a block of brain tissue containing the RS was submerged in ice-cold aerated (O2) saline containing (in mM): sucrose, 200; PIPES, 20; KCl, 2.5; NaH2PO4, 1.25; MgSO4, 10; CaCl2, 0.5; dextrose, 25; pH\u00a07.35 was set with NaOH. Coronal slices (250\u2013300\u00a0\u03bcm thick) were prepared with a vibratome. Slices were transferred to a holding chamber and kept submerged  in artificial cerebrospinal fluid (ACSF) containing (in mM): NaCl, 125; KCl, 2.5; NaH2PO4, 1.25; NaHCO3, 24; MgSO4, 2; CaCl2, 2; dextrose, 10; pH was adjusted to 7.35 by aerating the solution with carbogen (95% O2 and 5% CO2 gas mixture).Experiments were performed on NEC  connected to an upright microscope (ZEISS Axio Examiner.D1). All experiments were done in deep layer (Layer 5) of the cortex at 30\u201332\u00a0\u00b0C. Pyramidal neurons of Layer 5 were visually identified .VM\u2009=\u2009VP\u201410\u00a0mV; with VM\u2009=\u2009membrane potential and VP\u2009=\u2009pipette voltage).Membrane currents were measured with glass microelectrodes pulled from borosilicate glass capillaries  with a resistance of 2.5\u20133.5\u00a0M\u03a9. Patch electrodes were connected to a HEKA EPC-9 patch clamp amplifier (HEKA Elektronik) via a chlorinated silver wire. Access resistances were between 8 and 20\u00a0M\u03a9. Series resistance compensation of \u226550% was routinely applied. Experiments were controlled by the PatchMaster recording software (HEKA Elektronik) at a sampling rate of 10\u00a0kHz, with a low-pass filter of 2\u20133\u00a0kHz. All recordings were corrected offline for a liquid junction potential of 10\u00a0mV  were recorded from tissue slices of 3 GAERS and 4 NEC in the presence of GABA receptor blockers (10-\u03bcM CGP and 25-\u03bcM gabazine) at \u221260\u00a0mV. The micropipette was filled with a potassium-gluconate (K-gluconate)-based intracellular solution containing (in mM): K-gluconate, 88; K3-citrate, 20; NaCl, 10; HEPES, 10; MgCl2, 1; CaCl2, 0.5; BAPTA, 3; Mg-ATP, 3; Na2-GTP, 0.5. The pH of 7.25 was set with KOH. Osmolality of the internal solution was 295\u00a0mOsm/kg. Spontaneous inhibitory postsynaptic currents (sIPSCs) were measured from 3 GAERS and 3 NEC and were pharmacologically isolated using glutamatergic receptor blockers (20\u00a0\u03bcM AP-5 and 10\u00a0\u03bcM DNQX) at \u221260\u00a0mV. The internal solution contained a high molarity of Cl\u2212 (in mM): KCl, 110; NaCl, 10; EGTA, 11; HEPES, 10; Phosphocreatin, 15; Mg-ATP, 3; Na-GTP, 0.5; MgCl2, 1; CaCl2, 0.5. pH was adjusted to 7.25 with KOH. Osmolality was set at ~290\u00a0mOsm/kg. Spontaneous currents were recorded for 5\u00a0min . The frequency and the amplitude of the events were analyzed offline manually using Clampfit  software.Spontaneous synaptic events were measured in voltage clamp mode. During recordings slices were continuously oxygenated and perfused (~2\u00a0mL/min) with ACSF containing (in mM): NaCl, 125; KCl, 2.5; NaHm) were obtained by fitting negative voltage deflections (induced by hyperpolarizing current injections of \u221240 pA) to single or double exponentials. Input resistance (Rin) was calculated according to Ohm\u2019s law: Rin\u2009=\u2009\u0394V/I. The membrane capacitance was estimated using the following formula: Cm\u2009=\u2009\u03c4m/Rin. The anomalous rectification (or voltage sag amplitude) of the current injection at \u2212240 pA was calculated as the differences between the maximal (at the beginning of the hyperpolarizing current injection) and steady state voltage deflection (at the end of the hyperpolarizing current injection). For depolarizing current steps, the number of action potentials (APs) was determined. For the spike in a train of APs, threshold and amplitude were determined. In addition, the number of rebound spikes, that is, the number APs following release from hyperpolarizing, was determined.Current clamp method was used to study the electrical properties of the pyramidal neurons. Recordings were done in brain slices of 6 GAERS and 6 NEC in ACSF (as described above). Micropipettes were filled with K-gluconate-based intracellular solution (as described above). The resting membrane potential (RMP) was measured in current clamp mode immediately after opening the membrane with zero current injection. Recordings were done at RMP and at \u221260\u00a0mV. To measure active and passive properties of the electrical membrane, 1000-ms hyperpolarizing (up to \u2212240 pA) and depolarizing (up to 360 pA) current steps with 40-pA increments were injected as square-wave current pulses. Analysis was done offline using FitMaster software (HEKA Elektronik). Membrane time constants -corrected correlation matrices was performed. Network based statistics (NBS) were applied by correcting this t-test for multiple testing by 1000 times permutation  refer to numbers of neurons and for immunostaining\u2014(n) to numbers of animals. Statistical differences between groups were established with repeated measures ANOVA, independent samples, two-tailed t-test with post hoc Tukey\u2019s multiple comparisons test. Significance levels are indicated as P values. *, **, and *** indicate P\u2009<\u20090.05, P\u2009<\u20090.01, and P\u2009<\u20090.001, respectively.Statistical analysis was performed with IBM-SPSS (version 24). All results are presented as mean\u2009\u00b1\u2009SEM. For patch clamp recordings, numbers given in text  after switching from Isoflurane to Neurolept. In seizure state, SWD epochs alternated with short epochs of rest  and second, after SWD onset (seizure state) A. Applyiz-values of the correlation coefficients between individual nodes . Global network parameters . Compared with NEC, shortest path length was low . Global clustering coefficient  intracortical connections compared with the preseizure state. NBS furthermore indicated that during seizures, particularly connections within and between basal ganglia and limbic regions (green) and within thalamic regions (blue) were significantly stronger. In the preseizure state  segregated from the remaining brain network A and shore state B, connecP\u2009<\u20090.004) intracortical connections . RS showed distinct connectivity patterns , we observed a tendency toward higher sEPSC frequencies in NEC  compared with GAERS   in comparison to NEC  A. While \u2009=\u20090.07) B. sIPSCs\u2009=\u20090.07) C. The amn\u2009=\u200910; GAERS: \u221266.6\u2009\u00b1\u20090.9\u00a0mV, n\u2009=\u200911; F\u2009=\u20090.02, df\u2009=\u200918, P\u2009=\u20090.2) and right  hemispheres. When challenged with positive current steps, pyramidal neurons from NEC revealed higher firing rates in the left compared with right hemisphere (Rin). Rin was significantly higher in the right hemisphere of epileptic rats both at RMP  and at \u221260\u00a0mV . Except membrane time constant (\u03c4m), passive and active membrane properties, such as membrane capacitance (Cm), membrane time constant (\u03c4m), voltage sag amplitude, AP threshold and AP amplitude, and number of rebound spikes, were not statistically different between groups under both experimental conditions  and Interdisziplin\u00e4res Zentrum f\u00fcr Klinische Forschung M\u00fcnster (core unit PIX).supplemetary_data_tgab023Click here for additional data file."}
{"text": "TEX19) is a specific human stem cell gene identified as cancer\u2010testis antigen (CTA), which emerged as a potential therapeutic drug target. TEX19.1, a mouse paralog of human TEX19, can interact with LINE\u20101 retrotransposable element ORF1 protein (LIRE1) and subsequently restrict mobilization of LINE\u20101 elements in the genome.Testis expressed 19  of Outcomes of this study revealed amino acids that potentially stabilize the predicted interaction interface between TEX19 and LIRE1. Of these SNPs, 37 were predicted to play a probably damaging role for the protein, three of them  located at the binding site of LIRE1 and could disturb this binding affinity.This information can be verified by further in vitro and in vivo experimentations and could be exploited for potential therapeutic targets. interaction pattern between TEX19 and LIRE1 proteins Formation of Van der Waals, electrostatic interactions and hydrogen bonding and formation of TEX19 and LIRE1complex The 3D structure of TEX19 protein was predicted by using the Iterative\u2010Threading ASSEmbly Refinement (I\u2010TASSER) server  software  for possible damaging effect on the protein. Sorting Tolerant From the Intolerant (SIFT) server was used for the prediction of the deleterious effect of mutations. For the prediction of disease\u2010related SNPs, we used Predictor of human Deleterious Single\u2010Nucleotide Polymorphisms (PhD\u2010SNP), and SNPs&GO servers. Project HOPE webserver was used to analyze the effect of single point mutation on protein structure.Different software were used for prediction of the effect of missense single nucleotide polymorphisms (SNPs) on the structure and function of the 2.5ConSerfserver. BioEdit version 2.7.5  and was then validated by PROSA statistic  analysis not only reflects the change of protein backbone versus simulation time but also indicates the divergence of the structure. The RMSD of the complex became stable at 15\u00a0ns. The RMSD value of modeled helicase was 0.45\u00a0nm Figure . The val3.4Table 3.5Residues of TEX19  showing hydrogen bonds with LIRE1 were among conserved sequences. Phe35 of TEX19 which have an interaction with LIRE1 predicted among highly conserved buried residues Figures  and 5.4In silico methods such as docking and molecular dynamic (MD) simulations are used to find the correct conformation of a ligand and its receptor and have been used previously in drug design (Bissaro et al., The authors have declared no conflict of interest.Conceptualization, O.R.A, F.A., and Y.H.; methodology, F.A., Y.H., H.A., and N.A.; software, Y.H., H.A., and N.A.; validation, F.A., Y.H., H.A., and N.A.; formal analysis, Y.H., H.E.A., and N.A.; investigation, Y.H., H.A., L.M., S.A., and N.A.; resources, F.A., Y.H., H.A., and N.A.; data curation, F.A., Y.H., H.A., L.M., and N.A.; writing\u2014original draft preparation, O.M.A., F.A., and Y.H.; writing\u2014review and editing, F.A., Y.H., H.A., S.A., L.M., N.A.,O.R.A., H.E.A., and O.M.A.; funding acquisition, F.A., N.A., S.A., and O.R.A."}
{"text": "Release of phosphocreatine kinase-myocardial band (73.86 \u00b1 1.95 vs. 25.93 \u00b1 0.66 IUL\u22121) and lactate dehydrogenase (299.01 \u00b1 10.7 vs. 152.3 \u00b1 16.7 IUL\u22121) was also decreased in the RIPC-treated group. These results demonstrate the cardioprotective effects of the hepatic remote preconditioning against the injury caused by I/R in the isolated perfused hearts.It has been convincingly demonstrated that remote ischemic preconditioning (RIPC) can make the myocardium resistant to the subsequent ischemia reperfusion injury (IRI), which causes severe damages by mainly generating cell death. However, the cardioprotective effects of the hepatic RIPC, which is the largest metabolic organ against I/R, have not been fully studied. The aim of our research is whether remote liver RIPC may provide cardioprotective effects against the I/R-induced injury. Here, we generated an I/R mice model in four groups to analyze the effect. The control group is the isolated hearts with 140-min perfusion. I/R group added ischemia in 30 min following 90-min reperfusion. The third group (sham) was subjected to the same procedure as the latter group. The animals in the fourth group selected as the treatment group, underwent a hepatic RIPC by three cycles of 5-min occlusion of the portal triad and then followed by induction of I/R in the isolated heart. The level of myocardial infarction and the preventive effects of RIPC were assessed by pathological characteristics, namely, infarct, enzyme releases, pressure, and cardiac mechanical activity. Subjected to I/R, the hepatic RIPC minimized the infarct size (17.7 \u00b1 4.96 vs. 50.06 \u00b1 5,  Acute myocardial ischemia accounts for the most common cause of hospitalization in Western countries. Myocardial infarction is recognized as a heart attack when myocardial ischemia exceeds a threshold, which causes irreversible cardiac cell damage or even death  . The FVB mice were kept in a room with controlled temperature and lighting . All animals had free access to chow and water. All protocols on animals were approved by the Ethics Committee of Beijing Anzhen Hospital , Capital Medical University. All experimental procedures were carried out following the Guide for the Care and Use of Laboratory Animals published by the U.S. National Institutes of Health .via a ventral penile vein. A small incision was made in the midline of the abdomen to expose the liver. The procedure of hepatic RIPC was performed by a three-cycle of 5 min before establishing the I/R in the isolated perfused heart. To prepare the isolated rat heart, the heart was excised and the aorta was cannulated for anterograde perfusion. The non-recirculating Krebs\u2013Henseleit buffer solution was used at a flow rate of 10 ml/min. The buffer solution is saturated with the gas mixture of 95% O2 plus 5% CO2 (pH = 7.4) and kept at a temperature of 37\u00b0C. A pressure transducer  was used to detect the coronary perfusion pressure. All isolated hearts were subjected to 30-min ligation of the left anterior descending coronary artery, followed by 90 of reperfusion, except for the control group.The mice were anesthetized by 50 mg/kg thiopental sodium and then 250 IU heparin was injected A total of 24 mice were randomly divided into four experimental groups. In the control group, the Langendorff isolated heart perfusion was established in 150 min. However, in the I/R group, the isolated hearts were exposed to ischemia for 30 min and then reperfusion for 90 min. The procedure conducted on the third (sham-operated) group was the same procedure as the I/R group except that a sham operation on the liver. The animals in the fourth group underwent a remote liver IPC by three cycles of 5-min occlusion of the portal triad before establishing the I/R in the isolated perfused heart .The coronary effluent samples were collected respectively before ischemia and after 0, 5, 30, and 60 min of reperfusion. The collected samples were stored at \u221220\u00b0C until analyzing to measure the level of creatine kinase-myocardial band (CK-MB) and lactate dehydrogenase (LDH). Enzyme-linked immunosorbent assay kits were used for the analysis: serum CK-MB  and serum LDH .via an elastic water-filled balloon connected to a pressure transducer . The initial end-diastolic pressure was adjusted to 10 mmHg and after that, the pressure signals were recorded for analysis using Chart 5.0.1 Data Recording Software . The heart rate, LVDP, and the percentage of the rate pressure produce (RPP%) were calculated from basic measurements.Left ventricular-developed pressure (LVDP) was determined At the end of the procedure of each experiment group, the heart was collected from the perfusion apparatus, and then it was sectioned from the apex to the base into 2-mm-thick slices. The infarct size, the area at risk of ischemic injuries, and the intensity of the I/R-induced myocardial injury were quantified using standard methods.p-value of at least <0.05 was considered significant.Significant differences were analyzed by the one-way ANOVA to compare between the experimental groups. A p < 0.0001) declined in the I/R and sham-operated groups compared to the control group. However, the RPP% in the group exposed to the hepatic RIPC reached the same level as the control group. The effects of hepatic RIPC on the rate pressure of the isolated heart subjected to 30-min ischemia followed by 90-min reperfusion are shown in The levels of the heart rate and LVDP were immediately decreased upon the commencement of the ischemia and reached zero level during the ischemia in the groups exposed to the global ischemia. The values of the hemodynamic parameters obtained in the preconditioned and non-preconditioned hearts at different times of the preischemia and postischemia are shown in p < 0.001) reduction in infarct size to 15.60%. The representative images of the infarct size data are shown in The effect of hepatic RIPC on I/R-induced myocardial infarct size in the isolated perfused hearts is shown in p < 0.001) increased enzyme releases were observed in the isolated perfused hearts subjected to I/R. However, there was significant (p < 0.001) reductions in the release of lactate dehydrogenase from 299.01 \u00b1 10.7 to 152.3 \u00b1 16.7 IUL\u22121 and phosphocreatine kinase-MB from 73.86 \u00b1 1.95 to 25.93 \u00b1 0.66 IUL\u22121 in the preconditioned group . The current results suggest the cardioprotective effectiveness of liver RIPC against I/R-induced myocardial cell injury. Consistently, it has been reported that hepatic RIPC had significantly diminished the incidence of I/R-induced arrhythmias in isolated rat hearts , National Natural Science Foundation (81970525), Beijing Hospitals Authority Incubating Program (No. PZ2021007), and Beijing Hospitals Authority Youth Program (No. QML20200604). The sponsors had no role in the study design, data collection and analysis, decision to publish, or manuscript preparation.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "In England, demand for primary care services is increasing and GP shortages are widespread. Recently introduced primary care networks (PCNs) aim to expand the use of additional practice-based roles such as physician associates (PAs), pharmacists, paramedics, and others through financial incentives for recruitment of these roles. Inequalities in general practice, including additional roles, have not been examined in recent years, which is a meaningful gap in the literature. Previous research has found that workforce inequalities are associated with health outcome inequalities.To examine recent trends in general practice workforce inequalities.A longitudinal study using quarterly General Practice Workforce datasets from 2015\u20132020 in England.The slope indices of inequality (SIIs) for GPs, nurses, total direct patient care (DPC) staff, PAs, pharmacists, and paramedics per 10 000 patients were calculated quarterly, and plotted over time, with and without adjustment for patient need.Fewer GPs, total DPC staff, and paramedics per 10 000 patients were employed in more deprived areas. Conversely, more PAs and pharmacists per 10 000 patients were employed in more deprived areas. With the exception of total DPC staff, these observed inequalities widened over time. The unadjusted analysis showed more nurses per 10 000 patients employed in more deprived areas. These values were not significant after adjustment but approached a more equal or pro-poor distribution over time.Significant workforce inequalities exist and are even increasing for several key general practice roles, with workforce shortages disproportionately affecting more deprived areas. Policy solutions are urgently needed to ensure an equitably distributed workforce and reduce health inequities. Pre-existing health inequalities, which are widening owing to COVID-19, may be exacerbated by an inequitably distributed health workforce. In addition, the composition of the general practice workforce is changing with the introduction of PCNs. Here, recent longitudinal trends are explored in the distribution of practice-based staff, including GPs, nurses, and allied health professionals. It is found that significant workforce inequalities exist and are even increasing for several key general practice roles, with workforce shortages disproportionately affecting more deprived areas. Policy solutions are urgently needed to expand access and reduce health inequities. The number of consultations in general practice has increased significantly in recent years, but staff numbers have not kept up with this demand. The percentage of GPs in the NHS workforce has been steadily decreasing, and the GP workforce is ageing; doctors are increasingly working part-time, which foreshadows future worsening shortages. In 2015, then-Secretary of State for Health Jeremy Hunt promised an additional 5000 GPs for the NHS by 2020, but this was not achieved; instead, it is predicted that there will be a shortage of 7000 GPs by 2024. England\u2019s increasingly depleted primary care workforce will likely be a 'make-or-break' issue for the NHS in coming years. Evidence suggests that these workforce shortages are not equally distributed across England; areas with higher levels of deprivation tend to have fewer GPs relative to the patient population despite a greater burden of chronic disease. Moreover, GP supply has been linked to health-outcome measures, including mortality rates, self-reported health, and life expectancy, even after controlling for sociodemographic measures.Health workforce shortages, especially in primary care, have long plagued healthcare systems globally, and the gap between the growing need for services and sufficient staff has been widening.The NHS Long Term Plan, published in 2019, emphasised the importance of general practice services and established PCNs, or groups of neighbouring practices that enable economies of scale and integrated care. PCNs were to boost the primary care workforce through the Additional Roles Reimbursement Scheme (ARRS), which guaranteed financial resources to recruit specified additional roles such as pharmacists, PAs, and paramedics into general practices. The expanded presence of allied health professionals in primary care is intended to achieve a dual aim of shoring up general practice by reducing pressure on existing clinical staff, as well as delivering outcomes specified in the PCN network contract. and through an exclusive focus on GPs.While it is still too early to evaluate recruitment under the ARRS, this research aims to quantify recent trends in the distribution of the general practice workforce, including nurses and additional roles, to uncover any existing workforce inequalities since 2015. It will also examine whether and how the skill mix within practices has changed. This analysis fills a gap in the previous literature on workforce inequalities, which is limited by age , Practices were matched with their respective PCNs using the NHS Digital GP and GP practice-related data page.Quarterly data from September 2015\u2013December 2020 (20 quarters) were obtained from the NHS Digital General Practice Workforce collection. and SPLWs and pharmacy technicians were introduced in June 2019. Atypical practices, that is practices with <750 total patients or <500 patients per GP FTE, were excluded, following previous analyses. The same method as that described in the General Practice Workforce Data Quality Statement was employed to account for missing workforce data: weighted average estimates were substituted for missing values for GPs, nurses, and total DPC staff in each quarter.Full-time equivalent (FTE) data were collected on the following staff: GPs, nurses, total DPC staff , pharmacists, physiotherapists, PAs, occupational therapists, podiatrists, paramedics, social prescribing link workers (SPLWs), and pharmacy technicians. In December 2016 and June 2017, only data on GPs were available. Paramedics were introduced into the dataset in September 2016, IMD scores for 2016, 2017, 2018, and 2020 were calculated based on a weighted mean of IMD 2015 and IMD 2019  and divided into deciles on a scale of 0\u20131. Deprivation increases with IMD decile; 0.1 corresponds to the least deprived decile, and 1 corresponds to the most deprived decile. Missing IMD data were imputed with IMD scores from the adjacent year, where available.Practice-level Index of Multiple Deprivation (IMD) 2015 and 2019 scores were obtained from the Fingertips National General Practice Profiles. While not an exact measure of patient need, this formula has been used similarly in previous research, and is one of the best summary measures available to capture patient need in GP practice populations. Practice-level Carr-Hill data were obtained from the NHS Payments to General Practice collection on NHS Digital, 2015\u20132016 through 2019\u20132020, five datasets in total. Higher Carr-Hill values indicate higher patient need. Missing Carr-Hill data were imputed with values from the adjacent year, where available.The Carr-Hill formula was used to adjust for patient need. This resource allocation formula considers patient demographics and health status, list turnover, market forces, and rurality to calculate a weighted practice population. The SII is a measure of the difference in FTE staff per 10 000 patients between the highest and lowest IMD decile. A negative SII value corresponds to pro-rich inequality, that is, fewer staff in more deprived deciles; a positive value corresponds to pro-poor inequality, that is, more staff in more deprived deciles. Confidence intervals that overlap zero indicate no significant distributional inequality. These unadjusted and adjusted SIIs were plotted for the quarters with available data from September 2015\u2013December 2020. The SII analysis was also done from March 2019\u2013December 2020 with workforce variables and IMD deciles aggregated to the PCN level for GPs and nurses only, weighted by patient population. Additional roles recruited and employed by PCNs may have been recorded in the newly introduced Primary Care Network Workforce datasets instead of the General Practice Workforce datasets beginning in March 2020; as a result, PCN-level SII analyses of total DPC staff and each additional role from March 2020 onwards may not be entirely accurate or complete, and were, therefore, excluded from this analysis.The practice-level number of FTE staff per 10 000 patients was calculated for GPs, nurses, total DPC staff, pharmacists, physiotherapists, PAs, occupational therapists, podiatrists, paramedics, SPLWs, and pharmacy technicians. Socioeconomic gradient bar charts depicting the mean FTE staff per 10 000 patients by IMD decile for each workforce variable at each quarter were plotted and visually assessed for linearity. Next, a linear regression analysis of FTE staff per 10 000 patients by IMD decile was conducted at each quarter, with and without Carr-Hill adjustment. The coefficient of this regression is the slope index of inequality (SII).A sensitivity analysis using head count (HC) instead of FTE staff was conducted and compared with the practice-level SII graphs. All analyses were done using Stata (version 16.1).Practice populations ranged from 750\u201389 786 patients. The descriptive statistics, including the percentage of missing data for each workforce variable (FTE staff per 10 000 patients) across the quarters with available data, are shown in Supplementary Table S1.Occupational therapists, podiatrists, and physiotherapists were excluded owing to insufficient data to detect distributional trends. SPLWs and pharmacy technicians also had low overall numbers but were included in the first step of the analysis because their employment sharply increased in the quarters studied.The socioeconomic gradient graphs of mean FTE staff per 10 000 patients by IMD decile are included in Supplementary Figure S1. SPLWs and pharmacy technicians were excluded from the regression analyses because they did not show any consistent socioeconomic gradient.Across all quarters, there were significantly fewer FTE GPs per 10 000 patients in practices in higher IMD deciles, that is, higher levels of deprivation. This inequality has widened slightly over time, as the SIIs have moved further from the null. While the PCN-level indices for GPs were less negative than the practice-level indices, the SII trends over time appeared similar.P<0.05) in 2019.For nurses, the longitudinal trend appears to be moving in the opposite direction, towards a more equal or pro-poor distribution over time. Before adjustment, the positive SII values for nurses suggest that there were more nurses per 10 000 patients employed in more deprived practices ; after aThe distribution of total DPC staff mirrors that of GPs, in that there were fewer total DPC staff employed in more deprived areas relative to the patient populations . SimilarFor both pharmacists and PAs, a trend of increasing pro-poor inequality was observed at the practice-level, both before and after Carr-Hill adjustment . StartinFor paramedics, widening pro-rich inequality was observed in both the adjusted and unadjusted practice-level SII estimates . This inInequalities were observed in the distributions of GPs, paramedics, and total DPC staff, with fewer staff employed in more deprived deciles . The opp on GP inequalities from 2004\u20132005 to 2013\u20132014 and updates it to include nurses and additional roles as well as PCN-level indices for GPs and nurses. In addition to its novelty, another strength of this analysis is its exhaustive use of available data. Instead of merging all 20 quarters of data, analyses were run separately at each quarter, minimising the number of excluded practices.This analysis extends a previous analysis As a result, the adjusted SIIs reported may underestimate the true adjusted inequality indices, that is, there may be higher levels of pro-rich inequality than this analysis reports. Furthermore, while SIIs have been used and justified in previous health and workforce inequality analyses, the reliance on a crude regression analysis masks variation across and within IMD deciles. The distributions of each workforce variable were assessed visually, and variables that did not show a linear gradient were excluded from further analysis. However, slight non-linear trends are still present in the remaining variables, which can be seen in Supplementary Figure S1. Finally, the publicly available general practice workforce datasets are limited, especially for newly introduced additional roles. Although substitution was employed for missing values where possible, as described in the Method section, the potential for inaccurate or incomplete workforce data as reported by practices remains a limitation of the analysis.However, this research has several limitations. First, the Carr-Hill formula, which has not been substantively updated since it was first implemented in 2004, has been criticised for not adequately considering the extra pressures that practices in areas of high socioeconomic deprivation face. Moreover, the present findings are comparable with a recent longitudinal report by The Health Foundation, which plotted general practice workforce supply over time by IMD quintiles; while this report did not include significance testing, the observed trends align with the results presented in this article. The most recent longitudinal SII analysis of workforce inequalities reported a slight pro-poor, although not statistically significant, SII estimate in 2013\u20132014. However, the SIIs in this analysis had been approaching the null since 2011\u20132012. It is, therefore, likely that GP workforce inequality has been increasing since 2011\u20132012.The finding that GP workforce shortages disproportionately affect practices in areas of higher deprivation, an inequality that has widened since 2015, is consistent with recent cross-sectional analyses of workforce inequalities. Previous reports have shown that practice closures have been increasing since 2013. Likewise, during this study period, far more practices were dropped from the datasets than added, which may have driven the widening inequality observed.This previous longitudinal analysis also found that the primary driver of GP inequality was the opening and closing of practices in more deprived areas, rather than recruitment into existing practices.et al as a disproportionate care law (DCL), or an increase in healthcare delivery with social disadvantage, but not relative to population need. The finding of an ICL operating for GP supply in England is especially striking given that this form of inequality has primarily been documented in countries with proportionately less or more fragmented public investment in health care; a DCL is more commonly observed in countries with publicly funded health systems that provide universal coverage such as the NHS.This research demonstrates the existence of an inverse care law (ICL), or a decrease in healthcare delivery with social disadvantage, within general practice in recent years. This is contrasted with previous analyses examining study periods before 2015, which had primarily found what is described by Cookson NHS Long Term Plan. Health needs are often greatest in areas of high socioeconomic deprivation, but we observe a relative undersupply of some key clinical staff in primary care in these areas. One effect of this is the persistence of the ICL in general practice. Addressing this is even more critical in the context of the COVID-19 pandemic, which has disproportionately affected under-resourced and underserved communities, and has widened existing health inequities patterned by class, race, and geography.Reducing health inequalities is a core government commitment and was specified as a primary goal within the  In addition, the impact of substituting nurses and allied health professionals for GPs in under-doctored practices on quality of care and health outcomes is not entirely known. Further research is needed to better understand the effects of skill-mix redesign in the health workforce.In England, PCNs are to be tasked with reducing health inequalities. To do this, practices and PCNs in the poorest areas will need relatively more GPs and allied health professionals to respond to the demand for primary care services. The finding \u2014 that in general there remains a pro-rich inequality in recruitment of staff in primary care \u2014 should be of significant concern to policymakers. They will need to consider why practices and networks in deprived areas are relatively understaffed, and how this can be reversed. Given the significant scale of the proposed expansion of the primary care workforce, policymakers must urgently consider what evidence-based mechanisms can be used to encourage equitable recruitment of additional roles in primary care. This might include but not be limited to incentivisation of DPC posts in understaffed areas, enhanced training offers for these roles, and offering practices and networks in understaffed areas additional recruitment support.Significant workforce inequalities exist, and are even increasing, for many general practice roles, with some workforce shortages disproportionately affecting more deprived areas. Expanded use of additional roles under the ARRS may partially alleviate GP workload in overstretched practices, but there is a risk that additional workforce will gravitate to more affluent areas, further perpetuating inequity in primary care staffing. These findings underscore the need for more intentional and directed policies addressing workforce inequalities in order to expand access and reduce health inequities."}
{"text": "We quantified intra-population genetic variance and predicted individual genetic performance along a climatic gradient. This approach can be adopted in most breeding and conservation programs, boosting the speed of adaptation under climate change.In forest tree breeding, assisted migration has been proposed to accelerate the adaptive response to climate change. Response functions are currently fitted across multiple populations and environments, enabling selections of the most appropriate seed sources for a specific reforestation site. So far, the approach has been limited to capturing adaptive variation among populations, neglecting tree-to-tree variation residing within a population. Here, we combined the response function methodology with the  Additive genetic variance  from 21 test sites in Austria ranging from Alpine to lowland regions. We utilized height and wood density measured directly in forest stands on individual mature trees with reconstructed pedigree. Using the response function methodology combined with mixed-model genetic evaluation, we quantified the intra-population As outlined above, response functions have been proposed to capture adaptive variation at the population (provenance) level, unlike the conventional breeding focusing mainly on intra-population The European larch data used in this study were previously sampled and genetically analyzed by Lstib\u016frek et al. . We willWe extracted climatic variables for the test sites from the WORDCLIM dataset ; Z is the genetic relationship matrix; a is the vector of additive genetic (breeding) values, where A is the average numerator relationship matrix, \u03c3a1a2 is the additive genetic covariance between traits 1 and 2, and \u2297 is the Kronecker product operator. The random residual error effect was modeled using an unstructured covariance matrix structure aswhere e1e2 is the residual covariance between the two traits. Random effects were assumed to be independent.where \u03c3We utilized the above predictions of the fixed site effects and calculated the respective all-pairwise differences. Next, we trimmed the dataset so that each half-sib family was represented in at least six sites to achieve even representation of families while maximizing their distribution across multiples sites  to describe the within-population genetic variation following major climatic gradients. We tested the linear, quadratic, and Gaussian models as they have been predominantly used in previous studies  and wood density , respectively. We observed negligible additive genetic correlation between the respective traits . Our data did not show a significant genotype by environment interaction (GxE), as shown earlier by Lstib\u016frek et al. . 87% of all pairwise differences between sites were statistically significant (p < 0.05). Details are provided in Experimental site effects (considered fixed) were found statistically significant  varies from 35 to 120. This uneven number is explained because it is a product of natural crosses among parents; hence the families' sizes were only revealed at the pedigree reconstruction stage. In Nb and the mean model's p-values of the RFs curve fitting were significant (p < 0.05), except one (genotype L2).In  of 0.27 . All p-vIn Phenotypic data were regressed onto random genetic and fixed site factors using the mixed linear animal genetic model. The genetic variation observed in this study resembles typical values for height and wood density in conifers  take place in operational afforestation sites with a designated seed source. Further, uneven gametic contributions within and among the respective sites are optimally accounted for within the combined genetic evaluation protocol, i.e., multi-site animal genetic model. Unlike the traditional breeding programs relying on transfer within and among fixed-seed zones, the current approach is flexible. Seed transfer delineation is dynamic in line with particular CC development.There are possible pitfalls of this proposed strategy that should be addressed here. Although used in many studies, the quadratic model fitting is a simplistic representation of the trait response to the environment. It assumes a physiological response that increases to a maximum value, then drops immediately  identification of a common seed source representing a specific population, i.e., a provenance, (2) phenotypic evaluation followed by pedigree reconstruction  can be found at: ML and SS conceived the project. VP and DC conducted statistical analyses. VP and ML wrote the manuscript. SS, DC, JS, and HK contributed to discussions. All authors contributed to the article and approved the submitted version.VP was financed by the Internal Grant Agency of the Faculty of Forestry and Wood Sciences, Czech University of Life Sciences Prague. DC, HK, and SS were supported by the Austrian Research Promotion Agency (FFG) and the Cooperation Platform Forst Holz Papier (FHP) and LIECO nurseries and the Austrian Federal Forests (\u00d6Bf). ML was supported by grant \u201cEXTEMIT \u2013 K\u201d, no. CZ.02.1.01/0.0/0.0/15_003/0000433 financed by OP RDE. ML and JS were supported by the Ministry of Education, Youth, and Sports program INTER-EXCELLENCE, subprogram INTER-ACTION [grant number LTAUSA19113].The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Furthermore, NiOx can be fabricated via scalable and controlled physical depositionmethods such as RF sputtering to facilitate the quest for scalable,solvent-free, vacuum-deposited HaP-based solar cells (PSCs). However,the interface between NiOx and HaPs isstill not well-controlled, which leads at times to a lack of stabilityand Voc losses. Here, we use RF sputteringto fabricate NiOx and then cover it witha NiyN layer without breaking vacuum.The NiyN layer protects NiOx doubly during PSC production. Firstly, the NiyN layer protects NiOx from Ni3+ species being reduced to Ni2+ by Ar plasma, thus maintaining NiOx conductivity.Secondly, it passivates the interface between NiOx and the HaPs, retaining PSC stability over time. This doubleeffect improves PSC efficiency from an average of 16.5% with a 17.4%record cell to a 19% average with a 19.8% record cell and increasesthe device stability.The interfaces between inorganic selective contacts andhalideperovskites (HaPs) are possibly the greatest challenge for makingstable and reproducible solar cells with these materials. NiO One of the main factorsfor the high PCE in PSCs composed of polycrystalline thin films isthe intrinsically low defect concentration in the bulk of halide perovskites(HaPs).x) is a sturdy andefficient hole-transport material (HTM), which has been reported toimprove the stability of PSCs over that achieved with organic HTMs.9 Radio-frequency (RF) sputtering is a scalable fabrication methodfor metal oxides with a highly controlled oxygen partial pressure.Wang et al. have shown that sputtered NiOx at low temperatures has controlled transparency and conductivitythat affect the efficiency of the PSC.10 Moreover, sputtered NiOx is preferredover wet-chemically processed NiOx becauseit leaves no residues of solvents or precursors that can damage thestability and efficiency of the final device.11 However, sputtered NiOx hole-transportlayers (HTLs) with no further treatment have parasitic resistancethat leads to PSCs with moderate fill factors (FFs) and efficiencies.14Nickel oxide , a very small bandgapsemiconductor, as an ultra-thin \u223c2 nm layer on NiOx, essentially an in-situ modification of the NiOx surface without breaking vacuum. This NiyN interlayer becomes a buffer between theoxide and the HaP film. We then investigate its effects on PSC performanceand stability.In this work, we use RF magnetron sputtering for an alternativein-situ route to passivate the HaP/NiOyNprotects NiOx from the reduction of Ni3+ cationsto Ni2+ during the Ar plasma cleaning step, typically usedto improve the wettability of the oxide, thus maintaining NiOx conductivity. The NiyN layer also passivates the interface between NiOx and MAPbI3 and inhibits the reactionbetween MAPbI3 and Ni3+. Although NiyN is conductive and could be expected to introducetrap states that damage PV performance, we show that thin enough NiyN can passivate the interface between NiOx and HaP, thereby improving device efficiencyand stability.We find that NiFluorine-doped tin oxide -coated glass substrates  werecleaned in a sonication bath with soap (Decon 90) and deionized waterand then rinsed in deionized water followed by dry ethanol.x and NiyN were deposited using RF sputtering  from2-inch NiO and Ni targets, respectively . NiOx deposition was done at room temperaturewith an Ar gas flow of 30 sccm and a total chamber pressure of 3 mTorr.NiyN deposition was done at room temperatureand a total chamber pressure of 3 mTorr, with Ar and N2 gas flows of 15 and 45 sccm, respectively. In the first stage, theNiOx target was set to 80 W for 1 h, thenthe chamber was purged for 10 min, and finally, the Ni target wasset to 60 W for 3 min. Ar plasma cleaning was performed by applyinga power of 30 W on the substrate with an Ar flow of 30 sccm.NiO3 was synthesized from MAI (Greatcell Solar) andPbI2  precursors in a 1:1 ratioat a concentration of 1.5 M. The precursors were dissolved overnightat 60 \u00b0C in \u03b3-butyrolactone  anddimethyl sulfoxide  at a 7:3 ratio.The solution was spin-coated at 4000 rpm for 35 s with 800 \u03bcLof a toluene  anti-solvent drip after 30s. For device fabrication, 20 mg of PCBM was dissolved in 1 mL ofchlorobenzene overnight, spin-coated at 2000 rpm for 30 s, and annealedfor 10 min. After 15 min of cooling, a solution of 3 mg of bathocuproine in 6 mL of isopropanol wasspin-coated at 4000 rpm for 30 s. Finally, thermal evaporation wasperformed to deposit round Ag contacts of 3 mm diameter. A schemeof the device structure is given in the Supporting Information (SI).MAPbI\u201310 Torr) with He I photons (21.22 eV)generated by a He discharge lamp, with a pass energy of 5 eV and a0.02 eV step size.Ultraviolet photoemission spectroscopy(UPS) was used to probe the vacuum level and the position of the Fermilevel with respect to the valence band edge, leading to the determinationof the work function (WF) and ionization energy (IE) of the measuredmaterials at a resolution of 0.15 eV. UPS was performed in an ultrahighvacuum  withan Al K\u03b1 anode (1486.6 eV) was used to probe the Ni 2p, N 1s,and C 1s core levels at a resolution of 0.8 eV. Scans were taken witha pass energy of 25 eV and a 0.05 eV step size at a low base pressureof 10\u20138 Pa (\u223c5\u00d7 10\u201310 Torr). The binding energy (BE) wascalibrated vs carbon (C 1s = 285 eV). Survey scans were collectedwith a pass energy of 200 eV and a 1.0 eV step size, followed by high-resolutionscans with a pass energy of 50 eV and a step size of 0.1 eV. The sampleswere exposed for \u223c1 min to air during the sample transfer.XPS in Bar-Ilan University (BIU) wasperformed using a Thermo ScientificNexsa spectrometer XPS system with an Al K\u03b1 anode (1486.6 eV)at a base pressure of \u223c7 \u00d7 102 atmosphere.Optical transmission measurements were performed using an opticalfiber-based custom-made system that consists of a CCD array spectrometer and two integrating spheres. The measurementswere done over a 400\u20131000 nm spectral range with a circulardiameter of 3 mm in a NTwo-probe measurementswere done with a Keithley 2400 source measurementunit (SMU) in a potential range of \u22120.5 to 0.5 V at a 50 mV/pointrate.J\u2013V characteristicsweremeasured with the same Keithley source at a potential range of \u22121.2to 0.2 V at a 20 mV/point rate in ascending and descending scan directions.The device was illuminated through an optical fiber using a laser-drivenlight source  xenon lamp calibrated to theAM1.5G solar spectrum.2 atmosphere, using an air photoemission system , illuminated by a deuterium (D2) UV source, coupledwith a motorized grating monochromator.Photoemission yield spectroscopy (PEYS)was used to measure theIE  ofperovskite surfaces. The measurements were done under a NTransient PL decay measurementson the HaP thin films depositedon NiO/FTO substrates with and without a NiN interlayer were measuredin ambient conditions. The HaP thin films were excited with a 450nm picosecond pulsed laser diode source, and PL decay characteristicsin the 760\u2013765 nm emission wavelength range were recorded witha photomultiplier tube.x layer from a NiO target on an FTO-coatedglass substrate. To modifythe NiOx surface, we used reactive sputteringtreatment of the Ni target with a plasma composition of 25% Ar and75% N2.We used RF sputtering to deposita NiOx surface, we used XPS on NiOx samples modified and unmodified by reactivesputtering. TheXPS spectra from both NiOx samples showa broad and shallow nitrogen signal around a binding energy of 399eV, which typically fits the signal of nitrogen in organic matrices position in the material. The O 1s feature is a superposition oftwo core level peaks corresponding to oxygen bound to Ni3+ and Ni2+. The BE of the O 1s peak is found to increaseby 0.6 eV upon Ar+ etching, from 528.6 to 529.2 eV, forNiOx  positions obtained by linear extrapolationof the leading edge of the filled states are shown in x valence band shows a 0.39 eV shift away from EF upon Ar+ etching, whereas the NiyN-modified NiOx valence band remains at the same position (negligible shift of 0.03eV). Comparing the valence bands of the NiOx reference and NiyN-modified NiOx after 5 s of Ar+ etching, wefind the VBM to be 0.30 eV closer to the Fermi level for NiyN-modified NiOx (1.00eV below EF) than for the unmodified NiOx (1.30 eV below EF) .To understand theeffect of Arelow EF) 2. Thistx (left) and NiyN-modifiedNiOx (right) before and after 5 s Ar+ etching,plotted relative to the vacuum level (Evac), are shown in Ef), as they were measured,are shown in the SI . The WFfor unmodified NiOx decreases from 4.75to 3.94 eV after 5 s Ar+ etching and from 4.52 to 4.10eV for NiyN-modified NiOx. Together with the linearly extrapolated VBM values, the IEvalues are found to be 5.24 eV for Ar+-etched, unmodifiedNiOx and 5.10 eV for NiyN-modified NiOx  and the p-type character of the film, as shown by the positionof the Fermi level in the lower part of the gap (x we synthesized is O-rich as reported inthe literature.28 The charge carrier (hole) densityin the NiOx is the result of nickel vacancies(VNi\u2033) and/or oxygen interstitials (Oi\u2033).29 Ar+ etching presumably creates more oxygen vacancies (VO\u00b7\u00b7), becauseoxygen is lighter than nickel and, thus, more easily ejected fromthe etched surface. Oxygen vacancies can reduce the charge carrierconcentration as x films. NiyN-modified NiOx is more resistantto such a process, as seen by the XPS and UPS results, demonstratingthe passivating effects of NiyN on theNiOx surface. This passivating effectmakes the NiyN-modified NiOx film less prone to electronic structure changesduring subsequent processing steps, which is further corroboratedby the unchanged energies of the valence states with respect to theFermi level in NiO of Ni3+ S2 and th of Ni3+ S2 and th+ etching of both surfaces (Evac) shift, which agrees withthe 0.42 eV change in the NiyN-modifiedNiOx WF measured by UPS  above EF upon Ar+ etching  betweenthe FTO electrode and the NiOx surfacewith and without a NiyN layer, both beforeand after Ar plasma treatment. The Ar plasma treatment dramaticallyincreased the unmodified NiOx resistance\u223c40\u00d7, from 1.9 M\u03a9 before to 80 M\u03a9 after. TheNiyN layer reduced the NiOx resistance from 1.9 to 0.09 M\u03a9 before plasmatreatment, but even more critically, after Ar plasma treatment, theresistance increased about three times to 0.3 M\u03a9, lower thanthat of the unmodified NiOx . The VBM shift toward EF as NiyN gets thicker mayexplain the minor resistance increase after Ar plasma, as part ofthe NiyN layer is etched away.The NiOied NiOx 3b. The dx with and without NiyN, beforeand after plasma etching, we marked NiyN-modified NiOx after plasma treatmentas the best candidate for PSCs. Thus, we deposited MAPbI3 on top of NiOx with and without a NiyN layer after plasma treatment and then performedtime-resolved photoluminescence (TRPL) to measure differences in chargeextraction after NiyN deposition and plasmatreatment. A fit of the PL decay to a double exponential curve typicallyindicates two kinds of decay mechanisms, which are common when HaPis deposited on a selective contact.34 A short lifetime \u03c41 correspondsto charge transfer and detrapping of charge due to light exposure,and a longer lifetime \u03c42 corresponds to recombinationsat the interface and within the absorber. Because \u03c41 and \u03c42 were hard to distinguish, we chose to calculateonly \u03c42 according to a monoexponential fit at a decaytime > 60 ns.35 Similar lifetimes, 31and29 ns for MAPbI3 on NiOx andNiyN-modified NiOx, respectively (yN modificationdid not cause more (or less) recombination at the interface. Furthermore,PEYS, AFM, SEM, and XRD measurements  do not differ between MAPbI3 layers deposited on NiyN-modified or unmodified NiOx.Aftermeasuring the transparency and resistance of NiOectively 4a, indicyN modification does not show any differencein morphology .AFM imaging of the surfaces before and after NiFigures S6 and S7) measurementsshow no significant difference in MAPbI3 morphology andcrystallinity . Both XRD analysisand SEM micrographs did not show any signs of PbI2 beyondthe peak-to-noise ratio level.SEM andXRD , but only the descendingdirection is shown for simplicity . The similarity in Voc between these two samples is consistent withthe similar results obtained by TRPL. At the same time, the FF improvesdramatically from a 65% average with unmodified NiOx to 75% with the NiyN layer, regardlessof its thickness or the etching time  for these samples andis explained by the decrease in transparency, as seen in yN modificationis to have as thin a NiyN layer on NiOx as possible, which can passivate the HTLwith a minimum loss in Voc and transparency.The minor decrease in r plasma 5d. A sliing time 5e is coning time S9 for thyN layer has on the complete solar cell FF, we performeddark I\u2013V measurements todetermine the shunt resistance (Rsh) andthe series resistance (Rs) of the SC , we ascribe this to aVBM shift toward the vacuum level that increases the driving forcefor hole extraction from the HaP film but at the expense of the Voc (To further investigate the huge effect that the Nisurement S3, we asyN modificationon cell stability, 18 cells were measured over 4 days at room temperaturein a N2-filled chamber with a controlled environment andrelative humidity that did not surpass 5%. The cells were held inthe dark between the measurements and were exposed to light for 4h before and naturally during measurements. For both types of cells,the PCE decreased over the 4 days. However, on average, the referencecell PCE values were reduced by almost 50%, from 15.9 to 9%, whilethose of the NiyN-modified cells werereduced only by 15%, from 16.5 to 14% (To test the effect of the Ni5 to 14% 7a.yN thanthose without it. The Voc and Jsc of both types of cells show inverse changesover the 4 days of testing. The Jsc ofthe reference cells decreased by 40% to, on average, 14 mA/cm2, whereas the Jsc of the NiyN-modified cells remained almost constantat 20 mA/cm2 (Voc of the referencecells increased by 3% up to 1.1 V, and the Voc of the NiyN-modified cells decreasedby 8% down to 0.95 V (yN modified-NiOx; see yN-modifiedcells remained constant for 3 days, and only on the fourth day didthe series resistance increase by 30% (Jsc reductionand the Rs increase in untreated PSCsare prominent evidence of a reaction at the NiOx\u2013MAPbI3 interface inhibited by the NiyN treatment. The NiyN layer plays a dual role, as it helps maintain the Ni3+ concentration, passivates the NiOx\u2013MAPbI3 interface, and presumably preventsa reaction between the more active Ni3+ and MAPbI3. These two features of the NiyN layerimprove the solar device FF and, most importantly, cell stability.Further investigation of the SC statistics revealsa differentaging mechanism for cells with Ni0 mA/cm2 7e. The Vo 0.95 V 7c. The Fe by 30% 7d,f, stiI\u2013V characteristics over 4 days,but this time we repeated the I\u2013V measurements for 100 cycles every day (yN-modified cells do not. Although in theinitial response, the shunt resistance of the reference cell is higherthan that of the NiyN-modified SC, itsseries resistance is higher by 150%, which leads to the two typesof cells having equal FFs. After 4 days of cycling, the series resistanceof the reference cell increased by 70%. Similar to what Khenkin etal.36 showed, the initial Voc of the reference PSC started every day at 1.1 V butdecreased as the number of cycles progressed, which is not the casefor the NiyN-modified cells. We interpretthis finding as an acceleration of the reaction at the interface bythe constant change in the electric field applied to the SC underworking conditions. The Jsc and Rs reductions suggest that an insulating interfaciallayer formed between NiOx and MAPbI3. In contrast, in the cells prepared with NiyN-treated NiOx, Jsc only undergoes a 3 mA/cm2 loss over the100 cycles. The constant Rs and Rsh over time indicate no change in charge transportand therefore no change of the material under working conditions.These results altogether support that NiyN modification inhibits reaction at the NiOx\u2013MAPbI3 interface and prevents the formationof a blocking layer that deteriorates the SC performance.To further investigate the current reduction source, we measured very day 8a,b. Thex HTLs with NiyN inorganiclayers, which is the first time that such a modification was everdone. We showed that NiyN plays a dualrole, improving the PSC\u2019s efficiency and stabilizing the NiOx\u2013HaP interface. The NiyN layer formed on NiOx retains the Ni3+ species within the nickel oxide bulk,preserving its conductivity and thereby improving the overall cellefficiency. Furthermore, the same NiyNlayer protects HaP from the reactive Ni3+ species, necessaryfor nickel oxide conductivity, and prevents degradation of HaP, givingdevices superior stability over those built with untreated referenceNiO films. Although, with time, some of the NiyN might be oxidized by the NiOx layer, in a well-encapsulated device, the interfacial reactivitycan be kept below the level where charged defects will start to changethe overall defect density of the transport and absorber layers. Theseinteractions should be investigated further beyond the scope of thisstudy. We also showed that when NiyN isthin enough, its small energy gap, which can block sunlight and introducetraps for charge carriers at the interface, has a negligible effecton the overall SC efficiency. Our first reported solid-state, inorganic,in situ passivation route via RF sputtering deposition presents amajor step toward solvent-free fabrication of reproducible and stablePSCs.We used a physical vapor deposition methodto improve NiO"}
{"text": "The results support the assumption of an urban\u2013rural divide in terms of perspectives and values. The discourse indicates that rural actors who are most affected by the wolves\u2019 vicinity have more negative attitudes towards them. At the same time, they feel abandoned and dominated by urban perspectives and politics. In addition, linkages to right-wing populist positions and conspiracy narratives that can be interpreted as a consequence of political alienation are found.Given that wolves have been extinct in Germany for approximately 150 years, their return and growing population over the last decade has caused intense discussion and conflict. To develop a widely accepted and just coexistence between humans and wolves, a comprehensive understanding of the conflict is needed. There are indications that the conflict goes beyond dealing with the wolf population and marks a spatial\u2013cultural divide between urban and rural areas. Nevertheless, the social dimensions of the human\u2013wolf conflict in Germany have been little studied. The aim of this paper is to narrow this gap by means of a media discourse analysis including reader comments in order to provide insights into the constituent elements of this conflict. We conducted a qualitative content analysis. The sample comprises articles ( Worldwide, the recolonization of large carnivores such as wolves and bears often results in human\u2013wildlife conflicts  attention?Against this background, the aim of this study is to narrow this knowledge gap and gain a better understanding of the social conflict over wolves in Germany by means of a media discourse analysis. We follow the working thesis that conflicts surrounding the recolonization of wolves may reveal deeper underlying social tensions, such as the rural\u2012urban divide , nor would it be useful with regard to the qualitative research approach, we reduced the number of articles for analysis. Qualitative approaches aim to show the range of different qualitative manifestations of a research subject and to theorize possible interrelationships and patterns. Determining the sample size and assessing its appropriateness therefore followed the frequently applied criteria in qualitative research studies of \u201ctheoretical saturation,\u201d \u201cinformational power,\u201d and \u201cinformational redundancy\u201d  had to be a central topic of the article. Only mentioning it was not sufficient.ii.The article must have focused on the normative dimension of the human\u2012wolf relationship in that meaning was attributed to this relationship. It did not matter whether the normativity came directly from the author or, for example, in the context of an interview or quotation.iii.High numbers of reader comments attributed to an article were regarded as indicating high resonance by either favouring this perspective or holding antagonistic views. It can therefore be argued that these articles constitute good representations of discursive struggles, and they were preferentially included in our sample.The selection of these articles was guided by the following criteria:Data processing was performed using MAXQDA software. All the articles and reader comments were evaluated and interpreted following the seven-step guide to qualitative content analysis by Kuckartz  on the bThe results show varying discourse themes around wolves and variations in the frequency with which the different media cover wolves  actor groups and their mutual relations or perspectives/perceptions, including conflict over interpretative sovereignty; (2) an instrumental utility discourse about benefits versus costs, risks and goal conflicts connected with wolf resettlement; (3) an urban\u2013rural divide and political alienation; 4) links to right-wing populist discourses, narratives of conspiracy and forms of escalation; and (5) issues in wolf management. Table  links toi.agriculture versus nature conservation andii.rural people versus the \u201curban elite\u201d.Actors with opposing values, perspectives and interests are a central part and constituting category of the \u201chuman\u2013wolf\u201d conflict in Germany, which largely indicates a social conflict over wolves. The results show that views in the conflict about wolf resettlement in Germany are characterized by two strongly opposed dichotomies:In addition, there are distinct actor groups, such as politicians, scientists and experts, hunters and the media, forming or supporting the parties in the conflict. In the content studied here, these positionings resulted from attribution of criticism and devaluation of opposing positions. It was apparent that the conflict over the reintroduction of wolves is also a conflict over interpretative sovereignty. Frequently, strategies were used to devalue opposing arguments and strengthen the actor\u2019s own position. Credibility, expertise and knowledge became contested attributes denied to the other side through degrading attributions. These devaluation mechanisms were used by wolf supporters and wolf opponents alike but with different attributions and levels of intensity. Thus, references to other social groups of actors came primarily from opponents of the wolf-recolonization efforts. From the perspective of many wolf-resettlement opponents, nature conservationists and urban people were \u201cwolf romanticists\u201d and \u201cwolf freaks\u201d with \u201ceco-social romantic fairy tale ideas\u201d who are \u201cfar removed from reality\u201d. Further attributions included that they are \u201cignorant and [have a] know-it-all attitude\u201d, they enforce \u201cdouble standards\u201d and tell \u201clies\u201d, they \u201clack expertise\u201d, and they engage in \u201cunobjective/ideological/emotional discussions\u201d.Opponents of wolf recolonization considered politicians to lack a firm \u201cgrip on reality\u201d and \u201cexpertise\u201d and to be \u201cidle/actionless\u201d while practising politics only for the benefit of the \u201curban elite\u201d. Some wolf-recolonization opponents accused the media of being biased and \u201cpro-wolf\u201d. However, the analysis of the positioning of the articles studied contradicted this accusation (see 3.1), as it showed that media coverage of the wolf population is varied and not one-sided.In contrast, some proponents of wolf resettlement accused those opposed of \u201cscaremongering\u201d, having \u201cirrational fears\u201d, exhibiting \u201chysteria\u201d, and engaging in an \u201cemotional debate\u201d. Farmers were considered \u201ccomplainers\u201d who destroy nature with their agricultural practices.Another main theme throughout the media articles and reader comments was a benefit-versus-cost discourse. The \u201cdamage\u201d caused by wolves was frequently used as an argument against wolf resettlement. Often mentioned, damage included \u201clivestock killed by the wolves\u201d, potential \u201crisks to people and especially to children\u201d, \u201cfear of wolf attacks\u201d and a resulting \u201cdiminished quality of life\u201d due to the perceived restricted range of motion for humans and playground areas for children. In addition, the cost of prevention measures funded by taxpayer money was criticized. Target conflicts in nature conservation were cited, particularly regarding the high nature value of extensive pastureland, which is regarded as endangered by wolf recolonization. A further ethical conflict was seen regarding animal welfare when wolves kill grazing animals in fenced pastureland.Q2: \u201cBut here, where every German citizen has only 2000 square metres of usable space to \u2018survive\u2019, one should differentiate a little as to who is allowed to sit at the table. The wolf does not fit here.\u201d (Reader_TopAgrar)In addition to the discourse about damage, the general benefits of having wolves were questioned by wolf-recolonization opponents . In particular, wolf recolonization in Germany\u2019s densely populated \u201ccultural landscape\u201d was repeatedly denounced (Q2\u20134). Here, the statements documented the perception of or fear of competition with wolves and the narrowing of humans\u2019 interests and scope for action:Strikingly, the wording of comments frequently implied active settlement by wolves instead of a natural dispersal process (Q3).Q6:\u201cIf a tiger is shot in India, the German is the first to raise a finger. But we don\u2019t care about our own fauna.\u201d (Reader_Spiegel)Reader comments also included arguments for the protection of species of larger predators in distant regions of the world but not in their own immediate vicinity (Q4). This form of colonization of other countries to further species conservation was considered critical by some wolf-recolonization advocates, who noted that the conservation of large carnivores and mammals in countries in the Global South is more precarious (Q5-6).Q12: \u201cAs you often hear, the fears you describe exist, whether justifiably or not is irrelevant. I ask myself why we want to do this to ourselves, or to those who are afraid, just to prove a few opinionated wolf romantics right. Fear is not a nice thing, and one should not make fun of it.\u201d (Reader_NOZ)While some saw the wolf as an unnecessary \u201cluxury\u201d that causes great financial damage, which must be remedied by adequate compensation, a main argument against wolf dispersal was the perceived fear and risk of humans being attacked by wolves (Q7-8), especially the danger that wolves present to children, which was a recurring theme in the discourse (Q9). This fear, particularly of the danger posed to children by wolves, was a motif that ran throughout the reader comments (Q10-11). In this context, the feeling of not being taken seriously was also found.In contrast, the views and arguments expressed by supporters of and experts in wolf resettlement revealed that compared with other everyday risks, they viewed the risk as very low or acceptable. Compared with wolf-recolonization opponents, who focused on the uncertainty and potential risk posed by future developments, wolf-recolonization supporters and experts highlighted that there have been no fatal wolf attacks on humans thus far (Q13). Other arguments emphasized that humans constantly live with certain risks (Q14). In addition, proponents of wolf recolonization argued for the potential benefits of wolves as a regulating force against game browsing and damage to crops. They considered the wolf to play an important role in \u201creestablishing the ecological balance\u201d. In the Lusatian region, a main habitation area for wolves in Germany, tourism experts even believe that the wolf population has the potential to become a tourist attraction (Q15).Beyond a pure cost\u2013benefit argumentation that considers the wolf merely from an instrumental utility perspective, there were also reader opinions that attributed an intrinsic value to the wolf. These actors criticized the colonial dominance of humans and recognized the right of the wolf as a species to exist for its own sake. However, this last argument was rarely put forward.The reader comments documented contrasting perceptions of the realities of life in the city and the country, coupled with processes of political alienation. The discourse painted a picture of disparity between city and country, between an \u201curban elite\u201d and the rural population (Q16). There was a perceived political \u201cdominance by urban people\u201d and their opinions over the rural population. At the same time, the rural population was portrayed as an oppressed minority (Q17\u201318).Q19: \u201cThe people in the areas where wolves live are already suffering from massive restrictions on their quality of life. [\u2026] It\u2019s unfair for nature-minded urban people to be in favour of the wolf, which they will never encounter in their lives!\u201d (Reader_FAZ)Q20: \u201cWe are bombarded with wolf propaganda by the nature conservation authorities. But when concerned graziers show the cruel reality, the state authorities intervene. What a complete dismissal of the rural population!\u201d (Reader_TopAgrar)In addition, the difference in the degree to which urban and rural populations are affected by wolf recolonization was emphasized by some readers\u2019 comments. The support for wolf resettlement found among urban people, who are rarely affected by the presence of the wolves, was perceived as arrogance towards the rural population (Q19\u201322).Here, a motif of perceived spatial injustice emerges, which was also associated/contextualized with other developments and conflicts in rural areas, such as the energy transition and the conflictual designation of areas for wind turbines (Q23) or the growing demand for organic food and sustainable agricultural practices, which increasingly pressures farmers to change (Q24). Urban people were accused of lacking an understanding of nature, being out of touch with reality, and lacking judgement (Q25\u201327). The city of Berlin recurred not only as a symbol of urban living and as an urban space but also, alongside the city of Brussels, as a political centre of power where decisions about rural areas are made removed from the context in which the issues occur (\u201cin distant Berlin\u201d) (Q28\u201329). Mixed into this was also a demonstrable loss of trust in politics and the state, feelings of political alienation and sympathy with populist positions . Politicians were frequently accused of inaction, but the opposite was found in the media coverage. Despite the many other challenges brought by development in rural regions, such as demographic change, the wolf population received special attention and played a comparatively large role in both the media and politics (Q33). Thus, the wolf recolonization conflict was discussed at the highest political levels during the study period, including by the Chancellery, the Prime Minister of Saxony, and the Ministers of the Environment and Agriculture.The political alienation that was evident in the analysed material was regularly linked to sympathy for right-wing populists and antidemocratic positions (Q30\u201332). In the discourse on the wolf population, vocabulary typically used by right-wing populist groups appeared conspicuously often. The use was documented exclusively in reader comments by those opposed to wolf recolonization in Germany. In addition to the motif of the \u201clying press\u201d (Q34-35), there were recurring allusions to \u201cconspiracies\u201d by \u201celites\u201d and rejecting the European Union, and references to the 2015/2016 refugee crisis in Germany and Europe were made using the term \u201cWillkommenskultur\u201d (Q36), which was influential at that time.It was not just the reader comments that took up this issue; the articles themselves examined it as well. The articles revealed that defensiveness about wolf recolonization is being made an election campaign issue by the right-wing populist party AFD in Germany (Q37\u201338). In fact, the Federal Minister of Agriculture considered the wolf an \u201cAFD acceleration programme\u201d, as anti-wolf positions were strongly represented by and related to the AFD party.In addition, various conspiracy narratives were found in the reader comments. One common narrative was that the wolves are hybrids that were deliberately brought to Germany and released. Another narrative asserted that important information was being kept secret (Q39). It alleged a conspiracy among scientists, politicians and actors from NGOs: scientists were purportedly falsifying results in their expert reports, and NGOs would earn money from the wolves.The media discourse on wolves is divisive and polarizing, and there are signs of increasing escalation and intensity in the conflict, which manifest in hostility and threats. Not only emotional statements and mutual accusations but also insults were observed in exchanges between the parties in the conflict, and these pointed to hardened positions (Q40). In addition, various forms of protest, such as vigils, demonstrations and social media campaigns, as well as calls for \u201cillegal wolf killing\u201d, were mentioned. This call for criminal action was justified as a form of self-defence (Q41\u201343).One of the most frequently discussed topics were wolf management issues. These included \u201cstock regulation/wolf population control\u201d, subsequent demands for \u201clegislative changes\u201d, aspects of \u201cherd protection\u201d and \u201ccompensation payments\u201d, demands for \u201cconflict management\u201d and \u201ccounselling and information services\u201d, such as training and education to increase public knowledge about wolves.Overall, in concrete discussions of suitable wolf management measures, the discourse notably took on a more objective tone. Emotional or sarcastic expressions were less commonly observed. The positions expressed seemed more conciliatory and solution-oriented, and the conflict appeared less intense in such discussions.Regarding population regulation, there were very few voices in favour of extirpating the wolf completely, but many favoured population regulations. Opinions ranged from allowing \u201cstrict population regulation/sharp hunting\u201d (Q44\u201345), setting an \u201cupper limit\u201d on moderate regulation and removing wolves \u201cin case of danger\u201d or \u201cproblem wolves\u201d. The latter is also seen and advocated as a measure to promote acceptance of the wolf population (Q46). The demands for wolf population regulation went hand in hand with demands for legislative changes that allow the removal of wolves as well as the designation of wolf-free or protected grazing areas. In addition, herd protection measures and the adaptation of pasture management, including installing fences, stable security, using guard dogs and scaring away wolves, were discussed. Commenters who had already had good experiences with these measures also spoke up here. There were several indications that damage from wolves mainly occurs where there is no or minimal herd protection.There were many reader comments that demanded comprehensive \u201ccompensation payments\u201d for the herd protection measures enacted and the damage caused by wolves. However, this appears to be somewhat irritating, as 100% of these costs are already being reimbursed. In this context, it seems natural that the idea of \u201cconflict management\u201d was often alluded to in the articles (Q47) in reference to learning processes, training and information services that could increase acceptance.The aim of this article was to analyse the human\u2012wolf conflict in German media discourse, determining how the conflict is constituted and documented, whether it is a symbol of an urban\u2012rural divide, and why the topic is covered so intensively in the media. In the following, we will discuss our findings in relation to results from other geographical contexts (5.1) and justify our argument that the human\u2012wolf conflict is indicative of broader societal conflicts, such as the urban\u2012rural divide (5.2).Our findings about the human\u2013wolf conflict in Germany have much in common with the results of studies in other regions of Europe and North America. The return for wolves in regions where they have been previously extinct creates conflicts (e.g., Ericsson and Heberlein Dressel et al.  have shoOur analysis further reveals a prevailingly utilitarian discourse in the German media that questions the wolf against the background of a cost\u2013benefit discourse. The wolf is seen as \u201cuseless\u201d and harmful by farmers, and its presence thus deepens the already existing conflict between stakeholders in agriculture and in nature conservation (see also Friedrich et al. The observation by Figari and Skogen  that theAll the media investigating the wolf topic continually reported on it. The issue received significant attention, and the debate can be regarded as emotionalized. A similar level of attention was also observed in Northern European countries after wolf populations began to spread again (Ericsson and Heberlein Consistent with Wilson\u2019s  observatMoreover, these results show that the wolf symbolizes the political alienation of the rural population, who feel dominated by urban worldviews influencing policies and the will of supposed majorities. Eriksson  showed tAdditionally, some scientists, especially ecologists normatively involved in conservation, seem dismissive of these concerns. As an example, Chapron and L\u00f3pez\u2010Bao  criticizNevertheless, the geographical and spatial disparities between urban and rural areas have led to increasing social distortions in recent years, which are also reflected in the successes of right-wing populist parties (e.g., Kallert et al. However, further research is needed to elaborate whether the conflict line is the rural\u2012urban divide or whether other conflict lines are congruent with this line; thus, other sociocultural aspects may be relevant, as described in recent theoretical and empirical sociological research in Germany (e.g., Lux et al. In Europe, wolf recolonization is a result of, and supported by, international nature conservation law, such as the Washington and Berne Convention and the EU Habitats Directive. However, this is a top-down approach that insufficiently considers local specificities and region-specific development opportunities in rural areas. The wolf and its coexistence with humans thus seem politically imposed, which inhibits successful coexistence (K\u00f6nig et al. To date, human\u2012wolf conflict in Germany remained understudied. In particular, qualitative analyses that allow for an integrative understanding are lacking. The present media analysis contributes towards filling this gap. Overall, it shows that media analyses achieve considerable density in the qualitative description of human\u2012wildlife conflicts. However, this description takes place on a superordinate aggregated societal level, which can differ greatly from local specific and varying manifestations. In addition, media filter information according to newsworthiness and also attention or entertainment value. However, even the reader comments analysed here do not provide a representative depiction of the human\u2012wolf conflict but rather indicate the different dimensions and facets that play a role. For a deeper understanding of the conditions for successful coexistence, therefore, further analyses are needed that look at different local characteristics and also at the interactions of different social factors with varying management instruments and communication approaches.The recolonization of wolves in densely populated cultural landscapes causes major social conflicts reflected by a high amount of media attention. There is a divide in the perspectives of urban and rural actors, which is supported by the narrative of \u201cpro-wolf\u201d urbanites and \u201canti-wolf\u201d ruralites and is also visible in the media coverage. The unequal distribution of the nonmaterial costs and benefits of the recolonization of the wolf population results in \u201ccoexistence inequalities\u201d, which in turn may lead to political alienation and a sense of imposition. However, the human\u2013wolf conflict symbolizes a larger conflict based on spatial disparities and inequalities between urban and rural areas. Damage prevention and compensation measures alone will not be sufficient to resolve the conflict. Going forward, it will be important to consider regionally specific development options, strengthen local decision-making competences and facilitate honest participation and dialogue so that different actors with different opinions are valued in decision-making. Only in this way can a just and sustainable coexistence between humans and wolves be established.Supplementary Information"}
{"text": "C. elegans that express reporter proteins that are sensitive to changes in the protein folding environment and respond by misfolding and displaying readily scorable phenotypes, such as localized YFP fluorescence or paralysis. We found that nPM exacerbated protein aggregation in body wall muscle cells, increasing the number of large visible protein aggregates, the amount of high molecular weight protein species, and proteotoxicity. Taken together, the data point to nPM negatively impacting proteostasis. Therefore, it seems plausible that nPM exposure may exacerbate symptoms of AD and age-related dementia in a manner that is at least partially dependent on proteostasis decline.The proteostasis network comprises the biochemical pathways that together maintain and regulate proper protein synthesis, transport, folding, and degradation. Many progressive neurodegenerative diseases, such as Huntington\u2019s disease (HD) and Alzheimer\u2019s disease (AD), are characterized by an age-dependent failure of the proteostasis network to sustain the health of the proteome, resulting in protein misfolding, aggregation, and, often, neurotoxicity. Although important advances have been made in recent years to identify genetic risk factors for neurodegenerative diseases, we still know relatively little about environmental risk factors such as air pollution. Exposure to nano-sized particulate air pollution, referred to herein as nanoparticulate matter (nPM), has been shown to trigger the accumulation of misfolded and oligomerized amyloid beta (A\u03b2) in mice. Likewise, air pollution is known to exacerbate symptoms of AD in people. We asked whether nPM contributes to the misfolded protein load, thereby overwhelming the proteostasis network and triggering proteostasis decline. To address this, we utilized  C. elegans engineered to express misfolded Huntington\u2019s disease (HD)-associated protein Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author1. Does the manuscript adhere to the experimental procedures and analyses described in the Registered Report Protocol? </font> If the manuscript reports any deviations from the planned experimental procedures and analyses, those must be reasonable and adequately justified.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 2. If the manuscript reports exploratory analyses or experimental procedures not outlined in the original Registered Report Protocol, are these reasonable, justified and methodologically sound? </font> A Registered Report may include valid exploratory analyses not previously outlined in the Registered Report Protocol, as long as they are described as such.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 3. Are the conclusions supported by the data and do they address the research question presented in the Registered Report Protocol? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. The conclusions must be drawn appropriately based on the research question(s) outlined in the Registered Report Protocol and on the data presented.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. </font> Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. Reviewer #1:\u00a0In the manuscript entitled \u201cNanoparticulate air pollution disrupts proteostasis in Caenorhabditis elegans\u201d, Manriquez et al. evaluate the impact of environmental risk factors such as air pollution on proteostasis. Using well established C. elegans protein conformation disease (PCD) models, the authors examine protein aggregation using visual and biochemical assays and monitor proteotoxicity using behavioral readouts for movement. Based on this analysis, the authors conclude that nanoparticulate matter (nPM) exacerbates protein aggregation and proteotoxicity in the PCD models and has no impact on stress responses in wild type animals. Taken together, the authors suggest that exposure to environmental air pollution may overwhelm the proteostasis network and worsen symptoms associated with Alzheimer\u2019s disease and dementia. Overall, the manuscript is well organized and well communicated. This reviewer concludes that the manuscript is appropriate for publication in PLOS ONE after addressing the issues outlined below.To support the authors\u2019 conclusions, the following additions to the experimental data are recommended.1. To better view the visual aggregates that were quantified in Figure 1B, include an inset with higher magnification that depicts the type of aggregate that was scored. Specifically, magnify the area at the end of the arrowheads.2. It is unclear what the reader should observe in Figure 1C. Addition of arrows to denote what the authors refer to as AB puncta and arrowheads to highlight what the authors refer to as larger aggregates is needed.3. Supplemental Figure 2 shows the quantification of relative protein levels in each polyQ model. To support the conclusion that protein levels do not change, a representative gel image of the area quantified would be helpful. Specifically, polyglutamine tracts can lead to accumulation of proteins in the stacking gel of SDS PAGE gels. It would be important to note if protein accumulated in the stacking gel and if this was included in the final determination of protein levels. An image of a representative gel/blot to resolve this would be informative.4. In Supplemental Figure 2, the authors state that there is no statistical difference  were statistically significant.8. In Figure 3, it is unclear if the high molecular species are normalized to total protein in each lane or to control. Or are the values determined only by comparing intensity of the HMW species vs monomers for each strain. This reviewer recommends calculating relative amounts of HMW in total for each strain.9. In Supplemental Figure 4, the figure legend states that protein was collected for the Q40 strain immediately instead of after 72 hours, which was the procedure for aggregate counting. Is there a rationale for why the treatment with nPM was not similar to the procedure for aggregate counting?10. Supplemental Figure 4 shows the quantification of high molecular weight species in the Q40 and Q44 models. A representative native gel image highlighting the area quantified would be beneficial.The recommendations above ask for additional data and further analysis of the data to strengthen the authors conclusions. This reviewer offers additional suggestions to address within the text to further strengthen the manuscripts conclusion.1. Have the authors examined the impact of nPM on stress responses in PCD models? The authors demonstrate no impact on N2 animals but the extra challenge of expressing a misfolded disease protein along with the nPM may lead to activation of a stress response.2. In Supplemental Figure 1A, nPM leads to an unexpected decrease in Q40 aggregates. To explain this surprising result, the authors state that Q35 is a \u201cbetter sensor\u201d than Q40. The authors should also consider that the treatments are done at different times in the developmental cycle of the worm, which may affect proteostasis demands.3. In the conclusions section, it would be helpful if the authors offer their insight into why nPM that exacerbates protein misfolding in body wall muscles can suggest deficiencies in protein folding of AB species in neurons leading to dementia.Reviewer #2:\u00a0The paper by Garcia Manriquez et al is a well written report that describes a study in C.elegans models to assess the proteotoxicity of nanoparticulates associated with air pollution. The study is technically sound. The methods used appear appropriate and appropriate statistical methods were used to assess the data. One short-coming of the study is uncertainty regarding the potential exposure in vulnerable neurons of human brain relative to the dose of nanoparticulates that the worms were exposed to.The only technical comment I have is that in Fig 1C, the authors should indicate the number of replicates that were examined to produce the representative images.********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0NoReviewer #2:\u00a0No**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 4 Jan 2023See file titled \"response to reviewers.\"AttachmentResponse to reviewers.docxSubmitted filename: Click here for additional data file. 2 Feb 2023Nanoparticulate air pollution disrupts proteostasis in Caenorhabditis elegansPONE-D-22-25226R1Dear Dr. Kikis,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Mahesh Narayan, Ph.D.Academic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments: 14 Feb 2023PONE-D-22-25226R1 Caenorhabditis elegansNanoparticulate air pollution disrupts proteostasis in Dear Dr. Kikis:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Mahesh Narayan Academic EditorPLOS ONE"}
{"text": "SOD2) plays a crucial role in cells\u2019 protection against mitochondrial oxidative damage. A genetic polymorphism in the mitochondrial targeting sequence of the SOD2 gene has been implicated in various diseases, including prostate cancer. Paller et al. have shown an increase in prostate-specific antigen (PSA) doubling time in patients with the Ala/Ala (wildtype) genotype when treated with pomegranate/grape extract antioxidants. We developed and validated a pyrosequencing assay that detects the common germline SOD2 SNP (rs_4880) with the aim of identifying men with castrate-resistant prostate cancer eligible for an antioxidant therapy clinical trial. We first selected 37 samples from the 1000 genomes study with known genotypes determined using Illumina-based sequencing and confirmed them by Sanger sequencing. In a blinded design, we then performed the new pyrosequencing assay on these samples and assigned genotypes. Genotypes for all 37 samples  were all concordant by pyrosequencing. The pyrosequencing assay has been live since May 2018 and has proven to be robust and accurate. Manganese superoxide dismutase-2 ( Biochemically recurrent (BCR) patients experiencing rising prostate-specific antigen (PSA) following local therapy  make up the largest subset of prostate cancer patients undergoing monitoring and treatment in the United States. The standard of care for these patients ranges from watchful waiting to androgen-deprivation treatment (ADT), but many of them seek treatment alternatives to ADT because of its significant impact on quality of life, including potential obesity, erectile dysfunction, hot flashes, decreased muscle mass, and osteoporosis. Consequently, the use of complementary medical products is widespread among prostate cancer patients, with 39% of recently diagnosed patients and 51% of patients overall reporting that they have used such products as herbal, vitamin, and mineral dietary supplements (primarily antioxidants) to try to boost their immune system and prevent disease progression ,3,4,5,6.SOD genes that have evolved in mammals: manganese superoxide dismutase (MnSOD) in mitochondria, copper-zinc superoxide dismutase (Cu-Zn SOD) in the cytosol, and extracellular superoxide dismutase (EC-SOD) in the extracellular compartments [SOD2 gene, has a scavenging role during oxidative phosphorylation, where it converts superoxide anion into oxygen and hydrogen peroxide [Sod2 gene was incompatible with life [Superoxide dismutases (SODs) are antioxidant enzymes and there are three artments . MnSOD, peroxide ,8,9. Theith life ,11.SOD2 gene that encodes for valine  instead of alanine (Ala) at codon 16 has been shown to be less efficiently imported into mitochondria [Signal sequences at the N-terminus target proteins to their respective compartments within the cell ,13,14. Achondria ,18,19. Achondria , althougchondria ,21,22.SOD2 biomarker is supported by three studies. Muscadine grape skin and pomegranate trials showed a 6\u201312 month lengthening of PSA doubling time (PSADT) in the BCR AA-SOD2 population but not in the control group or in VV or VA patients [SOD2 genotype randomly assigned to \u03b2-carotene (antioxidant) treatment (versus placebo) had a relative risk of 0.6  for fatal prostate cancer, but found no significant association in men with the VV/VA genotypes [Identifying biomarkers that will predict response to antioxidant therapies could potentially allow some patients to improve their quality of life and help reduce morbidity. The rationale to further explore this patients . Similarenotypes .In order to test the hypothesis that identifying biomarkers will predict response to antioxidant therapies, a SOD2 test was validated in a Clinical Laboratory Improvement Amendments (CLIA)-certified molecular laboratory and was developed for a phase III trial to determine whether 48 weeks of antioxidant treatment compared with placebo significantly lengthens PSADT in AA-SOD2 BCR men. The trial, which is called Muscadine Plus (MPX) in Men with Prostate Cancer (NCT03535675), is an 80-patient, phase III, randomized, double-blind clinical trial was being performed at 15 sites in the United States and using muscadine grape skin extract. Unfortunately, the trial closed for futility 1 July 2022, as it would not meet its primary endpoint. An analysis is underway to see if any of the biomarker endpoints were significant. The CLIA test is also being used in two other diet-based trials, one weight loss intervention in breast cancer (NCT04499950) and another plant-based diet in prostate cancer (NCT05471414), to see if genotype correlates with outcomes.SOD2 gene using pyrosequencing. After the pyrosequencing is performed, a given patient\u2019s result is pattern-matched to the three pyrograms representing each of the genotypes. We selected 13 homozygous wildtype (WT), 12 heterozygous, and 12 homozygous variant samples with established genotypes from the 1000 genomes project, confirmed their genotypes using Sanger sequencing, and used them for orthogonal validation of the pyrosequencing assay. The assay has been live since May 2018, and approximately 120 runs were completed to select 80 men with castrate-resistant metastatic prostate cancer with the Ala/Ala genotype to be eligible for the clinical trial.We report the analytic validation of the codon 16 polymorphism in the mitochondrial leader sequence of the We obtained 37 DNA samples from the NIGMS Human Genetic Cell Repository at the Coriell Institute for Medical Research  under a research agreement with the 1000 Genomes Consortium See . SamplesSOD2 SNP analysis was restricted to a small region around codon 16 within exon 2 (NM_ NM_000636.4(SOD2):c.47T>C ). Five different forward primers and two different reverse primers were designed using Primer3 . All primers were ordered from IDT Technologies  with M13 forward and M13 reverse universal primers. The best-performing primers  were as follows: forward primer 5\u2032-tgtaaaacgacggccagt-ACTGACCGGGCTGTGCTT-3\u2032  and reverse primer 5\u2032-biotin-caggaaacagctatgacc-GCGTTGATGTGAGGTTCCAG-3\u2032, , where M13 forward and reverse universal primers are indicated in lower case letters. Samples were PCR amplified using 100 ng genomic DNA. Cycling conditions were as follows: 96 \u00b0C for 1 min; 35 cycles of 95 \u00b0C for 30 s; 62 \u00b0C for 30 s; 72 \u00b0C for 1 min, and a final extension of 72 \u00b0C for 10 min. The expected size of the full-length PCR product was 174 bp, including the M13 primers. After amplification, PCR products were visualized by gel electrophoresis  and Sanger sequenced to confirm the previously determined genotypes. Based on previous findings, 2, 0.2 mmol/L of each dNTP, 5 pmol of forward primer (listed above), 5 pmol of reverse primer (biotinylated), 0.8 units of HotStar TaqDNA polymerase (Qiagen), 10 ng of template DNA, and dH2O to a 25 ul final volume. Pyrosequencing was done on the PyroMark Q24 (Qiagen) instrument, as previously reported, in a reaction containing 0.3 \u03bcmol/L sequencing primer (5\u2032- AGCAGGCAGCTGGCTCCG -3\u2032) and annealing buffer. The nucleotide triphosphate dispensation order for codon 16 was G,A,T,A,C,T,A,G,A,T,A,T.PCR-amplified products were generated using the same primers optimized for Sanger sequencing above, except that the reverse primer was biotinylated at the 5\u2032 end to capture the bottom (anti-sense) strand for pyrosequencing. Each reaction contained 1X PCR buffer, 1.5 mmol/L MgClA total of 3 mL of peripheral blood from each patient was submitted to the Molecular Diagnostics Laboratory at The Johns Hopkins Hospital. DNA was isolated from 350 ul of peripheral blood using the Qiagen EZ1 Advanced XL instrument per the manufacturer\u2019s protocol . Isolated DNA was quantified using Qubit 2.0 . We identified EBV-transformed lymphoblastoid cell lines to use as controls for each of the three genotypes . GM12878 is a commonly used reference sample whose use is advocated by the National Institute of Standards and Technology and the Centers for Disease Control (CDC). DNA samples were PCR amplified and pyrosequenced as described above. Analysis was done using Pyromark Q24 software, and pyrograms were pattern-matched for the genotype. The full protocol is available upon request.SOD2 gene using the 1000 genomes data sequenced on the Illumina platform. We then tested all possible primer combinations  were included on the same pyrosequencing run. Results were concordant and reproducible .We included four different controls in this assay . As such, we expected the heterozygous control to be present between 40% and 60%. This range is easily achievable by pyrosequencing technology, which has a limit of detection between 3% and 5%.We calculated the percent of C:T alleles in all of the samples that were pyrosequenced. The background noise for the homozygous (C/C) wildtype was \u22645% T, and for the homozygous (T/T) variant, it was \u22645% C. The heterozygous (C/T) control was consistently between 45\u201355% C:T. Non-template controls consistently demonstrated no signal.SOD2 polymorphism status were pyrosequenced. Pyrosequencing results showed 100% concordance compared to the consensus genotype , 204 Ala/Val, and 105 Val/Val (49.9%). Controls never failed on any of the runs, and NTC was never contaminated/amplified.SOD2. In contrast, samples that showed the Ala/Val genotype were reported as heterozygous, and those determined to have the Val/Val genotype were reported as homozygous variants for SOD2. Reports cited that the Val/Val genotype has been associated with a modestly increased risk of cardiomyopathy in the Japanese population [Samples determined to have an Ala/Ala genotype were reported as homozygous wildtype for pulation  and diabpulation  in generSOD2 p.A16V SNP. Analytical validation was performed on 37 samples used in the 1000 genomes project. The assay achieved 100% accuracy. Genotypes determined by the pyrosequencing assay demonstrated complete concordance with orthogonal assays (Sanger and Illumina sequencing) run on the same samples.We developed an assay for an ongoing clinical trial in a CLIA-certified laboratory that is routinely able to genotype samples for the The validated assay has been used in a phase III, randomized, double-blind clinical trial (NCT03535675) and two ongoing trials in breast and prostate cancer . All samples are being received and processed in a timely manner. The outcomes of these trials will tell us more about the prognostic potential of this biomarker.SOD2 gene (rs_4880) have a higher risk of aggressive prostate cancer in the presence of low antioxidant concentration8. Previous studies have demonstrated that this subgroup of men may benefit from compounds that reduce oxidative stress [SOD2 genotyping assay with outstanding analytical sensitivity, specificity, accuracy, and precision.Men with Ala/Ala genotype in the gene rs_480 have ae stress ,31. In tSOD2 genotype has been implicated in various diseases, including prostate cancer [SOD2 genotype, one might question why AA-SOD2 BCR prostate cancer patients would benefit from MPX treatment. The answer lies in the Physicians\u2019 Health Study finding of a 10-fold increase in the risk of aggressive prostate cancer from high to low quartiles of antioxidant status in men with the AA genotype (but not in men with the VA or VV genotypes) [SOD2 genotype who had low consumption of dietary antioxidants [SOD2 men will show a significant decrease in PSA slope when treated with MPX compared to placebo. If the trial shows that the AA-SOD2 BCR subpopulation will benefit from ellagic acid supplementation, the results will encourage physicians to check patients\u2019 SOD2 genotypes to make recommendations about antioxidant supplementation. Negative results should put to rest the claim that MPX and ellagic acid as single oral agents are active in a clinically meaningful way in this patient population. Finally, the development of this assay will allow for further exploration of the predictive capacity of AA-SOD2 to predict the response to antioxidants in other cancers, such as early-stage breast cancer.Further, this e cancer ,33,34,35notypes) . In addinotypes) ,36. Furtoxidants ,38. This"}
{"text": "The incidence of recurrent esophageal and gastric variceal bleeding (EGVB) during the follow-up showed significant differences among the three cohorts . Conclusion: The nomogram based on our model provides a simple and convenient method for predicting PVT in cirrhotic patients. Cirrhotic patients with PVT had a shorter survival time and were prone to recurrent EGVB compared with those in the non-PVT group.Aim: Portal vein thrombosis (PVT) is a common complication in cirrhotic patients and will aggravate portal hypertension, thus leading to a series of severe complications. The aim of this study was to develop a nomogram based on a simple and effective model to predict PVT in cirrhotic patients. Methods: Clinical data of 656 cirrhotic patients with or without PVT in the First Affiliated Hospital of Soochow University and The Third Affiliated Hospital of Nantong University from January 2017 to March 2022 were retrospectively collected, and all patients were divided into training, internal and external validation cohorts. SPSS and R software were used to identify the independent risk factors and construct a predictive model. We evaluated the predictive value of the model by receiver operating characteristic (ROC) curve, calibration curve, and decision curve analyses. The feasibility of the model was further validated in the internal and external cohorts. All enrolled patients were followed up to construct the survival curves and calculate the incidence of complications. Results: The predictors of PVT included serum albumin, D-dimer, portal vein diameter, splenectomy, and esophageal and gastric varices. Based on the clinical and imaging findings, the final model served as a potential tool for predicting PVT in cirrhotic patients, with an AUC of 0.806 . The decision curve analysis revealed that the model had a high level of concordance between different medical centers. There was a significant difference between the PVT and non-PVT groups in survival analyses, with  Portal vein thrombosis (PVT) refers to the presence of a thrombus in the main lumen of the portal vein, which can extend to the intrahepatic or extrahepatic vein branches such as the splenic vein and superior mesenteric vein. PVT is a common complication in cirrhotic patients, especially in advanced cirrhosis. The morbidity of PVT varies in different studies. A prospective study showed that the cumulative incidence of PVT during the first year and third year was 3.7% and 7.6%, respectively, and it increased with the progression of cirrhosis .Recent studies have focused on the reasons why cirrhotic patients would undergo PVT, with consideration given to the decreased coagulation factors and platelet counts. Patients with cirrhosis have an unbalanced coagulation system, which can vary to promote bleeding or thrombotic tendency in different disease stages . At presAccording to a recent study, the risk factors for PVT in cirrhosis include cryptogenic and metabolic-associated fatty liver disease-related cirrhosis; Child-Pugh grade B and C; esophageal varices grade equal to or greater than grade II; portal vein blood flow < 15 cm/s; large portosystemic collateral circulation with high blood flow; local vascular damage; previous splanchnic vein thrombosis; sclerotherapy of esophageal varices and splenectomy; inflammation of the portal vein, abdominal cavity, and intestinal tract; and partial splenic embolization. Most of these risk factors are associated with portal hypertension ,4,5. HowPatients with PVT present with the absence of specific clinical manifestations and sometimes experience only mild abdominal pain or even no symptoms at all. PVT is usually discovered incidentally by imaging during a physical examination. However, if the thrombus obstructs not only the main trunk and branches of the portal vein but also spreads to the splenic vein and superior mesenteric vein, it will lead to a series of related complications, such as massive gastrointestinal bleeding, cavernous transformation of portal vein, intestinal ischemia and necrosis, multiple organ failure, and even death . In addiTherefore, considering the occult nature and severity of the disease, we aimed to construct a predictive model for PVT and design a nomogram to help clinicians identify the high-risk population of PVT among cirrhotic patients to improve their prognosis.Clinical data of 700 patients with cirrhosis treated in the Department of Infectious Diseases at the First Affiliated Hospital of Soochow University and The Third Affiliated Hospital of Nantong University from January 2017 to March 2022 were collected retrospectively. Forty-four patients were excluded from the study due to the missing data, and finally, there were 656 patients enrolled in the study. We used randomized assignment to divide the 510 patients from The First Affiliated Hospital of Soochow University into two groups: the training and internal validation cohorts (ratio 2:1). The training cohort contained 340 patients, and the internal validation cohort contained 170 patients. A total of 146 patients from The Third Affiliated Hospital of Nantong University were selected as the external validation cohort. The flow diagram is shown in 9/L with no clear explanation, serum albumin (Alb) < 35 g/L, excluding malnutrition or kidney disease, international normalized ratio (INR) > 1.3 or prolonged prothrombin time (PT) (suspend thrombolytic or anticoagulant drugs for more than 7 days), and APRI (AST/PLT) score > 2). (3) Imaging examinations indicated thrombosis in the portal vein system, including the main trunk and branches, with or without the splenic vein and superior mesenteric vein, in the PVT group, and imaging examinations showed that blood flow was unobstructed in the portal vein system without filling defects in the non-PVT group. CT/MRI combined with ultrasound were used to diagnose PVT: CT or MRI was used as a confirmative technique when thrombus was suspected by ultrasound.. The exclusion criteria are as follows: (1) chronic liver diseases that did not progress to cirrhosis, such as liver fibrosis; (2) patients with liver failure, hemorrhagic shock, septic shock, and other serious complications; (3) patients with hematological diseases ; (4) patients with Bud\u2013Chiari syndrome; and (5) patients with hepatocellular carcinoma and any other types of cancers, whether or not they had cancer thrombus formation; (6) patients with primary thrombosis in the portal vein without cirrhosis, such as hepatic sinus obstruction syndrome, and thrombophilia; (7) patients with previous thrombosis events, such as pulmonary embolism and deep vein thrombosis; (8) patients taking anticoagulation or thrombolytic drugs within the previous three months. The study protocol was reviewed by the Ethics Committee of the First Affiliated Hospital of Soochow University, and ethical approval was obtained .The inclusion and exclusion criteria were based on the consensus and guidelines for the diagnosis and treatment of chronic viral hepatitis, alcoholic liver disease, autoimmune hepatitis, cirrhosis, and portal vein thrombosis in cirrhotic patients . The diaWe retrospectively collected the enrolled patients\u2019 clinical data, including gender, age, etiology of liver diseases, liver disease course, and Child-Pugh score; routine blood tests, such as white blood cell (WBC) count, hemoglobin (Hb) levels, PLT count, mean platelet volume (MPV), and platelet distribution width (PDW); routine biochemical tests on blood, such as alanine aminotransferase (ALT), Alb, and triglycerides (TG); routine blood coagulation tests, such as PT, D-dimer, and antithrombin \u2162 activity (AT-\u2162 a); routine imaging data, such as the main portal vein diameter (PVD), absence of spleen, length and thickness of the spleen, esophageal and gastric varices, and ascites; and endoscopy data for esophageal and gastric varices. All clinical data were obtained when PVT was first detected or when the patient was first hospitalized for cirrhosis.The time to death was chosen as the main endpoint of the follow-up. In addition, we also counted the incidence of recurrent EGVB, refractory ascites (RA), HE, and liver failure during the follow-up. According to continuous enrolled patients, all patients were followed up by clinical inpatient data, outpatient information, and telephone contact from July to August 2022. The follow-up time was defined as the time from the first hospitalization or first detection of PVT to the time at which the outcome occurred. Recurrent EGVB means that hematemesis or melena occurred after hospitalization with transjugular intrahepatic portosystemic shunt, endoscopic ligation, or conservative treatment to reduce portal pressure. RA is defined as ascites that cannot be eliminated or its early recurrence after paracentesis or that cannot be satisfactorily prevented with sodium restriction and diuretic therapy.  The defip < 0. 05 was considered statistically significant.SPSS , R software , and GraphPad Prism 9  were used for statistical analysis. If the measurement data conformed to a normal distribution, they are expressed as the mean \u00b1 standard deviation. If they did not conform to a normal distribution, they are expressed as median and quartile ranges. For the comparison of measurement data between the two groups, the t-test or Mann-Whitney U test was used according to whether the data conformed to a normal distribution. Count data are expressed as frequencies and percentages, and the Pearson \u03c72 test or Fisher\u2019s exact probability test was used for comparisons between the two groups. R software was used to construct a nomogram to predict the occurrence of PVT in cirrhosis. The performance of the nomogram was assessed by discrimination and calibration curves. The discriminative ability of the model was determined by the area under the receiver operating characteristic curve (ROC), which ranged from 0.5 to 1 (no discrimination to perfect discrimination). The calibration of the prediction model was carried out by a visual curve comparing the predicted and actual probability of PVT. GraphPad Prism 9 was used to construct the survival curve. Unless otherwise stated, all tests were performed at a two-tailed significance level of 0.05. p < 0.05). Through univariate regression analysis, we chose some significant indicators (p < 0. 05) to input into the multivariate regression analysis and found that Alb, D-dimer, splenectomy, esophageal and gastric varices, and PVD were independent risk factors for PVT in cirrhosis . Multivariate regression analysis showed that it could be a powerful independent risk factor (p = 0.013). Our results are consistent with previous studies which showed that serum albumin was independently associated with PVT after adjustment for several factors, such as Child-Pugh score [As mentioned above, there are many risk factors for PVT formation in cirrhotic patients. In the present study, we selected five independent risk factors, including Alb, D-dimer, splenectomy, esophageal and gastric varices, and PVD, to build our model. The level of serum albumin can reflect liver synthesis function. A low serum albumin can indicate poor prognosis in patients with liver diseases . Previough score ,8,16,17.gh score . Due to gh score . Basili\u2019p < 0.001) in patients with acute worsening of chronic liver disease [D-dimer is produced during fibrinolysis. It has been widely used for the diagnosis of suspected VTE in clinical practice. A negative D-dimer in combination with clinical manifestations can rule out the diagnosis of deep vein thrombosis and pulmonary embolism, which reduces the need for ultrasound or CT scanning ,21. Howe disease . In our  disease . In addi disease . Patientp < 0.01), with a cutoff of >12.5 mm [p = 0.01) [PVD is considered the best indicator for portal hypertension. The wider the portal vein is, the more likely it is to cause damage to the venous vessel wall due to the extended high pressure in the lumen, and when combined with slow blood flow, the blood easily forms a vortex, promoting coagulation and eventually promoting the formation of PVT ,27. Dong>12.5 mm . The mec>12.5 mm . In the >12.5 mm . In a re>12.5 mm . In addi = 0.01) , which iCirrhotic patients with PVT tend to have severe complications and poor prognosis. It is generally assumed that PVT contributes to portal hypertension complications, subsequently increasing the risk of mortality. Patients with PVT have more portal hypertension signs, such as EGVB, splenomegaly, and thrombocytopenia. In the present study, we compared the incidence of complications in two groups among three cohorts during the follow-up and found that the occurrence of recurrent EGVB both in the training and validation cohorts showed significant differences . In the There are some limitations in our study. First, this study retrospectively collected the patients\u2019 data; thus, the reliability and completeness of the data are limited. In addition, the enrolled patients came from one region, and the etiology of cirrhosis and lifestyle factors, such as diet and alcohol consumption, may also affect the development of PVT. Third, considering the changes in the clotting system, inflammatory response, and platelet function in PVT, coagulation factors, fibrinolysis markers, inflammation biomarkers, and activation markers of platelets could also be used to predict PVT. Finally, the sample size of our research is small, and we only included patients from two medical centers. Research with a large sample size and patients from additional medical centers should be carried out in the near future.The model we constructed to predict PVT in cirrhotic patients has good diagnostic value. Patients with PVT have poor prognosis due to portal hypertension. With this prediction model, clinicians can evaluate patients with cirrhosis for their risk of developing PVT and apply the appropriate interventions as early as possible. For example, for patients with high scores on the nomogram, the lumen and blood flow of the portal vein should be assessed periodically by ultrasound. Symptomatic supportive treatment such as albumin infusion, the reduction of portal hypertension, or even prophylactic anticoagulation could be given after evaluation of the hemorrhage risk and systemic status. The proper management of PVT requires early detection, diagnosis, treatment, and follow-up. We expect that this nomogram based on laboratory tests and imaging findings will be a useful tool to guide individual care for high-risk cirrhotic patients."}
{"text": "Salvia miltiorrhiza Bunge, is widely used for treating various diseases. The low content of tanshinones (terpenoids) has always restricted development of the S. miltiorrhiza industry. Here, we found that SmDXS5, a rate-limiting enzyme-coding gene located at the intersection of primary and secondary metabolism, can effectively change the transcription level and secondary metabolome profile of hairy roots of S. miltiorrhiza, and significantly increase the content of tanshinones. Agrobacterium rhizogenes was used to infuse S. miltiorrhiza explants, and hairy roots of S. miltiorrhiza expressing the SmDXS5 gene were obtained successfully. We identified 39 differentially accumulated metabolites (DAMs) by metabolomics based on ultra-high performance liquid chromatography quadrupole exactive mass spectrometry and multivariate statistics. These DAMs might be key metabolites of SmDXS5 gene regulation. RNA sequencing was used to compare gene expression between the hairy roots of the SmDXS5 overexpressing group and the blank control (BC) group. Compared with the BC group, 18,646 differentially expressed genes were obtained: 8994 were upregulated and 9,652 downregulated. The combined transcriptome and metabolome analyses revealed that the mevalonate and methylerythritol phosphate pathways and synthase gene expression levels in the SmDXS5 overexpressing group were upregulated significantly, and the accumulation of tanshinone components was increased significantly, which promoted the process of glycolysis and promoted the transformation of carbohydrates to secondary metabolism. Moreover, the expression of SmPAL, the first rate-limiting enzyme gene of the phenylpropane pathway, decreased, reducing the accumulation of phenolic acid, another secondary metabolite. Therefore, SmDXS5 can be defined as a \u2018valve\u2019 gene, mainly responsible for regulating the distribution of primary and secondary metabolic flow of tanshinones in S. miltiorrhiza, and for other secondary metabolic pathways. The discovery of SmDXS5 and its molecular valve function in regulating primary and secondary metabolism will provide a basis for the industrial production of tanshinone components, and cultivation of high quality S. miltiorrhiza.Red sage, the dry root and rhizome of the herbaceous plant  Salvia miltiorrhiza Bunge. belongs to the family Labiatae, which has a very high medicinal development value. Its dry roots and rhizomes, red sage  has long been used in the famous traditional Chinese medicine (TCM) recorded in the \u201cChinese Pharmacopoeia\u201d. S. miltiorrhiza alone or in combination with other traditional Chinese medicine has a curative effect. S. miltiorrhiza is used to treat various diseases, especially cardiovascular diseases  and tanshinone (lipid-soluble)  . Due to S. miltiorrhiza, synthesized from common C5 precursors, isopentenyl pyrophosphate, and its isomer dimethylallyl diphosphate , fat metabolism, and energy metabolism in primary metabolism, and acts as the \u201cstarting substrate\u201d of the mevalonate (MVA) pathway of terpenoid secondary metabolism. Acetyl-CoA regulates secondary metabolism and primary metabolism independently to some extent. It can be said that acetyl-CoA is an important \u201cmetabolic button\u201d of the primary and secondary metabolism of terpenoids . The bioS. miltiorrhiza, and all 5 genes encode proteins with domains and motifs conserved among previously known DXSs SmDXS5 is mainly expressed in leaves and stems, and its expression level is lower compared with the other four SmDXS genes.The biosynthesis of tanshinones is a complicated process, roughly divided into 3 stages. In the first stage, MEP is the main pathway, supplemented by the mevalonate (MVA) pathway to generate isopentenyl diphosphate (IPP). In the second stage, IPP was transformed into geranyl diphosphate (GPP), farnesyl diphosphate (FPP) and geranylgeranyl diphosphate (GGPP). Finally, GGPP generates diterpenoids through stepwise ionization and cycloisomerization reactions . All MEPS. miltiorrhiza were mainly accumulated in its root, and SmDXS2 was highly expressed compared with other 4 SmDXS genes, indicating the importance of SmDXS2 in tanshinone synthesis. It is generally believed that the content of secondary metabolites in plants is affected by the gene expression. In our previous experiment, we overexpressed the gene SmDXS2 with high expression in hairy roots, and the content of tanshinone components in overexpressed SmDXS2 hairy roots was lower than that in the hairy roots of overexpressed SmDXS5 gene constructed in this experiment. SmDXS5 significantly promoted the accumulation of secondary metabolites in hairy roots of S. miltiorrhiza compared with SmDXS2. This indicates that gene expression level is a factor affecting plant metabolism, but the key factor lies in the response effect of genes. It also confirms the valve role of SmDXS5 gene and overturns the previous cognition.Previous studies  showed tAgrobacterium rhizogenes is a gram-negative bacterium. It transforms plants by transferring a discrete segment of its DNA, the T-DNA, to plant cells  cDNA was isolated and cloned from the sterile seedlings of S. miltiorrhiza (SmDXS5 construct. The blank vector pCAMBIA1305.2 without exogenous gene was used as the blank control.The complete iorrhiza . The vecS. miltiorrhiza plants were cultivated on Murashige and Skoog (MS) medium at 25 \u00b0C under a 16 h light/8 h dark photoperiod, with 0.7 % agar and 3% sucrose (pH 5.8 \u00b1 0.1). All the constructs were introduced into Agrobacterium tumefaciens strain C58C1, which were then transformed into S. miltiorrhiza to produce transgenic lines with hairy roots. The blank construct (blank vector pCAMBIA1305.2 without exogenous gene) was used as the blank control. The sterile leaves of S. miltiorrhiza were taken, the upper and edge parts with thin veins were cut off, submerged in the bacterial suspension for 10-12 min. Then we removed the leaves, dry the bacterial solution with sterile filter paper and then transferred the leaves in MS medium supplemented with 30% sucrose, 0.8% agar, at 22\u00b0C in darkness. After co-cultivation for 3 days, the leaves were washed with 60 ml sterilized water three times, and blot-dried on sterile filter paper then transferred to half-strength MS medium with 200 mg/L timentin for 2\u20133 weeks, in order to eliminate the agrobacteria. Pieces of the hairy roots of approximately 2\u20133 cm were cut off and transferred to a new MS medium containing timentin. The medium was changed every 7 days, and the concentration of timentin was gradually reduced until there was no plaque. Rapidly growing hairy roots on MS medium were selected and DNA was extracted using plant genomic DNA Extraction Kit (Tiangen). The PCR-positive hairy roots (3-4 cm in length) were then placed in 150 mL erlenmeyer flasks with 100 mL of 6,7-V liquid medium, and grown at 25 \u00b0C on an orbital shaker set at 100 rpm in darkness.Hairy roots samples were freeze-dried and crushed using a mixer mill. Each sample was accurately weighed at 10 mg and placed into a 2 ml centrifuge tube, added 1 ml of 75% methanol and weighed, ultrasonically extracted for 30 min, made up to the weight with 75% methanol, centrifuged at 12000 rpm for 2 min, and the supernatant was absorbed and filtrated (0.22 \u00b5m pore size) and filled into liquid-phase vials for testing as hairy roots.Hairy roots sample extracts were analyzed based on the UPLC-Q-Exactive-MS system. the UPLC column was a Water CORTECS C18 . Mobile phase consisted of solvent A was pure water with 0.1% acetic acid while solvent B was pure acetonitrile. Linear gradient programmed as follow: 0.0\u20133.0 min, 95-5%; 3.0\u201315.0 min, 80-20%; 15.0\u201316.0 min, 70-30%; 16.0-27.0 min, 60-40%; 27.0-31 min, 50-50%; 31-34 min, 30-70%; 34-41.0 min, again 90-10% of solvent B. Flow rate: 0.2 ml/min, injection volume: 2 \u03bcl. The column temperature was 35 \u00b0C and sample manager temperature was 4 \u00b0C.Mass spectrometry conditions: positive and negative ion scanning mode, range of 100-1500 m/z, HESI ion source, ion source temperature 350\u00b0C, capillary temperature 320\u00b0C, gasification temperature 400\u00b0C, spray voltage 3.5 kV, capillary voltage 35 V, tube lens voltage 110 V, sheath gas and auxiliary gas are high purity nitrogen (purity > 99.99%), sheath gas flow rate 35 arb, auxiliary gas flow rate 10 arb, S-lens RF level 55%.https://proteowizard.sourceforge.io/) and uploaded to Xcms Online (https://xcmsonline.scripps.edu). The website performed pre-processing operations such as peak identification, peak correction and finally exported as an xls. format file. The data were imported into MetaboAnalyst 5.0  for missing values imputation, denoising and area normalization and cluster analysis.Raw data were converted into mzML format by MSConvert software (http://www.hmdb.ca/), METLIN (http://metlin.scripps.edu/) and KEGG (https://www.genome.jp/kegg/pathway.html), compounds were identified and metabolic pathways were analyzed to elucidate their metabolic regulatory mechanisms.Multivariate principal component analysis (PCA) and orthogonal partial least squares-discriminant analysis (OPLS-DA) were conducted using the base package and \u201cMetaboAnalystR\u201d in R. Metabolite P-values were calculated by SPSS 19.0, and metabolites that met the conditions of P-value < 0.05 and VIP value > 1 were considered as potential biomarkers. Retrieval of the database HMDB  and StringTie (http://ccb.jhu.edu/software/stringtie/). The mapped reads were assembled and spliced, compared with the known transcripts, the transcripts without annotation information were obtained, and the potential new transcripts were functionally annotated. In order to obtain more comprehensive gene function information, compare all genes and transcripts obtained by transcriptome assembly with six databases, namely, the Kyoto Encyclopedia of Genes and Genomes (KEGG)  , the Nons (KEGG) , Gene Ons (KEGG) , Pfam, aP-adjust < 0.05 and |log2 FC \u2265 1| were analyzed for differential expression among samples to identify the differentially expressed transcript information among samples, and then to investigate the function of the differentially expressed genes (DEGs)/transcripts. The major DEGs were clustered using the MetaboAnalyst 5.0 .The gene expression level was normalized using the FPKM (fragments per kilobase of transcript per million mapped reads) method. After obtaining the read counts of genes/transcripts, the samples that met the criteria of S. miltiorrhiza were selected to investigate the expression profiles by qRT-PCR analysis, including SmAACT1, SmDXS2, SmDXS5, SmKSL1, SmPAL1 and SmTAT1. Transcript-specific primers and gene information were listed in SmActin  was selected as an internal control.6 candidate initiation synthase genes linking primary metabolism with secondary terpenoid and phenylpropanoid pathways of \u2013\u0394\u0394CT method . Real-time PCR was performed with SYBR Premix Ex Taq II . Template cDNA was used for qRT-PCR amplification of genes, and the relative expression level of each gene was detected. Each sample was parallel for 3 times. Ct value obtained from detection was used to calculate the relative expression level of genes by 2T method .https://www.metaboanalyst.ca/) to further reveal the valve role of SmDXS5 gene in regulating carbon flux of primary and secondary metabolism of S. miltiorrhiza. Based on the transcriptome gene expression and metabolite expression correlation analysis results, further screening of higher correlation analysis results using Cytoscape software (https://cytoscape.org/) to draw the gene-metabolite correlation network diagram.Based on the transcriptome and metabolome data, Pearson\u2019s correlation tests were used to explore the correlations between the DEGs and differential accumulated metabolites (DAMs). Only the detected correlations with a Pearson\u2019s correlation coefficient (PCC) value \u2265 0.9 and P \u2264 0.01 were selected. Cluster analysis of DAMs and DEGs was conducted on MetaboAnalyst 5.0 website  group, this might be due to the tanshinone accumulation.Hairy roots cultured for 20 days Figure\u00a01SmDXS5 gene showed a single peak  is a statistical method of supervised discriminant analysis, which can be used to further find the differential metabolites in each group. The OPLS-DA model of http://metlin.scripps.edu) were searched at the same time, taking the error of less than 10 ppm as the standard, the potential DAMs were finally inferred. According to the above method, there were 29 DAMs in positive ion mode and 24 DAMs in negative ion mode, as shown in https://www.metaboanalyst.ca/) to annotate the path. The DAMs were combined with sample clustering to draw a heat map. The colors represented the peak intensity of metabolites, with red representing high expression and blue representing low expression. As shown in SmDXS5 overexpression group could be clustered into one group respectively, indicating differences in metabolites between the two groups. Caffeic acid, arginine, sucrose, glucose, CoA, acetyl CoA, succinyl CoA, malic acid, succinic acid and pyruvate were clustered with BC group, while secondary metabolites tanshinones and amino sugars were clustered with SmDXS5 overexpression group. Cluster analysis showed that the carbon flux in S. miltiorrhiza was distributed in different metabolic pathways.In this experiment, the two groups were compared based on the OPLS-DA method, and the DAMs were further screened with absolute log 2 (fold change) \u2265 1, p-value < 0.05, and variable importance in projection (VIP) \u2265 1. Then, according to the mass-to-charge ratio (m/z) in the positive and negative ion mode, the human metabolome database and Metlin database . As shown in The RPKM values were calculated for each unigene by setting |log2(fold change)| \u2265 2 and P \u2264 0.05 as thresholds for significant DEGs selection. We performed KEGG functional annotation for all DEGs in the two groups . The results showed that SmDXS5 overexpression group and NC group could be clustered into one group in DEGs, indicating differences between the two groups. Most of the genes involved in glycolysis, TCA cycle and terpenoid synthesis were significantly positively correlated in SmDXS5 overexpression group, while the enzymes involved in phenylpropane synthesis pathway and lactate dehydrogenase genes were significantly negatively correlated in SmDXS5 overexpression group  value, the histogram Figure\u00a09SmDXS5 group. At the same time, the expression of sucrose, glucose, TCA cycle intermediates, caffeic acid and phenylpropane biosynthesis genes could be clustered together, and had a significant positive correlation with BC group. Cluster analysis results further intuitively revealed that SmDXS5 overexpressed gene can regulate metabolic carbon fluxes in different metabolic pathways through molecular regulation, demonstrating the role of SmDXS5 valve gene. Based on gene expression and transcriptome metabolites to express the correlation analysis results, respectively, based on gene - metabolites  selected corresponding relation, metabolites, gene  corresponding relationship, combined with gene and metabolites logFC information difference between the groups, nine quadrant diagram was drew , and the synthesis of their C5 framework precursors IPP and DMAPP is carried out through MVA and MEP pathways, respectively . In this pathway . TranscrI enzyme . DiffereI enzyme , and theBC group . These rCYP76AH1 can catalyze miltiradiene to synthesize ferruginol  is a kind of self-oxidizing heme multifunctional protein family, which can catalyze a variety of oxidation reactions and play an important regulatory role in plant growth and secondary metabolite accumulation . In the rruginol , which iS. miltiorrhiza were rosmarinic acid (RA) and salvianolic acid B, both of which could be considered as caffeic acid derivatives, and RA might be used as a precursor compound for complex salvianolic acid compounds , the intermediate product of glycolysis, was significantly accumulated. The expression levels of hexokinase (HK), 6-phosphofructokinase (pfkA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), enolase (ENO) and pyruvate kinase (PK) were significantly increased. These results indicated that under the regulation of SmDXS5 overexpression, glycolysis pathway was activated, and sugars were utilized to synthesize downstream carbon sources. However, metabolome data showed that in SmDXS5 hairy roots, the contents of pyruvate and acetyl CoA were decreased when glycolysis was activated, which we speculated was used by secondary biosynthesis. Pyruvate can be converted to lactic acid in the last step of glycolysis, and the reaction is catalyzed by L-lactate dehydrogenase (LDH). At the same time, it can also be catalyzed by pyruvate dehydrogenase complex (PDHC) on the inner membrane of mitochondria to generate acetyl CoA  can be found below: X-YW conceived the study and performed the experimental measurements, processed the experimental data. D-CZ, L-LL, and Z-RW integrated the data and wrote the manuscript. W-JX and J-LL performed the experimental measurements and helped in sampling. S-TT and J-HW performed the RNA extraction and the qRT-PCR experiments. YL, CZ, and CL analyzed the results and prepared the figures and tables. Zhirong Wang has made important contributions to data analysis and writing, Da-chuan Zhang and Zhirong Wang contribute equally to the article and are co-first authors of the article. All authors contributed to the article and approved the submitted version.This work was supported by the National Science and Technology Fundamental Resources Investigation Program of China (No. 2018FY100700), and the Science and Technology Support Plan of Guizhou Province (No. 20204Y074).The authors are thankful to the Beijing University of Chinese Medicine for the assistance in conducting this study.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Harlequin ichthyosis is a rare autosomal recessive disorder occurring in 1: 3,000,000 birth characterized by thick keratin skin with a scaly appearance. Preterm deliveries, early, and consanguinity of marriage are some risk factors. Antenatal checkup of DNA for ABCA12 mutation helps in diagnosis but ultrasonography in places was not available. Her gestational age of pregnancy was approximately 36\u2009weeks based on the first day of the last menstrual period. No remarkable complications were seen in the last ultrasound examination (USG) at the 28th week of pregnancy. She had a negative history of consanguinity of marriage, any relevant past medical history and her family members reporting such condition. She denied having any allergy history and was immunized against Tetanus Toxoid and COVID\u201019 vaccine. Her first child died due to neonatal jaundice after 5\u2009days of birth via cesarean section a few years ago.Her physical examinations were all normal and initial conservative treatment was given along with Inj. Dexamethasone 5\u2009mg, 2.5 ampoule IM stat. Then, the patient was counseled for the cesarean section mode of delivery.A female, 2.5\u2009kg, 40\u2009cm height with occipitofrontal circumference of 35\u2009cm baby with Harlequin ichthyosis was born. Figure\u00a02.1The patient's parents\u2019 belonged to a lower\u2010middle\u2010income family and did not have enough money for management. In addition, they mentioned the social stigmata being an important role in not treating the baby. According to their statement, they were not informed about such condition on their previous USG reports nor performed any anomaly scan of the fetus. However, we counseled them about the genetic condition and the need for caution in future pregnancies with the proper test to detect HI.3Harlequin ichthyosis, also called keratosis diffuse fetalis or ichthyosis congenital, is a rare disorder found equally in both sexesHI is clinically diagnosed at birth with the typical presentation of large, coarse, shiny, yellowish brown, generalized hyper\u2010keratinized sticky plates resulting in constricted mobility in upper and lower limbs with clasped fists and incurved toes. Later, deep fissures or cracks occur on these hard plates that spread to the dermis. Neonates with HI have growth retardation, eclabium, edema, microcephaly, and ectropion.Later in surviving patients, the hyperkeratotic scales fall off in the first few months, leaving an overlying persistent erythematous skin. In our patient, all these features were present suggestive of HI. Several studies have reported the presence of variation in the ABCA12 (Adenosine\u2010triphosphate\u2010Binding Cassette A12) gene encoding a protein for lipid transport in the skin is involved in the pathophysiology of the disease. The ABCA12 gene on chromosome 2 translates a protein involved in keratinocyte lipid transport across the epidermis of the skin which helps in the physiological development of skin and controls the progression of desquamation. The lack of normal ABCA12 function of transportation of lipids from the cytosol to the lamellar granules results in defective skin permeability and accumulation of scales.Prenatal diagnosis is important and helps in the early detection of the disease. Chorionic villous sampling and microscopic analysis of the amniotic fluid cells and USG especially 3D USG for assessment of the shape of the fetal mouth particularly during the early third trimester of pregnancy have been useful for early detection.In addition to this, obtaining a detailed account of family history, previous obstetric history, consanguinity between the parents, and the presence of other dermatological disorders in other offspring are equally important.Initial management necessitates monitoring in Neonatal intensive care unit settings (NICU) including supportive therapy to maintain quality of life by use of humidified incubator for monitoring temperature regulation. Intubation helps with the airway and breathing. Maintenance of fluids, electrolytes, and nutritional support through umbilical cannulation as access to peripheral veins becomes difficult. Limb contracture leads to amputation due to the presence of tissue necrosis and gangrene. Hence, it should be a reminder for surgical intervention using autologous skin grafts with the utmost care, physiotherapy, analgesia for painful deep fissures, and proper infection control.A comprehensive case series comprising 45 patients assessed by Rajpot et al.Critical factors in this patient's management include cooperation and educating the family about the outcomes and options because HI has a social disgrace in our country linked with a lack of knowledge and awareness of the disease and to avoid further endangering the child. Our patient was discharged on request after birth due to non\u2010compliance by her father.4Harlequin ichthyosis is a severe lethal disorder yet preventable with a proper antenatal checkup. In low\u2010middle\u2010income countries like Bangladesh, it is highly important to focus on routine Antenatal follow\u2010up at least four times. Although DNA analysis for ABC12 mutation will help to diagnose the case in the prenatal period, this might be tough in developing nations. The alternative approach is via USG during the second trimester, but in our case, a single USG could not catch the anomaly hence, repeated USG is highly advisable.ABS involved in conceptualization. RR, MHN, and SS involved in writing manuscript. ABS and SS performed manuscript editing and writing. PB collected patient information. LH was the supervisor. All authors reviewed the article and agreed on submission.No funding was received for this study.None declared.Informed written consent has been taken from the patient and will be provided on request."}
{"text": "Spasticity is a common complication of intracerebral hemorrhage (ICH). However, no consensus exists on the relation between spasticity and initial clinical findings after ICH.This retrospective study enrolled adult patients with a history of ICH between January 2012 and October 2020. The modified Ashworth scale was used to assess spasticity. A trained image analyst traced all ICH lesions. Multivariable logistic regression was used to examine the association between ICH lesion sites and spasticity.p < .001). Logistic regression analysis revealed that lower age, higher NIHSS scores, and drinking were associated with an increased risk of moderate\u2010to\u2010severe spasticity . However, smoking and ICH in the thalamus were associated with a reduced risk of moderate\u2010to\u2010severe spasticity  compared with ICH in the basal ganglia.We finally analyzed 304 patients . The incidence of spasticity in patients with ICH was 30.92%. Higher National Institutes of Health stroke scale (NIHSS) scores were associated with an increased predicted probability for spasticity (odds ratio, OR\u00a0=\u00a01.153 , Our results suggest that ICH lesion locations are at least partly associated with post\u2010stroke spasticity rather than the latter simply being a physiological reaction to ICH itself. The predictors for spasticity after ICH were age, NIHSS scores, past medical history, and ICH lesion sites.  Patients with subarachnoid hemorrhage were excluded. Patient characteristics were prospectively recorded, including age, sex, education, insurance, past medical history, lesion sites, lesion side, and National Institute of Health stroke scale (NIHSS) scores after acute intervention.2.2Compared with the relative contralateral brain region, lesions were visually identified as having altered fluid\u2010attenuated inversion recovery (FLAIR) and diffusion\u2010weighted imaging (DWI) signal intensities. We used DWI sequences for MRI within 48\u00a0h post\u2010stroke and FLAIR sequences for MRI within 48\u00a0h to 7 days post\u2010stroke , the most widely used clinical scale for assessing increase in muscle tone, which manifested as increased resistance of joints to passive movement on a scale ranging from grade 0 to grade 4  . This study conformed to STROBE guidelines. The STROBE checklist is included in the All variables in the study were calculated using descriptive statistics. The 3p = .014; Table p < .001; Table In total, 304 patients with ICH  were eligible for the study. The patient characteristics are shown in S1. Among the 304 patients, 94 experienced spasticity (31%). The results indicated that patients with spasticity were younger than those without spasticity (The spasticity characteristics at different lesion locations are shown in Table\u00a0p < .001). Similarly, the results revealed that higher NIHSS scores and younger age were associated with moderate\u2010to\u2010severe spasticity compared with mild spasticity . Smoking could reduce the risk of moderate\u2010to\u2010severe spasticity . Conversely, drinking was associated with a higher risk of moderate\u2010to\u2010severe spasticity . However, no significant differences were found between the occurrence of spasticity and the different ICH lesion locations. However, further analysis showed that patients with ICH in the thalamus or multiple sites had a lower risk of moderate\u2010to\u2010severe spasticity  than patients with ICH in the basal ganglia.The multivariable logistic regression analysis for the potential predictor variables for spasticity is presented in Table\u00a04This analysis of patients with ICH found that the occurrence of post\u2010stroke spasticity was associated with NIHSS scores, and the degree of spasticity was related to age, NIHSS scores, smoking, drinking, and lesion location. Our findings are consistent with those of previous studies showing that NIHSS scores are significant clinical predictors of post\u2010stroke spasticity , so we could not further examine the relationship between smoking/drinking and spasticity. Finally, the predictors identified in this study only appear to explain some of the variability of the incidence/severity of post\u2010stroke spasticity, indicating other contributing factors that we did not consider.6NIHSS score is a significant predictor of post\u2010stroke spasticity. Logistic regression analyses revealed that lower age, higher NIHSS scores, and drinking may increase the risk of moderate\u2010to\u2010severe spasticity, while smoking and ICH in the thalamus may reduce this risk. These findings may help identify the risk of post\u2010stroke spasticity and prioritizing early prevention and treatment.Chang\u2010Yue Gao and Ling\u2010Yi Liao conceived the study. Ling\u2010Yi Liao, Pei\u2010Dong Xu, Xiang\u2010Qin Fang, Huan Cheng, and Yong Tao collected data. Qing\u2010Hua Wang, Pei\u2010Dong Xu, and Ling\u2010Yi Liao oversaw the statistical analysis plan, conducted the statistical analysis, and contributed to data interpretation. Xiang\u2010Qin Fang and Pei\u2010Dong Xu contributed to data quality assurance and data quality analysis. Ling\u2010Yi Liao drafted the initial manuscript and Chang\u2010Yue Gao, Pei\u2010Dong Xu, Xiang\u2010Qin Fang, Qing\u2010Hua Wang, Yong Tao, and Huan Cheng critically revised the manuscript. All authors gave final approval for publication.The authors have no conflict of interest to declare.https://publons.com/publon/10.1002/brb3.2906.The peer review history for this article is available at Supplementary MaterialClick here for additional data file."}
{"text": "The aim of the study was to quantify the glycolytic energy metabolism (WGly) during a 2000 m ergometer rowing time trial (RTT) and \u03bdLa.max during a 10 s maximum ergometer rowing sprint test (RST) and to unravel associations between those variables and RTT performance. Combined post-exercise lactate measurements and oxygen uptake after RST and RTT were used to determine \u03bdLa.max and glycolytic energy contribution (WGly) in seven male and three female German U 23 national rowers . WGly during RTT ranged from 7 to 15.5% and \u03bdLa.max between 0.25 and 0.66 mmol\u2219L\u22121\u2219s\u22121. \u03bdLa.max correlated with WGly  and the mechanical power output (W) for the first 300 m (300first) during RTT . \u03bdLa.max further correlated with \u2206300first\u2212last (W) for the first and last 300 m (300last) during RTT  and also within the subgroup of male rowers. \u03bdLa.max displays a wide spectrum of individual differences in rowers. Due to this and its correlation to specific phases of RTT, it contributes to an individual energetic performance profile in rowing. Future studies must undermine the role of \u03bdLa.max for exercise performance and whether it serves as a marker that can be specifically targeted for a training-induced increase or decrease.The diagnostics of anaerobic glycolytic metabolism which play a subordinate role in elite rowing and parameters such as maximum lactate accumulation rate ( At the top level, the 2000 m distance for men and women is covered between 335 and 460 s, depending on the classification, i.e., heavyweight or lightweight, boat classification and sex, and conducted with a mean mechanical power output between 450 to 550 W ,2. To faormances ,9,10,11.ormances . Importatabolism ,14. So ftabolism ,16. De CThe contribution of anaerobic metabolism to rowing performance is generally more difficult to quantify  but was The glycolytic energy metabolism produces considerable amounts of energy per second ,21,22, e\u22121 (P4) and is around or above the 2max [\u03bdLa.max), determined via specific sprint tests, may serve as a measure for the individual rate of anaerobic glycolytic energy metabolism in an athlete [\u03bdLa.max significantly affects the power output at the anaerobic lactate threshold [\u03bdLa.max shifts the lactate curve to the right and improves mechanical power output at the lactate threshold, a high \u03bdLa.max decreases lactate threshold performance [\u03bdLa.max [The 2000 m rowing race consists of specific race phases contributing to the mean mechanical power output and the entire race time ,27,28,29 V.O2max ,15,16. A V.O2max  assumed, athlete  it was sformance . However[\u03bdLa.max .Performance diagnostics for rowers in Germany usually focuses on the determination of the P4  which is2 and lactate accumulation (La\u2212) obtained during and post 2000 m RTT, three energy system contributions  were calculated in German U 23 national rowers. Furthermore, \u03bdLa.max in a 10 s maximum sprint test (RST) was determined to get an estimate for the interindividual variability of this diagnostic marker in rowers. By correlating \u03bdLa.max with specific phases of 2000 m RTT and the glycolytic energy contribution, we aimed to determine and quantify possible associations that may indicate a specific role of \u03bdLa.max to support energy metabolism during 2000 m RTT and the share of glycolytic energy contribution during 2000 m RTT.Because the 2000 m rowing time trial (RTT) puts high demands on all energy metabolism pathways and the prominent diagnostic procedures in rowing do not specifically test for the glycolytic energy metabolism, the aim of our approach was firstly to determine the contribution of glycolytic energy metabolism during 2000 m RTT performance. Using a mathematical model involving The sample size was calculated using the G*Power software : effect size = 1.80, alpha error probability = 0.05, statistical power = 0.80. The consideration of effect size was based on previous studies ,33,34. TAll participants received written athlete information in advance and were informed about the aim, procedure, and risks of the study. This participant information also contained instructions on which aspects the participants must consider before their individual test days. Some days before the testing procedures, all participants were informed orally and in writing in advance of the study for a second time and gave their written informed consent prior participation. The study was approved by the Institutional Review Board of University of Hildesheim (No. 259_22) and followed the Declaration of Helsinki. The athletes did not perform any strength training or physically demanding rowing training for 48 h before the tests and participated in the rested state.\u22121, 20 \u03bcL) were collected into an end-to-end capillary  from the earlobe. Lactate samples were analyzed immediately after collection using an enzymatic\u2013amperometric sensor chip system . An automatic calibration of the system was performed after 60 min. For each test, resting lactate values were \u22642.0 mmol\u00b7L\u22121.For the determination of lactate concentration, capillary blood samples (mmol\u00b7L2) was measured using a spirometry system K5  in breath by breath mode. The values were averaged at 5 s intervals using Omnia Cardiopulmonary Diagnostic Software version 1.6.10 . The flow sensor was calibrated with 5 strokes of a high precision 3 L syringe . The gas calibration was performed with calibration gas . All athletes wore silicone masks in sizes M and L which were attached to a flowmeter of the K5 system .Oxygen uptake . The sprint tests were conducted on a modified ergometer which was additionally equipped with a FES  measurement system. This system consists of a load cell for force measurement and a rotary transducer to calculate the power output. Values were submitted to the associated computer software . In the starting position before each test, athletes sat with the rolling seat close to the resting flywheel, i.e., the participants\u2019 knees were in flexion. This position was chosen in each test because it equals the start in the boat. Drag factor settings in the tests were based on the conditions that apply at national Olympic Training Centers and German Rowing Association (DRV). The drag factor on an air-braked rowing ergometer simulates the water resistance that the paddle of the rower must overcome in the boat. A high drag factor in the sprint test was necessary to provide adequate starting resistance for rowers to generate a maximum mechanical power output from the starting position.Heart rate (bpm) was measured beat to beat continuously during each test using a Suunto Dual heart rate belt .All tests were conducted at a relative humidity of 39\u201348% and a temperature of 20.3\u201322.5\u00b0 Celsius. The values were measured using a Kestrel anemometer .rest). In case, the resting lactate values were higher than 2.0 mmol\u00b7L\u22121, participants were advised to continue rowing with a low intensity until blood lactate levels were below 2.0 mmol\u00b7L\u22121.The 10 s RST was conducted on the Concept II Type C rowing ergometer equipped with the FES measurement system, because an external measurement of mechanical power output is imperative when utilizing the C2 for short tests, due to a substantial underestimation of the start strokes . After t\u03bdLa.max.The intensity of the warm-up program was kept low (100 W) to avoid effects on maximum post-exercise lactate. Participants conducted the 10 s RST with the highest possible frequency to achieve a maximum mechanical power output during the test. The drag factor was 185 for men and 170 for women. The coaches verbally motivated all participants during 10 s RST for maximal effort. Immediately after the end of the test, the participants remained seated on the ergometer. For the determination of the maximum post-exercise lactate concentration, capillary blood was collected from the earlobe in one-minute intervals over a total time of 10 min. Once the lactate value dropped twice in a row, the test was considered complete and no further blood samples were obtained. The lactate values were needed to calculate the \u03bdLa.max is as follows (Equation (1)) [peak = the maximum lactate concentration after 10 s RST; Larest = the resting lactate concentration before 10 s RST; tExer = total exercise (rowing) time (10 s) and tPCr = the time of dominant phosphagen system contribution.The formula of ion (1)) :(1)\u03bdLaThe time of dominant phosphagen system contribution was calculated using an interpolated model that has been reported previously  . Because complete CPET was required for the determination of energy system contributions, these parameters could not be determined for the two athletes mentioned above (n = 8). Nevertheless, these two athletes were able to complete the 2000 m RTT. For this reason, the 2000 m performance and the mechanical power output from the first and last 300 m were obtained from all athletes (N = 10).The 2000 m RTT was performed on the air-braked Concept II Type C rowing ergometer without the FES measurement system because it was not necessary to measure mechanical power output of individual strokes. Before the start, during and after 2000 m RTT, all athletes wore a silicone mask to measure oxygen uptake via CPET. Resting oxygen uptake was measured with each participant seated (5 min). During CPET, two male rowers had to remove their silicone masks because of self-reported breathing problems. However, 2 was continuously measured for off\u00a02 kinetics [peak was determined during post exercise every minute from minute 7 to 17 min. Lactate samples were analyzed immediately after the 2000 m RTT. If two lactate values decreased twice in a row, the blood samplings were considered to complete and no further collections were obtained. The entire test was completed after the last post-exercise lactate collection after reaching Lapeak. The main variables of the 2000 m RTT were:(1)2000 m RTT performance (s).(2)first and P300last in W).Average power over the first and last 300 m of 2000 m RTT (P300(3)first-last).Mechanical power output difference between 300 m first and last (\u2206300 (4)2 (litres O2\u00b7min\u22121) before, during, and after 2000 m RTT.(5)Resting lactate and peak blood lactate concentration after 2000 m RTT.All participants were encouraged to run the test with maximum effort, as this is the only way to obtain a reliable and close-to-competition calculation of the energetic contributions. The drag factor was 145 for the men and 130 for the women. After the test, the participants remained seated on the ergometer and kinetics  (6 min) rest). For men, the power of the first stage was 150 W. Female participants started at 80. After each stage, there was a half-minute break before the next one followed. During the 30-s rest period, heart rate and blood lactate were measured and the individual rate of perceived exertion (RPE) was queried. Power output was increased by 50 W per stage for men and 40 W for women. Accordingly, the fifth and final stage resulted in 350 W for men and 240 W for women. On a screen, in front of the ergometer, the athletes were able to see whether they met the required mechanical power output. If the average of the last three strokes was 10 W or more below the target power output, athletes received a visual warning that they must increase mechanical power output. After the fifth warning, the test was automatically terminated. This test is only possible with the FES system and the associated software. At the end of the test, post-exercise lactate measurements were conducted at 3, 5, and 7 min. The drag factor was 145 for men and 130 for women. Thus, the P4 on the rowing ergometer was determined.The incremental step test was performed on the air-braked Concept II Type C rowing ergometer with FES measurement system. The test consisted of five stages, each with a duration of 4 min and was conducted according to the DRV standards in ergometer rowing. After a low intense warm-up on the rowing ergometer of around 5 min (100 W), capillary blood samples were obtained to determine the resting lactate concentration (La2 (during 2000 m RTT), peak La\u2212, and the fast component of excess 2 after exercise (EPOCFAST), respectively [WPCr) was calculated considering 2 after 2000 m RTT, and the fast component of excess post exercise after 2000 m RTT [2 was fitted by mono- and bi-exponential models using OriginPro 2021  and the slow component of the bi-exponential model was negligible. Therefore, the post-exercise 2 data were fitted to a mono-exponential model, and WPCr was calculated by estimating the integral of the exponential area [WGly) was considered by the lactate concentration after 2000 m RTT, assuming that the accumulation of 1 mmol\u2219L\u22121 (La\u2212) is equivalent to 3 mL O2\u2219kg\u22121 of body mass [\u2212) was calculated by subtracting the resting lactate concentration from the highest La\u2212 after 2000 m RTT [WOxi) was calculated by subtracting the resting 2 (2rest) from 2 levels during 2000 m RTT by the trapezoidal method. In this method, the area under the curve is divided into sections and then the sum of the trapezoid is utilized to calculate the integral [2rest was measured in the sitting position, within the last 30 s of a 5 min period used as a reference value [WTotal) was calculated as the sum of the three energy systems (WOxi + WPCr + WGly) in kJ [Phosphagen, glycolytic, and oxidative contributions were estimated by the assessment of ectively ,37,38,3900 m RTT ,37,40. Tial area ,32,37,39ody mass . The del00 m RTT ,37,38. Tintegral . V.O2resce value ,34,37,39ce value . Total ep < 0.05 for all statistical analyses. The effect sizes were calculated for non-parametric tests . Parameters are presented as arithmetic mean and standard deviation (SD). The Friedman repeated-measures rank test with Dunn\u2019s post hoc was utilized to compare the energy system contributions during the 2000 m rowing ergometer test . The \u03b1-level of significance was set at ectively . FurtherWPCr in kJ: 69.8 \u00b1 10.4, WGly in kJ: 76.0 \u00b1 27.3, WOxi in kJ: 498.7 \u00b1 62.9, WPCr in %: 10.9 \u00b1 1.7, WGly in %: 11.5 \u00b1 2.8, WOxi in %: 77.5 \u00b1 1.5, respectively).The first aim was to determine the energetic contributions towards 2000 m RTT. p = 0.002) were found between those pathways. Values of WOxi in kJ and % were significantly higher compared to WGly and WPCr  (WGly and WPCr in kJ nor in % (p > 0.05).Significant differences in the energetic contributions in kJ and % (= 0.008) B,D. Ther\u03bdLa.max is displayed in the group of participants. \u03bdLa.max values ranged from 0.25 mmol\u00b7L\u22121 (P3) as the lowest value to 0.66 mmol\u00b7L\u22121 (P6) as the highest value. During the first 300 m, the mean mechanical power output ranged between 466 W (P5) and 218 W (P3). The mechanical power output on the last 300 m to the finish of the 2000 m RTT ranged from 433 W (P8) to 218 W (P3).Next, the aim was to determine in which range \u03bdLa.max contributes to the glycolytic energy contribution (in kJ). A positive correlation was observed between WGly and \u03bdLa.max . There was no significant correlation between \u03bdLa.max and 2000 m RTT performance for the entire group (p > 0.05). . A\u2212D.\u03bdLa.max and the delta (\u2206300first\u2212last) value. Similarly, it was analyzed for a correlation between \u03bdLa.max and on the first and last 300 m during 2000 m RTT. A correlation between the \u03bdLa.max value and \u2206300first\u2212last was found  recovery (return to baseline PCr levels) after intense exercise, serves as a more precise method to consider the phosphagen contribution in our study [Our calculation revealed a percentage of 11.5 \u00b1 2.9% which corresponds with the data from Diry and colleagues . The useur study ,52,53,54\u03bdLa.max during 10 s RST was determined to analyze in which range this easily detectable marker of anaerobic glycolytic energy metabolism displays itself in our group of participants and whether it is related to the glycolytic energy contribution over 2000 m RTT. Within the tested athletes, \u03bdLa.max values between 0.25 and 0.66 mmol\u00b7L\u22121\u00b7s\u22121, 2peak values between 3.5 and 5.9 L\u00b7min\u22121, and P4 values between 200 and 338 W were observed , a correlation was found between  \u03bdLa.max . This in00 m RTT A emphasi\u03bdLa.max. This may attribute \u03bdLa.max a contributing role towards fatigue during specific phases of 2000 m RTT, because athletes with a higher \u03bdLa.max also show a higher reduction in the possible mechanical power output at the end of 2000 m RTT.Interestingly, the decline in mechanical power output between the first and last 300 m during 2000 m RTT also correlated with \u03bdLa.max testing, may be feasible to assess one\u2019s individual ability for glycolytic energy metabolism via a non-complicated and time-efficient test procedure.Our data imply that an extended performance diagnostic in rowing, including \u03bdLa.max as a measure of the individual maximum lactate accumulation rate was introduced by Mader in the 1980s [\u03bdLa.max so far are used for performance diagnostics in running [The concept of he 1980s . Approac running  and cycl running . A key d running . On the  running . Further running . In such\u03bdLa.max, we used a phosphagen-contributed time frame of 2.95 s in which energy metabolism is fueled by high energy phosphates and glycolysis is not yet maximally activated and followed already published calculations [\u03bdLa.max in running and cycling are described to last between 15 and 30 s [We chose 10 s for the RST, a duration which has been described to minimize oxidative metabolism but is sufficient to maximally activate glycolysis . To calculations . While sand 30 s ,58,59,602peak, but also low \u03bdLa.max values  an increase or decrease in \u03bdLa.max may increase rowing-specific performance. Specific training regimens could then be incorporated into rowing training to modulate \u03bdLa.max.Based on the former considerations and the high training volumes conducted in rowing, a directed and training-induced increase in \u03bdLa.max, 2peak, and segments of rowing-specific performance would have greatly undermined our findings and more precisely enclose our interpretations in more extended and significant correlations. Out of 10 participants, only eight data sets could be used for the determination of energy turnover during 2000 m RTT and three of our data sets were from female athletes which also determined the lower limit in our correlations concerning \u03bdLa.max, rowing performance during 2000 m RTT, and P300first. Hence, those data have influenced our correlations. Although energetic contributions in female athletes follow generally the same physiological regulations as in men, specificities for female athletes exist [Despite our group of highly trained German U23 national rowers, the sample size is still limited. A broader spectrum of 2000 m RTT performances as well as es exist  that mus\u03bdLa.max, arises as an individual component of energetic performance that supports the total energy requirements of 2000 m RTT. Based on its broad variety in athletes and its relationship to specific phases of 2000 m RTT, it may serve in the future as a diagnostic marker in rowing to detect potential limiting factors of exercise performance beyond usual diagnostic markers.Although energy supply during 2000 m RTT is predominantly ensured by the oxidative metabolism, the anaerobic glycolytic metabolism, as determined by"}
{"text": "The benefits of home-based cardiac rehabilitation exercise are well-established and depend on long-term adherence. However, there is no uniform and recognized cardiac rehabilitation criterion to assess home-based cardiac rehabilitation exercise adherence for patients with cardiovascular disease. This study aimed to develop a home-based cardiac rehabilitation exercise adherence scale and to validate its psychometric properties among patients with chronic heart failure.The dimensions and items of the scale were created based on grounded theory research, literature content analysis, and defined by a Delphi survey. Item analysis was completed to assess the discrimination and homogeneity of the scale. Factor analysis was adopted to explore and validate the underlying factor structure of the scale. Content validity and calibration validity were evaluated using the Delphi survey and correlation analysis, respectively. Reliability was evaluated by Cronbach\u2019s \u03b1 coefficients, split-half reliability coefficients, and test-retest reliability coefficients.A scale covering four dimensions and 20 items was developed for evaluating home-based cardiac rehabilitation exercise adherence. The content validity index of the scale was 0.986. In exploratory factor analysis, a four-factor structure model was confirmed, explaining 75.1% of the total variation. In confirmatory factor analysis, the four-factor structure was supported by the appropriate fitting indexes. Calibration validity of the scale was 0.726. In terms of reliability, the Cronbach\u2019s \u03b1 coefficient of the scale was 0.894, and the Cronbach\u2019s \u03b1 coefficients of dimensions ranged from 0.848 to 0.914. The split-half reliability coefficient of the scale was 0.695. The test-retest reliability coefficient of the scale was 0.745.In this study, a home-based cardiac rehabilitation exercise adherence scale was developed and its appropriate psychometric properties were confirmed.The online version contains supplementary material available at 10.1186/s12912-023-01426-2. Despite progress in prevention and control, the number of patients with cardiovascular disease is still on the rise due to global aging  CardiovaCardiac rehabilitation aims at ensuring that patients with cardiovascular disease achieve optimal physical, mental, and social functioning through their efforts . VariousCurrently, there is a lack of uniform and recognized criterion for assessing home-based cardiac rehabilitation exercise adherence among patients with cardiovascular disease. In existing studies, a series of relevant scales were developed and validated to assess cardiac rehabilitation preference and barriers, covering the cardiac rehabilitation inventory , the carIn a previous study , we explTherefore, building on the findings of previous constructivist grounded theory research , this stEligible patients with chronic heart failure were recruited using the convenient sampling with the help of community health service workers in 4 communities in Liaoning province in mainland China. In this study, participants had to meet several inclusion cardiac rehabilitationiteria, including being 18 years of age or older, engaging in home-based cardiac rehabilitation, and voluntarily participation. In this study, home-based cardiac rehabilitation refers to the phase during which patients with chronic heart failure continue their cardiac rehabilitation at home after completing the initial rehabilitation process in a healthcare institution. The inclusion criteria was confirmed by community electronic records, community health service workers, and researchers. On the other hand, patients with various mental illnesses or had other significant organic diseases were not permitted to join. The sample size was established based on the general rule of factor analysis , which rFrom February to April 2023, we conducted a multi-phase study using both quantitative and qualitative approaches to develop and validate the home-based cardiac rehabilitation exercise adherence scale, which involved three phases: (a) item generation and revision; (b) item evaluation and exploration; (c) psychometric evaluation of the scale. The development process of the scale is depicted in Fig.\u00a0The literature review was conducted to identify relevant studies on cardiac rehabilitation exercise adherence. The review involved a content analysis approach to select meaningful sentences which were used to form an initial item pool. Additionally, based on the previous constructivist grounded theory , the dimThe items of the pre-test scale were evaluated using a range of analytical methods, including critical ratio analysis, correlation coefficient analysis, and internal consistency analysis. The samples were divided into a high group top 27% scores) and a low group (bottom 27% scores), and the two groups of samples were analyzed to appraise the discrimination of the items. An acceptable critical ratio for each item was 3.0 or above and significant (P\u2009<\u20090.05) . Item-to% scores The content validity of the scale was assessed by inviting seven experts. The inclusion criteria for experts were consistent with the inclusion criteria for the previous Delphi experts. A four-point Likert scoring system, which spans from one point (irrelevant) to four points (very relevant), was utilized to collect expert responses. The content validity index of the item (I-CVI) was calculated as the ratio of the number of experts ranking an item 3 or 4 points to the total number of experts. For the content validity index of the scale (S-CVI), the average of all item I-CVI scores was calculated. To meet the criteria for content validity, an I-CVI score of 0.78 or above and an S-CVI score of 0.90 or higher were required .To assess the construct validity of the scale, an exploratory factor analysis (EFA) was conducted to reveal the underlying factor structure and establish consistency with the conceptual framework. Bartlett\u2019s test of sphericity and the Kaiser-Meyer-Olkin (KMO) value were used to determine the suitability of data for EFA, with a significant result (P\u2009<\u20090.05) and a KMO above 0.6 as prerequisites. All common factors should account for more than 40% of the total variance \u201332. AddiTo examine the calibration validity, the exercise self-efficacy scale  was adopAs a calibration tool, the Chinese version of the multidimensional exercise self-efficacy scale was adopted to assess patients\u2019s confidence in adherence to exercise in this study . The scaTo evaluate the internal consistency reliability of the scale, the Cronbach\u2019s \u03b1 coefficient and the split-half reliability coefficient were calculated. Additionally, 36 participants previously surveyed were invited to complete the questionnaire again two weeks later to assess the scale\u2019s stability across time. To establish good internal consistency, reliability, and test-retest reliability, the Cronbach\u2019s \u03b1 coefficient, the split-half reliability coefficient, and the test-retest reliability coefficient should be 0.70 or higher , 40.In the first phase, the experts were provided with a compressed package containing informed consent and an expert consultation questionnaire via email, following a brief introduction to the study\u2019s purpose and significance. The experts were asked to provide their feedback and suggestions within two weeks of receiving the questionnaire. In the second phase, community outpatient follow-ups were conducted for 380 chronic heart failure patients. Before participation, the patients were informed about the purpose, importance, and voluntary and anonymous nature of the study. Out of the 380 patients who were invited to participate, 366 provided anonymous responses to the questionnaires after providing consent.The data was analyzed using SPSS 26.0 and AMOS 18.0 software. The Delphi survey was conducted to revise the items and assess the content validity of the scale. In the EFA, the maximum variance rotation was adopted to explore the underlying factor structure. The structural equation model, using the maximum likelihood method, was utilized to verify the factor structure\u2019s consistency with the theoretical expectation. To determine the scale\u2019s reliability, internal consistency analysis and test-retest reliability analysis were performed, assessing the scale\u2019s homogeneity and stability, respectively.In this study, all procedures were conducted in accordance to the Declaration of Helsinki of 1964 and its further modifications. All participants signed informed consent forms. The participants were allowed to withdraw from the study at any point and were not obligated to respond to any questions. The protocol of this study was approved by the Ethics Review Committee of the First Affiliated Hospital of China Medical University on January 27, 2023 (No. 2023. 66).The study included 366 chronic heart failure patients, comprising 200 males and 166 females. The average age of the participants was 66.46\u2009\u00b1\u20096.49. Nearly half of the participants had primary education (45.6%), and the majority were married (56.3%). Regarding monthly income, 49.7% of participants earned less than 3000 RMB, and 48.6% of participants had a condition duration of less than four years. The majority of participants were from urban areas (80.1%) . Consequently, a 22-item pre-test version of the scale encompassing four dimensions was formed, and a five-point scoring system was determined by experts to collect participants\u2019 responses. The first survey resulted in a 100% questionnaire return rate, a 0.900 authority coefficient, and a Kendall\u2019s consistency coefficient of 0.672 (P\uff1c0.05). The second survey yielded a corresponding 100% questionnaire recovery rate, a 0.900 authority coefficient, and a Kendall\u2019s consistency coefficient of 0.724 (P\uff1c0.05).In the item analysis, the critical ratio of the items ranged from 5.233 to 18.096 (P\u2009<\u20090.05). The total scale\u2019s Cronbach\u2019s \u03b1 coefficient was 0.891, but if items 11 (0.893) and 12 (0.892) were removed, the Cronbach\u2019s \u03b1 coefficient would increase. Additionally, the items-total correlation coefficients ranged from 0.423 to 0.710 (P\u2009<\u20090.05), except for items 11 (0.346) and 12 (0.389). In the exploratory factor analysis, all items showed factor loadings ranging from 0.622 to 0.887, except items 11 (0.290) and 12 (0.280). Given these results .2\u2009=\u20092835.793, P\u2009<\u20090.001) indicated that the data was suitable for EFA. A maximum variance rotation was performed to extract common factors, resulting in four common factors with eigenvalues\u2009\u2265\u20091, which explained 75.1% of the total variation .The Cronbach\u2019s \u03b1 coefficient of the scale was 0.894, and the Cronbach\u2019s \u03b1 coefficients of each dimension ranged from 0.848 to 0.914. The split-half reliability coefficient of the scale was 0.695. After 2 weeks, 36 previously labeled patients with chronic heart failure were sampled to assess home-based cardiac rehabilitation exercise adherence, with a test-retest reliability coefficient of 0.745 (P\u2009<\u20090.001).Among existing research tools, a scale for measuring home-based cardiac rehabilitation exercise adherence has not yet been explored. To address this gap, our study developed a grounded theory-driven evaluation tool, namely the home-based cardiac rehabilitation exercise adherence scale (Appendix C). We validated the four-factor structure of this scale, which overcomes the limitations of previous tools and comprehensively reflects adherence to home-based cardiac rehabilitation exercise. By incorporating this scale into a remote follow-up platform within medical institutions, we can actively and dynamically track patients\u2019 home-based cardiac rehabilitation exercise adherence, significantly reducing the time cost of out-of-hospital follow-up for cardiac rehabilitation professionals. Additionally, this scale can multidimensional identify the weak links of patients\u2019 home-based cardiac rehabilitation exercise adherence, facilitating cardiac rehabilitation professionals to develop precise intervention strategies.Seeking supports is a crucial initial adherence behavior for patients with cardiovascular disease during home-based cardiac rehabilitation exercise . This isExercise, as a recommended Level A1 evidence, is central to cardiac rehabilitation , 5. It wExercise monitoring is a key adherence behavior for patients with cardiovascular disease during home-based cardiac rehabilitation exercises . EffectiInformation feedback is a driving adherence behavior in cardiac rehabilitation exercises , which hIn general, based on previous grounded theory research , the dimBased on grounded theory research and literature review, the dimensions and items of the scale were preliminarily determined. After a two-round Delphi survey, a pre-test version with 22 items was developed. The Delphi survey demonstrated satisfactory enthusiasm, authority, and consistency among the experts in relation to the items . Thus, tIn the item analysis, the critical ratio of the items satisfies the reference standard value , supportIn this study, the content validity, construct validity, and calibration validity of the scale were successively confirmed. Regarding content validity, both I-CVI and S-CVI exceeded the recommended standard values , supportIn this study, the internal consistency reliability and test-retest reliability of the scale were confirmed. Regarding internal consistency reliability, both the Cronbach\u2019s \u03b1 coefficient and the split-half reliability coefficient of the scale exceeded the recommended reference values , supportThere are some limitations to this study that warrant discussion. Firstly, bias resulting from the intrinsic nature of convenience sampling is unavoidable. Secondly, there were three items related to social support with factor loadings less than 0.40 in the CFA. However, we meticulously considered that social support is of vital importance in home-based cardiac rehabilitation exercise, and thus, all items were retained. Finally, the newly developed scale is applicable to all patients with cardiovascular diseases. However, the scale was only validated in patients with chronic heart failure in this study, which weakens the applicability and scientificity of the newly developed scale in other patients with cardiovascular diseases to a certain extent. Therefore, in future studies, the scale will be applied to other patients with cardiovascular disease to compensate for this limitation and improve the extrapolation of this scale.In the current study, we developed a home-based cardiac rehabilitation exercise adherence scale and validated its psychometric properties among patients with chronic heart failure. This newly developed scale covers four dimensions and 20 items. It can accurately and comprehensively evaluate the level of home-based cardiac rehabilitation exercise adherence for patients with cardiovascular disease. In future studies, the developed scale could be adopted to investigate adherence levels and measure the impact of interventions, thereby identifying weaknesses and evaluating their effectiveness.Below is the link to the electronic supplementary material.Supplementary Material 1Supplementary Material 2Supplementary Material 3"}
{"text": "No indication of small study effects was found in the association between SIII values and OS (p = 0.5301). High SIII values were associated with worse OS and PFS. However, further primary studies are suggested to enhance the effect of this marker in different outcomes of testicular cancer patients.The systemic immune-inflammation index (SIII) is a marker studied in multiple types of urologic cancer. This systematic review evaluates the association between SIII values with overall survival (OS) and progression-free survival (PFS) in testicular cancer. We searched observational studies in five databases. The quantitative synthesis was performed using a random-effects model. The risk of bias was assessed using the Newcastle\u2013Ottawa Scale (NOS). The only measure of the effect was the hazard ratio (HR). A sensitivity analysis was performed according to the risk of bias in the studies. There were 833 participants in a total of 6 cohorts. We found that high SIII values were associated with worse OS (HR = 3.28; 95% CI 1.3\u20138.9;  According to GLOBOCAN, 74,458 new testicular cancer cases and 9334 deaths were estimated in 2020, of which 33.7% were in Europe and 27.7% were in Asia. However, Asia has a wide advantage regarding mortality, with a rate of 42.8% . The worTesticular cancer can be classified, according to histopathology, into germ cell tumors and non-germ cell tumors, of which germ cell tumors account for 98% . The forThe literature reports various risk factors related to a poor prognosis in testicular cancer. Among the most studied factors, age over 35 years, serum alpha-fetoprotein above 1000 Ku/L before chemotherapy, and human chorionic gonadotropin above 5000 IU/L stand out [Recently, the association between a poor cancer prognosis and different inflammatory markers has been described. A study using systemic inflammatory markers, based on preoperative complete blood count, found that neutrophils, the neutrophils to lymphocytes ratio (NLR), and the mean red blood cell distribution width were significantly higher in the tumor group. In contrast, the mean volumes of platelets and lymphocytes were significantly higher in the cancer-free group .As well as these markers, the NLR, the platelets to lymphocytes ratio (PLR), the monocytes to lymphocytes ratio (MLR), and the preoperative albumin to globulin ratio have been identified ,13. In 2We used the PECO strategy: population (P), exposure (E), comparison (C), and outcome (O) to guide the main objective of this systematic review. Based on the PECO strategy, we ask the following question: Do patients with testicular cancer (P) and high values of SIII (E) have worse overall survival and progression-free survival (O) than patients with testicular cancer and low values of SIII (C)?We registered the study protocol on the International Prospective Register of Systematic Reviews (PROSPERO). The register code is CRD 42021281533. Likewise, we used the Preferred Reporting Items for Systematic Reviews and Meta-analysis (PRISMA) statement  checklist . No langWe included studies that: (i) evaluated the association between the systemic immune-inflammation index (SIII) and testicular cancer reporting outcomes, such as progression-free survival (PFS) and overall survival (OS), (ii) included males with a confirmed diagnosis of testicular cancer, and (iii) items that provide a defined cut-off value for the systemic immune-inflammation index (SIII)  to help in the screening and selection of studies . Four auWe collected the following data: author, year, country, median follow-up time, participants\u2019 median/mean age, the type of testicular cancer, cut-off values, and associations between systemic immune-inflammation index values and overall survival or progression-free survival  for case-control/cohort studies, by two authors (FES-V and VAV-C), based on 3 different items: selection, comparability, and outcome/exposure . The maxp-value of <0.1 and an I2 statistic with values >70% as a sign of severe heterogeneity. A sensitivity analysis was performed, excluding articles with low methodological quality, to test the robustness of our findings. Egger\u2019s test was carried out to assess publication bias; p-values less than 0.1 indicated publication bias [The information collected from the selected articles was combined using Review Manager 5.4 (RevMan 5.4) . Hazard ratios (HRs) and 95% confidence intervals (CIs) were the only measures used to obtain a pooled effect. We used a random-effects model (DerSimonian and Laird) for the quantitative analysis. The heterogeneity of the studies was evaluated using Cochran\u2019s Q test with a ion bias ,22.We identified 72 articles, leaving 50 studies after eliminating duplicates. The screening process evaluating titles and abstracts left 13 studies for full-text review. Likewise, the full-text screening left five studies that met all the selection criteria ,24,25,26Four studies were included from a total of five cohorts since the study by Chovanec et al.  analyzedp < 0.05, which could alter and bias our results).The association was assessed in five cohorts (n = 805). However, only four studies were included in the meta-analysis  (p < 0.001) but with null heterogeneity (I2 = 0%)  a. Due toI2 = 0%) b.p < 0.001) with null heterogeneity (I2 = 0) (The association was assessed in four cohorts (n = 443). We found that testicular cancer patients with high SIII values were associated with worse PFS  .Publication bias could not be determined because there were no more than five meta-analyzed studies in any of the outcomes.Our main results show that a high SIII value is associated with worse OS and PFS in patients with testicular cancer. This reflects the role of inflammation in the genesis and progression of several types of cancer, including urological cancers.In tumor genesis, inflammation mediates the creation of reactive oxygen species and the activation of cell signaling pathways that promote cell proliferation and limit apoptosis . In the As a tumor marker, SIII reflects the balance between host inflammation and immune response status . LikewisIn the case of neutrophils, their presence is associated with poor prognosis in cancer patients because they can activate endothelial and parenchymal cells that facilitate metastasis of circulating tumor cells . In addiOn the one hand, platelets can protect circulating tumor cells from the antitumor immune response and promote the angiogenesis and metastasis of cancer cells . In vitrMoreover, lymphocytes, especially tumor-infiltrating lymphocytes, play a key role in the host\u2019s immune response to cancer . They caSeveral systematic reviews evaluating the prognostic role of SIII in urological cancers have been published. A systematic review of 15 articles found, in subgroup analyses, that high SIII indicated a worse overall survival rate in urinary cancers and hepatocellular carcinoma, gastrointestinal tract cancers, small cell lung cancer, and acral melanoma ,46,47,48Our results show the potential role of SIII in survival outcomes of patients with testicular cancer and being an easy-to-measure and low-cost marker. However, this biomarker, in comparison with other inflammatory markers used to predict the prognosis of urological cancers, such as NLR , PLR 7070, and CIn our study, we found limitations that should be considered. Firstly, due to the small number of studies, it was impossible to perform a correct stratification of results according to the clinical or sociodemographic variables of the patients. Secondly, it was only possible to study the association of SIII values with two clinical outcomes, so it would be necessary for future studies to study the association with other outcomes. Third, high statistical heterogeneity was found due to the methodological and clinical differences between the studies. However, heterogeneity decreased when the sensitivity analysis was performed, which only included a low risk of biased studies. Finally, sensitivity and specificity values of the SIII cut-off points in OS and PFS have not been reported, which could help evaluate the precise prognostic value of this biomarker in testicular cancer.High SIII values are associated with worse OS and PFS. However, further primary studies are suggested to enhance the effect of this marker in different outcomes of testicular cancer patients."}
{"text": "The MOF 1 displayed a -connected (3.43.52)(32.44.52.66.7) network topology, while 2 had a -connected network with a Schl\u00e4fli symbol of (410.511.622.72)(43)2. These MOFs have been employed as photocatalysts to photodegrade nitrophenolic compounds, especially p-nitrophenol (PNP). The photocatalysis studies reveal that 1 displayed relatively better photocatalytic performance than 2. Further, the photocatalytic efficacy of 1 has been assessed by altering the initial PNP concentration and photocatalyst dosage, which suggest that at 80 ppm PNP concentration and at its 50 mg concentration the MOF 1 can photo-decompose around 90.01% of PNP in 50 min. Further, radical scavenging experiments reveal that holes present over 1 and \u00b7OH radicals collectively catalyze the photodecomposition of PNP. In addition, utilizing density of states (DOS) calculations and Hirshfeld surface analyses, a plausible photocatalysis mechanism for nitrophenol degradation has been postulated.Metal\u2013organic frameworks (MOFs) are peculiar multimodal materials that find photocatalytic applications for the decomposition of lethal molecules present in the wastewater. In this investigation, two new d PNP is an essential industrial raw material used in the manufacturing of insecticides, dyes, and pharmaceuticals. However, the USEPA has designated this essential nitrophenolic molecule as a priority pollutant due to its intrinsic toxicity, mutagenicity, and carcinogenicity  constructed from 3,5-benozoicacid and 4,4\u2032-bipy shows the photo decomposition with rate constant (k) 0.007 min\u22121 (PNP) at 12 min [3-tp)2(\u03bc2-pyz)2] and CuWO4 showed a maximum 81% degradation of PNP after 135 min under LED light irradiation [3O4/MIL-53(Fe)/H2O2 was used as a photocatalyst and showed that about 60% of the PNP was photocatalytically degraded after 150 min of visible light irradiation [g-C3N4/PDI@MOF heterojunction was synthesized by the in situ growth of NH2-MIL-53(Fe) onto the g-C3N4/PDI layer. This material displayed excellent photocatalytic performance for the removal of several water-soluble and toxic organic pollutants (50 ppm) for an efficiency of up to 100% (30 min) under visible light irradiation [A new 3D three-connected ThSit 12 min . A new Madiation . Meanwhiadiation . A new gadiation .1 assisted photodegradation of PNP, radical scavenging experiments were performed. To execute these, 10 mg ammonium oxalate  scavenger)/10 mg benzoquinone /0.2 mL tertiary butyl alcohol  were used under the optimized reaction conditions  center was also evident. Also, the conduction bands between 1.8 and 2.0 eV in 1 and 2.2 and 2.5 eV in 2 had contributions from aromatic carbon and oxygen centers. Hence, these calculations suggest that the main electronic transitions in both 1 and 2 were intraligand and ligand-to-ligand, with an admixture of metal orbitals in 1. These transitions are primarily responsible for photocatalysis. Apart from this, the MOF 1 possessed a relatively smaller band gap than that of 2, which is the other reason for its better photocatalytic efficacy compared to 2.Further, band gap calculations were performed to assess the plausible photocatalytic mechanism for the MOF-aided PNP photodegradation . The out+) in VB. The hydroxyl radicals (\u2022OH) are then generated by the reaction of H+ with O2\u207b. The O2\u207b are generated by the reduction of O2 by e\u207b and the oxidation of OH by holes (h+)  In presence of light, the electrons of MOFs are excited from VB\u2192CB to generate equivalent numbers of holes (hles (h+) .1 and 2 are isolated from the reaction mixture, washed repeatedly with the solvent, and reused again for the fresh catalytic cycle  was also performed for both 1 and 2 before and after photocatalysis  and Cd(II) MOFs were synthesized using the 5,5-diisophthalic acid ligand and 1,1\u2032-bis(imidazole) (bbi) linker. The Zn(II) MOF displayed a -connected (3.43.52)(32.44.52.66.7) network topology, while Cd(II) had a -connected network with a Schl\u00e4fli symbol of (410.511.622.72)(43)2. These newly synthesized MOFs can be used as photocatalysts to photodegrade nitrophenolic compounds, especially p-nitrophenol. Amongst both the MOFs, the Zn(II) offered relatively better photocatalytic performance, which was attributed to relatively better O\u00b7\u00b7\u00b7H interaction contribution as well as a greater void volume and void area than the Cd-based MOF. Apart from this, the relatively smaller band gap in Zn-based MOF in comparison to the Cd-based MOF might be another reason for the better photocatalytic performance. Further, the photocatalytic efficacy of the MOF was assessed by altering the PNP concentration and photocatalyst dosage, which indicated that under the optimal reaction condition, viz., 80 ppm PNP concentration and 50 mg photocatalyst concentration, an ~90.01% photodegradation of PNP was observed in a 50 min time span. Therefore, it can be concluded that the use of mixed ligands can result in the development of novel d10-configuration-based MOFs with tuned electronic properties that not only have structural robustness, but also show desirable photocatalytic properties for the safe and long-term degradation of PNP and related nitrophenols for real water samples that contain such pollutants. In this study, two new dComprehensive descriptions of the methods and equipment used in the study presented are included in the electronic supporting material (ESI).4L , bbi , Zn(NO)3\u00b76H2O , 10 mL of H2O, and 2 drops of HNO3/H2O (v/v = 1:1) was prepared and after stirring for 30 min this was thereafter transferred into a 25 mL Teflon-lined reactor, sealed and heated to 180 \u00b0C for three days and then cooled with a cooling rate of 5 \u00b0C/h to give a colorless block-like crystal of 1 with 72% yield based on zinc. IR (cm\u22121): 3412 vs, 1678 s, 1611 s, 1570 s, 1457 s, 1412 m, 1091 m, 758 m. See the ESI , bbi , Cd(NO)3\u00b74H2O , 10 mL of H2O, and 2 drops of HNO3/H2O (v/v = 1:1) was prepared and, after stirring for 30 min, this was transferred to a 25 mL Teflon-lined reactor, sealed and heated to 180 \u00b0C for three days and then cooled with a cooling rate of 5 \u00b0C/h to give a yellow block crystal of 2 with 63% yield based on cadmium. IR (cm\u22121): 3012 vs, 1640 s, 1605 s, 1571 s, 1422 s, 1398 m, 1081 m, 771 m. See the ESI (A homogenous solution of H the ESI .1 or 2 was added to 60 mL aqueous solution of nitrophenols and stirred for half an hour in the dark to achieve an adsorption equilibrium between MOF and nitrophenols, and then it was irradiated using a 350 W Xe lamp. About 2 mL of this suspension was isolated after every 10 min and centrifuged and UV-Vis spectroscopies for the obtained solutions were performed using a Varian 50 UV/Vis spectrophotometer. The photograph of the photocatalytic setup is shown in In a typical process, 50 mg of MOF Theoretical calculations were used to elucidate the putative photocatalysis mechanism, and for this a unit of MOF was geometrically optimized using the B3LYP function  employinMolecular Hirshfeld surfaces analyses were performed using previously reported protocols ,74."}