{"text": "Many medical specialities have reviewed the statistical content of their journals. To our knowledge this has not been done in general practice. Given the main role of a general practitioner as a diagnostician we thought it would be of interest to see whether the statistical methods reported reflect the diagnostic process.British Medical Journal , British Journal of General Practice and Family Practice over a one-year period (1 January to 31 December 2000).Hand search of three UK journals of general practice namely the A wide variety of statistical techniques were used. The most common methods included t-tests and Chi-squared tests. There were few articles reporting likelihood ratios and other useful diagnostic methods. There was evidence that the journals with the more thorough statistical review process reported a more complex and wider variety of statistical techniques.BMJ had a wider range and greater diversity of statistical methods than the other two journals. However, in all three journals there was a dearth of papers reflecting the diagnostic process. Across all three journals there were relatively few papers describing randomised controlled trials thus recognising the difficulty of implementing this design in general practice.The  For example, the use of the na\u00efve Bayes' discriminant function (and from it the derivation of likelihood ratios) is appropriate. Proponents of Bayes' argue for its simplicity and ease of interpretation,6. In coMany medical journals, both generalist,11 and sBritish Medical Journal (BMJ) , British Journal of General Practice (BJGP) and Family Practice. These three journals were chosen because they reflected the main primary care journals in the UK. The journals were hand searched for original research articles over a one-year period (1 January to 31 December 2000). Articles were classified for both their statistical content and methods of design according to criteria laid down elsewhere[Three statisticians   including one Professor, one Senior Lecturer and one Lecturer each reviewed one leading UK journal in general practice. The fourth author (NS) is a Primary Care Physician. The journals chosen were the elsewhere,20. TablThe main study was preceded by a pilot phase in which a random sample of 10 articles was classified both by statistical content and study design by the three statisticians. Where there were differences of opinion, consensus was reached by discussion. We met once to discuss our classification system, and to iron out differences of opinion. One problem lay in how we actually classified study design. For example, one of use used the phrase 'cross-sectional survey' while another used the phrase 'questionnaire survey' when both meant the same in terms of study design. Another problem was that we missed some of the statistical techniques (where there were many) and this required much more careful reading of the articles when we carried out the main survey. We did not carry out a formal reliability study of the pilot phase but instead relied on our experiences both as statisticians, and as journal reviewers. Similarly we chose not to carry out a formal reliability analysis in the main study.BMJ  (n = 79), BJGP (n = 145) and Family Practice (n = 81).The total number of articles reviewed over a one year period was as follows: BMJ, BJGP and Family Practice respectively (Table Family Practice (21.0% compared to an average of 11.8%). Qualitative studies included those encompassing terms such as 'focus groups' and 'semi-structured interviews' for example. Figure Helicobacter pylori for the detection of peptic ulcer). Examples of more unusual study designs include those based on video recordings, literature reviews and quasi-experimental designs.The most common design was that of a cross-sectional survey being found in 24.1%, 39.3% and 35.1% of articles in the BMJ shows a greater range and breadth of articles than Family Practice. More sophisticated techniques are reported more often in the BMJ than either of the other two journals. In the BMJ, the two most common statistical methods used were logistic regression  and the Chi-squared test . The two least common were the Mantel-Haenszel statistic  and Cronbach's alpha . Relatively new innovations such as random effects models were seen in both the BMJ and the BJGP. The least sophisticated statistical methods appeared in Family Practice. Methods based on likelihood ratios were seldom found in either the BMJ or BJGP and not at all in Family Practice. Nonparametric tests were often unspecified but where they were included Mann-Whitney U test, Spearman's correlation coefficient and the Wilcoxon matched-pairs signed ranks test. Multiple comparisons included Bonferonni techniques and Scheffe's contrasts. Survival analysis included Kaplan-Meier curves and Cox regression.The range of statistical methods reported can be seen in Table One-third of all articles reported no statistics or simple summaries . No journal article with a qualitative design had any statistical content.BJGP. This was due to a wide range of statistical methods being reported only once. Examples include time series, multilevel modelling and factor analysis. In others, we could not decipher which statistical techniques had been used.A large number of articles reported other statistical methods, in particular the Table BJGP and Family Practice. Papers in the BMJ and the BJGP used more sophisticated statistical methods than Family Practice . It is perhaps too easy for us to lay blame at the Editors door for this lack of sophistication. Statisticians are relatively rare, and review, for the most part, is unpaid.Two-thirds of all journal articles relied on some type of statistical analysis beyond descriptive statistics Table . The Chice Table . While byears ago. Despitelsewhere,,15,17,20lsewhere,. The BJGAlthough these three journals publish a large proportion of the research in general practice within the UK, they by no means represent 100% of it. To look at this further we examined the year 2000 and undertook a MEDLINE search using the key indexing phrase 'General Practice'. We found over 800 articles in a diversity of journals. Articles were published in the fields of rheumatology, medical ethics, obstetrics, public health, clinical pharmacology, clinical neurology and telemedicine to name but a few.We chose to look at the year 2000. Would our results be different had we selected a different year? The published literature suggests otherwise. In a 20 year old study, Emerson and Colditz found t-Now let us turn to study design. The gold standard research design is considered to be the randomised controlled trial (RCT). It has been acknowledged that carrying out RCTs in general practice are difficult,24. In oWhat are the issues here? Are they really that different from secondary care? A recent publication posed the question 'What do residents really need to know about statistics?'. The autFor all three journals there was a dearth of articles reflecting the diagnostic process. Why is this? It has already said that diagnosis is the Achilles Heel of GPs. If it iThe author(s) declare that they have no competing interests.Three authors  carried out the literature review while all four authors contributed to the writing.The pre-publication history for this paper can be accessed here:"}
{"text": "This review article focuses on the various aspects of translational research, where research on human subjects can ultimately enhance the diagnosis and treatment of future patients. While we will use specific examples relating to the asbestos related cancer mesothelioma, it should be stressed that the general approach outlined throughout this review is readily applicable to other diseases with an underlying molecular basis. Through the integration of molecular-based technologies, systematic tissue procurement and medical informatics, we now have the ability to identify clinically applicable \"genotype\"-\"phenotype\" associations across cohorts of patients that can rapidly be translated into useful diagnostic and treatment strategies. This review will touch on the various steps in the translational pipeline, and highlight some of the most essential elements as well as possible roadblocks that can impact success of the program. Critical issues with regard to Institutional Review Board (IRB) and Health Insurance Portability and Accountability Act (HIPAA) compliance, data standardization, sample procurement, quality control (QC), quality assurance (QA), data analysis, preclinical models and clinical trials are addressed. The various facets of the translational pipeline have been incorporated into a fully integrated computational system, appropriately named Dx2Tx. This system readily allows for the identification of new diagnostic tests, the discovery of biomarkers and drugable targets, and prediction of optimal treatments based upon the underlying molecular basis of the disease. Our systematic approach to translational medicine has been designed to achieve a vision shared by numerous \"ambitious\" investigators who are focused on applying bench-side discoveries to the clinical setting Figure . We sharWhile a degree of project specificity must be incorporated into the design of any research effort, many of the components of translational research are shared across apparently disparate disease areas Figure . AlthougEffective translational research requires a multi-disciplinary and team approach. Our initial concept meetings include HIPAA/IRB advisors, research nurses, surgeons , pathologists and members of diagnostic service labs, information technologists  and statisticians in addition to the principal investigators. Each member of the translational research team is critical to the overall productivity and success of the pipeline. In acknowledgement of the effectiveness of this approach, we would advise other establishments to involve key personnel across the various disciplines early. We also believe that smaller dedicated teams can often be more efficient and less bureaucratic than oversized consortium.The development of research protocols on human subjects that involve specimen and/or data collection must be approved by the investigational review boards (IRB). The IRB governs patient safety and risk for the hospitals and/or universities/institutions. In accordance with federal regulations, one of the requirements states that each human subject must be thoroughly informed about the research to be undertaken on their sample and/or data during a consenting process. The specificity of the consent should be such that it outlines the research protocol, study procedures and risks and benefits and meets the federal, state and local requirements, so that the subject can make an informed decision regarding participation in the study. In retrospect, a well informed patient can help facilitate the procurement of clinical data and samples in an efficient and longitudinal manner..While the typical testing of a hypothesis requires the collection of only a subset of the available clinical data , the emerging field of medical informatics and electronic charts allows for the potential collection of vast quantities of standardized clinical data that potentially harbors invaluable information with regard to additional \"traits\" or \"phenotypes\". As such, we currently collect upward of 9000 potential data fields per patient within our specific IRB-approved protocols, all of which can be populated during the normal course of patient care and stored within either electronic or paper records for each subject. In addition, each patient receives a standardized self-reporting questionnaire addressing histories . Any protected fields are restricted through a security portal, which can be considered a suitable clinical gatekeeper  Figure . This seIn addition to IRB and HIPAA issues, patient recruitment can also be a major hurdle. The teamwork approach is critical here, together with patient/physician outreach and screening efforts as necessary. Our experience is the vast majority of patients are enthusiastic about inclusion in research studies so long as they are informed of the opportunity, particularly since we are careful to follow standard-of-care. For the most part, we are finding a willingness to participate for the hope of betterment for the whole, whether it is potentially helping their own families or others with their disease. At this level, the physician is the central figure and is uniquely positioned to introduce the protocol and support patient participation in the study. For studies where low participation is expected (predominantly due to low incidence), we typically include an IRB-approved public educational effort  that maximizes recruitment. Our clinical research nurses work closely with the physician(s) and their office scheduling staff for notification of potential candidates in advance wherever possible. This team approach with the physician advocating the effort allows the greatest accrual particularly when there are several geographic sites for meeting potential protocol volunteers. On site consenting of high risk or suspected individuals within the outpatient clinic and hospital settings where these patients are typically evaluated should to be considered to enhance accrual. For patients with known disease, the best environment for accrual occurs in a multidisciplinary setting in which the key physician works closely with the medical oncologist, radiation oncologist, nurses, physician assistants, residents and research staff. This is particularly important for longitudinal sampling of patients on treatment protocols to minimize the loss of follow-up data. The logistics of a coordinated approach may differ between a university medical school setting and a community based practice due to the competing obligations of a busy private practice. The multidisciplinary approach is optimal in a single setting in which patients can be seen by the various disciplines, thereby, reducing the extent of patient relocation between specialty offices and allowing for centralized specimen and data collection. Nonetheless, in community-based practice, we have introduced standardized mechanisms allowing us to consent patients and collect clinical samples and data from multiple sites.There are now abundant examples where clinical researchers are using the revolutionary \"omics\" technologies to demonstrate a clear association between the molecular make-up (\"genotype\") of clinical samples and well-defined clinical characteristics (\"phenotype\"). Near-complete genotypes can now be obtained through multiplex technologies such as sequencing, mutational screening (such as single nucleotide polymorphism (SNP) analysis) and gene/protein expression profiling. The absence of well annotated clinical information , however, is evident from most studies reported to date. Rather than taking the reductionist approach at the time of data collection, our group instead chooses to gather all information relating to an individual's medical history as well as follow-up data as it becomes available and as approved by the IRB. It is relatively trivial to reduce the clinical data pool retrospectively during analysis as deemed necessary. Our Dx2Tx system date/time stamps individual events for a given subject/sample, such that multiple events can be temporally associated. The first step is to gather the information in its rawest form from a standardized source. This could be as complicated as a centralized medical informatics database  housing rich longitudinal clinical data that can be expressed in Health Level 7 standards for data portability), or it could be as uncomplicated as a locally maintained excel spreadsheet or access database. Regardless of the source, we attempt to collect as much information regarding a subject's history, diagnosis, treatment, and response assessment as possible. As highlighted above, the critical elements are reliability of the source data and standardization. While we do perform statistical analysis on parsed text from open string comments, we attempt to force objective measurements  wherever feasible. In the absence of a centralized clinical database utilizing standardized clinical nomenclature and data, the responsibility falls on the clinical members of the team to interpret clinical data within isolated databases and/or paper charts. Clearly, the navigation from paper to electronic medical records, and the generation of middleware that can link disparate databases, will greatly alleviate this burden that rapidly becomes a major rate-limiting step in the translational pipeline. Coupled with voice recognition and electronic data recording with inbuilt QC check-points, standardized digital data entry should become the norm in the not so distant future.Clinical data permitted under protocol should be, where possible, prospectively accumulated. The accuracy of the data, particularly those parameters such as the pathologic characteristics, clinical staging, dates of intervention, dates of intermediate endpoints (such as disease progression or death), must be unquestionable in order to identify clinical and molecular correlations among diverse datasets. The accuracy of these data will depend to a large extent upon the frequency of follow-up for parameters such as disease progression, and the degree to which the patients' status is investigated longitudinally. Patients on clinical trials, where the procedures and follow-up are specified as part of the protocol, will have the most robust and standardized data since interval radiographic and physical examinations and/or other clinical procedures and methods of data collection must be adhered to in order to avoid protocol violation. Moreover, the approach of the physician(s) who follows the patient and the availability of an existing mechanism that readily allows the retrieval of prospective data (i.e. a database) will greatly influence the accuracy of the data. Within oncology, staging issues are some of the more difficult to resolve, especially if inadequate staging is performed in the operating room (OR) or if one must rely entirely on clinical or radiographic data. For the majority of organ systems, the oncological staging system is specified in the AJCC Staging Handbook, but it is the responsibility of the investigator to know whether the pathologic and intraoperative details necessary for accurate staging were adequately performed. These include but are not limited to accurate size measurement of the primary tumor, careful intraoperative description of abutment or invasion of nearby structures, verification of negative margins, and extent of lymph node involvement. The patients used in the examples below were all part of either Phase II or Phase III mesothelioma protocols, with computerized tomographic surveillance after surgery every 3\u20134 months until death. As such, the accuracy of the clinical data was optimized. One surgeon performed the operations, obtained aggressive intraoperative staging in all cases, and took the responsibility for collecting samples and data from all participants in the study. This approach led to the development of a consistent standard of care philosophy for the surgical management of mesothelioma.Our Dx2Tx system performs detailed statistical analysis on both clinical and molecular data, thus leaving little room for error when it comes to standardized data collection and entry. Physicians are uniquely positioned to organize the various aspects of data collection. This endeavor begins with the design of a clinical protocol for the procurement of specimens and the collection of data from a patient population. In addition to identifying the experimental group of patients (i.e. those with a condition or trait of interest), it is important to ensure the inclusion of the proper control populations wherever possible. With respect to our mesothelioma protocols, the correct controls for early diagnostic strategies include age-matched individuals exposed to similar doses of asbestos in order to compare with equivalent individuals diagnosed with the established disease. The recruitment of these control subjects ideally begins in parallel with the recruitment of the experimental group. In the absence of the correct control group, the investigator must identify cohorts of individuals within existing cooperative group mechanisms, SPORES, or the Early Detection Research Network (EDRN). In order to circumvent this problem, the Karmanos Cancer Institute has established a National Center for Vermiculite and Asbestos Related Cancers through a cooperative clinical trial with the Center for Environmental Medicine in Southeast Michigan. This center, under informed consent, evaluates individuals who have been exposed to asbestos in the workplace or at home, and depending on history and pulmonary function data, these individuals undergo computerized tomographic scanning to establish a baseline radiographic evaluation of asbestos exposure and risk. These individuals also give written permission for periodic sample collection including blood and urine for studies of marker assessment for asbestos related malignancies.A major focus of our research is to identify the molecular causes of differential therapeutic response across patient populations (pharmacogenetics). It is generally appreciated that patients and their disease show significant variations in response to a given treatment . It is tWe have introduced standard procurement procedures for various physiological samples including tissue, urine and blood, all of which are now routinely collected under our IRB-approved protocols. These have been optimized for both ease and reliability of clinical collection as well as maintaining the integrity of the sample for subsequent histopathological and molecular analysis. DNA from peripheral blood mononuclear lymphocytes (PBML) obtained from whole blood can be screened by SNP analysis, to identify possible genetic markers of a clinical event -4. Once The precise flow of the clinical sample from the patient to the researcher will depend largely on the disease in question and pre-existing departmental procedures. For example, in a study of pancreatic cancer, urine is provided by the patient prior to the procedure, since we have found that intra-procedural catheterization can result in blood contamination that effects subsequent proteomic analysis. Blood is drawn from an IV access for collection of plasma and PBML, while surgically resected tissue is snap frozen on site (see below). However, a multiple myeloma research protocol requires the collection of bone marrow aspirates from both inpatient and outpatient clinics, which are placed into tissue culture media and rapidly transported on ice to the Flow Cytometry Molecular Diagnostic Laboratory for immunophenotyping and cytometric sorting of plasma cells. The sorted fraction is then archived in freezing media for subsequent DNA, RNA and/or protein analysis. Irrespective of procedure, it is important to maintain a log book that tracks the flow of a sample from the subject to freeze. Procurement time is particularly important for RNA and some protein analysis, since biomolecular degradation can be a significant factor.Prior to collection, our procurement team (lab personnel and research nurses) pre-label collection tubes and containers with anonymous identifier tags that are freezer safe. Several kits that include equipment for blood draws, urine collection and tissue procurement are preassembled and made available to the research staff to ensure rapid response for obtaining specimens. We have an on-call list of several members for the research team who can reach the pick-up point within 30 minutes of receiving a collection call. Through a coordinated multidisciplinary approach, consenting and scheduling is typically obtained well in advance in either the outpatient or inpatient setting.At the Karmanos Institute, we have found that the easiest way to insure proper specimen harvest from patients with solid tumors is for the surgeon to divide the specimen directly in the OR and supervise its collection and distribution to the laboratory for archiving. However at the Van Andel Research Institute, we require oversight from the Hospital Department of Pathology to release surgically resected samples within the OR to the research team. The critical issue is to ensure suitable material is harvested in the correct fashion to allow accurate histopathological diagnosis. In no way should the research effort impede this quality-of-care. As a safety margin, we hold all frozen tissue for a period of time until an official diagnosis has been reported. In addition, wherever possible we embed samples in OCT freezing media, and generate hematoxylin/eosin (H/E)-stained histopathology slides for each research sample. This not only provides high quality histopathology slides for possible diagnostic back-up, but also allows us to correlate our molecular findings with the histology of the same working sample. In addition to entering pertinent data regarding the official diagnostic pathology report, we have also developed standardized report templates within Dx2Tx that accompany each research sample, in which the pathological image is associated with the corresponding data addressing critical variables such as relative amount of each cell type, stage, morphology etc. As with all data entered into Dx2Tx, these metadata are directly amenable to subsequent statistical analysis (see below).At the time of resection, solid tissue samples are immediately frozen in either liquid nitrogen or, for sites with no supply, a dry ice-chilled isopentane bath. Samples are transported in aluminum foil, and stored at -80\u00b0C until further processing. It should also be pointed out that many of our protocols involve the collection of tissue biopsies in addition to surgical resections. Since it is physically difficult to split a biopsy , we typically acquire additional samples beyond what are required for accurate pathological diagnosis. If these additional samples are required by the research team, it is important to disclose the supplementary procedures to the patient in the informed consent. While obviously smaller in size compared to surgical resections, we procure these specimens as fresh tissue as described above. It is important to note, some of our molecular technologies allow for the use of as few as 500 cells for complete multiplex analysis. Since biopsy material will doubtless be the predominant source of tissue for future molecular-based diagnostics, it is important to develop protocols to address smaller sample size and possible mis-sampling issues. In addition, as a result of not restricting samples to excess surgical specimens, biopsies can rapidly increase sample accrual from larger cohorts of patients.Urine and blood samples are transported on wet ice to the research labs, while frozen tissue is transferred on dry ice. Upon arrival in the laboratory, urine is typically divided into suitably sized aliquots and frozen at -80\u00b0C. Blood is fractionated into plasma or serum , while PBML are isolated by centrifugation and Ficoll/Hipaque density gradient centrifugation and cryogenically frozen. Fresh frozen tissue specimens are blocked in OCT if possible and stored at -80\u00b0C until further use. All specimens are associated with the donating subject within Dx2Tx, and archived in a simple grid system within dedicated and alarmed -80\u00b0C freezers. The location and use of each aliquot is tracked within Dx2Tx to readily allow for subsequent retrieval.). We enter these variables into Dx2Tx in association with the corresponding experimental procedure such that they can be analyzed together with the derived molecular and clinical data. In this fashion, important QC and QA parameters can be interrelated with molecular and clinical data. Experiments that do not meet certain QC/QA criteria can be excluded from the analysis if the data suggest that the variable(s) is a major confounder. In this fashion, Dx2Tx serves as an electronic notebook, the entries into which can be routinely recorded and statistically analyzed. This feature will be particularly important as potential applications advance towards clinical utility, for example through ensuring compliance with the FDA and accrediting agencies such as JACHO, CMS and CAP, and while maintaining the necessary state, federal, and insurance applications required to provide clinical diagnostic services.The tissue collection protocols outlined above should be evaluated for compatibility for the molecular analysis to be performed. We typically perform SNP analysis on DNA isolated from the PBML fraction of whole blood, gene expression (mRNA) analysis on tissue, and proteomic analysis of blood plasma/serum, urine and tissue. The detailed discussion of each of these molecular protocols is beyond the scope of this review  and detection (such as mass spectrometry) elements. Coupled with extensive clinical content, this collectively presents significant challenges for data storage and retrieval, as well as statistical analysis. The most frequent frustration of new users of the \"omics\" technologies remains \"What are the data telling me?\"Before proceeding with specific examples, it is important to grasp the concepts of normalization and data massaging or \"filtering\" . To compOne problem in dealing with vast amounts of clinical and/or multiplexed molecular data from a relatively small sample population is that many of the observed correlations could (not necessarily do) occur by random chance. One method investigators use to minimize the probability of this so called \"false discovery\" is to reduce the complexity of the data through successive rounds of filtering. Depending on the application, we do use some filtering under certain circumstances. However, as with normalization, this is done during data analysis and not prior to database entry. In this fashion, we can filter and analyze the data \"on the fly\", allowing the user to evaluate the effect of filtering the raw data. For example, if we were looking for a specific set of genes that are found highly expressed in mesothelioma relative to other tumor types, we may eliminate genes in mesothelioma samples below a certain expression (intensity) threshold, and those above a certain level in other tumor types. This would maximize the likelihood of identifying sensitive and specific mesothelioma genes, and minimize the gene pool and hence probability of false discovery. We also use fold-change filters depending on the application. For example, we may only be interested in diagnostic biomarkers that display at least a 4-fold increase in mesothelioma tumor tissue relative to other tumor types and normal mesothelium. In addition, genes with certain characteristics  to identify relationships between variables  within large datasets ,14. Thes), we also map results to molecular pathways using detailed pathway mapping software now available. Taking this approach, the coordinated expression of genes/proteins can be seen to map to specific molecular networks, therefore providing important information as to which pathways maybe activated or in-activated in association with a clinical event. For example, when all the genes differentially expressed in recurrent mesotheliomas relative to non-recurring tumors at a defined statistical significance (p < 0.001) are mapped using the MetaCore\u2122 software (MetaCore\u2122 ), a clear signaling pathway associated with cell proliferation is identified that appears to be hyper-activated in aggressive mesothelioma tumors  within the complex clinical and molecular datasets that could be translated into clinical diagnostic applications, we typically begin with unsupervised clustering techniques such as hierarchical clustering as shown above in Figures Once a hypothesis has been generated, Dx2Tx identifies samples against which the hypothesis can be tested. Certain inclusion and exclusion eligibility criteria can be considered and used to filter the content of the database to identify subjects/samples/experiments with certain characteristics. Dx2Tx also allows samples to be selected based upon the extent of any attribute(s) Figure . For exaOnce the sample population is selected, we test the hypothesis across the series of selected samples in a 2-step process. A subset of the samples  are selected  from each subgroup (for example disease versus control) to develop a discrimination algorithm that identifies statistical correlates of the feature in question. It is worthwhile to note that Dx2Tx identifies clinical, experimental and molecular correlates of the selected feature(s), thereby integrating both clinical and molecular data into the potential diagnostic algorithm. The user can exclude any attribute from the input to the training algorithm. In a second cross-validation test, the trained algorithm is applied to the remainder of the samples , to determine if the test could have accurately predicted the nature of the remaining samples. The outcome of the test is plotted using a receiver operator characteristic (ROC) curve to determine the accuracy of the test. The ROC curve is a way to visualize and quantify the effectiveness of a procedure by graphing the true positive rate (Y axis) against the false positive rate (X-axis). The area under the curve (AUC) provides an approximation of the accuracy of the test. A procedure with no effectiveness (AUC = 50%) would show a random 1:1 line, indicating that for every true positive, the procedure also generated a false positive. Generally, an AUC of 90\u2013100% is considered excellent, while an AUC of 80\u201390% is good. The ideal diagnostic test would of course identify all true positives before encountering a false positive (AUC = 100%).In this working example, the hypothesis generated from analysis of unsupervised clustering of gene expression data from mesothelioma tumors is that survival time of patients can be predicted based upon the underlying genomic signatures of the tumor. Thus, patients with the shortest and longest survival time following surgery were placed into two groups. Each group was then randomly divided into 2 additional groups, the training set and the test set. The discriminating clinical and molecular features are first identified using a standard t-statistic for numerical data and chi squared for binary (including text) data. This test statistic is then used in a weighted voting metric . Data ar). These so called \"companion diagnostics\", which could accompany therapeutic agents and assist in treatment decisions, are also being developed for specific agents that display varying degrees of efficacy and toxicity across sample populations. With the accurate capture of longitudinal clinical data including toxicity and response assessment, associations between clinical response and molecular features of either the patient and/or the disease tissue should be readily identifiable within complex retrospective datasets. For example, we have identified a genomic signature within plasma cells isolated from multiple myeloma patients that correlates with tumor response to the drug melphalan. This genomic signature is currently being applied to additional patient samples using cross-validation statistics as outlined above, to determine the accuracy of this possible companion diagnostic application. As with most single agent treatment regimens, drug resistance in the area of oncology represents a significant problem in the treatment of the disease. Therefore, pre-treatment tests could conceivably identify the patients who would benefit the most and least from treatment.In addition to the identification of potential diagnostic applications, we have a major focus on identifying new treatment targets, and/or improving therapeutic strategies involving existing treatments. Patient variation, with respect to treatment response (efficacy and toxicity), is a well documented phenomenon . ThroughOur research also includes the discovery of possible early surrogate markers of therapeutic index. This ideally requires the collection of clinical specimens and data both pre and post treatment. In conjunction with the treatment of cell lines in culture and molecular analysis of livers and kidneys from treated mice, early biomarkers of efficacy and toxicity have been identified in association with several treatment regimens. If these biomarkers of response can be validated in retrospective patients, they could be written into future clinical studies to provide an early indication of therapeutic effect. These biomarkers may ultimately be used as surrogate markers to determine discontinuation or modification of protocols to maximize therapeutic index in prospective trials.There are currently a number of drugs in development, in clinical trials or that have recently received FDA approval that target specific molecular aberrations -23. UnliThe FDA approval process of the EGFR inhibitor Iressa has received a great deal of attention . RecentlIn addition to pursuing existing drug targets, we are also attempting to identify novel targets that may warrant future drug discovery efforts. We typically attempt to validate only candidate genes/proteins that have or are predicted to have \"drugable\" characteristics. To determine whether a potential target is drugable, we are currently using some relatively simple criteria based upon the classes of drug targets that have been actively pursued by pharmaceutical/biotech companies to date. For example, we have annotated the publicly available drug targets described above using gene ontology and literature mining tools within Dx2Tx , and ideThe majority of the preceding discussion has focused on the identification of molecular correlates of disease, and identifying those that may represent diagnostic biomarkers and/or treatment targets for intervention. A large proportion of our translational research effort is dedicated to functional validation, where through various means, the expression and/or activity of the target are modified and the functional consequences addressed. While determining the function of a diagnostic biomarker is not necessary, the functional consequence of target gene/protein disruption is essential when establishing the true therapeutic value of a potential target. An ideal therapeutic target would be one that is causative of the disease, and inhibitors against which thus cause disease regression. The following discussion will focus on a high-throughput means by which we assess the functional significance of target gene/protein disruption in murine models of various human malignancies.There are a variety of approaches one can take to interfere with gene/protein expression and/or function with the purpose of demonstrating a definitive role in a biological process . These iWe have developed an avian retroviral vector that can deliver siRNA to cells expressing the viral receptor (TVA) [35]. TVA expression can be directed to specific cells in vitro through exogenous transfection/infection, or in vivo through transgenic technology . This syin vivo significance of experimental findings in a relevant preclinical setting. We particularly focus on the development of orthotopic xenograft models, in which human tumor cells are implanted into their corresponding site of origin within an immune compromised mouse. In this fashion, human tumors form in the tissue site of origin that more closely resemble the human counterpart with respect to biological behavior. These orthotopic models better recapitulate the various stages of tumor progression and more accurately reflect responsiveness to various therapeutic intervention strategies [37]. Coupled with in vitro and in vivo delivery of siRNA against multiple target genes, these preclinical models readily allow us to evaluate the requirement of proposed target genes in tumor progression. Through these studies, we are beginning to identify the optimal combination targeting strategies that may lead to the eventual treatment of aggressive cancers.Improved murine models that depict specific features of the human disease in question are essential to validate the In the vast majority of cases in which molecular data is being correlated with clinical events, a hypothesis-driven inquiry is tested against archived clinically documented specimens. The majority of these trials are asking either a classification question (i.e. what profile sets this tumor apart from other tumors), a prognostication pattern (what group of genomic/proteomic patterns will predict time to progression or time to death), early detection , or response to therapy (is there a de novo set of genomic/proteomic parameters which predict either response or resistance to a given therapy). For classification phenomena, the investigator must currently rely on pathologic differences to stratify tumors into clusters which, upon genomic/proteomic analysis, have consistent and congruent distinguishing features. This is probably the easiest of analyses and relies mainly on established architectural and morphologic differences between tumors instead of clinical behavior and endpoints. Nevertheless, as with all discovery test-sets, validation prospectively must be performed in order to test the accuracy of the classification algorithms. This requires prospective application of the algorithm to blinded samples, and comparing the predicted outcome with the actual observed pathology.For the early detection, prognostication, and prediction of therapeutic response, one must link potential diagnostic tests to newly developing trials to allow validation of the established hypothesis. Before undertaking such an effort, however, the investigator must realize that the data were typically derived from a set of patients within a particular treatment regimen. For example, the patients presented in this article were characterized as having specimen procurement prior to definitive cytoreductive surgery followed by adjuvant therapy, and therefore a prospective trial which conforms to this treatment regimen should ideally be designed to avoid confounding variables. For the validation of diagnostics that predict time to recurrence or survival following treatment, a phase II trial of surgery and/or postoperative adjuvant therapy could be designed in which samples are harvested at the time of surgery. The diagnostic test would then be performed on the clinical specimen to obtain a prediction of patient outcome, and the patients' clinical course followed to see if there is prospective validation of the test. These analyses, however, must be performed in patient groups not weighted towards either high or low risk patients, and indeed, some stratification of clinical parameters should be specified at the outset in order to make reasonable comparisons. This is especially true if the molecular data is to be validated as part of a Phase III randomized trial comparing two treatment regimens after surgery. As the content of Dx2Tx expands to include clinical trial data, analysis can be performed on only those patients that conform to specified clinical parameters. Therefore, with the complete and standardized collection of clinical data from a large population of patients receiving various treatment regimens both on and off of protocol, established hypotheses can be further tested on additional retrospective subjects; in a sense a virtual trial that begins to more closely resemble the carefully controlled prospective clinical trial.in vitro discovery of genomic/proteomic patterns defined in cell lines treated with the corresponding agent(s).The ideal clinical trials addressing the validity of molecular data to predict a clinical parameter are those involving patients with no prior diagnosis or treatments, who subsequently receive a single therapeutic regimen. Preferably, both pre- and post-treatment specimens are obtained from these patients. Such a pure trial could, for example, test whether a predefined genomic/proteomic pattern could predict a poor outcome despite favorable clinical parameters. Trials of patients receiving initial chemotherapy could also help to define the fidelity of the omics technologies for the prediction of chemosensitivity. These hypotheses may have been derived from a retrospective set of patients receiving the same chemotherapy or targeted therapy for which outcomes were known, or from the Early detection clinical trials using genomic and/or proteomic technologies will typically take the longest to validate. After the discovery of proteins as candidate markers from analyses of serum, urine, or other fluids in patients with early stage malignancies compared to the appropriate high risk group, cohorts of high risk individuals (e.g. asbestos exposed or tobacco smokers) must be identified who are willing to have collections of the appropriate specimens longitudinally at given intervals. Moreover, in initial trials of these markers, the investigator must define at what time to disclose the value of the measured biomarker. One possibility would be to allow the prospective clinical trial to reach a certain endpoint  and then reveal the results of the marker to see whether there is predictive value. Another way would be to define the value of the marker at follow-up intervals during the course of the trial and, in the face of radiographic or physical findings, initiate an invasive workup to \"find\" the predicted cancer. It is generally agreed that, although a two stage validation effort takes longer , such a model is currently preferred.With respect to novel treatment strategies predicted from retrospective analysis and/or through the preclinical studies defined above, the next logical step is to attempt to validate the retrospective data which initially pointed the investigators to these potential treatment options. If the new therapy has never been used in humans before, it is important to define the maximum tolerated dose of the treatment. This is defined as the dose at which, in a Phase I clinical trial, a defined fraction  of the patient cohort develop dose limiting toxicity. Once the dose or treatment strategy is found to be acceptable, a Phase II trial is designed to provide a measure of the activity of the agent(s) and to begin to define whether there is any benefit of the regimen in certain patient cohorts. The use of tools such as Dx2Tx could be invaluable in the future tracking and analysis of such trials, especially if samples are prospectively harvested at various times pre and post treatment. For example, in the Phase I/II trial, genomic/proteomic correlates of clinical toxicity could be readily identified by melding the clinical data with \"omic\" data from the patients who have undue toxicity. Molecular pathways that intuitively result in toxicity could be identified which could possibly be abrogated with another agent. With respect to determination of therapeutic efficacy, our present means of defining \"clinical correlates of response\" is essentially a \"best guess\" or subjective prediction of what clinical markers may indicate that the new agent is yielding a therapeutic effect. A more objective measure of downstream events resulting from an efficacious agent would result from analysis of the molecular data in tandem with clinical information for the responders compared to the non-responders. Dx2Tx would be able to then define the most important markers of response, both clinical and molecular, which could then be validated in a Phase III trial assessing agent efficacy.It is unknown when an integrated clinical/molecular evaluation of the suspected or afflicted cancer patient will be of use to the end user, the practicing physician. Certainly, many of the same arguments that are used for and against \"genetic testing\" in other diseases may be used for such a global approach to oncology. There is no doubt however, the ability to define clinical behavior in a more efficacious and predictive manner, other than the archaic prognostic indicators which we use today, will help clinicians initiate and/or alter treatment course earlier and guide clinicians toward informed discussions with their patients in order to make treatment and/or surveillance decisions. If indeed the fidelity of combinatorial molecular and clinical medicine proves to be satisfactory, we may then be able to spare patients unnecessary treatment interventions which are currently doomed to failure. Moreover, the medical oncologist will be able to choose the correct cytotoxic and/or targeted therapy based on a global clinical-molecular snap-shot, which should translate into more favorable health economic policies and patient outcomes.Throughout this review, we have highlighted the importance of designing research protocols involving human subjects that permit the collection of not only clinical specimens, but also extensive standardized clinical data in a longitudinal fashion. Through the merging of clinical and molecular data, non-biased patterns can be discovered that could translate into novel diagnostic and/or treatment opportunities. We have introduced a methodical approach for archiving and mining these seemingly disparate data sources that we believe can accelerate the translational research discovery pipeline. While there are clearly improvements to be made in the systematic collection of accurate and nationally standardized clinical data, we believe the integration of medical informatics and the molecular technologies can convert the once visionary concept of molecular-based medicine into a present reality.CW \u2013 A provisional patent has been filed on the Dx2Tx system described in this article.HP \u2013 This author declares that he has no competing interests."}
{"text": "A mixed-effects model repeated measures approach (MMRM) was specified as the primary analysis in the Phase III clinical trials of duloxetine for the treatment of major depressive disorder (MDD). Analysis of covariance using the last observation carried forward approach to impute missing values (LOCF_ANCOVA) was specified as a secondary analysis. Previous research has shown that MMRM and LOCF_ANCOVA yield identical endpoint results when no data are missing, while MMRM is more robust to biases from missing data and thereby provides superior control of Type I and Type II error compared with LOCF_ANCOVA. We compared results from MMRM and LOCF_ANCOVA analyses across eight clinical trials of duloxetine in order to investigate how the choice of primary analysis may influence interpretations of efficacy.a priori in the various protocols were included in the comparisons.Results were obtained from the eight acute-phase clinical trials that formed the basis of duloxetine's New Drug Application for the treatment of MDD. All 202 mean change analyses from the 20 rating scale total scores and subscales specified rd decimal place . For the HAMD17 total score, the primary outcome in all studies, MMRM yielded 9/12 (75%) significant contrasts, compared with 6/12 (50%) for LOCF_ANCOVA. The expected success rate was 80%.In 166/202 comparisons (82.2%), MMRM and LOCF_ANCOVA agreed with regard to the statistical significance of the differences between duloxetine and placebo. In 25/202 cases (12.4%), MMRM yielded a significant difference when LOCF_ANCOVA did not, while in 11/202 cases (5.4%), LOCF_ANCOVA produced a significant difference when MMRM did not. In 110/202 comparisons (54.4%) the p-value from MMRM was lower than that from LOCF_ANCOVA, while in 69/202 comparisons (34.2%), the p-value from LOCF_ANCOVA was lower than that from MMRM. In the remaining 23 comparisons (11.4%), the p-values from LOCF_ANCOVA and MMRM were equal when rounded to the 3Important differences exist between MMRM and LOCF_ANCOVA. Empirical research has clearly demonstrated the theoretical advantages of MMRM over LOCF_ANCOVA. However, interpretations regarding the efficacy of duloxetine in MDD were unaffected by the choice of analytical technique. Treatment effects are often evaluated by comparing change over time in outcome measures. However, valid analyses of longitudinal data can be problematic, particularly if some data are missing for reasons related to the outcome measure ,2. SinceA common method of analyzing clinical trial data is to use analysis of variance or analysis of covariance (ANOVA or ANCOVA) with missing data imputed by the last observation carried forward approach (LOCF_ANCOVA). The popularity of LOCF_ANCOVA may be due to its simplicity, and also the belief that violations of the restrictive assumptions inherent to LOCF_ANCOVA lead to a conservative analysis . ConsideOne such method, termed MMRM (Mixed Model Repeated Measures ), has beThe MMRM approach was specified as the primary analysis in the Phase III clinical trials of duloxetine for the treatment of major depressive disorder (MDD), while LOCF_ANCOVA was specified as a secondary analysis. In the present investigation, we provide a comprehensive summary of results from MMRM and LOCF_ANCOVA in the eight acute-phase clinical trials that formed the basis for duloxetine's New Drug Application (NDA) for MDD. The primary objective of this investigation was to determine whether differences in results between MMRM and LOCF_ANCOVA influenced conclusions regarding the efficacy of duloxetine.The data source for this investigation was the eight acute-phase clinical trials in which duloxetine was compared with placebo in the treatment of MDD. Relevant details of these studies are highlighted in Table a priori in the various protocols to be analyzed for mean change from baseline to endpoint, and were collected at more than one postbaseline time point  With regard to statistical significance of the difference between duloxetine and placebo, the proportion of outcomes showing agreement between MMRM and LOCF_ANCOVA was compared with the proportion of outcomes for which MMRM and LOCF_ANCOVA yielded disparate results; 2) The proportion of outcomes for which MMRM yielded the lowest p-value was compared with the corresponding proportion for LOCF_ANCOVA; 3) The number of outcomes for which \"substantial evidence of efficacy\" was demonstrated. In regulatory settings, the criterion for substantial evidence of efficacy is frequently the demonstration of a statistically significant advantage over placebo in two or more studies. This criterion was utilized here to define substantial evidence of efficacy for a particular outcome.The frequency of lower p-values provides a \"fine-tuned\" measure of sensitivity of the two analytic methods. However, in certain cases such an assessment may actually be misleading. For example, to distinguish between p= .800 and p = .810, or between p =. 002 and p =. 003, implies that the methods yielded different results when in fact the similarities far outweigh the differences. Hence, it is equally appropriate to simply categorize based upon the presence or absence of a significant difference. Furthermore, given the large number of outcomes assessed across the eight studies, it would not be surprising to see the two methods disagree with regard to statistical significance on at least a small number of outcomes. Therefore, perhaps the most clinically meaningful summary measure is the number of outcomes for which substantial evidence of efficacy was demonstrated.17) total score, the HAMD17 Maier subscale, and the Visual Analog Scale (VAS) for overall pain severity. The HAMD17 total score was an obvious choice as it was the primary outcome in all studies. The other outcomes were selected since they are frequently focal points in manuscripts and presentations regarding duloxetine's efficacy. Finally, we provide case studies to help explain how and why results from MMRM and LOCF_ANCOVA may differ.Three outcomes were selected for more detailed presentation of results: the 17-item Hamilton Rating Scale for Depression , MMRM and LOCF_ANCOVA agreed with regard to the statistical significance of the difference between duloxetine and placebo. In 25 cases (12.4%) MMRM yielded a significant difference whereas LOCF_ANCOVA did not, while in 11 cases (5.4%) LOCF_ANCOVA yielded a significant difference when MMRM did not.17 total scores, leading to a three-fold greater standard error.Both methods tended to yield significance more frequently in depression rating scales and subscales than in outcomes related to somatic and painful physical symptoms. The studies were generally underpowered for these secondary somatic and pain outcomes owing to the greater variance in changes score for these outcomes. For example, the variance in VAS overall pain severity was approximately nine-fold greater than the variance in HAMDrd decimal place .In 110 of the 202 outcomes (54.4%) the p-value from MMRM was lower than that from LOCF_ANCOVA, while in 69 cases (34.2%) the p-value from LOCF_ANCOVA was lower than that from MMRM. In the remaining 23 cases (11.4%) the p-values from LOCF_ANCOVA and MMRM were equal when rounded to the 317 total score, HAMD17 Maier subscale, and VAS overall pain) are presented in Table 17 total score, the advantage of duloxetine over placebo in mean change from baseline to endpoint from MMRM analyses was greater than the corresponding advantage from LOCF_ANCOVA in 9/12 comparisons  are used to further illustrate MMRM and LOCF_ANCOVA  results. Results from these studies were originally reported by Detke et al [17 total score tended to increase over time whereas duloxetine's advantage in VAS overall pain was greatest at intermediate visits  from MMRM in Studies 1 and 2 were 4.86 (p < .001) and 2.17 (p = .024), respectively. The corresponding advantages from LOCF_ANCOVA were 3.80 (p < .001) and 1.73 (p = .048). Although the differences were significant for both methods in both studies, MMRM yielded treatment contrasts that were approximately 25% greater than LOCF_ANCOVA.In the case of the HAMDFor VAS overall pain, the advantage of duloxetine over placebo at endpoint from MMRM in Studies 1 and 2 were 5.88 (p = .055) and 4.40 (p = .135), respectively. The corresponding advantages from LOCF_ANCOVA were 6.91 (p = .019) and 5.17 (p = .037). In both studies, the endpoint differences were significant from LOCF_ANCOVA, but not from MMRM. The LOCF_ANCOVA treatment contrasts were approximately 15% greater than those from MMRM.17 total score and VAS overall pain.Standard errors from LOCF_ANCOVA were approximately 5% smaller than the Week 9 standard errors from MMRM for both the HAMDIn many areas of clinical research, the impact of missing data can be profound ,12-14. TConsiderable advances in statistical methodology, and in our ability to implement these methods, have been made in recent years. Methods such as MMRM, which require less restrictive assumptions regarding missing data, may now be easily implemented with standard software ,5,18,19.No universally superior approach to analysis of longitudinal data exists. However, a series of studies -9 demonsetc. to blind analysts to the treatment names, Molenberghs et al [Similar results regarding control of Type I and Type II error for LOCF_ANCOVA and mixed-effects model analyses have been obtained independently ,20-22. Fhs et al  concludeThe theoretical differences between MMRM and LOCF_ANCOVA have been summarized ,18, estaThe VAS pain results highlight a limitation of endpoint analyses of any type, namely that they provide only a snapshot view of the response profile. From LOCF_ANCOVA analysis, one can only conclude that drug was superior to placebo at endpoint. However, MMRM analysis reveals that drug had a significant effect early in the trials, but that advantage was somewhat transitory as the placebo group tended to \"catch up\" over time. In order to understand the response profile of a drug, the entire longitudinal profile should be considered . From MMIn the duloxetine database, results from MMRM and LOCF_ANCOVA were in general agreement regarding substantial evidence of efficacy and frequency of significant differences. However, MMRM tended to be more sensitive to drug-placebo differences for outcomes related to overall depressive symptoms and core emotional symptoms of depression, with mean advantages over placebo that were 10% to 20% greater than LOCF_ANCOVA. However, MMRM did not universally increase duloxetine's advantage over placebo in comparison to results from LOCF_ANCOVA. For example, in somatic and painful physical symptom outcomes, results from LOCF_ANCOVA showed mean advantages over placebo that were approximately 40% greater than that from MMRM.Therefore, while the overall conclusions regarding the efficacy of duloxetine were unaffected by the choice of analytic method, this should not mask the important differences between MMRM and LOCF_ANCOVA. The advantages of MMRM and similar methods over LOCF_ANCOVA have been conclusively demonstrated in many studies and are evident in the duloxetine data.17 total score), while LOCF_ANCOVA produced a 50% success rate, in comparison to the expected rate of 80%. While many factors may reduce the success rate in Phase III clinical trials, the use of a statistical method with known inflation of Type II error  is an obvious suspect.Khan et al  compiled17 total score) when LOCF did not was in the Phase II study (Study 3).An unduly high rate of false negative results could be especially problematic in early phases of drug development where only one or two chances exist to make the correct decision regarding the efficacy of a drug. It is noteworthy that one of the instances when MMMRM yielded a significant difference on the primary outcome  is an obvious suspect. Thus, the unexpectedly low success rate in Phase III is consistent with the conclusion that LOCF_ANCOVA inflates Type I error .Hence, results from the duloxetine NDA are consistent with research suggesting a move away from LOCF_ANCOVA and other simple analytic techniques to methods such as MMRM that are more robust to the biases from missing data.Important differences exist between MMRM and LOCF_ANCOVA. Research has clearly demonstrated the advantages of MMRM over LOCF_ANCOVA. However, interpretations regarding the efficacy of duloxetine in MDD were unaffected by the choice of analytical technique.Drs. Mallinckrodt, Raskin, Wohlreich, Watkin, and Detke are employees of Eli Lilly and Company.CHM designed the statistical analyses, and participated in interpretation of data and drafting of the manuscript. JR, MMW, JGW, and MJD participated in interpretation of data and drafting of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
{"text": "Traditional two dimensional journal publishing may no longer be enough, and may be hindering, the interpretation of the complex datasets and analyses generated by microarray experiments in medicine Statistical Applications in Genetics and Molecular Biology (3: article 37), discuss a paradigm for the presentation of complex data\u2014in this case, from microarray analyses. The title of the article, \u201cA Compendium to Ensure Reproducibility in High-Dimensional Classification Tasks,\u201d may not lend itself easily to a clinical audience, but the underlying message to clinicians could not be more important: that, currently, studies involving large datasets, especially ones that have a clinical outcome, are so poorly reported (or possibly so poorly done) that many are not reproducible. This problem was also the topic of a recent meeting in Heidelberg, \u201cBest Practice in Microarray Studies\u201d (http://www.biometrie.uni-heidelberg.de/workshops/bestpractice/index.htm).\u201cPublishing results in traditional paper based way in a journal hides too much information.\u201d This is the verdict of Markus Ruschhaupt and colleagues who, in a paper in As microarrays have become mainstream research tools in biology and medicine, the large datasets and complex analyses from these studies have presented challenges: for authors in analyzing the data, for reviewers and editors in deciding on the suitability of papers for publication, for journals in determining how much data needs to be presented within the paper itself, for other researchers in reproducing the data, and, finally, for readers in deciding how to assess the data presented. The results from several high-profile papers have already proved difficult to reproduce, even by those with sufficient time and computing expertise.Where do such analyses leave the new science of molecular pathology? Ruschhaupt and colleagues comment that \u201cthe literature on the induction of prognostic profiles from microarray studies is a methodological wasteland.\u201d Much the same could be said of other applications of molecular biology to clinical samples. A systematic review of molecular and biological tumor markers in neuroblastoma (Clin Cancer Res 10: 4\u201312) found that its conclusions were limited by \u201csmall sample sizes, poor statistical reporting, large heterogeneity across studies\u2026and publication bias.\u201d John Ioannidis and colleagues (Lancet 362: 1439\u20131444) did a similar analysis of 30 microarray studies with major clinical outcomes in cancer. They showed that the studies were small\u2014median sample size was 25 patients, and validation was incomplete in most studies. They recommended that molecular prognostic studies be classified as phase 1 (early exploratory probing associations), phase 2 , or phase 3 (large confirmatory studies with pre-stated hypotheses and precise quantification of the magnitude of the effect), and that only studies that had undergone phase 3 testing should be considered robust enough for use in clinical practice. Most current studies should be considered as phase 1 or, at best, phase 2.So, despite considerable hype, the published studies are far from the level of evidence that would be accepted for virtually any other medical test. In a review in 2003 (Hematology [Am Soc Hematol Educ Program] 2003: 279\u2013293), Rita Braziel and colleagues concluded, \u201crapid identification and neutralization of spurious results is essential to prevent them from becoming accepted facts.\u201dBut these problems are not new in medical research. In 1994 (BMJ 308: 283\u2013284), Doug Altman, who was instrumental in developing the CONSORT guidelines for reporting of clinical trials, said that \u201chuge sums of money are spent annually on research that is seriously flawed through the use of inappropriate designs, unrepresentative samples, small samples, incorrect methods of analysis, and faulty interpretation,\u201d and \u201cthat quality control needs to be built in from the start rather than the failures being discarded.\u201dPLoS Medicine is keen to work with authors towards making such reporting possible. But although the time might have gone when the two-dimensional journal article could suffice for complex papers, clinicians should nonetheless apply the same critical assessment that they would for any other clinical tool. If a result is too good to be true, it probably is.So how can we ensure that the wealth of data pouring out of microarray and other molecular diagnostic studies is turned into meaningful knowledge? The Microarray Gene Expression Data Society has proposed a set of guidelines (MIAME) for the reporting of microarray data, and that all such data should be deposited in public databases. But as Ruschhaupt and others have shown, disclosure of results and data is not enough, since there is little consensus on the appropriate statistical analyses and many are developed on a case by case basis, which may not be reproducible, even by the authors. Some researchers advocate the use of standard statistical packages, which allows the reader to repeat an entire analysis quickly and, hence, assess the robustness of the results. Some authors have produced a transcript of their statistical analyses as a supplement to their articles . At the very least authors should have a protocol with a prespecified plan for patient selection and statistical analysis\u2014accepted practice for clinical trials, but not yet for other medical research. An ultimate aim for reporting would be the type of compendium discussed by Ruschhaupt and colleagues\u2014\u201can interactive document that bundles primary data, statistical processing methods, figures, and derived data together with the textual documentation and conclusions.\u201d One such compendium is illustrated in a paper by Robert Gentleman (Stat Appl Genet Mol Biol 4: article 2)."}
{"text": "We describe a system of web applications designed to streamline the interdisciplinary collaboration in outcomes research.The outcomes research process can be described as a set of three interrelated phases: design and selection of data sources, analysis, and output. Each of these phases has inherent challenges that can be addressed by a group of five web applications developed by our group. QuestForm allows for the formulation of relevant and well-structured outcomes research questions; Research Manager facilitates the project management and electronic file exchange among researchers; Analysis Charts facilitate the communication of complex statistical techniques to clinicians with varying previous levels of statistical knowledge; Literature Matrices improve the efficiency of literature reviews. An outcomes research question is used to illustrate the use of the system.The system presents an alternative to streamline the interdisciplinary collaboration of clinicians, statisticians, programmers, and graduate students. In the last decade, the number of relevant data sources available for outcomes research has grown exponentially. In contrast, the number of individual researchers with clinical and statistical expertise required to explore these data sets increase at a much slower pace. As a result, an immense quantity of valuable clinical data are left untouched, never becoming clinical publications that could potentially improve health care.The disproportion between data volume and number of qualified researchers can be explained by the growing complexity involved in outcomes research projects using secondary data analyses. Researchers have to formulate of a clinically relevant and methodologically sound research question, find appropriate data sources, perform statistical analyses, and generate a final manuscript that will be submitted for peer-review. Frequently, individual researchers have the training and time to perform a few of these steps, but the integration of all tasks calls for an interdisciplinary systems approach ,2. This This article describes a suite of web applications developed to facilitate the process of converting outcome databases into clinical manuscripts, to streamline the interdisciplinary collaboration of researchers, and to connect all different steps of the outcomes research process. To illustrate its use, we will describe how a research project has been conducted using this system from its early phase of research question formulation to the completion of the final manuscript.. The following sections will describe each of the Web applications and their application in the answer of a real outcomes research question.The system of Web applications is composed by five different tools: QuestForm, Research Manager, Analysis Charts, and Literature Matrices. These tools were designed to assist researchers in each of the phases encountered in an outcomes research project involving secondary data analysis Figure . All too for an updated list). All databases have been de-identified and do not contain protected health information as specified by the Health Insurance Portability and Accountability Act . The application The application is built using Extensible HyperText Markup Language 1.0 (XHTML) [QuestForm, an acronym for \"Question Formulation\", is an application designed to assist researchers in the location of clinical databases and formulation of outcome research questions Figure . Clinica (XHTML) .QuestForm starts by presenting researchers with three main strategies to find research databases: use of pre-determined key words that describe the database as a unit Figure , user-deDr. Guller initiated the project searching for an existing database that would allow him to compare surgical outcomes between laparoscopic and open appendectomy procedures in the treatment of acute appendicitis. The outcomes were pre-specified as mortality and infection, although other existing outcomes would also be of interest. Although there are multiple single-institution studies attempting to answer this question ,7, few sAs a first step, Dr. Guller searched across previously formulated Question Diagrams to evaluate whether other studies could have used a similar research design. Since none was found in QuestForm, Dr. Guller searched across more than forty different databases for an existing database that would have the variables to answer his research question. After navigating through multiple data dictionaries, Dr. Guller found that the Nationwide Inpatient Sample (NIS) Release 6, 1997  presenteOnce the database was located, Dr. Guller selected the outcomes of interest , main predictors (laparoscopic versus open procedures), and confounders , inserting each of them into the research question fields in QuestForm. Using built-in search engines for ICD9 codes, Dr. Guller created the definition for each of the above-mentioned variables and defined the inclusion and exclusion criteria. The final research question was then saved as a Question Diagram and immediately submitted to Dr. Pietrobon for feasibility evaluation. Dr. Pietrobon judged that the project was feasible and could be completed using the database indicated by Dr. Guller. At this point, the project was initiated and a detailed project management plan was established using Research Manager.Research Manager is a Web application developed by our group designed to facilitate the project management of clinical research projects. Similar to QuestForm, Research Manager is licensed under the GNU Public License , which aResearch Manager provides multiple features to facilitate project management of clinical research projects. All projects are displayed by category  with a brief description. The internal content of all projects is password protected. All internal tasks within a project are assigned to individual researchers. Project administrators initially assign deadlines that can be modified by task leaders within three days. All participating members of the project receive weekly reports containing details about the activity and the latest electronic file within each task Figure . These fResearch Manager helps identifying such problems and enables their early elimination, thus avoiding delays in the project completion. Finally, since weekly reports are generated to all participating members, Research Manager also provides peer-incentive for project members to complete their tasks in a timely manner.Once the Question Diagram was evaluated by the clinical epidemiologist, this project was transferred to Research Manager. Contact information for each of the researchers involved and deadlines for completion of the main phases of the research process were set, including data extraction and cleaning, data analysis, literature review, and manuscript writing. Weekly reports were generated to update investigators on all tasks of the project, including different versions of the statistical analysis, modifications in the research question, and manuscript sections.With an established project plan, the statistician in charge selected the best methods for analysis. Since the database is a random sample of the United States and requires special survey analysis methods, it was necessary that all involved researchers understood the statistical approach by using Analysis Charts.Analysis Chart is a tool designed to enhance the understanding of statistical methods to a format that is understandable by clinical researchers with different previous levels of statistical knowledge. As such, it is important in the design as well as the analysis phases of a project Figure . The applayers of information. Layer 1 summarizes the general goal of the method. Layer 2 presents previous clinical applications so that the researcher can visualize situations in which the method may be realistically applied. Layer 3 describes the data requirements for the application of the statistical technique. Layer 4 describes the basic statistical underpinnings of the method, initially breaking down equations and then reassembling them. Finally, layer 5 presents a list of available software packages for the implementation of the technique as well as cases studies where all previous layers are applied to real data sets. Each layer ends with a section containing selected references that explain the topic in more detail.Analysis charts are composed by cascading links that display information about quantitative methods in progressive levels of complexity called \"layers of information\". Each layer explains the statistical method with an increasing level of complexity. In this manner, clinicians interested in simply understanding the method to evaluate whether it can be applied to a research project can simply read the first three layers. In contrast, researchers interested in a direct application of the method to available research data can follow all layers and their respective references. Most commonly, complex techniques are presented using five While deciding on the most appropriate analysis strategy for the Question Diagram, Drs. Pietrobon and Guller consulted the Analysis Chart searching for the most appropriate statistical methods of analysis. Given the nature of the research question and that the NIS database has a sample design, Drs. Guller and Pietrobon opted for an approach involving multiple and logistic regression models while adjusting for sampling weights, strata, and clusters. With a defined analysis protocol, the research question was then transferred to a statistical programmer trained in the translation of Question Diagrams into statistical code. This process was closely evaluated by Drs. Pietrobon and Guller, who scrutinized the statistical code and results from a clinical and statistical perspectives. Once the results were deemed to be accurate, Dr. Pietrobon started the literature review using a Literature Matrix.\u00ae or Open Office Calc [Literature matrices consist of a comprehensive but not necessarily exhaustive review of the literature focused on a narrow clinical topic Figure . Each arice Calc .The advantage of the Literature Matrix as implemented in the Web suite is its availability over the web to the whole outcomes research community. This allows Literature Matrices to be constantly updated, with authors receiving their due credit in a list of contributors. Literature Matrices also enable researchers to obtain a complete summary of the literature without going through the cumbersome process of copying and reading a manuscript for the first time. In contrast, researchers' time can be spent more efficiently in reviewing what has already been compiled and attempting to expand the Literature Matrix with other relevant bibliographic references.In order to evaluate the literature, a graduate student performed a thorough literature search. All relevant articles were copied, read, and the data extracted according to the established categories. Once the Literature Matrix had been completed, Drs. Guller compared the current project results with results published in the literature. The structured information in Literature Matrices also allowed Dr. Guller to compare the strengths and weaknesses of the current project in relation to previous publications. Once this phase was completed, Dr. Guller proceeded to the final writing of the manuscript using Output Templates.At the end of the project, Dr. Guller combined the Question Diagram, Analysis Chart, and Literature Matrices to write the final manuscript. While Analysis Charts provided the information concerning the statistical techniques used in this study, Literature Matrices provided the basis for comparison of the study results against previous publications. Although not included in the final manuscript, Dr. Guller also had access to multiple analysis files through Research Manager to orient him in each of the steps taken during the research question formulation, data analysis, and literature review.The use of web applications by individual clinical researchers can be summarized in Figure Since the concept of streamlining the interdisciplinary collaboration preceded the existence of the current suite of web applications, different versions of the central idea have been gradually applied since the second half of 2002. Although our usability, qualitative, and economic studies to evaluate this application are still ongoing, we have noticed a significant improvement in the number and quality of our publications as evidenced by the increasing acceptance rates of our manuscripts for publication in peer-reviewed journals. The Web applications are currently used in research projects involving Duke University and other universities in the United States and abroad, where they have been shown to facilitate inter-institutional collaborations.Improving the efficiency of an interdisciplinary approach to secondary data analyses has multiple potential benefits. These include an increase in the overall clinical significance of the final publication, decrease in the number of failed projects, decrease in the time for completion of individual projects, improvement in the education of future outcomes researchers, decrease in the cost-benefit ratio for individual outcomes research projects, and, perhaps most importantly, an automation of repetitive tasks. This last factor is crucial since eliminating repetitive tasks will allow researchers to concentrate on the design of innovative projects .Surprisingly, few systems and applications have been described to solve the problem of complex interdisciplinary collaboration between clinicians and statisticians. Isolated approaches have usually focused on specific portions of the outcomes research process, without attempting to integrate them into a cohesive system. For example, Marshall  has propAlthough this newly developed system of applications provides a significant improvement in the way secondary data analyses are conducted, it still has limitations. First, because of the lack of a formal evaluation of the effectiveness of this system, we are unable to quantify its real time and cost saving benefits. Second, the system is currently restricted to secondary analyses and does not allow for the planning of prospective data collection. Although one of the main advantages of formulating a research question based on existing data sets is the bounded nature of the process, future applications should attempt to create rules and algorithms that may guide prospective data collection.In summary, we have experienced that this system has significant advantages over the traditional manner of conducting outcomes research based on secondary data analyses. This tool may have important applications, not only resulting in an improvement in the overall efficiency of the outcomes research process, but also affecting the way new outcomes researchers are trained and introduced to a research environment.The Web application is available at XHTML Extensible HyperText Markup Language 1.0JAVA: by Sun MicrosystemsICD9-CM: International Classification of Diseases, Ninth Revision \u2013 Clinical ModificationNIS: Nationwide Inpatient SampleGNU: GNU's Not linux General Public LicenseWebMIRS: Web-based Medical Information Retrieval SystemNHANES: National Health and Examination SurveyUR: Uniform ResourceThe author(s) declare that they have no competing interestsRicardo Pietrobon \u2013 design, manuscript draftingUlrich Guller \u2013 design, manuscript revision for important intellectual contentHenrique Martins \u2013 design, manuscript revision for important intellectual content, software programmingAndreia P Menezes \u2013 design, manuscript revision for important intellectual contentLaurence D. Higgins \u2013 design, manuscript revision for important intellectual contentDanny O. Jacobs \u2013 design, manuscript revision for important intellectual contentThe pre-publication history for this paper can be accessed here:"}
{"text": "There is confusion in the medical literature as to whether statistics should be reported in survey studies that query an entire population, as is often done in educational studies. Our objective was to determine how often statistical tests have been reported in such articles in two prominent journals that publish these types of studies.Academic Medicine and the Journal of General Internal Medicine in which an entire population was studied. We tallied whether inferential statistics were used and whether p-values were reported.For this observational study, we used electronic searching to identify all survey studies published in Academic Medicine and 22 in the Journal of General Internal Medicine. Overall, 38 (45%) of the articles reported or stated that they calculated statistics: 35% in Academic Medicine and 73% in the Journal of General Internal Medicine.Eighty-four articles were found: 62 in Educational enumeration surveys frequently report statistical tests. Until a better case can be made for doing so, a simple rule can be proffered to researchers. When studying an entire population  for factual information, do not perform statistical tests. Reporting percentages is sufficient and proper. The inclusion of statistical tests has been inculcated into investigators as a necessary step in the reporting of medical research. While descriptive statistics may always be used (unless the data are too sparse), the employment of inferential statistics \u2013 statistics calculated from a study sample in order to make generalizations about a larger study target population \u2013 is not always appropriate.One situation in which statistical testing must be used with caution is when tests are calculated from what may be a non-random sample . In the Another situation in which inferential statistics should not be used is when the study targets the entire population . This tyAcademic Medicine N = 1096) and a general medical journal  that frequently publish educational studies \u2013 using the search term \"survey.\" From this search, we identified all studies in which surveys were sent to an entire population of responders and determined whether inferential statistics that generate p-values, such as t-, Wilcoxon, Fisher's exact, and chi-square tests were used.For this observational study, we used PubMed to identify all articles (from 1987 to 2006) from two high impact factor journals \u2013 an educational journal  of the articles reported or stated that they calculated statistics. Of these, 31 (86%) reported p-values, 19 (50%) reported that they used chi-square tests, 12 (32%) t-tests, 6 (16%) some type of multiple regression analysis that included p-values or confidence intervals, and 5 (13%) analysis of variance; 2 studies each calculated other statistics including Fisher's exact tests, Wilcoxon tests, Mann-Whitney tests, and confidence intervals; other statistics were used for 8 other studies.Academic Medicine articles reported statistics in 22 of 40 articles (35%) while Journal of General Internal Medicine articles reported statistics in 16 out of 22 articles (73%). Statistics were more prevalent in more recent articles in Academic Medicine. For example, only 4 out of 30 (13%) before 1996 reported statistics compared to 18 out of 32 (56%) articles published afterwards.This study demonstrates that statistics are frequently overused in articles from two prominent and highly-cited journals that report educational studies. In fact, since 1997 the majority of articles reporting enumeration studies have inappropriately included statistics.The authors of one article that did not include statistics wrote directly to the issue in their methods section: \"All analyses are based on the entire population of interest. Therefore, tests of statistical significance are not provided\" . In anotThe findings of our study are worrisome for a number of reasons. The two journals that were studied are among the most prominent in their field and are highly cited. Authors may use them as role models in the reporting of educational studies. In addition, the concept of sampling is central to the whole of inferential statistics and is usually discussed in the early chapters of statistical textbooks . If reseA reviewer of this article suggested that there may still be a role for statistics in finite populations by appealing to probability distributions that generated the scores in the population, and that statistical tests are appropriate to compare not the actual numbers in the population but the probability distributions that are imperfectly indicated by the values in the populations. One situation in which this might be the case is when a survey questions an entire population  about values, preferences or impressions such as is often done with Likert-type questions. In this case, the referent distribution might be envisioned to be the impressions of all persons who might hold the office of the person who is responding to the questionnaire. This consideration would not be germane for factual information often queried about in surveys. Dusoir has suggested that \"statistics is a collection of warring factions, with deep disagreements over fundamentals\" and differences in reporting statistics from finite probabilities may be one of these fundamental issues . On the In addition to confusion about fundamental issues in statistics, the increasing prevalence of statistics in these studies over time suggests that the inappropriate use of statistical packages may be partly to blame. Many of the studies included statements to the effect that data were entered in statistical packages, when for all of these studies a spreadsheet program would have been more than adequate. While statistical packages can generate tests quite readily, the proper interpretation of their output is the responsibility of the investigator. Anthony has suggested that the \"use of such (packages) does, unfortunately, also allow you to perform meaningless statistics and incorrect statistical tests, and give misleading or wrong interpretations\" .This study did not sample all articles in the medical literature that have reported enumeration studies. However, it reports on all such studies that have been published in two leading journals that report medical educational studies. We suspect that this problem is also rampant in other journals that report this type of study. The proband case that led to this study was published in another leading journal .The improper use of statistics in medical research has become a matter of much concern . In an aThe author declares that he has no competing interests.ND is the sole author.The pre-publication history for this paper can be accessed here:"}
{"text": "Resistance to cytotoxic agents may be encountered during the treatment of acute myeloblastic leukaemia (AML). P-glycoprotein encoded by the MDR-1 gene has been implicated as a potential drug resistance mechanism in leukaemic cells. In recent years, many data have been accrued concerning the expression of P-glycoprotein in leukaemia, and several studies have been published which have related MDR status to outcome in AML. Conclusions as to the effect of P-glycoprotein expression on prognosis in AML have varied widely. The studies are not immediately comparable, since they differ in methodology, treatment regimens, demographic profile and, perhaps most importantly, criteria for positivity of MDR status. The technique of statistical overview  can be used to pool observational studies. Application of this statistical method to existing studies suggests an estimated relative risk of 0.68 for P-glycoprotein expression with respect to complete remission in AML. Further large studies are required to determine fully the role of P-glycoprotein in AML."}
{"text": "Citation counts are often regarded as a measure of the utilization and contribution of published articles. The objective of this study is to assess whether statistical reporting and statistical errors in the analysis of the primary outcome are associated with the number of citations received.We evaluated all original research articles published in 1996 in four psychiatric journals. The statistical and reporting quality of each paper was assessed and the number of citations received up to 2005 was obtained from the Web of Science database. We then examined whether the number of citations was associated with the quality of the statistical analysis and reporting.A total of 448 research papers were included in the citation analysis. Unclear or inadequate reporting of the research question and primary outcome were not statistically significantly associated with the citation counts. After adjusting for journal, extended description of statistical procedures had a positive effect on the number of citations received. Inappropriate statistical analysis did not affect the number of citations received. Adequate reporting of the primary research question, statistical methods and primary findings were all associated with the journal visibility and prestige.In this cohort of published research, measures of reporting quality and appropriate statistical analysis were not associated with the number of citations. The journal in which a study is published appears to be as important as the statistical reporting quality in ensuring dissemination of published medical science. Citation by other authors is important in the dissemination of published study findings. The attention that scientific articles get can be assessed using citation analysis. In this context, Egghe & Rousseau  claim thStatistical methods play an important role in medical research. This is reflected in the high proportion of articles which are essentially statistical in their presentation ,4. The mThe association between statistical reporting and the number of citations received is presently unclear . Our aimAmerican Journal of Psychiatry (AJP), Archives of General Psychiatry (AGP), the British Journal of Psychiatry (BJP) and the Nordic Journal of Psychiatry (NJP). AJP and AGP are the two leading medical journals covering psychiatric research and have consistently been the top two as ranked by Garfield's impact factor (IF), while BJP is the most cited psychiatric journal outside the United States and NJP represents the large group of journals having a markedly lower IF than the other three studied here. The four journals had the following impact factors in 2004: AGP 11.207, AJP 7.614, BJP 4.175 and NJP 0.887.For our investigation we selected four general English-language psychiatric journals: The All the articles published in these four journals in 1996 were supplied by the Medical Libraries in the authors' institutes. Papers were included for examination if they had been published as original research articles in 1996, reported research findings based on the systematic collection of data, and used statistical methods for data analysis. The total number of articles reviewed was 448, representing about 47% of all the articles in the four journals (N = 951). Those excluded were mostly letters (n = 287), brief reports , reviews (n = 22) or editorials. Further details of the sample and the statistical methodology used in the articles have been published in an earlier paper [Each article's citations, over 9 years till April 2005, were obtained from the Web of Science databases  in April 2005. Self-citation was deemed to have occurred whenever the set of co-authors of the citing article shared at least one author with that of the cited one, a definition used in various recent citation studies . The numOne reviewer (P.N.) assessed all papers to determine the primary outcome and main response variable(s) together with possible explanatory or grouping factors. The primary outcome was that which was stated in the research objectives (in the abstract or introduction) or labelled as \"primary\" in the methods. When no outcome met these criteria, the reviewer used his own judgment to select the outcome that was presented in the abstract, and/or the first outcome presented in the results, that appeared crucial to the final conclusions. The psychiatric sub-field and study design were also assessed. Papers that were difficult to assess were additionally reviewed by GR and MS, then jointly assessed.To ensure consistency of evaluation (assessments), the assessor used the same detailed  classification scheme for each paper, and was blind to the number of citations received.The reliability of the evaluation was investigated by comparing the ratings of two reviewers (P.N. and Jouko Miettunen). They independently reviewed all the 448 articles in separate research projects with different research questions; however, their review protocols shared two items. For the first, 'whether data analysis procedures were completely described in the methods part of the research report', the overall agreement between raters was 90.7% and kappa coefficient for inter-rater reliability was 0.75 (95% CI 0.68 \u2013 0.82). For the second, 'whether the statistical software used in the study was named in the report', the overall agreement was 96.9% and kappa coefficient 0.93 (95% CI 0.89 \u2013 0.96).To evaluate the quality of reporting, the following information was obtained: (i) whether the primary research question or hypothesis was clearly stated in the report's introduction or methods section; (ii) whether sample size and data analysis procedures were described in the report's methods section, and (iii) whether the article was difficult to read due to lack of clarity about the primary response or outcome variable.Each article was also assessed for inappropriate use of statistical methods. Specifically, each article was checked for the specific analysis errors defined by Altman  as 'defiStudies were categorised as including insufficient or incomplete analysis if the article drew conclusions not supported by the study data, reported significant findings without a statistical test or CI, or explicitly or implicitly made comparisons between p-values. The overuse of statistical tests, defined to be present if there was no clear main hypothesis, or several sub-group analyses using the primary outcome, was also assessed.As it is plausible that studies with larger sample sizes include more evidence, we categorised each study's sample size as small (< 50), medium (50 \u2013 360) or large (>360).Box plots showed that the distribution of the number of citations received is highly positively skewed, so we use the median as a measure of location. Mann-Whitney tests, Kruskal-Wallis ANOVA and negative binomial regression were used to investigate possible associations between the number of citations and reporting quality. We adjusted for journal to control for the effect of journal visibility. The statistical significance of differences in statistical reporting and errors between the four journals was evaluated using chi-square test.The statistical software used were the SPSS for Windows version 12.0 (SPSS Inc.) and SAS Release 9.1 (SAS Institute Inc.).The articles in our sample came from a variety of specialties: epidemiology, clinical topics, psychopharmacology, biological topics and others. The distribution of published articles by journal and topic is shown in table Figure Table Table Table Table An estimated multivariate negative binomial regression model for the effects of quality of statistical reporting and analysis on the number of received citations, adjusted for the publication forum, is shown in Table Further, in an additional analysis (suggested by a reviewer) we investigated whether there is a difference in the number of citations received by papers with (i) statistical errors that potentially affect the study results and (ii) papers with reporting failures. To this end, a combined variable \"Presence of errors potentially affecting the study results\" was defined using the last four variables given in Table Only 16 out of the 448 psychiatric articles published in the four journals in 1996 included sample size calculations, power analysis or any other justification for the sample size, contrary to the CONSORT  and STROFigure This study investigated the association between the quality of an article's statistical reporting and analysis and the number of citations it received. In this set of articles, failing to state essential information, such as the primary research question or the primary outcome variable did not affect the number of citations the article received. However, a sufficient description of the methods used was an important factor in increasing the number of citations received in two of the four journals. Statistical errors and sample size were not associated with number of citations received. Reporting quality was associated with the journal visibility and prestige.West and McIlwaine  have anaThe importance of stating the purpose and a priori hypotheses of a research project in the report is obvious, but such a statement was often (in 34.6% of papers) missing. In these cases, the results cannot be interpreted in light of a priori hypotheses. Further, unless the research question is clearly stated, the appropriateness of the study design, data collection methods and statistical procedures cannot be judged. For other researchers to cite the paper, however, it does not appear to matter whether the initial purpose of the cited study was clear, or whether the analyses are exploratory and speculative.We found that 25% of the articles were difficult to read due to an unclear definition of the primary response or outcome variable. Although it is valuable for medical studies to evaluate several aspects of patients' responses, it is important to identify a small set of primary outcome or response variables in advance . It is aArticles with clearly documented research methods did receive more citations. This association was more marked in papers published in AJP and BJP. In our sample, documentation of statistical methods used was generally sufficient in AGP (92.2%), consistent with the editorial policy of the journal which requires an extended methods section in submitted manuscripts.We included in our review four general psychiatric journals with different prestige and visibility. By involving several journals we were able to control for the effect of journal visibility on the number of citations received and compare the prestige of a journal with the quality of statistical presentation. The reporting of statistical information was more detailed, comprehensive and useful for the reader in the two leading journals (AGP and AJP). Again, this is consistent with their detailed guidelines for presenting statistical results, and also a more rigorous review process, including extensive statistical reviewing . In low-Several findings have demonstrated that a non-negligible percentage of articles \u2013 even those published in 'high -prestige' journals \u2013, are not statistically faultless ,8,19,20.It has been claimed that researchers prefer to cite large studies rather than small studies . Our datIn this cohort of published research, measures of reporting quality and appropriate statistical analysis were not associated with the number of citations. The journal in which a study is published appears to be as important as the statistical reporting quality in ensuring dissemination of published medical science ,24. A hiMost of the errors and shortcomings in the application and reporting of statistical information in the journal articles reviewed here are related to topics included in most introductory medical statistics books. Some of these errors are serious enough to call the author's conclusions into question. It seems strange that a problem seemingly so important, so wide spread and so long-standing should continue ,9. PossiThe author(s) declare that they have no competing interests.PN and MS had the idea for the article. PN collected data, did the statistical analysis and wrote the paper. GR contributed to the data collection, the statistical analysis and writing of the paper. JC contributed to the statistical analysis and writing of the paper. MS initiated the study project, coordinated the collection of material and contributed to the writing of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
{"text": "Brand's four reasons for clinical tests and his analysis of the characteristics of valid biomechanical tests for use in orthopaedics are taken as a basis for determining what methodologies are required for gait analysis in a clinical rehabilitation context.The state of the art of optical systems capable of measuring the positions of retro-reflective markers placed on the skin is sufficiently advanced that they are probably no longer a significant source of error in clinical gait analysis. Determining the anthropometry of the subject and compensating for soft tissue movement in relation to the under-lying bones are now the principal problems. Techniques for using functional tests to determine joint centres and axes of rotation are starting to be used successfully. Probably the last great challenge for optical systems is in using computational techniques to compensate for soft tissue measurements. In the long term future it is possible that direct imaging of bones and joints in three dimensions (using MRI or fluoroscopy) may replace marker based systems.There is still not an accepted general theory of why we walk the way we do. In the absence of this, many explanations of walking address the mechanisms by which specific movements are achieved by particular muscles. A whole new methodology is developing to determine the functions of individual muscles. This needs further development and validation. A particular requirement is for subject specific models incorporating 3-dimensional imaging data of the musculo-skeletal anatomy with kinematic and kinetic data.Clinical gait analysis is extremely limited if it does not allow clinicians to choose between alternative possible interventions or to predict outcomes. This can be achieved either by rigorously planned clinical trials or using theoretical models. The evidence base is generally poor partly because of the limited number of prospective clinical trials that have been completed and more such studies are essential. Very recent work has started to show the potential of using models of the mechanisms by which people with pathology walk in order to simulate different potential interventions. The development of these models offers considerable promise for new clinical applications of gait analysis. The core of most contemporary gait analysis is the measurement of joint kinematics and kinetics. Other measurements regularly made are electromyography (EMG), oxygen consumption and foot pressures. A systematic physical examination of the patient is usually conducted as part of a gait analysis.For the purposes of this paper clinical gait analysis. Richard Brand [clinical i.e. a clinical test is one conducted in order to select from among different management options for a patient (including the possibility of not intervening).Rehabilitation is a clinical discipline and this paper will thus concentrate on rd Brand ,2 proposclinical research. This differs from clinical testing in that the reason is not to make clinical decisions for the individual patient, but to learn about a condition affecting a group of patients or the effect of an intervention. It is important to remember that the criteria for valid clinical research may not be the same as those for valid clinical testing. For example if a measurement made on a patient cannot be relied upon because of random errors then that measurement will not be useful for clinical purposes. By increasing the number of patients in a sample however, even measurements with quite large random errors can result in meaningful conclusions in clinical research. This paper will focus on gait analysis for clinical use. It will also focus on methodology rather than areas of clinical application.Much contemporary gait analysis is done for the purpose of Brand's ,2 other Brand went on to propose a number of criteria for assessing the usefulness of biomechanical measurements in general which, with some modification, can be used as criteria for the usefulness of all clinical gait analysis. These are listed in Table In order to perform a diagnostic function it is necessary for measurements to be able to distinguish normal from abnormal patterns of movement and also between the characteristics of one disease entity and another. There are two aspects to this. The first is having measurement systems capable of working to adequate precision. The second is a knowledge of what characterises normal walking or a particular disease entity.The requirement for patient assessment pre-supposes that a diagnosis does not give sufficient information to determine the most appropriate management for a patient and that measuring the precise characteristics of a patient's condition are essential for this. Measurements thus have to be sufficiently precise to reveal clinically important differences between patients with the same diagnosis. For monitoring purposes measurements need to be sufficiently precise to be able to determine whether a patient's condition is stable, improving or deteriorating.Brand suggested that the measurement technique should not affect the function it is measuring. The walking performed in a gait analysis laboratory however, with the patient concentrating on what they are doing in an idealised environment, is not necessarily representative of their normal walking. At the very least this must be taken into account when interpreting results.Gait analysis should reveal information that is useful to the clinician and this will generally require that results are reported in terms analogous to accepted clinical concepts. It must be cost-effective, that is the benefit of performing the test must be worth the cost. This balance need not necessarily be determined in purely financial terms but the financial cost of gait analysis is a significant factor. Finally there is no point doing any clinical test if the results could be obtained sufficiently well by simply observing the patientThe information obtained by assessing the patient is that used for selecting management options. This process does not, therefore, make further demands on the measurement systems but does require an understanding of how the patient's condition is likely to be affected by an intervention (or none) to a level sufficient to determine which options are preferable. Prediction of outcomes takes this one stage further to being able to determine not only which management option is best but also how the patient will be after that intervention.This sequential analysis of the four potential purposes of clinical tests reveals a progression from just requiring reliable and precise measurements to the additional requirement of having an understanding of how such information is incorporated into clinical practice. The state of the art is that the measurement component of gait analysis can reasonably be described as an objective process whereas the interpretation component is predominantly subjective.Making the interpretive component more objective can be achieved in two ways. The first is to develop a general theory of how people walk whether they have recognised pathology or not. As long ago as 1982 Cappozzo lamented, \"The approaches to clinical gait analysis and evaluation are not supported by general theories\"  and despModern clinical gait analysis traces its origins back to the early 1980s with the opening of the laboratory developed by the United Technologies Corporation at Newington, Connecticut and those provided with equipment by Oxford Dynamics (later to become Oxford Metrics) in Boston, Glasgow and Dundee. Retro-reflective markers were placed on the skin in relation to bony landmarks. These were illuminated stroboscopically and detected by modified video cameras. If two or more cameras detect a marker and the position and orientation of these cameras are known then it is possible to detect the three-dimensional position of that marker .Whilst the basic principles remain the same as the earliest systems, the speed, accuracy and reliability has advanced beyond all recognition. It is not uncommon now to find clinical systems using 8, 10 or more cameras functioning at over 100 Hz and capable of detecting reliably the presence of many tens of markers of between 9 and 25 mm diameter. Calibration of the systems  can generally be accomplished in less than a minute. Marker positions from clinical trials can be reconstructed and markers labelled automatically in real time . The determination of the accuracy of such systems is now generally limited by the accuracy of any alternative means to determine marker position and can be taken to be of the order of 1 mm. This is probably an order of magnitude smaller than other sources of error in determining joint kinematics and kinetics. This particular measurement technology has thus reached a mature state of development that, whilst advances will almost certainly continue, already probably delivers all that is required by conventional gait analysis [The same cannot be said of the computer models used to derive joint kinematics and kinetics from the marker position data supplied by the measurement hardware. Almost all commercially available clinical systems use some variant of the Conventional Gait Model  which haThe primary problem of current measurement technology is that of reliability in routine clinical use. Several studies have now been reported in which a single subject has been analysed in a number of different laboratories -14. ThesAt least one recent study has shown that it is possible to get levels of reliability sufficient to justify the continued clinical use of gait analysis within a single centre . Too fewWhilst not the most exciting field of research, a very real need of clinical gait analysis is for the development of techniques for establishing the reliability of measurement techniques and of methods of quality assurance that will ensure that the very highest standards of reliability are achieved in routine clinical practice.model calibration). This has two aspects, placing markers accurately with respect to specific anatomical landmarks and determining the location of the joint centres  in relation to these markers. Failure to place markers accurately is probably the single greatest contributor to measurement variability in contemporary clinical gait analysis. This is partly a matter of appropriate staff training and quality assurance but at least as important, and more fundamental, is the problem that many of the landmarks used to guide marker placement are not themselves particularly well defined in patients with certain conditions [There are two principal sources of error. The first is the difficulty determining the anthropometry of the individual subject . Once such technology is available however it is quite possible that this will supersede the presently available systems. The cost of any such new systems however is likely to prohibit ready clinical availability in the foreseeable future.There has been some work done on markerless optical methods. By placing a number of video cameras around a subject and tracing the silhouette of the walking subject on each it is possible to generate a 3-dimentional silhouette of that subject. This has already been achieved but the next step of using such a silhouette to determine the co-ordinate systems associated with the moving body segments has not yet been satisfactorily achieved.It is possible that the problem of skin movement can only be satisfactorily addressed by making direct measurements of bone position. It is now possible to take 3-dimensional images of bones (and muscles) using MRI but only within a very restricted capture volume -35. The Using 3-dimensional imaging techniques to directly determine bone movements during walking either as a technology with potential clinical applicability or for use as a gold reference standard from which to improve the implementation of conventional marker based technologies is one of the greatest challenges in this area.The second element of clinical gait analysis is the interpretation of data. Conventions for describing 3-dimensional joint kinematics and kinetics are well formulated. Many laboratories are augmenting conventional kinematics and kinetics with muscle length and, less commonly, moment arm graphs. Normal patterns of movement as represented by these data are now generally fairly well understood by clinical specialists although there is actually very little normative data published in the peer-reviewed literature. Similarly, many abnormal patterns of movement are quite widely recognised by clinicians but there few published attempts at formal classification of these -46. Manymoment arm in three dimensions [Despite the widespread acceptance of many of these conventions there are still problems. Baker  demonstrmensions  and it iA consistent, comprehensive and clear method for describing joint kinematics and kinetics in three dimensions would be of immense benefit for the clinical gait analysis community.what happens rather than why it happens. Many in the clinical gait analysis community regard kinematics as descriptive but contend that kinetics explain movement patterns. This is almost certainly misguided. Kinetics are simply another set of measurements and can thus only be descriptive.Perhaps the most important limitation of our present understanding of human walking, however, is that it is primarily descriptive. We know There have been various attempts at establishing a theory of walking but none is particularly convincing. Saunders, Inman and Eberhart's determinants of normal walking  are perhPerhaps the closest we have come so far to understanding why we walk the way we do has come from the work of Pandy and Anderson ,75. TheyAn obvious challenge in the emerging field of computational biomechanics is to apply similar techniques to model walking with particular forms of pathology.Conceptually, modifying such models to incorporate a specific abnormality of the musculo-skeletal anatomy such as a leg length discrepancy or contracture of a particular muscle is reasonably straightforward. It is much less certain whether such techniques can be applied at all to patients with neuromuscular pathology who are most frequently seen by clinical gait analysis services. Optimisation techniques assume that movements are controlled in such a way that a specific control function is minimised. In many neuromuscular conditions  the problem is one of a loss of central control and this would appear to invalidate any techniques modelling human movement as an optimised process.If such models are developed it will be interesting to see whether they give any insights into the clinical management of patients. Further it will be interesting to see whether their use leads to an understanding of why we walk the way we do which can be formulated as theories that are applicable without the use of such complex models.Perhaps the greatest challenge in clinical gait analysis is still to answer the question. \"Why do we walk the way we do and why don't our patients?\".Whilst the answer to this question still seems as far away as ever, significant advances have been made over recent years in understanding the mechanisms by which we walk particularly in the way that muscles act. For many years it was assumed that a muscle's anatomical position determines how it acts. It was assumed for example that the action of the hamstrings, passing behind the knee, was always to flex the knee. It is only comparatively recently that biomechanists have come to appreciate that any individual muscle has an effect on all the segments of the body and that in some circumstances this may result in a muscle having an action different to its anatomical function -81. It iSuch work depends on knowing the joint kinematics and kinetics and inertial properties of the body segments. These can be used to estimate the forces in individual muscles -83. Thispatient-specific models of walking.A further area of challenge is in using 3-dimensional imaging techniques to model musculo-skeletal deformities to allow the generation of There is also considerable debate at present about the validity of these techniques . Whilst the general principles are sound the techniques are known to be extremely sensitive to certain aspects of their implementation (and may be sensitive to many more). For example the forward modelling in particular is sensitive to how the interaction between the foot and the floor is modelled with there being no clear consensus as to the most appropriate method for this ,77,81.Implementation of these models must be based on robust techniques being developed to validate models, the first step of this is in rigorous analysis of the sensitivity of models to the assumptions on which they are based.Understanding how to interpret clinical gait analysis data is not itself sufficient to allow selection from amongst treatment options Table . For thiThere are then two methods for understanding the effects of intervention in these patients; clinical research to establish what the actual effect of a given intervention is or using knowledge of the mechanisms of walking to predict the effect of modifying the characteristics of the musculo-skeletal anatomy.By far the most common approach to date has been the use of clinical research \u2013 the comparison of gait patterns before and after a particular intervention -55,86-88Perhaps the most challenging field of research for clinical gait analysis is in the design and conduct of prospective clinical trials to ascertain the effects of specific treatments on specific patient groups.An alternative to the use of clinical trials is to use knowledge of the mechanisms of walking as a basis for modelling the effect of changing that mechanism. Reports of such studies are now starting to emerge. For example Arnold et al.  have repApplication of such techniques to a wider range of clinical problems represents another exciting sphere of research in clinical gait analysis. It may well be that such techniques are limited to the fairly narrow range of interventions that are based on correction of the mechanisms for very specific aspects of walking but identifying the range of potential applications will be an important part of this process.The author has received research funding from Oxford Metrics Plc"}
{"text": "Geographic Information Systems (GIS) have been used in a wide variety of applications to integrate data and explore the spatial relationship of geographic features. Traditionally this has referred to features on the surface of the earth. However, it is possible to apply GIS in medicine, at the scale of the human body, to visualize and analyze anatomic and clinical features.    In the present study we used GIS to examine the findings of transanal endoscopic microsurgery (TEM), a minimally-invasive procedure to locate and remove both benign and cancerous lesions of the rectum.  Our purpose was to determine whether anatomic features of the human rectum and clinical findings at the time of surgery could be rendered in a GIS and spatially analyzed for their relationship to clinical outcomes.   Maps of rectal topology were developed in two and three dimensions. These maps highlight anatomic features of the rectum and the location of lesions found on TEM.  Spatial analysis demonstrated a significant relationship between anatomic location of the lesion and procedural failure.This study demonstrates the feasibility of rendering anatomical locations and clinical events in a GIS and its value in clinical research.  This allows the visualization and spatial analysis of clinical and pathologic features, increasing our awareness of the relationship between anatomic features and clinical outcomes as well as enhancing our understanding and management of this disease process.  This paper addresses technical considerations in rendering data on transanal endoscopic microsurgical outcomes in a GIS. It is a companion to the clinical paper published in the Journal of Gastrointestinal Surgery a. set base height expression = [Z] - [Base]b. set extrusion expression = adding to each feature's base heightc. Apply extrusion by: D. Plotting lesions: 3DArcMap, using Table 1. In a. x1 = 2cos\u03b8b. y1 = 2sin\u03b8c. z = - distance fieldFile-Add Data).2. Add data table to map  and export data to save coordinates (right-click event layer- Export data).3. Plot xArcScene4. Display in a. set base heights to [z] \u2013 points will float in spaceb. Overlay on Regions layerAnimated 3-D rendering of anatomic regions with lesions. Animated 3-dimensional visualization of features allows exploration from all perspectives.Click here for fileAnimated transparent 3-D anatomic regions. Transparent rendering in ArcScene allows features to be highlighted more clearly. The peritoneal reflection appears as an oblique plane in cross-section.Click here for file"}
{"text": "Preterm labor affects up to 20% of pregnancies, is considered a main cause of associated neonatal morbidity and mortality and is responsible for neonatal care costs of multimillion euros. In spite of that, the commercial market for this clinical indication is rather limited, which may be also related to high liability. Consequently, with only a few exceptions, preterm labor is not in the orbit of great interest of the pharmaceutical industry. Coordinated effort of research community may bring the change and help required to reduce the influence of this multifactorial syndrome on society. Between the novel techniques that are being explored in a SAFE  group, there are new research models of preterm labor as well as novel methodology of analysis of biological signals. In this article, we briefly describe new clinical and nonclinical human models of preterm labor as well as summarize some novel methods of data processing and analysis that may be used in the context of preterm labor. In spite of decades of ongoing research, its pathophysiology still remains not fully discovered ,2, and cEthical issues in clinical studies significantly limit the possibility of using placebo-controlled protocols. On the other hand, the application of alternative protocols drastically reduces the chances of drug candidates in the process of registration. The effect of combination of above-mentioned factors creates the situation where very few medicines are labeled for use in pregnancy, and especially, preterm labor. Considering the whole situation surrounding preterm labor, it appears that only a coordinated effort of research networks, such as SAFE  and those involved in preterm labour, is capable of bringing the new data that could be of potential use in discerning its pathophysiology and point to new pharmacological targets.Therefore, in this setting there is much to be done towards solving this important problem. Here, we put forward new clinical and non-clinical models of uterine contractile activity together with new methods towards the detection and processing of biological signals that can be used as significant examples to build upon between collaborating partners.1a vasopressin receptor [in vivo and in vitro models that could closely reflect the reactivity of human myometrium/uterus, serving in pathophysiologic/pharmacologic studies.One of the major concerns in studies on preterm labor, especially on uterine contractile activity is that practically none of the models is adequately sufficient and easy to use \u2013 mice uteri lack Vreceptor , rats prreceptor  and laboreceptor . Studiesreceptor , howeverin vitro studies on uterine strips isolated from human pregnant/non-pregnant women as well as in vivo human or animal models [in vitro model of contractility of human myometrium presented in the literature [et al. [in vitro studies.Valuable information on the biology and pharmacology of uterine contractile activity may be provided by l models -11. One terature ,13, may  [et al.  we confiIn vitro studies are usually preceding clinical application of drug candidates. As ethical specificity practically excludes testing on pregnant volunteers, there is a hectic need for optimal in vivo model. Consideration should, therefore, be given to the uterus of non-pregnant women \u2013 where, aparting from the lack of significant rise in oxytocin receptors as seen in late pregnancy [regnancy , most ofregnancy -18. Moreregnancy , showingregnancy  or magneregnancy  activityregnancy . SpecialOur advanced methods of signal processing and analysis reported here give added support to the potential benefit of new preclinical and clinical models of preterm labor. Such an attitude could provide new insights into \"well known\" phenomena such as uterine contractile activity. Classical modalities of signal analysis, such as time domain and frequency domain-based analysis are frequently insufficient in providing significant biologic data on uterine contractile activity. In the classical, so called \"time domain\" analysis, studied parameters including area under curve recording (AUC), maximal amplitude of contractions and various statistical quantities . Although easily computed even for short time recordings , these aContrary to the Fourier decomposition, the continuous and discrete wavelet transforms allow extracting local and global variations of the recorded contractions. Graphical presentation of such data  shows the distribution of energy in the time-frequency plane. For normal contractions, scalograms of the fundal and cervical signals are very similar. In the case of dysmenorrheic contractions, patterns are quite different . StudiesIn the case of bivariate sets of signals (i.e. recorded in two distant locations of the uterus), which contain two simultaneously recorded time series, it appears clinically important to understand how the variables interact. Cross-correlation function can be employed to analyze the association between two time series ,19,26. TTime shifts may be an important indicator of propagation of uterine contractions, which could be altered in women in preterm labor. Figure Fractal analysis serves another example for advanced data analysis to be utilized in the studies on uterine contractile activity. Fractals, a relatively new analytical concept of the last few decades, have been successfully applied in many areas of science and technology. We performed a comparative study of ten methods of fractal analysis of signals of intrauterine pressure. We found significant differences between uterine contractions in healthy volunteers and women with primary dysmenorrhoea . There wNonlinear dynamics is one more example of advanced data analysis that could be implemented for uterine contractility signals. In recent years the physiological signals obtained from the complex systems like the brain or the heart have been investigated for possible deterministic chaotic behavior. The human uterus is undoubtedly a complex system. Smooth muscles comprising the myometrium interact in a complex manner. We used the techniques of surrogate data analysis to testing for nonlinearity in the uterine contraction signals. The results showed that the spontaneous uterine contractions are considered to contain nonlinear features  which inAfter decades of continuous research, especially as no breakthrough in the interest of pharmaceutical industry can be seen, only well-planned and coordinated international programs may provide additional data of different aspects of preterm labor. Possible directions for future research may be related to development of new biophysical methods of evaluation of uterine activity  together with implementation of novel methodology of analysis of signals and diagnosis of molecular genetic malfunctions.The authors declare that they have no competing interests.All the authors  have made substantive and equal intellectual contributions to a published study and have been involved in drafting the manuscript or revising it critically for important intellectual content."}
{"text": "The randomized study by Auvert et al.  on male Some might argue that the intent-to-treat analysis is more scientific, and reduces the impact of some selection or behavioral bias in those who opted for circumcision notwithstanding their allocation to the control arm. For example, it could be that men allocated to the noncircumcision group who were predisposed to less risky behavior but wanted to be extra safe might have chosen to be circumcised. In the opposite direction, those who were indulging most in risky behavior might have chosen to be circumcised to reduce their risk.In my view, however, if we are interested in the true biologic effect, it is not very scientific to bias in favor of the analysis with a 10% contamination of that biological effect. In this study, we are fortunate enough to have quite richly reported behavioral data. More analysis of the per protocol analysis should have been presented, including the behavior of the crossovers. It is reasonably likely that any difference in the behavior of the crossovers would have little impact since, in the intent-to-treat analysis, adjustment for the increase in riskier behavior in the treatment group had little effect on the overall result.The paper should have had prominent presentation of both analyses. In either case, the protection is quite substantial. But from an epidemiologic and personal perspective, what amounts to a failure rate of 40% versus 24% could be quite important."}
{"text": "The analysis of large-scale gene expression data is a fundamental approach to functional genomics and the identification of potential drug targets. Results derived from such studies cannot be trusted unless they are adequately designed and reported. The purpose of this study is to assess current practices on the reporting of experimental design and statistical analyses in gene expression-based studies.We reviewed hundreds of MEDLINE-indexed papers involving gene expression data analysis, which were published between 2003 and 2005. These papers were examined on the basis of their reporting of several factors, such as sample size, statistical power and software availability.t-test and ANOVA represent the most widely applied techniques in microarray data analysis. But remarkably, only 5 (3.5%) of the application papers included statements or references to assumption about variance homogeneity for the application of the t-test and ANOVA. There is still a need to promote the reporting of software packages applied or their availability.Among the examined papers, we concentrated on 293 papers consisting of applications and new methodologies. These papers did not report approaches to sample size and statistical power estimation. Explicit statements on data transformation and descriptions of the normalisation techniques applied prior to data analyses (e.g. classification) were not reported in 57 (37.5%) and 104 (68.4%) of the methodology papers respectively. With regard to papers presenting biomedical-relevant applications, 41(29.1 %) of these papers did not report on data normalisation and 83 (58.9%) did not describe the normalisation technique applied. Clustering-based analysis, the Recently-published gene expression data analysis studies may lack key information required for properly assessing their design quality and potential impact. There is a need for more rigorous reporting of important experimental factors such as statistical power and sample size, as well as the correct description and justification of statistical methods applied. This paper highlights the importance of defining a minimum set of information required for reporting on statistical design and analysis of expression data. By improving practices of statistical analysis reporting, the scientific community can facilitate quality assurance and peer-review processes, as well as the reproducibility of results. The analysis of large-scale gene expression has become a fundamental approach to functional genomics, the identification of clinical diagnostic factors and potential drug targets. DNA microarray technologies provide exciting opportunities for analysing the expression levels of thousands of genes simultaneously . A fundat-test, ANOVA) has improved in these disciplines, some errors regarding their sound application and reporting can still be found. For instance, the t-test and ANOVA are fairly robust to moderate departures from its underlying assumptions of normally-distributed data and equality of variance (homogeneity) except in the presence of very small or unequal sample sizes, which can considerably decrease the statistical power of the analyses [Consolidated Standards of Reporting Trials (CONSORT) have been adopted. CONSORT has significantly assisted researchers in improving the design, analysis and reporting of clinical trials [Over the past few decades the medical research disciplines, especially the area of clinical trials, have widely emphasised the importance of rigorous experimental design, statistical analysis implementation and the correct use of statistics in peer-reviewed publications -6. Althoanalyses -10. In ol trials . This isl trials ,13 that t-test and ANOVA. Our research also examined how papers present fundamental statistical justifications or assumptions for the correct application of the t-test and ANOVA, which are widely applied to gene expression data analysis.The main objective of this investigation is to assess the reporting of experimental design and statistical methodologies in recently published microarray data analysis studies. Among the experimental design factors under study are sample size estimation, statistical power and normalisation. This paper also provides insights into the design of studies based on well-known statistical approaches, such as PubMed [methodologies and biomedical-relevant applications); b) reporting of methods of sample size calculation and statistical power; c) reporting of data standardisation  and method of normalisation applied; d) description of data analysis techniques applied; e) discussion about missing values; f) explicit statement of directionality (i.e. one-sided or two-sided test); g) explicit statement of hypothesis and alternative; and h) reference to software tools applied for implementing data analyses. In this study application papers refer to any paper whose main contribution is the generation or testing of biological or biomedical hypotheses, including potential diagnostic, prognostic and therapy design applications, as well as biologically-relevant discoveries. Methodology articles emphasize the presentation of a novel, problem-specific  method or procedure, which may drive a biologically-relevant advancement or discovery.PubMed  was usedPubMed . The repIn connection to the description of data analysis techniques applied, we concentrated on the assessment of techniques or models that were fundamental to obtain key findings in the application and methodology papers. With regard to the discussion of missing data estimation methods, we targeted the application of previously-published imputation or estimation methods.We examined the two main categories of papers on the basis of the factors defined above. For all the factors, except for factor d), we asked whether or not a factor was reported in each paper. In relation to factor d), we reviewed the techniques applied and then organised the papers into groups according to major data analysis paradigms or approaches. Table We reviewed papers published in Medline-indexed journals. Among these papers 152 (51.9%) concentrated on the presentation of new methodologies for gene expression data analysis, and 141 (48.1%) papers mainly contributed application studies, e.g. discoveries directly relevant to molecular biology and clinical studies. The definition of these paper categories was provided above.Our results show that none of the 293 applications and methodology papers reported approaches to sample size calculation. Moreover, none of these papers reported information relating to the statistical power of their analyses. Only 23 (7.8%) of the papers (9 application and 14 methodology papers) presented discussions about the limitations of small sample sizes in their analyses of real data. Among the methodology papers, only 9 (5.9%) manuscripts provided evidence that their analyses techniques were adequate  for small sample sizes. Only 1 of the application papers discussed statistical power and sample size factors. Among the methodology papers, 94 (61.8%) used real data for assessing the data analysis methodologies or techniques proposed. Three of the methodology papers (2%) only used simulated data to support their evaluations; and 55 (36.2%) papers analysed both real and simulated data for evaluating the methodologies proposed. Table t-test and ANOVA represent the most widely applied techniques in microarray data analysis studies (Table t-test (21 papers) or ANOVA (47 papers). However, our review showed that only 5 (3.5%) of the application papers discussed variance homogeneity assumptions in their analyses. Moreover, only 7 (4.6%) of the methodology papers presented statistical justifications for the application of either ANOVA or the t-test.Among the 141 application papers, 11 papers (7.8%) did not report the statistical methods used in their data analyses. Clustering-based analysis, the es Table . Table 3Our results showed that among the methodology and application papers, 133 (87.5%) and 115 (82%) did not report the directionality of the tests (one-sided or two-sided test) respectively. Also among the methodology and application papers, only 19 (12.5%) and 26 (18%) included discussions about missing values  respectively. Explicit statements of hypothesis and alternative hypothesis were reported in only 43 (28%) and 29 (20.6%) methodology and application papers respectively. In addition, of the 141 application papers, only 52 (36.9%) included sections or sub-sections to describe data analysis methods applied.As shown in Table t-test) then spurious predictions and type II errors (\u03b2) can be seriously misleading. In fact, undetected significant differences may be explained by a lack of statistical power for detecting true differences between genes or as a result of inadequate sample sizes (subjects or arrays). Our study showed that very few research studies (i.e. either methodology or application papers) discuss power and sample size requirements in microarray experiments, which are fundamental factors to accomplish the validation of the statistical analyses [Our assessment suggests that published papers lack relevant information regarding the determination of sample sizes and statistical power in microarray data analysis studies. These studies often involve hundreds or thousands of genes and only a fraction of genes are expected to be differentially expressed. Therefore, genes that do not show clear patterns of differential expression are filtered out, by performing statistical group comparisons. However, if the subjects or arrays (sample size) have not been properly estimated before the statistical comparisons  methodology and application papers explicitly discussed issues relating missing values, e.g. sources and estimation methods. Gene expression data often contain missing expression values, which may require the application of missing data estimation or imputation techniques to obtain a complete matrix of expression values. Like in the case of data normalisation, authors not only should report on missing values, but also on their approaches to dealing with such a problem. Again this is a crucial factor because different estimation methods may have different effects on the same dataset -42,54. AFinally, our review suggests that the above reporting practices may be improved by encouraging authors to provide separate sections or sub-sections focusing on data analysis. Only 36.9% of the application papers, for example, included a section dedicated to these aspects, i.e. detailed discussion of methods, tools, assumptions. A section (or sub-section) on statistical methods should clearly state, for instance, how the sample size was estimated and how the data were analysed in relation to each of the objectives and underlying biological and statistical assumptions made. Such a section should also include information about statistical software or tools applied for data analysis (e.g. origin and availability) and the directionality of the statistical tests applied.Even when this study did not aim to analyse the possible causes of such relative lack of statistical information reporting standards, it is necessary to stress the importance of ensuring the participation of statisticians in both the design and analysis phases of gene expression studies. However, in some cases this may be accomplished only if adequate provisions and decisions are made during the project formulation and funding assessment phases (i.e. adequate budget considerations should me made to achieve such participation). An interpretation of the results on the reporting of test directionality should also take into account that for many authors it may be common practice not to report test directionality as they may assume that two-sided directionality is the default setting. However, this assumption should not be used to justify the lack of more rigorous reporting practices, which are commonly adopted in other statistics-driven areas, such as medical sciences, epidemiology and clinical trials.It is also necessary to recognise that the lack of more rigorous reporting standards may be understood in the light of the technical complexities and constraints presented by the area of gene expression data analysis. For example, there is a need for more comprehensive theoretical and empirical studies about the statistical nature of gene expression data in order to help researchers to present deeper discussions on sample size and power analysis. In relation to these factors, one may also argue that, unlike the clinical sciences domain, there is a lack of accepted, comprehensively-validated methods tailored to gene expression data. Therefore, it is fundamental to promote deeper investigations and the generation of robust, user-friendly tools to assist researchers in their approaches to the discussion of these factors.Gene Expression Omnibus Database using this procedure [More investigations on the application and reporting of other important experimental procedures, such as sample pooling prior to hybridization, are required. It has been shown that pooling may significantly affect the quality of data analysis . Our revrocedure .Another fundamental analysis factor that continues deserving additional investigations is the application and reporting of P-values adjustments. Our review revealed that only 15 (10.7%) and 28 (18.4%) of the application and methodology papers respectively explicitly reported the P-value adjustment method applied. For instance, among the 141 application papers, 8 (5.7%) and 7 (5%) papers reported the use of Bonferroni and Benjamini-Hochberg adjustment methods respectively. With regard to the methodology papers : 14 (9.2%), 12 (7.9%) and 2 (1.3%) papers reported the application of Bonferroni, Benjamini-Hochberg and Hochberg adjustment methods respectively. The selection of a suitable adjustment method depends on the error rate that one wants to control . For exaOur study may be complemented by other reviews on the correct application of evaluation strategies, such as data sampling and significance interpretation . AdditioFuture work may involve an analysis of potentially interesting, significant time-dependent trends relating to statistical information reporting. This may allow the scientific community to assess emergent practices and patterns of knowledge generation and reporting in gene expression data analysis.Medical research disciplines, especially the area of clinical trials, have placed relatively more emphasis on the reporting of experimental design, statistical analysis implementation and the correct use of statistics in peer-reviewed publications -6 in comThe present survey indicates that the quality and coverage of information regarding experimental design and statistical analysis in gene expression data-driven studies deserve to be improved. The reporting of statistical power, sample size, normalisation and missing data estimation techniques requires a more rigorous treatment. Poor or incomplete reports may significantly affect our capacity to interpret results and assess the relevance and validity of research studies. Moreover, inadequate reporting of statistical analysis information may increase the likelihood of publishing spurious associations or predictions. By paying more attention to these factors authors will be facilitating quality assurance and peer-review processes, as well as the reproducibility of results, which are fundamental factors for the advancement of scientific and technological development, policy and decision making.Community-driven efforts such as the MIAME (Minimum Information About a Microrray Experiment) protocol  may be uThe author(s) declare that they have no competing interests.PJ and FA co-designed the study. PJ implemented it by retrieving and reviewing papers and constructing quantitative descriptions of the review. FA selected relevant papers and resources for the analysis. PJ and FA co-wrote the manuscript.The pre-publication history for this paper can be accessed here:Origin of papers- List of journalsClick here for file"}
{"text": "Statistical analysis methods and applications have traditionally placed relatively little attention to the graphical visualisation of data and information. Such techniques are fundamental not only for summarising the outcomes originating from statistical analyses, but also for facilitating the detection and assessment of relevant findings. Data-intensive application domains such as medical informatics, biomedical engineering and bioinformatics rely on the application of several statistical analysis and information visualisation techniques to support the generation, validation and integration of hypotheses. This requires an understanding of fundamental principles of data sampling, comparison and classification.S-Plus, R and SAS. Executable functions and macros are also provided for several graphical display methods.Heiberger and Holland have produced a comprehensive, well-presented review of essential statistical topics. Furthermore, they emphasise the application of graphical display techniques to summarise data and assess analysis results. This book explains why, how and when to apply particular techniques and tools. Another important feature is the incorporation of examples and exercises directly relevant to three leading statistical languages: After discussing basic statistical concepts, such as probability distributions and hypothesis testing, graphical display techniques are overviewed with an emphasis on scatterplot-based methods. An introductory chapter on inference illustrates how to compare two populations, determine sample sizes and measure goodness of data fit. Chapters dedicated to one-way analysis and multiple comparisons are followed by several chapters on linear, multiple and logistic regression. It also discusses two-way analysis of variance, design of experiments, bivariate and nonparametric statistics. The last section focuses on time series analysis.The authors, collaborators and publishers made a serious effort to achieve a high quality presentation of text, tables and figures (only black and white). Although the book concentrates on the application of S-Plus, R and SAS, it is a relevant resource to users of other software platforms.Overall, this is an excellent book for supporting advanced undergraduate courses on statistics or data analysis. Postgraduate students of machine learning and data mining topics may also be greatly benefited from reading most of its chapters. This is a valuable reference source to researchers from these and related areas including medical decision support, clinical engineering and bioinformatics."}
{"text": "For scientific, ethical and economic reasons, experiments involving animals should be appropriately designed, correctly analysed and transparently reported. This increases the scientific validity of the results, and maximises the knowledge gained from each experiment. A minimum amount of relevant information must be included in scientific publications to ensure that the methods and results of a study can be reviewed, analysed and repeated. Omitting essential information can raise scientific and ethical concerns. We report the findings of a systematic survey of reporting, experimental design and statistical analysis in published biomedical research using laboratory animals. Medline and EMBASE were searched for studies reporting research on live rats, mice and non-human primates carried out in UK and US publicly funded research establishments. Detailed information was collected from 271 publications, about the objective or hypothesis of the study, the number, sex, age and/or weight of animals used, and experimental and statistical methods. Only 59% of the studies stated the hypothesis or objective of the study and the number and characteristics of the animals used. Appropriate and efficient experimental design is a critical component of high-quality science. Most of the papers surveyed did not use randomisation (87%) or blinding (86%), to reduce bias in animal selection and outcome assessment. Only 70% of the publications that used statistical methods described their methods and presented the results with a measure of error or variability. This survey has identified a number of issues that need to be addressed in order to improve experimental design and reporting in publications describing research using animals. Scientific publication is a powerful and important source of information; the authors of scientific publications therefore have a responsibility to describe their methods and results comprehensively, accurately and transparently, and peer reviewers and journal editors share the responsibility to ensure that published studies fulfil these criteria. Scientific progress is driven by developing and testing novel hypotheses. Investigating these new ideas using appropriately and robustly designed experiments is fundamental to this process. The entire scientific community is also equally reliant on published research being transparently and accurately reported. Critical appraisal of scientific publications, for instance by peer review, is only possible if the methods and results of the studies are comprehensively reported. Accurate and transparent reporting is therefore vital to allow the reader to assess the methods of the study, and the reliability and importance of the scientific findings. This is particularly necessary for scientific research using animals, as poorly designed experiments and reporting omissions can raise both ethical and scientific concerns.The National Centre for the Replacement, Refinement and Reduction of Animals in Research (NC3Rs), established by the UK government in 2004, is an independent scientific organisation dedicated to finding innovative solutions to replace animals in research with non-animal alternatives, reduce the number of animals used in experiments, and minimise suffering and improve animal welfare by refining husbandry and procedures (the 3Rs). It is widely accepted that applying the 3Rs to experiments using animals is consonant with good scientific practice In order to assess the scope for improved experimental design, statistical analysis and reporting, and to further the implementation of the 3Rs, the NC3Rs has carried out a systematic survey of the quality of reporting, experimental design and statistical analysis of recently published biomedical research using laboratory animals. This paper reports the main findings and conclusions of this survey.A systematic search of the Medline and EMBASE databases was carried out to identify potentially relevant scientific papers published between January 1999 and March 2005 reporting original research on live rats, mice and non-human primates (referred to hereafter as \u2018primates\u2019) see . RodentsThe search identified studies covering a wide variety of experimental fields, including behavioural and diet studies, drug and chemical testing, and immunological experiments see , publishThe main experiment reported in each publication was identified and detailed information was collected on objective measures such as the numbers and characteristics of the animals used including the species, strain, age, sex, and weight. Details of the experimental design such as the size and number of experimental groups, how animals were assigned to experimental groups, how experimental outcomes were assessed, what statistical and analytical methods were used, were also recorded. This information was collected in two distinct stages. In phase 1, data were collected from all 271 papers, and in phase 2, a random sub-sample of 48 papers  was chosen from the 271 papers evaluated in phase 1, and assessed in more detail see . The majThe survey's first question addressed the fundamental premise of each scientific publication. A clear statement of the objective of the study, or the main hypothesis being tested, was described in the introduction by 95% of the 271 publications; the remaining 5% of the studies either did not describe the purpose of the study at all, or it was not clear to the assessors see . In 6% oIn 4% of the 271 included publications, the number of animals used in the main experiment assessed was not reported anywhere in the In order to investigate the proportion of papers that had multiple reporting omissions and to provide an overall assessment of the quality of reporting, we identified those papers which clearly stated the study hypothesis, reported three animal characteristics , and also reported the number of animals used; 59% of all 271 papers reported all this information see .Next we assessed the quality of experimental design, and in particular, how many papers had incorporated measures to reduce bias such as randomisation and blinding. Formal randomisation is a process used to allocate animals to experimental groups and is carried out to avoid any bias in assigning the animals to the treatment groups, making it more likely that the groups are comparable Qualitative scoring of an experimental observation or result by a researcher often involves a subjective assessment or judgement, and as such is more susceptible to bias than quantitative (numeric) measures (e.g. weight). Blinding, where the researcher does not know which treatment the animal has received when judging an experimental result, is an effective way of minimising this bias A design factor is an experimental variable (e.g. treatment) to which an animal is allocated by a researcher, ideally at random. Other variables that may influence the effect(s) of treatment(s) but that cannot be randomly assigned to the animals (such as sex or strain) can also be chosen by the researcher. Factorial and stratified experimental designs allow combinations of two or more design factors to be evaluated in one experiment at the same time in the same animals. These types of experimental design are efficient ways of maximising the information gained from each experiment, and can reduce the overall number of animals used whilst increasing the strength of the scientific findings Statistical methods were used to analyse the data in 91% of all 271 studies; ANOVA and t-tests were the methods used most frequently. However in 4% (10/247) of the studies that used statistics, it was unclear what statistical method had been used, i.e. a p-value or statistical significance was indicated, but no other methodological details were reported see . FurtherAlthough almost all (99%) of the 271 included studies presented numerical data see , only abThe NC3Rs survey has provided a detailed analysis of both the quality of the reporting and the quality of the experimental design and statistical analysis of experimental research using laboratory animals. The survey has identified a number of issues \u2013 particularly reporting omissions.Every study faces a trade-off between maximising power within the study itself  by minimising sample heterogeneity and maximising the generalisability of the findings . The number of papers assessed in this survey is approximately twice the number of studies included in similar surveys published to date (133 and 149 papers respectively) Nature and Science. Whilst it would be useful to know if there is a relationship between the quality of the papers surveyed and the impact factors of the journals they were published in, this analysis was not in the remit of this survey.Our study was carefully designed to ensure that the sample was representative of the target literature. The search strategy, which included species names, will have selected for a subset of papers, i.e. those that at least reported the species of animal used. Whilst our findings apply to this sample of papers, our results may in fact underestimate the extent of the reporting omissions. It is highly unlikely that our search terms or inclusion/exclusion criteria would have biased the sample to include a disproportionate number of poor quality publications from lower ranking journals. In fact, the search retrieved papers from a range of publication years (1999 \u2013 2005), covering a wide variety of research areas, and an extensive range of journals across the impact factor spectrum, including Scientific papers should report sufficient relevant information about the experimental objectives, animal characteristics, experimental methods used and results obtained, in order to critically assess the findings and both the scientific and ethical implications of a study, or to allow the work to be repeated. Surprisingly, some of the studies surveyed either did not describe the purpose of the study at all or it was unclear to the assessors, and thus presumably also to any non-specialist reader. In addition, in some of the studies surveyed it was unclear whether one or more experiments were being described, and the experimental unit  was not clearly identified.Many of the studies surveyed omitted details about the strain, sex, age and weight of the animals used. These are all factors that can potentially influence experimental results and are therefore scientifically important Many journals offer supplementary online space  not only for methodological information but also for additional results and tables. This information resource was considered, where it was available, for the papers surveyed. The availability of this resource negates the argument that the lack of detail in published papers is primarily due to a lack of space. Studies have found that some experimental details  are extensively discussed in the body of the paper, whilst information about animal characteristics, sample sizes etc are scantily provided or are absent In some of the included publications, the number of animals used was not reported anywhere in the Power analysis or other very simple calculations, which are widely used in human clinical trials and are often expected by regulatory authorities in some animal studies, can help to determine an appropriate number of animals to use in an experiment in order to detect a biologically important effect if there is one The assessment of experimental design found that random allocation of animals to treatment groups was reported in only a very small proportion of all the studies surveyed. Randomisation reduces selection bias, increases the validity of the findings and, in principle, is always an appropriate and desirable aspect of good experimental design when two or more treatments are compared We cannot rule out that some of the studies surveyed may have used randomisation where appropriate, but did not report using it. If this was the case, then this kind of reporting omission can easily be rectified. But if not, incomplete reporting masks potentially flawed experimental methods.When humans have to make observations there is always the possibility of bias\u201d \u201cReviews of animal research in the field of emergency medicine found that studies which did not use randomisation and blinding to reduce bias when comparing two or more experimental groups, were significantly more likely to find a difference between the treatment groups Statistical methods are important for calculating the degree of confidence in, for example, the reproducibility and general validity of experimental results, and were used and reported by the majority of studies. The majority of the studies that used and described a statistical method were judged to have used a correct statistical method. Whilst the majority of papers that used a statistical method described it and reported the numerical results with an error measure, many papers did not. Reporting the statistical method used together with an indication of the measure of variation or uncertainty is essential for interpreting any results, and has implications for the reliability and generalisability of the findings to other species and systems  Our findings indicate that there are problems both with the transparency of reporting and the robustness of the statistical analysis of almost 60% of the publications surveyed. In many papers, due to the lack of information detailing the statistical methods it was difficult to judge whether or not the statistical analysis were appropriate, or if data had been efficiently extracted and analysed.These issues are not new, as previous surveys of publications describing animal research and assessing specific aspects of experimental design, statistical analysis and reporting, have shown The problems with experimental design and reporting that we have identified are also in line with similar reviews of the literature in various other scientific and clinical research areas Standards developed for reporting clinical research have improved the quality and transparency of reporting of clinical trials and have been adopted by many leading medical journals as part of their instructions to authors This is the largest and most comprehensive survey of this kind carried out to date. We provide evidence that many peer-reviewed, animal research publications fail to report important information regarding experimental and statistical methods. Whilst our findings are limited to experimental studies using rodents and primates carried out in UK and US laboratories, this is the statistical population that dominates the biomedical research literature, so our results are important and indeed, indicate cause for concern.Scientific publication is the method by which research has traditionally been described and the results communicated and it remains a powerful and important source of information. The authors of scientific publications therefore have a responsibility to describe their experimental and statistical methods and results comprehensively, accurately and transparently, and journal editors share the responsibility to ensure that published studies fulfil these criteria. This is particularly pertinent for research involving animals, as poorly designed and reported experiments raise ethical as well as scientific concerns. Whilst we recognise that in some studies, not all of the details we assessed  will necessarily have an important impact on the overall findings, there are principles at stake \u2013 namely the transparency, reproducibility, and reliability of scientific publications. We are simply arguing for the inclusion of all relevant information that will allow a suitably skilled reader to assess, analyse, and repeat the study's findings.There are many opportunities for the scientific community to improve both the experimental design and the quality of reporting of biomedical research using animals. Serious efforts are needed to improve both the quality of experimental design and the quality of reporting in order to make research articles better suited to the needs of readership. The NC3Rs has identified a number of ways of helping to make these improvements. Raising awareness that these problems exist will be the first step in tackling these fundamental issues. In addition, working with researchers, journal editors and funding bodies, the NC3Rs is building on the results of this survey by developing a set of reporting guidelines to assist researchers, journal editors and research funding bodies to take appropriate steps to improve the quality and transparency of reporting in the scientific publications with which they are associated.An information specialist searched the Medline and EMBASE databases for all potentially relevant English language scientific papers published between 1 January 1999 and 31 March 2005, reporting original research on live rats, mice and non-human primates (referred to hereafter as \u2018primates\u2019) carried out in publicly funded research establishments in the UK and the USA. (See supplementary online information for search terms).Databases were searched using the following search terms:1. exp MICE 14. Hominidae2. usa.in. 15. 12 or 133. 1 and 2 16. 15 not 144. exp great britain17. Pan troglodytes5. england.in.18. 16 or 176. uk.in.19. exp CEBIDAE7. 4 or 5 or 620. exp MACACA8. 1 and 721. exp Papio9. exp RATS22. 18 or 19 or 20 or 2110. 9 and 223. 22 and 711. 9 and 724. 22 and 212. PRIMATES25. 3 or 8 or 10 or 11 or 23 or 2413. HaplorhiniAn upper limit on the number of papers that would be included in the survey was set at 300 \u2013 made up of approximately 50 papers for each of three species and two countries. This limit was based on pragmatic considerations that included the time taken to assess and extract information from each publication. The sample size for surveys such as this is not normally based on formal statistical considerations, as there are no primary hypotheses being tested. There was therefore no need to formally power this study.A sample of the most recently indexed abstracts was selected from the total number of potentially relevant publications identified in the database search. We chose the most recently indexed papers from all the papers identified in the search as an unbiased way of selecting the publications. When a journal is added to a database and becomes indexed, all previous issues are also indexed, enabling us to have a spread of publication years in the sample. The abstracts were appraised and publications were selected or rejected based on the exclusion criteria listed below see . The fulAll relevant English language studies published between January 1999 and March 2005, reporting original scientific research carried out in UK or USA publicly funded research establishments and whose source(s) of funding were UK- or USA- publicly funded bodies such as universities, charities or other non-industry funding, such as the NIH, USPHS, MRC, BBSRC, etc., were included. Studies that had any commercial/industry funding were included only if the majority of the other funding sources were UK or USA public funding sources and the work was carried out in a UK or USA publicly funded research establishment. Studies that had any non-UK or non-USA public funding were included only if the majority of the other funding sources were from UK or USA public funding sources and the work was carried out in a UK or USA publicly funded research establishment. Studies whose funding source was not stated were included only if the research was carried out at a UK or USA publicly funded institution. Note was made that the funding source information was not reported.We chose to limit our investigation to publicly funded research in the USA and UK because the funding for this study came from both US and UK publicly funded bodies, the two countries are highly influential in setting the scientific agenda, and because there should theoretically be no constraints on reporting publicly funded research for reasons of confidentiality or commercial sensitivity.The survey was restricted to original scientific research studies using mice, rats, and primates. The experiments had to use live animals  and state that they had used UK Animals [Scientific Procedures] Act 1986 (ASPA) licensed interventions, or equivalent USA institutional guidelines for animal care and use. Rodents are the most widely used animals and primates are the most high profile and \u2018ethically sensitive\u2019 group (for convenience primates are designated a species here). Other species or groups such as fish, birds, rabbits and guinea-pigs are either used in small numbers or in more specialised areas of research. The sample sizes for these species would have been too small to draw any strong inferences about the reporting standards in these research areas. In addition, every such study that was included would reduce the statistical power of the study for drawing inferences about reporting and experimental design standards studies involving more widely used species.In vitro studies, studies using tissue from animals killed before use, or that did not involve experimental procedures/testing, technical or methodological papers not involving actual experiments using animals, review articles, genetics papers reporting linkages of genes, studies with no abstract, and brief communications with no methods, were also excluded. No more than two papers were included from any single laboratory to ensure that the survey results were not unduly influenced by the bad \u2013 or good \u2013 practice of one particularly productive laboratory.Publications were excluded if industry/commercial funding was the sole source of funding, or if the research was solely funded by an organisation not based in the USA or UK. The unit of analysis was the \u2018main experiment\u2019 reported in the paper. Many papers report the results of more than one experiment; accordingly, the number of experiments per paper was noted. For those studies that reported more than one experiment, the experiment that used the most animals was considered the \u2018main experiment\u2019. Details and results from the main experiment were used to complete the data collection sheets. Although the specific details described in this report relate to a single experiment assessed in each publication, the whole paper was searched for information relevant to that experiment, and to the way the experimental work was conducted and analysed in general.The survey was carried out in two steps identified as phases 1 and 2.In phase 1, the full texts of the 271 included studies were divided equally between two assessors who were experienced statisticians (one from the UK and one from the USA). Assessor 1 analysed the even numbered papers, assessor 2 analysed the odd numbered papers extracting the relevant information to complete the Quality of Reporting checklist see . Any supIn phase 2, a random sub-sample of 48 papers chosen from the 271 papers evaluated in phase 1, stratified by animal and by country (i.e. 8 papers\u00d73 species\u00d72 countries), was assessed. This number was selected as an appropriately sized sub-sample of the papers assessed in phase 1 based, as was the case for phase 1, on the time necessary to complete the very detailed reports. The statistical methods and analysis of the papers were assessed to determine whether the experimental design and the statistical analysis were appropriate. This involved the expert judgement of two statisticians, both of whom assessed all 48 papers using the Quality of Experimental Design and Analysis checklist see . The maiAny disagreements or differences in interpretation of the checklists were resolved by consultation and discussion with a third assessor and, where necessary, the relevant studies were re-analysed. To allow for possible discrepancies between the two assessments, in phase 2 the mean of the results from the two statisticians are reported in all data summary tables. Overall agreement between the assessors was assessed once during each phase of the survey \u2013 In phase 1 both assessors applied the relevant checklist to the same sub-set of 30 (of 271) papers and their analyses compared, and in phase 2, all 48 papers were used to assess agreement see .Supporting Information S1Survey Checklists(0.17 MB PDF)Click here for additional data file."}
{"text": "Pseudoreplication occurs when observations are not statistically independent, but treated as if they are. This can occur when there are multiple observations on the same subjects, when samples are nested or hierarchically organised, or when measurements are correlated in time or space. Analysis of such data without taking these dependencies into account can lead to meaningless results, and examples can easily be found in the neuroscience literature.A single issue of Nature Neuroscience provided a number of examples and is used as a case study to highlight how pseudoreplication arises in neuroscientific studies, why the analyses in these papers are incorrect, and appropriate analytical methods are provided. 12% of papers had pseudoreplication and a further 36% were suspected of having pseudoreplication, but it was not possible to determine for certain because insufficient information was provided.p-values are reported. This information should be a requirement for all publications.Pseudoreplication can undermine the conclusions of a statistical analysis, and it would be easier to detect if the sample size, degrees of freedom, the test statistic, and precise  With a sample size of ten rats, there should only be eight degrees of freedom  associated with this statistical test. The concept of degrees of freedom is perhaps not the most intuitive statistical idea, but it can be thought of as the number of independent data points that can be used to estimate population parameters , and whenever something is estimated from the data, a degree of freedom is lost. Therefore the total df is equal to the sample size only if all the samples are independent: measuring the height of ten unrelated individuals provides ten independent pieces of information about the average height of the population from which they were drawn; measuring the height of one person ten times provides only one independent piece of information about the population. In the above rat example, the three observations from each rat (from the three days of testing) were treated as independent samples, and hence the 28 degrees of freedom arose from thinking that the fifteen data points in each group contain independent information about the effect of the treatment . Incidentally, the correct analysis with a t-statistic of 2.1 on 8 df has a corresponding p-value of 0.069. In addition to the incorrect degrees of freedom, there is also the problem of false precision, which is discussed at greater length below  are independent, once the effects of all the other explanatory variables have been taken into account. In addition, other variables that are not included in the analysis (e.g. the order in which the samples were obtained) must not influence the outcome or be correlated with the residuals. The remainder of the introduction will define some commonly used terms, illustrate why pseudoreplication is problematic, and finally, discuss the four situations in which it can arise.sample, replicate, observation, experimental unit, n, and experiment have overlapping meanings, are often used interchangeably, and can have different meanings based on the context. An experimental unit is defined as the smallest entity that can be randomly assigned to a different treatment condition 66].F-statistic so that the actual \u03b1-level is closer to the nominal \u03b1-level . Modern statistical methods can model different types of variance-covariance relationships directly, making ad hoc adjustments to degrees of freedom unnecessary. Kristensen and Hansen provide an excellent introduction and a comparison of different analyses on rats [One important drawback of the repeated measures ANOVA is that the assumptions of compound symmetry and sphericity are rarely met. These terms refer to the correlation structure of the data. Returning to the rat rotarod example, the correlation of the outcome variable at each combination of time points can be calculated . If these three correlations are all similar, and in addition the variances at each day are similar (homogeneity assumption), then the data are said to be compound symmetrical. If differences rather than correlations between each combination of time points are calculated, then the data are said to be spherical if these difference scores all have the same variance , Crawle on rats ,70 and F on rats , and a m on rats .Mixed models and their extensions  are the preferred methods for analysing the type of data discussed in this paper and are already being used to model litter effects  and hiert-test; Table df = 5 + 5 - 2 = 8, and not the 28 that the authors reported. Even if degrees of freedom are not reported, it is still possible to determine whether pseudoreplication was handled correctly using standard software such as OpenOffice Calc or MicroSoft Excel. Both of these programmes have a TDIST function which can calculate a p-value given a t-statistic, degrees of freedom, and whether the test is one or two-sided. If the dfs were not reported for the rotarod example, we could check the results with =TDIST, where 2.1 is the reported t-statistic , 8 is the correct number of degrees of freedom, and 2 indicates that it is a two-tailed test. The result is p = 0.07, which does not correspond to the reported value of p = 0.045. Substituting 28 df for 8 in the above command does give p = 0.045, and allows us to conclude that the reported analysis is incorrect. The same procedure can be carried out in R using the command pt*2 .When the necessary information is provided, it is easy to check whether pseudoreplication has been handled correctly, for this one needs to know the degrees of freedom associated with common statistical tests, and these are provided in Table F-tests using the =FDIST function in OpenOffice/Excel and pf in R/S-Plus. This analysis may not be of much use if the authors only report whether the p-value was greater or less than 0.05, but it does provide a method for checking partially reported results.A similar procedure can be carried out for ANOVA The problem of pseudoreplication has been recognised for many years in ecology and related areas , as welln), degrees of freedom, the test statistic, and precise p-values to be reported, allowing many of these errors to be detected at a glance. This information also allows for a more detailed analysis if required, either by editors, reviewers, or other readers.Statistical competence will not happen overnight, but stricter reporting requirements will make it easier to detect pseudoreplication, and this requires the sample size  and research background are primarily in experimental neuroscience. SEL also holds a masters in Computational Biology and currently works as a Senior Research Statistician in the pharmaceutical industry.by Christopher D. Fiorillofiorillo@kaist.ac.krEmail: Address: Department of Bio and Brain Engineering, Korea Advanced Institute of Science and Technology, Daejeon, KoreaLazic makes many useful points about the misuse of statistics. However, his article on pseudoreplication does not demonstrate a clear understanding of the goals and issues at stake in primate neurophysiology, nor does it clarify the importance of independence in statistical tests.Lazic's criticisms of my paper  generaliThe statistic comparison that the author has questioned (in figures three c and four c) was designed to test whether there is a difference in neuronal firing rates (across the recorded population of neurons) between responses to juice reward depending on when juice was delivered following a conditioned stimulus. If one knows the subject matter and reads my paper for more that just statistical methods, then one has a strong prior expectation that the statistical comparisons made in figures three c and four c will be highly significant, and thus the statistical significance is not of much interest. The interesting point of the figures, as described in the main text, is that although significant, the differences are surprisingly small relative to the very large difference seen in comparing either of these responses to unpredicted reward. The statistical significance that was quantified in these figures was thus superfluous and could have been omitted entirely. There were no statistical tests performed on the important effect because it was so large as to be obvious (see mean \u00b1 sem firing rates in figures three b and four b). To paraphrase a colleague who is an excellent scientist but a reluctant statistician, it passed the \"bloody ... obvious test.\"Lazic also makes the point that \"neurons of the same brain are not independent.\" If this statement does not signify confusion on the part of its author, it may nonetheless confuse readers. There is an important difference between physical or causal independence on the one hand, and logical or statistical independence on the other. Neurons in the same brain may be physically or causally related. However, that fact in itself does not necessarily require that the neurons are or are not statistically or logically independent. Statistical independence is all that matters with respect to statistical tests, and statistical dependencies could be present regardless of whether the neurons are in the same brain or different brains.A second critical error that is often made is to confuse the functioning of a physical system with our knowledge of that system. Statistics and hypotheses are derived from the latter. \"Statistical independence\" means that we, the people performing the statistical test, do not have knowledge of how two pieces of data (such as the firing rates of two neurons) are related. We believe that neurons within a defined population, clustered together in the same region of the brain, are likely to have direct or indirect physical interactions with one another, and likewise, to display some sort of correlations in their firing rates. But at the outset of a typical study, we do not know what these correlations are, and thus it is rational for us to treat the data from each neuron as independent. By contrast, if we already knew neurons within clusters of known dimensions to be tightly coupled to one another through gap junctions, then we would probably try to avoid recording from neurons within the same cluster, and when we did obtain data from neurons in the same cluster, we might average it together before doing an analysis of responses across clusters. The data from my neurons was \"statistically independent\" because, at the time that I did the statistical test, I was ignorant of any relevant relationship between the firing rates of discrete neurons. Given a different state of knowledge, statistical independence may not apply and another type of statistical test may be more appropriate.Probability Theory, the Logic of Science, in which E.T. Jaynes discusses these issues and other \"pathologies of orthodox statistics other \"path \" [I strongly recommend  \"path \" . It will \"path \" .C.D.F. was supported by a \"World Class University\" Grant from the Korea Science and Engineering Foundation (R32-2008-000-10218-0).By Takahisa Furukawa, M.D and Ph.D.furukawa@obi.or.jpE-mail: Address: Department of Developmental Biology, Osaka Bioscience Institute, 6-2-4 Furuedai, Suita, Osaka, 565-0874, JapanMany life science studies employ histological analyses, frequently immunostaining of tissue sections, and incorporate this image data into papers. Although it used to be that only the most representative images were displayed in paper figures, quantitative analysis along with statistical analysis of data are often required to obtain an analytical conclusion on immunostaining image data for publication. The author, Lazic, mentioned in his paper that the reason he picked Nature Neuroscience in particular for his case study is that this journal has detailed instructions for statistical analyses. As Lazic mentioned, authors basically examine their results to test whether or not their data is statistically significant, and present their data with statistical analysis results in their papers. This means that this journal requires high quality data and expects researchers conduct their studies according to these requirements. In Lazic's paper, the author picked multiple examples, In including our statistical analysis of our electron microscopy (EM), and indicated that the statistical analysis method used in our paper was inappropriate . Lately,In order to confirm this EM observation, we also performed 3D electron tomography analysis and described the result in the paper. Furthermore, the results from other experiments including electroretinogram and optokinetic responses also support our conclusion that photoreceptor synaptic terminal formation is impaired in the pikachurin null retina. Ultimately, the Lazic paper points out some very important issues in conducting appropriate statistical analysis for biological studies. We understand that we have to be very careful in choosing a suitable statistical method for analyzing our data in the future, however, the Lazic paper does not affect the conclusions in our paper.Classification of manuscripts. Summary of the papers in the August 2008 issue of Nature Neuroscience.Click here for file"}
{"text": "Beilstein Journal of Organic Chemistry a flavor of the synthetic challenges of liquid crystal research, as well as interdisciplinary aspects from material science, physics, physical and theoretical chemistry. It is a great pleasure to serve as a guest editor for this thematic series, where leading experts from all over the world have contributed original research papers and accounts that deal with diverse topics such as phthalocyanine-fullerene hybrid materials for photovoltaic devices, functional metallomesogens, coaxial electrospinning of liquid crystal-containing microfibers, banana-discotic hybrid systems, ionic liquid crystals, relations between molecular length distribution and formation of smectic phases, nematic phase engineering by using V-shaped molecules, saddle-shaped columnar systems displaying anomalous odd-even effects, theoretical studies on the origin of chirality transfer in liquid crystalline host-guest systems, liquid crystalline carboranes and dyes and discotic phenanthrene quinones. Many new exciting discoveries in this diverse research area are to be expected in the near future and our aim with this Thematic Series is to attract a new audience to this topic.Since their discovery in 1888 by the botanist Friedrich Reinitzer, who studied the melting behavior of cholesteryl benzoates, liquid crystals have developed from a mere curiosity to a highly interdisciplinary research field, with LC displays being the most important application to date . HoweverSabine LaschatGuest Editor"}
{"text": "International Committee of Medical Journal Editors (ICMJE) warned against sole reliance on NHST to substantiate study conclusions and suggested supplementary use of confidence intervals (CI). Our objective was to evaluate the extent and quality in the use of NHST and CI, both in English and Spanish language biomedical publications between 1995 and 2006, taking into account the International Committee of Medical Journal Editors recommendations, with particular focus on the accuracy of the interpretation of statistical significance and the validity of conclusions.The null hypothesis significance test (NHST) is the most frequently used statistical method, although its inferential validity has been widely criticized since its introduction. In 1988, the Original articles published in three English and three Spanish biomedical journals in three fields  were considered for this study. Papers published in 1995-1996, 2000-2001, and 2005-2006 were selected through a systematic sampling method. After excluding the purely descriptive and theoretical articles, analytic studies were evaluated for their use of NHST with P-values and/or CI for interpretation of statistical \"significance\" and \"relevance\" in study conclusions.Among 1,043 original papers, 874 were selected for detailed review. The exclusive use of P-values was less frequent in English language publications as well as in Public Health journals; overall such use decreased from 41% in 1995-1996 to 21% in 2005-2006. While the use of CI increased over time, the \"significance fallacy\"  appeared very often, mainly in journals devoted to clinical specialties (81%). In papers originally written in English and Spanish, 15% and 10%, respectively, mentioned statistical significance in their conclusions.Overall, results of our review show some improvements in statistical management of statistical results, but further efforts by scholars and journal editors are clearly required to move the communication toward ICMJE advices, especially in the clinical setting, which seems to be imperative among publications in Spanish. H0 - which, generally speaking, establishes that certain parameters do not differ from each other. He was the inventor of the \"P-value\" through which it could be assessed [significance testing theory considered the p-value as an index to measure the strength of evidence against the null hypothesis in a single experiment. The father of NHST never endorsed, however, the inflexible application of the ultimately subjective threshold levels almost universally adopted later on .The null hypothesis statistical testing (NHST) has been the most widely used statistical approach in health research over the past 80 years. Its origins dates back to 1279 [hypothesis statistical testing. The Neyman-Pearson approach is based on the notion that one out of two choices has to be taken: accept the null hypothesis taking the information as a reference based on the information provided, or reject it in favor of an alternative one. Thus, one can incur one of two types of errors: a Type I error, if the null hypothesis is rejected when it is actually true, and a Type II error, if the null hypothesis is accepted when it is actually false. They established a rule to optimize the decision process, using the p-value introduced by Fisher, by setting the maximum frequency of errors that would be admissible.A few years later, Jerzy Neyman and Egon Pearson considered the Fisherian approach inefficient, and in 1928 they published an article  that wouH0, is known. With these data the P-value is computed. Finally, the null hypothesis is rejected when the obtained P-value is smaller than a certain comparative threshold  and it is not rejected if P is larger than the threshold.The null hypothesis statistical testing, as applied today, is a hybrid coming from the amalgamation of the two methods . As a maThe first reservations about the validity of the method began to appear around 1940, when some statisticians censured the logical roots and practical convenience of Fisher's P-value . SignifiAlthough there are very comprehensive works on the topic , we list\u2022 The P-values are used as a tool to make decisions in favor of or against a hypothesis. What really may be relevant, however, is to get an effect size estimate  rather than rendering dichotomous true/false verdicts -11.\u2022 The P-value is a conditional probability of the data, provided that some assumptions are met, but what really interests the investigator is the inverse probability: what degree of validity can be attributed to each of several competing hypotheses, once that certain data have been observed .\u2022 The two elements that affect the results, namely the sample size and the magnitude of the effect, are inextricably linked in the value of p and we can always get a lower P-value by increasing the sample size. Thus, the conclusions depend on a factor completely unrelated to the reality studied  ,14.\u2022 Those who defend the NHST often assert the objective nature of that test, but the process is actually far from being so. NHST does not ensure objectivity. This is reflected in the fact that we generally operate with thresholds that are ultimately no more than conventions, such as 0.01 or 0.05. What is more, for many years their use has unequivocally demonstrated the inherent subjectivity that goes with the concept of P, regardless of how it will be used later -17.\u2022 In practice, the NHST is limited to a binary response sorting hypotheses into \"true\" and \"false\" or declaring \"rejection\" or \"no rejection\", without demanding a reasonable interpretation of the results, as has been noted time and again for decades. This binary orthodoxy validates categorical thinking, which results in a very simplistic view of scientific activity that induces researchers not to test theories about the magnitude of effect sizes -20.Despite the weakness and shortcomings of the NHST, they are frequently taught as if they were the key inferential statistical method or the most appropriate, or even the sole unquestioned one. The statistical textbooks, with only some exceptions, do not even mention the NHST controversy. Instead, the myth is spread that NHST is the \"natural\" final action of scientific inference and the only procedure for testing hypotheses. However, relevant specialists and important regulators of the scientific world advocate avoiding them.International Committee of Medical Journal Editors  incorporates the following recommendation to authors of manuscripts submitted to medical journals: \"When possible, quantify findings and present them with appropriate indicators of measurement error or uncertainty . Avoid relying solely on statistical hypothesis testing, such as P-values, which fail to convey important information about effect size\" [Taking especially into account that NHST does not offer the most important information , many experts recommend the reporting of point estimates of effect sizes with confidence intervals as the appropriate representation of the inherent uncertainty linked to empirical studies -25. Sincct size\" .As will be shown, the use of confidence intervals (CI), occasionally accompanied by P-values, is recommended as a more appropriate method for reporting results. Some authors have noted several shortcomings of CI long ago . In spitAlthough twenty years have passed since the ICMJE began to disseminate such recommendations, systematically ignored by the vast majority of textbooks and hardly incorporated in medical publications , it is isignificance fallacy is present, an inertial deficiency that consists of attributing -- explicitly or not -- qualitative importance or practical relevance to the found differences simply because statistical significance was obtained.In addition to assessing the adherence to the above cited statistical recommendation proposed by ICMJE relative to the use of P-values, we consider it of particular interest to estimate the extent to which the Many authors produce misleading statements such as \"a significant effect was (or was not) found\" when it should be said that \"a statistically significant difference was (or was not) found\". A detrimental consequence of this equivalence is that some authors believe that finding out whether there is \"statistical significance\" or not is the aim, so that this term is then mentioned in the conclusions . This meInternational Committee of Medical Journal Editors recommendations, with particular focus on accuracy regarding interpretation of statistical significance and the validity of conclusions.The general objective of the present study is to evaluate the extent and quality of use of NHST and CI, both in English- and in Spanish-language biomedical publications, between 1995 and 2006 taking into account the We reviewed the original articles from six journals, three in English and three in Spanish, over three disjoint periods sufficiently separated from each other  as to properly describe the evolution in prevalence of the target features along the selected periods.Obstetrics & Gynecology and Revista Espa\u00f1ola de Cardiolog\u00eda); Public Health and Epidemiology  and the area of general and internal medicine . Five of the selected journals formally endorsed ICMJE guidelines; the remaining one (Revista Espa\u00f1ola de Cardiolog\u00eda) suggests observing ICMJE demands in relation with specific issues. We attempted to capture journal diversity in the sample by selecting general and specialty journals with different degrees of influence, resulting from their impact factors in 2007, which oscillated between 1.337 (MC) and 9.723 (BMJ). No special reasons guided us to choose these specific journals, but we opted for journals with rather large paid circulations. For instance, the Spanish Cardiology Journal is the one with the largest impact factor among the fourteen Spanish Journals devoted to clinical specialties that have impact factor and Obstetrics & Gynecology has an outstanding impact factor among the huge number of journals available for selection.The selection of journals was intended to get representation for each of the following three thematic areas: clinical specialties  analytical papers, or (3) articles that address theoretical, methodological or conceptual issues. An article was regarded as analytical if it seeks to explain the reasons behind a particular occurrence by discovering causal relationships or, even if self-classified as descriptive, it was carried out to assess cause-effect associations among variables. We classify as theoretical or methodological those articles that do not handle empirical data as such, and focus instead on proposing or assessing research methods. We identified 169 papers as purely descriptive or theoretical, which were therefore excluded from the sample. Figure Forty-nine of the 1,092 selected papers were eliminated because, although the section of the article in which they were assigned could suggest they were originals, detailed scrutiny revealed that in some cases they were not. The sample, therefore, consisted of 1,043 papers. Each of them was classified into one of three categories: (1) purely statistically significant. It was deemed that an article uses CI if it explicitly contained at least one confidence interval, but not when it only provides information that could allow its computation . Probability intervals provided in Bayesian analysis were classified as confidence intervals  since what is really of interest here is whether or not the authors quantify the findings and present them with appropriate indicators of the margin of error or uncertainty.To estimate the adherence to ICMJE recommendations, we considered whether the papers used P-values, confidence intervals, and both simultaneously. By \"the use of P-values\" we mean that the article contains at least one P-value, explicitly mentioned in the text or at the bottom of a table, or that it reports that an effect was considered as substantive, relevant or important. The use of the term \"significant effect\" when it is only appropriate as a reference to a \"statistically significant difference,\" can be considered a direct expression of the significance fallacy [In addition we determined whether the \"Results\" section of each article attributed the status of \"significant\" to an effect on the sole basis of the outcome of a NHST . Similarly, we examined whether the term \"significant\" (applied to a test) was mistakenly used as synonymous with  fallacy  and, as We also assessed whether the \"Conclusions,\" which sometimes appear as a separate section in the paper or otherwise in the last paragraphs of the \"Discussion\" section mentioned statistical significance and, if so, whether any of such mentions were no more than an allusion to results.To perform these analyses we considered both the abstract and the body of the article. To assess the handling of the significance issue, however, only the body of the manuscript was taken into account.The information was collected by four trained observers. Every paper was assigned to two reviewers. Disagreements were discussed and, if no agreement was reached, a third reviewer was consulted to break the tie and so moderate the effect of subjectivity in the assessment.Clinical Medicine, Primary Care, and International Journal of Epidemiology) was performed. The results of this pilot study were satisfactory. Our results are reported using percentages together with their corresponding confidence intervals. For sampling errors estimations, used to obtain confidence intervals, we weighted the data using the inverse of the probability of selection of each paper, and we took into account the complex nature of the sample design. These analyses were carried out with EPIDAT [In order to assess the reliability of the criteria used for the evaluation of articles and to effect a convergence of criteria among the reviewers, a pilot study of 20 papers from each of three journals  were found to be analytic, while the remainders were purely descriptive or of a theoretical and methodological nature. Five of them did not employ either P-values or CI. Consequently, the analysis was made using the remaining 869 articles.The percentage of articles that use only P-values, without even mentioning confidence intervals, to report their results has declined steadily throughout the period analyzed Table . The perWhile the percentage of articles referring implicitly or explicitly to significance in an ambiguous or incorrect way - that is, incurring the significance fallacy -- seems to decline steadily, the prevalence of this problem exceeds 69%, even in the most recent period. This percentage was almost the same for articles written in Spanish and in English, but it was notably higher in the Clinical journals (81%) compared to the other journals, where the problem occurs in approximately 7 out of 10 papers Table . The kapThe percentage of papers mentioning a numerical finding as a conclusion is similar in the three periods analyzed Table . ConcernA similar pattern is observed, although with less pronounced differences, in references to the outcome of the NHST (significant or not) in the conclusions Table . The perThere are some previous studies addressing the degree to which researchers have moved beyond the ritualistic use of NHST to assess their hypotheses. This has been examined for areas such as biology , organizall findings as potentially eloquent. This is probably the frequent denunciations of the tendency for those papers presenting a significant positive result to receive more favorable publication decisions than equally well-conducted ones that report a negative or null result, the so-called publication bias [At first glance it is puzzling that, after decades of questioning and technical warnings, and after twenty years since the inception of ICMJE recommendation to avoid NHST, they continue being applied ritualistically and mindlessly as the dominant doctrine. Not long ago, when researchers did not observe statistically significant effects, they were unlikely to write them up and to report \"negative\" findings, since they knew there was a high probability that the paper would be rejected. This has changed a bit: editors are more prone to judge ion bias -50. ThisThe results did not show a significant difference between groups; however, with a larger sample size, this difference would have probably proved to be significant\". The problem with this statement is that it is true; more specifically, it will always be true and it is, therefore, sterile. It is not fortuitous that one never encounters the opposite, and equally tautological, statement: \"A significant difference between groups has been detected; however, perhaps with a smaller sample size, this difference would have proved to be not significant\". Such a double standard is itself an unequivocal sign of the ritual application of NHST.Consequently, even though it was not an aim of our study, we found many examples in which statistical significance was not obtained. However, many of those negative results were reported with a comment of this type: \"significance fallacy is huge.Although the declining rates of NHST usage show that, gradually, ICMJE and similar recommendations are having a positive impact, most of the articles in the clinical setting still considered NHST as the final arbiter of the research process. Moreover, it appears that the improvement in the situation is mostly formal, and the percentage of articles that fall into the The contradiction between what has been conceptually recommended and the common practice is sensibly less acute in the area of Epidemiology and Public Health, but the same pattern was evident everywhere in the mechanical way of applying significance tests. Nevertheless, the clinical journals remain the most unmoved by the recommendations.The ICMJE recommendations are not cosmetic statements but substantial ones, and the vigorous exhortations made by outstanding authorities  are not In some cases, the role of CI is not as clearly suitable , butThe inherent resistance to change old paradigms and practices that have been entrenched for decades is always high. Old habits die hard. The estimates and trends outlined are entirely consistent with Alvan Feinstein's warning 25 years ago: \"Because the history of medical research also shows a long tradition of maintaining loyalty to established doctrines long after the doctrines had been discredited, or shown to be valueless, we cannot expect a sudden change in this medical policy merely because it has been denounced by leading connoisseurs of statistics \".It is possible, however, that the nature of the problem has an external explanation: it is likely that some editors prefer to \"avoid troubles\" with the authors and vice versa, thus resorting to the most conventional procedures. Many junior researchers believe that it is wise to avoid long back-and-forth discussions with reviewers and editors. In general, researchers who want to appear in print and survive in a publish-or-perish environment are motivated by force, fear, and expedience in their use of NHST . FurtherJournal of the American Medical Association published a bibliometric study [British Medical Journal and Annals of Internal Medicine. The data analysis is characterized by methodological orthodoxy. The authors just use chi-square tests without any reference to CI, although the NHST had been repeatedly criticized over the years by two of the authors:For example, ic study  discussiDouglas Altman, an early promoter of confidence intervals as an alternative , and SteThe present effort is certainly partial in at least two ways: it is limited to only six specific journals and to three biennia. It would be therefore highly desirable to improve it by studying the problem in a more detailed way , and continuing the review of prevailing patterns and trends.Overall, results of our review show some improvements in statistical management of statistical results, but further efforts by scholars and journal editors are clearly required to move the communication toward ICMJE advices, especially in the clinical setting, which seems to be imperative among publications in Spanish.The authors declare that they have no competing interests.LCSA designed the study, wrote the paper and supervised the whole process; PSG coordinated the data extraction and carried out statistical analysis, as well as participated in the editing process; AFS extracted the data and participated in the first stage of statistical analysis; all authors contributed to and revised the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2288/10/44/prepub"}
{"text": "This review is atypical by design. It has used a synthesis of the available literature relating to the aetiology of AIS to draw attention to the lack of progress in this area despite intensive research for more than 100 years. The review has argued that if progress is to be made in this area then significant changes in approach to the problem must be made. Such changes have been outlined and major areas of potential focus identified with the intention of creating debate and discussion. There is no doubt that people are working hard in this area of research but this review has deliberately attempted to question its achievements and future directions.\"It is not enough to be busy, so are the ants. The question is what are you so busy about.'Walden \u2013 Henry David Thoreau This paper is not a typical review of the literature that might be expected when considering a review of adolescent idiopathic scoliosis (AIS). In this electronic age, using keywords such as 'scoliosis review' in Google or a medical database quickly reveals an enormous amount of material on this topic which should satisfy those people seeking fundamental, factual material (1478 'hits' by simply typing just 'scoliosis review' into PubMed database) [Scoliosis has been recognized since at least the time of Hippocrates and presents itself as an abnormal lateral curvature of the spine accompanied by vertebral rotation. Interestingly, the plasticity of the elements of the spine allows scoliosis to take many different forms dependent on the multitude of different forces being applied to the various tissues making complex any classification and recognition of underlying causes. Some causes of scoliosis are readily apparent  and such cases have been removed from the general population of scoliosis patients because the underlying mechanism can be explained. Similarly, several diseases have been associated with scoliosis development  and these too have been removed from the general pool of patients even though the underlying mechanism for the development of scoliosis is sometimes not clearly understood. However, even with the removal of these cases from the general pool of patients with scoliosis, there remains a large pool of patients (80%) who are justifiably classified as having idiopathic scoliosis because the cause remains unknown. Consequently, idiopathic scoliosis is a diagnosis by elimination rather than by positive identification which is a significant distinction.Idiopathic scoliosis has three apparent peaks of time for diagnosis: congenital, infantile, and adolescent. AIS manifests itself at the time of puberty. Accordingly this paper focuses on AIS which is the most common type of scoliosis and which has received the most attention.A simple review of the mountain of available literature shows that the aetiology of AIS has been explored extensively for more than 100 years. Seemingly, every conceivable aspect of development and tissue associated with the spine appears to have been placed under close scrutiny using the best techniques available at that time often with repeat evaluations occurring as techniques have improved or become available. Interestingly, the basic conclusions from this research can be synthesized as follows:The development of AIS is associated with:the growth spurt at the time of puberty- greater severity of curve development in females than males- multiple variations of deformity - an inheritance within families- Unfortunately, despite the intensity of the research over such a long period of time, these are the only reliable conclusions that can be made. When you consider the time and money that has been directed towards producing these few conclusions it is disappointing to realize that an observant visitor to a scoliosis clinic could reach the same conclusions probably within 20 minutes.Why is this? Why have more significant advances into understanding the aetiology of AIS not been made? In contrast, there have certainly been significant advances made in the treatment strategies used for AIS and this area forms the bulk of presentations and materials at research meetings. The lack of parallel advancement in understanding the aetiology of AIS is disturbing and disappointing. It is further surprising because a better understanding of the aetiology of AIS would presumably result in the development of better treatment strategies but while there has been much interest, there has been little useful advancement.With further thought, perhaps the four conclusions outlined above are not the only ones that could be drawn from the literature. Maybe another conclusion can be drawn:If major advances in understanding the aetiology of AIS are to be made, then the methods currently being used and the approaches being made must be changed because they have not been very productive so far.It has been said that one sign of madness is to continue doing the same thing repeatedly and expect different results. If the current methods to study the aetiology of AIS continue to be applied, why should different results be expected when such intense, detailed research in the past has revealed so little? What changes should be made if advancement in an understanding of the aetiology of AIS is to be achieved?To study the aetiology of AIS efficiently and effectively, an experimental model needs to be developed to form the foundation of any experiments. The results from the experiments will either support the model as being correct or provide direction for making changes which can then be tested further. Fundamental to any model for the study of AIS is the question:Do all cases of AIS have the same single underlying cause or are the abnormal curvatures the common end-result of several different causes?While this is a very simple question, the answer has enormous consequences especially for experimental design and is an important question to be considered when viewing the available research literature.If the answer selected on which to build an experimental model is that all cases of AIS have the same single underlying cause, then the traditional experimental design would be to obtain samples or measurements from a group of patients who have severe AIS (extreme cases) and compare the results to similar ones collected in the same way from a group of control subjects. The focus of the experiment would be on identifying any significant differences between the mean values of the measurements taken from each group. Experiments with this basic design are common in the literature but the results for any parameter being examined vary widely. It is no surprise that there is confusion and little forward progress being made when results from similar experiments are so diverse. Alternatively, perhaps there is a message in this important and extensive literature that has been overlooked. Perhaps the wide diversity and inconsistency in the results from similar experiments is suggesting strongly that the model being used (a single cause) might be wrong and that AIS actually has several different underlying causes .If the true experimental model for AIS should be built on the premise of there being several different causes then no significant differences for any parameter would be expected using the traditional experimental design. Consider the following situation: if the hypothesis was that there were fewer spindles in the vertebral muscles of patients with AIS  then the traditional experimental design would include samples being collected from patients with AIS and appropriate controls. The samples would be sectioned and stained and the number of muscle spindles counted and compared between the experimental and control groups. Unfortunately, the mean values of the two groups of subjects would probably be very similar and not significantly different even though the hypothesis being examined (e.g. fewer muscle spindles) might well be an underlying cause of AIS. If fewer muscle spindles are the basic cause in only 10% of AIS patients, then their contribution to the mean values of numbers of muscle spindles in the group of AIS patients will be overwhelmed by the normal values from the 90% of AIS patients in the same group who have normal values but whose underlying cause is quite different. Unfortunately, this experimental design has been the used in many experiments performed in search of the aetiology of AIS and, not surprisingly, no reliable evidence has been found to support any conclusions for any parameter studied. In experiments designed in this way, the interesting values would be those of the 'outliers' in the experimental group rather than the mean values of the whole group but these extreme values rarely get reported.If AIS has multiple, different causes then experiments designed with a single-cause being the underlying mechanism (such as described above) will not reveal any meaningful results even if the suspected cause of scoliosis being tested is quite valid. Reviewing the literature from this point of view suggests very strongly that the diverse results obtained so far confirm that AIS is the common end result of several different causes and not just a single cause common to all cases. Contributors to conferences and authors of manuscripts should be required to explain their experimental design to clarify this issue.As groups of patients with associated diseases have been culled from the group of AIS patients, the associated disease has been recognized as the underlying cause. As these groups have been removed, the number of underlying causes within the remaining AIS group presumably has been reduced by one. This raises an interesting question:In the current population of patients diagnosed with AIS, is there just one cause remaining to be identified or are there still several different causes within the population that are simply proving more difficult to identify?For example, currently there is considerable discussion related to identification of syringomyelocoele in boys as being an underlying cause of scoliosis and debate exists over whether or not such cases should be removed from the general AIS pool. On this basis alone, it seems most likely that among patients currently diagnosed with AIS several separate causes have yet to be identified within the population rather than there being a single underlying cause common to all.In contrast, the evidence to support AIS having just a single underlying cause is very limited. Certainly, curve progression seems to have many common characteristics and AIS can usually be recognized from a series of radiographs taken of a patient but there is not much else.When a child develops AIS, they are unaware of its development in the early stages when the curve is small. Usually, it requires observation of sloping shoulders or other physical characteristic by another person before the lateral curve is recognized. By this time, the curve is already quite large for this manifestation to be noticed and has probably been present for several months, if not years, before a specialist is seen. This period of time when the abnormal spinal curves were first developing is critical for research purposes because the underlying cause will be present and yet it is a time of anonymity when no measurements can be made. Extrapolation of later measurements into this time period have proved to be limited because treatment strategies have affected curve development and, consequently, any extrapolation procedures.severe AIS are selected for the experimental group because, while such patients certainly represent the extreme cases, they are usually much older than when their curve first started to develop \u2013 which is the most important time for examination to identify the underlying cause. Unfortunately, the time of initial curve development cannot be identified.The biomechanics associated with spinal curve development are complex and not well understood. As it is usually several months (18?) from the time the curve started to when it is first recognized in a patient with AIS, it is possible that the underlying problem causing the development of the curve has been corrected without any treatment. The continued curve progression seen in AIS patients might then be due entirely to the biomechanical aspects of curve development rather than the continued effects of the underlying problem. In these cases, the patient with AIS might be completely normal when being examined! In particular, the experimental group in any experiment might well be perfectly normal in regards to the hypothesis being tested even though the hypothesis was in fact true \u2013 but only at the early stages of development. Presumably this would be particularly important when considering possible causes such as differences in hormonal production or timing of hormonal changes, parameters that are very evident during puberty and which might well have harmonized by the time of measurement. It is certainly a problem when patients with At present, patients with AIS cannot be identified prior to initial development of the spinal curve. There is no marker available which can predict future scoliosis development. Consequently, it is almost impossible to separate cause from effect of the scoliosis from any measurement taken from patients with AIS because there are no earlier measurements available for comparison. This makes interpretation of results from experiments involving AIS patients very difficult to interpret as a genuine cause of scoliosis with any degree of confidence when considering the experimental parameter because any significant changes found could be the result of the scoliosis.A bipedal stance appears to be necessary for development of scoliosis and Man is the only true bipedal animal. Bipedalism arose in Man because the increased lumbosacral angle allowed Man to hold his head and torso high while retaining quadrupedal characteristics in the pelvis and lower limbs, necessary for locomotion. No other animal appears to have adopted the same evolutionary pattern. Consequently, the selection of an animal on which to develop a research model is very difficult. Avians, with their pseudo-bipedal stance, have been used with some success but there is a large phylogenetic gulf between birds and mammals and significant differences in physiology and biochemistry make progress in understanding any mechanism very difficult. For example, pinealectomy in newly-hatched chickens often results in scoliosis development but similar surgery in young mammals (quadrupeds) has no effect UNLESS they are also made bipedal by removal of their upper limbs and tail. This model certainly has potential but questions remain concerning the effects associated with the extent of deviation from normal morphology as well as actual time spent in a bipedal stance when compared to normal, quadrupedal mammals.A strong case has been made in this review to suggest that among the population of patients with AIS there are several, different underlying causes that remain to be identified. Consequently, the cause of AIS is described as being multifactorial. Unfortunately, the problem is probably much more complex than simply being a series of different underlying causes because each separate cause might consist of several contributing elements themselves. For any single underlying cause, these constituent elements might also not be equal in importance with some elements being essential for future curve development while others may or may not need to be present either alone or in combination with the other elements for any spinal curve to develop. This interweaving of the threads associated with scoliosis development creates a complex knot and, currently, there is insufficient data to create a theoretical model on which to build.Despite the criticism of the available literature outlined above, there remains a wealth of information contained in the literature which could be gained by re-reading the literature using a different approach. The useful data is mixed in with data from badly designed experiments which have been designed based on a model of AIS having a single underlying cause (as described above). Such experiments need to be identified and their data re-evaluated and either removed or incorporated into a new database of information. In particular, the outliers from experiments designed with a single cause as the model should be identified if possible and their values looked at very carefully.If many underlying causes for AIS remain to be identified, then they need to be evaluated and explored separately. However, this cannot be approached in the traditional way of collecting samples and measurements from a group of patients with AIS and comparing these values with similar measurements from a control group. Instead, a new approach needs to be developed along the lines of:- develop a theory based on the literature and thoughtful ideas- consider if it can be demonstrated in an appropriate animal model- outline the symptoms that would be seen in a specific group of patients with scoliosis if the theory was correct- search for such patients retroactively or among current patientsThis approach is far more laborious (needle in a haystack?) than the traditional approach but any results would be positive and constructive.There are two types of molecular approach that would be productive:It is well recognized that there is a familial relationship in scoliosis. However, this relationship is confusing and not well defined probably because of the complex nature of AIS, especially the multifactorial (more than one cause) and multi-elemental nature of the underlying cause. The environmental influence on scoliosis development is also unknown but the fact that there is only 70% concordance in identical twins diagnosed with AIS illustrates its significance. Similarly, it is interesting to note that the concordance between dizygotic twins  is only 37% and yet the concordance between non-twin siblings is only 6\u20137%. Such differences raise the question of what influence does prenatal environment have on scoliosis development? The data to explain these differences and the influence of the environment on scoliosis development needs to be expanded so that the focus of research can be more directed.Currently, identifying genes that are different to normal in patients with a specific disease is receiving major attention in many areas other than AIS. In some instances, single specific genes have been identified and make for dramatic headlines. Other diseases have been found to be much more complex with several, if not many, genes being identified as being involved with the disease. AIS falls into the latter group of diseases even though there have been headlines claiming the finding of just single genes being identified as the underlying cause of scoliosis. Again, the problem would probably be reduced if it was possible to identify curves that had developed from different causes and study them separately but, currently, the pool of AIS patients is heterogeneous with a mix of all types of underlying cause in most cases. Certainly, more-refined strategies where members from the same family are being examined will probably reduce the number of suspect genes but if the underlying, single cause has many constituent elements then the situation and model to be developed becomes very complicated and continues to be difficult to solve. Adding to the complexity, the concordance for AIS between monozygotic twins is only 70% which implies that there are some people with identical DNA where one has developed scoliosis while the other has not. Furthermore, how do you identify the contributing genes for scoliosis among family members where the DNA is not identical when scoliosis may or may not develop among people with identical DNA! Similarly, if the complexity of the multifactorial, multi-elemental model proposed for the aetiology of AIS in this review is accepted, then it is quite possible that the lack of concert in gene expression for the elements within a single cause means that some members of the same family will possess similar critical genes but because of the differences in timing patterns, some members of the family develop scoliosis while others do not. This will be a long and difficult process .It used to be thought that 'one gene' meant 'one protein (or enzyme)' but recent advances in cell biology have revealed that gene expression is modified at various levels before protein expression occurs with, in at least one case, at least 180 proteins being found to be expressed from one gene. The unexpected, relatively few genes found in the human genome appears to have been a mask to hide the real complexity and volume of proteins being expressed.Nevertheless, given the success of molecular genetic research in making progress in understanding the aetiology of other diseases, a molecular genetic approach to the aetiology of AIS appears to have the best chance for long-term success. Perhaps it is also possible to make even more rapid progress by copying the methods employed in research of a disease with similar characteristics to AIS but it is difficult to identify one which might be appropriate for comparison because of its complexity. Suggestions for a comparative disease might include cancer and autism, both of which appear to have similar end-results among their patients but which have apparently many different underlying causes. However, it must be realized that even though the genetic differences from normal have been recognized for many years in many diseases, very little progress has been made in introducing corrective genes to the patient.Even if an association is made between scoliosis and a particular characteristic  there is a long path and much explanation required to connect the underlying mechanism with the development of a spinal curve. What is perceived as an association between a particular characteristic and AIS must be connected to a mechanism to produce the spinal curve \u2013 and this is often a very difficult and complex path to understand and isolate. Nevertheless, research in this area would be valuable because it would provide insight into the mechanisms of scoliosis development which is currently poorly understood and guide development of successful treatment strategies ,10.There are three prime areas in which a prominent engineering approach would be beneficial and valuable in obtaining a better understanding of the aetiology of AIS:Postero-anterior and lateral radiographs have been used routinely to observe overall curve morphology, especially degree of curvature, as well as curve development between clinic visits. Such images allow a basic 3D image to be created in a rather primitive fashion but it has proved particularly useful to the surgeon in deciding treatment. However, it must be remembered that a radiograph is compression of a 3D structure into 2D and has many inherent problems for interpretation. Scoliosis is a 3D deformity and, as such, should always be thought of in 3D terms. In particular, the compression of a 3D structure into 2D (as in radiographs) does not allow for the exclusion of the same spinal curve being thought of as changing in severity and classification between visits when only simple rotation of the spine has occurred. The ability to observe or image the spine in 3D has improved enormously in recent years and its availability has also increased especially with refined development of MRI technology. If a complete understanding of spinal curve development is to be achieved, then research evaluations have to move away from 2D imaging such as with basic radiographs and observe only 3D images. 2D assessment should be no longer acceptable for research purposes and new techniques of 3D assessment need to be developed to keep pace with the improvements in imaging techniques. The following statement highlights this area:'Measure in 2D, you think in 2D; measure in 3D, you think in 3D' \u2013 and scoliosis is a 3D problem.Visits to the scoliosis clinic by patients provide the opportunity to see 'snapshots' along the continuum of spinal curve development. However, spinal curve development is a continuous process and not simply a series of images separated by time. The development of techniques to produce a continuous image (movie?) of curve development from the images collected from patients during visits to the scoliosis clinic would be very valuable. Just as more information would be available by observing curve morphology using 3D imaging, even more information would be available if continuous imaging of curve development was also introduced. There is an opportunity for such techniques to be developed because technology has caught up with the desires of researchers \u2013 it is simply a matter of defining the techniques wanting to be created.As a spinal curve develops and increases, it seems reasonable to imagine that the biomechanics associated with column construction affect curve development and associated rotation and that their influence increases with curve progression. It also seems reasonable to suggest that while the abnormal spinal curve remains small, removal of the underlying cause would allow the body possibly to return the curve to normal. An understanding of the biomechanical principles involved with column structure and curve development would be invaluable to understanding the aetiology of AIS but is currently unavailable. Extending this concept, it also appears possible that a point of abnormal curve development might be reached during progression at which correction cannot be achieved by the body even if the underlying cause was removed. Such a point might be related to morphological changes such as those seen with vertebral wedging but the realization that curve development will continue to progress even with the underlying, deforming force removed would be valuable in the development of treatment strategies especially in the area of providing supportive treatments such as those associated with 'bracing' .Perhaps the ultimate research tool would be the development of computer models to simulate spine morphology and normal growth which could include curve development. Such techniques have had outstanding success in other areas of research and there are certainly seeds of development of these techniques in scoliosis. Clearly, the potential for unparalleled success in understanding the mechanics of scoliosis using such techniques suggests strongly that this area of research should receive much more attention in the near future.The lack of any really substantial knowledge relating to the aetiology of AIS as seen in the literature emphasizes the basic areas that should form the focus of all current research because knowledge in these areas is most critical and readily applicable:The development of a marker to identify those children who are going to develop AIS. This would allow treatment strategies to be developed to avoid even initial curve development.The development of a marker which would indicate whether a small, abnormal spinal curve will progress, remain the same, or regress. This would allow aggressive treatment strategies to be applied to those patients whose small curves have been identified as going to progress.The development of techniques to treat small, spinal curves that have already developed to ensure that they do not progress and are corrected instead.The development of new techniques to replace the extensive and invasive techniques currently being used (successfully) to repair large, abnormal spinal curves.cure?' The goal for research into the aetiology of AIS should be to find a cure (other than surgery) as soon as possible, preferably tomorrow \u2013 but, unfortunately, a cure remains a dream and does not even seem to be on the distant horizon. Researchers in this field, particularly basic science researchers, should ask themselves if their work has produced results that have affected the treatment of even a single patient with AIS and, if not, then why not?In his recent successful book 'Where have all the leaders gone?' Lee Iacocca, the former CEO of Chrysler, reports coming into contact for the first time with medical researchers (for diabetes) in his retirement years. He commented that medical research was much like government \u2013 kind of a self-generating bureaucracy. Cynically, he noted that people do research so that they can write papers to get more funding to do more research to write more papers. He was prompted to ask: 'Hey, isn't anyone trying to find a Finally, a plea for better communication: in today's electronic and computerized environment with relatively easy access to video cameras and the ability to both see and hear each other so readily available, could a world-wide research environment be created that involves all interested researchers in all the different areas with regular intercourse and discussion?"}
{"text": "The number of subjects that can be recruited in immunological studies and the number of immunological parameters that can be measured has increased rapidly over the past decade and is likely to continue to expand. Large and complex immunological datasets can now be used to investigate complex scientific questions, but to make the most of the potential in such data and to get the right answers sophisticated statistical approaches are necessary. Such approaches are used in many other scientific disciplines, but immunological studies on the whole still use simple statistical techniques for data analysis.The paper provides an overview of the range of statistical methods that can be used to answer different immunological study questions. We discuss specific aspects of immunological studies and give examples of typical scientific questions related to immunological data. We review classical bivariate and multivariate statistical techniques  and more advanced methods aimed to explore causal relationships  and illustrate their application to immunological data. We show the main features of each method, the type of study question they can answer, the type of data they can be applied to, the assumptions required for each method and the software that can be used.This paper will help the immunologist to choose the correct statistical approach for a particular research question. The understanding of the importance of immunological mechanisms underlying human disease and the identification of associated immunological markers have grown enormously over the past ten years and the number of published immunological studies that investigate the relationships between human disease and cytokines and other immunological parameters has increased rapidly. Technical developments in sample processing and sophisticated immunological techniques permit the analysis of more immunological parameters in larger samples of human subjects, containing information that allows not only the measurement of simple associations between two parameters but also the exploration of the complex relationships between immunity, disease, environmental, social and genetic factors. The potential complexity of the possible relationships between large numbers of immunological parameters poses a special challenge for the applied immunologist: how to select the appropriate statistical techniques to extract the maximum relevant information from complex datasets and avoid spurious findings.Immunologists tend to use simple statistical approaches even when multiple relationships between immunological parameters are expected, ,2 insteaThis paper provides an overview of statistical analysis techniques that may be considered for the analysis of immunological data. We discuss specific aspects of immunological studies, give examples of typical scientific questions related to immunological data and present a statistical framework to help the immunologist to choose the correct statistical approach for a particular research questions. Although we have focused on cytokine data in the examples provided, the methods presented are applicable to most other immunological parameters.In the following section we discuss specific aspects of immunological studies that are relevant for statistical analysis.Before analysing immunological data it is very important to examine the structure of the data because most statistical methods will only give the correct answer if the data has the characteristics required for the use of that method (\"satisfy the data assumptions\"). For example, common data assumptions are that the observations are approximately normally distributed or that the variances are similar across different subpopulations. Unfortunately, immunological data very frequently do not meet these assumptions and investigators are obliged to either apply data transformations , or to choose an alternative statistical techniques with less stringent data assumptions  may have different effects in different cell populations, at different times and in the presence (or absence) of other immunological parameters. We often aim to explain the complete causal pathway from a non-immunological factor  to an outcome (e.g. atopy or asthma). Clearly simple univariate statistical analysis would not be able to identify such inter-relationships among several study variables and the underlying immunological mechanisms that cannot be measured; multivariate statistical techniques are required that can examine multiple parameters simultaneously. A fundamental step to guide statistical analysis is to make the hypothesis explicit in a conceptual framework . ConceptTwo further important aspects of immunological data that are not the focus of this paper but should be mentioned are:Reproducibility reflects how often we obtain the same result using the same laboratory test and sample. Some variation is expected for any measurement and statistical analysis must take into account the degree of variation. Although reproducibility of immunologic measurements is well defined for some immunological outcomes, particularly those used for diagnostic purposes, such as antibody levels associated with vaccine protection (e.g. levels >10 IU/mL for anti-HBS for vaccine response to hepatitis B vaccine), and for phenotypic characterization , reproducibility is not well defined for most immunological parameters. This is independent of the separate but important issue of repeatability between centres in multicentre studies that measure the same immunological parameters in different laboratories or even the measurement of the same parameter between different studies.multiple testing is becoming increasingly relevant in immunological studies as the number of immunological parameters that can be measured increases and investigators conduct a large number of statistical tests on the same study data [The problem of udy data . A speciudy data .In this section we list typical research questions from immunological studies.Common objectives of immunological studies can be grouped into four overall categories:investigate patterns of associations between several immunological parameters, without assuming any causal relationship (and therefore not classifying study variables as dependent variables (i.e. outcomes) and independent variables (i.e. explanatory variables or covariates).i) Those that For example, typical research questions of such studies are:To assess the magnitude of the correlation between different cytokines or to quantify the balance between levels of cytokine expression. For example, the research question might be to measure the correlation between pro-inflammatory and anti-inflammatory cytokines (e.g. correlation between TNF-\u03b1 and IL-10) or to quantify the \"balance\" between pro-inflammatory and anti-inflammatory cytokines .\u2022 To identify highly correlated cytokines and to place them into groups which reflect an unobserved underlying mechanism. For example, Th1-related immune responses such as IFN-\u03b3 and TNF-\u03b1 may mediate an inflammatory disease. Depending on the question being investigated, it may be more appropriate to first use a statistical analysis approach to \"reduce the data\", i.e., to aggregate the correlated Th1 related cytokines to form a \"summarising variable\" that reflects the underlying immunological mechanism (e.g. \"degree of Th1 immune response\") and use that summary variable in the analysis rather than using all the variables with the original cytokine levels.\u2022 To identify individuals with similar profiles of immunological parameters and to place them into groups . For example, patients with a clinical outcome might be defined as \"atopics\" or \"non-atopics\" based on the values of skin prick tests; or subjects with a specific infection may be classified into groups  defined by the overall elevation in antibodies . However, within the same group of patients, clusters with distinct or overlapping profiles might be distinguishable and subsequent analyses might show associations between distinct clusters and disease (or some other outcome).\u2022 investigates causal relationships between one or more immunological parameters  and other study variables (e.g. an outcome such as asthma). To guide the investigation of causation it is important to have developed an a priori causal pathway model. This will allow the appropriate definition of variables, i.e. defining which variables are dependent variables (outcomes), intervening variables (mediating the effect) or independent variables  and will determine the choice of statistical approach.ii) The second group of research objectives Possible research objectives for causality include:Identification of determinants of immunological profiles. The objective may be to compare the expression of cytokines between two or more groups defined by an exposure, e.g. people infected or not infected with helminths, or people vaccinated and non-vaccinated in a vaccine trial where the vaccine exposure is assumed to influence the levels of the immunological parameter to be measured. For example, the question may be to determine if BCG vaccination influences the levels of IFN-\u03b3 secreted by mononuclear cells stimulated in vitro with a mycobacterial antigen. The immunological parameter is the outcome or dependent variable.\u2022 Identification of clinical consequences of immunological profiles,  or, in other words to identify associations between an immunological parameter and clinical (or other) outcomes. For example, immunologists are interested in predicting the probability of a disease occurrence by measurement of cytokine levels. For example, whether elevated TNF-\u03b1 levels are associated with active disease in rheumatoid arthritis? The immunological parameter is the risk factor  or independent variable.\u2022 more complex research questions that may include two or more of the objectives described above. Such questions may examine the role of cytokines in larger causal constructs, including more than one risk factor, intervening variables that mediate and modify an effect, and outcomes; and inter relationships between them. An example will be to investigate the causal inter relationships between early life infections, level of expression of pattern recognition receptors (such as Nods), activity of pro-inflammatory cytokines (IFN-\u03b3 and TNF-\u03b1) and the development of inflammatory bowel disease.iii) The third group consists of in silico immunology  is a rapidly developing and expanding field and has been used to address several types of study questions, such as:iv) The field of \u2022 The prediction of immunogenic sequences from microbial genomes to predict potential vaccine candidates .\u2022 The prediction of protein sequences in therapeutic antibodies that may be associated with adverse reactions .\u2022 Identification of regulatory molecules in the innate immune system .These approaches are generally high-throughput analyses of large data sets  using available software (e.g. EpiMatrix) to either generate or test hypotheses and have been reviewed in detail elsewhere -15.In silico statistical analyses use many of the multivariate statistical techniques discussed later in this review . Because this is a highly specialised field for which there are many computational tools available [in silico immunology will not be discussed further in this review.vailable , in sili\"cytokine$\" or terms to identify specific cytokines  and common univariate and multivariate statistical techniques .We conducted a systematic literature search in the database MEDLINE (1980\u20132005) to review statistical methods that have been previously applied to cytokine data. Because the objective was to get a crude overview rather than to reveal the exact number of papers published in this area we defined quite sensitive search criteria using the following key words: bivariate methods \u2013 also called univariate methods when variables are classified as dependent and independent variables). We frequently found standard methods to compare means of immunological parameters between independent groups , bivariate correlation analysis (Pearson's or Spearman's correlation coefficients) and univariate linear regression. By contrast, multivariate techniques  were less frequently applied to cytokine data. Several studies used factor analysis  or cluster analysis  or discrimination techniques such as logistic regression, discriminant analysis . We also found a few examples of advanced modelling techniques  that simultaneously model multiple relationships between the study variables.Table In the following section we provide an overview of statistical methods that can be considered for analysing immunological data that should help the applied immunologists without a detailed knowledge of statistics to select the appropriate statistical technique for each particular research question. The definition of which method is the most appropriate is strongly dependent on the research objective, the type of data collected, whether data assumptions are fulfilled and whether the sample size is sufficient. We begin with a short introduction to these topics.An important first step in analysing immunological data is exploring and describing the data. Whatever the research question investigators should first explore the data in tables showing summary statistics  and apply graphical methods such as bar charts, histograms, Box and Whisker plots, or scatter plots. For multivariate data, scatter plot matrices are a powerful tool to examine associations among several immunological parameters . A good data assumptions. The first assumption is the scale of measurement of the data, i.e. whether the data type is categorical , ordinal  or continuous . This restricts the statistical methods that can be used. When the investigator has to deal with continuous data the second assumption to test is whether the data follow a theoretical distribution . Distributional assumptions can be tested graphically by diagnostic plots or by applying a statistical test that compares the distribution of the data with a theoretical distribution. When the original data do not meet distributional assumptions required for a particular statistical technique  a common approach is transforming the data to meet the data assumptions, for example to use the logarithm of the values [The next thing investigators have to consider when selecting a statistical method is whether their data meet a number of e values . Howevere values . Anothere values .\" The coe values . For exaCohen's Power analysis guide is a useful review for calculating sample sizes for common univariate and some multivariate techniques  [A second major issue that immunologist frequently face and that also substantially affects the statistical approach to be used is to estimate the appropriate sample size for a statistical analysis. Whereas for univariate techniques  sample size can be determined by conducting a power analysis , sample ression) . Unforturession) ,22. Authression) . There iression) ,25.Bayesian statistical methods that also might be useful for application to immunological data seeking to combine a priori information with the information captured in the present data; a good overview is provided by Lee [In this section we provide an overview of statistical methods that we consider useful for statistical analysis of immunological data. Our guide for data analysis was written with the \"classical statistical approach\" in mind, i.e. we provide statistical techniques to extract the maximum information from the present data. We do not discuss d by Lee . Moreoved by Lee . We haveinter-dependence techniques, i.e. statistical methods aimed to explore relationships between study variables without assuming any causal relationship. These techniques are appropriate when the investigator cannot define (or may not wish to define) which variable is the independent variable  and which is the dependent variable . For example, inter-dependence techniques might be very useful in immunological studies to examine relationships between different cytokines measured in the same individual.The first group embraces so called bivariate correlation analysis that aims to assess the magnitude of the linear relationship between two continuous variables  [Factor Analysis [Datasets with several highly correlated immunological parameters can be simplified using \"is (PCA) , which iAnalysis . The ideA useful feature of factor analysis and especially PCA is that the weights (the \"factor loadings\") for each variable within the components can be interpreted as correlation measures between the observed variable and the underlying unobservable component. Data assumptions in factor analysis are more conceptual than statistical. From a statistical point of view, normality is only necessary if a statistical test is applied to measure the significance of the factors, but these tests are rarely used in practice. The more important conceptual assumptions are that some underlying structure does exist in the set of selected variables and that results in some degree of multicollinearity.et al [In immunological studies factor analysis or PCA could be applied to extract information on the Th1- or Th2-related immune response from a set of cytokines or the ratio of a Th1- and Th2-score could be calculated to quantify the degree of \"Th1/Th2 bias ,31.\" Foret al  instead Cluster Analysis (CA) is the appropriate statistical approach when the researcher seeks to group individuals (not variables) according to their values of study variables (e.g. cytokine levels) [Agglomerative algorithms treat each observation as a cluster and group similar individuals into clusters, while divisive algorithms start with the whole study population as a single cluster and divide the population by identifying homogeneous subgroups. The most appropriate clustering approach for a particular dataset depends on the type of data collected and the research question. Agglomerative clustering is preferable when there are extreme values in the data (outliers). levels) . CA grouCA has strong mathematical properties but not statistical foundations. Data assumptions  that are important in other multivariate techniques are of little importance in cluster analysis. However, the researcher is encouraged to examine the degree of multicollinearity in the data because each variable is weighted and variables that are multi-collinear are implicitly more heavily weighted in the clustering algorithm. For example, a cluster solution derived from a dataset with five highly correlated Th1-related cytokines and two correlated Th2-cytokines would substantially overestimate the importance of the Th1-component in the clustering. This can be avoided by first applying a data reduction technique (e.g. PCA) to derive the \"principal components\" that quantify the magnitude of Th1/Th2-immune response and afterwards clustering the individuals with respect to these immunological components.et al [S. mansoni into clusters defined by levels of parasite specific IgE, IgA, IgM and the IgG subclasses. The authors identified two clusters, a cluster with high levels of IgM and low levels of all other antibodies and a cluster with high IgM and IgG1 and medium IgG4 and low levels of all other antibodies. In further analyses the authors investigated whether epidemiological features of schistosomiasis were associated with cluster membership and whether treatment changed this.In immunological studies cluster analysis may be useful to identify groups of individuals with similar immunological patterns (e.g. cytokine or antibody levels) that reflect an unknown common underlying immunological mechanism. For example, Mutapi et al  sought tCanonical Correlation Analysis (CCA) [Another useful technique to study associations among immunological parameters without assuming any causal relationship is is (CCA)  an approdependence techniques that are appropriate when the study investigates causation, i.e. variables can be classified as independent  and dependent variables , based on concrete a priori hypotheses about the underlying biological mechanisms. For example, an immunological parameter might be considered as an independent variable when it is the proposed cause (e.g. an autoantibody in an autoimmune disease) or the dependent variable when it is considered to be an effect , or an intervening variable or intermediate factor (mediating variable) within a complex causal chain . For example, Black et al [\u03b3 response to Mycobacterium tuberculosis (as the outcome variable) before and after receiving BCG vaccination (the independent variable). Cooper et al [The second group of techniques are statistical ck et al  studied er et al  studied The choice of which statistical dependence technique is most appropriate for a particular research question will depend on the study design, the number and \"scaling\"  of the study variables and other data assumptions . Robust alternatives when data assumptions are violated are non-parametric or non-linear regression techniques. Examples of applications for regression analysis in immunological studies are predicting the levels of expression of a continuous outcome variable (e.g. a cytokine) by a continuous variable  when a causal relationship can be assumed.By contrast, analysis  is the bMultivariate dependence techniques are needed when there are three or more variables involved and at least one variable can be considered the dependent variable.Linear Discriminant Analysis (LDA), a method that derives linear combinations of the independent variables  that best discriminate between the two outcome groups (defined on the basis of the independent variable) [Logistic Regression [These methods are required when there are several independent variables (e.g. cytokines) and one categorical outcome (e.g. atopy). One classical approach is ariable) . LDA reqgression .\u03b3 and TNF-\u03b1) to discriminate between clinical and asymptomatic forms of visceral leishmaniasis. The authors found that TNF-\u03b1, IL-10 and IL-4 were highly correlated with the clinical form, while IL-2, IL-12 and IFN-\u03b3 were correlated with the asymptomatic form. In another study, logistic regression was used to explore the role of parasite induced IL10 in decreasing the frequency of atopy: Van Biggelaar et al [In immunological studies classification techniques can be very useful to identify immunological profiles that best discriminate two or more pre-defined groups of interest (e.g. atopy vs. non atopy). For example, Gama et al  used LDAar et al  sought tMultivariate Analysis of Variance (MANOVA) or Multi-way Analysis of Variance (Multi-way ANOVA), are used to compare the distributions of one or more continuous variables between groups defined by one (\"one-way\") or more (\"multi-way\") factors of interest  between two groups (asthmatic vs. non asthmatic). By applying MANOVA instead of repeated application of ANOVA the investigator can avoid the problem of type I error inflation for the whole experiment.These techniques such as Multivariate Analysis of Covariance (MANCOVA) is an extension of MANOVA that additionally allows to control for the effect of an other continuous variable to be controlled (e.g. a confounder) [\u03b3, TNF-\u03b1, etc.) across groups defined by one or more experimental factors (e.g. vaccinated or control) and adjusted for age.founder) . An applMultiple Regression is appropriate when the research question is to predict a single continuous dependent variable by a set of continuous and/or categorical independent variables [et al [\u03b3, TNF-\u03b1, IL-12, IL-10, TGF-\u03b2).ariables . The staariables . Regresss [et al  used mulPartial Least Squares (PLS) Regression [gression  is an exmultiple relationships among immunological parameters and other study variables so that a simple multivariate approach might not be sufficient to reflect the complexity of the underlying immunological process. For example, in an immuno-epidemiological study conducted to study risk factors for asthma and allergy, investigators could define a conceptual framework that assumes multiple relationships between risk factors , immunological profiles (e.g. cytokine expression levels) and the occurrence of outcomes   are techniques developed by geneticists [\"latent variables\" . A structural equation model consists of two components: \"a measurement model\" that defines how the observed measurements  are related to the unobserved latent variables and a \"structural model\" that defines the assumed relationships between the observed study variables and one or more latent variables.All the multivariate statistical methods that have been mentioned above have one common limitation: although they may include many variables, they all assume the presence of one single relationship between them. However, in modern immunological studies investigators often assume opy) Fig . To modeeticists ,46 and eeticists  that caneticists . SEM is path diagram of the study in which multiple relationships are assumed between the study variables. In this example we consider that the cytokines IL-12, IFN-\u03b3 and TNF-\u03b1 represent an unobservable latent variable \"Th1-related immune response\" and the cytokines IL-4, IL-9 and IL-13 represent the latent variable \"Th2-related immune response\". Further, the structural model assumes relationships between the two latent variables (c1) and the \"effects\"  of these on an outcome variable . In SEM the concept of the \"measurement model\" is similar to factor analysis in which a linear relationship between the (observed) indicator variables and the (unobserved) latent variable is assumed. For example, in Figure a priory a path diagram that specifies which variables are the indicators of the underlying latent variables and the correlations of the measurements with the latent variables are derived that best reflect the whole conceptual framework e.g. maximizing the correlation between all latent and observed variables.The concept of latent variables and SEM is likely to be useful in immunological studies because immunologists frequently hypothesise that the measured immunological parameters are the result of unobservable underlying complex immunological processes. For example, imagine a hypothetical immunological study where different cytokines are measured to quantify two important immunological components. Figure et al [\u03b1) in a complex causal chain of the metabolic syndrome. There are few applications of conceptual frameworks, path analysis and SEM to immunological data in the literature. However, because of increasing sample size and advancing knowledge about underlying complex immunological mechanisms, these approaches have a potentially important role in the analysis of data from modern immunological studies. The concept of latent variables in SEM will be especially useful because immunological mechanism can rarely be observed directly and must therefore be inferred through the measurement of different immunological indicators. Moreover, the unique feature of SEM that allows the analysis of multiple relationships between the study variables would be appropriate for the inference of causal chains of immunological processes.Application of these techniques to immunological data should allow the inference of complex immunological phenomena. For example, Chan et al  used SEMRandom or Mixed Effects Models [The application of s Models  for stata priori hypotheses that are based on a sound knowledge of the scientific literature.The aim of this paper is to provide a modern overview for applied immunologists to explain and illustrate the statistical methods that can be employed for the analysis of immunological data. Our review should help immunologists without a detailed knowledge of statistics that are faced with the problem of statistical analysis of immunological data to select the appropriate statistical technique that will allow the valid extraction of the maximum information from the data collected. However, the statistical framework presented here should not be used as a substitute for an experienced biostatistician who should be involved from the beginning of the study for advice on study design, calculation of the sample size and planning of the statistical analysis. The systematic literature review illustrates the fact that most immunological studies still employ simple statistical approaches to immunological data even when multiple inter-relationships among several study variables are expected. We think it is important that more sophisticated statistical techniques are used for complex immunological data that will permit a better understanding of complex underlying immunological mechanism. Our focus has been on multivariate techniques that permit the analysis of multiple study variables simultaneously and hope that our examples from both real and hypothetical immunological studies will stimulate immunologists to make more use of these techniques. Moreover, bearing in mind the complexity of research questions addressed by modern immunological studies, we have introduced the idea of conceptual frameworks, latent variables and advanced statistical techniques , providing a toolbox that should help the investigator to analyse multiple relationships among several study variables simultaneously. Finally, it should be pointed out that statistical techniques are a tool for the inference of underlying mechanisms and can never substitute for BG and LCR had the idea for the paper, conducted the literature review, developed the guide for statistical analysis and wrote the manuscript. PJC and MY participated in writing the sections about research objectives of immunological studies and specific aspects of immunological data and evaluated the applicability of the proposed statistical framework for data from modern immunological studies. MLB participated in developing the statistical framework and helped to draft the manuscript. All authors have read and approved the final manuscript.Appendix: Glossary of statistical and epidemiological terms.Click here for file"}
{"text": "Short inter\u00admolecular distances between the centroids of the five-membered rings [3.5340\u2005(8)\u2005\u00c5] indicate the existence of \u03c0\u2013\u03c0 inter\u00adactions. An inter\u00adesting feature of the crystal structure is the presence of short intra\u00admolecular Cl\u22efN inter\u00adactions [3.0015\u2005(11)\u2005\u00c5]. Mol\u00adecules are linked via pairs of inter\u00admolecular N\u2014H\u22efO hydrogen bonds, generating R               2               2(8) ring motifs. Furthermore, N\u2014H\u22efO hydrogen bonds form R               2               1(7) ring motifs with C\u2014H\u22efO contacts, further consolidating the crystal structure. In the crystal, mol\u00adecules are linked by these inter\u00admolecular inter\u00adactions, forming chains along [001].The title mol\u00adecule, C \u00c5                           b = 10.4316 (2) \u00c5                           c = 14.4352 (2) \u00c5                           \u03b2 = 94.599 (1)\u00b0V = 1963.21 (6) \u00c53                                                   Z = 8                           K\u03b1 radiationMo \u22121                        \u03bc = 0.84 mmT = 100 K                           0.49 \u00d7 0.22 \u00d7 0.08 mm                                 Bruker SMART APEXII CCD area-detector diffractometerSADABS; Bruker, 2005T                           min = 0.683, T                           max = 0.934Absorption correction: multi-scan (16375 measured reflections3742 independent reflectionsI > 2\u03c3(I)3060 reflections with R                           int = 0.029                                                            R[F                           2 > 2\u03c3(F                           2)] = 0.034                           wR(F                           2) = 0.100                           S = 1.13                           3742 reflections140 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.46 e \u00c5\u22123                        \u0394\u03c1min = \u22120.35 e \u00c5\u22123                        \u0394\u03c1                                 APEX2  used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL and PLATON (Spek, 2009Data collection: 10.1107/S1600536809026567/tk2498sup1.cif            Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809026567/tk2498Isup2.hkl            Structure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF report            Additional supplementary materials:"}
{"text": "Intra\u00admolecular C\u2014H\u22efN hydrogen bonds form five-membered rings, generating S(5) ring motifs. Each imino functional group is coplanar with its adjacent benzene ring; the two benzene rings form a dihedral angle of 51.30\u2005(4)\u00b0. An inter\u00adesting feature of the crystal structure is weak inter\u00admolecular Cl\u22efCl [3.4752\u2005(4)\u2005\u00c5] and Cl\u22efN [3.2927\u2005(9)\u2005\u00c5] inter\u00adactions. Inter\u00admolecular Cl\u22efN inter\u00adactions link mol\u00adecules into dimers with 22(22)R ring motifs. The crystal structure is further stabilized by weak \u03c0\u2013\u03c0 [centroid\u2013centroid distances = 3.6970\u2005(6)\u20133.8560\u2005(6)\u2005\u00c5] inter\u00adactions.The title compound, C \u00c5                           b = 9.3275 (2) \u00c5                           c = 9.7841 (2) \u00c5                           \u03b2 = 92.213 (1)\u00b0V = 1790.96 (6) \u00c53                                                   Z = 4                           K\u03b1 radiationMo \u22121                        \u03bc = 0.36 mmT = 100 (1) K                           0.51 \u00d7 0.35 \u00d7 0.10 mm                                 Bruker SMART APEXII CCD area-detector diffractometerSADABS; Bruker, 2005T                           min = 0.836, T                           max = 0.966Absorption correction: multi-scan (21670 measured reflections6419 independent reflectionsI > 2\u03c3(I)5273 reflections with R                           int = 0.028                                                            R[F                           2 > 2\u03c3(F                           2)] = 0.036                           wR(F                           2) = 0.095                           S = 1.03                           6419 reflections208 parametersH-atom parameters constrainedmax = 0.38 e \u00c5\u22123                        \u0394\u03c1min = \u22120.32 e \u00c5\u22123                        \u0394\u03c1                                 APEX2  used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL and PLATON (Spek, 2003Data collection: 10.1107/S1600536808035307/tk2319sup1.cif            Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808035307/tk2319Isup2.hkl            Structure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF report            Additional supplementary materials:"}
{"text": "Two inter\u00admolecular N\u2014H\u22efN and C\u2014H\u22efN hydrogen bonds to the same acceptor N atom form seven-membered rings, producing R               2               1(7) ring motifs. These inter\u00adactions link neighbouring mol\u00adecules into one-dimensional chains extended along the c axis. The crystal structure is further stabilized by weak inter\u00admolecular C\u2014H\u22ef\u03c0 inter\u00adactions.In title compound, C \u00c5                           b = 11.5663 (3) \u00c5                           c = 10.0098 (3) \u00c5                           \u03b2 = 90.154 (1)\u00b0V = 709.95 (4) \u00c53                                                   Z = 4                           K\u03b1 radiationMo \u22121                        \u03bc = 0.37 mmT = 100.0 (1) K                           0.54 \u00d7 0.28 \u00d7 0.22 mm                                 Bruker SMART APEXII CCD area-detector diffractometerSADABS; Bruker, 2005T                           min = 0.825, T                           max = 0.922Absorption correction: multi-scan (27675 measured reflections3100 independent reflectionsI > 2\u03c3(I)3040 reflections with R                           int = 0.021                                                            R[F                           2 > 2\u03c3(F                           2)] = 0.050                           wR(F                           2) = 0.128                           S = 1.24                           3100 reflections91 parametersH-atom parameters constrainedmax = 0.62 e \u00c5\u22123                        \u0394\u03c1min = \u22120.39 e \u00c5\u22123                        \u0394\u03c1                                 APEX2  used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL and PLATON (Spek, 2003Data collection: 10.1107/S1600536809001068/at2706sup1.cif            Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809001068/at2706Isup2.hkl            Structure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF report            Additional supplementary materials:"}
{"text": "The nitro group makes a dihedral angle of 71.66\u2005(5)\u00b0 with the plane of the benzene ring to which it is bound. The two rings are almost coplanar, with a dihedral angle of 4.44\u2005(5)\u00b0. Short inter\u00admolecular distances between the centroids of the six-membered rings [3.7188\u2005(6)\u20133.8299\u2005(6)\u2005\u00c5] indicate the existence of \u03c0\u2013\u03c0 inter\u00adactions. The inter\u00adesting features of the crystal structure are the short inter\u00admolecular O\u22efO and O\u22efN inter\u00adactions. The crystal packing is stabilized by intra\u00admolecular O\u2014H\u22efO and inter\u00admolecular C\u2014H\u22efO (\u00d73) hydrogen bonds, and C\u2014H\u22ef\u03c0 inter\u00adactions.The title compound, C \u00c5                           b = 8.4250 (2) \u00c5                           c = 12.1845 (3) \u00c5                           \u03b2 = 93.946 (1)\u00b0V = 889.02 (4) \u00c53                                                   Z = 4                           K\u03b1 radiationMo \u22121                        \u03bc = 0.14 mmT = 100.0 (1) K                           0.35 \u00d7 0.14 \u00d7 0.13 mm                                 Bruker SMART APEXII CCD area-detector diffractometerSADABS; Bruker, 2005T                           min = 0.900, T                           max = 0.982Absorption correction: multi-scan (22792 measured reflections3028 independent reflectionsI > 2\u03c3(I)2493 reflections with R                           int = 0.041                                                            R[F                           2 > 2\u03c3(F                           2)] = 0.041                           wR(F                           2) = 0.119                           S = 1.11                           3028 reflections165 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.50 e \u00c5\u22123                        \u0394\u03c1min = \u22120.23 e \u00c5\u22123                        \u0394\u03c1                                 APEX2 (Bruker, 2005APEX2; data reduction: SAINT (Bruker, 2005SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL and PLATON (Spek, 2003Data collection: 10.1107/S1600536808021594/at2591sup1.cif            Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808021594/at2591Isup2.hkl            Structure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF report            Additional supplementary materials:"}
{"text": "An intra\u00admolecular O\u2014H\u22efN hydrogen bond involving the hydr\u00adoxy and imino groups generates an S(6) ring motif. Inter\u00admolecular C\u2014H\u22efO and N\u2014H\u22efO hydrogen bonds form an R               2               1(7) ring motif involving a methanol O atom and two H atoms of the imidazole and benzene rings, respectively. The latter links neighbouring mol\u00adecules into one-dimensional extended chains along the a axis. The two benzene rings are inclined towards each other, as indicated by the dihedral angle of 52.13\u2005(10)\u00b0. The phenol ring is almost coplanar with the basic quinoxaline unit, making a dihedral angle of 2.43\u2005(6)\u00b0. The short distances between the centroids of the five- and six-membered rings prove the existence of \u03c0\u2013\u03c0 inter\u00adactions [centroid\u2013centroid distances = 3.5234\u2005(9)\u20133.7885\u2005(10)\u2005\u00c5]. The crystal structure is stabilized by intra\u00admolecular O\u2014H\u22efN, inter\u00admolecular O\u2014H\u22efO, N\u2014H\u22efO and C\u2014H\u22efO (\u00d7 2) hydrogen bonds and weak inter\u00admolecular C\u2014H\u22ef\u03c0 and \u03c0\u2013\u03c0 inter\u00adactions.The title compound, C \u00c5                           b = 11.4574 (2) \u00c5                           c = 11.9983 (2) \u00c5                           \u03b1 = 116.325 (1)\u00b0\u03b2 = 107.465 (1)\u00b0\u03b3 = 95.147 (1)\u00b0V = 1192.81 (4) \u00c53                                                   Z = 2                           K\u03b1 radiationMo \u22121                        \u03bc = 0.09 mmT = 100.0 (1) K                           0.39 \u00d7 0.29 \u00d7 0.12 mm                                 Bruker SMART APEXII CCD area-detector diffractometerSADABS; Bruker, 2005T                           min = 0.876, T                           max = 0.990Absorption correction: multi-scan (23412 measured reflections7076 independent reflectionsI > 2\u03c3(I)5031 reflections with R                           int = 0.043                                                            R[F                           2 > 2\u03c3(F                           2)] = 0.061                           wR(F                           2) = 0.182                           S = 1.07                           7076 reflections335 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.99 e \u00c5\u22123                        \u0394\u03c1min = \u22120.48 e \u00c5\u22123                        \u0394\u03c1                                 APEX2 (Bruker, 2005APEX2; data reduction: SAINT (Bruker, 2005SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL and PLATON (Spek, 2003Data collection: 10.1107/S1600536808025269/at2610sup1.cif            Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808025269/at2610Isup2.hkl            Structure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF report            Additional supplementary materials:"}
{"text": "Genome-wide association studies (GWASs) identify single nucleotide polymorphisms (SNPs) that are enriched in individuals suffering from a given disease. Most disease-associated SNPs fall into non-coding regions, so that it is not straightforward to infer phenotype or function; moreover, many SNPs are in tight genetic linkage, so that a SNP identified as associated with a particular disease may not itself be causal, but rather signify the presence of a linked SNP that is functionally relevant to disease pathogenesis. Here, we present an analysis method that takes advantage of the recent rapid accumulation of epigenomics data to address these problems for some SNPs. Using asthma as a prototypic example; we show that non-coding disease-associated SNPs are enriched in genomic regions that function as regulators of transcription, such as enhancers and promoters. Identifying enhancers based on the presence of the histone modification marks such as H3K4me1 in different cell types, we show that the location of enhancers is highly cell-type specific. We use these findings to predict which SNPs are likely to be directly contributing to disease based on their presence in regulatory regions, and in which cell types their effect is expected to be detectable. Moreover, we can also predict which cell types contribute to a disease based on overlap of the disease-associated SNPs with the locations of enhancers present in a given cell type. Finally, we suggest that it will be possible to re-analyze GWAS studies with much higher power by limiting the SNPs considered to those in coding or regulatory regions of cell types relevant to a given disease. Asthma is a chronic inflammatory disease, characterized by reversible airway obstruction and increased bronchial hyperresponsiveness. This complex disorder is influenced by the interdependencies between various factors - genetic and environmental being the most important ones. The estimate that 35\u201380% of the variation in the risk of asthma can be attributed to genetic variation has spurred a number of genome-wide association studies (GWASs) of asthma Recently, there has been a vast acceleration in the identification of non-coding genomic elements that regulate gene transcription Notably, the location of enhancers is highly cell-type specific Based on these considerations, we tested the hypothesis that SNPs associated with a specific disease are more frequently found in enhancers specific to cells that are relevant for the disease. Using asthma as an example, we document a significant enrichment of asthma-associated SNPs in genomic regions marked by H3K4me1 in CD4+ T cells, which are known to contribute to asthma pathogenesis. In contrast, cells from brain, breast and skeletal muscle tissues unrelated to asthma, are depleted of asthma-associated SNPs in their enhancer regions. Thus, the methodology we report here can be utilized to make an unbiased prediction of which cell types contribute to disease pathogenesis, and which disease-associated SNPs are likely to be functionally important.2\u200a=\u200a0.8) based on the most recent release of HaploReg We retrieved all known asthma-associated SNPs from the GWAS integrator database In an elegant study by the Kellis group In contrast, regions with heterochromatin state and repetitive elements  showed high depletion for disease-associated SNPs, as did some states associated with transcription .Notably, we also found significant enrichment in States 9, and 34, which are associated with promoter and enhancer regions, suggesting that SNPs present in non-coding regions (enhancers and promoters) contribute to disease pathogenesis by perturbing the transcriptional regulation of an associated gene.Enhancers have previously been reported to be tissue and cell-type specific Next, we compared the enhancers identified in different datasets by calculating pair-wise Matthews correlation coefficients (MCC), which quantify the overlap of enhancers on a per nucleotide basis . To determine if there was differential enrichment of asthma-associated SNPs in the enhancers of different cell types, we merged the enhancers identified in each of the eight cell/tissue type specific clusters displayed in Next, we performed a similar analysis using a second enhancer marker, H3K27ac . H3K27acWe asked whether the enrichment for asthma-associated SNPs could be increased by excluding ubiquitous enhancers found in many cell types/tissues. The highest enrichment was determined by considering either the SNPs unique to CD4+ T cells, or SNPs found in up to two other cell types. By contrast, enhancers in skeletal muscle cells were clearly depleted of asthma-associated SNPs, and such depletion became increasingly pronounced when excluding enhancers also found in other cell types. A similar, but less pronounced, trend was found for cells from breast and brain tissues (Table S5 in File S1), whose enhancers are depleted of asthma-associated SNPs and become more depleted when eliminating enhancers shared with other cell types. For the remaining cell types (liver and adipose tissues), which showed an enrichment of asthma SNPs in their enhancers, the enrichment increased further when considering subsets of enhancers unique to these cells.To examine the putative functional mechanism of asthma SNPs in enhancers, we were interested if might modulate in Transcription Factor Binding Sites (TFBSs). In summary, our analysis demonstrates that focusing on enhancers present in a few cell types further enriched asthma-associated SNPs compared to background SNPs. Since by far the greatest enrichment was observed at enhancers of CD4+ T cells which are known to contribute to asthma, our approach is capable of simultaneously prioritizing those SNPs that are more likely to contribute to a given disease, and identifying the cell types involved.cis-regulatory elements (enhancers) present in cell types that drive disease pathogenesis such as CD4+ T cells, we predict that SNPs present in such cell-type-specific enhancer regions  project after our initial results were submitted for publication Our present analysis is meant more as a proof of concept than an optimized, definitive study; there are multiple ways in which it can be significantly improved. First, the amount of published asthma-associated SNPs is continuously increasing, with a gain of 65% from January to October 2012, and additional SNPs will continue to be discovered. Moreover, rather than relying on SNPs that reach statistical significance in whole genome studies, our approach would be even more powerful when GWAS data is re-analyzed from scratch, limiting the SNPs considered to those in active genomic regions of the cells of interest.cis-regulatory elements such as suppressors or isolators may well have similar importance to enhancers, and because even for enhancers, H3K4me1 in combination with other markers may provide a more accurate identification. We expect classifications such as those by the Kellis group to become available for multiple cell types in the near future. Also, the chromatin state classifications could be further tailored to our type of analysis by focusing on those states that show the highest correlation with disease-associated SNPs, and identifying the optimal set of chromatin marks that identifies these regions. Finally, we want to reiterate that asthma-associated SNPs are significantly enriched not only in enhancers and promoters, but also in coding and untranslated regions. The transcription of these regions could further depend on both genetic and epigenetic factors.Second, the peak-calling algorithm used (MACS) is not optimal for identifying histone modifications, but was designed for identifying much better-defined transcription factor binding sites. Preliminary analysis showed that we obtained a higher enrichment with other algorithms, such as SICER In conclusion, we have demonstrated a novel approach to GWAS data analysis that integrates epigenomic information to identify SNPs and cell types contributing to disease. We expect our approach to be broadly applicable, and to further enhance the value of the accumulating information from GWAS of disease. Future work needs to experimentally confirm the functional role of the identified SNPs.To create a collection of asthma related SNPs, we had all asthma-associated variants (SNPs) downloaded from GWAS Integrator http://genome.ucsc.edu/cgi-bin/hgLiftOver]. Some non-asthma SNPs where un-mappable by this tool, and discarded from that calculation. For a given chromatin state, we determined the fraction of asthma-associated SNPs located in the corresponding genomic region, and compared it to the fraction of background SNPs to calculate enrichments. Significance was assessed using the chi-square test.To estimate distribution of asthma SNPs in different chromatin states we used chromatin state prediction for CD4+ T-cells by Ernst and Kellis http://www.genboree.org/epigenomeatlas/edaccGridViewerPublic.rhtml].ChIP-seq H3K4me1 data together with the input data for 37 datasets were obtained from Human Epigenome Atlas, release 5. [The samples analyzed came from the following cell types. CD4+ T cells: three samples of CD4+ memory T cells, two samples of CD4+ naive T cells, one sample of CD4+ CD25- IL17- T cells, CD4+ CD25- T cells, CD4+ CD25- IL17+ Th17 cells, CD4+ CD25+ CD127- Treg cells; brain: brain germinal cells, brain mid frontal and inferior temporal lobe, two samples of brain hippocampus middle, two samples of brain anterior caudate, two samples of brain substantia nigra and brain cingulate gyrus; three samples of adipose derived mesenchymal (ADM) stem cells; three samples of liver cells; two samples of kidney cells; five samples of adipose nuclei; two samples of breast myoepithelial cells and three samples of skeletal muscle cells. Total number of all analyzed samples is equal to 37; the number of analyzed cell types is equal to 19 because for some cell types data for more than one donor was available. These 19 cell types belonged to eight different tissues.For each sample we calculated H3K4me1 enriched regions by enrichment of treatment reads under a local background model estimated from control reads by employing the statistical software MACS  All available ChIP-seq H3K27ac data for the samples that contained H3K4me1 datasets were obtained from Human Epigenome Atlas, release 5. Thus, we have analyzed H3K27ac marks for the same CD4+ T cells (9 samples), one sample of brain anterior caudate, one sample of adipose nuclei and one sample of skeletal muscle cells. The twelve cell types mentioned above belong to four different tissues and for each sample we have calculated H3K27ac peaks using exactly the same parameters as we used for H3K4me1 peak calling.In order to compare the enhancers in different datasets we calculated pair-wise Matthews correlation coefficients (MCC), which quantify the overlap of enhancers on a per nucleotide basis. For each pair of samples (datasets) the MCC was calculated using the following formula:To calculate distribution of asthma SNPs within and without Transcription Factor Binding Sites (TFBSs) we have used TFBSs by ChIP-seq data from the ENCODE (Release 2) Figure S1 in File S1Asthma-associated SNPs and H3K4me1 (enhancer) enriched regions in the human IKZF3 locus of different cell/tissue types. From top to bottom, using the UCSC genome browser, are displayed: the gene track (genes), all the SNPs not associated with asthma, the SNPs associated with asthma , H3K4me1 ChIP-seq track (green) for different cell/tissue types (named on the left) underlined by the corresponding peak-calling track (black boxes). For the blood CD4+ T cells, peak calling tracks from seven samples/cell-types are displayed. The red box shows an H3K4me1 peak that is present only in CD4+ T cells.(PDF)Click here for additional data file."}
{"text": "Increasingly, health workforces are undergoing high-level \u2018re-engineering\u2019 to help them better meet the needs of the population, workforce and service delivery. Queensland Health implemented a large scale 5-year workforce redesign program across more than 13 health-care disciplines. This study synthesized the findings from this program to identify and codify mechanisms associated with successful workforce redesign to help inform other large workforce projects.This study used Inductive Logic Reasoning (ILR), a process that uses logic models as the primary functional tool to develop theories of change, which are subsequently validated through proposition testing. Initial theories of change were developed from a systematic review of the literature and synthesized using a logic model. These theories of change were then developed into propositions and subsequently tested empirically against documentary, interview, and survey data from 55 projects in the workforce redesign program.Three overarching principles were identified that optimized successful workforce redesign: (1) drivers for change need to be close to practice; (2) contexts need to be supportive both at the local levels and legislatively; and (3) mechanisms should include appropriate engagement, resources to facilitate change management, governance, and support structures. Attendance to these factors was uniformly associated with success of individual projects.ILR is a transparent and reproducible method for developing and testing theories of workforce change. Despite the heterogeneity of projects, professions, and approaches used, a consistent set of overarching principles underpinned success of workforce change interventions. These concepts have been operationalized into a workforce change checklist. The Australian healthcare system faces a number of challenges that test its ability to deliver effective, efficient, and responsive services to the population. These challenges are well documented and include: an increasing demand for services ,2, a groThe Australian Allied Health Workforce - An Overview of Workforce Planning Issues; allied health staff felt pressured by [name] to attempt unachievable deliverables.\u2019 1.3 Better success of the new models of care is associated with top-down supportet al. [Best et al.  found thThis proposition was supported at several levels of our study:\u2013A change of government towards the end of the MoC project resulted in a change of strategic priorities, uncertainty, and reallocation or cessation of funding. This change and uncertainty prevented the completion of some projects and prevented the sustainability of other successful projects due to realignment of priorities at policy and decision-making levels.\u2013Leadership in the form of change management training for staff, and support for AHA staff to undertake certificate training contributed to the success of projects.\u2013Strong executive sponsorship was associated with project success, whereas projects without executive support were discontinued or did not receive recurrent funding.1.4 Better success of the new models of care is associated with legislative scaffoldingAustralia\u2019s Health Workforce Productivity Commission Research Report[Support for the development and introduction of the new roles came from national and state initiatives. The recommendations in the ch Report served a1.5 Better sustainability of the new models of care is associated with codification of the processes, practices, and training used to implement the roleOne of the major outputs from the QH MoC projects was the codification of processes necessary to implement new roles; specifically, this involved role definitions, service definitions, new competencies and competency frameworks, and new tools and pathways to support implementation of the new MoC. The codification of processes was important to help both the sustainability of the project in times of change, as well as the transfer of the project into a new environment/service/context. This was exemplified in one project, which specifically identified that having poorly defined role descriptions, objectives, and goals at the commencement of the project substantially slowed progress of the project; role descriptions were negotiated late in the project, delaying staff and patient recruitment.Five projects used the Calderdale Framework  in the d1.6 Better success of the models of care is associated with having powerful allies to drive the role forwardAs previously noted, the engagement of key and powerful allies  within an organization was paramount to the success of new roles and MoC. Support from these individuals can enable the necessary legislative changes required for acceptance of the new role and scope of practice by the regulatory body. They can also foster acceptance of the new MoC by others whose practice may be affected by the role changes.1.7 Better success is associated with implementing new models of care that are appropriate for the contextThe context into which the new MoC is implemented needs to be receptive to and supportive of the need for change . The characteristics of contexts that were identified as associated with successful implementation were:\u2013Willingness to discuss the potential to implement change. This required being flexible, open minded, and openly engaging with new ideas.\u2013Having a mindset that supports change.\u2013Willingness of team members to work with the change leader throughout the entire process.\u2013Ability to focus changes around those that will positively impact on patient outcomes.\u2013Having the relevant participants located in close proximity to each other.A number of unsuccessful projects were initially started in contexts that were not receptive or supportive of the proposed changes and were discontinued; when moved to more supportive contexts that demonstrated the above characteristics, they were expected to be successful.2.1 More efficient use of the role is associated with clearly defined roles within the model of careThere was evidence from 15 projects that having a clearly defined worker role within the MoC was associated with increased efficiency and sustainability of the role. In particular, it was important to have clearly defined role descriptions and identified training needs. In the absence of role clarity, protection of role boundaries was more likely to arise, as well as inefficient delegation of tasks to new practitioners. An important area requiring further clarity was the differentiation between advanced roles and full scope of practice.2.2 More efficient use of the role is associated with clearly defined, understood, and unambiguous delegatory or allocatory models of careThe need for clearly defined delegatory or allocatory MoC was an important indicator of project success (8 projects). In particular, it was important to clearly identify tasks that could be delegated. Professional readiness for taking on extended practice varied between practitioners.2.3 More efficient use of the role is associated with delegating practitioners having confidence in delegation and trust in the practitionerTrust between practitioners was an important component of efficient delegation. This was supported by having a clear understanding of the roles, training, and competencies of the practitioners to whom they are delegating. Lack of trust resulted in a lack of confidence in the delegating practitioner, and consequently, in inefficient delegation.2.4 More efficient use of the role is associated with allowing practitioners to work to their full scope of practiceEnabling staff to work to their full scope of practice, and providing structures to reinforce this was associated with increased efficiency (six projects). One of the strongest examples of this was the orthopedic podiatry triage service, which enabled podiatrists to work to their full scope of practice and led to substantial reductions in orthopedic surgery waiting lists and more efficient use of the orthopedic surgeon\u2019s time.Conversely, the inability or unwillingness of AHPs to delegate parts of their role to others, predominantly AHAs, resulted in inefficient use of the newly created roles. These challenges were related to:\u2013Lack of clarity with overlapping roles.\u2013Lack of understanding of how to delegate, and the need for education, supervision, and frameworks to support delegation. These structures needed to be in place from the beginning of the project.\u2013Lack of trust in assistants and engagement with the training provided to assistants by AHPs.\u2013Turf protection and reluctance to let go of some tasks to a workforce perceived to be less skilled.The use of the Calderdale Framework assisted in resolving these challenges as it allowed AHPs to understand how they could improve their own patient care by delegating specific tasks and functions to AHAs.3.1 Greater staff satisfaction is associated with models of care that provide for better career development opportunitiesThe implementation of new MoC improved career opportunities and led to greater staff satisfaction. Surveys to measure staff satisfaction with the new MoC were undertaken in some projects as part of their evaluation processes. The following outcomes were identified:\u2013Development of more sustainable roles within the organization.\u2013Perceived ability by allied health team members to complete more quality activities, therapy interventions and patient education, thus improving their job satisfaction.\u2013More appropriate task to skill matching.\u2013Increased sense of achievement through the learning of new skills and acquiring a broader knowledge base, particularly for AHA.\u2013A perception of inclusion into a multidisciplinary team.\u2013Improved staff morale.However, in projects where turbulent leadership, poor recruitment to leadership roles, and an influx of junior/inexperienced staff were reported, the staff satisfaction with the new MoC was poor. These barriers overshadowed the positive impacts the new MoC may have had on team members.3.2 Greater staff satisfaction is associated with role clarityThe data did not demonstrate a direct link between increased staff satisfaction and role clarity. However, there was evidence that improved understanding and acceptance of the new roles arose, in part, through appropriate consultative processes that were reinforced through processes of role clarity. This is consistent with findings from other studies that examined role clarity issues associated with role boundaries for workplaces with multi-disciplinary teams . Issues Better understanding and acceptance of new roles was associated with: 1) AHPs having the increased knowledge and ability to identify appropriate tasks for the proposed assistant role, 2) building trust in delegation models and a multi-professional assistant workforce, and 3) changes that resulted in more advanced AHP and advanced AHA positions being incorporated into services to improve efficiencies and reduce costs. Staff acceptance of these new roles within the teams was demonstrated in six projects with the majority of these projects being continued.This proposition is, therefore not upheld in this context.3.3 Greater staff satisfaction is associated with seeing value in/impact of the new models of careAppreciating the value and impact of a new role is largely associated with the new MoC being driven by a locally identified need or being driven from the bottom-up. The other main factor impacting on this is engagement. Both of these factors are described under Proposition 1.3.4 Greater staff satisfaction is associated with appropriate support for the development and implementation of the new models of careThis factor is also closely related to the importance of engagement of key stakeholders from across a multitude of levels within the organization, and therefore, is closely related to Proposition 1.4.1 Better patient outcomes are associated with greater engagement of patients in the decision making associated with their care deliveryFew of the projects reported the patient perspective; therefore, there is limited data to assess this proposition. Failure to facilitate patient engagement was highlighted in one unsuccessful project; the patients using the service did not feel that there was a need for additional services and therefore did not use them.4.2 Better patient outcomes are associated with putting the patient at the center of the new models of care, rather than the practitionerThis study found evidence that if patients were not involved in driving the new services then patient outcomes were less likely to be the specific focus of the project, or were not improved. In particular, one project, driven from the top-down, with the goal of reducing unplanned hospitalizations in a pediatric population was not successful because the patients (parents) did not see a need for more services, and therefore did not make use of the new services. Another project used a multidisciplinary team to shift the approach from professionally centred care to patient centred care. Some projects were focused on decreasing wait times for patient and improving patients safety; however, the outcome evaluations were generally based on the staff\u2019s perceptions that patient outcomes improved.any care or service where the alternative is no service, or a long waiting list4.3 Better patient outcomes are associated with providing The data from this study predominantly related to providers and identified outcomes from the provider perspective; however, there was some empirical evidence to support this proposition. Eleven projects provided care or services where previously, there was limited or no service provided due to long waiting lists or geographic inequities in service distribution. However, because of the lack of data collected to describe outcomes from the patient\u2019s perspective, we recommend that in future workforce change projects, data are captured that focus on the patient\u2019s perspective of new MoC.This project identified and tested empirically a series of propositions associated with successful workforce change. The propositions that were supported by the data are listed below:1. Better sustainability of a new MoC is associated with:\u2022full engagement of all key stakeholders first\u2022bottom- up drivers (rather than top-down)\u2022top-down support to drive, underpin, and sustain the new MoC\u2022legislative scaffolding to reinforce the new MoC, including award and pay structures supported in industrial agreements, and ratified at the highest possible levels of government, to avoid undermining by professional boundary arguments\u2022codification of the processes, practices, and training used to implement the role\u2022powerful allies to drive the role forward\u2022implementing new MoC that are appropriate for the context 2. More efficient use of health practitioner roles is associated with:\u2022clearly defined roles within the MoC\u2022clearly defined, understood, and unambiguous delegatory or allocatory MoC\u2022delegating practitioners having confidence in their delegation, which comes from understanding the roles, training, and competencies of the practitioners to whom they are delegating\u2022trust, derived from time and exposure to the new MoC , is important for establishing appropriate delegation/collaboration/referring practices\u2022allowing practitioners to work to their full scope of practice and having structures that reinforce this.3. Greater staff satisfaction is associated with:\u2022better career development opportunities\u2022appreciating value / impact of the role\u2022appropriate support for the development and implementation of the MoC.4. Better patient outcomes are associated with:\u2022greater engagement of patients in the decision making associated with their care delivery\u2022putting the patient at the centre of the MoC, rather than the practitioner\u2022providing any care or service where the alternative is no service, or a long waiting listThese propositions have been further synthesized into three broad principles of workforce change:(1) Drivers for change need to be closely linked to clinical practice and patient care. Workforce change needs to be driven by perceived or potential benefits to patients, staff and /or services at the local level.(2) The context for workforce change must be supportive at all levels. This includes a supportive legislative and industrial environment, professional environment, and leadership and champions.(3) Mechanisms for workforce change should include engagement of key stakeholders, access to resources to support the implementation and performance of the role, a facilitated change management process, and appropriate governance and support structures.The first two propositions had the greatest volume of data to support them. While there was evidence to support the propositions within statements 3 and 4, they were not mutually exclusive to these domains, and tended to reinforce the statements within Propositions 1 and 2.The strength of the evidence largely reflects the nature and volume of data collected relating to each factor. In other words, \u2018weak\u2019 evidence was likely to be due to a lack of available data rather than findings that refuted the propositions. We were surprised by (a) the lack of patient engagement and (b) the lack of patient focus in the projects. Consistent with the literature in this field, the majority of the projects focus on professions and changing role boundaries or developing new MoC. This focus, by definition, leads to interdisciplinary challenges and rivalry because the emphasis of change becomes the renegotiation of roles, rather than the best way of allocating care to meet the needs of the patient. The lack of a clear patient focus meant that goals were often process-based, rather than outcome-focused.This project developed and tested a novel method, Inductive Logic Reasoning, to create and empirically test theories of workforce change. This method has the advantage that it enabled us to develop and develop theories from the existing literature to create a series of propositions that were then tested empirically and transparently against a large dataset. This method aimed to address some of the limitations of the existing theory-based evaluation approaches by using logic models in a transparent way to develop theories of change which can be transparently tested. The dataset incorporated a large range and volume of data sources of varying structure, content, and quality, and we were able to transparently extract data against pre-defined themes to create the initial logic model.This study involved the analysis and synthesis of a large volume of data from a range of sources, in varying formats, and over a short period of time. The combination of the logic model and proposition development and testing appears to have been an effective and transparent way to arrive at a high-level synthesis of the data, which was the goal of this study. However, in achieving that goal, we have lost a great deal of depth and detail of the raw data.One of the challenges of the evaluation was identifying measures of success due to the heterogeneity of the projects and their large range of potential impacts. We were unable to draw firm conclusions about the outcomes of the workforce projects for reasons identified above; however, there were clear process indicators associated with project success. The nature of the evidence of change makes it difficult to draw causal relationships.As with all research, there is the risk of researcher bias. Workforce research is highly contextually dependent, and we have framed this research within the Australian health workforce context. This approach automatically biased the researchers towards certain norms. We attempted to ensure objectivity by embedding our propositions within the literature first, and then testing them empirically against the data arising from the projects; however, the research still has the Australian health-care context as its normative setting.The project reports used as data were not written with the expectation that they would form part of a large-scale evaluation; hence, their findings were presented in different ways. We have triangulated a range of primary and secondary data sources from a variety of participants to ensure the validity of our findings.We acknowledge that methods to empirically develop and test change theories require further development and refinement. For instance, it may be possible to draw tighter conclusions if we were to re-assess each project against the success criteria. This would also help to validate the success criteria.The implementation of new MoC is a complex process and broad principles of change management apply. Based on the findings of this study, we developed a comprehensive Workforce Change Checklist: An Evidence Based Practice Guide for Implementing Successful Workforce Change , which iAHAs: Allied health assistants; AHPs: Allied health professionals; CASP: Critical Appraisal Skills Programme; EPOCH: The Cochrane Collaboration\u2019s Effective Practice and Organisation of Care; ILR: Inductive logic reasoning; MoC: Models of care; QH MoC: Queensland Health Models of Care.Kerry Vanniekerk-Lyons was employed as a project officer by Queensland Health and was involved in the project management of the overall Models of Care projects. Her role in this research has been to help broker access to the data, provide support for the multiple site specific research governance requirements, and provide clarification of facts relating to the data. To maintain objectivity, the remaining members of the research team, who were external to the Queensland Health MoC processes, undertook the majority of interpretation and analysis of the data and have no competing interests.SN conceived the original project, obtained the funding, developed the methodology and was involved in the data analysis and synthesis and drafted the paper. AR was overall project manager and was responsible for much of the data management, synthesis and analysis. AM and SG were involved in the data analysis and synthesis. KV provided ethics and governance support. All authors provided input into the conceptual development and ongoing drafts of the paper. All authors read and approved the final manuscript.Susan Nancarrow, Director of Research at the School of Health and Human Sciences, Southern Cross University, Australia.Alison Roots and Anna Moran are research fellows at the School of Health and Human Sciences, Southern Cross University, Australia.Sandra Grace is a senior lecturer at the School of Health and Human Sciences, Southern Cross University, Australia.Kerry Vanniekerk-Lyons is a full-time PhD student examining sustainable workforce change at the School of Health and Human Sciences, Southern Cross University, Australia.Data extraction template for Queensland Health documents.Click here for fileSingle case study of the introduction of a social work assistant illustrating data output from the Google form[ogle form.Click here for fileQueensland Health models of care project summaries.Click here for fileSummary of project outcomes.Click here for fileProposition summaries and supporting evidence.Click here for file"}
{"text": "Effective collaboration between the Ministry of Health, local government, and implementing partnersSocial mobilization to sensitize the community about the importance of net useDevelopment of a mobile application to facilitate data collection and analysisA school-based net distribution program, piloted in the Southern Zone of Tanzania to sustain \u226580% universal net coverage previously attained through mass campaigns, successfully issued nets to nearly all eligible students and teachers. Keys to success included: Effective collaboration between the Ministry of Health, local government, and implementing partnersSocial mobilization to sensitize the community about the importance of net useDevelopment of a mobile application to facilitate data collection and analysisA school-based net distribution program, piloted in the Southern Zone of Tanzania to sustain \u226580% universal net coverage previously attained through mass campaigns, successfully issued nets to nearly all eligible students and teachers. Keys to success included: Tanzania successfully scaled up coverage of long-lasting insecticidal nets (LLINs) through mass campaigns. To sustain these gains, a school-based approach was piloted in the country\u2019s Southern Zone starting in 2013, called the School Net Program 1 (SNP1). We report on the design, implementation, monitoring, and outputs of the second round (SNP2) undertaken in 2014. SNP2 was conducted in all schools in Lindi, Mtwara, and Ruvuma regions, targeting students in primary  and secondary (Forms 2 and 4) schools and all teachers. In Lindi region, 2 additional classes (Standards 2 and 4) were targeted. LLIN distribution data were managed using an Android software application called SchoolNet. SNP2 included 2,337 schools, 473,700 students, and 25,269 teachers. A total of 5,070 people were trained in LLIN distribution , and 4,392  community change agents undertook sensitization and mobilization. A total of 507,775 LLINs were distributed to schools, with 464,510 (97.9% of those registered) students and 24,206 (95.8% of those registered) school teachers receiving LLINs. LLIN ownership and use is expected to have increased, potentially further reducing the burden of malaria in the Southern Zone of Tanzania. Keep-up strategies focus on long-term, continuous distribution through channels such as schools, health facilities, community initiatives, and the private sector; catch-up strategies are periodic mass distribution campaigns. NATNETS assessed all possible keep-up options and determined that a combined approach including the TNVS and school-based distribution, involving both push and pull systems, was the most cost-effective and efficient keep-up strategy for Tanzania.The Ministry developed a keep-up strategy in schools to complement the voucher scheme.In 2013, the NMCP and partners piloted the first round of the School Net Program (SNP1) to distribute LLINs in the Southern Zone of Tanzania . Each student in Standards 1, 3, 5, and 7 of primary schools, and Forms 2 and 4 of secondary schools, received an LLIN to take home. A total of 421,285 students (83% of those eligible) received LLINs.We describe here the design, implementation, monitoring, and outputs of the second round of the School Net Program (SNP2), conducted in 2014.SNP2 aimed to increase access to LLINs and maintain at least 80% coverage in the 3 regions by distributing LLINs free of charge to primary and secondary school students and teachers. Teachers were included as beneficiaries in SNP2 because there was an excess supply of LLINs from SNP1. In Lindi, an additional 2 grades (Standards 2 and 4) were targeted for LLIN distribution to reduce the expected remaining stock. As in SNP1, each student from Standards 1, 3, 5, and 7 and Forms 2 and 4 in Mtwara and Ruvuma received 1 LLIN.An SNP task force, chaired by the NMCP, was created to oversee the implementation of SNP2 . The tasNational Malaria Control ProgrammeMinistry of Health and Social Welfare School Health ProgramMinistry of Education and Vocational TrainingPrime Minister\u2019s Office Regional Authority and Local GovernmentSwiss Tropical and Public Health Institute\u2019s NETCELL projectU.S. President\u2019s Malaria InitiativeWorld Health OrganizationJohns Hopkins Center for Communication ProgramsU.S. Peace CorpsMennonite Economic Development AssociatesRTI InternationalTanzania Red Cross SocietyPopulation Services InternationalJohn Snow, Inc.Members of the SNP2 task force included representatives from the:www.vector-works.org/resources/netcalc-planning-tool) to estimate the quantity of nets required to maintain at least 80% universal coverage in the Southern Zone of Tanzania.Before the SNP1 pilot, we used the NetCALC Planning Tool  at the district level, who then trained implementers (teachers) at the ward level. This was a shift away from a more centralized model used in SNP1, which required a substantial period of time, as one team of trainers moved from one district and region to another to conduct trainings. The training period for SNP2 was also reduced from a 2-day session to a half-day session at both the district and ward levels. The TOT targeted district malaria focal persons, district school health coordinators for health and education, and the ward education coordinators. The training of implementers was at the ward level, whereby head teachers and school health teachers from all schools within a ward attended the training. The ward education coordinators were the principal trainers who were supervised by national, regional, and district-based staff. Training focused on the use of LLINs, continuous distribution of LLINs through schools, monitoring, and reporting. Participants learned a systematic approach to managing the LLIN distribution process, including handling data collection forms, enumerating students, recording LLIN issuance data, summarizing data, and submitting data.The IEC/BCC subcommittee of the SNP task force planned advocacy and sensitization meetings; reviewed information, education, and communication (IEC) and behavior change communication (BCC) materials; and trained community change agents and volunteers. The task force distributed IEC materials, and aired radio spots and programs on local radio stations in Ruvuma, Lindi, and Mtwara regions to sensitize the community on the importance of LLIN ownership and use. IEC materials and radio spots focused on the community aspect of LLIN distribution. Spots provided details on the importance of using LLINs, emphasizing that students who received LLINs served as conduits for delivering them to the community.The M&E subcommittee of the SNP task force was set up to revise data collection tools and training manuals. The M&E team developed registration and issuance booklets as well as summary booklets to capture data at the school level during LLIN issuance. They used the summary booklets, filled in by the school principal, to compare the number of LLINs issued against the number of students in the registration and issuance booklets, filled in by class teachers.We developed a database application called SchoolNet to facilitate the collection and management of data from SNP2 schools. The SchoolNet app runs on Android tablets. We trained data clerks to use the SchoolNet app and developed an operative manual for guidance. Data clerks were responsible for entering data from the respective schools onto the tablets. Data were transmitted in real time through the local mobile phone network to a central database where the M&E team cleaned and analyzed the data in a timely manner for programmatic decision making. This approach to data management reduced the time-lag between LLIN issuance and data reporting, which enabled prompt analysis while maintaining high standards of data quality.A tablet-based application called SchoolNet enabled real-time data collection from schools on LLIN issuance.The logistics subcommittee of the SNP task force was responsible for reviewing the transport and logistics protocols, streamlining distribution procedures, and developing a program and timeline to distribute LLINs from Dar es Salaam to all SNP2 schools. The bulk transportation and distribution of LLINs to schools was led by the Tanzania Red Cross Society (TRCS), a humanitarian organization with expertise in logistics and supply chain management. Moving the LLINs from Dar es Salaam to schools involved geographical reconnaissance, transportation planning, rebundling, storage, and transport to the schools through the districts. TRCS transported LLINs from the central-level medical store department warehouse to the district level, rebundled them according to the quantification data, and stored them in warehouses until distribution to respective SNP2 schools.Logistics teams were dispatched to all districts to collect data regarding storage facilities, availability of council and private transports, and maps to design distribution routes. The geographic reconnaissance data were critical to developing a comprehensive logistics and transportation schedule, as it took into account geographical opportunities and challenges, such as poor road infrastructure in hard-to-reach areas.Rebundling LLINs involved grouping them into bales according to the needs of each school in the district, based on quantification data gathered during the SNP2 planning phase. TRCS packed LLINs in smaller volumes and labeled each with the quantity of LLINs and the respective school name. Labeled bundles were loaded onto smaller vehicles for ease of access on rural roads to ensure that they reached the targeted schools. To properly account for the LLIN inventory, SNP2 used delivery notes, warehouse journals, and bin cards to document and track net movement at every point of delivery. We conducted an independent procedural audit to track the LLINs from the central warehouse in Dar es Salaam, to a sample of 3 districts warehouses and to a sample of 27 schools. The audit reported that the logistics chain was effective in delivering LLINs and that there were no losses.LLIN delivery and issuance to all primary and secondary schools took place over a 3-day period on regular school days. Class teachers organized preregistered students by their respective classes. Each student and teacher receiving an LLIN were required to sign against his or her name in the registration and issuance booklets as proof of having received an LLIN. Supervision and documentation focused on the integrity of school data; adherence to procedures for distribution; and feedback on successes, challenges, and areas for improvement related to the LLIN distribution and issuing. We defined LLIN coverage as the proportion of eligible students and teachers who received LLINs.With technical assistance and supervision from the M&E team, data clerks entered data from hard copy training reports, inventory booklets, attendance registers, and school registers in central databases via the SchoolNet app. All information was subjected to periodic data quality checks through regular supervision and review of documents. The head teacher or school principal filled in summary booklets for each school, which the M&E team used to compare the number of LLINs issued against the number of students registered in each class. The issuance forms also captured the number of LLINs that schools received from the district warehouses, thus enabling the schools to keep track of remaining stocks.Issuance forms captured the number of LLINs that schools received, enabling them to track remaining stock.Data from each school were submitted to ward education coordinators for verification and subsequently sent to the district education officers. The M&E team then verified and cleaned the data. The M&E team visited all district offices to supervise the data collection process and to verify the quality, tools, and methodology used. To verify the data entered onto the tablets by the data clerks, the M&E team cross-checked them with hard copies of the issuance forms and summary booklets. All hard copy records were reviewed for accuracy and consistency, and filed in a central repository. Naming conventions were assigned for easy storage and retrieval of the records on hand. Relevant data were extracted from the SchoolNet app database and exported to a Microsoft Excel spreadsheet for analysis.The M&E team used Stata 12.0 to conduct data analysis. The team used descriptive statistics to investigate frequency distributions and proportions, and box plots to investigate the distributions of number of students eligible for SNP by class and region.SNP2 was undertaken as part of public health programming, and therefore ethical clearance was not required a priori. The National Health Research Ethics Subcommittee granted written permission to publish these data.PataPata children\u2019s radio programs were broadcast through local radio stations, including Jogoo FM, Pride FM, Newala FM, and the Tanzania Broadcasting Corporation. A total of 4,392 community change agents  delivered 1,500 sensitization and mobilization sessions, reaching 42,626 people.Comprehensive social mobilization activities complemented LLIN distribution, including IEC and BCC materials, radio spots, and sensitization sessions.All 2,337 schools participated in SNP2-targeted districts, the majority of which were primary schools . The numSchools received a total of 507,775 LLINs, of which 91.5% and 4.8% were issued to students and teachers, respectively . After dOverall, 98% of eligible students and 96% of eligible teachers received LLINs in the 3 regions.,,The school-based net distribution program, SNP2, successfully issued LLINs to 98% of eligible students and 96% of eligible teachers in the 3 targeted regions of Tanzania. Our findings are consistent with a similar pilot study in Ghana where LLINs were distributed to students in grades 2 and 6 of primary schools, teachers, and district office team members, and achieved nearly 100% LLIN coverage among eligible participants.We recommend implementing continuous LLIN distribution through schools within 9 to 12 months of any mass distribution campaign.,,Compared with SNP1, SNP2 achieved higher LLIN coverage of students (98% versus 83%), distributed 16% more nets, and had fewer LLINs remaining after distribution (4% versus 17%) due to a change in the program design to include teachers in all regions and additional grades in Lindi region. SNP2 was built on effective collaboration and teamwork between the Ministry of Health and Social Welfare, local government, and implementing partners. Specific roles and responsibilities were assigned to working groups to implement elements of the SNP framework\u2014a crucial ingredient for the success of SNP2 activities, as demonstrated in previous campaigns conducted in Tanzania.Slight differences between school enrollment data provided by districts (used for quantification) and student registration at schools  may have resulted in a deficit or oversupply of LLINs in a small proportion of schools. Such deficits were resolved through redistribution of excess LLINs from neighboring schools. We therefore recommend that head teachers should provide school enrollment data for net quantification. Also, based on feedback from participants, the half-day training for trainers and implementers was not adequate to cover all necessary SNP2 details; trainings should be extended to 1 day in future rounds of the SNP. We also recommend that the training of key implementers (teachers) should be coordinated by the Ministry of Education and Vocational Training, who should be more engaged in SNP. Finally, models have shown that 35% of households are potentially not reached by either the TNVS or SNP.Future school-based LLIN distribution should consider targeting primary school students only.SNP2 was successful in reaching 98% of eligible students and 96% of eligible teachers in 3 regions in Tanzania. Effective partnerships, coordination, and teamwork facilitated the successful implementation of SNP2. LLIN ownership and use in the community is expected to increase and therefore reduce the burden of malaria in the 3 regions. This program can serve as a model for other countries who wish to implement a school-based approach as a keep-up strategy to maintain universal coverage of LLINs for malaria prevention and control."}
{"text": "NSP4) is a critical protein for rotavirus (RV) replication and assembly. This protein has multiple domains and motifs that predispose its function and activity. NSP4 has a sequence divergence in human and animal RVs. Recently, 14 genotypes (E1-E14) of NSP4 have been identified, and E1 and E2 have been shown to be the most common genotypes in human.Non-structural protein 4 (NSP4 in RV-positive samples were inspected with the aim of NSP4 genotyping and variation analysis in viroporin and other domains. P and G typings of RV samples were carried out by WHO primers using a semi-multiplex PCR method. Non-typeable RV samples were amplified by conserved primers and sequenced.The gene and protein sequence of In viroporin and enterotoxin, conserved sequence was detected, and amino acids substitution with the same biochemical properties was found.NSP4 genotype with P or G genotyping G1/G9 correlates with E1 genogroups. In electrophoretyping of RV, E2 genotype had a short pattern when compared to E1.Association of  Reoviridae family with 100 nm diameter and contains icosahedral nucleocapsid symmetry, 1T-1 P[8], and 3T-1 P[6] forward and reverse primers, respectively. The cDNA was constructed with RevertAid First Strand cDNA Synthesis Kit  and gene specific consensus End 9 and con3 primers . Typically, the first-round PCR was performed in a 50-\u00b5l volume containing 1 \u00d7 PCR buffer  for 1 to 2 min until the appearance of dark-stained bands on the yellow background in 17 (62.9%) samples, P[4] in 8 (29%), and P[6] in 1 (3%). Amplicon sizes of P[4], P[8], P[6], and P[9] genotypes were 484, 346, 260, and 392 bp, respectively; P[9] genotype was not identified . In all NSP4 genotyping assay  and E2  were obtained. In general, E1 and E2 genotypes are dominant E genotypes in human RV samples/E1, and G2P[4]/E2 were detected, and no inter-genogroup reassorting containing VP7, VP4, and Based on previous epidemiological studies from Iran-42, ther"}
{"text": "Objective: The purpose of this study was to validate our previous genetic association findings related to the endoglin (ENG) pathway from an American Caucasian preeclampsia cohort in independent preeclampsia cohorts. We also sought to explore the ENG pathway for new genetic associations in these independent cohorts. Study design: We used a tagging single nucleotide (tSNP) approach to assess genetic variability across five ENG pathway genes  in a Caucasian cohort from Norway (n\u202f=\u202f77 preeclampsia cases & n\u202f=\u202f63 normotensive controls) and a White Hispanic cohort from Southern California (n\u202f=\u202f69 preeclampsia cases & n\u202f=\u202f106 normotensive controls). Main outcome measures: Univariate analyses  and multivariate logistic regression were conducted to evaluate the association between tSNP genotype distributions and pregnancy outcome in each cohort. Logistic regression models were adjusted for maternal age at delivery, infant sex, parity, smoking during pregnancy, and pre-pregnancy BMI. Results: Although we were unable to replicate our previous SNP-specific findings , we found that genetic variation in TGF\u03b2R1[ALK5] (rs6478974) and TGF\u03b2R2  was significantly associated with preeclampsia in the Norwegian cohort and genetic variation in ALK1 (rs706819) and TGF\u03b2R2 (rs9843942) was significantly associated with preeclampsia in the Latina cohort. Conclusion: Overall, our results provide further support for the involvement and investigation of the endoglin pathway in preeclampsia. Characterized as one of the \u201cgreat obstetrical syndromes,\u201d ENG mRNA expression is elevated in the placenta and the maternal blood (cellular and cell-free components) in women who develop preeclampsia ENG mRNA expression is significantly elevated in microvascular endothelial cells isolated from adipose tissue obtained at cesarean section in women with preeclampsia trans-membrane ENG receptor, is postulated to enter the maternal circulation from the placenta where it sequesters transforming growth factor beta (TGF\u03b2) and inhibits TGF\u03b2-mediated cell signaling and endothelial function Endoglin  is a membrane-bound co-receptor of transforming growth factor beta (TGF\u03b2) that regulates vascular tone ENG and other members of the TGF\u03b21 signaling system may play in the development of preeclampsia. Using a case-control genetic association study design and a tagging single nucleotide polymorphism (tSNP) approach, we previously found that genetic variation in ENG  and TGF\u03b2R2 (rs6550005) was significantly associated with the development of preeclampsia in American Caucasian women, while genetic variation in TGF\u03b21 , TGF\u03b2R1 (rs10739778), and TGF\u03b2R2  was significantly associated with the development of preeclampsia in African American women These elevations in endoglin mRNA expression and circulating endoglin protein levels in women with preeclampsia, assumed to be due to the increased contribution from a dysfunctional placenta, prompted us to investigate the role that maternal genetic variation in ENG pathway for new associations in these two cohorts.The purpose of this current study was to 22.1De-identified clinical data and DNA samples were obtained from the Oslo Pregnancy Biobank and the \u201cPilot Study of Novel Candidate Genes for Preeclampsia\u201d research study conducted at the University of Southern California, for Norwegian and Latina cohort participants, respectively.Participants of the Oslo Pregnancy Biobank were women with singleton pregnancies who delivered via elective cesarean section between the years 2001 and 2008. Women with a history of chronic hypertension, renal disease, diabetes, or other chronic diseases were excluded. Preeclampsia was defined as new-onset hypertension and proteinuria after gestational week 20, in accordance with the American College of Obstetricians and Gynecologists 2002 criteria that were in place when the study was conducted Participants of the \u201cPilot Study of Novel Candidate Genes for Preeclampsia\u201d case-control research study  were retrospectively recruited from delivery logs at the Los Angeles County and University of Southern California Women\u2019s and Children\u2019s Hospital or during their postpartum stay at the Women\u2019s and Children\u2019s Hospital between the years of 1999 and 2008. Women with lupus, chronic renal disease, multiple gestation, or sickle cell disease/trait were excluded from participation. Preeclampsia was also defined in alignment with the blood pressure and proteinuria criteria outlined by the American College of Obstetricians and Gynecologists in 2002 (please see criteria above) 2.2TGF\u03b2R2 AND rs11129420) to learn about the potential function of the tSNPs that were significantly associated with pregnancy outcome in the multivariate models.DNA aliquots obtained from the Norwegian cohort participants were extracted from EDTA peripheral blood samples using the MagNA Pure LC DNA Isolation Kit . DNA aliquots obtained from the Latina cohort participants were extracted from either peripheral blood samples or buccal swabs using the QIAamp DNA mini kit , saliva samples using the Oragene kit , or mouthwash samples using a phenyl-chloroform protocol previously described 2.3t-test, Fisher\u2019s exact test). For the main analyses, we utilized a tiered analytic approach. For the first analytic tier, we used Chi-square or Fisher\u2019s exact tests  and multivariate regression models to evaluate three tSNPs that were found to be significantly associated with pregnancy outcome in our previous study . In the second analytic tier, we evaluated the remaining tSNPs that had been genotyped. Univariate analysis with either Chi-square or Fisher\u2019s exact tests was conducted to initially explore the relationship between pregnancy outcome and each tSNP. A p-value of p\u202f\u2264\u202f0.15 was considered as potentially important. Multiple logistic regression models were then used to assess the relationship between potentially important tSNPs and pregnancy outcome while controlling for maternal age at delivery, infant sex, parity, self-reported smoking status during the index pregnancy, and pre-pregnancy body mass index (BMI). The adjusted odds ratio, 95% confidence interval, and the p-value of the tSNPs were reported. The overall goodness-of-fit of the logistic models were assessed by the Hosmer-Lemeshow test. We did not correct for multiple comparisons. Power analysis revealed that a sample size of 140 achieves 80% power to detect moderate effect size (W) of 0.2368 using a 1 degree of freedom Chi-square Test with a significance level  of 0.05.Demographic and clinical characteristics were compared between cases and controls using parametric and non-parametric tests . We used gestational age at delivery as a surrogate marker for preeclampsia onset  and compared. tSNP genotype distributions for each preeclampsia subgroup to the healthy control group using Fisher\u2019s exact tests.33.1TGF\u03b2R2 tSNP (rs6550005) was associated with preeclampsia in both an American Caucasian and an African American cohort. We found additional tSNPs that were associated with preeclampsia in the African American cohort that were not found to be associated with preeclampsia in the American Caucasian cohort, but here we focused on tSNPs that were associated with preeclampsia in the American Caucasian cohort given that our replication cohorts were not of African ancestry.The demographic and clinical characteristics for the Norwegian and Latina cohorts are presented in ENG: rs11792480, rs10121110; TGF\u03b2R2: rs6550005) and preeclampsia status were not replicated in both the unadjusted and adjusted analyses (p\u2019s\u202f>\u202f0.05)  and TFF\u03b2R2 (Six intronic tSNPs in two 3773663)   and TGFBR2 (Our exploratory subgroup findings suggest that certain tSNPs in two ntronic) . Because4ENG pathway are associated with an increased susceptibility to preeclampsia in both American Caucasian and African American women ENG mRNA expression and circulating sENG protein levels is well documented across multiple studies, few studies have explored the role of ENG pathway genetic variation in preeclampsia development.Preeclampsia is a heterogeneous disorder of pregnancy whose etiology may stem from a variety of underlying mechanisms. Women who develop early-onset and late-onset preeclampsia differ on average on several aspects, including their risk of future cardiovascular disease ENG pathway and susceptibility to/protection from preeclampsia in independent, well-characterized preeclampsia cohorts. We first sought to validate our genetic association findings from an American Caucasian preeclampsia cohort  in Norwegian and Latina cohorts. We further explored the other gene candidates from the ENG pathway for new genetic associations with preeclampsia in these cohorts. We were unable to validate/replicate the SNP-specific previous findings in these independent cohorts. However, we identified other associations between ENG pathway candidate genes and preeclampsia in the Norwegian  and Latina  cohorts in our adjusted models. We have previously demonstrated that variation in TGF\u03b2R1[ALK5] was associated with preeclampsia in an African American cohort TGF\u03b2R2 is associated with susceptibility to/protection from preeclampsia in all of the populations we have studied. Although the TGF\u03b2R2 tSNPs that were associated with a particular cohort may differ, these findings, along with the other associations in the Norwegian and Latina cohorts, provide additional evidence to support the ENG pathway\u2019s role/involvement in the development of preeclampsia.In this study we investigated the association between maternal genetic variation in the 4.1Several potential explanations could account for our inability to validate our previous results in independent cohorts. First, these cohorts may not have been sufficiently powered to detect statistically significant associations when they truly existed. Second, tSNPs that were selected based on Caucasian ancestry (CEU population-European descendants living in Utah) may not be as informative in the Norwegian and Latina cohorts if the haploblocks tagged by the tSNPs differ by ancestry. Finally, differences in the definition of preeclampsia phenotype may underlie our failure to validate our previous results. In the original cohort, a diagnosis of preeclampsia was based on hypertension, proteinuria, and hyperuricemia. Hyperuricemia was included in the original cohort\u2019s research definition as a way to identify a more homogeneous and potentially more severe form of preeclampsia. In both the Norwegian and Latina cohorts, hyperuricemia was not included as a criterion for the preeclampsia phenotype. Given the heterogeneous nature of preeclampsia, these cohorts may represent different preeclampsia subtypes with differing etiologies.4.2TGF\u03b2R1[ALK5] and TGF\u03b2R2 was associated with susceptibility to/protection from preeclampsia in the Norwegian cohort, while genetic variation in ALK1 and TGF\u03b2R2 was associated with susceptibility to/protection from preeclampsia in the Latina cohort. Seven of the eight significantly associated tSNPs .In addition to small sample size and differences in ancestry that were previously discussed, there were several other limitations associated with this study. First, the cohorts\u2019 sample sizes were further reduced when we carried out our exploratory preeclampsia subgroup analyses, which limited our ability to adequately evaluate preeclampsia subgroups. Second, we did not adjust for multiple comparisons and therefore we cannot rule out the potential for type 1 error. As such, follow-up studies with larger sample sizes, including larger preeclampsia subgroups, will be needed to validate these results. Third, we were unable to successfully genotype three SNPs (5Overall, our results provide further support for the involvement and investigation of the endoglin pathway in preeclampsia, yet additional research with larger sample sizes, including larger samples of different preeclampsia subgroups, is needed. Due to the relatively low frequency of preeclampsia, there is a need for investigators across the globe to collaborate and share data/biological samples with each other so that we can continue to put preeclampsia\u2019s puzzle pieces together."}
{"text": "In vitro studies assessed the role of caspase-2 in adipose tissue proliferative properties and susceptibility for lipoapoptosis. Caspase-2-deficient mice fed a Western diet were protected from abdominal fat deposition, diabetes mellitus, dyslipidemia and hepatic steatosis. Adipose tissue in caspase-2-deficient mice was more proliferative, upregulated mitochondrial uncoupling proteins consistent with browning, and was resistant to cell hypertrophy and cell death. The liver was protected from steatohepatitis through a decrease in circulating fatty acids and more efficient hepatic fat metabolism, and from fibrosis as a consequence of reduced fibrogenic stimuli from fewer lipotoxic hepatocytes. Caspase-2 deficiency protected mice from diet-induced obesity, metabolic syndrome and nonalcoholic fatty liver disease. Further studies are necessary to assess caspase-2 as a therapeutic target for those conditions.Obesity and its resulting metabolic disturbances are major health threats. In response to energy surplus, overtaxed adipocytes release fatty acids and pro-inflammatory factors into the circulation, promoting organ fat accumulation , insulin resistance and the metabolic syndrome. Recently, caspase-2 was linked to lipoapoptosis, so we hypothesized that caspase-2 might be a critical determinant of metabolic syndrome pathogenesis. Caspase-2-deficient and wild-type mice were fed a Western diet  for 16 weeks. Metabolic and hepatic outcomes were evaluated.  Ectopic fat accumulation in the liver, dubbed nonalcoholic fatty liver disease (NAFLD), strongly associates with the metabolic syndrome.4 Whereas metabolic disturbances, including insulin resistance undoubtedly can induce hepatic steatosis, whether or not hepatic steatosis can induce insulin resistance is still a matter of debate. On one hand, epidemiological studies suggest that patients with NAFLD are at increased risk for developing T2DM.5 On the other, several mouse models of NAFLD do not develop insulin resistance, and even exhibit increased sensitivity to insulin.8Western societies exist in an era of caloric excess that is at odds with evolutionary adaptations to the ancestral low-calorie lifestyle. As Western dietary habits have spread, obesity prevalence has nearly doubled worldwide. In 2008, 1.4 billion adults were overweight and half a billion obese, comprising 35 and 11% of the world population.9 Fat-swollen adipocytes become insulin resistant, decrease expression of adipokines such as the anti-inflammatory insulin-sensitizer adiponectin, and increase expression of the satiety factor leptin.10 Stressed adipocytes undergo cell death in mice with genetic- or diet-induced obesity, and in morbidly obese humans.11 Adipocyte cell size and cell death correlate with the presence of metabolic syndrome, insulin resistance and NAFLD.12Adipocytes respond maladaptively to chronic energy surplus, resulting in adipocyte hypertrophy.13 The primary function of caspase-2 remains to be determined, however, because it has also been implicated in several other vital processes including regulation of cell cycle checkpoints, oxidative stress responses, autophagy and senescence.17 Intriguingly, caspase-2 mRNA expression is elevated in adipose tissue of rats fed high-fat diet.18 Recently, caspase-2-initiated apoptosis was associated with lipotoxicity caused by accumulation of saturated fatty acids in frog oocytes,19 cultured mouse hepatocytes, and in mouse and human NAFLD.20 Caspase-2 expression strongly correlated with liver disease severity in patients with NAFLD.20 Further, caspase-2 depletion protected mice with methionine/choline-deficient (MCD) diet-induced steatohepatitis from hepatocyte apoptosis and fibrosis progression.20Caspase-2 is an initiator caspase for cellular apoptosis.We hypothesized that caspase-2 may be a key link between energy surplus, adipocyte death and the development of the metabolic syndrome and NAFLD. Our data support this concept because caspase-2-deficient mice fed a Western diet were protected from many aspects of the metabolic syndrome, namely increased adiposity, insulin resistance, dyslipidemia and NAFLD development and progression. These results suggest caspase-2 as a target for managing the metabolic syndrome, obesity, T2DM and NAFLD.versus subcutaneous distribution of body fat is deleterious.21Caspase-2-deficient mice and wild-type (WT) controls were fed standard chow diet or high-fat, high-sugar Western diet for 16 weeks. At the end of treatment, WT mice fed Western diet weighed 10% more than WT mice-fed chow diet. However, Western diet induced minimal additional weight gain in caspase-2-deficient mice . SimilarDifferences in adiposity could not be explained by decreased food intake, as caspase-2-deficient mice ate 8% more solid food and drank 40% more sugar-supplemented water than WT mice. Indeed, WT mice had higher food efficiency, gaining more weight per gram of food ingested .23 Western diet induced hyperplasia of pancreatic Langerhans islands in WT mice, but this expansion was significantly blunted in caspase-2-deficient mice . Caspase-2-deficient mice were protected from dyslipidemia . The fai10 Consistent with the increased number of smaller cells in caspase-2 knockout mice, these cells also had increased expression of cyclins, suggesting increased proliferative activity in the adipose cells of caspase-2-deficient mice , suggesting browning of the adipose tissue . UCPs deogenesis .28 Relative to WT mice, expression of crucial genes that regulate adipocyte metabolism and differentiation were increased in the adipose tissue of capase-2 deficient mice, including lipoprotein lipase, peroxisome proliferator activator receptor-\u03b3 (PPAR-\u03b3); sterol regulatory element-binding protein-1 (SREBP-1), CCAAT-enhancer-binding protein-\u03b1, (CEBP-\u03b1) and liver X receptor-\u03b1 (LXR-\u03b1) (Caspase-2 expression decreases as 3T3-L1 pre-adipocytes become adipocytes during culture-induced differentiation. (LXR-\u03b1) . Further (LXR-\u03b1) . Accumul29 Western diet induced massive hepatomegaly in WT mice, with an almost twofold increase in liver mass, and 50% increase in liver-to-body weight ratio. However, caspase-2-deficient mice maintained normal liver weight and liver-to-body weight ratio on Western diet , correlating with fibrosis severity in patients. of NASH . Western of NASH . We also of NASH , TUNEL s of NASH  and immu of NASH .30 Western diet induced more liver fibrosis in WT mice than in caspase-2-deficient mice, as assessed by Sirius Red staining, hydroxyproline content, qRT-PCR for collagen-1\u03b11, and immunohistochemistry for the myofibroblast markers, \u03b1-smooth muscle actin (\u03b1-SMA) and desmin (20 Fibrosis progression in NASH directly correlates with accumulation of reactive appearing bile ductules and inflammatory cells (the ductular reaction).31 Compared with WT mice fed Western diet, caspase-2-deficient mice were also protected from diet-induced ductular reaction  that induces cell death and is expressed in most tissues, and caspase-2S (short isoform) that antagonizes cell death, and is expressed mainly in brain, heart and skeletal muscle.32 This suggests an ancient role for caspase-2 in preserving the most essential organs by sacrificing less critical tissues in order to survive prolonged fasting. However, in modern times, energy surplus can also lead to accumulation of toxic lipids, leading to maladaptive caspase-2 activation.The involvement of a protein known to regulate cell death and the cell cycle in regulating whole-body metabolism is non-intuitive. Natural selection optimized mechanisms to cope with food deprivation. When presented with energy surplus, these adaptive mechanisms become deleterious and lead to the development of the metabolic syndrome. Caspase-2, the most evolutionarily conserved caspase,18 and complement an earlier report showing that caspase-2-deficient mice resist age-induced glucose intolerance.16 Our findings are in concordance with previous work from other labs showing an increase in adipocyte apoptosis both in mouse models of diet-induced obesity and obese humans.33 Adipocyte apoptosis correlates with insulin resistance and metabolic disturbances in obesity.34 Moreover, adipocyte apoptosis likely plays a causal role in both processes because deletion of the pro-apoptotic factor, Bid, prevented adipose tissue inflammation, systemic insulin resistance, and hepatic steatosis in mice with diet-induced obesity.33 The mechanisms involved are being uncovered. For example, there is evidence that apoptosis-effector caspases cleave PPAR-\u03b3 and GLUT-4, leading to decreased lipogenic gene transcription and impaired glucose uptake, effects that promote insulin resistance.35 In aggregate, these data suggest a unifying hypothesis whereby adipocyte apoptosis both leads to a massive decrease in adipose tissue capacity for fat storage by limiting the expansibility of the adipose tissue and induces an insulin resistant and pro-inflammatory state that promotes the metabolic syndrome. As a key initiator of adipocyte apoptosis, caspase-2 activation is a critical driver for this state of \u2018relative lipodystrophy' that limits the adaptive response to energy surplus.We propose the following paradigm: Western diet leads to accumulation of toxic lipids in adipocytes. Lipotoxic adipocytes activate caspase-2, inducing cell stress and death, leading to the release of toxic mediators , decreased uptake of NEFAs from blood, and release of NEFAs from dying cells. The net result is an increase in circulating NEFAs and perturbed adipokine secretion, promoting the metabolic syndrome. Supporting this hypothesis, caspase-2-deficient mice fed a Western diet showed some evidence of reduced activation of apoptosis in abdominal adipose tissue, normal adipokine secretion profile, decreased levels of circulating NEFAs, and protection from the development of insulin resistance/T2DM and the metabolic syndrome. These new findings reveal the relevance of increased caspase-2 in adipose tissue of rats fed a high-fat diet,36 Indeed, in twin pairs discordant for obesity, the prevalence of insulin resistance, metabolic syndrome and NAFLD in obese twins with hyperplastic adipose tissue is similar to that of their lean siblings, whereas obese twins with hypoplastic adipose tissue have higher rates of these conditions than their lean counterparts.37 In other studies, adipocyte size also had a strong positive correlation with risk for developing T2DM, cardiovascular disease and NAFLD.39 Several putative mechanisms for insulin resistance have been demonstrated in enlarged adipocytes including impaired insulin signaling due to decreased concentration of cholesterol in the cellular membrane,40 cytoskeleton disassembly,41 and excessive local accumulation of NEFAs.42 Fat depots with hypertrophic adipocytes also exhibit oxidative stress,43 ER stress,44 hypoxia,45 inflammation46 and fibrogenesis.47 These cellular stresses can culminate in adipocyte death, decreasing adipose tissue storage capacity during energy surplus, with the resultant relative lipodystrophy promoting an inflammatory state that characterizes human obesity.We identified several mechanisms in caspase-2-deficient mice that promote adipocyte homeostasis in response to energy surplus. Abdominal adipose tissue from caspase-2-deficient mice is fundamentally different from that of WT mice: adipose stem cells are more proliferative and hence, caspase-2-deficient mice have a larger number of small adipocytes, even when fed chow diet. Fat mass expansion by hyperplasia (increased cell number) is considered a healthier mechanism to compensate for energy surplus than expanding fat mass via adipocyte hypertrophy (increased cell size).48 In addition, female caspase-2-deficient-mice are known to have more primordial follicles than WT mice, although this results from reduced apoptosis, rather than increased cell division.49 Here we show not only that untransformed adipose stem cells are more proliferative in vitro, but also that chow-fed caspase-2-deficient mice have more adipocytes in abdominal adipose tissue in vivo than WT mice, and this difference persists after challenge with Western diet. The mechanism by which caspase-2 depletion confers a proliferative advantage is not yet fully understood. Caspase-2 is likely to inhibit replication because its activity is typically repressed during mitosis by a mechanism involving cyclin B1-mediated phosphorylation of caspase-2.50 Caspase-2 has been proposed to regulate cell cycle checkpoints through regulation of p53;51 p53 also regulates caspase-2 by controlling transcription of p53-induced protein with a death domain (PIDD), a scaffold protein required for caspase-2 activation. On the other hand, caspase-2 negatively regulates the NFkB survival and proliferative pathways through cleavage and degradation of receptor-interacting serine/threonine protein kinase 1 (RIPK1)52 and competition for assembly with PIDD.13Our study is the first to report increased proliferative capacity in untransformed somatic cells of adult caspase-2-deficient mice. Embryonic fibroblasts from caspase-2-deficient mice were reported to have a higher growth rate after oncogenic transformation than comparable cells from WT mice.53 Metabolic reprogramming of adipose tissue can also help explain the phenotype of caspase-2-deficient mice. We found increased expression of adipocyte differentiation markers, PPAR-\u03b3, CEBP-\u03b1 and SREBP-1c in caspase-2-deficient mice. These genes control adipocyte triglyceride storage capacity, and are expressed at high levels in adipose tissues of metabolically healthy obese individuals.54 In addition, PPAR-\u03b3 is a crucial regulator of gene networks involved in glucose homeostasis, controlling adiponectin expression.55 LXR-\u03b1 expression was also increased in caspase-2-deficient adipose tissue. LXR-\u03b1 promotes lipolysis and fatty acid stimulated oxygen consumption, and associates with decreased adipocyte size.56 The net outcome of these various responses to caspase-2 deletion is adipose depots with a larger number of adipocytes that are able to consume more energy. Hence, caspase-2-deficient mice do not develop stressful enlargement of adipocytes when challenged with an energy-dense Western diet. This is important as increased size/volume of adipocytes correlates with the development of T2DM.10 These beneficial effects of caspase-2 deletion of adipose tissue metabolism are likely to contribute to the profound protection from hepatic steatosis in caspase-2-deficient mice fed Western diet. Indeed, caspase-2-deficient mice were not protected from hepatic steatosis when fed MCD diet,20 a model in which hepatic steatosis is a consequence of reduced hepatic lipid export, rather than increased import of adipose-derived NEFAs. Additionally, the livers from caspase-2-deficient mice coped better with Western diet-related energy surplus by reprogramming hepatic metabolism, decreasing de novo hepatic lipogenesis, increasing hepatic fatty acid oxidation, and increasing fat export from the liver as lipoproteins. As in our prior study of MCD diet-fed mice,29 caspase-2 depletion protected Western diet-fed mice from liver injury, inflammation, and fibrosis. Thus, modulating caspase-2 activity is an appealing therapeutic approach for obesity and related metabolic syndrome pathology, including NAFLD.Our data also show, for the first time, that white adipocytes from caspase-2-deficient mice have evidence of browning, as indicated by UCP induction to more effectively cope with energy excess. Caspase-2 can also regulate metabolism through other mechanisms that are not fully understood. For instance, it has been suggested that caspase-2 regulates expression of FoxO1 and FoxO3a, important players in insulin signaling.57 Our studies, on the other hand, demonstrated a decrease in the level of liver oxidative stress caused by Western diet. This result is consistent with evidence that caspase-2 deficiency reduced diet-induced lipid accumulation, because ectopic fat accumulation is a major driver of oxidative stress.Capase-2 inhibition appears to be safe in mice. Caspase-2-deficient mice have a near normal phenotype and do not develop excessive tumors with aging, despite the fact that caspase-2 is an inhibitor of apoptosis and as such, might have some tumor suppressing functions. Specific inhibition of caspase-2 is also predicted to be safer than compromising the function of multiple caspases by treatment with pan-caspase inhibitors. Nevertheless, some reports have suggested that caspase-2 deficiency might lead to premature aging by reducing the clearance of cells damaged by oxidative stress.Our work raises several questions that must be further addressed. The biochemical mechanism by which caspase-2 deficiency protects from metabolic dysregulation remains unidentified. This must be clarified in order to design an appropriately targeted intervention that abrogates the deleterious effects of caspase-2 during energy excess. Current understanding of caspase-2 biochemistry suggests that caspase-2 might drive metabolic stress either via its proteolytic-catalytic activity (which is pro-apoptotic) or its scaffolding functions (which mediate the molecule's actions on proliferation and gene expression). Further, because no specific inhibitor of caspase-2 has been developed yet, it has not been possible to test the ability of such an agent to recapitulate the effects of caspase-2 gene deletion. Nevertheless, the current study provides compelling novel evidence that caspase-2 is a potential target to correct obesity and its associated comorbidities: metabolic syndrome, insulin resistance/T2DM and NAFLD. These diseases are the major killers of the Western world, and approaches to treat or prevent them will have tremendous implications for overall human health.et al. inactivated the caspase-2 gene by homologous recombination in 129S4/SvJae-derived J1 embryonic stem cells, and the founder mice were backcrossed to C57BL/6J inbred mice for 10 generations by Bergeron et al. before being donated to the Jax Lab, where they were C57Bl/6J-backcrossed for at least one more generation, resulting in genetic uniformity. Mice were fed either chow diet  or Western diet  for 16 weeks, beginning at 4 weeks of age. Diet specifications are in Male caspase-2-deficient and congenic WT C57Bl/6J mice were obtained from Jackson Laboratory . Bergeron During the last week of diet, glucose and insulin tolerance tests were performed. Glucose tolerance test was performed after 12\u2009h of fasting, by IP injection of glucose (2\u2009g/kg). Insulin tolerance test was performed after 5\u2009h of fasting, with IP injection of 0.6 units/kg of human regular insulin. Glucose levels were measured at sequential time points by tail vein sampling using a glucometer.2, as previously described.58In mice, body mass index was calculated as the body weight (g)/(crown-rump length (mm))Animal care and procedures were approved by the Duke University Institutional Animal Care and fulfilled National Institutes for Health and Duke University IACUC requirements for humane animal care.\u03bcm serial sections for H&E and Oil red staining. Immunohistochemistry was performed as previously described,20 with the primary antibodies specified in Formalin-fixed, paraffin-embedded liver, pancreas and epididymal adipose tissue biopsies were cut into 5\u2009Insulin was measured with Ultrasensitive Mouse Insulin ELISA kit , after 12\u2009h fasting. Lipids were measured with Triglyceride Colorimetric Assay kit , Free Fatty Acid Quantification Kit,  and Cholesterol Quantification kit ; serum leptin and adiponectin were determined with Abcam mouse ELISA kits, ab100718 and ab108785, respectively.59 For primers, see Total RNA was extracted from tissue using TRIzol . RNA was reverse transcribed into cDNA templates using random primer and SuperScript RNAse HReverse Transcriptase (Invitrogen). Semiquantitative qRT-PCR was performed using iQ-SYBR Green Supermix  on a StepOne Plus Real-Time PCR Platform , as previously described.Total proteins were extracted from liver and adipose tissue using RIPA buffer . Equal amounts of protein were separated by electrophoresis on 4\u201320% Criterion gels (Bio-Rad), transferred onto polyvinylidene difluoride membranes, and incubated with the primary antibodies specified in 60Mouse adipose tissue stem cells were isolated from caspase-2-deficient and WT mice as previously described.61 and differentiation confirmed with Oil red staining. Differentiated adipocytes were treated with 1\u2009mM palmitate without or with 20\u2009\u03bcM caspase-2 inhibitor Z-VDVAD-FMK  for 48\u2009h.3T3-L1 cells were differentiated into adipocytes,Apoptosis was measured using ApoTox-Glo Triplex Assay  and proliferation using BrdU assay .P<0.05 considered significant.Results are expressed as mean\u00b1S.E.M. Significance was established using two-way ANOVA, with"}
{"text": "The measurement of Pavlovian forms of fear extinction offers a relatively simple behavioral preparation that is nonetheless tractable, from a translational perspective, as an approach to study mechanisms of exposure therapy and biological underpinnings of anxiety and trauma-related disorders such as post-traumatic stress disorder (PTSD). Deficient fear extinction is considered a robust clinical endophenotype for these disorders and, as such, has particular significance in the current \u201cage of RDoC (research domain criteria).\u201d Various rodent models of impaired extinction have thus been generated with the objective of approximating this clinical, relapse prone aberrant extinction learning. These models have helped to reveal neurobiological correlates of extinction circuitry failure, gene variants, and other mechanisms underlying deficient fear extinction. In addition, they are increasingly serving as tools to investigate ways to therapeutically overcome poor extinction to support long-term retention of extinction memory and thus protection against various forms of fear relapse; modeled in the laboratory by measuring spontaneous recovery, reinstatement and renewal of fear. In the current article, we review models of impaired extinction built around (1) experimentally induced brain region and neural circuit disruptions (2) spontaneously-arising and laboratory-induced genetic modifications, or (3) exposure to environmental insults, including stress, drugs of abuse, and unhealthy diet. Collectively, these models have been instrumental in advancing in our understanding of extinction failure and underlying susceptibilities at the neural, genetic, molecular, and neurochemical levels; generating renewed interest in developing novel, targeted and effective therapeutic treatments for anxiety and trauma-related disorders. Canst thou not minister to a mind diseased,Pluck from the memory a rooted sorrow,Raze out the written troubles of the brain\u2026Shakespeare, Macbethfear extinction, the CS is typically a previously neutral stimulus that, through conditioning, has come to be associated with an aversive outcome, such that its occurrence alone is capable of eliciting some form(s) of fear/anxiety/defensive CR. The CR, and the degree of its diminution in amplitude and frequency under extinction, can be objectively measured and quantified in the laboratory in human  and rodent  subjects and has even been documented in invertebrates  described extinction as a phenomenon whereby repeated non-reinforced presentation of a conditioned stimulus (CS) led to the reduction in the magnitude of the conditioned response(s) (CR) Pavlov . In the In addition to being relatively easy to compare readouts of fear extinction between humans and rodents, given the similarity of laboratory testing procedures, there are a number of other factors that give extinction translational appeal. First, as summarized below, many of the brain regions that have been connected in some way to effective or deficient fear extinction, respectively, are common across humans and rodents\u2014lending credence to the idea that findings at the neural level in one species are informative to the other  of these factors, and is distinguished from the use of fear extinction as a test or assay  inactivation, have been supplemented by newer optogenetic and chemogenetic approaches that allow for access over specific neural populations and pathways with better spatial and/or temporal precision. From these studies, it is clear that the learning of and the memory for extinction is distributed in a network fashion across brain areas including the prefrontal cortex (PFC), amygdala and hippocampus, but also a range of additional structures such as periaqueductal gray (PAG), bed nucleus of the stria terminalis (BNST), VTA, striatum, and others.The broad strokes of the principal findings to date are as follows: Using a range of techniques, including temporary inactivations, immediate-early gene analyses, single-unit recordings, and optogenetics, activity in the dorsomedial PFC (dmPFC) positively associates with high fear/poor extinction, via reciprocal connections to pro-fear subpopulations of projections neurons in the basal amygdala (BA) .The well-studied vHPC-mPFC-BA system subserving extinction is itself supported by other structures that are being revealed by recent work. These include the ventrolateral periaqueductal gray (vlPAG), which when inhibited impairs extinction (and fear learning)   encoded within this genomic region , suggesting this gene affects extinction by modulating a key stress-regulating system  (C57BL/6\u00a0J) mice could be split into extinction-resilient and susceptible subgroups, that were in turn associated with specific patterns of corticoamygdala activity Table  and geneThere are interesting overlaps between the effects of exposure to stress and drugs of abuse, another risk factor for anxiety disorders and PTSD, on extinction. For example, chronic cannabis use is associated with impaired extinction in humans (Papini et al. Unlike most other abused drugs, alcohol is consumed like a food and is a source of calorific intake. The degree to which this contribute to the deleterious physiological effects of chronic drinking is debated but may be relevant here given recent evidence that abnormal diet can affect fear extinction. Rats fed a high-fat/high-sugar diet over the course of 6\u00a0weeks developed poor extinction Table  and alteWe wish to highlight these latter findings not to overstate the potential importance of poor diet as a risk factor for trauma-related conditions, but rather to underscore the expanding range of environmental insults found to disrupt fear extinction. A challenge for future work will be to model the real-world combination of dietary factors, exposure to drugs and life stressors faced by most at-risk individuals, and to use the rodent models to decipher how these interact and potentially synergize to affect clinical outcomes.The value of rodent models of impaired extinction is ultimately gauged by their utility as a platform for the identification of novel mechanisms for therapeutically normalizing extinction. While there are examples of targeting circuit abnormalities via deep brain stimulation in these models (Rodriguez-Romaguera and Quirk Once a promising pharmacological target is identified, a critical question is how it should be clinically administered to maximize its therapeutic potential and mitigate risk of failure in clinical trials. In this regard, the administration of a single drug concomitant to fear extinction in extinction-deficient individuals does often not suffice to support the extinction memory-augmenting mechanism to an extent that prevents temporal, spatial, or stress-dependent fear relapse (Singewald et al. Supporting the utility of this dual pharmacotherapeutic concept, it was demonstrated that fear relapses in extinction-deficient mice can also be reduced by combined administration of L-DOPA and the HDAC-inhibitor MS-275, concomitant to extinction training (Whittle et al. Beyond pharmacological approaches, less conventional approaches have to date been less studied in extinction-deficient models, but are certainly worthy of investigation. One interesting modification to changing the way extinction memories are formed simply involves training in multiple contexts (de Jong et al. A final point to underscore is that eventual success of novel treatments will be bolstered by grounding them in a solid understanding of how they act at the neural level. The field can draw upon the great advances that have been made in delineating the neural circuitry of fear extinction, as discussed above (Hariri and Holmes"}
{"text": "Renal disease is not rare among patients with inflammatory bowel disease (IBD) and is gaining interest as a target of research. However, related changes in glomerular structural have rarely been investigated. This study was aimed at clarifying the changes in collagens and glomerular filtration barrier (GFB)-related proteins of glomeruli in a dextran sulfate sodium (DSS)-induced colitis mouse model. Acute colitis was induced by administering 3.5% DSS in Slc:ICR strain mice for eight days. Histological changes to glomeruli were examined by periodic acid-Schiff (PAS) and Masson\u2019s trichrome staining. Expressions of glomerular collagens and GFB-related proteins were analyzed by immunofluorescent staining and Western blot analysis. DSS-colitis mice showed an elevated disease activity index (DAI), colon shortening, massive cellular infiltration and colon damage, confirming that DSS-colitis mice can be used as an IBD animal model. DSS-colitis mice showed increased glycoprotein and collagen deposition in glomeruli. Interestingly, we observed significant changes in glomerular collagens, including a decrease in type IV collagen, and an increment in type I and type V collagens. Moreover, declined GFB-related proteins expressions were detected, including synaptopodin, podocalyxin, nephrin and VE-cadherin. These results suggest that renal disease in DSS-colitis mice might be associated with changes in glomerular collagens and GFB-related proteins. These findings are important for further elucidation of the clinical pathological mechanisms underlying IBD-associated renal disease. Inflammatory bowel disease (IBD) is a chronic, remitting and relapsing inflammatory disease of the gastrointestinal tract characterized by inflammation and mucosal tissue damage and is associated with significant morbidity. Ulcerative colitis and Crohn\u2019s disease are the two most common forms of IBD. Ulcerative colitis and Crohn\u2019s disease differ from each other in physiology, but show similar symptoms such as severe diarrhea, rectal bleeding, abdominal pain, fever, and weight loss ,2. CliniDextran sulfate sodium (DSS) is a water-soluble sulfated polysaccharide. Oral administration of DSS to trigger acute colitis has been widely used in experimental animal models for preclinical studies of IBD, because the pathophysiology resembles human Ulcerative colitis ,13,14. RIn this study, we investigated glomerular structural changes focusing on specific types of glomerular collagens and GFB-related proteins after DSS administration, to demonstrate the coexistence of glomerular structural changes and IBD in a DSS-induced colitis mouse model. This study should help establish an experimental animal model for further elucidation of the clinical pathological mechanisms of IBD-associated renal disease.p < 0.05)  A. DAI sc < 0.05) B. Colon  < 0.05) C. Histol < 0.05) D. These Human and mouse studies have indicated the involvement of non-intestinal organs in IBD ,6,7,8,9.Glomerular collagens including type IV collagen , type I collagen  and type V collagen  ,27 were The GFB comprises glomerular endothelial cells, the GBM and podocytes ,23. PodoWestern blot analysis of these four proteins in glomeruli showed declines in all proteins B, consisThese findings confirmed that DSS administration caused podocyte damage  and changes to endothelial adherens junctions in glomerular endothelium (reductions in VE-cadherin). These results are shown in Renal manifestations and complications in patients with IBD have been reported in several clinical and experimental studies from recent years ,10,11,28This study adopted the DSS-induced colitis mouse model and confirmed symptoms of DSS-induced colitis such as body weight loss, diarrhea, gross bleeding and colon architecture destruction , similarWe noticed that kidney size and weight were decreased in DSS-colitis mice after DSS administration , since kTo clarify the assumption that DSS induces renal structural change, we investigated the changes in specific types of collagens in the glomeruli. Our results showed that type IV collagen was decreased in the GBM, whereas type I and V collagens increased in the renal glomerular capillary loops and interstitium of DSS-colitis mice . Type IVRenal disease has been reported in human IBD patients, but GFB-related protein changes have not been closely investigated. The present study investigated four proteins  to clarify GFB damage, because these proteins have not been investigated in the kidneys of DSS-colitis mice, and the relevance of GBM damage in the DSS-induced colitis mouse model has not been reported yet. Our results showed declined expression of all four proteins in glomeruli after DSS administration . PodocytTaken together, our results imply that DSS administration could cause the glomerular collagen changes, including decreased type IV collagen as a supporting ECM of GBM structure and deposition of type I and type V collagens in renal interstitium. These collagen changes might lead to structural damage to podocytes such as a loss of polarity and detachment from the GBM, as well as loss of endothelial cell junctions, eventually causing renal disease. Loss of the podocyte cytoskeletal proteins synaptopodin and podocalyxin and the slit diaphragms protein nephrin, as well as the defective endothelial cells adherens junction protein (VE-cadherin) which may be associated with podocyte damage.Based on our findings, the lack or insufficiency of these GFB-related proteins in DSS-colitis mice might cause glomerular structural damage, and consequently lead to damage not only to podocytes, but also to adherens junctions in the vasculature, which might result in GFB damage.In conclusion, this study used the DSS-induced colitis mouse model, a very common experimental model of colitis, to clarify changes in glomerular collagens and GFB-related proteins after DSS administration. These findings on glomerular structural change in experimental mice with DSS-induced colitis should lead to novel uses of the animal model for further investigations into IBD-associated renal disease.Seven-week-old male Slc:ICR strain mice weighing 28\u201330 g  were housed in the Central Animal House at the University of Tsukuba under climate-controlled conditions . Cages were cleaned and sterilized every week. All mice were given free access to food and water. Animal experiments were conducted in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the Science Council of Japan and Ministry of Education, Culture, Sports, Science and Technology of Japan. The protocol was approved by the Committee on the Ethics of Animal Experiments of the University of Tsukuba  based on the Institutional Animal Care and Use Committee (IACUC). All surgery was performed under sodium pentobarbital anesthesia, and all efforts were made to minimize suffering.w/v) DSS  dissolved in drinking water for eight days. Six mice per group were used in each experiment, and were not allowed to access to any other source of water. Mouse weights were monitored daily to quantify the systemic consequences of colitis. Mice were fed with normal water in place of DSS water on Day 8 and euthanized on Day 9. Colon length and kidney weight were measured for each mouse at harvest, then fixed in 10% neutral buffered formalin  or stored at \u221280 \u00b0C for further use. Mice receiving only distilled water were used as controls.As a widely used model of IBD, the DSS-induced colitis mouse model was used in this study to investigate changes to renal glomerular collagens and GFB-related proteins. This mouse model was established by inducing colitis with the administration of DSS in drinking water for eight days , followiWeight loss, stool consistency, and rectal bleeding were recorded daily to assess the severity of DSS-colitis. DAI was determined based on the methods described previously . BrieflyTo detect injury to the colon and renal tissues, prepared tissues were cut into 2-\u03bcm thick sections using a microtome  and stained with hematoxylin and eosin (HE) for histological investigations. To assess the GBM, periodic acid-Schiff (PAS) was used to estimate the glomerular deposition of matrix glycoprotein . Briefly\u00ae 488 or 568 ; double-stained with rhodamine-conjugated phalloidin  for F-actin; and finally submerged in fluoroshield mounting medium containing 4\u2032,6-diamidino-2-phenylindole (DAPI) . Confocal imaging was performed according to the method described previously [\u00ae 488, and 568 signals were detected at laser excitation wavelengths of 488 nm and 543 nm, respectively.Immunofluorescence staining was performed by following the method described previously . Brieflyeviously  with a cKidney cortex tissue from each mouse was removed, glomeruli were isolated using a serial sieving method described previously , and the3VO4, 1 mM NaF, 20 mM Na4P2O7, 0.02% NaN3, 1% Triton X-100, 0.1% SDS and 1 mM PMSF) with 1% protease inhibitor cocktail  by sonication , followed by incubation on ice for 10 min and centrifugation at 10,000 rpm for 10 min. Supernatant was collected and protein concentration was quantitated using the Micro BCA Protein Assay kit  according to the instructions from the manufacturer. Thirty micrograms of total protein were loaded per lane and separated by 7.5% polyacrylamide gels, followed by transferring onto methanol-activated PVDF membrane . Protein-transferred membranes were incubated with primary antibodies against type I collagen, type IV collagen, type V collagen, synaptopodin, VE-cadherin, nephrin, podocalyxin and \u03b2-actin, respectively, at 4 \u00b0C overnight, followed by incubation with horseradish peroxidase-conjugated secondary antibody for 2 h at room temperature. Blots were visualized with chemiluminescence substrate for 1 min and detected using a luminescent image analyzer . Band density was quantitated densitometrically with Image J software  by calculating the average optical density in each band. Relative and normalized protein expressions were calculated using the ratio of each protein density to \u03b2-actin density.Kidney cortices (~50 mg) or isolated glomeruli from kidney cortices of each mouse were homogenized in lysis buffer  in at least 3 independent experiments. The significance of differences between groups were analyzed using Student\u2019s t-test. A probability level of p < 0.05 was considered significant.Statistical analyses were performed using Prism software . All data are expressed as mean \u00b1 standard error of the mean (SEM) from 6 replicates ("}
{"text": "SUOX). Clinically, the disorder is classified as one of two forms: the late-onset mild form or the classic early-onset form. The latter is life-threatening and always leads to death during early childhood. Mild ISOD cases are rare and may benefit from dietary therapy. To date, no cases of ISOD have been reported to recover spontaneously. Here, we present three mild ISOD cases in one family, each with a stable clinical course and spontaneous recovery.Isolated sulfite oxidase deficiency (ISOD) is an autosomal recessive disorder caused by a deficiency of sulfite oxidase, which is encoded by the sulfite oxidase gene . The siblings included two males and one female with late ages of onset (12\u201316\u2009months) and presented with specific neuroimaging abnormalities limited to the bilateral globus pallidus and substantia nigra. The three patients had decreased plasma homocysteine levels. They exhibited a monophasic clinical course continuing up to 8.5\u2009years even without dietary therapy.All three siblings had two novel compound heterozygous mutations in the This is the first report of mild ISOD cases with a stable clinical course and spontaneous recovery without dietary therapy. Our study provides an expansion for the clinical spectrum of ISOD. Furthermore, we highlight the importance of including ISOD in the differential diagnosis for patients presenting with late-onset symptoms, bilaterally symmetric regions of abnormal intensities in the basal ganglia, and decreased plasma homocysteine levels. SUOX) [SUOX gene result in a decrease in SUOX activity, leading to an accumulation of sulfur-containing amino acids, inducing mitochondrial impairment and energy failure, and resulting in severe neurological damage [Isolated sulfite oxidase deficiency  is an inborn error of metabolism characterized by severe neurological impairment including dystonia severe psychomotor delay, refractory seizures, and lens dislocation. Clinically, the disorder is classified as one of two forms: mild or severe. Severe ISOD often presents within the first 72\u2009h of life and leads to death during early childhood in most cases , 2. ISODSUOX) . Mutatiol damage , but clil damage . Therefo. This study was approved by the Ethics committee of the Affiliated Hospital of Zunyi Medical University, China.The three patients in this report were children of a non-consanguineous Chinese couple Fig.\u00a0a who wer1Before age 1, psychomotor development in the firstborn male patient was normal, and he could walk independently. This patient exhibited rapid regression of acquired motor skills and cognition after a 2-day episode of mild diarrhea at age 1. Seizures were not observed. On examination, his growth was found to be in the 90th percentile, and his alertness and eye movement were both normal. He was not able to sit. No dysmorphic features, tremor, ataxia, or involuntary movements were observed. Cranial nerve examination findings were normal. He had generalized hypotonia with normal deep tendon reflexes. His blood lactate level was slightly increased, but uric acid, plasma glucose, and cerebrospinal fluid (CSF) test results were unremarkable. Brain magnetic resonance imaging (MRI) using T2-weighted (T2WI) and fluid-attenuated inversion recovery (FLAIR) sequencing demonstrated high signal in lesions limited to the bilateral globus pallidus and substantia nigra . Whole-exome sequencing showed that all three siblings harbored two novel compound heterozygous mutations  in the SUOX is associated with ISOD, and therefore, the levels of sulfite in the urine and plasma homocysteine were measured for each of the three children. This indicated that sulfite concentrations were higher than normal and that homocysteine levels were lower than normal in all three children (Table en Table . The thrVery few patients present with the mild form of ISOD. Previously, only seven patients with mild ISOD have been reported in the literature \u201311, 13. SUOX gene have a milder clinical presentation than those with null mutations [SUOX gene only lead to decreased biosynthesis of SUOX, whereas null mutations of the SUOX gene lead to complete abolishment of SUOX biosynthesis [SUOX gene, further supporting the hypothesis that missense mutations of the SUOX gene contribute to a milder presentation.Mechanisms for milder presentations of ISOD have not been fully elucidated. It has been reported that patients with missense mutations in the utations , since mynthesis . The genOur case series and 2 cases of late-onset mild ISOD reported by others show decreased homocysteine levels. Sulfite reacts readily with free thiol groups to form sulfocysteine. It can also conjugate with homocysteine to form sulfocysteine, thus depleting plasma homocysteine . The sliMore than 90% of patients with classic early-onset ISOD show severe cerebral and cerebellar atrophy and/or cystic white matter changes , 14, 15.Restricting dietary intake of methionine, cysteine, and taurine has been reported to be effective in patients with mild ISOD \u201311. TouaIn conclusion, to our knowledge, this is the first literature review to summarize the characteristics of late-onset mild ISOD and the first report of late-onset mild ISOD cases with a stable clinical course and spontaneous recovery without dietary therapy. We propose that when patients present with late-onset symptoms, a monophasic clinical course, neuroimaging indicating a bilateral globus pallidus lesion, and decreased homocysteine levels, ISOD should be considered. Furthermore, we can reasonably predict a good prognosis for children with late-onset mild ISOD based on their monophasic clinical course and reversible neuroimaging features.Additional file 1: Video S1. Video for case 1 at the age of 9.5\u2009years showing the movement ability. The boy had unsteady gait, no choreiform movements were observed.Additional file 2: Video S2. Video for case 2 at the age of 5.5\u2009years showing the movement ability The girl could walk several steps without support, with an unsteady gait and choreiform movements.Additional file 3: Video S3. Video for case 2 at the age of 5.5\u2009years showing the language ability. Her vocabulary was normal, she could read smoothly.Additional file 4: Video S4. Video for case 3 at the age of 4.5\u2009years showing the movement ability. He could not sit until age 4.5\u2009years because of generalized hypertonia. He had some mild choreiform movements."}
{"text": "Mullerornis and Aepyornis, and represent small-bodied and medium-bodied aepyornithids, respectively. Aepyornis contains two distinct morphometric subgroups, which are identified as the largely allopatric species A. hildebrandti and A. maximus. The third morphotype, which has not previously been recognized as a distinct genus, is described as the novel taxon Vorombe titan. Vorombe represents the largest-bodied aepyornithid and is the world's largest bird, with a mean body mass of almost 650 kg. This new taxonomic framework for the Aepyornithidae provides an important new baseline for future studies of avian evolution and the Quaternary ecology of Madagascar.Madagascar's now-extinct radiation of large-bodied ratites, the elephant birds (Aepyornithidae), has been subject to little modern research compared to the island's mammalian megafauna and other Late Quaternary giant birds. The family's convoluted and conflicting taxonomic history has hindered accurate interpretation of morphological diversity and has restricted modern research into their evolutionary history, biogeography and ecology. We present a new quantitative analysis of patterns of morphological diversity of aepyornithid skeletal elements, including material from all major global collections of aepyornithid skeletal remains, and constituting the first taxonomic reassessment of the family for over 50 years. Linear morphometric data collected from appendicular limb elements, and including nearly all type specimens, were examined using multivariate cluster analysis and the Bayesian information criterion, and with estimation of missing data using multiple imputation and expectation maximization algorithms. These analyses recover three distinct skeletal morphotypes within the Aepyornithidae. Two of these morphotypes are associated with the type specimens of the existing genera  Then someone turned up another thigh-bone four feet six or more, and that they called Aepyornis titan \u2026 if they get any more Aepyornises, he reckons some scientific swell will go and burst a blood-vessel.\u201dAepyornis Island [H. G. Wells, s Island An accurate understanding of taxonomy and diversity in recently extinct groups is necessary in order to understand evolutionary processes that have contributed to the functioning of past ecosystems, patterns of regional biogeography and ecological disruption caused by humans in prehistory ,3. HowevThe Quaternary faunal record of Madagascar contains a unique and extraordinary megafauna, including giant lemurs, hippopotami, giant tortoises and the world's largest birds, the elephant birds. These taxa all survived into the Late Holocene and became extinct following the arrival of prehistoric human settlers, with available radiometric data suggesting that elephant birds persisted until around 1000 years ago . Studies2.Following the presentation and description of the world's largest egg and enormous avian skeletal remains from Madagascar in 1851 , the eleRichard Owen investigated diversity within another extinct insular radiation of giant island-endemic ratites, the moa (Aves: Dinornithiformes) of New Zealand, through a series of linear measurements of leg bones  that allowed separation and diagnosis of moa taxa  ,16. ThesAepyornis Geoffroy Saint-Hilaire, 1851, type species Aepyornis maximus Geoffroy Saint-Hilaire, 1851 [Mullerornis Milne-Edwards and Grandidier, 1894 [Mullerornis betsilei [Flacourtia Andrews, 1895, type species Mullerornis rudis [Aepyornis (approx. 400 kg) and Mullerornis (approx. 100 kg). Differentiation of species was based largely on linear measurements of the limited remains then available for study in respective national collections and via inter-museum loans of casts. Most of these taxa were erected between 1893 and 1895, and authors attempted to demonstrate their authority by synonymizing \u2018competing\u2019 taxa, often focusing on laying claim to the largest birds  was summarized by Brodkorb [M. grandis Lamberton, 1934 [Aepyornis recognized geographical co-occurrence of A. maximus and A. medius in both the central west coast region and the extreme south of Madagascar, with A. hildebrandti Burckhardt, 1893 [Mullerornis was also considered to contain two geographically co-occurring species, M. agilis Milne-Edwards and Grandidier, 1894 [M. rudis Milne-Edwards and Grandidier, 1894 [M. betsilei Milne-Edwards and Grandidier, 1894 [In the early twentieth century, further attempts to clarify the taxonomic diversity of the Aepyornithidae were made by Monnier , LambrecBrodkorb . Althougon, 1934 , based oon, 1934 ,29\u201331  and Mullerornis (approx. 2 mm thick) [The elephant birds have been the focus of remarkably little study during the late twentieth and early twenty-first centuries in comparison to moa and many other Quaternary megafaunal vertebrates. Following the recent development of methods of evolutionary and ecological analysis using ancient biomolecules, elephant bird material has been studied in efforts to reconstruct their evolutionary history and phylogenetic relationships , dietary maximus ,30. Howefication , combinefication  or eggshfication . Aepyorn3.Multivariate analysis of morphometric data derived from skeletal elements constitutes a significantly more powerful diagnostic tool for delimiting taxa than the univariate and bivariate methods used in historical aepyornithid systematic studies. However, multivariate methods require data frames with no missing values. As aepyornithid remains are rarely found completely intact, attempts to quantify multivariate morphometric data inclusive of all available specimens must compensate for these data gaps \u201337.Omission of characters and specimens from analysis is a common method for addressing the problem of missing data ,37,38. HThe alternative to omitting data is to estimate missing values while preserving natural variation of characters within taxa. One approach, imputation based on the means of observed variables, can create conservative models that can underrepresent natural variation within the morphological range for a given taxon  and may Many studies that aim to test the validity of a given taxonomic hypothesis using morphometric data are supported by a well-delimited higher-order nomenclature and good geographical provenance of specimens ,41,42. CTo clarify the confused state of elephant bird taxonomy, and to assess how many taxonomic units represented by distinct morphological clusters can be identified within a rigorously determined quantitative framework, we performed a series of morphometric analyses on linear measurement data from almost all of the specimens of aepyornithid appendicular limb elements available for study in global museum collections. We used an iterative modelling approach to permit comparison between models alternately assigning specimens to a varying number of clusters . This st4.4.1.n = 97), tibiotarsi (n = 162) and tarsometatarsi (n = 87) of adult individuals (defined on the basis of full fusion of epiphyses) were studied from the following collections: American Museum of Natural History, USA (AMNH), Centre ValBio, Madagascar (CVB), Museum f\u00fcr Naturkunde, Germany (MfN), Museum National d'Histoire Naturelle, France (MNHN), Natural History Museum, UK (NHMUK), Naturhistorisches Museum, Austria (NHMW), Oxford University Museum, UK (OUMNH), Universit\u00e9 d'Antananarivo, Madagascar (UA), Natural History Museum, University of Oslo, Norway (UIO), United States National Museum, USA (USNM) and Zoologiska Museum, Uppsala Universitet, Sweden (ZIUU) . A standard series of 20 femoral, 20 tibiotarsal and 44 tarsometatarsal measurements were taken where possible  were completely intact and undamaged . As some taxa might only be represented by broken specimens, proportions of missing linear measurements from broken specimens were examined in 5% stepped increments. Selection of first-round data frames was defined by the inclusion of elements with less than 25% of linear measurements missing (approx. 50% of available specimens) to minimize imputation and maximize potential taxonomic inclusion. Skeletal elements with more than 25% of linear measurements missing were omitted from the first round of imputation calculations and taxonomic assessments. The first-round data frames included 48 femora (49% of specimens and 11.6% imputed data), 73 tibiotarsi (45% of specimens and 7.8% imputed data) and 46 tarsometatarsi .k-fold cross-validation as a regulation mechanism to remove noise and improve prediction quality. The \u2018tuned parameters\u2019 were determined by fivefold cross-validation to find the PCA loadings that produced the smallest mean square error of predictions, using the \u2018estim_ncpPCA\u2019 function of the MissMDA package [All statistical analysis was performed in R v. 3.1.3 . MI meth package . Linear 4.3.PCA was conducted on observed and imputed data derived from the first round of EM imputation, to investigate whether morphometric measurement data are able to identify discrete clusters of elephant bird specimens that are likely to correspond with taxonomically distinct groups. This approach extracts and summarizes the major features of morphometric shape variation and reduces high dimensionality to examine the distribution of different taxonomic groups in shape-space, without making any prior assumptions about the pattern of clustering of specimens.The package \u2018MClust\u2019  was usedA second dataset was generated to include all data with more than 25% missing specimens, any available type specimens that had not yet been included in cluster models, and all specimens with location data. Missing data point imputation, clustering, and removal of specimens demonstrating high levels of classification uncertainty were then performed. Clustering was performed using the same method as above, but the number of clusters was limited to the number observed from the first round of analysis.The large amount of missing data included in this second phase of imputation means that cluster assignment of these poorer-quality specimens must be interpreted with caution; however, this represents the only quantitative framework for identifying distinct morphological forms from incomplete remains of elephant birds. Where accession data were available for specimens, their cluster and geographical location was recorded to examine any potential pattern of spatial distributions. This second dataset included 64 femora (26.9% missing datapoints), 95 tibiotarsi (22.8% missing datapoints) and 70 tarsometatarsi (27.0% missing datapoints) .All PCA analyses were re-run using log-transformed data, to further reduce the potential confounding influence of variation in size alone .4.4.ANOVAs were performed on individual measurements for each morphological cluster of femora, tibiotarsi and tarsometatarsi, in order to describe the measurement parameters of each cluster and therefore define the taxonomic groupings represented by each cluster. Mass estimations were calculated using the Campbell and Marcus algorithm for estimating body mass in birds from femoral least-shaft circumference (LogM = 2.411 \u00d7 LogLCF \u2212 0.065) . Mean ma4.5.14C dating at the Oxford Radiocarbon Accelerator Unit, Oxford, UK and calibrated using ShCal13 [Bone samples from elephant bird specimens assigned to different morphometric clusters were submitted for accelerator mass spectrometer (AMS)  ShCal13  implemen ShCal13 .5.5.1.From our sample, 41 femora, 83 tibiotarsi and 41 tarsometatarsi were excluded from the first round of analysis due to exceeding the more than 25% missing marker criterion for taxonomic assessment. The percentage of total imputed data generated in this round was 11.6% for femora, 9.1% for tibiotarsi and 5.5% for tarsometatarsi. Five femora, 49 tibiotarsi and one tarsometatarsus were excluded from taxonomic classification through clustering due to high uncertainty in classification (greater than 5% uncertainty). Four femora, 43 tibiotarsi and 12 tarsometatarsi were excluded from subsequent biogeographical analysis, again due to greater than 5% uncertainty of classification. For the biogeographical assessment dataset, 26.9% of femoral markers, 23.0% of tibiotarsal markers and 27.0% of tarsometatarsal markers were not observed and so were imputed.Cluster analysis performed separately on PCA weightings created from each specimen's linear measurements from all three limb bones revealed that the comprehensive sample of elephant bird specimens analysed in this study fall into multiple distinct morphometric groups, defined as a stable result by BIC differentiation between cluster models of greater than 2 . Femora  and tibiIn all taxonomic PCA clusters, PC1 was highly correlated (greater than 0.75) with almost all measurements from each skeletal element , indicating a primary separation of clusters based on overall size . However, clusters overlap in size ranges and can also be differentiated by other patterns of distinctive morphotype variation, with clear autocorrelation between size and differing morphology.In cluster analysis of log-transformed data, femoral data were more stable than tarsometatarsal data. Four stable groups were recovered in unsupervised clustering of femoral data: clusters 1, 2 and 3 were separated along PC1, and cluster 2 was further subdivided into two subclusters on PC2. When supervised clustering based on these four groups was then applied to tarsometatarsal data, this produced the same classification of all tarsometatarsal specimens within the same clusters as in non-transformed cluster analysis .5.2.Tarsometatarsal data provide the best-resolved assessment of morphological diversity within aepyornithids, as the four clusters based on data for this limb bone resolve well and group membership is the most stable . FemoralAepyornis Geoffroy Saint-Hilaire, 1851; Mullerornis Milne-Edwards and Grandidier, 1894 and Flacourtia Andrews, 1895. The type specimens or type series of 10 of the 15 species that have been assigned to these genera can still be located in museum collections, and were included within the clustering analysis. The taxonomic identity of each morphometric cluster was established by determining which type specimens were included within which clusters, and which of these type specimens represented the oldest available taxonomic name , Mullerornis agilis Milne-Edwards and Grandidier, 1894 (part of syntype series: tibiotarsus) and Mullerornis rudis Milne-Edwards and Grandidier, 1894 (part of syntype series: tibiotarsus). Cluster 2 contains the intermediate-sized specimens across all skeletal element datasets and contains well-predicted type material of Aepyornis hildebrandti Burckhardt, 1893 (part of syntype series: tarsometatarsus), Aepyornis medius Milne-Edwards and Grandidier, 1869 (holotype: femur), Aepyornis cursor Milne-Edwards and Grandidier, 1894 (holotype: tarsometatarsus), Aepyornis lentus Milne-Edwards and Grandidier, 1894 (holotype: tarsometatarsus) and Aepyornis gracilis Monnier, 1913 (holotype: femur). When subdivided by supervised cluster classification (four groups), cluster 2a contains the type material of Aepyornis hildebrandti (part of syntype series: tarsometatarsus), Aepyornis lentus and Aepyornis gracilis. The syntype femur of Aepyornis hildebrandti was also assigned to cluster 2a, but this specimen is incomplete and cluster assignment was poorly predicted due to high uncertainty, so taxonomic assignment of the name Aepyornis hildebrandti was based solely on the tarsometatarsus. Cluster 2b contained the holotypes of Aepyornis medius and Aepyornis cursor. All tibiotarsi that fell within cluster 2 demonstrated high uncertainty of cluster classification and were therefore not used for taxonomic assessment. Cluster 3 contains the largest specimens of all skeletal elements and contains the syntype material of Aepyornis titan Andrews, 1894  and Aepyornis ingens Milne-Edwards and Grandidier, 1894 (tibiotarsus and tarsometatarsus).Cluster 1 represents the smallest specimens across all skeletal element datasets and contains the type material of Aepyornis maximus by Geoffroy Saint-Hilaire [A. maximus as reported by Owen is 127 mm, indicating that the type series of this species falls within the range of cluster 2b.Owing to the vague description of skeletal measurements, only eggshell dimensions can be compared accurately from the original description of -Hilaire . However-Hilaire  publishe-Hilaire , but are-Hilaire  that canMullerornis betsilei type series by Milne-Edwards & Grandidier [M. betsilei (70 mm) falls within the range of cluster 1.The original published description of the andidier  includesMullerornis grandis. Here, we use the minimum femoral shaft circumference, which shows discrete measurement values between clusters for Mullerornis . The minimum shaft circumference range reported for M. grandis (125\u2013145 mm) falls within the upper range of cluster 1.Lamberton  includedAepyornis mulleri was described on the basis of a skull, mandible, vertebrae, ribs, sternum, part of pelvis, \u2018the leg bones\u2019 and phalanges [A. mulleri was previously considered to be a subjective synonym of A. hildebrandti by Monnier [halanges . No publ Monnier , but is Aepyornis Geoffroy Saint-Hilaire, 1851 was first used to describe Aepyornis maximus, which our data demonstrate can be assigned to cluster 2b, and this name can therefore be interpreted as the senior synonym for all of cluster 2. The genus Mullerornis Milne-Edwards and Grandidier, 1894 was first used to describe Mullerornis betsilei, which was subsequently designated as the type species by Richmond [Aepyornis in 1894, represents a further distinct morphotype which on this basis also needs to be recognized as distinct at the genus level. A third aepyornithid genus name, Flacourtia Andrews, 1895, is also available, but the holotype tibiotarsus of the type species Mullerornis rudis clusters reliably within cluster 1, and so the name Flacourtia represents a junior synonym of Mullerornis and cannot be used to describe cluster 3. There is therefore no available genus name that can be applied to cluster 3.The genus Richmond , and whiRichmond ,18, thisMullerornis), and so we apply the oldest species name for this cluster, Aepyornis modestus, to name the single species that can be recognized in this genus. Cluster 2 (Aepyornis) can be separated into two distinct morphological groups on the basis of both tarsometatarsal and femoral data, and we interpret these groups as representing separate species within the same genus: the oldest available species names within each cluster are Aepyornis hildebrandti (cluster 2a) and Aepyornis maximus (cluster 2b). No morphological differentiation can be demonstrated within cluster 3 (unnamed genus). Within this cluster, the two species names Aepyornis titan and Aepyornis ingens were both published in 1894, but titan (published January 1894) predates ingens (published February 1894) by one month, so that the oldest available species name for this group is Aepyornis titan. Body mass estimates for these four recognized aepyornithid taxa are given in Our analysis does not distinguish distinct morphotypes within cluster 1 . This specimen is the type specimen for Aepyornis lentus and is missing more than 25% of measurement data, leading to potential unreliability of cluster assignment. New AMS dates for specimens assigned to Aepyornis hildebrandti and Vorombe titan are given in Owing to the poorly resolved clustering of tibiotarsal data, we selected only femoral and tarsometatarsal geographical location data to reconstruct distributions of newly defined elephant bird taxa. Specimens with high uncertainty were also removed from the pooled location dataset. Locality data associated with well-resolved specimens in our analysis  are plotted by species in ighlands . Almost 6.Order Struthioniformes Latham, 1790 [am, 1790 Family Aepyornithidae Bonaparte, 1853 [te, 1853 Revised diagnosis:Femur: Trochanter femoris extremely large, expanded medio-laterally and medio-distally. Crista trochanteris rounded and convex, expanded cranio-caudally and medially, oriented slightly caudally; muscle scars present on lateral facies. Facies articularis antitrochanterica concave. Shaft flattened caudally. Linea intermuscularis caudalis leads to medial margin of shaft. Linea intermuscularis cranialis leads to distal margin of shaft. Impression of m. gastrocnemialis lateralis presents as large, deep pit on cranio-lateral margin, just proximal to very wide trochlea fibularis. Sulcus patellaris broad, deep u-shape in distal aspect, laterally directed.Tibiotarsus: Distally flattened, much wider medio-laterally than cranio-caudally deep. Pronounced crista cnemialis lateralis, expanded proximally. Pronounced crista cnemialis cranialis, expanded medially. Both cnemialis crista oriented medially. Incisura tibialis wide, deep u-shape in proximal aspect, separating facies articularis lateralis and crista cnemialis lateralis. Facies articularis prominent and rounded, longer proximo-distally than latero-medially. Shaft narrows from proximal end, with linea intermuscularis cranialis terminating on lateral margin. Canalis extensoris proximal to condylus lateralis at distal end. Condylus lateralis with greater caudo-cranial expansion than condylus medialis. Pons supratendineus present. Distal end much wider medio-laterally than cranio-caudally.Tarsometatarsus: Proportionately long, with triangular facies dorsalis. Proximal end and trochleae expanded medio-laterally; lateral margin expanded proximally, medial margin enlarged distally. Shaft flattened dorsally. Single high and long hypotarsal ridge. In anterior view, foramina closely spaced within sulcus extensorius formed by flattened-triangular orientation of metatarsi. In posterior view, foramina widely separated by hypotarsal ridge oriented away from midline of broad, long shaft. Distal end with large intertrochlear notches. Three trochleae; trochlea III always terminating furthest distally and marginally forward of shaft and larger than trochleae II and IV, which are nearly equal in size.Aepyornis Geoffroy Saint-Hilaire, 1851Genus  [re, 1851 Aepiornis Geoffroy Saint-Hilaire, 1851, p. 52 [1, p. 52 Epiornis Muller and Baldamus, 1851, p. 48 [1, p. 48 Epyornis Bonaparte, 1853, p. 139 [, p. 139 Type species:Aepyornis maximus Geoffroy Saint-Hilaire, 1851 (by monotypy) [onotypy) .Recognized species:Aepyornis maximus Geoffroy Saint-Hilaire, 1851 [Aepyornis hildebrandti Burckhardt, 1893 [re, 1851 ; Aepyorndt, 1893 .Revised diagnosis:Femur: Proportionately broader and more robust than Mullerornis, and slightly more robust than Vorombe. Facies articularis antitrochanterica is shallow concave surface between trochanter femoris and caput femoris, which are oriented at shallower angles proximally than distally. Significantly larger than Mullerornis in following measurements: F1\u2013F4, F6, F10\u2013F12, F16 . Significantly smaller than Vorombe in following measurements: F1\u2013F14, F16\u2013F17, F19\u2013F20 .Tibiotarsus: Shaft broader in proportion to overall size in comparison to other genera. Smaller tibiotarsi (A. hildebrandti) of similar length to Mullerornis but considerably more robust, with more rounded cnemial crista. Proximal end expanded, particularly medio-laterally. Margin between crista cnemialis cranialis and crista cnemialis lateralis flatter than other genera.Tarsometatarsus: Smaller tarsometatarsi (A. hildebrandti) of similar length to Mullerornis but medio-laterally broader and with much shallower triangular cross-section. Trochlea IV distally larger and longer than trochlea II. Significantly larger than Mullerornis in following measurements: Tmt2\u2013Tmt6, Tmt9\u2013Tmt11, Tmt13\u2013Tmt25, Tmt27\u2013Tmt31, Tmt33\u2013Tmt39 . Significantly smaller than Vorombe in following measurements: Tmt1, Tmt3\u2013Tmt6, Tmt10\u2013Tmt11, Tmt13\u2013Tmt22, Tmt27\u2013Tmt28, Tmt31, Tmt33, Tmt35\u2013Tmt36, Tmt38\u2013Tmt41, Tmt43\u2013Tmt44 .Revised description:Femur: (In addition to diagnostic features above) Crista trochanteris large, rounded and convex. Medio-distal margin of caput femoris with broad curvature, transitioning into medial margin of shaft. Shaft narrows from proximal end, with straight middle section, and expanding distally into condylus medialis. Condylus medialis expanded proximo-distally. Trochlea fibularis with acute angle to lateral margin of shaft and trochanter femoris. Fossa poplitea with pronounced, proximally arched margin; very large, positioned above lateral portion of condylus medialis and sulcus patellaris.Tibiotarsus: (In addition to diagnostic features above) Crista cnemialis cranialis directed proximo-medially, extending proximally to crista cnemialis lateralis. Rounded, proximally expanded crista cnemialis lateralis extends into ridge, leading into prominent, straight linea intermuscularis cranialis that terminates approximately 50% along length of shaft on lateral margin. Proximal margin of sulcus intercnemialis is very shallow concave curve between the two crista in cranial view. Shaft medially straight and laterally curved, expanding into distal condyles. Distal articular surface broad and shallow.Tarsometatarsus: (In addition to diagnostic features above) Very robust . Medio-laterally broad at proximal end, with rounded lateral portion; expanded plantar-dorsally, transitioning into shaft. Tuberositas m. tibialis cranialis small, rounded, slightly larger medio-laterally than proximo-distally. Shaft very broad, narrowing slightly in medial section, with both medial and lateral margins having continuous broad concave curvatures.Aepyornis maximus Geoffroy Saint-Hilaire, 1851 [re, 1851 Aepyornis maximus Geoffroy Saint-Hilaire, 1851, p. 104 [Aepyornis medius Milne-Edwards and Grandidier, 1869, p. 97 [9, p. 97 Aepyornis cursor Milne-Edwards and Grandidier, 1894, p. 124 [Syntype series: Tarsometatarsus of adult individual and two eggs, from \u2018the south coast\u2019 of Madagascar, purchased from Merchant Captain M. Abadie. Original tarsometatarsus now cannot be located, and eggs cannot be distinguished from other collections in MNHN.Lectotype: Tarsometatarsus from original syntype series , designated herein.Revised diagnosis:Femur: Compared to A. hildebrandti, has similar length and width of proximal and distal ends, but markedly more robust; trochanter femoris larger in proportion to total femur size and more expanded proximally and dorsoventrally; caput femoris slightly shorter medially; shaft with greater circumference and more clearly defined linea intermuscularis cranialis. Significantly larger than A. hildebrandti in F15 .Tibiotarsus: Compared to A. hildebrandti, crista cnemialis lateralis more expanded proximally and more laterally oriented, and with shallower angle of transition into pronounced linea intermuscularis cranialis; fascia gastrocnemialis proportionally larger; shaft proportionally wider, and similarly expanded at proximal and distal ends; distal condyles more expanded medio-laterally and protrude equally distally. See Tarsometatarsus: Compared to A. hildebrandti, proximal end flatter, with less proximal expansion on lateral metatarsal and more expanded medio-laterally; expansion of medial margin continues more distally; trochleae proportionately less expanded. Significantly larger than A. hildebrandti in following measurements: Tmt9, Tmt14, Tmt19, Tmt33, Tmt35\u2013Tmt36, Tmt40, Tmt43 . See Revised description:Femur: (In addition to descriptions and diagnostic features above) Comparatively long and very stout . Condylus medialis expanded medially and with flatter distal surface leading into trochlea fibularis; fossa poplitea with pronounced, proximally arched margin with slight orientation towards medial shaft margin.Tibiotarsus: (In addition to descriptions and diagnostic features above) Long and very robust . Shaft with distinct curvature on lateral margin.Tarsometatarsus: (In addition to descriptions and diagnostic features above) Long and stout . Foramina within shallow fossa infracotylaris dorsalis, which has slight concave curvature from proximal margin of articular surface. Proximal end more medio-laterally enlarged and with slightly greater lateral length than distal end.Proportions of limb elements: 1 : 1.6 : 0.9 (tarsometatarsus : tibiotarsus : femur). Data in tables\u00a0Measurements of type material (mm) reported by Owen [: Extreme breadth across trochlear condyles, 127 mm (5 inches); transverse diameter of shaft 6 inches above lower end, 74 mm (2.9 inches); antero-posterior diameter of shaft 6 inches above lower end, 33 mm (1.3 inches). by Owen : ExtremeAepyornis hildebrandti Burckhardt, 1893 [dt, 1893 Aepyornis hildebrandti Burckhardt, 1893, p. 127 [, p. 127 Aepyornis lentus Milne-Edwards and Grandidier, 1894, p. 124 [Aepyornis gracilis Monnier, 1913, p. 15 [3, p. 15 Syntype series: Femur (MfN MB.AV.73), tibiotarsus (MfN MB.AV.70), tarsometatarsus (MfN MB.AV.67), from Antsirabe, Madagascar.Lectotype: Tarsometatarsus (MfN MB.AV.67), designated by Brodkorb [Brodkorb .Revised diagnosis:Femur: Compared to A. maximus, trochanter femoris proportionally smaller and less expanded proximally and dorsoventrally; caput femoris longer medially, with more continuous curvature of distal margin; shaft much more slender, with less well-defined linea intermuscularis cranialis. Significantly smaller than A. maximus in F15 .Tibiotarsus: Compared to A. maximus, crista cnemialis lateralis less expanded proximally and more medially oriented, and with more acute angle of transition into weak linea intermuscularis cranialis; concavity from crista cnemialis cranialis to shaft less acute; fascia gastrocnemialis smaller; shaft proportionally narrower, and more expanded at proximal end than at distal end; distal condyles more expanded proximo-distally; condylus lateralis protrudes distally to condylus medialis.Tarsometatarsus: Compared to A. maximus, metatarsal IV more expanded proximally, creating angled proximal articular surface; medial margin less expanded distally; trochleae more expanded medio-laterally. Significantly smaller than A. maximus in following measurements: Tmt9, Tmt14, Tmt19, Tmt33, Tmt35\u2013Tmt36, Tmt40, Tmt43 .Revised description:Femur: (In addition to descriptions and diagnostic features above) Comparatively short but robust . Condylus medialis expanded proximo-distally; concave fascia leading into trochlea fibularis; fossa poplitea with pronounced, proximally arched margin in centre of shaft.Tibiotarsus: (In addition to descriptions and diagnostic features above) Long and robust . Shaft with distinct curvature on lateral margin.Tarsometatarsus: (In addition to descriptions and diagnostic features above) Small and stout . Foramina within fossa infracotylaris dorsalis, which has concave curvature from proximal margin of articular surface. Distal end more medio-laterally enlarged than proximal end; lateral length greater than medial length.Proportions of limb elements: 1 : 1.5 : 1 (tarsometatarsus : tibiotarsus : femur). Data in tables\u00a0Measurements of type material (mm). MfN MB.AV.73: F2 = 43.24; F3 = 158; F4 = 52.7; F16 = 100.4; F20 = 11.2. MfN MB.AV.70: Tt1 = 473; Tt2 = 39.32; Tt3 = 110; Tt4 = 26.76; Tt5 = 90.1; Tt6 = 59.34; Tt7 = 72.7; Tt8 = 128.8; Tt9 = 85.54; Tt10 = 93.92; Tt11 = 30.4; Tt12 = 65.6; Tt13 = 59.16; Tt14 = 70.88; Tt15 = 53.48; Tt16 = 28.02; Tt17 = 18.62; Tt18 = 43.32; Tt19 = 71.6; Tt20 = 153. MfN MB.AV.67: Tmt1 = 266; Tmt2 = 21.04; Tmt3 = 42.98; Tmt4 = 41.42; Tmt5 = 96.02; Tmt8 = 51.88; Tmt9 = 97.12; Tmt10 = 68.86; Tmt11 = 96.86; Tmt13 = 40.7; Tmt14 = 32.76; Tmt15 = 31.82; Tmt16 = 36.02; Tmt17 = 44.94; Tmt18 = 40.48; Tmt19 = 45.6; Tmt20 = 36.18; Tmt21 = 31.02; Tmt22 = 33.8; Tmt23 = 42.34; Tmt24 = 40.24; Tmt25 = 37.44; Tmt26 = 42.84; Tmt27 = 45.7; Tmt28 = 45.14; Tmt29 = 34.16; Tmt30 = 41.5; Tmt31 = 36.8; Tmt32 = 13.28; Tmt33 = 80.28; Tmt34 = 19.16; Tmt35 = 52.8; Tmt36 = 38.38; Tmt41 = 252; Tmt42 = 237; Tmt43 = 261; Tmt44 = 256.Mullerornis Milne-Edwards and Grandidier, 1894Genus  [Flacourtia Andrews, 1895, p 23 [95, p 23 Type species:Mullerornis betsilei Milne-Edwards and Grandidier, 1894 [er, 1894 .Recognized species:Mullerornis modestus  [r, 1869) .Revised diagnosis:Femur: Smaller, proportionately narrower and less robust than Aepyornis or Vorombe. Facies articularis antitrochanterica and caput femoris form smooth concave surface, oriented proximo-distally at shallower angle proximally than distally. Distal end medio-laterally expanded. Significantly smaller than Aepyornis in following measurements: F1\u2013F4, F6, F10\u2013F12, F16 . Significantly smaller than Vorombe in following measurements: F1\u2013F14, F16\u2013F17, F19\u2013F20 .Tibiotarsus: Similar in total length to Aepyornis hildebrandti, but with more slender shaft and well-defined, protruding cnemial crista. Proximal end expanded laterally, but with reduced medial expansion compared to other genera. Crista cnemialis lateralis prominent, projecting proximally, forming distinct curved and laterally positioned ridge. Crista cnemialis cranialis more prominent than in other genera, expanded markedly medially to form extremely pronounced curve into shaft. Margin between crista cnemialis cranialis and crista cnemialis lateralis sharply concave.Tarsometatarsus: Similar in length to Aepyornis hildebrandti, but markedly narrower. Shaft with acute triangular cross-section. Trochleae with reduced lateral expansion and minimal medial expansion. Trochlea IV protrudes distal to trochlea II; trochlea III protrudes distal to trochleae II and IV. Significantly smaller than Aepyornis in following measurements: Tmt2\u2013Tmt6, Tmt9\u2013Tmt11, Tmt13\u2013Tmt25, Tmt27\u2013Tmt31, Tmt33\u2013Tmt39 . Significantly smaller than Vorombe in following measurements: Tmt1\u2013Tmt6, Tmt9\u2013Tmt36, Tmt38\u2013Tmt41, Tmt43\u2013Tmt44 .Revised description:Femur: (In addition to descriptions and diagnostic features above) Short and slender . Crista trochanterica large, rounded and convex at proximal end. Distal margin of caput femoris with reduced concave curvature. Shaft narrows in middle, curved medially and laterally, expanding into broad condylus medialis; with reduced concave curvature on distal fascia. Medio-distal condyle much less expanded than latero-distal condyle, and protrudes proximally. Fossa poplitea very large in proportion to size of femur, with poorly defined proximal margin, positioned above sulcus patellaris. Trochlea fibularis very large in proportion to size of femur; oriented disto-laterally, pointing away from trochanter femoris.Tibiotarsus: (In addition to descriptions and diagnostic features above) Long and slender . Crista cnemialis cranialis extends markedly past crista cnemialis lateralis, directed proximo-medially. Crista cnemialis lateralis protrudes markedly medially, transitioning sharply into clear linea intermuscularis that approaches lateral margin approximately 50% along shaft length, then runs parallel and becomes undefined above condylus lateralis. Proximal margin of sulcus intercnemialis is sharply concave curve between the two crista in cranial view. Shaft relatively straight, narrowing markedly on medial margin but with only shallow curvature on lateral margin and only minor expansion into distal condyles. Distal condyles protrude equally at distal end.Tarsometatarsus: (In addition to descriptions and diagnostic features above) Small and slender . Proximal end with small amount of lateral expansion and marginal medial expansion. Hypotarsal ridge very broad and deep in proximal aspect. Proximal fascia relatively flat, with minimal proximo-distal expansion. Foramina within fossa infracotylaris dorsalis that has concave curvature from proximal margin of articular surface. Tuberositas m. tibialis cranialis centrally positioned, rounded and slightly larger medio-laterally than proximo-distally. Shaft narrow with lateral margin reducing towards distal end, and relatively straight medial margin.Mullerornis modestus  [r, 1869) Aepyornis modestus Milne-Edwards and Grandidier, 1869, p. 314 [, p. 314 Mullerornis agilis Milne-Edwards and Grandidier, 1894, p. 125 [Mullerornis betsilei Milne-Edwards and Grandidier, 1894, p. 125 [Mullerornis rudis Milne-Edwards and Grandidier, 1894, p. 125 [Holotype: Femur (MNHN 1908-5), from Ambolisatra, Madagascar.Revised diagnosis: As for genus.Revised description: As for genus.Proportions of limb elements: 1 : 1.5 : 0.9 (tarsometatarsus : tibiotarsus : femur). Data are presented in tables\u00a0Measurements of type material (mm). MNHN 1908-5: F1 = 255; F2 = 29.9; F3 = 121; F4 = 41.84; F5 = 112; F6 = 34.9; F7 = 34.54; F8 = 68.54; F9 = 90.66; F10 = 55.98; F11 = 63.66; F12 = 223; F14 = 240; F16 = 96.52; F17 = 75.88; F18 = 95.24; F19 = 23.36; F20 = 11.66.Vorombe gen. nov.Genus Etymology: From the Malagasy for \u2018big bird\u2019 (neuter).Type species:Aepyornis titan Andrews, 1894 [ws, 1894 Recognized species:Vorombe titan  [s, 1894) Diagnosis:Femur: Extremely large and robust in comparison to other genera, with enlarged proximal and distal ends. Medio-distal margin of caput femoris with more acute curvature than in other genera. Facies antitrochanterica and caput femoris form smooth concave surface. Caput femoris oriented at equal angles perpendicular to shaft proximo-distally. Marked crista supracondylaris medialis present (absent in other genera). Condylus medialis expanded medially and flatter than in Aepyornis. Significantly larger than both Aepyornis and Mullerornis in all measurements .Tibiotarsus: Extremely large in comparison to other genera. Proximal and distal ends enlarged, particularly medio-laterally, with proximal articular surface marginally more concave than Aepyornis but much less than Mullerornis, and with more pronounced narrowing transition into shaft; shaft narrower in proportion to total length compared to Aepyornis. Lateral condyle markedly more expanded distally and laterally than in other genera, terminating distal to condylus medialis.Tarsometatarsus: Considerably larger and markedly more expanded medio-laterally than other genera, particularly at proximal and distal ends. Lateral portion of proximal articular surface protrudes proximally to medial portion, creating markedly angled proximal articular surface similar to A. hildebrandti. Trochlea II protrudes marginally proximal to trochlea IV. Trochleae II and IV more equal in size than in other genera; expanded similarly both medio-laterally and dorsoventrally. Significantly larger than Mullerornis in all measurements . Significantly larger than Aepyornis in following measurements: Tmt1, Tmt3\u2013Tmt6, Tmt10\u2013Tmt11, Tmt13\u2013Tmt22, Tmt27\u2013Tmt28, Tmt31, Tmt33, Tmt35\u2013Tmt36, Tmt38\u2013Tmt41, Tmt43\u2013Tmt44 .Description:Femur: (In addition to descriptions and diagnostic features above) Robust . Crista trochanterica large, rounded and convex. Medio-distal margin of caput femoris transitions into medial margin of narrowing, medially straight shaft, which then expands into condylus medialis. Condylus lateralis expanded proximally. Trochlea fibularis very large, shallow and broad; parallel to shaft and trochanter femoris. Fossa poplitea with poorly defined proximal margin; transitions smoothly into shaft, positioned above lateral portion of condylus medialis and sulcus patellaris.Tibiotarsus: (In addition to descriptions and diagnostic features above) Very long . Crista cnemialis cranialis extends past crista cnemialis lateralis, directed proximo-medially. Crista cnemialis lateralis rounded, medially and marginally proximally expanded; transitions via smooth curve into medial surface of shaft, extending into prominent, straight and well-defined linea intermuscularis terminating on lateral margin just proximal to distal condyles. Proximal margin of sulcus intercnemialis very shallow concave curve between the two crista in cranial view. Shaft narrowing near proximal end on medial margin, but with only shallow curvature on lateral margin, becoming very straight and parallel at midshaft before expanding markedly into distal condyles.Tarsometatarsus: (In addition to descriptions and diagnostic features above) Robust  and long. Extremely medio-laterally broad at proximal ends; lateral portion rounded and expanded plantar-dorsally. Hypotarsal ridge very broad and deep in proximal aspect. Foramina within shallow fossa infracotylaris dorsalis that has slight concave curvature from proximal margin of articular surface. Tuberositas m. tibialis cranialis small, rounded, slightly larger medio-laterally than proximo-distally. Shaft highly tapered and broad; medial margin becoming straight, lateral margin retains continuous broad concave curvature.Vorombe titan (Andrews 1894) [ws 1894) Aepyornis titan Andrews 1894, p. 18 [4, p. 18 Aepyornis ingens Milne-Edwards and Grandidier, 1894, p. 124 [Syntype series: Femur (NHMUK A439), tibiotarsus (NHMUK A437), from Itampolo (Itampulu V\u00e9), Madagascar ; newly designated (signated .Diagnosis: As for genus.Description: As for genus.Proportions of limb elements: 1 : 1.8 : 1 (tarsometatarsus : tibiotarsus : femur). Data are summarized in tables\u00a0Measurements of type material (mm). NHMUK A439: F2 = 71; F3 = 271; F4 = 91.5; F5 = 232; F6 = 68.6; F7 = 74; F9 = 203; F11 = 141; F14 = 414; F15 = 346; F19 = 32; F20 = 24. NHMUK A437: Tt2 = 75.8; Tt3 = 206; Tt4 = 44.3; Tt5 = 162; Tt6 = 112.5; Tt7 = 134.5; Tt20 = 263.7.Mullerornis samples) represents specimens that are already uncontroversially recognized as being distinct at the genus level from the other clusters, the comparably morphometrically distinct largest-bodied cluster (cluster 3) must therefore also be recognized as taxonomically distinct at the genus level. Further morphometric subdivision within cluster 2 is interpreted as representing species-level differentiation. We therefore identify three valid elephant bird genera, two of which are monotypic, and one of which contains two species.Our study provides the first rigorous quantitative analysis of morphometric variation within elephant birds, using data from almost all of the specimens available for study in global museum collections, and employing multivariate analyses of morphometric data with methods for estimating missing values that are robust to potential sources of error. This exhaustive analysis fundamentally revises the taxonomic framework for understanding diversity and variation within elephant birds, compared to historical taxonomic reviews that were based largely on qualitative assessment of much smaller sample sizes of specimens. We demonstrate that three main morphometric clusters can be identified within measurement data for elephant bird appendicular elements, with one cluster further divisible into two separate subclusters. As one of these clusters  [Aepyornis spp. and three Mullerornis spp.) [Our new data-driven taxonomic revision recognizes both different numbers and different identities of elephant bird taxa compared to previous assessments. Our taxonomic framework recognizes only four elephant bird species, substantially reducing the number of valid species recognized by earlier authors, who variously identified 15 different putative species tables\u00a0; for exaepyornis , Lambertis spp.)  and Brodis spp.) . As our is spp.) .Mullerornis has generally been interpreted in recent decades as comprising three species, M. agilis, M. betsilei and M. rudis. However, not only do we synonymize these three taxa as representing a single species on the basis of morphometric analysis, but we also identify the name M. modestus as the senior synonym for all three taxa; this name was previously considered to be a junior synonym of Aepyornis maximus [Aepyornis maximus has commonly been interpreted as the largest elephant bird, both in older taxonomic reviews and also in popular culture, but the type material of this first elephant bird to be described has rarely been considered since its original description, with the species concept of A. maximus instead becoming associated with later collections of very large elephant bird bones that have been erroneously assigned to the taxon. Our analysis demonstrates that the name Aepyornis is in fact not associated with the largest known elephant bird material, but instead represents the medium-sized genus-level cluster in our morphometric analysis, with this genus containing only two diagnosable species (A. hildebrandti and A. maximus) compared with previous assumptions of four or more congeners  exceeds estimates based on comparable data for other extinct Quaternary giant birds such as Dinornis (Dinornithiformes: range = 61\u2013275 kg) and Dromornis  [Vorombe on the basis of size; this specimen had a least-shaft circumference of 308 mm and a corresponding mass estimate of 860 kg, making this the largest known bird individual ever recorded. This body mass estimate is comparable to or greater than available estimates for the smallest sauropod dinosaurs  [Aepyornis maximus based on broad, qualitative size ranges assumed for this \u2018wastebasket taxon\u2019, leading to underestimation of the true size of the largest elephant birds by previous authors [As the name urements  demonstr60.0 kg) , giving  authors .Aepyornis maximus  [Aepyornis hildebrandti and Vorombe titan demonstrate that specimens assigned to these clusters are also Holocene in age  . New dire in age . We can Dinornis, which was formerly interpreted as representing taxonomic variation, has been shown instead to constitute extreme reversed sexual size dimorphism [Aepyornis maximus and A. medius, two formerly recognized species that were considered to be distinguishable only by size, could represent male and female morphs of the same species [. Indeed, although we do not exclude the possibility that elephant birds exhibited sexual size dimorphism, our morphometric clusters are scaled and therefore independent of size, and are differentiated by more complex patterns of variation across a large series of characters that would not be expected from sexual size dimorphism. Any sexual size dimorphism is therefore likely to be captured as within-cluster variation in our analysis, and our clusters are better interpreted as representing distinct taxonomic units. Recent quantitative analysis has similarly failed to detect any reliable morphometric differentiation of sexual dimorphs in non-avian dinosaurs [Morphological variation in the giant moa morphism ,67, and morphism . Several species . Our quainosaurs . Howeverinosaurs ,67,70.M. modestus, A. maximus and V. titan in the south and southwest of Madagascar and into the central highlands. The substantial disparity in size between these different taxa suggests that these birds were able to coexist by exploiting distinct dietary niches and floral interactions [Aepyornis lentus\u2019 is excluded from biogeographical consideration due to potential unreliability of cluster assignment, all of the specimens assigned to A. hildebrandti in our analysis are restricted to the highest elevations of the central highlands at Antsirabe and Masinandreina. This biogeographical pattern suggests that, whereas different elephant bird genera were morphologically and ecologically distinct enough to be able to coexist in the same landscapes, different species within the same genus (Aepyornis) displayed largely allopatric differentiation between different ecoregions. This spatial pattern is also shown in many other vertebrate taxa across Madagascar today [Dinornis that exhibited size differences across altitudinal gradients and habitat types have been shown to be conspecific through ancient DNA analysis [Pachyornis on New Zealand's South Island, with P. elephantopus occurring in lowland habitats and P. australis restricted to subalpine shrublands and fellfields during the Holocene [Aepyornis therefore provides further support for our interpretation of clusters 2a and 2b as representing taxonomic variation rather than sexual dimorphism.Locality data associated with elephant bird specimens included in distinct morphometric clusters demonstrate the sympatric co-occurrence of ractions ,71. Howear today , and simar today . Althouganalysis , comparaHolocene . The allPrevious assumptions of elephant bird species richness (15 putative proposed species variously accepted by different authors; We encourage further investigation of elephant bird systematics and taxonomy, employing complementary data and methods to those presented in this study. In particular, the suggested bimodality in thickness of elephant bird eggshell  was cons"}
{"text": "Ventilatory parameters have been investigated in several species of Testudines, but few species have had their ventilatory pattern fully characterized by presenting all variables necessary to understand changes in breathing pattern seen under varying environmental conditions.Trachemys scripta and the terrestrial tortoise Chelonoidis carbonarius under normoxia, hypoxia, and hypercarbia and furthermore compiled respiratory data of testudine species from the literature to analyze the relative changes in each variable.We measured ventilation and gas exchange at 25\u00a0\u00b0C in the semi-aquatic turtle NVP) were three to four times longer in T. scripta than in C. carbonarius. Hypoxia and hypercarbia significantly increased ventilation in both species and decreased TNVP and oxygen consumption in T.\u00a0scripta but not in C.\u00a0carbonarius.During normoxia both species studied showed an episodic breathing pattern with two to three breaths per episode, but the non-ventilatory periods (TC.\u00a0carbonarius did show considerable non-ventilatory periods with more than one breath per breathing episode, and the breathing pattern in T. scripta was found to diverge significantly from predictions based on mechanical analyses of the respiratory system. A quantitative analysis of the literature showed that relative changes in the ventilatory patterns of chelonians in response to hypoxia and hyperbarbia were qualitatively similar among species, although there were variations in the magnitude of change.Contrary to expectations, the breathing pattern in  The order Testudines differs from the other groups of reptiles by the presence of a rigid shell, impeding lung ventilation through movement of the ribs . To overTestudines can be divided into two suborders. The 100 species of Pleurodira are characterized by a retraction of the neck in the horizontal plane, whereas the 250 species of Cryptodira retract their neck in the vertical plane . All PleTrachemys scripta and Chrysemys picta have been used in numerous respiratory studies , the semi-aquatic dies see . Althougdies see . While tdies see . Furtherta e.g.,\u00a0. The totta e.g.,\u00a0. Fong, ZTestudo pardalis employs regular single breaths separated by short breath-holds. A regular singlet breathing behavior has also been shown by Testudo graeca and by Testudo horsfieldi. The semi-aquatic Pelomedusa subrufa, on the other hand, uses breathing episodes containing several ventilations interspaced by longer breath-holds  and the South American red-footed tortoise Chelonoidis carbonarius (Testudinidae). Trachemys scripta, the model species for cardiorespiratory studies, was investigated because no previous study reported all ventilatory variables obtained from the same animals and experimental protocols, both under hypoxic and hypercarbic conditions, whereas C.\u00a0carbonarius was chosen because it is a widespread South American tortoise that has not had its respiratory physiology investigated previously. Furthermore, the present data were compiled together with available data from the literature to characterize the general response of Testudines to hypoxia and hypercarbia and to verify if terrestrial species show a significantly different ventilatory pattern compared to semi-aquatic species.Given these variations in the breathing pattern during normoxia, hypoxia, and hypercarbia among Testudines, and considering the very few ventilatory data available for terrestrial species, the aim of the present study was to analyze the ventilatory response to different gas mixtures in two cryptodirans, the red-eared slider T.\u00a0scripta  and C.\u00a0carbonarius  living under natural conditions were obtained from the Jacarez\u00e1rio, Univeridade Estadual Paulista \u201cJ\u00falio de Mesquita Filho\u201d, Rio Claro, SP, Brazil, transported to the laboratory at the University of S\u00e3o Paulo in Ribeir\u00e3o Preto, SP, and maintained for at least three months before experimentation to acclimate to laboratory conditions. Experiments were performed between November 2014 and February 2015 following approval by the Instituto Chico Mendes de Conserva\u00e7\u00e3o da Biodiversidade  and Comiss\u00e3o de \u00c9tica no Uso de Animais . Animals were maintained under a 12\u00a0h light/dark photoperiod cycle, in a temperature-controlled room at 25 \u00b1 2\u00a0\u00b0C and received a mixed diet supplemented with amino acids, vitamins and minerals  three times a week. T.\u00a0scripta were housed in a box with a water reservoir for diving whereas C.\u00a0carbonarius were housed in boxes whose bottom was covered with wooden chips.Adults of both sexes of T. scripta were placed in an aquarium with a single access to an inverted funnel, and each individual only needed to extend its neck and protrude its nostrils into the chamber for air breathing. C. carbonarius were placed in a plastic box and a mask was fitted to the head of each animal for respirometry and a collar was fixed to the neck to prevent head retraction. The dead space of the funnel or the mask was never larger than 40\u00a0ml. The exit of the funnel and the frontal tip of the mask were equipped with a pneumotach (Fleisch tube), which was connected to a spirometer . The gas inside the funnel or mask was sampled at 180\u00a0 ml\u00a0min\u22121, dried, and pulled to a gas analyzer . Data were recorded and analyzed using PowerLab 8/35 and LabChart 7.0 .Animals were submitted to open respirometry following 2 were used to calibrate the gas exchange measurements. In all cases, calibrations resulted in linear regressions with R2 >0.95.Both the funnel and the mask were calibrated by injections of known volumes, using an Inspira ventilator , and concentrations of gas, supplied by a Pegas 4000MF gas mixer . Air was used for the spirometer calibration with volumes ranging from 1 to 60\u00a0ml and different volumes and concentrations of O2) or progressively increasing hypercarbic  exposures, and after that animals were exposed again to normoxia. The exposure time of each gas mixture, as well as normoxic conditions, was 2\u00a0h. Animals were first exposed to one randomly chosen progressive gas exposure and the following day to the other one.Experimental temperature and photoperiod were the same as during maintenance, and all animals were fasted for three to seven days before experimentation to avoid the confounding effects of digestion on metabolism. The animals were weighed one day before the beginning of each experimental treatment. Before any measurements, animals were placed into the experimental setup or equipped with a mask at least 12 h before initiation of experiments. Experimentation started around 08:00, and ventilation and gas exchange were measured first under normoxic conditions, followed by progressively decreasing hypoxic , frequency of breathing episodes , duration of non-ventilatory period , duration of inspiration , duration of expiration , total duration of one ventilatory cycle , tidal volume , breathing frequency , and oxygen consumption  (\u22121), the relative duration of expiration (TEXP\u2215TTOT), the relation between inspiration and expiration (TINSP\u2215TEXP), the expiratory flow rate , minute ventilation (\u22121 min\u22121), oxygen consumption (2 kg\u22121 min\u22121), and air convection requirement (The last hour of each exposure was used to extract the following data: breathing frequency during breathing episodes (fO2\u00a0kg\u22121) . During P\u00a0<\u00a00.05 were considered significant.Data were analyzed using GraphPad Prism 6.0 and applying Repeated Measures ANOVA followed by a Tukey\u2019s multiple comparison test. Values of To compare the results of the present study with previously published data, we searched for relevant publications using Pubmed, Web of Science, and Google Scholar databases using keywords such as \u2018turtle\u2019, \u2018Testudines\u2019, \u2018hypoxia\u2019, \u2018hypercarbia\u2019, \u2018hypercapnia\u2019, \u2018ventilation\u2019, \u2018gas exchange\u2019, etc. Values of respiratory variables of Testudines obtained under exposure to environmental hypoxia or hypercarbia (but not anoxia or hypoxic-hypercarbia) measured at temperatures between 20 and 30\u00a0\u00b0C were included . Data frTNV P was, on average, three to four times longer in T. scripta than in C. carbonarius. In T. scripta, hypoxia significantly increased fE, VT, Repi, TNV P and C. carbonarius significantly increased fE, TINSP, VT, fR, fR in C. carbonarius, which was significantly greater when compared to the pre-hypoxic value. Exposure to CO2 increased T. scripta, whereas in C. carbonarius TINSP, TTOT, VT, fR, NV P and f\u2032 significantly decreased  were not significantly affected by either hypoxia nor hypercarbia, just as expiratory flow rate (VT/TEXP), but the latter did show a tendency to increase in both species with increasing levels of hypoxia and hypercarbia , whereas hypoxia caused a greater increase in fE, but slightly decreased fRepi (exception C. carbonarius). Neither hypoxia nor hypercarbia drastically altered TINSP, TEXP, TTOT, and f\u2032 , in C. picta   . In the Testudo graeca and T. pardalis, respectively, but in both species breathing pattern consisted of just one ventilatory cycle interspersed by short and regular non-ventilatory periods. In the present study, both, T. scripta and, unexpectedly, C.\u00a0carbonarius, showed more than one ventilatory cycle per breathing episode, but the mean duration of the non-ventilatory periods was lower in C. carbonarius when compared to T. scripta. aO2 and pH and increasing PaCO2 , possibly explaining the episodic breathing seen in this terrestrial species, but currently a physiological explication for this behavior is lacking. Interestingly, other ectothermic terrestrial species such as varanid  are similar to ours. E as in the present study (from 8.4 \u00b1 1.6 in normoxia during winter up to 37.1 \u00b1 2.3 episodes.h\u22121 in summer), but found considerable variation in fRepi through different seasons, ranging from 3.6 \u00b1 0.4 breaths.episode\u22121 in normoxia during winter up to 26.1 \u00b1 5.4 breaths.episode\u22121 in hypoxic-hypercarbia during autumn, thereby demonstrating considerable seasonal variation in breathing pattern in T. scripta. Repi and fE during normoxia and hypoxia, and Repi during normoxia. Repi during both normoxia and hypercarbia, and Repi at 10\u201312% CO2 to be 5.6 \u00b1 1.0 at 28\u00a0\u00b0C.Comparing our data with previous studies on the effect of hypoxia or hypercarbia on ventilation and gas exchange in T, fR, 2 kg\u22121 min\u22121 , but are somewhat similar to the values found by 2 . The general response of T. scripta to reducing oxygen concentrations can be described by a moderate, when compared to the response during hypercarbia, increase in minute ventilation, mainly caused by increasing VT, and a reduction in oxygen consumption, thereby increasing the air convection requirement. These changes are generally more pronounced below 5% O2. The response to hypercarbia also includes an increase in ventilation due to an increase in VT and fR. In T. scripta neither hypoxia nor hypercarbia caused significant changes in TINSP, TEXP, TTOT, f\u2032, and fRepi, whereas fE and TNV P, increased and decreased significantly, respectively.The values for minute ventilation in C. carbonarius during hypoxic or hypercarbic exposures, only data on VT, fR, Terrapene carolina carolina, possibly indicating that animals in their study may not have been resting quietly during normoxia. However, their 2 is identical to the values from other studies at similar oxygen concentrations. VT in C. carbonarius is on the lower end of data available for terrestrial Testudines, which may have been influenced by the relative large amount of bone tissue present in adult individuals of this species . Breathing frequency and In respect to udinidae .Gopherus polyphemus and Terrapene carolina, found values of oxygen consumption very similar to those of C. carbonarius during both normoxia and hypoxia. Interestingly, G. polyphemus spends a significant amount of time in burrows that may show hypoxia as well as hypercarbia, and whose critical oxygen level  was similar to the lowest G. polyphemus (0.05 mlO2 kg\u22121 min\u22121) and T. carolina (0.08 mlO2 kg\u22121 min\u22121) at less than 1% O2 , meaning that for a minute pump ventilation of 200 ml min\u22121. Animals should therefore ventilate at a frequency of 40 breaths min\u22121 and a tidal volume of 5 ml to ventilate the respiratory system with the lowest mechanical work, but such a breathing pattern would result in severe alkalosis due to increased CO2 excretion (T. scripta reached the greatest level of minute ventilation (215.9 ml min\u22121 kg\u22121) at 6% CO2, using a tidal volume of 57.2 ml kg\u22121 and an instantaneous breathing frequency of 18.3 breaths min\u22121 (fR\u00a0=\u00a03.0 breaths min\u22121), values much different from mechanical predictions. The significance of this variation in breathing pattern versus the mechanical predictions of work of breathing needs to be investigated to better understand the mechanical work of breathing of the Testudines respiratory system, since mechanical work of breathing increases markedly with increasing tidal volume, e.g., from 57 to 272 ml cmH2O min\u22121 kg\u22121 at 6.2 ml kg\u22121 and 3.0 breaths min\u22121 in undisturbed T. scripta versus 34.2 and 0.8 breaths min\u22121 in vagotomized T. scripta, each at 4% O2  show much smaller tidal volumes during normoxia than other chelonians (mostly between 10 and 20 ml kg\u22121), resulting in relatively larger increases in VT during hypoxia and hypercarbia than the other species. Both species also showed relatively larger increases in R and VT under normoxic conditions.The relatively large increases seen in VP. geoffroanus under both hypoxia and hypercarbia can be explained by the very low oxygen consumption under normoxic conditions, which could be a consequence of significant extra-pulmonary gas exchange or hypometabolism in this species , when compared to the incomplete PPS of the emydid T. scripta  merianae, whose static breathing mechanics was significantly affected by the removal of their post-hepatic septum (T. scripta.The chelonian respiratory system shows significant variations in lung structure, as well as in associated structures such as the post-pulmonary septum PPS; . The PPS scripta . The prec septum . SimilarC. carbonarius and the semi-aquatic T. scripta during hypoxic and hypercarbic conditions. Contrary to most previous reports on breathing pattern in terrestrial Testudines, C. carbonarius did show considerable non-ventilatory periods with more than one breath per episode. While our data confirm previous data on the general response of T. scripta to hypoxia and hypercarbia, breathing pattern has been found to diverge significantly from predictions based on mechanical analyses of the respiratory system.This is the first study to present all the different variables necessary to fully characterize the breathing pattern in the terrestrial Our meta-analysis demonstrates general trends regarding ventilatory parameters of Testudines when exposed to hypoxia or hypercarbia, but a multivariate analysis of the taxons respiratory physiology will need a complete set of ventilatory parameters from a much larger number of species. To date it is not possible to associate the variations in the magnitude of different respiratory variables with phylogeny, habitat, behavior, and/or lung structure, which could provide important information regarding the evolution of cardiorespiratory physiology in chelonians. Cardiovascular data regarding intracardiac shunt, pulmonary and systemic perfusion, and blood gases during hypoxia and hypercarbia are particularly needed from more species to fully understand blood gas homeostasis in such an important group of intermittent breathers.10.7717/peerj.5137/supp-1Table S1Click here for additional data file."}
{"text": "TCR-independent activation of these MAIT cells from blood and gut was maximized by extending the panel of cytokines to include TNF-superfamily member TL1A. RNA-seq experiments revealed that TCR-dependent and TCR-independent signals drive MAIT cells to exert overlapping and specific effector functions, affecting both host defense and tissue homeostasis. Although TCR triggering alone is insufficient to drive sustained activation, TCR-triggered MAIT cells showed specific enrichment of tissue-repair functions at the gene and protein levels and in in\u00a0vitro assays. Altogether, these data indicate the blend of TCR-dependent and TCR-independent signaling to CD8+ MAIT cells may play a role in controlling the balance between healthy and pathological processes of tissue inflammation and repair.MAIT cells are an unconventional T\u00a0cell population that can be activated through both TCR-dependent and TCR-independent mechanisms. Here, we examined the impact of combinations of TCR-dependent and TCR-independent signals in human CD8  \u2022Activation of human MAIT cells is TCR-dependent or TCR-independent and enhanced by TL1A\u2022TCR-dependent and TCR-independent triggering induces distinct transcriptional responses\u2022TCR-dependent triggering of MAIT cells induces a tissue-repair program\u2022in\u00a0vivo studies in mice indicates a shared transcriptomeData integration with  in\u00a0vivo, consistent with a homeostatic role for these cells in epithelia.Leng et\u00a0al. explore the consequences of activation of human MAIT cells via their TCR and/or cytokines, including the gut-associated TNF-superfamily member TL1A. TCR triggering reveals a transcriptional program linked to tissue-repair functions seen  Human innate and adaptive immune systems form a critical partnership in immune defense against microorganisms. Studies have revealed several types of unconventional T lymphocytes that sit at the bridge between innate and adaptive immunity, including mucosal-associated invariant T (MAIT) cells . MAIT cein\u00a0vivo. Normal expansion is only seen if ligand is\u00a0delivered with a toll-like receptor (TLR) stimulus  B  . In\u00a0vitrt manner . Cytokine (Gr) B . We and e (Gr) B , with a   . The autby H2M3) .+ memory T\u00a0cells expressing IL-18R\u03b1 and DR3 (+CD4+ T\u00a0cells in the presence of anti-CD3 or IL-12+IL-18 (Tumor necrosis factor (TNF)-like protein 1A (TL1A)/TNF superfamily member 15 (TNFSF15) is a gut-associated proinflammatory cytokine originally characterized in a screen for TNF-\u03b1 homologous molecules. It is expressed by activated T\u00a0cells, dendritic cells, and monocytes and signals through death receptor-3 (DR3) . TL1A is and DR3 . More sp12+IL-18 . This ma12+IL-18 .in\u00a0vitro blood- and gut-derived MAIT cells. We find that IL-12 and IL-18, in synergy with TCR triggering, promote the activation of MAIT cells and that additional TL1A signaling can optimize this response in a dose-dependent manner. Triggering with TCR alone or supported by cytokines drives a set of functions linked to a tissue-repair gene expression signature, accompanied by relevant protein expression and function. Overall, our data provide insight into the precise nature of TCR- and cytokine-mediated human MAIT cell activation, characterized by a range of effector functions including not only emergency host defense but also ongoing homeostasis maintenance. This feature may be relevant to other innate-like T\u00a0cell subsets found at barrier sites in humans.Here, we addressed how TCR-dependent and TCR-independent signals synergize and drive the activation of + T\u00a0cells  in combination with suboptimal doses of IL-12 and IL-18 in a dose-dependent manner A\u20131C. Exp+ and CD161\u2212 CD8+ T\u00a0cells  and IL-18 (50\u00a0ng/mL) with or without TL1A and/or IL-15 in combination with 5-OP-RU  to characterize transcriptional profiles of MAIT cells under different treatments: TCR , cytokines , and a combination thereof (labeled here as TC). Transcriptional profiles of differentially stimulated MAIT cells were compared with those of untreated (UT) cells. TCR beads were used at a 1:1 bead-to-cell ratio, and cytokines were used at the concentrations optimized earlier. To confirm activation, MAIT cells from the same donors were examined for their release of IFN-\u03b3, TNF-\u03b1, and expression of GrB in response to the same stimulations A\u2013S4C.The mRNA levels of 132, 1,124, or 1,375 genes were significantly modulated  by TCR, cytokines, or combined TCR and cytokine stimulation, respectively. Venn diagrams highlight the overlapping and unique transcriptional signatures elicited by these 3 stimulations . We founAnalysis of the other genes unique to TCR and cytokines (TC) indicates these two signals induce diverse physiological functions in MAIT cells A. Among The 1,594 genes with significantly altered expression levels among conditions were then plotted in a heatmap according to their normalized expressions using average linkage hierarchical clustering D. We alsWe next analyzed volcano plots that show differentially expressed transcriptional profiles of stimulated MAIT cells compared with their unstimulated counterparts F\u20134H and IL-26, oncostatin M (OSM), and heparin binding early growth factor (HBEGF)  G and 4H\u2014 (HBEGF) E\u2013S4G. InGiven the range of responses seen after TCR- and cytokine-mediated activation, we speculated that functions of MAIT cells extended beyond conventional antimicrobial responses. The discovery of a skin-homing Tc17 subset in mouse responsive to commensal ligands has shed light on a unique form of adaptive immunity in which antimicrobial functions and tissue repair are coupled within the same subset of unconventional T\u00a0cells . These cFirst, we examined the volcano plots in Next, genes that were significantly differentially expressed compared with unstimulated MAIT cells were identified from TCR-, C-, and TC-stimulated MAIT cells and statistically compared in aggregate to the tissue-repair gene dataset . Gene set enrichment analysis demonstrated significant enrichment (p\u00a0< 0.0002) of these tissue repair-related genes in MAIT cells stimulated by TCR with or without cytokines A and 5B,E.\u00a0coli led to the production of TNF, Furin, and CCL3 in a TCR-dependent manner, because it could be blocked fully or partially by anti-MR1 at 20 or 72 h, respectively   G. This e24\u201336 h) F and 5G.in\u00a0vivo and in\u00a0vitro (in\u00a0vitro (5-OP-RU stimulation) and in\u00a0vivo , because these were shown to align with activated H2M3-restricted cells from publicly available data from in\u00a0vitro-activated human T\u00a0cells and those in the mouse. In this analysis, the closest neighbors of the maximally activated cells (TC and C) were the Tc17 cells activated in the mouse skin and the in\u00a0vivo chronically or in\u00a0vitro-activated MAIT cells from in\u00a0vivo. Hence, despite the cross-species comparison, stronger stimulation creates an important and relevant shift in the position on the dendrogram. These data indicate, in an unsupervised analysis, that closely shared transcriptional patterns exist between our in\u00a0vitro-stimulated cells and different subsets that are performing tissue-repair functions (as well as host defense functions) in\u00a0vivo in mice.We performed a data integration analysis by fusing RNA-seq datasets containing mouse data from activation studies in\u00a0vitro  with ourin\u00a0vitro . First, in\u00a0vivo. Overlap was seen between the different human datasets , indicating the comparability of the studies despite the different protocols and sites.Finally, we performed, using an extension of this bioinformatic approach, alignment among all 3 generated datasets on human and mouse MAIT cell activation to assess their comparability. All 3 have shown that under conditions in which the TCR is stimulated, there is a tissue-repair signature, but when tested in both our dataset and that of Given the relationship between MAIT cells and epithelial maintenance, we wished to assess how closely associated such cells are with the epithelial layer. Because only limited data are available on this (partly because of the availability of suitable antibodies and the need for antibody combinations to reliably identify MAIT cells), we developed a high content imaging protocol based on chip cytometry. By costaining for multiple relevant markers  in colonic tissue, we could observe apposition between MAIT cells and intact epithelium, suggesting two-way cross talk is possible under homeostatic conditions .Figure\u00a07in\u00a0vitro and in\u00a0vivo   , yet fulin model   and matrix metalloproteinases. T\u00a0cell-derived furin has been shown to be critical in tissue protection in a transfer colitis model and affects regulatory T\u00a0cell (Treg) development . CCL3 M. Both of closure F and 5G.in\u00a0vivo . Thus, a reasonable body of data has emerged in parallel among the three studies that suggests MAIT cells possess tissue-repair activity of relevance in barrier defense.A similar set of RNA-seq data, functional data, and conclusions has been obtained using parallel experiments in human MAIT cells ytokines . Severalytokines . Looking\u22126).Taking together the data here and those of + MAIT cells. Their triggering behavior reflects that of other MAIT subsets in which this has been studied, although some functional differences may exist , our model suggests that ongoing maintenance of the barrier is an integral part of the function of such unconventional cells concentrated in epithelia, which goes hand-in-hand with control of microbial invasion.paul.klenerman@medawar.ox.ac.uk). Please note that this study did not generate new unique reagents.Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Paul Klenerman .Healthy PBMCs were isolated from leukocyte cones (NHS Blood Services). For long-term storage, PBMCs were kept in liquid nitrogen with freezing media . These samples are fully anonymized, so data on age and gender are not available for comparison. Colonic tissues were collected in the form of polyp biopsies or from the uninvolved mucosa of patients with colorectal cancer. Patient information is shown in the table below. All patients involved gave written consent. Colonic tissues were digested at 37\u00b0C for overnight with Collagenase A (Roche) and DNase I (Sigma-Aldrich). Colonic lymphocytes were then isolated from the cell suspension by a Percoll-  gradient: cells were resuspended in 4ml of a 40% Percoll solution that was carefully overlayed over 4ml of 80% Percoll. After centrifugation , lymphocytes were obtained from the interphase between the two Percoll layers. A detailed protocol has been described by Characteristics of the CRC patients.2. Caco2 cells  were cultured at a starting density of 4x105 cell/cm2 in T-175 cell-culture flasks, using GlutaMAX medium supplemented with 10% fetal bovine serum (FBS), 1% MEM Non-essential-amino acid solution (NEAA), 100ug/mL Penicillin-Streptomycin, 2mM L-glutamine (Sigma Aldrich). Cultures were maintained with media exchange every second day and routinely split every week when cells had reached approximately 70% confluency.Cell lines were cultured at 37\u00b0C in 5% CO5 to 106 cells/mL in T-175 cell-culture using RPMI-1640 medium (Sigma Aldrich) supplemented with FBS, Penicillin-Streptomycin and L-glutamine.THP1 cells  were cultured at a density between 2x10+ T\u00a0cells were positively labeled with CD8 Microbeads , and enriched from PBMCs using MS or LS columns following the manufacturer\u2019s instructions (Miltenyi Biotech). Colonic lymphocytes were used without prior enrichment by CD8 microbeads and were maintained in R10 supplemented with 25ng/mL amphotericin B (GIBCO), 40\u00a0\u03bcg/mL gentamicin (GIBCO), and 10\u00a0\u03bcg/mL ciprofloxacin (Sigma-Aldrich).PBMCs were thawed, washed and maintained in RPMI 1640 with 10% fetal calf serum, 1% L-glutamine, and 1% penicillin/streptomycin (R10) . CD8For non-specific TCR triggering, PBMCs, enriched CD8 T\u00a0cells, sorted cells or colonic lymphocytes were stimulated with plate bound anti-CD3/28 antibodies (Miltenyi), or anti-CD3/28 beads (Miltenyi) at 1:1 ratio. ELISA plates (Greiner) were coated with 5\u00a0\u03bcg/mL anti-CD3/28 with the final volume of 100\u00a0\u03bcL at 4\u00b0C for overnight. Antibody mix was washed off the next morning, and plates were used after 1-hour 37\u00b0C incubation with R10. Anti-CD3/28 beads were prepared following the manufacturer\u2019s instructions.5 MACS-enriched CD8s with 1x105 THP1 cells which had been previously pulsed with 10nM 5-OP-RU (kindly provided by David Fairlie) for 2 hours. Unpulsed THP1s were used as controls.MAIT-specific TCR triggering was achieved by co-culturing of 2x10For cytokine triggering, cells were stimulated for 20 hours with IL-12 (Miltenyi) at 2ng/mL, IL-18 (MBL) at 50ng/ml, IL-15 (Miltenyi) at 25ng/ml, TL1A (R&D) at 100ng/ml, unless otherwise stated.E.\u00a0coli  at a 25 bacteria per cell (BpC) ratio overnight. Bacterially loaded THP1s were washed and co-cultured with MACS-enriched CD8s at a 1:2 ratio. In order to block the TCR-dependent component of this activation, in some experiments an anti-MR1 blocking antibody  was added to the co-cultures.For activation of MAIT cells by bacteria-derived ligands, THP1 cells were loaded with PFA-fixed  Brefeldin A  was added into the cell cultures for the last 4 hours before intracellular staining.Cells were stained with the antibodies and dyes listed in the + T\u00a0cells were enriched from PBMCs of three healthy individuals and were rested overnight prior to sorting. On the next day, MAIT (CD1612+ V\u03b17.2+) cells were sorted using a Beckman Coulter MoFlo XDP and stimulated with a range of conditions including anti-CD3/28, cytokines (IL-12/IL-18/IL-15/TL1A), or the combination of both, or left untreated in R10 media for 24 hours. RNA was then extracted from these 12 samples using an RNeasy Micro kit (QIAGEN). The quantity and quality of extracted RNA was first evaluated using both a nanodrop spectrophotometer and the Agilent 2100 bioanalyzer. All samples had RNA integrity (RIN) values greater than 9 and were free from contaminating protein and organic compounds. RNaseq was performed by Wellcome Trust Centre for Human Genetics (University of Oxford) on a HiSeq4000v platform. Gene lists that were differentially expressed  between various conditions and their normalized expression values, as well as the principle component analysis (PCA) plots, were generated with Partek\u00ae Flow\u00ae, an online analysis platform for Next Generation Sequencing data (http://www.partek.com/partek-flow/), following the user\u2019s guide. Volcano plots were generated with Prism software. Heatmaps were generated using normalized counts with Heatmapper (http://www.heatmapper.ca/expression/) with the averaged linkage clustering method and Pearson distance measurement method. Venn diagrams were drawn with an online diagram drawing platform developed by Ghent University, Belgium (http://bioinformatics.psb.ugent.be/webtools/Venn/). Gene set enrichment analysis (GSEA) was performed using GSEA version 3.0  and CD161- V\u03b17.2- cells were sorted from pre-enriched blood CD8+ T\u00a0cells. These cells were then stimulated with anti-CD3/28, cytokines (IL-12/IL-18/IL-15/TL1A), the combination of both or left untreated in R10 media for 20 hours. The total RNA of sorted T\u00a0cells was extracted with an RNeasy Micro kit (QIAGEN) and reverse transcribed using reverse transcribed using SuperScript III Reverse Transcriptase (Invitrogen). For detection of IL-26 mRNA, a 20X IL-26 human TaqMan\u00ae probe was used (Hs00218189_m1) with 2X TaqMan\u00ae Fast Advanced Master Mix (both from ThermoFisher Scientific). OSM and HEBGF cDNA quantification was performed with Roche \u00ae hydrolysis probes , with GAPDH as the internal control .CD161+ were co-cultured with THP1 cells loaded with fixed E.\u00a0coli at 25 BpC in the presence or absence of 20\u00a0\u03bcg/mL LEAF anti-MR1 Antibody (Biolegend). Supernatants were collected at 72 hours. A total of 1.5x104 Caco2 cells were seeded per well in a 96-well clear flat bottom plate (Corning) and grown to confluency at 37\u00b0C for 5\u00a0days with media exchange every 2\u00a0days. Monolayers were scratched using a WoundMaker (Essen Bioscience), washed with serum-free medium and incubated with CD8+ 72h hour supernatants diluted 1:4 with fresh media. As a negative control, fresh media was used. Time lapse imaging was recorded every 4 hours using IncuCyte S3 Live Cell Analysis System (Essen Bioscience) for 36 hours at 37\u00b0C. GlutaMAX medium supplemented with 10% FBS, 1% NEAA, Penicillin-Streptomycin and L-glutamine was used throughout this experiment.Enriched CD8in situ at room temperature for 10\u00a0minutes using 4% paraformaldehyde solution, then washed with 10-20\u00a0mL of PBS. Non-specific binding was blocked by incubating in 5% normal goat serum (Thermo Fisher cat016201) in PBS for at least one hour at room temperature. All antibodies were directly conjugated to their fluorophore and were diluted for the staining step in PBS. Immunostaining was performed using an iterative approach where up to three colors could be applied simultaneously. Fluorophores were subsequently bleached and a new round of antibodies applied to build up the panel . Sections were fixed he panel . Images https://www.immgen.org/) samples (voom function in limma R package (http://www.informatics.jax.org/orthology.shtml). Batch effects were removed using ComBat function in \u2018sva\u2019 R package . Statistical significance was assessed using paired Student\u2019s t test, or repeated-measures two-way analysis of variances, with Bonferroni\u2019s correction for multiple comparison assays. For the analysis of the RNaseq dataset, Partek Flow was used. For the GSE129906.The accession number for the raw and pre-processed data from the RNaseq datasets reported in this paper is GEO: The members of Oxford IBD Investigators are Carolina Arancibia-Carcamo, Adam Bailey, Eillie Barnes, Beth Bird-Lieberman, Oliver Brain, Barbara Braden, Jane Collier, James East, Alessandra Geremia, Lucy Howarth, Satish Keshav, Paul Klenerman, Simon Leedham, Rebecca Palmer, Fiona Powrie, Astor Rodrigues, Alison Simmons, Peter B. Sullivan, Simon P.L. Travis, and Holm H. Uhlig."}
{"text": "Twenty-two community-dwelling patients with chronic hemiplegia participated in this study. Eight participants performed only discrete-skill step training during the loading response phase, focusing on paretic hip extension movement (LR group). Another eight performed only discrete-skill step training during the preswing phase, focusing on paretic swing movement (PSw group). The remaining six were trained using both training methods, with at least 6 months in each group to washout the influence of previous training. Therefore, the final number of participants in each group was 14. The braking and propulsive forces of GRFs were measured during gait before and after 30 repetitions of the discrete-skill step training.  Although both groups showed a significant increase in stride length, walking speed was increased only in the LR group. The PSw group showed an increase in braking forces of both sides without any change in propulsion. In the LR group, paretic braking impulse did not change, while nonparetic propulsion increased.  The discrete-skill step training during loading response phase induced an increase in nonparetic propulsion, resulting in increased walking speed. This study provides a clear understanding of immediate effects of the discrete-skill step training in patients with chronic stroke and helps improve interventions in long-term rehabilitation. Stroke is a leading cause of long-term dysfunctionality in daily living due to motor paralysis, muscle weakness, abnormal muscle tone, and sensory impairments. Although the majority of patients post stroke are able to walk independently, many cannot walk with sufficient speed and endurance for resuming daily activities . PreviouThe important walking phase concerned with paretic lower limb deficit is the double-stance phase. The major role of this phase, step-to-step transition, is to control the center of mass (COM) trajectory using ground reaction forces (GRFs) generated from both the paretic and nonparetic limbs . Since tEssentially, motor skills are classified into discrete, serial, and continuous . WalkingThis pilot study presents a preliminary exploration of long-term interventions in individuals with chronic stroke. We hypothesized that the discrete-skill step training based on loading response and preswing phases of the paretic limb movement results in a faster gait speed immediately by regulating the paretic braking force and propulsion, respectively. This study investigates whether a single session of step training using discrete skills on step-to-step transition can improve walking in individuals with chronic stroke.Twenty-two community-dwelling patients with hemiplegia due to chronic stroke participated in this study. All participants could walk independently. The inclusion criteria were as follows: (i) history of a single stroke at least 6 months prior to this study and (ii) the ability to walk independently for at least 5\u2009m without using a cane, with or without ankle-foot orthosis (AFO). The exclusion criteria were as follows: (i) orthopedic diseases affecting measurements and (ii) other neurological diseases such as Parkinsonism and ataxia.The participants were randomly assigned to each group and trained on the paretic lower limb movement using a discrete skill in one session. Eight participants performed only discrete-skill step training during the loading response phase, focusing on paretic hip extension movement (LR group). The other eight performed only discrete-skill step training during the preswing phase, focusing on paretic swing movement (PSw group). The remaining six were trained using both training methods. In this case, a period of more than 6 months was set up to washout the influence of previous training. Finally, the number of participants added up to 14 in both groups.This study was approved by the Institutional Ethics Committee. All participants provided written informed consents prior to participation in this study.In this study, we focused on developing discrete skills of the paretic lower limb during two double-stance phases of gait including loading response and preswing.The loading response phase requires weight acceptance and redirection of the COM with the leading limb . In indiThe preswing phase is also important since the COM is propelled forward and upward by the propulsion generated on the trailing limb in this phase . In indiAll participants performed step training by grasping the parallel bar using the nonparetic hand. Those who used an AFO during gait evaluation prior to the step training also used it during step exercise. Prior to the training, one of the two skilled physical therapists instructed verbally and displayed how to perform the step training. In the training, instructions and feedback of the step movement were provided by the therapist. Firstly, the participants in the LR group were given instructions: \u201cStrengthen the hip extension of the paretic limb.\u201d If the therapist observed that the paretic movement was difficult or inadequate, he gave the second instruction: \u201cMore forward stepping of the nonparetic limb.\u201d On the other hand, the participants in the PSw group were given the first instruction: \u201cTry to relax the knee of the paretic limb.\u201d Similarly, if the therapist noticed that the paretic movement was performed inadequately or inappropriately, he gave the second instruction: \u201cImmediately transfer the weight toward the nonparetic side.\u201d These second instructions were to facilitate a smooth weight transfer.Gait parameters were measured before and after each step training session. Two pieces of force plates  were used to measure GRFs during gait rehabilitation. The force plates were 60\u2009cm long and 40\u2009cm wide. They were arranged side by side along their length in the middle of the walkway (4\u2009m 40\u2009cm). The participants were instructed to walk at a comfortable walking speed without a cane. If some participants were unable to walk without AFO, they were allowed to wear it . The GRF data were recorded at a sampling rate of 1,000\u2009Hz during the stance phase on the paretic and nonparetic limbs. Due to the setting of force plates, the GRF data were measured on one side for each trial. The GRF data were collected from more than three successful stance phases of both sides. In addition, the number of steps and the time taken during the 3\u2009m walk were also measured. A time interval of a few minutes was set between the preassessment and training period and between the training period and the postassessment to prevent fatigue. If the participants needed, a further few minutes was given as appropriate.For the clinical evaluation, the following tests were performed to assess the physical function in both groups: a score on the Fugl-Meyer Assessment (FMA) scale was evaluated for motor function, and the Functional Ambulation Categories (FAC) score was evaluated for walking ability.GRF data were filtered with a low-pass fourth-order Butterworth filter at 6\u2009Hz forward and backward in time. Peak forces, impulses, and duration time in both braking and propulsive phases were calculated. Each parameter was averaged by the number of measured trials. Peak forces and impulses were normalized according to the participant's body weight. Walking speed and cadence were calculated using the number of steps and the time taken for a 3\u2009m walk. Stride length was also calculated by doubling the average step length.t-tests for parametric or Wilcoxon signed-rank tests for nonparametric. Similarly, the differences in temporospatial parameters, such as walking speed, stride length, and cadence, were compared using the same tests, as appropriate. Statistical significance was set at P < 0.05.First, we investigated the normality of all variables using Shapiro-Wilk tests. The differences in GRF parameters, such as peak forces, impulses, and duration of braking and propulsive forces of both sides, were measured before and after the step training and comparatively analyzed using paired Two participants in the LR group and one participant in the PSw group were excluded from the analysis because it was difficult for them to walk by placing the affected limb properly on the force plates. Therefore, the enrolled participants in this study finally were 12 in the LR group and 13 in the PSw group. Six participants in the LR group and ten participants in the PSw group were not able to walk without AFO, so they were allowed to use the AFO during step training and gait evaluation.P = 0.038), whereas impulse and duration time did not change significantly . Nonparetic propulsive forces increased significantly . Simultaneously, the duration time of the nonparetic propulsive phase decreased significantly. While nonparetic braking forces increased significantly , paretic propulsive forces did not change significantly but tended to increase .As immediate effects on the LR group, stride length and walking speed increased significantly after the training . Among tRegarding immediate effects on the PSw group, stride length increased, and cadence decreased significantly . HoweverThis study revealed that the single discrete-skill step training session could immediately change paretic and nonparetic GRFs while performing a continuous skill such as walking. The findings of this study can be beneficial for gait rehabilitation in patients with gait dysfunction due to chronic stroke.The stride length and walking speed immediately increased in patients of the LR group after the repetitive step training that emphasized on the paretic hip extension during loading response. In general, the impulses of anteroposterior GRFs are expected to increase as the stride length and walking speed increase , 22. In Nonparetic propulsion increased significantly with peak force and impulse in this study. However, paretic braking force increased only in peak force, not in impulse. It is noteworthy that there was a difference between changes in peak force and impulse in paretic braking forces. The increase in peak braking force of the paretic leading limb suggests that the paretic limb could receive a greater propulsive force from the nonparetic limb as walking speed increases. On the other hand, no change in paretic braking impulse would indicate another reason. Turns et al. reported that paretic braking impulse increased as compared to the nonparetic limb in individuals with severe hemiparesis . This exNeptune et al. showed that the hamstring muscles accelerated the trunk forward at the beginning of stance . Since tThe stride length of PSw group patients increased, although their cadence was decreased without changes in walking speed. A decreased cadence indicated a prolonged gait cycle. Therefore, although the stride length was increased, walking speed remained unchanged due to the prolonged gait cycle. Only braking forces (peak and impulse) of both limbs increased along with the increase in stride length. Conversely, the propulsive forces of both limbs did not change.Previous studies on walking simulations reported that the triceps surae muscles contribute to the propulsion and swing of the lower limb . The proThe training in the PSw group emphasized on knee flexion during paretic swing phase. However, the difficulty of paretic swing control may slow down the swing motion and lead to a prolonged gait cycle after training. In addition, we ascribed that the step length increased due to the increase in paretic swing movement, resulting in an increase in paretic braking force. Previous studies reported that the iliopsoas is also a contributor muscle to the knee flexion during preswing , 27. RegIf clinicians want to increase the patient's walking speed immediately, the step training with consciousness of the paretic hip extension during loading response may be beneficial. On the other hand, although propulsive force is generated during the preswing phase, it may be difficult to improve walking speed immediately by step training with consciousness of paretic swing movement.There are some limitations to this study. First, the effects of step training using a discrete skill were not compared with another training using a continuous skill. In the future, it is necessary to clarify the effects of step training using discrete skill by comparison with a step training session based on using continuous skill. Second, more detailed kinetic and kinematic parameters, such as step length of both limbs and joint motion, could not be measured because of environmental hindrances. Further investigation is needed to reveal the effects of discrete-skill step training using more detailed gait parameters.The current study revealed that a single session of repetitive step training using the discrete skill could change gait performance immediately in individuals after chronic stroke. Notably, discrete-skill step training, which focuses on paretic hip extension movement during loading response, immediately increases walking speed because of the increased nonparetic propulsion by regulating paretic braking force. On the other hand, the step training that focused on paretic swing movement during preswing immediately increased stride length and decreased cadence. The participants in this group immediately increased only braking forces of both limbs with no change in walking speed. These findings suggest that step training may be useful as an explicit learning to change GRFs during gait."}
{"text": "Knowledge about GDM significantly improved after education, with few differences between the two education settings. Both patients in group and individual education were equally satisfied with the content and duration of the initial and follow-up education. Of all group participants, 91.8% (n = 90) were satisfied with group size (on average three participants) and 76.5% (n = 75) found that group education fulfilled their expectations. In conclusion, women diagnosed with GDM were overall satisfied with the education session\u2019s content leading to a better understanding of their condition, independent of the education setting. Group education is a valuable alternative to better manage the increasing workload and is perceived as an added value by GDM patients.The value of diabetes education, focusing on lifestyle measures, in women with gestational diabetes mellitus (GDM) is acknowledged, but requires intensive education and input of resources if done on an individual basis. Group education could be a valuable alternative to individual education. This study aims to investigate the impact of multidisciplinary group education on women\u2019s knowledge about GDM, education, treatment satisfaction, and emotional status. Two hundred women with GDM were enrolled in a prospective observational study. Dutch speaking women were offered group education at their first visit after GDM diagnosis. Non-Dutch speaking women or women for whom group education was not possible received individual education. Individual follow-up with a dietitian was planned within two weeks for all women. Women receiving individual education ( Gestational diabetes mellitus (GDM) is one of the most frequent medical conditions during pregnancy and is defined as diabetes diagnosed in the second or third trimester of pregnancy, provided that overt diabetes early in pregnancy has been excluded . GDM is Treatment of women with GDM results in a lesser degree of perinatal complications and can potentially improve the health-related quality of life ,3,12,13.Group education is a well-documented alternative to individual education in the organization of diabetes care in general, serving as a method to meet the educational needs of diabetes patients while at the same time providing peer support and motivation ,16. HoweClinicaltrials.gov (NCT02528162). Participants provided written informed consent before inclusion in the study.This study was performed in compliance with the principles of the Declaration of Helsinki (2008) and received approval from the local Ethics Committee of UZ Leuven (B322201525589). Prior to the first inclusion, the study was registered in This monocentric prospective observational cohort study was conducted at the University Hospital UZ Leuven in Belgium from October 2015 to September 2018. Since October 2015, the endocrinology department of UZ Leuven replaced the initial individual education session for the management of GDM as much as possible by structured group education sessions. Screening for GDM was based on a universal two-step screening strategy with a 50 g glucose challenge test (GCT) and a 75 g oral glucose tolerance test (OGTT) using the IADPSG/2013 WHO criteria. After diagnosis of GDM, Dutch speaking women were invited to attend a multidisciplinary group education session of maximum 1.5 h with a maximum of six participants. The session was organized on a weekly basis and was provided by a certified diabetes educator and a specialized diabetes dietitian. For non-Dutch speaking women or if group education was not possible, the first education session was delivered individually. A structured PowerPoint presentation was used both in the group and individual education sessions to educate about the pathophysiology, consequences and treatment of GDM\u2014including dietary intake, physical activity and SMBG. The structure and content of this presentation was evaluated on a regular basis and adapted if necessary to the most recent guidelines and recommendations. For non-Dutch speaking patients, the presentation was translated to French and English. At the end of the education session, women received the handouts of the presentation, a brochure with information on physical activity, a glucose monitoring diary, a seven-day diet journal, a brochure on specific dietary guidelines with adapted recipes and material for SMBG.Regardless of the initial education setting, all women were offered an individual follow-up session of 30 min with a dietitian within two weeks after the initial education session. During this session, women received further advice regarding their gestational weight gain and dietary habits based on their seven-day diet journal together with the SMBG results. The glycemic targets of the American Diabetes Association (ADA) were followed (fasting plasma glucose < 95 mg/dL (5.3 mmol/L) and two hours after meals < 120 mg/dL (6.6 mmol/L)) [Women diagnosed with GDM could participate if at least 18 years old. Women were excluded if they had a history of bariatric surgery, were diagnosed with pregestational diabetes or if they could not speak fluently Dutch, French or English. All other women attending a group or individual education session were invited to participate in the study. Data were collected from the electronic medical records and through questionnaires. Outcome data from women who received the initial education session in group were compared to those from women who received the initial education session individually.All participants\u2014both in group and individual education\u2014were asked to complete several questionnaires at three different time points during the multidisciplinary education program: prior to the initial education session, immediately after the initial education session and after the individual follow-up session with the dietitian. The questionnaires aimed to evaluate the education of GDM, the knowledge on GDM and the emotional status. For this purpose, the questionnaires measured sociodemographic characteristics of the subjects, knowledge of GDM, feelings of depression and anxiety associated with the diagnosis of GDM, and the satisfaction with the education and the treatment. It took about 10 to 15 min at each point in time to fill in the questionnaires. All questionnaires were translated into French and English for non-Dutch speaking participants. An overview of the questionnaires administered at each time point is given in Questionnaire I on sociodemographic characteristics: A self-designed sociodemographic questionnaire\u2014including data on education level, ethnicity, financial and marital status\u2014was administered at the start of the initial education session. This questionnaire was based on a questionnaire that has previously been used in the Belgian Diabetes in Pregnancy Study .Questionnaire II on knowledge of GDM: Knowledge of GDM was assessed before and after the initial session and after the follow-up session to measure knowledge gains, using a self-designed questionnaire containing 14 multiple-choice questions on risk factors for and consequences of GDM, diagnosis of GDM, treatment of GDM and follow-up after delivery. Proportions of correct responses on the knowledge questionnaire of the total cohort prior to the initial education session were compared to those after the follow-up session in order to evaluate knowledge improvement after education. In order to compare the knowledge about GDM between participants in group education and those in individual education, response rates on the knowledge questionnaire after the initial education session were compared between both groups. Questionnaire IIIa and IIIb on satisfaction with the education sessions: Two self-designed questionnaires were created to evaluate satisfaction with the education program and whether treatment goals could be achieved. The first education satisfaction questionnaire (IIIa) was administered after the initial education session and evaluated the participant\u2019s degree of agreement with the clarity and relevance of the explanation on twelve items that were discussed during the presentation, using a five-point Likert scale. This questionnaire also contained an extra section with multiple choice questions for women attending the group education to evaluate perceptions on the duration of the group session, the advantages and disadvantages of group education and the size of the group. At the end of the questionnaire, an open question was included to share comments about the education session. The second education satisfaction questionnaire (IIIb) was completed after the follow-up session with the dietitian and again assessed participant\u2019s satisfaction with the twelve discussed items during the session. An additional set of questions on a five-point Likert scale was included regarding patient satisfaction on accomplishing lifestyle modifications in the week following the initial education session. At the end of this questionnaire, women were given the opportunity to share their opinions about the education session in an open question. Questionnaire IV on depression: To measure possible feelings of depression, the \u2018Center for Epidemiologic Studies Depression\u2019 (CES-D) questionnaire was completed at all three time points. The CES-D questionnaire is a validated tool to use in pregnancy and consists of 20 items with each item being scored between 0 and 3 on a four-point Likert scale, from respectively \u2018rarely or none\u2019 to \u2018almost all the time\u2019. Total score on the CES-D questionnaire can range from 0 to 60, with a score of \u2265 16 being suggestive for clinical depression . Questionnaire V on anxiety: The validated six-item short-form of the Spielberger State-Trait Anxiety Inventory (STAI-6) questionnaire was administered at each point in time to measure state anxiety level. The six items are scored from \u2018very much\u2019 to \u2018not at all\u2019 with a four-point Likert scale and a total score ranging from 6 to 24, with a higher score referring to a greater level of anxiety ,23. Questionnaire VI on treatment satisfaction: The Diabetes Treatment Satisfaction Questionnaire\u2014status version (DTSQs) is a validated tool for measuring satisfaction with diabetes treatment regimens and was administered after the follow-up session. This is an eight-item questionnaire in which each item is scored on a seven-point Likert scale from 0 to 6 . The DTS2), obesity (BMI \u2265 30 kg/m2), gestational weight gain , parity, family history of diabetes, smoking, alcohol intake during pregnancy and history of GDM. Excessive gestational weight gain was defined according to the most recent Institute of Medicine (IOM) guidelines [Data from the participant\u2019s electronic medical record (EMR) were collected during pregnancy, at delivery and at three months postpartum. Maternal characteristics recorded were age, ethnicity, height, body weight, body mass index (BMI) at first prenatal visit and at delivery, overweight , preeclampsia -syndrome), preterm delivery (<37 weeks of gestation) and cesarean section (planned and emergency sections combined). Neonatal pregnancy outcomes recorded were: gender, birth weight, macrosomia (birth weight > 4 kg), large-for-gestational age infants , small-for-gestational age infants , shoulder dystocia, Apgar score at five minutes and admission at the neonatal intensive care unit (NICU) .p-value of <0.05 (two-tailed) was considered significant.Statistical analyses were performed using SPSS software for Windows . Continuous data were expressed as mean and standard deviation (SD) if normally distributed, otherwise, variables were displayed as median and interquartile range (IQR). Categorical data were presented as frequencies and percentages. To compare variables between two groups, independent sample t-tests were used for normally distributed continuous variables, Mann-Whitney U-tests for non-normal variables and Chi-square tests for categorical variables. To evaluate the effect of the education, the Wilcoxon Signed Rank test was used for non-normal variables and McNemar test for categorical variables. Multivariable models were used to correct for significant differences in general patient characteristics between both groups. Linear regression was used for continuous outcomes and logistic regression for binary outcomes. A n = 392). Women with GDM who did not participate in the study despite meeting the inclusion criteria (n = 145), were mostly women who received the initial education during hospitalization, were unable to participate due to practical reasons such as arriving too late for the education session, or women who declined to participate. Of all participants, 100 attended the initial education session in group and 100 received the initial education session individually. As this was an observational study, the equal division of participants over the two groups occurred by chance. The average number of women seen in each group education session was three. Results did not differ when excluding non-Dutch speaking women. The A total of 200 pregnant women with a recent diagnosis of GDM were enrolled. The prevalence of GDM over this period was 6.6% (n = 13 of 116 women with more than one pregnancy) had a previous history of GDM, 23.7% (n = 47) had an ethnic minority (EM) background. The most frequent EM background was Asian in 10.6% (n = 21), Black-African in 4.0% (n = 8), Northern-African in 4.0% (n = 8), Middle-Eastern in 2.0% (n = 4) and Turkish in 1.5% (n = 3). Women receiving individual education were more often from an EM background than women in group education (32.0% (n = 32) versus 15.3% (n = 15), p = 0.01). There were no other significant differences in characteristics between women in each setting (n = 170) attended the postpartum OGTT of which 40.4% (n = 67) had glucose intolerance  had excessive gestational weight gain, 8.2% (n = 16) had preeclampsia and 30.3% (n = 59) had a cesarean section. Of all babies, 9.3% (n = 18) was LGA, 9.9% (n = 19) SGA and 5.2% (n = 10) had macrosomia. There were no significant differences in pregnancy outcomes between the different education groups  completed the knowledge questionnaire prior to the initial session and after the follow-up session. Women generally had good knowledge about GDM before the initial education session, which improved significantly for almost all items after the follow-up session .Women showed an overall good knowledge of most topics after the initial education session, with almost no significant differences between the group and individual education groups .Patients were overall satisfied with the content and duration of both the initial and follow-up education sessions . The majn = 98), 91.8% (n = 90) were pleased with the size of the group. A large majority of 76.5% (n = 75) indicated that group education fulfilled their expectations, although 22% (n = 22) indicated that they would prefer supplementary individual education after group education. Only four women (4.1%) preferred individual education alone. The most frequently reported advantages of group education were \u2018learning from the questions of others\u2019  and \u2018learning from the experience of others\u2019 , followed by \u2018feeling supported by the group\u2019  and \u2018helping you to stick to the advice\u2019 . However, 10 women (10.2%) reported no advantages of group education and four women (4.1%) indicated that they felt inhibited by the group.Of all women who completed the additional questions about group education (n = 152), a large majority agreed that is was possible to follow the advice about diet, physical activity, weight gain, and glycemic measurements. Almost all participants agreed or strongly agreed with the statement that they were confident in the given advice . However, 23.0% (n = 35) perceived the advice to be too strict and indicated that they felt starved. There were no significant differences in agreement with the feasibility of the advice between women who received group education and those who received individual education . Mean total score for the two items on perceived hyper- or hypoglycemia was 3.1 (\u00b1 2.1) and this was not significantly different between both education groups .Mean total score of the DTSQs was 27.3 (\u00b1 0.5) and this was not significantly different for women in group or individual education , 25.0% (n = 37) had a total score \u2265 16 at the CES-D questionnaire prior to the initial education session and were therefore considered at risk for clinical depression. This percentage declined to 18.9% (n = 28) after the follow-up session (p = 0.137). The median total score on the STAI-6 questionnaire decreased significantly from 12 (10\u201314) at the start of the initial education session to 11 (8\u201313) at the end of the follow-up session (p < 0.0001).Of all responders (p = 0.967) or median anxiety scores  were observed between both education groups after the initial education session.No significant differences in clinical depression rates (25.6% versus 24.2%, In general, most women indicated that the explanation was sufficient and felt that all of their questions had been addressed during the education sessions. However, topics such as postpartum follow-up and future risks should have been addressed in more detail according to a few women. Another recurring comment was the demand for specific recipes and nutritional instructions. Women often indicated that they were well aware of what they should not eat, but struggled with deciding what they were allowed to eat instead.Due to the worldwide obesity epidemic and the adoption of the 2013 WHO diagnostic criteria, the prevalence of GDM will continue to increase. This contributes to a number of practical challenges in the management of GDM, such as an increased workload for health care providers and a growing demand for additional resources ,28. In oImproved knowledge about GDM in newly diagnosed women might result in better adoption of a healthy lifestyle, better treatment adherence and better self-management. A Malaysian study among 175 women with GDM demonstrated that better knowledge about GDM is related to better glycemic control . Our stuPatient satisfaction is an important consideration in the organization of medical care, since improved satisfaction rates appear to be associated with a more effective engagement in health care programs . In thisThe results of the DTSQs revealed that the participants were generally very satisfied with their treatment, whether they received group or individual education. A Malaysian study in women with GDM showed that higher treatment satisfaction is associated with better glycemic control . Other sMore than 90% of all group participants were satisfied with the group size and almost 80% indicated that group education met their expectations. Only a small minority reported that they felt inhibited by the group and preferred individual education. This is in contrast to the findings of a study from New Zealand, establishing that only a minority of the people surveyed would consider participating in a group session, fearing that less attention would be paid to the individual needs of each patient . In our Depression is a common condition in women with GDM, with studies reporting depression rates between 15% and 20% in this population ,37. In oWe present the first prospective study on the impact of group education on patient\u2019s knowledge about GDM, their satisfaction with the education and treatment, and emotional status. Our study demonstrates that group education is at least as good an alternative to individual education with regard to these outcomes. Moreover, our results did not differ when non-Dutch speaking women were excluded from the analyzes.Our study has several strengths. We provide prospective data of a large cohort of women with GDM, allowing the evaluation of the impact of group education compared to individual education. In addition, we used several validated questionnaires to evaluate treatment satisfaction and emotional status of women with GDM. When validated questionnaires were not available, we used self-designed questionnaires based on our experience and previous research in women with GDM. We included French and English speaking women in our cohort, ensuring that our results are representative of a multi-ethnic population. However, we could not evaluate group education for non-Dutch-speaking, since group education was only offered to Dutch-speaking women in line with routine care in our hospital. A limitation of our study is the observational design. Women following individual education were more often from an EM background than women in group education, but we corrected for this difference through multiple regression analysis. In addition, some participation bias is likely since not all eligible patients participated in the study and we have no data available on their characteristics. The results of this study show that women with newly diagnosed GDM are overall satisfied with their education and treatment, and have a better understanding of their condition after education, independent of the education setting. We show that group education is a valuable alternative to better organize education in view of the increasing GDM prevalence and is perceived as an added value by GDM patients."}
{"text": "N\u00a0=\u00a094) were asked to evaluate five environments in terms of spatio-cognitive and emotional dimensions while listening to music. Two types of music were selected: music with a fast tempo and music with a slow tempo. In contrast with a previous study by Pleasant and Mystery. The environmental features of the evaluated locations had a stronger effect than music on the evaluation of the environments. Environments with natural elements were perceived as more pleasant, interesting, coherent, and mysterious than urban built environments regardless of the music. It is suggested that the intensity of music may be an important factor in addition to the research methodology, individual variables, and cultural differences.Music may modify the impression of a visual environment. Most studies have explored the effect of music on the perception of various service settings, but the effect of music on the perception of outdoor environments has not yet been adequately explored. Music may make an environment more pleasant and enhance the relaxation effect of outdoor recreational activities. This study investigated the effect of music on the evaluation of urban built and urban natural environments. The participants ( There is a large body of studies on auditory and visual interactions. Most studies have explored the effect of music on the perception of service settings  Legibility is the extent to which elements allow an observer to understand the environment and its content. The greater the legibility, the greater the preference. (3) Complexity involves the number or diversity of elements that the environment contains. The greater the complexity, the greater the preference. (4) Mystery is the degree to which the environment contains hidden information. The greater the mystery, the higher the preference. Previous research on the effects of music on the evaluation of visual environments was mostly directed by The objective of the current study was to replicate the investigation by Another important variable that may influence the perception of the environment is the tempo of music. Because music at a fast tempo also increases ratings of subjective arousal e.g.,\u00a0, in the Finally, the environmental features of a visual scene are important factors that influence subjective evaluation in terms of the emotional and spatio-cognitive dimensions. As previously discussed, the natural environment is preferred over the urban environment, and the urban environment with natural elements is preferred over the urban built environment without natural elements e.g.,\u00a0.In summary, the objective of the current study was to explore the effect of fast  and slow  music on the evaluation of diverse types of outdoor urban environments. Participants evaluated both urban built and urban natural environments while listening to music. The effects of music in terms of the emotional and spatio-cognitive dimensions of the perceived environment were investigated. Based on the results of Ninety-four undergraduates participated in the experiment. The sample comprised young adults between the ages of 19 and 23 . Participants were enrolled in the first, second or third year of various psychology courses. They were students in informatics, financial management and tourism at the University of Hradec Kr\u00e1lov\u00e9.The musical stimuli used in our previous study  were adoVirtualDJ software, a long seamless loop was used in both songs to create soundtracks with a duration of approximately 30\u00a0min.For the purposes of the present study, we chose two songs from this selection, specifically the song \u201cOne Fine Day\u201d  with a tempo of 187 beats per minute (bpm), which was used as the motivational music (the score of the Brunel Music Rating Inventory-2 was 28.8), and the song \u201cMadworld\u201d  with a tempo of 91 bpm, which was used as the non-motivational music (the score of the Brunel Music Rating Inventory-2 was 7.6). By using The sound levels of the musical tracks were adjusted to be audible as a musical background only. The sound levels of specific musical tracks were adjusted according to the assessment of the team of experimental assistants to have a low level of intensity and were constant during the experiment. The sounds were listened to through lightweight headphones (Genius HS-M200C) connected to a Nokia Lumia 520 phone, on which the musical tracks were recorded.Coherence, item 2 was related to the spatio-cognitive dimension Legibility, item 3 was related to the spatio-cognitive dimension Complexity, item 4 was related to the spatio-cognitive dimension Mystery, and item 5 was related to the spatio-cognitive dimension Openness. These items were selected from the study by Energy, item 7 was related to the emotional dimension Abandoned, item 8 was related to the emotional dimension Pleasant, and item 9 was related to the emotional dimension Interesting. Items 6\u20139 were selected from the more extensive questionnaire used in the study by A questionnaire that contained eleven items was used in the experiment . Item 1 The experiment was conducted in the city of Hradec Kr\u00e1lov\u00e9 in the Czech Republic. The city is located in the northeastern part of the Czech Republic and has approximately 100,000 residents. Six outdoor locations were selected . We chosThe initial location was situated in front of the university building. The site was used only for training participants in the evaluation of the environment and using the electronic questionnaire. The obtained data were not further processed. The first environment, where the data were processed, was chosen as an example of an ugly and unorganized urban environment. The second environment was represented by an urban environment with traffic. The third environment was a coherent natural environment with water. The fourth environment represented a coherent natural environment with a high level of spatial openness. The fifth environment was a coherent natural environment with a lower level of spatial openness. All environments were familiar to the participants because they were located close to the university buildings.Before the experiment, the participants signed informed consent and then were instructed. They were informed that their task was to take a route near the university along the Orlice River within a smaller group of people and to evaluate 6 selected sites by means of a questionnaire. They were also informed that they would either listen to music through headphones during the experiment or would take part in the experiment without listening to any music.A between-subjects design was used. Thirty-three participants were randomly assigned to the motivational music condition, twenty-eight participants were assigned to the non-motivational music condition, and thirty-three participants were assigned to the control condition. Because not all preliminarily registered participants came to the experiment , the sample sizes of both music conditions differed.The participants were asked to find the questionnaire on their smartphones (by using a QR code). The participants in the music conditions also received Nokia phones with recorded music and headphones. The research assistant turned on the music at the initial location. The participants listened to music without any interruption during the entire walk along the route and at the locations where they were asked to evaluate the environment. The participants moved along the route in groups of 2\u20136 people and were accompanied by a research assistant. The research assistant stopped the participants at the specific location, showed them the area to observe and asked them to make their records in the questionnaire on their smartphones. The walking distance between specific locations was approximately 2\u20133\u00a0min. To eliminate a possible order effect, the participants moved along the route from environment 1 to environment 5 or from environment 5 to environment 1. The study was conducted in 2019 on three weekdays: November 12, November 13, and November 14. It was cloudy, and the temperature was approximately 8\u00a0\u00b0C.Ethical approval for the experiments was obtained from the Committee for ResearchEthics at the University of Hradec Kr\u00e1lov\u00e9 (No. 8/2019). All participants signed a consent declaration in which they declared that they voluntarily participated in the experiment and that they were informed about the experimental procedure. They could decide to stop participating in the research study at any time without explanation. There were no known risks to the participants in this study.Statistica 12  was used to perform statistical analyses. First, the mean scores and standard deviations for all spatio-cognitive and emotional dimensions were calculated separately for the five evaluated environments .Given that the ANOVAs did not identify any significant effect of music on the evaluation of the environment, we examined whether the evaluation of an environment was mediated by the listener\u2019s level of liking of the music. The levels of liking of motivational music  and non-motivational music  were almost equal , and the difference was not significant  and music liking , while the effect of the musical condition was not significant . For the dependent variable Pleasant, the ANOVA revealed a significant effect of the environment  and music liking , while the effect of the musical condition was not significant .For both music conditions , we conducted a two-way mixed ANOVA in which the music condition and liking of music were predictors, the evaluated environment was the within-subjects repeated factor, and the mean scores of particular evaluated dimensions were the dependent variables. We found a significant effect of music liking for the dimension Interesting revealed a tendency for music liking to influence the evaluation of the environment, although p lies slightly above the conventionally considered threshold for statistical significance (p = 0.087). For the dependent variable, an ANOVA revealed a significant effect of the environment  and a nonsignificant effect of music liking , while the effect of the condition was not significant .The ANOVAs conducted for the further spatio-cognitive emotional dimensions did not show a significant effect of music liking.It is also worth noting that an ANOVA conducted for the dimension Mystery and Pleasantness. If people liked the music more, they evaluated the environments as more mysterious and more pleasant. There were no differences between the effects of both types of musicIt is worth remembering that musical stimuli used in this study were chosen to be liked by participants from our previous study . Clearlyt = 1.188, p = 0.26). For both music conditions , we conducted a two-way mixed ANOVA where music condition and disturbance by music were predictors, the evaluated environment was the within-subjects repeated factor, and the mean scores of particular evaluated dimensions were the dependent variables. We found a significant effect of disturbance by music on Coherence. The ANOVA revealed a significant effect of the environment  and a significant effect of disturbance by music , while the effect of the condition was not significant . Furthermore, we found an almost significant effect (p = 0.059) of disturbance by music for Mystery. The ANOVA revealed a significant effect of the environment  and a nonsignificant effect of disturbance by music , while the effect of the condition was not significant . The ANOVAs conducted for the further spatio-cognitive and emotional dimensions did not show significant effects of disturbance by music.Finally, we analyzed responses to the item \u201cThe music disturbed me when evaluating the environment\u201d. The scores  for motivational music  and non-motivational music  differed, but not significantly  or in various types of natural environments . Finally, in the discussion of our findings, we stressed the intensity of music as an important factor, but in this experiment, we did not manipulate this variable.The present study investigated the effects of audio-visual interactions on the perception of outdoor urban environments. In contrast with previous investigations , we did 10.7717/peerj.9770/supp-1Supplemental Information 1Click here for additional data file."}
{"text": "The mood and atmosphere of a service setting are essential factors in the way customers evaluate their shopping experience in a retail store environment. Scholars have shown that background music has a strong effect on consumer behavior. Retailers design novel environments in which appropriate music can elevate the shopping experience. While previous findings highlight the effects of background music on consumer behavior, the extent to which recognition of store atmosphere varies with genre of background music in sales spaces is unknown. We conducted an eye tracking experiment to evaluate the effect of background music on the perceived atmosphere of a service setting. We used a 2 (music genre: jazz song with slow tempo vs. dance song with fast tempo) \u00d7 1  within-subject design to test the effect of music genre on visual perception of a physical environment. Results show that the fixation values during the slow tempo music were at least two times higher than the fixation values during the fast tempo music and that the blink values during the fast tempo music were at least two times higher than the blink values during the slow tempo music. Notably, initial and maximum concentration differed by music type. Our findings also indicate that differences in scan paths and locations between the slow tempo music and the fast tempo music changed over time. However, average fixation values were not significantly different between the two music types. Music can have diverse effects on consumer behaviors, including emotion , purchasIn some cases, atmosphere can have a greater effect on a purchase decision than the product itself. Experimental studies about emotional response to store spaces emerged several decades ago. Using eye tracking to study visual attention, Scholars have shown that background music has a strong effect on consumer behavior . While pAn important goal for retail managers and marketers is to provide memorable and unique experiences for customers. Multisensory cues can help stores stand out from competitors and attract customers by delivering a pleasant shopping experience . Thus, rWhile vision is generally assumed to be the dominant sensory mode in retrieving external information , recent Numerous findings support the notion that auditory input during product interaction can strongly influence the perception and evaluation of products . CompareScholars have recognized the effects of using background music to influence consumer behavior in various settings and situations . FindingScholars have considered the influence of background music on consumers, including the presence or absence of music , liked oHowever, research on the effects of background music type  on consumer behavior is relatively sparse. Addressing other aspects of background music, scholars have found that quiet (vs. loud) airline cabin noise increased the intensity of sweet solutions and decreased the intensity of umami-flavored solutions . With revia eye fixations on a perceptual field. Outside that perceptual field, however, detailed information is likely to be missed. Moreover, people are normally unaware of the specific eye movements they make when performing a task. Eye movement is closely associated with covert attention. Covert attention plays a key role in information processing and decision making, not only by acting as a selection device but also by executing and maintaining central processing activity to ensure that decisions occur fast and accurately. Consequently, eye movements not only reflect selective attention but also the intensity and nature of the central cognitive processes in information perception, evaluation, and memory, providing real-time information about these ongoing processes that cannot be obtained otherwise. Thus, measuring where the eye is focused or how the eye is moving can help us understand how individuals view objects.People frequently do not choose between alternative courses of behavior; rather, they depend on cognitive abilities that are fairly well developed . Eye movement is one of the quickest and most frequent human actions, allowing people to gather numerous bits of information Data collection using eye tracking experiments does not depend on participant reports or memory. When questioned about their actions, participants might not remember their behavior. They might be unaware of what they did due to forgetting or lack of awareness. By examining data, visualizations, and replays, we can determine causes of behavior without relying on fallible human memory. Eye tracking analysis can lead to discoveries that would be considerably more difficult to uncover using other methods. Eye tracking shows how quickly and for how long customers notice features, key content, and brands and can reveal, through the accumulation of minute changes, where participants spent the most time looking.Scholars have shown that the human visual system is essential to information searching and decision making . BecauseTo test the hypotheses, we conducted a two-condition, randomized, within-subject experiment. The independent variable was music genre , and we measured visual attention using eye tracking technology.N = 109: jazz = 37; dance = 29; ballade = 23; old pop = 14; no music = 3; electronic = 2; new age = 1; and rock, world music, classic, and hip hop = 0). We used each genre with beat per minute (BPM) to create background music for the experiment (Music 1: jazz song with 88 BMP vs. Music 2: dance song with 137 BMP).We conducted a field survey to select the music genres for auditory stimuli. We visited eighty caf\u00e9s in Seoul, South Korea, and classified the kinds of music they played using 10 genres . We chose jazz (Music 1) and dance (Music 2) for our auditory stimuli because these two genres had the highest frequency scores , we collected quantitative data about eye movement and fixation using eye tracking equipment. First, for visual stimuli, we selected a cafe space that participants would recognize as a setting where they might make a purchase. We used a camera  to photograph this space and create images for the experiment. We configured the indoor space  so that the person placing an order at the counter and the person seated at a table to the side were at adult eye level. As a result, the image was a close approximation of a human field of view (FOV). We also used Adobe Photoshop CS6 to enhance image quality.We recruited 40 undergraduate students  enrolled at a private university in Seoul, Korea, in exchange for extra credit. We invited participants to the lab after confirming that they did not have any vision impairment that might limit their ability to see a computer screen . We prohibited mascara and color lenses during the experiment to maximize the quality of our eye tracking data. Upon arrival to the lab, participants signed informed consent forms approved by the Institutional Review Board (IRB) and then sat down at computer stations.The distance between the monitor and each participant was roughly 650\u2013700 mm to ensure accurate and consistent eye tracking calibration. Before the experiment, we ran a quick calibration program to prepare the eye tracking camera. On their computer screens, participants watched a white dot move to four different areas. We performed the calibration test up to two times and excluded participants who did not pass. Participants who did pass then read the following instructions on the screen: \u201cImagine you are visiting a coffee shop. Please look around the caf\u00e9 and think how the atmosphere of the space and the music feels.\u201d Because we used a within-subject study design, each participant looked at the image while listening to Music 1 and Music 2; however, the order in which they heard the two auditory stimuli was random. The first multi-sensory stimulation lasted 1 min. After a 1-min rest time, the second multi-sensory stimulation began. The experimental session lasted a total of 3 min and took place in a dark room so that the participants could focus on their task with maximum concentration.We measured the real-time eye movement of the participants. We used eye tracking equipment  to determine the impact of auditory stimuli on visual perception of the physical environment pictured in the image. We extracted raw fixation data using BeGaze 3.7 (SMI). We set the rate of recording and storage to 30 Hz .N = 40), we excluded six participants  who failed to exceed the criterion of 80% eye tracker accuracy and one participant (1) due to technical problems with raw data. Therefore, we analyzed the data from 33 participants. The mean effective rate was 90.9% (SD = \u00b14.13)  see . In the x-y coordinates.Using the eye tracking data, we extracted values for fixations, saccades, and blinks, the primary components of human eye movement. Fixations occur when the eyes stop scanning and hold in one place for a time while saccades are the rapid eye movements that occur between fixations, allowing the fovea to shift from one point of interest to another. When plotted in chronological order, fixations and saccades constitute a scan path. Fixation count refers to the number of fixations that occurred in an area of interest every 0.03 ms, indicating how long an individual spent looking at a particular part of the image on the screen . Frequency refers to how many times per second the eye tracker registered the position of the eyes . Blinking refers to the involuntary act of shutting and opening the eyelids. During each blink, the eyelid blocks the pupil and cornea from the illuminator, resulting in missing raw data points at particular Fixation and saccade frequencies did not differ significantly between Music 1 and Music 2. Fixation frequency for Music 1 (12.29) and Music 2 (12.22) was close. However, blink frequency for Music 2 (12.29) was twice the frequency for Music 1 (6.28). The fixation and saccade frequency and mean values were not significantly different between Music 1 and Music 2, but the blink frequency and mean values for Music 2 were two times those of Music 1 see . In addit-tests for fixation  and frequency  indicated no significant difference between Music 1 and Music 2. However, analysis of variance (s2) for fixation revealed that the standard deviation for Music 1  was more than two times Music 2 (s2 = 6294.78). Therefore, although the mean values were similar, fixation values differed across participants by music type (see Paired sample type see . Moreoven = 18) who showed more fixation during Music 1 was higher than the number of participants (n = 15) who showed more fixation during Music 2. In terms of fixation count, the number of participants (n = 17) with a higher index during Music 2 was higher than the number of participants (n = 14) with a higher index during Music 1. Two participants had the same fixation count during Music 1 and Music 2. The number of participants (n = 14) with higher average frequency for Music 1 was the same as the number of participants (n = 14) with higher average frequency for Music 2  and average maximum concentration  revealed no significant difference between Music 1 and Music 2.We defined the time at which the top 5% index value for high fixation started as initial concentration and the time at which the index value for high fixation peaked as maximum concentration. Results of paired \u03c32) and sample variance (s2) values among the participants, initial concentration during Music 1 was 1.5 times faster than during Music 2. Maximum concentration began at 36 s during Music 1 and 37 s during Music 2, and differences among the participants were not significant between Music 1 and Music 2. Although differences in average initial concentration were not large, differences in variance indicate different initial concentrations among the participants.On average, initial concentration began at 12 s during Music 1 and 15 s during Music 2. Based on population variance (n = 22) with earlier initial concentration during Music 2 was twice the number of participants (n = 11) during Music 1. The average initial concentration was between 10 and 15 s depending on music type, and the difference in average initial concentration between Music 1 and Music 2 was at least 5 s. Maximum concentration also differed between Music 1 and Music 2. The number of participants (n = 19) with an earlier maximum concentration during Music 1 was higher than the number of participants (n = 14) during Music 2. Maximum concentration differed among the participants (see The number of participants (ants see .n = 8) with initial concentration during Music 2 was higher than the number of participants (n = 7) during Music 1. In the second interval, the number of participants during Music 1 (n = 13) was more than three times the number of participants (n = 4) during Music 2. After 20 s, the number of participants who began concentrating during Music 2 was higher. We then analyzed maximum concentration frequency at 5-s intervals. We found no difference in the number of participants in the first two intervals. However, at 20 s, the number of participants (n = 4) during Music 1 was higher than the number of participants (n = 2) during Music 2. The difference between Music 1 (n = 7) and Music 2 (n = 1) was larger at 45 s , middle period (T2: 20 ~ 40 s), and late period (T3: 40 ~ 60 s) \u2013 and compared degrees of interest between Music 1 and Music 2. Analysis of grids during Music 1 revealed that exploration of the entire image was not intensive in T1 and that the primary area of interest was e-g\u2019 . The distribution of eye movement was primarily in the left half of the image. In T2, areas of exploration were more spread out to the left and right of the primary area of interest in T1. In T3, the area of interest shifted from e-g\u2019 to g-e\u2019 . Between 10  and 45 s , the area of interest shifted from human objects to purchasable objects.Analysis of grids during Music 2 revealed that initial concentration began in T1 and that frequency decreased thereafter see . As we fTraditionally, store managers have focused on interior store aesthetics for visual stimuli. To a lesser extent, they have started to pay attention to auditory stimuli. Previous findings have shown how cross-modal sensory stimuli can affect consumer behavior . RecentlIn the current study, we analyzed differences in visual exploration and fixation by music type. First, the average fixation values did not differ significantly between Music 1 and Music 2. One possible explanation is that because visual cues trigger our dominant sense, auditory cues might not exert a strong influence on eye movement. However, according to analysis of variance, the fixation values for participants during Music 1 were at least two times higher than during Music 2, and the blink values during Music 2 were at least two times higher than during Music 1. Comparing frequencies of eye movement between the raw data and the count values, we found that the areas across which eyes moved were larger during Music 2 , but that fixation frequency was higher during Music 1 . This analysis is meaningful because objects in scenes are generally coded for visual attention because they provide external information . ThroughSecond, initial and maximum concentration differed by music type. Regardless of music type, maximum concentration began after at least 40 s on average. Initial concentration was earlier during Music 1, and variance among participants was larger during Music 2. These findings suggest differences in the way the participants responded to music. The average maximum concentration was 36 s during Music 1 and 37 s during Music 2, and the earliest maximum concentration was 35 s. When we divided the time into 5-s intervals and examined frequency of initial concentration across the participants, we found that initial concentration began in the early period for both types of music. However, during Music 1, frequency of initial concentration was high at 10 s (39%) in T1. During Music 1, the highest frequency of maximum concentration was 45 s (21%), but a high frequency also emerged at 20 s (12%) in T1.Third, our findings indicate that differences in scan paths and locations between Music 1 and Music 2 changed over time. When we divided the viewing time into T1, T2, and T3, we found that eyes moved to the menu or products on the wall in T1. In T2, scan paths differed between music types. During Music 1, scan paths dispersed across the entire image so that eyes landed on both humans and products. During Music 2, scan paths dispersed across the entire image in T3, later than during Music 1. Synchronized stimuli, resulting in cross-modal effects , present different routes for perceiving objects in the scene. Auditory cues, enabling cross-modal sensation, further explain how individuals view objects. The results show how auditory cues might interact with visual cues. As sensory marketing research shifts attention from single sensory systems to cross-modal sensory systems, scholars need better insight into the way various sensory systems might interact with each other.In the current study, we analyzed differences in eye movement and fixation during multi-sensory stimulation . Although differences in average eye-movement values between music types were not large, the results are meaningful because we were able to extract the characteristics of visual perception and degree of interest in spaces using eye tracking. Our findings should guide practitioners of neuro-marketing to consider multi-sensory stimulation when designing spaces where consumers are likely to purchase products.The limitations of the current study open pathways to future research. First, we exclusively recruited college students. Scholars should consider using wider, more random sampling in order to increase generalizability. Second, we focused on two different genres of music: jazz music with slow tempo and dance music with fast tempo. Given the variety of existing genres, scholars should consider examining the potential impact of other types of background music. Third, we conducted this study conducted in a laboratory setting rather than investigating consumers in their normal shopping environments. For visual stimuli, we selected a cafe space that participants would recognize as a setting where they might make a purchase. Then we created images for the experiment. Participants in a real-setting experiment might have responded to the questionnaire differently. Follow-up field research could more fully reveal the effect of background music on the perceived atmosphere of a service setting. Finally, scholars should qualitatively examine how consumers move their eyes across a visual field and where they place their attention in the field of view.Sensory information  is typically stored in and retrievable from a sensory memory location. Sensory memory intensifies with the repetition of sensory information, serving as a buffer for external sensory stimuli. The perception of sensory attributes occurs when the process satisfies the condition. Attention then increases with the activation of a particular sensory modality . Nearly 70% of the sensory receptors in humans are allocated to vision, making it the most important element in the human sensory system. Thus, understanding how humans process visual sensory information and how it interacts with other sensory information is important. To investigate the effect of background music on visual perception of a physical environment, we conducted an eye tracking experiment in a service setting.Although we did not find any significant differences between the slow tempo and fast tempo conditions with regard to visual perception and interaction, the individual differences between groups by music type are meaningful. Results show that the blink values during the fast tempo music were at least two times higher than the blink values during the slow tempo music. Moreover, eye movement was more active when the background music tempo was relatively fast, indicating that external auditory information might have activated the visual cortex. We also investigated how differences in scan paths and locations between the slow tempo music and the fast tempo music changed over time. Our findings provide an empirical basis for examining changes in the way consumers respond to multi-sensory stimuli.Applying The datasets generated for this study are available on request to the corresponding author.The studies involving human participants were reviewed and approved by IRB Office, Soongsil University. The patients/participants provided their written informed consent to participate in this study.JK and JYK contributed to the conception and design of the study. JK organized the database and analyzed and interpreted the data under the supervision of JYK. All authors contributed to the writing and editing of the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Cholera epidemics continue to challenge disease control, particularly in fragile and conflict-affected states. Rapid detection and response to small cholera clusters is key for efficient control before an epidemic propagates. To understand the capacity for early response in fragile states, we investigated delays in outbreak detection, investigation, response, and laboratory confirmation, and we estimated epidemic sizes. We assessed predictors of delays, and annual changes in response time.We compiled a list of cholera outbreaks in fragile and conflict-affected states from 2008 to 2019. We searched for peer-reviewed articles and epidemiological reports. We evaluated delays from the dates of symptom onset of the primary case, and the earliest dates of outbreak detection, investigation, response, and confirmation. Information on how the outbreak was alerted was summarized. A branching process model was used to estimate epidemic size at each delay. Regression models were used to investigate the association between predictors and delays to response.p\u2009=\u20090.03). Outbreaks signaled by immediate alerts were associated with a reduction in delay to response of 39.3% .Seventy-six outbreaks from 34 countries were included. Median delays spanned 1\u20132\u2009weeks: from symptom onset of the primary case to presentation at the health facility , detection , investigation , response , and confirmation . In the model simulation, the median delay to response (10\u2009days) with 3 seed cases led to a median epidemic size of 12 cases  and 8% of outbreaks \u2265\u200920 cases (increasing to 32% with a 30-day delay to response). Increased outbreak size at detection (10 seed cases) and a 10-day median delay to response resulted in an epidemic size of 34 cases (upper range 67 cases) and <\u20091% of outbreaks <\u200920 cases. We estimated an annual global decrease in delay to response of 5.2% , in 8 to 99% of scenarios, a 10-day delay to response would result in large clusters that would be difficult to contain. Improving the delay to response involves rethinking the integration at local levels of event-based detection, rapid diagnostic testing for cluster validation, and integrated alert, investigation, and response. Cholera transmission was reported in 34 countries in 2018 and 55 countries in 2019 [In 2017, the Global Task Force on Cholera Control (GTFCC) recommended that countries increase their capacity to contain small outbreaks, using rapid response teams, to aid efforts to substantially reduce global transmission by 2030 . HoweverTo understand the potential for early detection and rapid response for cholera outbreaks in fragile and conflict-affected states, we examined temporal trends in cholera epidemics to evaluate with what delays the first case or cluster presented, was detected, investigated, responded to, and was confirmed by laboratory culture. We modeled epidemic sizes corresponding to these delays. To explain these delays, we investigated the mechanisms for early warning of these outbreaks, predictors of delays, and global improvements in reducing delays.The period of 2008 to 2019 was chosen to reflect recent experience with cholera response. A list of countries that appeared \u2265\u20092 times during this period on the World Bank\u2019s Harmonized List of Fragile Situations, and had a documented cholera burden as per the GTFCC\u2019s 2017 list of cholera-affected countries, was compiled  using a date-specific keyword search  and (2) regional outbreak bulletins and journals including the\u00a0WHO EMRO Weekly Epidemiological Monitor (2008 to 2019), WHO AFRO Outbreaks and Emergencies Bulletin (2017\u20139), WHO SEARO Journal of Public Health, WHO WPRO Western Pacific Surveillance and Response Journal, and UNICEF Cholera Outbreaks in Central and West Africa Bulletin (2015 to 2019) [We searched the peer-reviewed literature for further identification and reporting on cholera outbreaks. Peer-reviewed articles were sourced from PubMed/MEDLINE using a date-specific keyword search (\u201ccountry AND cholera\u201d). Given that only a small number of outbreaks are reported in the scientific literature, we searched the gray literature, including epidemiological summaries, national cholera preparedness and response plans, and non-peer-reviewed studies. The sources included the following: (1) Reliefweb to 2019) , 20\u201323.\u00a019 , 20\u20132to 2019) . When lito 2019) .formal alert detected by health workers reported immediately within the surveillance system, (2) informal alert from community members or a non-governmental organization (NGO) reported immediately, or (3) weekly data analysis of surveillance trends.Outbreaks were included if at least two of the following dates were available: 1) dates of symptom onset of the primary case, and/or case presentation, and/or outbreak detection, and (2) dates of investigation and/or response. If the date of symptom onset for the primary case was missing, it was estimated as 5\u2009days before the date of case presentation , or date of outbreak detection if date of case presentation was unavailable. If the date of case presentation was unavailable, it was replaced by the date of outbreak detection. The earliest dates of (1) symptom onset for the first identified primary case, (2) case presentation to a health facility, (3) detection of outbreak/alert raised, (4) investigation by local health authorities, (5) response, and (6) laboratory confirmation by culture were extracted  were calculated by subtracting the date of symptom onset of the primary case from the dates of (1) case presentation, (2) outbreak detection, (3) investigation, (4) earliest response, and (5) laboratory confirmation. For each outbreak, the dates were graphed on a timeline.To investigate the association between the observed delay from symptom onset of the primary case to response and potential predictor variables, a multivariate ordinary least-squares regression model was used. Delay to response was log-transformed to produce a normalized distribution. Extreme values in delay to response were judged to represent meaningful delays rather than data errors and were retained in the dataset. Predictor variables included signal type, context, crisis, WHO region, and year of outbreak onset (to detect any secular trend). Akaike information criterion (AIC) and a step-wise selection process was used to assess model fit and complexity. In separate regressions, year of outbreak onset was used as a predictor variable to investigate secular trends for delays to case presentation, outbreak detection, investigation, and confirmation. Loess curves were used to visualize the temporal trends using a smoothed trend line that down-weighted extreme values . PercentZ\u2009~\u2009NegB with a mean equivalent to the reproduction number  [S\u2009~\u2009gamma with a median of 5\u2009days [A preliminary review of retrieved reports demonstrated that the early epidemic sizes at the dates that the outbreak was detected and responded to were rarely documented. Instead, to estimate the potential early epidemic sizes at each delay, a branching process model was used to estimate the median and range of epidemic sizes at the time points indicated by the median delays to case presentation, investigation, response, and confirmation \u201329. We s . Each nef 5\u2009days , 32. We All analyses were carried out in R statistical software version 4.0.3 .Seventy-six outbreaks from 34 countries met the inclusion criteria. Overall, 1970 documents were reviewed, and 138 documents were retained . Table\u00a0p\u2009=\u20090.03), was found  , and a bivariate model for signal type only . Using AIC for the multivariable model, including only year of outbreak onset returned the lowest AIC score  were through alerts by a health worker or community health worker and 9/46 (19.6%) through informal alerts by community members. For example, in 2015, in Aleppo, Syria, an alert was issued through the EWARN via phone after RDT testing of a suspect, and an investigation initiated based on the positive result . In 2017, in a displacement camp in Northern Nigeria, an alert of a suspect case was issued by MSF by phone through the EWARS on the same day of case presentation , demonstrating the rapid recognition of a suspect case by health workers . CompariIn several instances, early warning systems further benefited from rapid investigation and response. For example, in Afghanistan, in 2010, the DEWS provided a response mechanism to link the detection of a large cluster of 60 suspect cases in a remote and insecure village by a local NGO with rapid action which reportedly led to containment within a month . In 2011, the DEWS in Afghanistan detected an already-large outbreak of 255 suspect cases in multiple clusters but with a rapidly administered response . Reduced transmission within 3\u2009months followed. In Liberia in 2017, a suspect case that died en route to the health facility was detected based on symptoms, triggering a rapid response to isolate additional cases in the index case\u2019s village . In Chad in 2017, two suspect cases among children which resulted in rapid progression to death were reported to the local health facility, who investigated the source village and found a larger cluster of 50 cases and 13 deaths . Though already a large outbreak, this led to a response on the following day.Information in reports suggested improvements in surveillance, investigation, and response over time. In Cameroon in 2016, two false alerts for cholera later attributed to food poisoning and rotavirus were made by health workers and community members respectively and led to rapid investigation upon detection, testing by RDT and culture, and ongoing control activities during the investigation period . In Somalia, faster response in insecure urban areas using EWARS in 2016 and 2018 can be compared to a lack of a comprehensive early response during ongoing transmission over 2\u2009months in 2008 . Nepal\u2019s EWARS facilitated rapid detection and response to clusters from 2011 onwards  , 162. InLong delays from symptom onset of the primary case to response (~\u20092\u2009weeks) were observed in 29/67 (43.2%) outbreaks for which a response date was available. These appeared to be related to poor sensitivity of the formal surveillance system due to the remote locations of outbreaks  , Ethiopia (2015 onwards), and Zambia (2017\u20138) have suffered from late detection and/or response, which has led to surges of cases that have overwhelmed health systems , 174\u2013176Our findings indicate that from 2008 to 2019, median delays from symptom onset of the primary case to case presentation at the health facility and to response were approximately 5\u2009days and 10\u2009days, respectively. Longer delays to response were documented across the whole time period. Evaluations from Nigeria, Yemen, and other settings have shown that reasons for delays to detection include poor population access to health services due to disrupted health systems and/or insecurity, difficulty in discerning diarrhea and dehydration due to cholera from other causes without rapid diagnostics, reliance on laboratory confirmation before initiating response, and less effective local response , 178. EpEnding Cholera roadmap. There are two reasons to believe that policy and practice have somewhat narrowed the gap between detection and response. First, we found a global improvement in time to response that corroborates a previous analysis of improvements for detection of all-pathogen outbreaks in low- and middle-income countries from 1996 to 2014 [Early detection and response are major aims of the  to 2014 . This ma to 2014 . Some co to 2014 \u2013181.Detailed case studies of cholera outbreaks provide practical observations on the mechanisms of surveillance, diagnosis, and response which can reduce delays. Early detection with high-quality epidemiological data has been augmented with the use of sentinel site surveillance at hospitals equipped with RDTs and trained and vigilant health workers in Kathmandu, Nepal ; communiVibrio cholerae that causes a range of disease severity, transmission chains may be missed. Fifty-one (67%) of the 76 outbreaks were missing the date of onset of symptoms for the primary case, which then had to be estimated, limiting accuracy. The dates of response were based on the judgment of the timing of the first transmission-reducing intervention and thus may represent variable intensity of response across outbreaks. Of note, the longest delays to response noted during outbreaks in Chad, Ethiopia, Somalia, and Uganda were related to the first viable response after an inadequate local response. To address these inconsistences, we sourced multiple reports per outbreak to triangulate the information and obtain a clear timeline, and excluded a large number of outbreaks where reports lacked detailed dates. Second, we note that while outbreaks are likely to occur during conflict, they are difficult to detect amidst violence where surveillance coverage is poor [Rt value.It is important to consider the limitations inherent to a retrospective review of data from secondary sources. First, as no global registry of cholera outbreaks exists, we relied on the manual compilation of available situation reports and articles. The most comprehensive source, the WHO\u2019s current compilation of annual cholera data, does not provide detailed information on outbreaks and misses non-reporting countries. The small annual numbers of outbreaks pre-2015 documented here\u00a0may reflect the few global data sources available. As well, larger outbreaks are more likely to be detected, responded to, and therefore documented and included here. Second, the delays are estimates of reality; dates from situation reports are likely inaccurate to an unquantifiable degree as the exact dates of local investigation and response may be subjective and are\u00a0documented infrequently. The identification of the primary case(s) depends on the depth of the field investigation, and with a multi-pathway pathogen like  is poor . These o is poor , 131. ThThe documentation of the occurrence and features of cholera outbreaks is currently very heterogeneous. A real-time global database\u00a0using standard outbreak event reports maintained by WHO regional offices to prospectively log data and metrics from outbreaks of cholera, as well as other epidemic-prone diseases, would yield superior accuracy for the\u00a0annual evaluation of timeliness. WHO AFRO\u2019s Weekly Bulletin on Outbreaks and Emergencies provides an existing template which can feed into such a global database . WHO AFRCholera epidemics will continue to appear unpredictably and cause serious morbidity and mortality in countries affected by armed conflict and fragility. Cholera surveillance and response is dependent on rethinking the timely detection, investigation, and response to primary cases at the local level. This includes reinforcing outbreak detection through event-based surveillance, consistent weekly reporting using standard case definitions, systematic use of enriched RDTs, and integrating early investigation with preliminary local response. These measures should increasingly underpin the detection and containment of emerging epidemics.Additional file 1. Countries investigated.Additional file 2. Compilation of outbreaks by country, date of onset, delays , signal, source, and description of investigation and response.Additional file 3. Histograms of delays from symptom onset to (A) case presentation, (B) outbreak detection, (C) investigation, (D) response, and (E) confirmation.Additional file 4. Overview of alternative models for the main analyses.Additional file 5. Model parameters for additional delay analyses."}
{"text": "The viscoelastic behavior and reinforcement mechanism of polyethylene glycol (PEG) as an interfacial modifier in green tire tread composites were investigated in this study. The results show a clear positive effect on overall performance, and it significantly improved all the parameters of the \u201cmagic triangle\u201d properties, the abrasion resistance, wet grip and ice traction, as well as the tire rolling resistance, simultaneously. For the preparation of the compounds, two mixing steps were used, as PEG 4000 was added on the second stage in order to avoid the competing reaction between silica/PEG and silanization. Fourier transform infrared spectroscopy (FTIR) confirmed that PEG could cover the silanol groups on the silica surface, resulting in the shortening of cure times and facilitating an increase of productivity. At low content of PEG, the strength was enhanced by the improvement of silica dispersion and the slippage of PEG chains, which are chemically and physically adsorbed on silica surface, but the use of excess PEG uncombined with silica in the compound, i.e., 5 phr, increases the possibility to shield the disulfide bonds of bis(3-(triethoxysilyl)-propyl) tetrasulfide (TESPT), and, thus, the properties were deteriorated. A constrained polymer model was proposed to explain the constrained chains of PEG in the silica-loaded composites on the basis of these results. An optimum PEG content is necessary for moderately strong matrix\u2013filler interaction and, hence, for the enhancement in the mechanical properties. Today, silica-based green tire treads have a great importance, as they are superior to carbon black-loaded tire treads regarding the \u201cmagic triangle\u201d properties: rolling resistance, wet skid performance and abrasion resistance ,2,3. TheThe surface of precipitated silica is covered with a polar and hydrophilic layer of acidic silanol groups. The dispersion of silica in nonpolar rubbers such as styrene\u2013butadiene copolymers (SBR), polybutadiene (BR), etc., is significantly more difficult to achieve than for carbon black . As a coIn our previous research, the immersion of silica-loaded vulcanizates in deionized water results in the permeation of water into the vulcanizates. The absorbed water has a huge effect on the dynamic mechanical properties of silica-loaded green tire tread vulcanizates. A new tan \u03b4 peak around \u22125\u20130 \u00b0C was formed after swelling in water, and the height of this peak increased with the amount of absorbed water. The interaction between silanol groups and water molecules occurs by hydrogen bonds , resultiTherefore, the present study emphasizes the use of a kind of interfacial modifier instead of water molecules, which can physically adsorb or/and chemisorb on the silica surface and will not show the reversibility in the vulcanizates. The selected interfacial modifier should have a phase transition temperature, which is a main factor to influence the dynamic mechanical performance and other physical properties in polymer science, closed to the phase transition temperature of water (or to the best in the range of \u221230 \u00b0C to 0 \u00b0C), because the higher tan \u03b4 at \u221220 \u00b0C and 0 \u00b0C are indicators for the better performances of ice traction and wet grip. The interfacial modifiers, such as polyethylene glycol, cetyltrimethylammonium bromide, polyoxyethylene sorbitan, ionic liquids and different amines are commonly used in silica modification ,24,25,26\u00ae VN3) with a specific surface area (CTAB) of 160 m2/g from Evonik Degussa (China) Co., Ltd. . The silane coupling agent, bis(3-(triethoxysilyl)-propyl)disulfide (TESPD), was obtained from Evonik Degussa (China) Co., Ltd. . The antioxidant Vulkanox\u00ae 4020NA and the ozone wax Antilux\u00ae 500 were supplied by Lanxess (China) Co., Ltd.  and Rhein Chemie (Qingdao) Co., Ltd. . Two kinds of PEG (molecular weight: 400 and 4000 g/mol) were obtained from Xiya Reagent (Shandong) Co. Ltd. . All of the ingredients were industrial grades and used as received.A solution-polymerized styrene butadiene rubber (S-SBR) grade RC2557-S and a solution high-cis polybutadiene polymer (BR) grade BR9000, both from Sinopec Beijing Yanshan Petrochemical Co., Ltd. , were used for the preparation of the compounds. The S-SBR has a vinyl content of 53 wt.% and a styrene content of 23 wt.% and is extended with aromatic oil (24.3 wt.%). The filler used was precipitated silica (UltrasilThe reaction model was established in the solution state. We added 1 g silica and 125 mL deionized water to each flask. The TESPD solution with a known concentration (80 ppm) was obtained by diluting appropriate standard stock solutions with methanol. We pipetted 1 mL of the standard solution containing 0.08 mg TESPD into each flask. All silica slurries were heated to a temperature of 80 \u00b0C under high-speed stirring for 1 h. Then, different content of PEG 400, with a concentration of 62.5 ppm, was added into the flasks, respectively, according to the formulation as shown in \u22121. All of the curves have been normalized.Attenuated total reflectance-Fourier transform infrared (ATR\u2013FTIR) spectra were measured by a VERTEX-70 FTIR spectrometer  equipped with a horizontal 45\u00b0 germanium (Ge) crystal ATR device at room temperature. The spectra were the results of 30 scans in the spectral range of 4000~550 cmTGA were done by TG209F1  at a heating rate of 10 \u00b0C/min from 30 to 800 \u00b0C in nitrogen atmosphere.Mooney viscosity, ML (1 + 4) 100 \u00b0C, was performed with an Alpha Technologies MV 2000E , according to Deutsche Industrie Norm (DIN) 53523.3.Payne effect of the composites was characterized on a dynamic mechanical analyzer  in the stain mode. The strain sweeps were measured from 0.45 to 13.0% at a constant frequency of 1 Hz and temperature of 25 \u00b0C. The sample dimension was 6 \u00d7 6 \u00d7 2 mmStress/strain tests were performed at ambient temperature with a Zwick tensile tester  at a crosshead speed of 500 mm/min using optical strain control (DIN 53504). For tear strength, the vulcanizates were tested at room temperature using angle-shaped rubber specimens with the same machine and speed as applied for tensile tests, according to DIN 53507. The measurements were done 5 times, and mean values were used.For the measurements of rebound, the specimens with cylindrical shapes were used  at 23 \u00b0C, according to DIN 53512, with the Zwick rebound tester 5109.01.The compression set was done at 23 \u00b0C and 70 \u00b0C for 48 h, according to DIN 53517. Five specimens were tested for each formulation, and midvalues were used.DIN abrasion was measured with Abrasion tester of Frank 11565, according to DIN 53516. The specimen was cylindrical shapes with a diameter of 16 \u00b1 2 mm and a minimum thickness of 6 mm. The abrading distance on the surface of the specimens and the speed were 40 m and 40 rpm, respectively.3.Dynamic mechanical analysis was characterized on a dynamic mechanical analyzer  in the tension mode. The temperature sweeps were measured from \u221280 to 100 \u00b0C at a constant frequency of 10 Hz, strain amplitude of 0.5% and a heating rate of 3 \u00b0C/min. The sample dimension was 6 \u00d7 4 \u00d7 2 mmv is the crosslink density, By means of equilibrium swelling the crosslink density of the vulcanizates and the polymer\u2013filler interaction was determined. The samples were immersed in toluene in closed bottles at ambient temperature on a shaker. Three aliquots of each sample were taken out periodically and removed of the excess liquid on the specimen surface by a filter paper and then weighed immediately with an electronic balance. The weight of the swollen samples was continued until reached the equilibrium. The crosslink density was determined by means of Flory\u2013Rehner equation :v=\u2212ln1\u2212VThe values of the Flory\u2013Huggins interaction parameter \u03c7 for cured rubber with different solvents can be found in the chemistry handbooks. For toluene \u03c7 = 0.37 was used in the calculations.A JEM-2100F scanning electron microscope  was used to characterize the fracture surface of the vulcanizates after tensile testing. The specimens were examined after sputter coating with a thin film of gold. An accelerating voltage of 1.0 KV and a magnification range from 500\u00d7 to 1000\u00d7 were used.\u22121 is due to \u2013OH bond stretching vibrations, and the whole band structure changes in a non-monotonous way. In the spectra, the absorption at around 3650 cm\u22121 indicated the uncombined \u2013OH in the system; for example, the residual of free water in the mix remains almost constant intensity. However, the intensity at 3350 cm\u22121 is result from the number of the associated hydroxyls, including the silanol hydroxyls and the chemically combined water absorbed on the silica surface. Although the residual water is one of the factors influencing the intensity of these peaks, a slight increase of the water content can be found from the weight loss from 30 to 110 \u00b0C of TGA results . The values of the scorch time (t10) and the optimum curing time (t90) can be used to evaluate the vulcanization rate. As illustrated in The addition of PEG into the silane-modified silica composites also affected the Mooney viscosity , which iBased on the results of the cure characteristics, the possible reaction mechanisms of TESPD and PEG on silica surface after vulcanization are shown in In order to characterize filler aggregation in the composites, DMA strain sweeps were performed at 25 \u00b0C, and the dependency of storage moduli (G\u2019) on the strain amplitude was determined by the difference between G\u2019 at low and high strains (Payne effect). A larger difference, i.e., higher Payne effect, means a higher degree of filler\u2013filler interactions, as well as a poorer filler dispersion. The results in The effect of PEG on the dispersion of silica was studied by SEM on the fracture surfaces of tensile testing, which were taken from PEG0 and PEG4. The respective micrographs are given in two magnifications . Figure To determine the effect of the filler\u2013rubber interaction due to silica, silane and PEG on the crosslink density in the vulcanizate structure, the rubber contents were each divided into the silica contents to calculate the values per 1 phr of filler contributing to the crosslink density. As can be seen in The static mechanical behavior of the composites was analyzed with a tensile tester. When compared to the PEG 0, there were only small changes in the tensile strength with the increase of the PEG content, as displayed in The use of PEG further shows a slight improvement in tear strength and DIN abrasion properties, compared to the PEG-free system, as shown in The rebound resilience is used to characterize the energy recovery capability of rubber composite after elastic deformation, mostly caused by compressive stress. Generally, the rubber resilience is related to the flexibility of polymer chain, intermolecular force, crosslink density, filler dispersion and softener effect. As shown in The compression set of vulcanizates is one of the important properties to evaluate the static permanent deformation of rubber products. It is mainly dependent on the recovery ability of the polymer chains. g).The response of viscoelastic performances to cyclic or sinusoidal deformations can be investigated by DMA\u2013temperature sweeps. The storage modulus (E\u2019) corresponds to the elastic deformation of rubber, and the loss modulus (E\u2019\u2019) corresponds to the viscous deformation. The mechanical loss factor is expressed as In The dependencies of tan \u03b4 on temperature are given in To evaluate the possibility of practical application of PEG in green tire tread, the effects of PEG on the magic triangle properties were compared with the typical tread formulation. When 3 phr of PEG was introduced into the silica/silane composite (PEG 3), all the three magic triangle properties, including rolling resistance and abrasion resistance, improved 39% and 24%, respectively, compared with the composite without PEG (PEG 0). The addition of 4 phr PEG in the compound did reduce the rolling resistance by 29% and increase the wet grip by 13%, respectively, suggesting that the excellent fuel consumption and driving safety are affected. As observed also for other properties earlier, the use of PEG, for example 3\u20134 phr, as an interfacial modifier in the silane-modified silica composites showed optimum properties, which indicates the best balance of both physical and chemical interactions and provides a solution for solving \u201cmagic triangle\u201d in the green tires for passenger cars.The addition of a small amount of PEG 4000 as an interfacial modifier on the second mixing stage in silane-modified silica composites improved the properties of Mooney viscosity; cure rate index; tensile strength; tensile modulus at 300% elongation; tear strength; DIN abrasion resistance; compression set at both 23 and 70 \u00b0C, due to an increase in the crosslink density; and silica dispersion. The dynamic mechanical properties, including rolling resistance, wet skid performance, ice traction and heat buildup were also improved, simultaneously. Summarizing from the perspective of tire performance, at optimum PEG content of 3\u20134 phr, the \u201cmagic triangle\u201d properties were improved simultaneously, compared to the silica/silane composites. PEG can shield the silanol groups on the silica surface, leading to shortened vulcanization time, which enables an increase in productivity and energy saving. However, the excess PEG acted as lubricant and increased the possibility to shield the disulfide bonds of TESPD and resulted in the reduction of crosslink density and physical mechanical properties. An optimum PEG content is necessary for the overall performance and polymer\u2013filler interaction. The results also demonstrated that the interfacial modifier, applied in green tire technology, physiosorbed/chemisorbed on the silica surface would improve of the performance, especially for the dynamic mechanical properties of tire tread. This finding will improve our understanding of the \u201cmagic triangle\u201d performance of silica-loaded tire tread vulcanizates in the future."}
{"text": "Moreover, in vitro TRPV2 over-expression in Ishikawa cell line increased migratory ability and response to cisplatin. CBD reduced cell viability, activating predominantly apoptosis in type I cells and autophagy in mixed type EC cells. The CBD improved chemotherapeutic drugs cytotoxic effects, enhanced by TRPV2 over-expression. Hence, TRPV2 could be considered as a marker for optimizing the therapy and CBD might be a useful therapeutic option as adjuvant therapy.Several studies support, both in vitro and in vivo, the anti-cancer effects of cannabidiol (CBD), a transient receptor potential vanilloid 2 (TRPV2) ligand. TRPV2, often dysregulated in tumors, is associated with altered cell proliferation and aggressiveness. Endometrial cancer (EC) is historically divided in type I endometrioid EC and type II non-endometrioid EC, associated with poor prognosis. Treatment options with chemotherapy and combinations with radiation showed only limited efficacy. Since no data are reported concerning TRPV2 expression as well as CBD potential effects in EC, the aim of this study was to evaluate the expression of TRPV2 in biopsies and cell lines as well as the effects of CBD in in vitro models. Overall survival (OS), progression-free survival (PFS), cell viability, migration, and chemo-resistance have been evaluated. Results show that TRPV2 expression increased with the malignancy of the cancer tissue and correlated with shorter PFS ( Medical Cannabis (MC) and pure phyto-cannabinoids  have been largely studied for their ability to ameliorate some of the most common and debilitating symptoms in cancer patients, like nausea, vomiting and pain ,2.In addition to these effects, MC and THC/CBD have attracted attention as potential anti-tumoral drugs, mainly as adjuvant for current therapies in different type of cancers . The maiIt can exert its biological activities via dependent (D)- and independent (ID)-receptors mechanisms (RMs). D-RMs mainly include weak antagonistic effects on cannabinoid receptor type-1 and -2  , agonistRegarding TRPV2, its expression and activation by CBD have been associated with deregulation of proliferation, cell differentiation and invasiveness in different cancer cell lines and animal models . BrieflyEndometrial cancer (EC) is the most commonly diagnosed gynecological malignancy in developed countries. ECs are divided into two subtypes, type I endometrioid EC and type II non-endometrioid EC. Type I is well differentiated and is frequently associated with a hyper estrogenic environment. Type II carcinomas develop from atrophic endometrium and are classified in different histological subgroups . These subtypes are poorly differentiated and associated with dismal prognosis ,37. TreaSince no data have been reported about TRPV2 expression in EC and there is a relative lack of robust diagnostic/prognostic biomarkers especially for EC type II, we firstly analyzed TRPV2 in human type II EC biopsies, and then, by in vitro investigations, we analyzed the TRPV2-dependent effects on cell migration and chemo-sensitivity. In addition, we evaluated the anticancer effects of CBD on EC cell lines.CB receptors and TRPV1/2 gene expression in 506 EC data samples from TCGA, queried with cBioportal . Samples were divided in type I endometrioid (397 samples) and type II serous type (109 samples).We assessed CB1 receptor was highly expressed (p < 0.001), CB2 was not expressed in both types. TRPV1 and TRPV2 were expressed in EC samples of both types. TRPV1 was more expressed in serous subtype (p < 0.05) while TRPV2 was more expressed in endometrioid subtype (p < 0.05)  .According to evidences in patients and since no data were available about TRPV2 and EC, we focused the attention on this channel.TRPV2 mRNA, although PCEM004a and b display a higher amount compared to the others  while the lowest staining was found in clear cell type (71.43%). Regarding peritumoral and normal tissues, TRPV2 was predominantly moderate or low. Samples were classified according to FIGO staging system and we found that TRPV2 expression increases with increasing of tissue malignancy. No significant difference in TRPV2 expression was detected in patients \u226468 or >68 years, according to the median age. Furthermore, Kaplan\u2013Meier analysis was performed, calculating overall survival (OS) and progression-free survival (PFS).high 37 months vs. TRPV2moderate 53 months, p = 0.9346, HR = 1.039, 95% CI = 0.4131 to 2.615, TRPV2high 37 months vs. TRPV2low 43 months, p = 1.326, HR = 1.039, 95% CI = 0.5579 to 3.149, TRPV2moderate 53 months vs. TRPV2low 43 months, p = 1.326, HR = 1.199, 95% CI = 0.5665 to 2.537). High TRPV2 expression correlated with a shorter PFS   .p > 0.05, HR = 0.6764, 95% CI = 0.3391 to 1.349) or PFS  . Stroma subgroup was excluded because there were too few patients for statistical analysis. Intra-tumoral TRPV2 distribution did not influence OS outcome (o 2.051) .Taken together, our data showed that TRPV2 expression correlates with malignancy in non-endometrioid EC and supported the investigation of CBD biological effects in EC.+ cells) and TRPV2 expression was subsequently confirmed by Western blot analysis   B.Additionally, since Protein kinase B (PKB), also known as Akt, pathway is involved in supporting several pro-tumoral processes, to assess the potential role of TRPV2 in regulating cancer cell migration, modulation of AKT/PKB pathway was evaluated through Western blot analysis.+ cells (p < 0.001) supporting the hypothesis that TRPV2 expression increases cancer aggressiveness , and PAC (from 0.00025 \u00b5g/mL to 4 \u00b5g/mL) for 72 h. Results showed that TRPV2 expression increased chemo-sensitivity in Ishikawa cells for CIS (p < 0.05), while it did not particularly modulate the effect of DOX and PAC  and percentage of cell viability was evaluated by a cell viability MTT assay . The res50 in daily administration, up to 72 h. Then, fluorescence was analyzed by flow cytometry. The results evidenced that CBD treatment increased the percentage of Annexin V+ or Annexin V+/PI+ cells in MFE-280, HEC-1a and in primary PCEM002 cell lines, indicating apoptotic cell death, but only PI+ cells were detected in Ishikawa cell line, indicating a necrotic cell death  and Propidium Iodide (PI) staining. Each cell line was treated with an appropriate dose of CBD according to the ICll death . In PCEMIn order to investigate the reduction in cell viability in mixed type I/II PCEM004a and PCEM004b, the role of CBD treatment in regulating cell cycle was evaluated. The results showed that CBD was able to induce cell accumulation in the G1 phase . These dSince it has been demonstrated that CBD is able to induce autophagy in cancer , we inveTo confirm autophagy activation, we used acridine orange dye, which accumulates in acidic vesicular organelles, considered as an indicative marker of autophagy. These organelles emit bright red fluorescence, the intensity of which is proportional to the degree of the acidity and the volume of these structures, thus we assessed this fluorescence at the microscope. As depicted in p < 0.05)  .p < 0.001)  .The effect of CBD combined with chemotherapeutic drugs was evaluated in TRPV2-transfected Ishikawa cells, compared with untransfected cells. Both models were exposed to CBD at 3.92 \u00b5g/mL, in combination with two non-cytotoxic doses of each chemotherapeutic drug: CIS 0.25 and 0.5 \u00b5g/mL, DOX 0.015 and 0.03 \u00b5g/mL, PAC 0.0015 and 0.003 \u00b5g/mL for 72 h. Chemotherapeutic drugs were administered once, while CBD was administered daily. The combined treatment induced an increased level of cytotoxicity, as compared with either CBD or all chemotherapeutic drugs alone, in both models . AdditioThe non-endometrioid type II EC is responsible for most EC-related deaths because it is characterized by an aggressive behavior and high resistance to the common therapies. Furthermore, there are no targeted therapies approved so far for this subtype, and it is still treated in the same way as endometrioid type I EC, which is generally characterized by good prognosis and good response to therapy ,43. The + EC cells have a high migratory ability, and its expression induces an increase of pAKT/AKT ratio, supporting the activation of PI3K pathway in TRPV2+ cells that leads to high migratory ability and survival. These data could support the evidence that high expression of TRPV2 in patients correlates with shorter PFS.Herein we show that TRPV2 expression augmented with the increasing of a non-endometrioid component and its expression in human EC samples of type II and mixed type was associated with a reduced PFS. Additionally, its expression increases with malignancy, according to FIGO stage. Previously, it has been demonstrated that TRPV2 expression correlates with worse OS and PFS for triple negative breast cancer , esophag+ EC cells with CIS, DOX or PAC, the presence of TRPV2 expression increased CIS cytotoxic effect, suggesting that TRPV2 can influence chemo-sensitivity to this drug. Compared with GBM cells, Ishikawa cells are more sensitive to DOX (~50-fold), and its increase in uptake and cytotoxicity TRPV2-dependent, as previously described in GBM -2,5 diphenyl tetrazolium bromide (MTT)  to the media. The absorbance of samples, solubilized in dimethyl sulfoxide (DMSO), against a background control  was measured at 570 nm using a reader microliter plate .Cell lines .Cell death was evaluated using Annexin V-FITC Apoptosis detection Kit  followed by biparametric FACS analysis. Cells, at a density of 3 \u00d7 104 cells/mL, were treated with CBD for up to 48 h, in daily administration. Cells were fixed by adding ice-cold 70% ethanol for 1 h and then washed with staining buffer . Next, 100 \u00b5g/mL ribonuclease A solution  was added for 30 min at 37 \u00b0C, stained with 20 \u00b5g/mL propidium iodide (PI)  for 30 min at room temperature and finally analyzed by flow cytometry using linear amplification.Cells, at a density of 3 \u00d7 104 cells/mL, were seeded in 12-well plates and were treated with CBD at 3.92 and 7.85 \u00b5g/mL for 48 h. Then, cells were stained with medium containing 1 \u03bcg/mL AO for 15 min at 37 \u00b0C, washed twice in PBS and immediately examined with Nikon Eclipse E800 fluorescence microscope and NIS-Elements 4.0 software . Cytoplasm and nuclei of AO-stained cells fluoresced bright green, whereas the acidic autophagic vacuoles fluoresced bright red.To detect the development of acidic vesicular organelles, which are the hallmarks of autophagy, the vital staining of PCEM004 cells with acridine orange  was performed. The cells, at density 3 \u00d7 10p < 0.05. Patients were divided in three groups according to high, moderate or low expression of the target protein. The Kaplan\u2013Meier (KM) method was used for Overall Survival and Progression-Free Survival analysis. For Univariate analysis of significance , long-rank test was used. * p < 0.05 was considered as statistically significant. Statistical analysis of IC50 levels was performed using Prism 5.0a .The data presented represent the mean with standard deviation (SD) of at least 3 independent experiments. The statistical significance was determined by Student\u2019s t-test and by One Way-Anova and Two Way-Anova with Bonferroni\u2019s post-test; * In conclusion, TRPV2 could be considered as a new potential marker for type II EC, especially serous subtype and high-grade tumors. In addition, its expression increased EC aggressiveness, enhancing migratory capacity through AKT/mTOR activation. CBD, a TRPV2 ligand, might be a potentially useful therapeutic option as adjuvant therapy to increase the efficacy of chemotherapeutic drugs to reduce cancer cell spreading."}
{"text": "The anterolateral ligament (ALL) is subject of the current debate concerning rotational stability in case of anterior cruciate ligament (ACL) injuries. Today, reliable anatomical and biomechanical evidence for its existence and course is available. Some radiologic studies claim to be able to identify the ALL on standard coronal plane MRI sections. In the experience of the authors, however, ALL identification on standard MRI sequences frequently fails and is prone to errors. The reason for this mainly lies in the fact, that the entire ALL often cannot be identified on a single MRI image. This study aimed to establish an MRI evaluation protocol improving the visualization of the ALL, using multiplanar reformation (MPR) with the goal to be able to evaluate the ALL on one MRI image. A total of 47 knee MRIs performed due to atraumatic knee pain between 2018 and 2019 without any pathology were analyzed. Identification of the ALL was performed twice by an orthopedic surgeon and a radiologist on standard coronal plane and after MPR. For the latter axial and coronal alignment was obtained with the femoral condyles as a reference. Then the coronal plane was adjusted to the course of the ALL with the lateral epicondyle as proximal reference. Visualization of the ALL was rated as \u201ccomplete\u201d , \u201cpartial\u201d  and \u201cnot visible\u201d. The distances of its tibial insertion to the bony joint line, Gerdy\u2019s tubercle and the tip of the fibular head were measured. On standard coronal images the ALL was fully visible in 17/47, partially visible in 27/47, and not visible in 3/47 cases. With MPR the ALL was fully visible in 44/47 and not visible in 3/47 cases. The median distance of its tibial insertion to the bony joint line, Gerdy\u2019s tubercle and the tip of the fibular head were 9, 21 and 25\u00a0mm, respectively. The inter-  and intraobserver  reliability was good to excellent. Complete visualization of the ALL on a single MRI image is critical for its identification and evaluation. Applying multiplanar reformation achieved reliable full-length visualization of the ALL in 94% of cases. The described MPR technique can be applied easily and fast in clinical routine. It is a reliable tool to improve the assessment of the ALL. Although reliable anatomical and biomechanical evidence for its existence is available today2, the impact of the ALL on rotational stability has not been fully understood. Furthermore, the indication to reconstruct the ALL has been discussed controversially3.The anterolateral ligament (ALL) is subject of the current debate on rotational stability in association with anterior cruciate ligament (ACL) injuries4. Another study that supports the important role regarding rotatory stability found a significant increase of rotatory instability when the ALL was sectioned additional to an ACL deficiency and therefore, claimed the ALL to be an important secondary stabilizer of the knee5. A recent study with a minimum 2\u00a0years follow-up was able to link this biomechanical findings to clinical results. They reported a lower reconstruction failure rate and better clinical outcomes in patients without ALL injury compared to patients with ALL injury on the initial MRI. Anterior stability and pivot-shift interestingly did not differ between those two groups6. The surgical decision to additionally perform an anterolateral stabilizing procedure is primarily made based on the clinical finding of rotational instability, i.e. a high-grade pivot shift and the type and level of the sporting activity of the patients7. An international consensus paper summarized the possible indications for additional anterolateral procedures. They stated that revision ACL reconstruction, high grade pivot-shift, generalized ligamentous laxity, genu recurvatum and young patients returning to pivoting activities may be good candidates for such additional procedures8.A biomechanical cadaver study reported abnormal knee kinematics in ALL deficient knees when only the ACL was reconstructed and found normalization of the kinematics if an additional modified deep Lemaire or MacIntosh tenodesis was added10. This should ultimately guide the surgical and non-surgical treatment of these patients. For radiologic assessment, an MRI is usually obtained in addition to standard radiographs. Previous studies report ALL identification rates on standard coronal plane MRI images ranging between 11 and 100%13. A recent review on the identification of the ALL on MRI highlights this heterogeneity and attributes this to different protocols used for the assessment. Moreover, knee sizes plays an important role regarding length, width and thickness of the ALL14. This is further supported by a study of patients younger than 18\u00a0years, were the authors stated that identification of the ALL was not possible on MRI in females younger than 7\u00a0years and males younger than 6\u00a0year. In this study a visualization of the ALL in 70% was reached after the age of 13\u00a0years in both sexes15. Most of the studies reporting on the ALL used standard coronal images for the assessment, while some tried to enhance ALL visualization by slightly flexing and externally rotating the knee during image acquisition14.The radiological assessment is crucial to distinguish whether rotational instability is due to an ALL injury or another reason such as a meniscal root tear16. To assess the ALL on MRI, a very good anatomical understanding of the anterolateral complex of the knee is required because the capsule, the meniscotibial and meniscofemoral ligaments as well as fibers of the LCL or the iliotibial band may be mistaken as the ALL due to their immediate proximity. Visualization of the whole ALL including its femoral and tibial attachment on one MRI layer seems to be critical for correct identification of the ligament, because if only parts of the ALL are visible, a confusion with other anterolateral structures like the posterior fibers of the iliotibial band, the joint capsule or the meniscotibial and meniscofemoral ligaments is possible. Considering this, a standardized imaging approach using well-defined anatomical landmarks is key but lacking to date. The mentioned anatomic structures are displayed in Fig.\u00a0However, identification of the ALL on standard coronal MRI images is challenging and associated with a high level of uncertainty in the discrimination of the ALL and its surrounding structures. This is because the ALL is a fine structure which is usually not aligned precisely to the coronal plane. Furthermore, it merges with the lateral collateral ligament (LCL) near its femoral insertion complicating the discrimination of the two structures proximally. Muramatsu et al. reported 3D-MRI in contrast to the above mentioned 2D analysis allows reliable full length identification of the ALLThis study aimed to establish an MRI evaluation protocol improving the visualization of the ALL using a standardized multiplanar reformation (MPR) protocol. It was hypothesized that visualization of the ALL can be improved significantly by applying this protocol when compared to the evaluation on standard coronal plane MRI.All patients undergoing an MRI performed due to atraumatic knee pain between 2018 and 2019 were retrospectively identified within the picture archiving and communication system (PACS). Only patients analyzed in a 3\u00a0T MRI with a 3-dimensional intermediate weighted (proton weighted) fat-suppressed sequence  and with a standard coronal reformation (slice thickness 1\u00a0mm) of this acquisition directly performed at the MRI console were included. MRIs revealing any injury or pathology as well as previous surgery around the knee were subsequently excluded. Due to technical reasons not anonymized MRI data was analyzed first, the anonymization was done when documenting the measurement results. The study was approved by the local ethics committee and handling of the data was performed in accordance with the guidelines of the Declaration of Helsinki and the Swiss human research act. The ethics committee  waived the need to obtain informed consent in this study, according to Article 34 of the Swiss human research act.19. Second, the 3D acquisition was analyzed using MPR allowing for free orientation of the axial, coronal, and sagittal image planes.First, the ALL was identified on standard coronal reformations and classified as completely visible, partially visible and not visible Fig.\u00a0. Complet20. Then the z-axis was tilted in the sagittal image . Data was not normally distributed and are given as median and range. Intraclass correlation (ICC) was calculated to assess inter- and intra-observer reliability. Two-way mixed measures checked for consistency and ICC is presented with 95% confidence interval. ICC values of\u2009<\u20090.40 were rated as poor, between 0.40 and 0.59 fair, between 0.60 and 0.74 good and between 0.75 and 1.00 excellentThe study was approved by the local ethical review board  Application BASEC-Nr. 2020-01559.Informed consent was not necessary for this retrospective study according to the swiss human research act.47 patients could be included for detailed analysis. 28 patients were women and 19 men, the mean age was 29 (range 20\u201339) and 24/23 were left/right knees, respectively. On standard coronal images Reader 1 rated the ALL as fully visible in 26% (12/47), partially visible in 66% (31/47), and not visible in 9% (4/47) cases in the first read and as fully visible in 28% (13/47), partially visible in 64% (30/47), and not visible in 9% (4/47) cases in the second read  and fair to excellent for reader 2 . The interobserver reliability regarding the same distances was good to excellent .This study aimed to establish an MRI evaluation protocol improving the visualization of the ALL using a standardized multiplanar reformation (MPR) protocol. It was hypothesized that visualization of the ALL can be improved significantly by applying this protocol when compared to the evaluation on standard coronal plane MRI. This analysis of 47 knee MRIs shows a significantly better visualization of the ALL after applying the MPR protocol\u00a0described above, which confirms our hypothesis.22. More recently, the ALL related debate has shifted towards the clinical relevance of this structure2 including controversial discussions on the need for ALL reconstruction when anterior cruciate ligament reconstruction is performed24. Other possibilities to address the anterolateral rotatory instability are lateral tenodesis of parts of the Iliotibial band with modified Lemaire\u2019s or modified MacIntosh\u2019s techniques being the most referred ones26. However, there is no clear data available to guide surgical planning yet.For many years the existence of a distinct ligament in the anterolateral knee capsule called the ALL has been questioned. Today, reliable anatomic, histologic and biomechanical data exist proofing the existence of the ALL28. After acute ACL injuries Ferretti et al. showed a high prevalence (88%) of ALL abnormalities on MRI, which were significantly associated with lateral joint capsule tears. There were no problems reported in identifying the ALL independent of whether the ALL was injured or not28. This is in concordance with many other studies reporting that it is possible to characterize the ALL on MRI in acute case in a high percentage and could also link the MRI findings to the results of surgical exploration during ACL reconstruction30. Another study investigating the same topic stated that the ALL was not visible in 24% of cases27. Helito et al. examined MRI scans of uninjured knees and reported a visibility of the whole ALL in 72% on standard MRI images12. A comparative table showing the visualization rates of recent MRI studies about the ALL can be found in the review of Andrade et al.14. Porrino et al. stated that in many MRI evaluations different anatomical structures are named as ALL and that a reliable discrimination of the anterolateral structures is very difficult if not impossible on routine MRI31. Another drawback of the studies mentioned above is their lack to specify the MRI layer thickness. MRI layer thickness may be a critical factor in identifying the ALL. Large slice thickness can obscure the delicate ALL due to partial volume artifacts/effects by adjacent ligamentous and capsule structures falling within the same voxels during MRI acquisition32. In the authors\u2019 opinion it should not be more than 1\u00a0mm. This is in agreement with a study by Taneja et al. which reported a visibility rate of the ALL of no more than 11% when MRI with a layer thickness of 3\u00a0mm were performed13.Several authors have claimed to be able to visualize the ALL on standard MRI sequences34. Therefore, on MRI this may give the impression of a continuous structure inserting at the tibia and femur. However, the femoral insertion of these fibers is slightly proximal and posterior to the origin of the ALL, but confusion of these structures on MRI is possible. Therefore, in our opinion, a reliable identification and evaluation can only be ensured, if the whole ALL is visible as a distinct ligamentous structure with clear tibial and femoral attachment on a single MRI image and with a femoral attachment right next to the lateral epicondyle. To reach this goal we applied multiplanar reformation and a novel MRI evaluation protocol based on anatomic landmarks of the ALL. With this technique, the full visibility of the ALL could be improved from 36% on standard coronal MRI images to 94%. However, it must be noted, that even using this technique the visualization of the ALL remains challenging and can only be accomplished by applying the knowledge of anatomical studies.This overview of MRI studies on the ALL points out the problems associated with its visualization and explains the varying results. The ALL is a very thin structure that may be mistaken easily for the capsule or the meniscotibial and meniscofemoral attachments. Moreover, the ALL lies in very close proximity to the capsulo-osseus layer of the ITB, which is connected to the femur at the intermuscular septum by Kaplan fibers19. A similar study using a 3D protocol was introduced by Muramatsu et al. in 2018, in this study a reference plane through the lateral epicondyle and a point midway between the posterior edge of Gerdy\u2019s tubercle and the anterior margin of the fibula was chosen. The authors claimed to be able to visualize the ALL in 100% of the uninjured cases using this technique16. Our study confirms this findings that the ALL can be visualized in a high percentage using a 3D technique. An advantage of the technique described in our work is, that it primarily uses the femoral condyles to align the MRI in a neutral rotation and neutral varus/valgus and therefore creates a reproducible starting point. Moreover, our reference plane did not go exactly through defined anatomical landmarks, but was oriented exactly to the course of the ALL using those landmarks only as a starting point. With this flexible reference plane the authors tried to address the variations of the femoral and tibial insertions of the ALL.To be sure that the ALL was identified correctly, we rechecked our results by measuring the distances of its tibial insertion to the bony joint line, the middle of the Gerdy\u2019s tubercle and to the tip of the fibular head. These were found to be 9\u00a0mm, 21\u00a0mm and 25\u00a0mm, respectively, which is within the range of the reported distances in anatomic studiesA major limitation of this study is, that the authors only had access to the MRI data and not to any clinical evaluation or additional demographic data like weight and height. Therefore absolute measurements of the dimensions of the ALL were not reasonable because they are directly linked for example to patient\u2019s height and need to be interpreted in that context. Another limitation is, that the described MPR technique cannot be utilized in standard 3\u00a0mm 2D MRI sequences, but needs 3D sequences with maximum 1\u00a0mm slice thickness. Moreover, we did not dived the visualization of the ALL in tibial, menical and femoral part as some authors proposed. The reason for this is that many authors claimed that the meniscal and femoral part of the ALL cannot be reliably identified on MRI. Therefor we decided to stay with \u201cpartially visible\u201d which is less precise but can be stated more reliable. The goal of this study was to visualize the entire ALL on one MRI image, which could be achieved in 94% of the case using our MPR technique. The question about the parts of the ALL will become more important when the technique described here is used for the assessment of ALL injuries. We will address this in further studies.Complete visualization of the ALL is critical for its identification and evaluation. Applying multiplanar reformation achieved reliable full-length visualization of the ALL in 94% of cases. The described MPR technique can be applied easily and fast in clinical routine. It is a reliable tool to improve the assessment of the ALL."}
{"text": "Amynthas corticis) were buried in two soils where the earthworms inhabited, or not, until more than 50% of the earthworm mass was lost. For both soils, earthworms decomposed faster during the early stage (between 0 and 3 days), as reflected by the higher rate of decomposition and increased accumulation of dissolved organic matter (DOM). This decomposition pattern was paralleled by bacterial community dynamics, where bacterial richness and diversity were significantly higher during early decomposition (p < 0.05) with the relative abundances of many genera decreasing as decomposition progressed. The succession of the bacterial community composition was significantly correlated with time-course changes in DOM composition (p < 0.05). Particularly, more functional groups  were identified to be linked with the change of a specific DOM type during the early decomposition phase. By exploring the ecologically important process of soil invertebrate decomposition and its associated bacterial communities, this study provides evidence, e.g., a statistically significant positive correlation between bacterial community and DOM compositions, which supports the widely recognized yet less-tested microbial community structure\u2013function relationship hypothesis in invertebrate decomposition.Soil invertebrate corpse decomposition is an ecologically significant, yet poorly understood, process affecting nutrient biogeochemical cycling in terrestrial ecosystems. Here, we attempted to answer how the substrate chemistry and microbial community change during soil invertebrate (earthworm) decomposition and what roles microbes play in this process. Specifically, the dead earthworms ( Decomposition is a fundamental process to energy flow and nutrient cycling within ecosystems, with the balance between decomposition and net primary production responsible for ecosystem carbon content . Compare1, account for up to 90% of invertebrate biomass present in soil  how the substrate chemistry and bacterial communities change during earthworm decomposition and (2) what roles bacteria play in the decomposition process. We hypothesized that the total concentration of DOM would first increase and then decrease, but with different magnitudes of change for various components, thus causing the changes in DOM composition during earthworm decomposition. Prior to these shifts in DOM, the bacterial community composition may also change. For example, nitrogen-cycling-related functional groups, stimulated by the protein-rich decomposing earthworm, would dominate in the initial stage of decomposition and then would be replaced by generalists  as decomposition proceeds. Thus, the microbial community structure\u2013function relationship would be observed during the decomposition of earthworm tissues.Amynthas corticis is an epi-endogeic earthworm species with global distribution  were retained for use in the experimental setup in order to circumvent the effects of minor factors  on results. Target individuals were brought to the laboratory, and non-targets were returned to the field. Then the target earthworms were surface-washed with sterile water and euthanatized by freezing at \u221240\u00b0C for 10 min , where the earthworms were originally collected from, and Xuchang , which is a non-native environment for the collected earthworms. The soils collected from Beijing and Xuchang were denoted as native soil and non-native soil, respectively. Both soils were classified as fluvo-aquic  but withFor each microcosm, sieved (mesh size 2 mm) and homogenized soil  was placed in polypropylene bottles . Three euthanatized earthworms were put in a nylon mesh bag (mesh size < 1 mm), and their weights were recorded. The mesh bags allowed for efficient sampling and nutrient exchange. Then the decomposition bag containing dead earthworms was buried in the middle layer of soil (4 cm from the bottom), mimicking a realistic situation. Soil moisture was adjusted to 40% of water-holding capacity by adding sterile deionized water. All microcosms were incubated at 20\u00b0C in the dark in a climate chamber. Based on a preliminary experiment, approximately 80% of earthworm mass is lost in native soil due to decomposition within 10 days. Therefore, to ensure sufficient samples for subsequent analysis, the incubation period was set as 8 days. To explore earthworm decomposition dynamics and bacterial community shifts, five replicates were destructively sampled on days 0, 1, 3, 5, and 8 for the following DNA extraction and DOM analyses. In total, 50 decomposition bags (2 soil types \u00d7 5 time points \u00d7 5 replicates = 50) and 50 soil samples (collected underneath the decomposing earthworm) were collected.The mass loss was determined from the difference of dry weight between the initial and final mass of each sampling time. At each sampling time, decomposition bags were removed from the microcosms and were freeze-dried at \u221240\u00b0C for 24 h to a constant weight using a vacuum freeze dryer . After drying, the undigested soil in earthworm gut was carefully removed from earthworm tissues using tweezers. Then the tissue samples were weighed and manually ground to fine powder with a mortar. The freeze-dried samples were also used for subsequent DOM analysis and DNA extraction. Because fresh earthworms were used for the decomposition experiment, the initial tissue dry mass (three euthanatized earthworms) in each microcosm was estimated based on the ratio of tissue dry mass to total wet mass . To determine the ratio, three replicates of fresh earthworms collected from the same batch were freeze-dried, and the tissue dry mass of these three earthworms was determined following the same procedure described above to calculate the proportion of tissue dry mass to total wet mass.g and 4\u00b0C for 10 min and then filtered through a 0.45-\u03bcm cellulose acetate membrane. The collected filtrate was diluted 20-fold with ultrapure water to an appropriate concentration  before excitation-emission matrix (EEM) spectroscopy analysis. The EEM analysis is a widely used tool to characterize the composition of complex DOM mixture (\u20131. The spectrum of ultrapure water was recorded as the blank (Freeze-dried earthworm powder (0.02 g) was dissolved in ultrapure water with a ratio of 1:10. The suspensions were centrifuged at 8,000  mixture , since dhe blank . Raman she blank : tyrosin2+; Takara, Dalian, China), 1 \u03bcl of template DNA (10 ng), and 8 \u03bcl of nuclease-free PCR-grade water. The PCR was performed on a T100 Thermal Cycler . The thermal cycling conditions were as follows: 94\u00b0C for 5 min, followed by 28 cycles of 94\u00b0C for 30 s, 55\u00b0C for 30 s, 72\u00b0C for 45 s, and a final extension at 72\u00b0C for 10 min. Negative controls, other ingredients not changed except the DNA templates replaced with sterilized water, were included for detecting potential contamination . The quality of DNA was assessed using the ND-1000 spectrophotometer . Primer pairs 338F (5\u2032-ACT CCT ACG GGA GGC AGC AG-3\u2032) and 806R (5\u2032-GGA CTA CHV GGG TWT CTA AT-3\u2032), targeting the V3\u2013V4 region of 16S RNA genes, were used for amplification . An addimination . PCR proThe resulting sequence reads were first sorted based on orientation, and the barcodes were extracted by using extract.barcodes.py in QIIME . Then tht-test  was performed based on the Bray\u2013Curtis distance of the DOM fluorescence spectra. Also, permutational multivariate analysis of variance (PERMANOVA) was conducted to test the significant distinctions in the DOM constituent across different sampling times.We estimated the temporal dynamics of mass loss and the bacterial alpha diversity of decomposing earthworms using linear regression analysis. The slopes of linear fits were compared by bootstrapping followed by t-test . The difPrincipal coordinate analysis based on the Bray\u2013Curtis matrix was performed to explore changes in the bacterial community composition, and the shift patterns were confirmed by PERMANOVA. To examine how the identity of bacterial taxa changed during earthworm decomposition, the shared genera between different sampling times and the unique genera at a specific sampling time were visualized via a network graph using Gephi v0.9.2 . To furtp-values of correlation analysis to control the false discovery rate caused by multiple testing. PCoA, PERMANOVA, and Mantel test were conducted using the \u201cvegan\u201d package in R platform2.Potential functions for bacterial taxa were evaluated with the program \u201cfunctional annotation of prokaryotic taxa\u201d (FAPROTAX). The FAPROTAX defines the metabolic functions in terms of prokaryotic taxa  . Currentp = 0.33). At each sampling time, the mass loss was also unaffected by soil origin (p < 0.01 for both soils); then the decomposition rate significantly decreased after day 3 . However, there was no significant difference in decomposition rate for soil either before day 3 (p = 0.19) or after day 3 (p = 0.40).After 8 days of incubation, a decrease in the total mass of approximately 60% was detected (l origin . Decompol origin  and non-l origin . In natil origin . In non-l origin . A signip < 0.01) and a subsequent decrease after day 3 (p < 0.01). More specifically, in native soil, the fluorescent intensities of all five DOM types increased during the first 3 days (p < 0.01), with a peak of \u223c2.2 \u00d7 105 arbitrary units on day 3 and then a decrease to \u223c1.3 \u00d7 105 arbitrary units by day 8 (p < 0.01). In non-native soil, the fluorescent intensities increased to a peak of \u223c2.0 \u00d7 105 arbitrary units during the first 3 days (p < 0.01) and then decreased to \u223c1.1 \u00d7 105 arbitrary units over time (p < 0.01). Both in native soil and non-native soil, the extracted DOM was dominated by tyrosine-like proteins , tryptophan-like proteins , and microbial byproduct-like materials .Throughout the study period, the total amount of earthworm DOM showed a clear temporal pattern in both native and non-native soils, with a distinct increase before day 3 (p < 0.01), as shown by the progressive changes of DOM composition over time in native soil (p > 0.05).The shifts in DOM composition over time were also visualized in the PCoA based on the Bray\u2013Curtis distance, and the significance of differences was confirmed by PERMANOVA. The decomposition time had a significant effect on DOM composition in both soils (ive soil  and non-ive soil . Similarp = 0.02) and then decreased  and then decreased during later stages of decomposition . The temporal changes of bacterial richness were marginally different in both soils either before day 3 (p = 0.06) or after day 3 . The Simpson index was significantly affected by soil origin only on days 5 and 8  as well as in the non-native soil treatment (p < 0.01). The bacterial communities displayed significant differences between native soil and non-native soil on most sampling days .The succession of the bacterial community on the decaying earthworms was also clearly detected, as indicated by PCoA performed on the entire dataset . The comProteobacterium) and two (Oscillochloris and Terrisporobacter), were present on days 5 and 8, respectively. The unique genera in the non-native soil (Brevibacillus and Romboutsia) and seven  on days 5 and 8, respectively. As decomposition proceeded, the number of genera shared by the two adjacent days also decreased. The number dropped to four and two, from 29 and 22 genera in native soil . Among the different compartments analyzed in this study, the contribution of soil-derived microbes was lower than that of earthworm-derived microbes . In the native soil treatment, the soil-derived microbes accounted for 4.8% on day 1 and then decreased to 0.8% (p < 0.05 on days 1 and 3). This result suggests that earthworm-derived microbes contributed primarily to the decomposition of earthworm tissues.Source tracking was used to quantify the contribution of the likely source environments (source) to the microbial community on decaying earthworms . The \u201cso to 0.8% . In the  to 0.8% . In contR = 0.54, p = 0.001) and non-native  soils. The effects of the bacterial community were still maintained when we merged the two datasets from different soils . In addition, the bacterial community compositions were significantly correlated to mass loss in native  and non-native  soils. The effects of bacterial community on mass loss were still maintained when we merged the two datasets from the different soils .Shifts in the DOM composition were significantly correlated to the changes in bacterial community composition for earthworms in native , were defined as those intimately associated with temporal DOM shift during earthworm decomposition. Among these functional groups, 29 were shared in both native soil and non-native soils. The direction of correlation between the abundance change of specific functional group and the amount change of each DOM type was consistent, within a specific sampling time in each soil treatment. Moreover, the direction of correlations between changes in specific functional group abundance and DOM amount was consistent at different sampling times except for the fermentation group.Among the 90 functional groups in the FAPROTAX database, 42 and 40 groups were present in at least one of the samples in the native soil and non-native soil treatments, respectively. After false discovery rate correction, 35 functional groups in native soil and 34 functional groups in non-native soil, whose relative abundance changes were significantly correlated to the amount change of a specific DOM type at a specific sampling time , while 13 functional groups showed the opposite directions between the two soils . The posAnimal decomposition, creating resource islands and nutrient pulses, is one of the main drivers of the biogeochemical cycle and consequently has bottom-up importance for ecosystem functions. Studies addressing the role of bacteria during animal decomposition are still rare . As far We conducted a controlled laboratory study to decipher the microbial-mediated process of earthworm decomposition. After 8 days of incubation in native soil and non-native soil, a decrease in earthworm mass of nearly 60% was detected . The decp < 0.05). In theory, the bacterial community composition in soil would be different between soils with earthworm additions and those without, because of the nutrients from decomposing earthworm tissues. In this regard, when the study focuses on how soil bacterial communities change during earthworm decomposition, it is best to set controls without earthworm addition.Multiple lines of evidence showed that the bacterial community on decaying earthworm changed as decomposition proceeded. For example, the bacterial richness and Simpson index showed higher values at the early decomposition phase and then decreased . Also, aR = 0.54, p = 0.001; R = 0.66, p = 0.001) correlated to the chemical composition of decaying earthworm. Bacterial community composition correlated weakly but significantly with mass loss , while it strongly correlated with DOM composition. These results indicated that microbial communities play an irreplaceable role in the progression of decomposition. These results also provided evidence regarding the microbial structure\u2013function relationship in invertebrate decomposition: the difference in DOM composition increased with the increasing dissimilarity in bacterial community composition.Although community succession occurred continuously, we identified two discrete phases of decomposition based upon changes in DOM composition and bacterial community diversity over time , 3. The Microbial taxa vary in their substrate preferences and strategies of nutrient acquisition, whereby some microbes may have higher acquisition ability and thus an advantage in the community . Based oThe main limitation of applying FAPROTAX to our data is the implicit assumption in FAPROTAX that if the cultured members of a taxon can perform a particular function, then all members of the taxon (both the cultured and non-cultured) can perform that function . HoweverAs far as we know, this is a novel study regarding the microbial-mediated process of earthworm decomposition by applying high-throughput sequencing. In this controlled laboratory study, we found that earthworms decomposed faster during the early stage (between 0 and 3 days), as reflected by the higher rate of decomposition and increased accumulation of DOM. We also found that the succession of the bacterial community composition was significantly correlated with time-course changes in DOM composition. In fact, the decomposition of soil animal tissue is a complex process because of many interacting factors related to the chemical, physical, and biological properties of the earthworm, as well as to soil environment and climate. This study provides evidence supporting the microbial community structure\u2013function relationship hypothesis in invertebrate decomposition.https://www.ncbi.nlm.nih.gov/, PRJNA637816.The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: YG designed research. Y-QS performed the research. Y-QS and YG analyzed the data and wrote the manuscript. Both authors read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Dendritic cells (DCs) regulate processes ranging from antitumor and antiviral immunity to host-microbe communication at mucosal surfaces. It remains difficult, however, to genetically manipulate human DCs, limiting our ability to probe how DCs elicit specific immune responses. Here, we develop a CRISPR-Cas9 genome editing method for human monocyte-derived DCs (moDCs) that mediates knockouts with a median efficiency of >94% across >300 genes. Using this method, we perform genetic screens in moDCs, identifying mechanisms by which DCs tune responses to lipopolysaccharides from the human microbiome. In addition, we reveal donor-specific responses to lipopolysaccharides, underscoring the importance of assessing immune phenotypes in donor-derived cells, and identify candidate genes that control this specificity, highlighting the potential of our method to pinpoint determinants of inter-individual variation in immunity. Our work sets the stage for a systematic dissection of the immune signaling at the host-microbiome interface and for targeted engineering of DCs for neoantigen vaccination. Dendritic cells\u00a0(DCs) play an outsized role in orchestrating innate and adaptive immunity: they act as sentinels, detecting invaders and initiating innate immune responses to clear them, and as antigen-presenting cells, initiating adaptive immune responses that are antigen-specific and tailored to the context in which the antigen was detected . In thisDissecting the pathways by which human DCs respond to innate immune stimuli and relay them into adaptive responses, however, has been challenging, due in large part to difficulties in genetically manipulating human DCs. Although approaches for gene repression in human DCs by RNAi have been reported , RNAi suBacteroides thetaiotaomicron (B. theta), recapitulating known LPS signaling pathways and revealing candidate genes that mediate species-specific LPS recognition and give rise to inter-individual variation in the response to LPS. These results highlight the potential of our strategy for identifying receptors for innate immune ligands, such as those from the human microbiome, and for pinpointing the genetic bases of inter-individual variation in human immunity. More broadly, our work now provides a general blueprint for functional genomics in human DCs.To address these limitations, we developed a CRISPR-Cas9 strategy to construct targeted knockouts directly in human monocyte-derived DCs (moDCs), which are readily derived from donor blood and are widely used for research and clinical applications . Using tTo enable introduction of specific knockouts in human\u00a0moDCs, we developed a non-viral genome editing strategy based on electroporation of in vitro-assembled Cas9-sgRNA complexes , an approach that has been validated in other immune cell types . BrieflyAAVS1, using a validated sgRNA sequence  after knockout of TNF or the LPS receptor TLR4  leveraged sgRNA design tools optimized for RNP activity  and (ii) targeted each locus with two\u00a0to\u00a0three sgRNAs with binding sites tiled across a 200 bp stretch to induce simultaneous double-strand breaks, a design that increases the likelihood of achieving functional knockouts by preventing error-free DNA repair and/or removing a stretch of the gene  . Becausetor TLR4  but not ignaling . We usedignaling . Benchmaignaling .E. coli LPS, a TLR4 agonist, and measured production of two cytokines: (i) TNF-\u03b1, which is induced by MYD88 and TRIF (TICAM1) downstream of TLR4, and (ii) CXCL10 (IP-10), which is induced by TRIF via activation of IRF3 and production of interferon beta (IFNB1), independently of MYD88 , TICAM1 knockout strongly reduced CXCL10 production and moderately reduced TNF-\u03b1 production, and knockout of IFNB1 or IRF3 only reduced CXCL10 production  that had been cultured alongside the knockout moDCs in 96-well plates  We purified LPS from a B. theta strain carrying deletions of all eight capsular polysaccharide (CPS) biosynthetic gene clusters (B. theta WT LPS (\u0394CPS) or just B. theta LPS. Human moDCs stimulated with B. theta LPS secreted moderate levels of TNF-\u03b1 as quantified by ELISA; this response was weaker than that elicited by E. coli LPS both in magnitude and apparent EC50 but substantially stronger than that elicited by Rhodobacter sphaeroides LPS, a well-characterized TLR4 antagonist  Although the pattern was consistent across moDCs from independent donors, response magnitude and EC50 varied by sixfold and\u00a0>20-fold, respectively   Thus, B. theta LPS is a partial TLR4 agonist whose immunostimulatory activity can be tuned by rational engineering.To further establish if bacteria , in addi pathway . Hypotheagonists  and thus4PP LPS) . B. thete donors .  to treatment with PBS (mock), B. theta WT LPS, or E. coli O55 LPS by RNA-seq (RPE65 from two independent donors from this experiment (donors p and q) to the profiles of unedited moDCs from a previous experiment (donors r and s). Transcriptional profiles segregated primarily by donor, and each of the profiles of knockout moDCs more closely resembled those of unedited moDCs from one donor than the profiles of unedited moDCs from different donors resembled each other . For each donor, we observed altered TNF-\u03b1 secretion for all four wells targeting the positive control gene TNF and one well targeting a neutral control gene (of 36 such wells).To identify additional factors that contribute to recognition of c screen . We desiTNF) impacted TNF-\u03b1 secretion in response to B. theta WT LPS in both donors. Knockouts in the TLR4 signaling pathway strongly reduced TNF-\u03b1 secretion, including TLR4 and its co-receptor MD2 (LY96), CD14 (which delivers LPS to TLR4 and initiates TLR4 endocytosis [RELA (TNFAIP3), which inhibits LPS- and TNF-\u03b1-induced NF-\u03baB signaling, secreted more TNF-\u03b1 (B. theta LPS.Knockout of 15 genes (including ocytosis ), as welis [RELA . Indeed,is [RELA . Other kre TNF-\u03b1 . Thus, oPTPN6 (SHP-1) and to a lesser extent IL10 increased TNF-\u03b1 secretion in response to B. theta WT\u00a0LPS in one donor (\u2018donor i\u2019) but not the other (\u2018donor h\u2019), suggesting that these factors can suppress TNF-\u03b1 secretion in response to LPS stimulation in a manner that differs among individuals , and TRIF (TICAM1)  . These d(TICAM1) . A separ(TICAM1) .TIRAP knockout caused a larger decrease in TNF-\u03b1 secretion than TLR4 knockout in donor h, we wondered if other TLRs contributed to the response to B. theta WT\u00a0LPS. We focused on TLR2, canonically known as a receptor for lipopeptides and teichoic acids, because TLR2 knockout caused the next-strongest decrease in TNF-\u03b1 secretion among TLRs and because TLR2 has been implicated in the response to non-proteobacterial LPSs  with 10% (v/v) standard fetal bovine serum , 100 units/mL penicillin, 100 \u00b5g/mL streptomycin, and 2 mM l-glutamine (Gibco). Lyophilized recombinant human GM-CSF  and recombinant human IL-4 (Gemini Bio) were reconstituted to 100 \u00b5g/mL and 40 \u00b5g/mL, respectively, in sterile ddH2O, aliquoted into 40\u2013100 \u00b5L aliquots, and frozen at \u201330\u00b0C until use. Fluorescently labeled antibodies against human CD14 , CD80 , CD83 , CD86 , HLA-DR , CD11b , CD11c , CD205/DEC205 , B2M , and TLR4  were obtained from BioLegend . Ghost Dye Violet 510 was obtained from Tonbo Biosciences . Ultrapure LPS from E. coli O55:B5 and Rhodobacter sphaeroides, along with Pam3CSK4, were obtained from Invivogen . Solid medium used for bacterial growth was BHI/blood agar, made from Brain Heart Infusion Agar  with 10% defibrinated horse blood . Liquid medium used for bacterial growth was supplemented BHI broth, made by preparing 1 L Brain Heart Infusion Broth (BD), and immediately before starting cultures adding 1 mL bovine hemin stock , 5 mg/mL in 1 N sodium hydroxide and filter sterilized, and 10 mL l-cysteine hydrochloride (Sigma), 50 mg/mL in Milli-Q water and filter sterilized. Sources of sgRNAs and Cas9 are listed below.Complete RPMI medium was generated by supplementing RPMI 1640 medium containing 25 mM HEPES, 2 mM B. theta strains were stored at \u201380\u00b0C in growth medium mixed in equal volume with 50% glycerol in water. Strains were streaked from glycerol stocks onto BHI/blood agar using plastic inoculating loops. Strains were allowed to grow 24\u201348 hr in an anaerobic chamber. Single colonies were used to inoculate 4 10 mL aliquots of supplemented BHI broth per strain, and after 24 hr the 10 mL cultures were expanded to 1 L each in glass bottles, producing 4 L total culture volume per strain. Cultures were allowed to grow to stationary phase (24\u201336 hr) and were pelleted at 3400\u00a0\u00d7\u00a0g for 1 hr at 4\u00b0C. Pellets were washed in PBS and shipped frozen to the UCSD GlycoAnalytics Core for LPS purification.B. theta strain (\u0394CPS) and the B. theta 4PP strain have been previously reported , and the 4PP strain has had only lipid A acyltransferase BT2152 and lipid A phosphatase BT1854 deleted, not the CPS gene clusters.Both the acapsular reported . BrieflyB. theta LPS preparations were performed by Biswa P. Choudhury at the UCSD GlycoAnalytics Core. A cell pellet from 4 L confluent culture of each B. theta strain was suspended in Milli-Q water and mixed with an equal volume of 90% phenol solution . The suspension was stirred continuously and maintained at 68\u00b0C\u00a0\u00b1\u00a02\u00b0C for 30 min. After cooling in an ice bath, suspensions were centrifuged at 3500 rpm at 10\u00b0C for 45 min and the upper layer removed to a clean Falcon tube. The remaining layers were extracted again with an equal volume of water for 30 min, cooled, and centrifuged as before. The upper layers were pooled and dialyzed  against 4 L of water for 4 days, replacing the water twice per day. The dialysate was lyophilized, resuspended in water, and subjected to ultracentrifugation at 105,000\u00a0\u00d7\u00a0g for 4 hr. The pellet was resuspended in water, treated with DNase I, RNase A, and proteinase K, followed by another round of ultracentrifugation as above. The resulting pellet was resuspended in water and lyophilized.6 to 1.3 \u00d7 106 per mL at 37\u00b0C and 5% CO2 for 7 days. Medium was exchanged every 2 or 3 days during this period . moDCs on day 7 were generally positive for CD80, CD83, HLA-DR, CD11b, CD11c, and CD205 and expressed intermediate levels of CD86 and low to intermediate levels of CD14 with some donor-to-donor variation, as assessed by flow cytometry on an LSR-II flow cytometer (BD BioSciences) or an Attune NxT flow cytometer (Thermo Fisher Scientific). All manipulations were performed in polystyrene conical tubes.Human moDCs were differentiated from monocytes isolated from commercially sourced fresh peripheral blood mononuclear cells (PBMCs) from de-identified healthy human donors . The authors did not obtain identifiable private information on donors. The commercial vendor obtained informed consent from all donors covering all experiments and data reported in this manuscript. Monocytes were isolated from PBMCs by negative magnetic selection using the EasySep human monocyte enrichment kit without CD16 depletion (StemCell) following the manufacturer\u2019s instructions and using a Big Easy magnet or Easy 50 magnet . Enriched monocytes were generally\u00a0>80% CD14-positive, as assessed by flow cytometry on an LSR-II flow cytometer (BD BioSciences) or an Attune NxT flow cytometer . Cell counts were determined in duplicate using a Countess II automated hemocytometer (Thermo Fisher Scientific). The isolated monocytes were cultured in complete RPMI medium, supplemented with 50 ng/mL GM-CSF and 20 ng/mL IL-4 immediately prior to use, at a density of 1\u00a0\u00d7 10l-glutamine, with equivalent results. RNA-seq data from moDCs from the same donor differentiated in parallel with and without penicillin/streptomycin/l-glutamine were virtually identical (not shown).All experiments reported in this manuscript were conducted using the methods described above. Preliminary experiments were also performed after isolation of monocytes using the EasySep human monocyte enrichment kit with CD16 depletion (StemCell Technologies) and the EasySep human monocyte isolation kit (StemCell Technologies) with equivalent results. Analogous experiments were also performed with cells cultured in RPMI 1640 medium without supplementation of penicillin/streptomycin/2 for 15 min. The cells were further detached by pipetting and gently tapping the flasks. The suspension was aspirated into a new conical tube and another round of detachment with CellStripper was performed for 5 min. The detached cells were combined, centrifuged at 100\u00a0\u00d7\u00a0g for 10 min, resuspended in RPMI medium, and combined with the non-attached cells. Cell counts were determined in duplicate using a Countess II automated hemocytometer (Thermo Fisher Scientific); at least two squares were counted for each replicate. All manipulations were performed in polystyrene conical tubes.For all assays, both non-attached and loosely attached moDCs were harvested and then combined. The culture supernatant containing the non-attached cells was first transferred to a conical tube. The remaining attached cells were then detached by addition of CellStripper , a non-enzymatic dissociation solution, to the flask  and incubation at 37\u00b0C and 5% COg for 10 min. The cells were resuspended in complete RPMI medium without cytokines. For readout by ELISA, cells were dispensed into flat-bottom 96-well plates in aliquots of 20,000 cells in 200 \u00b5L and incubated at 37\u00b0C and 5% CO2 for 2\u20134 hr. Each experiment contained medium-only (no cells) and PBS treatment (unstimulated/no treatment control) negative controls. For subsequent RNA isolation, cells were dispensed into flat-bottom 24-well plates in aliquots of 200,000\u2013250,000 cells at 1\u00a0\u00d7 106 cells/mL, as indicated for each experiment, and incubated at 37\u00b0C and 5% CO2 for 2\u20134 hr. To initiate the stimulation, purified LPS or PBS (no treatment control) was added to each well to the final desired concentration. LPS stocks were generally prepared at a 20\u00d7 concentration such that all wells received an equivalent volume of stimulant.To prepare moDCs for treatments, an aliquot of cells containing an appropriate cell number was centrifuged at 100\u00a0\u00d7\u00a02 for 20 hr, at which point the supernatants were transferred into a V-bottom 96-well plate, centrifuged at 3200\u00a0\u00d7\u00a0g for 10 min to remove residual bacteria and cell debris, transferred to new plates, and frozen at \u201330\u00b0C in aliquots.For readout by ELISA, the cells were incubated with the stimuli at 37\u00b0C and 5% CO2 for 2 hr. To harvest RNA from treated cells, a 3\u00d7 volume of TRIzol LS reagent  or TRI Reagent  was added directly to the cells. The suspension was mixed by pipetting to lyse the cells, followed by RNA isolation using the Direct-zol RNA Miniprep kit (Zymo Research) including an on-column DNase I digestion step. Purified RNA was quantified using a Qubit Fluorometer (Thermo Fisher Scientific) and stored at \u201380\u00b0C until use.For RNA purifications, the cells were incubated with the stimuli at 37\u00b0C and 5% COTNF-\u03b1 concentrations in undiluted or appropriately diluted supernatants were determined by ELISA using the SimpleStep human TNF alpha ELISA kit , performed following the manufacturer\u2019s instructions and with endpoint absorbance measurements at 450 nm on an Infinite M200 Pro plate reader . For each experiment, absorbance measurements from wells containing a twofold dilution series of purified TNF-\u03b1  were used to calculate a calibration curve using a four-parameter logistic fit, which in turn was used to calculate TNF-\u03b1 concentrations in all sample wells. Concentrations of CXCL10 and IL-10 were determined equivalently using SimpleStep human IP-10 ELISA kit (Abcam) and the SimpleStep human IL-10 ELISA kit (Abcam), respectively, following the manufacturer\u2019s instructions. When handling multiple 96-well plates simultaneously, plates were staggered in 3-min intervals starting with the last wash step to ensure that incubation times with the development solution and stop solution were constant.To generate cDNA, purified RNA was reverse-transcribed using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) with oligo(dT) primers in the presence of RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific) or using SuperScript IV VILO Master Mix (Thermo Fisher Scientific). All reactions in a given experiment were normalized to contain the same amount of RNA (250\u2013600 ng depending on the experiment). cDNA was diluted 1:10 and stored at \u201330\u00b0C until use. qPCR was performed using the KAPA SYBR FAST qPCR Master Mix  in 20 \u00b5L reactions containing 3 \u00b5L diluted cDNA and 200 nM of each primer. Reactions were run on a LightCycler 480 Instrument (Roche). All reactions were performed in technical triplicates. RT-qPCR primers were chosen as intron-spanning primers, when possible, from the Universal ProbeLibrary (Roche), with the following sequences:ACTB: GCTACGAGCTGCCTGACG (fw), GGCTGGAAGAGTGCCTCA (rv)IFNB1: CTTTGCTATTTTCAGACAAGATTCA (fw), GCCAGGAGGTTCTCAACAAT (rv)TNF: CAGCCTCTTCTCCTTCCTGAT (fw), GCCAGAGGGCTGATTAGAGA (rv)CXCL10: GAAAGCAGTTAGCAAGGAAAGGT (fw), GACATATACTCCATGTAGGGAAGTGA (rv)RNA-seq libraries were prepared from purified RNA using the Stranded mRNA Prep Ligation kit  in 96-well format, following the manufacturer\u2019s instructions. Input RNA amounts were held constant for all samples for a given donor, between 300 and 600 ng per reaction depending on the experiment. Final libraries were validated and quantified using the 2100 Bioanalyzer  using the High Sensitivity DNA kit (Agilent). Paired-end 100 or paired-end 150 sequencing was performed on a HiSeq 4000 (Illumina). Reads were aligned strand-specifically to the human genome (GRCh38) using the spliced read aligner STAR , versionAAVS1 was chosen from a previous report  with chemically synthesized sgRNAs (Synthego). Lyophilized sgRNAs targeting each gene  were resuspended to 100 \u00b5M  in RNase-free TE buffer  for 15 min at 25\u00b0C or overnight at 4\u00b0C with intermittent vortexing. Prior to use, sgRNA stocks were diluted to 25 \u00b5M in RNase-free H2O. Both stocks were stored at \u201330\u00b0C and freeze-thawed up to five times. To assemble RNP for electroporation of 4\u00a0\u00d7 105 cells, 50 pmol sgRNA and 20 pmol Cas9 were combined and diluted to 20 \u00b5L with nucleofection solution P1 or P3 . The mixture was incubated at 25\u00b0C for 10 min or up to 2 hr and immediately used to electroporate moDCs. For double knockouts, 50 pmol of sgRNA against each gene and 40 pmol Cas9 were combined in a total volume of 23 \u00b5L.RNPs were assembled by complexing purified recombinant Cas9 from 5 cells, 50 pmol crRNA:tracrRNA duplex and 20 pmol Cas9 v3  were combined and diluted to 5 \u00b5L in PBS, following the manufacturer\u2019s instructions.For experiments with guide RNAs in the crRNA:tracrRNA format , lyophil5 cells per electroporation\u00a0+5% excess) was transferred to a new conical tube and centrifuged at 90\u00a0\u00d7\u00a0g for 10 min. The cells were resuspended in 1\u20135 mL PBS and centrifuged again at 90\u00a0\u00d7\u00a0g for 10 min. For electroporation with RNPs assembled with sgRNAs , combined with 20 \u00b5L pre-formed RNP or nucleofector solution (no RNP control), and immediately electroporated using pulse code DJ-108 (solution P3) or other pulse codes, as described, using a Nucleofector-4D (Lonza) or a 96-well shuttle (Amaxa/Lonza) attached to a Nuclefector-4D. For electroporation with RNPs assembled with crRNA:tracrRNA duplexes 5 cells and 5 \u00b5L pre-formed RNP or nucleofector solution (no RNP control) was added. For no electroporation control cells, cells were treated identically, except that the corresponding cuvette well was not subjected to an electroporation pulse. Immediately after electroporation, 75 \u00b5L pre-warmed complete RPMI medium supplemented with 50 ng/mL GM-CSF and 20 ng/mL IL-4 were added to each well without disturbing the cells by letting the medium run down the side of the cuvette. After incubation at 37\u00b0C and 5% CO2 for 1 hr, the cells were mixed by pipetting and then split into two wells of a flat-bottom 96-well plate filled with 50 \u00b5L pre-warmed complete RPMI medium supplemented with 50 ng/mL GM-CSF and 20 ng/mL IL-4. The cells were incubated at 37\u00b0C and 5% CO2 for 5 days, with medium replenished after 2 or 3 days and then used for assays.Genome editing was performed by electroporation of moDCs with pre-formed Cas9 RNPs. moDCs were detached as described above. A suspension containing an appropriate number of moDCs (4\u00a0\u00d7 105 cells electroporated with 10 pmol Cas9 and 25 pmol sgRNA) was obtained through iterative grid searches of different conditions. In the process, several other conditions were also found to yield good results, including nucleofection solution P1 with pulse code CB-128  and used for phenotyping and genotyping.For all experiments in this manuscript, electroporated moDCs were harvested for phenotyping and genotyping 5 days post-electroporation, with the exception of data presented in 2 for 2\u20133 hr, and stimulated as described above. Each stimulation was performed in duplicate. Supernatants from stimulated cells were harvested and used to measure TNF-\u03b1 levels as described above.To determine the responses of cells to stimuli by ELISA, aliquots of cells were transferred into flat bottom 96-well plates, diluted to 200 \u00b5L with complete RPMI medium without cytokines, incubated at 37\u00b0C and 5% CO5 to 2.5\u00a0\u00d7 105 cells were transferred into flat-bottom 24-well plates, diluted to 250 \u00b5L with complete RPMI medium without cytokines, incubated at 37\u00b0C and 5% CO2 for 2\u20133 hr, and stimulated as described above. Each stimulation was performed in duplicate. RNA was extracted from treated cells as described above.For subsequent RNA isolation, aliquots containing 1\u00a0\u00d7 10During the incubation prior to stimulation, aliquots of the remaining cell suspension were used to determine cell counts for each sample using a CellTiterGlo luminescence assay . Briefly, replicate aliquots of cells were transferred into an opaque flat-bottom 96-well plate, diluted to 100 \u00b5L, and incubated at 25\u00b0C for 15\u201330 min. After addition of an equal volume of CellTiterGlo solution to each well, the plates were placed on an orbital shaker for 2 min and then incubated at 25\u00b0C for 10 min. Finally, luminescence in each well was recorded using a GloMax Multi\u00a0+\u00a0luminescence plate reader (Promega). For some experiments, luminescence measurements from wells containing known numbers of unedited moDCs, as determined using a Countess II automated hemocytometer (Thermo Fisher Scientific), were used to calculate cell numbers for each sample. TNF-\u03b1 secretion for each sample was then normalized to cell numbers. For other experiments, TNF-\u03b1 secretion was simply normalized to background-subtracted luminescence readings. In benchmark experiments, cell counts were also determined by flow cytometry on an LSR-II flow cytometer (BD Biosciences) equipped with a 96-well autosampler. Cell counts determined by flow cytometry and luminescence were well\u00a0correlated  and all To isolate genomic DNA from each sample for genotyping, aliquots of harvested moDCs were transferred to a 96-well V-bottom plate, centrifuged at 300\u00a0\u00d7\u00a0g for 10 min, and resuspended in 50 \u00b5L QuickExtract DNA extraction solution . The suspensions were transferred to 96-well PCR plates and incubated at 65\u00b0C for 20 min and then at 98\u00b0C for 5 min using a thermocycler. The extracted genomic DNA was stored at \u201330\u00b0C until use.5 cells at the time of electroporation) were harvested as described above and combined. After setting aside cells for genomic DNA extraction, the remaining cells were used for antibody staining. In parallel, moDCs from the same donors that had not been subjected to the electroporation procedure and had instead been cultured in T-25 flasks were also harvested and stained. Stains were performed in 96-well V-bottom plates. Aliquots of 3\u00a0\u00d7 105 to 5\u00a0\u00d7 105 cells per well were first stained with the amine-reactive viability dye Ghost Dye Violet 510 (Tonbo) by washing the cells twice in PBS (without protein additives) followed by incubation with 0.1 \u00b5L dye in 100 \u00b5L PBS on ice for 30 min in the dark. The cells were then washed twice in PBS containing 10% FBS, resuspended in PBS containing 10% FBS, and stained in a total volume of 100 \u00b5L with an antibody mix containing the following antibodies at the indicated final concentrations: anti-CD11c , anti-HLA-DR , anti-CD83 , anti-B2M , anti-TLR4 . Fluorescence-minus-one controls for each of the five antibodies were included for unedited cells from each donor. Cells were incubated with the antibody mixes on ice for 30 min in the dark, washed three times in PBS containing 10% FBS, and finally resuspended in 200 \u00b5L PBS containing 10% FBS. To set compensation, an aliquot of 2 \u00d7 105 heat-killed moDCs (incubated at 65\u00b0C for 15 min) was stained with Ghost Dye Violet 510 in the same fashion and then mixed with 2 \u00d7 105 live moDCs and washed as described above, and 1:1 mixtures of CompBead anti-mouse Ig, \u03ba beads (BD Biosciences) and CompBead negative control beads (BD Biosciences) were stained with each individual antibody at the same concentrations and washed as described above. Flow cytometry data were recorded on an Attune NxT flow cytometer (Thermo Fisher Scientific) and analyzed using FlowCytometryTools 0.5.0  were appended to the designed primer pairs. First-round PCRs of targeted sites were performed in 96-well format using at least 4000 genomic copies for each sample, 0.5 \u00b5M of each primer, and Q5 Hot Start High-Fidelity 2X master mix  and the following protocol: 98\u00b0C for 30 s; 35 cycles of 98\u00b0C for 10 s, 60\u00b0C for 30 s, and 72\u00b0C for 30 s; and a final extension at 72\u00b0C for 2 min. Products from the first PCR were diluted 1:100 in ddH2O and subjected to a second round of PCR using the constant adapters as annealing sites, appending Illumina P5 and P7 adapters and two eight-base barcodes on both ends that together uniquely identified each sample. Twelve cycles of PCR were performed using the same conditions described above. After the second PCR, all samples were pooled and the combined samples were purified using a 0.8\u00d7 AMPure XP purification . Final libraries were validated and quantified using the 2100 Bioanalyzer (Agilent) using the High Sensitivity DNA kit (Agilent) and sequenced in a 600-cycle paired-end run on a MiSeq Instrument (Illumina) using MiSeq v3 Reagent kits.Genomic regions surrounding each cut site were PCR-amplified using a two-step protocol, largely as described . Brieflyhttps://github.com/jeffhussmann/knock-knock)  . For a fTo measure how amplicon size affects amplification and sequencing efficiency in our genotyping approach, we subjected pools of purified amplicons of defined sizes to our sequencing library preparation protocol and determined the resulting sequencing counts . BrieflyAmplicons are of defined sizes between\u00a0~150 bp and\u00a0~500 bp (the range of amplicon sizes in our experiments) and amplified by the same primer pair;Sequencing library preparation protocol is analogous to that used for genotyping, including similar effective template concentration and presence of excess non-productive genomic DNA;Amplicon abundance is measured before sequencing library preparation and compared to final sequencing counts to estimate amplification and sequencing efficiency.Briefly, we generated five amplicons with final lengths of 146 bp, 249 bp, 349 bp, 447 bp, and 539 bp and with constant annealing sites at the ends by PCR-amplifying different fragments of a gene encoding BFP with a constant forward primer and reverse primers positioned at the appropriate distances. Forward and reverse primers contained overhangs  to create annealing sites for sequencing library preparation. Following the PCR, each individual amplicon was gel-purified and quantified using a Qubit Fluorometer (Thermo Fisher Scientific). The five amplicons were then mixed into pools at 11 different molar ratios. For increased accuracy, the abundance of each fragment in these pools was measured using the 2100 Bioanalyzer (Agilent) using the High Sensitivity DNA kit (Agilent). Each pool was then diluted to 33 fM  and 1 \u00b5L of diluted pool was used as template for the first-round PCR as described above, using a primer pair complementary to the constant overhangs on each fragment, designed with the same criteria as our other amplicon primers. The PCRs additionally contained 4 \u00b5L of genomic DNA from unedited DCs as excess non-productive template. The remainder of the sequencing library preparation was carried out as described above, with unique sequencing indices appended to each pool in the second-round PCR. The final libraries were sequenced on a MiSeq (Illumina) and counts for each fragment were determined by aligning reads to the expected amplicons.im is the measured fractional abundance, is the starting abundance, and ie the fragment-specific observation efficiency. Note that the equation takes this form because we can measure only fractional rather than absolute abundances of each amplicon at the end; thusTo infer observation efficiency (amplification\u00a0+\u00a0sequencing) for each fragment, we reasoned that the starting and the final composition of the pool should be related by the specific observation efficiency of each amplicon, which should shift the abundance of each fragment based on its specific observation efficiency:ne\u00a0=\u00a01) and then solved the resulting linear equation systemie for each fragment in each pool. Because we expected per-cycle PCR amplification efficiency to be a major contributor to these efficiencies, we compared log2 e to fragment size and found it to be approximately\u00a0linearly correlated  to 1 . For donor p, the RNA extraction for one replicate sample with knockout of  plastid . All othTo select genes to target in our arrayed genetic screen, we first included all genes from the following categories of pattern recognition receptors (PRRs): Toll-like receptors, NOD-like receptors, RIG-I-like receptors, C-type lectin receptors, Galectins, and SIGLECs. We then assembled a list of all genes encoding relevant signaling proteins downstream of these PRRs, including immediate adaptor proteins, kinases and ubiquitin ligases, the downstream transcription factors, as well as\u00a0a limited subset of effector cytokines and cytokine receptors. Finally, we completed the gene list with additional genes of interest by surveying our RNA-seq data from human moDCs for expressed potential pattern recognition receptors such as predicted surface/membrane proteins, carbohydrate-binding proteins, and proteins containing a V-set domain using searches for Pfam domains, and by browsing the list of genes with the GO term \u2018innate immune response\u2019 that we had not yet included. This process ultimately resulted in a list of\u00a0>400 genes. To narrow the list down to\u00a0~300 genes to enable screening in four 96-well plates, we first eliminated pseudogenes and a few PRR-like genes with well-established functions. We then eliminated many genes involved in linear signaling pathways while ensuring that each pathway was targeted at multiple nodes in the final library. In total, we targeted 291 unique genes of interest.CRX, KCNV1, TRHR, LALBA, RPE65, F13B, OR2D2, OR51T1, and\u00a0TAS2R9) that are not expressed in moDCs, as assessed by our RNA-seq data and non-essential in any cell type surveyed at the time (from Project Achilles)  and POLR2A (a component of RNA polymerase II). In total, we included 14 controls. All sgRNA sequences are listed in The library additionally included four classes of controls: (1) non-targeting negative controls; (2) neutral controls (targeting negative controls); (3) targeting positive controls; and (4) essential controls. As non-targeting negative controls, we picked non-targeting negative controls #1 and #2 from Synthego. As neutral controls, we selected nine genes (chilles) , and foral genes : U2AF2  from a single healthy human donor and differentiated into moDCs as described above. Differentiated moDCs were electroporated with sgRNAs in 96-well format as described above. Plates were staggered in 10 min intervals to minimize the amount of time cells spent in nucleofection solution and the time delay between electroporation and addition of recovery media. On day 3 after electroporation, four\u00a0wells of cells containing no pulse/no RNP control cells were harvested to assess responses of unedited cells to B. theta LPS and E. coli LPS and to determine an optimal B. theta LPS concentration for treatment of edited cells  were assigned the background-corrected absorbance of the sample with the lowest value greater than 0.Background-corrected absorbance values were normalized by the average luminescence (average of two replicate measurements) for each cell sample to calculate a cell count-normalized absorbance.For each sample, the cell count-normalized absorbance was normalized to the median cell count-normalized absorbance of all nine neutral targeting controls on the same 96-well plate to calculate a fold-change in TNF-\u03b1 or IL-10 secretion. Normalization was performed by plate to normalize for any plate effects.2 transformed to calculate log2 fold-changes in TNF-\u03b1 or IL-10 secretion.Fold-changes were log2 fold changes of replicate treatments were averaged to calculate the average log2 fold change of each knockout population. Normality tests suggested that the log2 fold-changes were generally normally distributed, rationalizing the averaging of the log2-transformed values.LogRaw and processed ELISA and cell count data are included in m of 60\u00b0C. Design criteria were successively relaxed if no primers matching these criteria were found, up to a maximum amplicon size of 500 base pairs and a minimum flanking distance of 25 base pairs. Primers containing overhangs as described above were ordered in 96-well format matching the sgRNA layout and tested for efficient amplification of the targeted locus by amplifying genomic DNA from unedited moDCs and sequencing the resulting amplicons on a MiSeq (Illumina), as described above. For loci with inefficient amplification or a high fraction of off-target amplicons, as assessed using knock-knock  were chosen. All primers are listed in To assess editing efficiency at all loci, amplification primer design and sequencing library preparation were streamlined to increase throughput. A first round of amplification primers was designed using PrimerServer , which uck-knock , primersck-knock  as descrSFTPA1 and SFTPA2), amplicons for both loci were detected with primer pairs designed to amplify each individual locus because it was impossible to design completely specific primer pairs with the criteria used. These amplicons were not excluded when calculating editing efficiency, such that editing efficiency is slightly underestimated for these loci. Results from outcome classification, after correction for size, are listed in Amplicon PCRs and sequencing sequencing library preparation were performed largely as described above, with the following modifications: (1) PCRs were performed in 384-well format; (2) first-round PCRs were set up using a Biomek FX liquid handling system with a 96-well head (Beckman Coulter); (3) first-round PCR products were diluted into Echo Qualified 384-Well Polypropylene Microplates using the Biomek FX; (4) PCR mastermix for the second-round PCR was dispensed into 384-well PCR plates using the Biomek FX; and (5) diluted first-round PCR products and indexing PCR primers were dispensed into the 384-well PCR plate using an Echo 525 acoustic liquid handler . Purification and validation of sequencing libraries, sequencing, classification of sequencing outcomes, and correction for amplicon size were performed as described above. For donor h, a small set of samples did not produce aligning sequencing reads in a first PCR attempt. These samples were repeated manually as described above, after which all but one sample produced aligning sequencing reads. Only successfully prepared samples were included for analysis. For donor i, the sequencing library preparation was repeated independently for\u00a0>200 loci, which produced near-identical results , validatNo sample-size calculation was performed in advance. All results were reproduced in cells from multiple independent donors, following conventions of the field. Within independent experiments, assays were performed in duplicate or triplicate following conventions of the field.All main findings were derived from experiments with cells from at least two independent donors. The main hits from the genetic screen were validated in cells from two additional, independent donors. All treatments were performed in duplicate for readout by ELISA and qPCR and in duplicate or triplicate for readout by RNA-seq. Cell counts were generally conducted in duplicate. Information on number of replicates is contained in the figure legends.For identification of differentially expressed genes in RNA-seq, only genes with an average count\u00a0>2 across all conditions were included for analysis. Exclusion criteria for editing analysis are described in the corresponding methods sections.https://github.com/jeffhussmann/knock-knock) (Amplicon sequencing data were processed using the publicly available pipeline knock-knock (k-knock) . RNA-seqk-knock) , featurek-knock) , and DESk-knock) . In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Acceptance summary:Jost and colleagues have developed a robust non-viral CRISPR/Cas9-based genome-editing methodology that enables to directly edit differentiated moDCs. This will open the possibility for functional genomics screening with DCs as well as targeted mechanistic studies that will enhance our biological understanding on the role of DCs for innate and adaptive immunity.Decision letter after peer review:eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Satyajit Rath as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Klio Maratou (Reviewer #1); Carla V Rothlin (Reviewer #2).Thank you for submitting your article \"CRISPR-based functional genomics in human dendritic cells\" for consideration by The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.Essential revisions:1. As this manuscript comes under the category of \"tools and resources article\", it is important that the authors demonstrate that the editing is not changing the function of dendritic cells for the readers to have more confidence that the methodology is sound and will enable future studies on dendritic cells biology. Since the authors have already collected RNAseq data, they should capitalised on this dataset and conduct a more thorough analysis of this data. They need to compare the neutral control RPE65 KO vs. PBS samples to show that the editing does not significantly alter the transcriptomic profile of the dendritic cells. Can they see statistically significant differential expression changes between the two samples. Do these changes relate to pathways that are important for dendritic cell function? If so, what are these? Are any of the dendritic cell maturation or cell signalling pathways affected? Finally, it could be possible to perform immunophenotyping of the cells using fluorescent\u2010based flow cytometry with a panel of DC markers and other myeloid cell lineage markers to show that the process of editing does not de-differentiate/activate the cells or change their morphology.2. To validate and apply this strategy, the authors conducted a genetic screen for factors relevant to the response to LPS from different species as well as drivers of interindividual variation. The study is by and large is carefully designed and includes appropriate controls such as for example editing of the chemokine receptor CXCR4 which is not involved in the response to LPS and therefore serves as a negative control. However, weaknesses are noted in the application of the strategy to identify receptors for LPS or drivers of interindividual variability. The authors claim that their genetic screen allows them to identify receptors for LPS derived from B. theta as well as drivers of interindividual variation. Unfortunately, at this stage, the data does not fully support the authors conclusions. The authors should validate the potential role of TLR2 in an independent setting, for example making use of a TLR2 reporter assay. This is of particular importance for concluding that TLR2 is a receptor for LPS derived from B. theta.3. The response to B. theta varies in magnitude between donors even in non-edited cells. Is donor to donor variability too high to enable us to draw any biological conclusions when moDCs are used in screening? How many donors should be tested for biological phenotypic data to be meaningful?As noted by the authors the maximal response to LPS in terms of TNF production is different between the donors. Also, it appears that EC50s are different. In order to establish drivers of interindividual variation, the authors should compare the effect of knocking out gene X in cells from individual A and B when stimulated with EC50 concentrations of LPS.E. coli LPS than those from donor h .\" The fact that unedited moDCs from donor i secrete less TNF-\u03b1 in response to LPS is not sufficient support that PTPN6 and IL-10 constitutively suppress TNF-\u03b1 secretion. The authors should test if moDCs spontaneously secrete TNF if knocked out for PTPN6 or IL-10?The authors emphasize differences in the effect of knocking out PTPN6 or IL-10 in the TNF secretion induced by LPS from B. theta. The authors go on to say (line 230) \"Most prominently, knockouts of PTPN6 (SHP-1) and to a lesser extent IL10 increased TNF-\u03b1 secretion in response to B. theta LPS in one donor (\"donor i\") but not the other (\"donor h\"), suggesting that these factors can constitutively suppress TNF-\u03b1 secretion in a manner that differs among individuals . Indeed, unedited moDCs from donor i secreted less TNF-\u03b1 in response to both B. theta LPS and In various instances, the authors should consider discussing the limitations of the approach and temper their conclusions: In this regard, the authors should revise their biological conclusions and stress that this only a proof-of-concept study as the screen was conducted with limited number of donors. The authors should be very careful with the interpretation on whether the genes that are hits from the screen are true drivers of interindividual variability. The authors clearly demonstrate that moDC responses to LPSs vary across individuals. This point highlights the importance of assessing immune phenotypes in donor-derived cells, but also raises the necessity to use multiple donors for meaningful and reliable conclusions to be drawn from the data. The number of biological donor replicates (2-3) used in this study is sufficient to show proof of concept, but subsequent studies using moDCs will require much larger number of donors. Essential revisions:1. As this manuscript comes under the category of \"tools and resources article\", it is important that the authors demonstrate that the editing is not changing the function of dendritic cells for the readers to have more confidence that the methodology is sound and will enable future studies on dendritic cells biology. Since the authors have already collected RNAseq data, they should capitalised on this dataset and conduct a more thorough analysis of this data. They need to compare the neutral control RPE65 KO vs. PBS samples to show that the editing does not significantly alter the transcriptomic profile of the dendritic cells. Can they see statistically significant differential expression changes between the two samples. Do these changes relate to pathways that are important for dendritic cell function? If so, what are these? Are any of the dendritic cell maturation or cell signalling pathways affected? Finally, it could be possible to perform immunophenotyping of the cells using fluorescent\u2010based flow cytometry with a panel of DC markers and other myeloid cell lineage markers to show that the process of editing does not de-differentiate/activate the cells or change their morphology.We agree with the reviewers that it is important to demonstrate that our method does not perturb DC function and will enable studies of dendritic cell biology. We now include additional data to support this point.First, we characterized edited and unedited DCs from two independent donors by flow cytometry, measuring levels of CD11c (a DC marker), HLA-DR and CD83 (two markers whose expression increases during DC maturation), TLR4 (expression of which decreases during DC maturation), and B2M . We did not include additional markers because we already occupied 6 colors (including a viability stain) and we wanted to balance the ability to quantify marker levels against the breadth of the panel. As shown in Figure 1\u2014figure supplement 5A, the staining patterns are qualitatively indistinguishable in knockout DCs and in unedited DCs (no electroporation control DCs or DCs electroporated with a non-targeting control sgRNA). We observed small differences between expression profiles of edited DCs and unedited DCs that were grown in flasks, pointing to changes in DC state as a consequence of culture conditions; such changes can be controlled by comparing knockout DCs to identically cultured unedited DCs or to DCs with knockout of a neutral gene, as we did throughout the manuscript. Overall, these results suggest that moDCs do not undergo de-differentiation or maturation as a consequence of the editing procedure.We also stained for B2M, but we designed the panel for maximal resolution in the other channels, precluding accurate quantification of reductions in B2M levels upon knockout. We can place a conservative lower bound of >70% depletion for B2M. More broadly, our functional assays clearly demonstrate a reduction in protein levels in knockout cells.The flow cytometry data are presented in Figure 1\u2014figure supplement 5 in the revised manuscript and described in a new paragraph in the Results section. We also included details of the experimental strategy in the methods section.To compare the transcriptional states of edited and unedited DCs, we compared RNA-seq data from mock-treated edited cells  and from mock-treated unedited cells . Clustering of the transcriptional profiles revealed that transcriptional states of edited DCs can be more similar to those of unedited DCs than those of unedited DCs from different donors to each other, suggesting that any changes induced by the editing procedure are smaller than any natural variation in DC state. In addition, the expression levels of a panel of DC markers are comparable between edited and unedited DCs. These analyses provide further evidence that the editing procedure does not substantially alter DC state. These data are included in the revised manuscript as Figure 2\u2014figure supplement 3 and are described in the Results section.We realize that this analysis may not be the one the reviewers had in mind. We could not perform the suggested direct comparison between unedited and RPE65 KO DCs because we did not include unedited DCs from the same donors in the RNA-seq experiment on knockout DCs. Indeed, throughout the manuscript we used DC populations with knockout of a neutral gene  as the control populations to which we compared all other data. In our view this is the most robust way to ensure that the comparisons isolate the effect of the knockout.Together with our data demonstrating that edited moDCs retain the ability to respond to diverse innate immune ligands , the flow cytometry data and the additional analyses of the RNA-seq data provide strong support that our editing procedure does not perturb DC state and function.2. To validate and apply this strategy, the authors conducted a genetic screen for factors relevant to the response to LPS from different species as well as drivers of interindividual variation. The study is by and large is carefully designed and includes appropriate controls such as for example editing of the chemokine receptor CXCR4 which is not involved in the response to LPS and therefore serves as a negative control. However, weaknesses are noted in the application of the strategy to identify receptors for LPS or drivers of interindividual variability. The authors claim that their genetic screen allows them to identify receptors for LPS derived from B. theta as well as drivers of interindividual variation. Unfortunately, at this stage, the data does not fully support the authors conclusions. The authors should validate the potential role of TLR2 in an independent setting, for example making use of a TLR2 reporter assay. This is of particular importance for concluding that TLR2 is a receptor for LPS derived from B. theta.B. theta LPS recognition and of PTPN6 in mediating inter-individual variation, were intriguing but not essential to establish the utility. We therefore re-framed the manuscript to more clearly emphasize the methods development and proof-of-principle nature of the screen, while presenting the additional points as hypotheses for further exploration.We agree with the reviewers that some of our claims needed further support to draw definitive conclusions. However, as the reviewers pointed out in the first and last main comments, the main innovation in our manuscript is the method to introduce knockouts in DCs. The genetic screen recapitulated known LPS signaling pathways and thus provided proof-of-principle for the utility and scalability of our method. The additional hypotheses emerging from the screen data, such as the potential roles of TLR2 in 3. The response to B. theta varies in magnitude between donors even in non-edited cells. Is donor to donor variability too high to enable us to draw any biological conclusions when moDCs are used in screening? How many donors should be tested for biological phenotypic data to be meaningful?B. theta WT LPS is a weaker agonist than E. coli LPS and B. theta 4PP LPS has further reduced activity in all donors. In addition, our genetic screen identifies many core factors that are important for LPS recognition across donors. Thus, many biological conclusions can be drawn from moDCs by interrogating cells from 2-4 different donors, as we did throughout the manuscript.First, although we observe that the magnitudes of the LPS response varies across DCs from different donors, many other core aspects of biology are consistent across donors. For example, the patterns of activity across different LPSs are consistent: Second and perhaps more broadly, inter-individual variability is an interesting biological phenomenon in itself, but how it arises from environmental and genetic factors has long been difficult to study. In this context, the ability to conduct genetics in moDCs from different individuals will be essential to pick apart these contributions, for example through longitudinally sampling cells from the same donor to disentangle genetic and environmental contributions. We provide first glimpses of how we can begin understanding the drivers of such variation by comparing cells from 2-4 different donors. We agree that to definitively pinpoint drivers, studies in larger numbers of donors will be needed, as further discussed below. Importantly, we observed high knockout efficiency across all donors , suggesting that the utility of our method is not limited by inter-individual variation and will be applicable to studies involving large numbers of donors.We touch upon these points in the Discussion section of the revised manuscript.As noted by the authors the maximal response to LPS in terms of TNF production is different between the donors. Also, it appears that EC50s are different. In order to establish drivers of interindividual variation, the authors should compare the effect of knocking out gene X in cells from individual A and B when stimulated with EC50 concentrations of LPS.We used non-saturating concentrations of LPS for all experiments with knockouts. We do not think we would be able to learn more about the drivers of inter-individual variation by stimulating at exactly EC50.E. coli LPS than those from donor h .\" The fact that unedited moDCs from donor i secrete less TNF-\u03b1 in response to LPS is not sufficient support that PTPN6 and IL-10 constitutively suppress TNF-\u03b1 secretion. The authors should test if moDCs spontaneously secrete TNF if knocked out for PTPN6 or IL-10?The authors emphasize differences in the effect of knocking out PTPN6 or IL-10 in the TNF secretion induced by LPS from B. theta. The authors go on to say (line 230) \"Most prominently, knockouts of PTPN6 (SHP-1) and to a lesser extent IL10 increased TNF-\u03b1 secretion in response to B. theta LPS in one donor (\"donor i\") but not the other (\"donor h\"), suggesting that these factors can constitutively suppress TNF-\u03b1 secretion in a manner that differs among individuals . Indeed, unedited moDCs from donor i secreted less TNF-\u03b1 in response to both B. theta LPS and PTPN6 or IL10 increases TNF- \u03b1 secretion upon stimulation. We re-phrased the corresponding section to clarify. More broadly, we now more clearly emphasize that this hypothesis requires further exploration.We did not clearly state our model. Our hypothesis is that PTPN6 and IL-10 suppress TNF-\u03b1 secretion upon stimulation of the cells, such that knockout of In various instances, the authors should consider discussing the limitations of the approach and temper their conclusions: In this regard, the authors should revise their biological conclusions and stress that this only a proof-of-concept study as the screen was conducted with limited number of donors. The authors should be very careful with the interpretation on whether the genes that are hits from the screen are true drivers of interindividual variability. The authors clearly demonstrate that moDC responses to LPSs vary across individuals. This point highlights the importance of assessing immune phenotypes in donor-derived cells, but also raises the necessity to use multiple donors for meaningful and reliable conclusions to be drawn from the data. The number of biological donor replicates (2-3) used in this study is sufficient to show proof of concept, but subsequent studies using moDCs will require much larger number of donors.We agree with the reviewers that a discussion of the strengths and limitations of the approach was missing from the manuscript and have included such a discussion in the revised manuscript at the beginning of the Discussion section.We also agree that studies in larger numbers of donors will be needed to definitively establish the roles of putative drivers of inter-individual variation, which we also note in the revised Discussion. More broadly, we now emphasize that our study provides proof-of-principle, suggests exciting hypotheses to be explored further, and provides enabling tools for such explorations."}
{"text": "Sleep disorders have been increasingly investigated in several medical illnesses as their presence may affect patients\u2019 quality of life. However, the research examining sleep disorders in oral cancer is relatively weak. Indeed, the majority of the available studies present a cross-sectional or retrospective designs. Moreover, very few of them have evaluated quality of sleep in oral cancer survivors (OC survivors). We aimed to carry out a case-control study with the purpose to investigate sleep disorders and mood impairment in 50 OC survivors. Our research has shown that quality of sleep is significantly affected in OC survivors compared to a healthy population and that OC survivors suffers from higher levels of anxiety and depression. Our results may suggest that an appropriate assessment of quality of sleep and psychological profile should be performed in OC survivors as a prompt treatment for both sleep and mood disorders is crucial for the overall improvement of patients\u2019 quality of life.p-value: <0.001). QoS of OC survivors was significantly impaired, especially with regard to some PSQI sub-items as the subjective sleep quality, sleep latency and daytime dysfunction . Moreover, poor QoS was negatively correlated with years of education  and positively correlated with alcohol consumption  and with the use of systemic medications . Sleep disorders and mood disorders are common comorbidities in OC survivors; therefore, early assessment and management before, during and after treatment should be performed in order to improve the quality of life of OC survivors.Quality of sleep (QoS) and mood may impair oral cancer survivors\u2019 wellbeing, however few evidences are currently available. Therefore, we aimed to assess the prevalence of sleep disorders, anxiety and depression among five-year oral cancer survivors (OC survivors). 50 OC survivors were compared with 50 healthy subjects matched for age and sex. The Pittsburgh Sleep Quality Index (PSQI), the Epworth Sleepiness Scale (ESS), the Hamilton Rating Scales for Depression and Anxiety , the Numeric Rating Scale (NRS), the Total Pain Rating Index (T-PRI) were administered. The global score of the PSQI, ESS, HAM-A, HAM-D, NRS, T-PRI, was statistically higher in the OC survivors than the controls ( Oral cancer is a life-threatening disease and a burden for health care systems worldwide. According to Global Cancer Statistics, GLOBOCAN, there were 354,864 new cases of oral cavity cancer causing 177,384 deaths during 2018 ..12].The recruitment of OC survivors and healthy subjects was conducted between January and September 2018 and was based upon convenience sampling. All potentially eligible individuals were invited to participate in the present study and provided their written informed consent.The case and the control groups were matched by age and gender. Specifically, first we recruited the patients and then calculated the gender distribution and the average age; secondly, we recruited the controls to obtain a matched sample.Participants of either gender and aged 18 or older were included. The inclusion criteria for the OC survivors\u2019 group were: (i) clinical and histopathological findings of oral squamous cell carcinoma (OSCC) or tobacco-related verrucous cell carcinoma (VCC) (ii) patients with a follow-up of at least five years after the diagnosis of OSCC or VCC and being free from malignancy for at least one year, (iii) all stages based on the American Joint Committee on Cancer Staging Manual 8th edition and (iv) patients managed by surgery, radiotherapy and/or chemotherapy.On the contrary, the exclusion criteria for the case group were: (i) patients affected by human papillomavirus (HPV)-related OSCC, (ii) patients affected by another type of tumor localized at the head and neck region, (iii) patients who had concomitant tumors in another organ, and (iv) patients who had experienced severe and irreversible side effects from OSCC treatment such as fibrosis, a mouth opening restriction of less than 30 mm, trismus, hyposalivation or osteoradionecrosis of the jaw.The inclusion criteria for the control group were: (i) patients treated at the University Dental Clinic only for routine dental care during the study period; and (ii) the absence of any oral mucosal lesions or any previous history of OSCC/VCC.For both groups the exclusion criteria were (i) breastfeeding or pregnant participants, (ii) patients affected by autoimmune disease or another debilitating condition or unstable disease (such as osteonecrosis of the jaw or dementia), (iii) participants with a medical history of a psychiatric disorder as defined by the DSM-5 or regularly treated with a psychotropic drug, (iv) drug-addicted or alcoholic participants and (v) individuals unable or not willing to give their consent or to understand and complete the questionnaires.A comprehensive intra- and extra-oral examination was carried out by two oral medicine experts (RG and AD). Upon admission, demographic data such as gender, age, educational level (in years), marital status, employment status, risk factors  body mass index (BMI), comorbidities and associated drug use were recorded for both groups.Details of clinical oral cancer related characteristics were also noted for the case-group, such as the clinical stage and grading at the time of diagnosis, the location of the tumor, any clinical nodal involvement, any metastasis, the type of treatment, and any need for further treatment during the 5-year follow-up. The performance status was assessed using the Eastern Cooperative Oncology Group (ECOG) scale in OC survivors whose scores range from 0 (fully active) to 5 (death), with higher values indicating a poorer performance status .-the Pittsburgh Sleep Quality Index (PSQI)  for the -the Epworth Sleepiness Scale (ESS)  for the -the Hamilton Rating Scale for Depression (HAM-D)  and the -the Numeric Rating Scale (NRS)  and the A predefined set of questionnaires was given to the participants of both groups in order to assess their quality of sleep (QoS), their psychological status (level of anxiety and depression) and the intensity and quality of any pain. The questionnaires comprised:The Pittsburgh Sleep Quality Index (PSQI) is a standardized questionnaire used for the assessment of the QoS and the incidence of sleep disturbances. This tool consists of 19 items which generate 7 \u2018component\u2019 scores: subjective sleep quality, sleep latency, sleep duration, habitual sleep efficiency, sleep disturbances, use of sleep medication and daytime dysfunction. The scores for each item range from 0 to 3, with higher scores indicating a poorer QoS. The items are combined to yield the seven components, each component having a score ranging from 0 to 3, and the sum of the scores for these seven components yields a global score ranging from 0 to 21. Global scores above five distinguish poor sleepers from good sleepers with a high sensitivity (90\u201399%) and specificity (84\u201387%) .The Epworth Sleepiness Scale (ESS) is used to measure an individual\u2019s general level of daytime sleepiness. The tool consists of 8 items assessing the propensity for sleep in eight common situations. Subjects rate their likelihood of dozing in each situation on a scale of 0 (would never doze) to 3 (would have a high chance of dozing). The ESS score is the sum of the eight items, ranging from 0 to 24, with a cut-off value of >10 indicating excessive daytime sleepiness .The Hamilton Rating Scale for Anxiety (HAM-A) is a measure of symptoms of anxiety and it consists of 14 items. Scores can range from 0 to 56, with scores from 7 to 17 indicating mild symptoms, between 18 and 24 indicating mild-to-moderate severity, and >25 indicating moderate-to-severe anxiety .The Hamilton Rating Scale for Depression (HAM-D) is a measure of symptoms of depression that is comprised of 21 items pertaining to the affective field. Scores can range from 0 to 54. Scores between 7 and 17 indicate mild depression, between 18 and 24 moderate depression, and over 24 severe depression [The Numeric Rating Scale (NRS-11) is a well-validated instrument for the evaluation of pain intensity. whose scale ranges from 0 to 10 . Respondents are asked to report pain intensity in the last 24 h .The Total Pain Rating Index (T-PRI) from the short form of the McGill Pain Questionnaire (SF-MPQ) is a measure of the quality of pain and it is a multidimensional pain questionnaire which measures the sensory, affective and evaluative aspects of the perceived pain. It comprises 15 items from the original MPQ, each scored from 0 (none) to 3 (severe). The T-PRI score is obtained by summing the item scores (range 0\u201345). There are no established critical cut-off points for the interpretation of the scores and, as for the MPQ, a higher score indicates worse pain .t-test procedure. The significance difference between the recorded medians of the PSQI, ESS, HAM-D, HAM-A, NRS and T-PRI, was measured by the Mann-Whitney Test.Descriptive statistics, including means, standard deviations, medians and the inter-quartile range (IQR) were used to analyse all the socio-demographic and clinical characteristics of the two groups. For the qualitative variables, the significance was calculated by the Exact Chi Square Test. For the demographic numerical variables the significance difference between means was calculated by the parametric two-samples p-value < 0.05 (two-tails) was considered as statistically significant.The addition of the clinical characteristics predictors of a poor QoS in OC survivors, hierarchical multiple regression analyses were performed and unadjusted coefficient estimations were obtained for each predictor. A total of six models was computed. The coefficient estimated for binary variables, such as smoking and alcohol consumption, measures the effect of the Yes response on the outcome estimation. For each model, we reported the adjusted R2 which measures the overall goodness of fit adjusted for the number of variables included into the model. The demographic model (model 1) was performed to test the contribution of the demographic variables to a poor QoS. Next, the clinical model (model 2), the psychological model (model 3), the daytime sleepiness model (model 4) and the pain model (model 5) were each performed after controlling for demographic variables to test the contribution of the clinical variables of the OSCC, anxiety and depression , daytime sleepiness (ESS), intensity and quality of pain  to a poor QoS. Finally, a standard regression analysis (model 6) was computed by entering all the variables simultaneously into the model in order to determine the relative contributions of all the variables to a poor QoS. In all the steps, standard errors of the model coefficients, which measure the statistical precision of the inference estimation of the model parameters, were provided. The IBM SPSS version 22.0 was used to conduct all the statistical analyses in this study, and The demographic characteristics, BMI and habits of the case and control groups are summarized in n = 26) and 46% (n = 24) were male and female for each group, respectively, with a mean age of 59.5 \u00b1 10.1 years for the cases and 65.1 \u00b1 14.4 years for the controls . No statistically significant difference was found in terms of marital status, years of education, BMI or alcohol consumption . However, the number of healthy participants in full-time employment and with a current smoking habit was significantly higher  in comparison to the case group.Of these participants, 54% , especially with respect to hypertension, hypercholesterolemia, prostatic hypertrophy and gastrointestinal diseases . Consequently, the number of OC survivors taking medications, such as angiotensin II receptor antagonists, beta blockers, proton pump inhibitors and statin agents was significantly higher compared to the controls .At the time of the assessment, 66% of the OSCC patients presented with an ECOG performance status of 0 (\u201cfully active\u201d) and 34% with an ECOG performance status of 1 .Among the OC survivors, 52% were poor sleepers (PSQI > 5), whereas only 12% of the controls reported a poor QoS. Moreover, mild to severe anxiety was reported in 84% of the OC survivors  along with mild to severe depression in 74% of cases . On the contrary, only 20% and 18% of the healthy participants showed mild anxiety and depression symptoms, respectively, and no cases of moderate to severe anxiety or depression were recorded in the control group.p-value: 0.017 *), especially for the items \u201csubjective sleep quality\u201d, \u201csleep latency\u201d and daytime dysfunction\u201d , and in the total ESS score  in comparison with the controls. Furthermore, statistically significant higher levels of anxiety and depression, as reflected by the total scores of the HAM-A and HAM-D, were also recorded among the OC survivors , together with higher levels of oral discomfort and pain according to the NRS and T-PRI total scores . Taken together, these findings suggest that QoS and psychological status may be severely impaired in OC survivors.p-values: <0.001 **, <0.001 ** and 0.019 * respectively) but not with the ESS and the NRS. Specifically, the majority of the PSQI sub-items (except for \u201cuse of sleep medication\u201d and \u201csleep latency\u201d) were positively correlated with the HAM-A and HAM-D (except for \u201cuse of sleep medication\u201d), whereas the T-PRI was correlated only with \u201csleep disturbances and daytime dysfunction\u201d which also correlated, as expected, with the ESS. Overall, patients with a poorer QoS presented with higher levels of anxiety and depression and a worse quality of pain but not with increasing daytime sleepiness or pain intensity  and resulted in a strongly significant increase in the coefficient of determination (R2) . The addition of the clinical characteristics showed that the PSQI was positively correlated with alcohol consumption  and with the use of systemic medications . When entering all the variables simultaneously in the second model, we found an increase in the R2 value with a \u2206R2 of 6.2%, possibly due to both the parameters, namely alcohol consumption and medications, although it was not statistically significant . The third model , testing the contribution of anxiety and depression to QoS, showed that the PSQI was positively correlated with the HAM-A and HAM-D  and resulted in a strongly significant increase in the R2 . The daytime sleepiness and pain models (models 4 and 5) did not result in a significant increase in the R2 value . The final full model  in which all of the variables were entered simultaneously  resulted in a moderate increase in the R2 value  and could explain the 44.3% of variance of poor QoS. In this last model, depression has shown a strong correlation to sleep disorders  contributing significantly to a poor QoS.The hierarchical multiple regression analyses predicting QoS are shown in The aim of this study has been to investigate the prevalence of sleep disorders (insomnia and hypersomnolence), anxiety and depression in OC survivors with a 5-year follow-up and to analyze potential predictors in the development of sleep disorders. The detection and treatment of factors which could influence the well-being of OC survivors are becoming increasingly important for healthcare systems in order to improve the follow-up care of these patients.Among this population, insomnia, poor QoS, short sleep duration, excessive daytime sleepiness and sleep-related breathing are commonly reported and tend to become often chronic and pervasive in patients during and after treatment for OSCC .In a recent systematic review, the prevalence of self-reported insomnia (defined with a PSQI cut-off of 5) in patients with head and neck cancer was 29% before treatment, 45% during treatment and 40% after treatment, while the prevalence rate of hypersomnolence (ESS cut-off > 10) was 16% before and 32% after treatment .In this study, a higher prevalence of insomnia among the OC survivors within the 5-year follow-up was found, in comparison with the study of Santoso et al.  as 52% oWith regard to the PSQI components a higher percentage of OC survivors reported an impaired subjective sleep quality, sleep latency, and daytime dysfunction.Pain, fatigue, medical treatment, psychological profile (anxiety and depression) and comorbidities  may causIn a previous study, a lower education level, the presence of systemic comorbidities and the use of systemic drugs, adversely affected quality of life outcomes in survivors of cancer . MoreoveOur results are in line with these studies, suggesting that the use of medications for systemic comorbidities could have a detrimental effect on the life of patients that over time could also influence QoS. However, medications with alcohol consumption contributed to sleep disorders on the account of 6.2% of the variance of poor QoS based on the second model of the regression analysis which suggests that medications may not have a pivotal role in explaining the higher prevalence of sleep disorders in this group of OC survivors, possibly for the absence of sleep disorder breathing and obstructive sleep apnea in our sample.In addition, the low intensity of pain (NRS: 2) reported by OC survivors is considered as a predictor of poor sleep, as suggested by the regression analysis. Although xerostomia was not detected in our sample of patients probably because radiotherapy was prescribed in only 16% (8) of patients, Shuman et al  similarlRegarding habits, alcohol abuse and tobacco smoking might play a role in the development of sleep disorders. Indeed, heavy alcohol users often experience insomnia even after they stop their alcohol consumption, while smokers suffer more frequently from poor sleep, compared with non-smokers ,28. In tWhile in a recent study insomnia and hypersomnolence were found to be associated with chemotherapy and radiotherapy,  in the pPrevious studies have suggested that obesity BMI > 30) is considered a significant predictor of sleep disorders  is consi.Regarding the psychological profile, the current literature has reported a prevalence of anxiety and depression, ranging from 19 to 50%, in cancer survivors, suggesting that the burden of cancer diagnosis and its treatment could have a strong impact on the psychological profile, persisting over time despite a successful operation and subsequently decreasing the quality of life of the affected patients. Moreover, Espie et al. reported that from 22% to 32% of OC survivors were anxious or depressed even ten years after the diagnosis and treatment . As a coIn this study, a higher prevalence of mood disorders has been found in comparison with the current literature; indeed, anxiety and depression were identified in 84% (42%) and 74% 37) of OC survivors, respectively. In addition, in the final full model, depression was found to be the most contributive factor to poor QoS. The higher level of depression may be related to the stress associated with a fear of cancer recurrence, since almost 40% [7 of OC sMood disorders and poor sleep were closely interconnected, as shown by the correlation analysis. In addition, anxiety and depression were predictors of poor sleep, as confirmed by the regression analysis. No differences between male and female patients were detected, and neither the stage and treatment nor the number of operations for cancer recurrence affected the incidence of sleep disorders. In line with previous studies, an impaired mood and sleep affected the functional recovery of patients and their return to work because, despite their age, the majority of OC survivors (48%) had retired.The results of this study suggest that the high prevalence of insomnia may be related not only to psychiatric symptoms or to a fear of cancer recurrence but could also be considered in some cases an independent variable  which needs to be addressed regardless of all the other factors. It is possible to consider that cancer itself can lead to the development of sleep disorders through inflammation. Inflammation has emerged as a crucial pathway which may be especially relevant with respect to cancer survivors. The sleep-wake cycle has emerged as a homeostatic regulator of inflammatory biology in which sleep loss induces an activation of nuclear factor KB (NF-kb)  and circAdequate sleep is a biological requirement for healthy physical, cognitive and psychological functioning so the management of sleep disturbance should be targeted by clinicians with appropriate interventions. In particular, the prominent role of cognitive behavior therapy has been studied . * AdditThe findings of the current study should be understood in the light of some limitations. First, the sample is small and all the patients were recruited at a single hospital, thus preventing the possibility of any geographical generalizability and slightly affecting the power of the regression analyses. Secondly, the exclusion of patients who had developed severe and permanent side effects due to the radiotherapy, may have produced a potential underestimation of the prevalence of sleep disorders in OC survivors. Moreover, the study design does not allow the drawing of any conclusive inferences about the temporality and causality of the relationships between the variables explored. Finally, only subjective sleep quality was investigated in this study, with objective sleep quality not being considered, and therefore additional measurement systems should be incorporated to verify our findings.Sleep disorders (including insomnia and hypersomnolence) continue to be prevalent both during and after treatment for OSCC. A lower level of education, the use of systemic drugs, the consumption of alcohol and the presence of anxiety and especially depression are predictors of poor sleep in OC survivors.The treatment of oral cancer must clearly remain the major goal, but the treatment of any psychological comorbidities is also important in order to improve the quality of life in these patients. Therefore, healthcare professionals should be encouraged to include sleep disorders assessment at the time of diagnosis, during treatment and in follow-up consultations. Further clinical and prospective studies should be conducted not only to evaluate the real prevalence of sleep disorders but also to plan an adequate treatment over time with respect to all OC survivors."}
{"text": "Risk factors for side effects following administration of one of the SARS-CoV-2 vaccines subject to the analysis included being female, young, and suffering from a diagnosed allergy. Our results clearly show that the short-term safety profiles of the eligible COVID-19 vaccines  are acceptable. Nevertheless, the two-dose COVID-19 vaccines available in Poland differ significantly in the frequency of both local and systemic side effects and their intensity. Women, young people, and patients diagnosed with allergies are particularly exposed to the risk of side effects. Further studies are needed to determine the long-term safety profile of COVID-19 vaccines.The aim of the study was to compare the safety profiles  of COVID-19 vaccines  among healthcare workers  administered with a first and a second dose of the vaccines. Another goal of the research was to evaluate potential demographic and clinical risk factors for the frequency and intensity of side effects. A post-marketing, cross-sectional survey-based study was carried out on a sample of 971 respondents , all more than 18 years old, who have taken two doses of the following SARS-CoV-2 vaccines: BNT162b2 (Pfizer\u2013BioNTech) (group 1), mRNA-1273 (Moderna) (group 2), and ChAdOx1 nCoV-19 (Oxford\u2013AstraZeneca) (group 3). A validated, self-administered questionnaire was developed and delivered online to the target population group of healthcare workers. The survey was conducted during the third wave of the COVID-19 (1 February 2021\u20131 July 2021) pandemic. It was based on the CAWI (computer-assisted web interview) method. Questionnaires were disseminated using selected social media. The BNT162b2 (Pfizer\u2013BioNTech) vaccine was the most commonly administered COVID-19 vaccine among healthcare professionals in Poland (69.61%). Side effects following a SARS-CoV-2 vaccine were reported by 53.11% of respondents in group 1, 72% in group 2, and 67.59% in group 3. The following were the most common side effects regardless of the type of vaccine administered: pain at the injection site, headache, muscle pain, fever, chills, and fatigue. The number and intensity of reported side effects following administration of a BNT162b2 (Pfizer\u2013BioNTech) vaccine were significantly lower than in the other two study groups ( The first patient with coronavirus disease 2019 (COVID-19) was identified in China in December 2019 . If adeqEffective vaccines are one of the most significant preventive measures to contain infectious diseases . COVID-1Current evidence on the safety of COVID-19 vaccines relies mainly on data from phase one\u2013three randomized controlled trials and vaccine safety surveillance systems in several countries . In the In Poland, the national SARS-CoV-2 vaccination program includes the use of four vaccines: BNT162b2 (Pfizer\u2013BioNTech), mRNA-1273 (Moderna), ChAdOx1-S (Oxford\u2013AstraZeneca), and Ad26.COV2.S (Johnson Pharm). The National Vaccination Program in Poland, like other government programs in the European Union (EU), has decided to prioritize healthcare workers in receiving the COVID-19 vaccine in the early stages of the national immunization strategy. Therefore, Polish healthcare decision makers have tried to ensure uninterrupted care and protect the most vulnerable patients. On 27 December 2020, the first cohort of health professionals received the COVID-19 vaccine. The implementation of the program began in Poland as a basic anti-COVID-19 strategy established by the Ministry of Health of the Republic of Poland .The long-term effect of mass vaccination programs and related reports on their safety profile obtained from independent studies is also expected to positively impact many healthcare aspects indirectly affected by the COVID-19 pandemic, such as diagnosis and treatment of various conditions.Accordingly, the presented study aimed to evaluate the short-term side effects  experienced after a Pfizer\u2013BioNTech (BNT162b2), a Moderna (mRNA-1273), or an Oxford\u2013AstraZeneca (ChAdOx1 nCoV-19) vaccine among healthcare professionals . Another goal of the research work was to identify selected clinical factors that have a significant impact on the risk of side effects following a SARS-CoV-2 virus vaccination.This post-marketing trial was designed as a cross-sectional survey-based study. The study group consisted of doctors, pharmacists, and nurses registered in the official database kept by the Supreme Chamber of Doctors and Nurses and Chief Pharmaceutical Inspectorate. Three thousand e-mails were sent to the above healthcare workers with a request to join the study voluntarily. The e-mail contained a link to the research questionnaire and all necessary information about the study\u2019s purpose and rules of participation. Moreover, potential respondents were able to download the link to the study questionnaire from the Poznan University of Medical Sciences website promoting our study project. The recruitment process took place during February and March 2021 and was subsequently extended to July 2021. A total of 1130 respondents  were taken into consideration. However, based on the inclusion criteria of the study and incomplete questionnaires by 159 healthcare workers, 971 respondents were finally included in the study. The response rate, defined as the number of adequately completed online forms, was 86% .The study group consisted of 971 respondents , all more than 18 years old, who had taken two doses of the following SARS-CoV-2 vaccines: BNT162b2 (Pfizer\u2013BioNTech), mRNA-1273 (Moderna), or ChAdOx1 nCoV-19 (Oxford\u2013AstraZeneca), within the priority groups from January\u2013April 2021 . A resean = 676):Group 1 ( Respondents vaccinated with two doses of vaccine BNT162b2 (Pfizer\u2013BioNTech) against SARS-CoV-2 virus;n = 150):Group 2 ( Respondents vaccinated with two doses of vaccine mRNA-1273 (Moderna) against SARS-CoV-2 virus;n = 145):Group 3 ( Respondents vaccinated with two doses of vaccine ChAdOx1 nCoV-19 (Oxford\u2013AstraZeneca) against SARS-CoV-2 virus.Patients were divided into three groups:An anonymous questionnaire on Google Forms was constructed based on the scientific literature. It was validated and then implemented with the use of the CAVI (computer-assisted web interview) method. This method was chosen because of the pandemic and the applicable restrictions, to avoid any potential risks to the survey subjects. The Poznan University of Medical Sciences website and social media  were used to distribute questionnaires. Questionnaires were also distributed electronically (by e-mail) throughout the country. The questionnaire was developed following a standardized protocol that consisted of a literature review , focusedDemographic data .Medical anamneses .COVID-19-related anamneses .Vaccine side effects .The questionnaire comprised 25 questions divided into four categories:The questionnaire inquired about the short-term side effects experienced following both doses of a COVID-19 vaccine. The side effects were classified as local or systemic, and their onset, duration, and intensity were self-assessed and self-reported by the participating subjects.The primary outcome was a safety profile assessment . Identification of selected clinical factors that have a significant impact on the risk of adverse effects following the administration of a SARS-CoV-2 vaccine was a secondary outcome.All respondents who qualified for the study completed a safety profile assessment questionnaire for the selected SARS-CoV-2 vaccines twice. The first time was after the first dose of the vaccine and one day before the scheduled second dose of the vaccine. The second time was at least 28 days after receiving the 2nd dose of the SARS-CoV-2 virus vaccine.p) < 0.05. Analysis was carried out using the TIBCO Software Inc. (2017) statistical package. Statistica , version 13. http://statistica.io (accessed on 5 October 2021). All tests were considered significant at p < 0.05.The quantitative parameters were presented using mean value, median, and standard deviation. Categorical data were presented as counts and percentages. A comparison of more than two groups was performed using the Kruskal\u2013Wallis test with the post hoc Dunn\u2019s test. The chi-square test for independence was used to analyze categorical data. In order to evaluate the potential demographic and medical predictors of side effects of administering COVID-19 vaccines, binary logistic regression for the incidence of local and systemic SRAEs was used. The inferential tests were done with the assumption for a confidence interval (CI) of 95% and a significance level of , all more than 18 years old, who had taken two doses of the following SARS-CoV-2 vaccines: BNT162b2 (Pfizer\u2013BioNTech), mRNA-1273 (Moderna) or ChAdOx1 nCoV-19 (Oxford\u2013AstraZeneca).n = 676, 69.61%), 150 respondents (15.48%) were vaccinated with the mRNA-1273 vaccine, while the ChAdOx1 nCoV-19 vaccine was administered to 145 respondents (14.93%). The analyzed groups of respondents did not differ in terms of gender, structure, age, health status, the frequency of presence of comorbidities, the frequency of stimulants use, or the frequency of infection with the SARS-CoV-2 virus (p > 0.05). There were significantly more subjects diagnosed with spine diseases in the group vaccinated with the ChAdOx1 nCoV-19 vaccine  compared with the other two groups . Arterial hypertension was significantly more common in group 3 , while hypothyroidism was substantially more frequent in group 2  (The characteristics of the study respondents are presented in 0.03243) .As a result of the study, we found that the vast majority of respondents in each study group experienced side effects following the administration of one of the three SARS-CoV-2 vaccines subject to analysis. This percentage was highest in group 2 (72%) and lowest in group 1 (53.11%) .In the conducted study, no cases of anaphylaxis, thrombosis, and thrombocytopenia were observed after administering any of the analyzed COVID-19 vaccines .p < 0.00001). A total of 67.59% of subjects in group 3 reported pain at the injection site.The most common local side effects in each study group was pain at the injection site. The above symptom was reported most frequently in the group following administration of the mRNA-1273 vaccine (72%) and least frequently by the group of respondents who had received the BNT162b2 vaccine (53.11%) (The most common systemic side effects following the BNT162b2 vaccine were fatigue (30.18%), headache (28.89%), muscle pain (25%), chills (19.67%), fever (16.57%), and joint pain (9.20%) .The most common systemic side effects following the mRNA-1273 vaccine were headache (50.00%), muscle pain (43.33%), fever (42.67%), fatigue (39.33%), chills (39.33%), joint pain (14.67%), lymphadenopathy (14.00%), and nausea (10.67%) .The most common systemic side effects following the ChAdOx1 nCoV-19 vaccine were fever (51.72%), muscle pain (46.90%), chills (46.21%), headache (42.76%), fatigue (33.10%), joint pain (24.14%), and nausea (11.72%) .p = 0.06056  was reported only by 2.22% of respondents in group 1 and by 4.00% of respondents in group 2,  0.06056 .p = 0. 00009), swelling at the injection site (p < 0.00001), headache (p < 0.00001), muscle pain (p < 0.00001), chills (p < 0.00001), joint pain (p < 0.00001), fever (p < 0.00001), dizziness (p = 0.04945), nausea (p < 0.00001), lymphadenopathy (p < 0.00001), and diarrhea (p = 0.01620). Prevalence of both local and systemic side effects was significantly lower in group 1 (BNT162b2 vaccine) compared with the other two groups (mRNA-1273\u2014group 2 and ChAdOx1 nCoV-19\u2014group 3). Details of the comparative analysis of the incidence of adverse reactions following receipt of one of the three SARS-CoV-2 vaccines are shown in Pearson chi-square comparative analysis on the incidence of side effects between the three types of SARS-CoV-2 vaccines revealed statistically significant differences in the incidence of the following side effects: pain at the injection site (p < 0.00001). Group 1 respondents (BNT162b2 vaccine) reported the least number of side effects\u2014median: 2.00 (0\u20135). The number of side effects in the other two groups was comparable: group 2\u2014median: 5.00 (0\u20137); group 3\u2014median: 5.00 (0\u20136) (p = 0.808387). The number of reported side effects following administration of a SARS-CoV-2 vaccine in group 1 was significantly lower than in the other two study groups (p < 0.00001).We used the Kruskal\u2013Wallis test, to show that the SARS-CoV-2 vaccines analyzed were significantly different in terms of the number of side effects experienced following their administration (p < 0.0001). Respondents in group 3 were significantly more likely to report side effects after receiving only one dose of the ChAdOx1 nCoV-19 vaccine (96.94%) compared with the other study groups . In contrast, respondents in both group 1 and group 2 were significantly more likely to report side effects after both the first and second dose of a vaccine  compared with group 3 respondents (3.06%)  .p = 0.52475)  .p = 0.6647). The mean duration of side effects to one of the three vaccines analyzed was: 2.53 \u00b1 3.09\u2014group 1, 2.31 \u00b1 1.39\u2014group 2, and 2.40 \u00b1 2.84\u2014group 3 . Compared with the other two study groups , group 1 respondents were significantly more likely to assess the severity of side effects as mild (37.40%). On the other hand, in both groups 2 and 3, respondents were significantly more likely to assess the nature of the course of side effects as moderate  and severe  when compared with group 1   .p = 0.0364\u2014group 1; 8.3 \u00b1 2.5 vs. 5.7 \u00b1 3.4, p = 0.0052\u2014group 2). However, no correlation was observed between the confirmed SARS-CoV-2 infection at baseline and the number and intensity of side effects following the administration of SARS-CoV-2 virus vaccines among all study groups (p > 0.005) (In the case of the respondents vaccinated against COVID-19 based on mRNA technology (groups 1 and 2), a relationship between the duration of side effects and the confirmed SARS-CoV-2 infection at baseline was demonstrated. In both study groups, the duration of side effects after receiving the COVID-19 vaccine was significantly longer in people with confirmed SARS-CoV-2 virus infection at baseline than those who did not have a previously confirmed infection  .p < 0.0001), the presence of an allergy (p = 0.005), and respiratory diseases (0.039) significantly influenced the risk of side effects following administration of the BNT162b2 vaccine. The risk of side effects after receiving the BNT162b2 vaccine was highest for women and those with a diagnosed allergy or respiratory disease  and age (p = 0.007) were the two factors significantly affecting the risk of side effects. The risk of side effects after receiving the mRNA-1273 vaccine was highest for women and younger individuals , and nicotine consumption (p = 0.008) significantly affected the risk of side effects. The risk of side effects after receiving the AZD1222 vaccine was highest for younger subjects and subjects with a diagnosed allergy and who did not consume nicotine , the presence of allergies , mRNA-1273 (Moderna), ChAdOx1-S (Oxford\u2013AstraZeneca), and Ad26.COV2.S (Johnson Pharm). A fifth vaccine will soon be available  for which the European Medicines Agency (EMA) has issued a positive scientific opinion for conditional marketing authorization on 20 December 2021 ,18. As oDuring the COVID-19 pandemic, prompt research and simultaneous lack of follow-up time post-vaccination aroused great public concern about the safety profile of vaccine candidates. While rare and non-serious side effects should not derail mass vaccination, a thorough risk-benefit analysis should be done . EMA\u2019s dAccording to the survey the vast majority of healthcare workers in Poland are vaccinated with Pfizer\u2013BioNTech\u2019s BNT162b2 (69.61%). This is due to the fact that Pfizer\u2013BioNTech\u2019s BNT162b2 vaccine was the first to be licensed in the EU, and the Polish government, as part of its strategy to implement a national COVID-19 vaccination program, classified healthcare workers as group 0, i.e., priority in the vaccination order. Furthermore, out of all vaccines available in the EU, the Polish government purchased the most doses of the Pfizer\u2013BioNTech vaccine (42.9 million) . These dIn this study, the occurrence of side effects following a SARS-CoV-2 vaccine administration was reported by 53.11% of respondents vaccinated with BNT162b2 (Pfizer\u2013BioNTech), 72% of those vaccinated with mRNA-1273 (Moderna), and 67.59% of those vaccinated with ChAdOx1-S (Oxford\u2013AstraZeneca). The most common local or systemic side effects regardless of the type of vaccine received were pain at the injection site , headache , muscle pain , fever , chills  and fatigue . These observations are in line with the results reported in phase three clinical trials and vaccine fact sheets ,27,28,29In clinical trials evaluating the efficacy and safety profile of the BNT162b2 vaccine (Pfizer\u2013BioNTech), local and systemic reactions occurring within 7 days of an injection were reported by 66% and 50% of subjects, respectively. The most common side effects in participants aged 16 years or older were pain at the injection site (>80%), fatigue (>60%), headache (>50%), muscle pain and chills (>30%), joint pain (>20%), and fever and swelling at the injection site (>10%) . More BNIn clinical trials evaluating the efficacy and safety profile of the ChAdOx1 nCoV-19 vaccine (Oxford\u2013AstraZeneca), 60% of subjects reported the occurrence of local and systemic side effects. The most commonly reported side effects were tenderness at the injection site (63.7%), pain at the injection site (54.2%), headache (52.6%), fatigue (53.1%), muscle pain (44.0%), malaise (44.2%), fever (33.6%), chills (31.9%), joint pain (26.4%), and nausea (21.9%) . A totalp = 0.435), whereas viral vector-based vaccines caused mainly mild systemic side effects  after both doses. Research conducted in the U.K. and Saudi Arabia also confirms the obtained results [In addition, the results obtained are consistent with previous observational studies conducted in Poland and worldwide. In a Polish study mentioned above, 78.9% and 60.7% of the individuals reported at least one local and one systemic side effect after the first and second dose of the COVID-19 vaccine, respectively . There w results ,27. Both results  and Menn results ,26,27,30This study found that the majority of local and systemic side effects, regardless of the type of vaccine received, were mild to moderate in severity and were usually resolved within 2\u20133 days of their onset. The vast majority of side effects, irrespective of the type of vaccine, occurred on the first day after vaccination. For Pfizer and Moderna vaccines, the highest proportion of subjects reported experiencing side effects after both the first and second dose: 42.94% and 46.30%, respectively. For the Oxford\u2013AstraZeneca vaccine, however, side effects after the first dose were reported significantly more frequently than after the second dose (96.94% vs. 0.00%). It was proved, both in clinical trials and in the real-world data, that side effects associated with the COVID-19 vaccine are mild to moderate ,27,28,29The study found that being female, young, and suffering from a diagnosed allergy are all risk factors for side effects following administration of one of the SARS-CoV-2 vaccines subject to analysis. The obtained results are consistent with both clinical and observational studies ,25,26,27Similar to other medications, allergic reactions can occur during vaccination. While most reactions are neither frequent nor serious, anaphylactic reactions are potentially life-threatening allergic reactions that are encountered rarely but can cause serious complications. Reactions are more often caused by inert substances, called excipients, which are added to vaccines to improve stability and absorption, increase solubility, influence palatability, or create a distinctive appearance, and not by the active vaccine itself. The excipients mostly incriminated for allergic reactions are polyethylene glycol, also known as macrogol, found in the currently available Pfizer\u2013BioNTech and Moderna COVID-19 mRNA vaccines, and polysorbate 80, also known as Tween 80, present in Oxford\u2013AstraZeneca and Johnson & Johnson COVID-19 vaccines . TherefoDifferences in the safety profiles of vaccines should always be discussed in the context of their efficacy. Currently, efficacy data confirm that all available vaccines exceed the 50% threshold set by WHO  and can As of 28 December 2021, a total of 8,687,201,202 vaccine doses have been administered . AnaphylThere is some evidence that two COVID-19 mRNA vaccines (BNT162b2 and mRNA-1273) are safe in certain populations such as pregnant women  immunosuFurther studies are needed to determine the long-term safety profile of COVID-19 vaccines. Further studies will also facilitate improved vaccine recommendations, vaccine safety surveillance systems, monitoring of early COVID-19 vaccine recipients, standardized reporting, and pharmacovigilance mechanisms. Safety issues noted for mass vaccination may have a deleterious impact on the global vaccine supply and the already fragile confidence in vaccines. Government agencies and scientists working on the development of COVID-19 vaccines should widely present any safety issues noted in mass vaccinations in order to reduce public vaccine hesitancy. Mass COVID-19 vaccination seems to be one of the most important ways to allow a worldwide return to normal life.Despite it being pioneering research in Poland to discuss the side effects related to COVID-19 vaccines, there are some limitations. The primary weakness of this study is related to self-reported data and information about COVID-19 vaccine side effects, instead of objective information reported by healthcare workers following formalized, unbiased assessments. The authors expected that healthcare workers were more likely to be cautious about health issues, as compared with the general population, as this group, by default, has adequate levels of health literacy, as well as scientific interest. Another limitation was the predominance of respondents vaccinated by a BNT162b2 (Pfizer\u2013BioNTech) COVID-19 vaccine, which resulted from phase one administration of this vaccine among healthcare professionals in the first weeks of 2021. Such a procedure was ordered by decision makers and public health officials. We decided to conduct this research project as a web-based study to ensure maximum safety for all study participants during the COVID-19 pandemic. Therefore, data were collected online in the form of a self-assessment survey. This might have compromised the inclusion of healthcare workers with limited internet access. However, the presented study is a good source of information on the occurrence of short-term adverse events of the most frequently administered COVID-19 vaccines. Therefore, the presented study meets the information needs of healthcare policymakers and the whole medical community.Our results clearly show that the short-term safety profiles of the eligible COVID-19 vaccines  are acceptable. The incidence, duration, and nature of the severity of side effects reported by the recruited subjects are similar to those reported in clinical trials, indicating all three vaccines have safe profiles. Nevertheless, the two-dose COVID-19 vaccines available in Poland differ significantly in the frequency of both local and somatic side effects and their intensity. Women, young people, and patients diagnosed with allergies are particularly exposed to the risk of side effects. Further studies are needed to determine the long-term safety profile of COVID-19 vaccines."}
{"text": "Similarly, headache is correlated with fever (r = 0.801) and pain at the site of injection (r = 0.868). Overall, it was observed that recipients of the Sinopharm vaccine reported the mildest side effects among all four vaccines. The crucial finding of this study is that the first and second dosage post-vaccination side effects were modest and predictable with no occurrences of hospitalization; this information can assist in lessening vaccine apprehension.Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) created a global pandemic (COVID-19) that has resulted in massive health and economic losses. The current unavailability of treatments leaves vaccination as the only way to control this disease. There are four vaccines  available in Bahrain. This project aimed to study the most common side effects resulting from the first and second doses of these four vaccines. Data were collected through an online questionnaire answered by 311 individuals who received both doses of one of these four vaccines. The results of this study revealed that regardless of the vaccine identity, participants experienced more side effects from the second dose. Among the different side effects, pain at the site of injection was primarily observed after the first dose of the Pfizer vaccine (43%), which was followed by the AstraZeneca vaccine (31%). Moreover, fever was observed in participants after the first dose of the Sputnik vaccine (37%), while headache was mainly observed after the first dose of the Pfizer vaccine (32%). It is important to note that fatigue was observed after the first dose of all four vaccines but was reported by the highest proportion of respondents in the Pfizer group (28%). Interestingly, there are some side effects, such as pain at the site of injection, that are correlated with fever ( The coronavirus disease 2019 (COVID-19) first reported in December in Wuhan, China, as an epidemic ,4,5,6. SIt has been reported that 11,503 clinical studies and 2388 randomized controlled trials (RCTs) were registered for COVID-19 . There were 308 vaccine candidates in different stages of development as of March 2021, with 73 in clinical trials, including 24 in Phase I trials, 33 in Phase I\u2013II trials, and 16 in Phase III development . SeveralThe development of these vaccines generated hope for an end to the COVID-19 pandemic. However, many were afraid of taking these vaccines due to myths, misconceptions, and side effects. Many studies have reported the unique side effects of individual vaccines ,15,16,17Common side effects of the above-mentioned vaccines are pain at the site of infection, fever, headache, fatigue, joint pains, cough, myalgia, and nausea ,17. FollThere is little published data to corroborate adverse responses to the COVID-19 vaccination. Only a few studies discuss the side effects of the Sinopharm vaccines ,23,24,25The Kingdom of Bahrain has approved only four vaccines: the Pfizer-BioNTech vaccine, Sputnik V, the AstraZeneca vaccine, and the Sinopharm vaccine. However, vaccine hesitancy remains high due to concerns regarding vaccine safety, side effects, and effectiveness against the COVID-19 virus. Therefore, this study was designed to determine the side effects of the COVID-19 vaccines provided by the Ministry of Health in the Kingdom of Bahrain. A randomized, cross-sectional study was conducted from 10 April to 15 May 2021, on Bahraini people who were vaccinated against COVID-19. Citizenship, ethnicity, occupation, and location of residence were not considered. Adults (18 years and older) were invited to participate in a self-administered online survey (Google Form) that was distributed through social media platforms . Potential participants were first informed about the study through distribution of a detailed description of the study\u2019s purpose. Then, those who wished to participate were asked to sign a mandatory electronic informed consent form that included statements regarding voluntary participation and anonymity. The participants who took only one shot of vaccine were not included in this study. Three hundred and eleven participants were included in this study, while 24 participants were excluded, as they took only 1 dose of any vaccine. This study was approved by the ethics committee of the Department of Biology. A questionnaire was prepared following a thorough review of the literature on databases including but not limited to Google Scholar and PubMed. The participants were informed in the questionnaire about some medical terms, for example, anosmia (loss of smell), dysgeusia (loss of taste), myalgia (muscle pain), and dyspnea (shortness of breath). This extensive literature review revealed a wide range of potential post-vaccination side effects that were subsequently considered in the design of the survey. Several questions requested demographic information, participants\u2019 general health status vaccination, and pre-and post-vaccination imprints of COVID-19 vaccinations. The survey was developed in English and modified following review by a panel of experts. The poll was translated into Arabic before being testing and distribution.A pilot study was conducted with 40 participants to test the clarity and comprehensibility of survey material. These pilot study participants were not included in the formal evaluation. Survey reliability was determined using the Cronbach\u2019s alpha test of internal consistency. In this study, the test indicated that the survey instrument was generally reliable, with a Cronbach\u2019s alpha of 0.79.The data were categorized based on the type of vaccine and side effects following vaccination, such as headache, fatigue, myalgia, fever, nausea, and injection site pain. The data were stored in Google forms until final responses were downloaded and used for data analysis. Univariate models were applied to estimate the percentage of symptoms reported after receipt. Pearson\u2019s correlation was applied to understand the association between each pair of symptoms. The null hypothesis for the Shapiro\u2013Wilk test confirmed that the data were normally distributed in this sample population. The number of participants was standardized for each vaccine to study the side effects of each vaccine using ANOVA. Another critical side effect that was observed after both doses was headache. The highest proportion of individuals reported headaches after the first dose of Pfizer (32.35%), which was followed by Sputnik (16.67%), whereas only 6% of participants felt headaches after the first dose of AstraZeneca and 8% after Sinopharm. Similar to the previously mentioned side effects, respondents reported less severe symptoms compared to the first dose. It was noticed that the second dose of Sputnik caused a headache in more participants (6.06%) than the other three vaccines . The difFew participants complained of myalgia after either the first or second doses of any of the four vaccines. A small number of participants reported myalgia after the first dose of AstraZeneca (10.3%) and Sputnik vaccinations (7.5%) .It is interesting to note that nausea was observed in participants who received the first doses of AstraZeneca (3.45%) and Pfizer (0.8%), but in the Pfizer group, nausea was observed only after the second dose (1.96%) . The difFatigue was one of the most common symptoms reported after COVID-19 vaccination. Following the first dose, fatigue was reported primarily by those who received Pfizer (28%), followed by Sputnik (20%), then Sinopharm (13%). Notably, very few individuals reported fatigue as a side effect after receiving the second dose of any of the four vaccines . The difr = 0.909). Headache is also correlated with fever (r = 0.801) and pain at the site of injection (r = 0.868). Some symptoms, primarily myalgia and cough, seem to be independent of any other side effect. Pearson\u2019s heatmap was applied to determine the correlation of reported side effects of four COVID-19 vaccines that have been used in the Kingdom of Bahrain. As shown in r = 0.909), headache and fever (r = 0.801), and headache and pain at the site of injection (r = 0.868) In contrast nausea, myalgia, and cough are not associated with other side effects. This study analyzed the side effects of first and second doses of four vaccines that have been used in the Kingdom of Bahrain. The results of this study revealed that the first dose of all four vaccines had more side effects than the second dose of these vaccines. Among different side effects, pain at the site of injection primarily observed after the first dose of the Pfizer vaccine (43.14%) followed by the AstraZeneca vaccine (31.03%). Fever was observed in the highest proportion of respondents who following the first dose of the Sputnik vaccine, while headache was mainly observed after the first dose of the Pfizer vaccine (37%). It is important to note that fatigue was observed after the first dose of all vaccines, most predominantly in individuals who received the Pfizer vaccine (28%). Surprisingly a few side effects are correlated to each other: pain at the site of injection and fever (The topic of this study is crucial due to the prevalence of vaccine hesitancy. It is a time to provide the public with data on the side effects of these vaccines. A few studies have reported on the side effects of a particular vaccine. Minimal reports are available where scientists have compared data on the side effects of four vaccines. The comparative nature of this study will play a key role in alleviating fears about the side effects of COVID-19 vaccines. A comparison of few important studies has been discussed in the Recently reports have highlighted the side effects of the Sinopharm vaccine . These sSeveral studies have reported the side effects of the Pfizer vaccine ,28,29,30AstraZeneca is the third Bahrain-approved vaccine developed to combat COVID-19. Interestingly, a study reported the short-term side effects of Pfizer and AstraZeneca in Saudi Arabia . SimilarThe primarily non-life-threatening short-term side effects reported in this study could help to dispel conspiracy theories and reassure vaccine-apprehensive members of the public of the safety of this vaccine. Nevertheless, there are few limitations of such self-reported online surveys. The reliance of our results on this method could have resulted in information bias due to misclassification of side effects. Furthermore, the sample diversity may differ from the wider public cohort due to the sole inclusion of people with internet access. The sample was not evenly distributed across gender or career, necessitating caution in generalizing the findings. However, these data are instrumental for the vaccine campaign, which is the only solution in the fight against the COVID-19 pandemic. In conclusion, all four vaccines available in Bahrain have short-term side effects that are modest in frequency, mild in intensity, and short-lived. These findings may help to boost public trust in the safety of COVID-19 vaccinations, hastening the immunization process in Bahrain by dispelling misconceptions and conspiracy theories concerning post-vaccination side effects."}
{"text": "Background: Pfizer-BioNTech and Oxford-AstraZeneca are recently introduced vaccines to combat COVID-19 pandemic. During clinical trials, mild to moderate side effects have been associated with these vaccines. Thus, we aimed to evaluate short-term post-vaccination side effects. Methods: Cross-sectional, retrospective study using an online questionnaire was conducted among COVID-19 vaccines recipients in Saudi Arabia. General and demographic data were collected, and vaccine-associated side effects after receiving at least one dose of each vaccine were evaluated. Results: Our final sample consisted of 515 participants with a median age of 26 years. Most of the study participants were female (57%). Nearly 13% of the study subjects have reported previous infections with SARS-CoV-2. Oxford-AstraZeneca and Pfizer-BioNTech vaccines have been received by 75% and 25% of the study participants, respectively. Side effects associated with COVID-19 vaccines have been reported by 60% of the study subjects, and most of them reported fatigue (90%), pain at the site of the injections (85%). Conclusion: Side effects that are reported post Oxford-AstraZeneca and Pfizer-BioNTech vaccines among our study participants are not different from those that were reported in the clinical trials, indicating safe profiles for both vaccines. Further studies are needed to evaluate the effectiveness of the current vaccines in protection against SARS-CoV-2 reinfections. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is a newly identified member of the human coronaviruses family that was discovered during the outbreak of the highly transmissible respiratory disease in Wuhan, China in 2019. SARS-CoV-2 causes the Coronavirus disease 19 (COVID-19) and is now continuing to spread worldwide causing a global pandemic ,4. By thIn our study, we evaluated the short-term side effects after receiving either Pfizer-BioNTech mRNA (BNT162b2) or Oxford-AstraZeneca (ChAdOx1 nCoV-19) vaccines in a sample of 18 years and older citizens and residents of Saudi Arabia.t-test and chi-square test were done for statistical analysis. The data were statistically analyzed using SPSS v.23  with a significance level of p \u2264 0.05. Multivariate logistic regression models were also applied to all symptoms that might be related to the side effects from which we obtained adjusted odds ratio (aOR), 95% confidence intervals (CI).This is a retrospective, cross-sectional, online survey that was conducted over a period of 3 weeks, between 7 April and 28 April 2021, in Saudi Arabia. The vaccination of the general population against COVID-19 in Saudi Arabia was initiated in early 2021 for both Pfizer-BioNTech and Oxford-AstraZeneca vaccines. A dual language (Arabic and English) online questionnaire was designed using Google Forms which was delivered to participants via social media. Additionally, an electronic email was also established and used to facilitate communication between study investigators and participants. Investigators kept careful and frequent verification for the participants\u2019 responses. The study questionnaire was divided into two main sections. The first section was designed to collect general information about the participants such as gender, age, chronic diseases, and infection status with SARS-CoV-2. The second section focused on the COVID-19 vaccine-related data such as type and date of COVID-19 vaccine, the first or second doses, side effects that are commonly associated with the COVID-19 vaccine, timing, and duration of the side effects. In our side effects subsection, we have included the most common side effects which were reported in other studies , includin = 294). Thirteen percent (66) of the study participants have been previously diagnosed with COVID-19. About 86% of the participants denied having a history of any chronic diseases. Most of the participants received Oxford-AstraZeneca (75%), followed by Pfizer-BioNTech (25%). Only 39 (8%) of the participants have received two doses from the same vaccine [Five hundred thirty-three individuals have participated in this study, and 18 of them did not meet our inclusion criteria. Our final sample consists of 515 participants with a median age of 26 years (SD:9) ranging from 18 to 70 years, of whom 57% were female (Three hundred seven of our study participants (60%) experienced side effects due to the COVID-19 vaccines . Nearly p 0.012). It has been reported, either from the trial results or the real-world data, that the side effects associated with the COVID-19 vaccine are mild to moderate [Since the beginning of the COVID-19 pandemic in January 2020, most countries have taken precautionary measures to control SARS-CoV-2 transmission with the hope of rapid production of safe and effective vaccines . Saudi Amoderate ,17,18. IDespite it being one of the few studies in Saudi Arabia that has discussed the side effects related to COVID-19 vaccines, our study has many limitations. The data have been collected by a self-administered online questionnaire and this could result in a reporting bias. Because COVID-19 pandemic and the recommendation to continue the social distancing and the preventive measures in Saudi Arabia, we preferred to conduct this study as a web-based study to ensure the safety of all study participants. Moreover, community-based surveys would be difficult to be done during this pandemic. Therefore, data collection was online as a self-reported survey, and the distribution of this survey depending on the authors\u2019 networks. As such, most of the participants were young. It would be insightful if we included more participants who benefited from the Pfizer-BioNTech vaccine, but the distribution process at the time of the study for the Pfizer-BioNTech vaccine was limited. Furthermore, it was not possible to assess the long-term side effects of the COVID-19 vaccine due to the inaccessibility of the online questionnaire to the participants. However, it would be helpful to assess the thromboembolic profiles and symptoms for the participants to evaluate its association with the current vaccines.In this study, we assessed the short-term side effects associated with COVID-19 vaccines approved for use in Saudi Arabia, Oxford-AstraZeneca, and Pfizer-BioNTech vaccines. We found that most of the participants reported fatigue, pain at the site of the injection, fever, and headache, and they are more common in those after the second dose of the vaccines. Moreover, only a few patients needed to see a doctor or to be admitted to the hospital due to vaccines\u2019 side effects. Fatigue and fever were significantly associated with Oxford-AstraZeneca, compared to the Pfizer-BioNTech vaccine. A follow-up study on a larger population is warranted to evaluate the effectiveness of the vaccines on the control and prevention of SARS-CoV-2 infection as well as the long-term side effects."}
{"text": "These findings were consistent with the results indicated by the clinical trial of ChAdOx1nCoV-19. Logistic regression analysis further revealed that compared to people aged 70 years or above, the incidence of reported side effects was significantly higher in people aged 18\u201330 years (odds ratio (OR) = 8.56), 31\u201340 years, (OR = 5.05), 41\u201350 years (OR = 4.08), 51\u201360 years (OR = 3.77) and 61\u201370 years (OR = 3.67). In addition, a significantly higher percentage of female participants suffered from post-vaccination side effects compared to males (OR = 1.51). It was concluded that the Covishield vaccine was well-tolerated among people of different age groups. Nevertheless, further long-term follow-up study with a larger sample size is warranted to establish the long-term safety of the COVID-19 vaccine.In response to the raging COVID-19 pandemic, Bangladesh started its vaccine administration in early 2021; however, due to the rapid development and launch of the vaccines in the market, many people had concerns regarding the safety of these vaccines. The purpose of this study was to evaluate the side effects that were experienced by the Bangladeshi residents after receiving the first dose of the Oxford-AstraZeneca\u2019s Covishield vaccine (ChAdOx1nCoV-19). The study was conducted using both online and printed questionnaires and the data were analysed using SPSS. The results included the responses of 474 vaccine recipients from March\u2013April 2021. Pain at the site of injection, fever, myalgia, fatigue and headache were the most commonly reported symptoms, and the overall side effects were found to be significantly more prevalent in the younger population ( The world has been going through a global crisis since early 2020 due to the COVID-19 pandemic, which is caused by the newly discovered coronavirus, namely, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) . FollowiAlthough the treatment of COVID patients with broad-spectrum antibiotics and antivirals has led to the recovery of patients to some extent, many of them have faced severe adverse effects. Therefore, many pharmaceutical companies and research centers have been racing to develop safe and effective vaccinations to tackle the pandemic . AccordiAfter the arrival of the first shipment of Oxford-AstraZeneca\u2019s Covishield vaccine (ChAdOx1nCoV-19) in Bangladesh on 25 January 2021, a countrywide COVID-19 vaccination campaign was initiated on 7 February 2021, with the target of inoculating 3.5 million people in the first month . MoreoveIn the UK, Brazil and the United States, phase 3 trials with ChAdOx1 nCoV-19 are being conducted to examine the vaccine\u2019s effectiveness and safety and the interim analysis of these ongoing trials indicates that it has 70.4% efficacy against symptomatic COVID-19 after completion of a two-dose vaccination ,12. HoweTherefore, it is important to assess any major side effects or undesirable consequences that may occur as a result of the vaccination programs. If no serious side effects of Covishield can be established, then people with low confidence about the COVID-19 vaccine would be more willing to participate in this immunisation program, making it easier to reduce the pandemic by preventing the vulnerable population from infection and disease and stop further transmission of this disease ,15. WithThe purpose of this study was to assess the short-term side effects that were experienced by the recipients of the first dose of Oxford-AstraZeneca\u2019s Covishield vaccine in Bangladesh.A cross-sectional study was conducted among Bangladeshi residents who were aged more than 18 years and who had received the first dose of the Covishield vaccine. To carry out this study, a questionnaire, both in English and Bengali, was developed and was made available on the Google platform. Printed copies were also used to collect data. The questionnaire was pre-tested for validity by conducting a pilot study. The respondents voluntarily participated in the study without any incentives. Each participant was allowed to provide a response only once. In some cases, multiple responses were allowed to gather data from elderly people with technical difficulties. All responses were reviewed carefully to eliminate any discrepancies. Data were collected for 1 month from 6 March to 8 April 2021.The survey consisted of three categories of questions. The first category included the socio-demographic data of the respondents. The second category focused on the perception of the participants towards COVID-19 vaccination. The last segment comprised the vaccination-related data. The side effects were selected according to the side effects observed in the clinical trial of the ChAdOx1nCoV-19 vaccine .Residents of Bangladesh who had received the first dose of the Covishield vaccine were included in the study. People who were not vaccinated against COVID-19 were excluded from the study. By using the Raosoft sample size calculator, the minimum required sample size for conducting the study was found to be 385, considering a 5% margin of error and 95% confidence interval. In the present study, in total, 474 participants who satisfied both the inclusion and exclusion criteria were purposively selected and their responses were subjected to statistical analysis.2) test. Additionally, a logistic regression analysis model was carried out via the \u201cEnter\u201d method to determine the influence of the different demographic characteristics on the presence of individual side effects.After the data collection, it was cleaned and coded using MS Excel and statistically analysed using SPSS v. 25. All data obtained from the 474 participants were subjected to descriptive statistical analysis. Associations of the number of side effects with different demographic groups were analysed using the chi-squared  and the rest were female . Regarding the age groups, the highest number of respondents was from the 41\u201350-year-old group (33.3%) and the lowest number was from the 70+-year-old group (3.6%). Almost 71.3% of participants achieved university or post-university education levels. The study population comprised 34.4% that were either a teacher or a student, 20.7% were service holders, 19.6% were housewives, 12.4% were business holders, 5.1% were healthcare workers, 5.3% were unemployed and the rest included a small percentage of other occupations. Most participants received their vaccines from vaccination centres located in Dhaka (50.6%), 23.4% from Khulna and 10.8% from Rangpur . Among the others, the majority of the respondents reported hypertension (33.3%), diabetes (24.5%), heart disease (8.4%) and lung disease (8%). About 45.1% had a history of allergic reactions to various allergens, such as the cold (19%), dust (31%), food (14.3%), insects (2.1%) and drugs (0.8%), which were associated with common symptoms, such as sneezing, coughing, itching, swelling, runny nose and shortness of breath.n = 29) had a history of confirmed COVID-19 infection, while 6.8% (n = 32) suffered from COVID-19 like symptoms prior to vaccination , swelling , itching , irritation at the site of injection  and a burning sensation . The solicited systemic side effects included fever or feeling feverish , myalgia , fatigue , a headache , drowsiness , dizziness , joint pain , nausea or vomiting , diarrhea  and a rash . A considerable percentage of vaccine recipients did not complain about any sort of side effects   .After receiving the vaccine, allergic reactions were experienced by 7% of recipients, which were mainly comprised of a cold (5.5%), coughing (3.6%), fever (5.5%), itching (6.5%), swelling (2.3%) and shortness of breath (2.1%). About 37.6% of vaccine recipients had to take some sort of medication for alleviating the adverse effects. Paracetamol was the most used (36.7%), followed by antiallergic drugs (1.7%), and only 1.9% of recipients required hospitalisation .p = 0.016), where female vaccine recipients had a 1.5 times higher chance of showing side effects compared to males (p = 0.067) (A chi-squared test was performed to assess the association between the number of post-vaccination side effects and the different demographic characteristics of the participants . A signi= 0.067) .p = 0.02) between the number of side effects reported by the different age groups of participants (p \u2264 0.05)  . This mep > 0.05).No significant association was found with participants\u2019 educational qualification, occupation type, body mass index (BMI), presence of comorbid conditions or previous history of COVID-19 infections (p = 0.008). Female participants (21.8%) experienced significantly more fatigue compared to male participants (14.6%) (p = 0.044).A chi-squared test was also performed to find out the association of individual side effects with gender and age . Fever wp \u2264 0.05). In the age group of 18\u201330 years, headache and drowsiness were experienced more than the other groups (p \u2264 0.01)  . No signThe unprecedented pace at which COVID-19 vaccines were developed had heightened the already existing vaccine hesitancy among general population, and further aggravated by the unregulated circulation of conspiracy theories and misinformation in the social media. Hence, research publications and information regarding the safety and efficacy of these vaccines are highly called for to prevent vaccine-related misconception and promote uptake of available vaccines . After ap = 0.016). This pattern was not particularly reported in the clinical trials of Oxford/AstraZeneca. However, this is similar to the trend displayed by adverse vaccine event monitoring studies of Pfizer-BioNTech vaccine in Saudi Arabia and other vaccines in general [The study revealed that a significantly greater number of female participants suffered from post-COVID-19 vaccination side effects compared to males . This finding is in congruence with the results of Oxford AstraZeneca\u2019s clinical trial [In this study, the majority of the participants were aged 40 years and above (73%). The 166.3 million Bangladeshi population comprises 68% of people between the ages of 15 and 64 years and about 5% of people above the age of 65 years . Initialal trial . Similaral trial , and wital trial ,28. Thisal trial , which eAbout two-thirds of vaccine recipients (69%) mentioned that they were confident regarding the vaccine\u2019s efficacy, which is similar to the finding by another recent study in Bangladesh, where 67% of respondents believed that the vaccine would work against COVID-19 infection  Figure b. The maThis study focused on the short-term side effects following the first dose of the COVID-19 vaccine because very few people had received the second dose at the time of the study. Moreover, this study only described self-reported side effects from the respondents and, because of purposive sampling, the generalisability of the study\u2019s outcome might be affected. A further study with a large and representative sample is therefore recommended.Overall, the short-term side effects following the administration of the first dose of the Covishield vaccine were common but not life-threatening and the findings were consistent with the clinical trial results. Despite the higher level of side effects reported by adult women and younger populations, the vaccine had generally been well-tolerated among the different age groups of people. At the time of this study, only Covishield was being administered in Bangladesh; hence, further studies comparing both the short- and long-term side effects of the different types of COVID-19 vaccines are recommended. This might help to curtail the vaccine misconceptions and fears among the general population, encouraging more people to participate in the mass vaccination program in the coming days."}
{"text": "Due to the theragnostic potential of mesoporous silica nanoparticles (MSNs), these were extensively investigated as a novel approach to improve clinical outcomes. Boasting an impressive array of formulations and modifications, MSNs demonstrate significant in vivo efficacy when used to identify or treat myriad malignant diseases in preclinical models. As MSNs continue transitioning into clinical trials, a thorough understanding of the characteristics of effective MSNs is necessary. This review highlights recent discoveries and advances in MSN understanding and technology. Specific focus is given to cancer theragnostic approaches using MSNs. Characteristics of MSNs such as size, shape, and surface properties are discussed in relation to effective nanomedicine practice and projected clinical efficacy. Additionally, tumor-targeting options used with MSNs are presented with extensive discussion on active-targeting molecules. Methods for decreasing MSN toxicity, improving site-specific delivery, and controlling release of loaded molecules are further explained. Challenges facing the field and translation to clinical environments are presented alongside potential avenues for continuing investigations. Small molecule approaches to diagnostic and therapeutic procedures suffer from multiple shortcomings, such as off-target toxicity and rapid clearance from the body. Boasting the ability to simultaneously diagnose and treat patients, theragnostic (a.k.a. theranostic) nanoparticles (NPs) emerged as a rapidly developing technology for overcoming these obstacles and enhancing clinical outcomes. In particular, mesoporous silica nanoparticles (MSNs) demonstrate a significant potential  to becomPairing with appropriate gatekeeper molecules can trap encapsulated molecules within the MSN pores, allowing for efficacious cargo release. In addition, the gatekeeper provides surface functionalization to prevent toxicity. These gatekeeper mechanisms protect the nontarget tissues\u2014in the host environment\u2014from loaded molecules, while simultaneously protecting the loaded molecules from the environment. This two-way shielding provided by MSNs allows for in vivo delivery of small molecules that, alone, would be clinically ineffective as a result of their high hydrophobicity or toxicity .The multifunctional nature of MSNs largely stems from the numerous surface modifications they can undergo. As mentioned, many different gatekeeper molecules can be employed to the encapsulated molecules loaded into MSN pores. These gatekeeper molecules can be chosen or designed to respond to disease-specific stimuli, thus, controlling the release of loaded molecules and limiting off-target delivery . The orgCompared to the number of preclinical studies, very few silica-based nanomedicine approaches were FDA approved for clinical trials ,6. ContiWhile many reaction pathways might be used ,8, MSNs Strategically tailoring MSN surface-oriented functional groups provides avenues to better control interfacial interactions, while offering additional functionality like drug loading and insertion of targeting domains. Both chemical treatment and polymer grafting strategies are widely used approaches for chemically or morphologically modifying MSN surfaces ,21. SelfBeyond the impact of polymeric, gatekeeper, or active targeting molecules, innate properties of the core MSN serve as key predictors of physiological fate. Prior to administration, complete characterization of MSNs is critical to approximating MSN behavior and correlating the theragnostic effect. Some of the common methods for verifying MSN properties by analyzing synthesized particles are dynamic light scattering (DLS)  and tranSeveral organ systems within the body possess structural or functional filtration abilities. For example, the glomerular layers of the kidney are responsible for filtering foreign and waste products that are smaller than approximately 5 nm ,26. SimuWhile control of the MSN size is primarily accomplished prior to treatment, it is critical to consider the fact that significant changes in the nanovehicle size might occur from physiological reactions in vivo. Following intravenous administration, MSNs are exposed to numerous proteins in the blood. Under certain conditions, these proteins can irreversibly bind the MSN surface through a process termed as opsonization ,40. The The final shape of the MSN core plays a similarly critical role in physiological fate and in vivo MSN behavior. MSNs are most commonly shaped as spheres or rods. The final shape primarily depends on the identity and volume ratio relative to water, in the cosolvent used during the sol\u2013gel reaction . The aspMSN porosity is characterized by the shape, diameter, and number of pores. Pore shape is primarily determined by the cosolvents used during synthesis. The standard honeycomb pore shape is produced when strong bases such as NaOH are used for the cosolvent ,62. WormThe major function of MSNs is the specific delivery of encapsulated cargo to a target location in vivo. To incorporate specificity, often a stimuli-sensitive gatekeeper is added to the surface of the MSNs. In addition to providing stimuli-responsivity for cargo release, the gatekeeper has the capability to circumvent toxicity. As the major benefit of the mesoporous nature of the MSNs allows for release of a cargo in conjunction with a particular disease, the MSN should have a gatekeeper on the surface of the MSN to allow promotion of site-specific drug/dye release. While non-coated MSNs reportedly induced proinflammatory and toxic responses, notably through accumulation in the liver and kidney ,68, non-2 form, or as a series of siloxanes . Additionally, hydrogen bonds can form between silanols, based on group density, forming vicinal silanol groups [The primary functional group present on unmodified MSNs is silanol, which has the general form \u2261Si-OH . The sill groups ,71. At pl groups . NPs witl groups ,74. Thisl groups ,75,76. Tl groups ,78. The l groups . UnsurprFunctional group modification is assessed as a method for altering MSN cellular interactions. For example, silanol groups can be replaced with the amine functional groups for the net positive surface charge . MSNs poMaintaining non-toxicity of MSNs is crucial in the pursuit of clinical adaptation. Thus far, MSN coatings focus on alternative uses for the biocompatible materials used in applications such as wound healing  or topicOften, polymer synthesis strategies rely on controlled radical polymerization (CRP) techniques, which allow for the controlled design of polymer architecture, chain length, branching, functionality, tacticity, stereochemistry, and composition, among other features. CRP strategies also retain functional end groups with high fidelity ,101,102,Besides altering the MSN surface chemistry, conjugation of organic molecules (such as polymers) to the surface of MSNs is a common strategy for limiting unfavorable MSN\u2013host interactions. Conjugated molecules impart addition functions to MSN nanovehicles, including gatekeeping and active targeting. Some modifications are performed to protect the NP from the host, or vice versa. The most common example of such a molecule is PEG, whose biocompatibility was demonstrated in numerous NP formulations . While PPolymers, polysaccharides, and other organic-based molecules added to the surface of MSNs can substantially alter interactions between the host milieu and the NP, resulting in reduced toxicity. These surface coatings or gatekeeper molecules must exhibit significant biocompatibility and negligible toxicity. Specific assessment of toxicity for gatekeepers was performed for select molecules, including chitosan ,116, polGiven the porous nature of MSNs and the potential toxic effects associated with the exposed functional groups, additional chemical and structural mechanisms are needed to both encapsulate molecules loaded into MSN pores and to limit unfavorable interactions between the MSN surface and the host. These \u201cgatekeeper\u201d systems, commonly comprised of organic polymer networks, facilitate release of loaded molecules, once the MSNs reach the target location or cell. Additionally, they serve as a surface onto which other molecules, such as active targeting ligands, could be conjugated. A selection of polymeric gatekeeper molecules that demonstrated stimuli-specific response in preclinical studies are provided in Controlled release of encapsulated molecules is triggered by cell- or site-specific stimuli that changes the gatekeeper system, exposing the pores of the MSN. Any loaded molecules would then diffuse out of the MSN into the target environment. Appropriate selection of gatekeeper molecule requires knowledge of any internal stimuli produced in the target cell or environment that the gatekeeper would respond to. While common stimuli are found internally, external stimuli provided by clinicians might also be used after sufficient accumulation of MSNs at the target site. Given the extensive and ever-growing number of possible gatekeeper molecules, it is more valuable to consider the methods of triggering gatekeeper stimuli-specific response. Upon identifying the stimuli that matches the target disease, an appropriate gatekeeper can be used in formulating the MSN nanovehicle.The altered metabolic behavior of malignant cells results in the synthesis of acidic byproducts that are transported to the extracellular environment . This ph2+ and CO32\u2212 ions in acidic pH [Chitosan is successfully used as a pH-sensitive gatekeeper in several MSN preclinical model studies ,120,121.cidic pH .While pH-response can preferentially increase delivery to preferred tissues, it is fundamentally a non-specific targeting strategy that can be neutralized by changes in pH. Any change in the pH of the suspending solution would induce release of the loaded molecules. Gatekeeper motifs can be constructed to break down in the presence of more specific stimuli, such as enzymes. Malignant cells often overexpress enzymes that promote proliferative or metastatic behavior . These eAs with pH-sensitive gatekeepers, many molecular networks stimulated by enzymes comprise polymers. Hyaluronic acid (HA) is a common example used in MSN formulations. HA is advantageous as it serves as both an active targeting molecule that binds to overexpressed CD44 and as a gatekeeper molecule whose dissociation is catalyzed by the lysosomal enzyme hyaluronidase . CD44 isInteractions between gatekeeper molecules and small molecules within the tumor cell or microenvironment can also stimulate controlled release of encapsulated molecules. Glutathione (GSH) is one such small molecule, residing in many tumor cell types at high concentrations, relative to healthy cells . GSH worWhile internal stimuli are abundant in vivo and provide overall ease of clinical application, external stimuli were studied as a means of controlling release from MSNs. These stimuli must be provided by clinicians following administration of MSNs. Further, pharmacokinetic considerations are necessary to apply external stimuli at times when MSN accumulation in target tissue is high. Multiple gatekeeper formulations requiring external stimuli were paired with MSNs. Primarily, these gatekeepers are thermosensitive in nature, requiring an increase of site-specific in vivo temperature . InductiPoly(N-isopropylacrylamide) (PNIPAM), the most studied temperature-sensitive polymer evaluated for biomedical and drug delivery applications, displays a lower critical solution temperature (LCST) at 37 \u00b0C ,143,144.For any NP to be clinically effective, it must reach the target site being sequestered in off-target tissue or otherwise cleared from the body. To accomplish this goal, multiple disease-site targeting strategies were implemented in preclinical nanomedicine studies. The primary options could be divided into three categories\u2014passive targeting methods, which take advantage of innate behaviors and characteristics of diseased tissue ; active Diseased tissues are frequently characterized by the gaps between endothelial cells. These gaps increase endothelial permittivity to large particles, such as NPs, while having no effect on the extravasation of small molecules . SubsequN-succinimidyl  cyclohexanecarboxylate contains a reactive amine group that forms maleimide bonds with thiol groups, such as those found on the amino acid cysteine [Malignant cells possess different characteristics than healthy tissue. Examples of such traits include altered metabolism, under- or overexpression of proteins and signaling molecules, or changes in gene expression. Conjugating molecules that selectively respond to these specific markers onto NP surfaces allows for active targeting of diseased cells. Attaching the MSNs to the targeting ligands can occur by multiple strategies. For example, reagents containing functional groups can be attached to MSN surfaces. These selected reagents should possess reactive functional groups that promote bond formation with the specific targeting ligand of interest ligands. For example, cysteine . Functiocysteine . Non-checysteine .Employing active targeting strategies significantly enhances NP accumulation near and engulfment by target cells. Several molecules were used to actively target MSNs to specific cells. While most such options utilize specific ligand\u2013receptor interactions, a few unique cases warrant special attention. A discussion of different active targeting molecules with apparent advantages and disadvantages is provided. For additional reference, The most prevalently used proteins for active targeting in nanomedicine, as well as for NP-free cancer therapies, are monoclonal antibodies (mAbs). Separate from NP applications, mAbs are well researched and clinically used against a myriad of diseases, for decades ,223,224.To overcome the size obstacle experienced with mAbs while still taking advantage of antibody targeting capabilities, antibody antigen-binding fragments (Fabs) can be used ,232. Fabv\u03b23 integrins [Similar to proteins, peptides possess the ability to selectively interact with diseased tissue cells. The primary advantage peptides have over whole proteins is their much smaller size. The smaller size promotes a more favorable ligand:NP ratio, and subsequently, a more favorable ratio of targeting ligand to target. Smaller size does impart some disadvantages, including high hydrophobicity and a lack of secondary structures, which result in less overall stability as compared to whole proteins ,235. Manntegrins ,240, arentegrins . The abintegrins ,244,245.Ligand\u2013receptor targeting is not the only method through which diseased cells might be distinguished from healthy cells. Often, diseased cells will alter the microenvironment in which they reside. For example, tumor cells increase the acidity of their extracellular environment from pH 7.4  to between pH 6.0\u20136.8 ,246. LarAnother technique for targeting diseased cells uses cell-penetrating peptides . Commonly derived from natural sources such as viruses, CPPs can act on cells in many ways. CPP action is typically independent of receptor-specific interactions. Their mechanisms does depend on the target cell type or molecules the CPPs might be carrying, among other factors ,257. CPPMSNs might also be functionalized with aptamers, short strands of DNA or RNA that can recognize and interact with malignant cell markers ,260,261 The examples presented thus far demonstrate the targeting effectiveness of large biomolecules. While these larger molecules comprise a significant majority of applied active targeting strategies, small molecule approaches can also be used in targeting diseased cells . The choBeyond physiological or molecular targeting options, magnetic manipulation of metallic agents can be used to induce NP accumulation at target sites. By applying magnetic fields around the desired site, NPs are attracted to the area, remaining in the tissue long enough for their action (such as delivery of loaded molecules) to occur. SPIONs are the primary component for magnetic targeting. While many approaches use such NPs alone or modified , MSNs caFor all the advantages that MSNs possess, several challenges need to be overcome prior to clinical translation. First, more human trials are needed to test the toxicity and clinical efficacy of agents that were shown to have more therapeutic potential than the lone molecules in preclinical animal models. The nature of passive targeting by the EPR effect in humans must be better understood to ensure a greater clinical effect of NP treatments . This isMSNs serve as a multifunctional platform for theragnostic nanomedicine. Innately, MSNs possess high loading capacities, stable porous structures, and high surface-to-volume ratios. Together, these characteristics provide a strong foundation for MSN encapsulation of drug or dye molecules, or even other smaller NPs. By tailoring the MSN properties during and after synthesis, in vivo behavior and clinical efficacy might be optimized. Surface modification of functional groups or application of gatekeeper molecules might prevent toxic interactions between the MSN core and the host environment. Simultaneously, the gatekeeper controls the encapsulation and release of loaded molecules in a stimuli-specific manner. The ability to functionalize MSNs with various targeting options is also highly favorable for enhancing clinical outcomes. Many active targeting strategies demonstrated significant preclinical potential with MSNs, with limited off-target accumulation. Based on the current body of evidence, MSNs that are within the 20\u201380 nm diameter range paired with stimuli-responsive gatekeepers and active targeting moieties, might operate as the most clinically beneficial formulation. As research continues to address the apparent presented obstacles, MSN formulations will see growing prominence in clinical nanomedicine, which might correlate to enhanced clinical outcomes and patient care."}
{"text": "We investigated risk factors associated with COVID-19 by conducting a retrospective, frequency-matched case-control study, with three sampling periods (August\u2013October 2020). We compared cases completing routine contact tracing to asymptomatic population controls. Multivariable analyses estimated adjusted odds ratios (aORs) for non-household community settings. Meta-analyses using random effects provided pooled odds ratios (pORs). Working in healthcare , social care  or hospitality  were associated with increased odds of being a COVID-19 case. Additionally, working in bars, pubs and restaurants, warehouse settings, construction, educational settings were significantly associated. While definitively determining where transmission occurs is impossible, we provide evidence that in certain sectors, the impact of mitigation measures may only be partial and reinforcement of measures should be considered in these settings. Non-pharmaceutical interventions (NPIs) play a critical role in the COVID-19 response, and are likely to remain important interventions for infection control despite high effectiveness of vaccines , 3. SomeThe risk of transmission of SARS-CoV-2 is highest in household settings, particularly in multioccupancy households mainly due to the high number of close contacts . CertainWe conducted three a case-control study in England with three sampling periods between August 2020 and October 2020 with the aim of developing improved understanding of settings and activities potentially associated with transmission of COVID-19 in England. The studies focused on non-household activities.We conducted a retrospective case-control study, frequency-matched for age group  and geographical region  to ensure a representative sample of controls and to account for regional variations in restrictions to activities. The study had three sampling periods: August, September and October 2020. The study population consisted of adults (aged 18 years or over) resident in England. Cases were individuals who had tested positive for SARS-CoV-2 and completed the NHS Test and Trace (NHS T&T) contact tracing questionnaire, and who were not reported to NHS T&T as household contacts of a confirmed case. Cases were randomly sampled based on these criteria from the NHS T&T database. Controls were members of the public, registered as volunteers for a market research panel. Controls were excluded if they had tested positive for SARS-CoV-2 or reported COVID-19 symptoms in the 7 days prior to completing the survey. A power calculation was performed for the initial sampling period and used for further samples without further refinement. With a false-positive error probability of 0.05, a total sample size of 4000 subjects, a 1:1 ratio of controls to cases and a minimum important odds ratio of 2, each sampling period had a power of \u22650.9 for exposure proportions of \u22650.02 in the control group.We introduced pragmatic plausibility thresholds for numbers of different activities reported, and excluded individuals who reported high numbers of different types of workplace exposures that appeared unrealistic, likely representing reporting errors .A different sample of controls was obtained for each study period. The sampling periods were late August 2020, late September 2020 and late October 2020, for sampling periods 1, 2 and 3, respectively. Case data were collected as part of routine contact tracing, where cases provide the information either through a digital route (self-completed) or through telephone interview with a contact tracer. The contact tracing programme completion rate for cases during the three study periods was 82.7%, 76.8% and 85.0%, respectively .Information on individuals' activities (exposures) was collected in a structured manner with any activity categorised by three nested levels providing increasing level of detail on activities. The highest level (Level 1) categorises the exposures to work and education activity, or leisure activities. The further information includes sectors, for example, educational, or hospitality setting. The most granular level (Level 3) of categorisation describes the workplace or the setting in more detail, for example, a pub or bar, or a secondary school. An example of this three-level structure for an exposure event associated with working in a warehouse is: Level 1 (least granular): \u2018work or education\u2019; Level 2: \u2018warehouse or distribution\u2019; Level 3 (most granular): \u2018warehouse\u2019.Controls completed an online survey with the same exposure questions structured identically to the case questionnaire. We used the postcode of residence of the cases and controls to adjust for socio-economic deprivation using the Index for Multiple Deprivation (IMD) .P values  were calculated.Cases and controls were described according to their demographic characteristics . Single variable (logistic regression) analyses were undertaken to estimate unadjusted odds ratios (uORs) as crude measures of association between exposures (non-household activities) and outcome (confirmed COVID-19). Confidence intervals (CI) and Sampling periods had a number of settings in which the number of individuals reporting \u2018exposure\u2019 was small, leading to the phenomenon of separation. We used the Firth correction  to obtaiInitially a random-effects meta-analysis was used to combine the estimated odds ratios from the multivariable analyses using sector-level exposures. Further meta-analyses explored the associations of the granular level workplace activities. The sector level exposures were broken down to their most granular level (Level 3) if the sectors showed evidence of a risk association  in all three study periods, or a trend of a substantial increase in the observed odds over the three periods. Other exposures were included as sector-level exposures.Across the three study periods, a total of 12\u00a0338 individuals were included, of which 6000 were cases. Overall, 3214 (54%) of cases self-completed contact tracing using the digital route, with limited variation between study periods (period 1: 1129 (56%); period 2: 964 (48%); period 3: 1121 (56%)). Females were overrepresented: 6926 (56%) individuals, of which 3268 (47%) were cases. Across the study periods, cases reported fewer activities  than controls . There was a greater proportion of individuals in the control group that were of white ethnicity (83%) compared to the cases (65%), although ethnicity was not recorded in 9% of case respondents. A greater proportion of cases lived in areas of low deprivation (17%) than controls (12%), although deprivation score was unknown for a large proportion of control respondents (11%). Case and control distribution was largely similar for all other demographic variables .Table 1There was statistical evidence that working in social or domiciliary care, health care or hospitality was associated with being a COVID-19 case in all three study periods . AdditioWe did not observe any substantial differences in uOR for point estimates obtained for level 2 workplace exposure groups using only cases completing contact tracing by the two different routes; across all three study periods: median difference\u00a0=\u00a00.29 (interquartile range 0.12\u20130.67) (full results not shown). Although some changes in statistical significance were seen when comparing these uOR, there was no change in the direction of the association (i.e. odds ratios both <1 or >1).All multivariable analyses were adjusted for age, sex, ethnicity, socio-economic deprivation (IMD), geographical region and leisure activities. All three study periods showed an association between working in healthcare, social care or hospitality, and becoming a COVID-19 case . WorkingI2\u00a0=\u00a078%, P\u00a0<\u00a00.01). A similar pattern was also observed in construction , and in educational settings   2.87; aORs 2.81, 2.72, 3.08, for studies 1\u20133 respectively), social care  or hospitality  were associated with increased odds of being a COVID-19 case. There was also evidence that working in a warehouse setting was associated with increased odds . The aORs for the association between warehouses and the odds of infection showed a substantial increase over the three study periods, also indicated by the evidence of heterogeneity between the observed aORs (ctively) .Fig. 2.I2\u00a0=\u00a069.4%, P\u00a0=\u00a00.04) (We explored the association between work-related exposures and infection using more granular level information on work activities . There w\u00a0=\u00a00.04) .Fig. 3.We observed important associations between certain occupations and SARS-CoV-2 infection. The associations between being a COVID-19 case and working in health and social care, hospitality, education or warehouse settings persisted over the three study periods. The findings highlight that infection control measures may have only a partial effect on reducing transmission in some workplace settings.The findings on hospitality, primarily working in bars, pubs or restaurants, are supported by the accumulating evidence on the risk of COVID-19 associated with these settings from other countries , 20, 21.The associations between certain settings and the odds of infection can only occur when there is an opportunity for the activities to take place. These opportunities are largely affected by NPIs, which in England have varied by geographical region and over time. It is therefore not surprising that, for example, the association between educational settings and increased odds of becoming a COVID-19 case was not observed in the first study period when most educational settings were closed. Educational settings have been associated with outbreaks , 15, andOur findings on the associations between infection and working in manufacturing, construction and warehouse settings are consistent with the most commonly reported outbreak settings in European countries , Canada The findings regarding the association observed between working in healthcare  and social care settings (primarily driven by exposure in care homes) and being a COVID-19 case were expected. These settings were closely associated with transmission in the first wave of the epidemic and, despite the appropriate use of personal protective equipment, healthcare workers experience high COVID-19 infection rates \u20139. Our sPublic health guidance and advice to reduce the risk of transmission in workplace settings have been published in England  and mitiOur study has a number of limitations. Across all three study periods, cases reported fewer exposures than controls. Cases are often first identified as contacts of other cases and it is possible that people modify their behaviour as a result. It is also possible that multiple biases affect the responses provided. One plausible explanation for this is that the cases going through the NHS T&T questionnaire may be experiencing high levels of questionnaire fatigue due to the length of the questionnaire. While the structure of the control survey (for exposures) was designed to be as identical to the case questionnaire as was practical, cases were required, as part of routine contact tracing, to provide considerable additional non-exposure information . It is also possible that cases may feel inclined to adhere to socially desirable reporting, and not report activities they perceive would not be socially acceptable in the context of the pandemic. This differential misclassification of exposure most likely biased the effect measures towards the null, hence the results described are more likely to be underestimates rather than overestimates. There is also a potential for selection bias. As of the end of the study period three, altogether 630\u00a0309 cases were reached by contact tracing, with 82% of cases transferred to NHS T&T being reached by contact tracing . This vaThis study took place in the context of COVID-19 pandemic response when there was an urgent need to provide timely evidence on the risks associated with community exposures. The findings from these sampling periods provided evidence which together with the wider pool of evidence was used to inform risk assessments, policies and targeted public health action in the operational context of the pandemic response. The study allowed rapid, concurrent data collection from both cases and controls, providing epidemiological insights with consistent estimates of associations reported over three study periods. To the best of our knowledge, this is the only case-control study on community risk factors for COVID-19 in England. As such, this study provides valuable insights into the risks associated with community settings and activities, and the findings are likely to be transferrable to other similar settings.We conclude that several workplaces were associated with increased odds of being a COVID-19 case, primarily those in health and social care, hospitality, warehouse and educational settings. The results are aligned with the existing literature. While it was not possible to determine whether transmission occurs at workplaces or outside the workplace, for example, during commuting, our findings provide further evidence that certain sectors have been more affected, highlighting that the mitigation measures in these settings may only be partial. While the study has limitations, these are likely to result in underestimation, rather than overestimations of the associations. Therefore, our recommendation is that further mitigation measures are considered in these sectors to improve the control of COVID-19 in these settings."}
{"text": "Graphene and graphene oxide have attracted tremendous interest over the past decade due to their unique and excellent electronic, optical, mechanical, and chemical properties. This review focuses on the functional modification of graphene and graphene oxide. First, the basic structure, preparation methods and properties of graphene and graphene oxide are briefly described. Subsequently, the methods for the reduction of graphene oxide are introduced. Next, the functionalization of graphene and graphene oxide is mainly divided into covalent binding modification, non-covalent binding modification and elemental doping. Then, the properties and application prospects of the modified products are summarized. Finally, the current challenges and future research directions are presented in terms of surface functional modification for graphene and graphene oxide. Graphene and graphene oxide have attracted tremendous interest over the past decade due to their unique and excellent electronic, optical, mechanical, and chemical properties. However, four years later, Kr\u00e4tschmer3 confirmed the cage structure of C60-fullerene. In 1991, Nippon Electric Company (NEC) Ltd. first reported carbon nanotubes and expanded the carbon material family.4 In 2004, Novoselov et al.5 successfully separated graphene from the monolithic state using a micro-computer peeling method, which challenged the scientific understanding of two-dimensional crystals. The structure of graphene is shown in 2 hybrid carbon atoms. It is a two-dimensional carbonaceous material with a hexagonal honeycomb crystal structure. To now, graphene is the thinnest and strongest nanomaterial, with a sheet thickness of 0.34 nm.6 Each carbon atom in graphene is bonded to three adjacent carbon atoms through a \u03c3 bond. The remaining p electrons most likely form a \u03c0 bond with the surrounding atoms due to their failure to form a bond, and the bonding direction is perpendicular to the graphene plane. The structure of graphene is very stable, and its C\u2013C bond length is only 0.142 nm.7 The connection between each carbon atom of graphene is very strong. When an external force is applied to graphene, the atomic surface inside it is deformed and further bent to offset the external force. Thus, there is no rearrangement and misalignment between the carbon atoms, maintaining a consistently stable structure.8 When the electrons of graphene move in the internal orbit, there is no scattering phenomenon due to the interference of foreign atoms or lattice defects.9,10 This unique lattice structure gives graphene various excellent properties. Nowadays, there are numerous methods for the preparation of graphene, but the main preparation methods include mechanical stripping, liquid phase stripping, chemical vapor deposition, epitaxial growth and redox methods.11 Recently, significant research has been conducted on graphene quantum dots,12\u201314 and carbon doped with other elements, molecules or organic materials.15\u201318Graphene is a carbon material,20 In recent years, with the further study of GO, scientists have found that it also has excellent properties with rich active oxygen-containing functional groups.21 These oxygen-containing groups or reduced doping elements can be used as catalytic active centers for covalent/non-covalent modification design according to the requirements of specific application fields. In addition, the presence of oxygen-containing groups also broadens the interlayer gap of graphene oxide. It can be functionalized by small molecules or polymer intercalations. At present, great progress has been achieved in the functionalization of graphene oxide. It has been applied in the fields of desalination,22 drug delivery,23 oil\u2013water separation,24 immobilization catalysis,25 solar cells,26 energy storage,27 healthcare,28,29etc.Compared with graphene (G), graphene oxide (GO) has the advantages of low production cost, large-scale production, and easy processing. It is often used as a precursor for the preparation of reduced graphene oxide (RGO).However, the single component graphene material has certain limitations, such as weak electrochemical activity, easy agglomeration and difficult processing, which greatly limit the application of graphene. Therefore, functional modification of graphene and graphene oxide is crucial to expanding their application. The functionalization of graphene and graphene oxide is based on the further modification of their intrinsic structure. Herein, we introduce the functional modification methods based on the intrinsic structural chemical bonds and functional groups of graphene and graphene oxide. Firstly, we introduce the basic structure and properties of graphene and graphene oxide, and then their functionalization based on their surface structure features, which is divided into three types, functional modification of covalent bond bonding, functional modification of non-covalent bond action and element doping modification. Subsequently, we categorize and systematically summarize the reaction process and reaction conditions of typical reaction types and their research methods. Finally, the future of surface functionalization of graphene and graphene oxide is presented.2.x electron and 2py electron), forming plane sp2 hybrid orbitals. The remaining orbital electron forms a large \u03c0 bond, and this electron can move freely in the plane. Graphene and graphene oxide show excellent electrical, mechanical, and thermal properties due to their unique structural and morphological features.30\u201336 They exhibit the Hall effect, tunneling effect, bipolar electric field effect and high thermal conductivity. The electrons are not easily scattered when they are transported in G, and the maximum electron mobility at room temperature can reach 2 \u00d7 105 cm2 (V s)\u22121,24 and thus the ideal conductivity of G is over 1 \u00d7 106 S cm\u22121.24 The Young's modulus of G can reach up to 1100 GPa,25 its transmittance is about 97.9% for visible light,25 and its specific surface area can be as high as 2630 m2 g\u22121.26 As a two-dimensional carbon material, graphene oxide has a single atomic layer, and the size of its sheets is polydisperse. Compared with graphene, there are many oxygen-containing functional groups on the graphene oxide sheet layer, thus the structure of graphene oxide is more complicated, and its properties depend on its structure. Lerf and Klinowski37,38 put up the structural model of graphene oxide, called the L\u2013K model. It indicates that the hydroxyl and epoxy groups are randomly distributed on the graphene oxide single layer, while the carboxyl and carbonyl groups are introduced at the edge of the single layer. Graphene oxide has an unoxidized benzene ring region and an oxidized aliphatic six-membered ring region, and the relative size of these two regions depends on the degree of oxidation and random distribution on graphene oxide. However, the L\u2013K structural model is based on certain conditions, ignoring the influence of raw graphene, oxidant and oxidation methods. Erickson et al.39 studied graphene oxide nano-plates via scanning electron microscopy (SEM), and found that graphene oxide not only has an oxidized region with high disorder and unoxidized graphene region, but also has hole defects due to overoxidation and lamellar peeling. Accordingly, in recent years, other models have been proposed, such as the dynamic structure model (DSM)40,41 and binary structure model.42 Extensive research has been conducted on the preparation and properties of G and GO by many scientists, and it has been found that the obvious difference between graphene and graphene oxide is the addition of oxygen atoms bound with some carbons, as shown in 2) and aliphatic (sp3) domains, which lead to an increase in the type of interactions that can occur on its surface. Graphene oxide can be reduced to graphene by a reducing agent. However, the produced graphene is not suitable for electronic applications and mechanical reinforcement of polymers due to the structural defects created during the synthesis of graphene oxide. Nevertheless, this is the preferable route for the large-scale modification of the surface properties of graphene materials by functionalization.Graphene has a planar hexagonal lattice structure. There are 4 valence electrons per carbon atom, including 3 electrons  had strong oxidizing properties in concentrated sulfuric acid, and there was a high risk of explosion when Mn2O7 contacted with organic matter at 55 \u00b0C.55 Subsequently, Marcano50 used the less corrosive phosphoric acid to produce graphene oxide in situ. This method does not involve the release of intense exothermic or toxic gases, and the prepared graphene oxide has a higher degree of oxidation and structural regularity, but requires a large amount of KMnO4 and concentrated sulfuric acid, thus increasing the cost of processing raw materials and the treatment of waste liquids. The preparation of graphene oxide using the K2FeO4/H2SO4 oxidation system49 at room temperature for 1 h is a safe and efficient method. Using benzoyl peroxide52 as an oxidant at 110 \u00b0C, graphene oxide can also be prepared by reaction for 10 min. Although this method is highly efficient, benzoyl peroxide itself is extremely unstable and there may be a risk of explosion when the reaction temperature is high. Besides the effect of oxidants on graphene oxide, the graphite raw materials and the reaction methods also affect the properties of graphene oxide, where relatively few hydroxyl and carboxyl groups are obtained on graphene oxide prepared from highly crystalline graphite powder.56 During the low-temperature and mid-temperature stages of graphene oxide preparation, a modified Hummers' method with the help of auxiliary ultrasound equipment was used, and the layer spacing of graphene oxide became larger.57 However, there were many holes in the graphene oxide due to excessive oxidation. When the reaction temperature was over 50 \u00b0C, the graphene oxide became unstable. If this reaction occurred at a relatively low temperature, the hole defects of graphene oxide would diminish significantly.58 Currently, the feasibility of the industrial preparation of graphene with graphene oxide as the precursor is high, but the existing graphene oxide preparation methods generally have technical problems such as complicated purification steps and many defects. Therefore, compared with mechanically exfoliated high-quality graphene, the prepared reduced graphene oxide is inferior in structure and properties.The different methods have advantages and disadvantages. In the early stages, nitric acid and KClO59 and preserves their inherent properties. The functionalization of graphene and graphene oxide results in new functions, and subsequently can possess excellent mechanical properties, electrical properties, thermal properties, etc. Currently, the methods for the functionalization of graphene and graphene oxide mainly include covalent bond functionalization, non-covalent bond functionalization, and other atomic doping functionalization.60The proper functionalization of graphene and graphene oxide prevents agglomeration during the reduction of graphene and graphene oxide,4.4.1et al.61 prepared graphene from graphene oxide using the sodium borohydride reducing agent and then sulfonation with the aryl diazonium salt of sulfanilic acid. The light sulfonated graphene was easily dispersed in water at a suitable concentration (2 mg mL\u22121) in the pH range of 3\u201310. By observing the AFM images shown in Si et al.62 reported a simple method for the fabrication of multifunctional fibers with mechanically strong RGO cores and highly conductive chemical vapor deposition (CVD) graphene shells (rGO@Gr fibers), which showed outstanding electrical conductivity as high as 137 S cm\u22121 and a failure strain value of 21%. These values are believed to be the highest values among polymer-free graphene fibers. We also demonstrated the use of the rGO@Gr fibers in high power density supercapacitors with enhanced mechanical stability and durability, which enables their practical applications in various smart wearable devices in the future. The main method involved the preparation of the CVD graphene film, GO fiber fabrication, fabrication of graphene\u2013GO fiber (a reduction solution (HI\u2009:\u2009AcOH = 2\u2009:\u20095 v/v)) and testing the thermal conductivity.Choi 4.2The reduction of GO with an alcohol is a relatively mild reduction method because this treatment method does not cause severe damage to the edge morphology of GO, and highly conductive RGO can be prepared.et al.63 reduced GO with ethanol vapor at high temperature to obtain highly conductive RGO. Experiments showed that the impedance of GO was 188\u2013418 k\u03a9 \u03bcm\u22122, and after ethanol vapor reduction at 900 \u00b0C, the impedance was reduced by 43 k\u03a9 \u03bcm\u22122. This result was similar to the result from reducing GO at 1100 \u00b0C under vacuum (40\u2013100 k\u03a9 \u03bcm\u22122). Besides, they also studied the reduction of GO with H2 at high temperature. The results indicated that ethanol vapor was more effective at reducing GO at the same temperature.Su 4.3et al.64 studied the peeling of GO for 20 h into a GNS sheet by hydroquinone upon refluxing GO with hydroquinone. The results showed that the product RGO had a low oxygen content and maintained an ordered crystal structure, but agglomeration occurred within only a few hours in water. It was also found that the thermal stability of the product was worse than that of graphite powder.In addition to alcohol reducing agents, some phenolic reducing agents are also used to reduce GO. Wang 4.4via the rapid heating of dry GO under inert gas and high temperature. The properties of thermal reduction products are directly related to the heating rate, reduction temperature and time. Too fast heating rate and too long reduction time will greatly expand the volume of the product, and the specific surface area is much lower than the theoretical value of graphene. Hyunwoo Kim65 reviewed that in top-down processes, graphene or modified graphene sheets are produced by separation/exfoliation of graphite or graphite derivatives. In general, these methods are suitable for large-scale production for polymer composite applications. For the process of TRG, heating GO in an inert environment for 30 s at 1000 \u00b0C causes the reduction and flaking of GO, thereby producing TRG sheets. Delamination occurs when the pressure generated by the gas (CO2) due to the decomposition of the epoxy and hydroxyl groups of GO exceeds the van der Waals force holding the graphene oxide sheets together.Thermally reduced graphene oxide (TRG) can be produced 66 also reported a polymer/GO material, where its preparation involved aqueous mini-emulsion copolymerization of St and nBA in the presence of nano-dimensional GO  and the conventional surfactant SDS. The obtained latex comprising polymer particles armoured with GO sheets were used directly for film formation at ambient temperature.Fadil4.52 reduction, ultraviolet radiation reduction method, and electrochemical reduction method. Some researchers prepared RGO using sulfur-containing compound reducing agents, and found that sulfur-containing compounds have good reducing properties. The oxygen content in the reduced product is relatively low and stably dispersed in solution. When SO2 gas was used as a reducing agent for reducing GO, the oxygen content of the product RGO obtained by this method was similar to that using hydrazine as the reduction agent, and the sulfur-containing compound could promote the dispersion of the product in aqueous solution.67 It was also found that the product RGO was a single layer having a thickness of only 0.87 nm, but the surface had significant wrinkles. When the number of layers was below 10 layers, a large area of wrinkles appears in GO,68 as shown in There as other reduction methods such as sulfur-containing compound reducing agent reduction method, SOet al.69 conducted an in-depth study on the ultraviolet (UV) irradiation reduction method, and a schematic of the TiO2\u2013graphene composite and its response under UV-excitation is shown in Ultraviolet radiation reduction and electrochemical methods are also environmentally friendly methods for the preparation of GNS, and they have a great potential in the large-scale preparation of GNS. Williams They obtained stable RGO by reducing the GO suspension by UV irradiation. Compared with the use of a photocatalyst or chemical reducing agent, this method is not only simple and easy, but also inexpensive, and it provides a new possible way for the mass preparation of GNS.5.59 and preserves their inherent properties. The functional modification of graphene and graphene oxide not only maintains their excellent characteristics, but also introduces new functional groups to give them new characteristics. Also, different functional groups give different characteristics. Presently, the methods for the functionalization of graphene and graphene oxide mainly include covalently functionalization, non-covalent functionalization, and elemental doping.70The proper functionalization of graphene and graphene oxide prevents their agglomeration during the reduction process,5.171 The covalent bond functional modification of graphene and graphene oxide is illustrated below according to the functional group. Covalent bond modification increases the processability and brings new functions. There are multiple strategies to covalently functionalize GO. For example, Man et al.72 using polystyrene particles \u201carmoured\u201d with nanosized graphene oxide (GO) sheets, which were prepared by aqueous mini-emulsion polymerization of styrene, exploiting the amphiphilic properties of GO in the absence of conventional surfactants. The nanoscale GO sheets were prepared from graphite nanofibers with a diameter of approximately 100 nm based on a novel procedure, thus effectively ensuring the absence of larger sheets.Covalent bond functionalization of graphene involves combining graphene with newly introduced groups in the form of covalent bonds to improve and enhance its performance. The oxygen-containing groups on the surface of graphene oxide makes covalent bond functionalization easier than that on graphene. The surface of graphene oxide contains a large amount of hydroxyl groups, carboxyl groups, and epoxy groups. These groups can be used for common chemical reactions such as isocyanation, carboxylic acylation, epoxy ring opening, diazotization, and addition.5.1.1 PBM data was replaced with SVG by xgml2pxml:<glyph-data id=\"z.dbd\" format=\"PBM\" resolution=\"300\" x-size=\"8\" y-size=\"10\" xml:space=\"preserve\">00000000000000000000000000000000111111110000000011111111000000000000000000000000</glyph-data><svg xmlns=\"http://www.w3.org/2000/svg\" version=\"1.0\" width=\"13.200000pt\" height=\"16.000000pt\" viewBox=\"0 0 13.200000 16.000000\" preserveAspectRatio=\"xMidYMid meet\"><metadata>Created by potrace 1.16, written by Peter Selinger 2001-2019</metadata><g transform=\"translate scale\" fill=\"currentColor\" stroke=\"none\"><path d=\"M0 440 l0 -40 320 0 320 0 0 40 0 40 -320 0 -320 0 0 -40z M0 280 l0 -40 320 0 320 0 0 40 0 40 -320 0 -320 0 0 -40z\"/></g></svg>C bond in the aromatic ring of graphene or graphene oxide. The graphene oxide diazotization reaction and Diels\u2013Alder reaction have been reported.73\u201375The functional modification of the carbon skeleton is mainly carried out using the Cet al.76 used solution-phase graphene as a raw material dispersed in 2% sodium cholate (as surfactants) aqueous solution, and stirred it with 4-propargyloxydiazobenzenetetrafluoroborate at 45 \u00b0C for about 8 h, to obtain 4-propargyloxyphenyl graphene  scale\" fill=\"currentColor\" stroke=\"none\"><path d=\"M80 600 l0 -40 600 0 600 0 0 40 0 40 -600 0 -600 0 0 -40z M80 440 l0 -40 600 0 600 0 0 40 0 40 -600 0 -600 0 0 -40z M80 280 l0 -40 600 0 600 0 0 40 0 40 -600 0 -600 0 0 -40z\"/></g></svg>CH). Then, a click chemistry reaction with the azido polyethylene glycol carboxylic acid . Finally, alkyne-functionalized polystyrene (HCC\u2013PS) was used to graft polystyrene onto the surface of the oxide by esterification to obtain graphene-based polystyrene. The modified graphene oxide had good solubility in polar solvents such as tetrahydrofuran, dimethylformamide and chloroform, and the distance between GO layers could be controlled by the length of PS. This method can be extended to the functionalization of other graphite polymer composites. The preparation route and reaction conditions for the target hydroxy-based functionalization of graphene oxide is shown in Graphene oxide contains a large amount of reactive hydroxyl groups on its sheet layer, where hydroxyl-based functional modification generally involves hydroxy-reaction of amide or isocyanate and graphene oxide to produce esters, and then further functional modification using different groups.et al.80 demonstrated novel reversible addition\u2013fragmentation chain transfer agent (RAFT-CTA)-modified reduced graphene oxide nanosheets (CTA-rGONSs) by crosslinking rGONSs with a RAFT-CTA via esterification reaction. These nano CTA-rGONSs were used to polymerize a hydrophobic amino acid-based methacrylamide  monomer with different monomer/initiator ratios. The synthetic procedure is shown in detail in Namvari 5.1.381,82 The carboxyl functionalization step is generally the activation of the reaction, and then the group containing an amino group and a hydroxyl group is dehydrated to form an ester or amide bond. The reagents commonly used for carboxyl activation include thionyl chloride (SOCl2),83 2-(7-aza-1H-benzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate,84N,N-dicyclohexylcarbodiimide (DCC),85 and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC).86 Ouyang et al.87 demonstrated the chemical functionalization of semiconducting graphene nanoribbons (GNRs) with Stone\u2013Wales (SW) defects by carboxyl (COOH) groups. It was found that the geometrical structures and electronic properties of GNRs changed significantly, and the electrical conductivity of the system could be considerably enhanced by mono-adsorption and double adsorption of COOH, which sensitively depends on the axial concentration of SW defect COOH pairs (SWDCPs). With an increase of the axial concentration of SWDCPs, the system transformed from semiconducting behavior to p-type metallic behavior. This makes GNRs a possible candidate for application in chemical sensors and nanoelectronic devices. The preparation route and reaction conditions for the target hydroxy-based functionalization of graphene oxide are shown in There are a large number of carboxyl groups at the edge of graphene oxide, and the carboxyl group is a highly reactive group, and thus has been greatly studied for the functionalization of graphene oxide.et al.88 removed the oxygen-containing groups from GO through a reductive treatment, and consequently reintroduced carboxyl groups onto the graphene surface. Carboxyl groups were inserted based on a free-radical-addition reaction, which occurred not only on the carbon atoms located at the edge plane, but also at the much more abundant basal plane of the graphene sheets. Specifically, chemically reduced graphene oxide (CRGO) was first functionalized with isobutyronitrile groups, which were generated from the thermal decomposition of azobisisobutyronitrile (AIBN) to give CRGO\u2013CN. Subsequent reflux of CRGO\u2013CN in a mixture of methanol and sodium hydroxide aqueous solution resulted in a hydrolysis reaction to provide CRGO enriched with carboxyl groups (CRGO\u2013COOH), as shown in Bonanni 5.2The non-covalent bond functionalization of graphene or graphene oxide results in the formation of a composite material having a specific function by interaction between hydrogen bonds and electrostatic forces between graphene and functional molecules, the greatest advantage of which is maintaining the bulk structure and excellent properties of graphene or graphene oxide, and also improving the dispersibility and stability of graphene or graphene oxide. The methods for the functional modification of surface non-covalent bonds mainly include \u03c0\u2013\u03c0 bond interaction, hydrogen bonding, ionic bonding, and electrostatic interaction modification. The non-covalent bond functionalization process is simple with mild conditions, while maintaining the structure and properties of graphene. However, the disadvantage of this method is that other components (such as surfactants) are introduced.5.2.1et al.89 inspired by interfacial interactions of protein matrix and the crystal platelets in nacre, produced a super tough artificial nacre through the synergistic interface interactions of p\u2013p interaction and hydrogen bonding between graphene oxide (GO) nanosheets and sulfonated styrene\u2013ethylene/butylene\u2013styrene copolymer synthesized with multifunctional benzene. The resultant GO-based artificial nacre showed super-high toughness of 15.3 \u00b1 2.5 MJ m\u22123, superior to that of natural nacre and other GO-based nanocomposites. The ultra-tough property of the novel nacre was attributed to the synergistic effect of the p\u2013p stacking interactions and hydrogen bonding. Thus, this bioinspired synergistic toughening strategy opens a new avenue for constructing high performance GO-based nanocomposites in the near future.Song et al.90 used a tetradecene derivative with a dendritic polyether branch as a modifier and the synergistic effect of an aromatic cyclic fluorene skeleton interacting with graphite and a polyether chain to induce high hydrophilicity, stripping graphite and stabilizing the graphene layer, as shown in Lee 5.2.2et al.91 researched the fabrication of reduced graphene oxide aerogel membranes (rGOAMs) via the reduction-induced self-assembly of rGO through hydrogen bond mediation. Using polyethylene glycol (PEG) as the mediator, the PEG\u2013rGO hydrogen bonding interactions partly replaced the interlayer p\u2013p and hydrophobic interactions during reduction, decreasing the rGO laminate size in 2D stacking and alleviating the structural shrinkage of the rGOA networks. The tight correlation between membrane pore size and porosity was broken, leading to rGOAMs with tunable pore sizes (0.62 to 0.33 mm) and high porosity (95%). The resultant rGOAMs could effectively reject oil-in-water emulsions with different sizes and exhibited ultrahigh water flux (up to 4890 L m\u22122 h\u22121) under 0.10 bar as well as a persistent anti-oil-fouling performance for up to 6 cycles.He et al.92 realized the surface functionalization of graphene by hydrogen bonding between graphene and DNA, which improved the hydrophilicity of graphene and stabilized it in water. On the other hand, the loading of organic molecules occurred on the surface of graphene. The functional modification of the graphene surface by hydrogen bonding does not introduce impurities, which is safe and reliable, and has important potential application prospects in biomedical field. A schematic illustration of aqueous dispersions of (a) GO, (b) GO\u2013PDI and (c) GO\u2013PyS through \u03c0\u2013\u03c0 interaction is shown in Patil via a simple noncovalent method, and the loading and release behaviors of DXR on GO were investigated by Patil et al.93 The efficient loading of DXR on GO was as high as 2.35 mg mg\u22121 at the initial DXR concentration of 0.47 mg mL\u22121. The loading and release of DXR on GO showed strong pH dependence, which may be due to the hydrogen-bonding interaction between GO and DXR. The fluorescent spectrum and electrochemical results indicate that strong \u03c0\u2013\u03c0 stacking interaction exists between them, as shown in A novel graphene oxide\u2013doxorubicin hydrochloride nanohybrid (GO\u2013DXR) was prepared 5.2.3et al.94 reported that a stable dispersion of reduced graphene was achieved in various organic solvents via noncovalent ionic interaction functionalization with amine-terminated polymers. An aqueous dispersion of reduced graphene was prepared via the chemical reduction of graphene oxide in aqueous media and vacuum filtered to generate reduced graphene sheets. Thorough FTIR and Raman spectroscopy investigation verified that the protonated amine terminal group of polystyrene underwent noncovalent functionalization with the carboxylate groups on the graphene surface, providing high dispersibility in various organic media, as shown in Choi et al.95 improved the mechanical and barrier properties of a starch film with reduced graphene oxide (RGO) modified by sodium dodecyl benzene sulfonate (SDBS). The hydrophilia of the modified RGO (r-RGO) was improved, which resulted in its good dispersion in the oxidized starch (OS) matrix. The tensile strength of the r-RGO-4/OS film increased to 58.5 MPa, which was more than three times that of the OS film (17.2 MPa). Besides, both the water vapor and oxygen barrier properties of the r-RGO/OS film improved greatly compared with that of the OS and GO/OS films. Moreover, the r-RGO/OS film could protect against UV light effectively due to its lightproof performance. In conclusion, the r-RGO/OS composite film has great potential applications in the packaging industry.Ge 5.2.4et al.60 used hydrazine as a reducing agent to control the reduction, while removing the functional groups such as hydroxyl groups and epoxy bonds of graphene oxide and retaining the carboxyl anion, which is well dispersed by charge repulsion. The chemical conversion of graphene can be conducted in water. Graphene oxide is soluble in water because its surface negative charge repels each other and forms a stable colloidal solution, as shown in Electrostatic repulsion between the same type of charge is another strategy to improve the dispersion of graphene. Bhunia 96 prepared novel environmentally friendly Gemini surfactants, i.e. each with two hydrophilic and two hydrophobic groups. The reaction was conducted in hydrogen peroxide for the epoxidation of the carbon\u2013carbon double bond. Methylene was used as the spacer group, and the nonionic hydrophilic head group was then introduced by ring-opening reaction. The targeted surfactants were synthesized via the reaction of chlorine sulfonic acid and hydroxy esterification. The results were compared with that for mixtures of the standard surfactants sodium decylsulfate and octaoxyethyleneglycol mono n-decyl ether under equivalent conditions. The surfactants were shown to exhibit improved performance over the mixed system both in terms of micellization and surface tension lowering.Ge X. and Li H.5.397\u2013100 Element doping adjusts the energy band structure of graphene, but the doping process is difficult to control quantitatively.Element doping modification usually adopts annealing heat treatment, ion bombardment, arc discharge and other means to incorporate different elements into graphene, thereby resulting in the substitution of defects and vacancy defects in graphene, and maintaining the intrinsic two-dimensional structure of graphene. Simultaneously, its surface properties change to give new performances.et al.100 used thermal annealing to treat graphene and ammonium nitrate to prepare 6.54 at% nitrogen-doped graphene, which catalyzed the oxidative degradation of phenol by 5.4 times that of undoped graphene. The synergistic effect of B-, P- or N-doped graphene was studied. The detailed growth process of N-doped graphene by thermal annealing treatment is shown in Duan et al.101 reported a CVD technique to produce N-doped graphene, which was the first experimental example of substitutionally doped graphene, which was hard to produce using other methods. The CVD method is a nondestructive route to produce graphene and realizes substitutional doping since the doping is accompanied by the recombination of the carbon atoms in graphene during the CVD process. By using SEM, TEM, Raman, XPS and EDS, they demonstrated the existence of N-doped graphene. The CVD method can not only be used to produce N-doped graphene, but also has potential to produce the graphene doped with other elements. Moreover, they measured the electrical properties of the N-doped graphene. This research provides a new type of graphene experimentally, which is required for the further application of graphene. The synthesis of N-doped graphene by electrostatic repulsion is shown in Wei 6.The functional modification of graphene is of great significance for the application of graphene composites. According to previously mentioned literature, the surface functional modification of graphene and graphene oxide is used to obtain related products and the interactions and reactions of the modification types have been studied, briefly explaining the functional characteristics and application fields of graphene surface-functionalized composites, as summarized in 7.102 medicine,103 energy,104 water splitting, biosensing, bioimaging, environmental studies, catalysis, photocatalysis, and biomedical technologies.105,106 However, a coin has two sides. Because of the unique structure of graphene, it is difficult to disperse in water and organic solvents, which is known as the agglomeration phenomenon of graphene. This problem limits the application of graphene. Therefore, it is important to functionalize graphene and graphene oxide to expand their various applications.Graphene has many unique and prominent physical and chemical properties  due to its special structure, and thus has wide application potential in many fields, such as heterojunction solar cells,Currently, the study of these functional methods is still in the experimental stage, and researchers are mainly focused on the development of new product varieties and their characterization and application. However, there are several problems as follows. (1) Functionalized target groups difficult to control, (2) the synthetic procedures are complicated, and (3) separation and purification are very difficult.Thus, considering the above-mentioned superior performance, we should pay attention to the relationship between the structure and properties of graphene and graphene oxide in future work. For example, according to the quantitative structure and property relationship principle, functional groups are introduced into molecules based on functionalized target group design. Functionalized target group design is carried out by molecular simulation technology, and the structure property model is set up to guide the synthesis of new products. However, the synthetic process of different types of graphene and graphene oxide is complex, which involves the introduction of many other special groups, thus it is difficult to control the reaction and obtain the target products. Also, some reaction conditions are extremely harsh. Nevertheless, considering the optimization of reaction procedures and environmentally friendly synthetic routes, graphene and graphene oxide will achieve industrialization. Of course, other new functional modification methods should be developed, such as non-alkali carbonylation and carbon\u2013carbon multi-bond addition reactions, which are rarely reported in functional applications.8.Graphene-based composites are involved in many fields with the development of science, such as graphene-based drug carriers to improve the stability, toxicity, metabolic kinetics of drugs, and many aspects are still unclear, pending further research and exploration by scientists. Accordingly, graphene and graphene oxide will be researched completely and use widely in the future.There are no conflicts to declare."}
{"text": "Central nervous system (CNS) metastases and acquired resistance complicate the treatment of anaplastic lymphoma kinase (ALK) rearrangement-positive (ALK-p) advanced non-small cell lung cancer (NSCLC). Thus, this review aimed to provide a comprehensive overview of brain metastasis, acquired resistance, and prospects for overcoming these challenges. A network meta-analysis of relevant phase III randomized controlled trials was performed to compare the efficacies of multiple ALK inhibitors by drug and generation in overall patients with ALK-p untreated advanced NSCLC and a subgroup of patients with CNS metastases. The primary endpoint was progression-free survival (PFS). Generation-specific comparison results showed that third-generation ALK inhibitors were significantly more effective than second-generation ALK inhibitors in prolonging the PFS of the subgroup of patients with CNS metastases. Drug-specific comparison results demonstrated that lorlatinib was the most effective in prolonging PFS, followed by brigatinib, alectinib, ensartinib, ceritinib, crizotinib, and chemotherapy. While lorlatinib was superior to brigatinib for PFS in the overall patient population, no significant difference between the two was found in the subgroup of patients with CNS metastases. These results can serve as a foundation for basic, clinical, and translational research and guide clinical oncologists in developing individualized treatment strategies for patients with ALK-p, ALK inhibitor-naive advanced NSCLC. The tremendous advances in tumor molecular research over the past two decades have contributed enormously to our understanding of the etiology of non-small cell lung cancer (NSCLC), which constitutes 84% of all primary lung cancers ,2,3,4,5.As shown in Lung cancer has a high probability of metastasis to the CNS, and patients with advanced NSCLC involving driver gene alterations, such as EGFR mutations and ALK rearrangements, frequently have brain metastases (BM). The incidence of BM in such patients is 37\u201364% ,24,25. HNevertheless, therapeutic strategies targeting ALK-p NSCLC with CNS metastases remain to be developed, and current strategies need to be improved ,12,14.Even patients who respond well to initial therapy with ALK inhibitors may experience tumor recurrence because of acquired resistance to these drugs via multiple mechanisms, including secondary ALK resistance mutations and tumor growth promoting molecular pathways. Therefore, the mechanisms underlying acquired resistance to ALK inhibitors must be elucidated to develop novel strategies to treat patients with ALK-p advanced NSCLC, especially those with CNS metastases ,12.In this meta-analysis report we first summarize the different ALK inhibitors  used in patients with ALK-p advanced NSCLC. We then discussed the treatment of patients with CNS metastases and the prospects for overcoming acquired resistance mutations in these patients.ALK inhibitors bind to the ATP-binding pocket of the intracellular tyrosine kinase domain, and regulate their downstream signals such as the RAS, PI3K-AKT, JAK/STAT signaling cascades which are involved in tumor progression; attenuation of these cascades produces an antitumor effect ,20,27. ACrizotinib is a first generation ALK inhibitor authorized for the potential therapeutic application in the treatment of ALK-p NSCLC. Two phase III trials (PROFILE1014  and PROFCeritinib is a second-generation ALK inhibitor developed to improve the low activity of first-generation ALK-TKIs against CNS diseases and overcome resistance. A phase III study (ASCEND-4) found that the PFS of patients with stage IV ALK-p NSCLC and PS 0\u20131 is longer with ceritinib monotherapy than with platinum combination therapy  . HoweverThree phase III trials  that inL  that in = 7/11 patients) than that of crizotinib monotherapy . However, the incidence of treatment-related serious adverse events is higher with ensartinib monotherapy (7.7%) than with crizotinib monotherapy (6.1%), with no new safety signals [A phase III eXalt3 trial demonstrated that ensartinib (X-396) monotherapy, as a first-line treatment for patients with ALK-p advanced NSCLC, is better than crizotinib monotherapy in prolonging PFS  . In addi signals .A phase III trial (CROWN ) showed In this section we discuss the treatment options for asymptomatic and symptomatic BM cases and the future direction of drug therapy development.For asymptomatic BM cases, single-drug therapy with TKIs is the preferred and recommended treatment option because the patients\u2019 tumors, including BM, are expected to have high responsiveness to these drugs ,26.However, BM progression can easily cause neurological symptoms and rapidly deteriorate the patient\u2019s condition. For example, BM lesions in the brain stem or close to the pyramidal tract can rapidly deteriorate, even if their size is small. Thus, intracranial radiotherapy is preferred for such patients, even those who are asymptomatic. Close monitoring of BM and the timing of radiotherapy intervention are critical in managing asymptomatic cases ,12,14. For symptomatic BM cases intracranial radiotherapy is the primary treatment option because robust local control of BM and neurological improvement are expected. The drugs selected by treating physicians are also essential in managing symptomatic BM cases. Several phase III clinical trials demonstrated that the intracranial antitumor activity of second- or further-generation ALK-TKIs is higher than that of crizotinib ,43. LorlDrug delivery into the CNS is generally prevented and primarily regulated by the BBB. WBRT can irreversibly disrupt the BBB and improve the delivery of ALK-TKIs ,47. WBRTDrug therapy combined with other agents and fourth-generation ALK-TKIs are future treatment options for ALK-p NSCLC with BM.Glycogen synthase kinase 3 (GSK3) is a serine-threonine kinase that serves an essential role in many cellular processes; thus, it has been considered as a promising target in various malignant diseases including brain tumors . A preclRadiotherapy, drug therapy, and their combinations have markedly progressed and prolonged the survival of patients with BM from ALK-p NSCLC. However, individualized treatment selection is a critical component for managing such patients. Thus, a multidisciplinary team comprising thoracic and radiation oncologists should conduct individualized treatment discussions to prolong the survival of patients with BM from ALK-p NSCLC.Although crizotinib can significantly prolong the response rate and PFS of patients with ALK-p NSCLC, disease progression inevitably occurs after treatment because of the acquired resistance of 1\u20132 years . The mecSecondary ALK inhibitor resistance mutations were previously identified in 20\u201330% of tumor samples with crizotinib failure . Among tSecond-generation ALK inhibitors, such as ceritinib, alectinib, and brigatinib, have been developed and approved clinically to overcome crizotinib-resistant mutations. These inhibitors are potent against common crizotinib-resistant mutations, L1196M, and G1269A ,59,60,61Although the G1202R mutation is rarely detected in crizotinib-relapsed clinical samples (2%), it is the most frequent resistance mutation following the administration of second-generation ALK inhibitors, accounting for 40\u201365% of all acquired resistance mutations ,64,65. SIn 2018 lorlatinib was approved by the U.S. FDA for the treatment of patients with ALK-p NSCLC. Lorlatinib displays activity against all potential ALK-TKI resistance mutations, including L1196M, G1269A, and G1202R . LorlatiMDR1) gene can induce multidrug resistance through the ATP-dependent efflux of chemotherapeutical agents [Activating bypass signaling pathways is important in ALK-independent resistance mechanisms via gene alterations, autocrine signaling with ligand overexpression, and feedback signaling. Such pathways include epidermal growth factor receptor signaling ,72, KIT l agents . P-gp acl agents . In mostl agents . Brain al agents ; otherwil agents . Phenotyl agents ,84,85,86l agents . The hisl agents . With reBased on these prospects, we conducted a comprehensive literature search and network meta-analysis . The results of this meta-analysis provide important information to guide clinical oncologists treating non-small cell lung cancer when considering treatment strategies for patients with ALK-p, ALK inhibitor-naive advanced NSCLC.A systematic literature search identified 2724 studies , second-generation ALK inhibitors , and third-generation ALK inhibitors (lorlatinib) in prolonging PFS were compared between generations in the overall patient population of ALK-p, ALK inhibitor-naive advanced NSCLC. Statistically significant differences were found among all generations compared  . RankingThe efficacies of chemotherapy, first-generation ALK inhibitors (crizotinib), second-generation ALK inhibitors , and third-generation ALK inhibitor (lorlatinib) in prolonging the PFS in a subgroup of patients with CNS metastases were compared. Statistically significant differences were found between third- and second-generation ALK inhibitors, third- and first-generation ALK inhibitors, second- and first-generation ALK inhibitors, third-generation ALK inhibitors and chemotherapy, and second-generation ALK inhibitors and chemotherapy, but not between first-generation ALK inhibitors and chemotherapy . RankingA paired comparison of the efficacies of ensartinib, lorlatinib, brigatinib, alectinib, ceritinib, crizotinib, and chemotherapy in prolonging the PFS of the overall patients is presented in A paired comparison of the efficacies of ensartinib, lorlatinib, brigatinib, alectinib, ceritinib, crizotinib, and chemotherapy in prolonging the PFS in the subgroup of patients with CNS metastases is presented in A paired comparison of the efficacies of ensartinib, lorlatinib, brigatinib, alectinib, ceritinib, crizotinib, and chemotherapy in prolonging the PFS in non-Asian subgroup was presented in A paired comparison of the efficacies of ensartinib, lorlatinib, brigatinib, alectinib, ceritinib, crizotinib, and chemotherapy in prolonging the PFS in the subgroup of patients with CNS metastases is presented in The qualities of the studies that were included were appraised on the basis of the Cochrane-recommended Risk of Bias tool 2 (RoB2) . Nine stOf the nine studies included in this analysis, three , indicating mild between-trial heterogeneity  were compared with that of chemotherapy in the overall patients with ALK-p, ALK inhibitor-na\u00efve advanced NSCLC and in the subgroup of patients with CNS metastases. The comparisons were conducted by ALK inhibitor generation and by drug. Generation-specific comparison results showed that third-generation ALK inhibitors had the best efficacy in prolonging the PFS of the overall patient population and in the subgroup of patients with CNS metastases. Statistically significant differences in efficacy were found between third-generation ALK inhibitors and second- and first-generation ALK inhibitors in the overall patients and in the subgroup of patients with CNS metastases. Significant differences in efficacy in prolonging PFS were also demonstrated between second- and first-generation ALK inhibitors. Drug-specific comparison results showed that lorlatinib had the best efficacy in prolonging PFS in the overall patients, followed by alectinib, brigatinib, ensartinib, ceritinib, crizotinib, and chemotherapy. The differences between lorlatinib and brigatinib, ensartinib, ceritinib, crizotinib, and chemotherapy were statistically significant. Analysis of the subgroup of patients with CNS metastases showed that lorlatinib exerted the most favorable effect, followed by brigatinib, ensartinib, ceritinib, crizotinib, and chemotherapy. The differences between lorlatinib and ensartinib, ceritinib, crizotinib, and chemotherapy were statistically significant. Several previous meta-analyses have compared the efficacies of ALK inhibitors in patients with ALK-p, ALK inhibitor-naive advanced NSCLC ,103,104.Notable findings were also obtained in drug-specific comparisons. For instance, lorlatinib was significantly better than brigatinib in prolonging the PFS of the overall patients, but their difference was not significant in the subgroup of patients with CNS metastases. In addition, evaluation results showed that brigatinib ranked third in the overall participant population but second, above alectinib, in the subgroup of patients with CNS metastases. These results support the theory that brigatinib, along with lorlatinib, is a potential first-line treatment option for ALK-p, ALK inhibitor-na\u00efve advanced NSCLC with CNS metastases.Our results also suggest that lorlatinib has potential as a novel first-line treatment for ALK-p, ALK inhibitor-naive advanced NSCLC. However, lorlatinib should not be recommended for all patients with this disease because its tolerability is reportedly lower than that of alectinib, and its effect on OS was not evaluated. Furthermore, in our analysis of racial differences lorlatinib ranked highest in PFS among non-Asians, whereas ensartinib ranked highest among Asians. Further clinical studies are warranted to develop a detailed treatment strategy for first-line treatment of ALK-p ALK-untreated advanced NSCLC.This NMA has several limitations. First, the study compared the efficacies of six ALK inhibitors in the overall patients and subgroup of patients with CNS metastases. However, OS and safety outcomes were not analyzed because of insufficient data reported for CNS metastases. Further validation is needed to determine whether the results of this comparative analysis of PFS in the subgroup with CNS metastases will be consistent with the results of the comparative analyses of OS and safety outcomes. Second, this analysis included patients who had received systemic anticancer chemotherapy and those who had not. Although the results of sensitivity analysis showed that the inclusion and exclusion of patients who had undergone systemic anti-cancer chemotherapy did not apparently influence the results, we cannot completely rule out the potential impact of this heterogeneity on the final conclusions. Third, mild heterogeneity, although not statistically significant, was demonstrated in the five studies comparing second-generation ALK inhibitors with crizotinib  age 18 years or older; (2) histologically or cytologically confirmed progressive or metastatic ALK-p NSCLC; (3) performance status of 0 to 2 ; (4) at least one measurable lesion assessed according to RECIST version 1.1,25; and (5) no prior exposure to ALK-targeted therapy.In this analysis, patients treated with ensartinib (225 mg/day), lorlatinib (100 mg/day), brigatinib (180 mg/day), alectinib (300 or 600 mg/day), ceritinib (750 mg/day), crizotinib (250 mg/day), and platinum-based chemotherapy  were considered. Phase III trials that included any of these agents were eligible for inclusion. Crizotinib was the first approved ALK inhibitor and the former first-line agent for initial therapy, and platinum-based chemotherapy was the first-line agent for ALK-p treatment-naive NSCLC prior to the approval of crizotinib. Thus, crizotinib or platinum-based chemotherapy was assumed as the common comparator for each treatment. The primary efficacy endpoint was PFS in all participants and in the subgroup of patients with CNS metastases, with corresponding HRs and 95% credible intervals (CrIs). To rank the relative efficacy of each therapeutic approach, the surface under the cumulative rank under the curve (SUCRA) values were calculated for each endpoint, with higher SUCRA values corresponding to a more preferred therapeutic approach for the corresponding endpoints . These aThe research for this systematic review and meta-analysis was a phase III trial of a parallel-group RCT.The Bayesian NMA was performed following robustly established methods developed at the National Institute of Medical Research ,109. We A sensitivity analysis  was condWe evaluated the statistical heterogeneity among the included studies to determine whether it impacts the final conclusions . StatistInstitutional Review Board approval and patient consent were waived because of the retrospective nature of this systematic review.This review outlines future treatment strategies and future prospects for ALK-p, ALK inhibitor-na\u00efve advanced NSCLC with CNS metastasis, with a focus on elucidating and overcoming acquired resistance mechanisms. In addition, the therapeutic efficacies of ALK inhibitors in prolonging the PFS of the overall patients with ALK-p, ALK inhibitor-na\u00efve advanced NSCLC and a subgroup of patients with CNS metastases are compared by drug and by generation. Generation-specific comparison shows that third-generation ALK inhibitors are significantly more efficient than second-generation and first-generation ALK inhibitors in prolonging the PFS of the overall patients and subgroup of patients with CNS metastases. Drug-specific comparison demonstrates that lorlatinib is the most efficient in prolonging the PFS of the overall patients and subgroup of patients with CNS metastases. Notably, although a significant difference in efficacy of prolonging PFS was found between lorlatinib and brigatinib in the overall patient population, no such significant difference was found in the subgroup of patients with CNS metastases. These results indicate a trend toward brigatinib as a promising first-line treatment option along with lorlatinib in the subgroup of patients with CNS metastases. These results can serve as a foundation for basic, clinical, and translational research and guide clinical oncologists in developing individualized treatment strategies for ALK-p ALK inhibitor-na\u00efve advanced NSCLC. This NMA includes direct and indirect comparisons, and additional studies are warranted to confirm the results. The results of this analyses can serve as a basis for further clinical studies formulating novel treatment strategies for ALK-p ALK inhibitor-na\u00efve advanced NSCLC with CNS metastases or acquired resistance mutations."}
{"text": "MedicDeepLabv3+ improves the state-of-the-art DeepLabv3+ with an advanced decoder, incorporating spatial attention layers and additional skip connections that, as we show in our experiments, lead to more precise segmentations. MedicDeepLabv3+ requires no MR image preprocessing, such as bias-field correction or registration to a template, produces segmentations in less than a second, and its GPU memory requirements can be adjusted based on the available resources. We optimized MedicDeepLabv3+ and six other state-of-the-art convolutional neural networks  on a heterogeneous training set comprised by MR volumes from 11 cohorts acquired at different lesion stages. Then, we evaluated the trained models and two approaches specifically designed for rodent MRI skull stripping (RATS and RBET) on a large dataset of 655 MR rat brain volumes. In our experiments, MedicDeepLabv3+ outperformed the other methods, yielding an average Dice coefficient of 0.952 and 0.944 in the brain and contralateral hemisphere regions. Additionally, we show that despite limiting the GPU memory and the training data, our MedicDeepLabv3+ also provided satisfactory segmentations. In conclusion, our method, publicly available at The online version contains supplementary material available at 10.1007/s12021-022-09607-1. Rodents are widely used in preclinical research to investigate brain diseases Carbone, . These sWith brain edema biomarkers in mind, our work focuses on cerebral hemisphere segmentation in MRI volumes of rat brains with ischemic lesions. Segmenting these images is particularly challenging since lesions\u2019 size, shape, location, and contrast can vary even within images from the same cohort, hampering, as we show in our experiments, traditional segmentation methods. Additionally, rodents\u2019 small size makes image acquisition sensitive to misalignments, potentially producing slices with asymmetric hemispheres and particularly affecting anisotropic data. Furthermore, although neuroanatomical segmentation tools can be used to produce hemisphere masks , these In recent years, convolutional neural networks (ConvNets) have been widely used to segment medical images due to their outstanding performance The T2-weighted MRI volumes were not preprocessed , and their intensity values were standardized to have zero mean and unit variance. Brain and contralateral hemisphere masks were annotated by several trained technicians employed by Charles River according to a standard operating procedure. These annotations did not include the cerebellum and the olfactory bulb. Finally, we computed the ipsilateral hemisphere mask by subtracting the contralateral hemisphere from the brain mask, yielding non-overlapping regions  for optimizing the ConvNets.We divided the MR images into a training set of 51 volumes, validation set of 17 volumes, and test set of 655 volumes. Specifically, we grouped the MR images by their cohort and acquisition time-point Fig. .Fig. 2MeMedicDeepLabv3+ is a 3D fully convolutional neural network (ConvNet) based on DeepLabv3+  is a quality metric that calculates the distance to the misclassification located the farthest from the boundary masks. Formally:A and B, respectively. In other words, HD provides the distance to the largest segmentation error. We provided HD values in mm and we accounted for voxel anisotropy. Finally, precision is the percentage of voxels accurately classified as brain/hemisphere, and recall is the percentage of brain/hemisphere voxels that were correctly identified:We assessed the automatic segmentations with Dice coefficient Dice, , HausdorWe compared our MedicDeepLabv3+ with DeepLabv3+ baseline  of MedicDeepLabv3+ at https://github.com/jmlipman/MedicDeepLabv3Plus.MedicDeepLabv3+, DeepLabv3+, UNet, HighRes3DNet, V-Net, VoxResNet, and Demon were implemented in Pytorch  and precision (0.94 and 0.94), and the lowest HD (1.856 and 2.064)  combining several preclinical neuroimaging studies to a large dataset of 723 rat MR volumes.ConvNets performed markedly better and their training time was about 10 times shorter than RATS Supplementary file2 (PDF 6.51 MB)Supplementary file3 (PDF 90.7 KB)Below is the link to the electronic supplementary material."}
{"text": "Children and adolescents with cerebral palsy (CP) are a vulnerable group who find it challenging to meet current physical activity guidelines, which predispose them to the negative health implications associated with low levels of physical activity and high levels of sedentary time. For these reasons, a key role for many clinicians, parents, and other practitioners working with children and adolescents with cerebral palsy is to encourage and facilitate an increase in habitual physical activity and reduce the amount of time spent sedentary, in order to optimize long-term health outcomes. Since 2014 Danish schools have been committed to enhance physical activity during the school day, but teachers still find it challenging to include children and adolescents with special needs. In Denmark, there is a strong tradition of practicing habitual exercise in the voluntary sports clubs (83% of children and adolescents). In sports clubs, these children are being physically active as well as experiencing being a part of a community. Children and adolescents living with CP are often not able to participate in these sports clubs which excludes them from the active and social life that's happening there. This study acknowledges that parents of children and adolescents living with CP play an important role in supporting them being physically active. Therefore, this study aims to identify perceived barriers and motivators for being physically active, experienced by this particular group of children and parents. This knowledge can be used by parents, clinicians, coaches, teachers and other practitioners to guide families living with CP towards a more physically active lifestyle and possibly optimize long-term physical and social health outcomes for children and adolescents with CP.This study will investigate the children's and parents' perceptions of motivators and barriers. The study is designed as a multi-family member interview study involving 10-14 combined in-depth interviews with children aged 8-15 (GMFCS I-III) and their parents. Interviews will be analysed thematically within and between groups.The study will take place in spring 2020 as a part of a pre-graduate research year and thus data and conclusions will be presented at the conference."}
{"text": "Their structures were elucidated through a detailed comprehensive spectroscopic analysis, as well as a comparison with the literature. An anti-inflammatory evaluation showed that compounds 2, 5, and 6 possessed inhibitory activity against the excessive production of nitric oxide (NO) and pro-inflammatory cytokines in LPS-treated RAW 264.7 macrophages in a dose-dependent manner without cytotoxicity. Further studies revealed that compound 2 was active in blocking the release of pro-inflammatory cytokines  induced by LPS both in vivo and in vitro. Our findings provide a basis for the further development of linear polyketides as promising anti-inflammatory agents.A new linear polyketide, named aspormisin A ( An acute inflammation response is usually triggered by infection or tissue injury, and the subsequent response is mainly mediated by tissue-resident macrophages and mast cells . A varie\u03b1 and IL-1, have long been regarded as pro-inflammatory cytokines induced by LPS and have been determined as markers for the systemic activation of pro-inflammatory cytokines + . A detailed analysis of 1H NMR data ; three olefinic protons at \u03b4H 6.56 , 5.43 , and 5.15 ; two oxygenated methines at \u03b4H 4.87  and 3.74 ; two methines at \u03b4H 2.77\u20132.82  and 2.69\u20132.74 ; and seven methyls at \u03b4H 1.88 , 1.65 , 1.57 , 1.56 , 1.55 , 0.89 , and 0.78 . The 13C NMR data and HSQC spectrum displayed nineteen carbon signals, including one aldehyde carbon at \u03b4C 195.4 (C-1); an ester carbon at \u03b4C 169.4 (C-18); three olefinic quaternary carbons at \u03b4C 138.0 (C-2), 137.2 (C-6), and 132.8 (C-10); three olefinic carbons at \u03b4C 158.6 (C-3), 127.9 (C-7), and 123.3 (C-11); four methines (including two oxygenated) at \u03b4C 82.3 (C-9), 78.9 (C-5), 37.3 (C-4), and 33.7 (C-8); and seven methyls at \u03b4C 20.9 (C-19), 17.3 (C-16), 16.7 (C-14), 12.8 (C-15), 12.2 (C-12), 11.4 (C-17), and 9.1 (C-13). The sequential 1H-1H COSY correlations /CH-5, CH-7/CH-8(CH3-16)/CH-9, and C-11/CH3-12. The above NMR data indicated that the structural skeleton of 1 was similar to that of the co-isolated 5,9-dihydroxy-2,4,6,8,10-pentamethyldodeca-2,6,10-trienal (2) + , 667.4172 [2M + Na]+ .Aspormisin A -1223-336033 or e-mail: deposit@ccdc.cam.ac.uk).The clear light colorless crystal of 6: C10H10O4, Mr = 194.18, crystal size 0.16 \u00d7 0.14 \u00d7 0.10 mm3, monoclinic, a = 6.5123 (10) \u00c5, b = 24.5467 (3) \u00c5, c = 16.8673 (2) \u00c5, \u03b1 = 90\u00b0, \u03b2 = 91.0470 (10)\u00b0, \u03b3 = 90\u00b0, V = 2695.88 (6) \u00c53, Z = 12, T = 100.00 (10) K, space group P21, \u03bc(Cu K\u03b1) = 0.944 mm\u22121, calcD = 1.435 g/cm3, 27695 reflections measured (5.24\u00b0 \u2264 2\u0398 \u2264 148.846\u00b0), 10555 unique . The final R1 values were 0.0503 (I > 2\u03c3(I)). The final wR(F2) values were 0.1342 (I > 2\u03c3(I)). The final R1 values were 0.0538 . The final wR(F2) values were 0.1366 . The goodness of fit on F2 was 1.034. The flack parameter was 0.02(6). (CCDC 2132859).Crystal data for v/v) fetal bovine serum , penicillin (100 U/mL), and streptomycin (100 mg/mL)  with 5% CO2 at 37 \u00b0C. For LPS induction, RAW264.7 cells were seeded in a 24-well plate at a density of 1 \u00d7 105 cells/well, after adhesion cells were exposed to 0.1 \u03bcg/mL LPS  and separately co-treated with the compounds  for another 24 h. Culture supernatant was collected to measure the content of NO, IL-6, TNF-\u03b1, and MCP-1, and cells were harvested for RNA extraction.RAW264.7 cells, which originated from the American Type Culture Collection (ATCC) , were obtained from the Peking Union Medical College. Cells were cultured in Dulbecco\u2019s modified Eagle\u2019s medium (DMEM) with high glucose  supplemented with 10% (4 cells/well (100 \u03bcL medium/well) were seeded in a 96-well plate until adhesion; then, they were exposed to the compounds at a final concentration of 10 \u03bcM for 24 h, respectively. Whereafter, CCK-8 solution  was added following the manufacturer\u2019s instructions and incubated at 37 \u00b0C for 1 h. The absorbance was read at 450 nm with a microplate reader . Cell viability was calculated by  \u00d7 100%.An amount of 3 \u00d7 10NO production was assessed with Nitric Oxide Assay Kit  according to the manufacturer\u2019s instructions. Briefly, after 24 h of LPS treatment, the culture supernatant (50 \u03bcL) was transferred to another 96-well plate, and Griess reagents I (50 \u03bcL) as well as Griess reagents II (50 \u03bcL) were successively added. Absorbance was read at 540 nm.\u03b1 , IL-6 , and MCP-1  in the culture supernatant collected above, according to the manufacturer\u2019s instructions. Absorbance was measured at 450 nm.Mice enzyme-linked immunosorbent assay (ELISA) kits were used to measure the contents of TNF-\u00ae Reagent  and 1 \u03bcg total RNA was reverse transcribed into cDNA using EasyScript\u00ae One-Step gDNA Removal and cDNA Synthesis SuperMix . Gene transcript levels of IL-6, TNF- \u03b1, MCP-1, iNOS, Cox2, and MCP-1 were quantified using the TransStart Top Green qPCR SuperMix  according to the manufacturer\u2019s protocol. \u03b2-actin was used as the housekeeper gene. Primers for quantitative PCR are shown in Total RNA was extracted from cells with TRIzoln = 6): the control group, the model group, and the compound 2 group. Mice in the compound 2 group were orally administrated with compound 2 (35 mg/kg) for 24 h before LPS (5 mg/kg) treatment, with saline used as the control in the other two groups. After 6 h of LPS administration, the animals were sacrificed for the collection of bronchoalveolar lavage fluid (BALF) and lung tissues. The content of inflammatory cytokines in BALF was determined by ELISA, and the upper left lungs from each group (n = 6 per group) were fixated with 4% buffered formalin solution. Serial sections 3 \u03bcm thick were stained with hematoxylin and eosin (H&E).All animal experiments have been approved by the Medical Ethics Committee of Peking Union Medical College  and comply with the regulations of the National Institutes of Health regarding the care and use of animals in research. Briefly, 6-week-old male BALB/c mice were purchased from Vital River Laboratories Co., Ltd. . The animals were randomly divided into 3 groups , were isolated from the alga-derived fungus A. ochraceopetaliformis SCSIO 41020. The X-ray single-crystal diffraction analysis of compound 6 was reported for the first time. Compounds 2, 5, and 6 dose-dependently inhibited the excessive production of NO and pro-inflammatory cytokines in LPS-treated RAW 264.7 macrophages without any evidence of cytotoxicity. The preliminary structure\u2013activity relationship is also discussed. Moreover, the greatest potential inhibitor (2) further attenuated the lung injury in LPS-treated mice by downregulating the levels of pro-inflammatory cytokines, including IL-6, MCP-1, and TNF-\u03b1. Our findings provide a basis for the further development of linear polyketides as potential anti-inflammatory agents.In conclusion, six polyketides, including a new one ("}
{"text": "Powered by this tool, coupled with domain expertise, we identify several potential COVID-19 drugs including methylprednisolone and metformin, and further discern key cellular SARS-CoV-2-affected pathways as potential druggable targets in COVID-19 pathogenesis.The current, rapidly diversifying pandemic has accelerated the need for efficient and effective identification of potential drug candidates for COVID-19. Knowledge on host-immune response to SARS-CoV-2 infection, however, remains limited with few drugs approved to date. Viable strategies and tools are rapidly arising to address this, especially with repurposing of existing drugs offering significant promise. Here we introduce a systems biology tool, the PHENotype SIMulator, which -by leveraging available transcriptomic and proteomic databases-allows modeling of SARS-CoV-2 infection in host cells   Soon afin vitro studies, in silico studies are of great value for rapid and effective drug discovery. Indeed, computational structure-based drug design and immuno-informatics have recently resulted in identification of potential SARS-CoV-2 target proteins and drugs that are being selected for further testing , target in Ref.  \u2013 recent in Ref. , however in Ref. .in silico with the addition of CD147 gene into KEGG, hereby developing an in silico \u2018knock-in\u2019 of the CD147 gene, in order to investigate the role of this extracellular matrix metalloproteinase inducer (EMMPRIN) in COVID-19  to the original simulator, if absent in KEGG. In the case of SARS-CoV-2 infection, the absence of some important genes involved in infection of host cells in the KEGG database, was considered a limitation. One gene in particular is Basigin (BSG)  gene. The importance of CD147 in SARS-CoV-2 infection in spike-protein (SP) binding and viral infiltration of host cells has been described . In our D-19 see .in silico model presented here provides an interesting framework that can be constinously developed and expanded further, achieving a more complete cell signature with input of (newly) available data on processes such as cell-cell communication through ligand-receptor complexes [in vitro studies are performed on cell lines, tissue tropism characteristics of viral infection seem key to better understanding viral activity [As discussed, the omplexes  or viralomplexes . As mostactivity . The samactivity ,62. Moreactivity . The sysactivity ,65. Inteactivity .Here we show distinct candidate drugs having a variable effect depending on the multiplicity of infection (MOI) of virus infection in A549-ACE2 expressing cells in low MOI 0.2; A and higin vitro SARS-CoV-2 drug screening [in vitro results  and identification of specific pathways of action of both pathogen and therapeutic compound in healthy and infected systems. For cost efficiency, validated predictive methods and assays for early elimination of potential drug candidates are of great value [in vitro experiments and clinical trials are time-consuming or impossible to reduce to practice. Optimally leveraging the power of pathway analysis by simulating host cell and tissue-specific infection and performing in silico drug selection, has a tremendous potential beyond COVID-19, with applicability to high global burden communicable diseases, translatable to pathogens of viral, bacterial and fungal origin, and potentially chronic disease such as inflamm-aging and diabetes. In conclusion, our PHENSIM approach will enable more effective in vitro experiments resulting in more rapidly initiated clinical trials and accelerated regulatory review of already pre-selected drugs with a high repurposable potential.PHENSIM gives rise to feasible validation and comparison of tal data ,9, givestal data ,52, tractal data , in siliat value . The oveat value , but in 4in vitro and cell-specific data, and will still need to be evaluated further in an in vitro and in vivo setting, as exemplified by HCQ which has not proven to be effective in vivo. Furthermore, our analysis is restricted to simulation of in vitro cell line data for specific cell types.The potential absence of some unknown important genes involved in SARS-CoV-2 infection of host cells in the KEGG databaseis a limitation of this study. Additionally, PHENSIM-determined potential candidates were based on 4Detailed methods are provided in the online version of this paper and include:-KEY RESOURCES TABLE-RESOURCE AVAILABILITYo Data and Code Availability:https://github.com/alaimos/phensim-covid19. Website: https://phensim.atlas.dmi.unict.it/[Bud Mishra: mishra@nyu.edu. Courant Institute of Mathematical Sciences Room 405, 251 Mercer Street, New York, NY 10012.o Lead contact: All input data, raw images, and source codes for PHENSIM are available atunict.it/.o Lead cConceptualization, design, drafting and revision of the manuscript: NIM, RVR, SA, BM, AJD, AF.Concept, design, and revisions of the manuscript: EB, AS, JACB, AP.Methodology: SA, AP; Writing original draft: NIM; Supervision: NIM, BM, AJD, AF.All authors declare no competing interests.https://github.com/alaimos/phensim-covid19. Website: https://phensim.atlas.dmi.unict.it/ [All input data, raw images, and source codes for PHENSIM are available at nict.it/ .Netherlands-Caribbean Foundation for Clinical Higher Education (NASKHO). S.A., A.F. and A.P. have been partially supported by the MIUR PON research project BILIGeCT \u201cLiquid Biopsies for Cancer Clinical Management\u201d.N.I.M. was funded in part by a fellowship award from the"}
{"text": "Identifying healthy carriers of germline pathogenic variants in high penetrance cancer susceptibility genes offers the potential for risk-reducing surgery. The NHS England National Genomic Test Directory offers germline and somatic testing to patients with certain cancers or rare and inherited diseases, or, in some cases, to their relatives. This review summarises current UK guidelines for risk-reducing surgical interventions available for individuals with no personal history of cancer, who are determined to carry germline pathogenic variants. An electronic literature search of NICE guidelines and PubMed citable articles was performed. NICE guidelines are available for bilateral mastectomy and are currently in development for risk-reducing bilateral salpingo-oophorectomy. Guidelines developed with affiliation to, or through relevant British Surgical Societies or international consensus, are available for risk-reducing hysterectomy, polypectomy, gastrectomy, and thyroidectomy. There is a disparity in the development and distribution of national guidelines for interventions amongst tumour types. Whilst we are focusing on UK guidelines, we anticipate they will be relevant much more generally and so of interest to a wider audience including where there are no national guidelines to refer to. We suggest that, as genetic testing becomes rapidly more accessible, guideline development for interventions should be more closely aligned to those for testing. Germline pathogenic variants (GPVs) in cancer predisposition genes play an important role in cancer susceptibility , 2. The BRCA1/2 testing in ovarian cancer [The NHS GMS is at the forefront of integrating genomic testing into routine care and aims to provide equity of genomic testing, aiming to sequence 500,000 whole genomes in England by 2024 [n cancer . Increasn cancer . With inCurrent management options for carriers of GPVs can include active surveillance, medical, endoscopic, and surgical management. Options for medication which reduces the risk of cancer are currently limited, therefore cancer prevention in this setting is usually in the form of risk-reducing surgery (RRS).This review focuses on summarising the current UK guidelines for risk-reducing surgical interventions available for individuals who are found to have GPVs with no personal history of cancer. It also discusses the implications of increased genomic testing on the management of people found to have GPVs.For the purposes of this review, a GPV is defined as per the Cancer Variant Interpretation Group UK classification , and doeBRCA1, BRCA2, PALB2, ATM, CHEK2), ovarian cancer , gastrointestinal cancers including Lynch syndrome , familial adenomatous polyposis, adenomatous polyposis coli (APC), MUTYH-associated polyposis (MUTYH), Juvenile polyposis syndrome , hereditary diffuse gastric cancer (CDH1), PTEN hamartoma-tumour syndrome (PTEN), Peutz\u2013Jeghers syndrome (STK11), Li Fraumeni syndrome (TP53), and multiple endocrine neoplasia type 2 (RET). Figure\u00a0GPVs were shortlisted for literature review based on current germline testing being offered by the NHS England National Genomic Test Directory (April 2022) , the UK\u00a0Clinical guidelines from the National Institute for Health and Care Excellence (NICE) and Scottish Intercollegiate Guidelines Network (SIGN) were screened to identify any existing recommendations for the management of GPVs. Search terms \u2018preventative\u2019, \u2018prevention\u2019, \u2018prophylaxis\u2019, \u2018prophylactic\u2019, \u2018surveillance\u2019, \u2018risk-reducing\u2019 and \u2018genetic\u2019 were used to manually screen both guidelines and guidelines in development.An electronic literature review was performed using PubMed to identify any journal articles summarising UK guidelines for the management of cancer-predisposing genetic syndromes. In the absence of any existing published UK management guidelines, further PubMed searches were performed to identify peer-reviewed publications outlining the management of individual hereditary cancer syndromes. All identified articles published in English language between January 1951 and May 2022 were assessed for suitability. Search terms included are detailed in supplementary table\u00a0British society guidelines were manually searched via their websites. Following the completion of the literature search, local expertise was sought to ensure no further UK guidelines were missed. Overview of literature search and outcomes is provided in Table\u00a0For this review, we created a hierarchy of evidence-based available UK guidelines, and the highest level of evidence has been used to summarise current UK guidelines for each hereditary cancer syndrome. NICE guidelines, are linked to the commissioning of services in England, Wales, and Northern Ireland, whilst SIGN guidance applies in Scotland. These have been considered as higher ranking to other guidelines, followed by national or speciality society guidelines, non-British-society-affiliated journal articles and local guidelines or expertise, respectively. This review has been developed with input from consultants in oncology, surgery and clinical genetics. All sub-speciality guidelines have been reviewed by a surgeon of that speciality.BRCA1, BRCA2, PALB2. It can also be indicated for other \u2018high risk\u2019 variants, including PTEN, TP53, CDH1 and STK11 [Breast cancer is the most common cancer in women . Approxind STK11 . BRRM isnd STK11 .BRCA1, BRCA2, PALB2, ATM, CHEK2, RAD51C and RAD51D truncating variants) are outlined in the NHS England National Genomic Test Directory which is updated twice per year  [Testing criteria for inherited breast and ovarian cancer (tories/) . Testingtories/)  and the tories/) \u201320 to caPTEN gene. For individuals with GPVs of the PTEN gene, there is a lifetime risk of developing breast cancer of between 67 and 85% [PTEN GPVs is indicated in affected individuals with clinical features  or in a deceased individual if appropriate tissue is available and no living affected individual is available for genetic testing [PTEN hamartoma-tumour syndrome (PHTS) is a multi-system disorder which predisposes an individual to an increased risk of breast, thyroid and renal cancers. It may also be associated with endometrial, colorectal, and skin cancer. It is caused by GPVs of the  and 85% \u201325. TestTP53 gene cause a TP53-related cancer syndrome (Li Fraumeni syndrome). It is associated with increased risk of multiple cancers including bone and soft tissue sarcomas, early-onset breast cancer, adrenocortical cancers, and malignant tumours of the central nervous system. Women have a risk of developing breast cancer of up to 85% by 60 years of age, the majority of which is early-onset breast cancer, with median age at diagnosis of 34 years [GPVs in the 34 years . TestingCDH1 tumour suppressor gene are known to cause hereditary diffuse gastric cancer (HDGC) and hereditary lobular breast cancer (HLBC). HLBC is classified as the presence of a CDH1 GPV in either an affected individual or a family with one or more lobular breast cancer cases, but without any diffuse gastric cancer. In those with CDH1 GPV with a personal or familial history of diffuse gastric cancer, this is recategorized as HDGC [CDH1 GPV, there is an estimated 39\u201355% risk of developing lobular breast cancer by age 80 [GPVs of the  as HDGC . For femy age 80 , 28. Geny age 80 . It can STK11 (LKB1) GPV. It is associated with tumours of the gastrointestinal tract, female reproductive system , breast, pancreas, and biliary tract. There is a lifetime female breast cancer risk of 19.3\u201354% in PJS, making it borderline for being a high-risk gene especially where no family history of breast cancer [Peutz\u2013Jeghers syndrome (PJS) is a multi-system disorder caused by a t cancer . GeneticThe NHS England National Genomic Test Directory allows testing outside of the criteria; however, it must be deemed appropriate by a specialist MDT .BRCA1, BRCA2 and TP53 GPVs and carriers of PTEN, CDH1 and STK11 GPVs [NICE guidelines stratify breast cancer risk as \u2018near population risk\u2019, \u2018moderate risk\u2019 and \u2018high risk\u2019. These categories have slightly different definitions based upon lifetime risk from age 20 to risk between ages 40 and 50. High risk of breast cancer is defined as a lifetime risk from age 20 of greater than or equal to 30%, a risk between age 40 and 50 of greater than 8% or known carriers of K11 GPVs . GPVs inNICE recommends that all women at high risk should be offered a discussion about BRRM. There are several prerequisites prior to this procedure taking place. All cases should be managed by a multidisciplinary team and should take into consideration individual risk factors including comorbidities, the woman\u2019s current age and life expectancy. Women who are eligible for BRRM should have genetic counselling under the care of a specialist cancer genetic clinic including pre-operative counselling about psychosocial and sexual consequences of BRRM and directed towards support groups. BRRM should be carried out by a surgical team with specialist oncoplastic/breast reconstructive skills . Breast CDH1 carriers state BRRM can be considered in hereditary lobular breast cancer and hereditary diffuse gastric cancer, however it is not generally recommended for those aged under 30 years or over 60 years [STK11 GPVs in the UK [NICE guidelines for BRRM, do not detail the age threshold for performing risk-reducing surgery. US guidelines and Hanson et al. suggest that BRRM should be considered from age 20 for female carriers of TP53 GPVs . Guideli60 years . Risk-re60 years , howevern the UK .BRCA1/2 or TP53 GPV. Annual MRI breast surveillance is available for young women (aged <50 years) with or at high risk of being a BRCA or TP53 carrier who meet set criteria. The PHTS guideline development group of the GENTURIS European Reference Network suggest screening in individuals with PTEN GPVs should ideally be with annual MRI surveillance, however, this is not NICE guidance [The current NHS England breast surveillance programme offers mammographic surveillance every 3 years to all women aged between 50 and 71 in England. For women at a higher than population risk of developing breast cancer additional surveillance is available. NICE guidelines outline breast imaging surveillance, including mammography, offered to women with a moderate- to high risk of breast cancer or those with a known guidance .BRCA1 female carriers [.Medication to reduce the risk of breast cancer is available for women at moderate-to-high risk of breast cancer for up to 5 years. Tamoxifen is a selective oestrogen receptor modulator which offers long period of prevention of breast cancer following 5 years daily use . It is ocarriers , 33.BRCA1, BRCA2, RAD51C, RAD51D and PALB2. Meanwhile, GPVs associated with ovarian cancer but not associated with breast cancer include those found in LS , and BRIP1 [Ovarian cancer can form part of an inherited cancer syndrome with or without association with breast cancer. GPVs which are associated with both ovarian and breast cancer include nd BRIP1 . The Eurnd BRIP1 .SMARCA4 [SMARCA4 testing is outlined in the national genomic test directory, but germline testing is not routinely available [Small cell carcinoma of the ovary, hypercalcaemic type, is a rare and extremely aggressive subtype of ovarian cancer associated with somatic and germline deleterious variants of SMARCA4 , 37. Somvailable . Given tvailable .The NHS England National genomic test directory outlines testing that is appropriate for the affected individual if they have high-grade non-mucinous epithelial ovarian cancer (EOC) at any age or EOC with a family history of EOC (at least one first or second-degree relative or greater than two second- or third-degree relatives). Testing can also be performed on a deceased affected individual if appropriate tissue is available and no affected living relative is available for testing. In inherited ovarian cancer which is associated with breast cancer, this is extended to living unaffected individuals in certain circumstances .BRCA1/2 GPVs [Risk-reducing bilateral salpingo-oophorectomy (RRBSO) is the gold standard for the prevention of ovarian cancer with an 80\u201396% risk reduction in patients with 1/2 GPVs . RRBSO d1/2 GPVs \u201340. Conc1/2 GPVs .BRCA1 44% , BRCA2 17% (11\u201325%) [RAD51C 11% (6\u201321%), RAD51D 13% (7\u201323%) [MLH1, MSH2 and MSH6 (LS) 11% (7.4\u201319.7%), 17.4% (11.8\u201331.2%) and 10.8% (3.7\u201338.6%), respectively [PALB2 ~5% (2\u201310%) and BRIP1 5.8% (3.6\u20139.1%) [BRCA1 GPVs and those with LS, between 40 and 45 years for those with BRCA2 GPVs, 40 and 50 years for RAD51C or RAD51D carriers and delayed to 45 and 50 years for carriers of BRIP1 or PALB2 [The Royal College of Obstetrics and Gynaecology (RCOG) has produced a summary of guidelines in conjunction with the British Journal of Obstetrics and Gynaecology regarding the role of RRBSO in individuals below the age of natural menopause . RRBSO c(11\u201325%) , RAD51C  (7\u201323%) , MLH1, Mectively , PALB2 ~.6\u20139.1%) , 44. Theor PALB2 .RRBSO is usually undertaken once a woman\u2019s family is complete, although this is considered in the context of her personal circumstances and risk. It is possible to consider the option of fertility preservation with IVF or oocyte freezing, as embryos can be implanted after RRBSO to enable the woman the potential option of completing her family later. For many women RRBSO is performed prior to the age of the natural menopause, resulting in an iatrogenic \u2018surgical\u2019 menopause. Consequently, immediate menopausal symptoms are often experienced which may include vasomotor symptoms, mood changes, sleep disturbance, vaginal dryness, and sexual dysfunction. Longer-term consequences of an early menopause include increased risk of cardiovascular disease, osteoporosis, and neurocognitive effects. Hormone replacement therapy (HRT) up to 51 years of age is recommended, in the absence of any contraindication including personal history of breast cancer or venous thromboembolism. It can result in symptom relief and minimises the long-term effect of early menopause; however, it may not completely ameliorate the effects of surgery on sexual function . The impBRCA1/2 GPVs  [The combined oral contraceptive pill (COCP) is a strong protective factor for ovarian cancer in the general population and has been demonstrated to substantially reduce the risk of ovarian cancer in women with GPVs in 19\u20130.73) , 46. Wom19\u20130.73) . There i19\u20130.73) .MLH1, MSH2, MSH6, PMS2 [Lynch syndrome (LS) is associated with GPVs in DNA mismatch repair (MMR) genes including GPVs of H6, PMS2 , 48. GPVH6, PMS2 .In the UK, all new diagnoses of endometrial and colorectal cancer are eligible for tumour immunohistochemistry to identify MMR-deficient or microsatellite instability tumours that may be suggestive of LS. Germline testing can subsequently confirm the presence of GPVs in LS genes. Germline testing is also appropriate for affected individuals or unaffected individuals with family history of LS-related cancer where no affected living individual is available for testing .MLH1, 48.9% in MSH2, 41.1% in MSH6 and 12.8% in PMS2 mutation carriers [The risk of endometrial cancer in LS varies as the genes associated with LS have different penetrance. Cumulative incidence of endometrial cancer at 75 years of age is 37% in carriers .MLH1 (13%), MSH2 (16%)| and MSH6 (11%) GPVs who would have been expected to develop endometrial cancer [MSH2 or MLH1 and after age 40 years for MSH6. There is insufficient evidence for recommending risk-reducing gynaecological surgery for carriers of PMS2 GPVs, however patient representatives have expressed that they should be offered RRS [MSH6 GPVs, the risk of developing ovarian cancer only starts to increase in the post-menopausal years, in contrast to an earlier onset risk for endometrial cancer. In these women, a two-stage RRS approach may be adopted, after counselling, with RRH offered from 40 years, and delayed RRSBO until after 50 years, in circumstances where the woman wishes to avoid surgical menopause and prefers to avoid taking HRT.Risk-reducing hysterectomy (RRH), often performed with bilateral salpingo-oophorectomy (BSO), is an option for patients with LS. RRH at age 40 years has been demonstrated to prevent endometrial cancer by age 50 years in carriers of l cancer . Currentered RRS . The Briered RRS . The BGCered RRS . For womBRCA1 carriers estimated as 3% lifetime risk [Recently, a few studies have reported an increased risk of serous endometrial cancer in ime risk , 54. Thiime risk .There is no population-wide surveillance tool for endometrial cancer in the UK. Current international guidelines do not recommend invasive screening for carriers of MMR GPVs, however there is a recommendation that they may wish to consider the option of annual clinician review from the age of 25 to discuss red flag features of endometrial and ovarian cancer . The BGCThere is strong evidence to show that obesity is associated with a significantly increased risk of endometrial cancer in the general population, whilst use of progestogen-containing hormonal contraceptives, oral or intra-uterine, is potentially associated with a decreased risk . The BGCSeveral syndromes are associated with a predisposition to colorectal cancer. This includes LS, APC-associated polyposis, Peutz\u2013Jeghers Syndrome (PJS), Juvenile Polyposis Syndrome (JPS) and MUTYH-associated polyposis. The British Society of Gastroenterology (BSG), Association of Coloproctology of Great Britain and Ireland (ACPGBI), and the UKCGG have produced extensive guidelines developed in accordance with the BSG NICE-compliant guideline process regarding the management of hereditary colorectal cancer . They reMLH1 48.3%, MSH2 46.6%, MSH6 20.3%, PMS2 10.4%) [LS is the most common heritable cause of colorectal cancer and is associated with 10-48% cumulative risk of developing colorectal cancer by the age of 75 years dependent on the mutated MMR gene  is defined by the presence of GPVs in the APC gene which predisposes an individual to colorectal and upper GI polyposis. The lifetime risk of malignancy in FAP is 100% . GeneticSTK11 and is associated with an increased risk of multiple tumours including a 28\u201334% cumulative risk of developing colorectal cancer by age 64 years [PJS is a rare autosomal dominant condition which causes hamartomas polyps and mucocutaneous pigmentation. It is caused by a GPV in 64 years , 59. TesSMAD4 or BMPR1A [MUTYH gene and is recessively inherited. It is associated with a 63% cumulative lifetime risk of colorectal cancer at age 60 years [Juvenile polyposis syndrome (JPS) is an autosomal dominant condition associated GPVs in r BMPR1A . It is cr BMPR1A . MUTYH-a60 years .Most interventions for carriers of GPVs which predispose to colorectal cancer involve endoscopic surveillance. However, in some cases, preventative procedures are recommended.In FAP, colonoscopic surveillance is recommended every one to 3 years, commencing from age 12\u201314 years. Risk-reducing colectomy is an option for patients with FAP. This can be through a total colectomy and subsequent ileorectal anastomosis; or a proctocolectomy with ileal pouch-anal anastomosis; or a proctocolectomy with ileostomy formation. Relative indications for preventative surgical intervention include polyps >10\u2009mm in diameter, high-grade dysplasia within polyps and a significant increase in polyp burden between surveillance examinations . The BSGIn the future, patients with LS may be referred to the NHS Bowel Cancer Screening Programme . In JPS Both NICE and the BSG/ACPGBI/UKCGG recommend daily aspirin to reduce the incidence of LS-related colorectal cancer , 63, 64.CDH1 or CTNNA1 GPV in either an individual with DGC, or unaffected individual with a family pedigree featuring one or more DGC cases in first-degree or second-degree relatives, with or without a personal or family history of lobular breast cancer [Hereditary diffuse gastric cancer (HDGC) is an autosomal dominant inherited condition characterised by a high prevalence of early-onset diffuse-type gastric cancer (DGC) and lobular breast cancer. Recent guidelines from the international gastric cancer linkage consortium (IGCLC) have revised the definition of HDGC to the presence of a t cancer . The cumt cancer , 65.CDH1 GPVs, and soon to include CTNNA1 GPVs, is available for affected individuals who meet the set clinical criteria whereby at least one cancer is histologically confirmed. It can alternatively be performed for a deceased individual where appropriate tissue is available, and no living affected individual is available. Full criteria are detailed in the NHS England National Genomic Test Directory [CTNNA1 testing should be considered for individuals who meet the criteria for genetic testing and no CDH1 GPVs are identified [Genetic testing for irectory . The IGCentified .CDH1 GPVs with a family history of DGC. For carriers of CDH1 GPVs without a family history of DGC, or with a family history of lobular breast cancer only, PTG should still be considered [A recommendation for prophylactic total gastrectomy (PTG) is made for all carriers of nsidered . PTG is nsidered . Surgerynsidered .An overriding principle in PTG is to minimise risk to the patient. Choice of surgical approach should be guided by that least likely to incur a complication as a serious complication following PTG may impact not only the patient but other family members and patients with HDGC in their decision to come forward for surgery. Both minimally invasive and open approaches are well-described with one of the largest series reporting a median one-day improvement in post-operative length of stay with a laparoscopic approach . As the As signet ring cell foci are multifocal and can occur throughout the stomach in HDGC there is no role for endoscopic or limited gastric resection in the treatment of HDGC. Total gastrectomy offers the potential for cure but has several risks and long-term sequalae, therefore it is recommended that patients have pre-operative psychosocial counselling and assessment for comorbid mental illness, particularly eating disorders and addiction . PatientThere are several common consequences of PTG including weight loss, nutritional deficiencies, a risk of dumping syndrome, pancreatic insufficiency, small-intestinal bacterial overgrowth, and hypoglycaemia. Life-long follow-up is needed to monitor for and treat these conditions to reduce their impact on quality of life .Due to the inherent risks of total gastrectomy and the significant lifestyle and nutritional consequences, many patients wish to defer surgery . All patRET gene and has an autosomal dominant inheritance pattern. MEN2 is subcategorised into MEN2a and MEN2b . Both MEN2A/B are associated with medullary thyroid carcinoma. The risk of medullary thyroid cancer is 95% in MEN2a and 100% in MEN2b [PTEN GPVs are associated with a 35% lifetime risk of thyroid cancer development [Multiple endocrine neoplasia type 2 (MEN2) is a multi-system disease associated with GPVs of the in MEN2b . MEN2b ain MEN2b  and is ain MEN2b , 76. In elopment .RET GPVs from those associated with the highest to moderate risk of medullary thyroid carcinoma [RET GPVs with specialist input from clinical genetics [Testing for MEN2 is outlined in the NHS England National Genomic Test Directory . In totaarcinoma . Prenatagenetics .PTEN GPVs is indicated in affected individuals with clinical features  or in a deceased individual if appropriate tissue is available and no living affected individual is available for genetic testing [Testing for  testing .RET GPVs and has dramatically improved outcomes in patients with MEN2. Risk-reducing surgery should be offered to disease-free carriers of RET GPVs. Given that risk-reducing surgery is an option for children, this should be discussed with parents before testing a child for a RET GPV. Timing of risk-reducing surgery is dependent on the risk of the variant such that children with the highest-risk variant, c.2753\u2009T\u2009>\u2009C (p.Met918Thr), would be recommended to have risk-reducing surgery within the first year of life and those with high-risk RET GPVs (codon 634 changes) are recommended to have risk-reducing surgery before age five Meanwhile, children with moderate risk RET GPVs may delay surgery to beyond 5 years of age [Risk-reducing thyroidectomy is an option for carriers of s of age , and thes of age .RET GPV carriers [PTEN GPVs [Ultrasound neck examination and calcitonin level monitoring are possible and should be introduced in the first year of life for highest-risk RET GPV carriers, or after age 3\u20135 years for all other carriers , 76. TheTEN GPVs . Risk-reTEN GPVs .This review summarises the current genomic indications for RRS, including mastectomy, bilateral salpingo-oophorectomy, hysterectomy, gastrectomy, polypectomy, and thyroidectomy, as well as highlighting surveillance available for healthy carriers of GPVs. The guidelines vary from NICE guidelines to recommendations by British specialist societies from international consensus guidelines to individual journal article recommendations. Figure\u00a0BRCA1/2 carriers have increased over the last two decades [The rates of RRS for  decades . However decades .Historically, there has been disparity in the availability of testing across the UK. There are differences in the way in which genomics has become integrated into healthcare across the four nations and the differences in the NHS structure and systems . To the The guidelines for intervention outlined in this review are based upon the presence of a specific GPVs, designated as pathogenic and according to the NHS England National Genomic Test Directory. VUS are variants detected during sequencing, for which there is insufficient evidence for or against pathogenicity . In a reThe Cancer Variant Interpretation Group UK (CanVIG) has developed a detailed framework  regardinVUS and variant reclassification pose a challenge for communication with patients, and a significant problem for clinicians and healthcare systems. CanVIG recently published a framework how to discuss the presence of VUS with patients . The UK Ethical considerations are important when communicating with patients. Surgical prophylaxis is controversial. In most inherited cancer syndromes, the patient will not definitely develop cancer, while surgery is not always guaranteed to prevent the development of cancer and can have life-changing implications. There must be careful consideration of the risk of developing cancer balanced against the effectiveness of a surveillance programme and the morbidity of surgical intervention and potential alternative management strategies. Effective communication is vital when discussing risk with healthy individuals to enable them to make an informed decision. Genomic medicine services often provide letters or leaflets for affected patients carrying GPVs to share with relatives whom it may affect. However, on rare occasions, known carriers may refuse to share information with at-risk relatives, which is ethically challenging. The joint committee on Genomics in Medicine outlines how to approach these situations and, in line with GMC guidance, when it is appropriate to break confidentiality and how to disclose to affected relatives without disclosing confidential information . With thThe UK is at the forefront of integrating genomic testing into routine clinical care . Many chThis review summarises the current indications for risk-reducing surgical procedures for healthy carriers of GPVs. There is currently a disparity in the development and distribution of national guidelines for interventions across tumour sites. For example, there are well-established but outdated NICE guidelines on the role of BRRM, but little guidance on the role of RRS in MEN2. There is a rapid progression of genomics in cancer medicine, however there is a risk of clinicians and patients receiving results without clear guidance for possible interventions, resulting in the potential for variation in and the possibility of inappropriate patient management. We suggest as testing becomes rapidly more accessible, guideline development for intervention needs to be more closely aligned to those of testing.Supplementary material"}
{"text": "Background: The treatment of the primary tumour in colorectal cancer with unresectable liver and/or lung metastases but no peritoneal carcinomatosis is still a matter of debate. In the absence of clear evidence and guidelines, our survey was aimed at obtaining a snapshot of the current attitudes and the rationales for the choice of offering resection of the primary tumour (RPT) despite the presence of untreatable metastases. Methods: An online survey was administered to medical professionals worldwide. The survey had three sections: (1) demographics of the respondent, (2) case scenarios and (3) general questions. For each respondent, an \u201celective resection score\u201d and an \u201cemergency resection score\u201d were calculated as a percentage of the times he or she would offer RPT in the elective and in the emergency case scenarios. They were correlated to independent variables such as age, type of affiliation and specific workload. Results: Most respondents would offer palliative chemotherapy as the first choice in elective scenarios, while a more aggressive approach with RPT would be reserved for younger patients with good performance status and in emergency situations. Respondents younger than 50 years old and those with a specific workload of fewer than 40 cases of colorectal cancer per year tend to be more conservative. Conclusions: In the absence of clear guidelines and evidence, there is a lack of consensus on the treatment of the primary tumour in case of colon cancer with unresectable liver and/or lung metastases and no peritoneal carcinomatosis. Palliative chemotherapy seems to be the first option, but more consistent evidence is needed to guide this choice. Colorectal cancer (CRC) is one of the leading cancers worldwide and is responsible for more than 900,000 deaths every year . DespitePatients with infiltrated regional lymph nodes are not considered metastatic, but distant nodal involvement is considered to be metastatic. According to the TNM system , CRC witHowever, in the past few decades, the prognosis of patients with metastatic CRC has significantly improved with the development of lung and liver resective surgery in case of oligometastatic disease, but in the presence of extensive secondary lesions radical surgery is no longer an option and any treatment is only aimed at prolonging the survival and controlling the symptoms.For elective patients, palliative chemotherapy can be effective, but the advantage it can offer in terms of overall survival is minimal and personalised effective treatments are yet to come .Despite some interesting evidence showing that in selected cases resection of the primary tumour (RPT) can guarantee better survival than chemotherapy alone , palliatwww.google.com/forms/about/ accessed on 16 March 2023). The survey was divided into 3 parts\u2014Part 1: demographics of the respondent; Part 2: 12 clinical scenarios; and Part 3: general clinical questions. The \u201cclinical scenarios\u201d were 7 elective cases and 5 emergency cases. Although each of them can represent a real clinical situation, as all cases are quite general, none of the clinical scenarios were deliberately and overtly taken from experiences of real patients who came under our care and each reference to real persons is to be considered the full result of chance. Questions are reported in www.linkedin.com accessed on 16 March 2023) and by email to the members of the Italian Association of Hospital Surgeons , the Italian Society of Surgical Pathophysiology  and the Tosco-Umbra Society of Surgery (Societ\u00e0 Tosco-Umbra di Chirurgia). The link was also emailed to known colleagues in Italy and abroad.An online survey was created using Google Forms . The distribution of responses for every single question was calculated. Subsequently, individual scores were calculated for each respondent based on how often he or she would offer resection of the primary tumour according to the clinical scenarios, both in elective (\u201celective resection score\u201d) and emergency situations (\u201cemergency resection score\u201d). The scores were calculated as a percentage of responses where \u201cresection\u201d was considered as the first choice on the total of elective or emergency scenarios. The scores are supposed to give an idea of the general attitude of that specific respondent. They were correlated to basic independent variables such as age, type of affiliation and specific workload. The variables were compared using a one-way ANOVA test . All variables were entered into a backward stepwise regression analysis to identify the independent prognostic variables associated with the elective and emergency resection scores.p-values less than 0.05 are considered to be statistically significant. Values of variables are approximated to the tenths. p-values are approximated to the thousandths.Statistics were performed within the same database with the add-on StatPlus for Mac v.7.8.11 . Missing values were excluded listwise. The demographics of the respondents are listed in Responses to the clinical questions  are visup = 0.000). Mean elective resection scores are also significantly lower than emergency resection scores for respondents who are younger and older than 50, for respondents who treat more than 40 colorectal cancers per year, for those affiliated with academic or non-academic hospitals, with or without a proper colorectal multidisciplinary team, and for consultants and non-consultants. Respondents younger than 50 years old have a significantly lower average elective resection score compared to more senior respondents (p = 0) (p = 0.645). Similarly, professionals who managed less than 40 cases of colorectal cancer per year have a higher elective resection score (p = 0.001) (p = 0.710). The elective resection score did not change significantly according to the type of practice. (p = 0) . This di= 0.001) . This diDue to the fact that none of the analysed variables resulted significantly associated with the emergency resection scores, regression analysis was conducted only for elective resections scores , and it Advanced colorectal cancer with non-treatable distant metastases is associated with poor prognosis. Palliative chemotherapy can help prolong survival, but the advantage brought by chemotherapy alone is only marginal, despite huge improvements in targeted and personalised treatments . BearingAfter denying any advantage of RPT for many years and suggesting upfront chemotherapy in all patients with Stage IV CRC, the last edition of the UK NICE  guidelines on colorectal cancer clearly suggest that RPT should be considered in patients with \u201cincurable metastatic colorectal cancer who are receiving systemic anti-cancer therapy and have an asymptomatic primary tumour\u201d  on the gThe guidelines of the Association of Coloproctology of Great Britain and Ireland (ACPGBI), those of the European Society for Medical Oncology (ESMO) and those of the German Guideline Program in Oncology do not mention the possibility of RPT and consider upfront chemotherapy in these cases ,9,10.The US National Comprehensive Cancer Network (NCCN) guidelines and those of the American Society of Colon and Rectal Surgeons (ASCRS) suggest upfront systemic chemotherapy and consider RPT only in case of significant symptoms or complications ,12.The 2020 guidelines of the Italian Association of Medical Oncology (AIOM) almost overlap with the NCCN and the ASCRS guidelines and briefly suggest RPT if the primary tumour is symptomatic, but without discussing the available evidence .Evidently, there is a degree of variability among the several national and international guidelines, reflecting slightly different points of view.The JCOG1007 study from Japan published in 2021 was terminated early due to futility as the first interim analysis showed that the predictive probability of survival being higher in the RPT group than in the chemotherapy group would be quite low at the final analysis if the study were to be continued. In fact, the updated final analysis on 165 patients failed to demonstrate better survival in the RPT group compared to the chemotherapy group .A specific randomized controlled trial comparing RPT to upfront chemotherapy in metastatic CRC, with a median follow-up of 15 months, was recently conducted in South Korea . The stuThe CAIRO4 phase 3 randomized controlled trial focused on 60-day mortality of patients randomized to RPT vs. upfront chemotherapy, and showed that RPT is associated with a higher risk of mortality compared to chemotherapy alone , in partThe FFCD 9601 study proved that the real advantage of RPT vs. upfront chemotherapy is in prolonging survival. In fact, median survival was 16.3 vs. 9.5 months, 2-year survival was 24% vs. 10% and 6-month progression-free survival was 38% vs. 22%. All these results were statistically significant. In multivariate analysis, RPT was the strongest independent factor associated with improved survival. Good performance status and distal location of the tumour were also independently associated with better survival. In other terms, good results in terms of improved survival could be obtained in patients in good general condition undergoing resection of a distal colonic primary tumour even in the presence of unresectable distant metastases [An 11-year-old metanalysis by our team of seven low-quality studies involving 1086 pooled patients failed to find any survival benefit in RPT compared to upfront chemotherapy , but a mA pooled post hoc analysis performed on 1155 cases from four trials showed that RPT guarantees better overall survival compared to chemotherapy alone in patients with unresectable metastatic CRC . As in mOn the contrary, a large observational retrospective cohort study from the US on 6735 patients from the National Cancer Data Base concluded that RPT does not improve survival and may delay the onset of palliative chemotherapy. However, despite the large sample size, the study has multiple limitations, including some degree of selection bias  .Xu et al. retrieved data from the US National Cancer Institute\u2019s Surveillance, Epidemiology and End-Results database, covering about 30% of the US population, and identified 44,514 patients with stage IVa and IVb CRC. Survival gain for patients who had RPT was 7\u201311 months (median 9 months) compared to those who have been treated only with any form of chemotherapy . RPT was independently related to better survival upon multivariate analysis. Furthermore, RPT patients had also a significantly lower likelihood of all-cause death .Other published papers are low or very low-quality retrospective cohort studies, with most of them showing that RPT is associated with better 2-year survival .Finally, the SYNCHRONOUS study was launched in 2012 and aimed at comparing RPT and chemotherapy in asymptomatic Stage IV CRC patients. Its main endpoint is long-term survival, but its results are still pending .Guidelines and evidence do not fully agree on this subject, and the decision to offer RPT or not is still up to the surgeon, the oncologist and the CRMDT, if present, but unsupported by clear guidance.This study was aimed at obtaining a snapshot of the current attitudes of medical professionals on the treatment of primary tumours in Stage IVa and IVb CRC.Our survey showed that the vast majority of professionals base their decision on age, comorbidities, performance status and symptoms. In fact, about half of the respondents to our survey would consider RPT in patients who presented as emergencies against only one-third who would consider RPT in elective and non-symptomatic patients.Only one-third of the respondents seem to be so confident as to base their decision on the K-RAS status. This finding might have something to do with the fact that most respondents are surgeons, who may not have the knowledge to understand how a na\u00efve or mutant K-RAS gene can influence the therapeutic options. As a matter of fact, the presence of a na\u00efve K-RAS would allow the oncologist to consider second- or third-line chemotherapy with monoclonal antibodies, while patients with mutant K-RAS (or N-RAS or BRAF) may have fewer options available, so cytoreductive surgery may become the last resort.Younger respondents seem to have a less aggressive approach in elective cases. This is quite surprising. A possible explanation could be that more experienced doctors have a more patient-centred attitude, trying to do the maximum for that patient despite all odds, against a more evidence-centred attitude of younger doctors who may be a little more realistic, considering that those patients have a poor prognosis anyway.Much more understandable is the finding that respondents with lower workloads\u2014in terms of the number of CRCs treated per year\u2014would offer RPT more often, to try and increase their surgical experience.These two variables\u2014age and workload\u2014also resulted significantly and independently correlated with the elective resection score upon multivariate analysis, thus confirming the findings of the univariate analysis.The nature of the hospital, the presence of a colorectal multidisciplinary team and professional seniority did not influence the choice to offer resection or not, both in elective and emergency scenarios.The main limitation of this study is the uneven geographical distribution of respondents, with most of them being from Southern Europe (75%), the unbalanced gender distribution, with most of the respondents being men (79%), and the prevalence of surgeons among the respondents (98%). It is not clear how much the results could have been biased because of this unequal distribution. However, we feel that a basis of more than 600 respondents is in any case a good sample size and may fairly represent the general attitude towards a topic that has never been clearly standardised and is probably not fully standardisable anyway. Another eventual downside of this survey is that the 12 clinical scenarios do not cover all the possible situations, and there are still grey areas that have not been explored by the survey. While we can appreciate that this may be a minor issue, we must emphasise that adding more and more questions would have made the survey hardly acceptable to potential respondents. Furthermore, we feel that the depicted clinical scenarios give a very good idea of the general attitude of the medical community towards the delicate topic of the treatment of the primary lesion in metastatic colorectal cancers.The lack of high-level evidence and specific evidence-based guidelines makes the indication of RPT in these patients still a matter of debate. A proper long-term multicentric randomized clinical trial with a large sample would hopefully be able to clarify this topic and shed some light on the decision-making for these patients.In conclusion, this survey has demonstrated that doubts remain in both elective and emergency situations on the treatment of the primary tumour in Stage 4 CRC with non-operable liver and/or lung metastases but no peritoneal carcinomatosis. Palliative chemotherapy seems to be the first option, particularly in elective situations, but more consistent evidence is much needed to guide this choice."}
{"text": "P\u2009=\u20090.015) and less delayed bone age (BA) before GH treatment (P = 0.026) predicted monogenic FSS. In children with BA delayed less than 0.4 years and with shorter parent\u2019s heights \u2264\u22122.4 SD, monogenic FSS was revealed in 13/16 (81%) cases. To conclude, in FSS children treated with GH, a monogenic etiology is frequent, and gene variants affecting the growth plate are the most common. Shorter parent\u2019s height and BA are clinical predictors of monogenic FSS.Familial short stature (FSS) describes vertically transmitted growth disorders. Traditionally, polygenic inheritance is presumed, but monogenic inheritance seems to occur more frequently than expected. Clinical predictors of monogenic FSS have not been elucidated. The aim of the study was to identify the monogenic etiology and its clinical predictors in FSS children. Of 747 patients treated with growth hormone (GH) in our center, 95 with FSS met the inclusion criteria (pretreatment height \u2264\u22122 SD in child and his/her shorter parent); secondary short stature and Turner/Prader\u2013Willi syndrome were excluded criteria. Genetic etiology was known in 11/95 children before the study, remaining 84 were examined by next-generation sequencing. The results were evaluated by American College of Medical Genetics and Genomics (ACMG) guidelines. Nonparametric tests evaluated differences between monogenic and non-monogenic FSS, an ROC curve estimated quantitative cutoffs for the predictors. Monogenic FSS was confirmed in 36/95 (38%) children. Of these, 29 (81%) carried a causative genetic variant affecting the growth plate, 4 (11%) a variant affecting GH\u2013insulin-like growth factor 1 (IGF1) axis and 3 (8%) a variant in miscellaneous genes. Lower shorter parent\u2019s height ( Familial short stature (FSS) is a term commonly used in clinical practice to describe the vertical transmission of a growth disorder. A short child is classified as having FSS if at least one of his/her parents is also short (height \u22122 SD or less in both the child and his or her shorter parent) . The etiNPR2 gene were revealed in 2\u20136% of ISS children   , 13. MutGH1 gene) is one example. Another possibility is rare AD inheritance of mutations in genes affecting pituitary morphogenesis and differentiation  that could cause FSS and multiple pituitary hormone deficiency  \u2013insulin-like growth factor (IGF) axis are also known to cause familial short stature . Growth ficiency , 15. InsB genes) .Despite the substantial advances in understanding the genetic background of short stature, most short children with short parents do not know the real cause of their growth disorder and are classified using only the descriptive diagnosis of FSS . The resFinding a genetic cause of a growth disorder is important both to understand the etiopathogenesis of short stature in the family and to screen for possible comorbidities frequently associated with the specific genetic finding . AccordiThe database of children treated with GH in our center currently includes 747 individuals. After the exclusion of patients with Turner syndrome, Prader-Willi syndrome, and those with secondary causes of their short stature , 528 children remained for further evaluation. Within this group, 125 children had FSS defined as a life-minimum height \u2264\u22122 SD in both the patient and his/her shorter parent. In 95 children with FSS, their legal guardians consented to genetic testing, and those children were enrolled in the study. All study participants or their legal guardians signed written informed consent prior to genetic testing. The study was approved by the institutional Ethics Committees of the 2nd Faculty of Medicine, Charles University in Prague, Czech Republic.The heights of all children were obtained during anthropometric measurements that also focused on body proportionality . Information about their birth parameters was obtained from medical records. The heights of all the parents were measured to the nearest 1 mm, and the heights of more distant relatives were obtained from the parents. All the data were standardized according to recent normative values , 18, 19.The median age of 95 children with FSS at inclusion in the study was 12 years (IQR 9\u201315 years), and their life-minimum height was \u22123.0 SD (\u22123.5 to \u22122.7 SD) and the height of their shorter parent was \u22122.7 SD (\u22122.9 to \u22122.2 SD). The children had been treated with GH for 5 years (3\u20137 years), with an average dose during the first year of treatment of 33 \u00b5g/kg/day (31\u221235 \u00b5g/kg/day). Within this group, 64/95 (67%) children were classified as having GHD. Their maximum GH level after stimulation was 6.4 \u00b5g/L . Forty-seven children had mild GHD with stimulated GH concentrations of 5\u221210 \u00b5g/L, and the remaining 17 children had stimulated GH concentrations <5 \u00b5g/L. Fifty-one children (54%) within the study cohort were born SGA . Their median birth weight and birth length were \u22122.0 (IQR \u22122.5 to \u22121.6) and \u22122.6 SD (IQR \u22123.1 to \u22122.3), respectively. Twenty children (20%) were classified as having combined GHD and SGA.in situ hybridization. In all boys with confirmed disproportionate short stature, SHOX deficiency, including point mutations, was examined using Sanger sequencing and multiplex ligation-dependent probe amplification. In children with clinical suspicion of a specific genetic disorder, targeted genetic testing was performed. In 11 children, genetic diagnosis of FSS was elucidated prior to the study (genes SHOX (6), ACAN (2), PTPN11 (2), and NF1). Children with no genetic cause of their short stature elucidated prior to the study were subsequently examined using next-generation sequencing (NGS) methods.All patients underwent basic genetic testing prior to the study, as described previously . In all Genomic DNA was extracted from peripheral blood in all patients included in the study. DNA from the first 26 patients with severe FSS (life-minimum height <\u22122.5 SD both in the patient and his/her shorter parent) was analyzed using whole-exome sequencing, and DNA from the remaining 58 patients was analyzed using a custom-targeted NGS panel of 398 genes known to be associated or potentially associated with growth , COL2A1 (5), COL11A1 (2), NPR2 (4), ACAN (2), FGFR3 (2), PTPN11 (2), COL11A2, COL1A2, COMP, MATN3, EXT2 and NF1 genes), and 4 children (11%) carried variants affecting the GH\u2013IGF1 axis . The remaining three children carried variants in miscellaneous genes . In all children, heterozygous variants were inherited from their shorter parent. One exception was a pathogenic variant in the SALL4 gene in patient 35 , who inherited the variant not from his short mother (height \u22122.4 SD) but from his father with normal height (\u22121 SD) and radial ray defects. Thus, we presume that the SALL4 pathogenic variant is causative for radial ray defects but likely not for short stature in the family. A diagram showing the examination process in detail is shown in Altogether, in 76/95 (80%) children with FSS treated with GH, we found at least one genetic variant of potential clinical importance in genes with a known impact on growth. Finally, monogenic etiology (pathogenic or likely pathogenic genetic variants discovered) was described in 36/95 (38%) children with FSS. Of these, 29 children (81%) carried causative genetic variants affecting the growth plate   , 13, 35.tations) , 37, 38.tations) . In chiltations) . Thus, tClarifying the genetic disorder-specific reactions to GH treatment that would lead to further refinement of indications for GH therapy poses one of the important current challenges of pediatric endocrinology. To achieve this aim, it will be necessary to accumulate large cohorts of children with specific monogenic growth disorders , 40. TheFor the abovementioned reasons, we consider genetic examination an important part of evaluating children with short stature. First, we should exclude Turner syndrome in all girls  and provide a targeted examination in case of clinical features leading to a suspicion of a specific genetic diagnosis  , 33, 34.We acknowledge that our study had several limitations. First, no functional studies have been performed. However, according to current guidelines, other methods can be used to prove the pathogenicity of genetic variants . In our Monogenic etiology is frequent in children with FSS treated with GH, and gene variants affecting the growth plate are the most common. A shorter parent height and the absence of BA delay are the best clinical predictors of monogenic FSS.The authors have no conflicts of interest to declare.This work was supported by the Ministry of Health, Czech Republic, grant number NU22J-07-00014."}
{"text": "The comorbidity burden has a negative impact on lung-cancer survival. Several comorbidity scores have been described and are currently used. The current challenge is to select the comorbidity score that best reflects their impact on survival. Here, we compared seven usable comorbidity scores  with coded administrative data according to the tenth revision of the International Statistical Classification of Diseases and Related Health Problems to select the best prognostic index for predicting four-month survival.This cohort included every patient with a diagnosis of lung cancer hospitalized for the first time in the thoracic oncology unit of our institution between 2011 and 2015. The seven scores were calculated and used in a Cox regression method to model their association with four-month survival. Then, parameters to compare the relative goodness-of-fit among different models\u00a0, and discrimination parameters (the C-statistic and Harrell\u2019s c-statistic) were calculated. A sensitivity analysis of these parameters was finally performed using a bootstrap method based on 1,000 samples.In total, 633 patients were included. Male sex, histological type, metastatic status, CCI, CCI-lung, Elixhauser score, and Elixhauser-lung were associated with poorer four-month survival. The Elixhauser score had the lowest AIC and BIC and the highest c-statistic and Harrell\u2019s c-statistic. These results were confirmed in the sensitivity analysis, in which these discrimination parameters for the Elixhauser score were significantly different from the other scores.Based on this cohort, the Elixhauser score is the best prognostic comorbidity score for predicting four-month survival for hospitalized lung cancer patients.The online version contains supplementary material available at 10.1186/s12874-023-01994-6. The median age at lung cancer diagnosis is 70 years . Given tThe negative affect of comorbidities on patient survival are well described \u20136. SinceCertain comorbidity scores are based on the International Statistical Classification of Diseases and Related Health Problems ICD-10), as Quan et al. published ICD-10 codes relative to comorbidities in 2005 . They in0, as QuaYang et al. found that the ACCI was better at predicting three-year overall survival than the CCI and Elixhauser score in a cohort of resected lung-cancer patients  based onAlthough the CCI is the most widely used comorbidity score, it would be informative to assess which score is more predictive of mortality in cohorts with administrative data. Here, we compared the seven comorbidity scores available using administrative data coded using the ICD-10 in predicting four-month survival of our cohort of hospitalized lung-cancer patients.We included patients hospitalized in the Thoracic Oncology Unit of Grenoble Alpes University Hospital from 2011 to 2015 described in an earlier publication . Lung-caThe study was approved by our institutional review board and ethics approval was obtained on September 1, 2021 .The database contains information on individuals including their age, gender, lung cancer\u2019 TNM staging, performance status at their first presentation case in multidisciplinary concertation meetings, and the histological type of the lung cancer.The outcome was median overall survival. Survival data were obtained from our district cancer registry, including the date of the last follow-up and the vital status at the last follow-up. Right censored date point was defined by median overall survival.Age, gender, lung cancer metastatic status, histologic type, age at hospitalization, and age at diagnosis were included as covariates.Data concerning comorbidities were obtained by the Health Information Services Department and coded using the ICD-10. The diagnoses for comorbidities were recorded at the patients\u2019 discharge in our medical unit. Seven comorbidity scores were calculated: CCI, ACCI, CCI-lung, NCI, NCI-lung, Elixhauser, and Elixhauser-lung. We did not record metastatic solid tumors and lung cancer as comorbid conditions. The seven scores are summarized in Table\u00a0For descriptive analysis, quantitative variables are expressed as medians [Interquartile ranges] and qualitative variables as n (%).Comorbidity scores were calculated and survival estimated as the time between the day of hospitalization and the date of last follow-up . The Kaplan Meier estimator was used to estimate the probability of survival. Log-rank tests were used to compare the probability of the event (death) between populations. The model was adjusted for each score. A Cox proportional hazards regression model was used to perform multivariable analyses of prognostic factors and calculate hazard ratios (HRs) and 95% confidence intervals (95% CI) for median survival for the seven comorbidity scores. A median cut-off was used for continuous variables in the multivariate analysis. Proportional hazards assumptions were verified using the Martingale method . Only coTo compare comorbidity scores, Akaike Information Criteria (AIC), Bayesian Information Criteria (BIC) were used to compare the relative goodness-of-fit among different models. Then, a discrimination analysis using the c-statistic, Harrell\u2019s c-statistic, sensitivity, specificity was performed from a base model containing significant covariables from the multivariate analysis. Sensitivity and specificity were respectively calculated as follow: (True positive\u2009=\u2009Death estimated by the model) / ); and (true negative\u2009=\u2009non-dead patients estimated by the model) / .The impact of the scores was compared using the base model  plus each index score alone by multivariable Cox regression. The model with the lowest AIC and BIC indicates which model was the best fit for the data and the highest c statistic and Harrell\u2019s c statistic was considered to be the best predictive model.A sensitivity analysis using a bootstrap method for each statistical indicator, with 1,000 samples from two thirds of the cohort, was performed. Each indicator  was calculated for the 1,000 samples. Boxplots were generated for the four parameters.All statistical analyses were performed using SAS 9.4 for Windows . A p-value\u2009<\u20090.05 was considered significant.In total, 633 patients were enrolled in the study. The demographic characteristics of the population are presented in Table\u00a0In multivariable analysis, only the presence of metastases, male gender, and histological type were prognostic factors of four-month survival.We assessed the prevalence of each comorbidity that contributed to the score for each comorbidity score , but also in the weight assigned to each comorbidity; some use the beta coefficient obtained from the regression and others the hazard ratio. The beta coefficients and hazard ratios are related to each other by an exponential relationship, and although the use of beta coefficients is preferred when using a summary score , we calcThere are several possible explanations concerning the better performance of the Elixhauser score. The Elixhauser score was developed using a short-term outcome: in-hospital mortality. The median overall survival in our cohort was four months, which is short relative to the other scores , which were constructed using a long-term outcome, such as one- or two-year mortality. This result corroborates another publication concerning in-hospital mortality of non-cancer patients, in which the Elixhauser score outperformed the CCI . AnotherThis study had several limitations. We assessed comorbidities that occurred both before and after lung cancer diagnosis and did not distinguish between death from lung cancer and that from other causes. Extension of this paper results should be done with one caution. Despite we had 71% of men and 74.2% of patients with metastatic status at diagnosis, which is similar to literature, age have a non-significant effect on survival. This may be due to the inclusion criteria which is hospitalized patients and therefore frailty ones with the shortest survivals, and high comorbidity burden (Median Elixhauser score of 6). Because performance test has been performed on the same data used to train the model there will be a need for external validity of the results. There may have also been unknown confounders. Moreover, this was a retrospective monocentric study.The use of ICD-10 codes to identify the comorbidities was a strength of our study, as they can be used to query easily available structured datasets and allow the comparison of comorbidity scores, as well as sensitivity analyses, which confirmed the superiority of the Elixhauser score for estimating four-month survival in our cohort.Despite the extensive use of the CCI in the literature, other comorbidity scores are available, including scores based on administrative data coded using the ICD-10. In this original study, in which we compared seven comorbidity scores using administrative data, the Elixhauser score was the comorbidity score best suited to hospitalized lung-cancer patients for predicting four-month mortality. It could be informative to repeat these analyses with a longer follow-up of the patients.Below is the link to the electronic supplementary material.Supplementary Material 1: Table S1Supplementary Material 2: Figure S1Supplementary Material 3: Table S2Supplementary Material 4: Table S3Supplementary Material 5: Figure S2"}