{"text": "We investigated the relationship between cutaneous malignant melanoma and multiple sunburns in the Queensland population. Interview data were gathered from 236 case-control pairs concerning their lifetime experience of severe sunburns, their occupational and recreational sun exposure, and their skin type. Excluding the lentigo maligna melanoma subtype, an association between multiple sunburns and melanoma was evident. After controlling for other major risk factors there was a significant dose-response relationship (P less than 0.05): the estimated relative risk associated with 2-5 sunburns in life was 1.5, and with 6 or more was 2.4. This observation extends the hitherto circumstantial evidence of a causal relationship between exposure to solar ultraviolet radiation and melanoma, and suggests that precautionary measures could prevent the development of this disease in a proportion of cases in fair-skinned populations."}
{"text": "Studies of morphological integration provide valuable information on the correlated evolution of traits and its relationship to long-term patterns of morphological evolution. Thus far, studies of morphological integration in mammals have focused on placentals and have demonstrated that similarity in integration is broadly correlated with phylogenetic distance and dietary similarity. Detailed studies have also demonstrated a significant correlation between developmental relationships among structures and adult morphological integration. However, these studies have not yet been applied to marsupial taxa, which differ greatly from placentals in reproductive strategy and cranial development and could provide the diversity necessary to assess the relationships among phylogeny, ecology, development, and cranial integration. This study presents analyses of morphological integration in 20 species of australodelphian marsupials, and shows that phylogeny is significantly correlated with similarity of morphological integration in most clades. Size-related correlations have a significant affect on results, particularly in Peramelia, which shows a striking decrease in similarity of integration among species when size is removed. Diet is not significantly correlated with similarity of integration in any marsupial clade. These results show that marsupials differ markedly from placental mammals in the relationships of cranial integration, phylogeny, and diet, which may be related to the accelerated development of the masticatory apparatus in marsupials. The correlated evolution of traits is a fundamental issue in evolutionary biology, with great importance for understanding morphological evolution and the generation of morphological diversity Most studies of morphological integration focus on microevolutionary hypotheses , documenting the relationships among development, genetics and phenotypic integration, usually in single species . The few comparative studies conducted have focused on placental mammals Because placentals and marsupials differ greatly in the timing of cranial bone ossification A plausible null hypothesis is that evolutionary history (phylogeny) is correlated with similarity in patterns of morphological integration. Of the placental clades studied, however, only a few support this hypothesis These results from previous studies demonstrate that a complex relationship exists between phylogenetic relatedness, integration, and ecology across placental mammals. In addition, as suggested by Steppan As noted above, examination of morphological integration in marsupials is particularly important, because of the striking differences in the timing of cranial bone development between marsupials and placentals. Ossification of the anterior masticatory apparatus  is accelerated in marsupials relative to placentals. This heterochronic shift is related to the unique marsupial reproductive pattern in which neonates are birthed after a short gestation period and complete their early development attached to the teat Cranial landmarks were captured using an Immersion Microscribe G2\u00d73-D digitizer. Fifty-seven landmarks were collected across the skull, emphasizing points of certain homology across taxa, such as tripartite sutures. In addition, landmarks corresponding to those in earlier studies also were used, to permit direct comparison with previous results. Landmarks are listed in Twenty species of australodelphian marsupials were included in this analysis, spanning Dasyuromorphia, Peramelia, and Diprotodontia . Taxa weData were collected from 13 to 16 adult specimens per species, for a total of 327 specimens from 20 species, and male and female specimens are as equally represented as possible . While hAnalytical methods follow previous studies Matrix correlation analysis was employed to assess similarity in patterns of morphological integration To test the relationship between MSI and phylogenetic relatedness, multiple phylogenetic similarity matrices were constructed for all of the taxa examined, using recently published phylogenetic hypotheses Perameles, Isoodon, and Macrotis) and Peroryctidae . Szalay Macrotis as the nearest outgroup to the rest of the peramelians included in this study, while Westerman et al. Peroryctes outside the remaining peramelians in this study. Each of these competing phylogenetic hypotheses for Marsupialia and for Peramelia was analysed separately to test the relationship between phylogeny and similarity of morphological integration +1, such that the most distantly-related species have a value of one and sister taxa have the maximum value. Matrix correlation analysis was used to test the correlation of various phylogenetic distance matrices with MSI. Mantel's test is used to determine the significance of the matrix correlation. Mantel's test randomly reorders the rows and columns of one of the two correlation matrices being compared and recalculates the matrix correlation between the two matrices An alternative analysis of phylogenetic relationship also was employed. Pairwise similarity of morphological-integration values were averaged for taxa related at various taxonomic levels , basal Dasyuromorphia , and Dasyuromorphia+Peramelia . Because diet is significantly correlated with phylogeny, the dietary-similarity matrix was regressed against the phylogenetic-distance matrix to isolate diet from phylogeny. The dietary similarity residual matrix (hereafter DSRM) was compared to the original MSI, using matrix correlation analysis with Mantel's test for significance.Across all australodelphian marsupials, there was a significant correlation with phylogeny using all topologies , Table 2Single pairs analysis was also conducted for each clade . When siNeither DSM nor DSRM were significantly correlated with similarity in morphological integration in any of the clades examined in this study , Table 3Within placental mammals, morphological integration has been analysed comparatively in Primates Matrix correlation analysis and single pairs analysis produced consistent results in most analyses. Both support a significant relationship between phylogeny and similarity of integration across australodelphian marsupials. These three orders are quite morphologically distinct and diverged 40\u201350 million years ago The three orders examined, however, display three different patterns with respect to phylogeny, size, and cranial integration. While Dasyuromorphia and Dasyuridae show significant correlations between phylogenetic distance and similarity of integration, both including and excluding size , DiprotoPeroryctes) that show particularly low similarity of integration with other taxa, whether including or excluding size. However, Perameles nasuta, which shows comparatively high similarity of integration with other peramelians when size is included, displays the lowest similarity of integration values when size is removed, most notably with the congeneric species Perameles gunnii (0.22). As the congeneric peramelid species reflects only a single comparison, between Perameles nasuta and Perameles gunnii, greater sampling of congeneric species is necessary to determine if that low similarity of integration among species is a general characteristic of Peramelia. However, these results suggest that size-related correlations are a more significant factor within Peramelia than in the other marsupial orders considered in this study, even though they occupy a smaller range of size than either Dasyuromorphia or Diprotodontia Peramelia shows an intermediate pattern between Dasyuromorphia and Diprotodontia, with marginally significant correlations in matrix correlation analysis when size is included, but not when it is removed. All three phylogenetic hypotheses for Peramelia produced similar results. Interestingly, the differences in correlation values between analyses with and without size are greater in Peramelia than in other clades. Likewise, in single pairs analysis, Peramelia shows increased similarity of integration with phylogenetic relationship when size is included, but a negative correlation when size is removed. This result seems to be primarily influenced by a few taxa , invertivorous (Myrmecobius), and folivorous  taxa, to species with a variety of mixed diets , frugivore (Fr), folivore (Fo), and carnivore (C). *The diet of Vombatus is primarily grasses and roots.(0.06 MB DOC)Click here for additional data file.Appendix S2Matrix of similarity of morphological integration. The lower triangle is the original MSI. The upper triangle is MSI without size.(0.15 MB DOC)Click here for additional data file."}
{"text": "We examined the expression of pancreatic secretory trypsin inhibitor (PSTI) in colorectal cancer by immunohistochemical staining using an anti-PSTI antiserum, an in situ hybridisation technique utilising sulphonated PSTI cDNA probe, and a Northern blot hybridisation method, using a 32P-labelled PSTI cDNA probe. Immunohistochemically, PSTI was detected in 80 of 95 (84%) colorectal cancer cases. Analyses with in situ hybridisation as well as Northern blot hybridisation demonstrated PSTI mRNAs in immunohistochemically positive cases, showing PSTI could be produced in colorectal cancerous cells. Histologically well or moderately differentiated adenocarcinoma showed higher incidence of PSTI immunoreactivity than the other types. Furthermore, the intensity of the immunohistochemical staining for PSTI increased the more cases advanced, particularly in regard to depth of invasion and tumour size. Thus, PSTI expression is widespread in colorectal cancer, and occurs more commonly in advanced cases. Considering the suggestion that PSTI is a growth-stimulating factor as an well as inhibitor to proteolytic proteinase, the present findings may indicate that PSTI expressed in colorectal cancerous cells may play a role possibly closely associated with tumour development."}
{"text": "Plasmodium species and its vectors may result in adaptive changes in genes that are crucial components of the vector's defense against the pathogen. By analyzing which genes show evidence of positive selection in malaria vectors, but not in closely related non-vectors, we can identify genes that are crucial for the mosquito's resistance against Plasmodium.Co-evolution between CEC1, GNBP-B1 and LRIM1, in both vector and non-vector species of the Anopheles gambiae complex. Whereas little protein differentiation was observed between species in CEC1 and GNBP-B1, McDonald-Kreitman and maximum likelihood tests of positive selection show that LRIM1 underwent adaptive evolution in a primary malaria vector; An. arabiensis. In particular, two adjacent codons show clear signs of adaptation by having accumulated three out of four replacement substitutions. Furthermore, our data indicate that this LRIM1 allele has introgressed from An. arabiensis into the other main malaria vector An. gambiae.We investigated genetic variation of three anti-malarial genes; LRIM1 to P. falciparum infection, an adaptive response of a known anti-malarial gene in a primary malaria vector is intriguing, and may suggest that this gene could play a role in Plasmodium resistance in An. arabiensis. If so, our data also predicts that LRIM1 alleles in An. gambiae vary in their level of resistance against P. falciparum.Although no evidence exists to link the adaptation of  Plasmodium falciparum transmission. The need to identify refractory genes for this effort has focused much attention on the immune system of malaria's main vector in Africa, An. gambiae. The completion of the An. gambiae genome Plasmodium infection Despite ongoing control efforts during the last decades, malaria remains one of the most deadly infectious diseases. The vast majority of its burden is carried by people on the African continent, where 1 to 2 million people die annually from this disease Plasmodium infection affects the mosquito's fitness, we may expect the accumulation of adaptive amino acid substitutions in those anti-malarial genes that are crucial in specifically limiting Plasmodium infection in vector species, whereas such changes should not be found in closely related species that do not transmit malaria.So far little attention has been devoted to examining polymorphism of immunity genes in natural malaria vector populations An. gambiae has in fact undergone an adaptive response to P. falciparum infection is suggested by several lines of evidence. First of all, P. falciparum goes through severe bottlenecks during its life cycle in this mosquito Plasmodium infection. Furthermore, P. berghei, which is not transmitted naturally by An. gambiae, produces a much higher oocyst number in An. gambiae than its natural pathogen P. falciparum. In fact, in a review of studies estimating the fitness effect of Plasmodium infection on Anopheles species, reduced fitness was observed in 10 combinations of Plasmodium and Anopheles species that do not occur naturally, whereas in 10 natural combinations, including An. gambiae and P. falciparum, no fitness effects were observed Anopheles species have evolved to limit infections of the Plasmodium species they come into contact with. This is corroborated by the fact that the immune response to P. falciparum is specific, i.e. An. gambiae up-regulates different genes in response to infection with P. falciparum vs. P. bergheiP. falciparum in An. gambiae and An. arabiensis are typically low, ranging between 3\u20139% P. falciparum infection. However, it should be kept in mind that the data summarized above indicate that the rate and intensity of P. falciparum infection is likely to have been much higher when Anopheles mosquitoes first came into contact with this pathogen.That An. gambiae belongs to a complex of closely related species that includes another primary African malaria vector, An. arabiensis. Additionally it contains several species, i.e. An. melas, An. merus and An. bwambae, that occasionally transmit malaria locally, but do not have wide enough distributions to be considered important vectors. More importantly for the purpose of the present study, the An. gambiae complex also contains the highly zoophilic An. quadriannulatus A and An. quadriannulatus B, which are never or rarely exposed to the human-limited P. falciparum.i.e. CEC1, GNBP-B1 and LRIM1, in six species of the An. gambiae complex. CEC1  is a cecropin gene whose expression in An. gambiae is induced by infection with bacteria and Plasmodium bergheiAn. gambiae that express CEC1 24 hours after a blood meal, showed a 60% reduction in the number of P. berghei oocysts GNBP-B1 (ENSANGG00000015205) is a pattern recognition receptor whose expression is strongly upregulated in response to infection with both P. bergheiP. falciparumLRIM1 (ENSANGG00000010552) is a leucine-rich repeat immune protein that is an important plasmodium antagonist. This protein is up-regulated in response to infection with P. berghei, and silencing of this gene increases oocyst load 3.6-fold An. gambiae and An. arabiensis, to examine if these genes show signs of an adaptive response that may implicate them in the co-evolution of the mosquito vector and Plasmodium pathogen. Whereas no evidence for positive selection was found in CEC1 and GNBP-B1, our results clearly indicate that LRIM1 underwent an adaptive response in the An. arabiensis lineage. Additionally our data also indicate that LRIM1 has introgressed from An. arabiensis into An. gambiae.In this study, we investigated patterns of polymorphism in three anti-malarial genes, CEC1 gene, consisting of 177 bp of coding sequence and two introns comprising a combined 90 bp, was amplified. A total of 186 alleles of this gene were obtained from six species of the An. gambiae complex, 66 of which were unique . Very few fixed differences were present between species, and in most comparisons no fixed non-synonymous differences were found  for the coding region. Very few fixed replacement substitutions were observed between species  the annotation of this gene was altered, and it is now thought that these 858 bp represent about half of the coding sequence of LRIM1. We obtained a total of 138 alleles from six species, of which 108 were unique (Dxy ranged from 1.03 to 3.06 (per 100 bp) between species. In contrast to CEC1 and GNBP-B1 however, McDonald-Kreitman tests of positive selection indicated a significant excess of fixed non-synonymous differences between An. arabiensis and An. quadriannulatus A, An. merus as well as An. bwambae . However, a branch test did show that it is significantly larger than \u03c9 along the background branches . Values of \u03c9 along the branches leading to An. melas, An. merus and An. bwambae/An. quadriannulatus A were estimated to be 0.299, 0.298 and 0.147 respectively  and is also found in one of the \u201carabiensis-like\u201d An. gambiae alleles.A total of four non-synonymous substitutions occurred along the foreground branch . Three oAn. arabiensis is fixed for nucleotide A at sites 704, 706 and 707 (codons 235 and 236). With the exception of An. gambiae, all other species are fixed for nucleotides T, G and G at these respective positions. The few \u201carabiensis-like\u201d An. gambiae alleles also have the (AAA) arrangement. Positions 416 through 718, a 302 bp stretch, cluster these An. gambiae (AAA) alleles with An. arabiensis (An. gambiae (AAA) alleles with the rest of An. gambiae. Additionally, no fixed differences were found between An. gambiae and An. arabiensis anywhere in this gene.abiensis . Only poLRIM1 is located inside the 2La inversion. Therefore we determined the karyotype of our An. gambiae samples with respect to the 2La arrangement. Out of 32 specimens from Cameroon, three were 2La/+ heterozygotes, all of which were also heterozygous for the (AAA)/(TGG) alleles. The karyotype of one (AAA)/(TGG) heterozygote was not clear, as it produced a second band of unexpected size. The remaining four (AAA)/(TGG) heterozygotes, as well as all (TGG) homozygotes, carried the 2L+/+ karyotype. These findings confirm that the (AAA) allele is at very high frequency or even fixed in the 2La inversion in Cameroon, and is present at very low frequency in the 2L+ arrangement (\u22487%).LRIM1 in An. arabiensis showed signs of a recent selective sweep, a HKA test was performed by comparing the polymorphism/fixed differences ratio of LRIM1 to CEC1 and GNBP-B1. A selective sweep reduces the amount of standing genetic variation within a species, as indicated by a relatively low ratio. However, no significant differences were found between the genes, and in fact, this ratio was considerably higher for LRIM1 (20/20.2) as compared to CEC1 and GNBP-B1 (17/28.1).To examine if CEC1 and GNBP-B1 did not show any signs of positive selection, and in particular, showed little or no differentiation between malaria vectors and the non-vector species, indicating that these genes are largely subject to purifying selection. In two of the species comparisons GNBP-B1 showed a significant excess of non-synonymous polymorphisms. Some cloning error is expected to be present in the GNBP-B1 data set. Since a majority of possible mutations are non-synonymous, random errors will bias the observed number of non-synonymous polymorphisms upward. However, the number of PCR errors in the data is not nearly high enough to explain the difference. Therefore, most likely purifying selection is responsible, with numerous slightly deleterious substitutions present at low frequency in populations, but which are prevented from going to fixation. In contrast, LRIM1, a gene with no known homologue in other organisms, shows clear signs of positive selection in An. arabiensis.An. gambiae and An. arabiensisLRIM1 in An. arabiensis. First of all, a demographic explanation should affect all genes. As noted before, GNBP-B1 has a higher ratio of non-synonymous/synonymous polymorphisms than fixed differences in most or all populations, including An. arabiensis. This indicates the presence of a relatively large number of slightly deleterious alleles in this gene, few or none of which became fixed in ancestral populations. This is contrary to the demographic explanation. More importantly however, it is extremely unlikely that three out of four fixed amino acid changes would occur in two adjacent positions in a 285 amino acid protein, if the random process of genetic drift were responsible.As pointed out by MacDonald and Kreitman, an excess of non-synonymous fixed differences between species may result from a much smaller population size in the past LRIM1 provides strong evidence that the presence of \u201carabiensis-like\u201d alleles in An. gambiae is caused by introgression and not by the retention of ancestral polymorphism. It is unlikely that recombination would not have broken down a linkage group of at least 352 bp, if it were maintained in the population for long time. Furthermore, the introgression hypothesis is supported by the complete absence of fixed differences between these species anywhere in the LRIM1 gene.Polymorphisms are shared between species in all three genes we examined, and there is no doubt some of this is due to the retention of ancestral polymorphism. However, the pattern of polymorphism observed in An. gambiae (AAA) and An. arabiensis , introgression has occurred multiple times, after which, according to the shared polymorphism between the An. gambiae (AAA) and (TGG) alleles (positions 324 and 327), these alleles recombined between position 327 and 416. The introgression of LRIM1 from An. arabiensis into An. gambiae is also consistent with previous studies that have shown that introgression between these two species has occurred in the past nd2 chromosome, on which LRIM1 is located, has been shown to transfer most readily between An. gambiae and An. arabiensis. Based on the shared polymorphisms between LRIM1 in An. arabiensis has evolved in direct response to malaria infection, but our observation that this anti-malarial gene shows distinct signs of positive selection in a primary malaria vector, but not in a species that does not transmit Plasmodium, is intriguing. This suggests that the observed adaptive evolution of LRIM1 may have been the result of the infection of An. arabiensis with Plasmodium, with at least two adjacent amino acids playing a crucial role in this adaptation. If this is true, variation for Plasmodium resistance should be present at LRIM1 in An. gambiae.Mosquitoes, like other organisms, encounter numerous pathogens during their life cycle, all of which could potentially exert selection pressure on the immune system. In fact, molecules that play a role in host-parasite interactions are one of the main groups of proteins on which positive selection has been demonstrated LRIM1 contains a leucine-rich repeat (LRR), which in other LRR genes is crucial for the three-dimensional structure by folding it into an arc LRIM1, but the two neighboring adaptive amino acids (i.e. 235 and 236) are located well outside the leucine-rich repeat region (positions 30\u2013160), suggesting that they could have a more specific function.LRIM1 is known to play a role in suppressing P. berghei infection in An. gambiaeLRIM1 on P. falciparum infection in field-collected An. gambiaeP. berghei infection was confirmed. This could be because the action of LRIM1 in An. gambiae is specific against P. berghei. However, it is also possible that only some LRIM1 alleles suppress infection with P. falciparum, and these may even be specific for certain P. falciparum strains. Another study demonstrated the existence of such genotype by genotype interactions between P. falciparum and An. gambiae, by showing that no single strain of P. falciparum was best at infecting all of a set of iso-female An.gambiae lines LRIM1 is located inside the 2La inversion. While An. arabiensis is fixed for this 2La arrangement, An. gambiae is 2La/+ polymorphic. Since LRIM1 alleles introgressed from An. arabiensis into An. gambiae, we may expect that these An. gambiae (AAA) alleles are mostly found in the 2La arrangement. Interestingly, the mosquitoes that failed to show an effect of LRIM1 knockdown on P. falciparum infection 2L+). Our molecular karyotyping of the 2La inversion in our An. gambiae specimens shows that the (AAA) allele is indeed found at very high frequency in 2La inversions, whereas it is present in very low frequency in 2L+ (\u22487%).Although LRIM1 vs GNBP-B1/CEC1 did not show a relatively low level of genetic variation in LRIM1 in An. arabiensis. In fact, the relative level of polymorphism was higher in this gene than in CEC1 and GNBP-B1. Therefore we have no indication that LRIM1 in An. arabiensis is currently involved in an evolutionary arms race. This also implies that possible selective sweeps occurred long enough ago to allow mutation to regenerate polymorphism.Pathogen-host co-evolution has mainly been considered in terms of an evolutionary arms race LRIM1 has undergone adaptive evolution in a primary malaria vector. This could be because this gene has evolved in response to P. falciparum infection in this species. If so, LRIM1 is expected to play a role in the resistance of An. arabiensis against P. falciparum. So far the immune system of this mosquito species has not yet been investigated, and our data suggest the possibility that a knockdown of LRIM1 will enhance infections of P. falciparum in An. arabiensis. If LRIM1 did indeed evolve in response to P. falciparum infection in An. arabiensis, this gene also deserves further study in An. gambiae, in particular with respect to potential variation in resistance between the two major alleles found in this species.The data presented here indicate that the anti-malarial gene An. gambiae were collected from the villages of Mbeb\u00e9 and Nyabessan, Cameroon in Dec. 2005. An. gambiae from Mali were collected from Banambani in 2000. Adult An. arabiensis females from Cameroon were collected from Kousseri in Dec 2005. Adult An. melas were collected in Ipono, Cameroon, Dec. 2005. Larvae of An. gambiae, An. arabiensis and An. bwambae from Bwamba county, Uganda (2004) were kindly provided by Ralph Harbach. DNA extractions of An. merus from Furvela, Mozambique (2001 and 2003) were kindly provided by David O'Brochta. An. quadriannulatus A from Kruger National Park, South Africa, were kindly provided by Anton Cornel. Sample sizes for each gene and species are represented in Adult females of et al.et al.An. gambiae specimens belonged to the S molecular form. Molecular identification of 2La karyotypes was performed following White et al.CEC1, GNBP-B1 and LRIM1 were designed using Primer3 An. gambiae genome and anneal to the flanking or non-transcribed regions of the genes CEC-A and LRIM1 was performed using Amplitaq Gold polymerase (Perkin Elmer) using respectively the following primer pairs CECin1 (GTTAGCAGAGCCGTCGTCTT)/CECin12 (ACAGTCGGTTCAAAGCGTTC) and LRIM1in6 (AGGTAACGGACAGCAGCCTA)/LRIM1in9 (GTCCGGTACTGCTCCTTGAG). The following program was used for PCR amplification of CEC1 and LRIM1; 2 min at 94\u00b0, 35 cycles of 30 sec at 94\u00b0, 30 sec at 52\u00b0 and 45 sec at 72\u00b0, followed by 20 min at 72\u00b0. PCR products were excised from an agarose gel and purified using the Gel Purification Kit (Qiagen) and submitted for direct sequencing. A subset of the sequences from individuals heterozygous for two or more positions were amplified again and cloned using the TOPO-TA cloning kit (Invitrogen). Individuals were selected for cloning such that all observed polymorphic sites were represented in the final data set. From each individual a single colony was sequenced. PCR of GNBP-B1 was performed using Platinum High Fidelity Taq (Invitrogen) with the primer pair GNBPin1 (GTTTGGTAGGGGACGAATGA) /GNBPIN20 (GCGCTTTCAGTGGTTTGTTT) using the following program: 2 min at 94\u00b0, 35 cycles of 30 sec at 94\u00b0, 30 sec at 52\u00b0 and 90 sec at 72\u00b0, followed by 20 min at 72\u00b0. Direct sequencing of the PCR product of GNBP-B1 was not possible in many cases because of the presence of indels. Therefore, PCR products of this gene were cloned and sequenced as outlined above. However, nine sequences were produced through direct sequencing, allowing for an estimation of the PCR/cloning error. Sequencing was performed on an ABI 3730 Genetic Analyzer using Big Dye v 3.1 (Applied Biosystems )DNA was extracted using the DNeasy tissue kit (Qiagen). Species and molecular form diagnostics were performed following Fanello LRIM1 and CEC1 samples that were cloned were also sequenced directly, we were able to derive both alleles from each individual while removing PCR/cloning errors. The PCR error in the GNBP-B1 sequences amplified using the proof-reading polymerase was estimated to be 0.625 per 1000 bp. Therefore, each 1188 bp GNBP-B1 allele for which no direct sequence was available is expected to have an average of 0.74 errors.Based on a comparison between direct sequencing and plasmid sequencing, the PCR/cloning error using Amplitaq Gold was estimated to be approximately 1.5 per 1000 bp. However, because all Dxy values were calculated using DnaSP 4.0 All sequences were aligned using MEGA3.1 CEC1 and GNBP-B1, subsequent analyses were limited to LRIM1. Aimed at reducing the computational effort, a reduced LRIM1 data set, containing 70 sequences, was used for phylogenetic analyses and maximum likelihood tests of positive selection. This data set was compiled in such a way that at every observed polymorphism and fixed difference, i.e. the relevant information for tests for maximum likelihood tests of positive selection, was retained. This reduced data set was used to construct 50% majority-rule consensus trees with MrBayes 3.1.2 Since few or no fixed differences were observed in LRIM1 alleles from An. gambiae clustered within An. arabiensis  along the major branches of the tree. Under the neutral model the relative number of synonymous and non-synonymous substitutions is expected to be 1. Under positive selection, amino acid substitutions are favored and \u03c9>1, whereas under purifying selection amino acid substitutions are prevented and \u03c9<1. The An. arabiensis lineage was designated as the foreground branch, i.e. the branch of interest, and model 2 free \u03c9 was compared to model 0 to test if \u03c9 along the foreground branch was significantly larger compared to the \u03c9 along the background branches, i.e. all other branches. Model 2 \u03c9\u200a=\u200a1, with the \u03c9 value fixed at 1 along foreground branch, was compared to model 2 free \u03c9 to test if \u03c9 along the foreground branch was significantly larger than 1. Model 1 was used to estimate \u03c9 along the central branches of the tree  of (1.19 MB TIF)Click here for additional data file.Figure S2LRIM1 in five species of the An.gambiae complex. Posterior probabilities are indicated along branches. An. arabiensis samples from Uganda, Madagascar and Mali are indicated by UG, MAD, and MAL respectively, with all remaining An. arabiensis samples originating from Cameroon.Bayesian tree (unrooted) of (0.72 MB TIF)Click here for additional data file."}
{"text": "Five percent of the Swiss population attribute symptoms to electromagnetic fields (EMF). General practitioners (GPs) might play a key role in recognising an emerging health risk, since they are the first to observe and follow up persons who attribute symptoms to EMF. It is unclear to what extent EMFs have become an issue in general practice and which experiences GPs report from the consultations.We conducted telephone interviews in a random sample of GPs in Switzerland in order to assess the frequency of consultations in primary care due to EMF and the GPs' experience with these patients.342 general practitioners were interviewed, corresponding to a response rate of 28.2%. 69% of the GPs reported at least one consultation due to EMF, but GPs with a certificate in complementary medicine were much more likely to report EMF consultations. The median of EMF consultation numbers within one year was three. An overview of the most recent EMF-related consultation per GP yielded sleep disorders, headaches and fatigue as the most often reported symptoms and mobile phone base stations, power lines and the own use of mobile phones as the main EMF sources suspected to be associated to symptoms. GPs judged the association between EMF and the symptoms to be plausible in 54% of the cases. There was no combination of symptoms and EMF sources that was remarkably and consistently judged to be a plausible cause of the symptoms.In our survey, GPs often judged the association between the health problems and the suspected exposure to be plausible. This plausibility assessment seems to be based on grounds of preventive positions in a situation of scientific uncertainty. More research effort is needed to obtain more insight on a potential association between long term EMF exposure and unspecific symptoms. Everyone is exposed to a complex mixture of electric and magnetic fields at many different frequencies. In the scientific literature and in the media, increasing attention is paid to the potential adverse effects of electromagnetic fields (EMF) on human health, especially since the introduction of modern telecommunication technologies. Regarding radiofrequency EMF, such as those from base stations or mobile phones, the Stewart Report concluded in 2000 that \"the balance of evidence to date suggests that exposures to RF radiation below guidelines issued by the National Radiological Protection Board (NRPB) and the International Commission on Non-Ionizing Radiation Protection (ICNIRP) guidelines do not cause adverse health effects to the general population\" . In 2004So far, it is unclear to what extent EMFs have become an issue in general practice and which experiences GPs report from these consultations. In 2005, an estimate based on a representative survey yielded that more than half of the Swiss population perceived EMFs as potentially harmful and 5% attributed symptoms to EMF  reMost of the GPs reported little experience with EMF consultations in general practice: 71% of all GPs reported to have had fewer than five EMF consultations in the previous year. Of the GPs with few or no EMF consultations in the previous year, the majority still estimated an association between health complaints and EMF sources to be plausible in 52% of the cases. This makes it unlikely that GPs develop their plausibility assessment based on frequent and repeated experience with EMF-related consultations.There were some indications that GPs did not feel confident about counselling persons with symptoms attributed to EMF, e.g. 75% expressed to need more information on the topic for their work as a GP and less than half of the GPs reported to have a standard approach on how to deal with these patients. 53% would welcome the implementation of a national or regional interdisciplinary environmental medicine counselling centre.From the general practitioners' observations no obvious symptom-EMF source pattern could be extracted, which would link a specific EMF source to a specific health complaint and thus call for a new direction of investigation that is not yet pursued by researchers. However, the scientific uncertainty regarding long term effects of EMF on unspecific symptoms is mirrored in the GPs plausibility assessments: The majority of GPs believed that exposure to everyday EMF could cause symptoms, and the relation between EMF and the symptoms of their EMF-related consultations was judged to be \"plausible\" in more than half of the cases. Thus, we conclude that more research effort is needed to obtain more insight on a potential association between long term EMF exposure and unspecific symptoms.CATI \u2013 computer assisted telephone interviewEMF \u2013 electromagnetic fieldsGP \u2013 General PractitionerICNIRP \u2013 International Commission on Non-Ionizing Radiation ProtectionNRPB \u2013 National Radiological Protection BoardThe author(s) declare that they have no competing interests.AH coordinated the study and drafted the manuscript and MR conceived of the study. Both authors designed the study, developed the questionnaire used in the survey, analysed and interpreted the data, revised the draft and read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
{"text": "Expression of alpha-1-antitrypsin (AAT) in tumour cells of 102 surgically resected lung adenocarcinomas was examined by immunohistochemical method using anti-AAT antiserum. While only 13 cases (13%) were negative for AAT expression, 89 cases (87%) contained AAT at varying degrees. The degree of AAT-positive tumour cells was significantly higher in advanced cases than in early cases. Clinical follow-up study of the patients, particularly in stage I, showed that strongly AAT-positive cases have poor prognosis than weak-to-moderately AAT-positive or AAT-negative cases. Thus, AAT expression status in tumour cells of lung adenocarcinoma may be a biological marker of prognostic significance in regard to tumour growth."}
{"text": "Individuals with severe Z \u03b11-antitrypsin (AAT) deficiency have a considerably increased risk of developing chronic obstructive lung disease (COPD). It has been hypothesized that compensatory increases in levels of other protease inhibitors mitigate the effects of this AAT deficiency. We analysed plasma levels of AAT, \u03b11-antichymotrypsin (ACT) and secretory leukocyte protease inhibitor (SLPI) in healthy (asymptomatic) and COPD subjects with and without AAT deficiency.Studied groups included: 71 asymptomatic AAT-deficient subjects  identified during Swedish neonatal screening for AAT deficiency between 1972 and 1974; age-matched controls ; older asymptomatic ZZ (n = 10); healthy MM ; and COPD patients . Plasma levels of SLPI, AAT and ACT were analysed using ELISA and immunoelectrophoresis.No significant difference was found in plasma ACT and SLPI levels between the healthy MM and the ZZ or SZ subjects in the studied groups. Independent of the genetic variant, subjects with COPD (n = 19) had elevated plasma levels of SLPI and ACT relative to controls (n = 153) .Our findings show that plasma levels of ACT and SLPI are not elevated in subjects with genetic AAT deficiency compared MM controls and do not appear to compensate for the deficiency of plasma AAT. Serine proteases play key roles in coagulation, fibrinolysis, and in kinin and complement activation. The activities of these enzymes are controlled at least in part by specific serine protease inhibitors, most of which are serpins. The relationship between serine protease and serpin inhibitor levels has been examined extensively, since an imbalance between them is linked to local tissue injury and to many pathologies, including cancer, autoimmune diseases, chronic obstructive lung disease (COPD), inflammation and infectious diseases -5.The serine protease inhibitor found in highest concentration in plasma is \u03b11-antitrypsin (AAT). Severe AAT deficiency in the homozygous Z variant, which differs from the wild type M variant in the substitution of Glu-342 by Lys, was first recognized as a hereditary condition predisposing to COPD on the basis of low plasma levels  of AAT . This siIndividuals with severe AAT deficiency have at least a 20-fold increased risk of developing lung disease, especially if they smoke . AAT is It has been hypothesized that compensatory increases in other protease inhibitors and/or decreased leukocyte activity may reduce the severity of AAT deficiency by favourably affecting the overall protease/protease-inhibitor balance in AAT-deficient individuals -22. To f1 and FEV1/FVC%) was found among the studied subject groups with ZZ, SZ and MM variants of AAT.The first study group included 71 asymptomatic, 31 year old, AAT-deficient subjects: ZZ, n = 48, 24 females and 24 males, age 31.1 \u00b1 0.52 years and SZ, n = 23, 12 females and 11 males, age 31 \u00b1 0.58 years, identified in the Swedish neonatal screening study during 1972\u20131974 -22. ClinThe second study group consisted of 20 healthy MM AAT adults , 10 asymptomatic ZZ AAT adults  and 20 COPD patients, among them 10 patients with ZZ AAT  and 10 patients with MM AAT . COPD was diagnosed according to the NHLBI/WHO Workshop guidelines . The ZZ Blood was taken by venipuncture, plasma was directly separated by centrifugation and stored at -20\u00b0C or -80\u00b0C until assayed. AAT-phenotyping was performed by isoelectric focusing at the Department of Clinical Chemistry, University Hospital.Secretory leukocyte proteinase inhibitor (SLPI) was analysed using ELISA kits  according to the manufacturer's instructions. Absorbance was measured spectrophotometrically at 450 nm using a microplate reader (Labsystems). The minimum detectable level of SLPI was 0, 0625 ng/ml.The plasma concentration of ACT and AAT was determined by the rocket immunoelectrophoresis method based on a quantitative estimation of proteins by electrophoresis in 1% agarose gel containing monospecific antibodies against ACT or AAT at a concentration of 5.5 \u03bcg per square gel area . The ACTThe statistical package SPSS for Windows  was used for statistical calculations. Differences in the means were analysed for their statistical significance with the one-way ANOVA combined with a multiple-comparisons procedure (Scheffe multiple range test). The equality of means was analysed for statistical significance with an independent two sample t-test and Pearson correlation analysis. Tests showing p < 0.05 were considered to be significant. Data are expressed as mean \u00b1 SD.As expected, plasma levels of AAT in 31 year old subjects were ranked: MM>SZ>ZZ and are significantly different among the groups  , while ZZ COPD patients had 25% higher plasma AAT levels compared to asymptomatic ZZ cases, although this was not statistically significant. We also compared levels of ACT and SLPI in healthy/asymptomatic and COPD individuals independent of the genetic variant of AAT and age. As shown in Table To contain the potential injurious effects of serine proteases, the anti-proteases developed in a parallel network consisting of \"alarm\", locally produced such as SLPI and elafin/ESI/SKALP, and \"systemic\" inhibitors. The latter, such as \u03b12-MG, ACT and AAT ,29, are To further evaluated this hypothesis, we analysed plasma levels of AAT, ACT and SLPI and compared in both healthy and COPD adult patients with and without AAT deficiency. We analysed these inhibitors in two different groups of individuals, the first group consisting of 31 year old asymptomatic AAT deficiency individuals from the prospective follow-up study , and theReports published from the prospective follow-up study of ZZ and SZ individuals up to age 26 years, focusing on clinical health, lung and liver function tests and plasma markers of the protease/protease inhibitor balance, have shown that ZZ and SZ subjects had significantly higher plasma concentrations of \u03b12-MG, ACT and antithrombin III  at age 8The increased protease inhibitor plasma levels in young AAT deficiency subjects relative to normal subjects could be linked to age rather than to a ZZ or SZ phenotype. For instance, \u03b12-MG levels in cord blood and in young children have been found to be very high and to fall fairly rapidly from age 15 to 20 years, and to continue to decline gradually until the age of 30 to 40 -35. SimiIt is also important to point out that, for example, when subjects were 26 years old, but not 18 and 31 years old, SLPI was found to be significantly higher in AAT-deficient subjects than in wild type controls. These inconsistent findings during the follow-up studies suggest that plasma may not be the relevant biological fluid to measure SLPI levels. Alternatively, because SLPI is produced locally in the airways and is regulated by various pro-inflammatory stimuli, its plasma levels when analysed in healthy (asymptomatic) subjects may not reflect the real situation. One can not exclude that under inflammatory conditions the compensatory increase in SLPI and/or other protease inhibitors may reduce the severity of AAT deficiency by favourably affecting the overall protease/protease-inhibitor balance in AAT-deficient individuals.Our data show small increases in ACT and SLPI, as well as AAT, concentrations in normal MM subjects with COPD relative to well subjects. These differences exceed those for the same parameters for ZZ subjects with and without COPD and suggest that the COPD disease state could confound conclusions drawn from comparative studies seeking to attribute phenotypes (elevated protease inhibitor levels) to genotypes .We conclude that there is no clear evidence for compensatory up-regulation of protease inhibitors, such as ACT and SLPI, in healthy (asymptomatic) subjects with severe AAT deficiency. Thus, the changes in circulating levels of protease inhibitors and their likely impact on individual susceptibility to lung disease remains to be confirmed through further studies.1, forced expiratory volume in 1 second; FVC, forced vital capacity;AAT, alpha-1-antitrypsin; PiZZ, homozygous AAT-deficiency variant; PiMM, wild type AAT variant; ACT, alpha-1-antichymotrypsin; COPD, chronic obstructive pulmonary disease; \u03b12-MG, alpha2-macroglobulin; SLPI, Secretory leukocyte proteinase inhibitor; FEVThe author(s) declare that they have no competing interests.CH carried out the analysis, participated in the interpretation of data and helped to draft the manuscript. EP and TS collected patient material. UW and AW helped with the interpretation of data and the study design. SJ designed the study, carried out the final statistical analysis and wrote the manuscript. All authors have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
{"text": "Asthma affects 1 in 8 school-aged children in industrialized countries, making it the most common chronic illness in this group. Now a meta-analysis of child asthma studies led by pharmaceutical scientist Fawziah Marra of the University of British Columbia shows that children diagnosed with asthma were twice as likely as nonasthmatics to have received antibiotics before age 1. The more courses of antibiotics a child received in the first year of life, the higher the risk for asthma.Chest, examined the link between antibiotic exposure in babies and subsequent development of asthma, as well as the dose\u2013response relationship. Marra\u2019s team analyzed four prospective studies and four retrospective studies conducted between 1999 and 2004. Each study involved between 263 and 21,120 children, including cases who had been diagnosed with asthma between the ages of 1 and 18 years. The number of antibiotic courses taken ranged from one to seven, and averaged three.The meta-analysis, reported in the March 2006 issue of Pooling the data from all eight studies revealed a twofold risk of developing asthma with at least one course of antibiotics. Each additional course raised asthma risk 1.16 times. Information about the antibiotics prescribed could not be obtained from the studies.The findings support the \u201chygiene hypothesis,\u201d which proposes that an immune system that doesn\u2019t get enough practice killing germs (due to either an excessively clean environment or overuse of antibiotics) will become overly sensitized and overreact to normally harmless environmental agents such as pollen and dust.Marra and her colleagues recently launched a community education campaign in British Columbia called \u201cDo Bugs Need Drugs?\u201d The program uses media ads, classroom visits, and educational materials to teach health professionals and the general public about the overuse of antibiotics. The campaign emphasizes the difference between bacterial and viral infections, useful preventive measures such as hand washing, and the need to use antibiotics wisely. \u201cIn children, antibiotics are commonly used to treat ear infections, upper respiratory tract infections, and bronchitis,\u201d says Marra, even though many such infections are viral and don\u2019t respond to antibiotics. Some parents may refuse to leave a doctor\u2019s office without a prescription.The information gained from the meta-analysis is valuable for physicians who are striving to cut back on prescribing antibiotics, says W. Michael Alberts, president of the American College of Chest Physicians: \u201cIt can help to convince parents of young children to hold off on giving antibiotics unless absolutely necessary.\u201d"}
{"text": "Toxoplasma gondii as a model. Ablation of MORN1 in a conditional null mutant resulted in pronounced defects suggesting a central role for MORN1 in apicoplast segregation and in daughter cell budding. Lack of MORN1 resulted in double-headed parasites. These Janus-headed parasites form two complete apical complexes but fail to assemble a basal complex. Moreover, these parasites were capable of undergoing several more budding rounds resulting in the formation of up to 16-headed parasites conjoined at the basal end. Despite this segregation defect, the mother's cytoskeleton was completely disassembled in every budding round. Overall this argues that successful completion of the budding is not required for cell cycle progression. None of the known basal complex components, including a set of recently identified inner membrane complex (IMC) proteins, localized correctly in these multi-headed parasites. These data suggest that MORN1 is essential for assembly of the basal complex, and that lack of the basal complex abolishes the contractile capacity assigned to the basal complex late in daughter formation. Consistent with this hypothesis we observe that MORN1 mutants fail to efficiently constrict and divide the apicoplast. We used the null background provided by the mutant to dissect the function of subdomains of the MORN1 protein. This demonstrated that deletion of a single MORN domain already prevented the function of MORN1 whereas a critical role for the short linker between MORN domains 6 and 7 was identified. In conclusion, MORN1 is required for basal complex assembly and loss of MORN1 results in defects in apicoplast division and daughter segregation.The membrane occupation and recognition nexus protein 1 (MORN1) is highly conserved among apicomplexan parasites and is associated with several structures that have a role in cell division. Here we dissected the role of MORN1 using the relatively simple budding process of  Toxoplasma gondii is a member of the phylum Apicomplexa. Several apicomplexans cause severe disease in humans  while others cause economic losses to livestock . T. gondii in particular affects immunosuppressed individuals giving rise to life-threatening encephalitis in AIDS patients. In pregnant women toxoplasmosis can lead to congenital infection causing a variety of birth defects. Clinical disease is associated with the tachyzoite life stage causing tissue lesions by rapid proliferation Toxoplasma divides through a very distinct internal division mechanism termed endodyogeny, wherein two parasites are assembled within a mother parasite The obligate intracellular parasite Toxoplasma cell division, the basal complex acts in place of an actin-independent contractile ring in the late stages of cell division. The contractile force is probably generated by Centrin2, a calcium dependent contractile protein The membrane occupation and recognition nexus protein 1 (MORN1) is highly conserved among apicomplexan parasites and is associated with various structures that have a role in cell division th but degenerated and partial MORN motif T. gondii and P. falciparum have provided evidence that MORN1 is associated with both the cytoskeleton and a membrane component, consistent with its localization at the IMC extremities MORN1 is composed of a short unique N-terminus, 14 membrane occupation and recognition nexus (MORN) repeats, a linker of 5 amino acids between MORN domains 6 and 7 and a C-terminus composed of a 15T. gondii and dissected its phenotype in tachyzoites. Our results show that MORN1 is critical for viability and that the lack of MORN1 results in defective organelle partitioning and basal complex assembly. The most distinctive effect of these defects is the appearance of double and multi-headed parasites as a result of incomplete daughter abscission and sequential rounds of budding. These results indicate the absence of checkpoints on daughter maturation before entering the next round of cell division. Furthermore, we exploited the conditional MORN1 knock-out parasites to identify functional domains within MORN1 by complementation with a series of MORN1 deletion constructs.The distinct sub-cellular localization of MORN1 in the Apicomplexa and the function of MORN motifs in other systems suggest that MORN1 may act as a scaffolding protein organizing protein complexes with a critical role in mitosis and cytokinesis. To test this hypothesis we generated a conditional MORN1 knock-out in T. gondii. We anticipated that MORN1 likely would be essential and therefore we engineered a conditional knock-out parasite line using the Tet-off system 2) under control of the Tet7sag1 promoter. A clone was selected wherein the expression levels of the Myc2-tagged transgene closely matched that of the endogenous locus  was used; no additional acylation sites were detected) The conditional knock-out MORN1 parasite provides a powerful tool to identify functional domains within MORN1 through complementation studies with mutated MORN1 constructs. For example this could address whether different sections of MORN1 are required for centrocone localization than for apical or basal complex localization. In addition, we also wished to assure that the MORN1 null phenotype is indeed due to lack of MORN1. To answer these questions we generated a full-length MORN1 complementation construct as well as a series of MORN1 deletion mutants and a point mutant. To guide the construction of the MORN deletion mutants we assessed MORN1 for any functional motifs. As reported before, the MORN1 protein consists of 14 complete MORN domains and 1 partial MORN domain (PM) at the C-terminus . The N- To dissect the highly modular MORN1 structure we designed a \u2018sliding window\u2019 of MORN domain deletion mutants and additionally generated a mutant construct wherein the linker was deleted . Growth restoration was not to full wild-type levels as judged by the size of the plaques, although no significant reduction in plaque number was observed . The cau2-tagged MORN1 in these parasites did not completely disappear. This suggests that MORN1.3\u20138 prevented Myc2-MORN1 degradation and indicates the presence of strong aggregates.Complementation with the deletion constructs missing one or more MORN domains never resulted in the establishment of stable parasite populations, with the exception of a construct consisting of MORN domains 3\u20138 (MORN1.3\u20138). As shown in Toxoplasma daughter budding is a highly complex process that requires the coordinated assembly of numerous elements. We have recently demonstrated that the cytoskeleton that organizes the IMC is of even greater complexity than previously anticipated Toxoplasma division, i.e. maturation of the pellicle coordinated with mother disassembly is akin to the late stages in mammalian cells completing abscission. Although in mammalian cells the initial stages of cytokineses are mediated by an actin-myosin mediated cleavage furrow ingression, which compares with the basal complex constriction in Toxoplasma, the final segregation is organized by a septin and membrane remodeling based machinery T. gondii harbors machinery analogous to the septin based machinery to complete cell division. An argument against such machinery is that even in normal parasite development abscission is not complete and parasites are often observed to share a cytoplasmic bridge at their basal end Toxoplasma breaks the small cytoplasmic bridge present after completion of cytokinesis either by mechanical stresses within the vacuole or alternatively, by pulling away in opposite directions upon egress. Such a mechanic abscission model has been shown for the related ciliates It is somewhat surprising there is no checkpoint for assembly or contraction of the basal complex before progressing toward disassembly of the mother's cytoskeleton, as this appears to be crucial for the formation of viable parasites. Therefore we questioned how this compares to well-studied model organisms. The late stages in While the effects of the loss of MORN1 on completion of cytokinesis are very strong, the formation and partitioning of other organelles and structures are largely intact with one prominent exception: the loss of apicoplast division . The apiUpon complementation of the MORN1-KO with a full-length MORN1 encoding plasmid complete restoration of the wild-type phenotype is accomplished . Effortsin vitro2-tagged MORN1 allele was lost and Myc2-MORN was constitutively expressed. This indicates a genomic rearrangement or other mutations accrued in this phenotypic selection process.A MORN1 null mutant recently isolated by Heaslip and colleagues shows a similar phenotype yet is viable In conclusion, we have shown that loss of MORN1 results in an early loss of apicoplast division and prevents the assembly of the basal complex. As a result parasites fail to fully separate while still re-initiating new rounds of division resulting in the formation of the striking multi-headed parasites. Finally, we showed that the linker region between MORN domains 6 and 7 potentially serves as hinge critical for flexibility in the MORN1 complex and is a critical region for correct functioning of MORN1. Future work will be needed to address a potential role of palmitoylation and/or other post-translational modifications in the function of MORN1.RH strain parasites and transgenic derivatives were used throughout this study. Parasites were maintained in human foreskin fibroblasts (HFF) as previously described 2-MORN1/DHFR, primers MycF-1, MycF-2, MycR-1 and MycR-2 were hybridized to form the tandem Myc tag and were cloned BglII/AvrII into the pmorn1-YFP-MORN1/sagCAT plasmid NotI and the ends filled end in with T4 DNA polymerase followed by BglII digestion releasing the Myc2-MORN1-3\u2032dhfr segment. This segment was cloned into pDHFR-Tet7sag1-SpeI by SpeI digestion, filling in the ends and subsequent BclI digestion to generate pTet7sag1Myc2-MORN1/DHFR .All oligonucleotides used are provided in Supplementary The MORN1 open reading frame in cosmid PSBMG48 was replaced with a MORN1-flanking sequence flanked PCR amplified CAT cassette as previously described using primers MORN1_recomb-F and MORN1_recomb-R 2(MCS)/sagCAT plasmid PmeI/BglII), the first YFP (BglII/AvrII), the second YFP (AvrII/EcoRV), or the entire tandem YFP cassette (BglII/EcoRV). The sagCATsag cassette was replaced by the sagBLEsag cassette XhoI digest swapping. The megaprimer method was used to generate internal deletion or point mutations All MORN1 deletion plasmids were cloned based on the ptub-YFPPlasmids used that have been described previously are ptub-H2b-mRFP/sagCAT Immunofluorescence assays (IFA) were performed as described previously 2, with cells grown in MatTek glass bottom culture dishes. Images were processed to account for cell drifting.Live cell time-lapse movies were acquired using an I\u00d771 inverted epifluorescence microscope (Olympus) with a 100X oil immersion lens (UPlanApo 1.35 NA). Images were recorded using a Photometrics Coolsnap HQ camera and brightness/contrast were processed using SoftWoRx software (Applied Precision). Time-lapse imaging was performed in a humidified chamber heated to 37\u00b0C with 5% CO4, dehydrated in ethanol, treated with propylene oxide and embedded in Spurr's epoxy resin. Sections were stained with uranyl acetate and lead citrate prior to examination in a JEOL 1200EX electron microscope For transmission electron microscopy (TEM), parasites were grown in HFF confluent T25 tissue culture flasks, released by trypsinization, and fixed with 2.5% glutaraldehyde in 0.1 M phosphate buffer pH 7.2. The samples were post-fixed in OsO4 and dehydrated through an ethanol series. The coverslips were critical-point dried and coated with 20 nm gold. Samples were examined with a JEOL JSM-6340F field emission scanning electron microscope.For scanning electron microscopy (SEM), extracellular parasites were harvested following 48 hours of growth in the presence of ATc by filtration , washed twice in PBS and then fixed in 2.5% glutaraldehyde in 0.1 M phosphate buffer pH 7.4 at 4\u00b0C overnight. Fixed cells were settled onto poly-L-lysine coated coverslips, washed twice in 0.1 M phosphate buffer, post-fixed with 1% OsOAs described previously Essentially as described previously 2 incubator at 37\u00b0C. After these incubation times, cells were washed with 1\u00d7 PBS, and Ed1 medium without ATc was added. 7\u201310 days later, the monolayer was stained with crystal violet to visualize plaques A T25 flask confluent with HFF cells was inoculated with 50\u2013200 freshly lysed MORN1-KO parasites in Ed1 medium and incubated for 0, 12, 18, 24, 48, 72, or 168 (1 week) hrs with 1 \u00b5g/ml ATc in a humidified 5% COTable S1Oligonucleotides used in this study. Restriction enzyme sites are underlined, point mutations are represented in underlined, bold font.(0.03 MB DOC)Click here for additional data file.Figure S1MORN1 knock-out strategy and identification of mutant clones. (A) MORN1 spanning cosmid PSBMG49 was recombineered to replace the MORN1 open reading frame with a gentamicin (for selection in E. coli) and CAT cassette (for selection in T. gondii). (B) The MORN1 replacement cosmid was transfected into a parasite clone expressing the Tet-transactivator and a Tet7sag1 promoter controlled Myc2-MORN1 construct . Twenty-(0.53 MB TIF)Click here for additional data file.Figure S2Viability of the MORN1-KO phenotype upon ATc withdrawal after various times of ATc induction. (A) MORN1-KO parasites were allowed to plaque by inducing the phenotype for the indicated duration with ATc, followed by 9 days of growth in absence of ATc. Plaques were counted and plotted relative to the uninduced MORN1-KO strain. Average of three replicate experiments is shown; error bars denote standard deviation. Only 1 data point was collected at 96 hrs induction. (B) Stained plaque assays of the time course of ATc induction followed by 7 days plaque growth (0 hrs) or 9 days plaque growth .(2.39 MB TIF)Click here for additional data file.Figure S3Single channel fluorescence panels corresponding with (10.05 MB TIF)Click here for additional data file.Figure S4Dissection of the MORN1 overexpression phenotype by MORN1 deletion mutants. (A) Schematic representation of MORN1 and the tested deletion mutants. The MORN domains are numbered and their location indicated by green rectangles. The partial MORN motif at the N-terminus is labeled \u201cPM\u201d and the 5 amino acid linker region between MORN domains 6 and 7 is indicated with an arrowhead. The names of the constructs that were re-cloned under their endogenous promoter and without a tag for functional complementation studies are highlighted with a black background. (B) Summary of the observed YFP locations as outlined in panel C for the tested deletion constructs. Viability was determined by selecting for stable transfectants . (C) Representative images of the phenotypes that could be discerned. In several panels the parasites are co-transfected with H2b-RFP to identify the nucleus. WT: wild type; AG: aggregation (inclusion bodies); Fib: Fibers; CC: centrocone; AC: apical complex; iBC: immature basal complex; mBC: mature basal complex; Cyt: cytoplasm. Arrows and arrowheads as indicated in the panel. All MORN1 constructs were driven by the \u03b1-tubulin promoter and at the C-terminus fused to YFP. All microscopy was performed on live parasites.(1.71 MB TIF)Click here for additional data file.Figure S5Single channels fluorescence images of (6.52 MB TIF)Click here for additional data file.Movie S1MORN1-KO parasites expressing YFP-IMC3 and FNR-RFP were induced for 12 hrs with ATc and then imaged for 14 hrs. Time points are indicated where every time point represents a 10 min lapse.(2.12 MB MOV)Click here for additional data file."}
{"text": "The reactivity of alpha-1-antitrypsin (AAT) with Lens culinaris agglutinin (LCA) was studied by crossed immuno-affinity electrophoresis of the sera of 246 subjects from 6 groups , carcinoma metastatic to the liver and normal controls). Two species of AAT (LCA-reactive and -nonreactive species) were detected on crossed immuno-affinity electrophoresis in a gel containing LCA. The percentages of LCA-reactive species of AAT in neoplastic diseases of the liver were significantly higher than those in benign liver diseases and normal controls. There was no correlation between the percentage of LCA-reactive species of AAT and serum AAT concentration in any group. Furthermore, in studying 15 pairs of serum samples before and after the subsequent development of HCC, the percentage of LCA-reactive species of AAT after HCC occurrence was significantly higher than that before, although there was no statistically significant difference between the serum AAT concentration before and after development of the disease. The latter 15 patients were all of the normal protease inhibitor phenotype (PiMM) and no change in phenotype was observed before and after the development of HCC. The results indicate that measurement of the reactivity of AAT with LCA can be a useful marker for the diagnosis of HCC and carcinoma metastatic to the liver, especially when serum concentrations of alpha-foetoprotein or other tumour markers are within the normal ranges."}
{"text": "Deficiency of Alpha-1-antitrypsin (AAT) can be a genetic condition that increases the risk of developing liver, lung and possibly gastrointestinal disease. Since many autistic children also have gastrointestinal disorders, this study was designed to measure serum concentration of AAT and establish AAT genotypes in autistic children, age and gender matched non-autistic siblings, parents and controls.We used an indirect ELISA with monoclonal IgG to AAT to measure AAT serum concentrations in 71 members from 16 families of individuals with autism and 18 controls (no family history of autism). We used a duplex polymerase chain reaction to detect M, S and Z alleles for alpha-1 antitrypsin expression in 52 members of 12 of the above families.A significantly high number of autistic family members had lower than normal serum levels of AAT when compared to controls. Autistic children with regressive onset had significantly lower levels of AAT compared to controls, and a significant number of autistic children with low serum AAT also had hyperbilirubinemia, gastrointestinal disease and respiratory problems. We also found that a significantly high number of these individuals had the PiMZ genotype and correspondingly low levels of serum alpha-1 antitrypsin.Knowing that low levels of alpha-1 antitrypsin may be inherited, and that low levels of AAT may be associated with GI disease in autistic children, genotyping autistic children may help identify individuals susceptible to developing digestive problems. Alpha-1-antitrypsin (AAT) is the most abundant circulating serine protease inhibitor with normal serum concentration of 85\u2013250 mg/dL, but peak concentrations as great as fourfold that of normal may occur during inflammation.3AAT deficiency is a genetic condition that increases the risk of developing a variety of diseases including pulmonary emphysema, cirrhosis of the liver and possibly GI disease. It is caused by mutations in the AAT gene coding8The protease inhibitor or Pi system has been used to name the various mutations of the AAT gene.12Alpha-1 antitrypsin (AAT) is mostly secreted by hepatocytes and, to a lesser extent, by lung epithelial cells and phagocytes. It inhibits a variety of serine proteinases, but its preferred target is human neutrophil elastase (HNE), for which it demonstrates the highest affinity.13The major function of AAT in the lungs is to protect the connective tissue from HNE released from triggered neutrophils, as supported by the development of pulmonary emphysema early in life in subjects affected by severe inherited deficiency of AAT.17Alpha-1 antitrypsin production increases markedly after stresses such as surgery, injury, infection, or inflammation and with estrogen administration.18Toxic chemicals found in cigarette smoke, air pollutants, oxidizing chemicals, and oxidizing agents released by activated neutrophils, all inactivate a critical portion of the alpha-1-antitrypsin molecule.19If autistic children express low levels of alpha-1-antitrypsin.21Children with autism frequently have nongastro-intestinal symptoms suggestive of digestive diseased, such as reflux esophagitis.Since some autistic children have GI problems which might be associated with inflammation, we hypothesized that low AAT levels may be associated with these conditions.In this study, we determined AAT serum concentrations of 71 members from 16 families of individuals with autism, compared these to concentrations of AAT in 18 controls (parents with no family history of autism), and found that a significant number of family members had lower than normal AAT levels (less that 85 mg/dl). Using a duplex polymerase chain reaction, we detected M, S and Z alleles for alpha-1 antitrypsin expression in 52 family members from 12 of the above families. We found a significantly high number of family members (n= 37) with the MZ genotype. A significant number of these heterozygotes also had correspondingly low levels of serum alpha-1 antitrypsin.Since AAT concentration may be lower than that of the normal population, detection of low serum AAT and establishment of AAT genotype, might be useful tools for assessing prognosis in autism. Also, a better understanding of the incidence of AAT deficiency in autistic families and its potential relationship to gastrointestinal, liver and lung diseases, may lead to better therapy.We used an indirect ELISA and western blotting, as previously described29Purified Alpha-1 antitrypsin (Sigma) at concentrations of 1 \u03bcg, 0.1\u03bcg, 0.01 \u03bcg and 0.001 \u03bcg per 100 \u03bcl of bicarbonate buffer (pH 9.6), and 100 \u03bcl serum protein at a dilution of 1:500 (PBS), were fixed to wells of 96 well polystyrene microculture plate (Corning) by incubation overnight at 4 degrees C. Excess AAT/ serum was dumped from wells, and all wells were blocked by washing 3X with 300 \u03bcl blocking solution . One hundred microliters of primary antibody (mouse Mab to AAT (Biomedia), diluted 1:500 with PBS, was added to all wells and plate was incubated for 2 hours at 37 degrees C. All wells were washed 3 times with PBS/tween. One hundred microliters of affinity purified alkaline phosphotase conjugated goat anti mouse IgG (Biorad), diluted 1:5000 with PBS, were added to all wells and incubated for 45 minutes at 37 degrees C. All wells were washed 5 times with PBS/tween. One hundred microliters of AP substrate (Biorad) were added to all wells and the plate was incubated at room temperature until significant color change in positive control (10\u201315 minutes). Optical density was measured using ELISA Reader (Biorad).Purified AAT (Sigma), and controls were incubated 1:1 with loading dye (with beta mercaptoethanol) at 95 C for 5 minutes. Protein was run on SDS-Page (18%) (BioRad), at 100 volts, 1 \u03bcg/lane.Proteins were transferred to nitrocellulose at 30 volts, overnight at 4 C. Nitrocellulose was flooded with blocking solution (1% casein/PBS) and rocked gently overnight.Ten ml of primary antibody  was flooded over appropriate nitrocellulose sheets and incubated for 2 hours at room temperature with gentle rocking. Sheets were washed 3 times using PBS/tween. Five minutes for each wash, rocking gently at room temperature. Sheets were flooded with 10 ml of affinity purified goat anti-mouse IgG conjugated with Horse Radish Peroxidase (HrP) (Biorad), diluted 1:5000 with PBS. Sheets were washed 5 times with PBS/tween, five minutes each wash, rocking gently at room temperature. Sheets were flooded with 10 ml of HrP substrate at room temperature until significant color change.Polymerase chain reactions was performed with standard buffer . in a total volume of 100 \u03bcl containing: 250 ng of genomic DNA, 0.25 pM each of the oligonucleotide primers, 0.2 m\u03bc of dNTPs and 2.5 U of Taq polymerase. Primers used 11detectingtheSmutationare:5\u2032-TGAGGGGAAAC-TACAGCACCTCG-3\u2032 and 5\u2032AGGTGT-GGGCAGCTTCTTGGTCA-3\u2032; primers detecting the Z mutation are: 5\u2032-ATAAGGCTGTGCTGAC-CATCGTC-3\u2032 and 5\u2032-TTGGGTGGGATTCAC-CACTTTTC-3\u2032. Temperature cycling conditions were: initial 10 min denaturation at 94 \u00b0C, 30 cycles of 2 min at 94 \u00b0C, annealing for 2 min at 55 \u00b0C, extension for 3 min at 72 \u00b0C, and final extension for 10 min at 72 \u00b0C. Twenty microlitres of amplification product were digested for 3 h at 65 \u00b0C in a 50 \u03bcl volume containing 20 U of TaqI restriction enzyme, in the appropriate buffer. The digested DNA was electrophoresed in a 3% agarose minigel for 3 h at 90 volts, stained with ethidium bromide and visualized under 254 n\u03bc uv trans-illumination.Seventy-one family members from 16 families of individuals with autism, obtained from the Autism Genetic Resource Exchange , and 18 controls (parents with no family history of autism), obtained from National Disease Research Interchange  were tested for their serum concentration of alpha-1 antitrypsin and AAT genotype.Using an indirect ELISA, serum from individuals was tested using anti-AAT monoclonal IgG and compared to varying concentrations (1 \u03bcg\u20130.001 \u03bcg/) of purified AAT and negative control (PBS). Specificity of monoclonal anti-AAT IgG was established using western blotting . ResultsForty-five of the 71 individuals from the 16 families had AAT concentrations less than 85 mg/dL serum, making them low producing individuals . WhereasComparing AAT levels in parents and autistic children with a variety of demographics , a signiUsing medical history reports (gathered by AGRE), we analyzed the phenotypic characterization of the probands of family members tested in this study . OverallThree of the 23 affected individuals who answered the related questions had respiratory distress syndrome (RDS) (p < 0.05). Two of these three were born after short gestation (29 weeks). All three required oxygen supplimentation. None of these individuals had hyperbilirubinemia. Two of these three had deficient levels of AAT.Six other affected siblings (not including the three with RDS) reported respiratory problems later in life. Five of these 6 had deficient levels of AAT. Although none of the individuals had emphysema, two reported multiple respiratory problems\u2014tracheomalacia and sleep apnea, stridor and laryngomalacia. One reported reactive airway disease. One reported multiple incidences of pneumonia and the other two did not report a specific disorder.Seven of 22 affected siblings reported gastrointestinal problems. One of these did not answer the question. Five of the remaining six had deficient levels of AAT (p < 0.05). Three of the six reported chronic diarrhea, one reported constipation, one colic and the other, projectile vomiting.If we predicted the genotype of all 71 members of the 16 autistic families based on their AAT serum concentrations , most (4Using a PCR/Restriction Digest we genotyped 52 members from 12 of the 15 families who had been measured for serum AAT concentration (above) (DNA was not available for three of the families). Expected product demonstrating specific MM, MS, SS, MZ and ZZ genotypes for AAT expression is shown in A significantly high number of family members (37) had the MZ genotype. A significant number of these heterozygotes (35 of 37) had correspondingly low levels of serum alpha-1 antitrypsin (less than 100 mg/dL) .Approximately 75 allelic variants have been described in the AAT gene locus resulting in a very complex genetic classification based upon the phenotypic features of the circulating AAT protein. The most common variant, PI M, is present in approximately 95% of the Caucasian U.S. population and is regarded as the normal variant associated with normal serum levels of functional AAT. The predominant deficiency alleles, such as PI Z and PI S, may result in decreased levels of circulating AAT but with completely normal functioning proteins. The MM phenotype is therefore designated as manifesting 100% concentration of circulating AAT (85\u2013250 mg/dL). The heterozygous combinations MZ and MS yield 35% and the ZZ allele 10%\u201325% of this normal MM value. Approximately 95% of all AAT deficiency states leading to clinical manifestations are made up of PI ZZ homozygotes. Certain alleles, such as the S allele, either in the homozygous state or associated with the M allele, do not appear to be associated with the abnormally polymerized molecules within the endoplasmic reticulum and have not been incriminated in the development of liver disease unless combined with the Z allele.30The association of AAT deficiency and liver disease in children was first described in 1969.31Cederlund and Gillberg (2004),Asperger first recorded the link between celiac disease and behavioral psychosesIn inflammatory conditions, AAT levels are normally elevated. In this study, however, the results demonstrate low alpha-1-antitrypsin serum levels, which are probably due to genetic factors and not excess protein loss in stool. This might contradict the theory that autistic patients have inflammatory bowel disease because if there was chronic inflammation due to enterocolitis, the alpha-1-antitrypsin level should be elevated. However, there is evidence that increased inflammation is associated with AAT deficiency, such as GI inflammation in patients with ulcerative colitis, associated with the PiZ carriers,43In this preliminary study, a significant number of autistic family members have low serum levels of AAT, which is, at least in part, caused by the PiMZ genotype. Low serum AAT in autistic children supports the findings of Walker-Smith and colleagues, and strongly suggests an association between autism and AAT deficiency.A high number of autistic children with low levels of AAT in our study, also had neonatal hyperbilirubinemia (8/22), respiratory problems (9/23) and digestive disorders (7/22). Since AAT deficiency may be associated with these problems, this also supports our hypothesis of an association between AAT deficiency and autism.Our study also suggests an association between autistic children with regressive disease and AAT deficiency. This suggests that, besides genetic predisposition, environmental factors may be influencing levels of serum AAT in these individuals.Our observation, however, that some non-autistic siblings inherit AAT deficiency, and parents of autistic children who also have low levels of serum AAT, suggests that AAT deficiency alone is not a causative agent for ASD, but may make a subset of autistics susceptible to inflammatory disease.Knowing that low levels of alpha-1 antitrypsin is inherited, and that low levels of AAT may be associated with GI disease, genotyping autistic children may help identify those autistics susceptible to developing digestive problems. And a better understanding of the incidence of AAT deficiency in autistic families and its potential relationship to liver, lung and bowel diseases, may lead to better therapeutic strategies."}
{"text": "There is increasing evidence that septic complications, occurring after major hepatectomies, may be caused by gram negative bacteria, translocating from the gut. We investigated in rats, the effect of extended hepatectomy on the structure and morphology of the intestinal mucosa as well as on the translocation of intestinal bacteria and endotoxins. We also examined the effect of nonabsorbable antibiotics on reducing the intestinal flora and consequently the phenomenon of translocation by administering neomycin sulphate and cefazoline. Hepatectomy was found to increase translocation, while administration of nonabsorbable antibiotics decreased it significantly. In addition, hepatectomy increased the aerobic cecal bacterial population, which normalised in the group receiving antibiotics. Among the histological parameters evaluated, villus height demonstrated a significant reduction after hepatectomy, while the number of villi per cm and the number of mitoses per crypt, remained unchanged. Our results indicate that administration of nonabsorbable antibiotics presents a positive effect on bacterial and endotoxin translocation after extended hepatectomy, and this may be related to reduction of colonic bacterial load as an intraluminal effect of antibiotics."}
{"text": "To assess the development of and variation in lengths of stay in Dutch hospitals and to determine the potential reduction in hospital days if all Dutch hospitals would have an average length of stay equal to that of benchmark hospitals.th percentile length of stay hospital).The potential reduction was calculated using data obtained from 69 hospitals that participated in the National Medical Registration (LMR). For each hospital, the average length of stay was adjusted for differences in type of admission  and case mix . We calculated the number of hospital days that theoretically could be saved by (i) counting unnecessary clinical admissions as day cases whenever possible, and (ii) treating all remaining clinical patients with a length of stay equal to the benchmark . The average length of stay in Dutch hospitals if all hospitals were able to treat their patients as the 15th percentile hospital would be 6 days and the number of day cases would increase by 13%.The average (mean) length of stay in Dutch hospitals decreased from 14 days in 1980 to 7 days in 2006. In 2006 more than 80% of all hospitals reached an average length of stay shorter than the 15th percentile hospital in the year 2000. In 2006 the mean length of stay ranged from 5.1 to 8.7 days. If the average length of stay of the 15Hospitals in the Netherlands vary substantially in case mix adjusted length of stay. Benchmarking \u2013 using the method presented \u2013 shows the potential for efficiency improvement which can be realized by decreasing inputs (e.g. available beds for inpatient care). Future research should focus on the effect of length of stay reduction programs on outputs such as quality of care. The aveThese findings may be explainable because until 2005, the financing system in the Netherlands did not encourage length of stay reduction. Hospitals were paid through a system based, in part, on hospital patient days. Medical specialists were paid separately from this system, mostly on the basis of a lump sum. Hospitals still had several reasons to reduce length of stay. For example, the Dutch Ministry of Health Care encouraged hospitals to reduce the number of beds from 3.8 to 2.0 beds per 1000 inhabitants. Hospitals feared that their new building plans would only be accepted if they anticipated this objective to reach 2.0 beds per 1000 inhabitants. Other rRecently, the introduction of a new financing system for hospitals, the Diagnosis Treatment Combination system (in Dutch: DBC) substantially increased the incentive for Dutch hospitals to shorten lengths of stay. This is a Dutch variation of the Diagnosis Related Group system; hospitals are paid for every DBC. At the start of the DBC-system the prices of 10% of all DBC's were negotiable between hospitals and health insurance companies. This percentage is growing. The objective is that 65\u201370% of all hospital care will be negotiable in 2011. For medical specialists the financing system will also change. The lump sum will be abolished and some kind of competitive system will be introduced as an intermediate phase to entirely free prices. The essence of the new financing system is to reorganize health care on a free market-basis. This new financing system gives hospitals and specialists a strong motivation to reduce costs and lengths of stay.These developments raise the question, how many hospital days potentially could be reduced in the Netherlands in the near future? Brownell et al. 1995) determined the potential savings by reducing length of stay in eight major acute care hospitals in Manitoba  determin. Both foth percentile hospital).In this study we present a method to make a realistic calculation of the potential reduction of hospital days. We will assess the development of lengths of stay in Dutch hospitals and calculate the potential reduction of length of stay if all hospitals would work as efficiently as the benchmark . All data were provided by research Institute Prismant. In the LMR, data are available of admissions in general and academic hospitals in the Netherlands. This information includes medical data such as diagnoses and surgical procedures as well as patient specific data, including age, gender and hospital stay. The LMR is not based on DBC's but diagnoses are classified by the ICD-9 and procedures by the Dutch Classification System of Procedures. There have been no major changes to these classification systems between 1991 and 2006.Participation in the LMR is voluntary. Until 2004, the participation percentage of hospitals to the LMR was nearly 100%. Since 2005 some hospitals  stopped their participation to the LMR because of the introduction of a second hospital registration: the registration of DBC's. This registration is obligatory and these hospitals gave priority to the DBC-registration instead of prejudicing the LMR-registration. Despite this diminishing number of participating hospitals we decided to use the 2006 data, the most recent available.In 2006, the total number of general and academic hospitals in the Netherlands was 96; 11 of these hospitals did not participate in the LMR and 16 hospitals participated but did not register their procedures in the LMR. We excluded both of these groups in our analysis. Sixty nine hospitals  did contribute to this study. The excluded hospitals did not have a specific pattern in their lengths of stay. In 2004 their combined average length of stay was the same as the combined average length of stay of the 69 hospitals that were included in our study. For this reason we assumed that the data used in this study were representative of all Dutch hospitals.A specialty was included if it had 100 or more clinical discharges. For eleven specialties, a number of hospitals were excluded because they produced too few discharges. The number of hospitals that were excluded varied from 57 hospitals for ophthalmology  to 1 hospital for orthopaedic surgery.In order to compare length of stay between hospitals we applied two adjustments:Dutch hospitals differ in their admission policies. In principle, there is a choice between outpatient-care, day-care and clinical admission. Outpatients are treated in outpatient departments, where they consult a doctor, nurse or paramedic. Day-care is defined as care given in a specific centre for day-care to patients that only stay for several hours during the day (no overnight). Clinical patients are treated in the clinical department. They occupy a bed on a clinical ward and they intend to stay one or more overnight(s). Some hospitals tend to treat patients presenting for small procedures in day-care, while other hospitals have a larger threshold to treat in day-care. They tend to treat these patients on a clinical ward. If these patients are admitted in a clinical department, their (relatively short) length of stay contributes to the overall mean length of stay, while it does not if these patients are treated in day-care. Thus, hospitals with a larger threshold to treat patients in day-care more easily reach a short mean length of stay. In order to correct for this we excluded all hospital days of patients admitted on a clinical ward while they in principle could have been treated in day-care. In our study the hospital stay of these patients was analyzed separately. This is in accordance with the recommendation Hanning  made to Admissions that could in principle have been treated in day-care were selected on the basis of the occurrence of the main procedure in day-care. We listed all day-care procedures that were performed at least 50 times in the Netherlands in 1997 in at least 5 hospitals. Clinical admissions with a main procedure that appeared on this list were counted as admissions that could in principle have been treated in day-care if they also complied with all of the following conditions:\u2022 Non-acute admission;\u2022 Admission not for delivery;\u2022 Patient did not die in hospital;\u2022 Maximum clinical length of stay of three days;\u2022 Only one specialty was responsible during the stay ;\u2022 No transfer to another hospital.The year 1997 was used as reference to ensure that admissions really could be treated in day-care and to avoid discussions between professionals. Therefore, there is a chance for underestimation.A valid comparison of lengths of stay requires case-mix adjustment. Therefore we computed for each hospital specialty a ratio of actual length of stay to expected length of stay. The expected length of stay was computed by Prismant. For each specialty the expected length of stay was based on the characteristics of its patients and the national mean length of stay that is associated with these characteristics. A ratio\u2022 Age, divided in 5 classes: 0, 1\u201314, 15\u201344, 45\u201364, 65+ years;\u2022 primary diagnosis. This is the main diagnosis that led to the admission); it includes about 1,000 diagnoses classified by the ICD9 in three digits;\u2022 procedures, classified by the Dutch Classification System of Procedures. The procedures considered depend on the diagnosis of the patient. On average it includes five procedure groups.Together these three parameters produced about 5 \u00d7 5 \u00d7 1,000 = 25,000 cells for which the mean length of stay is taken as the expected length of stay. An exception was made for patients with a length of stay of 100 hospital days and longer and for patients who died in hospital. For the latter two groups the expected length of stay was kept equal to the actual length of stay and consequently the ratio of actual length of stay to expected length of stay always was 1.th percentile hospital of each specialty was determined by ranking the quotients of actual to expected length of stay of all hospitals with 100 or more discharges for each specialty. The hospital with the lowest ratio of actual to expected length of stay was identified as the hospital with the shortest length of stay. For each specialty the length of stay at the 15th percentile hospital in this ranking was used as the standard for calculating the potential reduction of length of stay in all hospitals with a longer length of stay. For 2006, we calculated how many hospital days Dutch hospitals could have reduced if they had all been at least as efficient with their beds as the 15th percentile hospital.In an Australian benchmark Hanning used the minimum length of stay as the standard (at state level) . Brownelth percentile and not the minimum we captured potential rest variation which was not adjusted for.Experiences gained in our consultancy practice have shown that setting a realistic goal motivates medical specialists to reduce the length of stay. In the first years of our consultancy practice we used the minimum as the standard, but medical specialists had many problems with this approach. They continued emphasizing potential 'rest'-variation which was not standardized for. The use of the minimum as a standard discouraged them to work on improving the health care process. They saw it as an unattainable goal. By using the 15th percentile hospitals, we distinguished between hospital days that could be gained by substitution from clinical to day-care and hospital days that could be gained by treating clinical patients with a shorter length of stay.To calculate the length of stay reduction that Dutch hospitals can achieve based on the results of the 15An example for internal medicine:\u2022 In the 69 hospitals of this study the total number of hospital days in clinic and day-care was 1,467,522;\u2022 215,587 patients were treated in day-care and 501 were treated in clinic only for 1 day;\u2022 3,965 patients were admitted in clinic for a 2-day  or 3-day  stays but could potentially have been treated in day-care;\u2022 Treating them in day-care would save 2,867 + 1,098 + 1,098 = 5,063 hospital days, which is 0.3% of all hospital days in clinic and day-care combined;\u2022 Without the  day-care patients the total number of hospital days was 1,242,406, generated by 139,904 patients;\u2022 The 15th percentile hospital had a ratio of actual to expected length of stay of 0.95. Using this ratio to all expected lengths of stay of every hospital, the total gain in hospital days could be 162,868, which equalled 11.1% of all hospital days in clinic and day-care combined.As a result, for internal medicine the hospital days that could be gained by substitution from clinical to day-care was 0.3%. Hospital days that could be gained by treating clinical patients with a shorter length of stay amounted to 11.1%. The combined level was 11.4%.The length of stay in Dutch hospitals has been decreasing nearly every year since data have become available. In 1978 (which is the first year for which data from the LMR could be used) patients stayed in hospital for an average of 14.1 days, while in 2006 the average length of stay was reduced to only 6.6 days. This amounted to an average decrease of 0.3 days per year. In Figure th percentile hospital had an average length of stay of 7.4 days.In 2000, the shortest average length of stay was 5.7 days while the longest was 11.3 days. The 15th percentile hospital in the year 2000. Between 2000 and 2006 the 15th percentile decreased from 7.4 to 5.7 hospital days. The difference between the longest length of stay and the shortest length of stay also declined during this period: In 2000, the longest length of stay (11.3 days) was 2.0 times longer than the shortest length of stay (5.7 days), while in 2006 it was 1.7 times as long (longest 8.7 days and shortest 5.1 days).In 2006 more than 80% of all hospitals reached an average length of stay shorter than the 15Substantial variation in length of stay among hospitals will occur because not all hospitals have the same specialty (to the same extent) and also within a specialty hospitals can have a different patient mix.Figure In Table and reduction length of stay to 15th percentile hospital) to all hospital days in all Dutch hospitals.In the last column of Table th percentile hospital is relatively small, but because Internal Medicine is the largest specialty (in number of admissions), the absolute number of hospital days that can be saved is the highest of all specialties.Expressed in absolute numbers Internal Medicine is the specialty that has the largest number of hospital days to save, but expressed in percentages this potential reduction is the smallest. The standard deviation of the mean length of stay for Internal Medicine is relatively small when adjusted for case-mix (0.11). Therefore, the potential percentage reduction generated by reducing lengths of stay to the 15For General Surgery, the second largest specialty in the Netherlands, the data are similar. The standard deviation for General Surgery is the smallest of all specialties (0.09). The percentage of hospital days that could be saved is 11.6%. In comparison with Internal Medicine a larger portion of days could be gained by substitution to day-care.th percentile. The standard deviation is 0.40. This specialty mostly treats older multi-problem patients with multiple secondary diagnoses. They often are in need of long-term care in a nursing home or the community and may block hospital beds. They cannot leave the hospital in case of lacking nursing home capacity, insufficient home care arrangements or slow referral procedures. The differences in lengths of stay between hospitals that do not have problems in transferring these patients to long-term care facilities and hospitals that do have these problems are substantial.'Geriatrics and other specialties' has the largest percentage of hospital days that could be saved by reducing length of stay to the 15th percentile hospital \u2013 would be 6.0 days and day-care (that is not included in this length of stay) would grow by 13%.Overall the average length of stay in Dutch hospitals \u2013 if all hospitals would be able to treat their patients like the 15The continuous reduction of length of stay is all the more remarkable considering two main developments with an increasing effect on the average clinical length of stay:1. Since the eighties of the last century many hospitals have introduced day-care and have increasingly substituted (short-term) clinical admissions for day-care ,10.2. Another development which had an increasing effect on the average length of stay is the ageing of the patient population. In 1978, 19% of the admissions were 65 years or older. In 2006, this increased to 48%. On average, elderly people stay longer in hospitals than younger ones; in 2006 the 0\u201364-year-old patient stayed an average 5.2 days in hospital and the patients aged more than 64 years stayed an average of 9.1 days.In spite of these two developments the average length of stay decreased from year to year. We expect this to continue because in the coming years, the financing system in Dutch hospitals will more and more be based on market forces and the reimbursement through payments per diem will be abolished (as in the United States more than two decades ago ). The inThe potential reduction in length of stay may in fact be higher because of two methodological choices.First, we have chosen to use a 1997 list of treatments that could have been performed in day care. This list could have been longer if we had used more recent data as a reference. Currently, we are planning to update the list. Probably a new list will show more possibilities to substitute inpatient care into day-care. Until now, the health care system in the Netherlands gave only few incentives to treat patients in day-care. Updating the list at this moment will also give an underestimation of the possibilities for day-care. We think that, when the changes in the financing system have been carried out entirely, an update will clearly show more possibilities for day-care.Second, in our standardisation for patient mix, the expected length of stay was not used for patients with a length of stay of 100 hospital days and longer and for patients who died in hospital. For these two groups the realised length of stay was used instead of the expected length of stay. This means that the results are without the potential gain in efficiency for these two groups. However, it concerns a small number of patients. Only 0.1% of all patients had a length of stay of 100 hospital days and longer and 2.4% of all patients died in hospital.The variation in the quotients of actual length of stay and expected length of stay shows that for several specialties the mean score is not 1. This is the case especially for cardiothoracic surgery and for 'other specialties'. For these two specialties it is 'normal' that the quotient of actual and expected length of stay is higher than 1.0. For 'other specialties' it is known that many hospitals created a special ward for patients that could not be discharged in time to next care facilities like nursing homes. The length of stay of these patients was longer because of these waiting days and the hospitals booked for these patients an administrative transfer to 'other specialties'. The code 'other specialties' is also used for geriatrics. This specialty treats patients that may have the same age group, diagnosis- and procedure group as patients treated by other specialty, but often the patients treated by geriatrics have a more complex syndrome and stay longer in hospital because of their frailty. The variables for standardisation  do not seem to be sufficient for patients that are discharged by these two specialties. The variable 'specialty' should also been taken into account. Because we did our analysis for each separate specialty this was no problem for this study, but if length of stay is benchmarked on the level of hospitals, 'specialty' is a variable that should be taken into account.th percentile as benchmark and not the minimum. If a more sophisticated comparison data based on severity of illness were available, it would be possible to identify which subpopulations  were generating the largest numbers of excess days. This could be possible in the future because the Dutch hospital information system will be upgraded in 2010.For a large part of the data, adjustment for age, primary diagnosis and procedure amounts to an adjustment for severity of illness. However, we realise that there may still be residual case-mix related variation that is not adjusted for. We did not adjust for variations in comorbidities Neither did we account for variations between elective versus emergency cases. Both parameters were recorded in the LMR, but the completeness of the registration of these items varies between hospitals. We realise that the presence or absence of a large number of comorbidities and/or emergency cases at hospital level will affect overall length of stay of a particular hospital. However, this potential residual variation that is not adjusted for is one of the reasons why we used the 15Length of stay is often used as an indicator of efficiency ,11-13. EFrom a health system perspective, efficiency also depends on the efficiency of other sectors and on health outcomes . When leOn the contrary, we did not find research that showed that shorter lengths of stay in hospitals is related to adverse quality ,18,1,5. Brownell stated that 'reassuringly, shorter stays have not been found to be related to adverse patient outcomes. In fact, a study of almost 4000 US hospitals showed that hospitals that discharged patients more efficiently had lower post discharge death rates' . FinallyIf quality improvement leads to shorter lengths of stay and shorter lengths of stay can lead to a better quality of care, we are curious if hospitals with shorter length of stay have better outcomes than hospitals with a longer length of stay. In future work we will investigate the connection between length of stay and quality of care.th percentile hospital in 2006 is taken as the standard, a 14% reduction of all hospital days would be attained. This percentage varied substantially across medical specialties . Extrapolating the potential reduction of lengths of stay of the 69 hospitals (that participate in the LMR) to all 98 Dutch hospitals yields a total reduction of 1.8 million hospital days.The length of stay in Dutch hospitals has been decreasing for decades. Between 1978 and 2006 the average decrease was 0.3 days per year. In 2006 more than 80% of all hospitals reached an average length of stay lower than the 15th percentile hospital in the year 2000. In 2006 the length of stay ranged from 5.1 to 8.7 among the 69 hospitals. Still, a further reduction of lengths of stay is possible. If all hospitals had substituted their potential day-care patients to day-care and if the average length of stay of the 15The authors declare that they have no competing interests.IB designed the study, performed the analysis, interpreted the results, and drafted the manuscript. RH, TK and RJL helped to interpret the results and contributed to the discussion GPW supervised the study and participated in the formulation of the discussion. All authors reviewed and edited the manuscript for intellectual content.The pre-publication history for this paper can be accessed here:"}
{"text": "Practicing mental repetition of \u201cOM\u201d has been shown to cause significant changes in the middle latency auditory-evoked potentials, which suggests that it facilitates the neural activity at the mesencephalic or diencephalic levels.dharana, and dhyana.The aim of the study was to study the brainstem auditory-evoked potentials (BAEP) in two meditation states based on consciousness, viz. ekagrata, i.e. single-topic lecture on meditation and (ii) cancalata, i.e. non-targeted thinking. The two meditation sessions were: (i) dharana, i.e. focusing on the symbol \u201cOM\u201d and (ii) dhyana, i.e. effortless single-thought state \u201cOM\u201d. All four sessions were recorded on four different days and consisted of three states, i.e. pre, during and post.Thirty subjects were selected, with ages ranging from 20 to 55 years  who had a minimum of 6 months experience in meditating \u201cOM\u201d. Each subject was assessed in four sessions, i.e. two meditation and two control sessions. The two control sessions were: (i) cancalata, ekagrata and dharana, but no change occurred during the dhyana session.The present results showed that the wave V peak latency significantly increased in cancalata, ekagrata and dharana, but there is no change during dhyana. It may be said that auditory information transmission was delayed at the inferior collicular level as the wave V corresponds to the tectum.These results suggested that information transmission along the auditory pathway is delayed during  The functions of the brain in meditation have been studied using different techniques. These include the electroencephalogram (EEG), evoked pEvoked potentials are used in meditation studies because a correlation between different evoked potential components and underlying neural generators is reasonably well worked out. Apart frStudies on short latency auditory-evoked potentials have not shown such clear changes. In that Patanjali\u2019s yoga sutras (circa 900 BC).[dharana, which is characterized by focusing on the object of meditation and dhyana, which is a defocused state of mental expansiveness. With this background, the present study was undertaken to determine whether short latency auditory-evoked potentials would change in normal subjects in meditation considered as both dharana and dhyana sessions on separate days.More recently, we have attempted to understand meditation based on descriptions from an ancient yoga text. This is  900 BC). Based onguru).Thirty subjects were selected in the age range between 20 and 55 years  recruited from a residential setup, Swami Vivekananda Yoga Research Foundation, Bangalore, in south India. This age range was selected as short latency does not vary within this age range in healthy individuals. Only malTo assess the quality of the practice, visual analogue scale (VAS) was used at the end of each session.All of them expressed their willingness to participate in the experiment. The project was approved by the Institution\u2019s Ethics Committee. The study protocol was explained to the subjects and their signed informed consent was obtained.Apart from their prior experience of \u201cOM\u201d meditation, they had undergone a 2-month orientation program in \u201cOM\u201d meditation under the guidance of an experienced meditation teacher.The condition to exclude subjects were any health disorder, especially psychiatric or neurological disorders, auditory deficits assessed by checking the auditory threshold of each ear separately and any medication that alters the functions of the nervous system. None of the subjects had to be excluded for these reasons.The order of the four sessions (i.e. two meditation sessions and two non-meditation control sessions) was randomized for each subject using a standard random number table. This wasekagrata, i.e. single-topic lecture on meditation and (ii) cancalata, i.e. non-targeted thinking. The two meditation sessions were: (i) dharana, i.e. focusing on the symbol \u201cOM\u201d and (ii) dhyana, i.e. effortless single-thought state \u201cOM.\u201d All four sessions consisted of three states, i.e. \u201cpre\u201d (5 min), \u201cduring\u201d (20 min) and \u201cpost\u201d (5 min).Each subject was assessed in four sessions, i.e. two meditation and two control sessions, to record BAEP. The two control sessions were: (i) The assessments were made on four different days, not necessarily on consecutive days, but at the same time of the day . The allocation of the subjects to the four sessions was randomized using a standard random number table. This was\u00b5V, number of sweeps averaged 1,500, sweep width 10 ms, delay 0 ms. Binaural click stimuli, of alternating polarity, with 11.1 Hz frequency and 100 \u00b5S duration, were delivered through acoustically shielded earphones . The stimulus intensity was kept at 80 dB nHL. The rejection level was expressed as a percentage of the full-scale range of the analog-to-digital converter. This level was set at 90%. Silver chloride (Ag/AgCl) disc electrodes were placed on the scalp using a conductive water-soluble paste. The active electrode was at Cz according to the International 10\u201320 system[BAEP were recorded using the Nicolet Bravo system . The amplifier settings were as follows: low-frequency filter 100 Hz, high-frequency filter 3 KHz, sensitivity 50 20 system referencdharana and dhyana) as two separate states and two control states, i.e. cancalata or non-focused thinking and ekagrata or focusing without meditation and on more than one thought.Throughout all sessions, the subjects kept their eyes closed and followed pre-recorded instructions. The instructions emphasized carrying out the practice slowly, with awareness and relaxation. The meditators who participated in the study underwent 1 month of orientation sessions, where they practiced two phases that formed a continuum in meditation , and has to be taken through the stages of \u201cstreamlining the thoughts\u201d (concentration or ekagrata) before moving on to the states of meditation. These are: one-pointed concentration or dharana and a defocused, effortless single-thought state or dhyana.These states are described in the traditional texts, i.e. the cancalata session, the 20-min period consisted of \u201cnon-targeted thinking,\u201d during which the subjects were asked to allow their thoughts to wander freely as they listened to a compiled audio CD consisting of brief periods of conversation and talks on multiple topics recorded from a local radio station transmission. In the ekagrata session, the 20-min period consisted of focusing on a single topic, which was listening to a lecture on meditation, with multiple, yet associated, thoughts. In the dharana session, the 20-min period consisted of focusing on the symbol \u201cOM.\u201d During this session, they were asked to focus on the meaning of the syllable, OM, which is used as a symbol for the entire universe because OM is considered to represent \u201cthat which sustains everything.\u201d[dhyana session, the 20 min of the practice consisted of meditation with effortless absorption in the single-thought state of the object of meditation, i.e. \u201cOM.\u201dIn the rything.\u201d In the dFor the two meditation sessions and the two control sessions, subjects were given guided instructions through separate recorded instructions for each session.For the BAEP, the peak latencies and peak amplitudes of all seven waves were calculated. Peak latency (msec) is defined as the time from stimulus onset to the point of maximum positive amplitude within the latency window. Peak amplitude (V) is defined as the voltage difference between a pre-stimulus baseline and the largest positive going peak within a given latency window.post hoc analyses with Bonferroni adjustment were performed to compare \u201cpre\u201d data with \u201cduring\u201d and \u201cpost.\u201dStatistical analysis was performed using SPSS (Version 10.0). The peak latencies and peak amplitudes of all seven waves were analyzed using repeated-measures analyses of variance (ANOVAs) and cancalata, ekagrata, dharana and dhyana, and Factor 2: States; with six levels, viz. pre, during (D1 to D4) and post. These repeated measures ANOVAs were carried out for the peak latency and peak amplitude of all levels.The repeated measures ANOVAs were performed with two \u201cwithin\u2013subject\u201d factors, i.e. Factor 1: Sessions; with four levels, viz. post hoc analysis with Bonferroni adjustment for multiple comparisons between the mean values of different states .This was followed by a F=3.894, for df=2.678, 77.651, P< 0.015, Huynh-Feldt epsilon=0.893) and between States .The peak latency of wave V showed a significant difference between Sessions  separately showed a significant increase in the latency of wave V during the cancalata session , ekagrata session  and following the dharana session .F=6.515, for df=2.692, 78.060, P< 0.001, Huynh-Feldt epsilon=0.897) and between States .The amplitude of wave V also showed a significant difference between Sessions  separately showed no significant change in the peak amplitude of wave V (P>0.05). Also, there were no significant change in the other waves (P>0.05).Hence, the changes in wave V peak latency alone are presented in dharana and dhyana) and two control sessions . BAEP were recorded throughout all four sessions. There was a significant increase in the wave V peak latency during the cancalata, ekagrata and dharana sessions but there was no change during the dhyana session.In the present study, normal healthy volunteers who were experienced in practicing meditation on the syllable \u201cOM\u201d were assessed in two meditation . In contrast, an increase in wave V peak latency was found in the cancalata, ekagrata and dharana sessions. No such increase was obtained in the dhyana session. An increase in the latency of an evoked potential component is taken to suggest that sensory information processing at the level of the underlying neural generator is delayed.[cancalata, ekagrata and dharana mental states, sensory processing at the midbrain level was delayed. Another feature of the present study is that a difference is seen in the nature of the results in the two meditation sessions.In the literature, there is only one previous study of short latency auditory-evoked potentials in TM practitioners. In this study, at moderate stimulus intensities (40\u201350 dB), the wave V latency increased following meditation. In contr delayed. This sugdharana and dhyana states have been described in an ancient yoga text, namely Patanjali\u2019s yoga sutras. In this text, dharana literary means \u201cfixing the mind on a specific object\u201d . The mind could be fixed on any point and. as long as disturbances from any corner are warded off, this mental state is called dharana. When dharana becomes effortless, it takes the form of dhyana, which is defined as the uninterrupted spontaneous flow of the mind toward the chosen object.In the introduction, it was already mentioned that cancalata and ekagrata are described in another ancient text, the Bhagavad Gita.[cancalata state is characterized by constant shifting of thoughts from one object to another. The ekagrata state is quite different from this and is similar to concentration. When haphazard thoughts are streamlined in a single direction, it is called ekagrata.In contrast to this, the two control sessions, i.e. vad Gita. The canccancalata), channelized thought in concentration (ekagrata) or in a state of channelized thought as in meditation (dharana), there was a delay in sensory information processing, as mentioned above at the mid-brain (possibly the inferior colliculus) level. In contrast, when the mental state was characterized by a lack of effort in dhyana, no such change occurred.Hence, irrespective of whether meditators were in a state of random thinking (dharana and dhyana states. The limitations of the present study are: (i) the fact that there was no attempt to vary stimulus intensities and hence the earlier findings of McEvoy, Frumkin and Harkins,[ekagrata, dharana and cancalata sessions were not different and cannot be ruled out as the VAS is essentially a subjective measure; no objective measure was taken. Only those subjects who achieved 75% of their ideal practice based of their subjective rating were included in the study. Again, the possibility that the sound stimulus influences all four practices cannot be ruled out. This is another limitation of the study.Further studies are required to understand whether neural relay centers further along the auditory pathway would also change differently in  Harkins, could nodharana and dhyana states of meditation based on BAEP.[17Despite these limitations, the present study does demonstrate a difference between the  on BAEP.1718"}
{"text": "Antibiotics are widely-used medicines for which a more prudent use has been advocated to minimize development of resistance. There are considerable cross-national differences that can only partially be explained by epidemiological difference and variations in health care structure. The aim of this study was to explore whether cross-national differences in use of antibiotics (prescribed and non-prescribed) are associated with differences between national cultures as described in Hofstede's model of cultural dimensions .Country-level data of prescribed antibiotic use and self-medication with antibiotics were correlated to country-specific scores of cultural dimensions obtained from Hofstede. Data on use of antibiotics were provided by three European studies, based on different methods and/or countries: Self-medication with Antibiotics and Resistance in Europe (SAR), based on a survey in 2003 on reported use of antibiotics in 19 countries, the European Surveillance on Antimicrobial Consumption, based on distribution and reimbursement of antibiotics in ambulatory care (1997\u20132002), and the 2002 interview-based Eurobarometer study, asking whether respondents had taken antibiotics in the previous 12 months. These studies provided data on antibiotics use for 27 European countries in total, for which scores of cultural dimensions were also available. The SAR-study differentiated between prescribed antibiotics and self-medication with antibiotics.Significant positive correlations were found for Power Distance Index with use of prescribed antibiotics in the three studies (rho between 0.59 and 0.62) and with self-medication (rho = 0.54) in the SAR study. Positive significant correlations were found for the Uncertainty Avoidance Index with the use of antibiotics as reported in two studies . Masculinity was not significantly correlated, except in one study after controlling for GDP (r = 0.81). For Individualism and Long-Term Orientation no significant correlations were found.Power Distance is a cultural aspect associated with antibiotic use, suggesting that the culture-specific way people deal with authority is an important factor in explaining cross-national differences in antibiotic use. There are indications that Uncertainty Avoidance also plays a role but further research is needed to better understand the complex effect of cultural dimensions. Antibiotics are important and widely used medicines ,2. ThereMany studies have shown the relevance of characteristics of the doctor ,6 or theSeveral models and questionnaires have been developed to analyse cultural differences -21. One Power Distance refers to the degree of hierarchy in a country. It has been defined by Hofstede as the extent to which the less powerful members of organizations and institutions accept and expect that power is distributed unequally. A lower score indicates a preference for deliberation and mutual dependence between subordinates and their chief and authority based on secular/rational arguments. Individualism refers to the prevalence of the interests of an individual versus the group. This dimension is defined as the degree to which individuals are integrated into groups. A higher score indicates more emphasis on individualism. Masculinity, as opposed to femininity, refers to a culture in which the emotional roles of the two genders are clearly separated. A higher score indicates for instance that a culture is assertive and competitive. Uncertainty Avoidance deals with a society's tolerance for uncertainty and ambiguity. A higher score indicates that people feel uncomfortable in novel, unknown or surprising situations. Values associated with Long Term Orientation are thrift and perseverance; in contrast, a low score on this dimension implies values associated with Short Term Orientation: respect for tradition, fulfilling social obligations, protecting one's 'face' and expecting quick results.While the influence of cultural dimensions on illness behaviour and use of medicines has been suggested in previous studies, ,25 very Although antibiotics are used worldwide and their effectiveness is unquestionable, these medicines are the result of a particular view on illness, the so-called germ paradigm ,28. It iOne of the authors (RD) postulated more that a decade ago what effect on antibiotic use could be expected of these cultural dimensions ,30.Power Distance has to do with preferences of how persons with a different status communicate with each other. Hence, one might expect that this will also play a role in patient-doctor communication. A preference for deliberation about the use and sense of antibiotics might be favoured in countries with low Power Distance, as contrasted with a 'doctor knows best'-attitude in countries scoring high for Power Distance.Another hypothesis was that countries with high Uncertainty Avoidance would use more antibiotics because doctors try to avoid the ambiguity in cases of ailments such as 'a cold' or 'the flu', which are usually \u2013 but not always \u2013 trivial, self-limiting viral infections. Prescribing antibiotics is then a coping-strategy, much like a ritual, to reduce the uncertainty. In such countries patients too might have problems accepting a doctor saying no exact diagnosis can be given and therefore one should just 'wait and see'.With regard to Individualism physicians face the problem that prescribing antibiotics for the individual patient increases the risk of resistance for the population as a whole. The same holds with regard to Long versus Short term Orientations: antibiotics are expected to give quick results but the prescribing of antibiotics now raises the risk of making them ineffective in the future.Masculinity can be expected to correlate positively with the use of antibiotics, e.g. because these countries are strongly result-oriented and value a 'live to work' ethic. In such countries antibiotics might be favoured because they are often perceived and used as strong medicines that can get you back to work more quickly. Conversely, feminine cultures are more concerned with ecological problems and might therefore be expected to pay more attention to problems of antibiotic resistance.Based on these hypotheses, it has been suggested that Power Distance and Uncertainty Avoidance were correlated with antibiotic consumption ,17. HoweThe aim of this study is to test the aforesaid hypotheses and to further explore whether cultural dimensions are significantly correlated with cross-national differences in the prescribed use of antibiotics and self-medication with antibiotics.Data on the use of antibiotics were provided by three European studies, based on different methods and countries.In the 'Self-medication with antibiotics and Resistance in Europe' (SAR) study, data were obtained from a survey in 2003 on the reported use of systemic antimicrobial drugs in the last year in 19 European countries. A multistage sampling design was used in each participating country. Within each country, a region with average prescribed antibiotic consumption was chosen, based on available national data on the use of medicines. However, in some countries these data were not available at the start of the SAR study, and a region representative of the country's population in terms of age and sex was chosen . In each region an urban area  and a rural area  were selected. Persons over 18 years of age were randomly selected from population registries in the selected regions. The questionnaire was developed specifically for this survey in English, translated into national languages, and back-translated for consistency. The SAR study could differentiate between prescribed antibiotics and self-medication with antibiotics. The questionnaire is available in English from the corresponding author. More information is provided elsewhere . RespondIn the European Surveillance on Antimicrobial Consumption, data were based on either distribution or reimbursement of systemic antibiotics in ambulatory care for the period 1997\u20132002. Data were collected in 24 countries that provided internationally comparable data. Additional information about the characteristics of the data sources and data providers, obtained from the national ESAC representatives, was used to check validity of the data [The Eurobarometer provided data based on face-to-face interviews of stratified at random samples of inhabitants, aged 15 years or older, in 15 countries. Samples consisted of at least 1000 persons per country (except for Luxemburg (N = 602) and Northern Ireland (N = 302)) and were compared to the total population. Respondents were asked whether or not they had taken antibiotics in the last 12 months .Data on cultural dimensions were obtained from Hofstede . For an For the SAR study ethic or data committee approval was required and obtained for 11 countries . For theSpearman's correlation coefficient rho was used to calculate correlations between country-aggregated use of antibiotics and country-specific scores of cultural dimensions. A p-value of 0.05 or smaller was considered significant. Since some cultural dimensions are known to covary with affluence ,33, we eTwo countries from the SAR study and two from the ESAC study could not be included because of lack of data on Hofstede's cultural dimensions table . Hence cSignificant positive correlations were found for Power Distance Index with prescribed use of antibiotics in the three studies . For the SAR study correlations are not significant, however.For Individualism, Masculinity and Long-Term versus short-term Orientation the correlations were not significant.Self-medication was only significantly correlated with Power Distance (rho = 0.54).When controlling for the Gross Domestic Product (GDP) per capita, the correlations changed for Power Distance and Uncertainty Avoidance and became not significant. Correlations were also insignificant for Individualism and Long Term Orientation. For Masculinity the correlations tend to become stronger but they were significant for only one dataset (Eurobarometer: r = 0.81).The findings of positive correlations for antibiotic use with Power distance and, in 2 of the 3 studies with Uncertainty Avoidance, corroborate our hypotheses with regard to these dimensions. When controlling the correlations between cultural dimensions and antibiotics for wealth, only one correlation (for Masculinity and the Eurobarometer results for antibiotic use) is significant.Our findings may have implications with regard to the more rational use of antibiotics and might help us to improve our understanding of why there are such remarkable differences in antibiotic use. The effect of Power Distances is complex and might work on several levels. The preference for consultation and secular/rational arguments, which is typically of countries with low scores on Power Distance, may have implications for collaboration between doctors and other health care providers, such as pharmacists and nurses, as well as for doctor-patient communication. In countries with a high Power Distance, hierarchic differences are more manifested and doctors may therefore have a more pronounced (therapeutic) autonomy, whereas in other countries one can expect doctors to feel more part of a team. In the Netherlands (a country with a low Power Distance and one of the lowest use of antibiotics) Pharmacotherapy Counselling Groups, in which GPs and local community pharmacists regularly meet to exchange information about drug therapy, have been the spearhead of a successful policy for more rational use of antibiotics and other medicines ,35,36.Power Distance is also supposed to affect the doctor patient-relationship, as well as the relations between professionals. In countries with a high Power Distance it is likely that patients look up to their doctor, expecting great expertise and feeling little need for involvement in the decision-making. A doctor asking \"what do you think yourself about taking an antibiotic?\" would embarrass the 'modal' patient. Likewise, a physician acknowledging that he is not sure whether it is a viral or bacterial infection will not inspire much confidence in such a cultural context. Prescribing antibiotics has strong symbolic connotations and it can be seen as a sign of power and expertise . Hence aCountries with low Power Distance, in contrast, show a preference for shared decision-making in which the patient discloses his concerns and point of view, e.g. with regard to the pros and cons of antibiotics. It is true that patients often put pressure on the physician to prescribe antibiotics but doctors often overestimate patients demand . Taking If we apply the avoidance of uncertainty to medical situations, patients and physicians are expected to have an aversion to diagnostic uncertainty and will prefer a clear labelling of diseases. However, many symptoms, such as coughing, sore throat, mild fever, etc. are difficult to label and remarkable cross-cultural variations have been found ,39. BaseSelf-medication might be intuitively expected to be an expression of individualism. Talking F Rahme's saying into account \"If I use an antibiotic too much, I am making it less useful for everyone\"  we also The results with regard to Long-term orientation are not conclusive, probably because of the limited number of countries for which correlation could be calculated.We found few differences between the effects of cultural dimensions on prescribed use of antibiotics versus self-medication. This suggests that in countries with high incidence of self-medication with antibiotics, the prescription of antibiotics is also high  and thatThe finding that, after controlling for GDP/capita, the correlations become insignificant for Power Distance and Uncertainty Avoidance illustrates the complex relationship between a country's wealth and cultural dimensions. Also correlation values for Masculinity change. The original positive insignificant correlations become stronger (significantly for the Eurobarometer data) which is an indication of the complex relationship between wealth and cultural dimensions. Other studies have pointed out a possible effect of cultural dimensions on wealth and vice versa: Power Distances covaries negatively with a country's wealth. Uncertainty Avoidance influences consumer behaviour. Masculinity affects the way countries spent their money (e.g. masculine countries are inclined to prioritise economic growth over care for the environment and development aid). Long Term Orientation correlates with economic growth. ,33Our study has some limitations. First, due to the selection of regions in the SAR study, it is not certain that the chosen regions really reflect the national culture of these countries. Also the response rate for the SAR data was low in some countries. We therefore repeated the analysis, limited to countries with response rates of >40%. We also plotted the results and checked for the effect of possible outliers. These verifications corroborated our results. We also used data from others studies, based on other data sources and sampling methods to minimise the biases and restrictions of each particular study. Secondly, since we tested correlations for 5 cultural dimensions the chance of finding statistically significant correlations by chance increases in one dataset. We used different data sets to test hypotheses that were formulated before the data were available. Nevertheless extra care is warranted in interpreting the results. Thirdly, culture is certainly a much richer phenomenon than the reduction into 5 dimensions presented and Hofstede has been criticized for trying 'to measure the immeasurable'. ,45 HowevThe VSM questionnaire has been developed to compare countries. It is not meant to compare individuals but to describe relative differences between social systems only. A common pitfall is to look at culture as a kind of collective personality. Such an interpretation neglects the fact that cultures are the result of interaction between different \u2013 at the same time conflicting and complementary \u2013 personalities . TherefoWe are also aware of the fact that cultural dimensions might be the resultant of important factors (as we showed for the impact of GDP). However, the strength of cultural dimensions is that they are the resultant of many interacting factors and that they can put phenomena together that initially seem unconnected. An advantage is also that they enable quantitative analysis of cultural aspects in relation to other relevant issues such as the use of antibiotics. This is not possible using thicker descriptions of cultures, i.e. anthropological descriptions based on qualitative data. Therefore, we believe cultural dimensions are a simple but useful tool to measure the extremely complex concept of culture. Up till now, this approach has seldom been used to improve our understanding of the remarkable and partially unexplained national differences in antibiotic us, but has been successfully employed in dozens of studies, e.g. on management and communication -48. It pIn summary, our study indicates that Power Distance is a cultural aspect associated with antibiotics use, suggesting that the culture-specific way people deal with authority is an important factor in explaining cross-national differences in antibiotic use. Uncertainty Avoidance can lead to high consumer demand and defensive medicine, which may result in unnecessary use of antibiotics. The effect of cultural dimensions is complex because they influence a multitude of social phenomena on the macro and micro level, such as the wealth of a country. Further cross-national comparative research, e.g. based on larger samples and including also non-Western countries, is needed to better understand the correlations between cultural dimensions and the use of antibiotics and the reasons for this, so that our hypothetical explanations can be corroborated or falsified.The authors declare that they have no competing interests.RD participated in the design of the study and data collection, carried out the analysis and drafted the manuscript. LG participated in the design of the study and data collection, the analysis and helped to draft the manuscript. CSL participated in the design of the study, the data collection and critically revised the manuscript. GH participated in the design of the study and critically revised the manuscript. JC participated in the design of the study, helped with the analysis and critically revised the manuscript. GVDK participated in the design of the study and the data collection, and critically revised the manuscript. LD participated in the design of the study and the data collection, and critically revised the manuscript. FMH\u2013R participated in the design of the study and coordinated it, helped with the analysis and the drafting of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
{"text": "Tinnitus is a frequent condition with high morbidity and impairment in quality of life. The pathophysiology is still incompletely understood. Electromagnetic fields are discussed to be involved in the multi-factorial pathogenesis of tinnitus, but data proofing this relationship are very limited. Potential health hazards of electromagnetic fields (EMF) have been under discussion for long. Especially, individuals claiming themselves to be electromagnetic hypersensitive suffer from a variety of unspecific symptoms, which they attribute to EMF-exposure. The aim of the study was to elucidate the relationship between EMF-exposure, electromagnetic hypersensitivity and tinnitus using a case-control design.Tinnitus occurrence and tinnitus severity were assessed by questionnaires in 89 electromagnetic hypersensitive patients and 107 controls matched for age-, gender, living surroundings and workplace. Using a logistic regression approach, potential risk factors for the development of tinnitus were evaluated.Tinnitus was significantly more frequent in the electromagnetic hypersensitive group (50.72% vs. 17.5%) whereas tinnitus duration and severity did not differ between groups. Electromagnetic hypersensitivity and tinnitus were independent risk factors for sleep disturbances. However, measures of individual EMF-exposure like e.g. cell phone use did not show any association with tinnitus.Our data indicate that tinnitus is associated with subjective electromagnetic hypersensitivity. An individual vulnerability probably due to an over activated cortical distress network seems to be responsible for, both, electromagnetic hypersensitivity and tinnitus. Hence, therapeutic efforts should focus on treatment strategies  aiming at normalizing this dysfunctional distress network. Tinnitus, the perception of sound in the absence of an external sound, is a frequent disorder of auditory perception, which is very difficult to treat Even if the pathophysiology of tinnitus remains incompletely understood, there is growing evidence that dysfunctional neuroplastic processes in the brain are involved. In particular, it is assumed that tinnitus might be the correlate of maladaptive neuroplastic changes due to distorted sensory input There has been an ongoing debate, whether tinnitus might be related to exposure to electromagnetic fields (EMF) Besides the hypothesized involvement in the generation of tinnitus, EMF-exposure has also been related to a variety of unspecific health symptoms . Despite a huge amount of studies investigating the health impact of EMF, no clear relationship between EMF-exposure and these unspecific health symptoms could be established and the majority of provocation studies failed to demonstrate such a relationship Due to the large sample size, the detailed clinical and neurobiological characterization and the control group, which was matched for age, gender and either living surroundings or workplace (as very rough proxies for EMF-exposure), this study population The study has been approved by the local ethics committee of the University of Regensburg. All participants gave written informed consent.Tinnitus occurrence and severity have been assessed in a sample of subjects who claimed themselves to be hypersensitive to electromagnetic fields (EMF-sensitive). Subjective electromagnetic hypersensitivity was defined by the occurrence of unspecific health complaints interfering with daily living and the subjective belief that these complaints are caused by named electromagnetic emission sources  Tinnitus occurrence and duration in the study population were assessed by the following questions: (1.) Do you currently perceive tinnitus? (2.) If yes, since how long? Furthermore, in all tinnitus sufferers tinnitus severity was assessed by a German translation in\u200a=\u200a0.05, pout\u200a=\u200a0.10) as model building strategy. The following variables were evaluated: (1) age at study entry; (2) subjective hypersensitivity to EMF, ability to differentiate electromagnetic evoked sensory stimuli, number of complaints in the Regensburg-EMF-complaint-list as an indicator of severity of subjective electromagnetic hypersensitivity; (3) gender; (4) measures of cortical excitability as determined by standard procedures with transcranial magnetic stimulation , anxiety disorder  and somatoform disorders  were significantly more frequent in the EMF-sensitive group compared to the control group . Furthermore, electromagnetic hypersensitive patients had a higher EMF-complaint level and a worse sleep quality . ElectroUsing a logistic regression analysis the following four items were found to be independent predictors for tinnitus . These wSince an association between tinnitus and sleep disorders is well known Interestingly, a reduced ability to discriminate real from sham magnetic pulses, which is typically diminished in subjectively electromagnetic hypersensitive subjects The primary aim of this study was to elucidate whether a potential relationship exists between EMF-exposure, electromagnetic hypersensitivity and tinnitus. The main finding is that tinnitus is much more frequent in subjectively electromagnetic hypersensitive patients compared to control subjects. Independent predictors of tinnitus occurrence were subjective belief of being electromagnetic hypersensitive, being male, a reduced sleep quality, and a reduced ability to discriminate real from sham electromagnetic evoked sensory stimuli. In contrast, no evidence for a relationship between EMF-exposure and tinnitus has been found.The observed prevalence of tinnitus of 17.5% in the control group is in accordance with findings from various epidemiological studies showing similar rates A new finding is the surprisingly high prevalence of tinnitus among the electromagnetic hypersensitive patients. Since the study design at least partially controlled for environmental EMF-exposure by recruiting patients and controls from the same private and working environments, the increased prevalence in the EMF-sensitive group can hardly be explained by differences in environmental EMF-exposure. Furthermore the utilization of mobile phones did not show any significant relationship to tinnitus. Our data thus indicate that the increased prevalence of tinnitus may rather be due to other factors raising the question about the nature of this relationship. One possibility is that tinnitus just represents another unspecific health symptom of subjectively electromagnetic hypersensitive patients. Another possibility is that tinnitus and subjective electromagnetic hypersensitivity share a common pathophysiology. A key feature repeatedly found in subjectively electromagnetic hypersensitive patients is reduced discrimination ability for magnetic pulses With the failure to prove a causal relationship between EMF-exposure and symptoms in subjectively electromagnetic hypersensitive patients The dysfunctional over-activation of this cortical neural network might be related to a disturbed representation of external and internal perceptions, which in turn could explain the reduced ability to discriminate real from sham electromagnetically evoked stimuli of electromagnetic hypersensitive patients Taken together these results point to a shared pathophysiology of subjective electromagnetic hypersensitivity and tinnitus. It may be hypothesized that these changes represent a key feature of somatoform disorders, which should be addressed in future studies.Although this study thus provides some interesting new findings, it is not without limitations. First, data were cross-sectional and correlation analyses were used, which makes it difficult to determine the exact nature of the relationships between the variables of interest. Hence, prospective, longitudinal studies are needed to establish the precise nature and the directions of the relationships explored in this study. Second, self-report measures were used for tinnitus assessment. Such measures may not accurately capture the phenomena under investigation. Third, the study design aimed at minimizing the influence of environmental physical  and social stressors. We are well aware that this design cannot guarantee equivalent EMF-exposure between both groups. However, it is noteworthy that the discrimination ability to differentiate real from sham magnetic stimuli, which was shown to be diminished in subjective electromagnetic hypersensitive patients and tinnitus sufferers, has been assessed under laboratory conditions in a double-blind, randomized design In conclusion, this study has shown that tinnitus is much more frequent among subjective electromagnetic hypersensitive patients whereas there is no hint for a relationship between tinnitus and exposure to electromagnetic fields. Rather, the correlation between tinnitus and electromagnetic hypersensitivity might be due to an individual vulnerability. Neurobiological characteristics of this increased vulnerability such as an oversensitive cortical distress network and an impaired discrimination ability for electromagnetically evoked sensory stimuli might be involved in the pathophysiology of both tinnitus and electromagnetic hypersensitivity and possibly also in other related perception disorders. Nevertheless, this hypothesis derived from our epidemiological study has to be confirmed in further studies by e.g. intervention studies aiming for a normalization of the postulated over-activated distress network in subjectively electromagnetic hypersensitive (e.g. cognitive behavioral therapy, which has been shown to be successful in electromagnetic hypersensitivity"}
{"text": "In recent years, ontologies have become a mainstream topic in biomedical research. When biological entities are described using a common schema, such as an ontology, they can be compared by means of their annotations. This type of comparison is called semantic similarity, since it assesses the degree of relatedness between two entities by the similarity in meaning of their annotations. The application of semantic similarity to biomedical ontologies is recent; nevertheless, several studies have been published in the last few years describing and evaluating diverse approaches. Semantic similarity has become a valuable tool for validating the results drawn from biomedical studies such as gene clustering, gene expression data analysis, prediction and validation of molecular interactions, and disease gene prioritization.We review semantic similarity measures applied to biomedical ontologies and propose their classification according to the strategies they employ: node-based versus edge-based and pairwise versus groupwise. We also present comparative assessment studies and discuss the implications of their results. We survey the existing implementations of semantic similarity measures, and we describe examples of applications to biomedical research. This will clarify how biomedical researchers can benefit from semantic similarity measures and help them choose the approach most suitable for their studies.Biomedical ontologies are evolving toward increased coverage, formality, and integration, and their use for annotation is increasingly becoming a focus of both effort by biomedical experts and application of automated annotation procedures to create corpora of higher quality and completeness than are currently available. Given that semantic similarity measures are directly dependent on these evolutions, we can expect to see them gaining more relevance and even becoming as essential as sequence similarity is today in biomedical research. Comparison and classification have been central pillars of biology since Linnaeus proposed his taxonomy and Darwin observed the mockingbirds on the Galapagos Islands. Like most scientific knowledge, biological laws and models are derived from comparing entities  and finding their similarities and differences. However, biology is unlike other sciences in that its knowledge can seldom be reduced to mathematical form. Thus, biologists either record their knowledge in natural language\u2014for example, in scientific publications\u2014or they must seek other forms of representation to organize it, such as classification schemes. When new entities arise, biologists approach them by comparing them to known entities and making inferences according to their degree of similarity.Comparing entities is not always trivial. For instance, while the sequences or structures of two gene products can be compared directly , the same is not true of their functional aspects. The difference is that sequences and structures have an objective representation and measurable properties, whereas functional aspects have neither. This does not mean that it is impossible to compare functional aspects, but that to be compared they must be expressed in a common and objective form.The advent of automated sequencing has had deep repercussions on knowledge representation in biology. As experimental methods shift in scope from the gene level to the genomic level, computational analysis is proving essential in handling the increasing amount of data. Thus it has become crucial to adopt common and objective knowledge representations to help knowledge sharing and computer reasoning. This need led to the development of ontologies for goals such as annotating gene products (Gene Ontology), annotating sequences (Sequence Ontology), and annotating experimental assays (Microarray and Gene Expression Data Ontology).The adoption of ontologies for annotation provides a means to compare entities on aspects that would otherwise not be comparable. For instance, if two gene products are annotated within the same schema, we can compare them by comparing the terms with which they are annotated. While this comparison is often done implicitly , it is possible to do an explicit comparison with semantic similarity measures. Within the context of this article, we define a semantic similarity measure as a function that, given two ontology terms or two sets of terms annotating two entities, returns a numerical value reflecting the closeness in meaning between them.The Gene Ontology (GO) molecular function, biological process, and cellular component. The nodes in the graph represent terms that describe components of gene product function. GO links the terms to each other by relationships, most commonly of the types \u2018is a\u2019 and \u2018part of\u2019, the former expressing a simple class\u2013subclass relationship and the latter expressing a part\u2013whole relationship. Gene products that are described by GO terms are said to be annotated with them, either directly or through inheritance, since annotation to a given term implies annotation to all of its ancestors (true path rule). The Gene Ontology Consortium is responsible for developing and maintaining GO terms, their relationships, and their annotations to genes and gene products of the collaborating databases. Moreover, GO Consortium is also responsible for developing tools that support the creation, maintenance, and use of all this information.GO provides a schema for representing gene product function in the cellular context. Several approaches are available to quantify semantic similarity between terms or annotated entities in an ontology represented as a DAG such as GO. This article distinguishes these approaches in the following way:Scope: Which entities they intend to compare, that is, GO terms versus gene products;Data source: Which components of the ontology they use, i.e., edges versus nodes;Metric: How they quantify and combine the information stored on those components.There are essentially two types of approaches for comparing terms in a graph-structured ontology such as GO: edge-based, which use the edges and their types as the data source; and node-based, in which the main data sources are the nodes and their properties. We summarize the different techniques employed in these approaches in distance, selects either the shortest path or the average of all paths, when more than one path exists. This technique yields a measure of the distance between two terms, which can be easily converted into a similarity measure. Alternatively, the common path technique calculates the similarity directly by the length of the path from the lowest common ancestor of the two terms to the root node Edge-based approaches are based mainly on counting the number of edges in the graph path between two terms While these approaches are intuitive, they are based on two assumptions that are seldom true in biological ontologies: (1) nodes and edges are uniformly distributed c can be quantified as the negative log likelihood,p(c) is the probability of occurrence of c in a specific corpus (such as the UniProt Knowledgebase), being normally estimated by its frequency of annotation. Alternatively, the IC can also be calculated from the number of children a term has in the GO structure Node-based approaches rely on comparing the properties of the terms involved, which can be related to the terms themselves, their ancestors, or their descendants. One concept commonly used in these approaches is information content (IC), which gives a measure how specific and informative a term is. The IC of a term The concept of IC can be applied to the common ancestors two terms have, to quantify the information they share and thus measure their semantic similarity. There are two main approaches for doing this: the most informative common ancestor (MICA technique), in which only the common ancestor with the highest IC is considered Approaches based on IC are less sensitive to the issues of variable semantic distance and variable node density than edge-based measures Other node-based approaches include looking at the number of shared annotations, that is, the number of gene products annotated with both terms molecular function terms, and gene products often participate in multiple biological processes and are located in various cellular components. Thus, to assess the functional similarity between gene products (within a particular GO category) it is necessary to compare sets of terms rather than single terms. Several strategies have been proposed for this, which we have divided into two categories: pairwise and groupwise approaches, as shown in Gene products can be annotated with several GO terms within each of the three GO categories. Gene product function is often described by several all pairs technique), while others consider only the best-matching pair for each term (best pairs technique). A global functional similarity score between the gene products is obtained by combining these pairwise semantic similarities, with the most common combination approaches being the average, the maximum, and the sum.Pairwise approaches measure functional similarity between two gene products by combining the semantic similarities between their terms. Each gene product is represented by its set of direct annotations, and semantic similarity is calculated between terms in one set and terms in the other (using one of the approaches described previously for comparing terms). Some approaches consider every pairwise combination of terms from the two sets . Functional similarity can be calculated either using graph matching techniques or, because these are computationally intensive, by considering the subgraphs as sets of terms and applying set similarity techniques.In vector approaches a gene product is represented in vector space, with each term corresponding to a dimension, and functional similarity is calculated using vector similarity measures. Vectors can be binary, with each dimension denoting presence or absence of the term in the set of annotations of a given gene product, or scalar, with each dimension representing a given property of the term .Since the first application of semantic similarity in biology, by Lord et al. The most common semantic similarity measures used with GO have been Resnik's, Lin's, and Jiang and Conrath's, which are node-based measures relying on IC While this measure is effective in determining the information shared by two terms, it does not consider how distant the terms are from their common ancestor. To take that distance into account, Lin's and Jiang and Conrath's measures relate the IC of the MICA to the IC of the terms being compared:However, being relative measures, To overcome this limitation, Schlicker et al. A constraint all of these measures share is that they look only at a single common ancestor (the MICA) despite the fact that GO terms can have several DCA. To avoid this, Couto et al. Bodenreider et al. Riensche et al. used coannotation data to map terms between different GO categories and calculate a weighting factor, which can then be applied to a standard node-based semantic similarity measure \u03b4 is the length in number of edges of the longest distance between term c1 and term c2. This measure was first applied to GO by Yu et al. Within the edge-based approaches, Pekar and Staab proposed a measure based on the length of the longest path between two terms' lowest common ancestor and the root (maximum common ancestor depth), and on the length of the longest path between each of the terms and that common ancestor Cheng et al. also proposed a maximum common ancestor depth measure, but weighted each edge to reflect depth molecular function terms is first derived from their co-occurrence in the same set of Interpro entries, and semantic similarity between two terms is calculated from the height of their lowest common ancestor in this \u201cFunctional Tree\u201d rather than in the GO graph. With this approach, the authors intend to reveal natural biological links between the terms.A distinct approach was proposed by Pozo et al. c1 and its ancestor ac, the authors define the semantic contribution of ac to c1, as the product of all edge weights in the \u201cbest\u201d path from ac to c1, where the \u201cbest\u201d path is the one that maximizes the product. Semantic similarity between two terms is then calculated by summing the semantic contributions of all common ancestors to each of the terms and dividing by the total semantic contribution of each term's ancestors to that term. Othman et al. proposed a hybrid distance measure in which each edge is weighted by node depth, node link density, and difference in IC between the nodes linked by that edge Wang et al. Several measures for calculating the functional similarity between gene products have also been developed, as shown in molecular function and biological process aspects of GO The most common methods of measuring gene product functional similarity have been pairwise approaches based on node-based term measures, namely, Resnik's, Lin's, and Jiang and Conrath's. Lord et al. were the first to apply these measures, using the average of all pairwise similarities as the combination strategy Pairwise approaches have also been applied to edge-based measures: Wang et al. and Pozo et al. used a best-match average combination strategy with their measures A with terms t1 and t2 will be considered 100% similar to a gene product B with terms t1 and t3 under the maximum approach, which obviously does not reflect the differences between the gene products. As for the average approach, because it makes an all-against-all comparison of the terms of two gene products, it will produce counterintuitive results for gene products that have several distinct functional aspects. For instance, two gene products, A and B, that share the same two unrelated terms, t1 and t2, will be 50% similar under the average approach, because similarity will be calculated between both the matching and the opposite terms of the two gene products. The best-match average approach provides a good balance between the maximum and average approaches by considering all terms but only the most significant matching.Of the several combination strategies employed in pairwise measures, the best-match average variants are the best overall. The maximum approach can answer the question of whether two gene products share a functional aspect, but is unsuitable to assess their global similarity, as it is indifferent to the number of functional aspects they share and to the number of functional aspects in which they differ. For instance, a gene product Purely set-based approaches are not common, because few measures consider only direct annotations, but many graph-based approaches use set similarity techniques to simplify the problem of graph matching. The first graph-based measure to be applied to GO was that of Lee et al. Based also on the Jaccard index, Pesquita et al. have proposed the simGIC measure, in which each GO term is weighted by its IC Ye et al. proposed a normalized version of simLP that takes into account the minimum and maximum depths within each GO category Cho et al. developed a simpler groupwise approach, in which the semantic similarity between two gene products is given by the information content of the most informative term they share part_of relation, if its number of annotations is smaller than its child's, to comply with the logic that if the part exists, necessarily the whole does too.Other graph-based measures consider the probability of a gene product being annotated with a particular set of terms (annotation set probability). Lin et al. calculate the similarity between two gene product subgraphs as the frequency of occurrence of the graph resulting from the intersection of both subgraphs, that is, the frequency of gene products whose annotation subgraph contains the intersect graph As for vector-based approaches, Huang et al. developed a gene product similarity measure based on annotation profiles that includes GO terms as well as many other derived from varied sources for the tool DAVID Chabalier et al. also consider gene products as a vector of all GO terms, but weight them according to their IC. Semantic similarity is then calculated through the cosine similarity algorithm, which is commonly used to measure document similarity in information retrieval Given the variety of approaches and measures for semantic similarity, a fundamental question arises: How well does each measure capture the similarity in function between two gene products?Addressing this question is not trivial, because there is no direct way to ascertain the true functional similarity between two gene products. If there were, there would be no need to apply semantic similarity in the first place. However, there are independent properties, such as sequence similarity or coexpression data, that can be used as measures of similarity at different levels, and by correlating semantic similarity with such properties it is feasible to assess how well a given measure captures the similarity between gene products.The choice of how to evaluate measures is still a subject of debate, because no gold standard and few global comparative studies exist. Furthermore, most authors test only a few measures of interest for their particular applications. The first assessment study was done by Lord et al., who tested Resnik's, Lin's, and Jiang and Conrath's measures against sequence similarity using the average combination approach Later, Wang et al. tested the same measures against gene coexpression data, also using linear correlation. Although a high correlation was found, no conclusion was drawn about the relative performance of the measures Sevilla et al. also used gene coexpression data, but tested these measures with the maximum combination approach rather than the average. In agreement with Lord et al., they found Resnik's measure to perform best, and found the biological process aspect to have the highest correlation with gene coexpression. This result was far from unexpected, since genes with similar expression patterns are likely to be involved in the same biological processes Couto et al. tested the GraSM variation of these measures using a best-match average combination strategy, correlating sequence similarity with the number of Pfam families shared. They found the highest correlation with Jiang and Conrath's measure and the biological process aspect Schlicker et al. compared their measure with Resnik's measure by viewing the distribution of sequence similarity over semantic similarity, considering discrete levels. They found their measure to perform best, particularly in distinguishing orthologous gene products from gene products with other levels of sequence similarity, for both molecular function and biological process aspects Lei et al. tested several semantic similarity measures in an application for predicting subnuclear location, using the multi-class classification results (Matthews correlation coefficient) as an evaluation criterion Guo et al. evaluated simUI, simLP, Resnik's, Lin's, and Jiang and Conrath's measures on their ability to characterize human regulatory pathways. They concluded that the pairwise approaches tested performed better than groupwise approaches, with Resnik's measure being the best performing overall Wang et al. tested their measure against Resnik's by clustering gene pairs according to their semantic similarity and comparing the resulting clusters with a human perspective. They showed that their measure produced results closer to human expectations Recently, Pesquita et al. have done an evaluation of semantic similarity measures by modeling their behavior as function of sequence similarity. These authors compared Resnik's, Lin's, and Jiang and Conrath's measures, using several combination strategies, and also the groupwise measures simUI and simGIC, showing that the relationship between semantic similarity and sequence similarity is not linear for any of these measures. They found that the average and maximum combination strategies produce worse results than the best-match average and, consistent with Lord's and Sevilla's results, found that Resnik's measure performs better than the other two term-based measures. Overall the best measure for gene product similarity was shown to be simGIC, slightly surpassing Resnik's measure using the \u201cpairwise-best pairs-average\u201d approach in resolution Saccharomyces cerevisiae as the standard Xu et. al have also conducted an evaluation study using protein\u2013protein interactions and gene expression datasets of Mistry et al. evaluated eleven measures: Resnik, Lin, and Jiang and Conrath with both the average and maximum approaches; three vector-based measures ; and TO and NTO. They investigated the correlation between measures and the correlation with sequence similarity. They found a good correlation between TO and Resnik's maximum and average. These three measures also correlated well to sequence similarity, with TO presenting the highest correlation.What we can draw from these studies is that there is no clear best measure for comparing terms or gene products. Different measures have performed differently under different circumstances, and a given measure can be well suited for a specific task but perform poorly in another. For instance, simUI was found by Guo et al. to be the weakest measure when evaluated for its ability to characterize human regulatory pathways, while Pesquita et al. found it to be fairly good when evaluated against sequence similarity. However, one result has been obtained consistently: pairwise measures using Resnik's term similarity outperform Lin's and Jiang & Conrath's methods in all studies except family similarity.There is also no clear best strategy for evaluating GO-based semantic similarity measures; there are arguments for and against most of the strategies employed. For instance, sequence similarity is well known to be related to functional similarity, but it is just as well known that there are gene products with similar sequences but distinct functions and vice-versa. Another example are Pfam families, which are related to global functional aspects of gene products, but will likely not be suitable to compare with detailed GO annotations.The rise in number of semantic similarity measures was accompanied by the development of tools to calculate them. Currently available tools fall into three categories: Web tools, standalone tools, or R packages see .http://xldb.fc.ul.pt/rebil/ssm) http://burgundy.cmmt.ubc.ca/GOToolBox) http://xldb.fc.ul.pt/biotools/proteinon) http://funsimmat.bioinf.mpi-inf.mpg.de) http://bioinformatics.clemson.edu/G-SESAME) Web tools, such as FuSSiMeG (http://gauss.dbb.georgetown.edu/liblab/dyngo.html) Standalone applications, such as DynGO (http://www.bioconductor.org/packages/2.2/bioc/html/SemSim.html) and GOvis (http://bioconductor.org/packages/2.3/bioc/html/GOstats.html) are part of the Bioconductor project, which comprises many R packages for bioinformatics and biostatistics applications. A more recent R based package for semantic similarity, csbl.go (http://csbi.ltdk.helsinki.fi/csbl.go/) The R packages SemSim . Most of the tools mentioned above also provide other types of services and information, such as protein interactions (ProteInOn), GO graph visualization , GO browsing (DynGO), and clustering .The application of semantic similarity allows gene products to be compared at different levels. This section presents several scenarios in which GO-based semantic similarity measures have been successfully applied.molecular function), the cellular and supracellular processes in which they are involved , and their cellular or extracellular location (cellular component). Comparing the molecular function aspect, we can measure the functional similarity between gene products and gain insight into function-related characteristics such as domains and active sites. The biological process aspect can be related to protein interaction, both physical and indirect (involved in the same process network), and thus can be used to predict them and to analyze coexpression data. The cellular component aspect can be linked to colocalization and in that context be used to validate physical interaction and localization-dependent functions and processes. Overall, GO-based semantic similarity measures have been applied mainly for validating and predicting functions and interactions, and for analyzing transcriptomics and proteomics data.For instance, GO-based semantic similarity can be used to compare gene products by their biochemical function , variable depth (terms at the same level have different levels of detail), and variable node density (some areas of the ontology have a greater density of terms than others). These are due to the irregular nature of biomedical knowledge and our limited understanding of it, and should be taken into account by semantic similarity measures, particularly edge-based measures, which are sensible to these issues. There are also problems with the use of annotated corpora in node-based measures, because these are biased by biomedical research interests (since terms related to subjects of research focus are expected to be more frequently annotated than other terms) and limited by current experimental techniques . Despite these issues, the use of IC on semantic similarity measures still makes sense probabilistically, if not always semantically, because commonly used terms are more likely to be shared by gene products than uncommonly used terms.IEA) indicates the annotation was inferred electronically  and not manually curated. Whether IEA annotations should be used or disregarded for semantic similarity is still a subject of open debate, because using them entails a loss of precision but not using them entails a loss of coverage  will have an impact in the IC values calculated for the terms, preventing their comparison. It is also important to stress that only results obtained with the same versions of GO's ontology and annotation data are comparable, since changes to both the ontologies and the annotations made with them affects semantic similarity .Another issue particular to GO is that not all annotations are equal, because evidence codes show the type of evidence that supports the annotation. While most evidence codes symbolize experimental methods and the corresponding annotations are manually curated, the most prevalent evidence code (ISS and IEA) to calculate the IC leads to data circularity, as there is direct dependency between both data sources. The same is true for the use of annotations inferred by physical interaction (IPI) when a measure is evaluated by correlation with protein-protein interactions, and other similar cases. To minimize the effect of data circularity, evaluation studies should  remove annotations based on evidence of the same nature as the data used to evaluate the measures.An important issue in the evaluation of semantic similarity measures based on the IC is that of data circularity between the data used to evaluate the measures and the GO annotations. For instance, if a given measure is evaluated by correlation with sequence similarity, then using annotations based on sequence similarity . These will give a measure of how similar two gene products are at their most similar aspect. For comparing multiple aspects, the best measures are \u201cpairwise\u2013best pairs\u2013average\u201d or groupwise approaches, since they allow for the comparison of several terms. However, depending on the level of detail desired, \u201cpairwise\u2013best pairs\u2013average\u201d or \u201cgroupwise\u2013set\u201d should be used for a higher degree of specificity (since only direct annotations are used) and \u201cgroupwise\u2013vector\u201d or graph for a more generalized similarity . To further minimize the relevance of specificity, unweighted graph or vector measures can be employed, so that high-level GO terms are not considered less relevant.However, having to analyze the dataset before deciding which measure to use can be cumbersome to researchers who just need a \u201cquick and dirty\u201d semantic similarity calculation. In this case, researchers should resort to one of the several semantic similarity tools available and use their good judgment in analyzing the results. Most semantic similarity measures proposed so far have shown fair if not good results, and for less detailed analyses any one of them can give a good overview of the similarities between gene products.Over the last decade, ontologies have become an increasingly important component of biomedical research studies, because they provide the formalism, objectivity, and common terminology necessary for researchers to describe their results in a way that can be easily shared and reused by both humans and computers. One benefit of the use of ontologies is that concepts, and entities annotated with those concepts, can be objectively compared through the use of semantic similarity measures. Although the use of semantic similarity in the biomedical field is recent, there is already a wide variety of measures available that can be classified according to the approach they use.There are two main semantic similarity approaches for comparing concepts: edge-based, which rely on the structure of the ontology; and node-based, which rely on the terms themselves, using information content to quantify their semantic meaning. Node-based measures are typically more reliable in the biomedical field because most edge-based measures assume that all relationships in an ontology are either equidistant or have a distance as function of the depth, neither of which is true for existing biomedical ontologies.Because biomedical entities are often annotated with several concepts, semantic similarity measures for comparing entities need to rely on sets of concepts rather than single concepts. There are two main approaches for this comparison: pairwise, in which entities are represented as lists of concepts that are then compared individually; and groupwise, in which the annotation graphs of each entity are compared as a whole.Several studies have been conducted to assess the performance of different similarity measures, by correlating semantic similarity with biological properties such as sequence similarity, or other classification schemas such as Pfam. Most measures were shown to perform well, but as few comprehensive studies have been conducted, it is difficult to draw any conclusion about which measure is best for any given goal.Until now, most research efforts in this area developed novel measures or adapted preexisting ones to biomedical ontologies, with most novel measures sporting an increased complexity compared to previous ones. This increased complexity is mainly a result of more recent measures combining several strategies to arrive at a final score. Although the need for improved measures is unquestionable, this trend fails to answer the most pressing community needs: (1) easy application to both small and large datasets, which would be best achieved by developing tools that are at once easy to use and powerful; and (2) elucidation of which measure is better fitted to the researcher's needs, which would imply comparative studies of all existing measures and approaches.Although important efforts in these two areas have already been made, semantic similarity is still far from reaching the status of other gene product similarities, such as sequence-based ones, in which fast and reliable algorithms coupled with the development of ever-growing databases has made them the cornerstone of present day molecular biology. One important step forward would be the development of a gold standard for gene product function that would allow the effective comparison of semantic similarity measures. Nevertheless, semantic similarity is not restricted to gene products and it can be expected that, as more biomedical ontologies are developed and used, these measures will soon be applied to different scenarios. It is then crucial that bioinformaticians focus on strategies to make semantic similarity a practical, useful, and meaningful approach to biological questions."}
{"text": "In several neuropathological conditions, microglia can become overactivated and cause neurotoxicity by initiating neuronal damage in response to pro-inflammatory stimuli. Our previous studies have shown that exposure to electromagnetic fields (EMF) activates cultured microglia to produce tumor necrosis factor (TNF)-\u03b1 and nitric oxide (NO) through signal transduction involving the activator of transcription STAT3. Here, we investigated the role of STAT3 signaling in EMF-induced microglial activation and pro-in\ufb02ammatory responses in more detail than the previous study.N9 microglial cells were treated with EMF exposure or a sham treatment, with or without pretreatment with an inhibitor  of the Janus family of tyrosine kinases (JAK). The activation state of microglia was assessed via immunoreaction using the microglial marker CD11b. Levels of inducible nitric oxide synthase (iNOS), TNF-\u03b1 and NO were measured using real-time reverse transcription-polymerase chain reaction (RT-PCR), enzyme-linked immunosorbent assay (ELISA) and the nitrate reductase method. Activation of JAKs and STAT3 proteins was evaluated by western blotting for specific tyrosine phosphorylation. The ability of STAT3 to bind to DNA was detected with an electrophoresis mobility shift assay (EMSA).EMF was found to significantly induce phosphorylation of JAK2 and STAT3, and DNA-binding ability of STAT3 in N9 microglia. In addition, EMF dramatically increased the expression of CD11b, TNF-\u03b1 and iNOS, and the production of NO. P6 strongly suppressed the phosphorylation of JAK2 and STAT3 and diminished STAT3 activity in EMF-stimulated microglia. Interestingly, expression of CD11b as well as gene expression and production of TNF-\u03b1 and iNOS were suppressed by P6 at 12 h, but not at 3 h, after EMF exposure.EMF exposure directly triggers initial activation of microglia and produces a significant pro-inflammatory response. Our findings confirm that the JAK2-STAT3 pathway may not mediate this initial microglial activation but does promote pro-inflammatory responses in EMF-stimulated microglial cells. Thus, the JAK2-STAT3 pathway might be a therapeutic target for reducing pro-inflammatory responses in EMF-activated microglia. In vivo animal experiments involving microglial activation, however, cannot clearly explain whether such activation is induced directly by EMF or indirectly as a consequence of neuronal injury from EMF exposure.The rapid development of society and technology has led to an unprecedented increase in the number and diversity of sources of electromagnetic fields (EMFs), including power lines, electric appliances, radio transmitters, and microwave sources. Numerous studies have investigated the effects of occupational or residential exposure to EMF, which has been identified as the fourth largest pollution hazard -7. SeverMicroglia, the resident innate immune cells in the CNS, become activated in response to certain cues, such as brain injury and immunological stimuli ,21. Actii.e., NF-\u03baB, AP-1 and C/EBP, are involved in microglial activation in vivo and in vitro : forward 5'-TAAAGACCTCTATGCCAACACAGT-3'; reverse 5'-CACGATGGAGGGGCCGGACTCATC-3'. iNOS [GenBank: 010927.2]: forward 5'-AACTGTAGCACAGCACAGGAAA-3'; reverse 5'-ACAAGATCAGGAGGGATTTCAA-3'. TNF-\u03b1 [GenBank: 013693.2]: forward 5'-GCCTATGTCTCAGCCTCTTCTC-3'; reverse 5'-GGAGGTTGACTTTCTCCTGGTA-3'. The amplification reaction was carried out in a Perkin-Elmer GeneAmp . The resulting PCR products were separated in 1.5% agarose gels and visualized with ethidium bromide staining. For semi-quantitative evaluation, densitometric analysis was performed using Quantity One software .Total RNA was isolated using Trizol  from 6-well plates according to the manufacturer's protocol. The integrity of the RNA sample was confirmed with gel electrophoresis and by reverse transcription-PCR using primers for house-keeping genes. Moloney murine leukemia virus (M-MLV) reverse transcriptase  was used to convert 1 \u03bcg of total RNA into cDNA at 42\u00b0C. The RT-PCR exponential phase was determined to be 20-32 cycles for semiquantitative comparisons. \u03b2-Actin was measured as a loading control. The amplification of cDNA was performed with the following primers: Data are presented as the mean of each treatment group \u00b1 standard deviation of the mean (SD). Statistical differences between the groups were assessed by one-way analysis of variance (ANOVA) followed by Duncan's Multiple Range test. Statistical significance was established at P < 0.05 unless otherwise indicated.It has been previously suggested that activated microglia express different proteins and surface markers. Of these, CD11b has the greatest biological significance ,64. BecaGiven the pro-inflammatory effect of EMF exposure on microglia, we measured levels of TNF-\u03b1 and iNOS, and the resulting NO production, in cell culture medium supernatants at the indicated times after EMF exposure. As shown in Figure In previous work, we have shown that activation of JAKs and STAT3 is involved in EMF-activated microglia . To furtUnder basal conditions, STATs are located in the cytoplasm; however, when these transcription factors become phosphorylated, they translocate to the nucleus within minutes . Accordii.e., the JAKs [Given the above results, we focused our studies on the upstream tyrosine kinases of the STAT3 signaling molecule, the JAKs , and perTo further assess the potential role of the JAK2-STAT3 pathway in EMF-induced activation and pro-inflammatory responses of N9 microglia, we examined whether the JAK inhibitor P6 could affect EMF-induced increase of TNF-\u03b1, iNOS and NO, and the initial activation of microglia. Western blot analysis and EMSA experiments show that P6 preconditioning completely blocks activation of JAK2 and STAT3 at 3 and 12 h after EMF exposure Figure  &5. Our In the present study, we observed N9 microglial activation and pro-inflammatory responses after EMF exposure. We found that the JAK2-STAT3 pathway is activated in EMF-stimulated N9 microglial cells. The activation of microglia and the secretion of pro-inflammatory factors were significantly reduced by P6 treatment at 12 h after EMF exposure, while P6 preconditioning did not inhibit the above processes at 3 h post exposure. Our data suggest that the JAK2-STAT3 pathway may play a pivotal role in the pro-inflammatory response but not in the initial activation of microglia after EMF exposure.in vitro model exposing N9 cells to 2.45 GHz using a waveguide system that simulates occupational or residential exposure, at a specific absorption rate (SAR) of 6 W/kg. This result suggests that EMF may potentially affect microglial activation. Our data are consistent with earlier findings demonstrating increased glial reactivity in a model using about 900 MHz from a global system for mobile communication, at a high SAR of 6 W/kg [It has been reported that increased CD11b expression corresponds to extent of microglial activation ,64,68. Hf 6 W/kg ,18,69. Of 6 W/kg -72. Takef 6 W/kg , could pMicroglia are known to be exquisite sensors of even minor pathological changes in the CNS ,61. TheyIt is well known that microglia monitor the external environment  and respTo investigate the potential function of the JAK-STAT pathway in EMF-activated microglia, we next examined whether the JAK inhibitor P6 could affect the EMF-induced increases of TNF-\u03b1, iNOS, NO and CD11b. P6 can effectively block the activation of JAK1, JAK2 and STAT3 ,88. Our et al.[et al. [Most previous studies have shown that the JAK-STAT signaling pathway is involved in microglial activation -55. In oet al. reported.[et al.  reportedet al. [et al. [It has been demonstrated that activated microglia secrete a diverse range of pro-inflammatory and neurotoxic factors such as superoxide, TNF-\u03b1, interleukin (IL)-1\u03b2, IL-6 and NO . The cytet al.  reported [et al.  indicateWe studied the effects of EMF exposure on cultured N9 microglial cells and demonstrate that an initial activation of microglia is induced by EMF exposure. In addition, many other physical factors such as infrasound exposure, irradiation, heat shock treatment and hyperthermia, can stimulate activation and pro-inflammatory reactions of microglia -100. TheOur results strongly suggest that external electromagnetic emission as a physical stimulation directly triggers an initial activation of microglia and produces significant pro-inflammatory responses. Activation of JAK2-STAT3 signaling occurs in parallel with the microglial activation and the release of pro-inflammatory factors. Microglial activation and pro-inflammatory responses are significantly reduced by P6 at 12 h, but not at 3 h, after EMF exposure. These results suggest that the JAK2-STAT3 pathway may not mediate the initial microglial activation, but does promote pro-inflammatory responses in EMF-stimulated microglial cells. Our results provide a basis to determine whether the pro-inflammatory responses of EMF-stimulated microglia can be suppressed by inhibition of the JAK2-STAT3 pathway in therapeutic interventions.EMF: Electromagnetic fields; NO: nitric oxide; TNF-\u03b1: tumor necrosis factor-\u03b1; JAK-STAT: Janus kinase-signal transducers and activators of transcription; iNOS: inducible NO synthase; P6: Pyridone 6; FACS: fluorescence activated cell sorting; EMSA: electrophoresis mobility shift assay; ELISA: enzyme-linked immunosorbent assay.The authors declare that they have no competing interests.This study is based on an original idea of XSY. XSY and GLH wrote the manuscript. XSY and MQL carried out the FACS and confocal double-label immunofluorescence assays. GLH, YTH, CHC carried out the RT-PCR, western blotting and EMSA assays. YW carried out some mediator assays. GBZ provided EMF exposure system. All authors have read and approved the final manuscript."}
{"text": "To apply a scaled, preference-based measure to the evaluation of health-related quality of life (HRQoL) in Parkinson's disease (PD); to evaluate the relationship between disease-specific rating scales and estimated HRQoL; and to identify predictors of diminished HRQoL.Scaled, preference-based measures of HRQoL (\"utilities\") serve as indices of impact of disease, and can be used to generate quality-adjusted estimates of survival for health-economic evaluations. Evaluation of utilities for PD and their correlation with standard rating scales have been limited.Utilities were generated using the Health Utilities Index Mark III (HUI-III) on consecutive patients attending a PD Clinic between October 2003 and June 2006. Disease severity, medical, surgical ), and demographic information were used as model covariates. Predictors of HUI-III utility scores were evaluated using the Wilxocon rank-sum test and linear regression models.2 = 0.56, P < 0.001) was highly predictive of HRQoL. UPDRS-III was a weaker, but still significant, predictor of utility scores, even after adjustment for UPDRS-II (P = 0.01).68 men with a diagnosis of PD and a mean age of 74.0 (SD 7.4) were included in the data analysis. Mean HUI-III utility at first visit was 0.45 (SD 0.33). In multivariable models, UPDRS-II score (rPoor self-care in PD reflected by worsening UPDRS-II scores is strongly correlated with low generic HRQoL. HUI-III-based health utilities display convergent validity with the UPDRS-II. These findings highlight the importance of measures of independence as determinants of HRQoL in PD, and will facilitate the utilization of existing UPDRS data into economic analyses of PD therapies. Parkinson's disease (PD) is a chronic neurodegenerative illness that results from progressive cell death affecting movement, mood, cognition and autonomic function . The preThe precise effect of optimal PD treatment on life expectancy is unclear, but living with this chronic degenerative illness is thought to have a profound negative impact on health-related quality of life (HRQoL) due to both disease manifestations, and the adverse effects of medical and surgical management strategies -9. As suThe Unified Parkinson Disease Rating Scale (UPDRS) consists of assessments in 4 domains including, mood and cognition (UPDRS I), activities of daily living (UPDRS II), motor symptom severity (UPDRS III) and complications of treatment (UPDRS IV) ; it is tGiven the increasing awareness of HRQoL as an important end-point that may not correlate directly with physical disability, there has been a growing literature documenting the predictors of low HRQoL in PD -17. HoweThe study population consisted of individuals attending the Philadelphia Veterans Administration Parkinson's Disease Research, Education and Clinical Center (PADRECC) between October 2003 and June 2006 with an ICD-9 diagnosis of Parkinsonism or PD. The PADRECC is a multidisciplinary center providing subspecialty care to veterans with PD and other movement disorders and serves a catchments area that covers Pennsylvania, New England and the Mid-Atlantic States. The population of veterans receiving medical care through the Veterans Administration healthcare system in this area is 998,061, of whom approximately 5303 have diagnosed PD. Individuals from this cohort are referred to PADRECC for expert guidance on disease management. Charts of all patients attending the PADRECC during the study period were reviewed. As this was a longitudinal prospective cohort study with respect to the outcome of interest (HUI-III), only individuals with at least 2 completed HUI-III questionnaires (from 2 separate visits) were eligible for inclusion. Review of the diagnosis of parkinsonism was further scrutinized and only individuals fulfilling United Kingdom Brain Bank Criteria  for idioHealth utilities are scaled, preference-based generic measures of health-related quality of life that lie on a zero-to-one scale, with a utility of 1 equivalent to perfect health, and 0, equivalent to death. . While utilities can be elicited using \"standard-gamble\" or \"time-tradeoff\" methods, these are intellectually rigorous, and may be upsetting to study subjects . The useP < 0.15 level were considered candidate covariates in multivariable regression models. Multivariable models were constructed using a stepwise selection algorithm, with covariates retained for P < 0.15 [We performed both cross-sectional analyses on baseline data collected for the study cohort, and longitudinal analyses in which we evaluated change in utility scores over time. Baseline HUI-III-based utility scores were evaluated for the cohort as a whole using descriptive statistics. The relationships between UPDRS scores and raw and log-transformed HUI-III utilities were assessed graphically. We evaluated the association between baseline patient characteristics (including PD severity) and baseline HUI-III scores through construction of bi-variable least-squares regression models, with standard errors adjusted to account for multiple measurements on some study subjects. Characteristics that were associated with HUI-III scores at the P < 0.15 . We creaP < 0.15 . Interacand UPDRS scores were available, we further explored the relationship between change in HUI-III scores and UPRDS III scores using the approach of Fitzpatrick et al. [Longitudinal changes over time in HUI-III scores, and UPDRS scores, were evaluated using repeated-measures ANOVA. For the subset of individuals (N = 20) for whom repeated HUI-III k et al. , with caWe screened 156 consecutive patients assessed for parkinsonism in our clinic over the study period. Of these 88 (57%) had more than 1 evaluation of health-related quality of life, and so were included in the study. Of these individuals, 20 had parkinsonism but did not meet Brain Bank criteria for PD; among excluded individuals six were diagnosed with likely vascular parkinsonism; eight were excluded based on atypical features not suggestive of idiopathic Parkinson's disease, two each were excluded based on diagnoses of multisystem atrophy and suspected diffuse Lewy body dementia, and one each was excluded based on diagnoses of fronto-temporal dementia, and progressive supranuclear palsy.Baseline patient characteristics are outlined in Additional File Comorbid medical conditions identified in the cohort included coronary artery disease, stroke, arthritis and diabetes mellitus. On average subjects had disease duration of 8 years at the time of the first recorded visit, with moderate disease severity (reflected by an average UPDRS III score of 30 and H+Y score of 2.8). Mean dosage of anti-parkinsonian medications, expressed as levodopa equivalent dose (LED) [The average value for baseline HUI-derived utility weights was 0.42 range -0.15 to 1.0). In univariable regression models, stroke was significantly associated with reduced HUI-derived utility weights; borderline significant associations were seen with diabetes and marital status  and S+E scores were independent predictors of HRQoL; increased disease duration was associated with The average time interval between first and last assessment in the cohort was 6.6 months (SD 4.9). The mean reduction in HUI-III utilities between first and last assessment was 0.014 (SD 0.25); 34 individuals (50%) experienced a net reduction in utility, 33 (49%) experienced a gain in utility, and 1 (1%) had no change in health utility. When utilities were analyzed using repeated measures ANOVA, there was no reduction in utility scores with succeeding visits (P = 0.67). Significant changes were identified in Schwab and England scores (P = 0.02), but not in UPDRS-III scores (P = 0.66) or Hoehn and Yahr scores (0.11) using a similar approach. Repeated measurements of UPDRS-II scores were obtained in only 20 of 68 subjects; there was no significant change over time in these scores (0.50).Notwithstanding the small number of individuals with both repeated HUI-III and UPDRS measurements, significant Spearman correlations were identified between changes in HUI-III scores  and rescaled change in UPDRS-III scores , Schwab and England scores , and Hoehn and Yahr scores . The largest correlation coefficient was observed for rescaled change in UPDRS-II scores, though because of the small numbers of individuals with repeated UPDRS-II measurement this was not statistically significant . In a multivariable regression model, changes in HUI-III utilities were predicted only by changes in UPDRS-III scores  and time between first and last evaluation .Although Parkinson's disease is most prominently identified with physical symptoms such as tremors and akinesia, this disease has a substantial impact beyond motor impairment and physical disability with an on overall reduction in all health-related quality of life dimensions including social and emotional well-being. To date, the relatively limited application of existing tools for the measurement of health-related quality of life (HRQoL) has made it difficult to compare the loss of HRQoL in PD to that experienced by individuals with other chronic conditions . Using aWe are aware of at least one other prior effort to map health utilities onto UPDRS scores ; SiderowIn comparison to the Siderowf study, our study further refined the relationship between health utilities and UPDRS scores. Perhaps surprisingly, we found that these reductions were most strongly correlated with the self-care component of the UPDRS (UPDRS-II), rather than the UPDRS-III motor sub-score. This finding serves as an important reminder that loss of independence may be an important source of morbidity in individuals with PD. As we demonstrated in regression analyses Figure , the corOther important predictors of low baseline HRQoL in this study included reductions in S+E disability scores, and higher axial sub-scores (PIGD). Though health-related quality of life and self-care ability in PD are inextricably linked to severity of motor dysfunction, the relationship between motor impairment and reduction in health-related quality of life may be complex and indirect, as demonstrated by our failure to find an independent relationship between UPDRS motor III sub-scores and HUI, after controlling for UPDRS-II and other scores. These results are consistent with previous findings that motor impairment in and of itself does not reduce health-related quality of life but the functional consequences of poor motor function including loss of self-care capabilities, inability to ambulate and loss of independence and its emotional consequences that may provide the link between physical impairment and low HRQoL ,35.We failed to find an association between either cognitive impairment or evidence of depression and low HRQoL, similar to one other study . HoweverSix prior longitudinal studies have evaluated HRQoL in PD. The first, based on a community-based cohort, found no relationship between any baseline clinical characteristics and reduction in HRQoL . AnotherForsaa et al.  prospectMarras et al. also evaluated predictors of diminished HRQoL  using a Health utility estimates and most indices of PD severity were relatively stable over the course of our study, which may reflect the relatively short duration of study, and perhaps also the fact that notwithstanding the decline in status expected with a degenerative disease like PD, at least some subjects may have experienced improved health-related quality of life as a result of optimized medical management following referral to the PADRECC. Changes in utility were correlated with changes in multiple PD-specific measures, though our ability to document relationships between changes in health-related quality of life and changes in UPDRS-II scores were limited by the fact that repeated UPDRS-II scores were available in only a small subset of subjects.This study had several important limitations. Our failure to identify a link between depression and low HRQoL contrasts with the results of other studies ,38-45 anOther limitations of this study relate to the generalizability of findings in a cohort of male U.S. veterans: our findings may not be generalizable to non-veterans or to women, as they were not represented in our cohort. Previous epidemiological surveys have suggested gender differences in PD; Men have been described to have earlier symptom onset , increasIn conclusion, we sought to evaluate health-related quality of life in PD using a \"health utilities index\" approach, and to assess the relationship between health utility scores and PD severity as measured using standard disease-specific tools. In cross-sectional analyses, we identified ADL-related components of the UPDRS as most closely linked to health-related quality of life, a finding that underscores the fact that PD manifests in dimensions aside from movement and motor control. Our findings, although preliminary, may pave the way for translation of PD-specific measures of disease severity into health utility scores, particularly if our findings can be replicated and externally validated in other populations and by other investigators.GKF was responsible for study conception, development of the study protocol, data collection and analysis. She wrote the first draft of the manuscript and revised the manuscript for important intellectual content. MBS was responsible for study conception, contributed to the development of the study protocol, and revised the manuscript for important intellectual content. DNF contributed to development of the study protocol, and data analysis, and revised the manuscript for important intellectual content. All authors have seen and approved the final manuscript draft.The authors declare that they have no competing interests. GFK had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysisTable S1: Characteristics of PD patients at the Philadelphia PADRECC at First Visit and Relationship with Health-Related Quality of Life in Univariable Regression ModelsClick here for file"}
{"text": "One particularly exciting field of research involves the use of gold nanoparticles (GNPs) in the detection and treatment of cancer cells in the liver. The detection and treatment of cancer is an area in which the light absorption and emission characteristics of GNPs have become useful. Currently, there are no data available regarding the fluorescence spectra or in vivo accumulation of nanoparticles (NPs) in rat liver after repeated administration. In an attempt to characterise the potential toxicity or hazards of GNPs in therapeutic or diagnostic use, the present study measured fluorescence spectra, bioaccumulation and toxic effects of GNPs at 3 and 7 days following intraperitoneal administration of a 50 \u03bcl/day dose of 10, 20 or 50 nm GNPs in rats.The experimental rats were divided into one normal group (Ng) and six experimental groups . A 50 \u03bcl dose of GNPs (0.1% Au by volume) was administered to the animals via intraperitoneal injection, and fluorescence measurements were used to identify the toxicity and tissue distribution of GNPs in vivo. Seventy healthy male Wistar-Kyoto rats were exposed to GNPs, and tissue distribution and toxicity were evaluated after 3 or 7 days of repeated exposure.After administration of 10 and 20 nm GNPs into the experimental rats, two fluorescence peaks were observed at 438 nm and 487 nm in the digested liver tissue. The fluorescence intensity for 10 and 20 nm GNPs (both first and second peaks) increased with the infusion time of GNPs in test rats compared to normal rats. The position of the first peak was similar for G1A, G2A, G1B, G2B, G3B and the normal (438 nm); that for G3A was shifted to a longer wavelength (444 nm) compared to the normal. The position of the second peak was similar for G1A, G1B, G2A, G2B and the control (487 nm), while it was shifted to a shorter wavelength for G3A (483 nm) and G3B (483 nm). The fluorescence intensity of the first and second peaks increased for G1A, G2A, G1B and G2B, while it decreased for G3A and G3B compared to the control.The fluorescence intensity of GNPs varied with the number, size and shape of particles and with the ratio of surface area to volume in a given sample. Fluorescence intensity changes during infusion depended on the size and shape of GNPs, with smaller particles experiencing larger changes during the infusion time in addition to the quenching produced by the larger GNPs. It is likely that smaller particles, which have a much higher ratio of surface area to volume compared to larger particles, are more prone to aggregation and surface interaction with biological components. This study suggests that fluorescence intensity can be used to evaluate bioaccumulation and the toxicity of gold nanoparticles in rats. Nanoparticles (NPs) offer great promise for biomedical applications, particularly in pharmaceutical delivery and novel diagnostic and therapeutic methods .Despite the many potential therapeutic benefits of nanoparticles, some studies indicate that certain nanoparticles, due to their small size and unique physical properties, may cause adverse effects ,3. The sThe small size of NPs may enable interactions with specific biological targets. Furthermore, metallic NPs can be made to exhibit a resonant response to a time-dependent magnetic field, producing a potentially useful energy transfer to the particles ,6. ThereGold NPs (GNPs) show several features that make them well suited for biomedical applications, including straightforward synthesis, stability, and the potential for surface modification with active biological molecules such as peptides or proteins .Semmler-Behnke et al. observed that a considerable percentage of 18 nm GNPs is removed from the blood and trapped predominantly in the liver and spleen .Fluorescence is the emission of light by a substance following absorption of light or other electromagnetic radiation of a different wavelength. In most cases, the emitted light has a longer wavelength, and therefore lower energy, than the absorbed radiation. However, when the absorbed electromagnetic radiation is intense, it is possible for one molecule to absorb two photons; this two-photon absorption can lead to emission of radiation having a shorter wavelength than the absorbed radiation.The origin of the unique optical properties of GNPs is a phenomenon known as surface plasmon resonance (SPR). The exposure of nanoparticles to electromagnetic radiation of a wavelength much smaller than the GNP diameter induces coherent, resonant oscillations of the conduction-band electrons across the nanoparticles. These oscillations are known as the SPR, which lies in the visible frequency range and results in strong optical absorbance and scattering by the GNPs ,12. ThisDespite these many useful applications of NPs, numerous studies have shown that exposure to smaller-sized particles produces greater inflammatory and cytotoxic responses compared to exposures to larger-sized particles at the same mass concentration . It is bThe toxicity of NPs is thought to depend on the size, surface area, composition, and shape of the nanomaterial. Particle size plays a role in how the body responds to, distributes, and eliminates materials ,15; it cThe particle-size-dependent organ distribution of GNPs has been studied in vivo -26. HyllGNPs can be used in various biomedical applications; however, very little is known about the size, dose and exposure dependence of in vivo nanoparticle processing kinetics. Furthermore, there are currently no data available regarding the fluorescence spectra and accumulation of nanoparticles (NPs) in rat liver following repeated in vivo administration.GNPs of different sizes  were purchased. All GNPs used in this study were in aqueous solution at a concentration of 0.01%. The mean size and morphology of these GNPs were evaluated from transmission electron microscope (TEM) images. The high electron density of gold makes this method particularly suitable for evaluating the homogeneity of the nanoparticles in terms of shape and size.Healthy male Wistar-Kyoto rats were obtained from the Laboratory Animal Centre . Rats of age 8-12 weeks (approximately 250 g body weight) were housed in pairs in humidity- and temperature-controlled ventilated cages on a 12 h day/night cycle. A conventional rodent diet and water were provided. Forty rats were individually caged and divided into a control group (NG: n = 10), group 1 , group 2  and group 3 . In addition, histological investigations of 10 rats were performed in support of this study. Doses (50 \u03bcl) of 10, 20 or 50 nm GNPs in aqueous solution were administered to the animals via intraperitoneal injection every day for 3 or 7 days. The rats were anesthetised by inhalation of 5% isoflurane until muscular tonus relaxed. Blood and liver tissue were collected from each rat. A blood sample of approximately 1 ml was obtained from each rat via venepuncture of an antecubital vein; the blood was mixed with 0.8 ml of heparin to prevent coagulation. In order to assess tissue uptake, as much blood as possible was collected from the rats to maximise residual blood drainage from the organs. All experiments were conducted in accordance with guidelines approved by the King Saud University Local Animal Care and Use Committee.3 was added. The closed reaction vessel was heated in a 130\u00b0C oven until digestion was completed. Samples were then diluted to a final volume of 20 ml with quartz-distilled water and stored in 1 oz. polyethylene bottles for subsequent fluorescence spectroscopy analysis.Liver tissue samples were wet-digested with nitric acid and stored as acidic digest solutions for analysis by fluorescence spectroscopy. The liver tissue was first freeze dried to minimise analyse loss and to facilitate subsequent sample preparation steps. The tissue was then homogenised to a fine powder by ball-milling in plastic containers. Approximately 0.20-0.25 g of powdered tissue was weighed into a Teflon reaction vessel and 3 ml of HNOFluorescence spectra of liver tissue containing GNPs of different sizes  were obtained using a FluoroMax-2 spectrofluorometer . Fluorescence measurements were made over the wavelength range 250-700 nm using 1 cm path length quartz cuvettes, which were cleaned before each use by sonicating for 5 min in deionised water and then rinsing with deionised water.The 10 and 20 nm GNPs showed spherical morphology with a narrow particle size distribution when dispersed in solution. The mean size for these GNPs was calculated from the TEM images. The mean measured size was 9.45 \u00b1 1.33 nm for 10 nm GNPs and 20.18 \u00b1 1.80 nm for 20 nm GNPs. GNPs of 50 nm diameters, in contrast, were not spherical but hexagonal in TEM images, as shown in Figure The maximum of the surface plasmon band (SPB) of GNPs in solution was shifted from 517 nm to 532 nm when the GNP size changed from 10 nm to 50 nm. This effect was attributed to the surface plasmon oscillation of free electrons. After injecting 20 nm GNPs into the experimental rats, we observed two fluorescence peaks at 438 nm and 487 nm in the digested liver tissue.Figures Figure Figures Figure Figure Figure Nanotechnology has recently emerged as a promising field for the treatment and diagnosis of a variety of diseases . GNPs arThe results of this study indicate that decreasing nanoparticle size, which produces an exponential increase in surface area relative to volume, may make the GNPs more self-reactive  and more prone to interactions with surrounding molecules . Moreover, increased uptake of nanoparticles may lead to accumulation in certain tissues, where the particles may interfere with critical biological functions ,21. We nTo evaluate the time dependence of GNP distribution and aggregation, we administered 50 \u03bcl of GNPs of  by daily intraperitoneal injection into rats for periods of 3 or 7 days. At these time points, the bio-distribution of the GNPs was quantitatively measured by fluorescence spectroscopy and TEM. The size of the GNPs strongly influenced the bio-distribution.The very small size of nanoparticles imparts physical and chemical properties that are very different from those of the same material in bulk form. Nanoparticles have a larger surface area to volume ratio compared to bulk materials; they may thus exhibit an enhanced or hindered tendency to aggregate (depending on the surface chemistry), enhanced photoemission, high electrical or heat conductivity, or improved surface catalytic activity ,21.Because nanoparticle surfaces can interact with biological components, nanoparticles may be more reactive than larger particles toward biomolecules. It has been shown, for example, that the severity and the likelihood of inflammatory response transiently increased, within 12 h, following injection of 200 or 100 nm GNPs into experimental animals. GNPs were ultimately trapped by macrophages in the spleen and liver and remained in these tissues until 4 weeks after the single injection .To evaluate the impact of particle size on tissue distribution, we injected rats with 50 \u03bcl GNPs of different sizes. The 50 nm GNPs were taken up by liver macrophages faster and to a greater extent than smaller GNPs; the particles were eliminated after uptake. This result is correlated with the inflammatory response of the liver.The present results show that 50 nm GNPs may be cleared via urine and bile rapidly. Nanoparticles for therapeutic use need to have a long retention time in order to encounter and interact with the desired target. However, a long retention time can result in toxic effects in vivo. Thus, route and rate of nanomaterial clearance is an important issue ,29.Absorbed nanoparticles in the systemic circulation can be excreted through various routes, such as the kidneys or bile. Renal clearance of solid nano-sized materials is known to be influenced by particle size and surface charge ,30. In tAll GNPs showed a propensity to accumulate in tissues following injection. The liver tissue distribution of GNPs was size dependent: the smallest particles showed the most widespread organ distribution. Smaller GNPs also showed greater accumulation in cells according to dose-metric treatment. Therefore, it should be taken into consideration that GNPs preferentially target organs with many phagocytic cells, such as kidney, spleen, lung, heart and mesenteric lymph nodes.High electron density and homogeneous shape and size make GNPs highly conspicuous in TEM images. We found that the 10 and 20 nm GNP preparations exhibit spherical morphology, while 50 nm GNPs are hexagonal.The size , shape and concentration of GNPs all contributed to differences in the fluorescence intensities between GNP samples. The time dependence of GNP fluorescence spectra was also dependent on these factors; smaller particles generally exhibited higher fluorescence that increased with GNP infusion time, whereas larger GNPs exhibited lower fluorescence decreasing with infusion time.This study suggests that fluorescence intensity may be a useful diagnostic probe for bioaccumulation and toxicity of gold nanoparticles administered to rats. Moreover, smaller particles, which have an increased ratio of surface area to volume, appear to be more reactive toward one another (resulting in aggregation) and toward biological components in the surrounding environment.The authors declare that they have no competing interests.MAKA and MMM have analyzed the data, interpreted and written the final draft of this manuscript. The animal model used in this study was obtained from the Laboratory Animal Center . MAKA has conceived the study and its design and obtained research grants for this study. Moreover, both authors have read and approved the final manuscript."}
{"text": "Advances in nanotechnology have identified promising candidates for many biological and biomedical applications. Since the properties of nanoparticles (NPs) differ from that of their bulk materials, they are being increasingly exploited for medical uses and other industrial applications. The histological and the histochemical alterations in the renal tissues due to gold nanoparticles (GNPs) have not well documented and have not yet been identified. The aim of the present study was to investigate the particle-size effect of GNPs on the renal tissue in an attempt to address their potential toxicity.A total of 70 healthy male Wistar-Kyoto rats were exposed to GNPs received 50 or 100 \u03bcl of GNPs infusion of size  to investigate particle-size effect of GNPs on the renal tissue. Animals were randomly divided into groups, 6 GNPs-treated rats groups and one control group. Groups 1, 2 and 3 received infusion of 50 \u03bcl GNPs of size 10 nm (3 or 7 days), size 20 nm (3 or 7 days) and 50 nm (3 or 7 days), respectively; while groups 4, 5 and 6 received infusion of 100 \u03bcl GNPs of size 10 nm, size 20 nm and 50 nm, respectively.The histological alterations were mainly seen in the cortex and the proximal renal convoluted tubules were more affected than the distal ones. In comparison with respective control rats, exposure to GNPs doses has produced the following renal tubular alterations: cloudy swelling and renal tubular necrosis. Interstitial alterations included: intertubular blood capillaries dilatation, intertubular hemorrhage and inflammatory cell infiltrations. The glomeruli showed moderate congestion with no hypercelluraity and mesangial proliferation or basement membrane thickening.The induced histological alterations might be an indication of injured renal tubules due to GNPs toxicity that become unable to deal with the accumulated residues resulting from metabolic and structural disturbances caused by these NPs. These alterations were size-dependent with smaller ones induced more effects and related with time exposure of GNPs. The produced histological alterations may suggest that GNPs interact with proteins and enzymes of the renal tissue interfering with the antioxidant defense mechanism and leading to reactive oxygen species (ROS) generation which in turn may induce stress in the renal cells to undergo atrophy and necrosis. More histomorphologcal investigations are needed to address the potential threat of GNPs as a therapeutic and diagnostic tool. Nanoparticles are an intermediate state of matter somewhere between bulk and molecular level. These particles have important application for cell labeling and imaging, drug delivery, biological sensors, diagnostic and therapeutic purposes mainly in cancer and photodynamic therapy -6. StudiGold in its bulk form has long been considered an inert, noble metal with some therapeutic and even medicinal value hence GNPs are thought also to be relatively non-cytotoxic . Yet theAlthough some scientists consider NPs as nontoxic, there are other studies reporting the toxic effects of NPs -16. WhilWhile nanotoxicity research is now gaining attention, little is paid to the effect of size and period of NPs mainly to their distribution and alterations in the tissue ,22. In tA total of 70 healthy male Wistar-Kyoto rats obtained from the Laboratory Animal Center . The rats nearly of the same age (12 weeks old) and weighing 220-240 gm of King Saud University colony were used. Animals were randomly divided into groups, 6 GNPs-treated rats groups and one control group. Following a period of stabilization (7 days), 10, 20 and 50 nm GNPs were administered intraperitonealy at the rate for 3 or 7 days as follows: Group 1: received infusion of 50 \u03bcl GNPs of size 10 nm for 3 or 7 days (n = 10); Group 2: received infusion of 50 \u03bcl GNPs of size 20 nm for 3 or 7 days (n = 10); Group 3: received infusion of 50 \u03bcl GNPs of size 50 nm for 3 or 7 days (n = 10); Group 4: received infusion of 100 \u03bcl GNPs of size 10 nm for 3 or 7 days; (n = 10); Group 5: received infusion of 100 \u03bcl GNPs of size 20 nm for 3 or 7 days (n = 10); Group 6: received infusion of 100 \u03bcl GNPs of size 50 nm for 3 or 7 days; (n = 10); Control group: received no GNPs (n = 10).The rats were maintained on standard laboratory rodent diet pellets and were housed in humidity and temperature-controlled ventilated cages on a 12 h day/night cycle. All experiments were conducted in accordance with the guidelines approved by King Saud University Local Animal Care and Use Committee.Fresh portions of both kidneys from each rat were cut rapidly, fixed in neutral buffered formalin (10%), then dehydrated, with grades of ethanol . Dehydration was then followed by clearing the samples in 2 changes of xylene. Samples were then impregnated with 2 changes of molten paraffin wax, then embedded and blocked out. Paraffin sections (4-5 um) were stained with hematoxylin and eosin  according to Pearse . StainedNo mortality occurred in any of the experimental groups of the present investigation, and no alterations were observed in the appearance and behavior of GNPs treated rats in comparison with the control ones. In comparison with the control group, the following histological alterations were detected in the renal tissue of GNPs treated rats: The following tubular alterations due to GNPs intoxication appeared in the renal tissue of the treated rats.GNPs produced occasional glomerular congestion in the rats exposed to 10 nm or 20 nm particles for 7 days but not in the glomeruli of the rats exposed to 50 nm  s Figure . This dis Figure .The loop of Henle showed very little or no alterations due to GNPs intoxication while occasional cytomegaly and luminal hyaline casts were the only alterations observed in the collecting tubules. The renal tissue of the rats received 50 or 100 \u03bcl of 50 nm GNPs for 3 or 7 days showed little or no alterations while none of the above alterations were observed in the renal tissue of any member of the control group Figures . StudiesThe results of the present work showed that the cortex is more affected than medulla due to treatment with GNPs. This could be partly due to uneven distribution of these particles in the tissue of the kidney where about 90% of the total renal blood flow enters the cortex via the bloodstream. Accordingly, a relative high concentration of particles might reach the cortex via the bloodstream than that would enter the medulla.The findings of the present study indicate that the potential toxicity of GNPs is dependent upon the size of these particles. These findings are in line with the reports of Pan et al., 2007  where ceHistological alterations by GNPs exposure as shown in the results of the present work could be an indication of injured renal tissue due to GNPs toxicity that become unable to deal with the accumulated residues resulting from metabolic and structural disturbances caused by these particles. One might conclude that these alterations are size-dependent with smaller ones induced more damage to renal tissue with relation with the time exposure of GNPs. This might be due to earlier accumulation of the larger NPs in the tissue while the smaller ones stay much longer in the bloodstream due to recirculation.The appearance of renal cells cytoplasmic degeneration and nuclear destruction may suggest that GNPs interact with proteins and enzymes of the renal tissue, interfering with the antioxidant defense mechanism and leading to generation and accumulation of the reactive oxygen species (ROS) which in turn may produce inflammatory response and mitochondrial destruction inducing stress in the renal cells to undergo atrophy, necrosis and programmed cell death.More histomorphologcal, histochemical and ultrastrucural investigations are needed to correlate the biomedical application of GNPs with their therapeutic and diagnostic use in correlation with the size, chemical composition, surface charge, solubility and surface structure of these particles.The authors declare that they have no competing interests.MAKA and BMJ have analyzed data, interpreted and written the final draft of this manuscript. The animal model used in this study was obtained from the Laboratory Animal Center . Dr. MAKA has conceived the study and its design and obtained research grants for this study. Moreover, both authors have read and approved the final manuscript."}
{"text": "Current research focuses on cancer therapy, diagnostics and imaging, although many challenges still need to be solved. However, for the application of gold nanoparticles (GNPs) in therapy and diagnostics it is necessary to know the bioaccumulation and local or systemic toxicity associated to them. The aim of the present study was to investigate the effects of intraperitoneal administration of GNPs on the histological alterations of the heart tissue of rats in an attempt to cover and understand the toxicity and the potential role of GNPs in the therapeutic and diagnostic applications.Animals were randomly divided into 3 GNPs-treated rats groups and one control group (CG). The 10, 20 and 50 nm GNPs were administered intraperitonealy at the rate of 3 or 7 days as follows: Group 1: received infusion of 100 \u03bcl GNPs of size 10 nm for 3 or 7 days; Group 2: received infusion of 100 \u03bcl GNPs of size 20 nm for 3 or 7 days; Group 3: received infusion of 100 \u03bcl GNPs of size 50 nm for 3 or 7 days. Control group: received no GNPs.In comparison with the respective control rats, GNPs-treated rat received 100 \u03bcl of 10 and 20 nm particles for 3 days or 7 days demonstrating congested heart muscle with prominent dilated blood vessels, scattered and extravasations of red blood cells, focus of muscle hyalinosis, disturbed muscle fascicles, dense prominent focus of inflammatory cells infiltrate by small lymphocytes and few plasma cells while GNPs-treated rat received 100 \u03bcl of 50 nm particles for 3 or 7 days demonstrating benign normal looking heart muscle with normal muscle direction and fascicles, and very few scattered small lymphocytes.The histological alterations induced by intraperitoneal administration of GNPs were size-dependent with smaller ones induced more affects and related with time exposure of GNPs. This study suggests that interaction of GNPs with proteins and various cell types might be evaluated as part of the toxicological assessment in addition to further experiments related to tissues antioxidant enzymes, oxidative parameters, lipid peroxidation, production of free radicals and/or ROS and cytokine, histomorphologcal and ultrastrucural will be performed to cover and understand the toxicity and the potential use of GNPs as therapeutic and diagnostic tool. The NPs are being investigated for gene delivery purposes -3 and caNPs may differ in reactivity and solubility and may interact with all kinds of endogenous proteins, lipids, polysaccharides and cells. A series of tests was proposed for evaluation of the toxicity of NPs used in drug delivery systems . GNPs caGold in its bulk form has been considered an inert, noble metal with some therapeutic and medicinal value. GNPs are thought also to be relatively non-cytotoxic  while thThe use of NPs as drug carriers may reduce the toxicity of the incorporated drug . There aThe particle size-dependent organ distribution of GNPs has been studied in vivo -17. In vIn order to understand and categorize the mechanisms for GNPs toxicity, histological data is needed on the response of living systems to the presence of GNPs of varying size, shape, surface, and exposure duration.The histological and histochemical characterization of the heart tissues due to GNPs has not been documented and identified before. In the present study, an attempt has been made to characterize the possible histological alterations in the heart tissues after intraperitoneal administration of GNPs and, if so, whether are related to the size of these GNPs and the time of exposure.GNPs of different sizes  were purchased. All GNPs used in this study were in aqueous solution at a concentration of 0.01%. The mean size and morphology of these GNPs were evaluated from transmission electron microscope (TEM) images.A total of 40 healthy male Wistar-Kyoto rats were obtained from the Laboratory Animal Center . The rats nearly of the same age (12 weeks old) and weighing 220-240 g of King Saud University colony were used. Animals were randomly divided into 3 GNPs-treated rats groups and one control group (CG). The 10, 20 and 50 nm GNPs were administered intraperitonealy at the rate of 3 or 7 days as follows: Group 1: received infusion of 100 \u03bcl GNPs of size 10 nm for 3 or 7 days (n = 10); Group 2: received infusion of 100 \u03bcl GNPs of size 20 nm for 3 or 7 days (n = 10); Group 3: received infusion of 100 \u03bcl GNPs of size 50 nm for 3 or 7 days (n = 10). Control group: received no GNPs (n = 10).The rats were maintained on standard laboratory rodent diet pellets and housed in humidity and temperature-controlled ventilated cages on a 12 h day/night cycle. All experiments were conducted in accordance with the guidelines approved by King Saud University Local Animal Care and Use Committee.Fresh portions of the heart from each rat were cut rapidly, fixed in neutral buffered formalin (10%), then dehydrated, with grades of ethanol . Dehydration was then followed by clearing the samples in 2 changes of xylene.Samples were then impregnated with 2 changes of molten paraffin wax, then embedded and blocked out. Paraffin sections (4-5 um) were stained with hematoxylin and eosin  according to Pearse . The briThe 10 and 20 nm GNPs show spherical shape while 50 nm GNPs show hexagonal shape. The mean size for GNPs was calculated from the images taken by the transmission electron microscope (TEM): The 10 nm GNPs was of mean size 9.45 \u00b1 1.33 nm, 20 nm GNPs was of mean size 20.18 \u00b1 1.80 and the 50 nm GNPs was of mean size 50.73 \u00b1 3.58 .No mortality occurred for the administration periods 3 and 7 days of GNPs in any of the experimental groups of the present investigation, and no alterations were observed in the appearance and behavior of GNPs treated rats in comparison with the control ones.Control group Figure : MicroscIn comparison with the control group, the following histological alterations were detected in the heart tissue of GNPs-treated rats. These histological alterations were observed in Figures 1) GNPs-treated rat received 100 \u03bcl of 10 nm particles for 3 days demonstrating heart muscle with prominent dilated congested blood vessels, scattered and extravasations of red blood cells and few small lymphocytic infiltrate as shown in Figure 22) GNPs-treated rat received 100 \u03bcl of 10 nm particles for 7 days demonstrating scattered and extravasations of red blood cells, congested dilated blood vessels, prominent focus of small lymphocytic infiltrate, focus of muscle hyalinosis, disturbed muscle fascicles as shown in Figure 3) GNPs-treated rat received 100 \u03bcl of 20 nm particles for 3 days demonstrating dense prominent focus of inflammatory cells infiltrate by small lymphocytes, few plasma cells, prominent congested dilated blood vessels and few scattered extravasations of red blood cells as shown in Figure 4) GNPs-treated rat received 100 \u03bcl of 20 nm particles for 7 days demonstrating dense chronic inflammatory cells infiltrate with extravasations of red blood cells as shown in Figure 5) GNPs-treated rat received 100 \u03bcl of 50 nm particles for 3 days demonstrating benign normal looking heart muscle with normal muscle direction and fascicles with no pathological effect as shown in Figure 66) GNPs-treated rat received 100 \u03bcl of 50 nm particles for 7 days demonstrating benign normal looking heart muscle, very few scattered small lymphocytes as shown in Figure The histological heart alterations induced by intraperitoneal administration of GNPs were size-dependent with smaller ones induced more affects and related with time exposure of GNPs.This infiltration of GNPs was more prominent after 7 days of administration and in rats received 10 and 20 nm GNPs than those received 50 nm GNPs. The histological heart alterations may suggest that GNPs could interfere with the antioxidant defense mechanism and leading to reactive oxygen species (ROS) generation which in turn may imitate an inflammatory response. Inflammatory cells infiltration was seen in the portal triads and the perioral zones of GNPs treated rats. The infiltrate cells were mainly lymphocytes and plasma cells .GNPs were more strongly oxidizing as evidenced by lipid peroxidation ,25 as weIt has been reported that 5 nm GNPs caused significantly greater oxidative stress and cytotoxicity effects than larger ones -29. The Several possible mechanisms of action for the toxicity of particles including injury of epithelial tissue , inflammNPs are nearly of same dimensions as some biological molecules such as proteins and nucleic acids. Many of these biomolecules consist of long macromolecular chains which are folded and shaped by cooperative and weak interaction between side groups. The GNPs may intrude into these complex folded structures.GNPs activate the phagocytic activity of the sinusoidal cells by increasing the number of Kupffte cells to help in removing the accumulated GNPs where lysosomes are involved in the intracellular breakdown into small metabolic products. The produced Kupffer cells hyperplasia might be correlated with the amount of injurious to the hepatic tissue induced by GNPs intoxication and represents a defense mechanism of detoxification. Kupffer cell hyperplasia is contributed to hepatic oxidative stress -23,38.+ due to GNPS effects. Cellular swelling might be accompanied by leakage of lysosomal hydrolytic enzymes that lead to cytoplasmic degeneration and macromolecular crowding [This scattered cytoplasmic vacuolization might indicate toxicity effect that exhibited as a result of disturbances of membranes function which leads to massive influx of water and Nacrowding .Fatty change was observed in some swelling hepatocytes of rats exposed to 100 \u03bcl of 10 nm GNPs and to lesser extent in the ones exposed to larger particles. This hepatic liposis was more prominent in rat exposed to GNPs for 7 days than those received the treatment for 3 days -23. HepaThe rats received 10 and 20 nm GNPs showed hemorrhage and excess extravasation of red blood cells. Less disruption was observed in rats exposed to 50 nm GNPs while more damage was detected after 7 days than 3 days of GNPs exposure. This alteration might indicate heart muscle damage and congestion by GNPs exposure.None of the above alterations were observed in the heart muscle of any member of the control group.The interaction of NPs with living systems is also affected by the characteristic dimensions. As noted above, GNPs, of smaller size, may reach inside biomolecules, a situation not possible for larger GNPs. It has been reported that inhaled NPs reach the blood and may reach other target sites such as the liver, heart or blood cells ,41.Reduction in size results in an enormous increase of surface to volume ratio, so relatively more molecules of the chemical are present on the surface, thus enhancing the intrinsic toxicity. This may be one of the reasons that smaller GNPs are generally more toxic than larger particles of the same insoluble material when compared on a mass dose base .In the present study we have not measured GNPs concentration in urine and feces, but this point will be taken into our consideration in other new additional experiments.Further experiments related to tissues antioxidant enzymes, oxidative parameters, lipid peroxidation, production of free radicals and/or ROS and cytokine, histomorphologcal and ultrastrucural will be performed to cover and understand the toxicity and the potential use of GNPs as therapeutic and diagnostic tool.In comparison with the respective control rats, histological alterations induced in the heart tissue exposure could be an indication of congested heart muscle with dilated blood vessels, extravasations of red blood cells, muscle hyalinosis, disturbed muscle fascicles, inflammatory cells infiltrate by small lymphocytes and plasma cells due to GNPs toxicity that became unable to deal with the accumulated residues resulting from metabolic and structural disturbances caused by these particles. One might conclude that these alterations are size-dependent with smaller ones induced more damage with relation to the time exposure of GNPs.The GNPs-treated rat received 100 \u03bcl of 50 nm particles for 3 or 7 days demonstrating benign normal looking heart muscle with normal muscle direction and fascicles, very few scattered small lymphocytes, and with no other pathological effects.One mechanism of toxicity of NPs is likely to be induction of ROS and the consequential oxidative stress in cells and organs. The appearance of congested heart muscle with prominent dilated blood vessels and focus of inflammatory cells infiltrate by small lymphocytes and plasma cells may suggest that GNPs interact with proteins and enzymes of the hepatic tissue interfering with the antioxidant defense mechanism and leading to reactive oxygen species (ROS) generation which in turn may induce stress.The author declares that he has no competing interests.AMAK has analyzed data, interpreted and written the final draft of this manuscript. The animal model used in this study was obtained from the Laboratory Animal Center . AMAK has conceived the study and its design and obtained research grants for this study. The authors have read and approved the final manuscript."}
{"text": "Gold nanoparticles (GNPs) have important application for cell labeling and imaging, drug delivery, diagnostic and therapeutic purposes mainly in cancer. Nanoparticles (NPs) are being increasingly exploited for medical applications. The aim of the present study was to investigate the particle-size and period effects of administration of GNPs on the renal tissue in an attempt to address their potential toxicity.A total of 70 healthy male Wistar-Kyoto rats were exposed to GNPs received 50 or 100 \u03bcl of GNPs infusion of size  to investigate particle-size effect of GNPs on the renal tissue. Animals were randomly divided into groups, 6 GNPs-treated rats groups and one control group. Groups 1, 2 and 3 received infusion of 50 \u03bcl GNPs of size 10 nm (3 or 7 days), size 20 nm (3 or 7 days) and 50 nm (3 or 7 days), respectively; while groups 4, 5 and 6 received infusion of 100 \u03bcl GNPs of size 10 nm, size 20 nm and 50 nm, respectively. Stained sections of control and treated rats kidneys were examined for renal tissue alterations induced by GNPs.In comparison with respective control rats, exposure to GNPs doses has produced the following renal tubular alterations: cloudy swelling, vacuolar degeneration, hyaline droplets and casts, anisokaryosis, karopyknosis, karyorrhexis and karyolysis. The glomeruli showed moderate congestion with no hypercelluraity, mesangial proliferation or basement membrane thickening. The histological alterations were mainly seen in the cortex and the proximal renal convoluted tubules were more affected than the distal ones.The induced histological alterations might be an indication of injured renal tubules due to GNPs toxicity that became unable to deal with the accumulated residues resulting from metabolic and structural disturbances caused by these NPs. The findings may suggest that GNPs interact with proteins and enzymes of the renal tissue interfering with the antioxidant defense mechanism and leading to reactive oxygen species (ROS) generation which in turn may induce stress in the renal cells to undergo atrophy and necrosis. The produced alterations were size-dependent with smaller ones induced more affects and related with time exposure of GNPs. Nanoparticles are an intermediate state of matter somewhere between bulk and molecular level. These particles have important application for cell labeling and imaging, drug delivery, biological sensors, diagnostic and therapeutic purposes mainly in cancer and photodynamic therapy -6. StudiGold in its bulk form has long been considered an inert, noble metal with some therapeutic and even medicinal value hence GNPs are thought also to be relatively non-cytotoxic . Yet theAlthough some scientists consider NPs as nontoxic, there are other studies reporting the toxic effects of NPs -16. WhilWhile nanotoxicity research is now gaining attention, little is paid to the effect of GNPs size mainly to their distribution and alterations in the tissue ,22. The A total of 70 healthy male Wistar-Kyoto rats obtained from the Laboratory Animal Center . The rats nearly of the same age (12 weeks old) and weighing 220-240 gm of King Saud University colony were used. Animals were randomly divided into groups, 6 GNPs-treated rats groups and one control group. Following a period of stabilization (7 days), 10, 20 and 50 nm GNPs were administered intraperitonealy at the rate for 3 or 7 days as follows: Group 1: received infusion of 50 \u03bcl GNPs of size 10 nm for 3 or 7 days (n = 10); Group 2: received infusion of 50 \u03bcl GNPs of size 20 nm for 3 or 7 days (n = 10); Group 3: received infusion of 50 \u03bcl GNPs of size 50 nm for 3 or 7 days (n = 10); Group 4: received infusion of 100 \u03bcl GNPs of size 10 nm for 3 or 7 days; (n = 10); Group 5: received infusion of 100 \u03bcl GNPs of size 20 nm for 3 or 7 days (n = 10); Group 6: received infusion of 100 \u03bcl GNPs of size 50 nm for 3 or 7 days; (n = 10); Control group: received no gold nanoparticles (n = 10).The rats were maintained on standard laboratory rodent diet pellets and were housed in humidity and temperature-controlled ventilated cages on a 12 h day/night cycle. Two animals from each group were killed by dislocation of the neck at intervals of 3 and 7 days of treatment with GNPs. All experiments were conducted in accordance with the guidelines approved by King Saud University Local Animal Care and Use Committee.Fresh portions of both kidneys from each rat were cut rapidly, fixed in neutral buffered formalin (10%), then dehydrated, with grades of ethanol . Dehydration was then followed by clearing the samples in 2 changes of xylene. Samples were then impregnated with 2 changes of molten paraffin wax, then embedded and blocked out. Paraffin sections (4-5 um) were stained with hematoxylin and eosin stain according to Pearse . StainedNo mortality occurred in any of the experimental groups of the present investigation, and no alterations were observed in the appearance and behavior of GNPs treated rats in comparison with the control ones. In comparison with the control group, the following histological alterations were detected in the renal tissue of GNPs treated rats:. No hypercellularity, mesangial proliferation or glomerular basement membranes thickening were detected in the glomeruli of all GNPs treated rats. Occasional dilatation of glomerular tuft blood capillaries was observed. These little alteration showed by the glomeruli might be due to the glomerular basement membrane which forms a barrier that prevents nanoparticles accumulation. Terentyuk et al., 2009 [GNPs produced occasional glomerular congestion in the rats exposed to 10 nm or 20 nm particles for 7 days but not in the glomeruli of the rats exposed to 50 nm l., 2009  reportedThe following tubular alterations due to GNPs intoxication appeared in the renal tissue of the treated rats.Cloudy swelling: renal tubules epithelial lining exhibited cloudy swelling with pale cytoplasm and poorly delineated and displaced nuclei in all GNPs treated rats. This alteration was more prominent in the proximal convoluted tubules than the distal ones and with more swelling with 100 \u03bcl dose than 50 \u03bcl one and with 10 nm and 20 nm size particles than the larger ones . Cytoplasmic swelling might be exhibited as a result of disturbances of membranes function that lead to massive influx of water and Na+ due to GNPS effects. This alteration might be accompanied by leakage of liposome hydrolytic enzymes that lead to cytoplasmic degeneration and macromolecular crowding [crowding .Vacuolar degeneration: vacuolization of the renal cells was seen and increased in severity in the renal tubules of rats received 100 \u03bcl of 10 or 20 nm GNPs with less or no vacuolar degeneration with 50 nm particles. More vacuolar degeneration was observed in the renal cells of rats exposed to 7 days than ones exposed to 3 days . Droplets appearance is associated with protein metabolism disturbances. This alteration was not seen in the renal tissue of rats exposed to 50 nm particles. Hyaline casts were also seen in the lumen of some distal convoluted renal tubules .s Figure . Droplets Figure .Anisokaryosis: variable nuclei sizes were observed in some renal cells. This change became apparent after 7 days of 50 nm GNPs administration . Some studies indicate that nuclear polymorphism is seen in dysplasia and carcinomatous lesion [s lesion .Nuclear pyknosis: sections of GNPs-treated kidneys developed pyknosis in some epithelium lining cells of the proximal tubules with lesser extent in the distal ones. This alteration was seen in all GNPs-treated rats with 10 and 20 nm particles . Pyknotic nuclei exhibited clumping and condensation of the chromatin materials in the periphery of the nuclei together with irregularity nuclear membranes. Karyopyknosis is an irreversible condensation of chromatin in the nucleus of a cell undergoing necrosis or apoptosis [s Figure . Pyknotipoptosis .Karyorrhexis: some renal cells of rats received 10 and 20 nm GNPs showed nucleoli disappearance . This nuclear damage was more prominent aftere Figure . This nu7 days of exposure to NPs. Karyorrhexis is a sort of destructive fragmentation of the nucleus proceeded by pyknosis and is followed by karyolysis .Karyolysis: this alteration appeared mainly in the kidney of GNPs-treated rats exposed to 100 \u03bcl of 20 nm size particles  which in turn may inflammatory response and mitochondrial destruction inducing stress in the renal cells to undergo atrophy and necrosis and programmed cell death.More histomorphologcal, histochemical and ultrastrucural investigations are needed to correlate the biomedical application of GNPs with the potential threat of their therapeutic and diagnostic use in correlation with the size, chemical composition, surface charge, solubility and surface structure of these particles.The authors declare that they have no competing interests.MAKA and BMJ have analyzed data, interpreted and written the final draft of this manuscript. The animal model used in this study was obtained from the Laboratory Animal Center . MAKA has conceived the study and its design and obtained research grants for this study. Moreover, both authors have read and approved the final manuscript."}
{"text": "Nanoparticles (NPs) can potentially cause adverse effects on organ, tissue, cellular, subcellular and protein levels due to their unusual physicochemical properties. Advances in nanotechnology have identified promising candidates for many biological and biomedical applications. The aim of the present study was to investigate the particle-size, dose and exposure duration effects of gold nanoparticles (GNPs) on the hepatic tissue in an attempt to cover and understand the toxicity and their potential therapeutic and diagnostic use.A total of 70 healthy male Wistar-Kyoto rats were exposed to GNPs received 50 or 100 ul of GNPs infusion of size  to investigate particle-size, dose and exposure duration effects of GNPs on the hepatic tissue.In comparison with respective control rats, exposure to GNPs doses has produced alterations in the hepatocytes, portal triads and the sinusoids. The alterations in the hepatocytes were mainly vacuolar to hydropic degeneration, cytopasmic hyaline vacuolation, polymorphism, binucleation, karyopyknosis, karyolysis, karyorrhexis and necrosis.+ due to GNPs effects accompanied by leakage of lysosomal hydrolytic enzymes that lead to cytoplasmic degeneration and macromolecular crowding. Hydropic degeneration is a result of ion and fluid homestasis that lead to an increase of intracellular water. The vacuolated swelling of the cytoplasm of the hepatocytes of the GNPs treated rats might indicate acute and subacute liver injury induced by the GNPs. Binucleation represents a consequence of cell injury and is a sort of chromosomes hyperplasia which is usually seen in regenerating cells. The induced histological alterations might be an indication of injured hepatocytes due to GNPs toxicity that became unable to deal with the accumulated residues resulting from metabolic and structural disturbances caused by these NPs. These alterations were size-dependent with smaller ones induced the most effects and related with time exposure of GNPs. The appearance of hepatocytes cytoplasmic degeneration and nuclear destruction may suggest that GNPs interact with proteins and enzymes of the hepatic tissue interfering with the antioxidant defense mechanism and leading to reactive oxygen species (ROS) generation which in turn may induce stress in the hepatocytes to undergo atrophy and necrosis. More histomorphologcal, histochemical and ultrastrucural investigations are needed in relation of the application of GNPs with their potential role as a therapeutic and diagnostic tool.The hepatocytes swelling might be exhibited as a result of disturbances of membranes function that lead to massive influx of water and Na The rats exposed to aerosols of GNPs revealed that the NPs were rapidly taken into the system with the highest accumulation in the lungs, aorta, esophagus and olfactory bulb . MoreoveAlthough some scientists consider NPs as nontoxic, there are other studies reporting the toxic effects of NPs -5. AlthoGold in its bulk form has long been considered an inert, noble metal with some therapeutic and even medicinal value hence GNPs are thought also to be relatively non-cytotoxic . Yet theThe histological and the histochemical characterization in the hepatic tissues due to GNPs are not documented and have not yet been identified. In the present study, an attempt has been made to characterize the possible histological alterations in the hepatic tissues following experimental GNPs and, if so, whether are related to the size of these NPs and the time of exposure.The present study was carried out to investigate the particle-size, dose and exposure duration of GNPs on the hepatic tissue in an attempt to cover and understand the toxicity and their potential therapeutic and diagnostic use in relation with the time of exposure.A total of 70 healthy male Wistar-Kyoto rats obtained from the Laboratory Animal Center . The rats nearly of the same age (12 weeks old) and weighing 220-240 gm of King Saud University colony were used. Animals were randomly divided into groups, 12 GNPs-treated rats groups and one control group (NG). Following a period of stabilization (7 days), 10, 20 and 50 nm GNPs were administered intraperitonealy at the rate for 3 or 7 days as follows: Group 1: received infusion of 50 \u03bcl GNPs of size 10 nm for 3 or 7 days (n = 10); Group 2: received infusion of 50 \u03bcl GNPs of size 20 nm for 3 or 7 days (n = 10); Group 3: received infusion of 50 \u03bcl GNPs of size 50 nm for 3 or 7 days (n = 10); Group 4: received infusion of 100 \u03bcl GNPs of size 10 nm for 3 or 7 days; (n = 10); Group 5: received infusion of 100 \u03bcl GNPs of size 20 nm for 3 or 7 days (n = 10); Group 6: received infusion of 100 \u03bcl GNPs of size 50 nm for 3 or 7 days; (n = 10); Control group: received no gold nanoparticles (n = 10).The rats were maintained on standard laboratory rodent diet pellets and were housed in humidity and temperature-controlled ventilated cages on a 12 h day/night cycle. Two animals from each group were killed by dislocation of the neck at intervals of 3 and 7 days of treatment with GNPs. All experiments were conducted in accordance with the guidelines approved by King Saud University Local Animal Care and Use Committee.Fresh portions of the lateral lobes of the liver from each rat were cut rapidly, fixed in neutral buffered formalin (10%), then dehydrated, with grades of ethanol . Dehydration was then followed by clearing the samples in 2 changes of xylene. Samples were then impregnated with 2 changes of molten paraffin wax, then embedded and blocked out. Paraffin sections (4-5 um) were stained with hematoxylin and eosin the conventional histological and stain according to Pearse . StainedThe 10 and 20 nm GNPs show spherical shape while the 50 nm GNPs show hexagonal shape. The mean size for GNPs was calculated from the images taken by the transmission electron microscope (TEM). The 10 nm GNPs was of mean size 9.45 \u00b1 1.33 nm, 20 nm GNPs was of mean size 20.18 \u00b1 1.80 and the 50 nm GNPs was of mean size 50.73 \u00b1 3.58 .GNPs-normal rat demonstrating normal hepatocytes are shown in Figure + due to GNPS effects. Cellular swelling might be accompanied by leakage of lysosomal hydrolytic enzymes that lead to cytoplasmic degeneration and macromolecular crowding [hepatocytes exhibited cloudy swelling with pale cytoplasm and poorly delineated and displaced nuclei in all GNPs treated rats. This ballooning degeneration was more prominent with 100 \u03bcl dose than 50 \u03bcl one and with 10 nm size particles than the larger ones Figure . This swcrowding .vacuolization of the hepatocytes cytoplasm was seen and increased in severity in the liver of rats received 100 \u03bcl of 10 nm GNPs with less vacuolar degeneration with larger ones. More vacuolar degeneration was observed in the hepatocytes of rats exposed to 7 days than ones exposed to 3 days Figure . Hydropiinclusions similar to Mallory hyaline bodies and hayaline vacuolations were detected in the cytoplasm of some hepatocytes of rats received 100 \u03bcl of 10 nm GNPs. This alteration was less prominent in rats exposed to larger particles Figures  and 2d.variable nuclei sizes were observed in some hepatocytes. This change became apparent after 7 days of 50 nm GNPs administration. Some studies indicate that nuclear polymorphism is seen in hepatic dysplasia and carcinomatous lesion .pyknotic nuclei were seen in some hepatocytes of GNPs treated rats. Some pyknotic hepatocytes of rats received 100 \u03bcl of 50 nm size particles exhibited clumping and condensation of the chromatin materials in the periphery of the nuclei together with irregularity nuclear membranes Figures  and 3b. some hepatocytes of rats received 50 nm GNPs showed nucleoli disappearance Figure . This nuthis alteration appeared mainly in the liver of GNPS-treated rats exposed to 100 ul of 50 nm size particles Figure . Karyolyoccasional binucleation and to lesser extent polynucleation were observed in GNPs treated rats. This change was more prominent in rats exposed to 100 \u03bcl of 50 nm size GNPs Figures  and 4b. sporadic spotty well-defined necrosis was noticed in some hepatocytes of GNPs treated rats Figure . The inshepatic sinusoids were more dilated in rats received 50 \u03bcl of 10 nm GNPs than those exposed to larger particles Figure . This alAbdelhalim and Bashir, 2011 have reported that GNPs-treated rat received 100 \u03bcl of 10 nm particles for 7 days demonstrating apoptotic characterization, GNPs-treated rat received 100 \u03bcl of 10 nm particles for 3 days demonstrating inflammatory cell infiltration, GNPs-treated rat received 50 \u03bcl of 10 nm particles for 7 days demonstrating Kupffer cells hyperplasia, GNPs-treated rat received 100 \u03bcl of 10 nm particles for 7 days demonstrating hepatic fatty degeneration and GNPs-treated rat received 50 \u03bcl of 20 nm particles for 7 days demonstrating hepatic central vein intima disruption .None of the above alterations were observed in the liver of any member of the control group Figure .Histological alterations by GNPs exposure as shown in the results of the present work could be an indication of injured hepatocytes due to GNPs toxicity that become unable to deal with the accumulated residues resulting from metabolic and structural disturbances caused by these particles. One might conclude that these alterations are size-dependent with smaller ones induced more damage with relation with the time exposure of GNPs.The appearance of hepatocytes cytoplasmic degeneration and nuclear destruction may suggest that GNPs interact with proteins and enzymes of the hepatic tissue interfering with the antioxidant defense mechanism and leading to reactive oxygen species (ROS) generation which in turn may induce stress in the hepatocytes to undergo atrophy and necrosis.More histomorphological, histochemical and ultrastructural investigations are needed to correlate the biomedical application of GNPs with the potential threat of their therapeutic and diagnostic use.The authors declare that they have no competing interests.MAKA and BMJ have analyzed data, interpreted and written the final draft of this manuscript. The animal model used in this study was obtained from the Laboratory Animal Center . MAKA has conceived the study and its design and obtained research grants for this study. Moreover, both authors have read and approved the final manuscript."}
{"text": "The process of microstructure evolution during sintering was clearly distinguished from 2D and 3D reconstructed images. Typical sintering parameters such as sintering neck size, porosity, and particle size of the sample were presented for quantitative analysis of the influence on the mechanical properties and the sintering kinetics during microwave sintering. The neck size-time curve was obtained and the neck growth exponent was 7.3, which indicated that surface diffusion was the main diffusion mechanism; the reason was the eddy current loss induced by the external microwave fields providing an additional driving force for mass diffusion on the particle surface. From the reconstructed images and the curve of porosity and average particle size versus temperature, it was believed that the presence of liquid phase aluminum accelerated the densification and particle growth.In order to study the influence on the mechanical properties caused by microstructure evolution of metal powder in extreme environment, 3D real-time observation of the microstructure evolution of Al-Ti mixed powder in high temperature and microwave compound fields was realized by using synchrotron radiation computerized topography (SR-CT) technique; the spatial resolution was enhanced to 0.37\u2009 A lot of the metals and alloys with excellent properties are prepared by powder metallurgy at high temperature , 2. MicrSynchrotron radiation X-ray computed tomography (SR-CT) technique is such a powerful imaging tool developed in recent years , 7. It h\u03bcm/pixel. Phase recovery method was used to get high-contrast qualitative microtomography, and microstructure evolution during sintering was clearly distinguished from 2D and 3D reconstructed images, such as sintering neck size, porosity, and particle size of the sample. The size of the sintering neck in each cross section image was calculated by using watershed algorithm, and typical sintering parameters during sintering were presented for quantitative analysis of the influence on the mechanical properties and the sintering kinetics during microwave sintering.In this paper, 3D microstructure characterization of Ti-Al metal powder mixture in high temperature and microwave compound fields was studied in situ, and the spatial resolution was firstly increased to 0.37\u2009The SR-CT technique is a testing method by which the specimen passed through by synchrotron radiation. X-ray is placed on a rotation device and the projection images of the specimen are received by an X-ray charge-coupled device (CCD). One projection image is collected each time when the specimen turns for an angle. After obtaining a set of projection data, reconstruction algorithm is used to obtain the internal microstructure of the sectional images. The 3D images of the microstructure can be obtained from a series of sectional images.\u03bcm. The microwave sintering experiment was carried out on the BL13W1 beamline at Shanghai Synchrotron Radiation Facility ; the energy of the beam ranged from 8 to 72\u2009KeV. Considering the X-ray absorption coefficient of Al and Ti, an X-ray with 26\u2009KeV was applied.In the experiment, Al and Ti were selected because they were more commonly used in high-performance metals and alloys. The elemental Al and Ti powders were 300~600 mesh and mixed in the ball mill with alcohol for 10 hours to prepare 87Al-13Ti (wt.%) and then dried in a vacuum oven. The mixed alloy powder was filled into a quartz tube with an inner diameter of 260\u2009A set of unique equipment specifically for the 3D imaging of samples using synchrotron of X-ray had been designed ; the powDue to the sampling capacity limit of CCD target surface, size of the view field would decrease with the improvement of the resolution; therefore, precise positioning of the sample was critical to achieve high resolution SR-CT experiment. The relationship between field of view size and resolution is shown in \u03bcm/pixel successfully.In order to carry out high resolution experiments, we developed a special multidimensional high-precision translation and rotation equipment; the design is shown in When there is a certain distance between CCD and the sample, phenomenon of absorption and phase shift occur simultaneously, the information received by CCD includes both absorption and phase information, and the phase contrast image cannot directly reflect the phase and structural information of the sample. X-ray propagation-based phase contrast CT (PPCT) method , 11 was The exposure time would be longer and more projectors would be required in high resolution SR-CT experiment, which led to significant changes in microstructure in the same group of projections, and because the intensity of X-ray decreased with time, the background intensity of projections would be inconsistent. Therefore, in order to increase data acquisition speed, the number of projections would be reduced. Using the inverse projection method could acquire high-quality reconstructed images with fewer projections. By using this method, a series of cross-sectional images at different sintering times was produced, from which 3D images were obtained by applying a 3D rendering algorithm. The 3D reconstructed images of the same microstructure at different sintering times are shown in Sintering necks which initiate and grow during sintering connect loose powders to form a solid metal material. The tensile strength of the metals can be significantly improved by improving the sintering neck structure. Neck growth is a basic phenomenon of sintering, and it plays an important role in determining the main diffusion mechanism and calculating the diffusion coefficient of the material . Therefox and a represent sintering neck and particle size, respectively, t is the sintering time, and different n represents different main diffusion mechanisms. The fourth state is not taken into account because of the presence of liquid aluminum. From x) and log(t), and the slope is 0.1361; the value of inverse slope equals 7.3, indicating that surface diffusion was the dominant diffusion mechanism, which was caused by conductance characteristic of metals. Al and Ti are electrical conductors; the eddy current loss induced by the external microwave fields constitutes the main loss mechanism. This eddy current is along the particle surface layer with the thickness about 1\u2009\u03bcm and will probably provide an additional driving force for mass diffusion on the particle surface. Therefore, on the Al and Ti particle surface, the mass transformation process was promoted preferentially.The dynamics of stable neck growth as summarized by Kuczynski is shown in the formula below :(1)(xa)Pores of a material reduce its mechanical properties, such as compressive strength, modulus, shear strength, and flexural strength . With th\u03bcm/pixel during microwave sintering, which demonstrated that high-resolution experiments under electromagnetic and high temperature compound fields were feasible. The reconstructed 3D images provided good understanding of various sintering phenomena. Parameters that typically influenced the mechanical properties such as neck size, porosity, and average particle size were analyzed. The neck size-time curve was obtained and the neck growth exponent was 7.3, which indicated that surface diffusion was the main diffusion mechanism, and the reason was the eddy current loss induced by the external microwave fields providing an additional driving force for mass diffusion on the particle surface. From the reconstructed images and the curve of average particle size versus temperature, it was believed that the presence of liquid phase aluminum accelerated the particle growth and densification. In this exploratory study, only a small part of the data acquired by SR-CT was used for quantitative statistical analysis. The 3D reconstructed images represent the complete evolution of microstructure in high temperature and microwave compound fields, such as the smoothness and relative positions of particles, the volume shrinkage of the powder system, and collapse caused by thermal stress; all of these parameters are vital and need to be studied, and they contain the kinetic and thermodynamic information which directly determine the performance of the materials. The challenge is to decouple the information and find the key influence parameters used to calculation model, which makes the study on the sintering more thorough.Based on the SR-CT technique, microstructure evolution of Ti-Al metal powder mixture was observed, and through the design of equipment and the introduction of excellent reconstruction method, the spatial resolution was firstly increased to 0.37"}
{"text": "Medical professionalism is a core aspect of medical education and practice worldwide. Medical professionalism must be reinterpreted to adapt to different social/cultural/historical contexts. We conducted a survey to examine the current understanding and perceived value of medical professionalism among Korean physicians.The survey was distributed to 950 physicians nationwide; 721 (75.89\u00a0%) completed surveys were returned between 1 April and 31 July 2011.In their practice, Korean physicians prioritized the values and virtues of medical professionalism in the following (descending) order: veracity, respect for patient autonomy, integrity, responsibility, altruism, and honesty. Approximately two-thirds of physicians responded that medical professionalism is an element of their vocation. When asked to choose the most important sets of attributes or virtues of medical professionalism from a provided list, the top three sets (in descending order of frequency) were: \u201cresponsibility and duty,\u201d \u201cveracity, integrity, and honesty,\u201d and \u201crapport with patients and conversational skill.\u201dKorean physicians value moral duties, such as responsibility and veracity, more than they do moral virtues, such as altruism and honesty with patients. It is presumed that physicians are under pressure due to governmental regulation of the national healthcare system and have difficulty exercising their autonomy.The online version of this article (doi:10.1186/s12910-015-0051-7) contains supplementary material, which is available to authorized users. Medical professionalism is a representative term that embodies the nature, obligations, and identity of medical doctors . The impWe start with the question of Korean physicians\u2019 understanding of medical professionalism. Traditional medicine had been practiced for many centuries in Korea before Western medicine was introduced. Asian medical practitioners have traditionally been expected to be concerned healers who cure sicknesses of body and soul; indeed, they are also respected for these virtues.Doctors in general are recognized as professionals who carry out a socially important role, similar to those of clergy and lawyers . An undeWestern medicine was introduced to Korea during a short period of modernization at the time of Japanese colonization , 18. It According to an old saying, the good doctor treats diseases of the body; the better doctor heals sickness of the soul; and the great doctor cures both of these and societal illness as well. The individual and collective obligations of physicians are to restore the health of the individual and of society . The essPublic concern about medical professionalism and medical ethics has increased due to two dramatic events in Korean medical history . The firThe roles and responsibilities of physicians must be redefined, and medical ethics must be promoted among Korean physicians. Physicians must understand these roles and responsibilities towards patients, their peers, and society if medical professionalism is to be reestablished in Korean society. The purpose of this study was to demonstrate, through physicians\u2019 ratings of importance of the various values or virtues of medical professionalism, that even physicians who are not familiar with the term \u2018medical professionalism\u2019 embody the concept through their history of devotion to medical practices that are consistent with these values.This study was based on an anonymous survey  in this finding, with the highest frequency of affirmative responses about professionalism among those in their 60s and the lowest ratings among those in their 20s  order of importance: veracity, respect for patient autonomy, responsibility, integrity, altruism, and honesty , \u201cveracity, integrity, and honesty\u201d , \u201crapport with patients and conversational skill\u201d , \u201cbenevolence, altruism, and compassion\u201d , \u201ctrustworthiness\u201d , \u201cpublic service\u201d , \u201cpatient autonomy\u201d 9,120 respondents, 16.71\u00a0%), \u201cvirtue and good heart\u201d , and \u201ccollegial relationships\u201d   incentive and CPD credits; reinforcement of medical ethics activation of regional medical societies; reorganization of medical insurance and adequacy of medical insurance reimbursements; use of role models; emphasis on medical professionalism and self-regulation within medical associations; reinforcement of doctors\u2019 involvement in and relationship with professional societies; public service; and cooperation between Western and Asian medicine (see Table\u00a0The term \u201cmedical professionalism\u201d implies elements of both \u201cmedicine\u201d and \u201cprofessionalism.\u201d Medicine is delivered by doctors who have professed to use their medical knowledge and skill only for the good of the patient. Medicine as a profession is maintained by doctors who develop, comply with, and embody the medical code . TherefoCruess et al.  emphasizWynia et al.  identifiThe Royal Academy of Medicine has stated that a strong motivation to be devoted to others is the primary characteristic required for a medical professional . AccordiAccording to the survey, over two-thirds of the physicians responded that medical professionalism is properly a part of the profession of medicine. Factors highly correlated with this response were physician experience and age. As Aristotle defined virtue as a stable disposition that is formed through habitual acts, physician\u2019s professionalism is formed throughout medical practice over the years. Pelligrino noted that a virtuous physician is not simply born, but is formed through years of deliberate practice. Time and experience are essential factors to nurture, cultivate, and promote medical virtues. As physicians accumulate practice, they are more likely to regard medical professionalism as an element of their vocation .Moral duty and responsibility were the component set that was advocated most highly as indicative of medical professionalism. Part of the survey included cases involving medical moral dilemmas in practice to determine the virtues most valued by Korean physicians. Regardless of whether the respondents endorsed medical professionalism as an element of the vocation, they listed veracity, respect for patient autonomy, integrity, responsibility, altruism, and honesty as important characteristics of medical professionalism. Korean physicians tended to emphasize moral norms, such as veracity and respect for patient autonomy, rather than altruism, as basic virtues or ordering principles of medical professionalism. The survey results reflect the current status of medical professionals in a country with a national health insurance system and a government-led healthcare policy. Korean physicians are overwhelmed with excess documents and are expected to comply with ever-changing policies. Therefore, physicians find it difficult to exercise their discretion and display the virtues of a medical professional; they feel a lack of autonomy as professionals despite their altruistic mindset.The Royal College of Physicians has stated that all doctors must abandon their sense of supremacy, autonomy, and privilege as medical professionals . HoweverIt is presumed that the life-long experience of doctors gives them insight and wisdom, which is consistent with Aristotle\u2019s virtue ethics. According to Aristotle, time and experience are essential to acquire appropriate virtue in practice . It is eIn our study, Korean physicians reported responsibility and obligation as core medical professionalism virtues in their practice, which reflects essential virtues according to the medical code of ethics. However, the physicians also recognized the importance of altruism and empathy as traditional medical professionalism virtues and reported that they realize these virtues in practice whenever the sociocultural conditions facilitate it. In conclusion, physicians tended to have an appropriate attitude toward medical professionalism, yet they felt that the social environment did not enable achievement of their potential as medical professionals. The finding that Korean physicians hold the more normative values like responsibility and veracity in higher esteem than other virtues reflects their lack of autonomy due to excess governmental limitations in the healthcare system. The health insurance review and assessment service evaluates the \u2018adequacy\u2019 of treatment provided to the patient . The \u2018adThe Korean healthcare system is experiencing a dilemma between extending health care insurance coverage and effectively managing the healthcare insurance budget. The government forces physicians to reduce healthcare service spending rather than raising the level of reimbursement. The degree and quality of healthcare service for a particular patient should left primarily to the physician\u2019s medical expertise and his or her conscience. Government\u2019s reinforcement of regulations and monitoring of physicians\u2019 decisions is not the best way to ensure ethical behaviors in medical practice. To promote ethical culture, it is necessary to allow physician\u2019s autonomy and to encourage a self-policing system within the medical profession . AccordiThe survey results demonstrate the necessity of implementing a CPD program to reinforce the autonomy of the medical profession and to promote medical professionalism in Korea. Physicians\u2019 autonomy requires responsible behaviors by physicians as moral agents. Therefore, the Medical Association should provide physicians with opportunities for continuing education and training to promote ethical behavior. Dissemination of ethical culture among physicians will change societal attitudes toward medical professionals, build trusting and respectful relationships, and contribute to a sound medical culture.The survey results showed that physicians do not recognize the importance of values such as \u201ccollegial relationships\u201d or \u201cpublic service,\u201d and these findings reflect a lack of collective medical professionalism, i.e., an inability and unwillingness to exercise self-governance, to nurture professional attitudes among colleagues, and to establish a moral culture as a professional group. Transformation based on social change is inevitable for Korean physicians and medical societies. As medicine cannot exist apart from society, the social responsibilities of physicians must be emphasized more than has been the case previously.The survey also showed that Korean physicians are aware of the need to strengthen the ethical elements of medical professionalism and proposed CPD as a means of achieving this. Implementing a CPD program for medical professionalism, including vocation, competence, ethical elements, and leadership, will enable doctors to maintain a moral basis for their work. Such a program could lead to establishment of a new and improved medical professionalism in Korea. It is time to initiate a movement for new medical professionalism in Korea. In this way, patient trust and the reliance of society on the medical community can be restored . It is eA solid education program is important to produce good doctors who practice medicine in an exemplary manner. In particular, the program should emphasize the teaching of students and the medical professionalism of young physicians. Nevertheless, just as making a good doctor is similar to making a good person, designing such a program to do either is challenging . The CatKorea has a relatively short history of medical professionalism, which is not yet entrenched in medical education or in the clinical context. The medical community must recognize the importance of appropriate identification and implementation of medical professionalism for Korea in the 21st century. Contemporary medical professionalism should address social concerns including public healthcare and social welfare, as well as the healing relationship between patient and physician. The country has a national health insurance system and a government-oriented health policy. Korean physicians need more opportunities to exercise self-governance and autonomy to be socially responsible for medical education and medical practice. A medical profession equipped with autonomy and independence will contribute to formation of a good medical culture.Medical professionalism is the basis for trust in the patient\u2013doctor relationship, and is a core element of being a good doctor \u201342. The As mentioned in the Health Foundation\u2019s new definition of medical professionalism, medical practice involves not only doctors but also all other healthcare professionals. doctors and patients has become more of a partnership , 47, 48\u2014"}
{"text": "Saxicola spp), which all breed during a short breeding season, but differ in migratory behavior, seasonal territory-acquisition and pace of life.Testosterone facilitates physiological, morphological, and behavioral changes required for breeding in male vertebrates. However, testosterone concentrations and the link between its seasonal changes and those in reproductive behaviors vary greatly among species. To better understand the impact of tropical and temperate environments and life history factors on this variation, we have compared testosterone, territorial behavior and song performance across sequential stages of the breeding season in males of 16 closely related taxa of East African tropical and West European temperate stonechats  contains supplementary material, which is available to authorized users. The sex steroid testosterone coordinates many reproductive traits in male vertebrates (reviewed by ). TestosHowever, quantitative differences in peak testosterone levels and differences in the degree to which testosterone mediates reproductive behaviors have been observed . For exaMore recently, however, several studies have shown that males of tropical species that breed in highly seasonal environments have indeed similar peak testosterone concentrations as temperate seasonal breeders . SuIn birds, song is a major component of territory establishment and mate attraction \u201355\u00a0and dSaxicola spp) have a wide distribution range from tropical to temperate environments, but wherever they occur, they are seasonal breeders ).Zonotrichia that breed in the Neotropics and North America. The life history of neotropical high altitude rufous-collared sparrows (Z. capensis) is very similar to the life history of afrotropical stonechats: both are residents and breed seasonally at high altitudes and in open grassland habitats during a relatively short breeding season of 3\u20134 months [Previous generalizations of low testosterone concentrations in tropical birds may have been biased by studies of neotropical or Australian species with extended breeding seasons , 101\u20131074 months . Similar4 months . However4 months , 109 \u2013 h(Troglodytes aedon) sang fewer elements at a slower rate than temperate house wrens [The differences in song performance which we report for tropical versus temperate stonechats may well be related to differences in territoriality and migratory behavior. Song characteristics play an important role during male-male interactions  and for se wrens . Neverthse wrens , 111\u2013114se wrens .In seasonally breeding species, regardless of latitude, short peaks of testosterone may help to avoid costs associated with high levels of this hormone, including potential impairment of the immune system, survival and male parental care , 32. Sev(Hylophylax n. naevioides) testosterone concentrations were very low during breeding, but rose transiently during prolonged simulated territorial intrusions [In some species with long breeding seasons, testosterone concentrations increase only during social interactions or periods of social instability . For extrusions . Alternatrusions , exemplitrusions , 118. WhThis is the first study that assessed the role of testosterone, territorial behavior and song concomitantly in several closely related taxa and populations of a songbird breeding at different latitudes from Europe to the Afrotropics. In both European and African male stonechats, a strong territorial response during the fertile period of females coincided with high testosterone concentrations. However, European males sang with a higher song and element rate during the pre-nesting and nest-building phase than African males, despite similar testosterone levels. Thus, in male tropical stonechats seasonal breeding and short breeding seasons may have led to similar peak testosterone concentrations and territorial aggression as in temperate stonechats. However, year-round territories and stable pair-bonds have reduced the pressure of finding a new mate at the beginning of the breeding season in tropical stonechats, which is reflected in a lower song performance in African compared to European male stonechats. Future studies should determine the role of extra-pair paternity in temperate and tropical stonechats as a potential evolutionary driver of high testosterone peaks when females are fertile. Further, as the data collected in this study are correlational, experimental approaches using androgen and estrogen receptor blockers to determine causal relationships between testosterone and behavior are necessary. This kind of information is particularly rare in tropical species, and especially for studies that also investigate song structure. Taken together, our study suggests that breeding in seasonal environments during short breeding seasons is a major selective force for high peak testosterone levels of male birds independent of breeding latitude and variation in pace of life, and that particular behaviors, in our case song performance, can be uncoupled from peak testosterone\u00a0levels."}
{"text": "This book presents a step-by-step surgical description of vaginal hysterectomy, abdominal hysterectomy, conventional laparoscopic hysterectomy, and robotic-assisted hysterectomy. It brings into balance theoretical background, clinical experience, and scientific findings in a readily comprehensible form with numerous illustrations and tables. The book contains a large proportion of interdisciplinary aspects that make a substantial contribution to meeting the growing requirements of interdisciplinary medical treatment. It offers related disciplines the opportunity to describe areas of common overlap and how these can be treated.Verschiedene chirurgische Verfahren einschlie\u00dflich vaginaler Hysterektomie, abdominaler Hysterektomie, konservativer laparoskopischer Hysterektomie und roboterassistierter Hysterektomie werden in diesem englischsprachigen Lehrbuch schrittweise beschrieben. In ausgewogener Art und Weise werden theoretische Hintergr\u00fcnde, klinische Erfahrungen und wissenschaftliche Erkenntnisse in leicht verst\u00e4ndlicher Form mit zahlreichen Abbildungen und Tabellen dargestellt. Indem es verschiedene interdisziplin\u00e4re Aspekte behandelt, wird das Buch den wachsenden Anforderungen der interdisziplin\u00e4ren medizinischen Therapie gerecht. Benachbarte medizinische Fachbereiche kommen zu Wort und haben die M\u00f6glichkeit, \u00fcberlappende Krankheitsbilder und deren Behandlung zu erl\u00e4utern. This comprehensive surgical approach to hysterectomy rests on the pillars erected by the great masters in gynecology and obstetrics. The first hysterectomy was performed as a vaginal hysterectomy and dates back to ancient times. The procedure was performed in the time of Soranus of Ephesus, 120 years after the birth of Christ. There were many reports of its use in the Middle Ages, nearly always for the extirpation of an inverted uterus, and the patients rarely survived. Hysterectomy became safer with the introduction of anesthesia, antibiotics and antisepsis, blood transfusions, and intravenous therapy. Apart from the transverse abdominal incision introduced by Johannes Pfannenstiel in the 1900s, there was little advance in hysterectomy techniques until the advent of endoscopic surgery and the performance of the first laparoscopic hysterectomy by Kurt Semm in Kiel in 1984, and Harry Reich in Kingston, Pennsylvania in 1988 (In this age of global communication, it seems more than appropriate to publish a specialist surgical book on hysterectomy that features leading surgeons, researchers and teachers from around the globe as contributing authors. With the assistance of over 200 multi-disciplinary authors, the editors have been able to compile a book that meets the requirements of a broad base of readers from beginners to specialists in gynecology. The book at hand also addresses specialists in other surgical fields, such as urologists, visceral surgeons, pathologists, radiologists, anesthesiologists, and conservative gynecologists, dealing with the interdisciplinary challenges associated with hysterectomy.Although there is a flood of literature on this topic, this comprehensive approach to hysterectomy is unique in that it includes the historical background of the leading surgical techniques of the present day and the future perspectives as seen by the leading, contemporary, multi-disciplinary authors.The main part of the book provides a balance of theoretical background, broad clinical experience, and scientific findings in a readily comprehensible and well-described manner, enriched with extensive illustrations and tables. For the beginner, this masterpiece serves as a reliable companion, providing background information and assistance for all procedures associated with hysterectomy. This includes abdominal, vaginal, conventional laparoscopic, and robotic-assisted surgical procedures for benign and malignant indications. Experienced surgeons in particular will be able to broaden their spectrum and learn experimental and innovative surgical approaches because this textbook is unique in offering traditional, up-to-date, and innovative surgical methods for hysterectomy. The associated medical fields, such as general surgery, urology, pathology, anesthesiology, radiology, and general /internal medicine, will benefit from the structured organization of the book and the integration of all interdisciplinary aspects.After beginning with the historical background, there follows a section on topographic anatomy for hysterectomy procedures. This section was written by a renowned clinical anatomist and provides new insights into the female anatomy. The next section comprises five chapters dealing with imaging and diagnostics, followed by a section examining extended, and often controversial, aspects regarding indications and contraindications. Even the often underrepresented aspects of communication and training have a firm place in the book . FurtherThe main aspects of the book deal with the practical performance of hysterectomy with conventional laparoscopic, robotic-assisted, abdominal, and vaginal surgical techniques. In addition to all types of hysterectomies for benign and malignant indications, concomitant procedures such as urogynecologic procedures, lymphadenectomy, and omentectomy are featured in the book.The book has several unique features. The historical chapters were written by world-renowned and respected contemporary witnesses of pioneering surgical developments . The imaThe book examines many interdisciplinary aspects and the editors believe it will make a substantial contribution to meeting the growing requirements of interdisciplinary medical treatment. It offers related disciplines the opportunity to describe the areas of common overlap and how these can be treated.The wide range of contents developed in the course of the conception of the book. Extended hysterectomy procedures cannot be separated from pre- and postsurgical aspects or from procedures on the internal genital organs or those involving the anatomic and functionally-relevant surrounding area. This book gives access to the most advanced treatment concepts of our time. Furthermore, the eBook version meets global demands of unlimited exchange and gives access to the worldwide community interested in this topic. This text book is an important addition to the literature on hysterectomy techniques, accessible to gynecologists worldwide, and thereby contributes towards the global improvement of healthcare for women."}
{"text": "The clinical high-risk state for psychosis syndrome (CHR) offers substantial potential benefits in terms of early identification and treatment for at-risk youth. Early treatment might lead to decreased symptoms, thus leading to reduced symptom-related stigma. However, stigma of the clinical high-risk state for psychosis designation might also initiate further stigma through the label of risk for psychosis. Identifying the effects of these sources of stigma is critical in order to best minimize stigma associated with CHR identification and to facilitate recovery.Baseline stigma assessments were conducted with 170 clinical high risk state for psychosis individuals in a major, NIH-funded longitudinal study at Columbia University Medical Center, Harvard University Medical Center, and Maine Medical Center from 2012 to 2017. Labeling-related measures of stigma  adapted to the CHR group, and a parallel measure of symptom-related stigma  were administered. These measures were examined in relation to outcomes of: a) self-esteem, b) quality of life, and c) social functioning, adjusting for sociodemographics and core CHR symptoms (e.g. attenuated psychotic symptoms).Results indicated that stigma related to symptoms was more strongly associated with all outcomes when compared with shame related to the risk-label. Stigma related to symptoms remained a significant predictor of self-esteem and quality of life even after accounting for stigma related to the risk-label and the effects of sociodemographics and CHR symptoms. Conversely, stigma related to the risk-label was no longer a significant predictor for outcomes after accounting for stigma related to symptoms.Overall, symptom-related stigma was a more salient correlate and was independently linked with self-esteem and quality of life even after accounting for the effects of stigma related to the risk-label. These results indicate that treating of symptoms through early identification and treatment may provide major benefit for CHR youth by also alleviating symptom-related stigma. These findings also indicate that CHR services should address stigma associated with symptoms immediately at first identification, as these have substantial effects on psychological and functional outcomes. These findings have implications for guiding implementation of specialized CHR services both in the United States and worldwide."}
{"text": "The treatment landscape for multiple myeloma is rapidly changing. At JADPRO Live 2017, presenters brought advanced practitioners up to date on the newest approaches to the management of this disease, as well as what to be aware of when treating common side effects. Multiple myeloma is a complex malignancy for which the treatment landscape is rapidly changing. Risk stratification is important in determining prognosis and tailoring treatment. At JADPRO Live 2017, Tiffany Richards, PhD, ANP, AOCNP\u00ae, and Hans Lee, MD, both from The University of Texas MD Anderson Cancer Center in Houston, brought listeners up to date on the newest approaches to management.Multiple myeloma is a malignancy of the plasma cells that can evolve over time. Almost all patients are initially diagnosed with monoclonal gammopathy of unknown significance (MGUS). Approximately 1% of MGUS patients per year will develop \"smoldering myeloma,\" and about 10% per year of these patients will eventually develop symptomatic disease, Dr. Richards said.The International Myeloma Working Group (IMWG) revised the diagnostic criteria for myeloma in 2014, which now incorporates biomarkers along with the standard \"CRAB\" criteria , and guides the initiation of treatment . In the For MGUS, most patients can be followed , with evaluations every 3 to 6 months for the first year, then annually thereafter. Patients with smoldering multiple myeloma can also be followed closely or enrolled in a clinical trial for smoldering disease. Studies are now evaluating whether aggressive treatment early on can affect outcomes.Once a diagnosis of multiple myeloma has been made, risk stratification is the next step, as discussed by Dr. Lee. \"There have been tremendous advancements in the treatment of myeloma over the past 10 to 15 years, mainly due to the approval of new drugs and resulting in a doubling of overall survival,\" he said. Since 2013, the treatment armamentarium has grown to include carfilzomib, pomalidomide , panobinostat (Farydak), daratumumab , ixazomib (Ninlaro), and elotuzumab (Empliciti).The life expectancy of standard-risk myeloma patients is now 10 to 12 years, but this falls to 3 years for patients with high-risk cytogenetics, despite the use of the newest agents. Risk stratification, therefore, is important for prognosis and for identifying candidates for novel treatments and clinical trials. High risk is defined by disease biology ; by phenotype (presence of plasma cell leukemia or extramedullary disease); by disease burden ; and by response to therapy.A number of chromosomal translocations, deletions, and amplifications have prognostic significance, particularly those involving the IgH heavy chain locus on chromosome number 14 and hyperdiploidy. Abnormalities of note include deletions 17p and 1p and translocations  and . Identification of these abnormalities by FISH is a critical part of risk stratification. The risk stratification approach is staging via the myeloma International Staging System (ISS), which was revised in 2015 to incorporate FISH studies. The IMWG has produced a simple table for risk stratification that is useful to clinicians .With many options available now, how do clinicians select an initial therapy for a newly diagnosed patient? The first question is whether the patient is a candidate for autologous stem cell transplant. The next step is to determine which frontline therapy should be used beforehand, Dr. Richards said. p = .0037), exceeding 34 months. Similarly, in the whole population, overall survival was improved from a median of 64 months with Rd to 75 months with VRd (p = .0250).For upfront treatment, a proteasome inhibitor has proven critical for good long-term outcomes. In SWOG S0777, the triplet of bortezomib (Velcade)/lenalidomide (Revlimid)/dexamethasone (VRd) proved clearly more effective than the lenalidomide/ dexamethasone (Rd) doublet . The oveIn other studies, bortezomib/thalidomide/dexamethasone provided better outcomes than the triplet of bortezomib/cyclophosphamide/dexamethasone (CyBorD), one being the French IFM 2013-04 trial . AnotherCarfilzomib (Kyprolis) is the newer proteasome inhibitor. Two important phase II studies showed that, with carfilzomib combined with Rd, complete or near complete responses were achieved by 52% and 62% of patients, respectively . In one Ongoing trials are comparing these effective triplets, studying VRd in combination with monoclonal antibodies, and asking whether VRd can delay the need for transplant, she added.In patients not eligible for transplant, the use of Rd as maintenance after frontline therapy, given either for 18 months or continuously, proved effective in the FIRST trial . Progres\"So, how do we decide what we\u2019re going to treat our patients with? If the patient is transplant eligible we recommend a triplet regimen. The current standard of care is VRd, but you may want to consider carfilzomib/lenalidomide/dexamethasone (CRd) in patients with high-risk disease. You definitely do not want to give melphalan, which can impact your collection of stem cells,\" Dr. Richards advised. \"For those who are transplant ineligible, based on the patient\u2019s frailty and comorbidities you could use a doublet, such as Rd, or you could consider triplet therapy, such as VRd, with maintenance given after initial therapy. You would also want to consider lower doses.\"p < .001). Overall survival at 4 years, however, did not differ significantly, \"suggesting that patients who deferred on their initial stem cell transplant could be salvaged by stem cell transplant later on in their disease course,\" he said.After completion of frontline therapy, is stem cell transplant still needed? With the emergence of many effective novel therapies, myeloma specialists have begun to debate this concept, according to Dr. Lee. The most recent and best study addressing this question is the Dana Farber Cancer Institute/IFM 2009 trial, in which patients received three cycles of VRd with stem cell collection, with or without transplant, plus maintenance lenalidomide . ResultsWhether transplant should be performed upfront or can be delayed is still an \"evolving question,\" he continued. Relevant issues are the role of indefinite maintenance with lenalidomide and its effect on long-term outcomes  and the role of minimal residual disease negativity as a clinically relevant endpoint in deciding upon upfront vs. delayed transplant.Lenalidomide maintenance has become an accepted component of care, based on CALGB 100104 in which maintenance improved progression-free survival by 19 months and improved 3-year overall survival as well . LikewisWhile maintenance with lenalidomide alone is probably sufficient for standard-risk patients, there is a trend toward combining an immunomodulatory drug (IMiD) and proteasome inhibitor for maintenance in high-risk patients. In a phase II study from Emory University, the VRd triplet as maintenance after transplant showed promise for patients with high-risk cytogenetics .\"For relapsed/refractory myeloma, there are many different options now. It\u2019s good news, but it can also be quite overwhelming to patients,\" Dr. Richards commented.In selecting a treatment option, clinicians need to determine the goal of treatment, and then look at the patient\u2019s previous treatment and response to it, duration of remission, previous toxicities, other disease-related factors, and comorbidities. If an appropriate clinical trial is available, this should also be considered.If it is an asymptomatic biochemical relapse in a standard-risk patient, treatment options are more flexible. Patients may do well on observation only, or on a doublet or an all-oral regimen; patients with high-risk disease, on the other hand, warrant prompt intervention. \"When those patients start to relapse, they take off very quickly,\" she noted. For patients displaying an aggressive clinical relapse, a daratumumab- or a carfilzomib-based regimen can be considered. Treatment should always be tailored in a way that balances efficacy with quality of life and adheres to the patient\u2019s goals, Dr. Richards emphasized.p = .0001; p = .01; The National Comprehensive Cancer Network has listed a number of triplets as its preferred regimens for relapsed disease, and one doublet, carfilzomib/dexamethasone. In the ENDEAVOR trial, carfilzomib/dexamethasone was superior to bortezomib/dexamethasone, including in high-risk patients, who achieved a 15.5% complete response rate vs. 4.4% with bortezomib/dexamethasone . But wheCarfilzomib/pomalidomide/dexamethasone has also been shown to improve outcomes in high-risk patients. In one study , MM-003,p < .001; For relapsed/refractory multiple myeloma, the monoclonal antibodies\u2014daratumumab and elotuzumab\u2014represent a significant advancement in treatment, Dr. Lee indicated. Elotuzumab was FDA-approved in combination with lenalidomide and dexamethasone based on the ELOQUENT-2 trial, in which response rates were 79% for patients in the elotuzumab arm, vs. 66% with Rd alone, and median progression-free survival was 19.4 vs. 14.9 months . Steps can be taken to greatly mitigate this risk . PremediSince daratumumab can also interfere with red blood cell (RBC) compatibility testing, local blood banks should be alerted to any patients initiated on this drug, and patients should have RBC phenotyping or genotyping prior to starting the drug. Patients should be closely monitored for reactions when receiving an RBC transfusion. There are other special considerations with lab tests  in patients receiving these two monoclonal antibodies, Dr. Lee indicated.These effective agents can be well tolerated, although there are some common side effects, as described by Dr. Richards .Peripheral neuropathy occurs in approximately 75% percent of previously treated patients. Advanced practitioners should be proactive about this toxicity and monitor for it at each visit. Better than using \"descriptors,\" she said, is telling patients \" \u2019Take note of what your hands and feet feel like right now and if that changes, then call so that I can assess you and determine if this is something that we need to be concerned about.\u2019 But don\u2019t just take the patient\u2019s word for it; we know they hide their symptoms. Do your physical exam and look at how they\u2019re walking, test their muscle strength, and make sure they have fine motor movement,\" she advised.The development of neuropathy signals the need for immediate dose adjustment. \"We tend to think about grade 1 as not a big deal, but it\u2019s actually like having your leg asleep all the time. If we dose adjust early, then we can prevent that from worsening,\" she pointed out. Neuropathy risk is less with subcutaneous bortezomib, carfilzomib, and ixazomib, than with intravenous bortezomib.Patients with neuropathy should be assessed for vitamin B12, B6, and folate deficiency (which can cause it). Gabapentin, pregabalin, duloxetine, acupuncture, physical therapy, and aquatherapy may be helpful, and there is some evidence that glutamine is preventive, she added.Also seen with proteasome inhibitors is an increased risk of herpes zoster. Prophylaxis with valacyclovir or acyclovir is critical, and patients must be instructed to stay on these antivirals. Patients with renal insufficiency should be given intravenous fluids prior to dosing with carfilzomib, but watch for fluid overload; the recommended amount is 250 mL. When creatinine clearance is < 30 mL/min, ixazomib should be dose-reduced. Renal function should also be monitored in patients taking carfilzomib, she said.With IMiDs, fatigue, gastrointestinal problems, thrombocytopenia, neutropenia, peripheral neuropathy, renal dysfunction, peripheral neuropathy, and rash can be issues. Rash, which occurs in up to 20% of patients on IMiDs, can be mitigated with the combination of cetirizine, ranitidine, and L-lysine, after stopping the lenalidomide. When rash resolves, many patients can be restarted on the same initial dose, without recurrence.Risk for thromboembolic events is high in all cancer patients; clinicians should look for other risk factors and anticoagulate with a daily aspirin, full-dose warfarin, or low-molecular-weight heparin. Since risk factors for thromboembolism can change over time, reassessment is important. Patients should know the symptoms and be encouraged to be mobile.For a number of reasons, myeloma patients have a 7-fold increased risk for bacterial infections and a 10-fold risk for viral infections. \"Be aware of this risk,\" Dr. Richards emphasized. In patients with frequent infections, risk can sometimes be reduced by monthly intravenous immunoglobulin treatment and by antibiotic prophylaxis. Patients receiving a proteasome inhibitor or a monoclonal antibody should also be on antiviral prophylaxis. Patients should receive appropriate vaccines (including flu vaccine and pneumonia vaccines), but not live vaccines.Patients should understand the importance of proper handwashing and should avoid people who are ill . Patients traveling outside of the country should be immunized appropriately.Patients must understand the importance of staying on their medications, and of recognizing and reporting adverse events so that doses can be modified. \"You want to reinforce the rationale for the ongoing treatment plan. It\u2019s important that patients understand that if we can keep them on therapy, even at a reduced dose, that\u2019s better than them not taking their medication or skipping doses,\" Dr. Richards said.Medication calendars, especially for patients on all-oral regimens, can be very helpful to patients and caregivers. She also told listeners to watch for treatment fatigue in their patients, and be willing to discuss treatment breaks when the disease is stable. Practitioners should also be aware that financial issues can be barriers to adherence, as can depression.With multiple drugs available, treatment can to some degree be tailored to the patient, Dr. Richards continued. For example, for a patient with preexisting neuropathy, a carfilzomib-based regimen may be preferred over bortezomib. For a patient with cardiomyopathy, a bortezomib-based regimen may be safer than carfilzomib. For a patient with renal failure, one might consider CyBorD to induce a rapid response. For patients with diabetes, the engagement of the primary care provider or endocrinologist is important, since steroids can cause diabetes. Patients with a history of bleeding should probably avoid an IMiD plus dexamethasone in favor of a proteasome inhibitor plus alkylating agent, which will avoid the need for thromboprophylaxis."}
{"text": "Zea mays L.) varieties could be facilitated by a greater understanding of the natural variation underlying kernel color, including as it relates to carotenoid biosynthesis and retention in maize grain. Greater abundance of carotenoids in maize kernels is generally accompanied by deeper orange color, useful for distinguishing provitamin A-dense varieties to consumers. While kernel color can be scored and selected with high-throughput, low-cost phenotypic methods within breeding selection programs, it remains to be well established as to what would be the logical genetic loci to target for selection for kernel color. We conducted a genome-wide association study of maize kernel color, as determined by colorimetry, in 1,651 yellow and orange inbreds from the Ames maize inbred panel. Associations were found with y1, encoding the first committed step in carotenoid biosynthesis, and with dxs2, which encodes the enzyme responsible for the first committed step in the biosynthesis of the isoprenoid precursors of carotenoids. These genes logically could contribute to overall carotenoid abundance and thus kernel color. The lcyE and zep1 genes, which can affect carotenoid composition, were also found to be associated with colorimeter values. A pathway-level analysis, focused on genes with a priori evidence of involvement in carotenoid biosynthesis and retention, revealed associations for dxs3 and dmes1, involved in isoprenoid biosynthesis; ps1 and vp5, within the core carotenoid pathway; and vp14, involved in cleavage of carotenoids. Collectively, these identified genes appear relevant to the accumulation of kernel color.Rapid development and adoption of biofortified, provitamin A-dense orange maize ( Malnutrition, or hidden hunger, remains a serious issue, even as increased agricultural productivity has helped to provide more energy and calories on a global scale . As muchFor biofortification to be effective, micronutrient densities must reach levels that impact human health, and the varieties and final food products must be acceptable to growers and consumers. Through decades of technical and broader contextual work, the international breeding organizations of CIMMYT, IITA and HarvestPlus, and partners have achieved the successful development of provitamin A-dense maize varieties, nearing target nutrient levels, which also have local and regional adaptation and relevance (cis-epoxycarotenoid dioxygenases (NCEDs), including strigolactones, abscisic acid (ABA), and various aromatic volatile compounds  is formed by deoxy-xylulose 5-phosphate synthase (DXS) in the first step of the non-mevalonate  pathway for isoprenoid biosynthesis in plastids. Seven more reactions are needed for the formation of the immediate carotenoid precursor, geranylgeranyl pyrophosphate (GGPP) from isopentenyl pyrophosphate (IPP)  Hirschb Hirschb. A numbea priori candidates for the genetic control of kernel color, given that their gene action could feasibly impact the hue and/or intensity of maize endosperm coloration.Many carotenoid compounds have yellow-to-red coloration dependent on functional groups and the length of their conjugated double bond systems , though Carotenoid composition, or relative abundance of individual carotenoid compounds, is typically quantified using high-performance liquid chromatography (HPLC). However, HPLC is cost- and labor-intensive and may not be amenable to the high-throughput measurements called for in certain stages of a breeding program . For exaGradation in orange kernel color was previously visually scored on an ordinal scale, on bulks of kernels sampled from maize ears of 10 recombinant inbred line (RIL) families of the U.S. maize nested association mapping (NAM) population (L*a*b*) system is based on color-opponent theory, or color being perceived by the following pairs of opposites  to facilitate pollination, harvesting and phenotyping efforts. Each set was arranged in a 20 \u00d7 24 incomplete block design. Each block within each set was augmented with an experiment-wide check line (B73) plot in a random position, and six other check lines of varying maturities based on flowering time  were included twice per block in random positions. An experimental unit consisted of a one-row plot, 3.81 m in length containing approximately 15 plants. Plots had a spacing between rows of 0.762 m. Efforts were made to hand-pollinate up to six plants per plot. Self-pollinated ears were hand-harvested and dried for 72 h with forced hot air. After drying, ears were stored away from light in burlap sacks at ambient winter temperatures in West Lafayette, IN, for up to four months until measurements could be taken.We grew a 2,448 experimental inbred line subset of a population consisting of 2,815 maize inbred lines maintained by the National Plant Germplasm System . We will use the term colorimeter and colorimetry henceforth. The color values L*, a*, b*, and hue (h) were measured. Chroma (C*) values were not provided by the colorimeter, thus this value was calculated according to the formula Chroma = (a*2 + b*2)1/2 1/2 . These mijklmnY is an individual phenotypic observation; \u03bc represents the grand mean; checki is the effect of check i; genotypej is the effect of experimental genotype (non-check line) j; yeark is the effect of the year k; genotype \u00d7 yearjk is the effect of the interaction between genotype j and year k; set(year)kl is the effect of set l within year k; row(year)lm is the effect of row m within year l; block(set \u00d7 year)kln is the effect of block n within set l within year k; and \u03b5ijklmn is the residual (or random error term) for individual phenotypic observation n. The residuals were assumed to be independent and identically distributed, normal random variables with mean zero and variance \u03c3\u03b52; that is, \u223ciid N. The Kenward-Roger approximation was applied to calculate degrees of freedom . Studentized deleted residuals  between the BLUP values for each pair of colorimeter traits was calculated to assess the degree of their association (at \u03b1 = 0.05), using the \u2018cor\u2019 function in R version 3.5.1  was obtained for a*, b*, and C*.Prior to conducting the GWAS, the Box-Cox power transformation  was usedhttp://datacommons.cyverse.org/browse/iplant/home/shared/panzea/genotypes/GBS/v27). Additional quality filters were imposed to retain SNPs with a call rate greater than 70%, minor allele frequency (MAF) greater than 2%, and inbreeding coefficient greater than 80%, resulting in a final dataset of 268,006 high-quality SNPs. In addition, inbred lines with a call rate lower than 40% were excluded, given that missing genotype scores were still present in the SNP data set after partial imputation.A GWAS was conducted for each of the five traits using the single-nucleotide polymorphism (SNP) data set developed using the genotyping-by-sequencing (GBS) platform for the Ames panel (2R statistic (2RLR)   was usedArabidopsis thaliana, and was previously used for a pathway-level analysis of carotenoid HPLC measurements in a small (n = 201) maize association panel (z-iso) and homogentisate solanesyl transferase (w3), are referred to as pathway genes or a priori candidate genes in this study. Pathway-level analysis was used to reduce the number of association tests conducted, thus using a priori knowledge of the pathway to reduce the magnitude of the correction used to control the FDR at 5% . The SNP marker data are available on CyVerse as previously specified, and accession names are listed in Tables S1 and S2. Supplemental material available at FigShare: L* (r = 0.75) and negatively correlated with a* (r = -0.94). Chroma and b* values were strongly positively correlated (r = 0.99) , given the larger magnitude of b* relative to a* and the equal weighting of these two traits in the calculation of Chroma, whereas a* values corresponded more to hue (perceived color) in this data set.All of the colorimeter traits were highly heritable, with line-mean heritabilities ranging from 0.75 to 0.89 . Hue val = 0.99) . This coP-value of 5% (Table S3). Manhattan plots for each trait are presented in Figure S1. Associations were detected for two genes involved in the provision of substrate for carotenoid biosynthesis. A single SNP was detected within  a gene encoding 1-deoxy-D-xylulose 5-phosphate synthase (dxs2), the first and committed step in the MEP pathway, with significant associations for a* and hue (a* were detected within a gene encoding phytoene synthase (y1), the first and committed step in the biosynthesis of carotenoids.A total of 27 unique SNPs were identified in GWAS for the five kernel colorimeter traits at an FDR-adjusted  and hue . Two SNPlcyE), which affects the partitioning of substrate into the \u03b1- and \u03b2- branches of the carotenoid pathway. A significant SNP associated with a* was located near the gene encoding zeaxanthin epoxidase (zep1), approximately 25 kb downstream of the gene. Zeaxanthin epoxidase converts zeaxanthin to antheraxanthin and subsequently violaxanthin, all within the \u03b2-branch of the pathway.Two genes in the core carotenoid pathway were also identified. Two significant SNP associations were detected for hue within the gene encoding lycopene \u03b5-cyclase . The product of this gene model was found to have 96% identity at the protein level with cytochrome P450 14 . Three other significant SNPs for a* were proximal to a gene that encodes isopentenyl transferase  and is expressed in the endosperm of B73 , the penultimate enzyme in glycolysis. This gene was highly expressed in endosperm of B73 . Two SNPs were significant for hue in the vicinity of 4-diphosphocytidyl-2C-methyl-D-erythritol synthase , another gene in the MEP pathway. Within the core carotenoid pathway, two additional genes were identified for a*: lycopene \u03b2-cyclase  and phytoene desaturase . Finally, a gene related to carotenoid cleavage, encoding 9-cis-epoxycarotenoid dioxygenase (NCED) , was identified for L*.Additional associations were identified through pathway analysis in regions proximal to a number of genes not identified in GWAS. An association was found for Chroma in the vicinity of another gene that encodes DXS , a gene that controls the first committed step in carotenoid biosynthesis  is separate vs. coordinated.Although joint linkage analysis of visual color score data detected a QTL in the vicinity of lcyE and zep1\u2014genes affecting flux within and through the core carotenoid pathway\u2014were identified both in this study of kernel color and in the prior study of carotenoid HPLC values in the Goodman-Buckler panel  have 11 conjugated double bonds and correspondingly have lower a* values and higher b* values than \u03b1-carotene and lutein, which have 10 conjugated double bonds  as well as lutein, zeaxanthin, total \u03b1-xanthophylls, and total \u03b2-xanthophylls. An allele of lcyE with reduced expression was found to result in the formation of fewer \u03b5-rings and a reduction in \u03b1-branch compounds relative to \u03b2-branch compounds  in the present study suggests that kernel color can be utilized to select for greater carotenoid abundance in general. However, the simultaneous identification of lcyE and zep1 (genes involved in carotenoid composition) suggests that the relative abundance of individual carotenoid compounds is likely to also be affected when selecting on kernel color. Therefore, the levels of individual carotenoid compounds will need to be monitored when colorimetry is applied as an early selection tool for lines having favorable orange color, to ensure that the favorable genetic variants needed for the maintenance or improvement of provitamin A levels are also retained. For example, the concentrations of the more abundant provitamin A carotenoids in maize grain, \u03b2-carotene and \u03b2-cryptoxanthin, might be increased simultaneously with orange kernel color if substrate were to be modulated via lcyE to flow preferentially through the \u03b2-branch of the pathway. Alternatively or in addition, favorable alleles of the gene encoding \u03b2-carotene hydroxylase (crtRB1), which converts \u03b2-carotene to \u03b2-cryptoxanthin to zeaxanthin, could be selected that favor accumulation and retention of these provitamin A compounds while also producing sufficient zeaxanthin to obtain the vivid orange color.Taken together, the identification of vs. starchy endosperm layers \u2014has many potential metabolic routes. Nevertheless, the action of enolase resides only two steps prior to that of DXS (which takes pyruvate as one of its substrates), and PEP is an important precursor for isoprenoid biosynthesis. An engineering strategy in E. coli that increased PEP concentrations was found to elevate levels of lycopene, the carotenoid compound that sits at the pathway branch point , its activity has been found in maize to affect the distribution of aleurone m layers . Certainm layers . The findxs3 suggests that this gene, in addition to dxs2, may play a role in the accumulation of carotenoids in the maize kernel. An association was found with dmes2, which encodes 4-diphosphocytidyl-2C-methyl-D-erythritol synthase, the third step in the MEP pathway. The gene encoding this enzyme in A. thaliana, present in a single copy and termed MCT, has been found along with certain other MEP pathway genes to have very low seed expression levels in certain developmental stages, in a manner that may be limiting to carotenoid biosynthesis  locus in maize  was not contained in the QTL support interval identified on chromosome 9 , the macrotransposon insertion that created Wc was subsequently characterized in Wc was only significant in two of the 10 NAM families analyzed . This dispersion could present particular difficulties for the detection of genetic signal in the presence of low SNP coverage and/or rare variation. Finally, given that only lines with yellow to orange endosperm were analyzed in this study, it could be that the variation in ccd1 copy number was too constrained , which corresponds to pure red, with the +b* axis (at 90\u00b0) corresponding to pure yellow. The hue angles observed in this study ranged from 61.78 to 93.08\u00b0 (Notably, o 93.08\u00b0 . Given ty1 and dxs2, in conjunction with the previously established alleles of lcyE and crtRB1, provide a logical and promising strategy for the rapid development of provitamin A-dense maize lines that also produce a recognizable and desirable orange kernel color.Further studies are needed to determine whether natural variation at the loci identified in these analyses corresponds to differences in transcription levels, post-translational regulation, and/or enzyme activity. A GWAS using kernel color phenotypes and HPLC-based carotenoid values for the same set of materials may enable the identification of alleles that are favorable for kernel color as well as carotenoid composition and concentration. An increasing knowledge of the genetic mechanisms affecting kernel color, and the potential relationships between color values and carotenoid values, will be useful in coordinating breeding efforts to improve both sets of phenotypes. Establishing optimal ranges for each colorimeter trait for use in a selection index could provide a useful and inexpensive breeding tool, particularly to screen for kernel color and total carotenoid levels in the early stages of breeding. Some of the evaluation, selection, and elimination could potentially be done while the ears are still on the plants, or in a harvest pile at the end of a nursery row. This would save labor and reduce handling of non-selected ears. Selection of favorable alleles of the loci detected in this study, particularly"}
{"text": "Total gonads carotenoid varied seasonally, with the highest level being observed in males during spawning season. Echinenone was the main pigment present in gonads, showing highest concentrations in males during spawning and gonad recovering. During the growing and early maturation period gonads were more reddish, yellowish and brighter, as well as more firm, irrespectively of the sex. Based on all seasonal changes affecting gonad yield and quality, the period between November and February seems the most suitable to harvest high quality gonads in the Atlantic coast of Portugal.Sea urchin population harvest in the North Atlantic coast of Portugal was characterized in terms of gonad yield, nutritional composition and important market-related traits, over one reproductive cycle (March 2016 to March 2017). Most of the quality attributes showed a seasonal variation strongly dependent on sea urchin sex. Maximum gonad yield (18%) was observed in March 2017. A single spawning event occurred between May and July. Gonads are rich sources of protein (12\u201318% WW) with low fat content (\u22646% WW), that increase during the gametogenic stages of recovery and growing (November-December). Polyunsaturated fatty acids were the dominant class in both sexes (4.2\u201314.7\u2009mg.g The global volume of sea urchin captures in 2016 reached 28575 tonnes, whilst farming has further contributed with 10057 tonnes2. Japan is an important driver of sea urchin market and represents 75% of total imports (11116 tonnes) of major sea urchin product forms  estimated in 14739 tonnes in 20162. Urchin roe can reach a high commercial value as demand often exceeds the market supply. Recently, excessive exploitation and destructive harvesting methods have caused the depletion of wild stocks3.Sea urchin gonads (roe) are a prized and gourmet seafood delicacy, due to its unique flavourParacentrotus lividus has being intensively harvested in most of its geographical range, throughout the Mediterranean Sea and the North eastern Atlantic, from Scotland (northern) to Canary Islands (southern)4. In Europe, the natural stocks found in France, Italy and Spain are considered overexploited, even so intensive harvesting is still occurring: in the North regions of Spain landings reached 520 tonnes in 20145. In Portugal, P. lividus is the dominant echinoid species in the rocky shores6 and landings are mainly concentrated in the North Atlantic coast (Viana do Castelo) where harvests reached 28 tonnes in 20157. Commercial harvesting has increased over the last decade, which might reflect the demand to supply markets of nearby regions, such as North Spain8.The sea urchin 9. A premium gonad is characterized by its size combined with specific sensory traits sought by the consumers . Desirable gonads present a bright yellowish-orange colour10, umami taste11, firm texture and high freshness12. However, gonads size and sensory traits largely depend on several factors, namely: (i) sea urchin species, (ii) gonads maturation stage (reproductive cycle), (iii) environmental cues  and (iv) animal nutritional status .The main market for sea urchin gonads is Japan where the price for fresh gonads is considerable higher than for frozen or dried/salted; fresh roe can reach 40\u2013100\u20ac/kgP. lividus reproduction follows a predictable seasonal pattern characterized by six gametogenic stages13. The annual reproductive cycle of this species can present one or two spawning seasons, depending on the habitat, latitudinal location and environmental conditions to which populations are subjected to4. Some studies have investigated the role of exogenous factors, such as temperature, photoperiod and primary production in sea urchin gametogenesis and spawning. However, it has been suggested that the environmental cues that trigger spawning may differ from those that stimulate gonadal growth and development14. Byrne13 observed that temperatures lower than 13\u2009\u00b0C may inhibit spawning of P. lividus populations in Ireland. Shpigel, et al.15 reported that short days and increasing temperatures (18\u201322\u2009\u00b0C) enhanced gonad development and gametogenesis, while Spirlet, et al.16, Spirlet, et al.17 suggested that the spawning event may be triggered by shorter day-length. Latitudinal patterns can also be found in echinoids reproductive cycles, the gonad index of P. lividus showed a clear geographical trend with the Atlantic populations reaching higher GSI than the Mediterranean populations18.14. Gonads are preferentially consumed before the beginning of gametogenesis, when their nutritive phagocytes are in maximum volume and rich in nutrients, attributes that contribute to a sweeter flavour and firmer texture. Once gametogenesis begins, the taste and texture of gonads deteriorates, mainly due to the utilization of yolk protein into synthesis of new compounds19.During the reproductive cycle, gonads from both females and males increase in size (yield) over two distinct periods: before gametogenesis, when nutrient reserves are stored in the nutritive phagocytes, and during gametogenesis, when increased number and size of gametes is observed10. Gonad echinenone content is limited by the availability, uptake and bioconversion of \u03b2-carotene from dietary sources, in particular from algae21. The consumption of different algae with different carotenoid profiles influences the concentration of pigments present in sea urchins22. Also, diet type  can drastically influence not only the biochemical composition of gonads but also their organoleptic properties, such as flavour and texture23.Gonad colour is a pivotal factor determining its quality and marketability. The desirable yellow-orange colour is determined by carotenoids deposited in the gonads, mainly the accumulation of echinenone that is its dominant pigment24, ecological25 and conservational8 issues of Portuguese populations of P. lividus, little is known about important market-related traits of this high valued species and its potential to commercialization. This study aims to characterize the seasonal variations of P. lividus gonads in terms of maximum yield, nutritional value, colour and texture over one reproductive cycle. The possible relationship between sex, season and gametogenic cycle and selected market-related traits was discussed, for the first time in a wild population, and the best period to harvest high quality gonads in the North Atlantic coast of Portugal was determined.To date, apart from a few studies focusing environmental26Detailed data on sea water temperature was obtained through daily records of an oceanic buoy located close to our study area. The annual variation of water temperature was minor and ranged between 11.8\u201316.4\u2009\u00b0C Fig.\u00a0. TemperaP\u2009\u2265\u20090.05). This evidences a size-class consistency in the evaluated sea urchin groups, allowing a direct comparison of gonadal quality traits over the 13-month period. Gonad weight decreased to almost half of its value from March-16 to June , then slowly increased until March-17 (15\u2009\u00b1\u20093.3\u2009g), consequently affecting GSI values over the year. The annual reproductive cycle of P. lividus population from Praia Norte is presented in Fig.\u00a0P\u2009<\u20090.05), but was similar between sexes  and test diameter (6.4\u2009\u00b1\u20090.4\u2009cm) of all sampled animals were not significantly different over time . Lipid content of gonads . Again, gonad energy was at minimum levels during spawning (3\u20134\u2009kJ/g WW), and achieved maximum content (7\u2009kJ/g WW) in November, during growing. Both sexes showed similar moisture content, ranging from 66 to 81% over the year  and peaked in June during spawning , followed by saturated fatty acids (SFA) (2.3\u201311.0\u2009mg.g\u22121 WW) and monounsaturated fatty acids (MUFA) (2.2\u20137.7\u2009mg.g\u22121 WW). The most represented PUFA was 20:5n-3 (EPA), varying between 1.5\u20134.8\u2009mg.g\u22121 WW followed by 20:4n-6 , 18:4n-3 (0.1\u20132.5\u2009mg.g\u22121 WW) and 18:3n-3 . Reduced amounts of 22:6n-3  were found in gonads of both sexes. Females had significantly higher levels of PUFA than males, particularly from the n-3 family (P\u2009<\u20090.05), however both DHA and ARA levels were similar between sexes (P\u2009\u2265\u20090.05). As a reference for the consumption of seafood as part of a healthy diet, the levels of EPA\u2009+\u2009DHA in fresh gonads varied between 1.5\u20134.9\u2009mg/g, being highest in November for both sexes. Most PUFA showed a seasonal variation in their content, being generally higher in November during gonad growth (stage II). Among SFA, the main compounds were 16:0 (1.3\u20136.2\u2009mg.g\u22121 WW), 14:0 (0.5\u20133.3\u2009mg.g\u22121 WW) and 18:0 (0.3\u20130.7\u2009mg.g\u22121 WW). Total SFA were significantly higher in females than males, and in November compared to the other months (P\u2009<\u20090.05). MUFA were mainly represented by 20:1n-9 (0.6\u20131.8\u2009mg.g\u22121 WW), 20:1n-11 (0.5\u20131.5\u2009mg.g\u22121 WW) and 18:1n-7 (0.3\u20131.2\u2009mg.g\u22121 WW), which were in higher amount in female gonads and preferentially concentrated in November (growing stage of gonads) (P\u2009<\u20090.05). A positive correlation was found between total lipids and EPA and DHA levels . EPA and ARA were negatively correlated to L* (r\u2009=\u2009\u22120.58 and \u22120.48) and positively correlated to \u03b2-carotene  composition of female and male gonads of P. lividus gonads is presented in Fig.\u00a0P\u2009<\u20090.05, Supplementary Table\u00a0P\u2009<\u20090.05, Fig.\u00a0The seasonal variation of colour parameters lightness (L*), redness (a*) and yellowness (b*) in P. lividus is presented in Fig.\u00a0\u22121 WW) during the spawning period when compared to February-March 2017 (61 to 72\u2009\u00b5g.g\u22121 WW), months prior to spawning characterized by high GSI values. By contrast, levels of total carotenoids did not vary significantly in females (61 to 103\u2009\u00b5g.g\u22121 WW) over the 13-month period. A negative correlation  compared to females. \u03b2-cryptoxanthin was the second highest pigment in gonads; it had similar levels in both sexes (P\u2009\u2265\u20090.05) and evidenced a seasonal variation  levels of \u03b2-carotene decreased to 10.88\u2009\u00b5g.g\u22121 WW, while in September (after spawning) levels peaked up to 26.58\u2009\u00b5g.g\u22121 WW. The less abundant pigment in gonads was \u03b1-carotene (0.3\u20132.2\u2009\u00b5g.g\u22121 WW), levels were significantly higher in male than in female gonads and peaked in June (during spawning). Females showed significantly higher amount of lutein pigment (0.5\u20138.7\u2009\u00b5g.g\u22121 WW) compared to males (0.9\u20134.0\u2009\u00b5g.g\u22121 WW), and the interaction between sex and month was found significant (P\u2009<\u20090.05). Lutein levels in females were higher from April to September, before and after spawning occurred.Five carotenoid pigments were identified and quantified in the gonads of both sexes: \u03b1-, \u03b2-carotene, echinenone, lutein and \u03b2-cryptoxanthin. Levels of individual pigments are shown in Table\u00a0P\u2009=\u20090.56). \u03b2-carotene levels were positively correlated with both total carotenoid and \u03b1-carotene content in gonads (r\u2009=\u20090.71 and 0.44). Also, \u03b1- carotene was negatively correlated to GSI , coinciding with the rise of seawater temperatures up to its maximum value (16.4\u2009\u00b0C). Spirlet, et al.16 pointed that populations of echinoids from temperate waters exhibit similar reproductive patterns: nutrient storage during Fall and Winter followed by a long spawning season during late Spring and Summer. A single annual spawning season was also described in populations from the Atlantic cost of France, Ireland and Spain27 and in the Mediterranean Sea28. However, the occurrence of two spawning events during an annual cycle has been described for P. lividus in the Mediterranean Sea29 and in the central West coast of Portugal6, where seawater temperatures are usually higher than those reported in presently studied area.Different aspects of the reproductive cycle of 6. The differences found in the two Portuguese populations might be explained by local environmental conditions, habitat and seasonality factors. According to Our\u00e9ns, et al.18, the GSI values of P. lividus show a geographical trend, where the Atlantic populations reach higher values than the Mediterranean ones. Also, a latitudinal pattern in the Atlantic populations was described, with higher GSI values at higher latitudes. Environmental cues such as food availability and quality, sea water temperature or/and photoperiod have been suggested to modulate P. lividus reproductive potential4. Interestingly, in this study, the mean GSI value observed at March-16 (9%) varied considerably from that observed in march-17 (17%). Since sea water temperature (mean of 12.5\u2009\u00b0C) and day-length (mean of 12\u2009h light) followed a quite similar variation pattern in these particular months, it is possible that changes in food availability or food type could have affected the development and maturation of gonads and thus partially explain the marked variation on GSI values.In this study, the highest GSI value (18%) observed in March 2017 was almost 2.5 times greater than the highest value registered in a southern population (8%) of PortugalP. lividus populations from Portugal6, Ireland13 and Mediterranean Sea30. Sellem and Guillou31 highlighted the importance of using histological analysis to interpret GSI variation; these authors related punctual decreases of GSI values with changes in gonad reserves rather to gamete release. However, changes in the GSI observed over the study period, namely gonad size and weight, followed the gonad maturation pattern described by histological analysis: an increase of size was observed during the growing (II) stage due to nutrient storage in the non-germinal cells, continued until reaching the maximum yield at maturation (IV) stage then, with spawning, gonads became smaller and empty in content (stages V and VI).GSI showed a seasonal variation, but did not differ between sexes. Similar results were observed in other P. lividus gonads showed a clear seasonal variation also varying with sex. Protein was the major component of gonads, ranging between 12\u201318% WW while total lipid content was considered low (\u22646% WW). All biochemical parameters were within the range of values previously reported for P. lividus32. Moreover, the seasonal variation of nutrient content in gonads reflected the reproductive cycle. Previous reports showed that the best period to harvest gonads with high nutritional quality and commercial value is during the growing period, generally prior to the onset of gametogenesis, when the nutritive phagocytes are full33 and accumulate higher levels of protein, lipid and carbohydrates34. In the present study we observed that gonads reached their highest content of protein, lipid and energy in November  and maintained this high nutritional value until January-February , before full maturation of gametes, suggesting this period as desirable for harvesting nutrient-rich gonads. Afterwards, when gonads were mature and peaked their GSI (March-17), their nutritive content started decreasing, in terms of lipids and energy, reinforcing that gonad quality deteriorates with gametes development. Changes in the biochemical content of gonads can impair their flavour, leading to a loss of economic value. Murata, et al.35 described that mature ovaries of Hemicentrotus pulcherrimus had a bitter taste, which was strongly correlated with the presence of a novel sulfur-containing amino acid, pulcherrimine. Furthermore, it was shown that the yolk protein stored in nutritive phagocytes is used during gametogenesis to synthesize new proteins and other nitrogen substances19, which might contribute to changes in gonad flavour. Despite these observations, no correlation could be found between the biochemical components of gonad and the GSI (which reflected gametogenic stages), confirming previous observations by Montero-Torreiro and Garcia-Martinez27. Likewise in many other species, the nutritional composition of edible tissues (gonads) seems to be highly dependent on sea urchin diet36. Changes on feed type and abundance throughout the year may affect the assimilation of nutrients and modify gonad composition. Moreover, recent studies have evaluated the effect of natural  and formulated diets on P. lividus gonad biochemical composition38 in order to promote the production of high valued gonads.The biochemical composition of P. lividus gonads was in general agreement with data reported in the literature40. But only a few of these studies discern sex as factor, mostly focusing on the effects of season or diet. Mart\u00ednez-Pita, et al.39 found differences in the FA profile of ovary and testis of P. lividus: females showed higher levels of 14:0, LA and ALA whereas males exhibited higher levels of 18:0 and ARA; in terms of FA classes, only SFA differed between sexes, being higher in females. These authors also observed differences in the FA profile of two distinct populations, which suggested that environmental factors, such as food source, may influence the gonad FA profile of individuals of the same sex. The source and availably of food, as well as other site-associated factors, should be taken into consideration when results are being compared with the literature, since it may mask the effects of sex or season. In our work, females showed much higher concentrations of PUFA, MUFA and SFA compared to males, and although concentrations were within the expected values for sea urchins, the variation between sexes was more pronounced compared to other studies of P. lividus39 and Psammechinus miliaris41.The FA profile of P. lividus male and female gonads, has been presented for a wild population. The seasonal effect on FA composition of gonads was clear; females and males had preferentially higher concentrations of the sum of PUFA, MUFA and SFA classes in November, which was coincident with the period of gonad growth (stage II), when the gonads were richer in nutrients. It was possible to relate the season factor with the gametogenic cycle, yet no correlation was found between GSI and any FA in gonads. Carboni, et al.37 showed that the FA profile of P. lividus (without sex distinction) changed during gametogenesis, however differences were related to dietary lipid intake and not to seasonality. As previously discussed, diet has an important role in determining the nutritional composition of gonads36. Sea urchins are generalist grazers, but they often prefer feeding on large kelp (Laminaria ps.) species. The selective ingestion of certain macro algae and their respective nutritional value, have certainly contributed to modulate the FA content of sea urchin gonads once macro algae are rich in PUFA, particularly in EPA42. A recent study conducted in the North coast of Portugal with Laminaria ochroleuca, an algae consumed by P. lividus4, showed a seasonal pattern of growth and reproduction for this algae43. Interestingly, L. ochroleuca accumulated more nutrients during its growth period (winter)43, which was coincident with the increase of nutrient content of gonads, namely FA.To our knowledge, this is the first time that effects of sex/season/gametogenic cycle on FA composition of 41. In contrast, ARA and DHA levels only suffered a seasonal variation, being more concentrated in November, in both males and females. The recommended daily consumption of EPA\u2009+\u2009DHA to decrease the risk of cardiovascular diseases in humans is between 0.25-0.5\u2009g44. If sea urchins are consumed during the period of highest concentration of PUFA in gonads (the growing stage in November) an intake of 50\u2009g of P. lividus (around 5 adults) can provide near 0.245\u2009g of EPA\u2009+\u2009DHA, which covers the daily recommended dose to promote human health, reinforcing the nutritional importance of sea urchin.Regarding the most relevant PUFA, EPA was preferentially accumulated in the ovary and levels decreased with increasing maturity stage, from September-November to February 2017. Previous studies have reported a trend of EPA accumulation in the gonads of sea urchins46. The results obtained by the CIE L*a*b* system were within the range of values reported for wild P. lividus fed on macroalgae. Seasonal changes in gonad colour were also reported for Strongylocentrotus franciscanus12 and S. droebachiensis1, which may be related to changes in gonad yield and possibly maturation stage (gametogenesis). In the present study, a positive correlation between L*, b* values and the GSI was observed, suggesting that the increase of gonad yield, from the growing to the full maturation stage, led to increased brightness and yellowish colour. Moreover, previous findings in P. lividus showed that gonads during the spawning season had an unacceptable coloration (dark red/brown) whilst during the growing period exhibited an excellent/good coloration (bright orange or yellow)45. In terms of colour, Cook and Kelly47 classified as acceptable to excellent coloration  gonads presenting (mean) values of 42 for L*, 20 for a* and 35 for b*. Our results showed that L* a* and b* values observed, in both sexes, between November (growing stage) and February (pre-mature stage) were similar or higher than those proposed by Cook and Kelly47, suggesting that gonads presented a desirable coloration for market. Additionally, it was also in this period that gonads become nutritionally richer and increased in size, as previously discussed. By combining all these positive features, one can propose the period between November and February as the most suitable to harvest premium gonads. Moreover, colour values decreased at spawning (June), showing some loss of colour quality, as previously observed with the nutrient content.Few studies have evaluated the seasonal variation of gonad colour from wild populations of sea urchins, despite the relevance of this trait for market valorisation. In most cases gonad colour was evaluated visually or instrumentally and without sex differentiationP. lividus45, P. miliaris48 and S. droebachiensis49. Carotenoids are pigments deposited in the gonads however, and according to Symonds, et al.45, acceptability of gonad colour is not directly linked neither with the levels of individual carotenoids nor their ratios found in the gonad. In fact total carotenoids picked after spawning, when gonads are known to be unacceptable for consumers45.Total carotenoids in gonads did not differ between sexes but showed some seasonality. Total carotenoid content varied with gonad maturation stages and followed a similar pattern in several sea urchin species, increasing during spawning (June) probably due to gonad loss of biomass, and decreasing afterwards. This is consistent with previous observations in 45. Moreover, echinenone levels were highest in males after spawning and onset of recovery period (September-November) whereas females showed more steady levels over time. Although no detailed evaluation of carotenoids deposition in gametes (eggs and semen) was performed, the white colour of semen contrasts with the orange coloration of eggs, suggesting that males might have kept most of the carotenoids in their gonads during spawning, that could partly explain their highest concentration after spawning, when gonad volume is strongly reduced. Moreover, males showed a considerable variation of echinenone concentration after spawning, which was also observed by Symonds, et al.45. This is probably related with the high variability in gametogenic stages of males observed post-spawning, that were found at recovery, partly spawned and spent stages. Also, no correlation could be found between echinenone in gonads and L* a* b* parameters, confirming previous observations in P. lividus45 and P. miliaris48. Gonads present a high content of pigments but its biochemical nature failed to be correlated with data obtained by instrumental or sensorial analysis, suggesting that the visual perception of colour may be influenced by other factors, besides carotenoid pigments. In P. lividus, unacceptable gonad coloration was observed with both very low and high levels of echinenone and total carotenoids in gonads45. These results suggest that carotenoids clearly made a contribution towards the red-orange pigmentation of the sea urchin gonad, but other factors may induce the sensorial evaluation of colour. The second major group of pigments present in P. lividus gonads were \u03b2-carotene and \u03b2-cryptoxantin, which only differ seasonally and not between sex. These findings may reinforce the hypothesis that, in P. lividus, echinenone is likely to be formed by bio-conversion of \u03b2-carotene via \u03b2-isocryptoxanthin10 and its metabolism may occur mainly in gonads21. Symonds, et al.45 also identified \u03b2-carotene as the second major group of pigments in P. lividus gonads, but in a different study, Shpigel, et al.20 reported the absence of \u03b2-carotene in gonads of urchins fed with a natural algal diet.Echinenone was the dominant carotenoid in the gonad of both males and females, confirming previous reports for this specieset al.12. These authors demonstrated that S. franciscanus gonads had higher moisture content and softer texture during maturation whereas the opposite was observed during the recovering and growing period, suggesting that gonads firmness was increased by lower moisture content. Few studies determined gonad texture, and were mostly focused on subjective evaluations50 rather than in instrumental analysis using a texture analyser12. The effect of sex in gonad texture was never reported before. Resilience is considered an useful texture measure for market valorisation, since a strong relation between high resilience values and high-quality rated gonads was reported by McBride, et al.12. In the present study, gonads resilience was not affected over time nor differed between sexes, being always higher than 75%. This may suggest that resilience remains acceptable throughout the year cycle.Firmer gonads were observed in November, during the growing period (stage II), whereas in both sexes, lower gonad firmness was observed in September (after spawning), when gonads appear as spent. Firmness was negatively correlated with gonad moisture content (r\u2009=\u2009\u22120.63), being in agreement with McBride, In conclusion, this study clearly demonstrated that most of the evaluated quality attributes were mainly dependent on sea urchin sex, but also showed a seasonal variation. According to the present observations, it is suggested that the best period for commercial harvesting sea urchins in the North Atlantic coast of Portugal is between November and February. During this period, gonads are mainly at the growing and premature stages of gametogenesis, holding a good nutrient storage in their nutritive phagocytes, as demonstrated by the highest levels of protein, lipid, n-3 and n-6 PUFA and energy content, in both males and females. In addition, gonads showed lower moisture content and simultaneously higher firmness, that is a valuable attribute. Also during this period, gonads were found more reddish, yellowish and brighter, irrespectively of the sex, being the values within those considered acceptable and desirable in the European market, were a bright and yellowish-orange gonad is rated premium. Moreover, as it was evidenced that most commercially important traits change seasonally compromising the gonad value, sea urchin production under controlled conditions (echinoculture) can be a sustainable alternative to assure a regular supply of high quality gonads. The present data can be further used to help tailoring new formulated feeds able to produce sea urchins with the desired gonad attributes for international markets.P. lividus were collected at Praia Norte , Portugal, after authorization from the national maritime authority (Captaincy of the Port of Viana do Castelo) and the Portuguese Institute for Nature Conservation and Forests (ICNF). Moreover, the sampling site did not involve protected areas nor endangered/protected species in the Atlantic region, and followed the Portuguese law Portaria n.\u235b 82/2011 on \u201cminimum size for captures and harvesting\u201d, implying that only commercial sized sea urchins (test diameter \u22655\u2009cm) were collected.All animal procedures respecting capture of wild specimens and tissue sampling were previously approved by the CIIMAR ethical committee, in compliance with the European Union Directive 2010/63/EU and the Portuguese law Decreto-Lei n\u235b 113/2013 on \u201cprotection of animals used for scientific purposes\u201d. Wild sea urchins P. lividus were collected between March 2016 and March 2017, by snorkeling in subtidal rocky reefs of Praia Norte, Portugal. Sea temperature records from A Guarda (Spain) oceanic buoy  were obtained from CMEMS (http://marine.copernicus.eu-SST_GLO_SST_L4_NRT_OBSERVATIONS) through AquaSafe by Hidromod (http://www.hidromod.com). Day length data were obtained for Porto city (near our sampling site) and assessed from the Observat\u00f3rio Astron\u00f3nico de Lisboa, University of Lisbon26.Adult 13: recovery (stage I), with primary gametes and nutritive phagocytes; growing (stage II) with clusters of primary gametes and packed nutritive phagocytes, premature (stage III) with gametes at all stages of development and reduced amount of nutritive phagocytes; mature (stage IV) with mature gametes and few nutritive phagocytes; partly spawned (stage V) with loosely packed gametes and depletion of nutritive phagocytes and spent (stage VI) with gonads empty of gametes.Eighteen (N\u2009=\u200918) sea urchins were collected monthly and transported to CIIMAR facilities in seawater. Individual records of test diameter and total wet weight were performed in laboratory; animals were then placed in an ice bath for 30\u2009min before dissection Fig.\u00a0. The fivP. lividus, likewise other sea urchin species, yet both male and female individuals were collected monthly over the 13-month period, without needing any further sampling during the same month. Sex ratio in samplings varied over time: a minimum of seven and maximum of eleven individuals from the same sex were collected , but a ratio of 9:9 female:male (N\u2009=\u200918) was found in the majority of the sampled months ; crude protein (N x 6.25) by a flash combustion technique followed by a gas chromatographic separation and thermal conductivity detection  and gross energy in an adiabatic bomb calorimeter . Total lipids were determined following the method described by Folch, et al.53 with dichloromethane-methanol (2:1) and gravimetric determination.Chemical analyses were run in duplicate, following the AOAC54, as described by Campos, et al.55. To each sample was added 1\u2009mL of internal standard solution . FAME were analysed in duplicate, using a Shimadzu GC-2010 Plus gas chromatograph , equipped with a flame-ionization detector and an Omegawax 250 capillary column . FAME were identified by comparing their retention times with known standards and quantified as mg.g\u22121 of dry biomass, using the internal standard C23:0.The fatty acid methyl esters (FAME) contained in total lipid extracts were transesterified by acidic methylation65. Readings were calibrated against a white tile and three replicate measurements were taken for each gonad and averaged to determine colour parameters.Gonad colour was evaluated instrumentally and by determination of the carotenoid content and profile. Colour was measured by the CIE 1976  method using a CR-400 colorimeter (Konica Minolta) at standard illuminant Det al.45 with some modifications. Briefly, carotenoids from frozen gonad tissue (0.4\u20130.5\u2009g) were extracted, in duplicate, in acetone . After centrifugation at 3500\u2009\u00d7\u2009g for 10\u2009min, at 8\u2009\u00b0C, the supernatant was collected and the extraction procedure was repeated twice to obtain a colourless supernatant. Supernatants were evaporated to dryness under a constant stream of nitrogen, re-suspended in n-hexane and filtered with a 0.2\u2009\u03bcL syringe filter for further analysis. Total carotenoid content was determined in a spectrophotometer , using the absorption maximum in hexane and the extinction coefficient (E1%1cm) of 250056, based in the equation describe by Pocock, et al.57:1%1cm\u2009=\u2009the extinction coefficient of a 1% (w/v) solution in a 1\u2009cm cuvette at a defined wavelength. G\u2009=\u2009sample weight (g).Total carotenoid extraction was performed according to Symonds, \u22121 of gonad biomass.The qualitative and quantitative profile of carotenoids was performed by high-performance liquid chromatography analysis , and was restricted to five sampled months: April, June, September, November 2016 and February 2017, selected to cover the gametogenic stages identified in this study. Each carotenoid extract was suspended in n-hexane and 20\u2009\u03bcL were injected in a reverse phase Acclaim\u2122 C30 LC column  with a mixture of acetonitrile, methanol, dichloromethane, hexane and ammonium acetate  under isocratic conditions . Detection was achieved by a diode array detector  at 454\u2009nm. Retention times and spectra of compounds were analysed by comparison with pure standards and quantification performed by the calibration curves of \u03b1- carotene, \u03b2-carotene, echinenone, , lutein and \u03b2-cryptoxanthin . Data were analysed using the Waters Empower\u2122 2 software and expressed as mg.gAn instrumental evaluation of firmness and resilience properties was performed in gonads using a TA.XT.plus analyser, fitted with a 5\u2009kg load cell and controlled by Exponent v6 software . Firmness was defined as the force (g) required to compress a sample at 25% of its original height (at a 1.7\u2009mm/s) using a 35\u2009mm cylinder probe. Resilience was defined as the capacity of a sample to recover its original height after a compression with the same probe, being determined as: Resilience (%)\u2009=\u2009 \u00d7 100. Briefly, after firmness determination the gonad was compressed up to 60% of its original height and held that position for 2\u2009s. The post-test height was recorded after 15\u2009s. Tests were performed individually in fresh gonads samples in three months of the studied period \u2013 September, November and February \u2013 which represented the recovery (I), growing (II) and premature (III) stages of gametogenesis, respectively. These stages of gametogenesis were selected based on their relevance to gonad quality, since market acceptability is higher before gametes development and spawning.P\u2009<\u20090.05.Data are presented as means and standard deviation. Tests for normality and homogeneity of variances were performed by Kolmogorov-Smirnov and Levene\u2019s tests, respectively. A two-way ANOVA followed by HSD Tukey test, using sex  and month as independent variables, was performed with STATISTICS 6.4 package . Pearson\u2019s correlation was used to relate all parameters, independently of the sex factor. In all cases significant differences were considered when Dataset 1"}
{"text": "To evaluate post-operative complications of circumcision requiring surgical reintervention.st, 2015 to May 31st, 2016. Retrospective analysis of medical records of patients submitted to circumcision from May 1 A total of 2,441 circumcisions were performed; in that, 1,940 using Plastibell and 501 by the classic technique. Complications requiring surgical reintervention were found in 3.27% of patients. When separated by surgical technique, 3.4% of circumcisions using Plastibell device required reoperation, as compared to 3% of conventional technique (p=0.79). Preputial stenosis was most frequently found in classic circumcision, with statistical significance (p<0.001). Bleeding was more frequent when using Plastibell device, but the difference was not statistically different (p=0.37). Patients\u2019 age was also evaluated to investigate if this variable influenced on the postoperative outcome, but no significant difference was found. There was no statistically significant difference when comparing complications between the different techniques performed at this hospital. Preputial stenosis was most frequently found in the classic circumcision, while bleeding was more prevalent when using Plastibell device. Patients\u2019 age did not influence in complications. When age was limited to 1 to 4 years, it was noted that 1.1% of these children were circumcised within this period.2Circumcision is one of the most ancient surgical procedures, and today is frequently performed by pediatric surgeons. In large American reviews, the circumcision rates in newborns can reach up to 61.1%, and many operations are related to cultural indications, and not only for medical reasons.The benefits of surgery include prevention of urinary infection and pyelonephritis, decrease in penile cancer rates, as well as a reduction in sexually transmitted diseases. Nevertheless, like other procedures, it is not exempt from complications.1 Bleeding is the most common complication of circumcision, with an incidence of up to 1% in recent retrospective studies. Meticulous attention to hemostasis during the procedure, and adequate compression on the skin suture can prevent this complication in most cases. Even so, there may be dislodgment of clots.1 In general, late complications are associated with remaining skin inclusions and the incomplete removal of the prepuce, which can result in wound contraction and scarring of the distal portion of the prepuce, leading to its stenosis. The fibrotic ring may, then, result in true phimosis, requiring reoperation in about 2% of cases.1Severe complications are rare.3 Some pediatric urologists consider that adolescent patients have a greater risk of postoperative bleeding, but this association has not been duly confirmed by literature.4The complication rates depend on multiple factors, including anatomical anomalies, clinical comorbidities, surgical technique used, and age of patients.To evaluate circumcision complications and compare them with the different surgical techniques used, and the influence of patient age in the postoperative complications.st, 2015, and May 31st, 2016, at the Hospital Pequeno Pr\u00edncipe, in Curitiba, State of Paran\u00e1, Brazil. The present study was approved by the Ethics Committee of the organization, official opinion number 1.602.963, CAAE: 56993816.0.0000.0097.This was a retrospective study, by means of the analysis of medical records of 2,441 patients submitted to circumcision between May 1Two different surgical techniques were used, and patients were divided into two groups. The choice was based on the personal opinion and experience of each surgeon. The sample included patients operated on by 19 different surgeons, 6 of whom were residents in pediatric surgery.All patients were operated on based on medical indication, and no newborn underwent surgery. Some similarities were noted among the two groups: blockage of the dorsal penile nerve was performed in all patients under general anesthesia, and no prophylactic antibiotic was used.The first technique, performed on 501 patients, consisted of classic circumcision. The redundant prepuce was retracted, the adhesions to the glans were released, and after skin excision, hemostasis was performed with an electrocautery. Approximation of the skin and mucosal borders was done with absorbable suture (Catgut 5-0).The second technique consisted of the use of Plastibell. The redundant prepuce was pulled upwards, and the device was positioned between the prepuce and the glans. The size of the ring was chosen according to the size of the glans. A non-absorbable suture was tied around the device, and the distal prepuce was excised. No bandaging was used, and in the immediate postoperative phase, topical neomycin was used. This group consisted of 1,940 patients.All cases were analyzed, and the sample consisted of 80 patients who presented with complications requiring surgical reintervention. The data collected was name, age on the day of surgery, surgical technique used, complications, and surgical treatment given after complication.\u00ae and analyzed using Fisher\u2019s exact test. A p value <0.05 was considered significant.The data were tabulated using Microsoft Office ExcelOf the total 2,441 circumcisions performed at the service during the period evaluated , 80 . Considering that no significant difference was demonstrated (p=0.37), we can only affirm that there was a greater tendency towards bleeding with the use of Plastibell . The presence of bleeding was most prevalent in cases in which the ring was used  patients. Three of them presented with hemorrhage and need for immediate surgical reintervention . When long-term complications were evaluated, we noted 32 cases, the majority of little clinical significance . Complications directly related to the use of the ring occurred in 6 (5.4%) patients \u2013 five of them with significant postoperative pain, and one who presented Plastibell retention by the foreskin, requiring manual removal. The complication rates did not show correlation with the size of the ring used, and were similar in the different age ranges.10 The incidence of early complications with the use of the plastic device reported by Bastos Netto et al., was similar to that of the conventional technique, and corroborates data of our study.10Plastibell was initially used to perform circumcisions in 1956. Since then, its use has been increasingly more widespread and frequent with satisfactory success rates, although there are reports of complications associated with its use.11 as the most common early complication with the use of Plastibell, and the rates varied from 2.5 to 4%. In general, bleeding results from the inappropriate ligature of the cord that holds the plastic ring, predisposing foreskin retraction and dislodgement of the ring.10 In this study, bleeding was the second most frequent complication of Plastibell use, following paraphimosis caused by dislodgement of the plastic ring \u2013 a complication that has not been previously analyzed in literature, but which, in this study, was responsible for the highest rate of reoperation among all patients.Several studies described bleeding9 of cases. Some authors10 recommended surgical revision as soon as possible in patients with preputial stenosis or redundant prepuce, in order to avoid this complication.Four patients from this study presented with postoperative balanoposthitis associated with preputial stenosis, the latter considered a late complication associated primarily with the greater quantity of foreskin that is maintained, and with the process of local scarring. Previous literature demonstrated the incidence of this infectious complication can be as high as 15%12 Assessing the complications using the Clavien-Dindo classification13 for surgical complications, the classes IIIa and IIIb  were emphasized in this study. No cases of class IV (life-threatening complications) were found. Another recently published study proposed a classification of circumcision complications by separating them into five different grades: I for skin problems; II, isolated urethral lesion; III, amputation of the glans; IV, lesion of the corpus cavernosum; and V, total loss of the phallus.14 According to this recent classification, this article did not present with complication among those considered most severe.Some severe complications with potential anatomical, functional, and psychological sequelae have already been reported, such as amputation of the glans, lesion of the corpus cavernosum, ablation of the penis, iatrogenic micropenis, and penile amputation.As to the limitations of the study, we highlight the fact of being conducted at single center, where different surgeons were involved in the procedures, including residents under training, which could have influenced the clinical progress in some patients.There was no statistically significant difference when comparing complications among the different surgical techniques used at this service. Preputial stenosis was more often observed in patients operated on by the conventional technique, whereas bleeding tended to be more frequent with the use of Plastibell. Paraphimosis due to dislodgement of the plastic ring was a frequent complication that required surgical reintervention. The age of patients did not influence in presence of complications."}
{"text": "To solve this problem, we constructed a Bayesian probabilistic framework that circumvents the limitations of previous reference correction methods that required protein resonance assignment and/or three-dimensional protein structure. Our algorithm named Bayesian Model Optimized Reference Correction (BaMORC) can detect and correct 13C chemical shift referencing errors before the protein resonance assignment step of analysis and without three-dimensional structure. By combining the BaMORC methodology with a new intra-peaklist grouping algorithm, we created a combined method called Unassigned BaMORC that utilizes only unassigned experimental peak lists and the amino acid sequence. Unassigned BaMORC kept all experimental three-dimensional HN(CO)CACB-type peak lists tested within \u00b1\u20090.4\u00a0ppm of the correct 13C reference value. On a much larger unassigned chemical shift test set, the base method kept 13C chemical shift referencing errors to within \u00b1\u20090.45\u00a0ppm at a 90% confidence interval. With chemical shift assignments, Assigned BaMORC can detect and correct 13C chemical shift referencing errors to within \u00b1\u20090.22\u00a0at a 90% confidence interval. Therefore, Unassigned BaMORC can correct 13C chemical shift referencing errors when it will have the most impact, right before protein resonance assignment and other downstream analyses are started. After assignment, chemical shift reference correction can be further refined with Assigned BaMORC. These new methods will allow non-NMR experts to detect and correct 13C referencing error at critical early data analysis steps, lowering the bar of NMR expertise required for effective protein NMR analysis.Poor chemical shift referencing, especially for The online version of this article (10.1007/s10858-018-0202-5) contains supplementary material, which is available to authorized users. Nuclear magnetic resonance (NMR) is a highly versatile analytical technique for studying molecular configuration, conformation, and dynamics, especially of biomacromolecules such as proteins Sait\u00f4 . Several1H, 13C and 15N chemical shifts CACB-type peak lists , which detects and corrects 13C chemical shift entries (datasets) as described in the Methods. Each dataset contains the protein sequence and the corresponding NMR chemical shifts. One point worth mentioning is that most of the datasets are not complete: i.e., there are fewer assigned residues than would be expected from the protein sequence. However, missing resonance assignments are common due to a myriad of experimental conditions, especially conformational flexibility in the protein structure that leads to intermediate chemical exchange. Using the secondary structure information accompanying the NMR chemical shift data provided by the RefDB, we associated residue-specific C\u03b1 and C\u03b2 chemical shifts and then sub-grouped them by amino acid and secondary structure type, as shown in Supplemental Fig.\u00a01 for 19 of the 20 common amino acids (not including glycine) in proteins and for the secondary structure types helix, sheet, and coil. The univariate C\u03b1 and C\u03b2 chemical shift distributions are multimodal, with most of the modes being secondary structure specific , weakening the covariance calculated between these chemical shifts. Therefore, we used quality control measures provided by the RefDB to evaluate the performance of the referencing and to select a subset of entries for deriving amino acid- and secondary structure-specific covariances between C\u03b1 and C\u03b2 chemical shifts  and covariances (Cov) are described in Eqs.\u00a0\u03b1 and C\u03b2 chemical shifts, since these shifts may come from separate spectral sources. Matrix E-Revised showed the best performance among the pure statistical models, exhibiting the closest 13C reference correction of 0.00\u00a0ppm for BMR6032 entry, as shown in Supplemental Fig.\u00a02 and Supplemental Table\u00a03. The performance of Matrix E-Revised as illustrated in Fig.\u00a0i is the helix,beta strand,coil.We created an unordered pair of Cogy see \u201c\u201d. The ca\u03b1/C\u03b2 bivariate statistical models on the observed amino acid content frequencies \u03b1/C\u03b2 bivariate statistical models using observed C\u03b1/C\u03b2 chemical shifts in the RefDB associated with specific amino acid and secondary structure types. The observed amino acid content frequencies \u03b1 and C\u03b2 chemical shifts in real datasets. The calculation of the prediction overlap matrix and predictor weights is described in the \u201cFigure\u00a0\u03b1/C\u03b2 bivariate statistical models with the prediction overlap matrix, while ignoring glycine residues. The BaMORC method improves the comparison of the predicted and observed amino acid and secondary structure frequencies more than 2.5-fold by modifying Y with the prediction overlap matrix to create The BaMORC method combines the E-Revised covariance method used in the chi-squared-based C\u03b1 chemical shift distributions for beta sheet and coil secondary structure types for glycine residues. This is illustrated by the universally-high prediction-overlap values for glycine predictors as shown in Supplemental Fig.\u00a03. The high values would significantly inflate the product of the matrix multiplication, which will greatly influence the residuals over the range of overlapping C\u03b1 chemical shift distributions. Thus, in the final implementation of the BaMORC methodology we ignored glycine residues.We also tried to add glycine-specific predictors in the BaMORC method. However, the inclusion glycine statistical models had mediocre performance in comparison to using only the 57 non-glycine predictors. This is illustrated in Supplemental Fig.\u00a04, which shows a bimodal distribution of reference correction values with a 90% confidence interval of \u00b1\u20090.82\u00a0ppm and absolute length of 1.64\u00a0ppm. The cause of the poor performance appears rooted in the complete overlap of C\u03b1 and C\u03b2 chemical shifts. Therefore, missing chemical shift data is a real issue that must be addressed. Accordingly, we tested the performance of the BaMORC method using unassigned datasets generated from the RefDB with varying amounts of missing 13C spin systems. First, we constructed datasets with 100% completion by removing amino acid sequences for missing C\u03b1 and C\u03b2 chemical shift values for 568 entries with 95% or greater starting completion. Then, we incrementally removed 5% of the 13C spin systems and tested the performance. Figure\u00a013C spin system data are present. The overall performance of BaMORC does not appreciably deteriorate until approximately 70% of the 13C spin systems were missing. Even, with 50% of the spin systems missing, the absolute length of the 90% confidence interval is less than 1\u00a0ppm, with the reference corrections within \u00b1\u20090.6\u00a0ppm. Therefore, BaMORC is very robust to missing 13C chemical shift data.Protein NMR datasets are typically incomplete from the perspective of what resonances are expected based on the protein sequence. This incompleteness is due to a host of experimental issues that prevent the detection of all protein resonances. In the RefDB itself, only 568 out of the 1557 entries include 90% or more of the expected CTo test the performance of our method in a real-life situation, we removed all of the secondary structure information from the RefDB data and used the sequence-based secondary structure predictions generated from JPred4 . Among 1557 entries, the correlation optimization filtered down to 729 entries for calculating optimal covariances. The resulting improvement between the inaccurate covariances and the optimal covariances is illustrated in Fig.\u00a013C-assigned peak lists, we see an opportunity to further refine covariance statistics. According to our estimates, about 180,000 13C-assigned peaks are required in the BMRB for the next generation of covariance analysis. Currently, the BMRB contains approximately 11,500 13C-assigned peaks.During the development of the BaMORC methodology, we addressed several issues regarding chemical shift data quality in the RefDB entries, which are derived from the BMRB. The reference correction of BMRB protein entries provided by the RefDB was a starting point that enabled the derivation of amino acid and secondary-structure-specific expected values and variances for CWe have tested the performance of the general BaMORC method in detecting reference correction values under various conditions. The reference correction values were within \u00b1\u20090.45\u00a0ppm of the SHIFTX determined references at the 90% IQR with an absolute length of 0.73\u00a0ppm for datasets derived from the RefDB. The typical NMR dataset includes approximately 85% of the expected spin systems. Therefore, we tested our algorithm on incomplete data by incrementally removing a certain percentage of the data from each dataset tested. The robustness of the algorithm is stunning: it performs very well, maintaining referencing correction within  ppm range of the correct value at the 90% confidence level, even when 50% of the data are randomly removed. This robustness is achieved because the algorithm uses a non-parametric approach (i.e. a comparison of expected and predicted amino acid frequencies). Additionally, keeping reference correction within \u00b1\u20090.6\u00a0ppm of the correct value is very important for accurate amino acid typing used in protein resonance assignment analysis and for accurate secondary structure analysis from chemical shifts. When carbon chemical shift referencing accuracy is outside the  ppm range, the relative error rate in amino acid and secondary structure prediction increases dramatically as illustrated by the increase in residuals in Supplemental Fig.\u00a06.\u03b1/C\u03b2 correlation and subsequent reference correction performance by BaMORC. Also, two of the experimental peak lists had a carbon chemical shift reference deviation that was over 2\u00a0ppm. Peak lists with large chemical shift referencing errors is the exact situation that Unassigned BaMORC was designed to detect and correct, so that a scientist does not waste time and effort trying to utilize such highly miss-referenced peak lists for downstream analyses, especially protein resonance assignment. The resulting assignments would be error prone and their chemical shifts would propagate error during structure determination. But even more subtle deviations in the 0.6\u20132.0\u00a0ppm range can have a significant impact on assignment and structural error. But Unassigned BaMORC has a demonstrated performance in keeping carbon chemical shift referencing within the \u00b1\u20090.4\u00a0ppm range.Also, this performance on spin system datasets derived from the RefDB completely translates to the real-world use-case where real, unassigned, experimental HN(CO)CACB peak lists are utilized. All peak list data were manually peak-picked. There are extra peaks in the data, which could be artifacts or from additional resonances due to multiple local protein conformations. Table\u00a0The computation time is scaled primarily on the number of probabilistic amino acid predictions performed, which in turn is dependent on the size of the data and the number of reference refinement steps; however, there are user-controllable settings allowing a trade-off between accuracy and computation time. By default, 50 incremental steps are employed in both rounds of reference scanning. The first round of scanning is performed over the range of  ppm in increments of 0.2\u00a0ppm, and the second round of scanning is centered at the results from the first round of scanning over the range of  ppm in increments of 0.04\u00a0ppm, resulting in 100 proposals , which for a 10\u00a0kDa protein, typically takes approximately 3\u00a0min to process on a standard desktop computer. More precisely, the algorithm has a number of stages, each with a different theoretical computational complexity. The grouping stage consists of two steps: registration and spin system grouping. The computational complexity of the registration stage is optimized to \u03b1 and C\u03b2 chemical shifts is identical and independent, following a bivariate normal distribution, and the shapes of the distribution are well-represented by ellipses. Although we expect the algorithm to be robust to morphologically similar distributions, such as flat-top clusters or low-aspect-ratio ellipses, the algorithm is certainly not designed for the analysis of very small proteins or peptides. In addition, the presence of paramagnetic compounds, ring current effects, and deuteration shift effects will generate outlier chemical shift values that significantly deviate from the expected values derived from the RefDB dataset.An issue facing any model-based approach to data analysis is the validity of the model assumptions. The most important model assumptions here are that each pair of CThe default assumptions stipulate that each input dataset is at least 50% complete, meaning that the number of missing spin systems should not represent more than 50% of the expected number of spin systems based on the protein sequence. In practice, we found datasets with greater than 70% completion produced consistent reference correction values. If the user wishes to statistically demonstrate the applicability of our approach to a problem, they can employ the residual (sum of the absolute difference) plot. We have thoroughly tested our defaults assumptions on a wide variety of protein scenarios  and found the correction results to be largely insensitive to protein classification. However, we recognize that there are extreme examples like disordered proteins for which these choices may not be advised. As with all Bayesian analyses, it should be remembered that the prior parameters should genuinely represent the subjective prior beliefs.13C chemical shift referencing using HN(CO)CACB-type peak lists. The focus on 13C chemical shift referencing is pragmatic from three perspectives: (i) C\u03b1 and C\u03b2 provide the most information about amino acid type, which is central to the BaMORC methodology; (ii) accurate 13C chemical shifts have the greatest impact on protein resonance assignment and other downstream analyses; and (iii) grouping of the HN(CO)CACB peaks into spin systems is more robust than for other NMR experiments. Likewise, Assigned BaMORC is designed to use assigned C\u03b1 and C\u03b2 chemical shifts for reference correction after initial chemical shift assignment, but before other downstream analyses. However, we are pursuing further improvements to the methodology and current implementations. We see a host of possible improvements that would extend the methodology to correct 1H and 15N chemical shift referencing and allow the application of the method to peak lists derived from other types of NMR experiments as well. Though, some of the improvements will require further evaluation and refinement of the chemical shifts from BMRB and RefDB entries and may require waiting until sufficient assigned peak lists are present in these public scientific repositories. For instance, developing an extension to handle intrinsically disordered proteins (IDPs) would likely require more than the 176 IDP BMRB entries available as of May 2018.Unassigned BaMORC is currently designed to correct \u03b1 and C\u03b2 chemical shift data to generate accurate 13C reference correction within \u00b1\u20090.45\u00a0ppm at the 90% confidence level on RefDB derived test datasets. BaMORC also demonstrates robust performance, keeping the 13C reference correction within \u00b1\u20090.6\u00a0ppm at the 90% confidence level even with up to 50% of the 13C chemical shift data missing. Keeping the reference correction within 0.6\u00a0ppm of the correct value is very important for accurate amino acid typing to be used in protein resonance assignment analysis. The Unassigned BaMORC method utilizes unassigned C\u03b1 and C\u03b2 chemical shift data from HN(CO)CACB-type experimental peak lists to generate accurate 13C referencing correction within \u00b1\u20090.4\u00a0ppm for all 10 HN(CO)CACB-type experimental peak lists tested. The Assigned BaMORC method utilizes assigned C\u03b1 and C\u03b2 chemical shift data to generate accurate 13C chemical shift reference correction within \u00b1\u20090.22\u00a0ppm at a 90% confidence interval. Unassigned BaMORC can correct 13C chemical shift referencing at the beginning of protein NMR analysis, when accurate 13C chemical shift referencing is needed the most for accurate protein resonance assignment, structure determination, and other downstream analyses. Assigned BaMORC can refine the referencing once assignments are made. Additionally, the underlying BaMORC method is robust to missing 13C chemical shift data, which addresses the real-world situation of incomplete 13C resonance detection. Therefore, the BaMORC methods will allow non-NMR experts to detect and correct 13C referencing error at critical early data analysis steps, lowering the bar of NMR expertise required for effective protein NMR analysis.The BaMORC method utilizes unassigned C1 on May 4th, 2015  entries using the SHIFTX-predicted chemical shifts based on corresponding 3D protein structures in the Protein Data Bank (PDB), which is managed by the international collaboration known as the worldwide Protein Data Bank (wwPDB) \u03b1 and C\u03b2 chemical shift information. Statistics were also calculated from the resulting data and verified using the results reported in the RefDB. Based on amino acid and secondary structure, we subdivided the data into 60 classes based on 20 amino acid types and three secondary structure types. In the early part of the methods development, we ignored the glycine classes and only employed the other classes representing the 19 amino acids with C\u03b2 resonances.For each RefDB entry, we first parsed the text data files with the extension of \u201c.str.corr\u201d, which are mostly in NMR-STAR 2 format, with additional sections added by RefDB, with a short R script that uses crafted regular expressions to clean and convert the relevant assigned chemical shift data into a tab-based format for parsing. The reason for this conversion step is to remove unnecessary metadata, missing values, blank spaces, and section breaks. In this conversion, we retained the full sequence, residue position, amino acid typing, secondary structure, and C\u03b1\u2013C\u03b2 pair into two clusters based on the smallest Euclidean distance from cluster centroids. Then, it uses iterative techniques to re-calculate the centroids and re-group the data until the centroids converge. To verify the clustering results, we compared the means and standard deviations of the two new subgroups with statistics reported in the RefDB. It is worth mentioning that even though the statistics from RefDB included two-state cysteines, there are no labels on any specific cysteine in the RefDB NMR data.From Fig.\u00a0\u03b1 and C\u03b2 for each group. We first calculated the mean . Thus, we first compared the two RMSD values, using the RMSD comparison equation Q, as shown in Fig.\u00a0We employed the root mean squared deviation (RMSD) as the criterion for selecting subgroups. The RMSD is recorded in every data file in the RefDB. The RMSD is a measurement of the confidence interval of the population mean  for each single data point. This statistic is calculated from Student\u2019s t-test. The higher the RMSD value, the less accurate the corrected data. In our methodology, we have two RMSDs from the C\u03b1\u2013C\u03b2 bivariate distributions overlap almost completely, as shown in Fig.\u00a0\u03b1 and C\u03b2 chemical shift values, to predict the \u03b1 and C\u03b2 chemical shifts, we calculated the probabilities of the 57 classes. Likewise, we used every glycine C\u03b1 chemical shift to calculate the probabilities for the three glycine classes. For example, for every data point of an alanine-beta strand, we calculated the probabilities of all of the classes. Then, we performed normalization across the columns and finally obtained a Sixteen of the 19 amino acid C\u03b1/C\u03b2 bivariate statistical models approximate the real distributions. Hence, we used the real distributions to calculate the prediction overlap between the bivariate statistical models and represented this overlap as prior information in the form of a prediction overlap matrix. Moreover, we employed the diagonal elements of this matrix  as weightsIn nature, amino acid chemical shift distributions are not ideal; i.e., the CThe overall optimization approach can be simplified into the following residual equation which is minimized as showing in Eq.\u00a0To calculate the 13C chemical shifts. To calculate the probability, we first need to transform each pair of the chemical shifts to a Chi square value using Eq.\u00a013C chemical shifts. For a given NMR dataset with The bottom right flowchart in Fig.\u00a0The search range is typically limited to \u2212\u20095 to 5\u00a0ppm centered around the current reference value of 0. The algorithm first evenly samples 50 candidate reference correction values in the range from \u2212\u20095 to +\u20095. Each of the candidate values is applied in the whole dataset, and the difference between the estimated and actual amino acid composition frequency is calculated. The one value that minimizes the difference is the raw correction value, \u03b1/C\u03b2 pair in BaMORC to only 1 probability calculation CACB), for 1H and 15N. Next, it groups peaks into spin system clusters using the derived match tolerance values. Then, the algorithm checks whether any ungrouped peaks remain and, if so, creates a new peak list and attempts to register it again itself again to determine new, larger match tolerances that can be used to group peaks into spin systems.The spin system grouping algorithm, as illustrated in Fig.\u00a013C chemical shifts derived from pairs of grouped HN(CO)CACB peaks. Using these pairs of 13C chemical shifts and the same BaMORC analysis pipeline reports an optimized correction value as a reference. Eventually, Unassigned BaMORC applies this correction value to all of the C\u03b1 and C\u03b2 chemical shifts and prints out a text file, that including all of the corrected peak lists in the final output.The reference correction methodology is essentially BaMORC. The input of the algorithm is the output from the grouping methodology, which are pairs of Below is the link to the electronic supplementary material.Supplementary material 1 (DOCX 3962 KB)"}
{"text": "It has also been shown, theoretically, that for planar tensor encoding (PTE), the direction\u2010averaged\u00a0diffusion\u2010weighted MRI signal decays as 1/b. We aimed to confirm this theoretical prediction in vivo. We then considered the direction\u2010averaged signal for arbitrary b\u2010tensor shapes and different tissue substrates to look for other conditions under which a power\u2010law exists.It has been shown, theoretically and in vivo, that using the Stejskal\u2010Tanner pulsed\u2010gradient, or linear tensor encoding (LTE), and in tissue\u00a0exhibiting a \u201cstick\u2010like\u201d diffusion geometry, the direction\u2010averaged diffusion\u2010weighted MRI signal at high b\u2010values \u00a0gradients.b power law for PTE. Moreover, our analysis showed that using an axisymmetric b\u2010tensor a power\u2010law only exists under very specific conditions: (a) \u201cstick\u2010like\u201d tissue\u00a0geometry\u00a0and purely LTE or purely PTE waveforms; and (b) \"pancake\u2010like\" tissue\u00a0geometry and a purely LTE waveform.Our in vivo results confirmed the predicted 1/A complete analysis of the power\u2010law dependencies of the diffusion\u2010weighted signal at high b\u2010values has been performed. Only three\u00a0specific forms of encoding result in a power\u2010law dependency, pure linear and pure PTE when the tissue\u00a0geometry is \u201cstick\u2010like\u201d\u00a0and pure LTE when the tissue geometry is \"pancake\u2010like\". The different exponents of these encodings could be used to provide independent validation of the presence of different tissue\u00a0geometries in vivo. In the statistical model developed by Yablonskiy et al,b for large b, while the other studies1/b.Diffusion MRI (dMRI)\u00a0provides a tool to study brain tissue based on the Brownian motion of water moleculesThe aforementioned studies all used the conventional \u00a0pulsed\u2010gradient diffusion encoding,This approach has been utilized by several groups for extracting microstructural information.In this study, we investigate the effect of different b\u2010tensor encodings on the diffusion signal at high b\u2010values. To remove the effect of fiber orientation distribution,b. We then consider, more generally, the direction\u2010averaged signal for arbitrary b\u2010tensor shapes and different tissue substrates to determine the conditions under which the power\u2010law exists. We establish the range of b\u2010values over which we observe any power\u2010law scaling, including considerations of signal amplitude compared to the noise, and the impact of the number of encoding directions on any power\u2010law decay. Finally, we consider how observation of a power\u2010law signal dependence with more than one gradient wave\u2010form could help to provide a \u201ccross\u2010validation\u201d for specific tissue geometries.In this work, we confirm in vivo the theoretical prediction2B=b/3(1-b\u0394)I3+bb\u0394ggT, where g is the diffusion gradient direction and the b\u2010value, b, is defined as the trace of the b\u2010matrix. The eigenvalues of the b\u2010matrix areb\u2016,b\u22a5(1) andb\u22a5(2) whereb\u22a5(1)=b\u22a5(2)=b\u22a5 andb\u2016 is the largest.b\u0394 is defined asb\u0394=(b||-b\u22a5)/(b||+2b\u22a5). Changingb\u0394, we can generate different types of b\u2010tensor encoding. For LTE, PTE, and STE,b\u0394=1,-1/2, and 0, respectively.In multi\u2010dimensional diffusion MRI, the b\u2010matrix is defined as an axisymmetric second\u2010order tensor,S is the normalized diffusion signal andD\u2016 andD\u22a5 are the parallel and perpendicular diffusivities, respectively. We use the subscript \u201ce\u201d and \u201ca\u201d to denote parameters of the extra\u2010axonal and the axonal compartments, respectively.For the powder\u2010averaged signal, the diffusion attenuation is a function of the orientation\u2010invariant aspects of the diffusion and the encoding. The compartment diffusion attenuation is (Equation (34) inHere, we study the effect of axisymmetric b\u2010tensor shape on the diffusion\u2010weighted signal at high b\u2010values.2.1b\u0394=1 and assuming stick\u2010like geometry,D\u22a5=0 in Equation Sic\u221db-1/2. The sensitivity of MR to axon radius would alter theb-1/2 scalingIn LTE,b\u0394=-1/2 andSic has the following form: bDa||\u226b1; therefore, the diffusion signal can be approximated by the following equation (see Appendix A): N depends on thebDa|| value \u226a1, and can be neglected.For large b\u2010values, the extra\u2010axonal signal decays exponentially faster than the intra\u2010axonal compartment,x) in Equation x\u00a0\u2192\u00a0\u221e, but large values ofbDa\u2016 would suppress the signal to immeasurable levels, and therefore there are practical bounds on the value ofbDa\u2016 that can be achieved. Therefore, we compared the original signal in Equation N andbDa\u2016 Normb\u0394=0 andSic=exp(-b3Da||). For large b\u2010values, both intra\u2010 and extra\u2010axonal signals decay exponentially fast,exp(-bDa\u20163)\u226a1,exp(-b(De\u2016+2De\u22a5)3)\u226a1 and both of them are negligible. Therefore, the STE does not provide a considerable signal for large b\u2010values in a two\u2010compartment model.In STE,2.2b\u0394\u22600 to cover all b\u2010tensor shapes betweenb\u0394=-0.5 (PTE) tob\u0394=1 (LTE).Here, we consider the general case of\u00a0an axisymmetric b\u2010tensor2.2.1D\u2016\u22600. In this case, to have a power\u2010law relationship between the signal and the b\u2010value, the exponential termexp[-b(D\u2016+2D\u22a5-b\u0394(D\u2016-D\u22a5))/3] should go to one and thereforeD\u2016+2D\u22a5-b\u0394(D\u2016-D\u22a5)=0. ForD\u2016\u22600,D\u22a5/D\u2016=(b\u0394-1)/(b\u0394+2) which is only physically plausible  forb\u0394-1\u22650, but the maximum value thatb\u0394 can take is one, and thereforeD\u22a5 has to be zero, that is, the tissue\u00a0geometry has to be that of a stick, and the b\u2010tensor has to be a pure LTE to have a power\u2010law relationship. IfD\u2016=0 then we have the imaginary error function and therefore there is a power\u2010law relationship for the pancake\u2010like\u00a0tissue\u00a0geometry.As noted above, in this range, the error function in Equation 2.2.2-0.5\u2264b\u0394<0, as in Equation -0.5<b\u0394<0 which is not physically plausible for the left side of the equation . Therefore, the only possible case is to have D\u22a5=0 which again means stick\u2010like\u00a0tissue geometry and b\u0394=-0.5 which is pure PTE. Clearly the exponential term will become zero if and only if b\u0394=-0.5, and thus, the 1/b signal form will occur if and only if the b\u2010tensor shape has just 2 non\u2010zero eigenvalues, that is, pure PTE. Thus, for stick\u2010like geometries, there are only two b\u2010tensor shapes for which a power\u2010law exists: pure linear and pure planar. Moreover, for pancake\u2010shape tissue geometries, a power\u2010law exists if and only if the encoding geometry is pure LTE.Conversely, in the range b power law. The S\u221db-1 dependence is valid for an intermediate range of diffusion weightings while the asymptotic behavior of the signal decay is determined by a steeper decay.Herberthson et al33.1s/mm2] with a step\u2010size of 500\u00a0s/mm2. The noise is considered Rician with SNR = 150 for the b0 image, which is practically feasible using the Connectom scanner with an echo time of 88\u00a0ms.f1,f2, andf3 are the intra\u2010axonal, extra\u2010axonal, and the sphere signal fraction respectively, W(n) is the Watson ODF,Sec is the extra\u2010axonal signal,Scyl is the signal attenuation of the impermeable cylindersSsph is the restricted diffusion inside the spherical compartment in the presence of b\u2010tensor encodingf1\u00a0=\u00a00.65,Da\u2016=2\u03bcm2/ms,De\u2016=2\u03bcm2/ms,De\u22a5=0.25,0.5,0.75\u03bcm2/ms and \u03ba = 11] and axon radiusri, come from the bins of the histograms in.ris weighted byri2. In histology, there is a possibility of tissue shrinkage. To account for this change, the axon radius values are multiplied with three shrinkage factors \u03b7\u00a0=\u00a00,\u00a01,\u00a01.5.\u03b7\u00a0=\u00a00 case simulates the effect of zero\u2010radius axons.Synthetic data were generated with 60 diffusion encoding gradient orientations uniformly distributed on the unit sphereRs=8\u03bcm to consider the effect of combining the environments on the power\u2010law scaling.The third compartment is simulated as a sphere with zero radius (dot) and a sphere with radiusSn and S are the noisy and noise\u2010free signal, respectively, andNr andNi are the normal distributed noise in the real and imaginary images respectively with a standard deviation of \u03c3.https://github.com/maryamafzali/PTE_Cylinder-).The noisy diffusion\u2010weighted signal is modeled according to the following: 3.2Two healthy participants who showed no evidence of a clinical neurologic condition were scanned in this study that was conducted with approval of the Cardiff University School of Psychology ethics committee. Diffusion\u2010weighted images were acquired with 60 gradient directions for PTE on a 3T Connectom MR imaging system . Twenty axial slices with a voxel size of 4\u00a0mm isotropic  and a 64 \u00d7 64 matrix size, TE = 88\u00a0ms, TR = 3000\u00a0ms, were obtained for each individual.To take full advantage of q\u2010space trajectory imaging, it is imperative to respect the constraints imposed by the hardware, while at the same time maximizing the diffusion encoding strength. Sjolund et als/mm2 with a step size of 1000\u00a0s/mm2 and each shell had the same 60 diffusion encoding gradient orientations uniformly distributed on the unit sphere. One b0 image was acquired between each b\u2010value shell as a reference.Diffusion data were acquired for 10 b\u2010value shells from 1000 to 10\u00a0000\u00a0The data were denoisedD=rrT(D\u2016-D\u22a5)+D\u22a5I, whereD|| andD\u22a5 are the parallel and perpendicular diffusivity, r is the tensor principal direction and I is the identity matrix. We used S\u00a0=\u00a0\u00a0exp\u00a0(\u2212trace(BD)) to simulate diffusion\u2010weighted signal for linear and PTE. The b\u2010matrix for LTE and PTE is defined asBLTE=bggT, andBPTE=b/2(I-ggT), respectively, where g is the gradient direction and the b\u2010value, b, is the trace of b\u2010matrix. The orientation, r, was rotated in 512 different directions to consider the effect of rotation. We usedb=7000-10000s/mm2 with a step size of1000s/mm2. We changeD|| andD\u22a5, while keeping the mean diffusivity ofMD=1.0\u03bcm2/ms and set FA = 0.95 because the impact of rotational variance is most pronounced at high anisotropy. The direction averaged signal was calculated and the coefficient of variation (CV) across all 512 orientations was estimated using CV\u00a0=\u00a0SD/E where SD and E are the standard deviation and mean value, respectively. The threshold was set to CV\u00a0<\u00a00.01 and the minimum number of directions to meet this condition was calculated.In order to find the minimum number of directions necessary to have a rotationally invariant signal powder average, we used the method proposed by Szczepankiewicz et al.4S^/S for3<bDa\u2016<20 and 4\u00a0<\u00a0N\u00a0<\u00a021. The selected range ofbDa\u2016 is compatible with the range of b\u2010values that we can obtain from the Connectom scanner and also the range ofDa\u2016 that exists in the brain.bDa\u2016 (N\u2264\u230abDa\u2016\u230b where \u230a...\u230b denotes the floor function) to have the minimum error (S^/S is close to one). As the number of terms goes beyond thebDa\u2016, the error increases. Table N, for different error threshold values (0.01\u20100.06). When the error threshold is 0.02, we can approximate Equation bDa\u2016\u226514. For the error threshold of 0.06, the maximumbDa\u2016 to approximate the signal with the first term is 3.Figure bDa\u2016\u226514). One of the challenges with the high b\u2010values is the noise, as the signal amplitude can be close to the noise floor. Therefore, here we find the maximum value ofbDa\u2016 that we can use before hitting this rectified noise floor (see Appendix C).Diffusion MRI is an inherently low SNR measurement technique, particularly when strong diffusion weightings are utilized. To reach the level that enables us to approximate the planar diffusion signal in Equation The noise in complex MR data is normally distributed, whereas the noise in magnitude images is Rician distributed.bDa\u2016 as a function of SNR for different encoding schemes and different noise floors. The maximum value ofbDa\u2016 that can be used while staying above the noise floor increases when SNR increases, but the rate of this change is different for different encoding schemes. The maximumbDa\u2016 value (bDa\u2016max) is proportional to the square of SNR, (bDa\u2016max\u223cSNR2) for LTE, where this relationship is linear for PTE (bDa\u2016\u223cSNR) and it is logarithmic for STE (bDa\u2016\u223cln(SNR)). Based on this plot, if SNR = 50 the values ofbDa\u2016max for linear, planar and STE schemes are around 312, 21 and 9 respectively. The SNR in our data is around 150 therefore the measured signal values in our experiment are higher than the noise level. For this SNR, thebDa\u2016max for linear, planar and STE schemes are around 15\u00a0625, 100 and 16 respectively.Figure f3=0) as a function of 1/b for three different perpendicular diffusivities and three different shrinkage factors. The result of the power\u2010law fit (S=\u03b2b-\u03b1) is represented by the red dashed line and the \u03b1 and \u03b2 values are reported in each plot. The trust\u2010region\u2010reflective algorithm is used for optimization with a fixed initial value (\u03b1\u00a0=\u00a01 and \u03b2\u00a0=\u00a00.2). The goodness of fit is evaluated using the Bayesian information criterion (BIC).f\u00a0=\u00a00.65,Da\u2016=2\u03bcm2/ms, therefore if the approximation in Equation \u03b2 \u2248 0.325 and \u03b1\u00a0\u2248\u00a01 indicate that the fit approximately matches the theory.Figure b<=4000s/mm2) compared to LTE (20\u201032 directionsb<=4000s/mm2), to provide a rotationally invariant signal powder average, making it more efficient for\u00a0achieving rotational invariance. Figure 1000<b<10000s/mm2). This was obtained using the method proposed by Szczepankiewicz et al.7000<b<10000s/mm2), the minimum number of encoding directions for rotational invariance is 45 for PTE and almost 80 for LTE.Szczepankiewicz et al\u03b1 using LTE compared to PTE. An insufficient number of diffusion directions in powder averaging may cause the break of power\u2010law scaling. Therefore, we have to consider this when computing a powder average at very high b\u2010values. In Figure \u03b1\u2010values deviate considerably from the theoretical value . The deviation is most likely attributable to the non\u2010zero perpendicular diffusivity, and also the shrinkage factor, \u03b7, chosen for the simulations. In Figure \u03b7\u00a0=\u00a01.5 andDe\u22a5=0.75\u03bcm2/ms matching the results of simulations in.\u03b1, versus \u201cstill water\u201d (a.k.a. \u201cdot\u201d) signal fraction for PTE and LTE on the simulated data withD\u22a5=0.75(\u03bcm2/ms). Note that over thef3 range of0<f3<0.02, the \u03b1 for LTE doesn\u2019t change by more than two percent, and thus is relatively insensitive to the presence of the still water fraction. In contrast, the PTE profile shows a much stronger dependence on the dot water fraction, with a rapid deviation from the \u201cpure stick\u201d, \u03b1\u2010value of 1, as the dot fraction increases.Figure \u03b1 in the presence of a spherical compartment  with a radius ofRs=8\u03bcm. The estimated values of alpha from these simulations are in the range of 1.2\u20101.5, increasing monotonically withf3. This range is remarkably close to the values found in vivo in gray matter, which were in the range 1.2\u20101.7 \u27e9)/(2/\u03c0\u27e8MB(x)\u27e9) where \u3008.\u3009 denotes the average operator. The estimation of the signal was performed using the average of several ROIs (with 4 voxels) with a high direction\u2010averaged signal,MS(x), for the same b\u2010value. . The parameter of noise \u03c3 is estimated from only noise pixels in the background, where the signal is known to follow a Rayleigh distribution. Using the mean of a Rayleigh,E{M(x)}=\u03c0/2\u03c3, we can estimate\u03c3^=2/\u03c0\u27e8MB(x)\u27e9. SNR in WM ranged from 7.5 to 10.3 forb=10000s/mm2 and between 130 and 150 for the non\u2010diffusion weighted image (b = 0).A rough estimation of the SNR was performed, using pixels from the signal area and from the background,b\u00a0\u2264\u00a010\u00a0000), the FA and \u03b1 map, the power\u2010law fit over white matter voxels, and the histogram of the \u03b1 values in white matter, gray matter, CSF. For high b\u2010values (7000<b<10000s/mm2), the amount of the signal is considerable compared to the noise and the white matter structure is completely clear in the images because of high SNR.Figure \u03b1 \u2248 1 which confirms the validity of the signal approximation using the first term in Equation The results show that the data are well described by power\u2010law behavior, with \u03b2 is estimated from the fitting of equationS/S0=\u03b2b-\u03b1 and based on Equation \u03b2\u2248f/Da||. In Figure \u03b2\u00a0=\u00a00.31. If we assume the intracellular signal fraction, f, is around 0.6 then the intra\u2010neurite diffusivityDa|| will be around2\u03bcm2/ms, which is feasible. To segment the brain image into different tissues, we used FAST (FMRIB\u2019s Automated Segmentation Tool) in FSL.\u03b1 value is close to one, supporting the theory. In gray matter and CSF, the exponent is larger . According to the theory outlined above, this would be consistent with a lack of pure \u201cstick\u2010like\u201d geometry in these tissue components. The spatial resolution of the data must be recognized, that is,\u00a0with 4\u00a0mm isotropic voxels, obtaining a \u201cpure\u201d GM signal and \u201cpure\u201d CSF signal is challenging. It is likely that the intermediate exponent in the GM between that of the WM and CSF is partly attributable to a partial volume effect, and partly attributable to the inadequacy of the model for gray matter architecture. The \u03b1\u2010value in the gray matter seems surprising because a substantial portion of gray matter is composed of neurites where the stick model seems plausible. The deviation away from an \u03b1\u2010value of 1 could, however, potentially be explained by differences in water exchange times between white and gray matter. For example, if the exchange time in gray matter is comparable to the diffusion time of our experiment, perhaps as a result of high permeability (compared to in white matter), then the \u201cstick\u2010like\u201d behavior would not be observed, leading to a deviation of the \u03b1\u2010value away from unity. The exponent in gray matter is similar to the one obtained using the combination of \u201cstick + sphere\u201d.The constant term \u03b1 in white matter, gray matter and CSF for two different subjects. The mean value in WM is around one, in the gray matter it is around 1.5 and for CSF around 2.Table 5s/mm2. In white matter, the average value of the estimated exponent is around one; and (2) proof that there are only 3 specific conditions under which a power\u2010law exists (for axisymmetric b\u2010tensor): pure LTE or PTE for pure stick\u2010like geometry and pure LTE for pure pancake\u2010like geometry. To the best of our knowledge, no pure pancake\u2010like geometries exist in the human brain and so in vivo validation of this latter result is impossible.The main findings of this paper are twofold: (1) confirmation in silico and in vivo, of a power\u2010law relationship between the direction\u2010averaged DWI signal and the b\u2010value using PTE, as given by Equation Returning to the case of a power\u2010law with PTE,\u00a0for smaller b\u2010values, this behavior must break down as the DWI signal of PTE cannot be approximated by Equation The exponent of approximately one for white matter using PTE is consistent with the large b\u2010value limit  predicted for a model of water confined to sticks Equation .b-1/2\u2010scaling\u00a0for LTE has previously been suggested byb for large b. Some other models,TheS\u223cb-1 for PTE, this power\u2010law relationship is also reported by Herberthson et al.\u03b1 value for PTE is much more sensitive to the inclusion of a still\u2010water compartment than LTE. If using LTE alone, one might erroneously conclude from an alpha value very close to 0.5, that only stick\u2010like geometries exist\u2014even in the presence of a non\u2010negligible dot fraction. In contrast, as seen in Figure \u03b1 is only close to 1 when the still\u2010water component is zero, which confers an advantage of PTE over LTE for identifying pure stick\u2010like geometry. This likely arises because at a given high b\u2010value the proportional contribution to the total signal from the dot\u2010compartment is larger for the PTE signal (decays as 1/b) than it is for the LTE signal (decays as1/b). One might therefore consider using PTE alone for identifying pure stick\u2010like geometry. However, given that the SNR per unit b is, by definition, much lower with PTE than with LTE, we recommend that PTE and LTE are used in combination as a way of \u201ccross\u2010validating\u201d pure stick\u2010like geometry. Finally, we observed a larger alpha value in the gray matter than in white matter. This difference in exponents was previously reported for LTE by McKinnon et al,This work interprets the diffusion\u2010weighted MRI signal decay at high b\u2010values in the form of6s/mm2. In white matter, the in vivo exponent characterizing this decrease is close to one\u2010half, for LTE and one for PTE. These experimental results are consistent with theoretical predictions for the signal decay at large b\u2010values for tissue in which axonal water diffusion is confined to sticks when there is no sensitivity to the axonal diameter, undulation, curvature and so on. Any sensitivity to the diameter or curvature of axon, will change this power law. Obtaining an exponent of \u22121 for PTE and \u22121/2 for LTE could provide useful cross\u2010validation of the presence of stick\u2010like geometries in tissue. A complete analysis of the power\u2010law dependencies of the diffusion\u2010weighted signal at high b\u2010values has been performed. Only two forms of encoding result in a power\u2010law dependency, pure linear and pure PTE. The different exponents of these encodings could be used to provide independent validation of the presence of stick\u2010like geometries in vivo where, due to the slower decay, LTE is the most SNR efficient method. Deviation from the 1/\u221ab power\u2010law in \u201cstick\u2010like\u201d geometries has been used recently to demonstrate sensitivity to the perpendicular diffusivity inside axons,b, that has previously only been reported theoretically for PTE. The power\u2010law relationship in PTE was observed over the b\u2010value range of 7000 to 10\u00a0000\u00a0s/mm2. We also showed that a power\u2010law relationship only exists in an extremely limited set of conditions: 1.\u00a0The substrate under investigation has \u201cstick\u2010like\u201d geometry and the b\u2010tensor shape is\u00a0purely linear  or purely planar \u00a0or 2. The substrate under investigation has \"pancake\u2010like\" geometry and the b\u2010tensor shape is purely\u00a0linear. A power law will not exist for any other\u00a0axysymmetric b\u2010tensor. The effect of dot and spherical compartments on the signal decay was also investigated. The results show that LTE is not sensitive to small contributions of dot and spherical compartment. In contrast, the exponent in PTE shows sensitivity to the presence of other such compartments.This work explores the diffusion\u2010weighted MRI signal decay at high b\u2010values for PTE and STE complementing and extending previous works on LTE. By exploring diffusion averaged signals, we conclude that the signal from STE decays exponentially for all the range of b\u2010values. The intra\u2010axonal signal does not decay exponentially as a function of b for linear and planar tensor encoding in high b\u2010values. The direction\u2010averaged DWI signal of PTE and LTE decreases with increasing b\u2010values as a power law, for b\u2010values ranging from 7000 to 10\u00a0000"}
{"text": "Bladder cancer is one of the most common cancers among men in industrialized countries and on the global level incidence and mortality rates are increasing. In spite of progress in surgical treatment and chemotherapy, the prognosis remains poor for patients with muscle-invasive bladder cancer. Therefore, there is a great need for the development of novel therapeutic approaches. The human amniotic membrane (hAM) is a multi-layered membrane that comprises the innermost part of the placenta. It has unique properties that make it suitable for clinical use, such as the ability to promote wound healing and decrease scarring, low immunogenicity, and immunomodulatory, antimicrobial and anticancer properties. This study aimed to investigate the effect of (i) hAM-derived cells and (ii) hAM scaffolds on the growth dynamics, proliferation rate, and invasive potential of muscle-invasive bladder cancer T24 cells. Our results show that 24 and 48 h of co-culturing T24 cells with hAM-derived cells (at 1:1 and 1:4 ratios) diminished the proliferation rate of T24 cells. Furthermore, when seeded on hAM scaffolds, namely (1) epithelium of hAM (e-hAM), (2) basal lamina of hAM , and (3) stroma of hAM (s-hAM), the growth dynamic of T24 cells was altered and proliferation was reduced, even more so by the e-hAM scaffolds. Importantly, despite their muscle-invasive potential, the T24 cells did not disrupt the basal lamina of hAM scaffolds. Furthermore, we observed a decrease in the expression of epithelial-mesenchymal transition (EMT) markers N-cadherin, Snail and Slug in T24 cells grown on hAM scaffolds and individual T24 cells even expressed epithelial markers E-cadherin and occludin. Our study brings new knowledge on basic mechanisms of hAM affecting bladder carcinogenesis and the results serve as a good foundation for further research into the potential of hAM-derived cells and the hAM extracellular matrix to serve as a novel bladder cancer treatment. Approximately 549,400 people were diagnosed with bladder cancer worldwide in 2018 and as its incidence continues to increase, bladder cancer is classified among the five most common malignancies in industrialized countries . OverallThere are two main clinical phenotypes of bladder cancer, namely non-muscle-invasive bladder cancer and muscle-invasive bladder cancer. At initial diagnosis, 75% of cases are non-muscle invasive bladder cancer and 25% are muscle-invasive bladder cancer. Moreover, 50\u201370% of patients with non-muscle-invasive bladder cancer have recurrences after surgical removal of the primary tumor, and 10\u201320% of those also progress to muscle-invasive bladder cancer . The devThe human amniotic membrane (hAM) is the innermost layer of the fetal membranes, which protects the embryo and later the fetus. hAM is composed of a monolayer of human amniotic epithelial cells (hAEC), the basal lamina and thick avascular stroma, which is further divided into the compact layer, a layer of human amniotic mesenchymal stromal cells (hAMSC) and a spongy layer . Moreove1. The use of hAM is relevant also in the field of urology, which has been demonstrated by several in vitro and in vivo studies. Previously we have shown that hAM as a scaffold enables the development of tissue-engineered urothelium, which is in molecular and ultrastructural properties comparable to native urothelium  were collected from healthy women serologically negative for HIV, hepatitis B and C, after vaginal delivery or cesarean section at term after obtaining informed written consent according to the guidelines set by the Comitato Etico Provinciale of Brescia number NP 2243 (19/01/2016), Italy. For the preparation of primary urothelial cells, porcine urinary bladders were obtained from a local abattoir. The experiments were approved by the Veterinary Administration of the Slovenian Ministry of Agriculture and Forestry in compliance with the Animal Health Protection Act and the Instructions for Granting Permits for Animal Experimentation for Scientific Purposes (U34453-15/2013/2).The use of hAM was approved by the National Medical Ethics Committee of the Republic of Slovenia (decree numbers 43/12/09 and 0120-179/2018/5) and prepared according to the standard procedures . Briefly4 cells/cm2 and cultured at 37\u00b0C and 5% CO2 in culture medium A-DMEM+F12 as described previously  was used as a model of muscle-invasive bladder cancer cells (passages 5\u201330). The T24 cells were seeded at seeding density of 5 \u00d7 10eviously . The cul4 cells/cm2 and cultured at 37\u00b0C and 5% CO2 in RPMI completed medium composed of RPMI 1640 medium  supplemented with 10% fetal bovine serum (FBS) , 2 mM L-glutamine , 100 U/mL penicillin , and 100 \u03bcg/mL streptomycin .The CFPAC-1 cell line that originated from human pancreatic adenocarcinoma , Saos-2 cell line that originated from human bone osteosarcoma , and human fibroblasts isolated from a skin biopsy. Skin-derived fibroblasts were obtained after informed consent as described by 5 cells/cm2. When the NPU cells reached confluence, they were cultured in the culture medium without serum, but with a physiological calcium concentration of 2.7 mM. The NPU cells were maintained at 37\u00b0C and 5% CO2 for 3 weeks. The experiments were approved by the Veterinary Administration of the Slovenian Ministry of Agriculture and Forestry in compliance with the Animal Health Protection Act and the Instructions for Granting Permits for Animal Experimentation for Scientific Purposes.Primary normal porcine urothelial cell cultures (NPU cells) were established as described previously  and cultg) and hAMSC were passed through 100-\u03bcm and 70-\u03bcm cell strainers and then centrifuged. Then hAMSC (p0) were plated (seeding density 1 \u00d7 104 cells/cm2) and cultured at 37\u00b0C and 5% CO2 in DMEM complete medium supplemented with 10% heat-inactivated fetal bovine serum , 2 mM L-glutamine , 100 U/ml penicillin and 100 \u03bcg/ml streptomycin or cryopreserved in 10% DMSO (Sigma-Aldrich) supplemented with 90% FBS until use. When hAMSC reached confluence, they were subcultured at a seeding density 1 \u00d7 104/cm2.Isolation of hAEC and hAMSC from human term placentas was performed as described previously . Brieflyg for 10 min and the cell suspensions were filtered through a 70 \u03bcm cell strainer , centrifuged again, plated  and cultured at 37\u00b0C and 5% CO2 in DMEM/F12 complete medium. When hAEC reached confluence, they were subcultured at a seeding density 4 \u00d7 104/cm2.For hAEC isolation, hAM was cut into pieces (15 cm \u00d7 15 cm) which were incubated for 10 min at 37\u00b0C in PBS containing 0.5 mM EDTA and 100 U/ml penicillin and 100 \u03bcg/ml streptomycin, followed by a 5-min incubation in 1\u00d7 trypsin/EDTA solution  at 37\u00b0C. The debris was discarded and the pieces were incubated for 10 min at 37\u00b0C in 1\u00d7 trypsin-EDTA solution, followed by washing in PBS and they were digested a second time in 1\u00d7 trypsin/EDTA for 10 min at 37\u00b0C. Cells from digestions were collected and centrifuged at 300 For phenotype evaluation, hAEC and hAMSC were trypsinized and then washed with FACS buffer  and 0.1% FBS (Sigma-Aldrich) in PBS), followed by a 20-min incubation at 4\u00b0C with anti-human fluorescein isothiocyanate- (FITC) or phyoerythrin- (PE) or allophycocyanin (APC)-conjugated antibodies or isotype controls (specified bellow) with 20 ml/ml polyglobin  prepared in PBS with 1% BSA to block non-specific binding. After incubation, the cells were washed with FACS buffer and the dead cells were eliminated by the propidium iodide (PI) staining. The following clones of the monoclonal antibodies were used: CD73 (clone AD2), CD90 (5E10), CD45 (HI30), CD105 (266), CD13 (L138), CD66b (G10F5) , and CD324 (67A4) .4 cells/well and 4 \u00d7 104 cells/well. For non-contact experiments, hAMSC, hAEC, CFPAC-1, Saos-2, and skin-derived human fibroblast cells were plated in the upper compartment  of transwell chambers (1 \u00d7 104 cells/transwell and 4 \u00d7 104 cells/transwell of RPMI complete medium). hAMSC, hAEC, CFPAC-1, Saos-2, and fibroblast cells were gamma-irradiated to block their proliferation ensuring the maintenance of the correct ratio during co-culture . Therefore, any proliferation observed would be attributed only to the T24 cell line, which was added after 24 h to each well in direct contact with hAMSC, hAEC, CFPAC-1, Saos-2, and skin-derived human fibroblast cells or in the lower compartment of transwell chambers (seeding density 1 \u00d7 104 cells/well in A-DMEM+F12 complete medium). After additional 24 and 48 h in culture, the proliferation of cancer cells was assessed by adding [3H]-thymidine  for 16\u201318 h and then by harvesting the cells with a Filtermate Harvester . Thymidine incorporation was measured by using a microplate scintillation and luminescence counter .The effect of amniotic-derived cells on the proliferation of T24 cells was evaluated either in direct contact or with physical separation using transwell chambers, as described previously . BrieflyThermolysin from Bacillus thermoproteolyticus rokko, Sigma-Aldrich, United States) at 37\u00b0C. After incubation, d-hAM scaffolds were rinsed with PBS and incubated for 15 min at room temperature on a shaker to remove cellular debris.Human amniotic membrane was manually separated from the chorion and washed with sterile phosphate-buffered saline (PBS), which contained antibiotics  and an antimycotic . Then hAM was cut into pieces (4 cm \u00d7 4 cm) and cryopreserved at \u201380\u00b0C in MEM  and glycerol (volume ratio 1:1) until use. After thawing at room temperature, hAMs were washed with sterile PBS (two times for 5 min) and A-DMEM+F12 culture medium (two times for 5 min). Next, the hAMs were fastened in membrane holders of 14 or 25 mm in diameter  with the amniotic epithelium facing up  or with the hAM stromal side facing up . To obtain d-hAM, hAEC were removed by a 15 min incubation in the proteolytic enzyme thermolysin  and transmission and scanning electron microscopy.Before seeding, T24 cells were labeled with a fluorescent dye DiI (Invitrogen). Briefly, T24 cells were incubated in a mixture of the DiI dye  and A-DMEM+F12 culture medium (1:1000) and incubated at 37\u00b0C for 30 min. Next, T24 cells were rinsed with culture medium (three times for 5 min). Labeled T24 cells were seeded on hAM scaffolds and synthetic scaffolds  at a seeding density of 5 \u00d7 10To evaluate the growth of T24 cells on hAM scaffolds and synthetic scaffolds, T24 cells were observed with an inverted fluorescence microscope Eclipse TE300 . Namely, on days 1, 2, 3, 7, 14, and 21 we took seven images of each scaffold at random positions. The area of the hAM scaffolds covered with T24 cells was evaluated with ImageJ software , measuriThe proliferation rate of T24 cells grown on hAM and synthetic scaffolds was analyzed by labeling the proliferating cells with the Click-it Plus EdU Alexa Fluor 488 Imaging Kit  and subsequent analysis with ImageJ software. Briefly, 24 h before the analysis the T24 cells grown on hAM and synthetic scaffolds were incubated in the culture medium A-DMEM+F12 supplemented with 10 \u03bcM 5-ethynyl-2 \u2032-deoxyuridine (EdU). To evaluate the proliferation of hAM-derived cells, the e-hAM scaffolds alone were incubated in the culture medium A-DMEMCF12 supplemented with 10 \u03bcM EdU. After 24 h, hAM scaffolds and synthetic scaffolds were fixed for 15 min with 4% formaldehyde at room temperature, washed three times with 3% BSA/PBS, permeabilized with 0.5% Triton-X-100 in PBS and incubated at room temperature for 20 min. After permeabilization, samples were washed three times with 3% BSA/PBS. To stain the proliferating T24 cells, Click-it Plus reaction buffer containing AlexaFluor picolyl azide was prepared according to the manufacturer\u2019s instructions and samples were incubated with the reaction buffer at room temperature for 30 min. Afterward, samples were washed three times with 3% BSA/PBS, nuclei were stained with DAPI and samples were examined with a fluorescence microscope AxioImager.Z1 equipped with ApoTome . Furthermore, 10 images for each sample were taken and the ratio of proliferating cells was analyzed with the ImageJ software.To prepare paraffin sections, hAM scaffolds with T24 cells were fixed with 4% formaldehyde (w/v) overnight and then paraffin sections were prepared as previously described . BrieflyFor immunofluorescence, hAM scaffolds and synthetic scaffolds with T24 cells were fixed in (a) 4% formaldehyde (w/v) for 15 min, washed in PBS for 30 min, embedded in OCT and then cryosections were prepared, and (b) in ice-cold absolute ethanol for 20 min at room temperature. After blocking in 3% BSA/PBS for 45 min, samples were incubated in polyclonal anti-collagen IV antibody , rabbit polyclonal anti-N-cadherin antibody , rabbit polyclonal anti-occludin antibody , mouse polyclonal anti-E-cadherin antibody  and rabbit polyclonal anti-Snail + Slug antibody  overnight at 4\u00b0C. As a positive control for occludin and E-cadherin stainings, the NPU cells were analyzed. The next day samples were washed in PBS and then incubated in goat anti-rabbit and goat anti-mouse IgG conjugated with Alexa Fluor 488 or Alexa Fluor 555 for 2 h at room temperature . Afterward, DAPI was applied to stain nuclei. Samples were examined with the inverted fluorescence microscope Eclipse TE300  and a fluorescence microscope AxioImager.Z1 equipped with ApoTome .20, 0.5 M TRIS HCl, 10% Sodium Dodecyl Sulfate (SDS) supplemented with a cocktail of protease and phosphatase inhibitors . Total protein quantity was determined using the Pierce BCA Protein Assay Kit . Protein extracts (50 \u03bcg) were separated using 4\u201320% Novex WedgeWell Tris-Glycine Gels  and then transferred onto the nitrocellulose membranes . The membranes were blocked with 5% skim milk in 0.1% Tris-buffered saline/Tween 20 (TBS-T) for 1 h at room temperature. Next, the membranes were incubated overnight with primary antibodies: anti-N-cadherin , anti-Snail + Slug , anti-actin , anti-collagen IV  at 4\u00b0C with gentle shaking. Next day, the membranes were washed with TBS-T and incubated with HRP-conjugated goat anti-rabbit IgG antibody  for 1 h at room temperature with gentle shaking. Finally, SuperSignal West Pico Chemiluminescent Substrate  was used to visualize the bands. Densitometric analysis was performed using the Image J software. Actin served as a loading control.For Western blot analysis, T24 cells grown on hAM and synthetic scaffolds were lysed in ice-cold extraction buffer, comprised of a deionized HHuman amniotic membrane scaffolds and synthetic scaffolds with T24 cells were prepared for transmission and scanning electron microscopy as described previously . Brieflyt-test or two-way analysis of variance (ANOVA) when appropriate, adjusted by Tukey\u2019s or Sidak\u2019s method. Statistical analysis was performed using Prism 8 . p-values of <0.05 were considered statistically significant.All data were calculated from 3 to 5 biological samples of hAM and at least 3\u201310 technical repeats for each biological sample. Data are presented as mean \u00b1 SE. Statistical analysis was performed using a two-tailed Student\u2019s The authors declare that all data supporting the findings of this study are available within the manuscript. All information about the materials and methods used are available also in the Protocols.io database .p < 0.05) and 11% (ratio 1:1), respectively. Moreover, when grown in co-culture with hAEC, the percentage of proliferating T24 cells significantly decreased by approximately 52%  and 30% , respectively (p < 0.001) and 21% , while hAEC inhibited T24 cell proliferation by 57%  and 31%   .To investigate if any anti-proliferative effects were observed also in absence of cell-contact, co-cultures were physically separated by a transwell system. In this non-contact setting, we did observe a slight decrease of T24 proliferation after both 24 h  and 48 hp < 0.001), but not when cultured at 1:1 ratio   and Saos-2 cells which have an epithelial-like morphology similar to hAEC, or with skin-derived fibroblasts which are stromal cells similar to hAMSC. Co-culture with CFPAC-1 cells for 24 h  and 48 hificant) . Insteadificant)  and 48 hificant) , at bothWhen cultured in the transwell system, CFPAC-1, Saos-2, or skin-derived human fibroblast cells were unable to decrease T24 cell proliferation at both ratios tested and both after 24 h  and 48 hp < 0.001). Moreover, on the e-hAM and s-hAM scaffolds the T24 cells grew in a monolayer or, in rare exceptions, in two layers . Our results show that hAM basal lamina remained intact even after 3 weeks in culture with T24 cells in all hAM scaffolds. The T24 cells did not invade the extracellular matrix of any of the hAM scaffolds .To further evaluate the invasive potential of T24 cells grown on hAM scaffolds, we examined the expression of N-cadherin, a hallmark of epithelial-to-mesenchymal transition (EMT), which results in the acquisition of an aggressive tumor phenotype with enhanced migratory and invasive capacity . We haveNext, we examined the expression of transcription factors Snail and Slug, which are markers of EMT  and are Next, we examined the expression of epithelial markers, such as E-cadherin and occludin and performed ultrastructural analysis of T24 cells. We found that individual T24 cells expressed E-cadherin when grown on e-hAM and s-hAM scaffolds . E-cadheSimilarly, individual T24 cells grown on hAM scaffolds also expressed occludin . On the The ultrastructural analysis of T24 cells on hAM and synthetic scaffolds showed that in general, T24 cells were more tightly attached to each other when grown on the hAM scaffolds compared to synthetic scaffolds, where large intercellular spaces were observed . MoreoveDespite high initial response rates to multiagent chemotherapy, the median survival for patients with muscle-invasive bladder cancer is 15 months and the 5-year survival rate is only 15% , 2005, bHerein, we show that both hAMSC and hAEC reduce the proliferation of T24 cells, when cultured in direct contact with T24 cells and especially when cultured at a 1:4 T24:hAM cell ratio.Our results show some heterogeneity between different biological samples, which can be attributed to placenta donor heterogeneity and also to heterogeneity among cells derived from different parts of the hAM. As 0/G1 phase and prevention of cell cycle progression to S phase , confirm that the decrease in proliferation of T24 cells in presence of hAM-derived cells is not due to a simple decreased surface area available for cell growth or to the irradiation process. When T24 cells were cultured in contact with Saos-2 cells for 48 h and at a ratio of 1:4, or when T24 cells were cultured with skin-derived human fibroblasts, we observed a reduction of their proliferation, indicating that the anti-proliferative effects of hAM-derived cells are in common with other cell types of mesodermal origin. The inhibitory effects of human fibroblasts are not surprising considering that they share immunosuppressive properties similar to mesenchymal stromal cells . Moreove S phase . Similar S phase . Additio S phase . To concFurther, to address if the anti-proliferative effect on T24 was mediated by secreted factors, we prevented the cell contact between T24 and hAM-derived cells through the use of transwell system. In this experimental setting, we did not observe a significant decrease of T24 proliferation, suggesting the need of cell-contact in the hAM-derived cells reduction of T24 cell proliferation. These results are in accordance with previously reported data, showing only a mild attenuation of cell growth of breast cancer cells induced by human umbilical cord MSC when cultured in transwell system, compared to the predominantly effect observed in direct cell-contact , or withTo test whether hAM as a whole, i.e., hAM extracellular matrix with hAM cells, also has anticancer effects, we seeded cancer urothelial T24 cells on the hAM scaffolds. Our results show that T24 cells possess an altered growth dynamic when seeded on hAM scaffolds. Furthermore, in concordance with results of growth dynamics, we have shown that hAM scaffolds diminish the proliferative potential of T24 cells.The growth-inhibitory effect of hAM scaffolds was most prominent in the first 3 days after seeding and it subsequently decreased. However, it is important to point out that the beneficial effects of hAM scaffolds persisted for at least 3 weeks after seeding . We assume that most of the various molecules responsible for the anticancer effect were rinsed and thus removed from the hAM scaffolds in the first days of culture, first due to rinsing with PBS during the preparation of scaffolds, and then during replenishing of culture medium during culture on the scaffolds. Moreover, this could also explain why d-hAM scaffolds had the lowest effect on the T24 cells since the preparation of d-hAM scaffolds includes additional rinsing steps due to the treatment with thermolysin and additionally, also depletion of hAEC in d-hAM scaffolds could contribute to lessened growth-inhibitory effect of d-hAM scaffolds.The T24 cell line  is derived from a patient with a transitional cell carcinoma of the urinary bladder. This muscle-invasive cell line has been extensively used in bladder cancer research and several studies evaluated its invasiveness . For exaIn solid cancers local invasion and metastasis account for more than 90% of mortality . FurtherFurthermore, as the expression of N-cadherin is a hallmark of muscle-invasive cancer cells, we evaluated its expression in T24 cells grown on hAM scaffolds and the synthetic scaffolds after 3 weeks in culture. Our results show that hAM scaffolds diminish the expression of N-cadherin in T24 cells, as only a few of the T24 cells grown on hAM scaffolds expressed N-cadherin, while all T24 cells grown on the synthetic scaffolds expressed N-cadherin. Furthermore, even though N-cadherin is junctional protein and is typically expressed in lateral plasma membrane of adjacent cells, in most T24 cells grown on hAM scaffolds, its expression was mostly present in the cytoplasm, and not at the cell periphery.It is known that N-cadherin is required for pro-migratory signaling and cell-cell adhesion between invasive cells . Shih anSnail and Slug are zinc-finger transcription factors that serve as suppressors of E-cadherin transcription and promote EMT . FurtherImportantly, we have also shown that individual T24 cells grown on hAM scaffolds expressed adherence junctional protein E-cadherin and occludin, one of the key components of tight junctions, which are otherwise not expressed by the T24 cells. Furthermore, T24 cells grown on hAM scaffolds were more tightly attached to each other when grown on the hAM scaffolds and also individual T24 cells on the hAM scaffolds developed some signs of the apico-basal polarity. Therefore, these changes in ultrastructure could be associated with cell cycle arrest and also decreased migration and invasion potential of muscle-invasive bladder cancer cells.Radical cystectomy is the standard of care for muscle-invasive bladder cancer. Besides being associated with considerable morbidity and mortality, this procedure also results in a lower quality of life. New approaches allowing organ preservation are being developed, most of them including chemotherapy and radiation after aggressive transurethral tumor resection .in vivo by several researchers, used hAM for augmentation after partial cystectomy in rat and dog models. Importantly, researchers report the successful regeneration of bladder mucosa and neovascularization of bladder tissue , and Comitato Etico Provinciale of Brescia number NP 2243 (19/01/2016), Italy. The patients/participants provided their written informed consent to participate in this study. The animal study was reviewed and approved by The experiments were approved by the Veterinary Administration of the Slovenian Ministry of Agriculture and Forestry in compliance with the Animal Health Protection Act and the Instructions for Granting Permits for Animal Experimentation for Scientific Purposes.TZR, UDJ, LT, AJ, MM, EV, PBS, and MK performed the experiments. TZR, UDJ, LT, AJ, MM, EV, PBS, ARS, OP, and MK interpreted the results, reviewed and edited the manuscript, and approved the final manuscript. TZR wrote the first draft of the manuscript. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "The therapeutic use of adipose-derived stromal vascular fraction (SVF) is expanding in multiple pathologies. Various processes have been proposed for manufacturing SVF but they must be revisited based on advanced therapy medicinal product (ATMP) regulations. We report here the development and validation of a fully good manufacturing practices (GMP)-compliant protocol for the isolation of SVF. Adipose tissue was collected from healthy volunteers undergoing lipoaspiration. The optimal conditions of collagenase digestion and washing were determined based on measurements of SVF cell viability, yield recovery, and cell subset distribution. Comparability of the SVF obtained using the newly developed manufacturing process (n = 6) and the Celution-based automated method (n = 33), used as a reference, was established using inter-donor analyses. Characteristics of SVF (n = 5) generated using both manufacturing protocols were analyzed for an intra-donor comparison. In addition, these comparisons also included the determination of colony-forming unit fibroblast frequency, in vitro angiogenic activity, and in vivo regenerative effects in a mouse ischemic cutaneous wound model. We successfully developed a process for the generation of SVF presenting higher cell viability and yield recovery compared to the Celution device-based protocol. Characteristics of the SVF including phenotype, capacity for angiogenesis, and wound-healing promotion attested to the comparability of the two manufacturing processes. We validated an optimized non-automated process that should allow for a GMP-compliant, more affordable, and reduced-cost strategy to exploit the potential of SVF-based regenerative therapies. Adipose tissue (AT) has long been known for its filling ability, and autologous fat transfer, also called lipofilling, is performed daily to correct soft tissue defects ,2. AT isFrom a regulatory point of view, autologous SVF is considered an advanced therapy medicinal product (ATMP) according to the European Directive No. 1394/2007, as it is prepared using enzymatic digestion  and not intended to be used for the same essential function in the recipient and the donor (non-homologous use). Thus, since it is considered a drug product, SVF manufacturing must strictly follow good manufacturing practices (GMP) from its development to the markering authorization. In others words, appropriate measures and arrangements must be applied to safeguard the quality and the security of the product for their intended use. It included trained personnel, qualified premises and equipment, appropriate documentation, quality of production operations, quality of starting and raw materials, validated quality control and analytical methods, and a qualified person for the batch release. Common steps of SVF manufacturing include AT harvesting and washing, enzymatic digestion, centrifugation, and SVF pellet isolation and washing . HoweverIn this context, we aimed to develop an effective GMP-compliant and cost-optimized method to isolate therapeutic SVF. This study details the developpement of the standardized method, the validation of critical production parameters, and finally provides in vitro and in vivo comparability data on the manually isolated SVF with reference to SVF obtained from the most commonly used automated method.AT was obtained as excedent surgical residue from healthy donors undergoing liposuction for aesthetic purposes in the department of plastic surgery, La Conception University Hospital, Marseille, France. The study was conducted in accordance with the declaration of Helsinki and all subjects provided informed consent for scientific use of the surgical residues through a survey that was validated by the regulatory affairs department of AP-HM hospitals. AT samples were anonymized before transmission to the cell therapy unit.oume, Lipoplasty Products, Sunrise, FL, USA), a 12-gauge 12-hole multiperforated cannula, through a closed circuit, preventing contamination of the harvested product. Infiltration was performed using a mixture of xylocaine 10 mg/mL and adrenaline 0.05 mg/mL diluted in a saline solution . The mean volume of harvested AT was 187.74 mL \u00b1 68.28 mL. The AT was packaged in a medical device . Once harvesting was complete, the bag was immediately transported to the cell therapy unit.AT harvesting was performed by experienced surgeons from the plastic surgery department of La Conception university hospital in an operating room under general anesthesia after a standardized skin aseptic preparation using a Khouri cannula  was transferred aseptically into a 250-mL Puregraft bag  using 60-mL syringes . AT was washed three times, with a volume of lactate Ringer\u2019s solution  equivalent to half of the total Puregraft volume, preheated at 37 \u00b0C, using the Puregraft device, allowing the drainage of residual wetting/tumescent solution, red blood cells, and other debris. After discarding the waste bag of the Puregraft device, the sample was then weighed and diluted with RL 1:1 (v/v) at 37 \u00b0C (A class). The diluted AT was transiently incubated in a 37 \u00b0C incubator  for 15 min before the addition of collagenase enzyme  directly into the Puregraft device (injection performed under laminar airflow), at concentrations of 0.10 or 0.25 U/mL for 15, 30, or 45 min at 37 \u00b0C under constant agitation using an orbital shaker. Collagenase was previously sampled and validated for free germs. Then, the cell suspension was transferred aseptically into a new medical device  to allow for cellular concentration by centrifugation (5 min at 400 g)  and filtration using a cell strainer with porosity of 200 \u00b5m  to avoid any remaining debris. The filtration and washes to remove residual enzymes were performed with 2:1 (v/v) RL or saline solution (Baxter) supplemented with 5% of human serum albumin  (NaCl 5% HAS). All steps after digestion were aseptically performed in a closed circuit established with subsequent transfers of the cell suspension between transfer bags through sterile connections created using a sterile tubing welder . Finally, the active substance was concentrated and resuspended with 10 to 15 mL of RL or NaCl 5% HSA. First, under laminar airflow, the harvested AT contained in a MACO bag ; the Celution protocol, used here as the reference protocol, is described in several investigational medical product dossiers for clinical trial authorizations . Various biological characteristics of both SVF final products were comparatively assessed and classified as SVF specifications defined for batch release (viability), critical process parameters (recovery yield), and critical quality attributes  according to the International Conference for Harmonization . The extraction method for the Celution protocol is provided below.Once the LG protocol was developed and validated, six GMP preparations of SVF were performed and retrospectively compared to batches of SVF (n = 33) previously manufactured using the Celution device (Cytori Therapeutics) according to the manufacturer\u2019s instructions. The collected lipoaspirate was washed with RL (Baxter) and enzymatically digested with Celase, a GMP cocktail of enzymes provided with consumables . The cells were concentrated, washed, aseptically recovered, and resuspended in RL.SVF was obtained using the Celution 800/CRS automated processing system  in duplicate. Recovery yield was calculated as the number of total VNCs obtained divided by the initial volume of AT, which was measured after the removal of infiltration liquid.The VNCs concentration and cell viability percentage were determined using a NucleoCounter NC-100 (Chermo Fisher Scientific) plates in triplicate in proliferation medium . Then, the colonies were grown for 12 to 14 days, depending on the growth rate of the cells, with medium changes 4 days after seeding, and then every 2 days. At the end of the assay, the culture dishes were rinsed twice with phosphate-buffered saline , fixed with abolute ethanol , and stained with Giemsa reagent  for 20 min before two washes with distilled water. Cell colonies were counted under phase-contrast microscopy . All three culture dishes were counted, and the average and standard deviation were calculated to generate the final frequency percentage value, which was expressed as the colony-forming efficiency  divided by the number of cells seeded \u00d7 100.The clonogenic potential of MSCs present in the SVF was assessed by CFU-F assay as follows. First, 500\u2009VNCs were seeded into six-well , phycoerythrin (PE), phycoerythrin-Texas Red-X (ECD), and phycoerythrin-Cyanin 5.1 (PC5) (references listed in 4Cl for 10 min before the cells were centrifuged and resuspended in PBS Ca++/Mg++-free medium (Life Technologies). Then, NucBlue (Thermo Fisher Scientific), which allows the discrimination of viable and dead cells, was added for 5 min prior to flow cytometry analysis on a NAVIOS instrument . Data files were analyzed using Kaluza software (Beckman Coulter) with a multiparameter gating strategy. Briefly, CD45\u2212 regenerative cells were discriminated as CD34\u2212CD146+ pericytes and transitional cells, CD34+CD146+ endothelial cells (ECs), and CD34+CD146\u2212CD90+ MSCs. The CD45+ population includes all hematopoietic cells .Characterization of the SVF cell subpopulations was performed by flow cytometry. Aliquots of 5 \u00d7 10bcam, Cambridge, UK) according to the manufacturer\u2019s instructions and analyzed on an optical density reader .Washing solutions obtained after all SVF washing steps were collected and sampled to measure the enzyme residual quantity using a collagenase activity assay colorimetric kit  uses a computer-controlled incubation/detection system. The media used contained proprietary factors designed to inactivate a wide variety of antibacterial and antifungal agents. Bact/alert culture bottles were incubated at 37 \u00b0C and 5% CO2 for a total of 10 days, and automated readings were taken every 10 min . The detection of organisms resulted in an audible alarm and automatic recording of time of detection.SVF  was sampled in Bact/alert culture bottles . The Bact/alert method  coated with 10 \u03bcL of growth factor-reduced Matrigel  previously polymerized for 30 min; then, they were maintained in endothelial cell growth medium  at 37 \u00b0C and 5% CO2. Capillary-like structures were recorded during 96 h using a Leica DMI8 video-imaging inverted microscope equipped with an Incubator I8 (Leica Microsystems) at 5\u00d7 magnification; images were captured using the Leica Application Suite X software . The network, length of tubes, and nodes were quantified using ImageJ software  with the Angiogenesis Analyzer plug-in http://image.bio.methods.free.fr/ImageJ/?Angiogenesis-Analyzer-for-ImageJ&lang=en). Each experiment was performed in triplicate.SVF samples produced for the intra-donor comparative analysis (n = 2) were loaded at a density of 20,000 cells per well in a \u03bc-slide angiogenesis system  and seeded in non-adherent round-bottom 96-well plates , leading to the formation of spheroids with a defined cell number. After 72 h, spheroids were collected and embedded in collagen gel . The spheroid-containing gel was rapidly transferred into pre-warmed Lab-Tek II slides (Thermo Fisher Scientific) and allowed to polymerize (30 min); then, 100 \u03bcL of EGM2-MV medium was added on the top of the gel. Following 24 h of culture in EGM2-MV medium, spheroids were fixed for 30 min in 4% paraformaldehyde at room temperature. After washing and permeabilization with PBS containing 0.1% Triton X-100 and 1% bovine serum albumin (BSA), for 2 h at 4 \u00b0C, spheroids were immunolabeled overnight at 4 \u00b0C with phalloidin coupled with Alexa-647 (Thermo Fisher Scientific) (1/100), and nuclei were stained with 6-diamidino-2-phenylindole (DAPI) (1/5000) diluted in PBS containing 1% BSA. After washing, we then captured fluorescent optical image stacks along the z-axis at 20\u00d7 magnification using two lasers in sequential mode under a Leica DMI8 microscope (Leica Microsystems). The Las X software (Leica Microsystems) was used during all image acquisition procedures. Image processing prior to image measurements was performed using Huygens Essential Deconvolution software  using up to 40 iterations of the classical maximum likelihood estimation algorithm, with a theoretical point spread function and automatic background correction. Then, the images were analyzed using the Sprout Analysis plug-in developed by Eglinger et al. [SVF samples produced for the intra-donor comparative analysis (n = 2) were suspended in culture medium containing 0.2% (wt/vol) carboxymethylcellulose  with a square hole at each center (3 cm per side). This implant was folded and inserted into the incision surrounding the flap to prevent rapid cutaneous revascularization and healing of the edges of the flap. To improve animal welfare conditions, general analgesia by buprenorphine was administered daily for 1 week postoperatively. Four 6-mm punch excisional wounds were made in the dorsal skin of each mouse, according to Sullivan. Silicone donut-shaped splints fashioned from a 0.5-mm thick sterile silicone sheet  were fixed to the skin surrounding the wounds with immediate-bonding adhesive and 5-0 nylon sutures , according to Galiano [All experimental procedures were approved by the Region #14 Animal Ethics Committee (reference no. 2015102110259745). A mouse model of cutaneous ischemia was created using 8-week-old female nude Foxn1 Galiano . This cu2 were injected at the wound edges of the four punch excisional wounds (0.4 mL of SVF for each wound). Wound closure was measured weekly for 28 days using standardized digital photographs  and analyzed with ImageJ 1.52p. Mice were randomly separated into three groups: control group, LG group, and Celution group. Each group received subcutaneous injections of SVF obtained from the same donor with the LG or Celution protocol or a control RL injection. Two million VNCs/cmraphPad Software, La Jolla, CA, USA). Quantitative variables are reported as the mean \u00b1 standard deviation (SD) or the median 25\u201375 th percentile according to the normality of their distributions; minima and maxima are also provided. Continuous variables were compared using Student\u2019s t-test or the nonparametric Mann\u2013Whitney t-test. One-way analysis of variance (ANOVA) was employed to compare more than two groups. For assessment of wound closure in the mouse model, data are reported for each group as the average percentage of wound healing \u00b1 SD from the four wounds in each mouse. Two-way ANOVA was used for the in vivo wound healing follow-up. A p-value < 0.05 was considered to indicate a statistically significant difference.Statistical analyses were performed using Graph Pad Prism 5  was obtained under conditions of 0.25 U/mL and 45 min. Flow cytometry analyses of the percentage of CD45Altogether, the 0.25 U/mL and 45 min condition was adopted, as it allows SVF to comply with the usual viability specification with acceptable yields for VNCs and the proportion of regenerative cells.p = 0.01)  and a variation coefficient of 139.27%. Conversely, the yield was more repeatable with the NaCl 5% HSA washing solution, with a median value of 4.84 \u00d7 105 VNCs/mL AT (2.79\u201311.93 \u00d7 105 VNCs/mL AT) and a variation coefficient of 89.9%. Proportions of MSCs  or NaCl 5% HSA (n = 5). The measured cell viability of the finished product was statistically increased in the NaCl 5% HSA group compared to the RL group (median 92.50% (90.10\u201394.90%) vs. 78.90% (72.10\u201382.50%),  = 0.01) A. The am = 0.01) B. Howeve of MSCs C and ECs of MSCs D identifThus, NaCl 5% HSA was chosen as the main excipient for filtering and washing of the isolated SVF due to the high viability it confers to the cell product and its ability to maintain its viability (data not shown).Four independent SVF batches (A\u2013D) were produced using the parameters validated above. After each centrifugation/washing step, the washing supernatants were retained to quantify collagenase concentrations. Analysis of the kinetics of substrate degradation by collagenase over 180 min indicated that collagenase was undetectable when at least two washing steps were applied A. LinearCollectively, these results identify production parameters that allowed us to optimally design the LG protocol and comparatively evaluate it with reference to the Celution-based method. p < 0.01). Similarly, the LG protocol generated a greater number of VNCs/mL AT, with a median value of 4.20 \u00d7 105 (3.35\u201310.58 \u00d7 105 VNCs/mL AT) vs. 2.52 \u00d7 105 (1.50\u20133.18 \u00d7 105 VNCs/mL AT) in the Celution group (p < 0.01). The clonogenic potential of MSCs, assessed via CFU-F assay, did not statistically differ between the two processes (p = 0.43). The distribution of various cell subpopulations of SVF from the LG protocol was similar to that of SVF from the reference protocol, as the respective proportions of MSCs, ECs, pericytes, and leukocytes did not statistically differ between the two protocols. The results are summarized in The viability of nucleated cells manufactured with the LG protocol (94.15% (89.83\u201393.03%)) was significantly higher compared to that acquired from the Celution device (87.30% (84.60\u201390%), 5 VNCs/mL AT (3.74\u201311.45 \u00d7 105 VNCs/mL AT) vs. 3.39 \u00d7 105 VNCs/mL AT (2.25\u20134.54 \u00d7 105 VNCs/mL AT) with the Celution device  versus 91.70% (82.95\u201392.70%) for the reference protocol A. The LGn device B. The cln device C. The ceSamples of SVF (n = 3) produced using the LG protocol were submitted to sterility testing; the results established that no microorganisms were present.5 \u00b5m (0.94\u20132.06 \u00d7 105 \u00b5m) vs. 77.50 (72.00\u201383.00) and 1.31 \u00d7 105 \u00b5m (1.27\u20131.34 \u00d7 105 \u00b5m), respectively)  and 1.50 \u00d7 10ctively) A,B. The on group E. The nuon group F. The nuon group G. Finallon group H. These p > 0.05) and 25.70% (\u00b1 19.35%) for the Celution group (p > 0.05) vs. 12.99% (\u00b113.39%) for the placebo group. The same conclusion was observed at D14, with an average wound healing of 79.98% (\u00b1 26.50%) and 87.96% (\u00b121.71%) for mice who received SVF from the LG (p < 0.05) or Celution protocol (p < 0.001) vs. 61.08% (\u00b1 33.67%) for placebo. At D21, the percentages of wound healing were 95.56% (\u00b1 8.20%), 96.80% (\u00b1 9.41%), and 91.16% (\u00b1 24.49%) for the control, Celution, and LG groups, respectively; no statistically significant difference was observed. At D28, all wounds were healed.SVF produced for the intra-donor comparative analysis was tested for its wound-healing ability  in a mouse model of subcutaneous ischemia inspired by the Galiano model . Three gIn this study, we developed and validated a protocol, based on a classical enzymatic digestion using collagenase , that wa\u2212 SVF cells are also crucial for pro-healing and angiogenesis, as ECs and pericytes make direct contributions to vessel formation and maturation [We defined each step of the process by evaluating changes in manufacturing parameters that are critical both for regulatory requirements and potential effectiveness of the final medicinal product. Viability of the nucleated cells recovered after AT enzymatic digestion was chosen to be the only product specification, as that should confirm the quality and ensure the potential efficacy of the final product according to ICH guidelines. The yield of VNCs per mL AT was defined as a critical process parameter as it is the most representative of isolation protocol efficiency. In addition, it may have an impact on the product quality and should be controlled according to ICH guidelines. The applicability of SVF isolation methods is sometimes hampered by the poor availability of large volumes of AT as the starting biological material in patients with a low body mass index such as those presenting with vascular and/or inflammatory chronic disease. The use of a recommended AT volume of \u2248100 mL in the Celution procedure can be viewed as a potential limitation. Therefore, optimization of the SVF yield is critical, making monitoring of the digestion temperature one of the most crucial parameters to obtain an effective digestion. Manual methods for SVF isolation allow digestion to be directly run in a 37 \u00b0C thermostatic chamber. Finally, the cell subset distribution and clonogenic potential of MSCs are considered critical quality attributes according to ICH guidelines. Thus, although the mechanism of action of the SVF is not fully established, and no study to date has reported a link between the cell subset distribution of SVF and its clinical benefit in patients, it has been established that the MSC counterpart plays a prominent role through its paracrine activities and/or multipotent differentiation ability . MSCs frturation ,33 and pturation ,35. For Based on these parameters, the selected protocol consists of an AT digestion step with collagenase at 0.25 U/mL AT for 45 min. The best cell viability was achieved by using the highest concentration and the longest incubation time for collagenase. Consistently, as reported by Lee and colleagues, SVF viability was shown to decrease with increasing treatment duration, but this effect is significant only for a duration equal to or greater than 60 min . The folIn the second part of our work, we first retrospectively compared the final product manufactured with the LG protocol to a reference process based on use of the Celution automated device, which was the first commercially available device for SVF production following the discovery of multipotent stem cells in AT by Zuk and her team . InteresMore importantly, the robust intra-donor comparison performed on five batches from the same AT harvest and discriminated according to the LG or Celution-based process allowed us to attest the comparability of the two methods. The viability, yield of VNCs per mL AT, CFU-F assay, and cell subset distribution were statistically similar between both cell suspensions. One trend was a higher percentage of leukocytes within SVF obtained with the LG protocol. This could be explained by the automated initial washing step of the AT provided by the Celution device. This automated washing takes into account the level of blood contamination of the initial AT and is supposed to be more effective, as rinsing and washing steps are repeated until obtaining non-bloody AT. In the LG protocol, the initial washing step is defined by three rounds of washing with RL in 1:1 proportion with AT, leading to an acceptable visual aspect of the AT before digestion. No further development was performed on this initial step, as collagenase activity is driven by required electrolytes present in RL.To our knowledge, our study is the first to implement in vitro angiogenesis testing to analyze the comparability of SVF manufacturing methods. The expected added value is to provide functional testing that can be evaluated in the future as a potency assay. Such testing is still not defined and remains challenging in the context of the use of SVF as an experimental ATMP product. Our results showed that the sprouting ability as well as the capacity to self-organize into capillary-like structures in a Matrigel matrix in vivo was not different between the two SVF production methods. This observation is in line with the fact that the main cell subsets supporting SVF angiogenic activity were similarly represented in SVF from both processes. This also suggests that the functional paracrine interactions between SVF cells during capillary formation are equivalent regardless of the SVF manufacturing process. Consistently, both SVF products tested in an innovative wound model of cutaneous excision and ischemia in nude mice were able to accelerate wound closure. The pro-healing activity did not significantly differ between SVF obtained from the LG or Celution protocols.In the few last years, a substantial number of automated and semi-automated devices have been introduced or are currently in development, with a total of 17 devices reported in the review of Oberbauer and colleagues . A largeIn conclusion, this study reports for the first time the development of a GMP-compliant process for manual SVF isolation. This process showed satisfactory performance criteria and allows the manufacturing of clinical-grade SVF with angiogenic and pro-healing potency in vivo comparable to that obtained with an automated device previously used in clinical trials. Although future studies are required to evaluate the SVF obtained using this validated protocol in clinical settings, our study offers an easy to implement, cost-effective, and standardized technical option that is part of a global strategy aimed at promoting SVF-based cell therapy and favoring patients\u2019 access to medical innovations."}
{"text": "A. protothecoides heretofore. Temperature was a critical factor affecting growth and lipid metabolism of A. protothecoides. It also remained largely unknown whether these TFs would respond to temperature stress and be involved in controlling lipid metabolism process.Both APETALA2/Ethylene Responsive Factor (AP2/ERF) superfamily and R2R3-MYB family were from one of the largest diverse families of transcription factors (TFs) in plants, and played important roles in plant development and responses to various stresses. However, no systematic analysis of these TFs had been conducted in the green algae Hereby, a total of six AP2 TFs, six ERF TFs and six R2R3-MYB TFs were identified and their expression profiles were also analyzed under low-temperature (LT) and high-temperature (HT) stresses. Meanwhile, differential adjustments of lipid pathways were triggered, with enhanced triacylglycerol accumulation. A co-expression network was built between these 18 TFs and 32 lipid-metabolism-related genes, suggesting intrinsic associations between TFs and the regulatory mechanism of lipid metabolism.This study represented an important first step towards identifying functions and roles of AP2 superfamily and R2R3-MYB family in lipid adjustments and response to temperature stress. These findings would facilitate the biotechnological development in microalgae-based biofuel production and the better understanding of photosynthetic organisms\u2019 adaptive mechanism to temperature stress. AP2/ERF superfamily was a large family of plant transcription factors, containing one or two conserved AP2 DNA-binding domains (60\u201370 conserved amino acid sequences) . The AP2Chlamydomonas reinhardtii . The inoculum cultures were incubated at 28\u00a0\u2103 under 50\u00a0\u03bcmol\u00a0m\u22122\u00a0s\u22121 PAR in the dark/light cycles of 12-h Light/12-h Dark on an orbital shaker at 140\u00a0rpm for 48\u00a0h to reach the midlog phase (\u00d7108\u00a0cells/mL) as of seeds. Then, they were inoculated at the ratio of 10% (v/v) into a 500-mL Erlenmeyer flask with 200\u00a0mL medium with orbital shaking at 140\u00a0rpm under different temperature conditions (10\u00a0\u2103/28\u00a0\u2103/32\u00a0\u2103). Cells were cultivated without light illumination and any external supply of CO2. The experiments were repeated at least three times.escribed , includiCells were collected at 96\u00a0h in 10-mL tubes, rapidly harvested by centrifugation, frozen in liquid nitrogen and stored at \u2212\u200980\u00a0\u00b0C until lipid extraction. The lipid inactivation and extraction steps were performed twice and lipid extracts were pooled and dried. All LC\u2013MS analyses were carried out on an Exion UPLC coupled to QTRAP 6500 Plus . Further details of lipid extraction and LC\u2013MS analyses were described in the Additional file P\u2009<\u20090.05).Data statistical analyses were performed using the SPSS 21 software. Data were presented as mean values\u2009\u00b1\u2009SDs. For the statistical analyses of lipidomic data, non-parametric comparisons were performed by applying Kruskal\u2013Wallis test  and DGDG (B) in A. protothecoides grown for 96\u00a0h under low and high temperature stress. Figure S8. Heat map of differential expression of genes encoding lipases and genes involved in lipid transport under low and high temperature stress. Figure S9. Phylogenetic relationships of lipid acyltransferases from A. protothecoides, other green algae and plant.Additional file 2: Table S1. The RNA-seq data for the putative AP2/ERF and R2R3-MYB transcriptional factors of A. protothecoides. Table S2. The relative transcript levels of AP2/ERF and R2R3-MYB genes in response to low and high temperature stress in A. protothecoides grown for 168\u00a0h. Table S3. The detailed information of lipid species identified in this study. Table S4. The contents of the glycerolipid molecular species in A. protothecoides grown for 96\u00a0h under low, normal and high temperature conditions. Table S5. The RNA-seq data for the putative genes in glycerolipid metabolism of A. protothecoides grown for 96\u00a0h under low and high temperature stress. Table S6. Subcellular localization predictions for candidate proteins involved in glycerolipid metabolism in A. protothecoides. Table S7. The relative transcript levels of 32 individual genes associated with lipid metabolism in response to low and high temperature stress in A. protothecoides grown for 168\u00a0h. Table S8. Primers sequences used for RT-qPCR analysis.Additional file 3. Additional methods."}
{"text": "Rhipicephalus microplus transcriptome, we used RNA-seq to carry out a study of expression in (i) embryos; (ii) ovaries from partially and fully engorged females; (iii) salivary glands from partially engorged females; (iv) fat body from partially and fully engorged females; and (v) digestive cells from partially, and (vi) fully engorged females. We obtained >\u2009500 million Illumina reads which were assembled de novo, producing >\u2009190,000 contigs, identifying 18,857 coding sequences (CDS). Reads from each library were mapped back into the assembled transcriptome giving a view of gene expression in different tissues. Transcriptomic expression and pathway analysis showed that several genes related in blood digestion and host-parasite interaction were overexpressed in digestive cells compared with other tissues. Furthermore, essential genes for the cell development and embryogenesis were overexpressed in ovaries. Taken altogether, these data offer novel insights into the physiology of production and role of saliva, blood digestion, energy metabolism, and development with submission of 10,932 novel tissue/cell specific CDS to the NCBI database for this important tick species.To further obtain insights into the  Rhipicephalus microplus is a one-host tick, which preferentially feeds on bovines, and it is considered the most harmful cattle parasite2. The economic losses associated with R. microplus parasitism are due to direct effects of the tick itself, which causes skin injuries and long-standing blood loss, leading to anemia and reduction of both weight gain and milk production, or are produced indirectly via transmission of tick-borne pathogens such as Babesia spp. and Anaplasma marginale3. In spite of its huge impact on the economy, current tick control strategies still rely mostly on the use of chemical acaricides, even though selection of resistant tick populations to major used acaricides has been confirmed5. This is recognized as a worldwide drawback to successful tick control. Immunization of cattle against R.\u00a0microplus and other ticks has been recognized as an alternative approach against chemical control strategy6. Thus, a deeper understanding of tick physiology is needed as a means to find molecular targets that can be useful in the development of novel tick control methods.The cattle tick 8. The genomes of Ixodes persulcatus, Ixodes scapularis,\u00a0Haemaphysalis longicornis, Dermacentor silvarum, Hyalomma asiaticum, Rhipicephalus sanguineus, and Rhipicephalus microplus have been sequenced and now are helpful resources for studying tick physiology and biology11. The genome of the cattle tick R. microplus was estimated to be 7.1 Gbp in length and consists of approximately 70% repetitive DNA12. Recently, a cattle tick genome draft was reported13 using a hybrid sequencing and assembly approach to capture the repetitive fractions of the genome. According to this study, the R. microplus genome assembly is composed of 51.4% repetitive sequences, containing 38,827 putative R. microplus gene loci, of which 24,758 are protein coding genes13. In spite of the large number of loci and of the significant advance provided by this genome assembly, based on the proportions of highly conserved single copy genes found in all arthropods, the degree of completeness of this assemblage was estimated to be about 41%, still leaving a vast open field for gene discovery in this organism. Recently, a remarkable publication reported the genome assembly of six tick species, including that of R. microplus11. A BUSCO analysis of the predicted proteome of this tick indicated a 51.8% of complete and single BUSCOs, an improvement over the assembly of Barrero et al.13.Transcriptomic analyses have contributed with valuable information regarding the physiology of several parasites, including ticks13, transcriptomes17, and proteomes of ticks19. Based on these datasets, many different experiments have been carried out that elucidated tick-host20 or tick-pathogen interactions19, and can support the development of new control strategies15. Taken together, these reports highlighted the complexity of tick physiology mechanisms comprising both known and novel proteins participating in multiple cellular pathways. Recently, one study in Ixodes ricinus transcriptome shows that the genes involved in cuticle formation, chitin metabolism, and blood digestion enzymes are more related to fed stages. The basic energy metabolism pathway genes are more actively expressed during unfed stages, egg development, and embryogenesis21. In another recently published study, an integrated R. microplus transcriptome and proteome analyses of larvae and salivary glands of nymphs, males and females feeding on susceptible and resistant bovine hosts showed that the expression of genes involved in the host-parasite interaction are associated with host immune activation profile22.Currently, there are several studies describing the genomeR. microplus transcriptome, we used RNAseq to carry out a study of tissue differential gene expression: (i) embryos from 1, 3, 5, 7, 9, 11, 13\u00a0day-old eggs; (ii) ovaries from partially and fully engorged females; (iii) salivary glands from partially engorged females; (iv) fat body from partially and fully engorged females; and (v and vi) digestive cells from partially and fully engorged females. Reads from each library were mapped back into assembled transcriptome, giving us a view of gene expression in different tissues. Taken altogether, this study offers additional transcriptomic data for this important tick species. The data illustrate the dynamic gene expression changes during the parasitic phase and the embryo development of R. microplus and reveals sets of genes that have a highly tissue-specific expression profile, pointing to pathways that may perform essential roles in the physiology of these tissues. These findings could be useful for future studies of tick physiology, contributing to the development of new tick control methods, as well as new biotechnological and pharmacological applications.Here, aiming to obtain a further insight into Rhipicephalus microplus, we used\u00a0RNA-seq\u00a0to carry out a transcriptome study:(i) embryo from 1, 3, 5, 7, 9, 11, 13-day-old eggs (EMB); (ii) ovaries (OV) from partially and fully engorged females; (iii) salivary glands (SG) from partially engorged females; (iv) fat bodies (FB) from partially and fully engorged females; and (v) digestive cells from partially engorged females, and (vi) fully engorged females . We obtained >\u2009500 million raw reads, and after removal of Illumina primers and trimming of low quality bases, we obtained >\u2009190 million high quality reads  were obtained  using BLASTP. Over 9198 (48%), 10,308 (54%), and 13,692 (72%) of protein-coding sequences in the transcriptome had at least one significant BLASTP hit when using E-values\u2009<\u20091e\u201310,\u2009<\u20091e\u20135, or\u2009<\u20091, respectively , in order to avoid inclusion of poorly expressed contigs, totaling 16,240 CDS. The data presented a characteristic transcriptional pattern for each tissue, revealing a clear tissue-specific clustering of overexpressed genes in all samples  to highlight that some alterations are introduced in this storage lipoprotein after endocytosis. Vt is a major source of raw materials that support embryo growth. Proteases involved in Vt digestion in R. microplus have been described33. Interestingly, these enzyme transcripts are not abundant in ovaries, but are highly expressed in gut cells and fat body  transcripts , which were highly expressed in fat body and in gut digestive cellsdy Table \u2013S8. This25. Other examples are the tick heme-binding aspartic proteinase (THAP\u2014Rm-14882) and Boophilus yolk-pro-cathepsin (BYC\u2014Rm-849). From all the cathepsin-B coding transcripts with a role in oogenesis, only one (Rm-23945) is overexpressed in the ovary when compared with other tissues, suggesting a role in Vt degradation. A distinct pattern is observed for the Vg receptor (VgR\u2014Rm-80856), since its transcript was expressed mostly in the ovary. The VgR is responsible for Vg uptake; the main reserve protein stored in oocytes for embryo development35.Transcripts coding for proteases involved in Vt digestion are overexpressed, such as the vitellogenin-degrading cysteine endopeptidase (VTDCE\u2014Rm-15854), which was not significantly found in the ovary, and was overexpressed in DIG-F and FB Table . The VTD36. However, a sequence coding to a transcript that is highly homologous to a juvenile hormone acid methyltransferase is overexpressed in the ovary (Rm-49336).Transcripts encoding for proteins involved in nuclear regulation and export from the nucleus such as cell division control protein, chromatin assembly and modification-related proteins, enzymes involved in DNA synthesis and repair, and histone-related proteins represent about 18% of total RPKM for the ovary. Similarly, proteins involved in signal transduction correspond to about 6% of total RPKM Table , includiThe analysis of expression of the detoxification genes Fig.\u00a0 in all o37, a role that could well be assigned to these tick homologs.The presence of a robust flow of antioxidant potential calls for an equally high source of reactive oxygen species. The fact that two transcripts coding for Duox type NADPH oxidases also have a predominant expression in ovaries make these proteins a candidate for this role. Interestingly, this enzyme has been ascribed a role as the source of hydrogen peroxide for chorion protein cross-linking in an insect39. In ticks, the ovary is the residence of intracellular bacteria symbionts that are essential to tick development42. However, Guizzo et al.43 recently reported a quantitative analysis of the R. microplus microbial community revealing that, different from most animals, the tick gut harbors a very modest (if any) resident microbiota, in contrast to the ovary which has a large population of a Coxiella mutualist symbiont, that increase following the blood meal, paralleling the course of ovarian growth43. Interesting, Amblyomma sculptum and Amblyomma aureolatum have distinct transcriptional profiles of gut44 and microbiota composition45 that can be related to susceptibility to Rickettsia rickettsii.Duox enzymes also have been ascribed a central role in the control of gut microbial symbionts in several insect speciesR. microplus microbial population in the ovary might also involve production of reactive oxygen species, making it essential for a panel of antioxidants to maintain intracellular redox homeostasis. This last hypothesis is in accordance with the identification of seventeen transcripts showing similarity to the antimicrobial peptide microplusin , aurora kinases, polo-like kinases, and checkpoint kinases  are the most important protein kinases related to cell division. Figure R. microplus and I. persulcatus ticks53. Yet regarding control of cell fate and development, nucleoredoxin, a member of the thioredoxin family known to regulate the Wnt/beta-catenin signaling pathway in a redox-dependent way, also showed a high expression level in the ovary54.Research on insect reproduction has characterized many physiological and molecular properties of ovary and egg developmentComparative analysis of embryo allowed the identification of 347 transcripts that are five times overexpressed in embryos than in other analyzed samples Table . Interes57. In insects, these protective cellular layers prevent the loss of water and secrete defensins against bacterial infections; these protective layers are absent in tick embryonic development. These secreted proteins may have a role in immune protection during the long embryogenesis of R. microplus, which takes about 21\u201322\u00a0days in a potentially harmful environment 58.Among these 347 embryo-specific transcripts, those encoding transposons, lipocalins, glycine-rich proteins, and secreted proteins are the most abundant. These secreted proteins are homologous to genes previously described as defensins or genes involved in immune response. Some of these secreted molecules specifically expressed during embryogenesis could be trans-peptides involved in immune response during embryogenesis. Such a finding would be important for embryo survival, since chelicerates such as ticks do not display an extraembryonic enveloping protective layer such as the serosa, which is involved in embryonic immune response in insect egg. Conversely, protective layers have independently evolved in other chelicerates such as scorpionsR. microplus saliva is a complex mixture rich in bioactive compounds that modulate host hemostasis and immunological defenses to allow tick feeding activity60. In recent decades, cumulative information from transcriptomic and proteomic analyses of salivary glands and tick saliva of several tick species have provided insights into the immunological interactions at the tick\u2013host interface. In addition to facilitating blood-feeding, the antihemostatic and immunomodulatory activities of tick saliva may also support survival and establishment of hemopathogens in the host61. R. microplus\u00a0larvae attach to its host and then begin to feed and molt in nymphs before molting into immature adults, a process that takes around 12\u00a0days59. After mating, adult partially engorged females take larger blood meals to complete the maturation within 21\u201322\u00a0days and detach62. In the current study, SG were dissected from adult females feed on the host during 17 and 22\u00a0days. Therefore, data shown here combine part of the slow feeding phase and of the final rapid feeding phase. Consistent with reports that other tick species change salivary composition during feeding67, data in this study reveal that 320 transcripts are overexpressed in SG when compared to other tissues, including contigs encoding metalloproteases, proteinase inhibitors, and lipocalins olytic activities68. In a related study, RNAi silencing of metalloproteases from I.\u00a0ricinus impaired blood meal feeding and egg laying70. In R. microplus, vaccination with recombinant metalloprotease 4 (rBrRm\u2010MP4) significantly decreases the number of ticks that complete the life cycle on the host and egg hatching, providing an overall protection of 60% against tick infestation65.Tick metalloproteases have been suggested as participating in platelet disaggregation and blood coagulation by fibrinolytic and gelatinase activities, thereby facilitating blood feeding71. In ticks, some protease inhibitors have several Kunitz domains in tandem, and they are classified as monolaris, bilaris, trilaris, and so on, according the number of Kunitz domains. In R. microplus, 11 Kunitz protease inhibitors are overexpressed in the salivary glands, including nine monolaris and two bilaris  signature domains have been reported in blood-feeding mosquitoes and tick sialomes76. In R. microplus, TIL family members include peptides closely related to tick elastase inhibitors, which also have antimicrobial activity77, with a total of three contigs overexpressed in SG , and cystatin were overexpressed in SG Table . Most Kuis Table . SeveralSG Table .78. Contigs matching the tick histamine-binding domain were identified being overexpressed in SG of R. microplus us Table . The hig80. After erythrocyte lysis, blood proteins are taken up by endocytosis and digested in acidic vesicles by lysosomal hydrolases81. To address this singularity of the biology of ticks, we prepared cDNA libraries from DIG that were isolated from (1) partially engorged adult females (DIG-P) that were still engaged in the process blood feeding and were in the \u201cbig sip\u201d stage, and (2) fully engorged females (DIG-F) that had already completed blood meal and have detached from the host. To our knowledge, this is the first transcriptomic analysis of this cell type, as other previous studies on gene expression in tick gut have used whole organ extracts83.A unique feature of tick physiology that differs from hematophagous insects is that blood digestion is entirely intracellular, occurring inside a differentiated cell lineage: the so-called digest cells (DIG)Dermacentor variabilis gut84 and accounts alone for close to 20% of the total digestive secretome RPKM of R. microplus  were found in the DIGs libraries. Noticeably, although several inhibitors of cysteine proteinase (cystatins) were identified, these were nearly ten times less expressed than inhibitors of serine proteases. These inhibitors can be related to the inhibition of mammalian proteases involved in blood coagulation and complement cascades87, acting as a regulator of blood digestion in gut88 and modulation of the tick immune proteolytic cascades, that have been ascribed relevant roles in the interaction with the microbiota and with pathogens89. However, it is also possible to speculate that part of these inhibitors might be negative regulators of hemoglobin degradation, as the proteolytic activity involves the release of large amounts of heme, a pro-oxidant molecule90. Keeping the pace of hemoglobin degradation with heme detoxification should be of paramount importance for this cell. Regarding this topic, it is relevant to observe that in DIGs a significant expression of three transcripts coding for an aspartic proteinase, whose activity was shown to be inhibited by heme , was previously described as related to oogenesis28. In this study, THAP was found almost exclusively in the gut (97% of the RPKM); a result that makes it very likely that THAP may also play a relevant role in dietary hemoglobin degradation. However, we also identified the presence of two other contigs of probable paralogous enzymes  was highly transcribed in DIGs, similar to 97.Analysis of transcripts coding for classical antioxidant enzymes showed a common core of antioxidant potential sustained by glutathione synthesis , thioredoxin, and two transcripts coding for thioredoxin reductases, a phospholipid-dependent glutathione peroxidase, and the mitochondrial Mn-SOD that are expressed in all tissues. DIG libraries, however, showed particularly high expression levels of specific isoforms for the cytosolic Cu, Zn SOD, and a thioredoxin peroxidase (2-cys family), plus a selenium glutathione peroxidase and catalase, highlighting a focus on hydrogen peroxide detoxification by this cell type. A result that is in line with previous experimental data reporting the severe effect of chemical inhibition of catalase on blood fed ticks98. This hypothesis is consistent with some sulfotransferases  decreased expression in digestive cells after blood meal, making it likely that those enzymes are acting as players in extracellular matrix production that might support the growth of cells  is a sulfate donor to the biosynthesis of sulfated polysaccharides, major components of extracellular matrix of the tick gut101, where ABC-like transporters were implicated on heme transport in digestive cells of R. microplus. In addition, although this transporter has considerable expression levels in gut, it is even more intensively expressed in the ovary, which raises the interesting possibility that these transporters may be involved in heme transport to the growing oocyte, where vitellin is a major heme-storage protein.A major feature of tick gut DIGs is the presence of an organelle dedicated to heme detoxification, the hemosome. A heme transporting pathway directs heme derived from hemoglobin degradation in the acidic digestive vacuoles to the cytosol and then to the hemosome. Several ABC transporters have high expression levels in DIGs and therefore are likely candidates to function as heme transporters, including Rm-73791 that is almost exclusively expressed in DIGs. This is in accordance with previous biochemical data102.Among typical immune effectors, only defensins seem to be highly expressed in the DIG. However, transcripts receiving an immune label were mainly related to bacterial killing by phagocytosis . This is consistent with the digestive function of these cells being exerted by means of digestion of blood proteins in a lysosomal acid compartment and can be related to very low bacterial levels observed in the gut, including during blood feeding103, carbohydrate metabolism in this organism deserves some discussion concerning the correlation with this very rich protein diet. Two hexokinase coding transcripts were found in the six libraries analyzed. The isoform represented by Rm-54671, is almost 30 times more expressed than Rm-19014, but it is from six to seventy times less expressed in digestive cells than in any other tissue , UDPG-pyrophosphorylase (Rm-37883), UTP-glucose-1-phosphate uridyltransferase (Rm-26034), glycogen synthase (Rm-18733), and glycogen phosphorylase (Rm-26011) are observed in all tissues. The enzymes involved in glycogen accumulation are poorly expressed in digestive cells of fully engorged females. The transcript coding for hexokinase, the first enzyme of the glycolytic pathway, has a very low expression in digestive cells of both partially and fully engorged females; we could not find a transcript coding for phosphofructokinase-1. In contrast, the glucose 6-phosphate-phosphatase transcript was highly expressed, especially in digestive cells of partially engorged females. The high abundance of this transcript in digestive cells led us to speculate that most of the glucose in these cells might not come from the blood meal but from gluconeogenesis, and later being exported to hemolymph and other tissues. The following six enzymes catalyze reactions that are reversible in cellular conditions; the direction of these reactions thus being governed by the law of mass action, and therefore participating both in glycolysis and gluconeogenesis: fructose-bisphosphate aldolase (Rm-1568), triosephosphate isomerase (Rm-4663), glyceraldehyde 3-phosphate dehydrogenase (Rm-10107), 3-phosphoglycerate kinase (Rm-26739), phosphoglycerate mutase (Rm-62495), and enolase (Rm-19039) were found. Their expression levels, although varying among organs, are higher than those of transcripts coding for enzymes that are participating only in glycolysis but not in gluconeogenesis Table .R. microplus , were expressed in all organs tested. Nevertheless, their expression is higher in salivary glands. Moreover, ORFs of all enzymes necessary for \u03b2-oxidation were found, showing that conversion of fatty acids into ketone bodies occurs in us Table .Enzymes coding for the pentose phosphate pathway are all present in all tissues but are particularly highly expressed in the ovary. This could account for the high demand for NADPH reducing power by the glutathione/thioredoxin dependent antioxidant mechanisms described above, as well as by the very pronounced concentration of the lipid biosynthesis in the ovary .R. microplus revealed 210 CDS classified in the immune system category -related Lipid-recognition)] domain containing proteins , and GILT 108. GILT are the only molecules capable of keeping essential SH residues of cysteine proteinases reduced at acid pH, therefore preserving their activity inside the endosomal pathway109. As mentioned above, the R. microplus gut is inhabited by a very minute microbial population, probably reflecting the operation of a powerful microbe killing control, such as the production of hemocidins111. Data presented here suggest that the endosomal/lysosomal pathway also play a central role in the gut immunity of ticks  are missing in ticks, as well as in plesiomorphic orders of insects (Hemiptera) and crustaceans. However, it was observed that IMD pathway is functional in I. scapularis115 and in R. microplus116 , although little is known about its activation and effectors. Reports on functional characterization of components of tick immune signaling pathways are also scarce. It has been suggested that the JAK/STAT pathway plays a role in the control of infection by both Anaplasma phagocytophilum118 and Borrelia burgdorferi119 in I. scapularis. Moreover, it was reported that the host IFN\u03b3 upregulates a tick GTPase through the JAK/STAT pathway, limiting B. burgdorferi proliferation120. The IMD pathway was also enrolled in protection of ticks against infection. The knockdown of the transcription factor Relish increased the susceptibility of R. microplus to Anaplasma marginale116 and of I. scapularis to A. phagocytophilum115. Interestingly, it was shown that the activation of IMD pathway does not occur through recognition of bacterial peptidoglycans by PGRPs (peptidoglycan-recognition proteins) as in insects, but through recognition of bacterial lipids115.Different from the vastly available information on the immune signaling pathways in insects, very little is known about this subject in ticks. Sequences encoding components of immune signaling pathways were identified in the genome of 114. This result reinforces the constitutive expression of signaling pathway components in R. microplus, as previously suggested114.In the current study, we identified five CDS of Toll-like receptors and two CDS of the cytokine spaetzle, which are components of Toll pathway Table . Other c121. Among the AMPs described in ticks, defensins are a prominent group. These small peptides are synthesized as preprodefensins and are present in several species of both soft and hard ticks122. In R. microplus, one defensin was found in hemocytes47. Importantly, the knockdown of varisin, a defensin from the tick D. variabilis, reduced in 50% the activity of hemolymph against the Gram-positive bacterium Micrococcus luteus123. On the other hand, silencing of this same gene intriguingly reduced the infection of the tick-borne pathogen A. marginale124. Also, defensins were reported to be differentially expressed upon infection with Rickettsia montanensis125. In addition to hemolymph, expression of defensins was also reported to occur in other tick organs, for example the gut and salivary glands. Nineteen defensin CDS were here identified in the R. microplus transcriptome. Among them, one CDS exhibited high transcript levels in digestive cells and another in salivary glands  and cysteine (cathepsin L-type) peptidases. Notably, transcripts of both cathepsins D- and L-types were detected in the current study  and in synganglion of Amblyomma hebraeum129. It was shown that microplusin has the property of chelating copper, inhibiting the respiration of both bacteria and fungi131. Twenty-one microplusin CDS were detected in the present study . This study was conducted considering ethic and methodological aspects in agreement with the International and National Directives and Norms by the Animal Experimentation Ethics Committee of the Universidade Federal do Rio Grande do Sul (UFRGS). The protocol was approved by the Comiss\u00e3o de \u00c9tica no Uso de Animais (CEUA) \u2013 UFRGS (project 14403).Rhipicephalus microplus ticks (Porto Alegre strain) free of Babesia sp. and Anaplasma sp. were maintained on Hereford bovines acquired from a naturally tick-free area . The bovines were housed in individual thick-proof pens on slatted floors and infested with 20,000 10-day-old R. microplus larvae per animal59. Partially engorged female (PEF) ticks were manually removed from cattle, while fully engorged female (FEF) ticks were obtained after spontaneous detachment from the host. After collection, ticks were washed with 70% ethanol and had the dorsal surface dissected with a scalpel blade.81. Essentially, ticks were dissected in Petri dish containing sterile PBS, guts were isolated, opened gently with tweezers, and cells were detached from the gut wall manually with tweezers. Subsequently, cells were carefully collected using a 1-mL pipette tip, washed three times in sterile PBS and placed in a 12-well culture plate. In order to reduce the amount of debris and gut soluble contents, cells were washed with a gentle flow of culture medium (L-15 Leibowitz\u2019s medium supplemented with 150\u00a0mM NaCl) produced by a 1-mL pipette tip. During the isolation of the digestive cells, the gut was dissected and kept in an ice-cold medium. The procedure can be observed by the movie file included as Digestive cells were isolated as previously describedTissues (as described below) were separated with fine-tipped forceps and washed in ice-cold phosphate buffered saline pH 7.2 (PBS). For egg collection, FEF ticks were collected and incubated in Petry dishes at 28\u00a0\u00b0C and 85% relative humidity until oviposition. For embryos, eggs were kept during twelve days in disposable tubes under the same conditions as described above. Total RNA was extracted from the following tissues: (i) embryos ; (ii) ovaries from partially and fully engorged females; (iii) salivary glands from partially engorged females; (iv) fat bodies from partially and fully engorged females; (v and vi) digestive cells from partially and fully engorged females, using TRIZOL reagent according to the manufacturers\u2019 instructions . A total amount of 10\u00a0\u00b5g RNA was used as input material for the library preparation. Sequencing libraries were generated using the IlluminaTruSeqTM RNA Sample Preparation Kit  following the manufacturer\u2019s recommendations.14. Illumina adaptor sequences and low-quality bases were removed from the raw reads. The quality-filtered sequence reads of each sample were pooled to generate a single transcriptome assembly of the R. microplus. Reads were assembled with Abyss 1.3.3 software (https://www.bcgsc.ca/resources/software/abyss)133 with various k values . Because the Abyss software tends to miss highly expressed contigs, we have also run the Trinity 2.0 assembler (https://trinityrnaseq.github.io/)134 on the raw data. The resulting assemblies were joined by an iterative BLAST and CAP3 assembler14.Bioinformatic analyses were performed as described previously14, based on similarities to known proteins, or by obtaining coding sequences from the larger open reading frame (ORF) of the contigs containing a signal peptide identified by version 3.0 of the SignalP software 135. A non-redundant set of the coding sequences and their protein sequences were mapped into a hyperlinked excel spreadsheet. Signal peptide, transmembrane domains, furin cleavage sites, and glycosylation sites were determined with software from the Center for Biological Sequence Analysis (https://www.cbs.dtu.dk/services/). The automated annotation of the proteins was based on matches to various databases, including Gene Ontology (https://geneontology.org/)136, Pfam (https://pfam.xfam.org/)78, Swissprot (https://www.ebi.ac.uk/uniprot/), KOG (https://mycocosm.jgi.doe.gov/help/kogbrowser.jsf)137, SMART (https://smart.embl-heidelberg.de/)138, Refseq-invertebrates, and sequences containing Acari [organism] protein sequences obtained from GenBank (https://www.ncbi.nlm.nih.gov/genbank/). The manual annotation was performed as detailed in previous article14.Coding sequences (CDS) were extracted using an automated pipelineTo estimate the transcripts abundance, reads were mapped back into the CDS using BLASTn with a word size of 25 (-W 25 switch). The matches were used if they had less than two gaps and if their scores were equal to the best score. The resulting BLAST file was used to compile the number of reads each CDS received from each library, and to count the number of hits at each base of the CDS, allowing for the determination of the average CDS coverage, percent linear coverage, as well as maximum and minimum coverage. Mapping of the reads and RPKM values were included in an Excel spreadsheet.13 were used as reference to assess the assembly quality in terms of gene completeness using BUSCO v. 4.1.3 (https://busco.ezlab.org/)23.Finally, tick genomesSupplementary Table S1.Supplementary Information.Supplementary Video 1."}
{"text": "A patient\u2019s survival may depend on several known and unknown factors and it may also vary spatially across a region. Socioeconomic status, accessibility to healthcare and other environmental factors are likely to contribute to survival rates. The aim of the study was to model the spatial variation in survival for colorectal cancer patients in Malaysia, accounting for individual and socioeconomic risk factors. We conducted a retrospective study of 4412 colorectal cancer  patients diagnosed from 2008 to 2013 to model survival in CRC patients. We used the data recorded in the database of the Malaysian National Cancer Patient Registry-Colorectal Cancer (NCPR-CRC). Spatial location was assigned based on the patients\u2019 central district location, which involves 144 administrative districts of Malaysia. We fitted a parametric proportional hazards model in which the spatially correlated frailties were modelled by a log-Gaussian stochastic process to analyse the spatially referenced survival data, which is also known as a spatial survival model. After controlling for individual and area level characteristics, our findings indicate wide spatial variation in colorectal cancer survival across Malaysia. Better healthcare provision and higher socioeconomic index in the districts where patients live decreased the risk of death from colorectal cancer, but these associations were not statistically significant. Reliable measurement of environmental factors is needed to provide good insight into the effects of potential risk factors for the disease. For example, a better metric is needed to measure socioeconomic status and accessibility to healthcare in the country. The findings provide new information that might be of use to the Ministry of Health in identifying populations with an increased risk of poor survival, and for planning and providing cancer control services.  Cancer is a major health burden across the world, with over 14.1 million new cancer cases worldwide in 2012. Of these, around 1.35 million cases (9.6%) are new cases of colorectal cancer. The number of colorectal cancer cases is expected to increase by 80% by 2035, climbing to approximately 2.4 million new colorectal cancer cases and contributing to 1.3 million deaths worldwide [A number of studies have been carried out to investigate and model the spatial variation in survival for various types of cancer. For example, the spatial model of spatial variation in leukaemia survival in north west England , the spaSpatial variation in the survival of colorectal cancer patients has been observed in several studies conducted in developed countries. A study observed disparities in survival across New Jersey among more than 25,000 people diagnosed with colorectal cancer between 1996 and 2003. The lowest survival rates were found mostly in economically deprived areas while those in affluent areas had longer survival times; lack of healthcare accessibility is assumed to be one of the key predictive factors here .Existing research has quantified the geographical variation in survival using a discrete-time multilevel logistic survival analysis for colorectal cancer patients . This reIn Spain , space-tMaterial deprivation and geographical accessibility to healthcare were found to influence survival in colorectal cancer in a study involving cases from three cancer registries in France and one cancer registry in England . This stThere have been several previous studies that have examined the spatial distribution of colorectal cancer incidence in areas of Malaysia, and which have described variation in colorectal cancer incidence, but none have investigated the spatial variation in survival from this disease ,15,16. TOur aim is to model the spatial variation in survival for colorectal cancer patients in Malaysia while accounting for individual and socioeconomic risk factors. We also aim to investigate how individual and socioeconomic factors might affect survival from colorectal cancer, adjusting for spatial location.Identifying the factors that influence the difference in survival rates across the region may help public health authorities to better plan healthcare delivery, and thus eventually reduce disparities in colorectal cancer survival in Malaysia.There are two national cancer registries in Malaysia: the National Cancer Registry (NCR) and the National Cancer Patient Registry (NCPR) . Both arThe NCR captures the data on diagnoses from all regions in Malaysia. Diagnoses are reported to a state registry and from there to the National Registry. However, reporting cases to the state registries from hospitals is voluntary and therefore it is not always completed. However, the NCR is not passive; it conducts active case finding and routine checks. Assessment of the completeness of registration in the NCR is difficult because it is not clear how many of the 165 main hospitals in Malaysia are sending records to the registry, or how accurately diagnoses are recorded even when they are sent .The NCPR collects data on registrations of cancer from participating sites. These participating sites include 34 hospitals that diagnose and treat cancer patients in Malaysia. The objectives of the NCPR are to describe the natural history of cancers and to determine the effectiveness of treatments, to monitor safety, and to evaluate access to treatments. The NCPR collects data on four cancers: colorectal cancer, blood cancers, breast cancer and nasopharyngeal cancers. The NCPR records diagnoses and collects clinical data on risk factors, treatments and patient outcomes. This makes the NCPR data useful for research into the effects of treatments and survival from cancers . This stOur data consisted of 4501 patients with histologically verified primary colorectal cancer diagnosed between 2008 and 2013 . After excluding patients without Malaysian citizenship, patients with negative age and negative survival time, there were 4412 subjects\u2019 data available for analysis.There are many instances in this dataset where information was missing or incomplete, but these are recorded inconsistently with a variety of indicators such as \u201cmissing\u201d, \u201cnot applicable\u201d, \u201cnot available\u201d, \u201cunknown\u201d or \u201cNA\u201d. These do not always match up with the categories defined for each variable in the data. We therefore decided to combine the various missing data as \u201dunknown\u201d or \u201dnot applicable\u201d if these categories were stated as such in the patients\u2019 form, or otherwise just as \u201dmissing\u201d. We also obtained advice from our data provider about the uncertain category recorded in the database to justify our decision regarding data categorization. For example, even though the variable \u201dtumour differentiation\u201d has categories of \u201dnot applicable\u201d, \u201dnot available\u201d and \u201dmissing\u201d, most of the data in these categories did not tally with the data definition. Our data provider clarified this, and assured us that all data in those categories of this variable were actually just \u201dmissing\u201d.We collected exposure data on ethnicity as Malay and non-Malay. All others were coded as other because of the small numbers. Smoking status was categorised as: non-smoker, former smoker, active smoker and missing status. Education level was classified as \u201cNil\u201d, \u201cPrimary\u201d, \u201cSecondary\u201d, \u201cTertiary\u201d or \u201cmissing\u201d.Clinical data was recorded as three categories: yes, no and missing. However, cancer stage was recategorised to \u201cStage I\u201d, \u201cStage II\u2019, \u201cStage III\u201d, \u201cNot staged\u201d, and missing. Since the \u201csite of distant metastases\u201d contains many categories, each of which only contained a small number of data points, we decided to combine all the metastases regardless of their specific site. Irrespective of where and when it has been detected, the \u201cpresence of distant metastases\u201d was therefore reclassified into yes, no and missing. \u201dTumour differentiation\u201d was recorded as \u201cwell\u201d, \u201cmoderate\u201d, \u201cpoor\u201d and \u201cmissing\u201d.The treatment modalities were categorised into four types of treatment received by the patients. They are patients who underwent surgery alone, patients who underwent surgery followed by chemotherapy and/or radiotherapy, patients who underwent chemotherapy and/or radiotherapy and patients who got other alternative treatments or palliative care. Patients without information of the treatment received were recorded as an unknown group.The specific cause of death provided in the data was not verified and therefore could not be deemed reliable, so, we decided to perform the analysis on all-cause mortality. The data records whether each patient is dead or alive at the end of the study period; we relabelled each patient\u2019s status as either dead or censored. The censored group are patients who were alive until the end of the study period as recorded in the database. We obtained ethical clearance from the Ministry of Health Medical Research Ethical Committee (MREC), Malaysia and the Faculty of Health and Medicine Research Ethics Committee (FHMREC), Lancaster University (Ref no: NMRR-15-311-24656(IIR).The spatial data involved at the district level analysis includes all districts in Peninsular and East Malaysia and was based on polygonal data. The analysis for Peninsular Malaysia and East Malaysia was done separately as they are physically separated. We therefore separated the shapefile of Malaysia into Peninsular Malaysia and East Malaysia.In order to conduct analysis at the district level, each participant was assigned to their correct district based on the town variable recorded in the data. Each of the 520 unique names of towns seen in the data belong to one of the 144 administrative districts in Malaysia, of which 87 districts are in Peninsular Malaysia and 57 districts are in East Malaysia.We included a measure of socioeconomic status  and the On the other hand, we created a proxy-measure for accessibility of healthcare using the estimated number of hospitals per unit area (the density), calculated by the \u201cdensity.ppp\u201d function from the \u201cspatstat\u201d package in R software. Then, we included this density as one of the parameters in the spatial survival model. To model the correlation in space, we used an exponential correlation function, using the distance between the centroids of regions to determine the correlation.ho is the baseline hazard function, t is the observed time for the i th individual, Xi is a vector of covariate values for the i th individual, \u03c8 = h are covariate effects, the parameter of the baseline hazard and the parameter of the covariance function of a spatially latent Gaussian field Y, respectively. Yi is the value of the field at the location of individual i.We used the spatial survival model to analyse our spatially referenced survival data. We created our spatial survival model using the \u201cspatsurv\u201d package . The spa\u03b2, \u03c9, \u03b7 and Y. We compared plots of prior and posterior to check that our data were sufficient to allow identifiability of the parameters in our model. The model has been fitted using three different distributions for the baseline hazards: Weibull, Exponential and B-spline. The models were compared using the Watanabe-Akaike information criterion (waic) value.In the Bayesian model, a prior density for the parameter of interest was inputted and the data modified the prior by using the likelihood to arrive at the posterior.The spatsurv package uses a Markov chain Monte Carlo (MCMC) algorithm to perform Bayesian inference for the parametric proportional hazards model. The idea is to use MCMC to draw samples from the posterior and estimate the parameters in our model. The spatsurv package implements the Markov chain Monte Carlo (MCMC) inferential algorithms because although they are typically slower than approximate methods, such as those based on the Laplace approximation for example, they deliver an unbiased, joint inference for all model parameters and are relatively easily extensible to wider model classes with additional hierarchies . We lookWe plotted the posterior baseline and cumulative hazard for each model, as well as the spatial covariance function and correlation against distance, for Peninsular Malaysia and East Malaysia. The plots of the posterior spatial correlation function show how similar the hazard is across space, and how fast that similarity decays. A correlation plot with a fast drop  shows that there is little dependence between the hazard and distance. On the other hand, if the correlation plot has a slow drop, this shows that there is strong spatial dependence in the hazard or the risk of death from colorectal cancer is highly associated with place. It means that even though there may be a large distance between places, the correlation in their hazard is high. The interpretation of \u00d8 is that for distances over \u00d8 apart, there is little dependence on space.We also mapped the probability that the covariate-adjusted relative risk exceeds certain thresholds. These plots represent the risk over space that is not accounted for by the covariates in our model. All analysis were carried out using R software.We produced two spatial survival models, one for Peninsular (West) Malaysia and one for East Malaysia. After controlling for spatial location and socioeconomic factors, cancer staging still plays an important role in determining the risk of death from colorectal cancer in Malaysia. Patients diagnosed at Stage IV had six times ) and seven times ) higher risk of death from colorectal cancer in West and East Malaysia, respectively, than patients diagnosed at Stage I. Each year of increase in age led to a slight increase ) in the relative risk of death. Other factors that significantly affect survival in colorectal cancer patients in Malaysia were ethnicity, tumour differentiation and the presence of distant metastases. We included two parameters to represent the socioeconomic distinctions in the population; the density of the hospitals in each district and the middle-class household item index (socioeconomic index). However, the socioeconomic index was only available for Peninsular Malaysia. Both of these variables showed an association with a decrease in the risk of death as the value of the parameters increases, however neither result was significant.The table shows the hazard of death from colorectal cancer for the variables chosen in the spatial survival model. It is represented by the median HR and 95% credible interval.The spatial correlation function plot  shows hoIn this study, we investigated the survival model of colorectal cancer in Malaysia, and incorporated geographical location. Our findings show that there is spatial variation in survival prognoses, or the hazard of death, for colorectal cancer in Malaysia even after adjusting for individual-level and area-level covariates. Cancer staging, tumour differentiation and the presence of distant metastases have a significant effect on survival for colorectal cancer patients. However, we also found that Malays had a significant 26% higher risk of dying from colorectal cancer than non-Malays. An increase in age slightly increased the risk of death from colorectal cancer.We found that a high socioeconomic index in an area did not significantly affect the risk of death from colorectal cancer. Our findings were similar to those of  who founIt is possible that there is a positive association between our variable \u201ceducation\u201d, an individual-level variable, and our socioeconomic index, which is an area-level factor measure with education as one of its domains. We think that these two measures are not likely to be well correlated for the following reasons. The socioeconomic index includes a measure, at an area level, of the proportion of the population with tertiary education in a district (area level). Education is one of five domains by which the socioeconomic measure is comprised. We realize that education might drive socioeconomic status, but it is not the sole driver of socioeconomic status. The widely used UK Index of Multiple Deprivation (IMD) is comprised of seven domains, one of which is based on education, and the index measures small areas across England, called Lower-Layer Super Output Areas (LSOAs) .The education variable in the model represents the individual education level of the patients in this study, which is classified into five categories, nil, primary, secondary, tertiary and missing status. Thus, we think that the education and the SE index variable in the model represent different things. To see if this is likely, we checked if there was any correlation between the two variables but it was not significant with a correlation coefficient of \u03c1 = 0.01.We noticed that there were patients that had changed their address after diagnosis, but we decided not to take the distance of the patients\u2019 addresses to the hospital as our measure of accessibility to healthcare. Address at diagnosis is important as an \u201cexposure\u201d or proxy for unmeasured exposures, but we had no record of length of residence at the address at diagnosis, which leaves open the likelihood of misclassifying cases by exposure to place. For example, people move house or job for many reasons, but sometimes for health reasons. They may, for example, move nearer a hospital when ill, or away from an exposure when concerned and there is evidence that population movement can lead to misclassification in epidemiological studies, such as when a birth address is used in studies of birth defects . InsteadThe relationship between survival and distance to the treatment hospital is not clear cut: it is not necessarily the closest hospital to patients that they will choose to go to seek treatment and for this reason, we used the smoothed density as a covariate in our model. We expected the coefficient of this covariate to be positive, since, in places where there is a greater concentration of hospitals, patients tend to get diagnosed quicker as early symptoms are recognised and acted upon. We found that greater accessibility to healthcare decreased the risk of death from colorectal cancer but the effect was not significant in our study, which contradicts a previous study reporting that lack of access to healthcare was significantly associated with being diagnosed at a more advanced stage of colorectal cancer , which wThree areas were found to have a high risk of death . They were Jeli district in the North-East, Kinta district in the North-West and Melaka Tengah located in the West of Peninsular Malaysia. In East Malaysia, Sabah had better survival compared to Sarawak as shown by the probability of exceedance risk maps. The reasons for these differences could be such things as delay in chemotherapy treatment  and comoWe have a limitation as Malaysia does not have a formal socioeconomic status instrument that is consistent across the population  . CurrentThe spatial analysis method used here has several strengths. First it allows us to combine data from the individual level with data from aggregated levels and map our findings. It also allows us to estimate and map the effect of unobserved environmental confounders through the use of a spatially correlated random effect terms. We applied MCMC for our analysis as it delivers full joint inference for all model parameters. Some limitations to be considered is that this analysis assumes a particular model form and correlation structure for the spatial variation and that it can be difficult in practice to identify the parameters of the spatial process. Attaining good convergence and mixing of MCMC can be difficult without access to bespoke software but again this is not an issue for us. Despite these limitations, this is the first study to examine the variation in survival for colorectal cancer in Malaysia. Having controlled for the potential individual and area-level factors, we found there is variation in the survival or risk of death from colorectal cancer in the population.Our findings indicate there is wide spatial variation in colorectal cancer survival across Malaysia, after controlling for individual and area-level characteristics. Better healthcare provision and higher socioeconomic index in the districts where patients live decrease the risk of death from colorectal cancer, although the associations were not statistically significant in this study. To obtain reliable SES data from individuals would require a range of questions to be answered as part of the initial data entry form. This might seem an unnatural thing to try to elicit routinely as part of a colorectal cancer diagnosis by medical practitioners. Similar comments apply to our chosen measure of healthcare accessibility; again, this information would be better obtained from each patient.In the future, the following suggestions may improve the quality of data and its resulting analysis. Reliable measurements of environmental factors are needed to provide good insight into the effects of potential risk factors for the disease. For example, a better metric is needed to measure the socioeconomic status and accessibility to healthcare in the country. Ensuring complete, accurate and consistently recorded data in the National Cancer Registry database is vital for reliable analysis and meaningful results. Perhaps ascertainment of active cases across the country and also better training of staff that interact with the database is required in order to minimise the amount of missing data.This study will provide new input for the Ministry of Health to target the population with a high risk of poor survival in providing cancer control services and to enhance health activities that are cancer-related in order to improve survival in the population."}
{"text": "Emergence of acute kidney injury (AKI) in patients with nephrotic syndrome (NS) requires prompt diagnosis and differentiation between acute tubular necrosis (ATN) and proliferative glomerulonephritis. We studied the potential use of commercial urinary biomarkers' tests in the diagnosis of AKI in patients with NS.A cross sectional estimate of urinary concentrations of KIM-1 and NGAL was performed in 40 patients with NS: 9 with proliferative glomerulopathy, being 4 with AKI and 31 without proliferative glomerulopathy, being 15 with AKI. AKI was defined using the KDIGO criteria.The mean age was 35 \u00b1 16 years. The main diagnoses were focal and segmental glomerulosclerosis , membranous glomerulopathy , minimal change disease , lupus nephritis , and proliferative glomerulonephritis . Patients with ATN had higher levels of urinary KIM-1 (P = 0.0157) and NGAL (P = 0.023) than patients without ATN. The urinary concentrations of KIM-1 (P= 0.009) and NGAL (P= 0.002) were higher in patients with AKI than in patients without AKI. Urinary NGAL and KIM-1 levels were significantly higher in patients with ATN without proliferative glomerulonephritis than in patients with proliferative glomerulonephritis .Neutrophil gelatinase associated lipocalin (NGAL) and kidney injury molecule 1 (KIM-1) estimates correlated with histological signs of ATN and were able to discriminate patients with AKI even in conditions of NS. Furthermore, urinary levels of NGAL and KIM-1 may be useful in the differential diagnosis of acute tubular necrosis and exudative glomerulonephritis in patients with nephrotic syndrome. ATN usually requires supportive measures, while proliferative lesions can require immunosuppression ,-Currently, the diagnostic criteria for AKI are defined by elevation in serum creatinine levels and a decrease in urinary output, although serum creatinine is a later marker of kidney dysfunction and does not reflect kidney damage in some instances In this work, we studied the use of tests based on the urinary concentrations of KIM-1 and NGAL for the diagnosis of AKI in patients with nephrotic syndrome and examined the association of urinary concentration of these biomarkers with histological lesions consistent with ATN or proliferative glomerular lesions.Patients: This was a cross sectional study in which we reviewed the biopsies and clinical data of patients with nephrotic syndrome subjected to renal biopsies during relapse or initial presentation in the referral hospitals for renal disease in Salvador, Bahia, Brazil, between January 2012 and December 2013. The patients were divided in three groups according to presence of ATN histologically defined and proliferative glomerulonephritis, as follows: control group (CON), patients with neither proliferative glomerulonephritis nor ATN; acute tubular necrosis group (ATN), patients with ATN and without proliferative glomerulonephritis; and proliferative glomerulonephritis group (PGN), patients with proliferative glomerulonephritis or the presence of crescent lesion in renal biopsy, regardless of the presence of ATN. We studied the potential use of urinary estimates of KIM-1 and NGAL in the diagnosis of AKI in patients with nephrotic syndrome and correlated histological lesions of ATN with urinary concentrations of KIM-1 and NGAL.All of the biopsies were examined at the Instituto Gon\u00e7alo Moniz - Fiocruz, Salvador, Brazil. Cases were excluded if the histological slides were not available, if interstitial fibrosis was estimated to encompass 30% or more of the renal cortex area, or if there were fewer than 7 glomeruli in the sample.Clinical data: The following data were obtained from biopsy request forms and from the patients' medical records: age, sex, diagnosis of nephrotic syndrome, serum creatinine, albumin, cholesterol, and triglyceride concentrations, 24-hour urine protein excretion rate, and diagnosis of systemic arterial hypertension. Patients were diagnosed with nephrotic syndrome when the urine protein excretion rate was greater than 3.5 g/24 h associated with edema, hypoalbuminemia and dyslipidemia. AKI was defined as a serum creatinine increase of 0.3 mg/dL or 1.5x the baseline value, according to the KDIGO definition of AKI. Baseline creatinine value was defined as the lowest measurement during the previous year. When previous measurements were not available, the lowest creatinine value estimated during hospitalization was used.Histological analysis: All of the renal specimens were obtained by percutaneous biopsies. They were fixed in Bouin's solution, embedded in paraffin, cut in 2-\u00b5m slices, and stained with hematoxylin and eosin. A pathologist (WLCS) reviewed all of the slides. The severity of ATN was estimated as the percentage of the renal cortex that contained tubules with evidence of recent necrosis on examination by conventional optical microscopy. The following tubular changes were considered evidence of recent ATN: tubular dilatation with thinning of the tubular epithelium, accompanied by cellular casts and interstitial edema and the presence of morphological markers of epithelial regeneration, such as nuclear hyperchromatism, mitosis and binucleation. As shown previously, even mild ATN is associated with higher risk of renal failure. Hence, we used the extent of tubular necrosis for separating patients into two groups: with ATN, 10% or more of renal cortex presenting necrotic tubules and without ATN, less than 10% of the renal cortex presenting necrotic tubules. The intensity of tubular interstitial fibrosis was also estimated as a percentage of the renal cortex with increased extracellular matrix by visual assessment.KIM-1 and NGAL measurements in the urine: Morning urine samples were collected prior to renal biopsy. They were centrifuged at 2,000 x g at 4\u00b0C, and the supernatant was stored in 2-mL aliquots at -80\u00b0C. Urinary concentrations of KIM-1 and NGAL were measured by enzyme linked immunosorbent assay , according to the manufacturers' instructions. All the samples were run in duplicate.Statistical analysis: Data are reported as absolute numbers or percentages and are summarized as means, standard deviations, or medians, using lower and upper percentiles when appropriate. The performance of the biomarkers estimate for the diagnosis of AKI was assessed by analyzing a receiver operating characteristic (ROC) curve. Comparisons between groups were performed using the t-test or the Mann-Whitney (nonparametric) test when applicable. Differences involving proportions were analyzed using the chi-square test. The results were considered statistically significant if P < 0.05. Data were analyzed using Prism software, version 5.01 , and Stata IC software , version 11.Ethics approval: The study was conducted in accordance with the resolution No. 196/96  and the resolution No. 039/2011 (http://conselho.saude.gov.br/web_comissoes/conep/carta_circular/Uso_de_dados_de_prontuarios_para_fins_de_Pesquisa.pdf) of the National Health Council, and the procedures were approved by the Ethics Committee for Research Involving Human Subjects of Instituto Gon\u00e7alo Moniz, Fiocruz, Protocol No. 188/09 and No. 380/12.In accordance with these resolutions, written informed consent was obtained from all patients involved in the study. Patient records were only reviewed after approval by the Ethics Committee and authorization by the Hospital Clinical Board as required by the resolution No. 039/2011. All the informed consents are maintained in the records of the Laborat\u00f3rio de Patologia Estrutural e Molecular - LAPEM, Fiocruz Bahia.Sixty-five patients with nephrotic syndrome subjected to renal biopsies between January 2012 and December 2013 were randomly selected, and clinical data and urine samples were collected prior to renal biopsy. Twenty-five patients were excluded: 20 (30%) had more than 30% cortical fibrosis estimated, and 5 (8%) had fewer than 7 glomeruli in the biopsy. Forty patients were included and the clinical and laboratory data of the three groups are presented in Baseline serum creatinine value was available in 31 patients, of whom 19 (59%) presented with AKI according to KDIGO criteria. In nine patients, the baseline creatinine value was not available. Seven of these nine patients had isolated serum creatinine concentrations in the normal range. When estimated by the isolated serum creatinine concentration on the day of biopsy, 14 (35%) patients presented with renal failure. ATN was associated to renal failure in patients with nephrotic syndrome  and 0.8647 (95% CI= 0.7068-1.0000) respectively. The urinary concentrations of KIM-1 and NGAL were higher in patients with AKI  than in patients without AKI (KIM-1 = 1006 [202-2539] pg/mL), P= 0.009; and NGAL = 23.1 [6.6-182.1] ng/mL, P=0.002). Among the patients with proliferative glomerulonephritis, the KDIGO criteria for AKI were applied in only 6 patients, and 4 of them had AKI. Hence, further comparison between this group and the group of patients with AKI without proliferative glomerulonephritis was not performed  and of NGAL  with the percentage of renal cortex with histological lesions of ATN. Patients with ATN \u226510% had higher concentrations of urinary KIM-1 (4299 [630-9534] pg/mL) and NGAL (126.1 [22.8-1195] ng/mL]), compared to patients without ATN . Urinary concentrations of NGAL and KIM-1 were significantly higher in patients with ATN without proliferative glomerulonephritis than in those with proliferative glomerulonephritis .,In the present study, we found that AKI diagnosed by the KDIGO criteria was frequent in patients with nephrotic syndrome. Appel and colleagues 2007) reported AKI in 24 of 95 adult patients with minimal change disease007 repor,Studies associating the histological patterns of ATN, renal failure, and urinary biomarkers for AKI have been scarce in humans. Most of the knowledge in this field comes from histological studies in experimental animal models, transplanted kidneys, and intensive care patientsMost studies have assessed the performance of urinary NGAL and KIM-1 for predicting the diagnosis and prognosis of AKI in animal models of ischemic and toxic AKI, critical illness, and heart surgery patientsUrinary concentrations of NGAL and KIM-1were higher in patients with ATN associated with non-proliferative glomerulopathy than in patients with proliferative glomerulonephritis. Previous studies have demonstrated induction of NGAL in epithelial cells in inflammatory conditions, and in kidney, there is early expression of NGAL in proximal tubule epithelial cells in ischemic reperfusion injury. In patients with lupus nephritis, urinary NGAL excretion was predictive of the renal disease with better accuracy than Anti-dsDNA, and urinary concentrations of NGAL seem to correlate with disease activity and are elevated in renal flares,Finally, although AKI has been considered an uncommon complication of nephrotic syndrome, recent studies have demonstrated that AKI is, in fact, common in the course of idiopathic nephrotic syndrome in adults with minor glomerular abnormalities. Proteinuria has been associated with impaired antioxidative response, tubular epithelial cell injury, and apoptosis in animal models of tubular necrosisATN is a common cause of renal failure in patients with nephrotic syndrome;Neutrophil gelatinase-associated lipocalin (NGAL) and kidney injury molecule 1 (KIM-1) estimates were correlated with histological signs of ATN;The commercially available kits for NGAL and KIM-1 measurement were able to distinguish patients with AKI from among patients with nephrotic syndrome without requiring further processing steps;Future studies evaluating urinary concentrations of NGAL and KIM-1 could be used to differentiate ATN alone from proliferative glomerulonephritis;The use of these markers does not rule out the requirement of kidney biopsy for the diagnosis of kidney disease in adult patients with nephrotic syndrome."}
{"text": "Methyl Jasmonate (MeJA) could promote the opening of sorghum florets, but the molecular mechanism remains unclear.We aimed to investigate the molecular mechanism of exogenous MeJA in promoting the opening of sorghum florets.Hybrid sorghum Aikang-8 was selected as the test material in this study. Sorghum plants of uniform growth with approximately 20%-25% florets open were selected and treated with 0, 0.5 and 2.0 mmol/L of MeJA. Totally there were 27 samples with lodicules removed were obtained at different time points and used for the transcriptome analysis using the BGISEQ_500RS platform.LOC-1 (LOC8063704) and LOC-2 (LOC8076139) could induce the earlier flowering of Arabidopsis thaliana.The results showed the sorghum florets opened earlier than the control after the treatment with exogenous MeJA, and the promotive effect increased along with the increase of exogenous MeJA concentration. The number of differentially expressed genes (DEGs) in plasma cells increased with the increase of MeJA concentration, whether up- or down-regulated, after the exogenous MeJA treatment. Besides, the number of metabolic pathways was also positively correlated with the concentration of MeJA. GO and KEGG analysis suggested the DEGs were mainly enriched in starch and sucrose metabolism-related pathways , plant hormone signal transduction pathways , energy metabolic pathway  and the \u03b1-linolenic acid metabolic pathway . Functional analysis of target genes showed that two genes named The results of this study suggest that exogenous MeJA treatments could induce the up- or down- regulation of genes related to starch and sucrose metabolism, -linolenic acid metabolism and plant hormone signal transduction pathways in the plasma cells of sorghum florets, thereby promoting the opening of sorghum florets. So the research of floret opening became increasingly important in sorghum for the growing demand of people. Different species and varieties, and even the flowering time of spikelet at different positions on the same spike in one day are also different, which are affected by the characteristics of varieties and external environment factors . At pres unknown .Sorghum bicolor L. Moench and Sorghum Sudanesis (Piper) Stapf was significantly stimulated by immersing into 2 mM methyl jasmonate (MeJA) solution [Floret opening in grass plants is mainly caused by the swelling of a pair of lodicules at the base of the floret after water absorption . In thissolution . So it iRNA-seq is an very effective tool for studying the regulatory mechanism in plants, such as wheat , rice 1, cotton S. bicolor L. Moench) cultivar Aikang-8 was purchased from Shandong Ruiyou Agricultural Science and Technology Development Co., Ltd. in China and used to conduct the experiment. Aikang-8 seeds were planted in the training base of the Jiangxi Agricultural Engineering College On May 1st and May 10th for two times. Each time Aikang-8 was planted for 40 m2 with normal cultivation managements. The MeJA  was purchased from BOMEI (China). It was diluted into 10.0 mmol/L mother liquor with 1.0% ethanol, followed by further dilutions with 1.0% ethanol to 0.5 and 2.0 mmol/L. 1.0% alcohol was used for the blank control. Arabidopsis thaliana of wild-type was planted in small pots with a uniformly mixed mixture of peat, vermiculite, perlite by the ratio of 2:7:1 in growth chamber, respectively. The humidity was set at 60% and the temperature was set at 20\u201322\u00b0C. The photoperiod was 24h and the illumination intensity was set 80\u2013200 \u03bcmol\u00b7M-2\u00b7S-1. Agrobacterium-mediated genetic transformation method was used to infect the inflorescence of Arabidopsis thaliana for 2\u20133 times. Arabidopsis plants were moved to dark environment for 16-24h after the infection. Arabidopsis seeds were harvested and used for the screening of transgenic plants.In the study, sorghum  and 20:30 (2.5h) were labeled as SorgHM_1 and SorgHM_2, respectively; samples treated with 0.5 mmol/L MeJA at 19:00 (1h), 20:30 (2.5h) and 22:30 (4.5h) were labeled as SorgLM_1, SorgLM_2 and SorgLM_3, respectively; and samples treated with 0 mmol/L MeJA at 19:00 (1h), 20:30 (2.5h), 22:30 (2.5h) and 0:30 (6.5h) were labeled as SorgCK_1, SorgCK_2, SorgCK_3 and SorgCK_4, respectively. Each sample was repeated three times. Therefore, there were 27 samples were obtained with lodicules removed, followed by the storage in cold-proof RNase-free tubes at -80\u00b0C. The weight of each sample was greater than 0.13 g.Total RNAs of lodicules were extracted using pBIOZOL method, and RNA concentrations were measured using Nanodrop 2000, followed by RNA integrity test using 1.0% agarose gels. Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit) was used to detect the concentrations, RIN values, 28S/18S values and fragment sizes of the total RNAs. The results indicated that 27 samples were qualified for library construction. The same amount of RNA from each of the three replicates at each time point were collected and uniformly mixed into nine samples for the sequencing and cDNA library construction. Nine libraries were named libSorgHM_1, libSorgHM_2, libSorgLM_1, libSorgLM_2, libSorgLM_3, libSorgCK_1, libSorgCK_2, libSorgCK_3 and libSorgCK_4, respectively. Library was constructed as follow procedures: Magnetic beads with oligo (dTs) were used to enrich for mRNAs having polyA tails. A DNA probe was hybridized with the rRNA, and RNaseH was used to selectively digest DNA/RNA hybrids. Then, the DNA probe was digested using DNaseI. Target RNA was obtained through purification, and interruption buffer was used to obtain RNA fragments. This was followed by reverse transcription using a random N6 primer. Double-stranded DNA was obtained through the synthesis of double-stranded cDNA. The 5\u2019-end of the synthesized double-stranded DNA was phosphorylated, with an \u201cA\u201d tail at its 3\u2019 end. A connector with a \u201cT\u201d bulge at its 3\u2019 end was ligated as well. The ligated product was PCR amplified using specific primers. The PCR product was heated and denatured into single strands. The obtained single-stranded DNA was circularized using a bridge primer to obtain a single-stranded circular DNA library for further sequencing. Library construction and sequencing were performed by BGI, China.https://www.ncbi.nSorgLM.nih.gov/genome/?term=Sorghum%20bicolor%20) [The filtration of raw reads was performed using SOAPnuke (v1.5.2)  by BGI, olor%20) . The Mapolor%20) ,23. The 2ratio| values \u2265 1. The up- and down- regulation modes of the corresponding samples were described and analyzed. The DEG sequences were mapped to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database using BLAST (parameter: -p blastx-e1e-5-m8) [p-value < 0.05 were considered as significant enrichments.Clean reads were mapped to the reference sequence using Bowtie2 , and gen1e-5-m8) . An enri1e-5-m8)  and GO t\u00ae Select Master Mix (2X) reagents (ABI Inc.) and qRT-PCR. GAPDH (AK064960) was selected and used as the reference gene. The relative expression analysis of selected genes was calculated using the 2\u2212\u0394\u0394Ct method with triplicate for each sample [The extracted RNAs were used as templates for reverse transcription with a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) and several DEGS were randomly selected. The expression levels of genes were verified using SYBRh sample ,30.LOC-1 and LOC-2 were cloned with cDNA by PCR method using 50 \u03bcl reaction system, containing 10\u00d7PCR Buffer 5 \u03bcl, MgCl2 (25 mM) 3 \u03bcl, dNTP mixture (2.5 mM) 4 \u03bcl, forward primer (10 \u03bcM) 1 \u03bcl, reverse primer (10 \u03bcM) 1 \u03bcl, Taq (5U/\u03bcl) 0.5\u03bcl, cDNA 2\u03bcl, ddH2O 3.5\u03bcl. After the purification, PCR products were linked to pMD19-T Vector and transformed into DH5\u03b1 according to the optimized procedure. At the same time, vector pCAMBIA1300 and pBI121 were digested with EcoRI and HindIII simultaneously. Klenow fragment of pCAMBIA1300 and small fragment of PBI121 were recycled and linked to construct an integrated expression vector pCAMBIA1300-BI containing 35S promoter, GUS gene and terminator. Then the GUS gene was replaced with two target gene LOC-1 and LOC-2, which were added CaMV35s promoter and Nos terminator at 5\u2019 and 3\u2019 end, respectively. The constructed plasmid was transformed into Arabidopsis thaliana to verify its functions [Two target genes unctions .After the treatment at 18:00 PM, the florets did not open until 19:00 after treatment with the three MeJA concentrations. At 20:30 (2.5h), a large number of sorghum florets started to open under the treatment of 2.0 mmol/L MeJA, while other sorghum florets didn\u2019t open in abundance. At 22:30 (4.5h), a large number of sorghum florets started to open under the treatment of 0.5 mmol/L MeJA while the control sorghum florets (0 mmol/L MeJA) still didn\u2019t open in abundance. At 0:30 (6.5h), a large number of control sorghum florets started to open . BesidesAs shown in As shown in LOC8075740, LOC8056099, LOC8064482, LOC8058060, LOC110437037 and LOC8069151 were involved in starch and sucrose metabolism, and LOC8084355 was involved in hormone signal transduction pathways and LOC110429834 was involved in the \u03b1-linoleic acid metabolic pathway and LOC8072504 was involved in the regulation of plant circadian rhythm.To further verify the reliability of the transcriptome results, 17 genes with significantly different expression levels were selected  for fluoBased on the results of DEGs detection, biological pathway classification and enrichment analysis was performed in KEGG. Total of 29,135 unigenes were used to blast in the KEGG database, and finally 20,803 (70.96%) unigenes were annotated . In the At the same time point, the number of enriched metabolic pathways and DEGs increased along with the increase of MeJA concentration. For example, the number of enriched metabolic pathways and DEGs in SorgCK_1-VS-SorgHM_1 were greater than that in group SorgCK_1-VS-SorgLM_1. And the number of enriched metabolic pathways and DEGs in group SorgCK_2-VS-SorgHM_2 was greater than that in group SorgCK_2-VS-SorgLM_2.In order to dig out the pathways which were most closely associated with spikelets opening, screening was performed with the following rules: 1) total number of DEGs > 3,000; 2) number of enriched metabolic pathways > 100; and 3) Q value < 0.05. Finally four comparison groups met the criteria, including SorgCK_3-VS-SorgLM_3, SorgCK_2-VS-SorgHM_2, SorgLM_1-VS-SorgLM_3 and SorgLM_3-VS-SorgLM_3. Totally nine metabolic pathways were enriched, including alpha-Linolenic acid metabolism, glycerolipid metabolism, glycerophospholipid metabolism, plant hormone signal transduction, anthocyanin biosynthesis, phenylpropanoid biosynthesis, starch and sucrose metabolism, limonene and pinene degradation, and circadian rhythm\u2014plant .LOC8084842 and LOC8065295) that catalyze the binding of JA and Ile. The expression level of LOC8084842 significantly increased after the treatment with 2.0 mmol/L MeJA for 2 hr, and the score reached to 7.6. In addition, 10 genes, including OsJAZ13 , OsJAZ10 , OsJAZ8 (LOC8062740), OsJAZ2 (LOC8079184), OsJAZ9 (LOC8059788) and OsJAZ6 (LOC8077075), were found to be correlated with the JAZ protease activity. These genes could promote the degradation of JAZ, and significant differences were observed after the treatments of 2.0 mmol/L MeJA for 2 hr and 0.5 mmol/L for 4.5 hr compared with the controls. The difference score for LOC8072010 was 6.4. Seven genes, including LOC8069641, LOC8057408, LOC110436805, LOC8055721, LOC110433436, LOC8059158 and LOC8060491, were found to be correlated with bHLH zip transcription factors. These genes promoted MYC2 transcription initiation and the difference score reached 2.0 compared with the controls when treated with 2.0 mmol/L MeJA for 2 hr and 0.5 mmol/L MeJA for 4.5 hr. All results indicated that exogenous MeJA could induce the differential expression of these important genes, including JAR1, JAZM and MYC2. This demonstrated the important regulatory function of exogenous MeJA in sorghum floret opening at the molecular level.JA and isoleucine (Ile) could form a conjugate  when catalyzed by jasmonic acid-amido synthetase (JAR1), which induces the binding of the Jas motif in the jasmonate ZIM domain and COI1. The JAZ motif was then degraded, which was followed by the dissociation of the NINJA-TPL and transcription factor MYC2, resulting in the transcription of JA signaling-related genes \u201334. On tLOC8085653) and four genes related to the activity of lecithin A2 (EC: 3.1.1.4) . The differential expression score of LOC8085653 in SorgCK_2-VS-SorgHM_2 was 5.4, which was the most remarkable differential expression among the five groups. Besides, three genes related with lipoxygenase activity were also found, including LOC8082015, LOC8055177 and LOC8065835. All these genes were up-regulated in the \u03b1-linolenic acid metabolic pathway, positively regulating the biosynthesis of JA.The JAs are a class of fatty acid derivatives which play important regulatory roles in plant growth and development, mechanical damage and the induction of defense-related gene expression. JAs are mainly biosynthesized through the \u03b1-linolenic acid metabolic pathway. Lecithin on the cell membrane is catalyzed to release the precursor linolenic acid for the synthesis of JA, which is then oxidized to 13S-hydroperoxylinolenic acid through catalysis by lipoxygenase . 13S-Hydroperoxylinolenic acid subsequently forms 12S,13S-epoxylinolenic acid, followed by cyclization to form 12-oxo-phyto-dienoicacid, which is then subject to be catalyzed to form MeJA or other complexes/metabolites . As showLOC110437037, LOC8069151, LOC8064663 and LOC8060513 were related to the AGPase activity and five genes LOC8066439, LOC8081295, LOC8066807, LOC8068976 and LOC8071331 were related to GBSS and GBE activity levels  were significantly upregulated to promote the degradation of starch. Two target genes named LOC-1, playing an important role in the starch and sucrose metabolic pathway, and LOC-2, playing an important role in energy metabolic pathway, were selected and cloned, then transformed into wild-type Arabidopsis thaliana  into uridine diphosphate glucose (UDPG) and fructose, followed by a series of biochemical reactions to form starch . AGPase y levels . Expressthaliana . The resc plants . In summMa1, Ma2, Ma3, Ma4, Ma5 and Ma6 [OsDAD1, OSAOS1, OSAOC and OSOPR7, signal transduction related genes OsJAR1 and OsCOI1b, and 13 genes of the OsJAZ family, except OsJAZ5 and OsJAZ15, in lodicules cells were significantly up-regulated compared with the expressions at 18 h before floret open [Sorghum is a short-day tropical species with the characters of substantial photoperiod sensitivity and delayed flowering in long days . Sorghum and Ma6 ,39, but  and Ma6 . DocumenIn this study, RNA-seq method was used to explore transcriptome changes in lodicule cells during sorghum floret opening after exogenous MeJA treatments. 0.5 and 2.0 mmol/L MeJA were applied to treat sorghum florets and the results showed the number of DEGs annotated and functionally metabolic pathways increased along with the increase of MeJA concentration. Functional enrichment analysis of DEGS showed plant hormone signal transduction and starch and sucrose metabolism were closely related with the open of sorghum florets. Thus, the results in this study showed MeJA could induce various physiological metabolisms in lodicules of sorghum florets, thereby promoting the floret open in advance. The results of this study are consistent with the previous reports, further confirming the regulatory mechanism we proposed in gramineal crops.DAD1, LOX, AOS, AOC and OPR3. As shown in 2ratio = 3.0 as the criterion, significant expression differences were observed under the high concentration of 2.0 mmol/L treatment, including DAD1 activity related genes LOC8057399 (log2ratio = 3.5), LOC8085653 (log2ratio = 5.4) and LOC8055636 (log2ratio = 4.2), AOS activity related genes LOC8056861 (log2ratio = 3.1), 12-oxo-dienoic acid reductase related genes LOC8070772 (log2ratio = 3.9) and LOC8070773 (log2ratio = 3.3), OPC-8:0 coenzyme A ligase related gene LOC8063048 (log2ratio = 5.0). Interestingly, 19 genes including LOC8057399, LOC8082061, LOC80770776 and LOC8068239 and etc., were significantly upregulated under the treatment of 2.0 mmol/L, while no expressions were found under the treatment of 0.5 mmol/L. These 19 genes were actively involved in the biosynthesis of JA, and high expression levels of these genes could further increase the content of JA, which was favorable to the open of sorghum florets.JA biosynthesis begins with the release of the precursor \u03b1-linolenic acid from lecithin on the cell membrane, followed by a cascade of reactions catalyzed by multiple enzymes, including LOC8062786, LOC8083641, LOC8059386, LOC8056732, LOC110436805, LOC110429687, LOC8055721, LOC8055143, LOC8068250 and LOC110430094 were only differentially expressed under the 2.0 mmol/L MeJA treatment and these genes were barely expressed under the 0.5 mmol/L MeJA treatment, which suggested that 2.0 mmol/L MeJA treatment induced the expression of these genes to promote the open of sorghum florets by JA signal transduction.The JA signal transduction pathway starts with the JAZ complex, followed by enzyme catalysis by JAR1, JAZ and MYC2 to induce JA signals. As shown in LOC-1 and LOC-2 were cloned and transformed into Arabidopsis thaliana, overexpression of these two genes resulted the earlier flowering in transgenic Arabidopsis plants. This was not reported before.In this study, four genes correlated with AGPase, which is a rate-limiting enzyme in starch synthesis and metabolism, were all downregulated, while four genes correlated with AMY and AMS were significantly upregulated to promote the degradation of starch. This result suggested that exogenous MeJA induced the up-regulation of starch synthesis related genes and the down-regulation of starch degradation related genes, thereby promoting the degradation of starch in lodicules cells into sucrose, maltose or other sugars, which caused the decrease of the osmotic potentials in lodicule cells. This further allowed lodicule cells to absorb water and swell, resulting in floret open. Previous research reported that the altered expression patterns of genes involved in glycolysis/gluconeogenesis pathway could cause early flowering in rice ,41. In aIn conclusion, floret opening is initiated by water absorption and lodicule swelling that pushes the chaff out. This process requires the loosening of lodicule cell walls and the reduction of the solute potential in lodicule cells. The results of this study showed that exogenous MeJA could promote the degradation of starch and the reduction of the solute potential in sorghum lodicule cells at the molecular level , but theS1 Fig(TIF)Click here for additional data file.S2 Fig(TIF)Click here for additional data file.S1 Table(XLSX)Click here for additional data file."}
{"text": "The sex ratio  was 2.5. The mean delay of diagnosis was 53.5 months. Oral aphthosis was constant. The frequency of the manifestations was: genital aphtosis 71.5%, pseudofolliculitis 84.6%, erythema nodosum 11.5%, positive pathergy test 50%, ocular disease 36.9%, venous thrombosis 30%, arterial disease 4.6%, joint damage 30.8%, neurological disease 19.2% and digestive disease 0.8%. The male gender was significantly associated with ocular involvement (p =0.02), venous disease (p =0.01) and occurrence of relapses (p =0.01). The mean follow up was 68.5 \u00b1 77.3 months. The poor survival prognostic factors were male gender, ocular involvement, venous disease, cardiovascular disease, a duration of follow up \u226412 months and a diagnostic delay \u2264 24 months.  Beh\u00e7et\u2019s disease (BD) is a systemic vasculitis characterized by buccal and/or genital aphthosis with or without systemic manifestations. Its prognosis depends on clinical forms. Although BD seems to be the most common form of vasculitis in Tunisia , no reprType of the study: this study is a single-center, retrospective, descriptive and longitudinal study. We retained all patients with BD admitted to an Internal Medicine Department in Tunisia over a period of 26 years.Inclusion criteria: we retained all patients with confirmed BD responding to the International Criteria for BD [aphtosis of the mouth (two points); b) genital aphtosis (two points); c) skin damage (one point): pseudofolliculitis, erythema nodosum, papulo-pustular lesions and/or acneiform nodules not explained by corticosteroids and cutaneous aphtosis. d) Positive pathergic test (one point): it was considered positive if an aseptic papuleor pustule (superior than 2 mm) was objectified at the point of the bite. e) Eye damage (two points): in case of ocular abnormalities in ophthalmic examination, ophthalmological exploration was supplemented with retinal fluoresce in angiography. Visual field, visual evoked potentials and/or the ocular echography were practiced according to the clinical context.a for BD . A positmajor ocular lesions: uveal involvement  and/or retinal vasculitis (RV). Minor ocular lesions: conjunctival ulcerations, keratoconjunctivitis, episcleritis and / or scleritis.We included: Complications and ocular sequelaeVascular involvement (One point): it was confirmed by the imaging data. We included venous thrombosis: superficial vein thrombosis, deep vein thrombosis (DVT), pulmonary embolism (PE) and /or cerebral venous thrombosis (CVT). Arterial injury: thrombosis and/or arterial aneurysms.Neurological impairment (one point): retained in front of somatic neurological examination, neuroimaging and / or cerebro-spinal fluid.non-parenchymal lesions: they included CTV, arterial thrombosis and/or cerebral arterial aneurysms; neurological sequelae: objective neurological disorders persisting during the evolution and that could be a source of neurological handicap.We included: a) parenchymatous lesions retained on the cerebro-medullary magnetic resonance imagery sequences by hypo-signal lesions in T1 sequence and in hyper-signal in T2 and T2 flair sequence; b) Non inclusion criteria: we have not included the patients with confirmed BD but had never been hospitalized for BD and the patients to whom the diagnosis was rejected during the evolution and whose medical files were lost and/or unworkable.Modalities of evaluation: we defined different modalities of evaluation: a) a patient lost sight of was defined by a follow-up period necessarily longer than a month. b) A patient lost sight of out of hand was defined by a duration of follow-up obligatorily lower than one month. c) An improvement or remission was defined by subjective and/or objective good evolution of the clinical signs with a complete and/ or partial remission. d) A complete remission was defined by a complete resolution with disappearance of any sign of the disease, in the absence of any relapse during the follow-up period. e) A partial remission was defined by a significant but incomplete decrease in the signs of the disease, while maintaining a risk of subsequent relapse during the observation period. f) A relapse was defined by the reappearance of clinical signs after a favourable evolution. g) A stabilization was defined by a stability that no longer progressed toward improvement or worsening with a risk of relapse during the follow-up period. h) An aggravation was defined by an exacerbation of clinical lesions with appearance of complications.Statistical analysis: all data were analysed by the software SPSS 19.0. Statistical analysis contained absolute frequencies and relative frequencies. We calculated averages, medians and standard deviations and we determined the extreme values for the quantitative variables. For the analytic study, the comparison between two averages was made with the Student test for independent series, and by the non-parametric test of Mann and Whitney in case of low effectives. The comparison in percentages on independent series were made by the chi-Square test of Pearson and in case of significance of chi-square test and its non-validity, with exact bilateral Fisher test. The study of the binding was carried out by the Kaplan Meier method. Survival prognostic factors was performed in univaried analysis by comparing survival curves with Log rank test. In all statistical tests, the level of significance is 0.05.Epidemiological characteristics: we included 130 patients. Disease incidence was of five new cases per year. Patients were Tunisian in 97.7% of the cases and Algerian in two cases. The mean age at first disease manifestation was 30.3 years \u00b1 8.8 (extremes 12-58 years). The mean age at diagnosis was 34.6 years \u00b1 9.4 (extremes 15-65 years). Five patients were aged less than 16 years. Sex ratio (M/F) was 2.5.Onset disease: buccal aphthosis was inaugural in 55.4% of the cases. Genital and buccal aphthoses were associated in 25.4% of the cases. Severe organ involvement was revealed in 27 BD cases (20.8%). Mean diagnosis delay was 53.5 months \u00b1 65.2. Mean diagnosis delay for 72 patients with inaugural buccal aphthosis was 58.1 months \u00b1 79.6 and 49.5 months \u00b1 60.5 for other patients.Cutaneous mucosal manifestations: buccal aphthosis was constantly observed among patients. Evolutive genital aphthosis was observed in 71.5% of the cases. Genital scars were noted in 45.4% of patients. Two patients had peri-analaphthosis. Skin hypersensitivity was noted in 46.9% of the cases. Pathergy test was performed in 87.7% of cases and was positive in 50% of the cases. Skin damages were observed in 87.7% of the cases. Pseudofolliculitis and erythema nodosum (EN) were observed in 84.6% and 11.5% of the cases, respectively.Ocular manifestations: they were observed in 36.9% of the cases and inaugural in 10.8% of the cases. Ocular involvement was discovered in 6.2% of the cases. Complications and sequelae were diagnosed in respectively 47.9% and 6.2% of the cases. Patients were definitely blind at the moment of diagnosis in 8.3% of the cases. Uveal involvement was the most frequent lesion (77.1%) followed by retinal vasculatis (62.5%). Hyalitis was diagnosed in 15 patients (31.3%) and was associated to posterior uveitis in six cases. Seven patients (14.6%) had retinal hemorrhage.Vascular manifestations: they were noted in 31.5% of cases. It was about 35 cases of venous manifestations in 35 cases, arterial manifestations in two cases and both in four cases. Deep venous thrombosis(DVT) was the most frequent vascular manifestations (78%).Venous manifestations: venous impairment was observed in 95.1% of vascular manifestations and 30% of BD patients. It revealed the diagnosis in 20.7% of the cases. Venous manifestation appeared during BD evolution in 9.2% of cases with a mean delay of 45.8 months \u00b1 45.9. There were DVT in 32 cases and superficial vein thrombosis in 32 cases. The locations of DVT were the lower limbs (84.4%), the vena cava (28.1%), the upper limbs (9.4%), pulmonary embolism (PE) (9.4%), cerebral venous thrombosis (6.2%) and Budd Chiari syndrome (3.1%).Arterial impairment: it was observed in 14.6% of vascular manifestations and 4.6% of patient with BD and revealed BD in three cases. All patients were male. Arterial manifestations were as follows: isolated arterial aneurysms (n=1), isolated arterial thrombosis (n=4), and both manifestations (n=4). Pulmonary artery was the most frequent disease localization (n=5).Neurological manifestations: central nervous system disorders was reported in 19.2% and was inaugural in two cases. They were caused by parenchymatal lesions (88%). Psychiatric manifestations were observed in 36% of the cases with neuro-BD (6.9% of patients with BD).Cardiac manifestations: they were inaugural in one case. Three patients had pericardial effusion and coronary involvement.Other manifestations: joint damage and digestive disease were diagnosed in respectively 30.8% and 0.8% cases.Biology: biological inflammatory disorders were observed in 77 patients (59.2%). HLA typing was performed in 47 patients (32.2%) and was positive in 48.9% of the cases. Only one patient had a combined deficiency of proteins S and C.Therapeutic means in Behcet\u00b4s disease: the different therapies used for BD are summarized in Anticoagulant therapy and platelet aggregation inhibitors: all patients with DVT and /or arterial thrombosis were treated with anticoagulant therapies. The mean period of treatment was 60.9 months with extremes 2 to 218. Two patients had hemorrhagic complications secondary to vitamin K overdose.Evolution modalities: twenty-two patients (16.9%) were lost sight of the out of hand. The mean follow-up was 68.5 \u00b1 77.3 months (5.7 years), and extremes were 6 days to 26 years. Among 130 patients, 48.5% noted an improvement. It was about vascular manifestations (53.6%), cutaneous and mucosal manifestations (46.9%) and ocular manifestations (25%). Complete and partial remission were observed in respectively 26.2% and 22.3%. Disease stabilization and a worsening were observed in respectively 28.5 and 4.6%. The mortality rate in our study was 1.5%. A fatal vasculo-BD occurred in two cases. The relapse was observed in 42.3%. The mean number of relapses per patient during BD evolution was 7 \u00b1 6. The maximum number of relapses was 14. The mean period between BD diagnosis and first disease relapse was 34 months \u00b1 53. Definitive sequelae were observed in 10% of cases (n=13) and were mainly secondary to ocular and neurological involvement.Gender: women developed significantly more frequently EN (p=0.03) than men. Male gender was significantly associated with ocular involvement (p=0.02), venous manifestations (p=0.01), corticosteroid treatment (p=0.007), immunosuppressive therapy (p=0.01), anticoagulation (p=0.009) and relapses (p=0.001). Age: no difference in epidemiological, clinical, biological, diseaseevolution and prognosis in terms of age was observed among patients. b) Types of manifestations: patients with ocular involvement developed less frequent biological inflammatory disorders (p=0.001) and vascular manifestations (p=0.016). Remission is rarely observed compared with patients without ocular BD (p=0.001). Biological inflammatory disorders were more frequently observed in patients with angio-BD (p=0.003). Patients with articular manifestations develop significantly less relapses than patient with other organ involvement. (p=0.007). HLA profile: no difference in the type of manifestations and HLAB51 profile was observed among the patients. d) Prognostic factors: two cases of death were noted in our series. We were unable to identify prognostic factors of mortality. We studied the survival events of patients without relapses and survival events without aggravation and thus released the prognostic factors of survival that can influence the evolutionary profile and the survival of these patients. We compared the two subgroups of patients: 1) group1 (n = 74): patients who had no relapses or worsening of the disease (n=51) and patients who had only isolated mucocutaneous relapses (n=23); group 2 (n = 29): patients who have relapsed ocular, vascular, articular, and neurological manifestations and patients who have had a worsening of their disease. According to Kaplan Meier analysis, one- three- five-10-and 20 years the survival rates with-neither relapses nor worsening were observed in respectively 84%, 70%, 67%, 61% and 61% of the cases. The disease was stabilized after 8 years of evolution (volution . These pOur study was conducted during a long period of 26 years. A few works have been focused on BD characteristics and survival factor prognosis without relapse nor worsening. A better knowledge of different manifestations and prognosis factors of BD, are a key for early diagnosis and better management to improve the function and prognosis and guarantee a better quality of life for North African patients. However, retrospective and single center characteristics were the limitations of this study. Selection biais can also explain the important prevalence of multisystemic forms. BD seems to be the most frequent vasculitis in Tunisia . In a NoCutaneous-mucosal manifestations were inaugural in many studies , 13, andCentral nervous system involvement in BD is characterized by diffuse involvement with brain stem predilection observed in 21.4% to 70%of the cases. Hemispherical and medullary localizations were observed in respectively 14% to 19.8% and in 2.6% to 14% of the cases , 23. Theet al. [Cardiac manifestations incidence was comparable to the literature , 12. Caret al. . Pericaret al. , 27. Theet al. , 29. In et al. . Howeveret al. .BD has an important polymorphism and a relatively high incidence in the Maghreb. Poor survival prognostic factors are male gender, ocular involvement, venous disease, cardiovascular disease, a duration of follow up \u226412 months and a diagnostic delay \u226424 month. Behind the therapeutical progress, prognosis improvement is very important by shortening the diagnosis delay, multidisciplinary staff participation, and intensive treatment of the functional involvement and regular monitoring of patients. Education is important for the treatment of BD to guarantee patients\u00b4 compliance.BD is an inflammatory, systemic, chronic disease that evolves by relapses;The clinical presentation is polymorphic and associated with a bucco-genital aphthosis with various systemic manifestations. The positive diagnosis is often difficult especially in the absence of aphthosis;The therapeutic management remains controversial, due to the scarcity of therapeutic trials and the absence of standardized criteria for measuring the evolution. Its evolution is unpredictable. Its prognosis varies according to its clinical presentation. The neurological and ocular manifestations are responsible for a progressive deterioration of the functional prognosis. The vascular and digestive disorders condition the vital prognosis.The male gender is significantly associated with ocular involvement, venous disease and occurrence of relapses;The poor survival prognostic factors are male gender, ocular involvement, venous disease, cardiovascular disease, a duration of follow up \u226412 months and a diagnostic delay \u226424 months."}
{"text": "Humic substance (HS)-based biostimulants show potentials as sustainable strategies for improved crop development and stress resilience. However, cellular and molecular mechanisms governing the agronomically observed effects of HS on plants remain enigmatic. Here, we report a global metabolic reprogramming of maize leaves induced by a humic biostimulant under normal and nutrient starvation conditions. This reconfiguration of the maize metabolism spanned chemical constellations, as revealed by molecular networking approaches. Plant growth and development under normal conditions were characterized by key differential metabolic changes such as increased levels of amino acids, oxylipins and the tricarboxylic acid (TCA) intermediate, isocitric acid. Furthermore, under starvation, the humic biostimulant significantly impacted pathways that are involved in stress-alleviating mechanisms such as redox homeostasis, strengthening of the plant cell wall, osmoregulation, energy production and membrane remodelling. Thus, this study reveals that the humic biostimulant induces a remodelling of inter-compartmental metabolic networks in maize, subsequently readjusting the plant physiology towards growth promotion and stress alleviation. Such insights contribute to ongoing efforts in elucidating modes of action of biostimulants, generating fundamental scientific knowledge that is necessary for development of the biostimulant industry, for sustainable food security. This advances the understanding of regulatory network rules and mechanistic events in the cellular and chemical space of the plant under consideration, which, in turn, provides greater impetus for the translation of fundamental knowledge to actionable programs in the field + = 556.766, and [M \u2212 H]\u2212 = 554.2615, to ensure high mass accuracy (1\u20133 mDa) of analytes. For downstream structural elucidation, the MS analyses were set to result in both unfragmented and fragmented experiments through collision-induced dissociation (MSE), where the fragmentation patterns were obtained by alternating the collision energy from 10 to 50 eV. For targeted analysis, a triple quadrupole mass spectrometry platform, LCMS-8050 , equipped with an ESI source and ultra-fast liquid chromatography (UFLC) as the front-end, was utilized. A multiple reaction monitoring (MRM) method was used for absolute quantification of the targeted metabolites (amino acid and hormones)  source, was used for untargeted analysis. The MS detector was set to acquire centroid data in both positive and negative ionisation modes. The MS conditions used were as follows: the source temperature was set at 120 \u00b0C, desolvation temperature at 450 \u00b0C, capillary voltage 2.5 kV, sampling and extraction cones at 30 V and 4 V, respectively, cone gas flow at 50 L hormones) : descripApexTrack algorithm [m/z variable pairs, with m/z peak intensity for each sample. The following parameters were used for data processing: retention time (Rt) range of 1\u201317 min, a 100\u20131100 Da mass range, intensity threshold of 50, mass tolerance of 0.05 Da, and an Rt window of 0.2 min for both polarities. Normalization was then performed by using total ion intensities of each defined peak; prior to calculating intensities, the software performs patented modified Savitzky\u2013Golay smoothing and integration. Only data matrices with noise levels below 50% (MarkerLynx metrics) were used for downstream data analysis strategies. The data matrices generated from MassLynx were exported into the SIMCA-15.0 software  for statistical modelling. Some of the computed chemometrics models were included principal component analysis (PCA). The latter is an unsupervised method that aims at data dimensionality reduction and generates a model that reveals clusters, trends, and similarities between treatment groups [The UHPLC-qTOF-MS raw data were processed using MassLynx XS\u2122 software\u2019s MarkerLynx application . This application makes use of the patented lgorithm  to perfot groups . SuperviR1 significant components) were considered. Furthermore, different metrics and tests were used for model validation, which included an evaluation of explained and predicted variation (cumulative R2 and Q2), the analysis of variance testing of cross-validated predictive residuals , the receiver operating characteristic (ROC) curves, response permutation tests (with n = 100) and predictive testing. Thus, to ensure reliable results, only thoroughly validated and (preferably) parsimonious models were considered in this study. Quantitative analysis  was performed using average integrated peak areas and concentrations for untargeted and targeted metabolites, respectively.Before building the chemometrics models PLS-DA), data pre-treatment  was applied to normalize the variances and correct heteroscedasticity ,52. A nohttps://www.reifycs.com/AbfConverter/, accessed on 21 April 2021) and then uploaded into the Mass Spectrometry-Data Independent AnaLysis (MS-DIAL) software. The MS-DIAL data-processing program makes use of a deconvolution algorithm to perform mass spectral deconvolution of data-independent acquisition (DIA) data, thus making it applicable for the extensive untargeted metabolomics analysis of both DIA and data-dependent acquisition (DDA) centroid datasets [https://gnps.ucsd.edu/, accessed on 28 April 2021) using the WinSCP server for molecular networking.All the raw vendor  format MS/MS data were first converted to \u2018analysis base file\u2019 (ABF) format using the Reifys Abf converter software , thus allowing for molecular networks to be created [m/z) and coloured by means of pie charts based on the differential changes in the metabolite levels under different treatment conditions. The MolNetEnhancer networks, on the other hand, were coloured based on the classes such that nodes present in the same class had the same colour while grey nodes represented the non-matched metabolites. The fragmentation spectra of all the putatively annotated metabolites matched to the GNPS spectral libraries were manually validated using the metabolite annotation workflow described below.A feature-based molecular network (FBMN) was generated for both the negative and positive mode data by uploading the respective feature quantification table, MGF file and a metadata file describing the properties of the sample file . The MS/MS (fragmentation) spectra were clustered using the MS-Cluster algorithm with a precursor ion mass tolerance of 0.05 Da and fragment ion mass tolerance of 0.05 Da to create the consensus spectra. A network was generated where the lines/edges connecting the nodes were filtered to have a cosine score above 0.7 and a minimum of 4 corresponding fragment ions. This approach builds on the assumption that molecules which are structurally related give rise to similar fragmentation patterns when subjected to MS created ,54. The https://www.plantcyc.org/, accessed on 15 March 2021), Dictionary of Natural Product (DNP) , Chemspider , and Kyoto Encyclopedia of Genes and Genomes (KEGG) , to putatively assign compound names to the MF; (iii) structural elucidation was performed based on the fragmentation patterns by examining the MS1 and MSE spectra of the metabolites; and (iv) putative annotations of metabolites were also compared to the available literature, considering their respective chromatographic elution profiles on a reverse-phase column. In the current study, metabolites were putatively annotated to level 2 of the Metabolomics Standards Initiative (MSI) [Metabolite features were annotated based on the following criteria: (i) molecular formula (MF) from full-scan accurate mass data, filtered through heuristic rules such as mass differences, nitrogen rules, restrictions of element numbers, isotopic fit and rings-and-double-bond equivalent; (ii) the calculated, filtered elemental composition predictions were searched against bioinformatics tools or databases such as PlantCyc (ve (MSI) .http://metamapp.fiehnlab.ucdavis.edu/, accessed on 30 April 2021). MetaMapp-encoded chemical structures of all the identified metabolites were retrieved from the PubChem and KEGG databases, and the p-values and fold changes were obtained from OPLS-DA-derived descriptive statistics (All annotated and targeted metabolites  were useatistics . A TanimUnderstanding the modes of action involved in biostimulant-mediated growth promotion and stress resilience is one of the critical steps necessary for the full implementation and integration of biostimulants into agricultural practices. Thus, this present study intended to decode a metabolic choreography that defines the effects of an HS-based biostimulant on maize plants, under normal and starved conditions, in a greenhouse setting. Although further investigation may be needed to build on our findings, the model derived from this metabolomics study suggests that the HS-biostimulant induced a metabolic reprogramming in maize plants towards growth promotion and the alleviation of starvation stress. Molecular networking approaches aided in characterizing the HS-altered chemical space. In more detail, a wide and coordinated range of metabolic processes was involved in the response of maize plants to HS treatments. Impacted metabolic pathways included amino acid metabolism, phenylalanine metabolism, and alpha-linolenic acid metabolism, among others, involving a spectrum of metabolite classes such as amino acids, phytohormones, lipids, HCA compounds and flavonoids which are involved in growth promotion and nutrient stress alleviation. Furthermore, metabolic network analysis revealed some qualitative characteristics of HS effects on maize metabolism under nutrient starvation: a complex structural interconnectivity between altered metabolites involved in stress alleviation and metabolite hubs depicting possible biochemical regulatory mechanisms, which can be investigated further. These HS-induced multilayered metabolic reconfigurations in maize plants could generally be linked to morphophysiological data such as chlorophyll content, nutrient assimilation, and changes in biomass. The knowledge generated from this work provides a morphophysiological and metabolomic gateway to the mechanisms underlying the effects of HS-biostimulant on plants. Such insights lay a foundation for advancement of the biostimulant industry and incorporation of these formulations in agronomic practices, for sustainable food security."}
{"text": "Solanum lycopersium) under salinity stress conditions. This metabolomics study postulates that Si-based biostimulants could alleviate salinity stress in tomato plants through modulation of the primary metabolism involving changes in the tricarboxylic acid cycle, fatty acid and numerous amino acid biosynthesis pathways, with further reprogramming of several secondary metabolism pathways such as the phenylpropanoid pathway, flavonoid biosynthesis pathways including flavone and flavanol biosynthesis. Thus, the postulated hypothetical framework, describing biostimulant-induced metabolic events in tomato plants, provides actionable knowledge necessary for industries and farmers to, confidently and innovatively, explore, design, and fully implement Si-based formulations and strategies into agronomic practices for sustainable agriculture and food production.The ongoing unpredictability of climate changes is exponentially exerting a negative impact on crop production, further aggravating detrimental abiotic stress effects. Several research studies have been focused on the genetic modification of crop plants to achieve more crop resilience against such stress factors; however, there has been a paradigm shift in modern agriculture focusing on more organic, eco-friendly and long-lasting systems to improve crop yield. As such, extensive research into the use of microbial and nonmicrobial biostimulants has been at the core of agricultural studies to improve crop growth and development, as well as to attain tolerance against several biotic and abiotic stresses. However, the molecular mechanisms underlying the biostimulant activity remain enigmatic. Thus, this study is a liquid chromatography-mass spectrometry (LC-MS)-based untargeted metabolomics approach to unravel the hypothetical biochemical framework underlying effects of a nonmicrobial biostimulant (a silicon-based formulation) on tomato plants ( Excessive amounts of salt ions in the rhizosphere could occur naturally from processes such as mineral weathering and gradual withdrawal from the ocean, or because of irrigation malpractices and overuse of fertilisers . In. In37]. p-value rankings, with a cut off at 0.0005. DSPC graphical models allow discovering weighted connectivity between large numbers of metabolites, where several associations of metabolites can be discovered. On the network, very strong correlations were discovered between the flavonoid quercetin and vitexin, rutin and coumaroyl derivatives, and phenolic acids feruloyl-, coumaroyl- and sinapoyl derivatives  and the lowest negative between phenolic compounds and organic acids A. As disivatives B. This cIn general, correlation analysis can be used as proxy to describe a given physiological state of the system of interest because the correlation matrix and networks can change with the steady-state concentrations of metabolites ,41. HencIn metabolomics studies, correlation analysis provides a powerful view to understand biological systems where not only individual metabolites are connected, but also their interconnections, hence providing a more comprehensive understanding of the metabolome of the system in question . The gloAlthough some amino acids including alanine, leucine, glutamine and methionine appear to have been downregulated (red) in response to salt stress A, othersThe computed network-based correlation analysis provides a complementary tool to the statistical and multivariate analysis of metabolomics datasets for identification of metabolite alterations in different physiological states ,43. As sThe application of Si-based biostimulants on tomato plants under salt stress conditions induced shifts in primary metabolism, reflected through the reorganisation of several pathways involving fatty acids-, organic acids-, sugar- and amino acids metabolism C. PrimarZea mays and Swertia chirayita, respectively, where phosphogluconate and the enzymes involved in the PPP were enhanced upon Si formulation inclusion.Si-biostimulant application to salinity-stressed plants evidently alter the content of different organic compounds and sugars, e.g., reprogramming of ascorbate and alderate metabolism, sugar metabolism pathways and the TCA cycle in this current study . Under sOn the other hand, arabinose levels were relatively lower in stressed plants compared to the non-stressed and were marginally decreased post-biostimulant treatment . Under sIn addition to sugars, several studies have reported stress-induced modifications in the levels of organic acids including most commonly malic acid, citric acid and succinic acid ,56,57. OArabidopsis thaliana Pooled quality control (QC) samples were used for assessment of the reliability and reproducibility of the data generated, as well as for corrections of the non-linear signals. A QC sample was injected after each 10 randomised sample injections to accurately monitor the deviations caused by the instrument. In addition, 6 injections of a QC sample were done at the beginning and the end of each batch to ensure equilibration of the system and reduce bias in the measurements. The blank samples (consisting of 50% methanol) were also randomly run to detect any background noise.Centroid raw data acquired from both positive and negative ESI modes was visualised and pre-processed using MassLynx XSTM 4.1 , generating a data matrix of paired retention time (Rt) and m/z variables, with their respective peak intensities. For data processing, the MarkerLynx software parameters were set to process the m/z domain of 100\u20131200 Da within the retention time (Rt) range of 0.9\u201314 min. Mass tolerance of 0.05 Da and intensity threshold counts of 100 were set for both positive and negative data, with a Rt window of 0.2 min. Prior to computation of peak intensities, MarkerLynx software was set to execute a modified Savitzky-Golay smoothing and integration, retaining only data matrices with the noise levels below 10% (as determined by MarkerLynx) for subsequent data analysis. After data extraction (by MarkerLynx), a mandatory data scrutiny was meticulously done, including assessment of the number of extracted features , applying the 80% rule  and monitoring the quality of data and stability of the analysis using QC samples. Data transformation methods\u2014centering, scaling or transformation\u2014were \u2018exploratively\u2019 employed to put all variables on equal footing, minimise variable redundancy and adjust for measurement errors.The MassLynx generated data matrices were exported to SIMCA  software, version 15  and a web-based data analysis tool, MetaboAnalyst version 4.0  for data mining and interpretation. The approach followed in this study was a chemometric approach: (i) firstly, exploration of the data using unsupervised chemometrics methods, such as principal component analysis (PCA), to reduce the dimensionality of the data, evaluate the structures and characteristics of the data ; (ii) following unsupervised modelling, and based on the insights extracted from it, supervised multivariate hybrid machine learning (ML)/classical statistical methods such as orthogonal projection to latent structures-discriminant analysis (OPLS-DA) were applied. This allowed for sample classification  as well as the identification and selection of variables (metabolite features) underlying the discrimination between groups or classes. Different metrics and tests were applied for model validation, and these include evaluation of explained and predicted variation (cumulative R2 and Q2), cross-validation analysis of variance (CV-ANOVA) and permutation testing.k-fold cross-validation is the most common method for model evaluation and selection in machine learning, where a dataset is iterated k times. In each iteration, the dataset is divided into k parts: validation and training subsets. This implies that, in the case of a 7-fold CV, for a fixed number of components, the Y values of all individuals of each subset are predicted using a sub-model computed with the 6 other subsets. Results of this k-fold cross-validation procedure are summarised by quality parameters, such as R2 and Q2 metrics in this case. R2 indicates the explained variation  and Q2 refers to predicted variation  [Prior to computing chemometric and ML models, pre-treatment methods such as data transformation and Pareto-scaling were applied to normalise and adjust all the variables to a comparable footing. An adjusted non-linear iterative partial least square (NIPALS) algorithm was used to manage the missing values, with a correction factor of 3.0 and a default threshold of 50% . A sevene model) ,118.https://www.reifycs.com/AbfConverter (accessed on 6 June 2021)) then uploaded into the Mass Spectrometry-Data Independent AnaLysis (MS-DIAL) software ). The MS-DIAL data-processing program uses the deconvolution algorithm to perform mass spectral deconvolution of data-independent acquisition (DIA) data, thus making it applicable for the extensive untargeted metabolomics analysis of both DIA and data-dependent acquisition (DDA) centroid datasets [https://gnps.ucsd.edu/ (accessed on 21 June 2021)) using the WinSCP server for molecular networking.The raw MS/MS data was converted to \u2018analysis base file\u2019 (ABF) format using the Reifys Abf converter software (datasets . The dathttps://cytoscape.org/ (accessed on 30 September 2021)) network visualization tool/software (version 3.8.2), where the nodes were labelled with the precursor mass (m/z) and coloured based on metabolite class. The individual nodes, representative of measured ions, were also coloured to display colour-coded pie charts illustrating relative ion abundance across different treatments. The edges were coloured based on the type of interaction: Kyoto Encyclopaedia of Genes and Genomes (KEGG) reactant repair (krp) and the Tanimoto chemical similarity (tmsim) between the metabolites. The fragmentation spectra of all the putatively annotated metabolites matched to the GNPS spectral libraries were manually validated as described in the next session.The respective feature quantification table, MGF file and a metadata file describing the properties of the sample file  were uploaded for generation of a feature-based molecular network (FBMN). The MS/MS fragmentation spectra were assembled using the MS-Cluster algorithm with a precursor ion mass tolerance of 0.05 Da and fragment ion mass tolerance of 0.05 Da. A network was generated where the lines/edges connecting the nodes were filtered to have a cosine score above 0.7 and a minimum of 4 corresponding fragment ions. The MN spectra were then searched against the spectral libraries housed in GNPS where the same parameters  were used for metabolite annotation. To improve the chemical structural annotations, the generated molecular network data was enhanced with MolNetEnhancer then visualised on the Cytoscape (https://www.genome.jp/kegg/ (accessed on 18 October 2020)), Dictionary of Natural Product (DNP), ChemSpider (http://www.chemspider.com/ (accessed on 12 April 2020)) [https://www.metaboanalyst.ca/ (accessed on 17 August 2021)) [http://metamapp.fiehnlab.ucdavis.edu/ (accessed on 30 August 2021)) and visualized on Cytoscape v3.8.1 for a global view of the metabolic changes across different treatments.The chemometrically and statistically selected variables  from data modelling were confidently annotated through a multistep workflow, and metabolites were annotated to the level 2 as classified by the Metabolomics Standard Initiative (MSI) . Thus, the main steps followed for metabolite annotation in this study included: (i) computation of the molecular formula (MF) based on mass accuracy and the golden heuristic rules integrated in MarkerLynx formula generator algorithms  and element number restrictions); (ii) the computed MF were manually and automatically searched against various databases such as KEGG (l 2020))  and an it 2021)) , which aIdentifying and delving into the regulatory mechanisms of biostimulants in improving plant stress tolerance will help fine-tune the most effective application rates, areas, concentrations, and biostimulant-plant specificities which may collectively yield the highest impact on stress protection. Fundamental knowledge and understanding of such mechanisms are pivotal for the development and generation of biostimulants, where synergies of microbial and/or nonmicrobial mechanisms are functionally and complementarily designed, offering the potential to overcome specific and general stresses to a spectrum of plant species. A comprehensive and systematic approach to discover the mode of action of biostimulants has been proposed\u2014metabolomics. This multidisciplinary omics technique can be used to interrogate cellular biochemistry, providing a window to understand cellular and molecular language in the context of biostimulant-plant interactions. As such, metabolomics reveals mechanisms that define biostimulant activity in stress alleviation. Meta-analysis of the Si-biostimulant-mitigated salt stress alleviation was conducted in this study.The predictive models derived show positive modulations in the primary and secondary mechanisms of Si-biostimulant-treated plants under salt stress conditions, including reconfigurations in the metabolite profiles of amino acids, fatty acids, organic acids, and phenolics. The analysis found that Si-biostimulant application induces accumulation of primary metabolites in such treated plants, which collectively replenish the energy for several metabolic reactions, modulate stress signalling waves that lead to specialised plant stress responses, act as osmotic and photosynthetic protectants and are precursors for the more defence-oriented secondary metabolic reactions. Moreover, Si-biostimulant is postulated to confer salt stress tolerance via accumulation of phenolics, as indicated by the timely decrease in their content which points to stress alleviation. These specialised metabolites define a huge part of secondary metabolism with defence-related roles including ROS scavenging, activation of defence-related proteins and antioxidant enzymes, and inhibition of ROS-generating enzymes. Such metabolite reprogramming spans several biostimulant-impacted primary metabolism pathways including the TCA cycle, amino acid- and fatty acid biosynthesis pathways, the PPP and secondary metabolic mechanisms such as the phenylpropanoid pathway, flavonoid biosynthesis pathway, and other secondary metabolite biosynthesis pathways.As illuminating as the current study is, emphasis of future studies for an expanded and hypothesis testing could be extended to (i) a targeted analysis focused on the proposed mechanisms that define a nonmicrobial biostimulant activity, (ii) development of integrated omics technologies  research for a systems biology approach towards biostimulants and (iii) synergistic effects of microbial and/or nonmicrobial biostimulant formulations against a plethora of biotic and abiotic stresses."}
{"text": "Following the completion of the treatment, gene expression of inflammatory mediators , protein expression of MMP-2, MMP-9 and their respective inhibitors- TIMP-1 and TIMP-2, and gelatinolytic activity of MMP-2 and MMP-9 were determined. At the protein level, cadmium incites a differential effect on the expression and activity of gelatinases and their endogenous inhibitors in an exposure-dependent manner. Results also show that the administered cadmium dose elicits an inflammatory response until week 10 that slightly diminishes after 4\u00a0weeks. This study provides evidence of cadmium-induced imbalance in the MMP-TIMP system in the cardiac tissue. This imbalance may be mediated by cadmium-induced inflammation that could contribute to various cardiovascular pathologies.The aim of this study was to evaluate the role of chronic cadmium exposure in modulating cardiac matrix metalloproteinases (MMPs) in the heart of rats. Adult male Sprague-Dawley rats were exposed to 15\u00a0ppm CdCl Since the discovery of cadmium in 1817 , this elEven at low doses, cadmium has been reported to impart its toxic effects on other organ systems including the nervous system , immune In the context of cardiovascular dysfunction, a hallmark of chronic cadmium exposure is the induction of fibrosis . CriticaTherefore, this study aims to evaluate the role of cadmium in modulating cardiac MMPs in the heart of rats after cadmium exposure.All experimental procedures performed are in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals  and were approved by the Institutional Animal Care and Use Committee of Qatar University . The samples obtained in this study were acquired from the animals employed in a previous study from our research group .2  in drinking water for 10\u00a0weeks followed by 4\u00a0weeks of normal drinking water. The administered cadmium exposure dose was selected based on previous literature reporting that a dose of 15\u00a0ppm of CdCl2 is a non-carcinogenic dose  male Sprague-Dawley rats were obtained from Laboratory Animal Research Center, Qatar University and housed in individually ventilated cages (IVC) under standard conditions . Animals were randomly assigned to one of two regimes for 14\u00a0weeks- 1) control group or 2) cadmium treatment (Cd-treated) . The connic dose  leading nic dose . The calnic dose  for the nic dose .ad libitum access to standard rodent chow and drinking water during the experiment. Animals were sacrificed at weeks 5, 10 and 14 under anaesthesia with sodium thiopentone . Heart tissue was dissected, cleaned from residual blood, immersed in liquid nitrogen, and preserved in the tissue archive at \u221280\u00b0C until further analysis.Animals received Frozen heart samples were weighed to approximately 20\u201330\u00a0mg and homogenized by sonication at 40% amplitude in pulses of 5\u00a0s. Heart tissue was homogenized in radioimmunoprecipitation assay (RIPA) cell lysis buffer to extract total proteins in combination with cocktail protease inhibitor and TRIzol reagent to extract RNA.Sonicated heart tissue samples were lysed for crude protein by incubating in RIPA cell lysis buffer  containing cocktail protease inhibitor . Protein extraction for MMP activity assay included EDTA in the cell lysis buffer. Cellular debris was pelleted by centrifugation for 10,000\u00a0rpm, 10\u00a0min at 4\u00b0C. The supernatant containing total crude protein concentration was estimated using Quick Start\u2122 Bradford Protein assay  as per instructions in the user\u2019s manual provided .The protein expression of gelatinases i.e., MMP-2 & MMP-9  and their respective inhibitors-TIMP-1 & TIMP-2  in response to cadmium treatment were analyzed by Western blotting. Equal amounts of crude protein was loaded and resolved by reducing SDS-PAGE. Separated proteins were electroblotted to polyvinylidene difluoride (PVDF) membrane . Electroblots were washed with TBST , blocked and probed with primary antibodies for the targets overnight at 4\u00b0C. Detection was done using compatible secondary HRP-conjugated antibodies  and incubated in ECL solution for a minute. Immunoreactive bands were visualized using ECL  under SynGene Gel documentation system. Protein expressions was evaluated by densitometric analysis using Image studio Lite (Ver 5.2) and normalized against the corresponding expression of GAPDH. Analysis was presented as a fold change compared to the respective controls.2 and 0.02% Triton X-100] at 37\u00b0C until a clear lysis zone is observed. The gel was quick stained in 0.10% Coomassie brilliant blue R250 for 5\u00a0min and destained till contrast between the lysis bands and blue gel background was visible. The zymographs were documented using the SynGel Documentation system. The proteolytic activity was analyzed using ImageJ and presented as a fold change compared to the control.Gelatinolytic activity of MMP-9 and MMP-2 was determined by gelatin zymography. Equal amounts of crude protein (40\u00a0\u00b5g) were mixed with sample loading buffer  and were loaded into a 9% acrylamide:bis-arcylamide gel containing 0.1% gelatin  as substrate. Non-reducing electrophoresis was done. After electrophoresis, the gel was washed twice in renaturing buffer containing 2.5% Triton X-100\u00a0at 37\u00b0C and incubated in developing buffer [50\u00a0mM Tris-HCl (pH 7.8), 0.2\u00a0M NaCl, 5\u00a0mM CaClTotal RNA was isolated from frozen heart samples using TRIzol reagent  according to the manufacturer\u2019s instructions as previously described . Total R-\u03b1, NF-\u03baB and GAPDH individually . Quantification was done by the \u0394\u0394Ct method wherein results were compared against both calibrator (control group) and normalizer  to obtain the \u0394\u0394Ct value . Extracted total RNA was reverse transcribed to cDNA using High-Capacity cDNA reverse transcriptase kit  as per instructed in user\u2019s manual. Total cDNA was diluted by 4-fold in RNase-free water. The gene expression assay was performed using Quant Studio 6 Flex Real Time PCR system (Applied Biosystems). Amplification plots were obtained for each target using specific primers for IL-1\u03b2, IL-6, IL-10, TNFCt value . This vapost-hoc test using GraphPad Prism (ver.8.4) for Windows . p-value < 0.05 was considered as statistically significant.The results were presented as mean \u00b1 S.E.M and analyzed by two-way ANOVA followed by Tukey\u2019s To evaluate the level of expression of MMPs, 40\u00a0\u00b5g of crude protein was separated in 9% SDS-PAGE. Protein expression was evaluated by probing electroblots specific for MMP-2 and MMP-9. By western blotting, only MMP-2 was detectable at approximately 64\u00a0kDa. It was observed that MMP-2 increased by more than 2-fold at week 5, slightly decreased at week 10 and reaches a maximum fold change of more than 4-fold at week 14 . In compProtein expression of TIMPs was assessed by separating 50\u00a0\u00b5g of crude protein in 12% SDS-PAGE and probing immunoblots against TIMP-1 and TIMP-2. The expression of TIMP-1 showed limited changes at the level of the protein in comparison to the control group . Less thActivity of MMPs were evaluated by gelatine zymography indicated by visualization of bands of lysis corresponding to the molecular weight of MMP-2 and MMP-9. After 24\u00a0h incubation, activity corresponding to the proenzyme form of MMP-2 at 72\u00a0kDa was observed. Densitometric analysis of the detected area of lysis shows that the activity of pro-MMP-2 does not increase by more than 1-fold at all time points in comparison to their respective control group .p < 0.05). Also, the decrease in activity from week 10 to week 14 was found to be statistically significant (p < 0.01). In regard to proenzyme MMP-2 (p < 0.05).On extension of the incubation period to more than 60\u00a0h, the activity of proenzyme form of MMP-9 and both proenzyme and active enzyme form of MMP-2 was detected . Quantifme MMP-2 , the actme MMP-2 , there i, IL-6, IL-10, NF-\u03baB and TNF-\u03b1 were assessed and represented as a fold change  play a vital role in both extracellular matrix turnover and inflammatory response in normal physiology. A dysfunction in their expression and activity, specifically gelatinases has been widely implicated in various cardiovascular pathologies . The curatinases . Similarin vitro study on cadmium treated U-937 cells showed that cadmium doses (1.0\u201350.0\u00a0\u00b5M) did not have any effect of TIMP-1 levels however there was an alteration in the MMP-9/TIMP-1 expression at the level of the gene albeit not statistically significant (One of the strategies to regulate and modulate the expression of MMPs is by means of TIMPs. The inhibitory relationship of the TIMPs on their preferential MMPs was clearly reflected in the protein expression levels of TIMP-1 and TIMP-2. Furthermore, the expression of TIMP-2 can be inversely correlated with the expression of MMP-2 wherein an elevation in the expression of TIMP-2 decreased the expression of MMP-2. These results demonstrate the effect of cadmium on the expression of TIMPs and hence the inhibition of MMPs. An nificant . The stunificant , cadmiumnificant . This rein vitro study in ECV304 cells suggested that NF-\u03baB was activated by the cadmium treatment via phosphorylation and degradation of the NF-\u03baB inhibitor, I\u03baB\u03b1 (It is well-documented that IL-1\u03b2, IL-6 and TNF-\u03b1 cause inflammation, therefore changes in gene expression of these cytokines are indicative of inflammation . In the or, I\u03baB\u03b1 . In the or, I\u03baB\u03b1 .TNF-\u03b1 plays a pro-inflammatory role in local and systemic inflammation when secreted by activated macrophages in response to injury to amplify and prolong the inflammatory response . A studyin vivo and in vitro (in vivo and in vitro (Extensive research exploring the impact of cadmium along the inflammation axis have reported the production and upregulation of IL-6, TNF-\u03b1 and IL-1\u03b2 both in vitro . In thisin vitro . For thein vitro . Recent in vitro .The present study did not include the role of chronic cadmium exposure on the kidneys and its relation to the described cardiac dysfunction has not been examined. On the other hand, several prior studies have reported that cadmium at the same dose has resulted in renal and cardiac injuries . The autThe findings of this study provides considerable insight in understanding that despite the withdrawal of cadmium exposure, the impact of the exposure still persists in the heart. It must be noted that to the best of our knowledge, this study is the first to evaluate the impact of cadmium exposure on the heart after withdrawal of the treatment. This study shows that cadmium alters the expression and activity of gelatinases in the heart. Also, cadmium significantly stimulates an inflammatory response by the upregulation in the expression of pro-inflammatory cytokines that is still slightly sustained after withdrawal of the treatment. The sustained expression of cytokines can be attributed to the feedback regulation of MMPs to counter-regulate the inflammatory response and promote resolution . Alterat"}
{"text": "With many improvements on the culture protocols, current brain organoids could self-organize into a complicated three-dimensional organization that mimics most of the features of the real human brain at the molecular, cellular, and further physiological level. However, lacking positional information, an important characteristic conveyed by gradients of signaling molecules called morphogens, leads to the deficiency of spatiotemporally regulated cell arrangements and cell\u2013cell interactions in the brain organoid development. In this review, we will overview the role of morphogen both in the vertebrate neural development in vivo as well as the brain organoid culture in vitro Understanding human brain development and relevant neurological diseases have been one of the most important challenges in current biology. Considering human ethics, it is difficult to directly work on the live human brains. The brain specimens taken from the corpses cannot be sufficient to examine the dynamic development and function of the brain, therefore, animal models such as mice are widely used. However, there are a lot of nonnegligible differences between the brain of animal models and humans. For example, the surface of the mouse brain is smoother, while the neocortex is largely expanded and highly folded in humans due to the contribution of ventricular radial glial cells (vRGCs) and outer radial glial cells (oRGCs) , therefore, there are still some challengeable limitations for modeling complicated human structures such as the brain. For example, the concentration gradients of different growth factors and morphogens, which are important for the cell fate decision and regional specification in human brain development, are hard to completely recapitulate in the limited monolayer system. Besides, the cell\u2013cell interactions and cell migration during neurogenesis would be easily lost in such systems.In 1975, Martin and Evans have successfully formed an embryoid body using isolated single teratocarcinoma cells that can differentiate into almost all of the cell types in vitro, which can be regarded as the beginning of the in vitro culture system. Since then, the advance in pluripotent stem cell research including embryonic stem cell  developed by Sasai Lab  secrets several BMP antagonists including noggin  glycoproteins in canonical HH signaling. It plays key roles in the various important developmental process like the development of vertebrate limbs, brain, muscle, gastrointestinal tract as well as the heart , is expressed in the anterior border of the neural plate (ANB), which becomes the anterior end of the neural tube after neural tube closure, therefore antagonize the Wnt8B expressing in the presumptive midbrain and posterior forebrain and help form the global gradient of Wnt signaling along the A-P axis  expression in a dose-dependent manner (Rhinn et al. Although there are still many arguments on whether Wnt and FGF pattern A-P neural patterning through concentration gradient (Green et al. . For example, BMP signals transposed to the serum-free culture medium of ESCs could promote non-neural cell differentiation (Wiles and Johansson The success in organoid research was attributed to the early exploration of the morphogens as microenvironmental cues in many in vitro models, especially the ESCs and later the iPSCs. Early in 1981, Martin and his colleagues have already obtained the mouse ESCs from the inner cell mass of a blastocyst. The human ESCs were later successfully derived in 1998 (Thomson et al. brachyury in a dose-dependent manner (Kubo et al. . Therefore, different doses of Nodal/activin were then used to induce mesendoderm-derived structures such as heart, muscle, lung, intestine and so on in vitro (Kattman et al. Besides BMP, the addition of other morphogens such as Nodal/activin also helps direct cell differentiation from a pluripotent stem cell. An intractable problem for researching ESCs at the beginning is that it is hard to define primitive and definitive endoderm since their gene expression has a large overlapping. However, the addition of Nodal/activin, a vital factor in mesendoderm specification Schier , could bbrachyury induction (Watanabe et al. Wnts also play specific roles in cell fate specification. Adding Wnt1/Wnt3a to the ESC culture media could restrict neural differentiation of the ESC and enhance the The role of FGF in cell fate specification is more complicated as it comprises three main downstream signalings (Mossahebi-Mohammadi et al. Over the past two decades, multiple studies have improved the morphology of the aggregates and the organoids with different bioengineered strategies to achieve better reproducibility (Fedorchak et al. With sufficient comprehension of the role of different morphogens at different developmental stages both in vivo and in vitro. Many attempts using 3D culture systems together with different morphogen addition were done to recapitulate a more precise structure of the brain in vitro.3D neuroepithelial cyst model is a simple approach to uniformly generate neural plate progenitors that resemble dorsal neural tubes and responsive to different morphogens such as Shh (Meinhardt et al. SFEBq is another mature system applying self-organizing theory to generate complicated and well-organized 3D structures created by Yoshiki Sasai Lab (Eiraku et al. The sequential addition of specific morphogens together with improving 3D culture systems do help recapitulate several precise brain structures. However, these methods all directly supply the morphogen through the medium, the enriched morphogens and other intrinsic signals surrounding the organoids during the 3D culture may compromise the construction of the morphogen concentration gradient, therefore disrupt the positional information (Corr\u00f2 et al. First, the generation of assembloids, a co-culture system of different kinds of organoids (Andersen et al. Second, the 3D co-culture strategy could imitate the organizer to reproduce a more complete self-organization process Fig.\u00a0. This coThird, a powerful approach for creating complex biomolecular gradients is the use of the microfluidic system Fig.\u00a0C, which With such a short history of less than 10\u00a0years, brain organoid technology has brought us too much surprise to strengthen our understanding of human brain development and the relevant brain diseases. Many problems appear at the early stage of this technology such as lack of reproducibility, lack of cell-type specificity, heterogeneity and uncontrolled size have been largely improved in these years with the advance in engineering and stem cell biology. For example, the mixing of extracellular matrix and other additives with the biomaterial could produce a cultural environment that is more similar to the actual human brain and generate a high-reproducible brain organoid (Yin et al. As we discussed in this review, lacking accurate positional information is a nonnegligible problem in organoid research. In 2013, Sasai has already raised the idea that providing 3D self-organization cell cultures with positional information corresponding to morphogens presented during embryogenesis is the next generation of organogenesis Sasai , offerinHowever, there are still many obstacles that might not be solved only by providing spatial cues. For example, the absence of a vascular system restricts the growth and maturation of the organoid due to the limited oxygen and nutrients diffused from the culture medium, especially for the deep cells inside. Luckily, there are many successful attempts to establish vascular systems in brain organoids. Besides transplantation to the adult mouse brain to provide a vascularized physiological environment (Mansour et al. Also, such assembloid technology could be applied to supplement other missing non-neural cells in the human brain such as microglia and endothelial cells. Alternatively, a recent study reported that the organoid without SMAD inhibition at the early stage could contain several mesodermal progenitors that are able to differentiate into mature microglia (Ormel et al. Moreover, bioengineering research also promotes functional reproduction in the organoid. Early in this century, scientists have already found that geometry and patterning could improve the activity of cultured neuron networks (Nam et al. Overall, the brain organoid is a cutting-edge technology in the research of the human brain. Combining advanced research strategies and techniques, we could have an opportunity to better understand the human brain from broad perspectives not only limited to genetic, molecular and cellular level but also biomechanics. Establishing appropriate morphogen gradients have been suggested as a promising and effective approach to provide the positional information during human neural organoid culture, which largely improve the patterning and the maturation of the organoids. Although there are still many challenges, we strongly believe after replenishing those missing puzzles, this technology will bring us more surprise."}
{"text": "The TNF receptor-interacting protein kinases (RIPK)-1 and 3 are regulators of extrinsic cell death response pathways, where RIPK1 makes the cell survival or death decisions by associating with distinct complexes mediating survival signaling, caspase activation or RIPK3-dependent necroptotic cell death in a context-dependent manner. Using a mass spectrometry-based screen to find new components of the ripoptosome/necrosome, we discovered the protein-arginine methyltransferase (PRMT)-5 as a direct interaction partner of RIPK1. Interestingly, RIPK3 but not RIPK1 was then found to be a target of PRMT5-mediated symmetric arginine dimethylation. A conserved arginine residue in RIPK3  was identified as the evolutionarily conserved target for PRMT5-mediated symmetric dimethylation and the mutations R486A and R486K in human RIPK3 almost completely abrogated its methylation. Rescue experiments using these non-methylatable mutants of RIPK3 demonstrated PRMT5-mediated RIPK3 methylation to act as an efficient mechanism of RIPK3-mediated feedback control on RIPK1 activity and function. Therefore, this study reveals PRMT5-mediated RIPK3 methylation as a novel modulator of RIPK1-dependent signaling. TNF receptor-interacting protein kinases (RIPK)-1 and -3 are the master regulators of programmed cell death signaling. The concerted action of the RIP kinases downstream to the death receptors, interferon-alpha receptor (IFN\u03b1R) and Toll like receptor (TLR) regulate cell death/survival decisions during development and inflammation  catalyze transfer of one or two methyl groups to arginine residues, giving rise to monomethyl-arginine, asymmetric dimethyl-arginine (aDMA) or symmetric dimethylarginine (sDMA). The family of mammalian PRMTs consists of nine members sorted into three groups: Type I methyltransferases  generate aDMA by adding two methyl groups to the same terminal nitrogen of the arginine residue, Type II (PRMT5 and 9) mark each of the terminal nitrogen atoms of arginine with one methyl group, hence generating sDMA and the type III member PRMT7 catalyzes mono-methylation of arginine residues . Tight  in ref. . Interes in ref. . Other i in ref. . PRMT5 a in ref. , PKC\u03b9-metivation . Moreovetivation .Recent evidence indicate that the switch between pro-survival and pro-death functions of RIPK1 is regulated by a panel of modifications including phosphorylation and ubiquitination  and the Ripk1\u2212/\u2212 MEFs were rescued by the expression of doxycycline (dox)-inducible FLAG-tagged RIPK1 and single clonal cell lines were isolated and stably labeled by isotopes. Dox-induced expression of RIPK1 was detectable in both clones analyzed and RIPK1 was efficiently enriched by FLAG-tag-based immunoprecipitation. Immunoblots with anti-FLAG and anti-RIPK1 antibodies indicate that there is no detectable RIPK1 expression and enrichment in the non-induced cells  model system of induced expression of epitope-tagged RIPK1. To identify ripoptosome interactors by a non-biased screen, we applied SILAC-based MS analysis. After the enrichment of FLAG-RIPK1-associated proteins from differentially SILAC-labeled control and TNF\u2009+\u2009SM\u2009+\u2009zVAD Fig.  treated Since the RIPK1 interactors included the core methylosome components PRMT5 and WDR77, which induce symmetric dimethylation of arginine residues, we monitored arginine methylation of RIPK1 after co-expression of PRMT5 by using a symmetric di-methyl arginine motif (SdmArg) antibody. Despite clear association of RIPK1 and PRMT5 in the pulldown, there was no symmetric dimethylation detectable for GST-RIPK1 enriched using glutathione beads Fig. . We thenhttp://www.phosphosite.org) documents the existence of arginine methylation sites in both human and mouse RIPK3 outside the kinase domain  and methylation-deficient mutants (R486K or R486A) of RIPK3. After transduction and selection of cell lines for uniform transduction, the selected empty vector and RIPK3 expression lines showed similar expression levels of GFP expressed from the bidirectional promotor demonstrating uniform transduction and similar expression levels of WT and mutant RIPK3 expression [Ripk1\u2212/\u2212 MEFs, HEK293T cells, and PANC-1 cells were cultured in DMEM supplemented with 10% heat-inactivated fetal calf serum (FCS) and 1% penicillin/streptomycin. The cell lines were maintained at 37\u2009\u00b0C and with 5% CO2 in a humidified atmosphere.3T3-immortalized  Germany). Ripk1\u2212/MLKL (#14993), \u03b1SdmArg (#13222), RIP3 (#13526), Caspase-8 (#4927), pS166-RIPK1 (#65746), pS358-MLKL (#91689), pS345-MLKL (#37333), pS227-RIPK3 (#93654) phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (#4370) and pS473-Akt (#4060), pS536-NFkB p65 (#93H1), IkB\u03b1 (#9242) antibodies were from Cell Signaling Technology (CST). Further antibodies used were against GST , RIPK1 , GAPDH , EF2 , AKT1/2/3 , ERK2 , FLAG , PRMT5 Polyclonal antibody  and GFP . The secondary antibodies used were anti-rabbit IgG-HRP (Conformation Specific) , mouse TrueBlot\u00ae ULTRA , goat anti-mouse IgG (H\u2009+\u2009L)-HRP  and goat anti-rabbit IgG (H\u2009+\u2009L)-HRP .The following reagents at given concentrations were used for cell treatments: Doxycycline , recombinant human TNF\u03b1 , Birinapant/Smac Mimetics , pan-caspase inhibitor zVAD-fmk , PF3644022 , GSK591 , LLY-283 , Nec-1 , PP2 , NSA , GSK\u2019872 .Dox-inducible pSERS retroviral vector as described previously  was convHEK293T cells were transfected using polyethylenimine . Transfected cells were maintained in antibiotic-free DMEM media supplemented with 10% FCS for 12\u201316\u2009h followed by providing with complete DMEM media. Transfected cells were analyzed between 20 and 36\u2009h post-transfection. To monitor the effect of pharmacological inhibitors on methylation and interaction in transfected cells, cells were treated with inhibitors for the last 6\u2009h prior to cell lysis.Ripk1\u2212/\u2212 MEFs were stably rescued with Doxycycline inducible retroviral vectors expressing mouse RIPK1. For preparation of viral supernatants, 7.5 million Ecopack-HEK293T cells were seeded in 10\u2009cm plates and transfected overnight with 5\u2009\u00b5g each of pCL-Eco and pSERS11 based retroviral vectors using PEI, in antibiotic-free medium with 10% FCS. Medium was changed to fresh complete media supplemented with 1X non-essential amino acids. Virus-containing supernatants were harvested five times from transfected Ecopack-HEK293 cells (Clontech/Takara), over a period of three days post-transfection and filtered with 0.45\u2009\u00b5m filters. 1.2\u2009\u00d7\u2009105Ripk1\u2212/\u2212 MEF cells were seeded per well in a six well plate and were cultured for 4 days with viral supernatants in the presence of 8\u2009\u00b5g/ml polybrene. RIPK1 expression was monitored by intracellular staining and flow cytometry analysis using an Accuri-C6 cytometer (BD Biosciences).To generate a rescue model for RIPK3, PANC-1 cells (RIPK3-deficient) were transduced with lentiviral vectors expressing WT/mutant human RIPK3 or pLBID-MCS-GFP-P2A-Puro empty vector. ViraPower Lentiviral Expression System (Invitrogen) was used to package pLBID lentiviral vectors expressing FLAG-hRIPK3 or methylation site mutants or empty vector. Viral supernatants were collected 48\u2009h post-transfection and filtered through 0,45\u2009\u00b5m filters as described previously . PANC-1 7 cells/ml and were fixed with 3-volumes of 4% PFA. After 30\u2009min at room temperature, fixed cells were washed and permeabilized for 30\u2009min with ice-cold 90% methanol. After 2\u00d7 washes with PBS, cells were blocked with 4% BSA on ice for 30\u2009min. After 1\u2009h incubation at room temperature with anti-RIPK1 antibody  cells were incubated with 1:700 diluted secondary antibodies  for 30\u2009min. Samples were washed with PBS and analyzed with Flow cytometry using an Accuri-C6 cytometer (BD Biosciences).Cells were suspended in PBS at a concentration of 10Ripk1\u2212/\u2212 MEFs. These clones were metabolically labeled with light  and medium  non-radioactive isotope amino acids. SILAC Protein Quantitation Kit (Trypsin), DMEM  was used for generating light labeled cell lines and for generation of medium labeled cell lines, L-Lysine-2HCL,4,4,5,5-D4 (ThermoFisher Scientific) and 13C-labeled L-Arginine HCl  were individually purchased. Cells were cultured in respective medium supplemented with 200\u2009\u00b5g/ml of L-Proline for at least 10 passages for achieving incorporation of each respective labels. Cells were seeded at a density of 3\u2009\u00d7\u2009106 cells in 10\u2009cm plates and were treated the next day with doxycycline (1\u2009\u00b5g/ml) for 4\u2009h, followed by treatment of light-labeled cells with only DMSO control and of medium-labeled cells with TNF\u2009+\u2009SM\u2009+\u2009zVAD for 2\u2009h. FLAG-RIPK1 bound complexes were enriched from 1.5\u2009mg of protein lysate per sample. Pre-cleared lysates were incubated with 40\u2009\u00b5l of 50% ANTI-FLAG\u00ae M2 affinity gel  on a rotor for 3\u2009h at 4\u2009\u00b0C. After immunoprecipitation, Anti-FLAG beads were pooled from the two differentially treated light and medium labeled samples for each clonal cell line. Proteins were eluted from pooled beads with 0.5\u2009mg/ml FLAG peptide  by shaking at 1000\u2009rpm for 1\u2009h at 4\u2009\u00b0C. Samples were separated on a 10% SDS-PAGE gel and in-gel digested overnight with Trypsin/Lys-C protease mix and resulting peptides were desalted using C18-stage tip. The purified peptides from each sample were analyzed by mass spectrometry in technical duplicates. Samples were analyzed on the Evosep One system using an in-house packed 15\u2009cm, 150\u2009\u03bcm i.d. capillary column with 1.9\u2009\u03bcm Reprosil-Pur C18 beads  using the pre-programmed gradients for 60 samples per day (SPD). The column temperature was maintained at 60\u2009\u00b0C using an integrated column oven  and interfaced online with the Orbitrap Exploris 480 MS. Spray voltage was set to 2.0\u2009kV, funnel RF level at 40, and heated capillary temperature at 275\u2009\u00b0C. Full MS resolutions were set to 60,000 at m/z 200 and full MS AGC target was 300 with an IT of 22\u2009ms. Mass range was set to 350\u22121400. Full MS scan was followed by top 10 DDA scans, using 1.3\u2009m/z isolation window, 45,000 resolution, 86\u2009ms injection time, AGC target of 200 and normalized collision energy was set at 30%. All data were acquired in profile mode using positive polarity and peptide match was set to off, and isotope exclusion was on. The intensity of each peptide was normalized with intensity of RIPK1 in respective light and medium-labeled samples. SILAC ratios were then calculated by comparing the intensities of medium-labeled peptides to intensities of light-labeled peptides  as per manufacturer protocol. Transfected cells were cultured for 48\u2009h. Cells were then re-transfected overnight with mRIPK3 and hRIPK3 expression vectors. The next day, fresh media was provided to the transfected cells and plates were washed and frozen 24\u2009h post-transfection.Two siRNAs targeting human PRMT5  were used for knockdown experiments in HEK293T cells. The siRNA sequences are provided in Supplementary Table Cells were lysed directly in cell culture plates with 2\u00d7 SDS sample buffer containing 10% SDS, 1.5\u2009M TRIS pH 8.8, 5% Glycerol, 2.5% 2-Mercaptoethanol, and Bromophenol Blue. The samples were then boiled for 5\u2009min at 95\u2009\u00b0C. Denatured protein lysates were run on SDS-PAGE (7.5\u201316% gradient) gels and immunoblotted to Nitrocellulose blotting membrane . Western blots were blocked with 5% powdered skim milk in PBS with 0.1% Tween 20 for 1\u2009h at room temperature. After three washes with PBS containing 0.1% Tween 20, membranes were incubated overnight with the primary antibody at 4\u2009\u00b0C followed by 1\u2009h incubation with horseradish peroxidase-conjugated secondary antibodies at room temperature. Blots were developed with an ECL detection kit, WESTAR NOVA 2.0 , and the digital chemiluminescence images were taken by a Luminescent Image Analyser LAS-3000 (Fujifilm).3VO4, 10\u2009mM b-glycerophosphate, 50\u2009mM Sodium Fluoride, 5\u2009mM Na-pyrophosphate, 1% Triton X-100, 1\u2009mM benzamidine, 2\u2009\u00b5g/ml leupeptin, 0.1% 2-Mercaptoethanol, 0.27\u2009M Sucrose, 0.2\u2009mM PMSF, 1\u2009\u00b5g/ml Pepstatin A, 1X Protease Inhibitor Cocktail , Phosphatase Inhibitor Cocktail . Lysates were then cleared by centrifugation and the beads were blocked with 1% BSA to avoid non-specific binding of PRMT5 to Glutathione beads. For the enrichment of the fusion proteins, pre-cleared lysates were incubated with Monoclonal ANTI-FLAG\u00ae M2 affinity gel  or Protino Glutathione Agarose 4B  for 16\u2009h at 4\u2009\u00b0C. The beads were then washed 4\u00d7 with immunoprecipitation wash buffer containing 1X TBS, 50\u2009mM Sodium fluoride, 1% Triton X-100, 1\u2009mM Na3VO4. The beads were boiled in 2\u00d7 SDS sample buffer for 5\u2009minutes at 95\u2009\u00b0C and the eluted protein complexes were analyzed by Western blotting.GST-pulldowns (GST-PD) and FLAG-IPs were performed as described previously , 58. Celt-tests were used to calculate the statistical significance of the viability assays. This data is presented in Supplementary Table All Immunoblot results presented in the figures are representative results from at least three independent experiments. The calculations and statistical analyses were performed and graphs were plotted using Microsoft Excel. Two-tailed unpaired Supplementary Information LegendSupplementary Figures S1-S8Supplementary Table S1Supplementary Table S2Supplementary Table S3Supplementary Information_Original Immunoblot data"}
{"text": "Most of the high-grade serous ovarian cancers (HGSOC) are accompanied by P53 mutations, which are related to the nucleotide excision repair (NER) pathway. This study aims to construct a risk signature based on NER-related genes that could effectively predict the prognosis for advanced patients with HGSOC. In our study, we found that two clusters of HGSOC with significantly different overall survival (OS) were identified by consensus clustering and principal component analysis (PCA). Then, a 7-gene risk signature  for OS prediction was developed subsequently based on TCGA cohort, and the risk score-based signature was identified as an independent prognostic indicator for HGSOC. According to the risk score, HGSOC patients were divided into high-risk group and low-risk group, in which the distinct OS and the predictive power were also successfully verified in the GEO validation sets. Then we constructed a nomogram, including the risk signature and clinical-related risk factors (age and treatment response) that predicted an individual\u2019s risk of OS, which can be validated by assessing calibration curves. Furthermore, GSEA showed that the genes in the high-risk group were significantly enriched in cancer-related pathways, such as \u201cMAPK signaling pathway\u201d, \u201cmTOR signaling pathway\u201d, \u201cVEGF signaling pathway\u201d and so on. In conclusion, our study has developed a robust NER-related genes-based molecular signature for prognosis prediction, and the nomogram could be used as a convenient tool for OS evaluation and guidance of therapeutic strategies in advanced patients with HGSOC. High-grade serous ovarian cancer (HGSOC) is of great concern to the researchers among all ovarian cancers, as it accounts for 70%\u201380% of deaths from ovarian cancer. The modes of carcinogenesis, molecular-genetic characteristics, and the origin are distinctive from low-grade serous ovarian cancer . Due to In recent years, genome-wide expression profiling detection can effectively provide detailed information for the prognosis assessment of cancer patients . In breaDNA damage response and repair pathways play an essential regulatory role in the occurrence and development of ovarian cancer . DNA repIn the present study, we comprehensively explored the roles of 31 NER-related genes in HGSOC based on multiple transcriptome datasets, such as The Cancer Genome Atlas (TCGA), the Genotype-Tissue Expression (GTEx) Project, and the Gene Expression Omnibus (GEO) database. We evaluated the interaction and correlation among the 31 NER-related genes and employed the consensus cluster analysis to identify two HGSOC clusters with different clinical outcomes based on their expression patterns of these genes. Then we conducted the least absolute shrinkage and selection operator (LASSO) Cox regression to obtain a 7-gene signature on TCGA HGSOC cohort. This robust risk signature was successfully confirmed in two GEO validation sets and showed an excellent predictive effect on prognosis. Moreover, the risk signature and clinical characteristics were used to construct a nomogram to predict the prognosis of advanced patients with HGSOC. Finally, we also used the gene set enrichment analysis (GSEA) to explore the differences in the signaling pathways between subgroups classified by risk signature. Our results indicated that the risk signature derived from seven NER-related genes could serve as novel prognostic biomarkers for advanced patients with HGSOC.https://xenabrowser.net/datapages) (http://www.genenames.org)  (The study design flowchart is presented in tapages) . Accordimes.org) , and theect.org) .https://www.ncbi.nlm.nih.gov/geo). Gene expression in GSE13876 was performed using Operon human v3 \u223c35\u00a0K 70-mer two-color oligonucleotide microarrays ; Gene expression in GSE49997 was performed using ABI Human Genome Survey Microarray Version 2 ; Gene expression in GSE17260 was performed using Agilent-014850 Whole Human Genome Microarray 4 \u00d7 44K G4112F (Probe Name version) ; Gene expression in GSE63885 was performed using Affymetrix Human Genome U133 Plus 2.0 Array . Then, we integrated 346 standards-compliant samples from three datasets  as a combined validation set based on the exclusive criteria to improve the sample size, and we executed batch normalization between these three platforms using the \u201csav\u201d and \u201climma\u201d packages in R to avoid generating unreliable results  were downloaded from Gene Expression Omnibus (GEO) database  for gene screening. A total of 8,466 common genes were selected. According to previous studies , 31 sharp < 0.05. The mRNA expression profiles of 31 NER-related genes were obtained. The heatmap and violin plots were presented by \u201cpheatmap\u201d and \u201cggplot2\u201d packages in R.We first analyzed the mRNA expression levels between HGSOC tissues and normal tissues by using the \u201climma\u201d package with cut-off criteria of via the Search Tool for the Retrieval of Interacting Genes (STRING) (https://string-db.org/) (All 31 NER-related genes were used for the protein-protein interaction (PPI) analysis with a combined confidence score\u2009 \u2265\u20090.9 db.org/) . PearsonConsensusClusterPlus\u201d package in R  was applied to explore the clinical implications of the 31 NER-related genes in the TCGA HGSOC cohort. The number of clusters and their stability were determined by the consensus clustering algorithm  were determined by the univariate Cox regression analysis of 31 NER-related genes; the hazard ratios (HRs) of genes <1 or >1 were regarded as protective or risk genes, respectively. To prevent over-fitting in our analysis, the least absolute shrinkage and selection operator (LASSO) regression analysis was used to identify the optimal prognostic model out of the selected seven candidate genes  database.Similarly, the risk score of each advanced patient with HGSOC from the GSE13876 and the merged GEO datasets was calculated based on the formula above. Taking the median risk score in the TCGA cohort as the cut-off value, HGSOC patients in both validation sets were divided into high- or low- groups. The K-M method and log-rank test were employed to calculate OS with an overall significance level of p-value < 0.05, and false discovery rate (FDR) q-value < 0.25 were significantly enriched.Gene set enrichment analysis (GSEA) was used in the TCGA cohort to investigate the potential biological pathways underlying the different risk groups defined by the 7-gene expression signature. Kyoto Encyclopedia of Genes and Genomes (KEGG) gene sets (v7.1) and phenotype label (high risk vs. low risk) files were generated and loaded into the GSEA software . The permutation test run 1,000 times. The pathways with normalized enrichment score (NSE) absolute value >1, normalized limma\u201d, \u201csva\u201d, \u201cConsensusClusterPlus\u201d, \u201cpheatmap\u201d, \u201cggplot2\u201d, \u201ccorrplot\u201d, \u201cpROC\u201d, \u201crms\u201d, \u201csurvival\u201d packages were used for analysis or visualization in R. All statistical tests were two-sided and p < 0.05 was considered statistically significant.Unless otherwise specified, all statistics analyses were performed with R software. The differences between groups for the continuous and categorical variables were respectively assessed by student\u02bcs t-test or one-way ANOVA and the Chi-square test. The \u201cTo better understand the importance of the NER-related genes in tumor initiation and progression, we firstly investigated expression levels of NER-related genes in different tissue samples of the merged TCGA-GTEx dataset. The TCGA-GTEx cohort comprised 326 advanced patients with HGSOC and 88 ovaries of healthy donors. The clinicopathological characteristics of the TCGA HGSOC cohort were listed in The interaction relationships among the 31 NER-related genes were shown by the PPI network, and the number of interactions for each gene was counted in p = 0.021), which suggested that the 31 NER-related genes could classify the advanced patients with HGSOC at the prognostic level (p > 0.05).Next, TCGA HGSOC samples were selected for the subsequent consensus clustering analysis. According to the expression similarity of the 31 NER-related genes, k = 2 could be the optimal choice when clustering stability datasets increased from k = 2\u20139 . We notiic level . We thenp < 0.1). Among these seven genes, only DDB2 and POLR2D were considered as protective genes with HR <1, while RPA2, CCNH, XPC, ERCC2, and ERCC4 were considered as risky genes with HR >1  (p = 0.049), there were no significant differences between the high- and low-risk groups in the age, grade, stage, and residual tumor .According to our previous results, the collinearity between these genes may affect the accuracy of traditional Cox regression analysis . Therefo707e-05) . The 5-y707e-05) . Next, t707e-05) . The resMoreover, the Human Protein Atlas (HPA) database was used to validate the cellular sub-localization and expression patterns of the seven selected genes in serous ovarian cancer tissues and normal ovarian tissues at the protein levels . HPA anan = 415) and the merged GEO dataset (n = 346), respectively. According to the median risk score as the cut-off value in the TCGA HGSOC cohort, 192 (46.3%) patients were classified as low-risk, and 223 (53.7%) as high-risk in GSE13876; 255 (73.7%) patients were classified as low-risk, and 91 (26.3%) as high-risk in the merged GEO datasets. The corresponding 5-year OS was 24.1% for the high-risk group and 35.0% for the low-risk group in GSE13876 , or patients with CR/PR (p = 1.214e-03), or patients with optimal cytoreductive surgery (p = 2.263e-03), or those with non-optimal cytoreductive surgery (p = 0.025). However, no significant difference was observed for OS between high- and low-risk groups for patients with FIGO stage IV (p = 0.116), or patients with SD/PD (p = 0.245) due to sample size limitation.To confirm that the NER-related genes based on classifier had similar prognostic value in different cohorts, we assessed the samples in GSE13876 (p = 0.077), a nomogram that combined the age, treatment response, and risk signature was developed to predict 3- or 5-year survival of advanced patients with HGSOC , inositol phosphate metabolism , phosphatidylinositol signaling system , MAPK signaling pathway , and VEGF signaling pathway . In contrast, two downregulated biological processes/signaling pathways were observed in the high-risk group: DNA replication  and spliceosome   . These rSerous ovarian cancer was divided into low-grade serous ovarian cancer and HGSOC, and they had significantly different features in genomics, clinical manifestations, origin, and prognosis . The preNER is a complex biochemical process that requires multiple proteins assemble in an ordered at base damaged sites and then function as a multi-protein complex . In our We also identified a risk signature of seven genes consisting of ERCC2, ERCC4, POLR2D, DDB2, XPC, CCNH, and RPA2 that predicts OS in the TCGA and GEO datasets. ERCC2 single nucleotide polymorphisms (SNPs) were found to be associated with an increased risk of ovarian cancer . The samThe mechanisms were further investigated to reveal the causes of the different prognosis of the two HGSOC risk subgroups stratified by the 7-gene signature. GSEA demonstrated that some pivotal signaling pathways and biological processes were significantly enriched in the high-risk group with poor survival, including inositol phosphate metabolism, MAPK signaling pathway, mTOR signaling pathway, phosphatidylinositol signaling system, and VEGF signaling pathway. It was reported that inositol phosphate recycling regulated glycolytic and lipid metabolism that drove cancer aggressiveness . It was Despite encouraging findings in the present study, several limitations still exist. First of all, our results are mainly based on bioinformatics analysis. Although there are multiple datasets for mutual verification, experimental and clinical data will be needed to verify our results in the future. Secondly, although the risk signature and nomogram showed good prediction accuracy in the internal verification, their performance is still warranted validation in different HGSOC populations. Finally, our study did not contain clinicopathological information such as the scope of surgical resection and specific chemotherapy drugs, since TCGA did not cover such information, and the treatment standard for advanced patients with HGSOC has been controversial.Taken together, we profiled the sharply altered NER-related genes between HGSOC and normal samples, which may play a vital role in the progression of HGSOC. More importantly, a robust risk signature that was significantly associated with the clinical outcome of HGSOC was constructed and validated in two different GEO validation sets. In addition, we also developed a 7-gene nomogram containing the risk signature and clinical-related risk factors, which may aid the individualized prediction of the prognosis of advanced patients with HGSOC. Finally, further research on these genes may provide new insights into the potential relationship between the NER repair pathway and HGSOC prognosis."}
{"text": "TM cell analyzer revealed cell cycle arrest at G2/M phase and apoptosis induction. Inhibition of Bcl-2 and activation of Bax, leading to induction of the downstream caspase-dependent death pathway were confirmed by Western blot analysis. Co-culture with activated macrophages, kaffir lime extract and its constituents enhanced the development of pro-inflammatory (M1) macrophages and boosted TNF-\u03b1 production, resulting in SCC15 apoptosis. Findings revealed novel potential activities of kaffir lime leaf extracts and their constituents in inducing M1 polarization against SCC15, as well as direct anti-proliferative activity.Head and neck squamous cell carcinoma (HNSCC) is the seventh most common cancer worldwide. Late-stage patients have a significant chance of local recurrence and distant metastasis, as well as poor prognosis. Therapeutic goals for patients must be improved and personalized to reduce adverse effects. This study explored the anti-proliferative activity and immunomodulation potential of the constituents of crude kaffir lime leaf extract  under co-culture. Results showed high cytotoxicity to human SCC15 cell line but not to human monocyte-derived macrophages. Treatment with crude extract and the contained compounds also suppressed cell migration and colony formation of SCC15 compared to the untreated control group, while high levels of intracellular ROS production were detected in the treatment group of SCC15. The Muse Head and neck squamous cell carcinoma (HNSCC) was the seventh most common cancer worldwide in 2018 with 890,000 new cases and 450,000 deaths .Cancer is a complicated disease involving tumor microenvironment (TME) that defines the nature of cancer, not by the genetics of the tumor cells alone but by the surrounding environment that the tumor cells need for survival, growth, proliferation, invasion, and metastasis. The production of numerous intercellular mediators such as cytokines, chemokines and vesicles attract non-transformed cells in the surrounding area. The consequences are TME formation and close interaction with cancer cells to support the development of cancer hallmarks \u20136. The TMacrophages play an important role in the innate immune system by maintaining immune homeostasis. They are involved in several processes of initiating and regulating the immune responses to foreign antigens . Two majPouteria campechiana leaves stimulated the proliferation of murine macrophages, phagocytic activity, nitric oxide (NO), hydrogen peroxide (H2O2) and cytokines (interleukin (IL)-6 and tumor necrosis factor (TNF)-\u03b1) production [Curcuma xanthorrhiza Roxb. significantly increased phagocytosis and release of NO, H2O2, TNF-\u03b1 and PGE2 in a dose-dependent manner in macrophages by specific activation of nuclear factor-\u03baB (Nf-\u03baB) [et al. (2002) revealed that polysaccharides from safflower petals (Carthamus tinctorius L.) activated macrophages by recognizing and binding to the specific Toll-like receptor 4 on their surfaces [et al. investigated the immunomodulatory effects of Clinacanthus nutans extracts on THP-1 macrophages in co-culture with triple-negative breast cancer cells (MDA-MB-231). They concluded that this plant limited the pro-inflammatory condition in TME and showed potential anti-cancer properties on highly metastatic breast cancer condition [Macrophages are involved in tumor development and suppression. Immunostimulation of macrophages contributes to tumor regulation as a promising therapeutic target. Numerous studies have revealed that many plants or natural compounds have an immunomodulatory effect on macrophages. Methanolic extract from oduction . Crude p (Nf-\u03baB) . In Japasurfaces . Moreoveondition .Citrus hystrix DC., is commonly called makrut lime or kaffir lime. This plant belongs to the subfamily Aurantioideae, order Sapindales, family Rutaceae [Staphylococcus aureus, Streptococcus pneumoniae and Haemophilus influenzae [Rutaceae . Kaffir Rutaceae . KL contRutaceae . VariousRutaceae . The leaRutaceae . KL exhifluenzae ,24. In afluenzae  and showfluenzae ,27. Our fluenzae .However, the anti-proliferative potential on head and neck cancer and the immunomodulatory effect of KL on macrophages remain unknown. Here, the anti-proliferative properties of KL and its active compounds on squamous cell carcinoma 15 cell line (SCC15) and the immunomodulatory effect on THP-1 derived macrophages against SCC15 were investigated.Powdered kaffir lime leaves Lot. No. 250818 were obtained from Khaolaor Laboratories Co., Ltd., Samut Prakan, Thailand. The method for KL extraction was described in our previous study . The powTM . Cells were incubated at 37\u00b0C with 5% CO2 for 7 days until fully differentiate to macrophages, with media replacement every 3 days.Human monocyte-derived macrophages (MDM) were used as the primary normal cell control. Buffy coat was obtained from the Blood Bank, Naresuan University Hospital, Phitsanulok, Thailand. Ethics approval was obtained from the Human Ethics Committee of Naresuan University (IRB no. P1-0127/2565). Buffy coat was diluted with Hank\u2019s balanced salt solution (HBSS) and then overlaid on 5 ml Lymphoprep  and centrifuged at 2000 rpm for 30 minutes. The mononuclear cell layer was collected and washed twice with HBSS buffer and the peripheral blood mononuclear cells (PBMC) were suspended in 5 ml of RPMI medium. Then, monocytes were separated by size sedimentation centrifugation using Percoll  and the PBMC suspension was carefully overlaid on 10 ml of Percoll solution and centrifuged for 15 minutes at 2100 rpm. Monocytes between Percoll were collected and washed with HBSS, followed by centrifugation for 10 minutes at 1300 rpm. Isolated monocytes were cultured in RPMI 1640 and supplemented with 10% fetal bovine serum and 1% Antibiotic-Antimycotic purchased from Gibco2, with medium renewal every 2\u20133 days. The control conditions used untreated cells and Cisplatin  as an anti-cancer positive condition.Squamous cell carcinoma (SCC) 15 (ATCC\u00ae CRL-1623\u2122) was purchased from American Type Culture Collection (ATCC). Cells were cultured in Dulbecco\u2019s modified Eagle\u2019s medium and Ham\u2019s F12 medium  containing 10% fetal bovine serum. Cells were incubated at 37\u00b0C with 5% CO2 for a further 2 days. THP-1-derived macrophages were cultivated with 20 \u03bcg/ml of lupeol, citronellal and citronellol and 100 \u03bcg/ml of crude hexane, and crude ethanol before being incubated for 24 hours. The phenotype of THP-1- derived macrophages was investigated by flow cytometry.THP-1 is a monocytic human leukemia cell line from the ATCC that can be differentiated into macrophages. This makes it possible to investigate, in co-cultures without direct cell contact interactions, how KL extracts and their constituents affect macrophage defense against cancer cells. THP-1 cells were maintained in RPMI 1640 Complete Medium supplemented with 10% FBS and 1% Antibiotic-Antimycotic . Differentiation of the THP-1 cell line was induced by stimulation with 10 ng/ml of phorbol-12-myristate-13-acetate (PMA)  containing RPMI for 3 days, and the cells were incubated in fresh complete RPMI 1640 at 37\u00b0C with 5% CO4 cells/50 \u03bcl/well. Cells were treated with various concentrations of compounds, lupeol, citronellol and citronellal . Moreover, cells were treated with serial dilutions of two crude extracts, KL hexane and KL ET at 4.88, 9.77, 19.53, 39.06, 78.13, 156.25, 312.5, 625, 1250, 2500, 5000, and 10,000 \u03bcg/ml. Cells were then incubated at 37\u00b0C for 24 hours. Fifty microliters of MTT (0.5 mg/ml)  in medium free serum were added and cells were incubated at 37\u00b0C for 3 hours. MTT reagent was removed, and formazan crystals were dissolved in 100 \u03bcl of DMSO. Absorbance of the formazan solution was measured at 590 nm by a microplate reader . This method followed the previous protocol [MTT assay was used to determine the growth inhibitory role of crude extract and active compounds. MDM, THP-1-derived macrophage, and SCC15 were seeded in 96-well plates at a density of 1x10protocol . The hal4 cells/well and incubated for 24 hours. The cells were treated with extracts and compounds for 24 hours. The SCC15 cell line from each experimental condition was harvested using trypsin/EDTA solution  and incubated at 37\u00b0C for 5 minutes. Then 200 \u03bcl of completed DMEM HamF12 was added to stop the reaction of trypsin. Cells were aspirated and centrifuged at 1500 rpm for 5 minutes and then fixed with 70% ethanol and incubated for at least 3 hours at -20\u00b0C. Cells were then washed twice with cold PBS and resuspended in 200 \u03bcl of Muse\u2122 Cell cycle reagent before mixing gently and incubating for 30 minutes at room temperature in the dark. Cell cycle stage was then analyzed by a Muse\u2122 Cell Analyzer.To confirm the growth inhibitory role of KL H, KL ET, lupeol, citronellol and citronellal, the cell cycle was analyzed using Muse\u2122 Cell Cycle Kit  following the manufacturer\u2019s protocol. SCC15 cells were seeded in 24-well plates at a density of 1x10Muse\u2122 Annexin V & Dead Cell Kit  was used for apoptosis study. SCC15 cells from each experimental condition were harvested by trypsin/EDTA solution as described in cell cycle assay. Cells were washed in PBS and resuspended in the medium with 1% FBS. Then 100 \u03bcl of Muse\u2122 Annexin V & Dead Cell Reagent was added, mixed gently and incubated for 20 minutes at room temperature in the dark. Cell apoptosis was measured using a Muse\u2122 Cell Analyzer following the manufacturer\u2019s protocol.Colony formation assay was used to study the potentiality of single cells to form colonies. This assay followed the previous description . The SCC6 cells/ml and incubated at 37\u00b0C until reaching 80% confluence as a monolayer. The cell monolayer was scraped in a straight line with a SPL scar scratcher . Detached cells were removed and washed twice with 1 ml of medium. Cells were treated as described in the colony formation assay and incubated for 36 hours. A snapshot of cells from each condition was taken at time points of 6, 12, 24 and 36 hours using an inverted microscope . Distance of the wound area was analyzed by the ImageJ system.Cell migration of the SCC15 cell line was evaluated by wound closure assay modified from a previous method . The SCC2DCFDA  was used for detection of reactive oxygen species (ROS) production. Cells were seeded into dark clear bottom 96-well plates at 2.5 x 103 cells/well and incubated for 24 hours in standard culture conditions at 37\u00b0C. The medium was removed, and the cells were incubated with diluted H2DCFDA solution (20 \u03bcM) for 45 minutes at 37\u00b0C in the dark. Next, cells were washed with PBS and treated with cisplatin, KL H, KL ET, lupeol, citronellol and citronellal for 3 hours. The plate was measured immediately on a fluorescence plate reader at Ex/Em = 485/535 nm in end point mode.HSCC15 were cultured with 12.5 \u03bcg/ml of cisplatin as a positive control. Cells were treated with each compound , crude hexane and crude ethanol at 100 \u03bcg/ml. Total proteins of the SCC15 cell line from each condition were extracted by ice-cold RIPA lysis buffer  in the presence of Halt Protease/Phosphatase Inhibitor Cocktails , and centrifuged at 12,000 rpm for 15 minutes at 4\u00b0C. Quantification of total protein concentration was performed by the Bradford Coomassie-binding colorimetric method. The protein extract was mixed with an equal volume of 4X Leammli loading buffer and heated to denature at 95\u00b0C for 5 minutes. Samples were loaded into wells of 12% SDS-polyacrylamide gel electrophoresis (PAGE), and proteins were separated according to molecular weight and transferred to a polyvinylidene fluoride membrane . For Western blot analysis, the membrane was blocked overnight at 4\u00b0C with blocking buffer containing 5% bovine serum albumin  in Tris-buffered saline with Tween 20 (TBST) buffer. The membrane was blotted using primary antibodies specific to cleaved-caspase 3  , \u03b2-actin, pro-caspase 3, Bax and Bcl-2  for one hour at room temperature on a rotator. The membrane was then washed with TBST and incubated with horseradish peroxidase-conjugated goat anti-mouse IgG (H+L) secondary antibody  for one hour at room temperature. The membrane was observed by soaking in chemiluminescence substrate for 5 minutes and placed in a ChemiDoc XRS+ Imaging System . The chemiluminescence signal of the blotted membrane was detected by Image Studio Lite software .Cell surface markers were analyzed by immunostaining with PE-conjugated anti-human CD80 and FITC-conjugated anti-human CD163 . Cells were suspended with FACS buffer solution and directly stained with fluorescence-conjugated antibody. The reaction was incubated at 4\u00b0C for 1 hour in the dark and the cells were then washed twice with PBS. The cell pellet was resuspended with staining buffer and analyzed by an FC 500 Flow Cytometer . FITC-conjugated mouse IgG1,\u03ba isotype control and PE-conjugated mouse IgG1,\u03ba isotype control  were used as the negative control.4 cells/well) were seeded into the upper chamber of the transwell apparatus. THP-1 monocytes were differentiated into macrophages by 3 days of incubation with 10 ng/ml of phorbol 12-myristate 13-acetate . Cells were then washed, and the fresh complete RPMI was replaced for a further 2 days. THP-1-derived macrophages were cultivated with 20 \u03bcg/ml of lupeol, citronellal and citronellol and 100 \u03bcg/ml of crude hexane, and crude ethanol. SCC15 were seeded in the lower well at 5 \u00d7 104 cells/well for 24 hours to allow their adherence to the walls. The chambers with the THP-1-derived macrophages were washed and then placed directly on top of the well plates containing the SCC15 cells, and the resulting co-culture systems were incubated for 24 hours. SCC15 was collected for cell apoptosis analysis using Muse\u2122 Cell Analyzer.In the co-culture experiments, THP-1 monocytes were differentiated in 24-transwell inserts . The THP-1 monocytes . A 96-well plate was coated with capture antibody specific to TNF-\u03b1 at 4\u00b0C for one night. The plate was washed four times with a wash buffer between each step. The plate was then blocked with blocking solution for 1 hour with shaking. Supernatant from the cell culture of each condition and the standard were placed into the reaction and shaken for 2 hours at room temperature. The plate was washed, followed by binding of 100 \u03bcL of detection antibody, and incubated for 1 hour before washing. Avidin horseradish peroxidase-conjugated secondary antibody was then added, and the plate was shaken for 30 minutes. The reaction was completed by adding 100 \u03bcL of freshly mixed solution of 3,3\u2019,5,5\u2019-tetramethylbenzidine (TMB). After incubating for 15 minutes in the dark, the stop solution was added. The absorbance of the reaction was measured at 450 nm using an EnSpire\u00ae Multimode microplate reader . The production of cytokines in each condition was calculated from standard curves using known concentrations of recombinant cytokines.p = 0.05) was used in all statistical analyses.All experimental conditions were triplicated to provide accurate results. One-way ANOVA and the Bonferroni multiple comparisons test were used for data analysis by GraphPad Prism software. A confidence interval of 95%  and active compounds . Human monocyte-derived macrophages (MDM), SCC15 and THP-1 were treated with different concentrations of extracts and compounds for 24 hours. IC5 values of lupeol, citronellal and citronellol on human MDM were 112 \u03bcg/ml, 171.5 \u03bcg/ml and 98.5 \u03bcg/ml, respectively  and highCell cycle assay was assessed by a Muse\u2122 Cell Cycle Kit and nuclear DNA of the cell line was intercalated with propidium iodide (PI). Cells were discriminated at different phases of the cell cycle based on differential DNA content including G0/G1, S and G2/M phase. To investigate the effect of the extracts, lupeol, citronellal and citronellol on cell cycle progression, untreated and treated SCC15 were investigated by a Muse Cell Analyzer. DNA content index histograms of the control and treatment groups with crude extract and cisplatin in each cell cycle phase  are shown in After treatment with lupeol, citronellal and citronellal, G2/M enrichment significantly increased in SCC15 compared to the untreated control . This reTM Cell Analyzer following the Muse\u2122 Annexin V & Dead Cell Kit procedure for the SCC15 cell line stained with annexin V and 7-AAD (7-amino-actinomycin D). The first and second quadrants represented dead cells and late apoptotic cells, respectively, while the third and fourth quadrants represented live cells and early apoptotic cells, respectively , while wound areas of treated cells with drugs (67.42\u00b15.09%) and all extracts and compounds were widely open, with percentage range 46.45\u00b15.64 to 63.01\u00b12.42% (The wound closure assay is a method of 01\u00b12.42% .2O2 (100 \u03bcM) was used as the positive control. Results showed that KL H, lupeol, citronellal and citronellol strongly induced ROS production in the SCC15 cell line. Interestingly, lupeol and citronellal stimulated high levels of ROS compared to the positive control (H2O2) in a dose-dependent manner. However, a low level of ROS was observed in the KL ET treatment. This finding indicated that high intracellular ROS generation was stimulated by crude extracts and their bioactive compounds  and active compounds  significantly increased the levels of pro-apoptotic, Bax and cleaved-caspase 3. Treatment of SCC15 with KL extracts and their compounds resulted in suppression of Bcl\u20112 expression and decreased pro-caspase 3, showing similar results to the positive drug control, cisplatin . These fM1 macrophages express nitric oxide synthase (iNOS), TNF-\u03b1, IL-6, CD80 and CD86 costimulatory molecules. By contrast, M2 macrophages were defined based on the co-expression of CD163 (scavenger receptor) and CD206 (mannose receptor) as anti-inflammatory markers and arginase-1 (ARG-1) ,34. We nTM Cell Analyzer. Activated macrophages significantly induced cell apoptosis of SCC15 in the co-culture condition  polarized THP-1-derived macrophages toward M1. Next, we investigated the effect of crude extracts and compound-activated macrophages involved in anti-cancer activity. In this experiment, THP-1 cells were placed in the upper chamber and stimulated with PMA, followed by resting in fresh complete RPMI for 2 days. THP-1-derived macrophages were cultured with 20 \u03bcg/ml of lupeol, citronellal and citronellol and 100 \u03bcg/ml of crude hexane, and crude ethanol before being incubated for 24 hours and co-cultured with SCC15 at day 6, as shown in ondition . The relondition . CollectDioscorea nipponica (dioscin) in SCC15 [Rheum undulatum L. in HN22 and SCC15 [Head and neck squamous cell carcinoma (HNSCC) is the seventh most common cancer worldwide. The incidence of HNSCC continues to rise and is anticipated to increase by 30% by 2030 . Moreovein SCC15 , Rheum und SCC15  and cannnd SCC15 . In thisMoringa oleifera Lam., extract and compound 3-HBI inhibited cell proliferation and induced apoptosis in SCC15 cell line through the activation of cleaved caspase-3 and Bax as well as suppressing anti-apoptotic factor, Bcl-2 [et al. suggested that the cell cycle of K562 (chronic myelocytic leukemia) was significantly arrested at the G2/M phase after treatment with a subfraction of kaffir lime leaves for 24 hours [Our previous study explored r, Bcl-2 . Crude e24 hours . In this24 hours . Our curExcessive increase in intracellular ROS induced DNA damage, cell cycle arrest and senescence as well as apoptosis of tumor cells . Our stuin vitro techniques were used. In general, some cytokines activate M1 or M2 polarization in macrophages generated from in vitro culture. Nitric oxide synthase (iNOS), TNF-\u03b1, IL-6, and the costimulatory molecules CD80 and CD86 were expressed by M1 macrophages. In contrast, M2 macrophages were identified based on the expression of the anti-inflammatory markers arginase-1 and CD163 (scavenger receptor and mannose receptor) [Since immunotherapeutic strategies that target macrophages in the treatment of cancer, particularly HNSCC, are a potential approach. We thus evaluate the immunomodulation properties of kaffir lime leaf extracts and their constituents on inducing macrophage polarization against SCC15 in addition to the direct anti-cancer activity of these substances. Conventional classifications of macrophage polarization include naive macrophages, which rapidly differentiate into the other 2 main phenotypes of classically activated macrophages (M1) and alternatively activated macrophages (M2). In most investigations on macrophage polarization, straightforward eceptor) . Macropheceptor) . Due to eceptor) . M1 macreceptor) . Variouseceptor) ,13. Theret al. reported that phospholipase D4 (PLD4) were involved in the activation process of M1 phenotype macrophages and developed antitumor effects in colon cancer cells [et al. showed that cold plasma treatment stimulated the differentiation of pro-inflammatory (M1) macrophages to prevent solid cancer progression via release of anti-cancer cytokines [et al. concluded that Clinacanthus nutans extracts reduced pro-inflammatory condition in the co-culture of triple-negative breast cancer cells (MDA-MB-231) and THP-1 macrophages [In this study, we investigated whether polarization of macrophages toward M1 or M2 types might be induced by KL extracts and active compounds. Cells were cultured with kaffir lime leaf extracts and their constituents lupeol, citronellal, and citronellol in order to better understand the polarization phenotype of macrophages. The number of CD80 positive cells was significantly larger in macrophages treated with extracts and their components compared to the untreated control, according to flow cytometry used to identify M1 and M2 positive cell populations . The finer cells , while aer cells . Kaushikytokines , while Nrophages .The Nf-\u03baB and the STAT pathways are known to play pivotal roles in the transcriptional profile of macrophages. Among the transcriptional factors, STAT1 and canonical Nf-\u03baB (p50/p65 heterodimer) were essential for M1 tumoricidal functions and triggered the expression of pro-inflammatory cytokines . LPS is Our findings highlighted the potential of crude KL extracts and their compounds lupeol, citronellal and citronellol in stimulating M1 type polarization against cancer via TNF-\u03b1 induced apoptosis. However, further studies could investigate whether KL and its bioactive compounds activate STAT1 and Nf-\u03baB. It is suggested to use a variety of surface markers and confirm TAM activity by comparing it to a positive control in order to trigger apoptosis due to the limits of our work to apply biomarkers for the M1 and M2 phenotype. Different HNSCC cancer cell types must validate the extract\u2019s direct action, and these cells must also test various doses and time periods. The use of patient-derived xenograft models and HNSCC patient-derived samples in future studies will be very effective in examining combination effects and overcoming resistance mechanisms.This study explored the anti-proliferative effects among KL extracts from various solvents as hexane and ethanolic extracts and their contained compounds including lupeol, citronellal and citronellol on the SCC15 cell line. This plant extract and compounds inhibited cell growth and triggered apoptosis through activation of the pro-apoptotic Bax and inhibition of the anti-apoptotic Bcl-2, thereby inducing the downstream caspase-dependent apoptosis pathway, caspase-3 in SCC15. Treatment with KL extracts and their contained compounds significantly increased cell cycle arrest at the G2/M phase of SCC15. They were also ROS inducers associated with high apoptosis and G2/M enrichment. Interestingly, this was the first report of the immunomodulatory effect of crude KL extracts and their contained compounds that polarized M1-macrophages and increased TNF-\u03b1 production, resulting in apoptosis of SCC15 in co-culture with stimulated macrophages . Thus, bS1 Raw images(PDF)Click here for additional data file."}
{"text": "No current model of consciousness is univocally accepted on either theoretical or empirical grounds, and the need for a solid unifying framework is evident. Special attention has been given to the premise that self-organized criticality (SOC) is a fundamental property of neural system. SOC provides a competitive model to describe the physical mechanisms underlying spontaneous brain activity, and thus, critical dynamics were proposed as general gauges of information processing representing a strong candidate for a surrogate measure of consciousness. As SOC could be a neurodynamical framework, which may be able to bring together existing theories and experimental evidence, the purpose of this work was to provide a comprehensive overview of progress of research on SOC in association with consciousness.A comprehensive search of publications on consciousness and SOC published between 1998 and 2021 was conducted. The Web of Science database was searched, and annual number of publications and citations, type of articles, and applied methods were determined.n\u2009=\u200912 studies. EcoG data were assessed in n\u2009=\u20094 articles, fMRI in n\u2009=\u20094 studies, and EEG/MEG in n\u2009=\u200910 studies. Notably, different analytical tools were applied in the EEG/MEG studies to assess a surrogate measure of criticality such as the detrended fluctuation analysis, the pair correlation function, parameters from the neuronal avalanche analysis and the spectral exponent.A total of 71 publications were identified. The annual number of citations steadily increased over the years. Original articles comprised 50.7% and reviews/theoretical articles 43.6%. Sixteen studies reported on human data and in seven studies data were recorded in animals. Computational models were utilized in Recent studies pointed out agreements of critical dynamics with the current most influencing theories in the field of consciousness research, the global workspace theory and the integrated information theory. Thus, the framework of SOC as a neurodynamical parameter for consciousness seems promising. However, identified experimental work was small in numbers, and a heterogeneity of applied analytical tools as a surrogate measure of criticality was observable, which limits the generalizability of findings. Consciousness has been fascinated humankind since its very beginning and the relationship between the aware perception of stimuli and the orchestration of billions of neurons in the brain still is a baffling topic for many researchers all over the world . Over thTherefore, the purpose of this work was (i) to review the literature including annual number of publications and citations, type of articles, and applied methods, as well as to outline evidence bringing together theories and experimental evidence on how SOC may account for conscious perception and (ii) to give a conceptual perspective regarding agreements with the most influencing theories on consciousness described in the following.Theories on how consciousness relates to the physical domain generally start from different premises. Hence, the current two main theories of consciousness, the global workspace theory and the integrated information theory, incorporate distinct approaches to the definition of consciousness . The glo\u03d5, which reflects the amount of causally effective information that can be integrated across a subset of elements  uses a distinct approach claiming that the existence of consciousness cannot be inferred starting from physical systems . In theielements . Due to elements , the IITelements .Moreover, special attention has been given to the hypothesis that neural dynamics might be governed by the phenomenon of SOC. SOC, in the sense of statistical physics, is defined as a specific type of behavior, seen when a system undergoes a phase transition. During a phase transition, macroscopic properties of the system, termed the order parameters, change as a function of a so-called control parameter. For example, when water gets boiled, a phase transition from liquid to a vaporous phase occurs. Here, the order parameter would reflect the phase\u2019s entropy (such as water or vapor), whereas the control parameter is the temperature. Modifying the control parameter gradually changes the order parameter until a specific point, at which the values of the order parameter vary abruptly. Graphically, phase transitions are either marked by a discontinuity of the phase diagram (a jump of the order parameter) or by a point of non-differentiability reflected as a sharp corner. The latter is termed a continuous second order phase transition, which allows the system to be poised exactly between two phases. In that case the system is in the critical state, residing between two qualitative distinct types of behavior such as ordered and disorder. A system at criticality is therefore sometimes referred to as on the \u201cedge of chaos.\u201d If the control parameter is below the critical value, the state is called subcritical, whereas values above the critical state result in a supercritical state . SystemsAlan Turing was probably the first one speculating that the brain could be in a critical regime in his seminal paper on the topic of artificial intelligence written in 1950 . A decadin vivo experiments confirmed power law statistic and spontaneous activity in form of neuronal avalanches in cats under anesthesia  of mature organotypic cultures and acute slices of rat cortex using a multielectrode array . Indeed,esthesia , in awakesthesia  and in resthesia . First sesthesia . In 2013esthesia . Using iesthesia . Subsequesthesia .\u03c3, which is defined as the ratio of descendants, the number of events in a temporal interval t and the ancestors, the number of events in the following interval t\u2009+\u20091  were performed with the keywords (i) \u201cself-organized criticality\u201d OR \u201ccritical dynamics\u201d OR \u201cneuronal avalanche\u201d AND \u201cbrain\u201d as well as (ii) \u201cconsciousness\u201d OR \u201cconscious percept\u201d AND \u201cbrain\u201d OR \u201cneural activity.\u201d In addition, to quantify the growth in the field of SOC and consciousness with respect to the trends of the topics separately, the ratio between the number of citations was normalized by the total number of citations identified with the search (i) and (ii).Data were retrieved from the Web of Science (WoS) electronic database (SCI-Expanded). A search (All-Fields) with the keywords: \u201cself-organized criticality,\u201d OR \u201ccritical dynamics,\u201d OR \u201cphase transition,\u201d OR \u201cneuronal avalanches,\u201d AND \u201cconsciousness\u201d OR \u201cconscious percept\u201d was performed, Articles published between 01.01.1998 and 31.12.2021 were included. There were no language restrictions applied. The data were extracted in December 2021 from the Web of Science and exported to plain text. The data were then tabulated in a spreadsheet using Microsoft Excel . In total n\u2009=\u200971 publications were included. These had a total number of 1,968 citations , an h-index of 21, and 24.3 citations averaged per item. Most articles were original . This was followed by 31 reviews/theoretical articles (43.6%), three proceedings papers (4.2%) and one editorial (1.4%). The annual number of publications was highest in the year 2020 with a local maximum in 2017. The annual number of citations steadily increased over the years  reported on human data and in n\u2009=\u20097 (19.4%) studies data was recorded in animals. Regarding the methods, computational models were utilized in n\u2009=\u200912 studies (n\u2009=\u20094 articles (n\u2009=\u20094 studies (n\u2009=\u20094 studies (n\u2009=\u200910 studies (n\u2009=\u20093), the pair correlation function (n\u2009=\u20092), parameters from the neuronal avalanche analysis (n\u2009=\u20092), and the spectral exponent (n\u2009=\u20091), whereas one study applied multiscale entropy and permutation entropy and another one the autocorrelation function of global alpha oscillations.Out of the original articles,  studies , electroarticles , fMRI in studies , voltage studies , EEG/MEG studies  and EEG  studies . Notablyn\u2009=\u2009473), followed by G. Werner from the University of Texas with 143 citations from In total, 252 authors were identified. The author with the highest number of publications was U. Lee affiliated with the University Michigan, United States, followed by E. Tagliazucchi from Netherlands Institute for Neuroscience. The latter also had the highest number of citations , the IIT had the highest increase in publication and citation count .To note, findings of critical dynamics in the brain did receive substantial critiques . For ins\u03a6). Here, research on criticality and consciousness is largely informed by network models. For instance, Kim and Lee computed a large-scale human brain network model implementing a Kuramoto model on the scaffold of an anatomically informed human brain network structure constructed from diffusion tensor imaging  was determined as the minimum amount of information that is lost when splitting the system into two-subsystems introduced by \u03a6 and metastability was observed. This findings led the authors to conclude that the two influential theories GWT and IIT could be compatible and that the criticality hypothesis offers a framework in which experimental predications from both can coexist (Whereas the global workspace theory and the IIT address distinct aspects of consciousness, the first conscious access closely related to the function of conscious awareness and the latter the phenomenology of consciousness, one notable study combined both in the context of criticality . Enzo Ta coexist .Thus, summarized, the formulation of a regime within the IIT in which segregation and integration occur simultaneously at its maximum corresponding to the conscious state goes hand in hand with the critical state from a dynamical perspective . FurtherThe main limitation of this study is that the analysis was solely based on Web of Science. Web of Science covers approximately 34,000 journals with over 75 million records and includes the sub-databases Science Citation Index, Social Sciences Citation Index, Arts and Humanities Citation Index, Conference Proceedings Citation Index, Book Citation Index, and Emerging Sources Citation Index . FurtherThe topic is compelling as principles such as SOC describing outcomes of collective phenomena in any complex dynamical system, provide a model suitable to situate the phenomenon of consciousness within universal laws of the physical world . WhereasThe raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.NW conceptualized the study, analyzed the data, and wrote the manuscript. TH supervised the project and revised the final version of the manuscript. All authors discussed the results, contributed to the article, and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Auf das s\u00fcdliche Afrika verteilte sich vor der Pandemie circa\u00a02\u202f% des weltweiten internationalen Reiseaufkommens. Davon erreichten fast die H\u00e4lfte dieser j\u00e4hrlichen Ank\u00fcnfte S\u00fcdafrika. W\u00e4hrend der Pandemie hat sich gezeigt, dass gerade die Zugpferde des internationalen Tourismusmarketing der Region, die Safarilodges und Naturerlebnisanbieter, ohne Ank\u00fcnfte aus \u00dcbersee nicht zu bewirtschaften sind. Als Alternative f\u00fcr diesen Nachfrageeinbruch wird einer Steigerung der Regional- und Binnennachfrage kaum Potenzial zugestanden. Dieser Standpunkt soll hier bestritten werden, ohne dabei jedoch vom Alleinstellungsmerkmal des Safaritourismus abzur\u00fccken. Die Empfehlung zielt stattdessen auf eine Erweiterung des Angebotsspektrums ab. Dabei werden 3\u00a0Absichten verfolgt: Erstens, den Mangel an der Binnennachfrage f\u00fcr die klassischen Reiseangebote der Region zu ergr\u00fcnden, zweitens Chancen f\u00fcr eine Aufwertung des Afrikabildes darzulegen und drittens Potenziale f\u00fcr eine Produktdiversifizierung aufzuzeigen, die auch eine wachsende Regional- und Binnennachfrage in den Blick nimmt. Big\u00a05 kein Begriff sind, lernt ihn sp\u00e4testens bei der Ankunft am Tor des Safariparks kennen. Dass dieser zum Markenkern des Safaritourismus gewachsene Sammelbegriff f\u00fcr Leopard, B\u00fcffel, L\u00f6we, Elefant und Nashorn der kolonialen Troph\u00e4enjagd entstammt, erfahren Reisende selten. Dass es nun ab der ersten Safari darum geht, m\u00f6glichst viele dieser Tiere zu ersp\u00e4hen, ist aber schnell als Erfolgsziel ausgemacht. Safaritourismus ist das Alleinstellungsmerkmal Ostafrikas und des s\u00fcdlichen Afrikas, dem geographischen Untersuchungsgegenstand dieses Artikels. Insbesondere charismatische S\u00e4ugetiere gibt es in vergleichbarem Artenaufkommen in keinem anderen Zielgebiet der Welt zu fotografieren.Wem die Dennoch ist das s\u00fcdliche Afrika im globalen Vergleich nur sehr gering in internationale Reisem\u00e4rkte eingebunden und auch regional ist die touristische Reiset\u00e4tigkeit schwach. Mit Regionaltouristen sind hier Reisende gemeint, die sich zwischen den Staaten der Region bewegen.Studien zu Binnentourismus f\u00fcr die Region sind sehr begrenzt Rogerson . Viele LInternationale Tourismusank\u00fcnfte auf dem Kontinent werden von globalen Statistiken in den Schatten gestellt. Gemessen an den letzten Daten der UNWTO vor dem Ausbruch der Pandemie, gab es 2019 weltweit 1,464\u202fMrd. internationale Touristenank\u00fcnfte. Afrikas Anteil daran betrug 68,6\u00a0Mio. oder knapp 4,7\u202f% UNWTO , S.\u00a04. NF\u00fcr die meisten Destinationen sind die Daten zu Touristenank\u00fcnften in der Region jedoch h\u00f6chst unzuverl\u00e4ssig, vor allem deshalb, weil vielerorts klandestine Arbeitsmigranten als Touristen erfasst werden. Dies betrifft nicht nur Einreise-, sondern auch Transitdaten. \u00dcberseereisende, die mit hoher Sicherheit gr\u00f6\u00dftenteils als Urlaubs- oder Gesch\u00e4ftstouristen gelten k\u00f6nnen und auch umf\u00e4nglich touristische Dienstleistungen nutzen, machen deutlich kleinere Anteile unter den Ank\u00fcnften aus: Diese Verteilung erstreckt sich unter den Staaten des s\u00fcdlichen Afrikas zwischen 12,7\u202f% in Botsuana, einem Land mit sehr hohem Transitanteil und 28,1\u202f% in S\u00fcdafrika, dem beliebtesten Zielland f\u00fcr klandestine Arbeitsmigration in der Region . Letzteres betrifft gr\u00f6\u00dftenteils die urbane wei\u00dfe Mittel- und Oberschicht S\u00fcdafrikas. Doch gerade in S\u00fcdafrika w\u00e4re die Aussch\u00f6pfung eines breiteren Nachfragepotenzials auch in gehobenen Marksegmenten m\u00f6glich. Im Jahr 2019 wurden dort 54\u202f% der oberen 10\u202f% aller Einkommen von der ehemals unterdr\u00fcckten schwarzen Mehrheitsbev\u00f6lkerung erwirtschaftet . Viele Destinationen bieten den eigenen B\u00fcrgern zwar Rabatte auf die Parkgeb\u00fchren an. Verg\u00fcnstigte Tagesausfl\u00fcge in die Parks sind in den meisten Destinationen \u00fcblich und haben seit Pandemiebeginn stark zugenommen. Doch es gibt weitere Hindernisse, die viele Einheimische von l\u00e4ngeren Aufenthalten in den Lodges abhalten. Neokoloniale Untert\u00f6ne k\u00f6nnen Einheimische abschrecken Florio . Gerade Big-5-Tourismus aber nur eine Randrolle. In der Regel wird einmal im Reiseablauf zwischen Safaripark und Lodge am Wegesrand kurz Halt gemacht, um in einem eigens f\u00fcr diesen Zweck errichteten Kulturdorf  ein paar Bilder von Einheimischen vor ihren H\u00fctten zu machen. Leider findet hier jedoch wenig Vermittlung von Kulturgeschichte in Form von konkreten Inhalten und Sehensw\u00fcrdigkeiten statt, obwohl diese existieren. Kultur wird meist auf ein austauschbares Vortanzen bzw. Vorsingen der entsprechenden Volksgruppe begrenzt, in dessen Heimat man sich gerade befindet. Was f\u00fcr manch einen \u00dcberseetouristen wohl als halbwegs authentische Darstellung der lokalen Kultur durchgehen mag, kann f\u00fcr Menschen, die selbst aus diesen oder verwandten Kulturgemeinschaften kommen, zumeist vor allem eines sein: peinlich.Seit \u00fcber 40\u00a0Jahren befasst sich die Tourismuskritik mit ungleichen Machtverh\u00e4ltnissen zwischen Besuchern und Besuchten  als auch das Einbettungspotenzial von Narrativen in Destinationskulissen (Instragrammability). Letztere sind wichtige Faktoren f\u00fcr Reiseentscheidungen, gerade f\u00fcr afrikanische Quellm\u00e4rkte, die fast ausschlie\u00dflich aus j\u00fcngeren Generationen bestehen (Gumpo et\u00a0al. Ein Bewusstsein f\u00fcr die Rolle der sozialen Medien f\u00fcr die Ausgestaltung von Marketingnarrativen im Tourismussektor ist zwar l\u00e4ngst in der Region vorhanden. Abgesehen von S\u00fcdafrika, das auch in diesem Bereich eine Vorreiterrolle auf dem gesamten Kontinent spielt, gibt es aber bei Destinationen, die sich auch jenseits der S\u00fcdafrikas Marketingstrategie und -kampagne f\u00fcr den Inlandstourismus \u201eSho\u2019t left\u201c (Rogerson und Lisa Erfolgreich sind vor allem Produkte, die kompatibel mit Gruppeninteressen, zeitlich begrenzt und nicht zu kostspielig sind. Zielgruppen k\u00f6nnen Familienverb\u00fcnde sein, aber auch Freundesgruppen oder Liebespaare. Stattdessen werben viele Destinationen, beispielsweise die Viktoriaf\u00e4lle oder die Drakensberge, mit aufwendigen Abenteuerprodukten, die f\u00fcr regionale M\u00e4rkte nicht nur deutlich zu viel Nervenkitzel ank\u00fcndigen, sondern auch leere Brieftaschen.Reenactment kolonialer Rollenbilder bedient; und eine aufstrebende afrikanische Mittel- und Oberschicht, die neue Reisebed\u00fcrfnisse hat, die mehr mit einer digitalisierten Moderne als mit der \u00c4sthetik des ausgehenden 19.\u00a0Jahrhundert zu tun hat.Letztlich haben wir es bei der vorgestellten Thematik im Wesentlichen mit 3\u00a0Trends zu tun: ein beispielloser Abbruch interkontinentaler Ank\u00fcnfte in der Region \u00fcber einen Zeitraum von anderthalb Jahren; ein etablierter Big-5-Tourismus, der sein Erscheinungsbild auf eine kleine aber vergleichsweise zahlungskr\u00e4ftige Zielgruppe ausrichtet und sich dabei kolonialer Designs bis hin zu einem Storytelling ausgestalten. Langfristig bedarf es einer Dekolonialisierung der Eigentumsverh\u00e4ltnisse touristischer Betriebe. Zur Aufwertung der Erlebnisprodukte ist aber dringend auch eine deutliche Aufwertung kultureller Reiseinhalte durch die Inhaber des kulturellen Eigentums selbst gefragt.Nat\u00fcrlich ist es schwierig bis unm\u00f6glich nach 2 langen verlustreichen Gesch\u00e4ftsjahren in neue Angebote und Ausstattungen zu investieren. Es ist leicht nachzuvollziehen, dass eine Angleichung von \u00dcbernachtungspreisen an regionale Einkommen auch zu Qualit\u00e4tseinbu\u00dfen im Angebot f\u00fchren kann. Doch diese Einsch\u00e4tzungen sind buchst\u00e4blich zu kurz gedacht. Der Safarisektor ist gut beraten, an seinen Kernangeboten und M\u00e4rkten festzuhalten. Zugleich sollte der Sektor sich konzeptionell \u00f6ffnen, indem er zumindest beginnt, mit neuen Produktlinien zu experimentieren und eine inklusivere Zielgruppenstrategie zu fahren. Destinationen sollten kulturelle und historische Angebote nicht nur st\u00e4rker ausbauen, sondern diese inhaltlich auch mit marktorientiertem Big\u00a05 auch an Bigger Ideas.Sowohl das Afrikabild in \u00dcbersee als auch die Reisebereitschaft in den Binnen- und Regionalm\u00e4rkten Afrikas befinden sich in einem Wandel, der nach der weltweiten Eind\u00e4mmung der Pandemie und einer hoffentlich damit einsetzenden wirtschaftlichen Erholung in der Region, an Dynamik hinzuzugewinnen verspricht. Um auf diesen Zug aufzuspringen, bedarf es neben den"}
{"text": "Euryarchaeota , abundant but yet-uncultivated members of marine microbial communities, are thought to be (photo)heterotrophs that metabolize dissolved organic matter (DOM), such as lipids and peptides. However, little is known about their transcriptional activity. We mapped reads from a metatranscriptomic time series collected at Sapelo Island  to metagenome-assembled genomes to determine the diversity of transcriptionally active Ca. Poseidoniales. Summer metatranscriptomes had the highest abundance of Ca. Poseidoniales transcripts, mostly from the O1 and O3 genera within Ca. Thalassarchaeaceae (MGIIb). In contrast, transcripts from fall and winter samples were predominantly from Ca. Poseidoniaceae (MGIIa). Genes encoding proteorhodopsin, membrane-bound pyrophosphatase, peptidase/proteases, and part of the \u00df-oxidation pathway were highly transcribed across abundant genera. Highly transcribed genes specific to Ca. Thalassarchaeaceae included xanthine/uracil permease and receptors for amino acid transporters. Enrichment of Ca. Thalassarchaeaceae transcript reads related to protein/peptide, nucleic acid, and amino acid transport and metabolism, as well as transcript depletion during dark incubations, provided further evidence of heterotrophic metabolism. Quantitative PCR analysis of South Atlantic Bight samples indicated consistently abundant Ca. Poseidoniales in nearshore and inshore waters. Together, our data suggest that Ca. Thalassarchaeaceae are important photoheterotrophs potentially linking DOM and nitrogen cycling in coastal waters.Marine Group II  Euryarchaeota,2 definitive determination of their physiology and ecological roles has remained challenging due to the lack of a cultivated isolate. Nonetheless, as data describing MGII distributions throughout the ocean have increased, several patterns have emerged: MGII is often highly abundant in the euphotic zone and in coastal waters, can reach high abundance following phytoplankton blooms, and largely comprised two subclades, MGIIa and MGIIb.4 Early metagenomic studies provided the first evidence that MGII may be aerobic (photo)heterotrophs,7 a hypothesis supported by incubation experiments10 and by the gene content of diverse metagenome-assembled genomes (MAGs).15 Two recent studies deepened our understanding of the phylogenomics and metabolic potential of MGII by analyzing hundreds of MAGs, highlighting clade-specific differences in genomic potential for transport and degradation of organic molecules, light-harvesting proteorhodopsins, and motility.17 Here, we refer to MGII as the putative order \u201cCandidatus Poseidoniales,\u201d MGIIa and MGIIb as the putative families \u201cCa. Poseidoniaceae\u201d and \u201cCa. Thalassarchaeaceae,\u201d respectively, and putative genera as specified by Rinke et al.16 We occasionally use \u201cMGIIa\u201d and \u201cMGIIb\u201d for consistency with previous literature.Since the initial discovery of Marine Group II (MGII) Ca. Poseidoniales transcripts can be abundant in marine metatranscriptomes, suggesting transiently high transcriptional activity.19 When metatranscriptome reads from the Gulf of Aqaba were mapped to metagenomic contigs from the Mediterranean Sea, genes involved in amino acid transport, carbon metabolism, and cofactor synthesis were highly transcribed in the aggregate euryarcheal community.21 In another study, mapping deep-sea metatranscriptome reads to novel Ca. Poseidoniales MAGs indicated transcription of genes related to protein, fatty acid, and carbohydrate transport and metabolism, likely fueling aerobic heterotrophy.15 Finally, a metaproteomics study found abundant euryarcheal transport proteins for L-amino acids, branched-chain amino acids, and peptides throughout the Atlantic Ocean.22 Despite these advances, little is known about the similarities or differences in gene transcription between Ca. Poseidoniaceae and Thalassarchaeaceae.Metatranscriptomics is one strategy for gleaning information about microbial activity in the environment. Ca. Poseidoniales in coastal waters near Sapelo Island . Prior work suggested that Ca. Poseidoniales are sporadically active at Sapelo Island23 and may comprise the majority of archea in mid-shelf surface waters of the South Atlantic Bight (SAB).24 Since other studies thoroughly described the genomic content of Ca. Poseidoniales MAGs, our focus instead was determining which of the clades were transcriptionally active and identifying highly or differentially transcribed genes. We used two Sapelo Island MAGs25 combined with recent Ca. Poseidoniales MAG collections17 to competitively recruit reads from a metatranscriptomic time series26 and an incubation experiment23 to determine which of the clades were active over time. We then used representative MAGs from highly active genera to determine which Ca. Poseidoniales genes were transcribed. Finally, we used quantitative PCR (qPCR) to measure the abundance of Ca. Poseidoniales 16S rRNA genes in DNA samples throughout the SAB to assess the prevalence Ca. Poseidoniales in this region.We report MAG-resolved metatranscriptomic analyses of 25) to previously reported Ca. Poseidoniales MAGs, including those binned from TARA Oceans, Mediterranean Sea, Red Sea, Gulf of Mexico, Guaymas Basin, and Puget Sound metagenomes32 . All genomes were converted to contig databases, and proteins were identified using HMMER,36 concatenated, aligned using MUSCLE,37 and used to build a phylogenomic tree using FastTree38 within anvi\u2019o.The phylogenomic analysis compared SIMO Bins 19-2 and 31-1  as previously described.26 Briefly, 3\u20138\u2009L of surface water was pumped through a 3-\u00b5m pore-size prefilter followed by a 0.2-\u00b5m pore-size collection filter, which was frozen on liquid nitrogen. RNA was extracted from the collection filter as previously described,26 including the addition of internal RNA standards to calculate volumetric transcript abundances.39 Analyses of \u201cfield\u201d communities included Gifford et al. metatranscriptomes (iMicrobe Accession CAM_P_0000917)26 and the T0 metatranscriptomes from Vorobev et al.,23 while \u201cdark incubation\u201d analyses included only Vorobev et al. samples . Temperature, salinity, dissolved oxygen, pH, and turbidity data corresponding to metatranscriptome sampling times were downloaded from the NOAA National Estuarine Research Reserve System website .We used competitive read mapping to determine which 40) with the \u201cvery-sensitive\u201d flag. Samtools v.1.3.1 (ref. 41) was used to index BAM files, which were profiled and summarized in anvi\u2019o. Contig genus identity was imported to the anvi\u2019o contig database as an external collection. The number of transcripts L\u20131 was calculated by scaling the number of mapped reads by the volume of water filtered and the recovery of internal standards (reported in refs. 26) as previously described.39 Seasonal transcript abundances were compared using a one-way ANOVA test in R42 with data log-transformed to improve normality. Significant groupings were defined post hoc with Tukey\u2019s Honest Significant Difference (HSD) test using the agricolae R package.43Contigs from all MAGs used for phylogenomics  with 999 permutations.Nonmetric multidimensional scaling (NMDS) analysis of metatranscriptome hits was conducted using the vegan R package.VMDE00000000; SIMO Bin 31-1, VMBU0000000025) and one previously binned from Red Sea metagenomes . These MAGs represented genera O1, O3, and M, respectively, which were highly abundant in metatranscriptomes  using DIAMOND47 to search against all orthologous groups in eggNOG-mapper v.1 (refs. 46) and using the BlastKOALA portal .48 Putative genes for carbohydrate-active enzymes, peptidases, and membrane transport proteins were identified using HMMER searches of dbCAN2 (HMMdb v.7),50 MEROPS v.12.0 (ref. 51), and the Transporter Classification Database,52 respectively.MAGs were annotated using the archaeal database in Prokka v.1.13  by dividing by the total number of reads per sample. For each MAG, \u201chighly transcribed\u201d genes were 5% of putative genes with the highest median CPM across metatranscriptomes .Transcript reads were mapped to MAGs (combined into a single database such that each read mapped to only one MAG) to identify 53) was used to identify genes from each MAG that were differentially transcribed when each genus was highly transcriptionally active. For each MAG, \u201ctreatment\u201d samples in DESeq2 were those where the respective genus recruited \u226550% of Ca. Poseidoniales reads from the metatranscriptome. Thus, positive fold-change values are genes transcribed at higher levels when the genus is highly transcriptionally active (compared to other metatranscriptomes). DESeq2 was also used to identify differentially transcribed genes for each MAG between T0 and T24 samples in high-tide (HT) dark incubations.23 Since T24 samples were the \u201ctreatment\u201d condition in DESeq2, positive fold-change values here are genes transcribed at higher levels in T24 compared to T0 samples. In all DESeq2 analyses, genes with Benjamini\u2013Hochberg-adjusted p\u2009<\u20090.1 were counted as having significantly different transcription.DESeq2 v.3.11  and genera O1 (SIMO Bin 19-2) and O3 : most summer samples had >1010Ca. Poseidoniales transcripts L\u20131, more than other seasons , with most mapping to O1  genes were involved in translation, transcription, replication/repair, or post-translation protein modification  MAG were not highly transcribed by Ca. Thalassarchaeaceae, including genes encoding a carbamoyl phosphate synthetase subunit (carA), a family 2 glycosyltransferase, chromosomal protein MC1b, and a ftsX-like permease. The carA gene had the highest median coverage of Ca. Poseidoniaceae genes across coastal metatranscriptomes , and proteorhodopsin . Differentially transcribed genes mapping to the O3 MAG were mostly depleted in O3-active metatranscriptomes and largely encoded proteins of unknown function; only the gene encoding ribosomal protein L12 was enriched in O3-active samples , while hits from the corresponding T24 samples were 98.1\u201399.3% Ca. Thalassarchaeaceae due to increased transcript hits to genus O1  but changed to 78.3\u201398.8% hits to Ca. Thalassarchaeaceae at T24 due to an increase in hits to O1  and a ligand-binding receptor for a general amino acid transporter  and multiple subunits of pyruvate dehydrogenase . None of the genes mapping to the O3 or M MAGs were transcribed at significantly different levels between HT incubation time points , with a range from 1.6\u2009\u00d7\u2009 104 to 7.6\u2009\u00d7\u2009108 genes L\u20131  and the mean efficiency was 93.4%  is among the highest measured in the ocean. Greater gene abundance in inshore, nearshore, and mid-shelf waters indicates that Ca. Poseidoniales are more abundant over the shallow shelf than further offshore , little is known about which clades are transcriptionally active in these regions. At Sapelo Island, the striking dominance of the Ca. Thalassarchaeaceae (MGIIb) genera O1 and O3 in summer samples, which also contained the highest levels of aggregate Ca. Poseidoniales transcripts  transcripts . A previous study found relatively high salinity and DOM enriched in marine-origin molecules over the mid-shelf SAB during July 2014.70 Our data suggest that Ca. Poseidoniaceae were relatively active over the shelf during this time and were transported inshore during flood tides, leading to shifts in transcriptional diversity between LT waters  and HT waters (which included a higher number of Ca. Poseidoniaceae).While numerous studies have demonstrated a high abundance of Ca. Poseidoniaceae (MGIIa) are the predominant euryarcheal family in many coastal ecosystems, particularly in summer (see refs. 72), but it is unclear what general patterns govern Ca. Poseidoniales distributions in coastal waters worldwide. Studies of Ca. Poseidoniales ecology often focus on distributions with depth, typically finding abundant Ca. Thalassarchaeaceae (MGIIb) in deeper waters and Ca. Poseidoniaceae (MGIIa) more prevalent in euphotic waters (see refs. 75). A recent mapping of global ocean metagenome reads showed that coastal populations of Ca. Poseidoniales were primarily Ca. Poseidoniaceae, though Ca. Thalassarchaeaceae MAGs recruited a substantial number of reads from some coastal metagenomes.17 Our data match this latter pattern, with Ca. Poseidoniales populations in surface waters off Sapelo Island dominated by highly active Ca. Thalassarchaeaceae  may explain the unusual pattern found in SAB waters: these genera peaked in summer at Sapelo Island, when water temperatures were 29\u201330\u2009\u00b0C .We determined sets of \u201chighly transcribed\u201d genes mapping to MAGs of transcriptionally active Ca. Poseidoniales MAGs that were differentially transcribed when its genus was highly active  and our data indicate coastal Ca. Poseidoniales conform to this pattern, consistent with recent evidence from other regions.81 High transcription of proteorhodopsin supports the photoheterotrophic lifestyle hypothesized for Ca. Poseidoniales (see refs. 17).Our analysis revealed that es Figs.\u00a0 and 3. PCa. Thalassarchaeaceae proteorhodopsin transcription. However, depletion of O1 crtD  transcripts during dark incubation  and the function of constitutive transcription is not straightforward: while some bacteria use proteorhodopsin to produce ATP when carbon-limited,84 high amounts of proteorhodopsin in other bacteria can physically stabilize membranes even when inactive.85 The high proteorhodopsin transcription in our data emphasizes, but provides little mechanistic clarification of, the physiological role for proteorhodopsin in Ca. Poseidoniales  putatively encodes a membrane-bound pyrophosphatase, which generates a proton or sodium ion gradient via hydrolysis of pyrophosphate, a by-product of numerous cellular processes.86 In metatranscriptomes from a phytoplankton bloom, enrichment of hppA transcripts suggested high pyrophosphate-based energy conservation in oligotrophic waters,87 and hppA transcripts were similarly abundant at night in an oligotrophic lake.88 Although widespread in MAGs from Ca. Poseidoniales,16hppA has not been previously recognized as a potentially important part of their metabolism. Our data suggest that Ca. Poseidoniales may be capable of using pyrophosphatase  to generate a protonmotive force  during incubations  may be adapted to clearer waters and reduce transcription in dark conditions.Although the Tons Fig.\u00a0 suggestsCa. Poseidoniales may have been metabolizing proteins and fatty acids. High transcription of genes encoding proteases or peptidases from all Ca. Poseidoniales MAGs , active protein metabolism is consistent with previous experiments demonstrating protein assimilation10 and high transcription of Ca. Poseidoniales peptidase genes in other marine regions.21 In addition to genes encoding protein catabolism, high transcription of the 3-hydroxyacyl-CoA dehydrogenase gene from all three MAGs  but not Ca. Poseidoniaceae (MGIIa)17 and were among the most highly transcribed Ca. Thalassarchaeaceae genes  during incubations  with the high numbers of O1 pbuG transcripts in O1-active samples and dark-incubation endpoints  in Ca. Thalassarchaeaceae metabolism. In some phytoplanktons, pbuG is transcribed during nitrogen-stressed growth,96 potentially allowing access to DON. However, pbuG and xanthine dehydrogenase (xdh) are also transcribed when xanthine is catabolized by marine bacteria.97 Both Ca. Thalassarchaeaceae MAGs contain putative xanthine dehydrogenase genes : while all three MAGs contained this gene . They indicate an important role for Ca. Thalassarchaeaceae (MGIIb) as coastal photoheterotrophs, particularly in warm waters. High transcription of proteorhodopsin and membrane-bound pyrophosphatase genes suggested common methods for establishing proton gradients. Furthermore, high transcription of genes involved in protein/peptide metabolism and \u00df-oxidation of fatty acids confirmed peptide and lipid metabolism as a common trait. However, high transcription of Ca. Thalassarchaeaceae genes encoding amino acid-binding proteins and nucleotide transporters suggests uptake of these substrates may distinguish the two families. These data confirm the importance of DOM metabolism by Ca. Poseidoniales and suggest a potential role for organic nitrogen in Ca. Thalassarchaeaceae metabolism.Our metatranscriptomic data and associated experiments provide a novel window into the activity of SUPPLEMENTARY FIGURESSupplementary informationSupplementary informationSupplementary informationSupplementary informationSupplementary informationSupplementary informationSupplementary information"}
{"text": "Tumor treating fields (TTFields) is an FDA\u2010approved adjuvant therapy for glioblastoma. The distribution of an applied electric field has been shown to be governed by distinct tissue structures and electrical conductivity. Of all the tissues the skull plays a significant role in modifying the distribution of the electric field due to its large impedance. In this study, we studied how remodeling of the skull would affect the therapeutic outcome of TTFields, using a computational approach.Head models were created from the head template ICBM152 and five realistic head models. The electric field distribution was simulated using the default TTFields array layout. To study the impact of the skull on the electric field, we compared three cases, namely, intact skull, defective skull, and insulating process, wherein a thin electrical insulating layer was added between the transducer and the hydrogel. The electric field strength and heating power were calculated using the FEM (finite element method).Removing the skull flap increased the average field strength at the tumor site, without increasing the field strength of \u201cbrain\u201d. The ATVs of the supratentorial tumors were enhanced significantly. Meanwhile, the heating power of the gels increased, especially those overlapping the skull defect site. Insulation lightly decreased the electric field strength and significantly decreased the heating power in deep tumor models.Our simulation results showed that a skull defect was beneficial for superficial tumors but had an adverse effect on deep tumors. Skull removal should be considered as an optional approach in future TTFields therapy to enhance its efficacy. An insulation process could be used as a joint option to reduce the thermogenic effect of skull defect. If excessive increase in heating power is observed in certain patients, insulating material could be used to mitigate overheating without sacrificing the therapeutic effect of TTFields. Of all the tissues the skull plays a significant role in modifying the distribution of the electric field due to its large impedance. In this study, influence of remodeling of the skull on the therapeutic outcome of TTFields have been studied. This may provide new insights into the application scope of TTFields, and the strategy of utilizing skull defects to maintain field strength, avoid overheating, and maximize antineoplastic efficiency.22.1http://nist.mni.mcgill.ca/.Each patient's images were acquired through the local institutional review board review committee and informed consent was obtained from the patients. Patients with a new pathologic diagnosis of glioblastoma were included. Moreover, images were reviewed to ensure the selected tumors were in a single lobe or brainstem and harboring a significant central necrotic area. Necrotic areas, as the tumor cores, are necessary for analysis in FEM. Cranial MRI was acquired with the same 3T scanner. Radiological features were extracted from axial T1\u2010W, T2\u2010W and enhanced T2\u2010W images. The standard brain template ICBM152 image  was downloaded from the website 2.2https://itis.swiss/virtual\u2010population/tissue\u2010properties/database/dielectric\u2010properties/ Table\u00a0The head template, ICBM152, and five realistic head models  created from MRI data were used to construct five head models with embedded tumors. After aligning the images to MNI  space, the coordinates of real head models were unified with the ICBM152.2.3The results generated by segmentation were all exported as NIFTI files. Then each tumor and the ICBM152 tissues were imported into the 3D slicer software and the \u201csubtract\u201d operation was run to solve tissue overlap issues. After five operations, the tumors were implanted into the template, that is, five head models with tumors were obtained.2.4Based on the location of the tumor, the position and size of the skull defect were determined by a senior neurosurgeon. Considering that the defective part of the skull would be filled with scalp tissue, the electrical properties of this part of the tissue were consistent with the scalp in the calculations of the skull defect models. Finally, the interpolation function of the tissue coordinates and the electrical properties of a head with a skull defect was established and assigned to the head model, that is, head models with a skull defect were obtained.2.5Usually, two pairs of arrays are attached to the patient's head, i.e., left\u2013right arrays (LR arrays) and anterior\u2013posterior arrays (AP arrays). In this study, to compare the effect of the skull defect on the electric field, only one pair of electric arrays was added, depending on the location of the skull defect. Each array consisted of a total of 3\u2009\u00d7\u20093 transducers, which were electrode cylinders with a height of 1.0\u2009mm and a radius of 10\u2009mm. Based on the default layout of the electrode arrays (symmetric configuration) and the relative position of the transducers in the electrode arrays, the electrode sheets were added to the previously established head geometry model.2.6\u03c3 (S/m) is the electrical conductivity of tissues, \u03c9 is the angular frequency, \u03b5 is the relative permittivity, and E (V/m) is the electric field strength.Q (W/m3) is the heating power, J (A/m2) is the current density, and E* is the conjugate of electric field strength.The electric field distribution within the brain was calculated using the FEM to solve the electro quasistatic approximation of the Maxwell equations, which are valid for these models.2.7Considering the strong electric field strength at the defect site, there would be a significant increase in thermogenesis. To control the thermogenic effect, a scheme in this study, adding a thin electric insulating layer to the contact surface between the transducer and the hydrogel, was proposed. The electric insulating layer, with a thickness of 1\u00a0\u03bcm, a dielectric constant of 20\u2009mm, a relative permittivity of 2.2, negligible conductivity, a specific heat capacity of 2.3\u2009J/(kg\u00b7\u00b0C) and a heat conductivity of 0.42\u00a0W/m\u00b7K, was deposited on the inner surface of transducers at the site of the skull defect. Since the thickness of the insulating layer was negligible compared to that of the transducer, the boundary condition of contact impedance was applied to simplify the calculation.2.8The distribution of the intracranial electric field and the heating power of the gel were calculated according to above formulas, and were then exported and processed as colorful diagrams with color scales. Other data, including the average electric field strength and above\u2010threshold volumes (ATVs) of each tissue, were calculated in the COMSOL software and exported as needed.33.13. The ratio of males to females was 3:2.Patients with GBM and their imaging data were used in this study. The five included patients were 18\u201363\u2009years old; their tumors were confined to the unilateral frontal, insular, temporal, and parietal lobes, and the brainstem, respectively; and the tumor volumes ranged from 22.36 to 114.28\u2009cm3.2Depending on the tumor location, the electric field distribution was calculated only for a single pair of arrays, i.e., LR or AP arrays. Because the location of the skull defect and transducers were fixed, the skull defect only affected the pair of arrays with which there was a contact. The intracranial field distribution in the horizontal plane of each tumor is shown in Figure\u00a0In addition, a \u201chot spot\u201d formed at the interface of high and low conductivity tissues, which were not single points but regions with local field enhancement, as the field strength increased in the low conductivity tissues and decreased in the high conductivity tissues. In comparison, after bone flap removal, all models' tumor shell showed the expansion of volume and scope of \u201chot spot\u201d activity except the brainstem model. Moreover, there was no significant decrease in hot spot scope and field strength after adding the insulating layer.In addition, at the tumor site, our region of interest, the field strengths of the tumor core, tumor shell and \u201cbrain\u201d  were calculated, and the results are shown in Figures\u00a0Comparing each case in the same model, Figure\u00a03.3Although some encouraging results can be seen, we can increase the field strength to the tumor shell, as well as the intracranial field strength to some extent, by removing the bone flap. However, this created another problem i.e., the skin dermatitis, which is the main side effect of the electric field treatment, was caused by overheating of the electrode sheet and gel. While removing part of the skull increased the overall field strength due to the lack of the voltage dividing effect of the skull, the heating power of the gel increased. Concurrently, the cost of the temperature increase was reduction of voltage to maintain an equilibrium between heat production and dissipation, with the direct consequence that the increase in field strength was not sustainable, and the final intracranial field strength at equilibrium needed to be further inferred and calculated based on the heating power.Comparing the different models, it was obvious that the LR arrays had significantly larger heating power than the AP arrays, but the gap decreased after bone flap removal. What was found was that the increase in heating power was especially obvious after removing the bone flap in the insular lobe model, and the effect of the insulating layer on the heating power was different in each model.4In this study, we used a standard brain template, ICBM152, and intracranial lesions based on realistic head models derived from MRI data, to study the effect of skull defects on the intracranial electric field distribution and heating power in TTFields. We found that an increase in the intracranial electric field strength was accompanied by an increase in the heating power of gel in the presence of an incomplete skull. Skin dermatitis, the most common side effect of electric field therapy, is strongly correlated with heating power.Because there is no unified transducer array layout according to tumor location, size, and head parameters, and the object of this study was to investigate the effect of skull defects on the intracranial electric field distribution, the default array layout was adopted in each model in the study, and the calculation results only present the AP or the LR arrays, the pair of arrays that overlap with the location of the skull defect, since the effect of the skull defect on the other pair of arrays was almost negligible.Several in vitro experiments have shown that the lower threshold of 1.0\u00a0V/cm is the minimum magnitude for cell division and thus inhibition of cell line proliferation. Moreover, the effect is positively correlated with electric field strength, with the inhibition effect reaching a maximum at 2.5\u00a0V/cm.Since the therapeutic efficacy of electric field therapy is dose\u2010dependent and the average field strength of the tumor shell reached 1\u00a0V/cm when the skull was intact, the ATV 1.0 (to reach the minimum treatment threshold) and ATV 2.5 (to reach the maximum treatment effect) had greater significance. For all models, an increase in ATV 1.0 was observed when skull defects, especially in the frontal lobe model (44.71%) and the brainstem (17.6%), showed a significant increase in ATV 1.0. In addition, almost all tumor shells reached 1\u00a0V/cm after removal of the bone flap. Therefore, the elevated ATV 1.0 in the frontal lobe and brainstem may be related to their lower basal ATV 1.0. In other words, the field strength of the AP arrays was smaller than that of the LR arrays and removing the bone flap may enhance the therapeutic effect of the AP arrays to some extent. Moreover, all the models other than the brainstem model showed an extremely significant increase in ATV 2.5. These results suggest that removing the bone flap can improve the field strength of TTFields during treatment, especially for superficial tumors in the frontal and temporal lobes. For the insular lobe and brainstem models, several previous studies have demonstrated that although specific arrays can improve the electric field strength in the tumor shell, the results are still not ideal compared to superficial tumors, and removing bone flap can also improve the electric field strength in the tumor shell.Overall, Figure\u00a0Enormalized denotes the normalized electric field strength, E2 indicates the average field strength in the skull defect or insulation process case, W1 is the maximum heating power for the skull intact case, and W2 is the maximum heating power for the skull defect or insulating process case.It is known that in practical clinical applications, the temperature of the transducer is monitored, and the voltage will decrease when it reaches 41\u00b0C. During operation, the device can lower the voltage to make the heating power equal to the heat dissipation power, so that the temperature is controlled near 41\u00b0C. Since our results were based on the calculation of the default voltage, the actual tumor shell field strength needed to be further calculated based on the heating power. Therefore, we introduced a definition of \u201cnormalized electric field strength\u201d, using the heating power of the intact skull case as a benchmark for the treatment unification of each case. In other words, it may represent the actual change in the electric field strength when the transducer with the highest heat power was adjusted to that value in the case of skull defect or insulating process.In conclusion, Table\u00a0This study is a computational modeling study and the physical parameters of each tissue have a large impact on the accuracy of the study; every effort has been made to avoid this error by selecting parameters provided by authoritative organizations. Field correlation and anisotropic conductivity, which have an effect on the field distribution and efficacy, are not included in this study.Taian Jin and Zhangqi Dou were responsible for the study methods, data analysis, writing, and editing. Yu Zhao was responsible for the analysis. Boxing Wei, Biao Jiang, Jinghong Xu, Buyi Zhang, and Fei Dong were responsible for the clinical concepts and data acquisition. Chongran Sun and Jianmin Zhang were responsible for conceptualization, guidance, and supervision.None.The Second Affiliated Hospital, Zhejiang University School of Medicine, Center Institutional Review Board approved this modeling study using the de\u2010identified publicly available data. All patients provided informed consent."}
{"text": "Inflammatory bowel disease (IBD) refers to chronic intestinal immune-mediated diseases including two main disease manifestations: ulcerative colitis (UC) and Crohn\u2019s disease (CD). Epidemiological, clinical, and preclinical evidence has highlighted the potential anti-inflammatory properties of naturally occurring alkaloids. In the present study, we investigated the potential anti-inflammatory activities of the tobacco alkaloids nicotine and anatabine in a dextran sulfate sodium (DSS)-induced UC mouse model with a fully humanized immune system. Our results show that nicotine significantly reduced all acute colitis symptoms and improved colitis-specific endpoints, including histopathologically assessed colon inflammation, tissue damage, and mononuclear cell infiltration. The tobacco alkaloid anatabine showed similar effectiveness trends, although they were generally weaker or not significant. Gene expression analysis in the context of biological network models of IBD further pinpointed a possible mechanism by which nicotine attenuated DSS-induced colitis in humanized mice. The current study enables further investigation of possible molecular mechanisms by which tobacco alkaloids attenuate UC symptoms. Inflammatory bowel disease (IBD) is the collective term for chronic idiopathic immune-mediated diseases characterized by chronic and relapsing inflammation of the gastrointestinal tract. The incidence and prevalence of IBD have increased worldwide with a stable rise expected over the next decade, which will substantially increase the burden on health care systems and society ,2. IBD cThe correlation between cigarette smoking and IBD has been established by several epidemiological studies . While sSeveral preclinical and clinical studies have been published in which nicotine was administered to mice or patients with UC in different formulations using various administration routes ,18,19,20In the present study, to increase the human translatability of a colitis mouse model and investigate the potential role of tobacco alkaloids in reducing intestinal inflammation, we combined a mouse model with a fully humanized immune system and a validated DSS-induced mouse model of UC with disease-specific endpoints and system-wide molecular profiling.To mimic the contributions of the human immune system in a preclinical model, we engrafted immunodeficient mice (NCG) with cord-blood-derived human CD34+ hematopoietic stem cells and progenitor cells. Fourteen weeks after stem cell injection, engraftment level was monitored with flow cytometry analysis of human CD45+ cells among total blood leukocytes (mouse and human). Only mice with a humanization rate > 30% were used in the subsequent experiments (hu-mice). The average humanization rate was 52.9%. The engrafted human stem cells matured and developed a fully functional human immune system containing mostly B and T lymphocytes, but also monocytes, natural killer (NK) cells, and neutrophils A; T lympThe mice were treated with nicotine or anatabine for 2 weeks before colitis induction by DSS until the end of the experimental phases at day 7 (acute phase) or 12 (7 days DSS + 5 days replacing DSS with water ad libitum\u2014recovery phase).Treatment with alkaloids did not induce significant body weight loss before DSS induction. Overall survival was recorded during the 12-day experiment. Mice treated with nicotine did not show DSS-induced mortality, but five mice in the vehicle (drinking water) and three mice in the anatabine arms died by the end of the experimental recovery phase (day 12) .After colitis induction, body weight started to decrease and reached a loss of 22% in the vehicle-treated group. Anatabine and nicotine attenuated body weight loss, albeit not significantly . DiarrheThe three regions  in the Swiss-roll colon samples A were quFlow cytometry was performed to determine the effects of nicotine and anatabine on human immune cell populations in the blood samples collected at days 7 and 12. The number of circulating human immune cells (hCD45+) was not significantly affected by treatments on day 7 or on day 12 A. The nuTo assess human immune cell infiltration in the colon of DSS-treated hu-mice, the fixed colons were stained to label T cells, B cells, macrophages, neutrophils, and proliferative cells . AnalysiAs the samples used for RNA sequencing contained material from both mouse and human origins, we set up a dedicated preprocessing pipeline for the raw sequencing data see . Supplemp-value and directionality of the inferred regulation by nicotine at day 6 in To obtain mechanistic insight into nicotine\u2019s effects on DSS-induced colitis, we used an enrichment approach that relies on a database of over 800 molecular entities or nodes  with mRNAs known to be regulated by the nodes. The activity of these nodes can be inferred by comparing differential mRNA regulation in experimental data to the mRNAs assigned under each node, taking into consideration the expected directionality of the regulation ,35,36. HFirst, we investigated the pathways regulating nuclear factor-\u03ba-light-chain-enhancer of activated B cells (NF-\u03baB) complex\u2014inferred to be downregulated\u2014in the merged IBD network model A. Along Next, we investigated the impact of other pathways inferred to be regulated by nicotine in the DSS background and leading to intestinal permeability, wound healing, and inflammation. The inferred upregulation of Janus kinase (Jak) and downregulation of mitogen-activated protein kinase (Map3k)5 led to reduced intestinal permeability in nicotine-treated mice via increased translocation of beta catenin (Ctnnb)1 from intracellular space to tight junctions and decreased translocation of occludin (Ocln) and the tight junction protein (Tjp)1 from tight junctions to extracellular space, respectively B. IntereTraf3ip2 (Traf3 interacting protein 2) was inferred to be downregulated, suggesting increased cell proliferation and wound healing B. Enhanc\u2212/\u2212 mice transplanted with human cord-blood-derived CD34+ hematopoietic stem cells develop a na\u00efve and functional human immune system equipped with T and B cells, NK cells, dendritic cells, monocytes, and macrophages. Finally, our study design also considered the relapsing and remitting characteristics of human CD and UC with the addition of a 5-day recovery period following the 7-day DSS treatment period (referred to as the recovery phase). This is important to evaluate the alkaloids\u2019 effects on both the pro-inflammatory (acute) and anti-inflammatory/pro-wound healing (recovery) phases of the disease [Naturally occurring alkaloids in tobacco have been suggested to be potentially effective in treating several inflammatory conditions ,27,39,40 disease ,46.In this setting, our results clearly show that oral administration of nicotine and partially anatabine globally reduced the clinical manifestations of DSS-induced colitis accompanied by body weight loss, diarrhea, rectal bleeding, and colon shortening. Furthermore, we were able to link observed changes in the clinical outcomes to direct effects at the tissue level. The histopathological assessments confirmed the role of nicotine in reducing the inflammation, tissue damage, and mononuclear infiltration scores ,23,47 duThe node inference and network analysis pinpointed mechanisms known to be regulated by nicotine. In line with our findings, several studies have shown that the suppressive effects of nicotine on the production of inflammatory mediators such as Tnf and Il1b occur via inhibition of the NF-\u0138B pathway ,50,51,52The inferred downregulation of Tlr2 (upstream of the NF-\u0138B complex) could result from nAchR activation, which has been shown to attenuate Tlr signaling. Topically administered nicotine was shown to decrease Tlr2 production in diabetic wounds infected with bacterial agents and reduce the inflammatory response during skin wound healing ,58.Our analysis also predicted nicotine-mediated downregulation of Tlr7 in DSS-treated mouse colon. According to the network model, Tlr7 downregulation leads to downregulation of Ifnb1, which inhibits anti-inflammatory mechanisms. Although this is initially counterintuitive, the evidence shows opposite effects elicited by TLR7 activation/inhibition in the context of inflammation. Although TLR7 activation has been shown to protect mice from DSS colitis by mediating the action of enteric viruses ,60, its MAPKp38 is connected to epithelial cell migration in our IBD network models, and its inferred downregulation would indicate impaired wound healing. However, some studies have suggested that MAPKp38 is activated in the inflamed intestinal mucosa , and itsIn the IBD network model, vitamin D signaling downregulates the NF-\u03baB component, Rela , and itsThe study has its limitations. Due to the lack of an exposure arm without DSS treatment in the study design, it was not possible to investigate how tobacco alkaloids may impact the healthy colon in the humanized mouse model. Moreover, analysis of the human-cell-derived transcriptome was not possible due to the small sample sizes extracted from the colon of the alkaloid-treated DSS mice. Even though the changes in immune cell infiltration to the colon at day 7 were marginal in the tobacco-alkaloid- and DSS-treated groups compared to mice treated with DSS only, the immune cells likely signal to the colon epithelium. Hence, the analysis of the immune cell transcriptome in the humanized mouse model could further explain the inferred molecular changes observed in the colon transcriptomic analysis and increase understanding of how tobacco alkaloids protect the mouse colon. Nevertheless, our results can be used to generate limited hypotheses on the mode of action of nicotine in experimental colitis, which should be confirmed with additional investigations.In summary, we demonstrated that administration of nicotine in drinking water reduced colitis clinical symptoms and histologic features in a DSS-mouse model with a fully humanized immune system. The underlying molecular mechanisms were linked to known effects of nAchR\u03b17 signaling, and the node inference also suggested novel mechanisms of nicotine action that could be further explored.All animal procedures described in this study were reviewed and approved by the local ethic committee . The experiment was carried out with NOD/Shi-scid/IL-2R\u03b3null immunodeficient mouse strain . Briefly, 4-week-old immunodeficient NCG mice were engrafted with cord-blood-derived human CD34+ hematopoietic stem and progenitor cells  2 days after chemical myeloablative treatment. Fourteen weeks after cell injection, engraftment level was monitored with the analysis of human CD45+ cells among total blood leukocytes by flow cytometry . After engraftment confirmation, mice were assigned to each treatment group after manual randomized based on their humanization rate, their weight, and the cord blood donor ID.https://doi.org/10.26126/intervals.7p6n5w.1.Acute colitis was induced by adding DSS  in drinking water over 7 days, from day 1 to day 7. DSS powder was aliquoted on the first day of the experiment. DSS solution was freshly prepared by dissolving the aliquoted powder in MilliQ water , and it was renewed every 2 days. For the washout period, the DSS solution was removed and replaced by MilliQ water from day 8 to day 12. The progression of the disease severity was monitored with clinical scoring. Mice were weighed daily during the acute colitis cycle and scored for their stool consistency and rectal bleeding by visually monitoring stool. Using these parameters, a global clinical score was calculated  and anatabine  with a purity of 99%) were added to the drinking water to reach a value of 20 mg/kg/day.Flow cytometry analysis was performed on an Attune N \u00d7 T Flow Cytometer (Life Technologies/Thermo Fisher Scientific). Briefly, 100 \u00b5L of blood was stained with surface antibodies  and viability dye. Red blood cells were lysed with RBC lysis buffer . Samples were then permeabilized with Fixation/Permeabilization Buffer (Thermo Fisher Scientific) for the intracellular staining. Washing steps preceded cytometer analysis. The numbers of samples were n = 10 at D7 for all groups, n = 7 for the water and anatabine groups at D12, and n = 10 for the nicotine group at D12.Distal colon tissues were collected in Magnalyser tubes  and ground in 700 \u00b5L of Qiazol lysis buffer  with the FastPrep-24 5G . Total RNAs (including microRNAs) were purified using miRNeasy Mini Kit  according to the manufacturer\u2019s instructions.RNA concentration and purity were determined using a UV spectrophotometer  by measuring the absorbance at 230, 260, and 280 nm. The integrity of the RNA was further checked with the Agilent 2100 Bioanalyzer, and RNAs with RIN values > 7 were used in the downstream RNAseq workflow.The RNA was normalized to 200 ng for each sample, and the library was prepared with the Tecan Universal Plus mRNA-Seq Kit . Briefly, this kit generates stranded RNA-Seq libraries derived from poly(A)-selected RNA. The PolyA RNA was reverse-transcribed and transformed into a double-stranded cDNA. Unique dual-indexed adapters were ligated, and libraries were then amplified with 10 polymerase chain reaction cycles and purified. The quality of the libraries was also checked on a Fragment Analyzer 96 instrument . The purified libraries were then quantified with NuQuant and normalized to 10 nM. Eight sequencing pools were clustered on a c-Bot instrument and sequenced on the Illumina HiSeq 4000 Instrument .Colons were dissected, measured, and fixed in 4% paraformaldehyde for 24 h before storage in 70% ethanol. Samples were dehydrated before paraffin embedding and trimming using a Leica TP1020 Tissue Processor . Each colon sample was embedded in one paraffin block to perform longitudinal sections. Sections of 4 \u03bcm per block were deposited on Superfrost + slides before HE staining. Two sections of the same block were used to prevent artifacts from manual coloring. Analysis was performed on mice colon tissues prepared with the Swiss-roll technique. All slides were digitalized using the scanner Aperio Versa (Leica) with the \u00d720 objective in brightfield conditions. Inflammation/fibrosis, tissue damage, and mononuclear cell infiltration were then visually assessed in proximal, middle, and distal regions and scored . One-way ANOVA with Dunnett\u2019s multiple comparison test was used, and the results are shown in The raw sequencing data were first cleaned to remove low-quality and adapter sequences. Downstream analysis revealed that mouse RNA was much more abundant than human RNA in the collected samples . The validity of the mapping strategy was assessed by running an over-representation analysis of the top 1000 genes contained in each tail of the distribution of the log10 ratio between the mean read counts in human and mouse for orthologous genes. The tissue-specific gene set collections \u201cHuman_Gene_Atlas\u201d and \u201cMouse_Gene_Atlas\u201d were taken from the EnrichR website . The gene set over-representation calculation was performed using the piano package [Mapped transcriptomic data were processed in the R software environment for statistical computing . The hum package . Once thp-value < 0.05 were then mapped to the IBD network model suit using Cytoscape [Node enrichment analysis was used to identify molecular drivers of nicotine effects on DSS-induced colitis. The strength scoring algorithm is a threshold-free enrichment method that relies on mRNAs known to be regulated by specific nodes, as described in ,76. The ytoscape . The graytoscape . The IBDytoscape ,38."}
{"text": "Lambl's excrescences (LEs) are delicate filiform strands formed by connective tissue located along the valve closure lines within the cardiovascular system.\u00a0Most cases of these excrescences manifest without discernible symptoms, and the exact etiological factors contributing to their formation remain unknown.\u00a0These excrescences may embolize to the brain, causing strokes.\u00a0It is essential that all other possible causes of stroke be eliminated prior to identifying Lambl's excrescences as the cause of the stroke. Herein, we present a case of a patient who suffered a stroke, and all conventional testing for common causes of embolic strokes was ruled out.\u00a0In pursuit of a comprehensive evaluation encompassing\u00a0the classification of the stroke as\u00a0cryptogenic, a transesophageal echocardiogram (TEE) was performed, which effectively\u00a0disclosed\u00a0the existence of LEs situated\u00a0on\u00a0the aortic\u00a0valve leaflets.\u00a0The patient was treated with anticoagulation and discharged with close follow-up monitoring.\u00a0To\u00a0culminate,\u00a0the inclusion of this case within our study augments the currently scarce pool of instances that exhibit such characteristic cardioembolic\u00a0phenomena, thereby accentuating\u00a0the necessity for additional prospective investigations to substantiate the existence of a\u00a0causative\u00a0association linking LEs and cardioembolic strokes. Stroke is the leading cause of\u00a0long-term\u00a0disability and the second leading cause of death worldwide, resulting\u00a0in the death of 26\u00a0million people each year .\u00a0A strokLambl's excrescences were first described as a cause of embolic stroke in 1856 by Vil\u00e9m Du\u0161an Lambl, a Bohemian physician . In the A 53-year-old female presented to the emergency department (ED) with weakness in her left upper and lower extremities, a drooping left side of her face, and difficulty speaking.\u00a0She did not have a significant medical history or a surgical history, nor had she traveled recently.\u00a0According to the patient, she has never smoked, consumed alcohol, or used illicit drugs.\u00a0The physical examination was unremarkable except for the neurological examination, which showed dysarthria, facial asymmetry, and weakness in the left lower and upper extremities. The National Institutes of Health Stroke Scale (NIHSS) score was 11 .\u00a0The patient was out of the tissue plasminogen activator (tPA) window.The patient's laboratory results were not significant at the time of admission.\u00a0The urine toxicology screen was negative, and the lipid panel was within the reference range.\u00a0Electrocardiography (EKG)\u00a0showed\u00a0sinus bradycardia\u00a0with a normal rhythm Figure .CT scan of the head without contrast was performed, which indicated no acute intracranial pathology. A CT angiogram with contrast of the head and neck revealed occlusion of the supraclinoid internal carotid artery on the right, as well as cross-filling of the\u00a0right\u00a0A2 segment and the distal M1 segment of the middle cerebral artery (MCA) as shown in Figure The patient was\u00a0immediately\u00a0taken for\u00a0percutaneous transluminal mechanical thrombectomy of the right\u00a0MCA,\u00a0followed by treatment with aspirin, clopidogrel, and deep vein thrombosis (DVT) prophylaxis with heparin.\u00a0After the procedure, a CT scan of the head without contrast revealed an acute infarct in the right frontal lobe and right basal ganglia.\u00a0Additionally, a mass effect was observed on the right lateral ventricle without a shift in the midline. Following the procedure, the patient's left lower extremity weakness and left upper extremity weakness significantly improved; however, facial droop remains.A radiological and hematological examination was conducted to identify the source of the embolus.\u00a0A transthoracic echocardiogram (TTE) demonstrated a normal left ventricle size and left ventricle thickness above the normal range.\u00a0During early diastole, the left ventricle displayed decreased relaxation.\u00a0The TTE revealed no evidence of clots in the heart. A brain MRI without contrast was performed, which showed acute stroke in multifocal areas within the right cerebral hemisphere primarily in the inferior frontal lobe Figure .A bubble study was performed and revealed a small patent foramen ovale.\u00a0There were negative results for bilateral Doppler ultrasounds of the lower extremities, bilateral renal ultrasounds, and a Holter study of the lower extremities.\u00a0All coagulation tests, including factor V Leiden, lupus anticoagulant, anticardiolipin, antithrombin III activity, protein C and S resistance, prothrombin G20210A mutation, anti-nuclear antibody (ANA), and homocysteine levels, were negative.\u00a0A transesophageal echocardiogram (TEE) was performed which revealed a fine filamentous strand (6 mm in length and 1 mm in thickness) on the aortic valve consistent with Lambl's excrescence Figure , a rare The patient was hospitalized for 14 days, and the remainder of his stay was uneventful.\u00a0The patient was discharged on a regimen of aspirin, ticagrelor, and atorvastatin.\u00a0The patient was discharged to a rehabilitation facility for acute rehabilitation.The first description of Lambl's excrescences (LEs) came\u00a0from Bohemian\u00a0physician Vil\u00e9m Du\u0161an Lambl. Initially, these lesions were identified\u00a0on\u00a0the aortic valve as filiform lesions . While LThe aortic valve and mitral valve represent the two most common locations for LE, with the aortic valve being the chief source of stroke in LE .\u00a0In a stIt is possible for LE to appear in a variety of shapes  as well as a variety of sizes (1-10 mm in length and 1 mm in thickness) .\u00a0It is pA study conducted by Roldan et al. and Cohen et al. found that LE may not be a cause of cardioembolic strokes, may be present in normal valves without any pathological process, and may not require treatment ,13. ThisTo date, no definitive treatment has been identified for LE.\u00a0A patient's presentation will determine the type of treatment to be administered .\u00a0AntiplaLambl's excrescence continues to be a very rare cause of cardioembolic stroke without an established treatment. Herein, we present a patient with an established stroke confirmed to have Lambl\u2019s excrescence. A combination of medical and surgical management may be beneficial; however, more research is needed to determine the effectiveness of this approach.We present an exceptional case report of Lambl's excrescences (LEs) in a patient who had suffered an ischemic stroke. This singular case serves as an illustrative example, underscoring the requirement for further prospective investigations aimed at establishing a definitive association between LE and cardioembolic strokes.\u00a0The importance of such research endeavors cannot be overstated, since LE has the potential to cause recurrent ischemic events leading to lasting disability and irreversible damage.\u00a0The significance of elucidating this relationship lies in\u00a0its\u00a0potential to enhance our understanding of the pathophysiological mechanisms at\u00a0play. This will also enable clinicians to\u00a0develop targeted interventions\u00a0and ultimately improve patient outcomes."}
{"text": "Phytosterols (PS) have been shown to regulate cholesterol metabolism and alleviate hyperlipidemia (HLP), but the mechanism is still unclear. In this study, we investigated the mechanism by which PS regulates cholesterol metabolism in high-fat diet (HFD) mice. The results showed that PS treatment reduced the accumulation of total cholesterol (TC), triglycerides (TG), and low-density lipoprotein cholesterol (LDL-C) in the serum of HFD mice, while increasing the serum levels of high-density lipoprotein cholesterol (HDL-C). Compared with HFD mice, PS not only increased the antioxidant activity of the liver but also regulated the mRNA expression levels of enzymes and receptors related to cholesterol metabolism. The hypolipidemic effect of PS was abolished by antibiotic (Abx) intervention and reproduced by fecal transplantation (FMT) intervention. The results of 16S rRNA sequencing analysis showed that PS modulated the gut microbiota of mice. PS reduced the relative abundance of Lactobacillus and other bile salt hydrolase- (BSH-) producing gut microbiota in HFD mice, which are potentially related to cholesterol metabolism. These findings partially explain the mechanisms by which PS regulates cholesterol metabolism. This implies that regulation of the gut microbiota would be a potential target for the treatment of HLP. Since the 21st century, with the change of people's diet and lifestyle, obesity has gradually replaced malnutrition and infectious diseases as one of the most serious global epidemics causing medical problems . Current\u03b2-sitosterol, stigmasterol, campesterol, and brassicasterol [\u03b2-sitosterol, is widely studied and used, and it has been shown to be effective not only in lowering blood lipids but also in relieving colon inflammation and antianxiety [Phytosterols (PS), a class of plant-derived steroids that contain the same fused four-ring core structure  have a scasterol . The mosianxiety , 13. Stiianxiety . Campestianxiety . Since Pianxiety , 17. Henianxiety , 19.Although the benefits of PS affecting cholesterol metabolism have been reported constantly, the mechanism is still unclear. In this study, we used the HFD-induced HLP model to investigate the role of PS in regulating lipid metabolism. In addition, this study describes the role of PS in regulating the gut microbiota. We were attempting to explain the mechanism of PS in regulating cholesterol metabolism and the role of gut microbiota in this process.\u03b2-sitosterol content is more than 40%, campesterol is more than 20%, and stigmasterol is more than 14% . The purity of PS is more than 95%, 4% Table . High-faFive-week-old C57BL/6J male mice, weighing 18-20\u2009g, were purchased from Beijing HFK Bioscience Co., Ltd. Animals were kept in the South China Agricultural University Laboratory Animal Center (SYXK 2019-0136) at a room temperature of 25 \u00b1 2\u00b0C and relative humidity of 55 \u00b1 5\u00b0C. All experiments were performed in accordance with animal welfare and the standards of the South China Agricultural University Experimental Animal Ethics Committee. All experiments were approved by the Ethics Committee.After 1 week of adaptive feeding, C57BL/6J male mice were randomly divided into three groups: normal diet group (ND), high-fat diet group (HFD), and high-fat diet with phytosterol group (HFD+PS). In the first 4 weeks, mice in the ND group were fed normal chow, while mice in the HFD and HFD+PS groups were fed high-fat chow at 25%, 50%, 75%, and 100%, respectively. From the 5th week, mice in the HFD+PS group were gavaged with 100\u2009mg/kg of PS. Mice in the ND and HFD groups were gavaged with equal amounts of saline once a day for 8 weeks. Mice were executed at the end of the experiment. Samples were collected, and data were recorded according to experimental necessity.Twenty C57BL/6J male mice were adapted for 1 week and kept on high-fat chow for 12 weeks. At weeks 9 and 10, antibiotics  were added to the drinking water of mice in the HFD+Abx+PS group for clearing the gut microbiota. After that, both groups of mice were gavaged with 100\u2009mg/kg/d PS for 2 weeks. At the end of the experiment, mice were executed, and tissues were collected.Ten C57BL/6J male mice were adaptation housed for 1 week. After 100\u2009mg/kg/d PS gavage treatment for 2 weeks, 150\u2009mg fresh feces of fecal microbiota transplantation (FMT) donor mice were collected into a sterile test tube every day, mixed with 0.9\u2009mL PBS and suspended under anaerobic conditions, and vortexed for about 4\u2009min. The mixture was centrifuged for 5\u2009min at 4\u00b0C, 1000 \u00d7 g, and the supernatant was aspirated as FMT material, gavaged to recipient mice immediately after preparation.Twenty C57BL/6J male mice were adapted for 1 week and kept on high-fat chow for 12 weeks. At first 2 weeks, antibiotics were added to the drinking water of mice in the HFD+Abx+FMT group to clear the gut microbiota. At the 3rd week, mice in the HFD+Abx+FMT group were conducted FMT, 0.2\u2009mL/d for 1 week, while mice in the HFD+NS group were given with normal saline. At the end of the 12th week, animals were euthanized, and tissues were collected.Mice were fasted 12 hours in advance, and blood was collected from the tail vein using a blood collection needle. Blood glucose concentration was measured with a glucometer. Subsequently, mice were gavaged with 2.0\u2009g/kg of glucose solution. The blood glucose concentrations of mice were measured after 30\u2009min, 60\u2009min, 120\u2009min, and 180\u2009min. The concentration curves were plotted, and the area under the curve (AUC) was calculated using GraphPad Prism 7.0 software.The liver and epididymal fat of mice were fixed in 10% formalin. Hematoxylin-eosin (H&E) staining was performed on conventional paraffin-embedded tissues (nuclei were blue and cytoplasm was red), and histological examination was performed using a light microscope at 200\u00d7 visual field. Frozen liver sections were stained with oil red O solution and hematoxylin solution (lipid droplets are orange to bright red and nuclei are blue). Images were acquired for analysis at 200\u00d7 visual field.https://www.cusabio.com/) according to the manufacturer's instructions.The blood was collected and centrifuged at 3000\u2009r/min for 5\u2009min, and then, the upper serum layer was separated and stored at -80\u00b0C. Serum levels of TC and TG were measured by ELISA kit, which was purchased from Shanghai Enzyme-linked Biotechnology Co., Ltd . Serum levels of LDL-C and HDL-C were determined using ELISA kits . The primers were synthesized by Tsingke Biotechnology Co., Ltd (China). The primer sequences are listed in Table Total tissue RNA was extracted using the RNA Isolater Total RNA Extraction Reagent kit (R401), and RNA was reverse transcribed to cDNA using the HiScript III RT SuperMix for qPCR (+gDNA wiper) reverse transcription kit (R323). The reaction system was configured and performed according to the ChamQ Universal SYBR qPCR Master Mix kit (Q711), and the relative expression of target genes was analyzed by the 2DNA extraction from mouse fecal samples was performed using DNeasy PowerSoil Kit (Mo Bio/QIAGEN) according to the manufacturer's instructions. The absorbance values of DNA at 260/280\u2009nm were measured using a fluorescence spectrophotometer to assess the concentration of sample DNA. The quality of DNA was detected by 1% agarose gel electrophoresis. Primer sequences were F: ACTCCTACGGGAGGCAGCA and R: GGACTACHVGGGTWTCTAAT. The V3-V4 region of the microbial 16S rRNA gene was amplified by PCR. Sequencing was performed by Shanghai Personal Biotechnology Co., Ltd. using Illumina MiSeq gene sequencing platform.T-test. Multiple data groups were compared using one-way ANOVA and Tukey's multiple comparisons to analyze the variability between groups. P < 0.05 were considered statistically significant. Correlation analysis was performed by the genes cloud tools (https://www.genescloud.cn).The experimental data were statistically analyzed using GraphPad Prism 7.0 software. Data comparison between two groups was analyzed by According to the experimental design of the animal protocol, we monitored the body weight of each group of mice weekly . CompareNext, to determine whether PS ameliorated glucolipid metabolism, we measured the serum concentrations of TG, TC, LDL-C, and HDL-C in mice, which are considered clinical biomarkers of severe HLP . The conNext, we examined the levels of oxidative stress-related mRNA in the liver. Compared with the ND mice, HFD significantly decreased the mRNA levels of heme oxygenase 1 (HO-1); compared with the HFD group mice, PS significantly increased the mRNA levels of Kelch-like ECH-associated protein 1 (Keap1), nuclear factor, erythroid 2 like 2 (Nrf2), HO-1, NAD(P)H quinone dehydrogenase 1 (NQO1), glutamate-cysteine ligase modifier subunit (GCLM), and glutamate-cysteine ligase catalytic subunit (GCLC) Figures . These rThese results indicated that HFD significantly increased the concentrations of serum TG, TC, and LDL-C and decreased HDL-C, causing HLP and leading to impaired glucose tolerance in mice. PS treatment reversed these changes and ameliorated HLP and glucose tolerance.\u03b1-hydroxylase (CYP7A1), sterol 12\u03b1-hydroxylase (CYP8B1), oxysterol 7\u03b1-hydroxylase (CYP7B1), and sterol 27-hydroxylase (CYP27A1) and the bile acid (BA) synthesis rate-limiting enzyme related to cholesterol metabolism. It showed that compared with ND mice, the expressions of CYP7A1 and CYP8B1 were strongly increased in HFD mice, and the expressions of CYP27A1 and CYP7B1 also showed an increasing trend. PS intervention caused a significant decrease in the relative mRNA expression of CYP8B1 and a downward trend of CYP7A1 in HFD mice. CYP7B1 was significantly upregulated, and CYP27A1 was trended to increase in HFD+PS mice , Takeda G-protein-coupled receptor 5 (TGR5), and Farnesoid X receptor (FXR) and a decrease in the relative mRNA expression of small heterodimer protein (SHP) in mice. In HFD mice, PS treatment resulted in a significant decrease in the relative mRNA expression of TGR5 and FGFR4 and a significant increase in the mRNA levels of FXR and SHP in the liver Figures .As mentioned above, PS inhibited the classical pathway of hepatic cholesterol metabolism and promoted the expression of rate-limiting enzymes of alternative pathways. Meanwhile, PS inhibited TGR5 and FGFR4 and promoted the expression of FXR and SHP receptors.Previous studies have shown that the gut microbiota and its metabolites are closely related to cholesterol metabolism , 21. To Firstly, the results of principal component analysis (PCA) of gut microbiota showed that there were different clusters of gut microbial species abundance in the ND, HFD, and HFD+PS groups . Also, hHLP is a common and prevalent disease that occurs in obese or overweight people, and it is often complicated with diabetes, hypertension, and coronary heart disease , 23. TheWe hypothesized that the hypolipidemic effect of PS is related to the pathway of cholesterol metabolism in the liver. BA metabolism is an important route of cholesterol excretion. About one-third of the cholesterol catabolism in the body is achieved by BA synthesis . The entAccording to the previous reports, signaling by FXR and FGFR4 receptors in the liver can control BA synthesis pathways in the liver, while BA transport in the enterohepatic cycle alters the composition, size, and distribution of the BA pool, which in turn can have a significant impact on BA signaling and its downstream metabolic targets . FXR is Lactobacillus, Lactococcus, Streptococcus, Bacillus, and Bifidobacterium, and the highest enzymatic activity was reported for BSH-T3 present in Lactobacillus [Lactobacillus reduces BSH activity and leads to changes in the composition of BA, ultimately alleviating obesity [Lactobacillus, Lactococcus, Streptococcus, and Lactobacillus vaginalis was strongly associated with hyperlipidemia; also, these genera and the expression of CYP7A1 and CYP8B1 were positively correlated, while Bacillus was negatively correlated with CYP7B1. Our analysis of the gut microbiota showed that PS reduced the relative abundance of Lactobacillus and other BSH-producing gut microbiota in HFD mice, which is probably critical for regulating BA metabolism [Lactobacillus vaginalis. Furthermore, Allobaculum was thought to be positively correlated with HLP, and this was reinforced by the fact that PS intervention resulted in a significant reduction of Allobaculum in HFD mice [As mentioned above, BA synthesis is an important pathway of cholesterol metabolism. Signaling in the hepatic-intestinal axis directly regulates the relationship between gut microbiota and BA metabolism , 55. In bacillus . In cont obesity . Previou obesity . In thistabolism , 62. IntHFD mice , 64.In previous studies, the mechanisms of cholesterol absorption inhibition by PS are mainly focused on competition for binding sites, reduction of cholesterol absorption, and interference with BA metabolism mechanisms , 66. SomIn summary, we found that PS significantly increased the antioxidant function of the liver and alleviated HLP in mice. The mechanism was related to the regulation of cholesterol metabolism and the structure of the gut microbiota. The relative abundance of the gut microbiota is regulated when treated with PS. SHP and FXR were activated, and FGFR4 and TGR5 were inhibited, while the classical pathway of BA synthesis (CYP7A1 and CYP8B1) was inhibited, and the alternative pathway of BA synthesis (CYP27A1 and CYP7B1) was activated treated with PS. Our results partially explain the mechanism of PS treatment of HLP, which may be related to the regulating cholesterol metabolic pathways and the structure of the gut microbiota."}
{"text": "How back pain is related to intervertebral disc degeneration, spinal loading or sports-related overuse remains an unanswered question of biomechanics. Coupled MBS and FEM simulations can provide a holistic view of the spine by considering both the overall kinematics and kinetics of the spine and the inner stress distribution of flexible components. We reviewed studies that included MBS and FEM co-simulations of the spine. Thereby, we classified the studies into unidirectional and bidirectional co-simulation, according to their data exchange methods. Several studies have demonstrated that using unidirectional co-simulation models provides useful insights into spinal biomechanics, although synchronizing the two distinct models remains a key challenge, often requiring extensive manual intervention. The use of a bidirectional co-simulation features an iterative, automated process with a constant data exchange between integrated subsystems. It reduces manual corrections of vertebra positions or reaction forces and enables detailed modeling of dynamic load cases. Bidirectional co-simulations are thus a promising new research approach for improved spine modeling, as a main challenge in spinal biomechanics is the nonlinear deformation of the intervertebral discs. Future studies will likely include the automated implementation of patient-specific bidirectional co-simulation models using hyper- or poroelastic intervertebral disc FEM models and muscle forces examined by an optimization algorithm in MBS. Applications range from clinical diagnosis to biomechanical analysis of overload situations in sports and injury prediction. When humans evolved to adopt an upright position, the spine became a central structure of the human biomechanical system. As such, it can be a source of pain that can significantly impact a person\u2019s quality of life. Intervertebral disc (IVD) degeneration and herniation are possible causes of back pain. Research has shown that both aging  and overMultibody simulation (MBS) is widely used to gain insights into the healthy and pathological biomechanics of the spine from a macroscopic perspective. MBS models study joint reaction forces, muscle forces and muscle activation patterns in combination with respective movements or positions. There are several such models that include intervertebral joints with three rotational ,17,18,19Finite element method (FEM) spine models aim to simulate deforming bodies in a detailed manner to reveal their inner stresses. Models may include the whole spine, a segment or only an IVD. Most models contain manually created geometries for IVDs and vertebrae , but recIn summary, MBS models are suitable for investigations of the overall kinematics and kinetics of the trunk, or even the full body. However, detailed information on flexible body deformation and internal stress cannot be provided. Complex, heterogeneous structures, such as the IVD, or even entire functional spinal units (FSU) combining all stabilizing structures , are reduced to a resultant mechanical response to external deformation, often in reference to an approximated center of rotation. In contrast, FEM models are beneficial for simulating detailed structures and analyzing inner stresses and deformations. However, detailed FEM meshes may cause large computational costs, and thus, models often include simplifications. Additionally, defining realistic boundary conditions (BC) for FEM models remains a main challenge due to the lack of possibilities for in vivo measurements. Until now, no satisfactory, broad investigations are available containing this data .Coupling MBS and FEM takes advantage of the strengths of each method and offers great potential to analyze the deformations and stresses of IVDs while considering the overall kinematics and kinetics of the trunk. How coupling is implemented can be subdivided into two approaches: One is to calculate acting forces or present deformations completely before starting the other simulation . The second approach considers acting forces or displacements anew in every increment of an ongoing simulation, generating a constant, bidirectional data flow. Unidirectional coupling commonly includes an inverse dynamic MBS simulation with resulting forces and moments, which are subsequently used as loading and BCs in an FEM model ,41,42,43Hence, by using co-simulation, we can examine the pathological spine in a holistic way to analyze the interactions of various factors, such as motion, posture, back pain and the biomechanics of the IVD. In this work, we review advances in coupled MBS and FEM simulations of the spine. Specifically, we excluded reduced order models and instead focused on the type of data exchange, whether unidirectional or bidirectional, as this is essential for the simulation of large deformations and constant interactions of different components in the spine.Coupling MBS and FEM models has become a common practice in spine modeling during the last decade. However, no terminology has been established yet to differentiate between what are here called unidirectional and bidirectional co-simulation. To achieve comprehensive coverage of studies using co-simulation, the following keywords were searched in several combinations in different databases: coupled, spine, multibody, MBS, FEM, hybrid, finite element, co-simulation, combined. Resulting articles were manually reviewed and included only if they: (i) contained a type of coupling between MBS and FEM and (ii) were published after 2009 or included models that were still used in studies published after 2009.We first reviewed MBS and FEM models of the spine using unidirectional coupling, which was characterized by the execution of one simulation and the integration of the results into another simulation. Considering the order of execution, three distinct methods of coupling were identified: MBS execution and transfer of data to an FEM simulation; FEM and transfer of data to MBS; and a threefold data transfer from FEM to MBS and to FEM again. A unidirectional data transfer from MBS to FEM was the most common approach in unidirectional coupling. Muscle forces, reaction forces or displacements were calculated by an MBS simulation and integrated as boundary conditions (BC) in a subsequent FEM simulation.Esat et al. ,38 estabDu et al.  investigHenao et al.  simulateHonegger et al.  investig(I)The first model included an initial, detailed FEM representation of the spine.(II)The second model was based on the detailed model but consisted of rigid bodies and interconnecting beam elements. It is later referred to as the musculoskeletal (MS) model.A research group bulit around Shirazi-Adl and Arjmand has been developing numerical models of the spine since 1985  and has Version II was not solved with a classic MBS solver, but included clear characteristics of an MBS model, such as the involvement of mainly rigid bodies and their interconnections by joint-like components. While version II could not represent detailed deformations, it was able to perform large numbers of nonlinear analyses . The resIn 2002, Shirazi-Adl et al.  incorporAzari et al.  modifiedm and reaction moment MCoR, for each muscle. Reaction forces were considered as the sum of gravitational forces and muscle forces. The resulting forces and moments in a static equilibrium condition calculated in the MS model were applied to the vertebral growth plate FEM bodies as distributed pressures and shear stresses. Note, IVDs were solely considered as joints, and the biomechanical focus lay on the growth plates. FEM simulations were carried out with Abaqus . The resulting stresses in the growth plates were comparable with results from the literature and may be helpful in predicting growth patterns in scoliotic spines.To analyze scoliotic spine loads and their growth patterns, Kamal et al.  establisFurther studies included a hybrid model applying muscle forces calculated in the beam-joint-based MS model (II) to the updated, passive T12-S1 FEM model (I) . The MS In order to develop a self-defined gold standard of spine modeling, Rajaee et al.  further To sum up, multiple simulation approaches have been executed using MBS simulation results in FEM models. Transferred data included reaction forces, muscle forces or displacements of vertebrae on different spine levels. The vast majority of MBS studies rely on experimental data to define joint properties of the IVDs. However, one study investigated the potential of FEM simulations to define MBS model properties.Karajan et al.  investigThe resulting MBS model with adapted stiffness parameters could potentially be further used to provide information for a detailed FEM simulation, calculating stresses and deformations. This step has been realized by some research groups. Studies are reviewed in the following.To investigate the effects of muscle damage as seen in lumbar interbody fusion surgery, Kumaran et al.  used mulIn 2021, Meszaros et al., presented a study in which they adapted an established neuro-musculoskeletal spine model  to matchR line of action until it reached to MBS-predicted position. The novel reaction force RF obtained was iteratively compared with the initial reaction force FR while adjusting the translation, until the difference was smaller than a predefined tolerance. In a follow-up work, Liu and El-Rich used the same model, reduced to one functional spinal unit (L4\u2013L5), to investigate the influences of the NP position on the IDP, spinal loads and load sharing during 60\u00b0 forward flexion. Based on in vivo data, three posterior shifts of the NP were realized by the models: 0, 1.5 and 2.7 mm. Muscles and ligaments forces, and joint forces and moments at L3\u2013L4 were calculated by the MBS model and prescribed to the FEM model. IDP and spinal loads calculated by the FEM model show that the IDP and compressive forces within an FSU were distinctly influenced by the posterior shifts of the NP, and the CoRs calculated by their MBS and FEM model differ. Liu and El-Rich believe the kinetic results predicted by the MBS model to have been affected by single IVD rotating joints and suggest implementing an iterative process combining MBS and FEM models to account for compressive and shear stiffness. [Load sharing in the lumbosacral spine was explored by Liu et al.  in 2018 iffness. Refer to Independent of the data transfer being solely from MBS to FEM, from FEM to MBS or both, unidirectional co-simulation was often limited by linear deformations and manual adaption processes to synchronize both models ,40,42. TBidirectional co-simulation models benefit from an iterative data exchange that requires less manual intervention and more accurately accounts for large deformations of, e.g., IVDs. Approaches using this type of coupling are listed below, again focusing on how data are exchanged between MBS and FEM models.Monteiro et al.  realizedAnother coupling method was implemented by Dicko et al.  in combiIn 2021, Remus et al.  publisheRefer to Most co-simulation models of the spine use a unidirectional coupling approach, transferring data singularly from one simulation to the other by applying both simulation methods consecutively. MBS spine models can profit by defining joint stiffness parameters based on FEM simulations of the IVD. FEM models of the spine or spinal components can be improved when muscle or ligament forces and moments are implemented as BCs. However, when providing a time-dependent input, the time-dependency is influenced by the deformation properties of a material or component. Equal mechanics cannot be expected when comparing FEM and MBS IVD representations due to their different modeling approaches. The input accomplished by the results of the MBS initially carried out is therefore only partly suitable for being incorporated in a subsequent FEM simulation. This limitation is demonstrated in the effort that has been put into synchronizing the respective models of the unidirectional co-simulations. The manual adaption steps that become necessary may provoke inaccuracies and take much time. Kumaran et al. , for exaTo overcome these limitations, a few recent studies have implemented bidirectional co-simulations of the spine. By updating the deformation values of the IVDs and the resulting positions of the vertebrae in every increment, updated reaction moments and forces of muscles, tendons and ligaments can be considered. Of the research groups using bidirectional co-simulation models, all authors found that their models were able to deliver accurate results ,47,73. HThe particle-based approach divides the whole model into two types of particles, rigid and flexible ones ,73,74. TDespite these limitations, bidirectional co-simulation models of the spine can provide a holistic understanding of the spine because they consider both the overall kinematics with the muscular and gravitational forces and moments, and the detailed mechanics of the IVDs with their deformations and stress distributions.FEM is broadly used in detailed analyses of internal stresses in deforming bodies but lacks computational efficiency. MBS is more efficient, but can only achieve a certain degree of detail when it comes to deformations of model components. A combination of both methods, not only in a unidirectional way, but in a bidirectional manner of data exchange, can provide both accuracy and efficiency.Future studies will likely include widespread use of bidirectional co-simulation models to understand and predict the behavior of the spine. Including automated segmentation algorithms such as the one implemented by Sekuboyina et al.  could ac"}
{"text": "Disordered urban environments negatively impact mental health symptoms and disorders. While many aspects of the built environment have been studied, one influence may come from inequitable, discriminatory housing practices such as redlining, blockbusting, and gentrification. The patterns of disinvestment and reinvestment that follow may be an underlying mechanism predicting poor mental health. In this study, we examine pathways between such practices and internalizing symptoms  among a sample of African American youth in Baltimore, Maryland, considering moderation and mediation pathways including neighborhood social cohesion and sex. In our direct models, the inequitable housing practices were not significant predictors of social cohesion. In our sex moderation model, however, we find negative influences on social cohesion: for girls from gentrification, and for boys from blockbusting. Our moderated mediation model shows that girls in gentrifying neighborhoods who experience lower social cohesion have higher levels of internalizing symptoms. Likewise for boys, living in a formerly blockbusted neighborhood generates poorer social cohesion, which in turn drives higher rates of internalizing symptoms. A key implication of this work is that, in addition to standard measures of the contemporary built environment, considering other invisible patterns related to discriminatory and inequitable housing practices is important in understanding the types of neighborhoods where anxiety and depression are more prevalent. And while some recent work has discussed the importance of considering phenomena like redlining in considering long-term trajectories of neighborhoods, other patterns such as blockbusting and gentrification may be equally important. Internalizing symptoms (including anxiety and depression) are relatively common across adolescence , but minWhile redlining was outlawed in 1968, the decades-long practice of excluding minorities from access to mortgages created huge gaps in accrued wealth. The ensuing practice of blockbusting and white flight\u2014generated by the mortgage and banking industry in the 1970s and 1980s to spark panic selling and \u201cflip\u201d previously all-white neighborhoods \u2014led to aDisinvested urban environments trend with higher rates of anxiety and depression among youth , though In the current study, we examined: (a) whether inequitable housing practices\u2014specifically redlining, blockbusting, and gentrification\u2014were associated with internalizing symptoms, (b) whether these practices predict levels of neighborhood cohesion for boys and girls, and (c) whether neighborhood social cohesion mediated the relation between these neighborhood practices and internalizing symptoms. We examine all three practices in this article because the associations between the processes and outcomes are likely distinct, and merit consideration.Such practices are essential to consider and correct because the decades-long processes of structural racism in housing make us more vulnerable to the impacts of climate and urban change . America1.1.1.1.1.Redlining and blockbusting are two inequitable housing practices that have upheld racial and economic residential segregation and are responsible for vast differences in the quality of the built environment. Prior to 1968, no federal law ensured fair housing for all races . StartinFollowing redlining\u2019s prohibition, blockbusting was used to maintain segregation. Real estate agents and the mortgage industry colluded to create panic selling in previously all-white neighborhoods, convincing white residents to sell low and re-selling these homes at a premium to African American and other minority families . BlockbuIn addition to the direct financial implications of housing discrimination , it also1.1.2.Gentrification commonly entails an in-migration of middle-income residents, while spurring displacement of lower-income residents . It ofteA number of studies have linked gentrification with myriad health outcomes, although findings are mixed . GentrifHowever, there is also evidence that gentrification may contribute to better health outcomes. For example, increased empowerment for community improvement and cross-cultural exchange may bring new opportunities . Moreove1.2.Inequitable housing practices uphold racial and economic residential segregation and influence unequal access to resources and treatment  that creWhile segregation may have a protective effect on mental distress via living among one\u2019s own group , it typiPeople in segregated or resource-scarce neighborhoods may also internalize these environments as a personal deficit instead of seeing the structural racism that caused it, which may contribute to feelings of depression and anxiety. Conversely, racist societal assumptions contribute to the racial empathy gap and implicit bias that is negatively experienced among minority populations. Ethnic density can lessen depressive symptoms to a point but is shown to contribute to higher levels in highly segregated neighborhoods . AdditioWhere new investments do take place (often in areas considered to be gentrifying), the resulting housing inequalities may confer risk for internalizing symptoms among existing youth. For example, research suggests that more affluent older adults reported higher levels of anxiety and depressive symptoms relative to adults living in more economically depressed areas which may be due to concerns over increases in the cost of living, and anxiety regarding housing displacement and closure of businesses .1.3.Neighborhood social cohesion is defined by one\u2019s sense of community, neighborly trust, and the positive social interactions that occur therein . While hIndeed, research suggests that social connectedness may buffer against the negative impacts of gentrification, particularly among vulnerable populations , althoug1.4.While it is possible that historical neighborhood practices and perceived neighborhood cohesion may impact internalizing symptoms, there is reason to believe that sex differences may impact these relations. For example, living in a low-income neighborhood has been shown to predict social anxiety for girls, but not boys . AdditioIn addition, girls may be impacted more by their environments than boys . For exa1.5.To address the existing gaps in the literature, the current study examined pathways between inequitable housing practices and internalizing symptoms and the differential impact of these effects on boys and girls. We hypothesized that (a) there would be a direct and positive effect of inequitable housing practices on internalizing symptoms, (b) housing practices would also predict neighborhood cohesion and that these relations would be further moderated by sex, and, finally, (c) neighborhood cohesion would mediate the relation between housing practices and internalizing symptoms in both boys and girls.2.Participants were predominantly African American youth from Baltimore, Maryland, originally recruited for the Youth Opportunity (YO) program. The YO program\u2019s goals are to increase access to educational, occupational, and training opportunities for adolescents and young adults . The YO Mage = 18.76, SD = 1.71). Given the very small percentage of the sample that was not African American, only African Americans were included in the analyses . Approximately 60% of the sample participated in one of the YO programs and about 10% of the sample reported being employed (see Data were collected at three time points: baseline (when the study began in 2008), six months post-baseline, and one to two years post-baseline. Baseline data for the current study included 782 youth , reverse coded, and summed with higher scores reflecting higher levels of social cohesion. In the current sample, the measure demonstrated excellent internal reliability .We assessed neighborhood social cohesion using a three-item scale developed by 2.1.2.For each participant, we joined variables denoting whether they lived in an area that had been redlined, blockbusted, or gentrified  and summed to create a composite score (\u03b1 = 0.90). The measure demonstrated excellent internal reliability in the current sample .Internalizing symptoms were assessed by creating a composite of measures of anxiety and depressive symptoms. Anxiety symptoms were evaluated using the BAI . The BAIrarely or none of the time to 4 = most or all of the time) and summed to create a composite score (\u03b1 = 0.86). In the current sample, the measure demonstrated internal reliability . The anxiety and depression composites were z-scored  and summed to create an internalizing symptom composite .Depression symptoms were assessed using the CES-D . The CES2.2.Patterns of missing data and univariate normality were examined for all variables. Means and standard deviations between key study variables were also evaluated. Inequitable housing practices were examined in separate models to reflect the distinct time periods and investment patterns of each practice. Each of the hypotheses regarding the effects of inequitable housing practices was tested in a series of main effect and mediation models. First, the direct effects of sex, age, and each of the three inequitable housing practice predictors  on internalizing symptoms were evaluated. Second, the main effects of housing practices on neighborhood cohesion were examined. Next, we examined whether these relations were moderated by sex. Finally, we evaluated a moderated mediation model in which we examined whether the indirect pathway from inequitable housing practices to internalizing symptoms via neighborhood cohesion differed for boys and girls see .All analyses were run in SPSS Version 24 using the PROCESS macro. Non-parametric bootstrapping procedures  were utilized to evaluate the significance of the indirect effects as well as examine an index of moderated mediation. Unlike hypothesis testing based on parametric statistics, bootstrapping procedures do not assume that the indirect effect (the product of the effect of the independent variable to the mediator and the effect of the mediator on the outcome) is normally distributed . Indirec3.r = \u22120.39) and gentrification (r = \u22120.31) were moderate and negative, while the relation between redlining and gentrification was moderate and positive (r = 0.35). Results for the primary analyses are presented below.Very low rates of missing data were found for each variable (0\u20133.7%). All dependent variables were found to be within acceptable ranges for skew and kurtosis (\u22643.0). The correlations between blockbusting and both redlining  in three separate models. Across all models, only sex and age were significant predictors of internalizing symptoms, which indicated that girls and older youth experienced greater levels of symptomatology.3.2.In our second set of models, we examined inequitable housing practices as predictors of neighborhood cohesion in three separate models. In each of the models, only younger age was consistently linked to greater perceived neighborhood cohesion. Sex was also associated with neighborhood cohesion, indicating that boys reported higher levels of perceived neighborhood cohesion. None of the inequitable housing practices was a significant predictor of cohesion.3.3.\u03b2 = \u22120.233, p = 0.050), such that there was a negative effect of gentrification on neighborhood cohesion for girls only ; however, this effect was in the opposite direction. Results suggest a significant, negative effect of blockbusting on neighborhood cohesion for boys only, indicating that boys who lived in areas with higher rates of blockbusting reported less neighborhood cohesion . The first model found a marginally significant interaction between gentrification and sex . Moreover, the difference between the indirect effects for boys and girls was statistically significant . These findings indicate girls exposed to higher rates of gentrification experienced lower neighborhood cohesion which, in turn, predicted elevated levels of internalizing symptoms . Results support a moderated mediation model, indicating a significant indirect effect of gentrification on internalizing symptoms for girls only . The index of moderated mediation was also significant  suggesting these differences were statistically significantly different between boys and girls.Our next set of models evaluated a mediation model in which exposure to blockbusting predicted neighborhood cohesion which, in turn, predicted internalizing symptoms (controlling for participant age and sex). Findings suggest that the direct effect of blockbusting on internalizing symptoms was not significant, nor was the indirect effect via neighborhood cohesion. We then added sex as a moderator of the pathway from blockbusting to neighborhood cohesion within the larger mediation model (continuing to control for participant age). Results indicate that a significant interaction effect between sex and blockbusting predicting neighborhood cohesion in the same pattern as reported above. Findings suggest a significant moderated mediation effect, indicating that living in a historically blockbusted area was associated with lower neighborhood cohesion for boys only and that this, in turn, predicted higher rates of internalizing symptoms , we found no direct or indirect effect of redlining on internalizing symptoms. We then considered a moderated mediation model (controlling for participant age). We found that sex did not moderate the pathway from redlining to neighborhood cohesion and that there was not a significant moderated mediation effect. All moderated mediation models were also run controlling for each of the other housing practices. An identical pattern of results emerged.4.Our first major finding is that girls living in gentrifying neighborhoods reported lower perceived neighborhood cohesion, which in turn predicted elevated levels of internalizing symptoms. The fact that girls in gentrifying neighborhoods experienced greater levels of internalizing symptoms suggests that neighborhoods may fail to incorporate some existing residents into the new and changing social life of the community, which contributes to the development of internalizing symptoms, particularly among girls.A second major finding was that boys living in previously blockbusted neighborhoods reported less neighborhood cohesion which in turn predicted higher rates of internalizing symptoms. Blockbusted neighborhoods are effectively places of severe white flight and disinvestment . That boOur analyses did not find any impacts of redlining on social cohesion or internalizing symptoms. Although the impacts of redlining on inter-generational wealth and other issues remain unresolved, the lack of an association suggests that people physically living in these spaces do not experience significantly worse outcomes than people in other neighborhoods. And while redlining and gentrification were coincident in some cases , blockbuGiven the significant effects of blockbusting on health outcomes, these findings are important; they illustrate the need for land use policies that address legacy effects of types of housing discrimination beyond redlining. Such understanding is essential for future urban planning approaches that aim to build more equitable cities.4.1.Despite these strengths, our findings should be considered in light of a few limitations. First, the study utilized a cross-sectional design, which prevented us from disentangling the temporal relations between neighborhood cohesion and internalizing symptoms. It is possible that youth who experience higher levels of internalizing symptoms may, in turn, experience their neighborhoods as less interconnected. Second, we utilized self-report assessments to capture individuals\u2019 perceptions regarding both neighborhood characteristics and internalizing symptoms, which may have introduced bias related to shared method variance. Subsequent research into these domains may consider using other methods to evaluate neighborhood cohesion, including social network analyses, to more objectively capture these relations. Third, few studies have used an operational GIS-based definition of blockbusting as in . While t4.2.As the fields of public health and urban planning continue their path toward reconnection , we alsoSpecifically, our use of GIS to connect individual participants\u2019 neighborhoods to inequitable housing practices is particularly novel. This approach allowed us to capture objective measures of historical neighborhood characteristics and examine the influence of participants\u2019 perceptions of neighborhood cohesion and mental well-being. Additional strengths of the study include the careful examination of the role of participant sex in study constructs. While other studies suggest that geographic characteristics may impact boys\u2019 and girls\u2019 mental health differentially , this isThese results have potential policy applications, as they demonstrate the impacts of decades of housing practices on mental health outcomes. These findings highlight the need for considering mental health in determining housing policy  and sugg"}