{"text": "Traditional methods of measuring oral health mainly use clinical dental indices and have been complemented by oral health related quality of life (OHRQoL) measures. Most OHRQoL studies have been on adults and elderly populations. There are no systematic OHRQoL studies of a population-based sample of children. The objective of this study was to assess the prevalence, characteristics and severity of oral impacts in primary school children.Cross-sectional study of all 1126 children aged 11\u201312 years in a municipal area of Suphanburi province, Thailand. An OHRQoL measure, Child-Oral Impacts on Daily Performances index (Child-OIDP) was used to assess oral impacts. Children were also clinically examined and completed a self-administered questionnaire about demographic information and oral behaviours.89.8% of children had one or more oral impacts. The median impact score was 7.6 and mean score was 8.8. Nearly half (47.0%) of the children with impacts had impacts at very little or little levels of intensity. Most (84.8%) of those with impacts had 1\u20134 daily performances affected (out of 8 performances). Eating was the most common performance affected (72.9%). The severity of impacts was high for eating and smiling and low for study and social contact performances. The main clinical causes of impacts were sensitive tooth (27.9%), oral ulcers (25.8%), toothache (25.1%) and an exfoliating primary tooth (23.4%).The study reveals that oral health impacts on quality of life in Thai primary school children. Oral impacts were prevalent, but not severe. The impacts mainly related to difficulty eating and smiling. Toothache, oral ulcers and natural processes contributed largely to the incidence of oral impacts. Contemporary concepts of health suggest that dental health should be defined in physical, psychological and social well-being terms in relation to dental status ,2. That A number of socio-dental or OHRQoL measures have been developed and used for assessing oral well-being and to describe oral impacts on people's quality of life . GeneralMost studies using OHRQoL to assess oral impacts of the mouth and teeth have been on adults and elderly populations. Few studies have been done on children possibly because no OHRQoL measures designed for use with children existed until recently. A single measure, dental pain, has been used on children in Malaysia  and in SA cross-sectional survey was carried out in a municipal area of Muang district, Suphanburi province, Thailand. The sample was all 1,126 students aged 11\u201312 years, in the final year class of all primary schools (grade 6) in the area.Data were collected through: a) an interview for oral impacts using the Child-OIDP , by one The protocol of the study was approved by the Ethical Committee of the Ministry of Public Health of Thailand. Primary education and local health authorities as well as all primary schools in the study areas gave permission. Positive consent forms and letters informing parents were sent to parents.Two comprehensive OHRQoL measures specifically for use with pre-adolescent children have recently been developed; the Child Perceptions Questionnaire (CPQ11-14)  and the The procedure for using the Child-OIDP began with a self-administered questionnaire carried out with all children as a group in their classroom. The questionnaire contains a list of all oral problems that children are likely to perceive and also include an open answer for any unexpected perceived problem. It was developed during a pilot study, as a modification from the one used in the original OIDP. Children were asked to identify oral problems that they perceived in the last three months. This step aimed to focus children's attention to their oral health problems and to lead to the oral impacts assessment later. Their answers here were used only as a guide to investigate oral impacts on daily performances in the next step and were referred to when they were asked about the causes of oral impacts in individual interviews. Thereafter, children were individually interviewed, irrespective of their answers at the first step, to assess oral impacts on daily life in relation to 8 daily performances. The 8 performances were: a) eating, b) speaking, c) cleaning teeth, d) relaxing, including sleeping, e) smiling, laughing and showing teeth without embarrassment, f) maintaining emotional state, g) study, including going to school and doing homework and h) contact with other people. The individual interviews were aided by 16 pictures (negative and positive pictures for each performance). If children reported an impact on any performance, the frequency of the impact and the severity of its effect on their daily life were scored. Children were also asked to identify oral problems that in their opinion, caused the impact. The oral problems were identified from the list complied in the first step of the assessment.The oral impact score of each performance is obtained by multiplying severity and frequency scores, 0, 1, 2 or 3 each, in relation to that performance. Therefore scores can range from 0 to 9 per performance. The overall impacts score is the sum of all 8 performances (ranging from 0 to 72) divided by 72 and multiplied by 100. An alternative method of reporting the severity of oral impacts, from the same data set, is to use the 'intensity' and 'extent' of impacts. The intensity refers to the most severe impacts on any of the 8 performances or the highest performance score. It is classified into 6 levels; none, very little, little, moderate, severe and very severe  completed all stages of the survey. 52.4% were male and 47.6% were female. Their mean age was 11.3 years (sd = 0.6). The highest percentage of their fathers were agricultural workers or labourers (34.5%), 30.5% worked in business/private, 27.5% in governmental sectors, 2.1% did not work and 5.4% of children did not have a male guardian. The highest percentage of mothers worked in business/private (38.6%), 24.5% in agriculture, 21.1% in governmental organisations. 14.9% did not work and 1.0% did not have a female guardian.This population had a low level of dental caries: 43.1% were caries free and the DMFT scores ranged from 0 to 12 with a median score of 1.0 and a mean of 1.5 (\u00b11.8). Almost all children (97.0%) had a Community Periodontal Index (CPI) score of 1 or more; 84.2% had calculus. In terms of oral hygiene status, 5.4% had good, 69.1% had moderate and 25.5% had poor oral hygiene. OHI-S scores ranged from 0.5\u20135.5 with a median of 2.5 and mean score of 2.5 (\u00b10.9), indicating a moderate level of oral hygiene.The prevalence of oral impacts was high; 89.8% of children had experienced some kind of oral impact on their daily life during the past three months. There was no difference between the prevalence of impacts in girls and boys (Chi-square test). Impacts on Eating were the most prevalent 72.9%). The prevalence of impacts on Emotion (58.1%), Cleaning teeth (48.5%) and Smiling (40.1%) were also relatively high. The remaining prevalences of impacts were lower, namely Study (15.4%), Relaxing (14.7%), Contact with people (12.2%) and Speaking (9.9%) ; 16.2% had 1 PWI, 23.3% had 2, 26.9% had 3 and 18.4% had 4 PWIs. Few children had 5 or more PWIs. About 1 in 5 children had severe or very severe intensity of impacts; 18.7% had severe and 2.6% had very severe intensity of impacts.15.9% had very little, 31.1% had little and 31.7% had moderate intensity of impacts . This is surprising in that this was a low caries population in an area with a free accessible school dental service. Although there is no study using OHRQoL index with a population-based sample of 12 year olds to compare with, findings of previous OHRQoL studies suggest that oral impacts are very common in children of this age. In Brazilian adolescent populations, the prevalence of impacts was 32% ,20 and 69.8%. ThiDespite the fact that oral impacts were prevalent in this Thai child population, they were not severe. For example, half of this population had Child-OIDP score less than 7.6 and half of those with impacts had very little or little intensity of impacts Table . MoreoveThis study found that eating was the most important aspect of OHRQoL of children. Difficulty with eating due to oral problems was the most common impact (72.9%), and led to more severe oral impacts on children's quality of life than impacts on other performances. Oral ulcers and exfoliating primary teeth contributed to eating difficulties in nearly half of those with impacts. The finding that eating was the most common performance affected is similar to all studies using the OIDP in all age groups ,21-24. TDifficulty with smiling was another important aspect of children's OHRQoL. It affected 40% of children. The most prevalent cause was position of teeth. Dissatisfaction with position of teeth, moreover, accounted for oral impacts in 1 in 5 of all children Table . AlthougGum problems were the other important oral conditions affecting children's OHRQoL. More than one fifth of children perceived that bleeding and swollen gums caused oral impacts on their life, particularly in relation to difficulty cleaning, a problem experienced by nearly half of all children Table . ChildreAn interesting finding was that impacts relating to social dimensions, such as study being affected and contact with people, were less common and least severe. Schor suggested that children's social performances rely more on their physical and psychological performances than adults .It is apparent that an important reason for the high prevalence of oral impacts in children is natural processes such as exfoliating primary teeth or spaces due to a non-erupted permanent tooth. They contributed largely to the high incidence of impacts in these pre-adolescent children. On the other hand, these conditions were not reported as important causes of oral impacts in other age groups ,22. The Although children could often not specify precisely which impairments led to impacts, the question of perceived clinical causes should exclude impacts from some conditions which are definitely not related to actual impairments as well as to treatment needs. For example, toothache, ulcers and conditions relating to appearance definitely require different treatment and could be easily differentiated. However, the accuracy of detecting perceived impairment is limited in a population-based study, while it can be improved at the individual level of investigation.The specific age group under investigation, particularly in relation to their stage of development, may have influenced the high prevalence of oral impacts. Developmental changes unavoidably affect HRQoL between childhood and adolescence . MaturitThe prevalence of oral impacts on daily performances in this child population was very high. Oral impacts affected children's quality of life mainly through difficulty eating and smiling. There are various oral conditions that contributed significantly to the incidence of impacts, namely, sensitive teeth, toothache, oral ulcers and exfoliating primary teeth. Although the prevalence of impacts was high, the severity was not; many children had their quality of life affected at low levels. This reveals a need for further longitudinal studies to better understand and interpret OHRQoL measures in children.SG carried out all work including data collection, data analysis and writing the paper. GT supervised the project and assisted writing. AS initiated the idea of, and supervised the project and edited writing."}
{"text": "Human tooth pulp was extracted from teeth harvested from a total of twenty-two patients .Using specific antibodies for immunohistochemistry, we studied Nav1.8, were significantly increased on image analysis in the painful group: median (range) Nav1.8 to Neurofilament % area ratio, non-painful 0.059 (0.006\u20130.24), painful 0.265 (0.13\u20130.5), P = 0.0019.Fibres immunoreactive for Nav1.8 sodium channels may thus represent a therapeutic target in trigeminal nerve pain states.Na Pain is the most common symptom of diseased tooth pulp, often a result of coronal caries of the tooth, affecting up to 80% of the western population during their lives. The mature human dental pulp is densely innervated with over 900 axons entering the average human premolar tooth  that oriv1.8, (SNS/PN3) have been the focus of research in pain mechanisms [v1.8 in human sensory neurones [v1.8 in predominantly small medium sized neurons in human DRG, it is likely that Nav1.8 is present in both A delta and C fibres [Voltage-gated sodium channels play key roles in the pathophysiology of pain and are distinguished according to their sensitivity to the neurotoxin tetrodotoxin (TTX) as fast-activating TTX-sensitive (TTX-S) channels, or slow-inactivating TTX-resistant channels (TTX-R). The distribution and pathophysiology of these channels, particularly Nachanisms . Recentlneurones ; the chaC fibres ,10.v1.8-immunoreactivity within tooth pulp nerve fibres.This study aimed to assess if pulpal pain associated with caries was associated with any change of NaPatients scheduled for dental extraction at Guy's Dental Institute, London, were included in the study, subsequent to providing consent in accordance with the local research ethics committee.22 permanent molar teeth about to be extracted were tested, 1 hour prior to extraction, for vitality using an electric pulp tester  and with ethyl chloride to confirm the neural vitality of the dental pulp. A pain history was also collected (existing pain and duration). The patients were divided into two groups, those with existing pain from the tooth (n = 8 patients age range: 40.3 \u00b1 4.0 years) and those with no history of or existing pain (n = 14 patient age range: 37.3 \u00b1 14.6 years). The gender distribution of the groups was M:F 1:1. All the dental pain in this study was attributable to pulpitis due to extensive dental caries of the molar tooth, the duration of pain was 2.9 weeks (range 0.5\u20138), and the indication for extraction of the non-painful teeth was pericoronitis. All the teeth were removed by standard buccal approach under local or general anaesthesia. Subsequent to the extraction process (lasting less than 5 min), the teeth were sectioned vertically with a water-cooled drill and the pulp lifted out, and specimens immediately snap-frozen at -70\u00b0C. Intentional examination of the coronal pulp, including the densely innervated subontoblastic layer, was assisted by careful orientation of the pulp on a marked sterile card. Based on the number of inflammatory cells present, the inflammation was graded in accordance with local histological standard scales, which were mild, moderate or severe.v1.8 (K107), whose specificity has been described by us previously [v1.8 antibody (K107), showing positive staining in human DRG neurons, and no staining in pre-absorption experiments using Nav1.8 peptide in tooth pulp sections, were performed as previously described [Frozen pulp or nerve were embedded in OCT medium  and sections of 12 \u03bcm thaw-mounted onto glass slides pre-coated with poly-L-lysine. Sections were immersion-fixed in fresh 4% paraformaldehyde in phosphate buffered saline (PBS) for 30 min, then endogenous peroxidases blocked by incubation with alcoholic 0.3% hydrogen peroxide for a further 30 min. Sections were incubated overnight with a monoclonal antibody to the neuronal marker neurofilament  and a polyclonal antibody against the Naeviously . Sites oescribed .v1.8 and neurofilament immunoreactivity in fibres were quantified using computerized image analysis . Quantification of the data was performed using 12-micron thick serial sections. Images were captured via video link to an Olympus BX50 microscope  and scanned by computer. Setting grey-level detection limits at threshold, highlighted positive immunostaining, and the area of highlighted fibres was obtained as % area of the field scanned. Scanning was performed for a minimum of 5 fields at random per tissue section orientated longitudinally, assessed in a blind fashion; 3 tissue sections from each pulp were analysed, and the mean value from each patient obtained. Results are expressed as the average percentage ratio of the mean Nav1.8 to neurofilament reactive fibres in 5 fields.NaP values less than 0.05 were considered significant.The Mann Whitney test was used to compare ratios between groups; v1.8 antibody  compared to painful tooth pulp 5.855 (1.3\u20137.52), P < 0.005. There were also significantly more fibres immunostaining for Nav1.8 in relationship to neurofilament positive fibres in the painful pulp, compared with those without pain , and for painful 0.265 (0.13\u20130.5), P < 0.005. A degree of inflammation was seen in all painful pulp samples.By image analysis, neurofilament fibre median % area (range) in non-painful tooth pulp was 13.94 (3.05\u201322.05), and in painful tooth pulp was 18.21 (9.11\u201327.88); there was trend for an increase, but this was not statistically significant. There was a significant change of the corresponding Nav1.8-immunoreactive nerve fibres are present in human dental pulp in the subodontoblastic layer, and the Nav1.8-immunoreactive fibres were increased in the presence of caries-induced painful pulpitis. While there was a trend for increased neurofilament fibres in painful dental pulp, this was not statistically significant. An increase of nerve fibres within inflamed dental pulp, possibly due to nerve sprouting, has been previously reported in the rat dental pulp after dentine injury [v1.8 in this study, our previous study of TRPV1 and P2X3 receptors showed no significant change in painful dental human dental pulp [Neurofilament positive fibres have previously been reported in human dental pulp, including fine unmyelinated fibres in the sub odontoblastic layer ,12. Howee injury , and othe injury ,15. In ctal pulp .v1.8-immunoreactive neurons identified in the subodontoblastic layer implies that these receptors may be involved in signal transduction at the pulp-dentine junction. It is known that sensory neurones and odontoblasts exist in close proximity, but no synaptic or electrical connections have been identified [v1.8 expression by sensory neurons [v1.8-immunoreactivity varies with eruption or maturity of teeth.The presence of Naentified ,12 postu neurons ; NGF is  neurons . The samv1.8-immunoreactivity associated with the nodes of Ranvier in the radicular human tooth pulp. The difference in localisation between the studies could reflect characteristics of the antibodies and immunostaining methods, and further studies, including different techniques and functional assays, are necessary. The relative expression of Nav1.8-immunoreactive fibres to neurofilament positive fibres is low \u2013 this may also be due to the affinity of the antibody used in this study, or reflect the expression of this ion channel in a small sub-set of nerve fibres. The specific type of fibre expressing Nav1.8, the distribution of Nav1.8 throughout the human dental pulp, and the longitudinal changes in the Nav1.8-immunoreactivity caused by pulpal inflammation, all require further study.Although our cross reactivity and pre-absorption studies showed specificity of the antibodies used, the data should be interpreted with caution. Immunostaining of nerves appears to be axoplasmic in this study, and not at the nodes of Ranvier. Recently  Henry anv1.8-fibres as a proportion of neurofilament positive fibres. As Nav1.8 has been implicated in neuropathic pain, its expression by nerve fibres within human tooth pulp may contribute to the pathophysiology of dental pain. Further studies of the time-course of the disease, and severity of pain and/or inflammation, are necessary to elucidate the role and regulation of Nav1.8 ion channels in the pathophysiology of trigeminal pain. Nav1.8 represents a target for novel analgesic agents.In conclusion, nerve fibres in dental pulp from patients with dental pain showed significantly more NaThe author(s) declare that they have no competing interests.V1.8 antibodies used, help with interpretation of the data, and writing the manuscript. CB participated in the conception of the study, development of antibodies, and interpreting the data. PA conceived the study and participated in its design and coordination, interpretation and completion of the manuscript. All authors read and approved the manuscript.TR performed all the surgical procedures, extracted the tooth pulp and helped write the paper. YY participated in the immunohistochemistry, analysis of data and drafted the manuscript. CP, ST and CB were responsible for the design and production of the NaThe pre-publication history for this paper can be accessed here:"}
{"text": "The evolutionary success of mammals is owed in part to their ability to adjust their metabolism to the demands of their environment. For instance, mice faced with dropping external temperatures crank up the output of a specialized type of fat\u2014called brown adipose tissue (BAT) \u2014that generates heat. Faced with a lack of food, they turn on the production of glucose, a highly energetic sugar, by the liver. Both of these adaptive responses depend on a nuclear protein called PGC-1\u03b1. PGC-1\u03b1 simultaneously increases the expression of genes acting at multiple steps along the heat- or glucose-production pathways, thereby quickly boosting the pathways\u2019 efficacy. A related protein, PGC-1\u03b2, shares many of PGC-1\u03b1\u2019s functional characteristics: for instance, both proteins can, when overexpressed in mice, increase the activity of mitochondria, the intracellular organelles that turn sugars and fats into heat or the cellular fuel ATP. To determine what role PGC-1\u03b2 normally plays in energy metabolism, Christopher Lelliott, Gema Medina-Gomez, Antonio Vidal-Puig, and their colleagues created mice lacking the PGC-1\u03b2 gene. Their recent study of the resulting phenotype shows that PGC-1\u03b2 has different functions than PGC-1\u03b1 and plays a subtler role than PGC-1\u03b1 in energy metabolism.As expected from PGC-1\u03b2\u2019s ability to stimulate mitochondrial function, the loss of PGC-1\u03b2 decreased the transcription of genes encoding many of the mitochondrial proteins that generate ATP and heat. Yet the mutant mice appeared essentially healthy under normal conditions. Still, a slight impairment of mitochondrial function might lead to some metabolic imbalance, for instance obesity, since mitochondria burn energy that would otherwise be stored as fat. But the mutant mice were in fact smaller and leaner than their wild-type counterparts. This phenotype did not reflect differences in appetite or digestion, since the mutants ate and eliminated similar amounts of food as wild types. Instead, the mutants had higher metabolic rates than wild types at ambient temperature: they burnt more calories than wild types did to sustain basal physiological functions such as respiration, heartbeat, and body temperature, which would suggest that their mitochondrial functions were increased, rather than decreased.The explanation for these counterintuitive findings is that loss of PGC-1\u03b2 led to increased expression of PGC-1\u03b1 in fat tissues. The researchers propose that the increase in PGC-1\u03b1, which can stimulate heat production in BAT, compensates for the loss of PGC-1\u03b2 at ambient temperature. To remove the compensatory effect of PGC-1\u03b1, the researchers measured the metabolic rate of mutants housed at 30 \u00b0C, a temperature close to body temperature, at which PGC-1\u03b1 expression is largely abolished. At this temperature, mice lacking PGC-1\u03b2 had a reduced metabolic rate, suggesting that PGC-1\u03b2 can contribute to maintaining normal metabolic rates.The mutant mice were able to withstand and adapt to cold, presumably because cold temperatures could still trigger PGC-1\u03b1 expression. However, when mutant mice that were acclimatized to 4 \u00b0C were further stimulated by norepinephrine, a neurotransmitter that normally induces BAT to respond to cold, their BAT heat output was blunted compared to that of wild-type BAT. Therefore, PGC-1\u03b2 must normally play a role in thermal regulation, though its role is obscured by PGC-1\u03b1\u2019s induction at low temperatures.In other tissues such as liver, muscle, and heart, loss of PGC-1\u03b2 did not trigger PGC-1\u03b1 expression, which made the role of PGC-1\u03b2 easier to discern. In the liver, PGC-1\u03b2 proved necessary for the proper disposal of cholesterol and other lipid forms when mice were fed a diet rich in saturated fat. In muscles and heart, PGC-1\u03b2 was found necessary to maintain a normal number of mitochondria. But even with a reduced mitochondrial count, the hearts of mice lacking PGC-1\u03b2 functioned normally. Their only anomaly was a failure to increase their pulse rate properly when challenged with the heart stimulant dobutamine. By comparison, mice lacking PGC-1\u03b1 develop severe heart failure.These observations show that although PGC-1\u03b2 and PGC-1\u03b1 share sequence and functional similarities and are expressed in the same tissues, they cannot completely substitute for one another. The researchers propose that PGC-1\u03b2 maintains basal metabolic functions, whereas PGC-1\u03b1 allows the body to step up it response to high energetic demands."}
{"text": "In 1993, the Intelligent Systems for Molecular Biology conference was successfully launched as an annual meeting for scientific exchange within the nascent interdisciplinary science of computational biology. Demand grew stronger each year for an umbrella organization that extended its reach beyond a once-a-year conference. The International Society for Computational Biology (ISCB) was formed in 1997 to provide computational biologists and bioinformaticians worldwide with a community of peers with whom they could interact year-round in their mutual quest to advance the understanding of living systems through computation. Over the past 13 years, the ISCB has grown and evolved along with the fields of computational biology and bioinformatics. As the society's president, I am proud to report that our membership now comprises nearly 2,000 members in over 50 countries.PLoS Computational Biology, as the official journal of the ISCB, will publish the bylaws of the society. These are the legally registered rules by which the elected and appointed leaders of the society, along with the membership at large, must abide. It is my hope that ISCB members will take the time to read these rules, and to understand, thereby, the legal framework in which ISCB operates. Clearly, as ISCB grows, these rules will be adapted to changing circumstances\u2014knowing the current rules is a first step to making any improvements to them. We also believe that our bylaws may be useful to other groups trying to form similar organizations.Each year, The principal office of the Corporation shall be at San Diego Supercomputer Center, UCSD, 9500 Gilman Drive, La Jolla, CA 92093-0505The Corporation may also have an office or offices in such other place or places as the business of the Corporation may require and the Board of Directors may from time to time appoint.The annual meeting of the members of the Corporation shall be held on a day duly designated by the Board of Directors either within or without the United States if not a legal holiday, and if a legal holiday then the next succeeding day not a legal holiday, for the transaction of such corporate business as may come before the meeting.Special meetings of the members may be called at any time for any purpose or purposes by the Chairman of the Board, the President, a Vice President, or a majority of the Board of Directors, and shall be called forthwith by the Chairman of the Board, the President, a Vice President, the Secretary or any Director of the Corporation upon the request in writing of a majority of all the members entitled to vote on the business to be transacted at such meeting. Such request shall state the purpose or purposes of the meeting. Business transacted at all special meetings of members shall be confined to the purpose or purposes stated in the notice of the meeting.All meetings of members shall be held within or without the United States at a place designated by the Board of Directors. The members may hold their meetings in person, by conference telephone, by E-mail over the Internet or other similar electronic media, or by any combination of the foregoing.Written notice of each meeting of the members shall be mailed, postage prepaid by the Secretary or person appointed by the President or sent by E-mail over the Internet or similar electronic media by the Secretary or person appointed by the President, to each member of record entitled to vote thereat at his or her post office address or E-mail address, as it appears upon the books of the Corporation, at least ten (10) days before the meeting. Each such notice shall state the place, E-mail information if the meeting will be held partly or completely by electronic means over the Internet or other electronic media, day, and hour at which the meeting is to be held and, in the case of any special meeting, shall state briefly the purpose or purposes thereof.The presence in person, by E-mail over the Internet or similar electronic media, or by proxy , of one third of the members of the Corporation shall constitute a quorum at all meetings of the members except as otherwise provided by law, by the Certificate of Incorporation or by these bylaws If less than a quorum shall be in Attendance at the time for which the meeting shall have been called, the meeting may be adjourned from time to time by a majority vote of the members in Attendance, without any notice other than by announcement at the meeting, until a quorum shall be in Attendance. At any adjourned meeting at which a quorum shall be in Attendance, any business may be transacted which might have been transacted if the meeting had been held as originally called.Meetings of members shall be presided over by the President of the Corporation or, if he is not in Attendance, by a Vice President, or, if none of said officers is in Attendance, by a chairman to be elected at the meeting. The Secretary of the Corporation, or if he is not in Attendance, any Assistant Secretary shall act as secretary of such meetings; in the absence of the Secretary and any Assistant Secretary, the presiding officer may appoint a person to act as Secretary of the meeting.At all meetings of members every member entitled to vote thereat shall have one (1) vote. Such vote may be made either in person, by conference call, by E-mail over the Internet or similar electronic media, or by proxy appointed by an instrument in writing subscribed by such member or his or her duly authorized attorney, bearing a date not more than three (3) months prior to said meeting, unless said instrument provides for a longer period. Such proxy shall be dated, but need not be sealed, witnessed or acknowledged. All elections shall be had and all questions shall be decided by a majority of the votes cast at a duly constituted meeting, except as otherwise provided by law, in the Certificate of Incorporation or by these bylaws.If the chairman of the meeting shall so determine, a vote by ballot may be taken upon any election or matter, and the vote shall be so taken upon the request of ten percent (10%) or more of all of the members entitled to vote on such election or matter. In either of such events, the proxies and ballots shall be received and be taken in charge and all questions touching the qualification of voters and the validity of proxies and the acceptance or rejection of votes, shall be decided by members appointed by the chairman of said meeting.The members of the Corporation shall be composed of those individuals who have filled out a registration form and paid their dues. Individuals shall retain their status as members so long as they pay any and all annual dues imposed by the Corporation upon its members.The members of the Corporation shall nominate from the membership, no later than their annual meeting in the manner set forth in the Procedure for Nomination, up to four (4) Directors who shall also be concurrently nominated to hold one of the Nominated Offices as further defined in Article IV, Section 1 below. Said nominations shall be considered strong recommendations from the members to the Board of Directors to elect these individuals as officers and Directors of the Corporation (the \u201cDirector/Officers\u201d). Upon their election by the Directors as set forth in Article III, Section 4 below, these four Director/Officers shall serve as officers of the Corporation for one year in the case of President-elect, and two years for all other officers including President. The four Director/Officers shall also concurrently serve as Directors of the Corporation during their full term as officers plus one year following completion of their term or terms of office, unless removed by the Directors pursuant to the provisions of Article III, Section 4(iv) below. The membership shall follow such rules pertaining to the nomination of officers as are promulgated by the Board of Directors in the Procedure For Nomination adopted as of March 2003 as attached to these bylaws as Exhibit A, or as later amended.The Board of Directors of the Corporation shall be members. A Director who fails to keep his or her membership current during the course of his or her term will forfeit voting rights until current year registration is rectified, or resign from the Board of Directors if not registered by April 1 of the membership year.The property and business of the Corporation shall be managed under the direction of the Board of Directors of the Corporation.The number of Directors, including Director/Officers, shall be twenty eight (28) or such other number, but not less than three (3) nor more than thirty (30), as may be designated from time to time by resolution of a majority of the entire Board of Directors.The term of office of each Director, other than a Director/Officer, shall be for three (3) years; the term of office of each Director/Officer shall be for the duration of the term or terms of office of the officer plus one additional year after the final term as officer.In the case of any vacancy in the Board of Directors, including Director/Officers, the remaining Directors may elect a successor at a regular or special meeting of Directors, by affirmative vote of the majority thereof.In the case of any vacancy in the Director/Officers, the Directors may, but are not required to, ask the members to make nominations under the Procedure for Nomination.If the number of Directors is increased as provided in these bylaws, the additional Directors so provided for shall be elected by an affirmative vote of a majority of the entire Board of Directors already in office to hold office for a three (3) year term.Notwithstanding the foregoing provisions, any Director, including a Director/Officer, may be removed from office as a Director with or without cause by the affirmative vote of a majority of the Directors entitled to vote at any regular or special meeting of Directors called for that purpose. A Director who is a Director/Officer shall be automatically removed as an officer of the Corporation upon his or her removal as a Director.The Board of Directors may hold their meetings and have one or more offices, and keep the books of the Corporation, either within or outside the State of California, at such place or places as they may from time to time determine by resolution or by written consent of all the Directors. The Board of Directors may hold their meetings in person, by conference telephone, by E-mail over the Internet or other similar electronic media, or by any combination of the foregoing.Regular meetings of the Board of Directors may be held at such time and place as shall from time to time be determined by resolution of the Board, provided that written notice of each meeting of the Board of Directors shall be mailed, postage prepaid by the Secretary or person appointed by the President or sent by E-mail over the Internet or similar electronic media by the Secretary or person appointed by the President, to each Director and Director/Officer at his or her post office address or E-mail address, as it appears upon the books of the Corporation, at least ten (10) days before the meeting. The annual meeting of the Board of Directors shall be held within ten days prior to or following the annual meeting of members. Any business may be transacted at any regular meeting of the Board.Special meetings of the Board of Directors shall be held whenever called by any member of the Board of Directors. The Secretary or person appointed by the President shall give notice of each special meeting of the Board of Directors, by mailing the same at least three (3) days prior to the meeting or by E-mailing over the Internet or similar electronic media, the same at least two (2) days before the meeting, to each Director; but such notice may be waived by any Director. Unless otherwise indicated in the notice thereof, any and all business may be transacted at any special meetings. At any meeting at which every Director shall be in Attendance, even though without notice, any business may be transacted and any Director may in writing or by E-mail over the Internet or similar electronic media, waive notice of the time, place and objectives of any special meeting.The presence in person, by conference call, by E-mail over the Internet or similar electronic media, or by proxy appointed by an instrument in writing subscribed by such Director or his or her duly authorized attorney, bearing a date not more than three (3) months prior to said meeting, unless said instrument provides for a longer period   of a majority of the whole number of Directors shall constitute a quorum for the transaction of business at all meetings of the Board of Directors. If at any meeting less than a quorum shall be in Attendance, a majority of those in Attendance may adjourn the meeting from time to time. The act of a majority of the Directors in Attendance at any meeting at which there is a quorum shall be the act of the Board of Directors, except as may be otherwise specifically provided by law, by the Certificate of Incorporation or by these bylaws.An affirmative vote of a majority of those in Attendance shall be necessary for the passage of any resolution.Directors, including Director/Officers, shall not receive any stated salary for their services as such, but, at the discretion and unanimous approval by the Executive Committee, a fixed sum may be allowed for Attendance at each regular or special meeting of the Board and such compensation shall be payable whether or not a meeting is adjourned because of the absence of a quorum. This sum may be disbursed to all Directors, including Director/Officers, or to individual Directors or Director/Officers with extenuating circumstances regarding lack of institutional reimbursement of costs for Attendance at each regular or special meeting. If the sum to any or all of the Directors and Director/Officers exceeds $5000, it must be approved by majority vote of the Board. Nothing herein contained shall be construed to preclude any Director or Director/Officer from serving the Corporation in any other capacity, and receiving compensation therefore.The Board of Directors shall elect a septe Standing Committee for the conference coordination for the annual ISMB meeting which is responsible for oversight of all ISCB conference activities sponsored by and affiliated with the Corporation. Another Standing Committee shall be elected to assume responsibility for publications of the society. A Task Force shall be selected for the election of officers and for the setting of standards for voting at meetings held on the Internet or by other electronic media and shall consist of such Directors and members as determined by majority vote of the Directors. The Standing Committees shall be selected by the Board of Directors at any meeting of the Board of Directors. Any and all Task Forces may be selected by the Board of Directors at any duly constituted meeting of the Directors or by the Committee Chair(s) at any committee meeting.The Board of Directors may, by resolution passed by a majority of the whole Board, designate one or more other committees, each committee to consist of one or more of the Directors of the Corporation, which, to the extent provided in the resolution, shall have and may exercise the powers of the Board of Directors, and may authorize the seal of the Corporation to be affixed to all papers which may require it. Such committee or committees shall have such names as may be determined from time to time by resolution adopted by the Board of Directors.The Board of Directors and committee chairs may, by resolution passed by a majority of the whole Board or at the direction of the committee chairs, designate one or more Task Forces, each Task Force to consist of one or more of the Directors of the Corporation or one or more of the committee members for which the Task Force shall be formed. Task Forces shall be formed for the purposes of task-specific time-limited work in order to make recommendations to the Board of Directors or committee chairs. Task Forces shall not have nor exercise the powers of the Board of Directors, nor authorize the seal of the Corporation to be affixed to any papers which may require it. Such Task Forces shall have such names as may be determined from time to time by resolution adopted by the Board of Directors or at the direction of the committee chairs for which they have formed.The officers of the Corporation shall be a President-elect, a President, a Vice President, a Secretary, and a Treasurer (the \u201cNominated Officers\u201d), and also such other officers including a Chairman of the Board and/or one or more Vice Presidents and/or one or more assistants to the foregoing officers as the Board of Directors from time to time may appoint for the proper conduct of the business of the Corporation, including but not limited to an Executive Officer to assist in day to day business matters and a Vice Chair of Conferences to assist in managing the annual conference (collectively the \u201cAppointed Officers\u201d). The Nominated Officers shall be nominated by the members and Directors according to the procedures set forth in the Procedure For Nomination. The Nominated Officers shall serve for two years as officers. Any two or more of the above offices, except those of President and Secretary, may be held by the same person, but no officer shall execute, acknowledge or verify any instrument in more than one capacity if such instrument is required by law or by these bylaws to be executed, acknowledged or verified by any two or more officers. If compensation or salary is paid to officers or Director/Officers of the Corporation it shall be fixed by resolutions adopted by the Board of Directors.In the event that any office other than an office required by law, shall not be filled by the members, or, once filled, subsequently becomes vacant, then such office and all references thereto in these bylaws shall be deemed inoperative unless and until such office is filled in accordance with the provisions of these bylaws.Except where otherwise expressly provided in a contract duly authorized by the Board of Directors, all officers of the Corporation shall be subject to removal at any time by the affirmative vote of a majority of the Board of Directors or the whole membership at a special meeting of the Board of Directors or the members respectively, duly called according to the rules set forth in these bylaws. All agents and employees of the Corporation shall be subject to removal at any time by the affirmative vote of a majority of the whole Board of Directors, and any agents and employees, other than those elected by the membership, shall hold office at the discretion of the Board of Directors or of the officers appointing them.The Chairman of the Board shall preside at all meetings of the Board of Directors unless the Board of Directors shall by a majority vote of a quorum thereof elect a chairman other than the Chairman of the Board to preside at meetings of the Board of Directors. The Chairman may sign and execute all authorized bonds, contracts or other obligations in the name of the Corporation; and he or she shall be ex-officio a member of all standing committees.The President shall be the chief executive officer of the Corporation and shall have general charge and control of all its business affairs and properties. He or she shall preside at all meetings of the members.The President may sign and execute all authorized bonds, contracts or other obligations in the name of the Corporation. The President shall have signature power and the authority to assign signature power to the Executive Officer and/or Vice Chair of Conferences to sign checks in amounts up to $5,000. All checks for amounts over $5,000 for costs not associated with contracts and expenses previously approved by the Board of Directors shall require approval of the Board of Directors and the signature of two officers or one officer and one Appointed Officer. The President shall have the general powers and duties of supervision and management usually vested in the office of president of a corporation. The President shall be ex-officio a member of all the Standing committees. He shall do and perform such other duties as may, from time to time, be assigned to him by the Board of Directors.In the event that the membership does not take affirmative action to fill the office of Chairman of the Board, the President shall assume and perform all powers and duties given to the Chairman of the Board by these bylaws.The President-elect may sign and execute all authorized bonds, contracts, or other obligations in the name of the Corporation. The President-elect shall have such other powers and shall perform such other duties as may be assigned to the President-elect by the Board of Directors or by the President. In case of the absence or disability of the President, the duties of that office shall be performed by the President-elect, and the taking of any action by the President-elect in place of the President shall be conclusive evidence of the absence or disability of the President.The Board of Directors may appoint more than one Vice President. Any Vice President (unless otherwise provided by resolution of the Board of Directors) may sign and execute all authorized bonds, contracts, or other obligations in the name of the Corporation. Each Vice President shall have such other powers and shall perform such other duties as may be assigned to the Vice President by the Board of Directors or by the President. In case of the absence or disability of the President and President-elect, the duties of the office of President shall be performed by any Vice President, and the taking of any action by any such Vice President in place of the President shall be conclusive evidence of the absence or disability of the President.The Secretary shall handle all voting matters, whether at actual meetings, telephonic meetings or meetings held on the Internet or other electronic media; he or she shall give, or cause to be given, notice of all meetings of members and Directors and all other notices required by law or by these bylaws, and in case of his or her absence or refusal or neglect to do so, any such notice may be given by any person thereunto directed by the President, or by the Directors or members upon whose written request the meeting is called as provided in these bylaws. The Secretary shall record all the proceedings of the meetings of the members and of the Directors in books provided for that purpose, and he or she shall perform such other duties as may be assigned to him or her by the Directors or the President. He or she shall have custody of the seal of the Corporation and shall affix the same to all instruments requiring it, when authorized by the Board of Directors or the President, and attest the same. In general, the Secretary shall perform all the duties generally incident to the office of Secretary, subject to the control of the Board of Directors and the President.The Treasurer shall oversee the Executive Officer's and/or Vice Chair of Conferences' custody of all the funds and securities of the Corporation, and he or she shall oversee the Executive Officer's and/or Vice Chair of Conferences' full and accurate account of receipts and disbursements in books belonging to the Corporation. The Treasurer shall oversee the Appointed Officers' deposit of all moneys and other valuables in the name and to the credit of the Corporation in such depository or depositories as may be designated by the Board of Directors. He or she shall have the power to sign checks under his or her signature in amounts up to $5,000. All checks for amounts over $5,000 shall require the signature of two officers or one officer and one Appointed Officer.The Treasurer shall oversee the Appointed Officers' disbursement of the funds of the Corporation as may be ordered by the Board of Directors and may require the Appointed Officers to make proper vouchers for such disbursements. The Treasurer shall render to the President and the Board of Directors, whenever either of them so requests, an account of all of the Appointed Officers' transactions and of the financial condition of the Corporation.The Treasurer shall give the Corporation a bond, if required by the Board of Directors, in a sum, and with one or more sureties, satisfactory to the Board or Directors, for the faithful performance of the duties of his or her office and for the restoration to the Corporation in case of his or her death, resignation, retirement or removal from office of all books, papers, vouchers, moneys, and other properties of whatever kind in his or her possession or under his or her control belonging to the Corporation.The Treasurer shall perform all the duties generally incident to the office of the Treasurer, subject to the control of the Board of Directors and the President.The Board of Directors may appoint an Assistant Secretary or more than one Assistant Secretary. Each Assistant Secretary shall (except as otherwise provided by resolution of the Board of Directors) have power to perform all duties of the Secretary in the absence or disability of the Secretary and shall have such other powers and shall perform such other duties as may be assigned to him by the Board of Directors or the President. In case of the absence or disability of the Secretary, the duties of the office shall be performed by any such Assistant Secretary, and the taking of any action by any such Assistant Secretary in place of the Secretary shall be conclusive evidence of the absence or disability of the Secretary.The Board of Directors may appoint an Assistant Treasurer or more than one Assistant Treasurer. Each Assistant Treasurer shall (except as otherwise provided by resolution of the Board of Directors) have power to perform all duties of the Treasurer in the absence or disability of the Treasurer and shall have such other powers and shall perform such other duties as may be assigned to him by the Board of Directors or the President. In case of the absence or disability of the Treasurer, the duties of the office shall be performed by any Assistant Treasurer, and the taking of any action by any such Assistant Treasurer in place of the Treasurer shall be conclusive evidence of the absence or disability of the Treasurer.In the event that the President shall direct the Secretary to obtain a corporate seal, the corporate seal shall be circular in form and shall have inscribed thereon the name of the Corporation, the year of its organization and the word \u201cDelaware\u201d. Duplicate copies of the corporate seal may be provided for use in the different offices of the Corporation but each copy thereof shall be in the custody of the Secretary of the Corporation or of an Assistant Secretary of the Corporation nominated by the Secretary.Such officers or agents of the Corporation as from time to time shall be designated by the Board of Directors shall have authority to deposit any funds of the Corporation in such banks or trust companies as shall from time to time be designated by the Board of Directors and such officers or agents as from time to time shall be authorized by the Board of Directors to withdraw any or all of the funds of the Corporation so deposited in any such bank or trust company, upon checks, drafts or other instruments or orders for the payment of money, drawn against the account or in the name or behalf of this Corporation, and made or signed by such officers or agents; and each bank or trust company with which funds of the Corporation are so deposited is authorized to accept, honor, cash and pay, without limit as to amount, all checks, drafts or other instruments or orders for the payment of money, when drawn, made or signed by officers or agents so designated by the Board of Directors until written notice of the revocation of the authority of such officers or agents by the Board of Directors shall have been received by such bank or trust company. There shall from time to time be certified to the banks or trust companies in which funds of the Corporation are deposited, the signature of the officers or agents of the Corporation so authorized to draw against the same. In the event that the Board of Directors shall fail to designate the persons by whom checks, drafts and other instruments or orders for the payment of money shall be signed, as hereinabove provided in this Section, all of such checks, drafts and other instruments or orders for the payment of money shall be signed by the President or a Vice President and countersigned by the Secretary or Treasurer or an Assistant Secretary or an Assistant Treasurer or Appointed Officer of the Corporation.Such officers or agents of this Corporation as from time to time shall be designated by the Board of Directors shall have authority to effect loans, advances or other forms of credit at any time or times for the Corporation from such banks, trust companies, institutions, corporations, firms or persons as the Board or Directors shall from time to time designate, and as security for the repayment of such loans, advances, or other forms of credit to assign, transfer, endorse and deliver, either originally or in addition or substitution, any or all stocks, bonds, rights and interests of any kind in or to stocks or bonds, certificates of such rights or interests, deposits, accounts, documents covering merchandise, deposits and accounts receivable and other commercial paper and evidences of debt at any time held by the Corporation; and for such loans, advances or other forms of credit to make, execute and deliver one or more notes, acceptances or written obligations of the Corporation on such terms, and with such provisions as to the security or sale or disposition thereof as such officers or agents shall deem proper; and also to sell to, or discount or rediscount with, such banks, trust companies, institutions, corporations, firms or persons any and all commercial paper, bills receivable, acceptances and other instruments and evidences of debt at any time held by the Corporation, and to that end to endorse, transfer and deliver the same. There shall from time to time be certified to each bank, trust company, institution, corporation, firm or person so designated the signatures of the officers or agents so authorized; and each such bank, trust company, institution, corporation, firm or person is authorized to reply upon such certification until written notice of the revocation by the Board of Directors of the authority of such officers or agents shall be delivered to such bank, trust company, institution, corporation, firm or person.Any payments made to an officer or other employee of the Corporation, such as salary, commission, interest or rent, or entertainment expense incurred by him or her, which shall be disallowed in whole or in part as a deductible expense by the Internal Revenue Service, shall be reimbursed by such officer or other employee of the Corporation to the full extent of such disallowance. It shall be the duty of the Directors, as a Board, to enforce payment of each such amount disallowed. In lieu of payment by the officer or other employee, subject to the determination of the Board of Directors, proportionate amounts may be withheld from his or her future compensation payments until the amount owed to the Corporation has been recovered.The fiscal year of the Corporation shall end on the last day of December.Whenever, under the provisions of these bylaws, notice is required to be given to any Director, officer or member it shall not be construed to mean personal notice, but such notice shall be given in writing, by E-mail over the Internet or similar electronic media, by mail, by depositing the same in a post office or letter box, in a postpaid sealed wrapper, addressed to each member, officer or Director at such address as appears on the books of the Corporation, or in default of any other address, to such Director, officer or member at the general post office in the town of La Jolla, California, and such notice shall be deemed to be given at the time the same shall be thus mailed. Any member, Director or officer may waive any notice required to be given under these bylaws.Any notice required to be given under these bylaws or otherwise may be waived by the Director, officer or member to whom such notice is required to be given and the Attendance of any person at a meeting shall constitute waiver of notice thereof as to such person. Any action which may be taken at a meeting of the Directors, officers or members may be taken without a meeting if a consent in writing, setting forth the action so taken, shall be signed by all of the Directors, officers or members entitled to vote with respect to the subject matter thereof. Such consent shall have the same force and effect as a unanimous vote of the Directors, officers or members, as the case may be.Any member can propose an amendment of the bylaws by submitting the change to the President. If a majority of the Board of Directors adopts the amendment it shall be adopted.The Corporation shall indemnify and advance expenses to a Director, officer or Appointed Officer of the Corporation in connection with a proceeding to the fullest extent permitted by and in accordance with the General Corporation Law of the State of Delaware.With respect to an employee or agent, other than a Director, officer or Appointed Officer of the Corporation, the Corporation may, as determined by the Board of Directors of the Corporation, indemnify and advance expenses to such employee or agent in connection with a proceeding to the extent permitted by and in accordance with the General Corporation Law of the State of Delaware.September 16, 2003: Bylaws amended by majority vote of the Board of Directors"}
{"text": "The 1980s were not kind to African elephants. Poachers committed brutal acts in the pursuit of tusks to feed the human hunger for ivory. Gruesome images of the carnage they left behind\u2014mutilated corpses sprawled in twisted repose, attended by bereft companions and bewildered orphans\u2014helped document the precipitous collapse of Africa\u2019s elephant populations. Between 1970 and 1989, as global demand for ivory grew and poachers traded traditional hunting methods for AK-47s and elephant guns, an estimated three-quarters of a million elephants were killed, leaving just 600,000 survivors. Much of Africa, once home to as many as 10 million elephants, had turned into an elephant graveyard.This catastrophic decline, coupled with public outcry at the elephants\u2019 cruel fate, led to a ban on the international ivory trade, after the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) placed the African elephant on its most critically endangered list, Appendix I. The ban, which led to more aggressive anti-poaching campaigns and increased investment in wildlife protection, set African elephants on the road to recovery. But a new study from Stephen Blake, Samantha Strindberg, Fiona Maisels, and colleagues warns that while savannah elephants may indeed be rebounding\u2014in part because they live in countries with long histories of wildlife management, where protection is facilitated by open plains habitats and usually good infrastructure\u2014their forest relatives, hidden in the Congo Basin rainforests, still face intense poaching pressure.Humans have exploited elephants\u2019 ivory tusks for profit ever since ancient civilizations recognized the beauty and commercial potential of ivory. Despite increased awareness about the bloody legacy of the illegal ivory trade, consumers outside Africa, particularly in Asia, continue to buy ivory. And despite the 1989 ban, the status and management of African elephants remain precarious, except in southern Africa, where effective management of the savannah elephant has ensured its protection. Countries in southern Africa oppose the Appendix I listing and trade ban, arguing that their savannah elephants have either rebounded or were never threatened, thanks to good management. They want to sell their ivory stockpiles as reward for their success and use the proceeds to underwrite their conservation programs.  CITES approved one-time stockpile sales in 1997 and in 2002; though the 2002 sale has not yet proceeded, pending the completion of necessary monitoring commitments, it may be approved by CITES in June.While the life history and conservation status of savannah elephants are well known, relatively little is known about the biology of forest elephants, which scientists suspect may be a distinct species uniquely adapted to Africa\u2019s dense rainforests. And because central African nations\u2014where ivory poaching persists\u2014have far less capacity for elephant management than southern African nations, conservationists fear that legalizing even limited trade in ivory from southern African elephants will place the forest elephant in serious jeopardy.Unlike most eastern and southern African nations, which have thriving wildlife-based tourism industries and the funding and infrastructure to facilitate elephant protection, Congo Basin forest nations have crumbling infrastructure, poorly supported wildlife departments, and vast areas accessible only by foot. In some nations, high levels of corruption thwart wildlife management, while in the Democratic Republic of Congo, Congo, and the Central African Republic, high-intensity civil conflicts have interfered with management and led to accelerated poaching, often organized by the military. In nations without the law enforcement capacity to catch and prosecute ivory poachers, poaching levels appear to fluctuate with market demand and price. Kenya, which saw rampant elephant poaching in the 1980s, and countries in West and Central Africa, the heart of forest elephant habitat, continue to support the Appendix 1 listing of all African elephants. They worry that even one-off sales will stimulate global demand for ivory, expand the black market for ivory, and increase the incentive to poach.Devising a rational policy for managing elephants that balances the rights of local governments against wildlife conservation requires accurate measures of elephant abundance and distribution and rates of illegal killing across the continent. In savannahs, elephant counts usually involve flying over the plains to count both live individuals and carcasses. But tracking elephants and poachers through the vast, often swampy equatorial rainforest must be done on foot and presents significant methodological and logistical challenges. The last regional forest elephant survey, in 1989, estimated that about 172,000 forest elephants lived in the Congo Basin\u2014suggesting that forest elephants accounted for nearly a third of Africa\u2019s elephants at that time. Forest elephant distribution, the survey found, was primarily affected by the presence of humans and roads.With logging and road-building in the Congo Basin projected to increase dramatically, Blake et al. set out to chart the abundance and distribution of forest elephants across the Congo Basin. Working in conjunction with the CITES Monitoring of the Illegal Killing of Elephants (MIKE) program, the researchers systematically surveyed six protected MIKE sites, national parks expected to have significant forest elephant populations. Between 2003 and 2005, they walked through \u201csome of the most remote and difficult terrain in forested Africa\u201d to survey over 60,000 square kilometers for signs of elephants (dung piles) and humans , to collect data on the abundance, distribution, and illegal killing of forest elephants . Their analysis included data collected during a \u201cmegatransect,\u201d a continuous foot survey through 2,000 kilometers of \u201cthe most remote forest blocks in Africa,\u201d between northeastern Congo and southwestern Gabon.As expected, illegal killing and other human incursions played a profound role in shaping forest elephant distribution and abundance. Altogether, the researchers found 53 confirmed elephant poaching camps; they found poached elephant carcasses, with tusks removed, in every protected MIKE site. The probability of encountering elephants increased as one traveled away from the nearest major road, while the probability of detecting human signs decreased. The likelihood of discovering poached elephant carcasses also decreased with distance from the nearest road; no poached carcasses were found farther than 45 kilometers from the nearest road.In Salonga National Park\u2014the largest forested national park in Africa, and a UNESCO World Heritage Site in the remote heart of the Democratic Republic of Congo\u2014Blake et al. report as few as 1,900 elephants remain. Only two national parks had a mean estimated density of more than one elephant per square kilometer, Mink\u00e9b\u00e9 and Odzala-Koukoua, and these sites contain the largest tracts of remote wilderness left in the entire Congo Basin. The overwhelming trend from both the MIKE surveys and the megatransect was that elephants were more abundant with increasing distance from a road and decreasing evidence of humans.How could Salonga National Park, with three times the area of any other park surveyed, have so few elephants? Most likely because the park is divided into two sections, and is crisscrossed with old roads and navigable rivers, placing nearly half of its area within ten kilometers of an access point. In contrast, the two parks with remote areas over 60 kilometers from the nearest roads had elephant densities over ten times that of Salonga.Since the megatransect survey included both protected and unprotected areas over a large geographical scale, the researchers could determine what effects, if any, protected status has on the number and distribution of forest elephants and on the presence of humans. As in the analysis of the protected MIKE sites, the probability of encountering elephants increased with distance from a road, but at any distance from a road the probability of encountering elephants was higher in protected areas than in forest outside of protected areas. Protected areas, even those with limited management capacity, have a positive influence by attenuating rates of illegal killing.Overall, these results show that forest elephants are in deep trouble\u2014their range and numbers are shrinking as poachers continue to kill them for their tusks (and probably their meat). As logging road infrastructure explodes across the Congo Basin, the area of remote wilderness is decreasing rapidly, allowing poachers access to the last herds in the depths of the forest. Large areas of wilderness are critical for the survival of forest elephants, and important if human\u2013elephant conflict is to be minimized, yet they are disappearing fast.Given that this study describes the situation in and around well-established protected areas and remote forest, the researchers point out that the conservation status of forest elephants is probably \u201cconsiderably worse\u201d in the rest of the Congo Basin, where wildlife management resources are scarce. Legalizing the ivory trade based on the recovery of savannah elephants will only accelerate the forest elephants\u2019 decline, unless a change in trade status of southern African elephants comes with a strong commitment from CITES and ivory-trading nations to work with central African nations to reinforce elephant management capacity.What can be done to save the forest elephant? Given that protected areas tend to have more elephants and less people, the preservation of the forest elephant depends on improving management capacity in large, remote, well-managed national parks throughout their range in the Congo Basin. Preventing further declines will require beefed-up law enforcement to stop poaching and rein in the illegal ivory trade, carefully regulated road-building to preserve contiguous forest, and collaborations with logging and mining companies to reduce their impacts on protected areas and to improve ecosystem management and elephant protection in their concessions. Ultimately, consumers of unsustainable and illegally traded ivory must be educated to understand that their actions leave bloody, rotting carcasses in the depths of the forest. Illegal trade provides precious little benefit to the usually poor poacher, who may kill a six-ton elephant with 30-kilogram tusks worth thousands of dollars on the international market for the \u201csalary\u201d of a pair of shorts and a packet of cigarettes from an ivory-trading middleman.http://www.wcs.org/international/Africa/africanelephants or http://www.iucn.org/themes/ssc/sgs/afesg/aed/aesr2002.html.While the elephant clearly awakens the darker side of humanity, willing to lay waste a giant beast for the sake of its tusk, one can only hope that it can also inspire the human capacity for wisdom\u2014and the understanding that the world would be a poorer place without every incarnation of what Donne called \u201cnature\u2019s great master-peece.\u201d For more information on African elephants, visit"}
{"text": "To determine the prevalence, intensity and extent of the Oral Impacts on Daily Performances associated with self-perceived malocclusion among Peruvian schoolchildren.(Peru)Child-OIDP was used to assess the prevalence, intensity and extent of oral impacts on 8 daily performances . Self-perceived malocclusion included complaints about position of teeth, spacing of teeth and deformity of mouth or face. The prevalence of oral impacts was compared by covariables using the Chi-square test, whereas the intensity and extent of oral impacts were compared by covariables through the Mann-Whitney test.Eight hundred and five children aged 11 to 12 years attending 4 of 7 randomly selected schools linked to a Health Centre in Lima, Peru, participated in the study. The Spanish Only 15.5% of children reported impacts associated with self-perceived malocclusion during the last 3 months. Of them, 18.4% reported impacts of severe or very severe intensity and 76.0% reported impacts on only one daily performance. Psychosocial activities such as smiling, emotion and social contact were the most frequently and severely impacted everyday activities.Impacts of self-perceived malocclusion primarily affected psychological and social everyday activities. These findings provide further evidence to support the importance of psychological and social components of oral health on children's lives. A better knowledge about the physical, social and psychological effects of malocclusion is important since it provides insights into the perceived impacts of malocclusion on children's lives ,2. To daSpecific OHRQoL measures are designed for use in clinical situations. Their narrow focus means that they are potentially more responsive to small, but clinically important, changes in health ,4,5. SpeCondition-specific instruments are the most commonly used specific measures to assess quality of life . The advPrevious studies assessing the impact of malocclusion on children or adolescents have only reported on the prevalence of impacts on quality of life -16. No sThe study was carried out within the area related to the Mother-Child Health Centre of Zapallal in Puente Piedra . There are 7 public schools in this jurisdiction. In 2006, 1519 children aged 11 to 12 years (born in 1995 and 1994 respectively) attended these schools. 4 of these 7 schools were randomly selected as clusters, and all their 903 11-12-year-old children were invited to participate in the study. Ethical approval was obtained from the International Review Board at the Universidad Peruana Cayetano Heredia. Parents signed a consent letter accepting participation of their children. Children also gave written consent for interviews.(Peru)Child-OIDP were evaluated. For criterion validity, the Spanish (Peru)Child-OIDP scores were significantly associated with self-perceived oral health status, self-perceived dental treatment need and satisfaction with oral health status . For internal reliability, all inter-item correlations were positive and statistically different from zero (p \u2264 0.007), whereas the Cronbach's alpha coefficient was 0.62 and did not increase when any performance was deleted. Finally, test-retest reliability was evaluated through intraclass correlation coefficient, whose value was 0.85.Before data collection, the original English version of the Child-OIDP was cross-culturally translated and adapted into Spanish. Then, the validity and reliability of the Spanish The Child-OIDP was administered through individual interviews, except for the first question that was self-administered in a classroom setting. The children were first asked to provide socio-demographic information related to their sex, age and education level (e.g. primary or secondary school), and then, to identify problems with their mouth or teeth perceived during the last 3 months. Thereafter, 2 trained interviewers carried out individual face-to-face structured interviews. Oral impacts on daily life were assessed in relation to 8 daily performances namely, eating, speaking, mouth cleaning, sleeping, smiling, studying, emotion and social contact. If children reported an impact on any performance, the frequency of the impact  and the severity of its effect on daily life  were scored . If no iThe impact per daily performance was estimated by multiplying the corresponding frequency and severity scores. The overall CS-Child-OIDP score was the sum of the 8 performance scores (ranging from 0 to 72) multiplied by 100 and divided by 72 . Then, tFor the statistical data analysis, the prevalence of condition-specific impacts was compared according to sex, age and education level using the Chi-square test. The intensity and extent of condition-specific impacts were compared according to covariables using the Mann-Whitney test. Non-parametric tests were used to compare intensity and extent because the former was measured using an ordinal scale and the latter was not normally distributed in the sample .Eight hundred and five of the 903 11\u201312 year-old children attending the 4 selected schools participated in the study; a response rate of 89.1%. Fifty one percent (51.2%) were female and 48.8% male; 53.5% were at primary education and 46.5% at secondary education level. The mean age of the children was 11.93 \u00b1 0.63 years.95%]. The most frequently reported oral condition related to malocclusion was position of teeth (28.4%), followed by spacing of teeth (16.3%) and deformity of mouth or face (1.6%). The prevalence of self-perceived malocclusion did not differ by sex or age (p = 0.275 and 0.057 respectively). However, there was a significant difference of perceived malocclusion by education level (p = 0.021) ]. The most common daily performances affected by malocclusion were smiling and emotion (9.1% and 3.2% respectively). The prevalence of condition-specific impacts on the other evaluated 6 daily performances was less than 2.0% ] reported impacts of severe or very severe intensity ], with 76.0% of children with condition specific impacts reporting 1; 19.2% reporting 2, 3.2% reporting 3, 0.8% reporting 4 and 0.8% reporting 5 performances affected. None reported condition-specific impacts on 6 or more of the 8 daily performances. No statistically significant difference was found when the extent of the condition-specific impacts was compared by covariables   and maintaining the usual emotional state without being irritable. Other psychosocial activities such as carrying out schoolwork  and relaxing/sleeping  were the least frequent and least severely impacted. These findings highlight the importance of the psychological and social aspects of the teeth and mouth on children's lives. Teeth mainly affect social interaction with peers, where satisfaction with dental appearance plays a very important role ,20,26.Interference with predominantly physical activities such as eating and enjoying food, speaking clearly and cleaning mouth  were only reported by between 1.3% and 1.9% of the children. It has been reported that dissatisfaction with ability to chew was less often a reason for seeking orthodontic treatment because problems with chewing may be less common than problems related with dental appearance ,27. ThesMore than three-quarters of the children with impacts had only one daily performance affected. The performances affected were mainly related to smiling, laughing and showing teeth without embarrassment. Eating, sleeping and studying were not frequently affected. No child reported impacts on more than 5 daily performances. The findings support the view that children with a perceived malocclusion are more concerned with dental aesthetics than with function. Therefore, psychological factors, such as dental aesthetics, self-perception of dental appearance, rather than the severity of the clinical occlusal condition, most probably determine children's demand for orthodontic treatment ,28.The Child-OIDP measures impacts on the ultimate level of the oral impacts ,29, equiIf the figures reported here were used for orthodontic services planning, the estimates of orthodontic treatment need would likely be lower than those obtained using normative indexes alone ,14,15. UAlthough it has been argued that the physical, social and psychological effects are important reasons why orthodontic care is sought , our fin- Only 15.5% of the interviewed children reported impacts associated with self-perceived malocclusion during the last three months. Among children with impacts, 18.4% reported impacts of severe or very severe intensity and 76.0% had impacts on only one daily performance.- Among children with impacts, psychosocial activities such as smiling, emotion and social contact were the most frequently and severely impacted. These findings provide further evidence in support of the importance of psychological and social components of oral health children's lives.- Education level was the only demographic variable that significantly affected the prevalence of self-perceived malocclusion and intensity of the impacts associated with self-perceived malocclusion.The author(s) declare that they have no competing interests.Eduardo Bernab\u00e9 conceived of the study, was responsible for the data collection in Peru, conducted the statistical analysis and was responsible for the completion of the whole manuscript. Carlos Flores-Mir was consulted for methodology and revised the manuscript. Aubrey Sheiham contributed to the conception and design of the study and critically revised the manuscript. All authors read and approved the final version of the manuscript.The pre-publication history for this paper can be accessed here:"}
{"text": "However, extensive phenotyping revealed multi-system abnormalities indicative of an abnormal energy metabolic phenotype. The postnatal growth of heart and slow-twitch skeletal muscle, organs with high mitochondrial energy demands, is blunted in PGC-1\u03b1\u2212/\u2212 mice. With age, the PGC-1\u03b1\u2212/\u2212 mice develop abnormally increased body fat, a phenotype that is more severe in females. Mitochondrial number and respiratory capacity is diminished in slow-twitch skeletal muscle of PGC-1\u03b1\u2212/\u2212 mice, leading to reduced muscle performance and exercise capacity. PGC-1\u03b1\u2212/\u2212 mice exhibit a modest diminution in cardiac function related largely to abnormal control of heart rate. The PGC-1\u03b1\u2212/\u2212 mice were unable to maintain core body temperature following exposure to cold, consistent with an altered thermogenic response. Following short-term starvation, PGC-1\u03b1\u2212/\u2212 mice develop hepatic steatosis due to a combination of reduced mitochondrial respiratory capacity and an increased expression of lipogenic genes. Surprisingly, PGC-1\u03b1\u2212/\u2212 mice were less susceptible to diet-induced insulin resistance than wild-type controls. Lastly, vacuolar lesions were detected in the central nervous system of PGC-1\u03b1\u2212/\u2212 mice. These results demonstrate that PGC-1\u03b1 is necessary for appropriate adaptation to the metabolic and physiologic stressors of postnatal life.The gene encoding the transcriptional coactivator peroxisome proliferator-activated receptor-\u03b3 coactivator-1\u03b1 (PGC-1\u03b1) was targeted in mice. PGC-1\u03b1 null (PGC-1\u03b1 Eliminating the activity of the gene PGC-1 \u03b1 in mice reveals its role in post-natal metabolism and provides a link to obesity and some intriguing differences with another report of this knockout Mitochondrial functional capacity is dynamically regulated to meet the diverse energy demands imposed on the mammalian organism following birth. Postnatal mitochondrial biogenesis involves multiple signaling and transcriptional regulatory pathways that control the coordinate expression of nuclear and mitochondrial genes involved in mitochondrial structure, metabolism, and proliferation . Recent Several lines of evidence, based on the results of overexpression studies, indicate that PGC-1\u03b1 is sufficient to promote mitochondrial biogenesis and regulate mitochondrial respiratory capacity. First, PGC-1\u03b1 activates the transcription of mitochondrial uncoupling protein-1 (UCP-1) in BAT through interactions with the nuclear hormone receptors PPAR\u03b3 and thyroid receptor . Second,PGC-1\u03b1 gene have been shown to be associated with obesity, hypertension, and diabetes ) supplemented with 50 \u03bcg/ml saponin and permeabilized for 30 min at 4 \u00b0C with gentle stirring. Fibers were then washed twice for 10 min each . Respiration was measured at 25 \u00b0C using an optical probe . Following measurement of basal state 2 respiration, maximal (ADP-stimulated) state 3 respiration was determined by exposing fibers to 1 mM ADP. The integrity of the outer mitochondrial membrane was assessed by adding 8 \u03bcM exogenous cytochrome c to ADP-stimulated fibers. State 4 respiration (uncoupled) was evaluated following addition of oligomycin (1 \u03bcg/ml). The solubility of oxygen in the respiration buffer at 25 \u00b0C was taken as 246.87 nmol O2 \u00b7 ml\u22121. Respiration rates were expressed as nmol O2 \u00b7 min\u22121 \u00b7 mgdw\u22121.Mitochondrial respiration was assessed in saponin-skinned soleus fibers with succinate as substrate and in the presence of rotenone as previously described . In brieGlucose and Insulin tolerance tests were performed as described . Prior t2) of 5-wk-old female mice were measured using a Columbus Instruments Oxymax System. Resting baseline oxygen consumption rates were assessed for at least 1.0 h. For \u03b23-adrenergic stimulation studies, BRL 37344 (Sigma) was dissolved in sterile saline and injected IP (2 \u03bcg/g of body weight) -palmitic acid as described . Hearts were cannulated first via the aorta and perfused retrogradely by the Langendorff method. Following left atrial cannulation, perfusion was switched to the working mode with KHB solution containing 1.2 mM palmitate bound to 3% fatty acid-free BSA with a preload pressure of 11.5 mm Hg and an afterload pressure of 50 mm Hg for 60 min with oxygenated buffer solution. Functional measurements, namely cardiac output, aortic flows, peak systolic pressure, and heart rate were acquired every 10 min using inline flow probes , a pressure transducer  and data acquired with the MP100 system from AcqKnowledge (BIOPAC Systems). Cardiac work was calculated as the product of peak systolic pressure and cardiac output.Isolated working mouse heart perfusion was based on a previously described procedure . Adult mp < 0.05 in all cases. Data are reported as mean values \u00b1 SEM, unless otherwise noted. The ANOVA model used to analyze each sensorimotor test included one between-subjects variable (genotype), and one within-subjects variable . When ANOVAs with repeated measures were conducted, the Huynh-Feldt (H-F) adjustment of alpha levels was used for all within-subjects effects containing more than two levels, in order to protect against violations of the sphericity/compound symmetry assumptions underlying this ANOVA model. In addition, Bonferroni correction was used when appropriate to help maintain prescribed alpha levels  when multiple comparisons were conducted.Data were analyzed using T-tests or ANOVAs . The level of significance was set at Figure S1+/+ (n = 4) and PGC-1\u03b1\u2212/\u2212 (n = 3) female mice were monitored for 48 h after a 17-h period of acclimation. XY beam breaks were tabulated over the 12-h light and dark cycles as denoted on the bottom. The bars represent mean (\u00b1 SEM) beam breaks per each 12-h cycle.Using a CLAMS system, PGC-1\u03b1(342 KB EPS).Click here for additional data file.Figure S2p < 0.05 compared to the PGC-1\u03b1+/+ mice.An analysis of exploratory behavior included the number of entries into the center of the cage (upper left), the time spent in the center of the cage in seconds (sec) (upper right), the distance traveled in the center of the cage in meters (m) (lower left) as well as the distance traveled in the periphery (lower right). * (620 KB EPS).Click here for additional data file.Figure S3+/+ (n = 8) and PGC-1\u03b1\u2212/\u2212 (n = 11) mice. NS, not significant.8-wk-old female mice were fed a diet high in fat  for 6 wk. The change in body weight (grams) after 6 wk on a high-fat diet is shown for PGC-1\u03b1(264 KB EPS).Click here for additional data file.Figure S4+/+ (n \u2265 6) and PGC-1\u03b1\u2212/\u2212 (n \u2265 6) mice were fed a high-fat diet  beginning at 4 wk of age. Body weight was monitored weekly as shown on the graph on the left. The mean (\u00b1 SEM) change in body weight is shown in the bar graph on the right. *, significant difference compared to the PGC-1\u03b1+/+ controls, p < 0.05.Male and female PGC-1\u03b1(794 KB EPS).Click here for additional data file.Table S1Sequences of mouse-specific probes and primers used for real-time RT-PCR.(25 KB DOC).Click here for additional data file.http://www.ncbi.nlm.nih.gov/) accession numbers of the vector discussed in this paper is p1339-PGK-Neomycin targeting vector (AF335420).The GenBank ("}
{"text": "Evaluation of the relative merits of medical versus surgical management of vesicoureteral reflux (VUR) has been limited by the few prospective studies comparing these strategies. Among those trials that have been reported, the only consistent positive finding has been that incidence of febrile UTI is lower among children undergoing surgical treatment in comparison with medical treatment. Studies have not found significant differences in overall incidence of UTI, or in rates of new renal scarring or progression of existing scarring. It is likely that there is a subset of children with VUR who do benefit from aggressive treatment of their VUR, but we are not yet able to fully determine which children these are. It is hoped that future research will further clarify which treatments are useful in which children.  Urinary tract infection (UTI) is one of themost common serious bacterial infections in children. Cumulative incidence is1\u20132% among boys and 3\u20137% among girls, and between 70 000 to 180 000 of theannual US birth cohort will have a UTI by the age of 6 [In addition to itsassociation with UTI, VUR is also a highly genetic condition, displaying anautosomal dominant transmission pattern, with variable penetrance. VUR mayoccur in up to 66% of the offspring of VUR patients , and theIt has long beenappreciated that there is an association between recurrent UTI, VUR and renalparenchymal scarring . The traIn general, mostmanagement strategies for VUR have sought to address and defeat this process atvarious points along the pathogenic sequence. Medical management withantimicrobial prophylaxis seeks to maintain sterile urine, rendering the VURitself relatively harmless, since there are no bacteria present to reach andinvade the kidney. Antireflux surgery (ARS), in contrast, reconfigures the ureterovesicaljunction anatomy to block access to the upper tracts, so that any episodes of cystitisthat do occur cannot progress to pyelonephritis.However, this modelhas been called into question in recent years by data that challenges many ofthe assumptions of the VUR paradigm. Long-term studies show that renal scarringcan occur in children without VUR, and that renal scarring is not common inchildren with even high degrees of reflux , 8. RusAs we will seebelow, it has been difficult to demonstrate that current management strategies forVUR result in measurably improved outcomes. Since these management strategies arebased on assumptions about the pathophysiology of UTI, VUR, and renal scarring,if such assumptions are incorrect then it should not surprise us that ourinterventions seem to have little or no effect.The use of antimicrobials to reducerecurrent and/or chronic UTI's dates back to the 1940's and 50's, and is the mainstay of initial management in children diagnosedwith VUR. Based on the perception that antimicrobial prophylaxis is safe, effective,and easily tolerated, generations of children with VUR have spent yearsundergoing this treatment while awaiting the spontaneous resolution of theirVUR. The classic studies of Smellie et al. form much of the basis for prophylaxis as a management tool , 5, 12. As a consequence,antimicrobial prophylaxis lacks basic evidence of efficacy in prevention ofeither UTI or renal scarring. Three randomized controlled trials comparingantimicrobial prophylaxis with no treatment (surveillance only) have beenreported \u201315, and Since the initial report of surgical correctionof VUR by Hutch in 1952 , numerouThe extraordinarysuccess of modern ARS might lead one to assume that there is little room leftfor technical innovation in this field. However, investigators have long soughta less invasive way to correct VUR. In 1981, the first injection technique wasreported by Matouschek using polytetrafluoroethylene  paste .ConcernTo our knowledge,there have not been any prospective trials of surgical management compared withobservation in children with VUR. Therefore, we simply do not know if ARS issuperior to surveillance alone in prevention of UTI or renal scarring. Becauseactive management of VUR (either with antibiotics or surgery) is consideredstandard of care, it is difficult to find patients who have truly been given notreatment for their VUR, even in a retrospective review.Comparison of medical treatment withsurgical treatment for VUR is challenging because the different studies haveused various outcome measures, and even studies using similar outcome measuresmay be difficult to compare due to differing definitions of similar outcomes.Reported outcomes in many studies include postoperative incidence of any UTI, incidenceof febrile UTI , andrenal cortical abnormalities (scarring).In a recentmetaanalysis of clinical trials, Hodson et al. identified seven randomizedcontrolled trials comparing surgical and medical management \u201335, and There was no difference in incidence of any UTI between treatment groups, withincidence of 29\u201342% in antibioticonly group and 25\u201340% in thesurgical group . Thus, sReported in only 2 studies, this is the only outcome where significantdifferences in outcomes have been observed between treatments , 37. TheIn the five studies that assessed renal parenchymal abnormalities usingIVP criteria , 33, 38,There is little strong evidence supporting the hypothesis that earlydetection and treatment of VUR is of any benefit, primarily because it has beenso difficult to demonstrate any benefit from the available therapies. Perhapsthe one firm conclusion we can draw from the literature described above isthat, among children with VUR who have had breakthrough febrile UTI's while onantimicrobial prophylaxis, ARS is an appropriate therapy that can be expectedto reduce the incidence of such febrile episodes. However, neither prophylaxisnor ARS can be reliably stated to reduce the risk of new or progressive renalscarring, although it is prevention of this outcome that is widely assumed tobe the most important benefit of VUR treatment.It is plausiblethat, while treatment of VUR may reduce the risk of negative outcomes in asmall subset of VUR patients, the number needed to be treated ; it may be so high as to make the intervention unjustified for theoverall VUR population. For this reason, ongoing research into biomarkers thatwill indicate those at highest risk for recurrent infection and progressiverenal damage is crucial; such biomarkers would allow us to narrow the field ofcandidates for medical or surgical treatment to those most likely to benefit,and allow the larger VUR population to escape the morbidity and bother associatedwith these treatments.Finally, there hasbeen much recent discussion about whether the availability of endoscopic ARSshould alter the indications for ARS. Suggestions have begun to appear in theliterature and at national meetings that endoscopic treatment should beutilized as initial therapy for patients diagnosed with VUR. Advocates arguethat immediate endoscopic therapy is preferable to antimicrobial prophylaxis inchildren just diagnosed with VUR . Currentn = 600) will provide us with superb data regarding risk ofUTI and renal scarring in children with VUR in the short term, as well asdemonstrate whether antimicrobial prophylaxis is effective in preventing eitherUTI or scarring. Other studies assessing the utility of ARS in various clinicalscenarios are desperately needed. Until such studies are complete, clinicianswho treat children with VUR will continue to rely on clinical judgment,experience, and intuition to manage their young patients.Ongoing clinicalstudies will hopefully clarify some of the glaring shortcomings in our evidencebase. The NIDDK-funded RIVUR study is a randomized trial of antimicrobialprophylaxis versus placebo in children with VUR and UTI . Each su"}
{"text": "Tinospora cordifolia (Willd.) Miers. The adaptogenic effect of three samples of Guduchi ghrita, prepared using plain ghee (clarified butter) obtained from three different sources was studied in albino rats and compared with expressed juice of stem of Guduchi. The test preparations were evaluated against forced\u2013swimming induced hypothermia, gastric ulceration and changes in the hematological parameters. The test drug given in the form of 'ghrita' produced better effect in comparison to the expressed juice. Among the three 'ghrita' preparations evaluated, only the 'Solapur Guduchi ghrita' (SGG) was found to produce significant inhibition of stress hypothermia and gastric ulceration. The other two preparations 'Nanded Guduchi ghrita' (NGG), and 'Wardha Guduchi ghrita' (WGG) could produce only a marginal effect. In hematological parameters 'Guduchi' juice produced better reversal of the stress-induced changes in comparison to the test 'ghrita' preparations. The present study provides evidence highlighting the importance of formulation factors for the expression of biological activity.This study was undertaken to investigate the impact of formulation factors and adjuvants on the expression of biological activity of  Ghrita',also known as clarified butter, is a traditional adjuvant/ vehicle described in Ayurveda.[ghrita' with plant material is renowned for enhancing the therapeutic efficacy of the plant ingredients. In this reference, a specific word 'Sahasraveerya,' depicting infinite potency or power of 'ghrita,' is used by Charaka. The 'ghrita' is believed to be made more potent through its processing with substances possessing different properties. More interestingly, 'Ghrita' also possesses the property of 'yogavaahitwa' by way of which it enhances the properties of substances with which it is processed.[Tinospora cordifolia (Willd.) Miers., (Menispermaceae) is described in Ayurveda as a 'rasaayana'[Guduchi ghrita', is significantly superior to the antipyretic effect observed in 'Guduchi' juice-administered group.[Guduchi' juice-administered group was comparatively faster in appearance but was short lived. It appeared late but sustained for a longer period up to 12 hours, in all the three 'Guduchi ghrita' groups. The present study was conducted to evaluate the adaptogenic activity and hematologic effects of different formulations of Tinospora cordifolia in ghrita (ghee) obtained from various sources and the expressed juice of the stem of Guduchi.'Ayurveda. Processirocessed. Tinosporasaayana' and receasaayana'4 The plaasaayana' Our earled group. The antiTinospora cordifolia (Willd.) Miers were collected during winter (November 2005), as this is the suitable season for collection of plants,[Mature stems of f plants, Collectighrita', clarified butter or ghee prepared in the traditional way from cow's milk, were obtained from three different places namely Wardha, Nanded and Solapur and were used as the base materials for preparing 'Guduchi ghrita'.Three samples of 'Guduchi ghrita' each from 1 kg of plain ghee were prepared by one person at one place for this study in accordance with the formulation prescribed by 'Vaagbhata and explained by Indu'.[kalka' i.e. paste of 'Guduchi', 'ghrita' and 'swarasa' of 'Guduchi' was 1:4:16 respectively as prescribed by Indu.[Guduchi' is hard in consistency and does not yield 'swarasa' in adequate quantity by the method of crushing and squeezing the material. Hence the method described by Sharngadhara*[Guduchi swarasa'. The stem of 'Guduchi' was crushed and overnight soaked in double the quantity of water. The contents were then filtered through muslin cloth. The filtrate so obtained was used as 'Guduchi swarasa' (Expressed juice). All the ingredients were placed in a container, and were heated on a gas stove to evaporate aqueous part. The contents were stirred regularly to avoid burning. Heating was stopped when the 'ghrita' passed all the tests described in the text, such as disappearance of froth, formation of a wick, burning of 'ghrita' without crackling noise etc.[Guduchi ghrita' was collected in a clean autoclaved glass bottle and stored in a cool place. The test 'Guduchi ghritas' were named after the places from which the plain 'ghrita' samples were obtained, as Nanded Guduchi Ghrita (NGG), Wardha Guduchi Ghrita (WGG) and Solapur Guduchi Ghrita (SGG). The three samples of plain 'ghrita' used and the three samples of test formulations were subjected to preliminary physical and chemical investigations. Noted observations are shown in Tables Guduchi' sample was tested for bitterness value. Macro and microscopic studies of the sample were also carried out. High performance thin layer chromatograph profile of the plant material used, and the three final formulation products, was recorded.[ghritas', sourced from different places, the same plant material was used for all the preparations.Three samples of 'by Indu'. The prop by Indu. The stemngadhara* was usedoise etc. The contrecorded. Since thCharles Foster strain albino rats of either sex weighing between 140 and 200g, procured from the institute's animal house were used. They were maintained on 'Amrut' brand rat/mice pellets and exposed to ambient temperature, humidity and natural day and night cycles. All the experiments were carried out between 8 am and 12 noon. The studies were conducted in conformity with the guidelines of the Institutional Animal Ethics Committee after obtaining its permission.Guduchi ghrita' as practiced traditionally is 10 g per person. (The dose of 'ghrita' preparations as prescribed by Ayurvedic Formulary of India (AFI) is 12 g. However 10 g dose was taken for this study as an average dose.)[The human dose of 'ge dose.)ad libitum ii) 'Guduchi swarasa' , and iii) WGG 900 mg/kg body weight orally for 7 days, iv) NGG 900 mg/kg body weight orally for 7 days, v) SGG 900 mg/kg body weight orally for 7 days, vi) Plain 'ghrita' . The samples were used for estimation of hematological parameters. Hematological parameters were estimated with the help of an auto cell counter , which along with RBC counts, additionally gives size based quantification of RBC (micro and macro). After careful laparotomy, the stomach was excised out by opening along the greater curvature. It was washed gently with tap water. The inner surface of the stomach was carefully observed with a magnifying lens for the number of ulcers and severity of ulceration in glandular area as well as in lumen.  The seve0\u2010No visible ulcer1\u2010Approximate ulcerated area up to 1 mm. in diameter2\u2010Approximate ulcerated area up to 2 mm. in diameter3\u2010Approximate ulcerated area up to 3 mm. in diameter4\u2010Approximate ulcerated area more than 3 mm. in diameter5\u2010Perforation of the gastric wallSeverity of the ulceration and the number of ulcers in each rat stomach were recorded for calculating ulcer index.P< 0.05 was considered to be significant. In case of Ulcer index Mann Whitney U test was employed. The analysis was carried out using Sigma Stat version 3.1 and Graph pad 3.The data are presented as Mean \u00b1 Standard Error of Mean (SEM) for 6 animals per group. Comparison between control and test drug administered groups was made by one way ANOVA followed by Dunnet's multiple 't' test or by unpaired 't' test. The data pertaining to the effect of different types of treatments on forced-swimming-stress-induced hypothermia are shown in ghrita'-, test ghritas, and 'Guduchi swarasa'-administered groups an apparent decrease in hypothermia was observed in comparison to water control. However, the decrease observed in pooled plain ghrita and test ghritas was found to be statistically significant. When test ghritas were compared to pooled plain 'ghrita' control group, the decrease observed in SGG was also found to be significant. However, the observed difference in other groups was non-significant.Marked hypothermia was observed in water control rats subjected to forced-swimming stress. In pooled plain 'ghrita'-administered group, the severity of ulceration was 27.8% less in comparison to normal control. Severity of ulceration increased slightly in WGG- and moderately in NGG administered group. However, in SGG-administered group, significant decrease was observed in comparison to water control. When the data of SGG treated group was compared with pooled plain ghrita control group though 40% decrease in severity was noted, the difference was found to be statistically non-significant. Surprisingly in 'Guduchi swarasa' administered group, the severity was more than doubled in comparison to pooled plain 'ghrita' group. Because of the variation of the data and large SEM, the observed difference was found to be non-significant.Moderate\u2013to-severe ulceration in the stomach was observed in control rats subjected to forced-swimming stress. In pooled plain 'The data related to the effect of test preparations on stress induced changes in WBC related parameters can be seen in ghrita' administered group, the decrease in count was marginally less in comparison to stress control group. In test preparation-administered groups, the observed decrease was further less in comparison to the stress control group and was statistically significant employing unpaired 't' test. This difference was not reflected when ANOVA test was applied, however this test demonstrated significant difference between pooled plain 'ghrita' administered group and SGG treated group.Rats subjected to forced-swimming stress showed marked decrease (52.94%) in total WBC count in comparison to non-stressed control rats. In pooled plain 'ghrita' and SGG treated group. The stress-induced decrease observed in lymphocyte count was not reversed by treatment with either pooled plain 'ghrita' or test 'Guduchi ghrita' preparations. Weak reversal of the stress-induced decrease in granulocyte count was observed in 'Guduchi' juice and NGG-administered groups. However, the reversal did not reach statistically significant level. Other preparations had no effect on this parameter. Moderate reversal of stress-induced decrease in monocyte count was observed in 'Guduchi' juice administered group but it was statistically non-significant. No reversal could be observed in other test preparations-administered groups.Forced-swimming stress was found to decrease lymphocyte, granulocyte and monocyte counts in comparison to normal control rats, which was statistically significant in pooled plain 'guduchi juice treated group showed significant decrease in this elevation against stress water control when compared using unpaired 't' test.Though absolute count of lymphocyte was found to be decreased  in stressed animals, in comparison to normal control when the data were presented as percentages, significant increase in lymphocyte percentage and significant decrease in granulocyte and monocyte percentages were observed in stress control rats in comparison to normal control rats. The elevated lymphocyte percentage due to stress was not significantly reversed by any of the treatment mode employed (ANOVA). However, the Guduchi' juice, which did not reach statistically significant level (ANOVA). However, when compared using unpaired 't' test, it showed significant increase against stress water control. Similar non-significant reversal was observed in NGG and WGG administered groups.The stress-induced decrease in granulocyte percentage was antagonized by the administration of 'Guduchi juice reversed the stress induced decrease, which was not significant statistically.In case of monocyte percentage, Mean Corpuscular Volume (MCV) and Hematoctrit (HCT)% were found to be apparently increased in stress water control in comparison to normal water control groups. Although, unpaired 't' test showed that the observed increase is significant, ANOVA test did not show this difference.ghrita group, 'Guduchi' juice and NGG administered groups. Elevation of HCT (%) was found to be significantly reversed in the 'Guduchi' juice and SGG administered groups. The reversal observed in pooled ghrita, NGG and WGG administered group was found not significant using ANOVA although when unpaired 't' test was applied the observed difference in means was significant in the pooled plain ghrita and NGG groups as well.The apparent elevation observed in MCV was found to be significantly reversed in the pooled plain There was increase in MCHC level in rats subjected to forced-swimming stress as compared to normal rats. There was no significant effect on this parameter in any of the treated groups.ghrita', WGG and SGG administered groups. The moderate reversal observed in NGG-administered and 'Guduchi' juice-administered groups was statistically non-significant.Micro RBC formation was not observed in any of the groups studied. An increase in macro RBC count was observed in stress water control in comparison to normal water control. The increase observed in macro RBC count was found to be unaffected in pooled plain 'ghrita is summarized in Tables Guduchi ghrita'.The data related to physico-chemical investigation of Bhaishajya kalpana' in Ayurveda, has an important place in Ayurvedic therapeutics. Clear-cut guidelines, such as parts of plants to be used, processes to be followed for formulations, along with indications regarding disease- and patient-specific formulations, have been prescribed in ancient Ayurvedic texts. [The science of drug formulation, termed as 'c texts.  It is beghrita' is 99.5% milk fat. It is a complex lipid of glycerides, free fatty acids, phospholipids, sterols, sterol esters, fat-soluble vitamins, tocopherol, carbonyls, hydrocarbons, carotenoids, small amounts of charred casein, traces of minerals like calcium, phosphorus, iron, copper etc. Ayurveda describes that 'Ghrita', is a useful adjuvant/ vehicle. Administering the plant material incorporated in a ghrita is known to enhance the therapeutic efficacy of the plant ingredient. Characteristics of 'ghrita' suitable for processing have also been described in ancient Ayurvedic classics.[ghrita has been described to exert therapeutic effects like 'rasaayana' (adaptogenic activity). Moreover, 'ghrita' has been described to absorb the properties of the material with which it is processed ('sanskaraanuvartana').[Chemically, 'classics. Besides artana').Guduchi' in the form of ' ghrita' exerts better adaptogenic activity compared to 'Guduchi swarasa' (expressed juice) in the forced-swimming stress- induced hypothermia and gastric ulceration model. In fact, increased ulceration was observed in the group that received 'Guduchi'-expressed juice alone. Interestingly adaptogenic activity observed was different in the three formulations. SGG was effective in providing protection against hypothermia as well as production of gastric ulcers, while WGG and NGG failed to produce a significant effect. The reason behind the observed difference among the three test formulations is not clear from our results. It is to be noted that the same type of expressed juice from the same batch was used for the preparation of 'Guduchi ghrita'; only the plain 'ghrita' used was different. This clearly indicates that the quality of plain 'ghrita' used can have important influence on the activity expressed. The chemical- or formulation-related basis for the observed difference needs to be probed. It is very important to obtain such information considering that this difference will have serious implications in clinical settings.Our study indicates that administration of 'Guduchi' juice, whereas NGG was less effective. It is to be noted that the activity profile of the test formulations is different in different sets of parameters. This indicates possible involvement of different factors and existence of difference in the test formulations' ability to modulate them. However, one feature that stands out is that SGG was able to produce anti-stress activity against majority of the parameters recorded. This indicates that the SGG has special attributes that potentiate the adaptogenic activity of 'Guduchi' juice. The exact nature of the potentiation observed in this study requires further elucidation. The data generated in this study can be taken as an example of the importance of different formulation factors in the expression of biological activity.In the present study, significant elevation in RBC count, macro RBC percentage, MCV, HCT% and significant decrease in MCHC and Hb were observed in stress control group. This contradictory data may be due to increase in the number of immature RBC leading to increased RBC count without concomitant increase in Hb%. It has been observed that kidney plays an important role in the regulation of formation of RBC through formation of erythropoietin. Hypoxia in the kidney is the major stimulant for the increased formation of RBC through secretion of erythropoietin. It can b"}
{"text": "Endoscopic treatment for vesicoureteral reflux (VUR) has become an established alternative to long-term antibiotic prophylaxis and ureteral reimplantation. We present the outcome of endoscopic treatment with dextranomer/hyaluronic acid copolymer (Deflux) for VUR in children by a single surgeon at our institute from October 2003 to October 2009. We reviewed the cases of 150 patients , 56 girls (37%) and 94 boys (63%), with a mean age of 2.2 years and a median followup of 2.5 years (range 3\u201368 months). Among the 239 ureters treated, 67.4% (161/239) were cured with a single injection, and a second and third injection raised the cure rate to 86.6% (207/239) and 88.3% (211/239), respectively. None had postoperative ureteral obstruction. Vesicoureteric reflux (VUR) is a common problem encountered by pediatric urologists. Traditionally, if medical management with low-dose antibiotic prophylaxis failed, the only alternative was ureteral reimplant surgery . Since MWe retrospectively reviewed all cases of subtrigonal injection performed with Deflux from October 2003 to October 2009 at Taichung Veteran General Hospital. All patients who entered into the study had vesicoureteric reflux, as determined by voiding cystourethrogram (VCUG). The radiological grading of VUR is according to the international system introduced by the International Reflux Study Committee in 1985 . A totalOne hundred and fifty patients, 56 girls (37%) and 94 boys (63%), with a mean age of 2.2 years (range 1\u2009mo\u201310\u2009yr) underwent subtrigonal injection with Deflux from October 2003 to October 2009. Median followup duration was 2.5 years and ranged from 3 to 68 months. Eighty patients (53%) had bilateral VUR, 61 (41%) had unilateral VUR, and 9 (6%) had new contralateral VUR for a total of 239 ureters treated with a median followup of 2.5 years (range 2\u201362\u2009mo). There are 9 (3.8%) ureters graded as I, 44 (18.4%) as II, 113 (47.3%) as III, 57 (23.8%) as IV, and 16 (6.7%) as V. The VCUG or radionuclide cystogram followup showed that the overall cure rate was 88.3% (211/239). The detail of the patients' data is shown in There were 73 ureters with high grade VUR, including 57 with grade IV VUR and 16 with grade V VUR. Overall cure rate was 80.8% (59/73), 5 (6.9%) ureters were downgraded to grade I, and 9 (12.3%) converted to open ureteral reimplantation. Complete resolution of vesicoureteral reflux after a single injection occurred in 33 ureters (45%), and 26 (36%) required more than 1 injection to correct VUR. No patients had postoperative vesicoureteral obstruction, gross hematuria, and febrile UTI.Our series demonstrates an overall patient cure rate of 88.3% 211/239) of the ureters among those who were cured needed more than a single injection. In addition, approximate 5% (12/239) was downgraded to grade I, and no further treatment was needed. These results are acceptable when we compare the cure rate obtained by other series shown in 1/239 of The complication rate in this series was low. Contralateral low-grade de novo VUR was present in 6% (9/239) of the patients treated for unilateral VUR\u2014an incidence rate comparable to a previous report . ConversEndoscopic correction is a safe, effective, and minimally invasive outpatient procedure for VUR in children. It demonstrated a cure rate of approximately 92% (138/150) of patients and 88% (211/239) of the ureters by using the bulking agent, Deflux by an experienced surgeon. Even high grade VUR, complex VUR, and failed open ureteroneocystostomy do not seem to adversely affect results."}
{"text": "Natural landscapes are critical for species persistence and PAs can play a major role in conservation and in climate policy. Such contributions may be harder than expected to implement if new PAs are constrained to the same kinds of locations that PAs currently occupy.About an eighth of the earth's land surface is in protected areas (hereafter \u201cPAs\u201d), most created during the 20Quantitatively extending the perception that PAs occupy \u201crock and ice\u201d, we show that across 147 nations PA networks are biased towards places that are unlikely to face land conversion pressures even in the absence of protection. We test each country's PA network for bias in elevation, slope, distances to roads and cities, and suitability for agriculture. Further, within each country's set of PAs, we also ask if the level of protection is biased in these ways. We find that the significant majority of national PA networks are biased to higher elevations, steeper slopes and greater distances to roads and cities. Also, within a country, PAs with higher protection status are more biased than are the PAs with lower protection statuses.In sum, PAs are biased towards where they can least prevent land conversion (even if they offer perfect protection). These globally comprehensive results extend findings from nation-level analyses. They imply that siting rules such as the Convention on Biological Diversity's 2010 Target [to protect 10% of all ecoregions] might raise PA impacts if applied at the country level. In light of the potential for global carbon-based payments for avoided deforestation or REDD, these results suggest that attention to threat could improve outcomes from the creation and management of PAs. Initiatives to establish new protected areas (PAs) to conserve natural landscapes for species habitat and climate-change mitigation are underway worldwide Many goals and constraints influenced past PA locations. Given that, have we maximized conservation priorities? To maximize anything, PAs must have impact, i.e. change land-use outcomes. That is, land use would have to differ from what would have occurred in a PA-free world. To change the rate of loss of natural land cover, PAs have to be located where they can prevent forest clearing et al.'s Before explaining such choices or considering changing them, though, we must ask whether the global \u201crock and ice\u201d perception is correct. Previous national-level studies suggest the adage has a basis in reality All of these previous global studies have ignored political boundaries. That is a vital omission. Ecological processes cross borders but most PAs do not. The Convention on Biological Diversity's (CBD) 2010 Target aims to protect 10% of global terrestrial ecoregions We provide the first comprehensive global assessment of the distributions across space of all of the national PA networks of any significant magnitude (>100 km2). We ask whether it is true on the whole, across many countries, that national protection networks have evolved over time to be found disproportionately on higher, steeper, more remote, agriculturally unsuitable lands. We ask too whether the variation in the level of protection across the PAs within a national network is correlated with these indicators of low threat.2 or more of terrestrial surface (147 countries) and quantify the network's elevation, slope, agricultural suitability, distance to roads, and distance to urban areas, as well as its species richness  Materials and For summarizing many countries, additional description is required. Here, we empirically model the probability that a one kmFor all of our variables, we present summaries of such significance across all countries. This lets us summarize global trends in national decisions. For each variable, are biased towards higher elevation, steeper slope, and greater distance from roads and cities (away from suitable land). Yet it is in line with other variables as a majority of countries have networks on less suitable lands. A slight majority of national networks is biased away from the species-rich ecosystems.The majority of national networks d cities . The treBias in PA locations could be driven by a particular subset of the network. Six PA-management categories are defined by the International Union for the Conservation of Nature (IUCN). Greater human intervention is permitted as status moves from I to VI. Put another way, lower-numbered categories are designated as more protected. Category I-II PAs tend to be large We find  that prohow different protected lands are, in a way that brings together all the differences along the dimensions the table lists (e.g. slope and distance). Further it cannot show whether the difference between protected and unprotected lands is more or less than the difference between PAs with higher and lower protection status.To make those comparisons, we require a single index of similarity across all locations. The impact-evaluation literature regularly employs a probability of receiving intervention We find that locations currently within the protected area networks had on average a 24% chance of being protected (keeping in mind that on average only 10% of the country is protected). In contrast, the much larger group of unprotected locations had an 8% chance. Those percentages, however, are unweighted averages across many countries that are quite different in total size (the average country is 8% of the largest country) as well as in network size. When weighting the likelihood-of-protection numbers for each country by its national network size, the protected locations had a 32% chance of being protected while the unprotected had only a 14% chance. Either way, PAs are on lands more than twice as likely to be protected than unprotected lands. That is a considerable difference.Since weighting clearly matters, we also consider the medians. For protected locations, the median chance of being protected is 21% while for unprotected locations is it 6%, similar results to those above in confirming a significant difference. Looked at another way, looking across all the countries the median ratio of these two probabilities of being protected (for protected versus unprotected locations) is 3.0. By this measure of bias in location, protected lands were three times as likely to be protected as unprotected lands.Such an index is most useful for comparison purposes. It can be used, for example, to examine whether the differences just discussed are similar to those between higher and lower protection status . Using the same probabilities of being protected, we find that higher status locations had on average a 25% chance of being protected while lower status had a 20% chance (and the network-weighted averages are 27% for high status and 25% for lower). The median probability of protection for high-protection PAs is 18% while the median for lower categorized PAs is 15%. The median of the ratios of these probabilities is 1.3. This is much less bias than when we simply compared all protected versus unprotected lands.Across 147 countries' national networks, protected areas are indeed non-randomly located on the landscape. The same types of biases also hold, although less so, for the more highly protected area compared with less highly protected areas. All of these results corroborate prior descriptions of specific PA network biases towards, for instance, \u201crock and ice\u201d One area of research where our results are directly relevant is in the quantification of the \u201cconservation success\u201d or effectiveness of protected areas. Interest in this area has been growing rapidly This same concern applies to the differing impacts across PA management categories. Location bias means that much of the observed habitat retention in PA Categories I and II Such results also naturally raise the question of why some PA networks are representative while others are not. An exploratory examination finds no impact of total population or density of population or GDP on the sign and magnitude of coefficients reported above. What this likely means is that the issue of where protection is located is too variable, even within a country or region, to be easily summarized at a global scale. For example, PAs within the United States are (on average) preferentially located on marginal lands Fortunately, many recent PAs have been (and others will be) created under consistent and locally contextualized frameworks. Systematic conservation planning et al. Our results support the idea that targeting and blocking threat may deserve higher priority in the future creation and management of PAs. The issue of locating protection in areas of greatest threat has received the most attention in the discussion of biodiversity hotspots 2 resolution. We used ArcGIS 9.1 to harmonize projections, cell size, and extent and used Python 2.4 in order to remove all marine areas and to create individual text files for each variable for each country. All further analyses were done in R 2.7.1 All datasets are global in scale, in raster (grid) format, and projected into Albers Equal Area projection at a one kmThe analytical framework we used was a general linear model (package \u201cglm\u201d in R 2.7.1) with a probit link because the regressions we run here involve binary outcomes. In the first set of regressions for , we are 2 or more, were included. When two PAs overlapped, we assigned that area the highest IUCN classification of the two. Due to high potential error rates Information on PA location came from the 2007 World Database on Protected Areas (WDPA) 2 or more of categories I \u2013 II and 100 km2 or more of categories III \u2013 VI. To analyze protection over time . The SRTM gathered elevation data on a near-global scale, generating a very complete high-resolution elevation database. We calculated slope values from the SRTM elevation dataset. All slope values are degrees from horizontal. Distance to roads was calculated from a vector road network extracted from the VMAP Level0 dataset We obtained elevation data from the Shuttle Radar Topography Mission (SRTM) Figure S12 of protected area. See Global maps of predictors of all categories of protection for elevation, slope, distance to roads, distance to urban areas, agricultural suitability, and species richness. Red indicates that the variable was a significant and positive factor in a regression model explaining protection. Yellow shows a significant and negative association, black indicates the variable was not a significant predictor for that country, while grey shows those countries with less than 100 km(3.01 MB TIF)Click here for additional data file.Figure S22 of protected area. See Global maps of predictors of IUCN Category I or II protection within the entire protected area network for a country elevation, slope, distance to roads, distance to urban areas, agricultural suitability, and species richness. Red indicates that the variable was a significant and positive factor in a regression model explaining protection. Yellow shows a significant and negative association, black indicates the variable was not a significant predictor for that country, while grey shows those countries with less than 100 km(2.93 MB TIF)Click here for additional data file."}
{"text": "Vesicoureteral reflux is uncommonly diagnosed and treated after puberty. The natural history of uncorrected VUR after puberty is not documented. Postpubertal patients with recurrent pyelonephritis and VUR should be considered for treatment. Ureteral reimplantation, endoscopic injections, and laparoscopic or robotic ureteral reimplantation may be utilized. Endoscopic injection is an appealing option for these patients. The role of laparoscopic or robotic ureteral reimplantation in these patients is evolving. Vesicoureteral reflux (VUR) is a common finding in children with urinarytract infections (UTIs). The incidenceof VUR associated with UTIs drops significantly in older children, particularlyafter the age of 5 . It has There hasbeen a long-standing observation of the association of febrile UTIs and thedevelopment of renal scarring . The risThere has also been a change in VUR management by some pediatric urologists that is thepolar opposite of stopping prophylaxis and observing patients. Instead offollowing patients for resolution of their VUR, primary therapy with endoscopicinjections after the diagnosis of VUR is being offered . Touted The primary motivation for treatmentof VUR before puberty has been over concerns of increased risk of UTIs whenfemale patients become sexually active or pregnant. To my knowledge, however, the natural historyof women with persistent VUR during pregnancy has not been documented. Pyelonephritis is a known risk to pregnantwomen and strongly associated with bacteruria. Large series have reported rates of 2% of pregnant women . InpregThe incidence of VUR after pubertyis significantly lower than in young infants with febrile UTIs . It has Most postpubertal patients with VUR will present with UTIs. Since the majority of patients will not haveVUR and assuming that VUR is an important risk factor for pyelonephritis, whatare the factors that should prompt an evaluation for VUR in a postpubertalpatient? First and foremost should be a history of recurrent febrile urinarytract infections, as these patients if found to have reflux, have a good chanceof having their symptoms alleviated if VUR is found and treated. Suspicionshould be raised if there is a history of prior VUR, febrile infections as ayoung child, or a family history of VUR. Due to the high association of renal scarring and VUR, patients who havea history of recurrent febrile UTIs and evidence of renal scarring on imagingstudies should be evaluated for VUR. To evaluate for VUR a standard VUCG may beperformed, or if there are symptoms worrisome for voiding dysfunction avideourodynamics study. In patients with evidence of renal scarring or a smallkidney on ultrasound, a DMSA renal scan should be obtained to evaluate forrenal scarring and the differential function. Typically, the grade of VUR is an important factor for predictingresolution and risk of renal scarring; however, in postpubertal patients it hasnot been studied as extensively. It is expected that the rates of spontaneousresolution will be lower after puberty.One of the more humbling experiences for a pediatric urologist is their first ureteralreimplantation done on a female after puberty. These difficulties start asfemales approach puberty. During puberty, the pelvis widens and deepens in thefemale. The trigone assumes a deeper retropubic location which makes access tothe ureteral orifices and the mobilization of the ureters more difficult. Additionally, the plexus of vein running across the surface of the bladder enlarge and are more proneto troublesome bleeding during ureteral dissection. Though not well documented,most pediatric urologists would agree that, if a child truly needed ureteralreimplantation for correction of their VUR, then the operation is bestperformed if they are operated on during childhood rather than after puberty. Experience would tell us that they recover quicker and that technically thesurgery should be more successful, however, there are not series documentingpoorer results after ureteral reimplantation for patients treated afterpuberty. Options for treatment of VUR inpatients after puberty include intra- or extra-vesical ureteral reimplantation,endoscopic injection, and laparoscopic or robotic reimplantation. In patients with unilateral VUR to a poorlyfunctioning kidney nephrectomy may be an alternative choice to ureteralreimplantation. This can be performed laparoscopically with rapid recovery andshort hospitalization.As mentioned previously, the postpubertal changes in women make the surgical access to thetrigone more challenging and limit exposure; however, ureteral reimplantationcan be performed in women successfully. In males, the changes are less dramatic. Published results of ureteral reimplantation in postpubertal patientsare sparse due to the limited number of patients in whom this surgery isindicated. From a technical standpoint,it is prudent to position the patient over the break in the OR table. This allowsthe table to be flexed if necessary to open the pelvis and improve retropubicexposure. This is similar to thepositioning of a male undergoing radical retropubic prostatectomy. The size and body mass index will play a rolewith obese patients creating more difficulties with exposure. Proper surgicalplanning and the use of larger and more flexible fixed retractors such as aBookwalter rather than the Denis-Browne retractor will facilitate theprocedure. Both ureteral advancements and ureteroneocystotomy procedures  can be performed but limiteddata is available on their use in the treatment of VUR postpuberty \u201320. TherAlthough controversy remains about the role of endoscopic injection for VUR as analternative to ureteral reimplantation in young children, there are few\u201creimplanters\u201d who would completely dismiss this option in patients afterpuberty. This technique has been practiced for over 20 years and a variety of bulkingagents have been injected including polytetrafluoroethylene paste,gluteraldehyde cross-linked bovine collagen, polydimethysiloxane, and detranomer/hyaluronic acid copolymer (D/HA) . In the Minimally invasive ureteral reimplantation for VUR has been performed for over a decade;however its widespread uses have been slow to spread. Proponents oflaparoscopic surgery would cite the limited laparoscopic experience of mostpediatric urologists as a primary factor for this slow adaptation. However,many would argue against relearning to do a procedure which has rapid recovery,high success rate, low complication rate, and is done through an inconspicuousincision. A low, transverse abdominal incision leaves a scar that often blendsinto the natural creases of the abdominal skin leaving a barely visible mark. Ifplaced low enough it is covered by undergarments and is not disfiguring. Giventhe questionable benefits and technical difficulties the laparoscopic techniquehas been slow to gain acceptance. Onepopulation where this approach actually may be a real asset is in treating VURafter puberty.Both intra- and extra-vesical laparoscopic techniques for reimplantation have been described in children \u201328. In tRobotic assisted laparoscopic surgery has become a widely practiced urologic techniquefor performing radical prostatectomy . The surThe natural history of untreated VURin postpubertal patients is unknown. Treatment of VUR should be considered in those patients with VUR andrecurrent febrile UTIs. The optimal method to treat VUR is not clear. Endoscopic injection is a minimally invasive approach which has a good successrate for treating VUR and offers some benefits over ureteral reimplantation. The role of laparoscopic and robotic ureteral reimplantation is evolving andmay offer some advantages over open ureteral reimplantation in postpubertalpatients."}
{"text": "Micturating cystourethrogram (MCUG) is advocated in all patients with antenatally detected hydronephrosis to diagnose vesicoureteral reflux (VUR). In this study, the authors have tried to identify if MCUG is really needed for all these patients. They followed 55 children with antenatal hydronephrosis (ANH) by adopting a selective approach to performing MCUG. Ultrasound examination was done at one week for all unilateral hydronephrosis. It was done at two to three days postnatally in patients with bilateral hydronephrosis. All these patients were periodically followed up every two to three months by ultrasound. If the Antero-posterior (AP) diameter was more than 15 mm or more than 10 mm with calyceal dilatation on two months' ultrasound, Mercapto-acetyl Triglycine-3 renogram was done to rule out pelviureteric junction (PUJ) obstruction. None of the patients with AP diameter of less than 10 mm had antibiotic prophylaxis. In this study, 29 patients had MCUGs done to rule out VUR, based on the presence of any of the following ultrasound findings: bilateral hydronephrosis, ureteric dilatation, renal scarring, bladder wall thickness greater than 5 mm or presence of duplex system or ureterocele. Out of these only eight patients had VUR, of which resolution occurred in five cases. The remaining three patients did not require reimplantation of ureter. However, surgical correction was needed in one patient who underwent bilateral pyeloplasty and two who needed upper pole heminephrectomies. In 26 patients of ANH, followed without MCUGs, 18 had spontaneous resolution, five required pyeloplasty for increasing hydronephrosis and three had Multicystic Dysplasia of Kidneys (MCDK) on follow-up scans. Minimum follow-up in this study was three years. The authors believe that VUR in most antenatally diagnosed hydronephrotic kidneys is more physiological than pathological and hence resolves without long-term renal damage. More conservative approach to postnatal investigations of ANH reduces the number of unnecessary tests like MCUGs and does not result in missed renal scars.et al. have shown that neonatal VUR showed complete resolution or improvement in 95% of the cases by 20 months.[et al., studied 160 cases of unilateral HN and noted that in seven patients who were subjected to MCUGs for UTI, only one had documented VUR.[Vesicoureteral reflux is one of the common causes of ANH. There is no significant correlation between the degree of ANH and VUR. This necessitates MCUG being recommended in all cases of ANH including mild varieties to diagnose underlying VUR. This is to detect VUR which may lead to increased urinary tract infections (UTIs). The resultant long-term sequelae of renal scar and decreased renal function can thus be reduced. Farhat 0 months. Thomas ented VUR. in varioIn this study, the authors did not use prophylactic antibiotics in patients with renal pelvis diameter of less than 10 mm, who still may be having VUR, the possibility of which is already mentioned in their reference. The VUR per se is not the cause of infection but only facilitates the ascending infections, and hence the tendency to split neonatal VUR and reflux in older children, is an assertive suggestion."}
{"text": "Atherosclerosis is a complex pathological condition caused by a number of mechanisms including the accelerated proliferation of vascular smooth muscle cells (VSMCs). Diabetes is likely to be an important risk factor for atherosclerosis, as hyperglycemia induces vascular smooth muscle cell (VSMC) proliferation and migration and may thus contribute to the formation of atherosclerotic lesions. This study was performed to investigate whether PGC-1\u03b1, a PPAR\u03b3 coactivator and metabolic master regulator, plays a role in regulating VSMC proliferation and migration induced by high glucose.PGC-1\u03b1 mRNA levels are decreased in blood vessel media of STZ-treated diabetic rats. In cultured rat VSMCs, high glucose dose-dependently inhibits PGC-1\u03b1 mRNA expression. Overexpression of PGC-1\u03b1 either by infection with adenovirus, or by stimulation with palmitic acid, significantly reduces high glucose-induced VSMC proliferation and migration. In contrast, suppression of PGC-1\u03b1 by siRNA mimics the effects of glucose on VSMCs. Finally, mechanistic studies suggest that PGC-1\u03b1-mediated inhibition of VSMC proliferation and migration is regulated through preventing ERK1/2 phosphorylation.These results indicate that PGC-1\u03b1 is a key regulator of high glucose-induced proliferation and migration in VSMCs, and suggest that elevation of PGC-1\u03b1 in VSMC could be a useful strategy in preventing the development of diabetic atherosclerosis. Atherosclerosis and microvascular diseases are the major vascular complications of diabetes, and constitute the principal causes of morbidity and mortality among diabetics Recent studies demonstrated that TZDs, the PPAR\u03b3 ligands, decreased cardiovascular risks via exerting direct effects on vascular cells, for example, inhibition of VSMC proliferation and migration PGC-1\u03b1 is a transcriptional coactivator of PPAR\u03b3 and regulates expression of many genes coding for mitochondrial proteins High glucose has been reported to increase rat VSMC growth and movement The glucose-induced VSMC proliferation and migration was found to be associated with the inhibition of the expression of PGC-1\u03b1. As shown in We also examined PGC-1\u03b1 mRNA expression in the blood vessel media (VSMC is the only cell type in this layer) in normal and STZ injected rat arterial samples. In STZ-treated rats, PGC-1\u03b1 mRNA level was decreased by 66\u00b114% compared to the control group .To further study the role of PGC-1\u03b1 in VSMC proliferation and migration, VSMCs were infected with adenovirus driving the overexpression of PGC-1\u03b1. After 24 h PGC-1\u03b1 mRNA and protein level was markedly elevated. As shown in 6 cell/dish versus 0.98\u00b10.03\u00d7106, P<0.001, n\u200a=\u200a6, 6 versus 1.05\u00b10.06\u00d7106 cells/dish, P>0.05, n\u200a=\u200a6, 15 mmol/L glucose was used to stimulate VSMC growth and movement, the number of Ad-GFP infected cells, cultured in 15 mmol/L glucose were nearly 1.5-fold higher than cells cultured at 5.5 mmol/L glucose . Following PGC-1\u03b1 knockdown, the inhibitory effect of palmitic acid on VSMC proliferation and migration was abolished. As shown in High glucose stimulates VSMC proliferation and migration through the activation of MAPK ERK signaling PGC-1\u03b1, an important transcriptional coactivator, plays a key role in energy metabolism A large body of work has established that chronic hyperglycemia promotes VSMC proliferation and migration and contributes to the progress of diabetic atherosclerosis As the most prevalent saturated FFA in circulation, palmitic acid has been shown to down-regulate PGC-1\u03b1 expression in muscle cells It was previously shown that high glucose induces mitogenesis in VSMCs through increasing extracellular signal-regulated kinase (ERK) activity In summary, our results suggest that high glucose increases VSMC proliferation and migration through PGC-1\u03b1. Experimental elevation of PGC-1\u03b1  inhibits high glucose-induced VSMC proliferation and migration. Thus, our results reveal a novel function of PGC-1\u03b1 as a regulator of VSMC proliferation and migration, and provide a potential strategy of treatment for diabetic atherosclerosis.Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health . All animals were treated in accordance with guidelines established by the Nanjing University Institutional Animal Care and Use Committee.The investigation conforms to the Sprague-Dawley rats weighing about 180\u2013200 g were made diabetic by a single injection of streptozotocin  according to a previously described method Primary vascular smooth muscle cells were isolated from the thoracic aortas of 3- to4-week-old male Sprague-Dawley rats and characterized morphologically and immunohistochemically as described previously Recombinant adenoviruses expressing PGC-1\u03b1 GFP fusion protein and GFP alone were kindly provided by Dr. Daniel P. Kelly . VSMCs were infected with purified adenovirus at an MOI (multiplicities of infection) of 50 to obtain 95\u2013100% efficiency, as determined by GFP expression 24 h after infection.Three siRNA sequences targeting different sites of rat PGC-1\u03b1 cDNA were designed and synthesized by Genesil . Control sequence which could not target PGC-1\u03b1 cDNA was also included as a negative control. siRNA was transfected into VSMCs using LipofectAmine reagent  according to the manufacture's manual. Of several sequences tested for PGC-1\u03b1 knock-down, the sequence with the best interfering effect was selected as described previously 5 cells/dish) and were allowed to grow to subconfluence, then were growth-arrested by serum deprivation for 12 h. Cells were then divided into several groups and were applied to different stimulation. After 48 h, cells were resuspended with 0.05% trypsin and 0.02% EDTA, and the cell number was determined with hemocytometer.Cell counting analysis was performed for evaluation of the effect of glucose on VSMC proliferation. In separate experiments, VSMCs were seeded in 6 cm plastic dishes . A reference point was created on the bottom of the plate in the field of the wound using direct microscopic visualization. The measurement of the width of the gap after 48 h was subtracted from that at 0 h to give the distance the cells migrated. The results of the five readings from each well were averaged. Independent stimulation experiments were repeated three times. Boyden chamber cell migration assay was performed using transwell chambers with fibronection-coated 8-\u00b5m-pore-size polycarbonate membranes (BD Biosciences). Preconfluent VSMCs treated in the same way were then suspended in DMEM\u20130.5% FBS to a concentration of 4\u00d7105 cells/mL. Different fatty acids or serum free DMEM (0.6 mL) were added to the lower compartment. A 0.1-mL cell suspension  was added to the upper compartment, and cells were then incubated at 37\u00b0C (95% air\u20135% CO2). 6 h later, non-migrated cells were removed with a cotton swab, and the migrated cells were fixed with paraformal-dehyde for 30 min and stained with crystal violet. Cell migration was quantified by blind counting of the migrated cells on the lower surface of the membrane of 5 fields per chamber under microscope.Migration of VSMCs was investigated by a standard 5\u2032-AGGTCCCCAGGCAGTAGAT-3\u2032 (sense) and 5\u2032-CGTGCTCATTGGCTTCATA (antisense), probe: 5\u2032-fam-ATGAATCAAGCCACT ACAGACACC-tamra-3\u2032; primers for rat \u03b2-actin (GenBank access number V01217) were 5\u2032-AGGGAAATCGTGCGTGAC-3\u2032 (sense) and 5\u2032-CGCTCATTGCCGATAGT G-3\u2032 (antisense), probe: 5\u2032-fam-CTGTGCTATGTTGCCCTAGACTTC-tamra-3\u2032; Amplification conditions were: one cycle of 95\u00b0C for 5 minutes followed by 40 cycles of 95\u00b0C for 30 seconds, 60\u00b0C for 1 minute, and final one cycle of 72\u00b0C for 2 minutes. Relative abundance of mRNA was determined from the CT values and was normalized to the value of the house-keeping gene.Total RNA was isolated from rat arterial samples or rat VSMCs using RNeasy kit  according to the manufacturer's instructions. cDNA was synthesized and subjected to PCR amplification with the ABI Prism 7000 sequence detection system  as described For Western blot analysis, total proteins were applied to 7.5% SDS-PAGE gel electrophoresis for PGC-1\u03b1 detection, and rabbit polyclonal PGC-1 antibody  was used as primary antibody. Samples containing 50 \u00b5g total proteins were applied to 12.5% SDS-PAGE gel electrophoresis for phosphorylated ERK1/2 detection, and phospho-specific mouse anti-human ERK1/2 antibody (BD Biosciences), mouse anti-human ERK antibody (BD Biosciences) and mouse monoclonal GAPDH antibody (Santa Cruz) were used as primary antibody.All results are expressed as means\u00b1SEM. Data were analyzed using a one-way ANOVA and Student-Newman-Keuls tests for multiple comparisons or Student's test for unpaired data. In all cases P\u22640.05 was taken as statistically significant."}
{"text": "To investigate the role san-1(ok1580) animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580) embryos is significantly reduced when HCP-1 (CENP-F homologue), MDF-1 (MAD-1 homologue), MDF-2 (MAD-2 homologue) or BUB-3 (predicted BUB-3 homologue) are reduced by RNAi. Interestingly, the viability of san-1(ok1580) embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580);hcp-1(RNAi) embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation . Several of the san-1(ok1580);hcp-1(RNAi) animals displayed abnormal kinetochore (detected by MPM-2) and microtubule structure. The survival of mdf-2(RNAi);hcp-1(RNAi) embryos but not bub-3(RNAi);hcp-1(RNAi) embryos was also compromised. Finally, we found that san-1(ok1580) and bub-3(RNAi), but not hcp-1(RNAi) embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein.The C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580);hcp-1(RNAi) animals had a severe viability defect whereas in the san-1(ok1580);hcp-2(RNAi) and san-1(ok1580);hcp-2(ok1757) animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.Together, these data suggest that in the  The spindle checkpoint genes regulate chromosome segregation during mitosis and when mutated lead to a variety of human health concerns including cancer ,2. Thus,The spindle-checkpoint signaling pathway is well understood and has been discussed in many reviews ,5-9. BriCaenorhabditis elegans and Drosophila melanogastor. For example, in C. elegans the genes mdf-1 and mdf-2 (MAD1 and MAD2 homologues respectively) have a role in development and germline function [mdf-1(gk2) animals. A genetic screen for suppressors of the weak allele of mat-3, an APC subunit, identified several mdf-2,mdf-1, and san-1/mdf-3 alleles, providing evidence that the metaphase to anaphase transition in meiosis is regulated by the spindle checkpoint [C. elegans embryonic blastomeres [mdf-2 and san-1 (MAD3 homologue) genes are required for response to microtubule-depolymerizing environments such as anoxia-induced suspended animation and nocodazole [Much of the work to elucidate the mechanistic function of the spindle checkpoint proteins has been conducted in yeast and vertebrate cell culture. However, there is increasing evidence that the spindle checkpoint is also required for specific functions in function . Specifieckpoint . The spistomeres . Brieflycodazole ,22. Finacodazole ,21. TogeC. elegans embryos HCP-1, the CENP-F like protein, is localized to the kinetochore during mitosis; yet hcp-1(RNAi) animals do not have any obvious phenotype [In henotype . HCP-1 ahenotype ,24. Howehenotype ,25. The henotype ,25,26; ahenotype . Additiohenotype .san-1 by using RNAi to identify genes that are synthetic lethal with san-1(ok1580). The viability of san-1(ok1580) embryos is significantly reduced when HCP-1, MDF-2 (MAD-2 homologue) or BUB-3  are reduced by RNAi. The viability of mdf-2(RNAi);hcp-1(RNAi) embryos but not bub-3(RNAi);hcp-1(RNAi) embryos was compromised suggesting that HCP-1 interacts with a subset (san-1 and mdf-2) of the spindle checkpoint components. Phenotype analysis of san-1(ok1580);hcp-1(RNAi) embryos supports the idea that HCP-1 functions in the proper alignment of chromosomes and chromosome segregation and that these functions are dependent upon the spindle checkpoint pathway.In this report we further investigate the functional role of the spindle checkpoint gene san-1(RNAi) embryos are viable, yet sensitive to conditions that depolymerize microtubules (anoxia or nocodazole treatment), providing evidence that the san-1 gene product has a role in the spindle checkpoint pathway [san-1 has in C. elegans we obtained a san-1 deletion strain from the C. elegans Knockout Consortium. We verified this deletion by DNA sequence analysis and found that the san-1(ok1580) allele has a 992 kb deletion, which is consistent with what is documented in wormbase. The san-1 gene contains 8 predicted exons, of which the deletion in san-1(ok1580) removes all of exons 3\u20137 and the first 13 bp of intron 7. Thus, the san-1(ok1580) allele is minimally a catalytic null as the predicted kinase domain and Mad3/Bub1 homology region predicted to be essential for binding to CDC20p is absent (data not shown).Previously, it was shown that  pathway ,22. To isan-1(ok1580) hermaphrodites grown at 24\u00b0C have several phenotypes including a higher incidence of males in the population, egg laying defects, and a higher death rate in adult hermaphrodites due to vulva bursting or formation of a bag of worms [san-1(RNAi) was done at 20\u00b0C, we characterized the phenotype of san-1(ok1580) animals grown at 20\u00b0C. Similar to animals maintained at 24\u00b0C, we found that the san-1(ok1580) embryos were viable, yet had some low penetrant phenotypes (Table san-1(ok1580) animals have a larvae arrest and slow growth phenotype (Table san-1(ok1580) adults have a higher incidence of death resulting from defects in vulva morphogenesis (Table san-1(ok1580) animals and determined that the san-1(ok1580) animals contained tissue damage, abnormal vulva anatomy, and an increase in the protruding vulva phenotype  animals is not significantly different (P = .176) (Table san-1(ok1580) animals, indicating that some of the san-1(ok1580) animals were not laying embryos. Consistent with this idea, we observed that 18% (n = 16) of the san-1(ok1580) 1-day old adults had larvae hatching out in the uterus. We analyzed progeny production in san-1(ok1580) hermaphrodites and determined that the average number of progeny produced was significantly decreased in comparison to wild-type hermaphrodites (Table san-1(ok1580) hermaphrodites died as young adults and produced less than 60 progeny, whereas others did not die, yet they still produced significantly less progeny than wild-type hermaphrodites (P = .001). The san-1(ok1580) animals also have a higher incidence of males (Table san-1(ok1580) males have various defects in tail morphology including an increase in tissue damage, and abnormal ray morphology or tissue structure  males for mating indicating that the san-1(ok1580) males are not sterile. In summary, these results are consistent with defects in cell cycle progression leading to abnormal vulva development in the hermaphrodite and somatic cell defects in the adult male [Others have shown that of worms . As prioe Figure , Table 1e Figure . In our ult male .san-1 function in C. elegans we used RNAi to identify additional genes that genetically interact with san-1(ok1580). We were interested in determining if RNAi of specific gene products resulted in a more severe phenotype in the san-1(ok1580) background. This approach is similar in concept to a synthetic lethal screen, an established technique to identify genetic interactions in which the double mutant has a phenotype distinct or more severe than the phenotype(s) of the individual single mutants. The genes that we evaluated included those that are involved with kinetochore assembly or spindle checkpoint function and do not have severe embryonic lethality phenotypes. Thus, we analyzed hcp-1, hcp-2, the putative bub-3 homologue Y54G9A.6, the known spindle checkpoint genes, mdf-1 and mdf-2, and the predicted kinetochore protein kbp-5 [hcp-1/2 genes encode kinetochore-localized proteins required for kinetochore assembly, and animals only have a significant defect in viability when both HCP-1/2 are simultaneously depleted by RNAi [C. elegans Y54G9A.6 predicted gene product suggests there is homology with yeast BUB3 , Homo sapiens BUB3 , and D. malanogaster BUB3 . The amino acid identity between the C. elegans Y54G9A.6 predicted gene product and BUB3 proteins is 44% for H. sapiens, 43% for D. melanogastor and 19% for Saccharomyces cerevisiae, as determined using the ClustalW software. Thus, the Y54G9A.6 gene will be referred to as bub-3 in this report. Other gene candidates likely to interact with san-1, such as other spindle checkpoint genes (bub-1), genes that encode products essential for kinetochore assembly and function  and homologues to zw10 and rod , were not analyzed because RNAi of these gene products result in severe embryonic lethality, thus testing a synthetic lethal interaction with san-1(ok1580) is not possible. We chose to focus our analysis instead on genes bub-3, mdf-1, mdf-2, hcp-1, hcp-2 and kbp-5.To further analyze the in kbp-5 . The hcp by RNAi ,25. The san-1, mdf-1, mdf-2, bub-3) or the kinetochore assembly genes  individually did not result in severe embryonic lethality and the majority of animals developed into adults  and mdf-2(RNAi) animals had several phenotypes as adults including death due to vulva bursting or formation of a bag of worms (data not shown), which is consistent with what others have observed [mdf-1(gk2) deletion mutant has a significant embryo lethal phenotype [mdf-1(RNAi) acts as a null. In comparison to san-1(ok1580) animals, the san-1(ok1580);bub-3(RNAi) (P < .04), san-1(ok1580);mdf-1(RNAi) (P < .01) and san-1(ok1580);hcp-1(RNAi) (P < .0003) animals displayed a reduction in the ability for embryos to develop to adulthood ;hcp-1(RNAi) animals died as embryos or young larvae. The san-1(ok1580);hcp-2(RNAi) animals had a decrease in the ability to develop to adulthood, in comparison to san-1(ok1580) animals (P < .05), however the phenotype was not as a severe as the san-1(ok1580);hcp-1(RNAi) animals ;mdf-2(RNAi) had a reduced but not significant difference in viability (P = .073). We did not observe a viability defect in san-1(ok1580);kbp-5(RNAi) animals thus kbp-5 was not further analyzed (data not shown).A reduction in the spindle checkpoint genes  and san-1(ok1580) animals to produce a san-1(ok1580);hcp-2(ok1757) animal. The hcp-2(ok1757) allele is a 1.281 kb deletion, which removes most of exon 5 resulting in a frame-shift; hcp-2 has 8 predicted exons (data not shown). We verified this deletion by DNA sequence analysis. We determined that 26.25% of the F2 offspring (n = 80) from a san-1(ok1580) and hcp-2(ok1757) cross had phenotypes including embryo lethality, larvae lethality, odd morphology and lethargy. The number of F2 progeny with abnormal phenotypes was higher than the expected 1/16 (6.25%) for a homozygous double mutant animal (san-1(ok1580);hcp-2(ok1757)), suggesting that some of the F2 progeny that are a combination of homozygous and heterozygous mutations for either san-1(ok1580) or hcp-2(ok1757) may have an abnormal phenotype. We genotyped 39 F2 animals, using single worm PCR to detect the san-1 and hcp-2 deletions, and determined that the homozygous double mutant (san-1(ok1580);hcp-2(ok1757)) and animals homozygous for the san-1(ok1580) deletion and heterozygous for the hcp-2(ok1757) deletion displayed embryonic and larval lethality phenotypes. The hcp-2(ok1757) animals appeared to be lethargic as adults, as noted by their reduction in motility, yet did not exhibit embryonic lethality and the majority reached adulthood three days after egg laying ;hcp-2(ok1757) double mutant and determined that the majority of the embryos hatched, yet only 7.3 % \u00b1 2.4 of the larvae reached adulthood within three days at 20\u00b0C. However, if given four days to develop the majority of san-1(ok1580);hcp-2(ok1757) animals developed to adulthood ;hcp-2(ok1757) animals had morphological defects suggesting that the double mutant had a more severe phenotype then the single mutants (data not shown). Our results indicate that the phenotype observed in san-1(ok1580);hcp-2(ok1757) is not identical to that observed in san-1(ok1580);hcp-1(RNAi) animals.Because RNAi does not always completely remove all of a genes function, we used a genetic deletion of g Figure . We isold Figure . Severalhcp-1(RNAi);hcp-2(RNAi) embryos die during embryogenesis; however, over half of the san-1(ok1580);hcp-1(RNAi) or mdf-2(RNAi);hcp-1(RNAi) animals survive embryogenesis but die as larvae ;hcp-1(RNAi) or mdf-2(RNAi);hcp-1(RNAi) animals is not as severe in comparison to the hcp-1(RNAi);hcp-2(RNAi) animals [mdf-2(RNAi) animals, the mdf-2(RNAi);hcp-1(RNAi) animals had a significant decrease in the ability to develop and survive to adulthood (P < .011). The mdf-2(RNAi);hcp-2(ok1757) animals also had a decrease in the ability to survive to adulthood (P < .025), however the viability defect was not as severe as that observed in mdf-2(RNAi);hcp-1(RNAi) animals  or hcp-1(RNAi) animals, the bub-3(RNAi);hcp-1(RNAi) animals did not have a viability defect ;hcp-2(ok1757) ;hcp-2(RNAi) (data not shown) animals did not have viability defects. Using RT-PCR, in comparison to wild-type, a greater than 5 fold reduction in bub-3 transcript level (P < .029) was observed in bub-3(RNAi) animals, thus demonstrating RNAi efficiency. Together, these results suggest that san-1 genetically interacts with bub-3, mdf-2, mdf-1, hcp-1 and hcp-2 and that C. elegans requires both hcp-1 and either of the checkpoint genes, san-1 or mdf-2 but not bub-3. Furthermore, these results suggest that hcp-1 and hcp-2 have redundant but not identical functions.Nearly all of the e Figure , 2C. Thu animals . In compsan-1(ok1580);mdf-2(RNAi), san-1(ok1580);bub-3(RNAi) and san-1(ok1580);hcp-1(RNAi) animals, we analyzed the animals for developmental defects. The majority of animals, that did not die as embryos, arrested as larvae or had an abnormal gonad as adults ;mdf-2(RNAi), san-1(ok1580);bub-3(RNAi) and san-1(ok1580);hcp-1(RNAi) animals had larvae arrest or slow growth phenotypes ;mdf-2(RNAi) or san-1(ok1580);bub-3(RNAi) animals included abnormal cell morphology in the mitotic region of the gonad, abnormal cell morphology in the meiotic region of the gonad, meiotic cells that had button like cell morphology reminiscent of apoptotic cells, and abnormal oocyte structure ;hcp-1(RNAi) animals died or arrested as larvae. Abnormal gonad morphology was not observed in the bub-3(RNAi) or hcp-1(RNAi) animals. Some of the san-1(ok1580) and mdf-2(RNAi) had abnormal gonad morphology ;hcp-2(RNAi) animals die as embryos whereas many of the san-1(ok1580);hcp-1(RNAi) embryos hatch and later die as young larvae ;hcp-1(RNAi) embryos have developmental defects we used the pharynx as a marker for developmental progression, by analyzing the expression of myo-2::GFP. Briefly, myo-2 encodes a muscle-type specific myosin heavy chain isoform and is expressed during embryogenesis in the primordial pharyngeal muscle cells. Similar to the control embryos   ;hcp-1(RNAi) embryos had either a reduction in myo-2::GFP ;hcp-1(RNAi) embryos have developmental defects.The s Figure , the hcp) Figure  and san-) Figure  animals P Figure  or abnorP Figure . Togethesan-1(ok1580) animals depends upon bub-3 and hcp-1, however it is not clear if, like the san-1,mdf-1 and mdf-2 genes, the bub-3 and hcp-1 gene products function in the spindle checkpoint pathway. It is known that blastomeres of wild-type embryos exposed to oxygen deprivation (anoxia) reversibly arrest cell cycle progression [san-1(RNAi) and mdf-2(RNAi) embryos are sensitive to the microtubule disrupting environments of anoxia or nocodazole treatment. Specifically, san-1(RNAi) and mdf-2(RNAi) embryos exposed to anoxia have a significantly reduced number of metaphase blastomeres and an increase in anaphase bridging and chromosomal abnormalities; supporting the idea that san-1 and mdf-2 function as spindle checkpoint genes [san-1(RNAi) embryos, the san-1(ok1580) embryos exposed to anoxia had a reduced survival rate (Table bub-3(RNAi) embryos exposed to anoxia also had a reduced survival rate in comparison to wild-type animals suggesting that bub-3 functions as a spindle checkpoint protein in developing embryos. The hcp-1(RNAi) embryos were not sensitive to anoxia (Table hcp-2(RNAi) or hcp-2(ok1757) embryos (data not shown). These results suggest that hcp-1 and hcp-2 are not required for anoxia induced metaphase arrest and do not function as a spindle checkpoint protein.Our data suggest that the development of gression ,29. Unlint genes ,22. Simihcp-1 and san-1 gene products in developing embryos we determined if chromosome loss was occurring in the san-1(ok1580);hcp-1(RNAi) embryos. We analyzed chromosome structure in mitotic blastomeres from wild-type, hcp-1(RNAi), san-1(ok1580), and san-1(ok1580);hcp-1(RNAi) embryos collected, fixed and stained as previously described [san-1(ok1580), and hcp-1(RNAi) embryos ;hcp-1(RNAi) embryos had a significant increase in abnormal nuclei   Figure . These a) Figure , arrows.hcp-1(RNAi)  embryos ;hcp-1(RNAi) embryos with greater than 30 blastomeres, the nuclear pore complex, detected by mAb414, were in small aggregates surrounding the metaphase plates  ;hcp-1(RNAi) embryos.In young wild-type embryos (less than 30 blastomeres) the nuclear pore complexes detected by mAb 414 do not diminish during mitosis . In cont) Figure , and sans Figure . Howeversan-1(ok1580);hcp-1(RNAi) embryos we analyzed chromosome, kinetochore and spindle microtubule structure using indirect immunofluorescence. We first stained embryos with MPM-2, an antibody that recognizes mitotic proteins localized to the kinetochore and centrosomes [san-1(ok1580) and hcp-1(RNAi) embryos was similar to that of wild-type embryos ;hcp-1(RNAi) embryos contained both normal and abnormal kinetochore structure, as determined by the presence or absence of the two-line formation along the sister chromatids  and hcp-1(RNAi) embryos were similar to that of wild-type embryos ;hcp-1(RNAi) blastomeres with normally formed metaphase plates had normal centromere and microtubule structure ;hcp-1(RNAi) blastomeres with abnormal chromosome structure contained HCP-3 localized with chromosomes  and spindle microtubules, respectively ,26. HCP-s Figure . The sane Figure . The sans Figure ; yet in s Figure . In thess Figure . Embryossan-1(ok1580);hcp-1(RNAi) animals, it is likely that the blastomeres were transitioning through mitosis abnormally. To determine if this occurred in vivo we produced a san-1(ok1580);tbg-1::GFP;pie-1::GFP::H2B strain  for live cell imaging using a spinning disc confocal microscope. The san-1(ok1580);hcp-1(RNAi);tbg-1::GFP;pie-1::GFP::H2B embryos contained blastomeres with abnormal mitotic progression. Analysis of a typical san-1(ok1580);hcp-1(RNAi) embryo showed one blastomere which progressed to anaphase with normal chromosome segregation, and another blastomere with abnormal chromosome segregation leading to anaphase bridging ;hcp-1(RNAi) embryos.Given the presence of anaphase bridging, lagging chromosomes, and abnormal chromosome structure observed in the san-1(ok1580);hcp-1(RNAi) embryos abnormally segregate chromosomes which likely leads to developmental defects and lethality. The hcp-1(RNAi) embryos have not been shown to have chromosome segregation issues that lead to increased lethality. One possible reason for the synthetic lethal interaction between san-1 and hcp-1 is that loss of san-1 amplifies a subtle hcp-1 defect. Given the defect in progression through mitosis observed with mAb 414, timing of mitotic progression is possibly perturbed when hcp-1 is absent and loss of san-1 increases this defect. Therefore, we conducted live cell imaging to compare mitotic progression in hcp-1(RNAi);tbg-1::GFP;pie-1::GFP::H2B and control animals. We analyzed mitosis in the AB and P cell blastomeres of a 2-cell embryo. We determined the time it took to transition from nuclear envelope break down (NEB) to formation of the metaphase plate, metaphase to anaphase onset and NEB to anaphase onset in the P cell of a wild-type and hcp-1(RNAi) 2-cell embryo. We also determined the time between NEB of the AB cell and NEB of the P cell. We found that the mitotic progression of hcp-1(RNAi) embryos analyzed at 21\u00b0C did not have any chromosomal defects and the time it took to progress through mitosis was not significantly different in comparison to control embryos  animals require a functional spindle checkpoint for normal development.Thus far, we have shown that the san-1ok150;hcp-1. We determined that san-1(ok1580);hcp-1(RNAi), san-1(ok1580);bub-3(RNAi), san-1(ok1580);mdf-1(RNAi), and san-1(ok1580);mdf-2(RNAi) had a reduced ability to survive. The genetic interaction between san-1, mdf-1, and mdf-2 is expected, since these genes are thought to function in the spindle checkpoint pathway in mitotic and meiotic cells [C. elegans bub-3 gene product has high homology to BUB-3 from other systems and bub-3(RNAi) embryos are more sensitive to the microtubule disrupting process of anoxia exposure, supporting the idea that the Y54G9A.6 gene encodes the bub-3 spindle checkpoint gene.The use of synthetic lethal screens is a genetic tool to elucidate genes that interact in similar cellular functions or pathways. Thus, when a genetic mutant does not have a severe phenotype the use of a synthetic lethal screen to identify double mutants that have a phenotype distinct or more severe then the phenotype(s) observed for the individual single mutants often will aid in further understanding the function of the gene products. To analyze ic cells -21. The hcp-1/2 and the spindle checkpoint genes is likely to be more complex. The viability of san-1(ok1580);hcp-1(RNAi) and mdf-2(RNAi);hcp-1(RNAi) animals was severely compromised, suggesting that HCP-1 interacts with MDF-2 and SAN-1. However, the bub-3(RNAi);hcp-1(RNAi) animals did not have a significant decrease in survival rate. This could be due to BUB-3 and HCP-1 not involved together in a specific function. The san-1(ok1580);hcp-2(ok1757) animals have embryonic and larvae lethal phenotypes. We isolated a san-1(ok1580);hcp-2(ok1757) double mutant and determined that it had more severe phenotypes than that observed in the single mutants; this suggests that hcp-2 and san-1 genetically interact. However, the phenotype of the san-1(ok1580);hcp-2(ok1757) double mutants was not as severe as that observed san-1(ok1580);hcp-1(RNAi) animals, suggesting that HCP-1 and HCP-2 are not be completely redundant. HCP-1 and HCP-2 are 54% similar mostly at their N- and C-termini [The genetic interaction between -termini . Althoug-termini . Thus, isan-1(ok1580);hcp-1(RNAi) animals had severe developmental defects including embryo and larvae lethality. The viability defects observed are likely due to abnormal chromosome segregation, which will in turn compromise cellular structure and function. The san-1(ok1580);bub-3(RNAi) and san-1(ok1580);mdf-2(RNAi) animals had gonad defects. We and others have shown that san-1(ok1580) and mdf-2(RNAi) animals have low level gonad defects [san-1(ok1580) hermaphrodites and others have shown that mdf-2(av14) mutants have a reduced brood size, further supporting the role the checkpoint genes have in germline function [hcp-1(RNAi);hcp-2(RNAi) animals also have meiotic defects, supporting the idea that hcp-1 has a role in meiosis [The majority of  defects ,19; yet  meiosis . The exasan-1(ok1580);hcp-1(RNAi) embryos have severe chromosome segregation defects, and on average 55.3% of the embryos die and approximately 0.9% of the animals reach adulthood. Thus, in san-1(ok1580);hcp-1(RNAi) embryos, embryogenesis can progress, but the ability to produce viable adults is severely compromised. We used myo-2::GFP to analyze the structure of the developing pharynx in the san-1(ok1580);hcp-1(RNAi) embryos and found that there was not only abnormal pharynx morphology but we often observed a reduction in the myo-2::GFP in the embryos. It is not known if the reduction in myo-2::GFP in the san-1(ok1580);hcp-1(RNAi);myo-2::GFP animals is due to abnormal differentiation, the loss of myo-2::GFP DNA or abnormal regulation of the myo-2::GFP. An increase in genome loss due to chromosome segregation issues could result in either of these possibilities.The san-1(ok1580);hcp-1(RNAi) embryos have chromosome segregation defects leading to abnormal nuclei, anaphase bridging and lagging chromosomes. We determined that the nuclear pore complexes, detected by mAb414, formed small aggregates surrounding the metaphase plates in san-1(ok1580);hcp-1(RNAi) embryos, indicating that the nuclear membrane pore complexes are not completely breaking down. This may indicate that SAN-1 and HCP-1 influences additional mitotic events in addition to chromosome segregation. The centromeric protein HCP-3 was observed to have a normal or an abnormal localization pattern in the san-1(ok1580);hcp-1(RNAi) blastomeres. The abnormal localization of HCP-3 can be interpreted in several ways. First, it could be due to SAN-1 and HCP-1 directly regulating the localization of HCP-3 to the region that marks the centromere, however this seems unlikely since the kinetochore assembly pathway clearly places HCP-3 upstream of HCP-1 and SAN-1. Alternatively, the abnormal HCP-3 localization could be due to chromosome segregation defects causing loss of chromatin that marks the centromere. Finally, it is possible that the segregation defects result in chromatin fragments that HCP-3 associates with. Further studies would be required to determine the mechanism leading to abnormal HCP-3 localization.Closer examination of the chromosomes, nuclear pore proteins, centromere, kinetochore, and microtubules indicates that the san-1(ok1580);hcp-1(RNAi) embryos, the kinetochore proteins recognized by the MPM-2 antibody were not associated with the chromosomes when the chromosome structure was aberrant. Furthermore, the microtubule structure was altered in blastomeres with abnormal chromosome structure. Together, these data suggests that in the san-1(ok1580);hcp-1(RNAi) blastomeres the kinetochore and microtubule interaction is sometimes, but not always, compromised. Given the increase in anaphase bridges, lagging chromosomes and abnormal mitotic nuclei, the microtubule and kinetochore interaction in san-1(ok1580);hcp-1(RNAi) animals is likely not sufficient for proper chromosome segregation.In C. elegans hcp-1(RNAi);hcp-2(RNAi) blastomeres take longer to progress through mitosis [hcp-1(RNAi) blastomeres of embryos analyzed at 21\u00b0C did not take longer to progress from prometaphase to metaphase, in comparison to control blastomeres, suggesting that mitotic timing of hcp-1(RNAi) blastomeres is normal as long as hcp-2 gene product is present.Others have shown using mammalian cell culture (HeLa cells) that there is a prolonged mitosis in CENP-F (RNAi) cells and this prolonged mitosis is dependent upon the spindle checkpoint gene BUBR1 . In C. e mitosis . Our dathcp-1(RNAi) animals the spindle checkpoint is being activated to ensure proper chromosome segregation and genome defects will occur without normal spindle checkpoint function; specifically SAN-1 and MDF-2 function are required. Given that the involvement of the spindle checkpoint in tumor progression, it is of interest to fully understand the genes products that interact with the spindle checkpoint pathway to ensure genome fidelity and maintenance.CENP-F is required for chromosome alignment  and silesan-1 (mad-3 homologue). We show that the spindle checkpoint genes, san-1 and mdf-2, not only interact with one another but also interact with the CENP-F homologue hcp-1. The bub-3 spindle checkpoint gene does not genetically interact with hcp-1; suggesting that hcp-1 only interacts with a subset of the spindle checkpoint.In this report we identified genes that genetically interact with the spindle checkpoint gene san-1(ok1580);hcp-1(RNAi) embryos demonstrates that C. elegans embryos require san-1 and hcp-1 for proper chromosome segregation. Furthermore, gonad morphological defects were observed in san-1(ok1580);mdf-2(RNAi) and san-1(ok1580);bub-3(RNAi) animals further supporting a functional role of the spindle checkpoints in meiosis. We provide evidence to suggest that the hcp-1 and hcp-2 gene products may have overlapping but also distinct functions in C. elegans. Together, our data suggest that in the C. elegans embryo, HCP-1 functions in proper alignment and segregation of chromosomes and these functions are dependent upon elements of the spindle checkpoint pathway but not all of the spindle checkpoint proteins. Given the important role the spindle checkpoint and kinetochore proteins have in chromosome segregation and cell cycle progression, it is of great interest to characterize these gene products in developing organisms such as C. elegans.Detailed phenotype analysis of the E. coli (OP50) and raised at 20\u00b0C as described . The following strains were obtained from the Caenorhabditis elegans Genetics Center: RB1391(san-1(ok1580)), PD4790 (myo-2::GFP), TH32 , and RB1492 (hcp-2(ok1757)). The Caenorhabditis elegans Gene Knockout Consortium  produced the san-1(ok1580) and hcp-2(ok1757) deletion alleles. The hcp-2(ok1757) mutant (strain RB1492) was back-crossed to wild-type animals three times (strain PM117). The san-1(ok1580) allele was crossed, using standard genetic techniques, to produce the following strains: PM107 (san-1(ok1580);myo-2::GFP), PM115 (san-1(ok1580);tbg-1::GFP;pie-1::GFP::H2B), and PM116 (san-1(ok1580);hcp-2(ok1757)). The san-1(ok1580) allele was backcrossed into wild-type background once. The san-1(ok1580) and hcp-2(ok1757) alleles were genotyped by single worm PCR with the following primers: san-1 forward primer (CGC TTA AAG CTT GAT CAA CTT CTCG), san-1 reverse primer (GCT AGT GAT TTC TCC TCC GTT TTC TCA), hcp-2 forward primer (ACT CTG AAG TCG GAA CAT GAA ATT), and hcp-2 reverse primer (TGA AGA GCC TTC TGT GCA AA). DNA sequence analysis to verify the deleted region of the san-1(ok1580) and hcp-2(ok1757) strains was conducted using standard molecular techniques.The wild-type Bristol strain (N2) and mutant strains were cultured on NGM plates seeded with Saccharomyces cerevisiae was used to conduct BLASTp against the C. elegans, Homo sapiens and D. melanogastor genome to identify the most identical protein for each species. The primary amino acid sequences were aligned using ClustalW and processed using the LaserGene sequence analysis software package (DNASTAR). Clustal analysis between the C. elegans Y54G9A.6 gene product (referred to as BUB-3) and the S. cerevisiae, H. sapiens and D. melanogastor BUB-3 proteins was conducted to determine percent identity between the proteins.The BUB-3 protein from the yeast E. coli (OP50). To assay for the high incidence of males (him) phenotype several hermaphrodites, grown in the absence of males, were allowed to lay eggs for several hours and the percent of male progeny was determined (for wild-type and san-1(ok1580), n = 244, n = 325, respectively). The san-1(ok1580) animals were assayed for larval arrest and slow growth phenotypes (for wild-type and san-1(ok1580), n = 210, n = 218, respectively). To determine if larval arrest or slow growth was observed we collected a synchronized population of L1 larvae and placed on OP50 NGM plates at 20\u00b0C for three to five days. We quantified the number of animals that developed to adulthood within three days, animals that developed to adulthood within three to five days (slow growth) and those that remained arrested as larvae . To assay for adult death phenotype, animals were grown for the first 5 days of adulthood and analyzed every day for death or survivorship (for wild-type and san-1(ok1580), n = 210, n = 207, respectively). Hermaphrodites were moved daily to fresh plates and lost worms were eliminated from analysis. The average brood size was determined by quantifying the number of offspring individual hermaphrodites produced (for wild-type and san-1(ok1580), n = 5, n = 10, respectively). To quantify the number of eggs within the uterus we collected 1-day old adults, placed on an agar pad and visualized using a Zeiss compound microscope; the number of eggs within the uterus was determined (for wild-type and san-1(ok1580), n = 16). To assay for protruding vulva phenotype we collected 1-day old adults and counted the number of adult animals that had a protruding vulva (for wild-type and san-1(ok1580), n = 210, n = 207, respectively). The p values (P) were determined using standard student t test.For all experiments animals were kept at 20\u00b0C and grown on san-1(ok1580)) were grown to adulthood on NGM plates supplemented with 200 \u03bcg/ml ampicillin, 12.5 \u03bcg/ml tetracycline and 1 mM IPTG, seeded with a bacterial strain expressing dsRNA specific for mdf-2, mdf-1, bub-3, hcp-1, hcp-2 or control food [hcp-1 and hcp-2. Briefly, plasmid vectors for feeding RNAi were constructed by cloning either a 1.1 kb Spe I \u2013 Dra I fragment from the hcp-1 cDNA LM46-3 or a 1.6 kb Sal I fragment from the hcp-2 cDNA, yk19h10 into pPD129.36, which allows IPTG induction of double stranded RNA. Respective feeding vectors were transformed into the HTH115(BL23) E. coli strain and fed to animals, consistent with previously described RNAi methodology [E. coli strain, which has a plasmid with no insert, on identical NGM IPTG plates to account for any differences attributable to the vector. We conducted RT-PCR experiments to analyze the efficiency of RNAi by quantifying the level of bub-3 transcript in wild-type and bub-3(RNAi) animals. Methodology is as previously described [bub-3 are as follow: 5'TGGGATCCTTTCAATCGGAAGC3' and 5'TTATTTCGGTCTGCTCCGGA3'. The P value was determined using the Mann-Whitney U Test.RNA interference (RNAi) was used to decrease the expression of specific genes. For all experiments, the methodology was similar to that previously described . Briefly, a synchronous population of L1 larvae  animals were grown, from the L1 larval stage to the 1 day old adult stage, on RNAi food . The adults were placed on a fresh RNAi plate and allowed to lay eggs for 1\u20132 hours. The adults were removed and the embryos were placed into anoxia, for 1 day, using the BioBag type A environmental chamber. The embryos were allowed to recover in air and assayed 24 hours later for the ability to hatch and three days later for the ability to reach adulthood. Four independent experiments with at least a total of 200 embryos were analyzed.To assay whether specific genes are required for spindle checkpoint activity we exposed embryos to anoxia as previously described ,29. Briesan-1(ok1580), or san-1(ok1580);myo-2::GFP) were grown to adulthood on appropriate RNAi plates . To analyze the developing pharynx in embryos, both the san-1(ok1580);myo-2::GFP and the san-1(ok1580);hcp-1(RNAi);myo-2::GFP adult animals were dissected and the embryos were placed onto 2.5% agarose pads for microscopy analysis. To analyze the morphology of control, mdf-2(RNAi), hcp-1(RNAi), san-1(ok1580), san-1(ok1580);hcp-1(RNAi), san-1(ok1580);mdf-2(RNAi), and san-1(ok1580);bub-3(RNAi) animals, RNAi was conducted as stated above and the adult animals were placed on fresh RNAi plates and allowed to lay eggs for several hours. The embryos developed for three days at 20\u00b0C before DIC microscopy analysis. For all experiments the animals were placed on a 2.5% agarose pad and visualized using a motorized Zeiss Axioskop Fluorescent microscope and imaged using Openlab 3.17. At least three independent experiments were conducted.The L1 larvae  animals were grown on appropriate RNAi food from L1 stage to adulthood. The adults were collected and dissected to release embryos. Embryos were collected, fixed and stained as previously described [Wild-type and escribed ,29. Brieescribed ; the mAbescribed ; mAb MPMescribed ; anti-HCescribed ; and YL1tbg-1::GFP, pie-1::GFP::H2B) or PM115 (san-1(ok1580);tbg-1::GFP;pie-1::GFP::H2B) strain. L1 larvae were grown on RNAi control or hcp-1 RNAi food to adulthood at 20\u00b0C. 1-day old gravid adults were dissected and embryos of the appropriate stage were collected by mouth pipet and placed on a 2.5% agarose pad. The temperature of the room in which the embryos were analyzed was at 21\u00b0C. Mitotic progression was quantified for 2-cell embryos using a spinning disc confocal microscope. To examine mitotic progression, the time it took, in seconds, to transition from the onset of prometaphase (as seen by nuclear envelope breakdown and condensed chromosomes) to the formation of the metaphase plate, and from the formation of the metaphase plate to the onset of anaphase was determined. Seven embryos were analyzed, using the Simple PCI Version 6 software program. The p-value (P) was determined using a standard student t-test. Movies, to demonstrate mitotic progression in the san-1(ok1580);tbg-1::GFP;pie-1::GFP::H2B embryos, were obtained by analyzing live, young embryos using a spinning disc confocal microscope. Images were collected, processed using NIH Image, and imported into Quick Time for display.To analyze mitotic progression the chromosomes and centriole were used as markers, using the TH32 (The author(s) declare that they have no competing interests.VAH conducted the indirect immunofluorescent assays and confocal analysis, produced and analyzed genetic crosses, assisted with experimental design and data interpretation, generated images, and edited the manuscript. AMS conducted genetic crosses, assisted with RNAi viability assays, conducted RT-PCR reactions and edited the manuscript. LLM conducted bioinformatics analysis, conceived experimental design, assisted with interpretation of data, provided necessary reagents for the study, generated images, and edited the manuscript. PAP conceived experimental design, conducted RNAi viability assays, analyzed phenotypes of mutants and RNAi animals, conducted genetic crosses, analyzed live cell images, generated images, and wrote the manuscript. All authors read and approved the final manuscript.hcp-1 in C. elegans [In the process of revision of this manuscript others also demonstrated the genetic interaction between the spindle checkpoint genes and  elegans .C. elegans encodes a protein (BUB-3) with homology to the spindle checkpoint protein BUB3. The amino acid identity between the C. elegans putative BUB-3 protein and other BUB3 proteins is 44% for H. sapiens, 43% for D. melanogastor and 19% for S. cerevisiae. Identical amino acids have a black background shade.The Y54G9A.6 gene encodes the putative BUB-3 protein. A multiple sequence alignment using ClustalW indicates that the Y54G9A.6 gene in Click here for filesan-1(ok1580);hcp-1(RNAi);tbg-1::GFP;pie-1::GFP::H2B embryos. A spinning disc confocal microscope to analyze chromosome segregation in the san-1(ok1580);hcp-1(RNAi) animals. Images were collected, processed using NIH Image and imported into Quick Time for display. In this embryo there are two blastomeres that progress through metaphase. One of the blastomeres displays normal mitotic progression (top metaphase blastomere) whereas another blastomere displays abnormal chromosome segregation (bottom metaphase blastomere) leading to anaphase bridging.Live cell imaging of Click here for file"}
{"text": "There is ongoing controversy regarding the association between vesicoureteric reflux (VUR), recurrent urinary tract infections (UTI), and renal damage. Despite this, routine work up for VUR is still recommended after febrile UTI in most children. The present article reviews the indications and imaging modalities available for VUR diagnosis. Alternative newer techniques like MR cystography and voiding urosonography are discussed. The increasing evidence of the role of DMSA scans in managing children with VUR is highlighted. The goals of an imaging procedurein general are to confirm the diagnosis suspected with a high degree ofsensitivity and specificity, to aid treatment and allow prognostication. On theother hand, it is obligatory for the treating physician to analyze the risksand benefits of the diagnostic procedure and understand the natural history ofthe disease in question to establish whether or not the diagnosis and treatmentof a condition would alter long term outcome or impact management decisions.The diagnosis of vesicouretericreflux (VUR) is a relatively straightforward and well-established procedure.However, the underlying rationale for identifying VUR to prevent recurrentpyelonephritis (PN) and long-term renal damage has been vigorously questionedin the recent literature \u20134. CouplThe current article reviews theavailable modalities for evaluating VUR, suggests protocols for investigatingchildren with suspected VUR, and presents the recent evidence justifying theserecommendations.An ideal test for VUR detectionwould be one involving no radiation, no bladder catheterization, no sedation,low cost, high sensitivity, and one which provides complete anatomical details.The traditional method for diagnosing VUR is the fluoroscopic voiding cystourethrogram(VCUG). Currently, radionuclide cystography (RNC) remains the primaryalternative to a VCUG in evaluating VUR. The objection to performing a VCUG isrelated to the high radiation exposure of a traditional VCUG which is believedto be about 100 times that of a RNC. However, with the judicious use of digitaland pulsed fluoroscopy with meticulous image coning, the radiation exposurefrom a VCUG has been significantly reduced . DespiteP < .001).Several studies have compared thesensitivity of VCUG and RNC and concluded that RNC is at least as sensitive asor more than a VCUG for detecting VUR \u201310. S\u00fckaThe indirect RNC offers thepossibility of detecting VUR without bladder catheterization and presumably ina more physiological setting with natural bladder filling. The additionaladvantage is the ability to assess upper tract differential function anddrainage with the injected radioisotope. Although a few reports have shown acomparable degree of sensitivity between the direct and indirect RNC, theconsensus is that due to an inability to study the filling phase with anindirect RNC there is a considerable false negative rate with indirect RNC\u201315. TherThe sonographic evaluation of VURfollowing intravesical instillation of UScontrast agent has graduallypopularized VUS over the last decade. In a comprehensive review of VUS whencompared with VCUG, Darge showed that in 1338 patients with 2893 refluxingunits, VUS showed a diagnostic accuracy of 78%\u201396% . The oveMR cystography involves intravesical administration ofgadolinium with imaging using MR during filling and voiding. The relativebenefits of the procedure are that it can evaluate VUR without ionizingradiation and additionally give important information about renal-acquiredcortical defects and differentiate acquired cortical defects from congenitaldysplasia. It must be borne in mind that dysplasia and scarring are differententities diagnosed on histopathological examination. In this paper we refer tothem as congenital and acquired cortical defects. The potential drawbacksinclude a lower sensitivity as compared to VCUG, higher costs, and the need forsedation or anesthesia to perform the study. Takazakura et al. showed 90%sensitivity and a 96% specificity of MRVCUG and all children with grade 3 ormore VUR were identified using this modality . Lee et Rubenstein et al. in 2003introduced a novel but controversial technique to identify VUR in childrenpresenting with febrile UTIs and negative VCUG . The inhThe primary indications forevaluating children for VUR are discussed in this section. There has beenconsiderable evolution of our knowledge about VUR management over the lastseveral years. The role of antibiotic prophylaxis in preventing recurrentinfections has been challenged along with an increasing awareness of thedevelopment of antibiotic resistance \u20133. This The American Academy of Pediatrics: Committee on Quality Improvement recommends a VCUG for all childrenaged between 2 months to 2 years old following the first febrile UTI . The ratPrimary VUR is the commonestheritable disorder of the genitourinary tract and is inherited as a Mendeliandominant with partial expression . SeveralA tailored approach for siblingstherefore could be an RNC or a VUS in siblings younger than the toilet-trainedage and US as the initial screening modality for all older siblings. In thepresence of any US evidence of cortical damage a VCUG is recommended in children under 5 years ofage as they form the subset most at risk of renal damage. Symptomatic siblingsat any age are evaluated with a VCUG.VUR is suspected antenatally in thepresence of ureteric dilatation and/or hydronephrosis (HN) or following the diagnosisof ectopic kidneys, multicystic dysplastic kidney, and unilateral renalagenesis wherein there is an increased incidence of contra lateral VUR. VanEerde et al. performed a meta-analysis to review the value of antenatal HN inpredicting postnatal VUR . HN was A routine VCUG is recommended inthe work up of children with multicystic dysplastic kidneys (MCDK) based on thereported 15%\u201325% prevalence of VUR in children with MCDK \u201340. MillThe incidence of VUR in childrenwith unilateral renal agenesis (URA) is slightly higher than MCDK and variesbetween 24%\u201328% , 41\u201343. Primary VUR occurs in less than 1%of the general population but up to 50% of children who present with a UTIwill have VUR . TherefoThere is a considerable debateregarding the initial investigation following a febrile UTI with severalstudies highlighting the emerging role of DMSA scan vis a vis the VCUG. Therationale for this argument stems from the recent evidence which has downgradedthe importance of VUR as a sole factor in causing long-term renal damage. Infact, our aggressive management of VUR over the last several decades has notimpacted long-term renal outcome. Craig et al. reviewed the Australiaand New Zealand Dialysisand Transplant Registry between 1971 and 1998 and noted that over the decades,despite a more aggressive identification and treatment of VUR, refluxnephropathy continued to remain a cause of ESRD in about 14% of childrenregistered . This seRecent studies have demonstratedthat acquired renal scarring correlates best with recurrent UTI and not withVUR and primary VUR is neither sufficient nor essential for renal damage. Theexception to this rule is secondary reflux associated with bladder outletobstruction or high-pressure neurogenic bladders. Gordon et al. performed ameta-analysis to determine the value of VUR diagnosis to predict renal damagein children hospitalized with UTI . The anaMingin et al. retrospectivelyreviewed records of children who underwent DMSA scans following a febrile UTIor antenatal HN . 88% of In 303 children less than 2 years of ageevaluated with VCUG and DMSA scans after an episode of UTI, Hansson et al.found that 51% had an abnormal DMSA scan and 46% with a positive DMSA scanhad no evidence of VUR on VCUG . There wP = .04). Garin et al. performed arandomized prospective trial in 218 children with or without VUR who presentedwith PN, comparing prophylaxis with no prophylaxis [The role of VUR, especially lowergrades, as a predisposing factor for recurrent UTI is also controversial. Nuutinen and Uhari noted a higher rate ofrecurrent UTIs in children with grade III\u2013V VUR in comparison with childrenwith grade I-II VUR . It is nphylaxis .The facThe problem in interpreting studiesattempting to clarify this aspect is the lack of a standardized definition of afebrile UTI and the variability in the methodology of obtaining urine samples.The ongoing randomized intervention for children with vesicoureteric reflux (RIVUR)study is a multicenter, double blinded, randomized, placebo controlled trialwhich aims to answer the ongoing controversy regarding the role of antibioticprophylaxis in preventing recurrent febrile/symptomatic UTI in children withVUR diagnosed after a UTI.in children presented with a UTI, up to 50% of children may have evidence of upper tract damage without evidence of VUR on a VCUG;the rate of spontaneous resolution of VUR is higher in children with low-grade VUR and a normal DMSA scan;a positive DMSA scan at diagnosis predicts a higher rate of recurrent UTI or breakthrough infections in children with VUR;VUR identification has not altered the ESRD rate related to reflux nephropathy.The idea behindthese studies is to encourage a more selective approach in investigatingchildren who present with a first UTI, contrary to the AAP practice guidelines.A DMSA would be the initial investigation and all children with an abnormalDMSA will then proceed to a VCUG. This would identify the majority of childrenwith dilating/significant VUR who would then benefit from antibioticprophylaxis, thus reducing both the number of VCUGs and number of children onantibiotic prophylaxis. Such a selective approach is justifiable with oneobjection being that boys with a potential posterior urethral valve presentedoutside the neonatal period may be missed with this approach. However, this maybe unlikely if a US study is simultaneously performed as part of the routine work up.In summary:MRU is increasingly being advocatedas a single imaging modality, which can be used to provide information obtainedon a VCUG and DMSA scan. The primary advantage of the MRU is its ability todistinguish between renal dysplasia  and acquiredscarring  . In addiThe ALARA (as low as reasonably achievable)concept has stressed the importance of minimizing radiation exposure inchildren being followed conservatively after diagnosis of VUR . ThompsoPersistence of VUR is more likelyin high-grade VUR, in children with bilateral disease  and when reflux is diagnosed in the older child. The value of the VCUGand RNC in predicting VUR resolution has been studied. It has been demonstratedthat when VUR occurs at less than 60% of expected bladder capacity and thereflux volume is more than 2% of bladder capacity, the resolution is poor, 59. KnuVUR is a heterogenous disorder, andits diagnosis and management continues to remain one of the most controversialproblems in pediatric urology. There is a realization that rather than adisease entity, VUR is a marker of overall urinary tract dysfunction, which maypredispose to UTI. The primary goal for the treating physician should continueto remain preservation of renal function and preventing the relatively smallpercentage of acquired renal defects associated with VUR. There has been aparadigm shift in the earnestness with which the diagnosis of VUR is soughtafter based on an increasing body of evidence which suggests that acquiredrenal defects are often not related to VUR and that our current modalities fordiagnosing VUR are associated with unacceptable radiation exposure and bladdercatheterization. The newer modalities do hold promise but further work iswarranted before they can replace the existing well-established techniques."}
{"text": "Mosquitoes that breed in temporary pools in remote areas that dry up seasonally are especially difficult to control through chemical or biological means. The annual killifish has been suggested as a means of eradicating the aquatic stages of mosquitoes in transient pools because they can maintain permanent populations in such habitats by undergoing suspended animation or diapause during the embryonic stages to survive periodic drought. However, very little is known about the predatory activity of annual killifish and their usefulness in mosquito control.Nothobranchius guentheri, native to Tanzania, was used in this investigation. Food preference was tested under laboratory conditions by feeding juvenile killifish with 2nd instar mosquito larvae of Culex quinquefasciatus in the presence of alternative food sources, such as rotifers and chironomid larvae. Semi-field tests were conducted by introduction of hibernating killifish embryos and juvenile fish to artificial ponds in an outdoor open environment that allowed natural oviposition of Cx. quinquefasciatus. Food preference studies show that N. guentheri preferred to prey on mosquito larvae than either chironomid or rotifers. When hibernating killifish embryos were added to ponds simultaneously with the addition of freshwater, the embryos hatched and fed on mosquito larval population resulting in complete elimination of the immature stages. The introduction of juvenile fish to ponds with high density of mosquito larvae resulted in total eradication of the mosquito population due to predation by fish. Complete biocontrol of the mosquito larval population was achieved in the presence of 3 fish per m2 of pond surface area.The annual killifish, The annual killifish provides yet another tool that may be employed in the eradication diseases carried by mosquitoes through vector control, particularly in temporary bodies of freshwater. The fish can be conveniently transported in the absence of water in the form of hibernating embryos. Once introduced either as embryos or juveniles in ponds, the annual killifish can effectively reduce the larval population because of its aggressive predatory activity. Gambusia affinis), native to northeastern United States, was eventually selected for worldwide mosquito control because of its high larvivorous capacity, high fecundity and adaptability to new environments. However, the success of Gambusia in mosquito control was overshadowed by its intrinsic aggressive nature that drove many other native species of aquatic organisms to the brink of extinction [Gambusia in providing the same mosquito larval control in permanents streams and pools [Vector control using pesticides remains an important component of all mosquito control program worldwide. However, the persistent use of pesticides caused the development of chemically resistant substrains of mosquitoes. This chemical resistance in mosquitoes is increasing with new reports of resistance emerging in various areas -3. For ttinction . More rend pools -7.Mosquito larval control in breeding sites comprising pools that dry up seasonally limits the use of conventional fish. Transporting fish to remote areas is both logistically challenging and expensive. For these reasons, attention had been focused on a unique group of freshwater fish, collectively known as annual killifish, native to Africa and South America that can maintain populations in seasonal pools. These killifish can survive prolonged drought, sometimes lasting as much as five years, by undergoing suspended animation or diapause at three stages of their embryonic development ,9. At thNothobranchius taeniopygus to combat malaria in seasonal swamps in Tanganyika and Kenya [The first record of annual killifish being used for this purpose was during World War II when Vanderplank initiated the introduction of nd Kenya . In 1952nd Kenya . Years lnd Kenya ,19. Somend Kenya ,20. HoweNothobranchius guentheri, an annual killifish indigenous to Tanzania. A hypothesis regarding its survival strategy in nature has already been proposed [N. guentheri and ways these fish might be employed in mosquito control.Much more is now known about the life cycle of proposed . What isNothobranchius guentheri, was established at the Poseidon Sciences field laboratory in the Philippines where all the experiments described in this paper was conducted. This population was derived from the original population maintained in the United States since 1975 and interbred recently with N. guentheri breeding pairs supplied by Mr. Fred Behrman of Athens Aquatics  and Mr. Chris Butcher . The killifish were maintained in 10 gallon aquaria according to previously described methods [Artemia for the first 2 weeks. Thereafter, the fry were fed live fruit fly larvae (Drosophila melagonaster) until they reach the juvenile size of 1.5 cm in length.The breeding population of the annual killifish,  methods . The spaCulex quinquefasciatus. These mosquitoes were allowed to naturally oviposit in the experimental ponds. Other aquatic species present in the ponds in significant numbers were chironomids or midge larvae (Chironomus plumosus) and rotifers (Brachionus sp.).Laboratory and semi-field studies were conducted in the island of Panay in the Philippines  during the rainy season from May 2009 and ending in October, 2009. The water temperature ranged from 27\u00b0 to 30\u00b0C, with pH in the range from 7.0 to 8.0. The dissolved oxygen level was 4 ppm. The artificial ponds were constructed near banana trees, with the overhanging leaves providing partial shade. The nearby trees also provided shade and leaves were permitted to fall naturally onto the experimental ponds. The only species of mosquitoes occurring naturally at this location was N. guentheri, the prey organisms and the killifish were kept in glass tanks (11 cm depth \u00d7 29 cm length \u00d7 23 cm width) containing 7 liters of pond water. Freshwater rotifers were collected from an existing pond by passing the water through a fine mesh net. The concentrated freshwater rotifers were placed in the glass tanks filled with pond water. The rotifer count was determined by taking a 1 ml sample of the water and counting the number of rotifers under the microscope. 2nd instar larvae of Cx. quinquefasciatus were collected from ponds and also introduced in the glass tank either separately or in combination with rotifers in the presence of 1 male fish, which was starved for 24 hours prior to the experiment. The rotifer and mosquito larval consumption was obtained at 30 min and 120 min after killifish introduction to the tank.To study the food preference of nd instar larvae of Cx. quinquefasciatus were manually collected from the artificial pond and introduced into the test aquaria with killifish as described above. The number of larvae remaining in the tank after a given time period was determined.Chironomid larvae and 2All laboratory tests were conducted during the light phase of the artificial photoperiod (14 h light phase: 10 hour dark phase) at water temperature of 27 \u00b1 1.5\u00b0C. All freshwater used in this study was obtained from an artificial well.Cx. quinquefasciatus, the only mosquito species found in the pond, was characterized according to the stages (instars and pupae). The larvae and pupae were placed in shallow pans for counting and returned back to the pond within 3 hours. For simplicity, the total mosquito count represents all larvae and pupae combined. The chironomids were counted by determining the total number of intact cocoons found underneath leaves in the bottom substrate. The rate of growth of the annual killifish in the ponds was determined by measuring the standard length as the distance from the tip of the snout to the end of the caudal peduncle.All of the mosquito larvae and pupae were harvested from each test pond by using fine mesh dip nets. Given the small size of the test ponds, it was possible to harvest all mosquito larvae to obtain more reliable data on larval abundance. N. guentheri can hatch, survive and feed on mosquito larvae, 1 m \u00d7 1 m \u00d7 0.3 m plastic lined ponds were constructed using 0.75 mm polyethylene plastic sheeting. These artificial ponds were filled with freshwater initially to a height of 5 cm. The killifish embryos in peat moss were introduced to the pond on the same day. Each group is composed of 5 ponds. No other food was provided to the fries and the pond water was allowed to be augmented by the daily rains to a final height of 0.3 m. The bottom substrate was composed of sandy-muddy soil at a thickness of 1 cm. Cx. quinquefasciatus was allowed to naturally oviposit eggs simultaneously with the introduction of the fish embryos.To determine if newly introduced embryos of Cx. quinquefasciatus was allowed to naturally oviposit in the ponds. After one week, the ponds showed substantial presence of mosquito larvae at which time a total of 5 juvenile killifish at 25 days of age  measuring 1.5 cm in length were placed in each pond. The total number of mosquito larvae and pupae was determined at weekly intervals. The controls represented ponds that did not receive any killifish. Each test group consisted of 3 ponds. After 28 days, the killifish in the experimental ponds were removed to determine the time for mosquito population to recover in the absence of fish. Also at day 28, five killifish  were added to the control ponds to determine the effect of the killifish in ponds with an already high mosquito density. No mortalities were observed during the transfer of the killifish and during length measurements.Artificial ponds (1 m \u00d7 2 m) were constructed and filled with water to height of 0.3 m. 2 ponds at densities from 0 to 5 fish per pond. Each test group was composed of 5 ponds. Cx. quinquefasciatus was allowed to naturally oviposit eggs for 1 week to provide a natural population of mosquito larvae. The total number of larvae present in the ponds was determined 4 days after fish introduction.To determine the fish density required to eradicate mosquito larval population in the ponds, juvenile male annual killifish were added to 1 mThe statistical significance between control and experimental groups was evaluated using Student's t test.N. guentheri, when presented with mosquito larvae and rotifers. There was no difference between males and females as far as food preference was concerned when corrected for body size (data not shown). The data for both sexes were therefore combined. When mosquito larvae and rotifers were given simultaneously as food source, the killifish preferentially consumed the mosquito larvae. After 120 min, the average consumption of mosquito larvae was 61.3% while only 24.1% of the rotifers were eaten. However, when presented with rotifers alone, the killifish doubled their consumption of rotifers. The difference in the food consumption between the rotifers alone and rotifers provided simultaneously with mosquito larvae were statistically significant (P < 0.0001). When presented with mosquito larvae alone, the killifish consumed the same amount of larvae as those killifish given both rotifers and larvae in combination. A similar pattern was observed when killifish was presented with mosquito larvae alone or in combination with chironomid larvae , lesser water boatmen (Coryxa sp.) and various small crustaceans [With the current emphasis on integrated vector management for malaria control the use of local species of annual killifish may represent an additional tool in the control of malaria vector species since the distribution of malaria  overlapst Africa . In natustaceans . Mosquitstaceans .nd instar mosquito larvae at 0.6 mm was not markedly different from the mean length for chironomid at larvae at 0.7 mm. Rotifers were much smaller prey measuring approximately 0.2 mm. The annual killifish would eat rotifers and chironomids as alternate food source if no other food was available, but overwhelmingly preferred mosquito larvae. Like most annual killifish, N, guentheri is a surface feeder and specially adapted to feed on aquatic invertebrates at or near the surface of the pond. The annual killifish will actively chase after the mosquito larvae upon sensing movements. Hence, the preference for mosquito larva that spends most of its time at the surface. In contrast, chironomids are bottom dwelling and typically found underneath decaying leaves. Rotifers are free swimming throughout the water column and likely preferred by the young killifish fry during the first week after hatching because of their small size.Food preference for mosquito larvae was evident when either chironomids or rotifers were simultaneously presented as prey. The size of the prey is not likely a major factor since the average size of the 2N. guentheri on culicine larvae strongly suggests that it is a suitable candidate for mosquito control. The results in this study show that a minimum of 3 killifish is adequate to eradicate the larval population from 1 m2 of pond surface area. Whether anopheline mosquitoes will be equally preyed upon like the culicine mosquitoes in this study or whether other annual killifish will have similar aggressive predatory activity remains to be established. Recently, Louca, et al [gambiae do not share the same oviposition behavior and will continue to lay eggs in the presence of fish in the pond [An. gambiae is endemic.The high predatory activity of a, et al  demonstrthe pond . The preNothobranchius habitat is composed of black or gray mud, commonly referred to as \"black cotton soil\" or vertisols which consist of swelling clays, such as montmorillonite, with high water retaining capacity [Nothobranchius is never observed to maintain populations in habitats with red clays or oxisols. This habitat requirement may limit the type of environments that may sustain Nothobranchius species.The onset of diapause sets the annual killifish apart from conventional fish and provides a novel means of providing biological control in transitory bodies of freshwater. The convenience of transporting and disseminating embryos for mosquito control purposes remain a major advantage particularly in remote areas where insecticide resistance is rampant and places where chemical use is not wanted by the local population. Even if re-introduction of new embryos becomes necessary during the next rainy season, this task can be easily accomplished by local mosquito control officers or even by the local population. The likelihood that introduced eggs will maintain sustainable populations in any new habitats is still open for exploration. The substrate in a typical capacity ,28. NothN. guentheri to other areas, even within Tanzania, may pose some risk to contamination of other transient pools inhabited by other species of Nothobranchius. However, field studies have shown that in many instances Nothobranchius species can be found in natural settings already intermixed with other species of annual killifish [N. guentheri is used for this study merely as a demonstration of the potential of using annual killifish for mosquito control and should be limited for use in its natural geographic range, there are other species, such as N. melanospilus, that have a wider distribution in Tanzania that may be better adapted to the different conditions found in the country .There are, however, ecological issues of concern before annual killifish can be employed for this purpose. Introduction of illifish ,29. WhilN. guentheri is only evident when males compete for the attention of females for reproduction and to establish dominance hierarchies [Another issue of concern is whether introduction of this species in new habitats may pose risks to other indigenous aquatic organisms. Annual killifish survive only in temporary pools and require a period of drying to complete its life cycle. For this reason, annual killifish are never found in permanent bodies of water. Since they are typically the dominant inhabitant in a transient pool, annual killifish may not have evolved behavioral adaptations to compete against other fishes. In multi-species aquaria for example, annual killifish do not survive well. The aggressive nature of rarchies . While iThere are many practical advantages of the annual killifish in mosquito control. First, there is a wide range of indigenous species of annual fish found in South America and sub-Saharan Africa. It is therefore feasible to use indigenous annual killifish species for any given malarial region rather than introducing an exotic species to new habitats. Second, the use of diapausing embryos may allow in suitable areas to have recurring populations in transient bodies of freshwater so that re-introductions will not be necessary, thereby reducing cost of maintaining mosquito control. Vectors of malaria and dengue propagate in both permanent and in transient pools, such as tire tracks, water collecting stations, animal footprints and depressions created by mining activities. Transporting conventional live fish for biocontrol measures in such situations will be difficult and costly. On the other hand, transporting thousands of annual killifish embryos in peat moss or in a more convenient delivery system would make it easier and more economical. Third, the annual killifish are small and less likely to be used as food source. The small size also allows easy access to shallow areas where mosquito larvae tend to congregate. Fourth, the annual killifish is not aggressive against other fish, cannot survive in permanent bodies of freshwater and likely pose minimal ecological issues. And finally fifth, as shown in this report, the annual killifish is sufficiently larvivorous to exert substantial control of the immature stages of the mosquito population. All of these characteristics satisfy World Health Organization's recommendations on the selection of larvivorous fish for mosquito control .Nothobranchius guentheri, aggressively preys on culicine larvae preferentially compared to other aquatic food sources under both laboratory and semi-field conditions. Total control of the immature stages of mosquitoes in freshwater can be achieved with the introduction of killifish. More important, introduction of hibernating or diapause embryos serves as a convenient means of disseminating killifish in transient pools. This study suggests that annual killifish may be useful in the future as part of the integrated program in vector control.In summary, this study demonstrates that the annual killifish, The authors declare that they have no competing interests.JRM participated in the design of the study, writing the manuscript and performing the statistical analysis. AQA participated in its design, coordination and helped to draft the manuscript. All authors read and approved the final manuscript."}
{"text": "In this overview the influence of functional bladder disturbances and of its treatment on the resolution of vesicoureteral reflux (VUR) in children is discussed. Historically both bladder dysfunction entities, the overactive bladder (OAB) and the dysfunctional voiding (DV), have been described in conjunction with VUR. Treatment of the dysfunction was also considered to influence spontaneous resolution in a positive way. During the last decades, however, papers have been published which could not support these results. Regarding the OAB, a prospective study with treatment of the bladder overactivity with anticholinergics, did not influence spontaneous resolution ratein children with a dysfunction including also the voiding phase, DV and DES , most studies indicate a negative influence on the resolution rate of VUR in children, both before and after the age for bladder control, both with and without treatment. However, a couple of uncontrolled studies indicate that there is a high short-term resolution rate after treatment with flow biofeedback.It should be emphasized that the voiding phase dysfunctions (DV and DES) are more severe than the genuine filling phase dysfunction (OAB), with an increased frequency of UTI and renal damage in the former groups.To be able to answer the question if treatment of bladder dysfunction influence the resolution rate of VUR in children, randomized controlled studies must be performed. There is a close relationship between bladder dysfunction andvesicoureteral reflux (VUR). This is most evident in children with neurogenicbladder dysfunction, in which the high intravesical pressure due to outflowobstruction induced by detrusor/sphincter dyssynergia is directly responsiblefor the development of the reflux. Another example of VUR as a secondaryphenomenon is in boys with posterior urethral valves, where the reflux issecondary to an anatomical obstruction in the urethra. In most cases ofsecondary reflux, normalisation of bladder function means spontaneousresolution of the VUR. When it comes to primary VUR, a close connection to bladder functionpathology of nonneurogenic origin has also been established. Studies have beenpublished describing children with functional bladder disturbance and VUR aftertoilet-training age. Studies from the 1980s most often dealt with girls whohave overactive bladders (OAB) in combination with reflux, and treatment of thedysfunction positively influenced resolution of the reflux. During the lastdecades, however, bladder dysfunction including the voiding phase, such asdysfunctional voiding and dysfunctional elimination syndrome, has been reportedto have a negative influence on VUR resolution in some studies. In otherstudies, treatment of the dysfunction has improved the resolution rate. Children with high-grade congenital reflux have also been shown to haveabnormal bladder function in about half of the cases. This dysfunction wascharacterised by an overdistended bladder and incomplete emptying. Thedysfunction per se had a negative influence on spontaneous resolution of VUR, which didnot improve despite treatment.In this overview of bladder dysfunction and VUR, only primary reflux isdiscussed. There are some contradictory results in the literature available, asindicated above, which make an overview interesting. One of the major problems is the fact that the level of evidence in almost all papers is low, most have level three, a few have level two, and no paper was identified as level one.When studying the literature about bladder dysfunctionin refluxing children, one finds that there is still confusion emanating fromdifferences in terminology , diagnostic procedures , degree of dysfunction, andso on. In this review, two bladder dysfunction entities are addressed inchildren after the age for bladder control: overactive bladder (OAB) anddysfunctional voiding (DV). The ICCS definitions of these entities are used.This means that dysfunctional voiding is only used in the sense of adysfunction during the voiding phase, characterised by increased activity inthe pelvic floor during voiding. The term can only be applied if repeat uroflowmeasurements show a staccato or interrupted pattern . DysfuncThe overall term recommended in the standardisation document for bladderdysfunction is lower urinary tract (LUT) dysfunction. This term is used as asynonym for bladder dysfunction in the present overview.In the early 1990s, bladder dysfunction was reported in small infantswith high-grade reflux. The dysfunction was characterised by low bladdercapacity, high voiding pressure, and overactivity during filling \u20134. LaterDyscoordination at voiding was often seen in these young children withVUR, a finding that can be suggested as the reason for the high capacitybladder with incomplete emptying.However, investigations of nonrefluxing children haveshown that dyscoordination at voiding was seen in healthy infants, both incystometric  and freeInterestingly, a bladder dysfunction pattern that wassimilar to the above-mentioned high capacity bladder with incomplete emptyingdynamics was described as early as 1987 by Griffiths and Scholtmeijer , 10. TheHigh-capacity bladder has also been reported in otherstudies in children with VUR after the infant year, especially in boys  andtogeThe reported prevalence of bladder dysfunction in aVUR population varies. When diagnosed using invasive urodynamic investigations,higher figures were generally found (38%\u201375%) in contrast to what was seenwhen nonurodynamic investigations were used (18%\u201352%) . ThisvaThe earliest studies of bladder dysfunction mostlydealt either with dysfunctional voiding or the overactive bladder. Recentstudies often give the prevalence of both dysfunctions together in childrenwith VUR. The advantages of separating the dysfunctions are that differenttreatment modalities can be evaluated, as well as differences in results whenit comes to effects on VUR resolution. The disadvantage is that thedysfunctions often are combined and sometimes difficult to separate.The first reports about bladder dysfunction and VURcame in the 1970s. Hinman and Baumann and AlleA few years later, Koff and Murtagh and TaylIn studies of larger cohorts of children with VUR, theprevalence of all bladder dysfunction together was reported to be between 18%and 50%, using questionnaires and flow measurements for the diagnose , 14, 16.The concept dysfunctional elimination syndrome (DES)was introduced by Koff et al. in 1998 , includiThese latter results were in line with what was seenin a followup study at the age of 7 years of 20 children who presented duringinfancy with grade 4-5 VUR and bladder dysfunction, diagnosed at that time. Thedysfunction was characterised by high bladder capacity and incomplete emptying.At the followup, these children had infrequent voiding, and often did not voidat school or in the morning if not prompted by parent or other guardian.Constipation had been or was still a problem in the majority of these children. The repHowever, in other studies it has not been possible todiagnose dysfunctional elimination syndrome more often in children with VURthan in control groups. Shaikh et al.  investigIn studies where the inclusion criterion was idiopathic bladderdysfunction, the prevalence of VUR was between 14% and 47% , 29, 30The registration of severity of voiding LUTdysfunction and its response to treatment with regard to symptoms is oftenhighly subjective, since the definition of how often the symptoms areexperienced is seldom given. Furthermore, in most cases a number of symptomsare included. Using a symptom score has been suggested in order to overcomethis obstacle. Upadhyay and coworkers  reportedThe results of treatment of overactivity in relationto VUR resolution are conflicting. Most studies do not have a control group,include only a small number of patients, are retrospective, and have nonuniformways of diagnosing overactivity, which might explain the different results.Many studies suggest increased spontaneous resolution after such treatment , 32, 33 Conversely, Willemsen and Nijman  showed, Whether spontaneous resolution of VUR in a group withuntreated OAB is different from a group without OAB cannot be established from thestudies available.There are very few studies reporting on VUR andtreatment of isolated DV, while there are more on DV and detrusor overactivityseen together.Kibar et al.  reportedHomsy et al.  reportedSnodgrass  noted a However, including studies in which bladderdysfunction was characterised by a dysfunctional voiding pattern, data supportthe assumption that there is a decreased spontaneous resolution of VUR inchildren with this dysfunction, especially when seen in combination withhigh-grade VUR.Yeung et al.  showed, DES in children with VUR was also correlated to alower resolution rate , despiteIt has previously been suggested that reimplantationof the ureter into the bladder in a child with major voiding dysfunctioncarries a high risk of failure. The dysfunction that carries the high risk is asevere form of dysfunctional voiding, induced by functional obstruction duringvoiding , 38. ReRecurrent UTIs have been shown in many studies to behigher in VUR patients with bladder dysfunction than in VUR children withoutsuch dysfunction , 15, 20.Snodgrass  showed aMost of the studies reporting on children with VUR andthe OAB dysfunction have not found any difference in numbers of children withrenal damage in the groups with and without the dysfunction , 18. In The bladder function pattern with high capacitybladders and incomplete emptying seen at follow up in children presentingduring the infant year with high-grade VUR , 10 is The extra volume load induced by the refluxing urinevolumes, which circulate between the bladder and the upper urinary tract, mightalso be a factor of importance for the high capacity bladder. In such cases,the bladder problems should more or less disappear after surgical treatment ofthe reflux. Investigation of bladder function in a group of children ages 7-8years who had been surgically treated for high-grade reflux at the age ofmedian 4 years did not support this theory. These children were diagnosed earlyas having a bladder dysfunction characterised by high-capacity bladders withincomplete emptying. At the follow-up investigation, they still had highcapacity bladders with few voiding per day but their emptying ability hadimproved, with quite low volumes of residual urine . The reThe connection between the overactive bladder dysfunction pattern and reflux is less clear. It is difficult to consider bladder overactivity the cause of reflux, since it causes only intermittentincreases in bladder pressure, which is not thought to induce reflux if thejunction is competent. Only a concomitant obstruction inducing a continuouspressure problem in the bladder is considered to be able to induce VUR inparallel to what is seen in children with the NBD or anatomical urethralobstruction, for example, in boys with PUV. The other possibility is that thereis only marginal competence in the valve mechanism, and in these cases thedetrusor contractions against a contracted sphincter may induce VUR. If thislatter causality exists, it might explain why renal damage seldom is seen inchildren with an OAB : the preVUR is associated with both OAB and dysfunctionalvoiding, with different entities as described above. However, we can onlyspeculate about the precise causative mechanisms between the respectivedysfunction and VUR. There are divergent opinions concerning whether thetreatment of the overactive bladder influences the rate of spontaneousresolution. There are as yet no randomised studies investigating the effect onthe reflux of treatment of the OAB versus no treatment. To my knowledge, thereare no studies comparing a group of children with VUR and untreated OAB with agroup of children with VUR and a stable bladder.In children with dysfunctional voiding and VUR, it iseasier to see a causative connection, especially in the more severe forms ofVUR, since this can be considered parallel to neurogenic bladder dysfunction.It is not known whether this is an acquired dysfunction as most authors suggestor if it is a congenital anomaly and part of a complex that also includes VUR.Treatment of the dysfunctional voiding increases thespontaneous resolution rate as has been suggested in some studies, but not inothers. Since there are no randomised studies available comparing resolutionrates in treated children with untreated children, this cannot be established.However, what is known is that dysfunctional voiding, dysfunction elimination syndrome,and the similar dysfunction seen in children with high-grade congenital reflux,all have negative influences on the spontaneous resolution rate of VUR whenuntreated, and lead to an increased risk for recurrent UTI.Since there seems to be a lower resolution rate inchildren with dysfunctional voiding than in those with OAB, it is important todistinguish between the diagnoses when comparing VUR resolution rates ofchildren with and without dysfunction. OAB in its genuine form seems to be amuch more benign dysfunction than dysfunctions including incomplete emptying ofthe bladder. However, it should be remembered that bladder overactivity anddysfunctional voiding are often seen together.In summary, the question if treatment of bladderdysfunction improves prognosis for spontaneous resolution of reflux cannot beanswered from the studies available. This is true for the overactive bladder,the dysfunctional voiding, as well as the dysfunctional elimination syndrome.Randomised studies have to be performed to give an answer. In these studies alsothe definitions from the ICCS standardisation document have to be used, toavoid confusion about terminology. Maybe the use of a scoring system of bladderdysfunction symptoms would be useful as well. However, treatment of bladder dysfunction should ofcourse be recommended, especially in cases with dysfunctional voiding and DES.One reason is that the success of surgical treatment of the reflux, bothendoscopic and open, probably depends on the bladder function status. The mostobvious reason for treating the bladder dysfunction in these refluxing childrenis, of course, as in nonrefluxing children, the symptoms of urgency, urinaryincontinence, constipation, UTI, and so on."}
{"text": "Climate change has the potential to have many significant impacts on aeroallergens such as pollen and mould spores, and therefore related diseases such as asthma and allergic rhinitis. This paper critically reviews this topic, with a focus on the potential adaptation measures that have been identified to date. These are aeroallergen monitoring; aeroallergen forecasting; allergenic plant management; planting practices and policies; urban/settlement planning; building design and heating, ventilating, and air-conditioning (HVAC); access to health care and medications; education; and research. Although this impacts research has been reviewed by several authors recently, an overview and critical review of the adaptation responses has not yet been conducted. This is the aim of this paper. In the following sections, climate change (both observed in the recent past and projected into the future) is described, followed by a summary of the potential impacts of these changes on aeroallergens and allergic respiratory diseases, with the latter placed in context through a synthesis of the research on the public health importance of these diseases. The major focus of the paper is a review of adaptation responses to these potential impacts, including: aeroallergen monitoring; aeroallergen forecasting; allergenic plant management; planting practices and policies; urban/settlement planning; building design and heating, ventilating, and air-conditioning (HVAC); access to health care and medications; education; and research.2.2]) has increased from a pre-industrial value of about 280 parts per million (ppm) to 386.30 ppm in 2009 . The impacts of climate change on aeroallergens, and in particular pollen, include impacts on pollen production and atmospheric pollen concentration, pollen season, plant and pollen spatial distribution, pollen allergenicity, and similar impacts on mould spores. Details of, and evidence for, these impacts is provided in the following sections.Climate change impacts on many physical, biological and human systems. Although human health is clearly part of the latter system(s), many diseases are intimately related to the environment, and therefore impacts of climate change on physical and biological systems may also result, indirectly, in impacts on human health. Climate change has had, and will continue to have, many significant adverse impacts on human health. The impacts of climate change on allergic respiratory diseases such as asthma and allergic rhinitis, via impacts on aeroallergens such as pollen and mould spores, are now emerging as one of the major indirect impacts of climate change on public health. The impacts of climate change on aeroallergens were reviewed by Beggs  and moreet al. , and theet al.  and Shea [et al. . Further [et al.  recently3.1.2] and temperature can result in increases in pollen production and atmospheric pollen concentrations. Experimental research where ragweed (Ambrosia artemisiifolia) has been grown at pre-industrial, current, and potential future [CO2]s has found that pollen production in this species is significantly increased at current compared to pre-industrial [CO2] and also at potential future compared to current [CO2] . Similamosphere .Betula)    produced pollen that was significantly more allergenic than pollen produced by plants grown at both current and pre-industrial [CO2]. There is also some evidence to suggest that higher air temperature can increase birch pollen allergenicity s, produced nearly three times more spores and more than twice the total antigenic protein per plant than at lower [CO2]s. Earlier observational research by Corden and Millington  and temperature on pollen and allergen production of more plant species is required. Similarly, modelling and surveillance of future changes in allergenic plant ranges is required.Continued research is required. This includes further climate model studies of future changes in thunderstorms, which can lead to short-term outbreaks of asthma symptoms . ContinuFinally, more research into adaptation in this area is required . This is6.Climate change has the potential to impact on aeroallergens such as pollen and mould spores, including increases in production and atmospheric concentrations, earlier pollen and mould spore season starts, increased allergenicity, and changes in at least plant and pollen spatial distribution. These biological impacts of climate change will likely have significant adverse impacts on allergic respiratory diseases such as asthma and allergic rhinitis unless appropriate adaptation measures are implemented. A range of such adaptation measures have now been identified. The outcomes of some of these measures, such as modified planting practices and policies, would not eventuate for many years, and they should therefore be implemented as soon as possible."}
{"text": "The success of such screens and the interpretation of the data depend on the stringent design of RNAi libraries. We describe and validate NEXT-RNAi, a software for the automated design and evaluation of RNAi sequences on a genome-wide scale. NEXT-RNAi is implemented as open-source software and is accessible at  RNA interference (RNAi) screens have become an important tool for the identification and characterization of gene function on a large-scale and complement classic mutagenesis screens by providing a means to target almost every transcript in a sequenced and annotated genome. RNAi is a post-transcriptional gene silencing mechanism conserved from plants to humans and relies on the delivery of exogenous short double-stranded RNAs (dsRNAs) that trigger the degradation of homologous mRNAs in cells ,2. As anAnopheles gambiae and species used to study evolutionary aspects of development, such as Tribolium castaneum, Acyrthosiphon pisum and Schmidtea mediterranea. RNAi libraries will facilitate the functional characterization of genes in these species, either through studying smaller subsets of candidates or on a genomic scale.The availability of genome-wide RNAi libraries for cell-based assays and whole organisms has opened new avenues to query genomes for a broad spectrum of loss-of-function phenotypes ,5. The nThe design of RNAi reagents is key to obtaining reliable phenotypic data in large-scale RNAi experiments. Several recent studies demonstrated that the degradation of non-intended transcripts  and knock-down efficiency depend on the sequence of the RNAi reagent and have to be carefully monitored -13. BaseCaenorhabditis elegans and Drosophila, RNAi can be triggered by long dsRNAs that are intracellularly broken down into short interfering RNAs (siRNAs) ). We found 49 phosphatases expressed at five or more RPKM , indicating that the observed depletion efficiency depended on the targeted mRNA rather than differences in the NEXT-RNAi designs.In large-scale RNAi experiments, the design of genome-wide silencing libraries has remained an important problem due to the flux of gene annotation and novel insights into the mechanisms that influence RNAi efficiency and off-target effects. We present an approach for the rapid design of whole-genome RNAi libraries and the re-annotation of already existing reagent collections. The method is flexible, identifies multiple independent reagents per gene model and has been implemented in an organism-independent manner. The design process is fully automated and can use annotations from various sequence- or model-organism databases as input, thereby enabling the design of RNAi reagents for any sequenced (and annotated) organism.Drosophila phosphatases expressed in our tissue culture model and found that approximately 89% of the reagents caused at least 60% mRNA knock-down. The application of a standardized design pipeline for independent designs leads to reproducible knock-downs in our experiments (correlation of 0.85 between the independent designs).We have designed several independent RNAi libraries for a diverse group of organisms. The automated pipeline yielded designs for more than 95% of all predicted genes in the first round of prediction. All library designs are available as a resource for download from our webpage . We valiDrosophila and human cells. Our analysis of eight genome-wide RNAi libraries for Drosophila revealed differences in genome coverage and predicted quality , most likely depending on two factors: the quality of the underlying genome release and the factors known to influence reagent quality at the time of the library design. Further, reagents in these libraries often share target sites, thus preventing an independent confirmation of phenotypes on a genomic scale. The re-annotation of commercially available human libraries revealed that a substantial part of the siRNAs  either do not target the intended gene or are predicted to silence additional loci, demonstrating that quality control at the level of sequence mapping is crucial for the interpretation of large-scale screens.RNAi screens have become a key tool for functional genomic analyses. The interpretation of the increasing number of published data sets obtained through RNAi screens relies heavily on correctly annotated reagents. Phenotypes derived from large-scale screens should be linked to the sequence of the RNAi reagent rather than the gene model because off-target or splice-variant-specific silencing can rarely be excluded. For the correct interpretation of RNAi screens, and also the comparison between different libraries, reagent-to-gene-model linkages must be re-mapped in regular intervals because most genome annotations are still in flux. NEXT-RNAi can be used to rapidly evaluate and re-annotate existing genome-wide libraries. For example, we have applied the algorithm to re-annotate RNAi libraries for Several tools for the design of RNAi reagents exist  were grown in Express Five SFM (Invitrogen) supplemented with 20 mM Glutamax I, 100 U/ml penicillin, 100 \u03bcg/ml streptomycin. Total RNA was extracted using Trizol (Invitrogen), followed by Rneasy cleanup , including on-column DNAse digest. mRNA was isolated with the MicroPoly(A)Purist kit  and the RNAseq library was prepared according to Illumina's mRNA Sequencing Sample Preparation Guide. Paired-end reads were aligned to the g Tophat  and RPKMg Tophat  based onin vitro transcription as described in  repeats; DRSC: TH and MB developed the concept. TH wrote the software and performed all calculations presented in the manuscript. TH and TS carried out the experimental validation of RNAi reagents. TH and MB wrote the manuscript.Detailed NEXT-RNAi workflow for the (a) design and (b) evaluation of dsRNAs and siRNAs.Click here for fileet al. NEXT-RNAi predictions of siRNA efficiencies using both the 'rational' and 'weighted' methods for 2,431 siRNAs tested by Huesken  repeats; UTR = untranslated region; SNP = single nucleotide polymorphism.Click here for fileDrosophila and human RNAi libraries re-annotated by NEXT-RNAiSummary statistics for . CAN = CA[ACGT] repeats; UTR = untranslated region; SNP = single nucleotide polymorphism.Click here for fileDrosophila RNAi libraries in Figure Raw data for comparison of including number of genes targeted by each library, number of genes targeted by both the compared libraries and number of genes targeted with independent designs .Click here for fileDrosophila phosphatases for the knock-down validation study presented in Figure Primer sequences and target gene information for the independent long dsRNAs designed against 49 Click here for fileDrosophila phosphatases from RNA-sequencing of D.Mel-2 cells and knock-downs measured after RNAi with two independent designs by quantitative RT-PCR  values for 49 Additional file Click here for fileDrosophila phosphatasesResults for knock-down validation of two independent RNAi reagents against 49 . Target-genes were sorted for the measured mRNA knock-down of design one.Click here for fileDescriptions and default values of design parameters used for NEXT-RNAi version 1.31.Click here for file"}
{"text": "Leishmania lack RNAi activity and Argonaute or Dicer genes, we show that Leishmania braziliensis and other species within the Leishmania subgenus Viannia elaborate active RNAi machinery. Strong attenuation of expression from a variety of reporter and endogenous genes was seen. As expected, RNAi knockdowns of the sole Argonaute gene implicated this protein in RNAi. The potential for functional genetics was established by testing RNAi knockdown lines lacking the paraflagellar rod, a key component of the parasite flagellum. This sets the stage for the systematic manipulation of gene expression through RNAi in these predominantly diploid asexual organisms, and may also allow selective RNAi-based chemotherapy. Functional evolutionary surveys of RNAi genes established that RNAi activity was lost after the separation of the Leishmania subgenus Viannia from the remaining Leishmania species, a divergence associated with profound changes in the parasite infectious cycle and virulence. The genus Leishmania therefore offers an accessible system for testing hypothesis about forces that may select for the loss of RNAi during evolution, such as invasion by viruses, changes in genome plasticity mediated by transposable elements and gene amplification (including those mediating drug resistance), and/or alterations in parasite virulence.RNA interference (RNAi) pathways are widespread in metaozoans but the genes required show variable occurrence or activity in eukaryotic microbes, including many pathogens. While some  Leishmania major and Trypanosoma cruzi. The genome of L. braziliensis, a member of the early diverging Leishmania subgenus Viannia, retained key genes required for RNAi such as an Argonaute. We demonstrated that in fact L. braziliensis shows strong RNAi activity with reporter and endogenous genes affecting flagellar function. These data suggest that RNAi may be productively applied for functional genomic studies in L. braziliensis. We mapped the evolutionary point at which RNAi was lost in lineage leading to Leishmania and Crithidia, and establish that RNAi must have been lost at least twice in the trypanosomatids, once on the lineage leading to T. cruzi and independently following the divergence of the Viannia subgenus from other Leishmania species. Lastly, we discuss hypotheses concerning the forces leading to the loss of RNAi in Leishmania evolution, including viral invasion, increased genome plasticity, and altered virulence.RNAi interference pathways play fundamental roles in eukaryotes and provide important methods for the analysis of gene function. Occasionally RNAi has been lost, precluding its use as a tool, as well as raising the question of what forces could lead to loss of such a key pathway. Genomic and functional studies previously showed that within trypanosomatids protozoans RNAi was absent in both  Argonaute and Dicer suggests that this pathway may have been present in the common eukaryote ancestor ArgonauteIn metazoans, RNAi interference and related pathways play many key roles including regulation of mRNA levels and translation, chromatin silencing, programmed DNA rearrangements, genome surveillance, and defense against invading viruses. The phylogenetic distribution of key genes required for RNA interference such as Trypanosoma brucei), South American trypanosomes (T. cruzi) and a lineage encompassing a number of genera associated with insects or plants, ultimately leading to the mammalian parasite LeishmaniaT. brucei contain an active RNAi pathway and genes, including an Argonaute \u201cslicer\u201d  contains orthologs of T. brucei AGO1, DCL1 and DCL2L. braziliensis, and explored its utility as a genetic tool. Furthermore, we made evolutionary comparisons to map when the RNAi pathway was lost, and we discuss potential selective forces impacting on the parasite that may have contributed to the demise of RNAi during Leishmania evolution.The trypanosomatid protozoa comprise three major lineages, broadly grouped as the African trypanosomes , which in trypanosomes are 24\u201326 nt long i siRNAs .L. braziliensis transfection, when using episomal constructs previously developed in one of our labs that function effectively in many Leishmania species, and in many laboratories SSU) locus, using the appropriately digested DNA from pIR1SAT-based vectors, or derivatives thereof trans-splicing and 3\u2032 polyadenylation produces capped mRNAs that can direct protein synthesis We then developed a green fluorescent protein (GFP)-based RNAi reporter assay for siRNA formation, as well as target mRNA and protein levels. Initially we experienced unexpected difficulty in GFP65-StL) was flanked by Leishmania sequences required for efficient 5\u2032 and 3\u2032 end mRNA formation, and was expressed following integration into the parasite small subunit ribosomal RNA locus  construct, containing two copies of an AT-rich GFP reporter (GFP65) in an inverted orientation separated by a short loop . This GFGFP65 probe showed that expression of GFP65-StL gave rise to a variety of products . These data suggested that L. braziliensis expresses a robust Dicer-like activity.Northern blot analysis with a products , lane 2.products . In contGFP65) used in the GFP65-StL construct above, and the second by a GC-rich ORF (GFP+). These genes differ in most 3rd codon positions, but their protein products only differ by a single amino acid. Alignment of these genes showed that the longest tracts of identical nucleotides were less than 14 nt  L. braziliensis or the GFP65-StL transfectant that produces GFP65 siRNAs.We used two GFP reporters, one encoded by the AT-rich ORF  reporter, expressed alone or in combination with a LUC stem-loop construct, revealing strongly-reduced LUC expression , or the genes PFR1 and PFR2, which encode major components of the paraflagellar rod, a component of the trypanosomatid flagellum required for motility StL-transfectants showed a variable decrease in mRNA levels when estimated by qPCR, ranging from no effect (LPG1) to more than 10-fold reduction . This suggests that L. braziliensis requires only low levels of LPG biosynthetic proteins, similar to the relatively small effects of RNAi on trypanosome glycoconjugate biosynthetic genes HGPRT mRNA and protein levels showed 3\u20134 fold decreases in HGPRT-StL transfectants . Collectively, the strength of the RNAi effect for these phenotypic reporters suggests that RNAi may function sufficiently well to assess the functions of many genes in AGO1 gene in trypanosomes and L. braziliensisL. braziliensis AGO1 in RNAi, we employed the seemingly counterintuitive approach of \u2018RNAi of RNAi genes\u2019, where introduction of dsRNAs targeting RNAi pathway genes inhibits RNAi activity, albeit not to the same level seen in null RNAi pathway gene knockouts LUC) and a second encoding a luciferase ORF stem-loop (LUC-StL). This minimized experimental variability and the number of transfections required, allowing the assessment of RNAi efficacy by the introduction of a single construct. When introduced into WT L. braziliensis, the \u2018LUC RNAi self reporter\u2019 (LUC-SR) showed low levels of luciferase activity, about 4-fold over background and comparable to that obtained with lines expressing LUC and LUC-StL independently after successive transfections  into the LUC RNAi reporter line (LUC-SR). These transfectants showed an average of 100-fold increased luciferase expression relative to LUCSR transfectants, signifying a considerable reduction in the efficiency of RNAi  but not in Leishmania (Sauroleishmania) tarentolae, L. mexicana, L. major or L. donovani (data not shown). Partial genome sequencing of a close non-parasitic \u2018outgroup\u2019, Crithidia fasciculata revealed AGO1, DCL1 and DCL2. To confirm the presence or absence of a functional RNAi pathway, we expressed the GFP65-StL RNA in L. tarentolae, L. mexicana, L. panamensis, L. guyanensis and Crithidia fasciculata, and monitored siRNA formation by Northern blotting. Consistent with the observed distribution of RNAi pathway genes, GFP siRNAs were made only in Crithidia, L. guyanensis and L. panamensis .We explored the prevalence of RNAi pathways in other Trypanosomatid species by comparative genomics. PCR assays detected namensis , S4. TraViannia from the remaining species complexes  or have undergone gene deletion  for known trypanosomatid RNAi genes. Since species retaining only a partial set of intact RNAi genes have not been reported, from these data we cannot identify which essential RNAi pathway gene was lost first at this distant point in Leishmania evolution. Presumably, once a gene critical for RNAi activity was inactivated, the remaining genes of the pathway become superfluous and fall prey to evolutionary drift, as seen in many other metabolic pathways during evolution.Association of these findings with the trypanosomatid evolutionary tree  through omplexes . ImportaL. braziliensis AGO1 gene is not syntenic with that of T. bruceiT. cruzi, and a second time in the lineage leading to Leishmania, subsequent to the divergence of most Leishmania groups from the non-parasitic species Crithidia fasciculata and the Leishmania subgenus Viannia  described earlier, relative to transfectants expressing only LUC. Multiple clonal lines were obtained, and LUC expression was measured in six randomly selected lines , compared to the 300-fold reduction seen in the virus free L. braziliensis M2903 . Significantly, the LRV-free line LgM4147/pX63HYG showed a similar 30-fold efficiency of RNAi in these studies (3.3% LUC SR/LUC). These data suggest that the reduced RNAi efficiency seen in L. guyanensis M4147 does not require the continued presence of the virus.While the RNAi pathway was active in the LRV+ L. braziliensis possesses a functional RNAi pathway, which enables the down-regulation of a variety of reporter and endogenous genes when assayed at the mRNA or protein levels. RNAi of AGO1 was used to confirm a requirement for the sole argonaute gene AGO1 in this process. As seen in many organisms, strong reductions in mRNA expression were seen, often accompanied by phenotypic changes, albeit of variable strength. As anticipated, it was not possible to introduce stem-loop constructs for essential genes such as \u03b1- or \u03b2-tubulins. Studies of such genes will require the development of inducible expression systems in Leishmania, which while promising have not yet reached the point of utility attained in trypanosomes.Our studies have established that PFR1 and PFR2), closely approximating the phenotypes seen in gene deletion mutants in L. mexicanaLeishmania gene function in the future.Strong phenotypes were produced by the knockdown of two genes implicated in flagellar motility and paraflagellar rod synthesis . Selection for the presence of LRV able to promote parasite survival could thus provide a selective force promoting down-regulation of RNAi activity targeting RNA viruses.We proposed previously that viral pressure could act as a selective force for the loss of RNAi in Leishmania, one prediction is that in extant species or strains now harboring Leishmania LRVs, attenuation of the RNAi response may occur. Here we compared the efficacy of RNAi seen in the virus-free L. braziliensis M2903 used in the majority of our studies with a closely related species L. guyanensis that bears the cytosolic dsRNA virus LRV1-4 L. guyanensis, its activity as assayed with LUC or GFP reporters was attenuated \u223c10-fold relative to that seen in virus-free L. braziliensis  Leishmania species. In other eukaryotes the RNAi machinery includes as many as 9 proteins or more L. major to transcribe the antisense chromosomal strand at low levels L. major could be lethal Leishmania species will be a challenging task; nonetheless, efforts to introduce this suite of genes from RNAi proficient L. braziliensis are underway.Our findings provoke the question of whether the RNAi machinery could be transplanted from Leishmania braziliensis. These data provide some optimism for the application of RNAi approaches as a tool for the study of these predominantly asexual organisms, by forward and reverse genetic approaches. While less experimentally developed, L. braziliensis has the potential to emerge as an attractive model, and the advent of RNAi-based tools should provide a further stimulus for this effort. In the long term, delivery of siRNAs targeting essential parasite genes may prove an effective route to chemotherapeutic treatment of RNAi-proficient Leishmania. Lastly, the Leishmania provide an attractive system for testing hypotheses about forces leading to the evolutionary loss of RNAi, including the role of viral pressure, changes in genome plasticity, and virulence. As drug resistance mediated by gene amplification is one manifestation of gene plasticity, these findings have practical implications to parasite chemotherapy.In summary, we have shown that the RNAi pathway is functional in L. braziliensis \u03b1-tubulin mRNA plus the first 317 nt of the ORF were PCR-amplified from genomic DNA and inserted between the HindIII and XbaI sites of plasmid vector pPD19.36, which contains two opposing T7 RNA Polymerase promoters L. braziliensis SLACS (LbrM08\u2212V2.0700) was PCR-amplified with primers (LBSLACS1399F: 5\u2032-GCCAGAGAGGTGGTGAGGGTG and LBSLACSORFa-R: 5\u2032-GAGCTCGAGAAAGGTCCACCACCCCGA) from M2903 genomic DNA and TA cloned to generate a sense radiolabeled RNA probe for Northern analysis of small RNAs. For LPG2 (LbrM20_V2.2700) the probe was a PCR fragment (nt 1 to nt 411) amplified with primers SMB3219 and SMB3220 , treated with DNAse and purified using MEGAclear columns (Ambion). Reverse transcription (RT) was performed according to the manufacture instructions using Superscript III First-Strand reverse transcriptase (Invitrogen) in a 20 \u00b5l reaction containing 1\u00b5g purified RNA. Controls containing the same amount of RNA but lacking reverse transcriptase or template were used to rule out DNA or other contamination. For test RNAs, primers were designed to amplify \u223c100 bp amplicons within the target ORF but outside of the stem-fragment, and tested using L. braziliensis gDNA. PCRs were performed using the SYBR Green (Applied Biosystems) and the ABI PRISM 7000 Sequence Detection System instrument (Applied Biosystems). PCR amplifications were performed as follows: 50\u00b0C for 2 min and 95\u00b0C for 10 sec then followed by 40 cycles of 95\u00b0C for 15 sec, 60\u00b0C for 1min. The generation of specific PCR products was confirmed by melting curve analysis and agarose gel electrophoresis. Each primer set was individually tested for four StL transfectants . All samples were performed in triplicate. Control samples of H2O were included in each experiment. Amplification of SSU rRNA was used as internal control to normalize the parallel reaction of target amplicons.L. braziliensis M2903 (MHOM/BR/75/M2903), L. guyanensis M4147 (MHOM/BR/75/M4147) and L. panamensis WR120 (MHOM/PA/74/WR120) were obtained from Diane McMahon-Pratt , L. braziliensis strain M2904 from Angela Cruz (U. Sao Paulo Riberao Preto), L. tarentolae strain TarII was obtained from M. Ouellette and B. Papadopoulou , L. mexicana (MNYZ/BZ/62/M379) from David Russell (Cornell University), and Crithidia fasciculata Cf-C1 from Larry Simpson (UCLA). The LRV-bearing strain of L. guyanensis M4147 (MHOM/BR/75/M4147) and a virus free derivative M4147/pX63-HYG Viannia strains used were confirmed by partial and/or complete sequencing of the AGO1 or other genes (not shown).Viannia species were grown in freshly prepared Schneider's Insect Medium (Sigma-Aldrich Cat. No. S9895) supplemented with 10% heat-inactivated fetal bovine serum, 2 mM L-glutamine, 500 units penicillin/ml and 50 \u00b5g/ ml\u2212 streptomycin (Gibco Cat No. 5070). Other Leishmania and Crithidia were propagated in M199 medium supplemented with 10% heat-inactivated fetal bovine serum, hemin, adenine, biopterin and biotin L. braziliensis were resuspended in 100 \u00b5l human T-cell Nucleofector solution (Amaxa Cat No. VPA-1002) mixed with 5 \u00b5l of 4 \u00b5g/ \u00b5l of \u03b1-tubulin dsRNA or control dsRNA and subjected to nucleofection with an Amaxa Nucleofector with program U-033 using the kit's cuvette. The transfection mixture was transferred immediately to 10 ml of complete medium and kept in 28\u00b0C for 3 hrs. RNA from 9 ml cells was taken for Northern blot analysis with an \u03b1-tubulin hybridization probe.For each transfection, 10 ml of log phase SAT marker, parasites were plated on 50\u2013100 \u00b5g/ml nourseothricin , and with the PHLEO marker, parasites were plated on 0.2\u20132 \u00b5g/ml phleomycin (Sigma). After colonies emerged  they were recovered and grown to stationary phase in 1 ml media, and passaged thereafter in 10 and 0.1 \u00b5g /ml nourseothricin and phleomycin, respectively. The plating efficiency of untransfected L. braziliensis M2903 ranged from 60\u201395% and the transfection efficiency from 50\u2013220 colonies / 20 \u00b5g DNA.Stable transfections were performed using the high voltage (1400V) procedure described previously Crithidia fasciculata strain Cf-C1 by 454 sequencing technology will be described fully elsewhere. Blast searches using L. braziliensis AGO1 were used to identify homologous sequences, which were then assembled manually into several large contigs. PCR primers were designed to amplify missing gaps, and the 5\u2032 end of the mRNA was obtained by RT-PCR using a forward miniexon primer (CFSLB 5\u2032-AAGTATCAGTTTCTGTACTTTATTG) and reverse CfAGO1 specific primer (SMB2895: 5\u2032-AAGCAGTTCGTCTCCACCGTCACCTG). Then a nested PCR was done with CfSLB and CfAGO1 primers (SMB 2894: 5\u2032- GTGATGCCGCCCTCCTCGCGGTCACG). The PCR products were TA cloned and sequenced. The CfAGO1 sequence was deposited in GenBank (EU714010). We noted a polymorphism in the CfAGO1 sequence, introducing a stop codon yielding a truncated protein terminating after amino acid 198. The consequences of this polymorphism (if any) have not been investigated further. The sequence of the L. guyanensis M4147 AGO1 ORF was determined by direct sequencing of the PCR amplicon obtained with primers B2468 (5\u2032-ATGTTGGCGCTAAACGCAGGTTC) and B2469 (5\u2032- CTACAGGTAGTGCATCGTGGGGC), and deposited in GenBank (accession number FJ234150).The generation of whole genome shotgun sequence data from RT-PCR reactions were performed as described above, with two sets of primers to detect LRV viruses described previously XbaI/SmaI, site a, and BglII, site b). High fidelity thermostable polymerases such as recombinant Pfu DNA polymerase (Stratagene) were used for PCR, and constructs were confirmed by restriction mapping and sequencing of all relevant regions. Unless otherwise indicated, all constructs were digested with SwaI and the linear SSU-targeting fragment purified for subsequent transfection by electroporation.The constructs used in this work are derivatives of pIR1SAT (B3541) SAT marker of pIR1SAT with the PHLEO marker . pIR1PHLEO-GFP+(a) (B5793), pIR1PHLEO-GFP65(a) (B5779) and pIR1-GFP65*(a) (B5959) were constructed by generating ORF cassettes of the respective genes and inserting into the XbaI (a) site. The GFP+ ORF was taken from pXG-GFP+ (B2799), GFP65 from pXG-GFP65 (B2355), and GFP65* was obtained by site-specific mutagenesis of pIR1PHLEO-GFP65 , changing nt 193 from T to A, resulting in a S65T mutation. A luciferase (LUC) ORF was amplified using pGL3-basic (Promega) as template, with primers adding flanking BglII sites, and a CCACC initiation sequence preceding the initiation codon. The modified LUC ORF was inserted into pGEM-T (Promega) yielding pGEM-Luciferase (B6033); the LUC ORF was then extracted by BglII digestion and inserted into the BglII site of B5959 to create pIR1PHLEO-GFP65*(a)-LUC(b) (B6034).pIR1PHLEO (B4054) was created by replacing the LPG1 ; LPG2 ; LPG3 ; HGPRT ; \u03b1-tubulin ; \u03b2-tubulin ; PFR1 ; PFR2 , AGO1  and LUC . These steps yielded constructs pIR1SAT-LPG1-StL (B6128), pIR1SAT-LPG1-StL  (6132), pIR1SAT-LPG2-StL (B6137), pIR1SAT-LPG2-StL (B6138), pIR1SAT-LPG3-StL (B6140), pIR1SAT-HGPRT-StL (B6136), pIR1SAT-HGPRT-StL (B6135), pIR1SAT-PFR1-StL (B6294), pIR1SAT-PFR2-StL (B6282), pIR1SAT-\u03b1Tub-StL (B6283), pIR1SAT-\u03b2Tub-StL (B6295) and pIR1SAT-LUC-StL (B6185), or pIR1SAT-LUC-StL (B6190).pIR1SAT-GFP65-StL(b) (B4733) was described previously LUC Stem-Loop into the \u2018a\u2019 site of a modified pIR vector (pIR2SAT-LUC-StL(a)-LUC(b) (B6386). This construct is referred to as the \u2018LUC RNAi self reporter\u2019 or \u2018LUC SR\u2019. For RNAi studies of AGO1, an analogous construct was made with a HYG marker (pIR2HYG-LUC-StL(a)-LUC(b), strain B6447). A pIR1SAT-LbrAGO1-StL(b) construct was used for RNAi tests (B6524).A single construct enabling tests of RNAi activity was generated by inserting the LUC ORF into the \u2018b\u2019 site and a L. donovani HGPRT antiserum  as the primary antibody, and detected using goat anti-rabbit IgG as the secondary antibody . Parasites expressing GFPs were analyzed using a Becton-Dickenson FACS Calibur, using fluoroscein excitation/emission parameters. LPG was purified and quantitated from L. braziliensis lines grown in logarithmic phase (4\u20135\u00d7106 cells/ml) as described L. braziliensis LPG Western blots were performed as described elsewhere using anti-GFP  or anti-6 logarithmic phase promastigotes were suspended in 200 \u00b5l media containing 30 \u00b5g/ ml of luciferin (Biosynth AG) and added to a 96-well plate . After 10 min incubation, the plate was imaged using a Xenogen IVIS photoimager , and luciferase activity quantitated as photons/sec (p/s).10Promastigotes were fixed in 2% paraformaldehyde/2.5% glutaraldehyde  in 100 mM phosphate buffer, pH 7.2 for 1 hr at room temperature. Samples were washed in phosphate buffer and postfixed in 1% osmium tetroxide  for 1 hr. Samples were then rinsed extensively in water prior to en bloc staining with 1% aqueous uranyl acetate  for 1 hr. Following several rinses in water, samples were dehydrated in a graded series of ethanol solutions and embedded in Eponate 12 resin (Ted Pella Inc.). Sections of 95 nm were cut with a Leica Ultracut UCT ultramicrotome , stained with uranyl acetate and lead citrate, and viewed on a JEOL 1200 EX transmission electron microscope .Table S1Primers used for qRT-PCR.(0.05 MB DOC)Click here for additional data file.Figure S1L. braziliensis M2903 promastigotes and Trypanosoma brucei procyclics. This Northern blot was probed with a L. braziliensis SLACS probe and the autoradiogram is shown. Trypanosome SLACs differs greatly in sequence from that of L. braziliensis and as expected no siRNA hybridization is evident. Size standards are in the left track.SLACS-derived siRNAs. siRNA analysis of RNAs from (0.47 MB TIF)Click here for additional data file.Figure S2GFP Reporters ORF nucleotide alignment. An alignment of the AT-rich GFP65 ORF and GC-rich GFP+ nucleotide sequences is shown. The T\u2192A mutation in GFP65* (S65T in the protein) is indicated. Regions of identity are boxed.(2.87 MB TIF)Click here for additional data file.Figure S3L. braziliensis M2903 with lines bearing a Luciferase reporter subsequently transfected with LUC-StL. Luciferase activity (photons/sec or p/s) was measured as described in the L. braziliensis M2903 (Lb WT) and L. braziliensis M2903 expressing luciferase -LUC(b)). Test transfectants of Lb+LUC additionally expressed the LUC-StL in a convergent (SSU:SAT:LUC-StL(b-CONV); Panel A) or divergent orientation (SSU:SAT:LUC-StL(b-DIV); Panel B). GFP expression varied less than 10% amongst experimental samples.Tests of RNAi in (0.33 MB TIF)Click here for additional data file.Figure S4Crithidia. Crithidia fasciculata clone Cf-C1 was electroporated with the targeting fragment from pIR1SAT-HYG(a)-GFP(65)-StL(b), yielding SSU:SAT-HYG-GFP(65)-StL transfectants. These were confirmed by PCR tests for the marker and presence of the inverted GFP65 repeats, and RNA was isolated and subjected to Northern blotting for siRNAs using a GFP65 probe.GFP siRNAs in (0.94 MB TIF)Click here for additional data file."}
{"text": "Mammalian ATAD3 is a mitochondrial protein, which is thought to play an important role in nucleoid organization. However, its exact function is still unresolved.Caenorhabditis elegans (C. elegans) ATAD3 homologue (ATAD-3) and investigate its importance for mitochondrial function and development. We show that ATAD-3 is highly conserved among different species and RNA mediated interference against atad-3 causes severe defects, characterized by early larval arrest, gonadal dysfunction and embryonic lethality. Investigation of mitochondrial physiology revealed a disturbance in organellar structure while biogenesis and function, as indicated by complex I and citrate synthase activities, appeared to be unaltered according to the developmental stage. Nevertheless, we observed very low complex I and citrate synthase activities in L1 larvae populations in comparison to higher larval and adult stages. Our findings indicate that atad-3(RNAi) animals arrest at developmental stages with low mitochondrial activity. In addition, a reduced intestinal fat storage and low lysosomal content after depletion of ATAD-3 suggests a central role of this protein for metabolic activity.Here, we characterize the C. elegans development in vivo. Moreover, our results suggest that the protein is important for the upregulation of mitochondrial activity during the transition to higher larval stages.In summary, our data clearly indicate that ATAD-3 is essential for  Mitochondria are semi-autonomous organelles in eukaryotic organisms, which have a profound role in cell viability through the control of energy production via oxidative phosphorylation (OXPHOS) The mitochondrial DNA (mtDNA) typically forms a circular, double-stranded molecule that spans about 16,569 base pairs. It encodes 37 genes, all of which are essential for normal mitochondrial function  Obviously, gene expression and (timely) replication of mtDNA require a great number of regulatory factors, which are nuclear-encoded and translocate to the mitochondria to execute their tasks. In addition, specific proteins are involved in maintenance and structural organization of mtDNA. A novel candidate with a putative role in theses processes is mammalian ATAD3, an ubiquitously expressed protein, which was initially found in a proteomic screen of rat liver mitochondria  homologue of vertebrate ATAD3. We demonstrate that ATAD-3 is a mitochondrial protein and RNA mediated interference (RNAi) induced depletion leads to severe phenotypes, characterized by early larval arrest, gonadal dysfunction, reduced intestinal fat storage and embryonic lethality. Investigation of mitochondrial physiology revealed a disorganized organellar morphology in young adults. Nevertheless, enzymatic measurements after atad-3(RNAi) demonstrated that arrested L1 larvae had similar OXPHOS activities when compared to wild type L1 larvae. However, we also observed a clear increase in OXPHOS activities at later developmental stages in wild type animals, indicating an activation of mitochondrial biogenesis, which is apparently disturbed in atad-3(RNAi) animals.Here, we characterized ATAD-3, the C. elegans protein, encoded by the predicted open reading frame (pORF) F54B3.3, as a highly conserved homologue of human ATAD3. BLAST analysis Drosophila (CG6815-PA) with overall sequence identity of 58%, 55% and 53%, respectively  motif C. elegans ATAD-3 . However, there was no detectable signal in the cytoplasmic fraction. As further depicted in C. elegans ATAD-3 and human ATAD3, both protein localize to mitochondria.To confirm that ATAD-3 is indeed a mitochondrial protein, we generated anti-ATAD-3 antibodies see . and perions see .. As illC. elegans, we performed RNA mediated interference (RNAi) by \u201cfeeding\u201d atad-3(RNAi) animals revealed a clear decrease in the level of protein expression (To further investigate the function of ATAD-3 in pression .C. elegansatad-3(RNAi) animals showed a slightly disorganized mitochondrial network in comparison to control animals fed with HT115 bacteria carrying the \u201cempty\u201d L4440 \u201cfeeding\u201d-vector (F) and mitochondrial filamentation (aspect ratio\u200a=\u200aAR) of mitochondrial regions revealed a slight trend towards a more filamentous network in atad-3(RNAi) animals  animals (see atad-3(RNAi) on mitochondrial mass in adult worms/at this developmental stage.To gain information on potential changes in mitochondrial mass in young adult worms, we performed Western blot analysis of ATAD-3, NUO-2 and GAPDH protein expression levels. Experiments revealed no drastic changes in NUO-2 protein levels  in mals see . MoreoveC. elegans tissue homogenates. Mitochondrial complex I is the largest enzyme of the respiratory chain and constitutes the entry point of electrons into the system. Cirate synthase is a key enzyme of the krebs cycle and previous studies showed that it can be used as an accurate marker of mitochondrial mass in tissue atad-3(RNAi) treatment (atad-3(RNAi) animals did not develop normally but arrested at early larval stages, primarily at the L1 stage. To study the link between CI and CS activities with the stage of development we performed enzymatic measurements on synchronized wild type L1 larvae compared to a mixed stage wild type population. It revealed that wild type L1 worms typically presented low activities of complex I and citrate synthase per milligram of tissue protein, as compared to a mixed stage wild type population. This demonstrates that ATAD-3 deficiency does not alter mitochondrial function in L1 larvae, but suggests that it hinders the transition from L1 stage to later stages where mitochondrial activity is normally enhanced. Accordingly, the drastic increase observed in mitochondrial CI and CS activities at higher larval stages (C. elegans development. These data suggest that atad-3(RNAi) worms cannot perform this transition.To further investigate whether changes in mitochondrial architecture were subject of disturbed mitochondrial function or respiratory chain content, we performed enzymatic measurements of mitochondrial NADH-ubiquinone oxidoreductase (complex I) and citrate synthase (CS) in reatment . Howeverl stages  indicateatad-3 (RNAi) in more detail. Our first observation was that most of atad-3(RNAi) L1 larvae remained small and showed developmental arrest at this stage compared to wild type animals (atad-3(RNAi) plates for 3 days, only 20 became adult, while 11, 16, 31 and 51 arrested in L4, L3, L2 and L1 larval stages, respectively (atad-3(RNAi) animals was comparable to the control (data not shown).Based on the above mentioned observations, we investigated the phenotype caused by  animals . After iectively . Interesatad-3(RNAi) plates, we first noticed a decrease in the reproduction rate. Whereas the wild type control produced about 62 embryos within in the first 12 h, atad-3(RNAi) animals only produced 29 embryos (atad-3(RNAi) induced a very drastic reduction, finally leading to a complete failure of reproduction after 36 h (atad-3(RNAi) treatment of young adults developed apparently normal but showed arrest as L1 larvae. In contrast, atad-3(RNAi) embryos produced by young adults between 24 h\u201348 h showed an embryonic lethal phenotype with failure of pronuclear migration and abnormal spindle orientation  adults (see above), the overall gonade morphology, as judged by light microscopy, appeared to be rather normal, containing gonadal arms with a distal region, a loop and a proximal region where oocytes are formed (atad-3(RNAi) gonads the anti-ATAD-3 signal was strongly reduced but oogonia retained a rather well organized honeycomb-like pattern  analysis. Both parameters can be measured by the vital dyes Nile Red  animals accumulated significantly less fat than their wild type counterparts (atad-3(RNAi) animals  phenotype arise. Apart from the severe developmental disturbance, the observed alterations in mitochondrial organization are interesting and might indicate a functional defect. Increasing evidence has been provided that mitochondria form a functional reticulum, which on the one hand protects individual mitochondria from stochastic depletion of metabolic substrates or mtDNA and on the other hand mediates the sharing/transport of intramitochondrial constituents like antioxidants C. elegansatad-3(RNAi) animals may indicate additional changes in mitochondrial architecture. However, at the current stage, we cannot rule out that these changes may be due to reduced GFP transport to the mitochondrial matrix.In a combined view of these findings, interesting similarities to our C. elegans L1 larvae displayed very low complex I and citrate synthase activities when compared to a mixed stage wild type population, indicating a low mitochondrial content at this developmental stage. Apparently, atad-3(RNAi) animals mainly arrest at developmental stages with low mitochondrial content. These findings indicate that OXPHOS derived energy requirements are rather low during early larval development, whereas during later development the activation of OXPHOS/biogenesis of mitochondria is initiated to fulfill metabolic demands. These observations are in keeping with other studies showing that mtDNA copy number drastically increases especially after the L3 stage atad-3(RNAi) worms mainly arrest at developmental stages with low mitochondrial tissue content and activity.A remarkable finding of our study was that atad-3(RNAi) was a failure of fertilization. The distal part of the C. elegans gonad is a non-cellularized syncytium where germ line nuclei divide, while in the proximal part cellularization and oocyte growth takes place C. elegans, alterations in mitochondrial function might disrupt normal tissue function . After RNAi against atad-3 no obvious defects became apparent in the distal and proximal region of the gonad, as judged by immunofluorescence and Nomarski optics, respectively (The most obvious tissue-specific dysfunction that we observed after ectively . A furthatad-3(RNAi). These findings might suggest a disturbed balance between fat storage and mobilization, possibly indicating a problem with energy homeostasis and metabolic activity. Importantly, McKay et al. (2003) described that disturbed function of the mitochondrial respiratory chain severely impairs intestinal fat storage in C. elegansC. elegans (e.g. the germ line and the intestine atad-3(RNAi).In line with this idea, we also observed a reduced intestinal fat storage and lysosomal content in young adults after atad-3(RNAi) analysis reveals interesting parallels to phenotypes caused by other mitochondrial dysfunctions in C. elegans . The fragment was cloned in frame in the 6\u00d7 His-tag expression vector pQE30 (Qiagen), transformed and induced in E. coli strain M15 [pREP4] (Qiagen). Recombinant protein was purified on Ni2+-NTA matrix (Qiagen) and sent to Eurogentec  for immunization. The final bleed of one rabbit was purified using columns and the recombinant protein as a bait. For elution of anti-ATAD-3 antibodies Tris-Cl (pH 8.0) was used.PCR was used to amplify a 900 base pair fragment, encoding the C-terminal 300 amino acids of ATAD-3 (-HPIK\u2026 ETAV): forward: atad-3 was obtained from the Ahringer RNAi library (Geneservice Limited). After amplification of a single colony overnight , HT115 (DE3) bacteria  were seeded on NGMamp_tet plates, containing IPTG (1 mM) and further incubated overnight at room temperature (22\u00b0C) to allow the expression of double-stranded RNA. HT115 (DE3) bacteria harboring the \u201cempty\u201d KS+based vector, L4440 (containing two T7 promoters flanking a polylinker), were used as a control for RNAi \u201cfeeding\u201d experiments.RNAi by \u201cfeeding\u201d was performed essentially as described by atad-3(RNAi) bacteria plates. The plates with worms were incubated at room temperature and evaluated after 3 days. The effects on embryonic production were determined by counting the numbers of progeny that managed to hatch on either \u201cWT control\u201d plates or on atad-3(RNAi) bacteria plates.To determine the larval arrest phenotype, wild type L1 stage larvae were either placed on plates seeded with HT115 bacteria containing the \u201cempty\u201d feeding vector L4440 (\u201cWT control\u201d) or on Gravid adults were transferred with a drawn-out pipette to a microscope slide, coated with a thin layer of polylysine in a drop of sterile M9 buffer and cut with a scalpel. Embryos were immediately permeabilized by the freeze-crack method AR) and mitochondrial branching (formfactor\u200a=\u200aF) were quantified by using a modified computer-assisted approach published by Koopman et al., 2008 . For phenotypic characterization, worms were investigated under a Zeiss Axioplan 2 research microscope fitted with a Hamamatsu Orca-ER camera. To analyze mitochondrial structure, muscle cells of SJ4103 young adults Western blot analysis was performed essentially as described previously For separation of mitochondrial and cytoplasmic fractions, worms were harvested from well grown NGM plates and washed twice with M9 buffer. Washed worms were suspended in MSE buffer . After freeze/thaw three times using liquid nitrogen, worms were homogenized at 4\u00b0C, using a glass homogenizer and centrifuged at 4\u00b0C, 2000 rpm for 15 minutes. To separate mitochondria from cytoplasmic fraction the supernatant was centrifuged at 4\u00b0C, 13000 rpm for 15 minutes .2 spectrophotometer (SAFAS), using standardized and reproducible methods as previously described 2PO4, 5 mM MgCl2, 2 mM KCN, pH 7.2) was supplemented with 2.5 mg/ml BSA, 2 \u00b5g/ml antimycin A, 0.1 mM UQ1decylubiquinone and 0.1 mM NADH in a final volume of 1 ml. Enzyme activity was measured by starting the reaction with 20 \u00b5g of mitochondrial protein. The decrease in absorption due to NADH oxidation was measured at 340 nm in both the absence and presence of rotenone 10 \u00b5g/ml. The difference in both activities indicates the rotenone-sensitive activity of complex I. The extinction coefficient used for NADH was 6.22 mM\u22121 cm\u22121. The reduction of 5\u2032,5\u2032-dithiobis(2-nitrobenzoic acid) (DNTB) by citrate synthase (CS) at 412 nm (extinction coefficient 13.6 mM\u22121 cm\u22121) was followed in a coupled reaction with coenzyme A and oxaloacetate. A reaction mixture of 20 mM Tris-HCl, pH 8.0, 0.42 mM acetyl-coenzyme A, 0.1 mM DTNB and 20 \u00b5g of mitochondrial proteins was incubated at 37\u00b0C for 5 min. The reaction was initiated by the addition of 0.5 mM oxaloacetate and the absorbance change monitored for 5 min.Animals were collected in M9 buffer and frozen in liquid nitrogen. Semi-synchronized L1s were obtained by treatment with alkaline hypochloride (2 vol 4 M NaOH : 3 vol 13% NaOCl) . The pelhttp://rsbweb.nih.gov/ij/).Assays were performed essentially as described by others Figure S1Western blot analysis of ATAD-3, NUO-2 and GAPDH protein expression levels. Western blot analysis of ATAD-3, NUO-2 and GAPDH protein expression levels in young adult WT and atad-3(RNAi) animals. Experiments revealed no drastic changes in NUO-2 protein levels in atad-3(RNAi) animals, suggesting no major influence of atad-3(RNAi) on mitochondrial mass in these worms/at this developmental stage.(0.85 MB TIF)Click here for additional data file."}
{"text": "Aedes aegypti, modulating arbovirus infection of mosquitoes. Sindbis virus  is an arbovirus that infects Ae. aegypti in the laboratory. SINV strain TR339 encounters a midgut escape barrier (MEB) during infection of Ae. aegypti. The nature of this barrier is not well understood. To investigate the role of the midgut as the central organ determining vector competence for arboviruses, we generated transgenic mosquitoes in which the RNAi pathway was impaired in midgut tissue of bloodfed females. We used these mosquitoes to reveal effects of RNAi impairment in the midgut on SINV replication, midgut infection and dissemination efficiencies, and mosquito longevity.The RNA interference (RNAi) pathway acts as an innate antiviral immune response in Aa-dcr2 gene. In midgut tissue of the transgenic Carb/dcr16 line, Aa-dcr2 expression was reduced ~50% between 1-7 days post-bloodmeal (pbm) when compared to the recipient mosquito strain. After infection with SINV-TR339EGFP, Aa-dcr2 expression levels were enhanced in both mosquito strains. In the RNAi pathway impaired mosquito strain SINV titers and midgut infection rates were significantly higher at 7 days pbm. There was also a strong tendency for increased virus dissemination rates among the transgenic mosquitoes. Between 7-14 days pbm, SINV was diminished in midgut tissue of the transgenic mosquitoes. Transgenic impairment of the RNAi pathway and/or SINV infection did not affect longevity of the mosquitoes.As a novel tool for studying arbovirus-mosquito interactions, we engineered a transgenic mosquito line with an impaired RNAi pathway in the midgut of bloodfed females by silencing expression of the Ae. aegypti, the recombinant SINV-TR339EGFP was confronted with both MEB and a midgut infection barrier (MIB). Impairment of the RNAi pathway in the midgut strongly reduced both midgut barriers for the virus. This confirms that the endogenous RNAi pathway of Ae. aegypti modulates vector competence for SINV in the midgut. The RNAi pathway acts as a gatekeeper to the incoming virus by affecting infection rate of the midgut, intensity of infection, and dissemination from the midgut to secondary tissues.We showed that RNAi impaired transgenic mosquitoes are a useful tool for studying arbovirus-mosquito interactions at the molecular level. Following ingestion by  The RNA interference (RNAi) pathway is an innate immune pathway of invertebrates such as nematodes, trypanosomes, hydra, planaria, and insects . In mosqTogaviridae; genus: Alphavirus) is an arbovirus with a positive sense single-stranded RNA genome. A dsRNA intermediate is formed during replication, which triggers the RNAi pathway causing homology-dependent destruction of viral RNA . The plates were incubated at 37\u00b0C for 4 days. Cells were then stained with MTT  , incubated at 37\u00b0C for 24 h and the number of plaques was counted for each sample. Virus titers of individual mosquitoes were calculated as pfu/ml.SINV-TR339EGFP virus stocks were generated from an infectious cDNA clone that contained the EGFP marker gene under control of a duplicated sub-genomic promoter located upstream of the coding sequence for the structural genes . BrieflySeven day-old Carb/dcr16 and HWE females were either fed with a non-infectious bloodmeal or with a bloodmeal containing SINV-TR339EGFP. After bloodfeeding, 50 mosquitoes of each treatment were put into 470 ml cardboard containers and provided with sugar and water. A control consisting of females that were sugarfed only was included in the experiment. For a period of 28 days after bloodfeeding the daily number of surviving mosquitoes in each container was recorded.dcr2 ratios and SINV-TR339EGFP infection levels were normalized using a log10 transformation. Aa-dcr2 ratios, virus infection levels, and virus infection/dissemination rates were then analyzed using the least-squares means test followed by pair-wise comparisons with the Tukey-Kramer test.Statistical analyses were performed using SAS Statistical Analysis Software . The MIXED procedure was used for restricted maximum likelihood parameter estimation with incomplete data. Aa-CCHK designed and performed the qRT-PCR assays, virus challenge and survival experiments, analyzed the data and wrote the manuscript. JP assisted with sample preparations, qRT-PCR assays, mosquito rearing and virus challenge experiments. ISV performed the Northern blot. KEO conceived the study, analyzed the data and edited the manuscript. AWEF conceived the study, generated the IR effector construct and the transgenic mosquitoes, performed the Genome Walking experiment, analyzed the data and edited the manuscript. All authors read and approved the final manuscript."}
{"text": "The stability of ophthalmic preparations in multidose containers is influenced by the preservative as well as the stability of the active ingredient. Unstable drugs may require refrigeration to preserve their active ingredient level and they are more likely to degrade over time, therefore becoming more susceptible to degradation based on patient mishandling. The purpose of this study was to determine the degree of molecular degradation that occurs in bimatoprost and latanoprost in a patient-use setting.This was an open-label, laboratory evaluation of the relative stability of bimatoprost and latanoprost. Patients presently using bimatoprost (n = 31) or latanoprost (n = 34) were identified at 2 clinical sites in Brazil. Patients were instructed to use and store their drops as usual and return all used medication bottles between day 28 and day 34 after opening.Bimatoprost demonstrated no degradation, but latanoprost degraded at various levels. The mean age of bimatoprost was 43.0 \u00b1 3.4 days and the mean age of latanoprost was 43.9 \u00b1 2.8 days (P = .072). The mean percentage of labeled concentration was 103.7% in the bimatoprost bottles and 88.1% in the latanoprost bottles (P < 001).This study showed that bimatoprost maintained \u2265100% concentration throughout the study period while latanoprost did not. The stability of ophthalmic preparations in multidose containers is influenced by the preservative as well as the stability of the active ingredient . UnstablNumerous clinical studies show that the synthetic prostamide analog, bimatoprost, is a highly efficacious IOP lowering agent -4. BimatWhether temperature and humidity conditions found in actual practice environments, which vary across geographic locations and seasons, induce the degree of drug degradation found under laboratory conditions is not known. The purpose of this study was to determine whether storage and use practices of bimatoprost and latanoprost IOP-lowering medications affect the degradation rate of the active molecules of these drugs. Sao Paolo, Brazil, where the medications were used, is located in an equatorial climate zone characterized by a hot, dry winter season . SimilarThis was an open-label, laboratory evaluation of the relative stability of bimatoprost and latanoprost. Patients presently using bimatoprost (n = 31) or latanoprost (n = 34) were identified at two clinical sites in Sao Paulo, Brazil. After granting informed consent, all patients were instructed to store and use their eye drops at room temperature and to return all used medication bottles between day 28 and day 34 after opening. The bottles were collected between May and July 2002.Once patients returned the used bottles, they were collected and stored at room temperature for subsequent shipment to a central independent laboratory . During shipping (next-day air), the bottles were stored in insulative packaging with ice packs. The bottles arrived at the testing facility between day 35 and day 42. Shipment and arrival of bottles was scheduled so that all bottles were tested on approximately day 42 after opening.\u00ae C18 reverse-phase column, UV detection at 210 nm, and a mobile phase of 72/18/10  containing 0.03% (w/v) trifluoroacetic acid. Recovery studies were conducted for commercially available bimatoprost 0.03% preserved ophthalmic solution. Studies performed at 80%, 100%, and 125% of the label claim yielded recoveries of 100.5%, 100.6%, and 100.2% for peak areas and 101.5%, 100.6%, and 100.4% using peak heights, respectively. Linearity for bimatoprost was demonstrated from 0.002% to 0.009% (w/v) bimatoprost after dilution . Correlation coefficients (r) of 0.9999 by peak areas and 0.9992 by peak heights were obtained and a single point standard was used for calculations using peak areas and peak heights.All methods were validated by the testing facility, and analyses were carried out in accordance with good laboratory practices. High performance liquid chromatography (HPLC) was used to separate the molecules of interest from degradation byproducts and synthetic impurities, and for quantitation. The method for bimatoprost (AGN 192024) used a Waters SymmetryFor latanoprost, the method employed a Waters 600S equipped with a Waters 626 pump, a Waters 486 detector, and a Waters 717 Plus autosampler or equivalent, UV detection at 205 nm and mobile phase of 6/1/13  containing 0.05% (w/v) trifluoroacetic acid. Latanoprost stock solution with an acceptable concentration between 0.45 and 0.55 \u03bcg/mL was used in recovery studies; representing a range from 90% to 110% of the labelled concentration of samples after 100-fold dilution. A Free Acid Standard, Latanoprost Standard, Latanoprost and Free Acid Mixed LOQ Standard, and Latanoprost and Free Acid Mixed Standard were run against the diluted samples to determine the latanoprost concentration. A bracketing standard was injected after every 6-sample injection. The area of the latanoprost and free acid peaks within this bracketing standard were within 5% of the average area for the initial five injections of the latanoprost and free acid peaks. The relative standard deviation (RSD) for the 5 injections of the latanoprost and free acid mixed standard were \u22642% for each peak. Latanoprost concentration was determined using the following formula:Latanoprost concentration (\u03bcg/mL) = (average area latanoprost in sample)*/(average area latanoprost in standard).The primary endpoint, percentage of labeled concentration in the bottles at the time of testing, was calculated as: (concentration of intact drug in bottle/concentration of the drug indicated on the label) \u00d7 100. Percent concentrations then were recorded for each bottle of bimatoprost and latanoprost.Between-group comparisons were made using paired t-tests. The a priori level of significance for all tests was 0.05. The percentage of label claim was calculated as concentration remaining in the bottle/label claim \u00d7 100.The bottles were collected between May and July 2002, which corresponds to the end of fall and the beginning of the dry winter season in Sao Paulo. The average ambient temperature ranged between 14\u00b0C and 24\u00b0C.P = .072). Bimatoprost bottles retained a significantly greater percentage of the labeled active drug concentration after patients completed their course of therapy than did the latanoprost bottles. The mean percentage (\u00b1 SD) of labeled concentration was 103.7% \u00b1 1.3% in the bimatoprost bottles compared with 88.1% \u00b1 10.8% in the latanoprost bottles (P < .001) .There was no significant between-group difference in the mean age of the bottles on the test date. The mean bottle age was 43.0 \u00b1 3.4 days with bimatoprost and 43.9 \u00b1 2.8 days with latanoprost (This study demonstrated that bimatoprost maintained its labeled concentration of active drug, while the latanoprost active drug concentration degraded over the course of normal patient use in Sao Paolo, Brazil.In the present study, the active drug concentration in all bimatoprost bottles tested was at least 100% of the labeled concentration more than 40 days after they were originally opened. Conversely, with latanoprost, only 8.8% of the bottles tested had at least 100% of the labeled active drug concentration. This result differs from a patient-use stability study conducted in Los Angeles, California, USA, where little degradation of latanoprost was found , and varOne limitation of the study was that baseline concentrations of the drugs were not measured prior to patient use. However, regulatory agencies and pharmaceutical manufacturing specifications require that actual drug concentrations be within a narrow range approximating the labelled strength. Approximately 10% more or less than the labelled concentration generally defines this tolerance, but it may be tighter depending on the characteristics of the drug . The labWhether the degree of drug degradation that occurs under normal-use conditions is clinically relevant is unclear. Clinical trials over 1 to 6 months have shown that bimatoprost produces IOP reduction greater than or comparable to latanoprost in various patient populations ,13-17, aLoss of drug activity may reduce IOP-lowering efficacy and cause wide fluctuations in a patient's IOP, which may be an independent risk factor for progressive disease ,21. BothPackage inserts indicate that bimatoprost should be stored between 2\u00b0C and 25\u00b0C, and no shelf life limitation is indicated . LatanopPatients on ocular hypotensive drugs that consistently lower IOP are less likely to progress than patients whose medication levels decrease over time. In this study, latanoprost formulations degraded while bimatoprost did not, suggesting that patients are more likely to receive the prescribed dose of bimatoprost after opening. Patients that receive the labelled dose, which has been clinically shown to achieve maximal IOP lowering from that medication, are more likely to halt glaucomatous progression.MDP, NK and CCU declare that they have no competing interests. JGW is an employee of and owns stock in Allergan, Inc.MDP, NK, CCU collected the study medication bottles. MDP and JGW conceived of the study. All authors participated in the study design and coordination, and read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
{"text": "The prevalence of vesicoureteral reflux (VUR) has been estimated as. 4 to 1.8% among the pediatric population. In children with urinary tract infection the prevalence is typically from 30-50% with higher incidence occurring in infancy. When correction of VUR is determined to be necessary, traditionally open ureteral reimplantation by a variety of techniques has been the mainstay of treatment. This approach is justified because surgical correction affords a very high success rate of 99% in experienced hands and a low complication rate. In that context the purpose of this review article is to highlight the use of laparoscopy and robot-assisted techniques to perform ureteric reimplantation for the management of pediatric VUR. A detailed review of recent literature on the subject is performed to find out various aspects of minimally invasive surgery in the treatment of VUR, highlighting evolution of management approaches, operative steps, complications, results and the current status in clinical practice. We also share our experience on the subject. Vesicoureteral reflux (VUR), the most common urological abnormality in children, is considered as a significant factor for the development of urinary tract infection (UTI), progressive renal damage or scarring and end stage renal failure.\u20136 SurgicIn the last decade there has been a shift to perform ureteric reimplantation using the laparoscopic approach in order to provide all advantages of a minimally invasive technique and long-term results similar to traditional open ureteric reimplantation.et al., reported their experience in 22 children who underwent percutaneous endoscopic trigonoplasty.[The first laparoscopic extravesical  approach was used to perform modified Lich-Gregoir reimplantation. The Lich-Gregoir method, which evolved in the 1960s, is the most popular extravesical procedure and the first laparoscopic extravesical approach was performed by using the modified Lich-Gregoir technique. In 1993 and 1994, several groups reported experimental efforts with extravesical laparoscopic reimplantation in the porcine model 4,5 where animals first had reflux created by endoscopically incising the submucosal tunnel. Using a transperitoneal approach, on the posterior wall of the bladder a detrusor incision was created proximal to the ureteral hiatus, the ureter was positioned within the trough and the detrusor closed over it with either staples or absorbable sutures. The early results were promising although investigators reported it to be technically challenging. Shortly after the initial reports of extravesical ureteral reimplantation, experience with a combined transvesical and transurethral endoscopic approach to ureteral reimplantation was reported by two groups.12 In 199noplasty.2 into the retroperitoneal space and subsequent pneumoretroperitoneum and bladder collapse. The ureters were then reimplanted in a cross-trigonal fashion after the detrusor hiatus had been reapproximated with interrupted polyglactin sutures. The length of the submucosal tunnel was limited and the procedure probably achieved a 2 to 2.5 cm ureteral reimplantation on each side. At one year follow-up, 10 of 12 ureters managed in this fashion showed no reflux.Following this initial disappointing resolution rate with trigonoplasty, members of the same group performed transvesical mobilization of the ureters again using two suprapubic transvesical ports and a cystoscope. Using siIn an effort to improve on their results, Okamura and associates developed a new procedure called endoscopic trigonoplasty II.16 This wIn 2003 laparoscopic Cohen procedure using a pneumovesical approach was first described in an animal model. We devel2 pneumovesicum and it could also serve as an additional suction irrigation device during subsequent dissection and ureteric reimplantation. A 5-mm 30-degree scope is used to provide intravesical vision. Two more 3-5 mm working ports are then inserted along the interspinous skin crease on either side of the lower lateral wall of the distended bladder under vesicoscopic guidance [The patient is positioned supine with the legs separated apart for cystoscopy and bladder catheterization intraoperatively. For small infants the surgeon can stand and operate over the patient's head whereas for older children, the surgeon usually stands on the patient's left side. The video column is placed between the patient's legs at the end of the table. The port placement is preceded by transurethral cystoscopy to allow placement of the first camera port under cystoscopic guidance. The bladder is first distended with saline and a 2-0 monofilament traction suture is passed percutaneously at the bladder dome under cystoscopic vision, through both the abdominal and bladder walls. This helps to keep the bladder wall from falling away when the first camera port site incision is made and during insertion of the cannula. A 5-mm Step port  is then inserted under cystoscopic vision. A urethral catheter is then inserted to drain the bladder and start carbon dioxide insufflation to 10-12mmHg pressure. The urethral catheter is used to occlude the internal urethral meatus to secure COguidance . A 3\u20134 cguidance . IntraveThe ureter is mobilized by first circumscribing it around the ureteral orifice using hook electrocautery . With trWe have not faced any major complications with this technique. In the early part of the series when the cannulas were not secured to the bladder wall, displacement of the port outside the bladder wall occurred. This resulted in gas leakage into the extravesical space, with compromise of the intravesical space and endoscopic vision. It is usually possible to reintroduce the ports but securing the ports perfectly is the key to the success of this technique. We have Our operative success for laparoscopic Cohen performed in 60 children (46 girls and 14 boys) with an average age 1.81 years (range one month-7.24 years) and a mean follow-up of two years (range 1.1\u20135 years) has been 97.6%. These results are encouraging and endoscopic intravesical ureteric mobilization and cross-trigonal ureteral reimplantation can be safely performed with routine pediatric laparoscopic surgical techniques and instruments under carbon dioxide insufflation of the bladder.19The extravesical approach can be performed unilaterally or bilaterally, applying Lich-Gregoir technique. The patient is in supine position for an extravesical laparoscopic ureteral reimplantation. The bladder is first inspected with cystoscopy. A 3-Fr ureteral catheter may be placed at this time to help laparoscopic identification although we do not routinely use it. After scopy the bladder is drained by a catheter. An infraumbilical incision is made to place a 5-mm trocar for vision by open method. The other two trocars are placed along the lateral border of the rectus. Ports are fixed to the abdominal wall using a stitch which is also used to close the fascia. The ureter is normally seen well at the pelvic brim and can be followed to its insertion into the bladder. The technique follows the same steps as the open Lich-Gregoir procedure. It starts by dissecting the ureter after opening the peritoneum just over the posterior bladder wall. In females the ureter can be found in the anterior relation to the uterus. The ureter is freed from the surrounding tissue keeping its vessels intact. Approximately 4-5 cm is dissected to permit mobility and to prevent kinking as the bladder tunnel is created for the ureter. It is important to take care not to damage the Vas during the dissection around the UV junction. Adequate exposure of the posterior bladder wall is a key factor in this operation. A hitch stitch through the posterior bladder wall can be used to improve the exposure of the ureteral hiatus, attaching to the abdominal wall or through it.Once the ureter is free, the size of the tunnel is estimated after the bladder is partially distended. The ureter should course slightly laterally to avoid kinking of the ureter. A tunnel is adequately dissected to obtain a 5:1 ratio of length to width; the detrusor muscle is divided full thickness using a cautery hook while keeping the mucosa intact. Any perforations of the mucosa are closed using a 6-0 chromic suture. The ureter is positioned in the tunnel so as to avoid any kinking or excessive compression of the ureter to prevent obstruction. Closure may be from proximal end of the incision to distal or in the reverse fashion. In the latter, the ureter is well visualized while in the former needle needs to be passed under the ureter each time. The peritoneum is closed in a running fashion and a catheter is left in place, for one day. The indications for using the MIS extravesical Lich-Gregor approach are the same as for the open surgical technique although some investigators do not find the extravesical procedure appropriate for patients with megaureters requiring tapering.The common complication is accidental bladder mucosal perforations during the dissection of the detrusor muscle trough for the submucosal tunnel. The bladder mucosa perforations can be prevented by not over distending the bladder and use of blunt instruments like the suction tip to do the dissection of the mucosa from the detrusor muscle. Another limitation of this approach is transgressing the peritoneal cavity and difficult retraction of the bladder for the want of good exposure.et al., in 2004 have taken a similar approach and have documented excellent results and recovery in the post pubertal patients.[Lakshmanan and Fung reported extravesical laparoscopic reimplant in 99 ureters in 66 children aged four to 18 years.[patients. They alsThis technology has provided an opportunity to apply new techniques to practice MIS. From our own experience we believe that one of the main advantages of the robotic system, especially in children, is of offering surgeons inexperienced in laparoscopy the benefits of high dexterity in minimally invasive procedures and for the experienced laparoscopic surgeon to improve their capacity. Robot -a23The robot-assisted extravesical approach for treating VUR can be performed unilaterally or bilaterally, following the same steps as have been described in the laparoscopic section. Typically, the patient is in the supine position and legs placed apart. An open technique is used to place the first trocar, the 12mm camera port, in the umbilicus. The working ports, 8mm, are positioned in the mid-clavicular line bilaterally, about 1cm below the umbilical line. Ports are fixed and secured firmly to the abdominal wall using a stitch which is also used to close the fascia later. The robot is docked over the child's feet end to perform the surgery. For the robotic Cohen procedure the patient and robot docking position is the same as described for the extravesical approach. The procedure steps are the same as described earlier in the laparoscopic pneumovesicum reimplantation technique. While doing a robot-assisted procedure the main difference is the use of 12mm camera port and two 8mm working ports. Our experience of conventional lap for this technique has been quite different. The working space after all the three robotic ports have been placed inside the bladder is quite limiting as against what we usually experience with 5mm ports and 3mm instruments doing this surgery. There isn't enough data doing this technique by using robotic assistance. In our eDisadvantages of this robotic system include the lack of tactile sensation and thus visualization of anatomic landmarks is the key to successfully completing the operation. The unscrubbed surgeon is away from the operating table and therefore must depend on an experienced scrubbed assistant. Active communication between the primary surgeon, first assistant and staff is imperative. Although the learning curve for the surgeon may be short there is a substantial learning curve for the ancillary staff. Finally, the cost of the da Vinci robot is always a consideration. An initial investment of over $1,000,000 and subsequent running costs of $80,000 to $100,000 a year may not make this procedure feasible at many centers.Robotic surgery in pediatric urology is an evolving technique. The computer-assisted system has introduced smaller instruments (5mm) which are available although do not provide any added advantage in efficiency, primarily due to their design and the monocular lens system. Another improvement in design is the addition of a fourth arm which can be applied as a retractor and developing a smaller robot with better maneuverability while docking. As the technology continues to get better, the efficiency of the robotic system is likely to improve and offer the means to overcome impediment in children. Animal studies demonstrate robotic assistance can increase the applicability of minimally invasive surgery to complex procedures in children and neonates; however,To further determine the role of robotics in performing ureteric reimplantation in children, rigorous prospective research is needed that combines surgical and technical outcomes with overall subjective or cosmetic outcome and economic analysis.Laparoscopic surgery has gradually made its place in surgically dealing VUR. Laparoscopic and robot-assisted extravesical and intravesical surgeries have shown good early results.1921 It h1910The future of transvesical and extravesical minimally invasive procedures in children is promising and should be most interesting to follow over the next five to 10 years. Progress in the area of transvesical and extravesical surgery for treating vesicoureteral reflux in children will be made as more and more surgeons take up these procedures by laparoscopy and also by robot-assisted procedure with future innovations in robotic instruments."}
{"text": "Genetic screens, where the effects of modifying gene function on cell behaviour are assessed in a systematic fashion, have for some time provided useful information to those interested in disease pathogenesis and treatment. Genetic screens exploiting the phenomenon of RNA interference (RNAi) are now becoming commonplace. This article explains the different RNAi screen formats and describes some of the applications of RNAi screening that may be pertinent to the research pathologist. Put simply, experimental RNAi allows the research scientist to assess the function of a gene or protein by silencing its expression using synthetic RNAs or plasmids (an effect often referred to as \u201cknockdown\u201d). This technique exploits a physiological mechanism that represses gene expression by causing the degradation of protein-coding messenger RNA (mRNA) transcripts. In mammalian cells, physiological RNAi is primarily mediated by non-protein-coding RNA transcripts, known as microRNAs (miRNAs) . miRNAs Caenorhabditis elegans. In this context, dsRNA is processed into siRNA by an enzyme, Dicer.2In 1998, Mello and Fire demonstrated that potent gene silencing could be experimentally induced by injecting double-stranded (ds)RNA into the nematode The experimental use of synthetic siRNAs and shRNA plasmids has profoundly changed the way in which the loss of function of particular genes or proteins is studied. Previously, techniques that were either more time consuming, such as gene targeting , or capricious, such as antisense RNA, were used. Alternatively specific inhibitors of a particular protein could be used, but these are limited in scope. Now RNAi reagents can be purchased and trivially used to silence almost any gene in the genome.www.dharmacon.com), but if long-term silencing is required, shRNA expression constructs are more often the solution. These constructs express miRNAs or shRNAs that are processed by the target cell\u2019s own RNA-processing machinery into siRNA, which in turn mediate gene silencing. These constructs come in a variety of formats and can be purchased either as simple plasmids or as viral constructs that are easier to deliver to a wider range of cell lines. shRNA vector-based reagents can provide long-term, stable gene silencing, as the vectors used are able to integrate into genomic DNA and are thus copied along with cellular DNA. Although the inherent instability of some of the initial viral systems used to express shRNA limited their utility, this problem has now been addressed in the most recent versions that are available from commercial suppliers. One of the more recent advances in shRNA construct design has been the use of vectors that express miRNAs instead of shRNAs. It is proposed that, as this process more closely mirrors the mechanism by which endogenous mammalian miRNAs mediate gene silencing, it leads to an improvement in silencing efficiency.in vivo RNAi screens in whole animals, as opposed to in vitro screens in cultured cells. Already, individual genes can be targeted in mice using RNAi,7As described above, the types of RNAi reagents fall into two main categories, siRNAs and shRNA expression constructs. et alsiRNAs and shRNA expression constructs are now available as libraries that contain reagents targeting any number of genes. Depending on the application, RNAi reagents targeting a single gene, a particular gene subset, for example protein kinases, or indeed the entire genome may be purchased. The commercial availability of such reagents now means that a number of genes can be screened simultaneously, and relatively straightforwardly, for their involvement in a chosen biological phenotype. The format of how such a screen is performed is largely determined by the choice of RNAi reagent. Both shRNAs and siRNAs are well suited to \u201cone gene per well\u201d screens  where ceThe scale of whole-genome screens that involve the use of hundreds of multi-well plates can often be daunting. Given this, an alternative approach is to use shRNA-expression constructs in \u201cpooled\u201d screens . Here, pRNAi, RNA interference. The process by which RNAs that encode proteins (messenger RNAs (mRNAs)) are degraded in a sequence-specific manner by binding to a short interferring RNA.siRNA, short interfering RNA. The RNA species that binds mRNA in the RNA-induced silencing complex (RISC). The mRNA/siRNA interaction activates the nuclease activity of RISC, leading to degradation of the mRNA.shRNA, short hairpin RNA. A siRNA precursor, encompassing a \u201cstem\u201d and a \u201cloop\u201d structure formed by base pairing between short regions of the RNA sequence (these form the \u201cstem\u201d) separated by a short sequence that does not form base pairs (which forms the \u201cloop\u201d).microRNA (miRNA), a non-protein-coding RNA species. One of the known functions of miRNAs in mammalian cells is in RNA interferencepooled/non-pooled screens. In non-pooled screens, RNAi reagents targeting one gene are introduced into a single-cell population. Non-pooled screens are normally carried out in multi-well plates, with each well representing RNAi reagents targeting one gene. In pooled screens, RNAi reagents targeting a number of genes are introduced into the cell population at the same time.Infection, the process by which DNA, packed within a viral coat, is introduced into cells. DNA-encoding miRNAs or shRNAs can be packaged as virus and infected into cells.Transfection, the process by which \u201cnaked\u201d or non-virally packaged DNA is introduced into cells. Normally this is achieved by binding DNA to a lipid; the resultant lipid sphere binds to and merges with the target cell\u2019s plasma membrane, releasing the DNA into cells.C elegans and Drosophila melanogaster to take up long dsRNAs by feeding or soaking methods, eliminating the requirement for expensive transfection reagents. Recent studies indicate that many results from RNAi screens in model organisms translate to humans.The commercial availability and relative ease of use of RNAi libraries now means that most research labs are able to perform an RNAi screen, be it genome wide or targeting a smaller gene subset. Given this, it is worth describing the major issues that should be considered before embarking upon such an enterprise. As with any well thought out experiment, the screen assay to be measured must carefully reflect the clinical, pharmacological or biological question. The assay system must also be robust, reproducible and affordable. Most laboratories use human tumour cell lines for RNAi screens, as these can be routinely grown and transfected but, depending on the phenotype examined, the use of a non-human model system might be considered. The biggest advantage is cost, which can be significantly lower in model organisms because of the ability of Positive controls can be used to define the magnitude of change that is thought to constitute a meaningful biological effect and verify that the screen is returning valid biological data. They also provide biologically relevant thresholds for identifying positive hits from a screen. Comparison of positive and negative controls also allows the screening window coefficient or Z factorOnce decisions have been made on the factors described above, a typical screening strategy is as follows. Firstly, experimental parameters need to be optimised. Probably, the best place to start is to ensure that high-efficiency transfection or infection can be achieved in the format (multi-well plate or other) that is to be used for the screen. Ideally, one is looking for transfection/infection conditions that enable efficient delivery of the RNAi reagent without causing excessive, non-specific toxicity. One simple trick for assessing RNAi delivery parameters is to transfect or infect cells with RNAi reagents that silence genes that are essential for cell viability and compare cell death with control transfected cells. In human tumour cells, RNAi reagents targeting Polo-like kinase 1 are often used for this purpose, as knocking down this kinase consistently kills most cancer cells.et al.It is also absolutely vital to consider the analysis of screen data before embarking upon the screen itself. Perhaps one of the best methods of screen analysis has been described by Boutros Once the screen and data analysis are performed, it is often common to perform a secondary screen using only the control RNAi reagents and those silencing the \u201chits\u201d identified in the screen. Subsequent to this technical validation, it is necessary to eliminate the possibility of off-target effects, ie, effects that are due to silencing of genes other than the intended targets. Although silencing of genes via RNAi requires high complementarity to the target mRNA, off-target effects may require considerably less, in a similar fashion to the microRNA machinery. A 7\u20138-nucleotide \u201cseed\u201d region at the 5\u2032 end of the anti-sense strand is most critical in generating off-target effects, particularly when this seed region occurs in the 3\u2032 untranslated region of a potential off-target gene.www.ingenuity.com). However, it must be noted that this approach is only as good as the quality of the data in the pathway or interaction database that is used. Furthermore, this approach to validation is perhaps only appropriate for whole-genome RNAi screens, as particular gene subset screens may already be biased towards particular pathways.Validating individual hits from a screen can often be a more time-consuming and expensive enterprise than the screen itself. Given this, one may choose to use a more rapid approach that exploits the improvements in bioinformatic analysis that are now available. For example, one can now take the list of \u201chit\u201d genes from a RNAi screen and subject this list to some form of pathway analysis; where a number of hits from the screen fall into the same biological pathway, or indeed have a well-established physical or function interaction, one has some confidence that the effects are real. To achieve this, one has the option of using many of the pathway analysis tools that are publicly available or even the commercial tools such as Ingenuity (RNAi screens are now becoming part of everyday technology used in the research laboratory.There are a number of ways to use this technology based on the type of question asked and the scale of the undertaking.RNAi technology has the potential to dissect basic biological phenotypes, as well as providing insight into clinically relevant questions.As the reader will see below, RNAi screens represent more of a research tool rather than an application that could be used in the diagnostic laboratory. Nevertheless, individual RNAi reagents, rather than RNAi libraries and screens, do serve one obvious application for use in the diagnostic laboratory. The ability of RNAi reagents to knockdown the expression of specific proteins makes them ideal for the validation of antibodies that are to be used in diagnostic tests. For example, cells transfected with siRNAs targeting one gene/protein, when compared with control-transfected cells, serve as ideal controls for identifying the optimal conditions for the use of an antibody.Where RNAi screens are involved, the interest to the pathologist is their utility in the dissection of basic cellular pathways, but also in more translational areas such as identifying novel therapeutic approaches and mechanisms of drug resistance. To illustrate this, we present a number of \u201ccase reports\u201d describing a selection of the more pertinent RNAi screens.Flaviviruses, such as West Nile virus, represent a significant risk to human health. To understand what determines whether a cell can be infected with West Nile virus, Krishnan and colleagues5q-syndrome, a subtype of myelodysplastic syndrome, is characterised by a defect in erythroid differentiation and, as the name suggests, is thought to be caused by haploinsufficiency of one gene or a number of genes located within a 1.5-megabase region of chromosome 5q. To identify the causative defects in this syndrome, Ebert and colleaguesPIK3CA, conferring resistance to trastuzumab. Significantly, this RNAi screen suggests that analysis of the PI3K pathway may provide biomarkers to predict the likelihood of patient response to trastuzumab treatment.Many RNAi screens have been carried out with the aim of exploring the mechanism of resistance to chemotherapeutic drugs. For example, we recently used an RNAi screen to identify novel determinants of response to the commonly used breast cancer therapy, tamoxifen.Although RNAi technology is still evolving, it is also now suitably mature that RNAi screens are now becoming part of the everyday armoury of the research laboratory. Hopefully, we have shown you that there are a number of different ways to use this technology, primarily based on the type of question one has and the scale of the undertaking that one wishes to perform. Nevertheless, it is certainly becoming clear that this technology has the potential to allow the pathologist to not only dissect basic biological issues but also questions of a more translational bent."}
{"text": "One must demand an accurate, safe, radiation-free, and noninvasive method for reflux examination as the ideal possibility for reflux screening. Of course the available different imaging modalities are far from this ideal situation, but minimal radiation exposure is indeed a permanent objective. Additionally since all of these studies might be quite stressful to the child and the family, a specially designed and equipped environment is obligatory for the comfort of all involved. An absolute ideal modality in the diagnosis of VUR would be the definition of a certain marker in serum or urine that could identify children with VUR without the need for any interventional screening modality. Therefore more and more efforts have to be made in the future to investigate different markers for this purpose. Since reflux is one of the most frequent congenital conditions pediatric urologist have to deal with potential risks that might lead to renal insufficiency, noninvasive and radiation-free modalities should become the methods of choice, hopefully in the near future. Differentimaging modalities for evaluating vesicoureteral reflux (VUR) are nowadaysavailable and more and more attention is paid to concerns about radiationsafety, especially when multiple imaging studies are necessary with repeatexposition to ionizing radiation during a conservative follow up. Minimalradiation exposure is now a permanent objective.Experienceand logistic availability are often responsible for choosing the one or theother imaging study. Moreover, patient age, gender, race, and parentalpreference and anxiety about invasiveness and radiation exposure play anadditional role as well.Inthe past years, different innovative techniques like low-dose fluoroscopy havedefinitively decreased radiation dose to the patient. On the other hand,diagnostic quality images are mandatory for appropriate diagnosis andtreatment. Ultrasonography, nuclear medicine, and magnetic resonance arepreferred to intravenous urography and computed tomography whenever possible.In general, voiding cystourethrography has frequent indications in pediatricurology and efforts are made to replace it by radionuclide cystograms orsonocystograms in order to reduce the exposure to ionizing radiation.Furthermore,there is also no consensus about the timing of evaluation for possible refluxas well as in the conservative follow up or after intervention.Allthese three modalities can be used to demonstrate the presence or absence ofVUR. Voiding cystourethrograpy (VCUG) as well as direct radionuclidecystography (RNC) are invasive diagnostic tools with the need for patientpreparation and catheterization and the exposition of the patient to ionizingradiation although VCUG is a fluoroscopic examination and RNC a nuclearmedicine study, respectively. Additionally, an indirect RNC with theintravenous administration of technetium-99m-labeled diehtylenetriaminepentaacetic acid is a possible tool with the assumption of a possible VUR whenradioisotope counts increase in the renal areas after voiding. But the falsenegative rates may vary between 22 to 51% [Eventhough being invasive as well since catheterization is mandatory, the bigadvantage of performing a sonocystography is the prevention of any ionizingradiation to the patient at all.Fora conventional VCUG, a water soluble contrast medium is instilled into thebladder after preparation and transurethral sterile catheterization. An optionis the suprapubic administration of the contrast, but still invasive. Differentfluoroscopic images are taken to demonstrate the presence or absence ofvesicoureteral reflux.Thesame procedure (preparation and catheterization) is necessary for performing anRNC. Usually technetium 99m pertechnetate is the radiopharmacon of choice to beinstilled into the bladder. The radioactive emissions are continuously recordedwith a gamma camera.Whencomparing these two wide spread diagnostic modalities, the big advantages of aclassical VCUG are the provision of high-resolution images with a clearevaluation of the bladder wall, the urethra especially in males ,any sigAlthoughrecent improvements introducing low-dose fluoroscopy techniques and pulsefluoroscopy with the add of digital enhancing modalities have decreased theradiation dose to the patients dramatically \u20135,stillOnthe other hand, a direct RNC allows continuous monitoring for VUR throughoutthe whole examination time without any additional radiation introduced.Therefore, some authors prefer RNC to be more sensitive in the diagnosis of VUR althoughThemain advantage of RNC over fluoroscopic VCUG is definitively decreasedradiation exposure of the patient. The average effective radiation dose of aVCUG using low-dose fluoroscopy is around 3 mrem, compared to 0.5 mrem for anRNC. Of course the average effective dose of the VCUG is variable and dependson the patient size, operator, and machinery . The senSonocystographymay be used as a very sensitive tool in the detection of a possible VURespecially since the intervention of various ultrasound echo enhancing agents. First, Onemust demand an accurate, safe, radiation-free, and noninvasive method forreflux examination as the ideal possibility for reflux screening. Additionally,since all of these studies might be quite stressful to the child and the familya specially designed and equipped environment is obligatory for the comfort ofall involved. Preparation and education of the families help to reducediscomfort. If needed, sedation with the use of midazolam can be beneficialwithout any negative influence on the outcome of the examination .Contrastenhanced ultrasound allows an accurate and safe diagnosis and is in addition toVCUG and RNC radiation free as well; but unfortunately, still an invasiveprocedure with the insertion of a catheter. A future prospective might be anexogenous bubble generation to fulfil one of the most important criteria inreflux diagnosis: being noninvasive. Efforts are already being made to achievethis goal. Till then nuclear medicine studies and contrast studies will remainessential for the evaluation of VUR.2, urinary \u03b22-microglobulin,urinary interleukin levels, and serum endothelium leukocyte adhesion moleculehave been shown to be elevated in patients with VUR compared to controls. Sofar, none of these methods can localize which kidney is affected by reflux norcan they assess the grade but they probably offer the potential advantage ofrapidly screening for VUR.Anabsolute ideal modality in the diagnosis of VUR would be the definition of acertain marker in serum or urine that could identify children with VUR. Basicresearch is going on to investigate different markers that have been found tobe elevated in children with VUR . Measure\u03b2-hexosaminidase, has been shown to be higherin patients with VUR and renal scarring [Anothermarker, scarring . Tamm-Hoscarring . Interesscarring . Stilla"}
{"text": "PGC-1\u03b1 deficiency in an atherosclerotic mouse model.Atherosclerosis is a chronic inflammatory disease that evolves from the interaction of activated endothelial cells, macrophages, lymphocytes and modified lipoproteins (LDLs). In the last years many molecules with crucial metabolic functions have been shown to prevent important steps in the progression of atherogenesis, including peroxisome proliferator activated receptors (PPARs) and the class III histone deacetylase (HDAC) SIRT1. The PPAR\u03b3 coactivator 1 alpha (Ppargc1a or PGC-1\u03b1) was identified as an important transcriptional cofactor of PPAR\u03b3 and is activated by SIRT1. The aim of this study was to analyze total \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE and \u2212/\u2212 PGC-1\u03b1+/+ApoE mice kept on a high cholesterol diet. Despite having more macrophages and a higher ICAM-1 expression in plaques, \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE did not display more or larger atherosclerotic plaques than their \u2212/\u2212 PGC-1\u03b1+/+ApoE littermates. In line with the previously published phenotype of \u2212/\u2212PGC-1\u03b1 mice, \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE mice had marked reduced body, liver and epididymal white adipose tissue (WAT) weight. VLDL/LDL-cholesterol and triglyceride contents were also reduced. Aortic expression of PPAR\u03b1 and PPAR\u03b3, two crucial regulators for adipocyte differentitation and glucose and lipid metabolism, as well as the expression of some PPAR target genes was significantly reduced in \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE mice. Importantly, the epididymal WAT and aortic expression of IL-18 and IL-18 plasma levels, a pro-atherosclerotic cytokine, was markedly reduced in \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE mice.To investigate if total PGC-1\u03b1 deficiency affects atherosclerosis, we compared \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE mice, similar as \u2212/\u2212PGC-1\u03b1 mice exhibit markedly reduced total body and visceral fat weight. Since inflammation of visceral fat is a crucial trigger of atherogenesis, decreased visceral fat in PGC-1\u03b1-deficient mice may explain why these mice do not develop enhanced atherosclerosis. Atherosclerosis is a chronic inflammatory disease that results from interaction between activated endothelial cells, modified low-density lipoproteins (LDL), monocyte-derived macrophages, T cells, and the vessel wall. Activated endothelial cells express adhesion molecules that attract and recruit blood monocytes and lymphocytes. Upon binding to the endothelial layer, these monocytes transmigrate into the subintimal space, and differentiate into macrophages. Plaque macrophages interact with lymphatic cells, mainly T cells, ingest modified LDL via scavenger receptors and become foam cells, thereby promoting plaque formation PGC-1\u03b1 was the first described member of the small PGC-1 family of coactivators The phenotype of PGC-1\u03b1 knock-out mice underlines the central role of this transcription cofactor in homeostatic control of metabolism: they are leaner than wild-type (WT) littermates, have markedly reduced body fat content, and are resistant to diet-induced obesity, hence protected from developing insulin resistance and impaired glucose tolerance in vitro has been shown to prevent reactive oxygen species (ROS) production and NAD(P)H oxidase activity, with subsequently reduced NF-\u03baB activity and lower expression levels of MCP-1 and VCAM-1 in vitro and improved endothelial dysfunction in aortic rings ex vivoOverexpression of PGC-1\u03b1 in human aortic smooth muscle and endothelial cells The following studies suggest a link between PGC-1\u03b1 and atherogenesis at the clinical level: Xie et al. reported a correlation between PGC-1\u03b1 polymorphism and hypertension PGC-1\u03b1 deficiency on atherogenesis by comparing \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE and \u2212/\u2212 PGC-1\u03b1+/+ApoE mice.Thus, we investigated the effects of \u2212/\u2212PGC-1\u03b1 with \u2212/\u2212ApoE mice, and compared 20-week old male \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE and \u2212/\u2212 PGC-1\u03b1+/+ApoE mice that were kept on a high-cholesterol diet for 12 weeks. Histomorphometry of thoraco-abdominal aortae stained with Oil-Red O (ORO) revealed no difference in atherosclerotic plaque area between \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE and \u2212/\u2212 PGC-1\u03b1+/+ApoE mice , Cebpa (C/EBP-\u03b1), Fabp4 (aP2), Fasn (Fatty acid synthase), Fatp1 (Fatty acid transport protein 1), Lipe (Hormone-sensitive lipase), Lpl (Lipoprotein lipase), LXR-\u03b1 (Liver X receptor \u03b1), Pck1 (Phosphoenolpyruvate carboxykinase 1), and Ucp1 (Uncoupling protein 1). Expression of Cebpa, Fabp4, Pck1, and Ucp1 was significantly lower in \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE compared to \u2212/\u2212 PGC-1\u03b1+/+ApoE mice, while the expression of Fasn showed the same trend and mRNA levels of Adipoq, Fatp1, Lipe, Lpl, and LXR-\u03b1 did not differ (PPAR\u03b1 and PPAR\u03b3 expression and function may at least in part be suppressed in \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE mice.Peroxisome proliferator activated receptors (PPARs) are important regulators of adipocyte differentiation as well as lipid metabolism and inflammation and their transcription is regulated by PGC-1\u03b1 \u2212/\u2212 mice , whereas\u2212/\u2212 mice . To examt differ . These d\u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE and \u2212/\u2212 PGC-1\u03b1+/+ApoE mice. While expression of Adipoq, Nampt (Nicotinamide phosphoribosyltransferase), Retn (Resistin), IL-6, IL-10, TGF-\u03b2, MCP-1, IFN-\u03b3, Agt (Angiotensinogen), 11\u03b2-HSD1 (11-beta-hydroxysteroid dehydrogenase 1), TNF\u03b1, and Lpl was only mildly reduced or unchanged, the expression of leptin, Rarres2 (chemerin), Serpine1 (PAI-1), and IL-18 was lower, and expression of complement factor D (Cfd or adipsin) higher in \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE compared to \u2212/\u2212 PGC-1\u03b1+/+ApoE epididymal WAT  in atherosclerotic lesions IL-18 and SR-PSOX/CXCL16 mRNA levels were reduced in \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE mice, while IFN-\u03b3 expression did not differ between the two genotypes , Serpine1 (PAI-1), and IL-18 in visceral adipose tissue could be sufficient to avoid increased atherogenesis. Rarres2 is associated with white adipose tissue inflammation and promotes mobilization and chemotaxis of dendritic cells and macrophages Reduced expression of PAI-1-deficient mice showed attenuated neointima formation after perivascular cuff-induced injury PAI-1 overexpression prevented the development of abdominal aortic aneurysm PAI-1 is an anti-fibrinolytic enzyme and has beneficial and deleterious effects in atherogenesis. For example, \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE mice was observed for IL-18. IL-18 is a pro-atherogenic cytokine: Overexpression of IL-18 binding protein and direct injection of recombinant IL-18 accelerate atherogenesis, whereas IL-18 deficiency diminishes plaque formation in \u2212/\u2212ApoE mice \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE mice. It is conceivable that the lower expression of IL-18 alone is sufficient to avoid an acceleration of atherogenesis in our \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE mouse model.The lowest expression of the tested cytokines in the visceral WAT of \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE mice. However, protein levels of the soluble form of SR-PSOX/CXCL16 in plasma did not differ between \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE and \u2212/\u2212 PGC-1\u03b1+/+ApoE mice, suggesting that the proteolytic cleavage of this chemokine is not affected in \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE mice.Interestingly, IL-18-mediated increase of atherosclerosis is accompanied by elevation of SR-PSOX/CXCL16 expression Cfd encodes adipsin, the mouse homolog of human complement factor D, which is a serine protease that cleaves factor B in the alternative complement pathway, and it is secreted at high levels in adipose tissue adipsin was higher in \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE compared to \u2212/\u2212 PGC-1\u03b1+/+ApoE mice. Expression of adipsin and other components of the alternative complement pathway correlate with atherosclerosis \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE provides a pro-atherogenic contribution.\u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE mice. Further studies using tissue-specific PGC-1\u03b1 knockout or overexpression will be necessary to address these questions in more detail.Atherosclerosis is a disease combining the complexity of lipid/lipoprotein and inflammatory/immune disorders \u2212/\u2212ApoE C57BL/6 \u2212/\u2212PGC-1\u03b1 C57BL/6 \u2212/\u2212 PGC-1\u03b1\u2212/\u2212ApoE mice and \u2212/\u2212 PGC-1\u03b1+/+ApoE littermates. Of those, male mice were fed a high-cholesterol diet  for 12 weeks starting at the age of 8 weeks. Mice were weighted before being sacrificed, and biopsies of aortae, heart, liver, spleen, brown and white adipose tissue, and pancreas frozen in liquid nitrogen or OCT  for later analyses.All animal procedures were approved by the local animal committee  and performed in accordance with our institutional guidelines.en face analysis. Collagen, fibrous cap thickness, and necrotic core size were analyzed on Elastica van Gieson (EVG)-stained cryosections of the aortic sinus as described 5 mm serial cryosections from the aortic sinus were stained with rat anti-CD68, rat anti-CD3 (Abcam), rat anti-VCAM-1 (BD Biosciences), rat anti-ICAM-1 (Serotec), or oil-red O (ORO). Thoraco-abdominal aortae were fixed with 4% paraformaldehyde and plaques stained with ORO for Total RNA isolated from proximal aortae was extracted with TRIZOL (Invitrogen), reverse transcribed with Ready-To-Go You-Prime First-Strand Beads , and the cDNA (n\u22659 per genotype) quantified by qPCR using SYBR Green JumpStart Taq ReadyMix (Sigma-Aldrich). Primer sequences can be found in the supplemental Quantification of IL-18 and CXCL16 in plasma of mice where performed with Mouse IL-18 Platinum ELISA kit (Bender MedSystems) and Mouse CXCL16 ELISA kit (RayBiotech) according to the manufacturers instructions. Plasma was diluted 1\u22362 for the IL-18, and 1\u223632 for the CXCL16 ELISA assay.Total plasma cholesterol and triglycerides were quantified using Infinity Cholesterol TR13421 and Infinity Triglycerides TR22421 (Thermo Electron Cooperation), respectively. The lipid distribution in plasma lipoprotein fractions was assessed by fast-performance liquid chromatography gel filtration with a Tricorn Superose 6 10/300 GL column  en face ORO quantification was analyzed using a non-parametric Mann-Whitney U t-test. Statistical significance of differences of all other experiments was calculated using an unpaired Student's t-test. Significance was accepted at the level of p<0.05.Data are presented as mean \u00b1 SEM. The Table S1Primer sequences.(0.08 MB PDF)Click here for additional data file."}
{"text": "Vertebrate brains are composed of two hemispheres that receive input, compute, and interact to form a unified response. How the partially different processes of both hemispheres are integrated to create a single output is largely unknown. In some cases one hemisphere takes charge of the response selection \u2013 a process known as metacontrol. Thus far, this phenomenon has only been shown in a handful of studies with primates, mostly conducted in humans. Metacontrol, however, is even more relevant for animals like birds with laterally placed eyes and complete chiasmatic decussation since visual input to the hemispheres is largely different.Columba livia) were trained with a color discrimination task. Each hemisphere was trained with a different color pair and therefore had a different experience. Subsequently, the pigeons were binocularly examined with two additional stimuli that combined the positive color of one hemisphere with a negative color that had been shown to the other, omitting the availability of a coherent solution and confronting the pigeons with a conflicting situation. Some of the pigeons responded to both stimuli, indicating that none of the hemispheres dominated the overall preference. Some birds, however, responded primarily to one of the conflicting stimuli, showing that they based their choice on the left- or right-monocularly learned color pair, indicating hemispheric metacontrol.Homing pigeons (We could demonstrate for the first time that metacontrol is a widespread phenomenon that also exists in birds, and thus in principle requires no corpus callosum. Our results are closely similar to those in humans: monocular performance was higher than binocular one and animals displayed different modes of hemispheric dominance. Thus, metacontrol is a dynamic and widely distributed process that possibly constitutes a requirement for all animals with a bipartite brain to confront the problem of choosing between two hemisphere-bound behavioral options. Since the pioneering study of Broca in the nineteenth century, it is widely known that each of the two cerebral hemispheres processes and computes information differently. As outlined below, several studies report that this asymmetrical organization can be accompanied by unilateral control over a task. In this case, the performances under bilateral viewing are similar to the performances of a single hemisphere, and different from the performances of the other half-brain. The choice mechanism that determines which hemisphere will dominate the task is known as metacontrol Both left hemisphere (LH) metacontrol, meaning left hemisphere control over the task, and right hemisphere (RH) metacontrol were observed in humans Metacontrol has been shown in healthy humans To our knowledge, apart from humans, metacontrol was examined only in monkeys Columba livia) in a simple color discrimination task that these birds master quickly, and for which there are little or no hemispheric differences Both humans and macaques have frontally placed eyes that have a single fovea. Foveated objects are perceived by both hemispheres. Since primates produce a very high amount of eye movements, both half-brains see the majority of objects in the front of the animal. Conflicting and response-demanding input into the hemispheres is therefore not a major problem as long as stimuli are foveated. This is radically different for most birds. All birds have a virtually complete crossing of their optic nerves, transmitting visual input to the contralateral hemisphere 14 pigeons were the subjects of this study. Five were na\u00efve and the rest had participated in former, unrelated, experiments. The birds were housed individually in a room with other conspecifics and placed on a 12/12h light/dark cycle. They were kept at 80\u201390% of their free feeding weight. Food was provided during the experiment and after experimental sessions. Water was freely available in their home cages throughout the experimental period. The pigeons were trained on average 6 times a week.The experiment was conducted according to the specifications of the German law for the prevention of cruelty to animals and hence, the European Communities Council Directive of 24 November 1986.2, Philips), with a resolution of 1024\u00d7768 Pixels. Pecking correctly on the pecking key reinforced the pigeons with the activation of the feeder. Experimental sessions and data collection were controlled by a Pentium PC running MATLAB  and a partial pre-version of Biopsy Toolbox The experiment was conducted in a 33(w)\u00d734.5(d)\u00d736(h) cm custom made Skinner box. The box was equipped with a house light on the side panel, a centered feeder containing mixed grains , a feeder light located above the feeder that was lit simultaneously with the feeder activation. Additionally, a centrally located transparent pecking key was located on the front panel, with its upper right corner being located 14(w)\u00d77.5(h) cm from the upper right corner of the Skinner box. Through the pecking key, the pigeons viewed the 5(w)\u00d72.8(h) cm stimuli that were presented on a TFT LCD monitor (Brilliance 150PThe stimuli used were 5(w)\u00d72.8(h) cm rectangles. Training stimuli were half colored: the Red and Green stimuli were colored in their upper half, while the Cyan and Magenta stimuli were colored in their lower half . For sevTest stimuli were a combination of a Go training color with a NoGo belonging to the other color pair, i.e. Red-Magenta or Green-Cyan . The tesThe five na\u00efve pigeons were autoshaped to peck on a lighted pecking key (white square) in a standard autoshaping procedure containing 40 trials. The white square was presented for 5 seconds followed by 3 seconds of food access. After the pigeons started to respond to the pecking key, they were trained with a continuous reinforcement schedule. Subsequently, the pigeons were progressively trained with variable ratio , fixed interval  and variable interval  schedules. Each schedule proceeded until the pigeons responded correctly to more than 85% of the trials in two consecutive sessions. Each session contained 40 trials. Afterwards, they were monocularly trained in a VI20 schedule, in order to make them familiar with wearing and working with an eye cap. The other nine pigeons were already familiar with the Skinner box and the eye caps.Monocular viewing was made possible using eye caps. A velcro ring was fixed to the skin around the eyes using non-toxic glue. A cap could be attached to the ring, blocking the view of this eye and thus the contralateral hemisphere. The pigeons were adapted to the caps prior to the monocular testing sessions by wearing them in their home cages. The animals wore a cap for about 25 minutes before each testing session.A Go-NoGo task was used to teach the pigeons the discrimination. The schedule used was similar to the one used by Yamazaki et al. As the pigeon optic nerve decussates virtually completely at the optic crossing, each hemisphere can be tested separately by occluding one eye Four pigeons were trained in a Red/Green (Go/NoGo) color discrimination with the left hemisphere and a Cyan/Magenta discrimination with the right hemisphere.Four pigeons were trained in a Green/Red discrimination with the LH and a Magenta/Cyan discrimination with the RH.Three pigeons were trained in a Cyan/Magenta discrimination with the LH and a Red/Green discrimination with the RH.Three pigeons were trained in a Magenta/Cyan discrimination with the LH and a Green/Red discrimination with the RH.Each of the two hemispheres was tested alternately.The discrimination criterion was rho\u2265.9 in two out of three consecutive sessions, for both hemispheres.The test stimuli were either Go-color learned by the left hemisphere combined with a NoGo-color trained by the right hemisphere (LH-Go & RH-NoGo), or a Go-color trained by the right hemisphere combined with a NoGo-color trained by the left hemisphere (LH-NoGo & RH-Go).The binocularly seeing test sessions contained six stimuli: the four monocularly-learned stimuli: LH-Go (the Go-color learned by the LH), LH-NoGo (the NoGo-color learned by the LH), RH-Go and RH-NoGo, as well as the two critical test stimuli: LH-Go combined with RH-NoGo and RH-Go combined with LH-NoGo ((LH-Go & RH-NoGo) and (LH-NoGo & RH-Go), respectively). Each of the six stimuli appeared 8 times. The stimuli were presented in a random order that was changed among the pigeons. Test stimuli were not reinforced.The rho value was used to index performances Laterality index indicated if binocularly there was a performance difference between the LH-learned and the RH-learned color information. It was measured using the rho values obtained from the binocular discrimination of the monocularly\u2013learned color pairs.The The laterality index was calculated by the following formula:Dominance index indicated the type of hemispheric interaction during the conflicting situation. The dominance index was computed by the following formula, using the rho values calculated from the performances with the test stimuli:rho(LHtest) is the rho value for the number of times the pigeon pecked on the test stimulus containing the Go color learned by the LH: (LH-Go & RH-NoGo) relative to the number of pecks on the other test stimulus containing the Go color learned by the RH: (RH-Go & LH-NoGo).The rho(RHtest) is the rho value for the number of times the pigeon pecked on the test stimulus containing the Go color learned by the RH (RH-Go & LH-NoGo) relative to the number of pecks on the test stimulus containing the Go color learned by the LH (LH-Go & RH-NoGo).Bootstrap analysis was further performed to determine the likelihood of receiving the obtained dominance index values. The analysis was done for every animal separately by randomly assigning the pecks in the 16 test trials into Go and NoGo groups, for 1000 times. Following the reassignment, the distribution of dominance index value was computed, and a Z-score was used to calculate the probability of the obtained index.One sample t-test was used to calculate if the laterality index and the dominance index differ from zero. Using paired t-tests we compared the performances of the two hemispheres. A 2\u00d72 repeated measures ANOVA with the factors session (last monocular session vs. binocular session) and Hemisphere (RH vs. LH) analyzed the performances with the monocularly-learned stimuli. Pearson correlations were further used.Means values are reported in the format of mean\u00b1SEM.p\u200a=\u200a.362). Since reaching the discrimination criterion and moving to the test session depended on both hemispheres, in some pigeons the hemispheres were overtrained. Thus, overall, with the left hemisphere the pigeons were trained on average for 13.1\u00b12.6 sessions, and had 13\u00b12.6 sessions with the right hemisphere. The average performances in the last training session were rho\u200a=\u200a.971\u00b1.005 and rho\u200a=\u200a.975\u00b1.007 with the left- and the right-hemisphere, respectively. The hemispheres did not differ in their performances in the last training session (t(13)\u200a=\u200a\u2212.436, p\u200a=\u200a.670).The discrimination criterion was attained when performances reached rho\u2265.9 in two out of three consecutive sessions, for both the two hemispheres consecutively. On average, the pigeons needed 10.9\u00b11.8 sessions (ranged from 5 to 28) to reach rho\u2265.9 with the left hemisphere, and 8.7\u00b11.8 sessions (ranged from 3 to 27) with the right hemisphere. Nine pigeons achieved high performance more quickly with their right hemisphere, four with the left hemisphere, and one pigeon needed equal numbers of sessions with both hemispheres. This difference in acquisition speed was not significant (t(13)\u200a=\u200a\u22120.944, During the binocular test session the pigeons were confronted with six stimuli: the four stimuli known from the monocular training as well as the two conflict-producing stimuli that produced a Go-response in one and a NoGo-response in the other hemisphere.p\u200a=\u200a.600). Interestingly, the pigeons performed the color discrimination task better in the last monocular viewing session compared with the binocular viewing session \u200a=\u200a18.471, p\u200a=\u200a.001; pairwise comparison monocular vs. binocular performances: .088\u00b1.021, p\u200a=\u200a.001 Bonferroni corrected) \u200a=\u200a.196, p\u200a=\u200a.665).The binocular performances with the monocularly-learned stimuli were rho\u200a=\u200a.87\u00b1.036 (range: from rho\u200a=\u200a.523 to rho\u200a=\u200a1) with the color pair learned by the left hemisphere, and rho\u200a=\u200a.90\u00b1.03 (range: from rho\u200a=\u200a.625 to rho\u200a=\u200a1) with the color pair learned by the right hemisphere . The latrrected) . The perp\u200a=\u200a.520). Nonetheless, comparing the average bootstrap index of each pigeons to its measured index, as well as looking on the U value from which the rho value was obtained, showed that six pigeons exhibited significant metacontrol. Four pigeons had a significantly negative dominance index, and hence showed RH-metacontrol, whereas two pigeons showed LH-metacontrol as their dominance index was significantly positive  and (LH-NoGo & RH-Go), the pigeons were faced with a conflicting situation. For every test trial, the pigeons had to decide according to which monocularly-learned color pair, i.e. hemisphere, they would react. Hemispheric dominance was determined by the pigeons' relative choices with the two test stimuli. The pigeons showed complete distribution of hemispheric dominance, ranging from .8 to \u22121. Across the group, the hemispheric dominance was normally distributed \u200a=\u200a\u2212.661, positive .p\u200a=\u200a.004; RH: r(14)\u200a=\u200a\u2212.438, p\u200a=\u200a.117). Finally, the dominance index was approaching a significant correlation with number of monocular training sessions needed by the left hemisphere till criterion (LH: r(14)\u200a=\u200a.522, p\u200a=\u200a.055; RH: r(14)\u200a=\u200a.207, p\u200a=\u200a.472). The dominance index, however, was not correlated with the amount of overtraining sessions that occurred while a hemisphere was waiting for the other to reach criterion (LH: r(14)\u200a=\u200a.036, p\u200a=\u200a.904; RH: r(14)\u200a=\u200a. 389 , p\u200a=\u200a.170).The degree of metacontrol was correlated with the binocular discrimination of the LH-trained but not the RH-trained stimuli (LH: r (14)\u200a=\u200a.710, Metacontrol refers to the existence of a preference or choice mechanism that determines which hemisphere will control a task when the two sides of the brain are facing discrepant behavioral options In the initial training the pigeon were taught to discriminate between two color pairs, one with each hemisphere. This is an easy task for pigeons, and as shown previously As previously found in humans The half brain that has a slight advantage, either previously or due to training, seems able to take control over the task, possibly via commissural inhibition. In mammals this could be achieved with the corpus callosum. Since birds do not possess this commissure, other interhemispheric inhibitory pathways at brainstem level are obviously also able to achieve a similar function. Indeed, the intertectal commissures in birds are mostly inhibitory The lines to today's birds and mammals parted about 280 million years ago"}
{"text": "Laparoscopic extravesical ureteral reimplantation in children is currently a technically demanding procedure with sparse literature to aid in mastering the learning curve. We present our most recent technique and lessons learned after 20 cases in children 4\u201315 years of age. The literature is also reviewed to encapsulate the current state-of-the-art. Openextravesical ureteral reimplantation is a successful and well-toleratedprocedure with a proven track record in the surgical management ofvesicoureteric reflux (VUR). Nevertheless, the relentless pursuit of minimallyinvasive ideals has led to the development of alternatives. Most recently, theendoscopic injection techniques have become quite popular, but concerns remainover the success rate and long-term efficacy. Thus, the laparoscopic approach offers another option which improves onthe open procedure with better cosmesis and convalescence, while providing adurable and successful procedure compared to injection therapy.Despitemultiple reports in the early 1990s of experimental surgery in animal models and few A total of 20children aged 4\u201315 years (mean 7.3 years) have undergone laparoscopic extravesical ureteral reimplantation overa 5-year period. The subjects were mostly female (15 of 20) with 11 (55%) casesbeing bilateral. All cases were diagnosed with VUR after urinary infection andthe indication for surgery included breakthrough infection in 18 of 20 andpersistent high-grade VUR in 2 of 20.The highest gradeof reflux per patient ranged from 2 to 4, with only 1 case of unilateral grade2, that being a case of failed injection therapy. The distribution of VUR perpatient by highest grade was grade 4 in 7 patients (35%), grade 3 in 10 (50%),and grade 2 in 3 (15%). Megaureters, duplicated ureters, and neurogenicbladders were excluded initially. Previous open ureteral surgery remains anexclusion criterion. Bilateral cases areselected such that one side is not high-grade VUR, so as to minimize the riskof urinary retention. This hypothesis is based on the postulates that bladderdysfunction should not occur with unilateral extravesical dissection, and thathigh-grade VUR is a risk factor for postoperative bladder dysfunction [The postoperativefollow-up regimen includes a routine abdomino-pelvic ultrasound 1 month aftersurgery and a voiding cystourethrogram 3 months after surgery, with maintenanceof antibiotic prophylaxis until the VCUG is done. In the absence of newfindings on the first post-op ultrasound, another routine abdomino-pelvicultrasound is planned 1 year after surgery.Wefind it useful for learning purposes to divide the case into four specifictasks: 1-access, 2-uretero-vesical junction exposure, 3-detrusor tunneldissection, and 4-tunnel suturing.A 4-port approachis utilized with the patient in Trendelenburg position, legs spread apart, andthe arms tucked in at the side. A sterile Foley catheter is placed in theoperative field and controlled with a Toomey syringe. A mechanical bowelpreparation can be helpful in patients with constipation. The first port issupraumbilical, and the 3 others form an arc along the level of theanterior-superior iliac spine . The levblunt dissection adjacent to thebladder, often with the superior vesical artery coursing parallel. The assistantthen controls the ureter with a vessel loop  havehad resolution of reflux, with 2 cases refusing the post-op VCUG and 1 beinglost to follow-up. One case developed denovo contralateral grade 2 VUR. Three cases were converted to opensurgery, the first 2 cases, both bilateral, because surgical time had surpassed4 hours. Case 7 had a nonneurogenic neurogenic bladder with a severelyhypertrophied detrusor which made tunnel dissection difficult.The first 5 cases,4 of which were bilateral, can be considered the learning curve with operativetimes falling consistently below 3 hours for a unilateral case, and 5 hours fora bilateral case thereafter. Mucosal perforation remains the main determinantof operative time, in its absence the operative time averages 2 hours perureter. Mucosal perforation also remains the main determinant of hospital stay.The usual case is discharged the following day after having voided, whereasthose with suction drains remain for an extra day of observation. Three caseshave had a mucosal perforation including cases 4, 6, and 20, none of whichleaked postoperatively. There has been 1 complication, that of a distalureteral necrosis in case 5 which necessitated open revision with a Boari flap.In this case, the ureter was held on prolonged traction with a Babcock clamp,which is no longer used. None of thecases have experienced postoperative voiding dysfunction.Afew technical aspects merit greater commentary, especially where there may bedifferences with other authors. To begin, though exposure of the ureter isfastest from the bladder up to the pelvic brim, it may be helpful for the firstfew cases to mobilize the ureter from the pelvic brim caudally until one isfamiliar with the anatomical orientation of the juxtavesical ureter.Cystoscopically placed ureteral catheters are not necessary though they wereused in the first few cases to document that the ureter was not obstructed byan errant detrusor suture. The direction of the detrusorotomy should bestraight up; a medial orientation will lead to kinking of the ureter whereas alateral orientation makes for tedious dissection of the submucosal tunnel. Theinverted Y-type detrusorotomy is used sparingly so as to limit the chances ofmucosal injury. Instead, the detrusor tunnel edges are reapproximated withsutures further away from the ureterovesical junction, so as to limit ureteralobstruction by compression. If there is tension with the closure, a limited invertedY-type dissection is performed.Though all otherauthors describe the use of a single traction suture, this author believes thatthe use of 2 suspension stitches provides superior exposure of the mucosa asdissection progresses. In addition, the method of traction suture placementdeserves greater attention. Most authors describe percutaneous passage of aKeith needle into the abdomen, whereas this author passes an intracorporealsuture extracorporeally with the use of a fascial closure device. This approachpermits one to better judge the exit site of the stitch based on optimalexposure and orientation. The opposite and more commonly described approachcommits the surgeon to an exit site before one has a chance to test the effecton bladder exposure. The direction of tunnel dissection is ergonomically bestfrom the neohiatus downwards towards the ureterovesical junction.Unfortunately, this can lead to nuisance bleeding obscuring the exposure of theremaining mucosa. Ideally, one would want to dissect from the ureterovesicaljunction upwards towards the neohiatus that way the bleeding does not obscurevision, which is impossible with rigid instruments. Perhaps this is an area where the superiordexterity of the robot may be of benefit.Consideringthe multiple options for thesurgical management of VUR currently available, the indications for alaparoscopic extravesical approach are debated. The families electing to choosethis option are concerned with the success rate of injectables and the mountingevidence that the product is not durable over the long term. These familieswant a successful procedure so as to avoid multiple postoperative VCUG\u2019s or tominimize the risk of another pyelonephritis in those who have experiencedrecurrent pyelonephritis. The advantages of reduced pain and convalescence areless in the infant population such that the procedure is offered mainly toschool age children. Cosmetic considerations become more important in thepostpubertal population. As a result of this selection process, the case loadis smaller relative to the overall cohort of surgically managed VUR, which doesimpact on operative time.Havingchosen a laparoscopic approach, other considerations include whether to use atransvesical approach or an extraperitoneal approach. Though the extravesicalapproach is ideally suited to an extraperitoneal exposure, this author feelsthat the extra surgical time involved in creating the space is not warranted.When one considers that the bowel is not mobilized and that the peritonealwindow used for transperitoneal exposure is so small, it is difficult toimagine significant adhesions occurring in such a context. I have been impressed in thecases converted open at how small the peritoneal window was; in fact the boweldid not enter the wound. Likely forthese reasons, there are no published reports on extraperitoneal ureteralreimplantation, though extraperitoneal pelvic laparoscopy has been reported forvarious procedures .Thetransvesical approach with pneumobladder was first described by Okamura et al.with the technique of endoscopic trigonoplasty . This prLaparoscopicextravesical ureteral reimplantation was popularized by Lakshmanan and Fung with excNevertheless, inmost series, the occasional problem of mucosal perforation and its attendantprolonged catheter drainage persists in comparison to open extravesicalsurgery. It remains to be seen if the ergonomic advantage of robotic assistancewill be helpful in this regard. Improvements in instrumentation such as a hookelectrocautery which is shielded posteriorly and thus does not cause mucosalperforation by thermal injury would be of tremendous benefit. Furthermore,prospective experimental study of the facility of mucosal exposure at differentinsufflation pressures and different bladder filling volumes deserves greaterattention.Laparoscopicextravesical ureteral reimplantation is another option in the surgicalmanagement of vesicoureteric reflux. It offers a greater success rate anddurability compared to injection therapy, while offering cosmetic andconvalescence advantages over open surgery in the older child. The learningcurve of the procedure is reasonable and facilitated by an analysis based on 4components, namely, access, ureter exposure, tunnel dissection, and tunnelclosure. The component of tunnel dissection is the only one which could benefitfrom further improvement, likely accomplished with refinements in instrumentsor greater study of the variables which contribute to mucosal perforation."}
{"text": "Sir,Biotinidase deficiency is a rare metabolic disorder with an estimated incidence of 1:61,067 population, although severe or profound disease is much rarer .[Clinical manifestations include neurological, dermatological, immunological and ophthalmological abnormalities. BiochemiA 6-month-old male child born of nonconsanguineous marriage presented with a history of seizures from 3 months of age and was being treated with sodium valproate, but seizure control was not observed. Antenatal and natal history was uneventful. There was no family history of seizure disorders. According to the mother, the child developed normally for the first 3 months and after that was not growing normally. On examination, the child had normal neurological findings, except for hypotonia, irritability and alopecia . The chiBiotin is a cofactor required by acetyl CoA carboxylase, pyruvate carboxylase, propionyl CoA carboxylase and 3 methylcrotonyl CoA carboxylase. It is covalently attached to the apocarboxylases by the epsilon amino group of a lysine residue, where it functions at the active site as a carbon dioxide carrier in the carboxylation reactions. Biotinylation of the apocarboxylases is catalyzed by holocarboxylase synthetase in an adenosine triphosphate-dependent reaction, with the intermediate formation of biotinyl adenosine monophosphate. The turnover of carboxylases yields biotinyllysine (biocytin) from which biotin is regenerated by the action of a specific amidolyase, biotinidase. This enzyme is also required for the release of dietary protein-bound biotin.[Individual inherited disorders of all four biotin-dependent carboxylases have been reported in addition to reports of patients with simultaneous defects of all four enzymes (combined carboxylase deficiency). In a majority of patients with late-onset combined carboxylase deficiency, the underlying defect is biotinidase deficiency. The earlBiotinidase deficiency can be profound (<10% enzyme level) or partial (10-30% enzyme level). Clinical presentation depends on the severity of enzymatic defect. Profound defects usually manifest between 3 and 6 months of age, with neurological manifestations , skin manifestations  and (c) respiratory problems . Older children and adolescents may exhibit limb weakness, neurosensory hearing loss and eye problems, e.g. optic atrophy and scotomas. The present case had only seizures and alopecia. Many symptomatic children with biotinidase deficiency exhibit various neuroimaging abnormalities, e.g. cerebral edema, attenuated white matter signal, cerebral atrophy and compensatory ventricular enlargement. Neuroimaging features may improve or become normal after biotin treatment.[Laboratory findings include metabolic acidosis and abnormal organic acids in the urine, and diagnosis can be established by estimating biotidinase in the serum. Biotinidase deficiency may be detected on screening of the newborn.Biotinidase deficiency may be confused with holocarboxylase deficiency, previously called early-onset or infantile multiple or combined carboxylase deficiency, which presents early and the biotidinase level is normal.Because biotinidase deficiency can be treated readily with biotin, this disorder should be considered in children with infantile seizures, especially in the presence of other characteristic neurological or cutaneous features."}
{"text": "Our data show how mitochondrial function may be adapted in response to external stimuli, and support the concept that such adaptation is critically involved in cellular survival and in lifespan extension by calorie restriction.There is increasing evidence that longevity and stress resistance are connected, but the mechanism is unclear. We report that mitochondria are regulated in response to oxidative stress and calorie restriction through a shared mechanism involving peroxisome proliferator-activated receptor-\u03b3 co-activator 1\u03b1 (PGC-1\u03b1). We demonstrate that PGC-1\u03b1 subcellular distribution is regulated, and its transcriptional activity is promoted through SIRT1-dependent nuclear accumulation. In addition, the duration of PGC-1\u03b1 activity is regulated by glycogen synthase kinase beta (GSK3\u03b2), which targets PGC-1\u03b1 for intranuclear proteasomal degradation. This mechanism of regulation permits the rapidity and persistence of PGC-1\u03b1 activation to be independently controlled. We provide evidence that this pathway of PGC-1\u03b1 regulation occurs  Cellular response to stress generally reflects a balance between cell survival and death. Stress resistance is a measure of the cell's ability to survive under conditions that are detrimental. Manipulations that extend lifespan often increase stress resistance at the cellular level, and a number of factors that play a role in the stress response have also been implicated in longevity. It is unclear if regulation of metabolism is a feature of cellular survival or how the metabolic state of the cell influences stress resistance. Mitochondria are the key organelle in substrate utilization and energy production. Transcriptional profiling studies demonstrate that genes involved in mitochondrial energy metabolism are coordinately up-regulated in multiple tissues with calorie restriction (CR), suggesting a change in dynamic of the electron transport system and a role for this alteration in mitochondrial metabolism in the mechanisms of CR . BiochemThe transcriptional co-activator peroxisome proliferator-activated receptor-\u03b3 (PPAR-\u03b3) co-activator 1\u03b1 (PGC-1\u03b1) plays a multifaceted role in the regulation of metabolism . PGC-1\u03b1 We first examined PGC-1\u03b1 function and regulation using a cell culture model. As shown, extra copies of PGC-1\u03b1 conferred increased resistance to oxidative stress in mouse fibroblasts , in agreTo determine the cellular localization of PGC-1\u03b1, we used a strain over-expressing GFP-tagged PGC-1\u03b1. Antibodies against GFP or the N-terminal region of PGC-1\u03b1 reveal that PGC-1\u03b1 is localized both in the cytoplasm and in the nucleus . These dSIRT1 NAD-dependent deacetylase is a member of the sirtuin family that has previously been shown to play a role in the oxidative stress response . SIRT1 fPrompted by these findings, we set out to explore the immediate response of PGC-1\u03b1 to a low-intensity stress in cells that are not genetically manipulated. Under normal conditions, PGC-1\u03b1 was detected both in the nucleus and the cytoplasm. Following oxidative stress, SIRT1 and PGC-1\u03b1 accumulated in the nucleus and were colocalized . This diThe transient nature of PGC-1\u03b1 accumulation in the nucleus led us to ask how stress subsequently resets PGC-1\u03b1 distribution to the cytoplasm. There are two most likely explanations: (i) PGC-1\u03b1 is sequestered in the nucleus and, following transcriptional activation of target genes, is released back to the cytoplasm; and (ii) PGC-1\u03b1 is sequestered in the nucleus but now, following transcriptional activation, the nuclear pool is degraded, and the cytoplasmic pool is replenished by transcriptional activation of the PGC-1\u03b1 gene. To test this, we looked for evidence of nuclear degradation of PGC-1\u03b1. Subcellular fractionation revealed lower molecular weight forms and reduced levels of PGC-1\u03b1 in the nuclear pool 1 h following stress . One of In the presence of proteasomal inhibitor with subsequent exposure to hydrogen peroxide (45 min), immunofluorescent staining for PGC-1\u03b1 was further elevated, and bright intranuclear foci containing PGC-1\u03b1 were detected . The proPrior to ubiquitination and degradation, the target protein is usually \u2018tagged\u2019 by phosphorylation allowing it to be recognized by the ubiquitination apparatus. GSK3\u03b2 has been previously associated with the stress response where it regulates levels of \u03b2-catenin, and as a result, activity of the forkhead transcription factor Foxo4 . FurtherTo confirm that GSK3\u03b2 plays a role in PGC-1\u03b1 processing, we generated cells with reduced levels of GSK3\u03b2 using siRNA. In the absence of any other treatment, PGC-1\u03b1 staining is elevated 24 h after knockdown of GSK3\u03b2, and the increase is most evident in the nuclei . To testTo investigate this further, we conducted immunoprecipitaion experiments using extracts from cells grown in the absence or presence of GSK3\u03b2 inhibitor and treated with hydrogen peroxide for 15 min. Immunoprecipitation of GSK3\u03b2 coprecipitated PGC-1\u03b1, and this association was impaired in the presence of GSK3\u03b2 inhibitor . These dBased on these data, we propose a model for PGC-1\u03b1 regulation in the early response to stress . A key cin vivo in mice. Mice were exposed to the oxidative stressor paraquat, and tissue was harvested and processed for subcellular fractionation at the indicated time points  a response to increased energy demand as cellular survival pathways are induced; (ii) a change in flux of endogenous mitochondrial-derived reactive oxygen species (ROS) implemented as a protective mechanism to minimize mitochondrial damage; or (iii) the alteration in mitochondrial function is itself a secondary signal in the response to stress. While studies in isolated mitochondria indicate that increased ROS causes a decrease in membrane potential, the experiments described here differ significantly in that the cells are intact upon exposure to hydrogen peroxide retaining the possibility for extra-mitochondrial signalling and nuclear response.in vivo stress response and in CR. In exploring the relationship between SIRT1 and PGC-1\u03b1, we utilized the inhibitors nicotinamide and sirtinol. These inhibitors are not specific to SIRT1, but also influence other members of the sirtuin family , which is about 90% of the average ad libitum intake for these mice. The restricted mice were fed 58 kcal week\u22121 (a 41% reduction) from 8 weeks of age. The restricted diet was nearly isocaloric to the control diet, but was enriched in proteins, vitamins and minerals to avoid malnutrition. Under this regimen of controlled intake, animals ingest all the allocated food, and the calorie intake is precisely known. For the oxidative stress experiment, the mice were treated with paraquat  and sacrificed at 1, 3, 5 and 7 h after exposure. Tissues were collected, snap frozen in liquid nitrogen and stored at \u201380 \u00b0C until further processing by microarray or immunoblotting.Wild-type male C57B16 mice were housed under controlled, specific pathogen-free conditions at the Shared Aging Rodent Facility at Madison VA Geriatric, Research, Education, and Clinical Center. The mice were cared for in accordance with the Institutional Animal Care and Use Committee at UW Madison. To control calorie intake, the mice were housed singly and fed less than m) in serum-free media for up to 1 h. For inhibitor/viability experiments, cells were grown 1 h pre-incubation in the presence of nicotinamide , PSI proteasomal inhibitor , or 2 h pre-incubation GSK3\u03b2 inhibitor VII , Sirtinol  and JNK inhibitor II  prior to and during stress. Cell viability was determined by measuring fluorescence from cells in phosphate-buffered saline (PBS) with carboxyfluorescein diacetate  on a LS50B Perkin Elmer luminescence spectrometer  . Experiments were performed in triplicate, and values from four wells each were corrected for background fluorescence and normalized against identically treated cells without peroxide exposure. For localization and live imaging studies, cells were grown on cell-culture-treated cover slips . For protein stability experiments, cells were incubated in either PSI (10 \u00b5m) or lactacystin  for the indicated times. For mitochondrial membrane potential measurement by JC-1 staining, \u223c1 \u00d7 106 cells in triplicate were treated in the absence or presence of hydrogen peroxide 1 h and stained with presonicated JC-1  for 15 min. Cells were trypsinized, resuspended in PBS and fluorescence detected at \u03bbex527 nm and \u03bbex590 nm using Perkin Elmer LS50B.NIH3T3 cells  were cultured in Dulbecco's modified Eagle's medium with 10% foetal bovine serum and antibiotics. Transfections were performed with Lipofectamine  according to the manufacturer's instructions using pcDNA3.1 and pcDNA\u2013PGC-1\u03b1 . Clones were isolated, and expression of PGC-1\u03b1 was confirmed by Western blot. The GFP-tagged PGC-1\u03b1 was generated by polymerase chain reaction cloning the PGC-1\u03b1 cDNA from pcDNA\u2013PGC1\u03b1 into pcDNA3.1/NT\u2013GFP\u2013TOPO fusion vector (Invitrogen). Knock down of PGC-1\u03b1 or GSK3\u03b2 was performed by RNA interference using Silencer pre-designed siRNAs , and introduced into cells by electroporation using siPORT electroporation kit (Ambion). To determine sensitivity to oxidative stress, subconfluent cells were exposed to hydrogen peroxide  containing protease inhibitors (Sigma) and where indicated phosphatase inhibitors (Sigma). Proteins were detected by immunoblotting using standard techniques. Antibodies used were PGC-1\u03b1, SIRT1, lamin A, ubiquitin , GSK3\u03b2 , COX IV , GFP, MnSOD, catalase , GSK3\u03b2, phospho-GSK3\u03b2, JNK, phospho-JNK, Ac-lys , actin and tubulin (Sigma). Subcellular fractionation was performed using nuclear/cytoplasmic fractionation kit . For immunoprecipitation, 500 \u00b5g of extract was incubated overnight with control IgG or specific primary antibody; antibodies were precipitated with Protein A or Protein G Agarose beads (Santa Cruz Biotechnology). Immunoprecipitates were analysed by Western blot. Densitometric analysis was performed using NIH ImageJ software (http://rsb.info.nih.gov/ij/); cytoplasmic and nuclear band densities normalized against actin loading control and were analysed separately.Proteins from mouse tissues and cultured cells were extracted in modified RIPA buffer , with a Spot Insight Color camera  and Spot 3.3.1 software.Cellular localization was analysed by immunofluorescence using standard techniques. Following exposure to stress, cells were fixed  at the indicated times. Cells were incubated overnight in primary antibody, and cellular distribution of proteins was visualized using fluorescent-tagged secondary antibodies . For live imaging, cells were exposed to stress in media lacking phenol red, incubated in Mitotracker Red [, 300 mt-test assuming equal variance. Differences were considered statistically significant at P < 0.05.Effects of treatments were analysed by two-tailed"}
{"text": "The evaluation of children presenting with urinary tract infection (UTI) has long entailed sonography and cystography to identify all urological abnormalities that might contribute to morbidity. The identification of vesicoureteral reflux (VUR) has been of primary concern since retrospective studies from the 1930s to 1960s established a strong association between VUR, recurrent UTI, and renal cortical scarring. It has been proposed that all VUR carries a risk for renal scarring and, therefore, all VUR should be identified and treated. We will not discuss the controversies surrounding VUR treatment in this review focusing instead on a new paradigm for the evaluation of the child with UTI that is predicated on identifying those at risk for scarring who are most deserving of further evaluation by cystography. Concern for the influence of vesicoureteral reflux (VUR) on renal cortical scarring began with the recognitionthat VUR transmits bacteria to the upper urinary tract and the observation thatAPN, VUR, and renal scarring frequently coexisted in the same patient. AlthoughAPN was considered to be an ascending infection, it was mistakenly considered to alwaysresult from VUR , 2. WithSonography is appealing as a method ofevaluation following UTI; however, its ability to detect upper urinary tractabnormalities is limited. Although RBUS is noninvasive and sufficientlysensitive to evaluate collecting system dilatation, controlled trials havefound it to be less sensitive than contrast cystography and99m-Tc-dimercaptosuccinic acid (DMSA) renal scintigraphy in detecting VUR orparenchymal lesions. As much as 60% ofreflux and 50% of renal scan abnormalities noted on DMSA are routinely missedby sonography \u20136. GivenExperimental studies in the refluxingpiglet model of ascending acute pyelonephritis were conducted using stricthistopathologic criteria as the standard of reference to evaluate the truesensitivity and specificity of renal cortical scintigraphy , 10. TheThe DMSA scan was determined to behighly sensitive and reliable for the detection and localization ofexperimental acute pyelonephritis, with a sensitivity of 87 to 89 percent andspecificity of 100 percent for both. When individual pyelonephritic lesionswere analyzed, DMSA scan findings correlated with histopathological changes with an overallagreement rate of 89 to 94 percent. Those lesions not detected were microscopicfoci of inflammation not evident on gross examination and not associated withsignificant parenchymal damage. DMSA nuclearrenography has been shown to be the most accurate (96%) for the detection ofAPN as compared with gadolinium-enhanced MRI (91%), contrast CT scan (90%), andpower Doppler sonography (69%) .The clinical diagnosis of acutepyelonephritis traditionally has been made on the basis of the classic signsand symptoms of fever and flank pain or tenderness associated with pyuria andpositive urine culture. However, accurate diagnosis based solely on theseparameters is often incorrect, particularly in neonates and infants . DespiteThe critical role that infection playsin the pathogenesis of renal scarring associated with VUR was clarified byRansley and Risdon's experimental studies on the refluxing piglet model, bywhich\u2014in the face ofVUR and normal voiding pressures\u2014they showedthat renal scarring occurs only when UTI is present . While aSeveral investigators have nowevaluated the evolution of the acute inflammatory changes associated withpyelonephritis using serial DMSA renal scans \u201327. Acutattributable in part tothe increased risk of these kidneys for acute inflammatory damage at the timeof the initial infection [Despite these findings, the importanceof VUR (particularly grades III or higher) as a risk factor for renal scarringshould not be discounted. Clearly, patients with moderate and severe reflux aremuch more likely to develop acute pyelonephritic damage than children with mildor no reflux , 29. Furnfection , 28, 30.The DMSA renal scan could supplant thestandard evaluation scheme since it can better discriminate which child is atrisk for renal scarring irrespective of the presence of VUR. In this novel algorithm, a child who presentswith clinical signs and symptoms suggestive of pyelonephritis first undergoes aDMSA renal scan to detect renal inflammation. Once radiographic evidence ofrenal involvement is demonstrated, the child then undergoes cystography tosearch for VUR. This approach is supported by the following two studies.Hansson et al. retrospectively reviewed 303 children under 2years of age who presented with a first UTI (82% of whom had fever onpresentation) . VUR wasIn a follow-up study, Preda et al. prospectively evaluated290 children less than 1 year of age with UTI (79% of whom had fever onpresentation) with VCUG and DMSA renal scans . Fifty-oThis algorithm is further supported bythe observations that while clinically significant acute lesions may occur inthe presence or absence of VUR, significant renal scarring is most likely tooccur in those with gradesIII and IV VUR . Taken tThe \u201ctop-down\u201d approach also serves toreduce the overall charges for the evaluation of children with UTIs. How greata reduction depends on what estimates are used for the prevalence of patientswith VUR among children with febrile UTI, and among those with positive DMSArenal scans as well as the timing of evaluation. DMSA scans performed at alonger interval following the acute episode are less likely to demonstratepyelonephritis, as many as half of those lesions having resolved. In In our effort to identify those children who aremost at risk, we might be tempted to apply certain demographic facts to furtherminimize studies. Patient age is recognized as being a risk factor for renalscarring; younger individuals are thought to be more susceptible. Gender mayalso play a role as younger males, particularly those who are not circumcised,tend to be at greater risk for UTI as well as high grade reflux. Reflux inblacks is also less common; however the renal effects are the same as in othergroups in those who have reflux . FinallyTherefore, a negative evaluation by anymeans, whether by the traditional approach or by the \u201ctop-down\u201d approach, maynot be sufficient to exclude all children at risk. Therefore, those who presentwith recurrent febrile UTI deserve further attention. We, therefore, recommend that a prudentapproach includes DMSA renal scans for all children with febrile UTI, ideallyas close to the acute episode as possible. Those with positive scans shouldundergo cystography. If VUR is identified, the clinician should then formulatean appropriate treatment plan depending on various factors such as likelihoodof VUR resolution, likelihood of renal scarring, taking into considerationparental concerns regarding various treatments, and their outcomes. Childrenwith a negative DMSA scan require no further evaluation unless recurrentfebrile UTI occurs, in which case cystography should be performed. The use ofantimicrobial prophylaxis should be recommended based on known risks forrecurrent UTI and for renal scarring should UTI occur regardless of thepresence of absence of reflux.The \u201ctop-down\u201d evaluation provides anassessment of risk for renal scarring that strongly correlates with thepresence of clinically relevant VUR. Inaddition to being a more cost-effective means of evaluating children withfebrile UTIs, it is also predicted to lessen medical care costs by reducing thenumber of children on antibiotic prophylaxis and of children undergoing surgeryfor reflux that is unlikely to result in renal scarring."}
{"text": "Vesicoureteral reflux (VUR) is the most common anomaly associated with duplex systems. In addition to an uncomplicated duplex system, reflux can also be secondary in the presence of an ectopic ureterocele with duplex systems. Controversy exists in regard to the initial and most definitive management of these anomalies when they coexist. This paper will highlight what is currently known about duplex systems and VUR, and will attempt to provide evidence supporting the various surgical approaches to an ectopic ureterocele and duplex system and the implications of concomitant VUR. Less than 1% of thegeneral population has a duplex kidney . VUR is There are certainfactors that contribute to reflux resolution in single-system (SS) ureters,including patient age, grade of reflux, postnatal presentation, and thepresence or absence of associated voiding dysfunction . The natData from the availableliterature suggests that the majority of patients with DS and low-grade VUR canbe initially managed with antibiotics and careful observation. Parents should be counseled that it may takelonger for the reflux to resolve and young females with high-grade VUR may beat increased risk for infections. Despite these findings, the absolute indication for surgery inindividuals with low-grade VUR is not different from those with SS and similar VUR,and surgical correction is successful in the majority of cases . In factDuplex systems are anuncommon diagnosis causing prenatal hydronephrosis; however, when confirmed,ureteroceles are one of the most common associated findings , 10. EctThe initial and subsequent management of ureteroceles has beencontroversial and depends on several factors, including presenting symptoms, ectopicversus orthotopic position, presence or absence of reflux, and function of theassociated upper-pole moiety . Asthe In the above proposed setting, the clear indication for endoscopicdecompression of an ectopic ureterocele is in a child who presents with sepsis orbladder outlet obstruction. However, in thesetting of sepsis, one must open the ureterocele completely, as puncturing maynot result in adequate drainage. Thisprocedure almost invariably results in prompt improvement in patient symptoms,but the parents should be counseled that their child will require definitive reconstructionat a later date, as reflux into the upper-pole moiety is the rule, not theexception. In contrast, endoscopicpuncture of an ectopic ureterocele in the nonemergent setting may also committhe patient to future reconstruction. Inone series describing endoscopic puncture for ectopic ureteroceles, Jayanthi etal. reported postoperative reflux into the upper-pole moiety in 50% of cases . OverallUpper-pole heminephrectomy can result in excellent decompression of theureterocele and should be the procedure of choice if there is no ipsilaterallower pole or contralateral reflux . RemovinIn conclusion, ectopic ureteroceles that reflux or are associated withreflux into other moieties are likely best served with ureterocele excision ormarsupialization, bladder floor reconstruction, and ureteral reimplant. Another option would be a ureteroureterostomywith a lower-pole extravesical reimplant. In those patients who present with sepsis or bladder outlet obstruction,endoscopic decompression is highly successful but will likely commit thepatient to further surgery. Upper-poleheminephrectomy is best applied to those patients with nonfunctioning upperpoles and no associated reflux. In thissetting, this approach is highly successful and has the advantage of avoidingbladder surgery, limiting risks to the lower pole, and eliminating thepotential unknown risks of preserving a dysplastic upper pole . ArguablReflux found inassociation with a duplex system may take longer to resolve than single-systemreflux. Parents should be counseledaccordingly. Surgery to correct VUR induplex systems is highly successful. Ectopicureteroceles can present an interesting and difficult surgical challenge andcan be ultimately managed with multiple surgical approaches following initialconservative therapy. Endoscopicdecompression seems best reserved for the septic patient or one who presentswith bladder outlet obstruction. Itprovides excellent relief of obstruction and can preserve upper-pole renalfunction. Ultimately, these patients arecurrently managed by either an upper- or lower-tract approach. The most important factor in deciding whichapproach to take is the presence or absence of VUR."}
{"text": "This case is about a 48-year-old woman known with a reduced butyrylcholinesterase activity, who developed prolonged neuromuscular blockade following the unintentional administration of succinylcholine. We took the opportunity to monitor the development of neuromuscular function during this period and blood samples were taken for molecular genetic analysis and for quantitative and qualitative analysis since not all causative mutations are functionally characterized. Reduced butyrylcholinesterase activity is discussed in many aspects. Clinical considerations are suggested concerning genetic counselling. Normally 90 percent of intravenously administered succinylcholine is hydrolysed in the plasma by butyrylcholinesterase (BCHe) before it can bind to the alpha subunits of the nicotinic cholinergic receptor at the neuromuscular junction. BCHe hydrolyses ester bonds in many agents; local anaesthetics-like cocaine, procaine, chloroprocaine, and tetracaine, and also heroine and mivacurium, are metabolised by BCHE. Decreased activity of BCHe becomes clinically relevant in patients carrying at least one causative mutation in the BCHE gene . The BCHFollowing administration of succinylcholine to a patient with a known abnormal variant of BCHe, the duration of relaxation of skeletal muscles is predictable. In this case history the genotype of the patient was not known yet. After informed consent obtained from the patient we describe this case history concerning prolonged neuromuscular blockade following succinylcholine administration to a patient with a reduced butyrylcholinesterase activity and the follow-up investigation.A 48-year-old woman  was scheduled for a laparoscopic cholecystectomy because of cholelithiasis. At the preoperative assessment she reported postoperative apnoea following a Caldwell-Luc procedure at the ENT-OR in 1981. A prolonged effect of succinylcholine had been confirmed by a dibucaine number of 10, written on a crumpled warning card. The patient herself was absolutely clear about the condition of her butyrylcholinesterase deficiency. Her medical history showed an appendectomy, hypertension, and a trigeminal neuralgia due to repetitive sinus infections. Current medication was amitriptyline, gabapentin, diclofenac, omeprazole, metoprolol, and acetaminophen combined with codeine. Induction of anaesthesia was carried out with fentanyl and propofol. To facilitate tracheal intubation 100\u2009mg succinylcholine (0.9\u2009mg/kg) had been administered unintentionally. Maintenance was performed with intermittent dosages of fentanyl, morphine and a continuous infusion of propofol. The surgical procedure lasted 90\u2009minutes and was done uneventfully.Monitoring of neuromuscular function was started using acceleromyography (TOF-Watch SX), by performing intermittently a \u201ctrain-of-four\u201d. Determination of the supramaximal stimulus could not be performed, as deep neuromuscular blockade was already induced. Anaesthesia, using propofol continuously in combination with intermittent doses of morphine, and neuromuscular monitoring were continued until recovery of the TOF-ratio above 90%; at this value it was assumed that the patient could breathe without help. Recovery of neuromuscular function took more than seven hours. The first twitch was seen 87\u2009minutes after the administration of succinylcholine. The course was uneventful although the patient was emotional and anxious postoperatively we were able to regain her trust after several talks.After informing this adverse event to the patient and her partner, she gave permission to take blood samples for quantitative and qualitative analysis and for molecular genetic investigation.The plasma concentration of cholinesterase was 2520\u2009U/l (ref: 4800\u201312000\u2009U/l) and the dibucaine number was 8. These results are indicative for a homozygous atypical variant. Because of the very long clinical duration of action we did not limit molecular genetic investigations to known BCHE variants but decided to sequence both strands of the complete BCHE coding sequence. This identified a homozygous A- as well as a homozygous K-variant. The A-variant  is most causative for the clinical feature and the K-variant  contributed to the markedly prolonged muscle relaxation and the dibucaine number of 8. The clinical significance of the K-variant as a single mutation has been described by G\u00e4tke et al. [Immediately after induction, the attending anaesthesiologist realized that he had made a big mistake most probably caused by overconcentration. Although all preparations were done, in word and writing, this case shows us that anesthesia is done by humans. Unfortunately man makes mistakes. The best thing you can do afterwards is to be honest to the patient and that you will try to avoid it in the future.Succinylcholine in a dosage of 1\u2009mg/kg has a rapid onset (30\u201360\u2009sec.) and a short duration of action (3\u20135\u2009min.). It mimics the action of acetylcholine at the neuromuscular junction by depolarising the postjunctional membrane, provided that the depolarisation is sustained until succinylcholine is hydrolysed by BCHe. BCHe is synthesised by the liver, and among other plasma cholinesterases its physiological function is still not fully understood. In 1957, Werner Kalow identified plasma cholinesterase (pseudocholinesterase) as the cause of variable metabolism of drugs when he described persisting neuromuscular blockade (apnoea) after the administration of succinylcholine . By inveGenetic variants of butyrylcholinesterase result in differences in clinical response to succinylcholine. This often unexpected drug effect with potential morbidity as a consequence makes decreased BCHe activity a pharmacogenetic disorder . The actIn response to an adverse event in which an abnormal BCHe activity is suspected the first step is to perform biochemical investigations to confirm the phenotype . To specThe A- variant we detected  is different from the most frequent occurring A variant . Diagnosing the mutations in the BCHE gene in our patient, we could offer family members genetic counselling to screen for this mutation [In conclusion, using neuromuscular blocking agents, it is recommended to monitor the recovery of neuromuscular function. Persisting neuromuscular blockade following the administration of succinylcholine should be investigated using conventional biochemical testing and molecular genetic testing to distinguish between an inherited or acquired cause for the decreased activity of BCHe. Applying this knowledge into clinical practice will improve the safety of our patients and their relatives."}
{"text": "The aim of this study was to assess the responsiveness of the asthma control test (ACT) to detect changes at the initiation of therapy and its utilization in the initiation of asthma treatment.This study was designed as a randomized clinical trial conducted in a primary care setting. The subjects were asthma patients who had not received controller therapy for at least two months. The patients were randomized into two groups: The Saudi Initiative for Asthma (SINA) group and the Global Initiative for Asthma (GINA) group. Treatment in the SINA group was initiated at step1 when the ACT scores \u2265 20, step 2 when the score between16-19, and step 3 when the score < 16 began at step 3. The GINA group patients were started on step 2 when they had persistent asthma symptoms or step 3 when they had severely uncontrolled disease.p = 0.04)). The improvement in FEV1 was 5.8% in the SINA group compared to 3.4% in the GINA group (p = 0.46). The number of patients who achieved asthma control at the follow-up visit and required no treatment adjustment was 33 (73.3%) in the SINA group and 27 (60%) in the GINA group (p = 0.0125).Forty-five patients were analyzed in each group. The improvement in ACT score after treatment initiation was significantly higher when the SINA approach was used (2.9 in the SINA group compared to 1.7 in the GINA group (The ACT was responsive to change at the initiation of asthma treatment and was useful for the initiation of asthma treatment.ISRCTN31998214 The Global Initiative for Asthma (GINA) has evolved management from being based on a severity index to the concept of achieving asthma control -4. It haThe Saudi Initiative for Asthma management (SINA) was created by the Saudi Thoracic Society which was adopted and customized from the GINA, the NAEPP, and the available local literature ,8. The SThis study was a randomized clinical trial conducted in asthma patients who presented at primary care centers belongs King Abdulaziz Medical City, Riyadh, Saudi Arabia between 21 September and 12 November 2011. These primary care centers were operated independent of the main hospital and open to patients who has medical records at the center. The inclusion criteria included the following: an age above 12 years, a diagnosis of asthma, and literacy, as patients had to answer the ACT without assistance. Patients were excluded if they had used controller therapy for the two months prior to the initial presentation in order to ensure that our findings are contaminated by a prior controller treatment. Controller therapy was defined as the use of inhaled corticosteroids, leukotriene modifiers, and/or long-acting bronchodilators agents. This study was approved by the Institutional Review Board of the King Abdullah International Center for Medical Research (RC10-091). It was also registered in the International Standard Randomized Controlled Trial Number Register with the number ISRCTN31998214.1) was performed by a spirometer, as per American Thoracic Society standards [Patients were randomized to receive their initial treatment based on either the SINA approach  between baseline visit and follow-up visit was done by calculating the Pearson correlation coefficient. A p-value less than or equal to 0.05 was accepted as statistically significant. All randomized patients were included in the analysis, as per the intention-to-treat principle.Sample size calculation, we estimated the controlled patients to be 30% and thus, a sample size of 45 is needed in each arm to have an 80% power to detect a difference of 30%, at an alpha level of 0.05. The data were entered into a Microsoft Excel spreadsheet, which was then transferred into the Statistical Package for Social Sciences (SPSS) program, which was used for data cleaning, management, and analyses. The difference in outcome between the first visit and the follow-up visit was calculated, and then patients with a significant response were flagged. Descriptive analyses were carried out by calculating the number and percent for categorical variables and mean and standard deviation for continuous data. The inferential statistics for the comparison between the two groups was carried out using the Chi-square test for categorical variables, and the 1 values were lower in the SINA group than the GINA group, this difference did not reach statistical significance. Table 1 score of the SINA group (5.8%) than the GINA group (3.4%), this difference did not reach statistical significance (p = 0.46). In contrast, the improvement in PEF was higher in the GINA group compared to the SINA group, but this difference also did not reach statistical significance (p = 0.803). The improvement in the ACT score after treatment initiation was significantly higher in the SINA group compared to the GINA group (2.9 compared to 1.7 (p = 0.04)).Ninety-eight patients were recruited for this study Figure . Forty-fp = 0.185). The correlation between the difference in FEV1 and that of the ACT scores between the initial and follow-up visits was found to be statistically significant, with a correlation coefficient of 0.21 (p = 0.05). Although there was a positive correlation between the changes in FEV1 and PFM (correlation coefficient = 0.19), the change was not significant (p = 0.07). Finally, there was a very weak positive correlation between the changes in the PFM and ACT .Although both groups showed similarities in categorization based on the initial ACT scores table , the folp = 0.0125). Eight (17.8%) patients in the SINA group required a step down in therapy, and 4 required a step up in treatment at the follow-up visit. In comparison, 18 patients in the GINA group required a step down, while no patients required a step up.Figure This study showed that the ACT was responsive to changes at the initiation of asthma treatment . It has p = 0.04). Though the improvement in FEV1 was better in the patients who followed the SINA approach, this difference did not reach statistical significance. This lack of statistical significance could be related to an inadequate sample size to assess a positive response of this outcome. The conflicting results obtained regarding the improvement in PEF in the GINA group may be related to the poor correlation of PEF with the ACT and pulmonary function when used to assess asthma control [1. Moreover, the change in the ACT between the two visits was significantly correlated with the change in the FEV1 and FeNO in that study [1 is the main objective physiological measurement of asthma control, the ACT was also found to correlate well with lung function and inflammation [Utilizing the initial ACT score to determine the appropriate treatment in this study has led to an improvement of 2.9 units, better than the 1.7 unit improvement observed when treatment was determined by physician judgment based on the GINA approach . This was supported by the fact that 40% of those treated with the GINA approach required a step down in treatment upon follow-up, compared to 17.8% of those who treated with the SINA approach. Commencing treatment with the appropriate dose would enhance compliance and minimize the side effects of medications. On the other hand, 8.9% of the patients who followed the SINA required a step-up in treatment compared to none in the GINA group, a finding that may indicate an inadequate initial treatment.Finally, it is worth mentioning a few limitations and concerns related to this study. The utilization of the ACT as an objective measure for initiating asthma therapy is independent of the practitioners' clinical judgment. In contrast, the knowledge of those practitioners who utilized the GINA approach in this study may have been augmented by the pre-study workshop, possibly contaminating the results in that group. This issue was discussed during the preparation of the study protocol, and the authors felt that it was inappropriate to deny the practitioners' placement in the GINA arm due to ethical considerations. In day-to-day practice, most practitioners have variability in their knowledge and experience and may not have the opportunity for dedicated education sessions. Therefore, it is an area for future research to challenge our findings in general practice. Another limitation was the use of set ACT score limits of 16 and 19 for decisions regarding the appropriate initial treatment step. Due to the lack of evidence identifying ACT reference scores for treatment initiation, these numbers were extrapolated from studies that assessed asthma control to make decisions about treatment adjustment and maintenance. Defining the ACT categories that determine initial treatment is another area that needs to be challenged to support its suitability ,27.We believe that despite the aforementioned limitations and concerns, this study can be considered a pilot project that showed the ACT to be responsive to change at treatment initiation and showed usefulness for the initiation of asthma treatment compared to the GINA approach.1: Forced expiratory volumes in one second; FeNO: Fractional exhaled nitric oxide.ACT: Asthma control test; SINA: Saudi Initiative for Asthma; GINA: Global Initiative for Asthma; NAEPP: National Asthma Education and Prevention Program; PEF: Peak expiratory flow; FEVThe authors declare that they have no competing interests.MSAM: primary author, study design, analysis, and writing of the manuscript. MOAG: study design, data collection, and writing of the manuscript. AGAK: data collection, approvals, and writing of the manuscript. HMT: study design, randomization, data analysis and manuscript writing. All authors read and approved the final manuscript.This study was supported by a grant from the King Abdullah International Center for Medical Research.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2466/12/14/prepub"}
{"text": "Listeria GeneChip\u00ae, developed by FDA from 24 Listeria monocytogenes genome sequences, was used to further characterize a representative sample of the outbreak isolates. The microarray data  separated the isolates into two distinct groups as per their serotypes. The gene content of the outbreak-associated isolates was distinct from that of the previously-reported outbreak strains belonging to the same serotypes. Although the 1/2b outbreak associated isolates are closely related to each other, the 1/2a isolates could be further divided into two distinct genomic groups, one represented by pattern combination I strains and the other represented by highly similar pattern combinations III and IV strains. Gene content analysis of these groups revealed unique genomic sequences associated with these two 1/2a genovars. This work underscores the utility of multiple approaches, such as serotyping, PFGE and DNA microarray analysis to characterize the composition of complex polyclonal listeriosis outbreaks.A multistate listeriosis outbreak associated with cantaloupe consumption was reported in the United States in September, 2011. The outbreak investigation recorded a total of 146 invasive illnesses, 30 deaths and one miscarriage. Subtyping of the outbreak associated clinical, food and environmental isolates revealed two serotypes (1/2a and 1/2b) and four pulsed-field gel electrophoresis two-enzyme pattern combinations I, II, III, and IV, including one rarely seen before this outbreak. A DNA-microarray,  Listeria monocytogenes, a Gram-positive foodborne bacterial pathogen, is the causative agent for human and animal listeriosis. The invasive form of human listeriosis (Inv) is a disease predominantly affecting immuno-compromised people, the elderly, neonates and pregnant women and is characterized by septicemia and/or meningitis in non-pregnancy-associated cases, fetal loss, premature labor and neonatal septicemia or meningitis in pregnancy-associated cases with high case-fatality ratios (\u223c20\u201330%) L. monocytogenes is not routinely cultured from stool in clinical laboratories.L. monocytogenesAlthough the majority of the large listeriosis outbreaks detected in the United States have been associated with the consumption of ready-to-eat frankfurters and deli meats, as well as milk and dairy products, outbreaks due to consumption of produce  also have been previously reported L. monocytogenes were obtained from samples of blood or cerebrospinal fluid. The outbreak strains consisted of serotypes 1/2a and 1/2b and belonged to four distinct pulsed-field gel electrophoresis (PFGE) pattern combinations (PCs) I, II, III, and IV. Investigation by local, state and federal public health and regulatory agencies identified L. monocytogenes outbreak strains on cantaloupes collected from grocery stores, ill person's home, and whole cantaloupes collected from cold storage and the packing facility environment; environmental swabs collected at the facility also identified L. monocytogenes outbreak strains L. monocytogenes in the cantaloupe From August 12 to November 1, 2011, 146 outbreak-associated cases of invasive listeriosis were diagnosed among residents of 28 states in the USA. Thirty deaths and one miscarriage were reported during the outbreak, which was the largest number of fatalities due to an outbreak of foodborne listeriosis in the United States L. monocytogenes can be classified into 13 serotypes Listeria GeneChip\u00ae L. monocytogenes genomes available in public databases as of 2009. Using Listeria GeneChip\u00ae, we have already shown that the outbreak strains of L. monocytogenes can be further classified into different genomic groups or genovars and it could also identify epidemic clones and could further distinguish the individual outbreak strains and food and clinical isolates Although L. monocytogenes isolates were identified using methods described in the Bacteriological Analytical Manual L. monocytogenes isolates were typed following the standard PulseNet procedure using restriction enzymes AscI and ApaI  Cantaloupe outbreak isolates  were gro+), 20 mM EDTA, 0.01% Tween-20, 50 pM control oligoB2 , 0.1 mg/ml herring sperm DNA (Promega), 7.8% dimethylsulfoxide (DMSO) , were heated at 95\u00b0C for 1 minute followed by incubation at 45\u00b0C for 5 minutes, prior to hybridizing onto the Affymetrix Listeria GeneChip\u00ae at 45\u00b0C with rotation (60 rpm) for 16 hours in a hybridization oven. The wash and staining procedures were carried out on an Affymetrix FS-450 fluidics station using the mini_prok2v1_450 fluidics script as described by GeneChip\u00ae Expression Analysis Technical Manual with the slight modification previously described Hybridizations of the genomic DNA isolated from cantaloupe outbreak strains were performed according to the Affymetrix GeneChip\u00ae Expression Analysis Technical Manual All Affymetrix CEL files generated in this study were parsed and analyzed using algorithms including MAS5.0 L. monocytogenes serotype 1/2a and 1/2b was constructed using the uncorrected p-distance in Splitstree 4.11.3.The gene present/absent binary nucleotide calls based on the gene contents as T (present) and A (absent), were concatenated for each strain, such that a 18,630 bp sequence was generated to represent the gene content L. monocytogenes. Although the majority of recorded invasive listeriosis outbreaks were caused by serotype 4b, serotype 1/2a and 1/2b have been reported more frequently in recent years. Serotype 1/2a and 1/2b isolates have also been involved in several FG listeriosis outbreaks All isolates showed a positive agglutination reaction with Difco Type 1 antisera. Combining these results with the multiplex PCR results (data not shown) allowed us to make a final serotype determination within 24 hours of inoculating the initial BHI-A overnight culture. The multiplex, PCR-based serotypic determinations of several strains were independently confirmed by a standard antisera-based serotyping protocol using the Denka-Seiken commercial kit (data not shown). Thus, the multiplex PCR-agglutination protocol allowed us to rapidly and accurately determine the serotypes for the outbreak isolates. These analyses confirmed that this outbreak was a multi-strain and multi-serotype outbreak, involving two distantly related serotypes Molecular subtyping is one of the crucial tools for outbreak investigation. Since 2001 standardized PFGE has become the gold standard for establishing genetic relatedness among bacterial isolates obtained from foods, clinical samples and the environment AscI and ApaI) from selected outbreak strains ; however, the AscI patterns  differed by a band shift of \u223c40 kb possibly due to the presence of a phage in PC IV isolates . The PCs assigned to each isolate examined are shown in PFGE patterns  of these PCs in the database ranged from 6 to 60 with most of these isolates belonging to PC II . InteresIt is clear from the above paragraphs that the cantaloupe outbreak was caused by at least three strains belonging to two different serotypes. Four PCs were identified, of which two were closely related. In order to further characterize these strains at the genomic level, we chose eight isolates from food or the food processing environment and eight isolates from patients for microarray analysis .L. monocytogenes strains were identified from the microarray results using the Affy package in R-Bioconductor. The gene contents of the cantaloupe outbreak strains from both serotypes 1/2a and 1/2b were compared with the unrelated strains, which are ones we have previously characterized Listeria GeneChip\u00ae, 7,823 probe-sets were conserved, which left 4,041 (21.7%) and 6,766 probe-sets (36.3%) as present and absent, respectively. A neighbor-net tree, constructed based on the gene content analysis, clearly separated these cantaloupe outbreak and unrelated strains according to their serotypes (The gene contents (present/absent) of these erotypes . Previouerotypes  were fouL. monocytogenes isolates serotype 1/2a implicated in this 2011 cantaloupe outbreak, the PC I strains were genetically distant from the other two PCs, which in turn are closely related, confirming the PFGE results. Further comparison of genetic contents in the PCs III and IV with those from PC I revealed that approximately 3% of probe-sets were uniquely present in each group  using MAS5.0 algorithm. Gene content comparison among these cantaloupe outbreak isolates, an unmatched shrimp isolate (LS693), and previously reported strains ch group  and S2. To further analyze the genetic variability of the serotype 1/2a isolates, Robust Multi Array (RMA) algorithm L. monocytogenes serotype 1/2a strains were most amenable to phage transduction compared to other serotypes, including 1/2b and 4b comK could provide an added advantage for Listeria to survive in selective environments comK site. Thus, the increased ability to accept, maintain, and recombine/mutate phage gene sequences in serotype 1/2a PC IV strains could potentially contribute to the evolution of a more fit L. monocytogenes genovar. This raises an important question about the potential risk associated with the using of bacteriophages to control Listeria in foods. However, experimental evidence is required to determine whether isolates harboring the phage have a selective advantage relative to those that do not carry the phage and under what conditions the phage confers such an advantage.The majority of the serotype 1/2a isolates from the cantaloupe outbreak strains analyzed here belong to the PCs III and IV. Comparison of gene contents from all of these six isolates based on MAS5.0 analysis showed that 7,643 probe-sets were present and 10,415 probe-sets were absent, which encompassed 97% of conserved probe-sets. This result indicated that isolates from the PCs III and IV are more closely related to each other than to the PC I strains and could be considered variants of the same strain. There were three unique probe-sets present in the isolates from PC III, including two hypothetical protein genes and one intergenic region. On the other hand, the PC IV strains contained an additional 110 unique probe-sets , Fig. 8 The genetic relationship of the cantaloupe outbreak serotype 1/2b strains was examined based on the gene contents information obtained from the microarray analysis. The results indicated that 87.9% of total probe-sets were conserved among 1/2b isolates included in this study. Although the isolates from the cantaloupe outbreak are clustered together , the genAfter these analyses were completed, a state public health laboratory retrospectively identified a strain with a PFGE pattern combination different from all other PC in the national data base. This strain was detected on a sample of cantaloupe and only a single case of human illness was reported during the outbreak.L. monocytogenes isolates that caused the large, multistate outbreak of listeriosis in 2011. The outbreak was unique in the sense that it was the first documentation of a listeriosis outbreak associated with consumption of contaminated cantaloupe in the United States and was caused by several distinct serotypes and genotypes of L. monocytogenes. The increasing discriminatory powers of the three analytical tools applied in this study underscores the utility of multiphasic approach in revealing the complex polyclonal nature of this outbreak. Our microarray analysis showed that the 1/2a and 1/2b strains associated with this outbreak are distinctly different from the previously reported 1/2a and 1/2b strains associated with both Inv and FG listeriosis outbreaks and sporadic cases. The pan-genomic analysis of these strains provided a powerful tool for exploring the genomic footprints of these organisms and underlined the possibility that phage genomes may be an important driving force behind the evolution of some strains of L. monocytogenes.To summarize, a combination of serotyping, PFGE and DNA microarray hybridization analyses were employed to characterize the genomic footprints of the Table S1Probe-sets uniquely present in PC I serotype 1/2a.(DOCX)Click here for additional data file.Table S2Probe-sets uniquely present in PC III and IV strains serotype 1/2a.(DOCX)Click here for additional data file.Table S3Probe-sets uniquely present in PC IV serotype 1/2a.1.(DOCX)Click here for additional data file."}
{"text": "Listeria monocytogenes, a foodborne bacterial pathogen, causes invasive and febrile gastroenteritis forms of listeriosis in humans. Both invasive and febrile gastroenteritis listeriosis is caused mostly by serotypes 1/2a, 1/2b and 4b strains. The outbreak strains of serotype 1/2a and 4b could be further classified into several epidemic clones but the genetic bases for the diverse pathophysiology have been unsuccessful. DNA microarray provides an important tool to scan the entire genome for genetic signatures that may distinguish the L. monocytogenes strains belonging to different outbreaks. We have designed a pan-genomic microarray chip (Listeria GeneChip) containing sequences from 24 L. monocytogenes strains. The chip was designed to identify the presence/absence of genomic sequences, analyze transcription profiles and identify SNPs. Analysis of the genomic profiles of 38 outbreak strains representing 1/2a, 1/2b and 4b serotypes, revealed that the strains formed distinct genetic clusters adhering to their serotypes and epidemic clone types. Although serologically 1/2a and 1/b strains share common antigenic markers microarray analysis revealed that 1/2a strains are further apart from the closely related 1/2b and 4b strains. Within any given serotype and epidemic clone type the febrile gastroenteritis and invasive strains can be further distinguished based on several genetic markers including large numbers of phage genome, and intergenic sequences. Our results showed that the microarray-based data can be an important tool in characterization of L. monocytogenes strains involved in both invasive and gastroenteritis outbreaks. The results for the first time showed that the serotypes and epidemic clones are based on extensive pan-genomic variability and the 1/2b and 4bstrains are more closely related to each other than the 1/2a strains. The data also supported the hypothesis that the strains causing these two diverse outbreaks are genotypically different and this finding might be important in understanding the pathophysiology of this organism. Listeria monocytogenes is a Gram-positive foodborne bacterial pathogen responsible for human and animal listeriosis. Recent data L. monocytogenes have been reported L. monocytogenes is not known because FG cases are not routinely screened for L. monocytogenesL. monocytogenes strains can be classified into 13 serotypes L. monocytogenesL. monocytogenes strains isolated from these outbreaks. Franciosa et al (2001) analyzed a total of 32 strains, 16 from Inv and 16 from FG listeriosis outbreaks by ribotyping, arbitrarily primed PCR (AP-PCR) and interspersed repetitive sequence PCR (IRS-PCR) L. monocytogenes serotype 4b and 1/2b strains from Inv and FG listeriosis by several other molecular sub-typing techniques Based on somatic and flagellar antigens, L. monocytogenes appear to be highly clonal. These molecular subtyping methods revealed that L. monocytogenes can be classified into at least three lineages correlated to their serotypes L. monocytogenes strains associated with different outbreaks using molecular subtyping methods divide these strains into five epidemic clones (ECs), suggesting that strains causing major outbreaks are genetically related Based on several molecular subtyping studies including multi-locus enzyme electrophoresis (MLEE), RFLP and PFGE, genetic structures of L. monocytogenesL. monocytogenesL. monocytogenes based on the publicly available information (as of May 2009) of 24 L. monocytogenes genome sequences. Using our custom Listeria GeneChip (Affymetrix technology), we analyzed 38 L. monocytogenes strains isolated from Inv and FG listeriosis outbreaks. The strains represent serotypes 1/2a, 1/2b and 4b including epidemiologically matched clinical and food isolates. Our results show that the microarray-based analysis using this GeneChip can be used as an outbreak investigation tool to identify genome differences and separate L. monocytogenes strains based on their serotype, epidemic clone type and outbreaks. The distinct difference in genetic footprints between strains of FG and Inv outbreaks may help in understanding the diverse pathophysiology of this organism.With the advent of whole genome sequencing technology and the availability of advanced bioinformatics tools, it is possible to identify small changes in the genetic makeup of bacterial pathogens, including L. monocytogenes were obtained from various sources . Briefly, 200\u00b5l hybridization reactions containing 10\u00b5g of labeled fragmented DNA, 100mM MES, 1M(Na+), 20mM EDTA, 0.01% Tween-20, 50pM control oligoB2 , 0.1 mg/ml herring sperm DNA (Promega), 7.8% dimethylsulfoxide (DMSO) , were heated at 95\u00b0C for 1 minute followed by incubation at 45\u00b0C for 5 minutes, prior to hybridizing onto the Affymetrix Listeria GeneChip at 45\u00b0C with rotation (60rpm) for 16 hours in a hybridization oven. The buffer preparation, the wash and staining procedures were carried out on an Affymetrix FS-450 fluidics station using the mini_prok2v1_450 fluidics script as described by GeneChip Expression Analysis Technical Manual with the slight modification that Streptavidin solution mix was replaced with Streptavidin, R-phycoerythrin conjugate (SAPE) . Arrays were subsequently scanned using a GeneChip Scanner 3000 7G with GCOS v1.4 software.Hybridizations were performed according to the Affymetrix GeneChip Expression Analysis Technical Manual (L. monocytogenes microarray (Listeria GeneChip) is custom designed using Affymetrix chip technology and has components for use as an expression or genotyping array and probes for use as a tiling array. The Listeria expression/genotyping microarray was designed to represent 64,539 annotated gene sequences from 24 sequenced strains of L. monocytogenes which were available from GenBank and Broad Institute (http://www.broadinstitute.org/annotation/genome/listeria_group/MultiHome.html) as of May, 2009 and 7,354 intergenic sequences from four of the sequenced L. monocytogenes strains  (The ip81459) . IdenticThe tiling portion of the array consists of 568,677 probes covering the whole genome of AE017262 4b F2365. The 25-mer probes cover the genome at 4-nt gaps between starts, allowing for 20-nt overlap between probes. Each nucleotide in the genome is covered by 5 probes for detection of Single Nucleotide Polymorphisms (SNPs) relative to the reference sequence.All Affymetrix CEL files generated in this study were parsed and analyzed using algorithms including MAS5.0 L. monocytogenes gene contents for which the presence or absence of genes were coded as T (present) or A (absent), respectively. The gene present/absent binary nucleotide calls were concatenated for each strain, such that a 18,630 bp sequence was generated to represent the gene content. Genes that are not phylogenetically informative L.\u200amonocytogenes serotype 1/2a, 1/2b and 4b was constructed using the uncorrected p-distance in Splitstree 4.11.3.Affymetrix MAS5.0 algorithm using Affy package of R and Bioconductor was used to identify L. monocytogenes genome sequences allowed us to design a GeneChip that integrates sequences from many genomes in one single GeneChip. In this study, we investigated the L. monocytogenes genome diversity using Affymetrix high-density microarray GeneChip that was custom designed based on 24 L. monocytogenes genome sequences available at the time of GeneChip design (Listeria GeneChip was designed to study genome diversity and gene expression as well as single nucleotide polymorphisms (SNPs) of L. monocytogenes. All probe-sets on Our Listeria GeneChip consist of up to 14 probe-pairs per gene, phage gene and intergenic region. Each probe-pair contains one perfect-match probe (PM) and another with one nucleotide mismatch (MM). This feature enables us to perform highly accurate gene content detection.The availability of p design  .The LisL. monocytogenes strains, MAS5.0 gene detection approach was used p-values. In addition to the R Score, sensitivity and/or specificity of gene detection depends on a small positive threshold value, Taup-value using a one-sided Wilcoxon Signed Rank test as described by Jackson et al. p-value <0.05 were scored as present and \u22650.05 as absent. Tau values on gene present calls for strains LS402, LS406 and LS411. Increased Tau values clearly resulted in reduced numbers of gene present calls that correspond to false negatives. However, higher Tau values will also result in reduced numbers of truly present genes . In addition, it is important to note that our Listeria GeneChip was designed based on the available genome sequences to study global genomic diversity. Several probe sets may contain probes that share different percent identities from the same genes in various genomes. The predicted numbers of present genes, therefore, can or often do exceed the true numbers of genes in the L. monocytogenes genomes, providing better resolution for gene detection (To determine gene contents (present/absent) in etection .Tau values to the individual CEL files in the triplicate experiments, we found that the data reproducibility changed, depending largely on the Tau value selection. Tau values provided results with lower percent reproducibility. Tau values up to 0.3, on the other hand, increased the percent reproducibility to approximately 98%. While increasing Tau values above 0.3 resulted in reduced percent reproducibility, Tau values above 0.5 again raised the percent reproducibility. This increase in reproducibility resulted from more false absent calls occurring with Tau values above 0.5, . As a result, 10,592 out of 18,630 total probe-sets were automatically scored as absent. Although 8,038 probe-sets may be called as present, we found that 6,980 probe-sets can be scored as present based on the following two criteria. First, each probe-set must contain at least 40% of 100% matched probes compared to the total probe numbers. Secondly, each probe-set screened by the first criteria must contain at least six 100% matched probes, allowing at least 150 nucleotides to be detected. The numbers of nucleotides are therefore sufficient for gene detection. The gene detection calls from the triplicate LS411 hybridization experiments using varied Tau values were then compared with the gene present/absent calls from the BLAST analysis to identify the numbers of false positive and false negative. As expected, with increasing Tau values, the numbers of false negative rose due to more absent calls, whereas the numbers of false positive dropped exponentially . This analysis strongly indicated that Tau values between 0.2 and 0.3 provide the most accurate gene detection calls for the Listeria GeneChip hence the Tau value of 0.25 was subsequently used in the downstream analyses to identify the gene contents of different L. monocytogenes strains. A similar study using Affymetrix GeneChip\u00ae E. coli Genome 2.0 revealed that a Tau value of 0.2 provided the most accurate gene present/absent calls To further validate our e LS411,  [19], thentially . FurtherListeria GeneChip by comparing summarized probe-set intensities, independent to MAS5.0 algorithm. In contrast to MAS5.0 gene present/absent call analysis, MM probes are not considered as a part of the RMA calculation. The summarized probe-set intensities were therefore determined based on PM probes alone. As a part of the result validation, the same CEL files used in the MAS5.0 analysis from the triplicate hybridization experiments performed in some strains were subjected to RMA analysis using Affy package in R-Bioconductor. The summarized probe intensities among triplicate experiments with LS402, LS406 and LS411 were compared. The RMA scatter plots between the samples in triplicate (Listeria GeneChip is improved resolution as shown in The Robust Multi-array Averaging (RMA) approach iplicate  A\u2013F reveiplicate  by scattiplicate  whereas iplicate . This reiplicate  A\u2013C, theL. monocytogenes strains into 2 clusters correlating to their ECs (ECI and IV) while they are clearly distinct from the serotype 1/2b strains. The heat map reveals distinct trends in the differences of gene content among strains from different ECs as also established by previous study in E. coliWe further validated the microarray results using the RMA-summarized probe intensities generated from serotype 4b (ECI and ECIV) and serotype 1/2b strains. A heat map generated from the RMA-summarized probe intensities shows that, when the individual 4b strains were examined in triplicate, the results appeared to be identical suggesting consistency in the array data . The denL. monocytogenes strains, genomic content information (present/absent) was analyzed using MAS5.0 algorithm to infer strain relatedness. All CEL files generated from the genomic DNA hybridization of the 38 L. monocytogenes strains from the three serotypes  were parsed and analyzed using Affy package in R-Bioconductor with the Tau value of 0.25. There are 18,360 probe-sets on the array, of which 8,079 probe-sets are conserved (either present or absent) across all 38 strains , likely representing a large component of the core L. monocytogenes genome. As a result, they are not phylogenetically informative and were consequently excluded from the analysis L. monocytogenes. The 9,767 parsimoniously informative sites were selected from the 10,551 phylogenetically informative probe-sets. A neighbor-joining tree of the 38 strains constructed using the gene content information, separated the strains into their respective serotypes and epidemic clones . The serotype 4b strains were divided into four distinct clusters corresponding to their ECs . Interestingly, the parallelogram analysis revealed that there may be more substantial mutations or recombinations in ECI, ECII and ECV than those of the ECIV and serotype 1/2b strains. Pairwise homoplasy index (PHI) p-value of 0.0 which confirms that there was significant evidence of recombination or parallel gene gain/loss due to multiple transduction events. In addition, when 925 phage genes were removed from the analysis, the topology and clusters of the resulting tree were unaffected (data not shown) suggesting the stability of the genomes and the relationship among these L. monocytogenes strains has not been influenced by phages.The concatenated sequences of the probe-sets (present/absent) were also examined using Neighbor-net in Splitstree program L. monocytogenes genomes, is unique in 10 strains belonging to the ECI Currently, serotype 4b strains are divided into four ECs in which each of them are harboring unique probe-sets , S7, S8.L. monocytogenes genomes are very similar (syntenic) and most of the differences are due to phage genomes and transposable elements as well as SNPs L. monocytogenes may not require many genetic elements to adapt to different environments and exhibit different virulence attributes as suggested by Nelson et al.comK prophage in L. monocytogenes for niche-specific adaptation, biofilm formation and persistence has been recently demonstrated L. monocytogenes.Previous study involving the whole genome comparison between the serotypes 1/2a and 4b strains revealed that Based on the genomic profiles of 31 different strains representing serotypes 1/2b and 4b , both FG and Inv listeriosis strains from matched pairs of food and clinical isolates are more similar closely related than to those from the different outbreaks . HoweverL. monocytogenes genomes from the public databases and genomic analysis of L. monocytogenes outbreak strains using this GeneChip. Gene detection methods using the MAS5.0 algorithm to identify gene presence and absence have been optimized for our GeneChip based on known sequences. The numbers of present genes called may exceed the true numbers of genes in L. monocytogenes genomes due to redundancy of probes within probe-sets as a result of our microarray design in order to study global diversity of L. monocytogenes genomes. We showed that the results obtained from either RMA or MAS5.0 approaches are consistent, suggesting the reliability and validity of the data. The gene content analysis using the phylogenetically informative sites revealed that L. monocytogenes strains are divided into three distinct groups correlating with the serotypes. Strains belonging to the serotype 1/2a are more genetically distant from those of 1/2b and 4b strains. Within the same serotype, strains that belong to the same ECs are clustered closely together. Comparison of the serotype 4b, ECIV FG and Inv strains indicated that the majority of the uniquely present probe-sets in FG isolates are phage-related genes suggesting that phages may play a significant role in the divergence of these two pathotypes and may play important roles in pathotype determination. We showed that our high density microarray can identify genetic contents that are specific to serotypes, pathotypes and epidemic clones. Our results also indicated that microarray based genotypic analysis can be a very important tool in outbreak investigation as closely related members of the same serotype as well as the food and clinical isolates derived from outbreaks can further be differentiated from each other.In conclusion, we report the design of a microarray GeneChip consisting of 24 Table S1Listeria monocytogenes strains used in this study.(DOCX)Click here for additional data file.Table S2Probe-sets uniquely present in the serotype 1/2a strains.(DOCX)Click here for additional data file.Table S3Probe-sets uniquely present in the serotype 1/2b strains.(DOCX)Click here for additional data file.Table S4Probe-sets uniquely present in the serotype 4b strains.(DOCX)Click here for additional data file.Table S5Probe-sets uniquely present in the serotype 4b, epidemic clone I.(DOCX)Click here for additional data file.Table S6Probe-sets uniquely present in the serotype 4b, epidemic clone II.(DOCX)Click here for additional data file.Table S7Probe-sets uniquely present in the serotype 4b, epidemic clone IV.(DOCX)Click here for additional data file.Table S8Probe-sets uniquely present in the serotype 4b, epidemic clone V.(DOCX)Click here for additional data file.Table S9Probe-sets uniquely present in the serotype 1/2b strains that cause invasive listeriosis.(DOCX)Click here for additional data file.Table S10Probe-sets uniquely present in the serotype 1/2b strains that cause febrile gastroenteritis listeriosis.(DOCX)Click here for additional data file.Table S11Probe-sets uniquely present in the serotype 4b, ECIV strains that cause invasive listeriosis.(DOCX)Click here for additional data file.Table S12Probe-sets uniquely present in the serotype 4b, ECIV strains that cause febrile gastroenteritis listeriosis.(DOCX)Click here for additional data file."}
{"text": "Listeria monocytogenes while investigating a foodborne outbreak of listeriosis associated with consumption of cantaloupe during 2011 in the United States. Comparative analyses of strains worldwide are essential to identification of novel outbreak strains and epidemic clones.We identified a novel serotype 1/2a outbreak strain and 2 novel epidemic clones of  The Food and Drug Administration (FDA) inspected the involved farm; outbreak strains matching 3 of the PFGE profiles from clinical samples were isolated from washed cantaloupes and various environmental surfaces within the facility (www.fda.gov/Food/FoodSafety/CORENetwork/ucm272372.htm#report).In September 2011, the Centers for Disease Control and Prevention (CDC) in Atlanta, GA, was notified of an increase of listeriosis cases linked to eating cantaloupe  sequences were demonstrated to be unique to EC strains of L. monocytogenes in individual facilities that processed ready-to-eat meat and poultry or in multiple plants manufacturing similar ready-to-eat products  of comK prophage JF sequencing   and by FDA according to the FDA Bacteriological Analytical Manual . Isolates were serotyped by using commercial antisera  and analyzed by PFGE (CDC confirmed identification of  by PFGE . The Tecwww.pasteur.fr/mlst). MVLST data were obtained as described  and 3 USDA isolates (accession nos. JQ750615\u2013JQ750618).Isolates were grown overnight in tryptic soy broth with yeast extract at 37\u00b0C, and DNA was extracted by using the Ultra Clean Microbial DNA Isolation Kit  for isolates from CDC and USDA and the Wizard Genomic DNA Purification Kit  for isolates from FDA. Sequence types (STs) identified by using MLST were assigned as described  belonged to the globally disseminated ST5 ,. Becausehage JFs . PT11/11hage JFs . FurtherinlC from 3 other serotype 1/2a VT61 isolates  associated with the 2002 cheese-associated listeriosis outbreak in Canada  from cantaloupe differed by 1 single nucleotide polymorphism in  Canada ,. L2625 w,Listeria isolates from cantaloupe displayed 2 highly similar PFGE profiles and STs, and the same serotype, ApaI PFGE pattern, and VT  and L2676, LIS0072, and LIS0087  from cantaloupe samples shared the same VT (VT56) as isolates 10-0813 and 10-0812 associated with a listeriosis outbreak related to whipping cream during 2000 in Canada ,. These L, and VT . Isolaten Canada . The JF n Canada . These in Canada . HoweverL. monocytogenes strains, of the same genetic lineage as serotype 1/2b strains, reportedly survived and grew substantially better in mixed-serotype biofilms containing a specific strain of serotype 1/2a (Different clones, particularly ECVI and ECVII, might have cocolonized niches or harborage sites within the cantaloupe processing facility, possibly explaining the multiple strains associated with this outbreak. Serotype 4b ,L. monocytogenes.Six of the 7 currently identified ECs were found at some point in 1 or both of the US chicken processing plants included in the study . ListeriL. monocytogenes strains involved in the 2011 multistate cantaloupe-associated outbreak was greatly enhanced by the use of subtyping markers with different levels of epidemiologic resolution. Particularly, MVLST enabled the detection of 1 novel 1/2a outbreak strain and 2 novel ECs of L. monocytogenes. In contrast to focusing on isolates from a single outbreak (The molecular epidemiology of Listeria monocytogenes encountered in clinical and food or environment samples collected by the Centers for Disease Control and Prevention during a 2011 L. monocytogenes outbreak related to cantaloupe.Number of isolates of"}
{"text": "Background: The development of left and right superior temporal gyrus (STG) 50\u2009ms (M50) and 100\u2009ms (M100) auditory responses in typically developing (TD) children and in children with autism spectrum disorder (ASD) was examined. Reflecting differential development of primary/secondary auditory areas and supporting previous studies, it was hypothesized that whereas left and right M50 STG responses would be observed equally often in younger and older children, left and right M100 STG responses would more often be absent in younger than older children. In ASD, delayed neurodevelopment would be indicated via the observation of a greater proportion of ASD than TD subjects showing missing M100 but not M50 responses in both age groups. Missing M100 responses would be observed primarily in children with ASD with language impairment (ASD\u2009+\u2009LI) .Methods: Thirty-five TD controls, 63 ASD without language impairment (ASD\u2009\u2212\u2009LI), and 38 ASD\u2009+\u2009LI were recruited. Binaural tones were presented. The presence or absence of a STG M50 and M100 was scored. Subjects were grouped into younger (6\u201310\u2009years old) and older groups (11\u201315\u2009years old).Results: Although M50 responses were observed equally often in older and younger subjects and equally often in TD and ASD, left and right M50 responses were delayed in ASD\u2009\u2212\u2009LI and ASD\u2009+\u2009LI. Group comparisons showed that in younger subjects M100 responses were observed more often in TD than ASD\u2009+\u2009LI , with no differences between TD and ASD\u2009\u2212\u2009LI  or between ASD\u2009\u2212\u2009LI and ASD\u2009+\u2009LI . In older subjects, whereas no differences were observed between TD and ASD\u2009+\u2009LI, responses were observed more often in ASD\u2009\u2212\u2009LI than ASD\u2009+\u2009LI. Findings were similar when splitting the ASD group into lower- and higher-cognitive functioning groups.Conclusion: Although present in all groups, M50 responses were delayed in ASD. Examining the TD data, findings indicated that by 11\u2009years, a right M100 should be observed in 100% of subjects and a left M100 in 80% of subjects. Thus, by 11\u2009years, lack of a left and especially right M100 offers neurobiological insight into sensory processing that may underlie language or cognitive impairment. Autism spectrum disorders (ASD) are a set of developmental disorders characterized by social impairments, stereotypical behaviors, and deficits in communication. As a childhood disorder, an understanding of brain abnormalities in ASD requires an examination of brain processes in infants, toddlers, and young and older school-aged children with ASD. A growing number of electroencephalography (EEG) and magnetoencephalography (MEG) studies report auditory abnormalities in children with ASD. Findings include delayed superior temporal gyrus (STG) auditory 100\u2009ms responses in children with ASD  children  and M100 (MEG) are the most prominent deflections of the auditory event-related potential (EEG) or field (MEG), evolving with a peak latency of about 100\u2009ms after stimulus onset  is also often seen. The relevant MEG literature points to STG as the M50 generator  peak latency in children 5\u20136\u2009years of age ~85\u201395\u2009ms  .Diagnoses of ASD were determined prior to recruitment based on the child\u2019s performance during clinical interviews, their documentation of DSM-IV criteria for ASD, and results from tests such as the Childhood Autism Rating Scale and the autism diagnostic observation schedule (ADOS). Advertisements through local newspapers and pediatric practices within the Children\u2019s Hospital of Philadelphia (CHOP) primary care network were utilized for recruitment of TD controls.The subjects\u2019 first session at CHOP included clinical and diagnostic neuropsychological testing by a licensed child psychologist with expertise in autism (Lisa Blaskey) to ensure that all subjects met the minimum criteria for inclusion and to further confirm diagnoses of ASD, particularly by utilizing the ADOS, Social Responsiveness Scale (SRS), Krug Asperger\u2019s Disorder Index (KADI), and Social Communication Questionnaire (SCQ). For confirmation of the ASD diagnosis, all children had to exceed established cut-offs on both the ADOS and SCQ. Subjects one point below cut-off for ADOS scores were permitted entry into the study as long as they exceeded cut-offs on at least two parent questionnaires. In the rare event that diagnosis could not be confirmed via use of the ADOS and parent questionnaires alone, the autism diagnostic interview-revised (ADI-R) was administered to provide final clarification of diagnosis.For testing language impairment, all subjects were evaluated with the clinical evaluation of language fundamentals \u2013 fourth edition (CELF-4). The ASD sample was divided into ASD without language impairment (ASD\u2009\u2212\u2009LI) and ASD\u2009+\u2009LI groups. The ASD\u2009+\u2009LI group included subjects scoring at or below the 16th percentile (SS\u2009<\u200985) on the CELF-4 Core Language Index. All subjects scored at or above the 5th percentile (SS\u2009>\u200975) on the perceptual reasoning index (PRI) of the Wechsler Intelligence Scale for Children-IV (WISC-IV). The WISC-IV verbal comprehension index (VCI) was also obtained.The total number of subjects included 35 TD and 101 ASD . Although analyzing data from a different task, the present sample includes several, although not all, of the subjects reported in Roberts et al.  , an 800\u2009ms ISI, a second 50\u2009ms tone , and a 2350\u2009ms (\u00b1100) inter-trial interval. A total of 120 tone pairs were presented. The present study reports on S1 \u2013 the auditory response occurring after the long inter-trial interval and thus with the greatest recovery period. To obtain a response with sufficient trials, the S1 average included 1000 and 2000\u2009Hz tones.Stimuli consisted of 1000 and 2000\u2009Hz tones presented using Eprime v1.1. Tones were presented via a sound pressure transducer and sound conduction tubing to the subject\u2019s peripheral auditory canal via ear-tip inserts . Prior to data acquisition, 1000\u2009Hz tones of 300\u2009ms duration and 10\u2009ms rise time were presented binaurally and incrementally until reaching auditory threshold for each ear. Tones were presented at 45\u2009dB sensation level above threshold. Each trial consisted of a 50\u2009ms tone  in a magnetically shielded room. Prior to data acquisition, three head-position indicator coils were attached to the subject\u2019s scalp at the nasion, left-, and right-preauricular points, providing continuous specification on head position and orientation in relation to the MEG sensors. A movie (without sound) was displayed to prevent fatigue.Electrodes were attached to the left and right clavicles for electrocardiogram recordings (ECG) and to the bipolar oblique (upper and lower left sites) for electro-oculogram recordings (EOG). A band-pass filter (0.03\u2013150\u2009Hz) was placed over the EOG, ECG, and MEG signals, which were then digitized at 1200\u2009Hz with third order gradiometer environmental noise reduction over the MEG data.F\u2009=\u20098.82, p\u2009<\u20090.001, the difference between groups in the mean number of trials was small: TD mean of 110 trials (range 83\u2013119)\u2009=\u2009ASD\u2009\u2212\u2009LI mean of 107 trials (range 86\u2013119)\u2009>\u2009ASD\u2009+\u2009LI mean\u2009=\u2009101 trials (range 81\u2013116).Artifact correction was applied to remove eye-blink and cardiac activity  using a model with multiple sources . In particular, a M100 was scored if the magnetic flux topography were characteristic of the M100 response, was preceded by M50 , and followed by M200 , and with source strength greater than baseline. In the present study, M50 was operationally defined as the first reversal in magnetic-field topography preceding M100 (or M200 if M100 not present). As reported below, in many subjects, a left- or right-hemisphere M100 response was not observed. For these subjects, left and right STG dipoles were oriented at the maximum of M50. If neither a M50 nor M100 was observed, the dipole was oriented at M200. Identification of auditory responses and orientation of the STG dipoles were done blind to group.p\u2009>\u20090.05]. Examining all subjects, maximum head motion during the recording was greater in younger than older subjects .Of the subjects examined, 18 subjects  did not have observable M50, M100, or M200 responses in the left- or right-hemisphere. Lack of an observable auditory response in these subjects was due to large metal artifact or poor compliance. Data from these subjects was excluded. Examining only the subjects with an identifiable auditory response, goodness-of-fit values (average from the start of M50 to M200) did not differ between the TD and ASD groups [TD\u2009=\u200994% (SD\u2009=\u20092.28), ASD\u2009=\u200993% (SD\u2009=\u20093.00); In subjects with usable data , epochs were defined from the continuous recording: 500\u2009ms before the first tone to 500\u2009ms after the first tone. When a M50 or M100 response was observed, left and right M50 (35\u2013120\u2009ms) and M100 (80\u2013185\u2009ms) latency data were calculated from the largest point in the scoring windows using in-house MATLAB software after subtraction of prestimulus baseline activity. Given that in many subjects the M200 was of long duration and without a clear peak, M200 responses were simply scored as present or absent, with M200 defined as a sustained response occurring after the M100 interval  and showing a magnetic-field topography similar to M100.t-tests examined group differences in age, CELF-4 scores, SRS, and IQ scores. For between-subject analyses, chi-square tests examined group differences in the presence or absence of a M50, M100, and M200 response . For within-subject analyses, McNemar tests were used , hemisphere, and group\u2009\u00d7\u2009hemisphere differences in latency. To examine how M50 and M100 latency differs as a function of group and age, hierarchical regression was run entering age first, diagnosis second, and their interaction last, with M50 or M100 latency as the dependent variable.As shown in Table p\u2009=\u20090.27). Collapsing across group and age, the presence or absence of M50 differed between the right (85.4%) and left-hemisphere . Given a significant difference between hemisphere but not age, simple effect analyses examined group differences for each hemisphere, collapsing across age group.Collapsing across group and hemisphere, M50 responses were observed equally often in older (88.3%) and younger subjects , TD (91.7%) and ASD\u2009\u2212\u2009LI , or ASD\u2009\u2212\u2009LI (96.8%) and ASD\u2009+\u2009LI . In the right-hemisphere, collapsing across age, no differences were observed between TD (88.9%) and ASD\u2009+\u2009LI , TD (88.9%) and ASD\u2009\u2212\u2009LI , or ASD\u2009\u2212\u2009LI (85.7%) and ASD\u2009+\u2009LI . Splitting at the median head motion value, within each diagnostic age group, chi-square analyses showed that the presence or absence of M50 did not differ between individuals with more versus less head motion.In the left-hemisphere, collapsing across age, no differences were observed between TD (91.7%) and ASD\u2009+\u2009LI . Collapsing across group and age, the presence or absence of M100 did not differ between the right (85%) and left-hemisphere . Given a significant difference between age groups but no hemisphere difference, simple effect analyses examined group differences for each age group collapsing across hemisphere.Collapsing across group and hemisphere, M100 responses were observed more often in older (89.4%) than younger subjects . No differences were observed between TD (90%) versus ASD\u2009\u2212\u2009LI  or between ASD\u2009\u2212\u2009LI (76%) and ASD\u2009+\u2009LI . In older subjects, collapsing across hemisphere, whereas no differences were observed between TD (91%) and ASD\u2009+\u2009LI , or between TD (91%) and ASD\u2009\u2212\u2009LI , M100 responses were observed more often in ASD\u2009\u2212\u2009LI (95%) than ASD\u2009+\u2009LI . Given similar differences in the presence/absence of M100 between TD versus ASD\u2009+\u2009LI and ASD\u2009\u2212\u2009LI versus ASD\u2009+\u2009LI, the non-significant TD versus ASD\u2009+\u2009LI finding is likely due to a smaller N in the TD group. Splitting at the median head motion value, within each diagnostic age group, chi-square analyses showed that the presence or absence of M100 did not differ between individuals with more versus less head motion.In younger subjects, collapsing across hemisphere, M100 responses were observed more often in TD (90%) than ASD\u2009+\u2009LI . Marginally significant differences were observed between TD (88%) versus PRI-low . No differences were observed between PRI-high (78.2%) and PRI-low . In older subjects, collapsing across hemisphere, no differences were observed between TD (91%) and PRI-high , between TD (91%) and PRI-low , or between PRI-high (91.3%) and PRI-low . Although not exactly the same, findings splitting children with ASD into low and high PRI groups were similar to findings splitting children with ASD into low and high CELF-4 groups. This is likely due to the fact that group membership remained largely unchanged. In particular, of the 25 ASD\u2009+\u2009LI subjects, 19 were in the lower half and 6 in the upper half of the PRI group, and of the 48 ASD\u2009\u2212\u2009LI subjects, 9 were in the lower half and 39 in the upper half of PRI group.To assess if any of the missing M100 findings were specific to language impairment, the above analyses were re-run dividing the children with ASD into low and high PRI groups (median split). In younger subjects, collapsing across hemisphere, M100 responses were observed equally often in TD (88%) and PRI-high . Collapsing across group and age, the presence or absence of M200 did not differ between the right (96.4%) and left-hemisphere . Given no significant differences between age or hemisphere, simple effect analyses examined group differences for each group collapsing across age and hemisphere.Collapsing across group and hemisphere, M200 responses were observed equally often in older (94.7%) and younger subjects , TD (97.2%) and ASD\u2009\u2212\u2009LI , or ASD\u2009\u2212\u2009LI (98.4%) and ASD\u2009+\u2009LI .No differences were observed between TD (97.2%) and ASD\u2009+\u2009LI \u2009=\u20094.59, p\u2009=\u20090.01, showed marginally earlier responses in TD (67\u2009ms) versus ASD\u2009\u2212\u2009LI  and significantly earlier responses in TD versus ASD\u2009+\u2009LI . The ASD groups did not differ (p\u2009=\u20090.74). The main effect of hemisphere, F\u2009=\u20090.11, p\u2009=\u20090.74, and the hemisphere by group interaction, F\u2009=\u20091.41, p\u2009=\u20090.25, were not significant. Findings were unchanged re-running analyses with age as a covariate. The pattern of findings was unchanged splitting the ASD group based on PRI, with the earliest M50 latencies in TD, second earliest in the PRI-high group, and the longest in the PRI-low group (PRI-low and PRI-high groups did not differ).ANOVAs examined hemisphere and group latency differences in the subjects with a M50 and M100 response. For M50, simple effect analyses of a main effect of group, F\u2009=\u200914.03, p\u2009<\u20090.001, showed earlier responses in the right (119\u2009ms) than left (126\u2009ms). There was no main effect of group, F\u2009=\u20091.42, p\u2009=\u20090.24. Although the interaction term was not significant, given the right-hemisphere TD versus ASD group latency findings in Roberts et al. \u2009=\u20091.06, p\u2009=\u20090.31, a significant group M100 latency difference observed in the right-hemisphere, F\u2009=\u20094.87, p\u2009=\u20090.03, indicated earlier M100 latencies in TD  versus ASD . Findings were unchanged re-running analyses with age as a covariate. Analyses also showed M100 right-hemisphere latency differences between TD and the combined PRI group and no right-hemisphere M100 latency differences between ASD PRI-low and PRI-high.For M100, a main effect of hemisphere, s et al. , post hoTable p\u2019s\u2009<\u20090.001). Added first, age accounted for a significant 16% variance in left M50 latency (p\u2009<\u20090.001) and a significant 11% variance in right M50 latency (p\u2009<\u20090.001). Added second, group added a marginally significant 2% variance in left M50 latency (p\u2009=\u20090.06) and a significant 4% variance in right M50 latency (p\u2009<\u20090.05). The group\u2009\u00d7\u2009age interaction was not significant in either hemisphere . Figure For each hemisphere, to examine how M50 and M100 latency differs as a function of group and age, hierarchical regressions were run in which age was entered first, diagnosis second, and their interaction last, with M50 or M100 latency as the dependent variable. For M50, in both hemispheres the full regression model  accounted for considerable variance in M50 latency . Added first, age accounted for a significant 28% variance in left M100 latency (p\u2009<\u20090.001) and a significant 25% variance in right M100 latency (p\u2009<\u20090.001). Added second, group added a non-significant 1% variance in left M100 latency (p\u2009>\u20090.05) and a marginally significant 3% variance in right M100 latency (p\u2009=\u20090.07). The group\u2009\u00d7\u2009age interaction was not significant in either hemisphere . Figure For M100, in both hemispheres, the full regression model  accounted for considerable variance in M100 latency , whereas grand average waveforms are shown for each ASD by year age group, grand averages were computed in 2-year steps for TD.Grand average left and right STG source waveforms are shown for ASD Figure  and TD  as a funExamination of the left (solid line) and right (dotted line) waveforms in the TD groups shows even in the youngest TD subjects a distinct left and right STG M100 . Examination of the ASD\u2009\u2212\u2009LI and TD plots shows that the left STG M100 appears later in time , and only develops into a clearly distinct component in older subjects. For example, only in the 14- to 15-year-old TD group is the left M100 peak clearly distinct from M200. This is in contrast to the right M100, where even in the 6- to 7-year-old TD group, M100 is distinct from M200. With regard to hemisphere differences, the source waveforms suggest that only in the oldest ASD\u2009\u2212\u2009LI and TD subjects is there, on average, similarity in latencies between the two hemispheres.Atypical auditory responses were observed in ASD. First, although STG M50 responses were observed in almost all subjects , however, have reported different group latency findings. Using a paired-click paradigm and examining P50 responses at electrode Cz, Orekhova et al.  observedpost hoc analyses examining only the right-hemisphere showed significant right-hemisphere M100 latency delays in ASD\u2009+\u2009LI and ASD\u2009\u2212\u2009LI versus TD  than the TD and ASD\u2009\u2212\u2009LI groups. Thus, lower cognitive ability rather than language impairment likely account for the present findings and thus the hypothesis that language impairment would best predict missing M100 responses was not supported. Finally, The above M50 and M100 abnormalities in ASD may reflect distinct auditory cortex abnormalities. Development of deep layers (lower layer III to layer VI) in auditory cortex occurs between 6\u2009months and 5\u2009years of age . Present findings also clearly indicate that developmental studies examining N100 activity at a single midline scalp site  are problematic as latency and amplitude measures at a single site in any individual could reflect activity from only a single hemisphere or, more likely, from some n et al.  and Sussn et al.  note than et al.  for a moIt is possible that present findings could be improved via co-registering each subject to their own MRI and then using anatomical constraints  to place dipoles, a strategy that will be examined in future studies. Although possible in older children, as it is often not possible to obtain structural MR data in infants and young children, for some studies it will still be necessary to apply techniques to align MEG data to template MRIs. In future studies examining younger children, the use of whole-brain infant and young child MEG systems will be preferred, with a smaller helmet size providing optimal signal-to-noise in younger children , MEG does not easily detect radial sources. As such, studies using EEG (or simultaneous EEG\u2009+\u2009MEG) are needed to examine radially oriented STG auditory sources (e.g., see Ponton et al., Finally, present findings as well as other studies indicate the need for longitudinal studies to more fully understand the development of auditory responses. For example, it has been reported that in some subjects, two M50 responses are observed. For example, using source modeling to examine left and right STG activity in children aged 7- to 16-years-old, Orekhova et al.  observedAlthough almost all TD and ASD subjects had a M50 response, M50 responses were delayed in ASD than TD bilaterally. Although M100 latencies were longer in the left- than right-hemisphere in TD, this delay was not so pronounced such that even young TD subjects had an identifiable left and right M100 by 6\u2009years of age. Whereas there was a significant increase in the presence of M100 responses in the older than younger ASD\u2009\u2212\u2009LI group, many individuals in the older ASD\u2009+\u2009LI group had a missing M100. Examining the TD data, present findings indicate that by 11\u2009years, a right M100 should be observed in 100% of subjects and a left M100 in 80% of subjects. Thus, by 11\u2009years old, if a long inter-trial interval is used, lack of a left and especially right M100 offers neurobiological insight into abnormal sensory processing that may underlie language or cognitive impairment in ASD.The Reviewer Elysa Jill Marco declares that despite having collaborated with the author Timothy P. L. Roberts on another project, the review process was handled objectively and no conflict of interest exists. The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.http://www.frontiersin.org/Journal/10.3389/fnhum.2014.00417/abstractThe Supplementary Material for this article can be found online at Click here for additional data file."}
{"text": "Background: Auditory processing and language impairments are prominent in children with autism spectrum disorder (ASD). The present study integrated diffusion MR measures of white-matter microstructure and magnetoencephalography (MEG) measures of cortical dynamics to investigate associations between brain structure and function within auditory and language systems in ASD. Based on previous findings, abnormal structure-function relationships in auditory and language systems in ASD were hypothesized.Methods: Evaluable neuroimaging data was obtained from 44 typically developing (TD) children (mean age 10.4 \u00b1 2.4 years) and 95 children with ASD (mean age 10.2 \u00b1 2.6 years). Diffusion MR tractography was used to delineate and quantitatively assess the auditory radiation and arcuate fasciculus segments of the auditory and language systems. MEG was used to measure (1) superior temporal gyrus auditory evoked M100 latency in response to pure-tone stimuli as an indicator of auditory system conduction velocity, and (2) auditory vowel-contrast mismatch field (MMF) latency as a passive probe of early linguistic processes.Results: Atypical development of white matter and cortical function, along with atypical lateralization, were present in ASD. In both auditory and language systems, white matter integrity and cortical electrophysiology were found to be coupled in typically developing children, with white matter microstructural features contributing significantly to electrophysiological response latencies. However, in ASD, we observed uncoupled structure-function relationships in both auditory and language systems. Regression analyses in ASD indicated that factors other than white-matter microstructure additionally contribute to the latency of neural evoked responses and ultimately behavior. Results also indicated that whereas delayed M100 is a marker for ASD severity, MMF delay is more associated with language impairment.Conclusion: Present findings suggest atypical development of primary auditory as well as auditory language systems in ASD. Findings demonstrate the need for additional multimodal studies to better characterize the different structural features  that contribute to brain activity, both in typical development and in ASD. Finally, the neural latency measures were found to be of clinical significance, with M100 associated with overall ASD severity, and with MMF latency associated with language performance. The etiology or, indeed, etiologies of autism spectrum disorder (ASD) is currently unknown. It is hypothesized that alterations to brain structure and function contribute to the clinical symptoms common to ASD. Given the high rate of occurrence of communication and language impairments in ASD, research has focused on the brain regions associated with basic auditory processes and more complex language skills, with prior imaging studies showing alterations in temporal lobe structure, connectivity and function  measures of white-matter microstructure with magnetoencephalography (MEG) measures of cortical neural dynamics. Diffusion MRI is sensitive to microstructural properties of white matter such as axon density and myelination and has been used in quantitative studies of the superior temporal gyrus and arcuate fasciculus in ASD  of the thalamus to the primary/secondary auditory cortex of the superior temporal gyrus (STG). The second white matter pathway examined was the arcuate fasciculus (AF), a tract from the STG to higher-order language areas. These circuits represent relatively early stages of connection relevant for auditory processing and then later stages relevant for language functioning. To this end, the first functional MEG measure examined was the 100 ms (M100) STG auditory response. Auditory evoked M100 latency has been shown to be due, in part, to thalamocortical conduction velocity along the auditory radiation  children, with these associations less evident in children with ASD .Children with a prior clinical ASD diagnosis were recruited from the Regional Autism Center of The Children's Hospital of Philadelphia (CHOP) and from local parent support groups. During the research visit, clinical and diagnostic testing by licensed child psychologists were performed to confirm ASD diagnosis and to ensure that typically developing children met inclusion criteria. ASD diagnosis was confirmed with the th percentile on the CELF-4. All subjects scored at or above the second percentile (SS > 70) on either the Perceptual Reasoning Index (PRI) or the Verbal Comprehension Index (VCI) of the Wechsler Intelligence Scale for Children-IV (WISC-IV). Detailed inclusion and exclusion criteria of the ASD and TD groups have been described previously  = 0.35, p = 0.70]. Of the children with ASD with diagnostic language scores, 35 were classified as ASD with language impairment  and 56 as ASD without language impairment . Although, the difference in age between ASD/+LI and ASD/-LI was significant , the age difference was small. Given the challenges of multimodal imaging, complete diffusion MR and MEG datasets were not available for all subjects. In particular, 28 participants had evaluable HARDI and DTI for measurement of the auditory radiation as well as evaluable M100 latency. Eighty-two participants had evaluable MMF latency and 78 participants had evaluable DTI for measurement of the arcuate fasciculus.The pool of participants with evaluable neuroimaging data for this multimodal study included 44 TD (mean age 10.4 \u00b1 2.4 years) and 95 ASD (mean age 10.2 \u00b1 2.6 years). MEG and DTI findings from a smaller subset of these participants have been previously reported . The details of the M100 and MMF tasks and data processing have been previously described . HARDI and conventional DTI were performed. Whole-brain HARDI acquisition included 64 gradient directions at a priori hypothesis to reduce statistical confounds associated with multiple comparisons in more comprehensive explorations . A single \u201ceffective\u201d M100 latency for each participant's left and right STG was calculated with a linear mixed model to reduce the number of M100 latency analyses  = 9.1, p = 0.004; RD: F = 11.8, p = 0.001; FA: F = 6.63, p = 0.013]. The main effect of group was not significant for any DTI parameter. Significant age by group interactions for FA and RD , indicated group differences in maturation. In particular, collapsing across hemisphere, FA increased by 0.013 per year  in TD vs. 0.001 per year  in ASD, and RD decreased by 15.2 \u00d7 10\u22126 mm2/s/year  in TD vs. 3.04 \u00d7 10\u22126 mm2/s/year  in ASD.Each DTI parameter was linearly modeled with main effects of group, age, and hemisphere, along with each two-way interaction term. Auditory radiation MD and RD decreased with age and FA increased with age, indicating white matter maturation across both ASD and TD in the studied age range , RD , and AD . As depicted in Figure left hemisphere FA increased at a faster rate in the TD than ASD, driving the overall group by age difference. The slower maturation of FA in ASD was likely due to a slower rate of RD decrease in ASD vs. TD. No differences in rate of maturation were detected in the right hemisphere.Although, there was no significant group by hemisphere by age interaction, given overall group maturation rate differences and  FA . M100 did not predict language ability (CELF-4). A mean adjusted leverage plot was used to isolate and visualize the relationship between SRS and M100 latency  were modeled with M100 latency, age, and hemisphere as factors. M100 was a significant predictor of SRS [F1, 7 = 6.1, F = 4.7, p = 0.04, showed that increased RD was related to longer M100 latencies (slope = 15.7 \u00d7 104 ms * s/mm2). A similar trend was observed between MD and M100 latency, F = 3.4, p = 0.08. Analyzing groups separately showed this structure-function relationship was primarily driven by the TD group: RD was positively correlated with M100 in TD, F = 6.2, p = 0.04 , but not in ASD, F = 0.8, p = 0.4 (slope = 10.4 \u00d7 104 ms * s/mm2).For the multimodal analysis, to account for additional variance in the M100 latency, a linear model of each participant's effective M100 latency with average DTI parameters and group as effects was constructed. Age was not included given the above results indicating that both DTI and M100 measures show age dependence and may have interdependent maturational trajectories. A main effect of RD, p's < 0.005 with Tukey\u2013Kramer Adjustment for multiple comparisons). MMF latency was modeled with group, stimulus type (vowel /a/ or /u/), and hemisphere as fixed effects and subject as a random effect. Additionally, PRI was considered as a potential confounding covariate.Given the reported relationship between MMF latency and language ability, group comparisons of CELF-4 and MMF latency included three groups: ASD with and without language impairment  as well as TD. As expected, mean CELF-4 Core Language Index (CLI) scores were significantly different for all pairwise group comparisons  = 4.2, p = 0.02 . MMF latency did not differ with respect to stimulus type or hemisphere and was not associated with PRI or age. Within the combined ASD group, MMF latency (latency collapsed across hemisphere) correlated with CELF-4 CLI, F = 8.4, p = 0.01  = 7.5, p = 0.01 in left; F = 6.1, p = 0.01 in right. No significant association between MMF latency and language ability (CELF-4 CLI) was observed in TD. In contrast to M100 latency, no significant association between MMF latency and SRS was observed in ASD or TD.There was a main effect of group on MMF latency, F = 4.0, p = 0.05 (slope = 0.0024/year) and TD groups, F = 21.8, p < 0.0001 (slope = 0.0052/year). MD decreased with age in the ASD, F = 22.4, p < 0.0001 (slope = \u22120.052 \u00d7 10\u22124 mm2/s/year) and TD groups F = 28.6, p < 0.0001 (slope = \u22120.076 \u00d7 10\u22124 mm2/s/year). Group by age interactions were not significant, indicating no detectable group difference in FA or MD maturation slopes. DTI parameters (with age as a covariate) were not predictive of CELF-4 CLI in either ASD or TD.To examine the role of white-matter microstructure on MMF latency as well as language ability, arcuate fasciculus DTI parameters were measured. Arcuate fasciculus FA increased with age in the ASD, F = 4.2, p = 0.04, indicated associations between FA and MMF latency. Explored in each group, FA predicted MMF in TD, F = 4.60, p = 0.04  or in the ASD/+LI (p = 0.4) or ASD/-LI (p = 0.4) subgroups. No associations with MMF latency were observed for the other DTI parameters .To explore contributions to MMF latency by arcuate fasciculus microstructure, linear mixed models with MMF latency as the dependent variable were constructed with DTI parameter, PRI, group (ASD and TD), age, stimulus type, and hemisphere as main effects and subject as the random effect. A main effect of FA, 4 Figure , and notThe present multimodal and multi-circuit study examined associations between brain structure and function in auditory and language areas. In both auditory and language systems, white-matter integrity, and cortical electrophysiology were found to be coupled in TD, with white-matter microstructural features contributing to M100 and MMF latency. However, in ASD, these structure\u2013function relationships were less obvious or uncoupled. Results also suggested that the neural latency measures are of clinical significance, with a delayed M100 associated with increased ASD severity (as measured with SRS) and a delayed MMF delay associated with greater language impairment (CELF-4 CLI).Accurate and rapid encoding of auditory information is critical for receptive language. A prior study of auditory processing observed abnormal brainstem and cortical electrophysiology in children with language learning problems , supported the hypothesis that MMF latency is an index of language impairment rather than ASD severity or intellectual ability  as well as later-stage auditory processing (MMF) in ASD. As white-matter microstructure did not explain all the variance in M100 and MMF latency, other aspects of brain structure clearly contribute to age-related changes in M100 and MMF latency. Future multimodal studies examining a broader array of brain structure measures  are needed to more fully understand auditory encoding impairments in children with ASD. Finally, the neural latency measures were found to be of clinical significance, with M100 associated with SRS (but not CELF-4 CLI) indicating that slow auditory processing is an indicator of overall ASD severity, and with MMF latency associated with language performance.JB, TR, JE, SL, LB, and EK were involved in study conception and design. All authors were involved in acquisition of MRI, MEG, or clinical scores. JB, TR, JE, LB, EK, JD, and MK were involved in the interpretation or analysis of data. JB, JE, and TR drafted the manuscript. All authors approved the final manuscript.This work was supported by K01MH096091, R01DC008871-07, and the CHOP/UPenn IDDRC grant U54 HD086984.JB is a consultant for McGowan Associates. The other authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer AM and the handling Editor declared their shared affiliation, and the handling Editor states that the process nevertheless met the standards of a fair and objective review."}
{"text": "Findings of auditory abnormalities in children with autism spectrum disorder (ASD) include delayed superior temporal gyrus auditory responses, pre- and post-stimulus superior temporal gyrus (STG) auditory oscillatory abnormalities, and atypical hemispheric lateralization. These abnormalities are likely associated with abnormal brain maturation. To better understand changes in brain activity as a function of age, the present study investigated associations between age and STG auditory time-domain and time-frequency neural activity.While 306-channel magnetoencephalography (MEG) data were recorded, 500- and 1000-Hz tones of 300-ms duration were binaurally presented. Evaluable data were obtained from 63 typically developing children (TDC) (6 to 14\u00a0years old) and 52 children with ASD (6 to 14\u00a0years old). T1-weighted structural MRI was obtained, and a source model created using single dipoles anatomically constrained to each participant\u2019s left and right STG. Using this source model, left and right 50-ms (M50), 100-ms (M100), and 200-ms (M200) time-domain and time-frequency measures  and inter-trial coherence (ITC)) were obtained.t tests showed a right STG M100 latency delay in ASD versus TDC . In the left and right STG, time-frequency analyses showed a greater pre- to post-stimulus increase in 4- to 16-Hz TP for both tones in ASD versus TDC after 150\u00a0ms. In the right STG, greater post-stimulus 4- to 16-Hz ITC for both tones was observed in TDC versus ASD after 200\u00a0ms. Analyses of age effects suggested M200 group differences that were due to a maturational delay in ASD, with left and right M200 decreasing with age in TDC but significantly less so in ASD. Additional evidence indicating delayed maturation of auditory cortex in ASD included atypical hemispheric functional asymmetries, including a right versus left M100 latency advantage in TDC but not ASD, and a stronger left than right M50 response in TDC but not ASD.Paired Present findings indicated maturational abnormalities in the development of primary/secondary auditory areas in children with ASD. It is hypothesized that a longitudinal investigation of the maturation of auditory network activity will indicate delayed development of each component of the auditory processing system in ASD.The online version of this article (doi:10.1186/s13229-015-0065-5) contains supplementary material, which is available to authorized users. Autism spectrum disorder (ASD) is a set of developmental disorders characterized by difficulties in social communication and social interaction and restricted, repetitive patterns of behavior, interests, or activities. Electroencephalography (EEG) and magnetoencephalography (MEG) studies consistently report auditory abnormalities in children with ASD. Findings include delayed superior temporal gyrus (STG) auditory responses \u20134, reducIn adults, N100 (EEG) and M100 (MEG) are the most prominent deflections of the auditory event-related potential (EEG) or field (MEG), evolving with a peak latency of about 100\u00a0ms after stimulus onset . NaaThe maturation of primary/secondary auditory cortex involves a complex interplay of auditory event-related components. In young children, the P/M50 is readily evoked  and withDelayed auditory responses have been observed in ASD. As an example, in an initial study from our laboratory, the right STG M100 auditory response was delayed by approximately 10\u00a0ms in children with ASD versus typically developing children (TDC) . This laNeural networks exhibit oscillatory activity over a wide range of frequencies: from delta-band activity (0 to 4\u00a0Hz) to at least gamma-band activity (approximately 30 to 50\u00a0Hz). Oscillatory activity observed in EEG/MEG recordings reflects synchronized neural activity that occurs over relatively short time periods (milliseconds). Oscillatory activity within specific frequency bands is one of the most promising candidate mechanisms associated with information processing  as The present study comprehensively investigated the maturation of auditory cortical responses in TDC and in children with ASD, examining auditory time-domain and time-frequency activity.N\u2009=\u20096), no M50 and M100 response in either the left or right hemisphere (N\u2009=\u20091), and no structural magnetic resonance imaging (MRI) (N\u2009=\u20094). Evaluable MEG data were obtained from 63 TDC children  and 52 children with ASD . Demographics are reported in Table\u00a0Of 126 examined participants, MEG data were excluded from five TDC and six children with ASD due to noise from dental metal artifacts (All participants were selected according to the following criteria: (1) no history of traumatic brain injury or other significant medical or neurological abnormality, (2) no active psychosis, (3) no MRI contraindications, and (4) no known drug or alcohol use prior to any study procedure. Members of the TDC group were evaluated by licensed clinical psychologists who ruled out the presence of DSM-IV-TR Axis I disorders based on clinical judgment, review of the child\u2019s medical history form, and parent interview. Current diagnosis of ASD was confirmed by expert clinical judgment based on NIH CPEA guidelines, including the Autism Diagnostic Observation Schedule\u2014Generic  and AutiIn the ASD group, 17 participants were being treated with ADHD medications , 3 participants treated with second-generation antipsychotics , 12 participants with antidepressants , and 1 participant with anxiolytics (Buspirone). No participants in the TDC group were taking psychotropic medications. The study was approved by the Children\u2019s Hospital of Philadelphia IRB, and all participants\u2019 families gave written consent.MEG data were recorded using a 306-channel Vector View system  with a sampling rate of 1000\u00a0Hz and a band-pass filter of 0.1 to 330\u00a0Hz. Electrooculogram (EOG)  and electrocardiogram (ECG) were also obtained. The participants\u2019 head position was monitored using four head position indicator (HPI) coils attached to the scalp.Stimuli consisted of 500- and 1000-Hz sinusoidal tones presented using Eprime v1.1. Tones were presented via a sound pressure transducer and sound conduction tubing to the participant\u2019s peripheral auditory canal via ear tip inserts . Prior to data acquisition, 1000-Hz tones of 300-ms duration and 10-ms rise time were presented binaurally and incrementally until reaching auditory threshold for each ear. Tones were presented at 45-dB sensation level above threshold. Each trial consisted of a 500- or 1000-Hz tone (300-ms duration) plus a 1000-ms (\u00b1100) inter-trial interval. A total of 125 tones per condition were presented. The 500- and 1000-Hz tones were separately analyzed. To minimize fatigue, during the auditory test, participants viewed (but did not listen to) a movie projected onto a screen.ps\u2009>\u20090.05.Following the MEG task, MEG data were corrected for head motion using MaxMove, and Maxfilter was used for noise reduction using a signal space separation method with a temporal extension (tSSS ). After 3).After the MEG session, structural magnetic resonance imaging (sMRI) provided T1-weighted, 3D MPRAGE anatomical images for source localization  as well as an additional 200+ points on the scalp and face were digitized for each participant using the probe position identification (PPI) system , and a transformation matrix that involved rotation and translation between the MEG and sMRI coordinate systems was obtained via a least-squares match of the PPI points to the surface of the scalp and face.For all participants, measures were obtained for the left and right 50-ms (M50), 100-ms (M100), and 200-ms (M200) response. The primary generator of the M50, M100, and M200 is well-modeled by a single dipole in the left and right Heschl\u2019s gyrus and surrounding regions , 36\u201338. Dipole orientations were obtained after applying a 2  to 55-Hz  band-pass filter. The presence of a M50 (35 to 125\u00a0ms) and M100 (80 to 195\u00a0ms) response was determined based on amplitude (greater than baseline), latency, and hemisphere ingoing and outgoing flux topography . These slightly extended M50 and M100 latency ranges allowed capturing responses in younger children. M200 was operationally defined as the response showing a magnetic field topography similar to M100 but occurring after M100. As reported below, in many participants, a M100 response was not observed. In such instances, the M200 was defined as a response occurring later than 200\u00a0ms and with the appropriate magnetic field topography. Of note, as detailed in Edgar et al. [When a M50 or M100 response was observed, left and right M50 (35\u2013125\u00a0ms) and M100 (80\u2013195\u00a0ms) amplitude was measured at the signal maxima and latency the time at which this maximum occurred, within each latency interval. Examination of M200 source waveforms indicated that for most participants, the M200 response occurred between 200 and 325\u00a0ms and that for many participants, the M200 response was broad  and often not very \u201cpeaked\u201d. Due to this feature, M200 latency was not scored. For M200 amplitude, for each participant, in the 200- to 325-ms window, a source strength measure integrated over the full-width at half-max (FWHM) of the M200 response rather than selecting a single timepoint amplitude measure. For left and right STG M50, M100, and M200, the amplitude measure was obtained after baseline correction (\u2212400 to \u221225\u00a0ms).The calculation of single-trial phase and magnitude for the left and right sources used procedures outlined in Hoechstetter et al.  where inTotal power and phase-locking measures were extracted from the single-trial complex time-frequency matrix. Total power was calculated by averaging the time-frequency spectra of each MEG epoch. When baseline power is subtracted, post-stimulus total power (TP) assesses the post-stimulus increase in oscillatory activity. A measure of phase-locking referred to as ITC was also computed. ITC is a normalized measure assessing the trial-to-trial similarity of oscillatory activity, with ITC\u2009=\u20091 reflecting no phase variability and ITC\u2009=\u20090 reflecting maximal phase variability across trials. Time-frequency measures were obtained using the M50, M100, and M200 source models.t test group comparisons, family-wise error was controlled using cluster size thresholds derived from Monte Carlo simulations  package (AFNI AlphaSim) and clustering performed with custom MatLab software.For the TP and ITC time-frequency .g., see , 28). ThFor all following analyses, participants with values more than 2.5 standard deviations were excluded .As shown in Table\u00a0ps >0.05). For the 500- and 1000-Hz tones, M200 GOF was slightly lower in ASD (500\u00a0Hz\u2009=\u200976\u00a0% and 1000\u00a0Hz\u2009=\u200974\u00a0%) versus TDC . As described below, the slightly lower M200 GOF in ASD was likely due to more extended and less synchronous M200 responses in ASD versus TDC.For the 500- and 1000-Hz tones, bilateral M50 and M100 goodness-of-fit  did not differ between ASD and TDC . As shown in Table\u00a0ps <0.001). Analyses indicated similar age dependence of the presence of a M100 response in TDC versus ASD. The presence of a M200 response is not reported in Table\u00a0As shown in Table\u00a0ANOVAs examined hemisphere, frequency, and group latency differences in the participants with M50, M100, or M200 responses.F\u2009=\u200916.49, p\u2009<\u20090.001, showed earlier M50 responses in the right versus left STG. A main effect of frequency, F\u2009=\u200967.01, p\u2009<\u20090.001, showed earlier M50 responses for 1000-Hz versus 500-Hz tones.A main effect of hemisphere, F\u2009=\u20093.02, p\u2009=\u20090.09, showed earlier right than left response latencies in TDC (p\u2009<\u20090.001) and similar right and left response latencies in ASD (p\u2009>\u20090.05).A trending group \u00d7 hemisphere interaction, t tests showed the expected right hemisphere M100 latency delay in ASD versus TDC .Table\u00a0ANOVAs examined hemisphere, frequency, and group amplitude differences in the participants with M50, M100, or M200 responses.F\u2009=\u20096.23, p\u2009<\u20090.01, indicated stronger left than right M50 responses in TDC but not ASD (p\u2009<\u20090.01). A hemisphere \u00d7 frequency interaction, F\u2009=\u20095.34, p\u2009<\u20090.05, indicated stronger 1000- than 500-Hz responses in the right (p\u2009<\u20090.001) and similarly strong 1000- and 500-Hz responses in the left (p\u2009>\u20090.05).A group \u00d7 hemisphere interaction, F\u2009=\u20094.82, p\u2009<\u20090.05, indicated stronger M100 responses to 1000- than 500-Hz tones.A main effect of frequency, F\u2009=\u200930.12, p\u2009<\u20090.001, indicated stronger M200 responses in the right versus left. A trending main effect of group, F\u2009=\u20092.68, p\u2009=\u20090.10, indicated stronger M200 responses in TDC versus ASD. Figure\u00a0A main effect of hemisphere, F,108\u2009=\u200930Given absent M100 responses in many participants, time-frequency analyses were not performed for M100 sources. Given M200 amplitude group differences bilaterally, to reduce the number of tests, time-frequency analyses were performed only for M200 sources \u2009=\u20093.81, p\u2009<\u20090.05, indicated greater TP for the 500- versus 1000-Hz tones. Simple effect analyses of a hemisphere by group interaction, F\u2009=\u20097.60, p\u2009<\u20090.01, showed greater left STG TP in ASD versus TDC (p\u2009<\u20090.05) and greater right than left TP in TDC (p\u2009<\u20090.01) but not ASD (p\u2009>\u20090.05). For ITC, simple effect analyses of a hemisphere by group interaction, F\u2009=\u200915.43, p\u2009<\u20090.001, showed greater right STG ITC in TDC versus ASD (p\u2009<\u20090.05) as well as greater right than left ITC in TDC (p\u2009<\u20090.001) but not ASD (p\u2009>\u20090.05). Given no group \u00d7 condition interactions for TP or ITC, to reduce the number of tests, all further analyses were performed collapsing across 500- and 1000-Hz conditions. Table\u00a0To further explore the post-stimulus low-frequency group differences, ANOVAs examined hemisphere, condition , and group low-frequency differences using a single measure per hemisphere identified from the family-wise corrected statistics maps, computed for TP as the average in a 150- to 400-ms and 4- to 16-Hz region of interest (ROI), and computed for ITC as the average in a 200- to 300-ms and 4- to 16-Hz ROI. For TP, a main effect of condition, Given the pre-stimulus TDC and ASD group findings reported in Edgar et al. , a pre-sF\u2009=\u200950.16, p\u2009<\u20090.01, indicated that less pre-stimulus activity was associated with increased post-stimulus TP in both groups (r\u2009=\u20090.21). In the left, a significant second block main effect, F\u2009=\u20093.87, p\u2009<\u20090.05, indicated that left TP post-stimulus group differences remained even after removing variance associated with pre-stimulus activity. In the left, a significant first block main effect, F\u2009=\u200912.29, p\u2009<\u20090.001, indicated that less pre-stimulus activity was associated with increased ITC in both groups (r\u2009=\u20090.32). The left STG findings remained even after removing variance in post-stimulus activity associated with age. Age\u2009+\u2009pre-stimulus activity together explained 13 and 25\u00a0% of the variance in left TP and ITC, respectively. Right pre-stimulus activity was not associated with right TP or ITC. A significant second block main effect, F\u2009=\u20094.05, p\u2009<\u20090.05, indicated that right ITC post-stimulus group differences remained even after removing variance associated with pre-stimulus activity.Given previous findings that pre-stimulus activity predicts post-stimulus STG auditory processes , regressr2\u2009=\u20090.24) versus ASD (r2\u2009=\u20090.02), the interaction term was not significant, and as detailed in the \u201cFigure\u00a0ps >0.23) indicated that increased post-stimulus TP was associated with increased post-stimulus ITC in both groups.An additional set of analyses examined associations between post-stimulus TP and ITC (using the above defined M200 time-frequency ROIs). Given the above reported age, pre- and post-stimulus activity associations, for each hemisphere, a regression model examined whether post-stimulus TP predicted variance in post-stimulus ITC after removing variance associated with pre-stimulus activity and age . Post-stimulus TP predicted unique variance in left (23\u00a0%) and right (44\u00a0%) post-stimulus ITC. This positive association likely reflects the fact that (1) post-stimulus TP is computed as a percent change from pre-stimulus activity, with less pre-stimulus activity \u201callowing\u201d a greater pre- to post-stimulus change in power and (2) phase is more accurately estimated a higher versus lower signal-to-noise and thus ITC more accurately estimated in those individuals with stronger versus weaker post-stimulus activity . Non-sigThe present study examined the maturation of STG auditory responses in ASD. Cross-sectional findings indicated an array of abnormalities in the development of primary/secondary auditory function in children with ASD, including delayed right STG M100 responses and a reduced rate of change (and perhaps even no change) in left and right STG M200 activity as a function of age. Additional evidence indicating delayed auditory cortex maturation in ASD included atypical hemispheric functional asymmetries, including a right versus left M100 latency advantage in TDC but not ASD, and a stronger left than right M50 response in TDC but not ASD. The pattern of findings suggests the need for longitudinal studies investigating the maturation of auditory network activity in ASD, with the hypothesis that results from these studies will demonstrate delayed development of each component of the auditory processing system.In the present study, a novel, and perhaps the most robust finding, was abnormal maturation of the networks supporting low-frequency (4 to 16\u00a0Hz) M200 neural activity in ASD versus TDC. In particular, whereas in TDC, low-frequency M200 TP and ITC decreased as a function of age (resulting in a decreased M200 time-domain response over the course of development); these age-associated TP and ITC changes were less evident or were absent in ASD see Fig.\u00a0. There wEEG studies examining typically developing children show that N2 amplitude decreases as a function of age , 47, 48.Also indicating delayed maturation of auditory cortex in ASD was the observation of an absence of hemisphere functional asymmetries that are typically observed in children. First, replicating a previous finding , the absOther auditory cortex hemisphere asymmetries often observed in typically developing children, however, were observed to be intact in ASD. As an example, a M100 response was absent in many TDC and ASD participants, with M100 responses more often present in the right than left hemisphere and with M100 responses more often present in older (>10\u00a0years old) than younger participants. The latter findings indicated that the older individuals more easily encoded the auditory stimuli, with present findings thus consistent with prior studies showing that 100-ms auditory generators require longer intervals to produce a response in children than adults given hypothesized longer refractory periods in children than adults , 54, 55.In the present study, the presence/absence of M100 was similar between TDC and ASD. Edgar et al. , howeverTwo other findings observed in both TDC and ASD suggested faster maturation of right than left STG auditory areas: earlier M50 responses in the right than left hemisphere and less right than left pre-stimulus activity. The left versus right STG M50 latency difference observed in the present study has been reported in previous studies examining children and adolescents . As an eGiven changes in auditory cortex activity as a function of age, it is hypothesized that the pattern of TDC versus ASD group differences in auditory cortex activity (including group differences in hemisphere asymmetries) will differ as a function of the age, with some auditory encoding impairments most clearly observed in younger children with ASD , and other impairments more evident in older children with ASD. A review of the literature supports this hypothesis. For example, although in the present study, the observation of a delayed right M100 response in ASD versus TDC replicates previous studies , 4, the A limitation of the present study is that analyses were cross-sectional rather than longitudinal. A longitudinal study examining changes in auditory processes as a function of age in TDC and in children with ASD 5 to ~12\u00a0years old would support and extend the present cross-sectional findings. Future studies examining auditory processes in infants and children also are of interest given that treatments seeking to normalize auditory processes in ASD will likely target younger rather than older populations in order to have a better chance at normalizing auditory processes. In these studies, use of a whole-head infant MEG system is preferred given that MEG sensors are closer to the head in infant versus adult MEG systems \u201363.Although a movie was shown during the task to keep participants comfortable and awake , another study limitation is that group differences attending to the movie (not assessed) could account for some study findings, such as decreased attention to the movie and increased attention to the tones in one group contributing to the M200 group differences. Studies assessing group differences in attention during such tasks (perhaps using eye tracking) are needed.r\u2009=\u20090.49, ASD r\u2009=\u20090.14, power\u2009=\u2009~78\u00a0%; see also Additional file Finally, sample size was a slight limitation. In particular, although samples were moderately large, the present study was slightly underpowered for some analyses, especially for analyses involving interaction terms. As an example, as previously noted, although examination of the Fig.\u00a0Present cross-sectional findings showed an array of abnormalities in the development of primary/secondary auditory areas in children with ASD. Longitudinal studies, examining left and right auditory encoding processes from infancy through late adolescence  are needed to fully understand auditory encoding abnormalities in ASD. It is hypothesized that investigation of the maturation of auditory network activity will indicate delayed development of each component of the auditory processing system in ASD."}
{"text": "Curcuminoid as a single agent significantly induced EBV reactivation in recombinant GC and NPC lines. The drug effects were dose- and time-dependent. Micromolar concentration of curcuminoid EF24 enhanced the CLVA effect in all cell systems except SNU719, a naturally infected EBVaGC cell that carries a more tightly latent viral genome. These findings indicated that EF24 has potential as EBV lytic activator and may serve as an adjuvant in CLVA treatment.Epstein-Barr virus (EBV) persists in nasopharyngeal (NPC) and gastric carcinomas (EBVaGC) in a tightly latent form. Cytolytic virus activation (CLVA) therapy employs gemcitabine and valproic acid (GCb+VPA) to reactivate latent EBV into the lytic phase and antiviral valganciclovir to enhance cell death and prevent virus production. CLVA treatment has proven safe in phase-I/II trials with promising clinical responses in patients with recurrent NPC. However, a major challenge is to maximize EBV lytic reactivation by CLVA. Curcumin, a dietary spice used in Asian countries, is known for its antitumor property and therapeutic potential. Novel curcuminoids that were developed to increase efficacy and bioavailability may serve as oral CLVA adjuvants. We investigated the potential of curcumin and its analogs (curcuminoids) to trigger the EBV lytic cycle in EBVaGC and NPC cells. EBV-reactivating effects were measured by immunoblot and immunofluorescence using monoclonal antibodies specific for EBV lytic proteins. Two of the hit compounds ( Epithelial malignancies associated with Epstein-Barr virus (EBV) infection include undifferentiated nasopharyngeal carcinoma (NPC) and a subset of gastric carcinoma (GC) . EBV is Most EBV-associated carcinomas contain viral DNA that persists in a latent state with only a limited set of viral genes being expressed. EBV nuclear antigen 1 (EBNA1), small RNAs EBER1 and 2, BARF1 protein, and BamHI-A rightward transcripts (BART) encoding 40 miRNAs are expressed in all carcinoma cells [Besides personalized T-cell based immunotherapy, to date, no effective virus-targeted treatment has been developed for NPC and EBVaGC ,5. RecenThe mechanisms of induction of EBV lytic replication from latency using chemical inducers such as histone deacetylase inhibitors (HDACi), DNA demethylating agents, aspirin, NF-\u03baB inhibitory compounds and chemotherapeutic drugs that induce DNA-damage repair have been extensively investigated and recently reviewed in detail ,8,9. IndCurcuma longa possess various therapeutic properties including anti-oxidant, analgesic, anti-inflammatory and anti-cancer activities due to its effect on multiple biological pathways including the inhibition of NF-\u03baB [Meanwhile, several human clinical trials have reported that curcumin, a polyphenolic compound known derived from of NF-\u03baB ,13,14. Iof NF-\u03baB . Severalof NF-\u03baB ,21,22,23of NF-\u03baB ,21,22,23PGV-0, PGV-1, PGV-5, THPGV-0, cyclohexanone 206, piperidinone EF24, thiopyranones 211, 219 and thiopyranone dioxides 41, 227  have been reported to possess cytotoxic, antiproliferative and anti-angiogenesis properties in tumor cells by inhibiting COX-2 and NF-\u03baB signaling [EF24, a widely investigated curcuminoid with improved stability and bioavailability, has pleiotropic effects on inflammatory and oncogenic signaling pathways [EF24 induced apoptosis in leukemic cells [206 and thiopyranone 211 [41 > 227 > EF24, based on cell-based growth inhibitory concentrations (IC50). The apoptotic effects of 41 and 227 were attributed to activation of the unfolded protein response in response to heightened endoplasmic reticulum (ER) stress induced by these compounds [The cyclopentanones were obtained from the UGM-VU collection of curcuminoids and two members  and EBV-positive NPC cell lines  were used in this study. Natural EBV genome-carrying SNU-719 cells , natural EBV genome-carrying C666.1 NPC cells and recombinant AGS-BX1 cells were cultured as described before ,24,27. A206), thiopyranone , thiopyranone dioxide  and piperidinone (EF24) moieties [PGV0 and PGV1) demonstrated cytotoxic, anti-proliferative and anti-angiogenesis properties in tumor cells [Natural purified curcumin was purchased from Sigma , whereas novel analogs curcumin compounds were kindly provided by Mei Lin Go at The National University of Singapore (NUS), Singapore and by Ritmaleni at The University of Gadjah Mada (UGM), Indonesia in collaboration with Henk Timmerman of the Vrije Universiteit Amsterdam, The Netherlands (UGM-VU). The chemical structure of curcuminoids is summarized in moieties . NUS commoieties . Penta Gdinone EF moietiesdinone EF moietiesor cells ,27,28,294 cells) were seeded in 96-well culture plates without drug and allowed to adhere for 24 h. Subsequently, t = 0 was measured using MTT and hit compounds  including positive lytic activators SAHA and GCb+VPA were added at different concentrations (in 2- or 5-fold). After 72 h, cells were lysed in DMSO and absorbance was determined at 540 nm in a plate reader [The cytotoxicity of hit compounds was evaluated by 3--2,5-diphenyl tetrazolium bromide  proliferation assay. Briefly, EBV-negative and -positive NPC and GC cells  and GCb+VPA was determined by trypan blue exclusion assay. EBV-positive GC and NPC cells grown to 70% confluence were treated with a combination of hit compound  and GCb+VPA or GCb+VPA alone for 48\u201396 h depending on cell types  and high (1.25 \u00b5M) concentrations of curcuminoids for 48\u201396 h A. TreatmFACS analysis was used to screen lytic inducing capacity of various curcuminoids at nanomolar concentrations. GFP intensity representing induced lytic cells was measured by FACSCalibur Flow Cytometer . A gate was set to determine the percentage of lytic cells by analyzing the GFP intensity of uninduced AGS-BX1 cells and after the CLVA treatment (GCb+VPA). Expression of GFP in the infected AGS-BX1 and HONE1-EBV cells following curcuminoid treatments visualized and counted under a fluorescence microscope .Immunofluorescence staining was performed to analyze EBV reactivation in naturally infected GC (SNU-719) and NPC C666.1) lines 66.1 line,29,31. C41, EF24) and GCb+VPA or GCb+VPA alone for 48\u201396 h. Treatment with SAHA and SB were included in the analysis. After treatment, the cells were pelleted, washed once with PBS and RNA were extracted using Trizol reagent . EBV mRNA lytic gene expression was compared to untreated (DMSO) controls and presented as fold increase. Data were determined from three independent experiments.EBV latent and lytic gene expression was quantified by a multiplexed RT-qPCR method using a plasmid pool representing each EBV lytic target gene as described in detail recently ,32. EBV-We have previously reported that the CLVA drug regimen , significantly and synergistically reactivates the latent virus in NPC tumor cells into the lytic replicative phase both in vitro and in vivo and applied this strategy in a clinical Phase-I/-II trial with promising clinical responses ,6,7. We 211, 219, 41, 227, EF24) gave weak lytic induction signals   showed EBV Zebra and EA-D activation with 1.25 \u00b5M being the minimal dose for lytic reactivation in HONE1-EBV cells  in GFP-modified AGS-BX1 cells carrying recombinant EBV with GFP under lytic (BXLF1) promotor control and measured the green fluorescent intensity of lytic cycle induction by FACS. This cell line is frequently used by others in studies analyzing EBV lytic activation in an epithelial cell background ,9,12,28. signals . Howeverntration B. Curcum (10 \u00b5M) C. PGVs cBV cells C. To conEF24 for 48 h revealed that EF24 is more potent than 41 and 227  and HONE1 (NPC) cells with recombinant EBV genome are widely used to study induction of the EBV lytic cycle in vitro ,12,28. W and 227 D. These 41, 227, EF24) induced the expression of Zebra and EA-D proteins 1.5\u20132 fold higher than in HONE1-EBV (EF24 induced EBV reactivation in AGS-BX1 cells at a comparable level to GCb+VPA (62\u201369%), whereas curcumin itself induced only 10% of AGS-BX1 cells into the lytic cycle  could induce EBV lytic cycle in natural EBV genome-carrying GC (SNU-719) and NPC (C666.1) tumor cell lines. We included GCb+VPA [PGV0 10 \u00b5M) induced EBV lytic activation in C666.1 NPC cells, but not in SNU-179 (data not shown). Compound 41 and 227, which induced strong EBV lytic cycle in AGS-BX1 and HONE1-EBV, did not show lytic induction effects in SNU-719  and EA-D (range from 12% to 18%)  C,D. SAHA to 18%) D and in  to 18%) E. Intere to 18%) C,E, whic to 18%) C,E. In s41 and EF24 in GC and NPC cells, we performed MTT assays at 48 h post-treatment. Compound 41 and EF24 demonstrated higher toxicity in GC  and GCb+VPA in GC and NPC cells. As 41 and EF24 significantly inhibit cell proliferation and reduce cell viability, we wonder whether these hit compounds in combination with GCb+VPA can enhance the cell killing. GC and NPC cells were treated with 1.25 \u00b5M concentration of hit compounds  and/or GCb+VPA. Treatment with SAHA and SB were included as positive controls in each cell line and cell viability was measured by MTT assay for 96 h. At 48\u201396 h post-treatment, 41 and EF24 synergistically enhanced the cell killing effect of GCb+VPA in GC  significantly reduce viability in AGS-BX1 , the EBV lytic protein and lytic mRNA expression were examined by immunoblot and real-time quantitative RT-qPCR ,30,32 inheir own A,D and 4proteins E. On thell death A\u2013D but all death .We also examined the effect of pre-treatment with curcuminoids prior to GCb+VPA on EBV reactivation in recombinant AGS-BX1 cells. Following pre-treatment for 24 h and a further 24 h GCb+VPA incubation, cell extracts were collected for immunoblot analysis. Surprisingly, the induction of EBV lytic proteins (Zebra and EA-D) in response to CLVA (GCb+VPA) treatment was downregulated by pre-treatment with curcuminoids for 24 h . CurcumiEF24 and CLVA regimen. SAHA treatment was included as additional lytic induction control [EF24 to identify increased levels of both apoptotic markers [The variation of curcuminoids in activating EBV lytic cycle in different cell types indicates possible mechanistic differences in cell line-dependent lytic reactivation. As replication of EBV can be triggered by apoptosis , we cond control . Since t markers ,28.EF24, GCb+VPA or SAHA treatments. AGS-BX1 and HONE1-EBV cells treated with combined EF24, GCb+VPA did not show increased levels of both cleaved caspase-3 and PARP proteins. SAHA treatment showed a tendency to increase cleaved PARP protein levels in recombinant GC and NPC cell lines  with GCb+VPA resulted in a slight increase in immediate early (ZEBRA) and early (EA-D) protein levels in both the EBV-positive GC and NPC cells , thymidine kinase (TK), and small capsid protein (VCA-p18) in AGS-BX1 and C666.1 cells . Our datPC cells E\u2013G. To dEF24 together with GCb+VPA increased mRNA levels relative to DMSO of immediate-early , early , and late lytic mRNAs (VCAp18 ~5-fold) 48 h after treatment, whereas a treatment with GCb+VPA alone increased the EBV lytic gene expression approximately 10-fold  as adjuvant for CLVA treatment increases EBV reactivation at the mRNA level above GCb+VPA alone , but the effects were less pronounced in the natural genome-carrying GC cell line SNU-719. Compounds 41 and EF24 did have anti-proliferative activity in SNU-719 cells and enhanced anti-proliferative activity of GCb+VPA. Furthermore, we observed that the anti-proliferative activity of these compounds was not EBV-specific, confirming prior studies in other cancer models [Most existing lytic inducing agents are frequently cell line specific or reactivate a limited number of cells ,11,12,30r models ,33,34. HThe mechanisms that limit the level and speed of virus reactivation in different cell types or between cells in the same culture population are not well understood ,11,32,3441, EF24) with GCb+VPA in various EBV-linked carcinoma model cell lines. We observed that the combination of EF24 and GCb+VPA most effectively enhanced the reactivation of EBV lytic cycle in EBV-associated carcinoma cell lines, with the exception of SNU-719 cells. Reactivation was accompanied by a reduction of tumor cell viability. SAHA proved more broadly effective in EBV reactivation and triggered EBV reactivation even in the SNU-719 cell line. The synergistic induction of EBV lytic cycle combined with enhanced cell death in NPC and GC cells carrying recombinant EBV genomes, reflect the enhanced susceptibility of the recombinant lines to lytic induction.Recently, we showed that GCb+VPA can trigger EBV lytic replication in NPC patients in vivo creating therapeutic sensitivity to antiviral treatment ,6,7. How41 or EF24) with GCb+VPA induced immediate-early and early lytic rather than late lytic gene expression. In agreement with previous publications, low or undetectable levels of full EBV late lytic gene expression upon EBV reactivation by chemical treatment are suggestive of abortive lytic replication [It is well accepted that lytic activation in itself may render the infected cells more susceptible to immune recognition and killing due to the expression of viral lytic-switch proteins, in particular Zebra ,9,30,31.lication ,42. Howelication ,6,7. EF24 with the CLVA regimen at clinically acceptable doses, may enhance EBV reactivation and provide an attractive and safe therapeutic strategy for EBV-associated malignancies. A similar beneficial effect may be expected when using SAHA (Vorinostat) or the recently identified HDAC inhibitor romidepsin in the CLVA treatment regimen [Taken together, the combination of a curcuminoid, in particular compound  regimen . Combine regimen ,45 and o regimen .41) and piperidinone (EF24) scaffolds that serve as putative EBV lytic activators in latently infected EBV-positive carcinomas. EF24 has the potential to act as an adjuvant to enhance EBV reactivation induced by the CLVA regimen (GCb+VPA) for treatment of EBV-associated gastric and nasopharyngeal carcinomas.In conclusion, our study identified two curcuminoids bearing the thiopyranone dioxide ("}
{"text": "The Epstein-Barr virus (EBV) is a ubiquitous human \u03b3-herpesvirus causally linked to a broad spectrum of both lymphoid and epithelial malignancies. In order to maintain its persistence in host cells and promote tumorigenesis, EBV must restrict its lytic cycle, which would ultimately lead to cell death, selectively express latent viral proteins, and establish an unlimited proliferative potential. The latter step depends on the maintenance of telomere length provided by telomerase. The viral oncoprotein LMP-1 activates TERT, the catalytic component of telomerase. In addition to its canonical role in stabilizing telomeres, TERT may promote EBV-driven tumorigenesis through extra-telomeric functions. TERT contributes toward preserving EBV latency; in fact, through the NOTCH2/BATF pathway, TERT negatively affects the expression of BZLF1, the master regulator of the EBV lytic cycle. In contrast, TERT inhibition triggers a complete EBV lytic cycle, leading to the death of EBV-infected cells. Interestingly, short-term TERT inhibition causes cell cycle arrest and apoptosis, partly by inducing telomere-independent activation of the ATM/ATR/TP53 pathway. Importantly, TERT inhibition also sensitizes EBV-positive tumor cells to antiviral therapy and enhances the pro-apoptotic effects of chemotherapeutic agents. We provide here an overview on how the extra-telomeric functions of TERT contribute to EBV-driven tumorigenesis. We also discuss the potential therapeutic approach of TERT inhibition in EBV-driven malignancies. The Epstein-Barr virus (EBV) is a ubiquitous human \u03b3-herpesvirus infecting more than 90% of the world\u2019s population. Primary infection with EBV is often asymptomatic, but it can also manifest as infectious mononucleosis. Although EBV may infect various cell types, such as epithelial cells and T or Natural Killer cells, it preferably infects B lymphocytes, in which it establishes a lifelong asymptomatic latent infection. In immunocompromised individuals, EBV may cause a wide range of cancers, of both hematopoietic and epithelial origin, including Burkitt\u2019s lymphoma (BL), Hodgkin\u2019s lymphoma (HL), post-transplant lymphoproliferative disorders (PTLD), AIDS-associated lymphomas, and nasopharyngeal and gastric carcinomas .Like other \u03b3-herpesviruses, EBV has both lytic and latent cycles. Primary EBV infection occurs in the oropharynx, leading to productive lytic infection of B lymphocytes. EBV antigens promote immune recognition, inducing an EBV-specific immune response which controls viral infection in the immunocompetent host, and the viral lytic cycle triggers the death of the infected cells . In tumoBZLF1 and BRLF1 [While latency programs predominate in EBV-driven tumors, lytic reactivation may occur in a small fraction of infected cells, favoring the spread of the virus , 6. Lytind BRLF1 . As lytind BRLF1 \u201310. Trignd BRLF1 , 12. Thund BRLF1 \u201315.The establishment of EBV latency programs promotes cell proliferation, inhibits apoptosis, blocks viral lytic replication, and ensures accurate and equal partitioning of the episomal viral genome to daughter cells . HoweverTelomeres are specialized DNA structures located at the ends of chromosomes which are essential for stabilizing chromosomes by protecting them from end-to-end fusion and DNA degradation . In humaAlthough EBV-infected B cells exhibit higher proliferative activity than resting primary B lymphocytes, very few EBV-carrying B cells eventually progress to immortalization: most of them reach a proliferative crisis and end their lifespan after about 150 population-doubling levels, according to genetic factors, including telomere length. Soon after EBV infection, B lymphocytes may exhibit multiple signs of telomere dysfunction and ALT markers, including highly heterogeneous telomeres, appearance of extra-chromosomal telomeric DNA, accumulation of telomere-associated promyelocytic leukemia nuclear bodies, and telomeric-sister chromatid exchange . This phTelomerase is a ribonucleoprotein complex containing an internal RNA template  and a catalytic protein, TERT, with telomere-specific reverse transcriptase activity. TERT, which synthesizes de novo telomere sequences using TERC as a template, is the rate-limiting component of the telomerase complex, and its expression is correlated with telomerase activity. Although TERC has broad tissue distribution and is constitutively present in normal and tumor cells, the expression of TERT is usually repressed in normal somatic cells and is essential for unlimited cell growth, thus playing a critical role in tumor formation and progression .Regulation of telomerase operates at several levels: transcription, mRNA splicing, subcellular location of each component, and assembly of TERC and TERT in an active ribonucleoprotein. Transcription of the TERT gene is probably the key determinant in regulating telomerase activity, since TERT transcription is specifically up-regulated in cancer cells but silent in most normal ones. The TERT promoter reveals complex regulation dynamics, whereby multiple transcriptional regulatory elements play functional roles in different contexts, either individually or interactively. TERT contains recognition sequences for many important transcription factors such as TP53, P21, SP1, ETS, E2F, AP-1, HIF1A and MYC . Regulatvia the NF-\u03baB and MAPK/ERK1/2 pathways [MYC is in a germ-line configuration. In these malignancies, LMP-1 probably plays an essential role in TERT activation.Studies aimed at defining the mechanism underlying EBV-induced telomerase activation have demonstrated that LMP-1, the major EBV oncoprotein, up-regulates telomerase activity both in epithelial cells , 34 and pathways . Of intepathways , in B cepathways . This isThe canonical explanation for the tumor-promoting role of telomerase is that it allows cells to escape the barrier to unlimited replicative potential caused by telomere attrition. Accumulating evidence suggests that, besides its canonical role in stabilizing telomeres, TERT also has other biological functions, including enhancement of cell proliferation, resistance to apoptosis, and regulation of DDR, \u201339. TERTThe extra-telomeric roles of TERT have also been described in EBV-driven lymphomagenesis. TERT plays a critical role in establishing EBV latency and preventing the EBV lytic cycle, thereby contributing to transformed phenotypes. In particular, high levels of endogenous TERT or ectopic TERT expression in TERT-negative EBV-infected B cells prevents the induction of the viral lytic cycle. By contrast, TERT silencing by specific siRNA or short-hairpin (sh)RNA induces the expression of BZLF1, EA-D and gp350 EBV lytic genes, and triggers a complete lytic cycle. This occurs in both EBV-immortalized and fully transformed B cells, thus supporting the concept that TERT is a critical regulator of the balance between viral latent and lytic cycles , 21. TheStudies aimed at defining the mechanism(s) by means of which TERT prevents the viral lytic cycle have demonstrated the involvement of the NOTCH2/BATF pathway. BATF is a transcription factor expressed in hematopoietic tissues and in B cells infected with EBV \u201348. In LMore recently, the impact of TERT on EBV infection and viral gene expression has also been studied in epithelial cells . GastricTelomerase inhibitors remain an attractive approach to target cancer cells, given the specificity of TERT expression in tumor cells. However, in theory, the time to antineoplastic effectiveness of telomerase inhibitors depends on the original length of the telomeres in cancer cells and, apparently, these agents are effective in halting tumor growth only after the cancer cells have shortened their telomeres. This aspect acquires particular importance in the context EBV-carrying malignancies as it has been demonstrated that EBV-positive BL cell lines show longer telomeres compared to EBV-negative BLs  and, durIn this scenario, the evidence of extra-telomeric functions of TERT in cellular kinetics and resistance to apoptosis has recently opened the door to potential telomere length-independent therapeutic effects. In EBV-driven malignancies, besides sustaining the latency program required for the EBV-driven transformation, TERT may promote EBV tumor progression by enhancing the kinetics of cell proliferation. In fact, EBV-infected B cells with sustained telomerase activity grow faster than telomerase-negative cells . AccordiAs mentioned previously, the first mechanism by means of which short-term inhibition of TERT may induce cell death of EBV-transformed cells is induction of the EBV lytic cycle. Inhibition of TERT leads to down-regulation of BATF and up-regulation of BZLF1, the main regulator of the viral lytic cycle. Notably, cell death induced by TERT inhibition in EBV-positive cells does not depend only on the induction of the EBV lytic cycle: inhibition of TERT with short hairpin (sh)RNA in both EBV-positive and EBV-negative BL cell lines induces apoptosis via a AKT1/FOXO3/NOXA pathway . In partIn EBV-positive tumor cells, the lytic cell cycle induced by TERT inhibition may be exploited to sensitize cells to antiviral drugs such as GCV. GCV is an antiviral prodrug activated by EBV lytic protein kinase , 11. PhoMost recent data show that LCLs and both EBV-positive and EBV-negative BL cells short-term treated with BIBR1532 (BIBR), a chemical compound which selectively inhibits the catalytic activity of TERT . These eIn addition, treatment of LCL with BIBR in combination with Fludarabine or Cyclophosphamide, two agents frequently employed to treat B-cell malignancies, induces a significant increase in specific cell death compared with results seen after treatment with chemotherapeutic agents alone. These results may lead to the substantial clinical application of TERT inhibitors in combination with standard chemotherapeutic protocols to treat EBV-positive B-cell malignancies .via the NOTCH2/BATF/BZLF1 pathway (Fig. via the AKT1/FOXO3/NOXA and ATM/ATR/TP53 pathways. Notably, cell cycle arrest and the pro-apoptotic effects of short-term TERT inhibition are independent of telomere length. Thus, in both EBV-driven and virus-unrelated B-cell malignancies inhibition of TERT seems to be an effective approach in inducing cell death, regardless of telomere length. In vitro experiments also demonstrate that the therapeutic approach based on inhibition of TERT enhances the pro-apoptotic and anti-proliferative effects of chemotherapeutic agents in EBV-transformed cells. Further studies of primary tumor cells from patients with EBV-driven malignancies and suitable animal models will pave the way for a solidly based pre-clinical rationale for including TERT inhibitors in chemotherapy protocols for treating these malignancies.Since a latent program is required to promote EBV tumorigenesis, whereas the lytic cycle induces cell death, the finding that TERT, besides maintaining telomere integrity, also plays a critical role in the establishment of EBV latency and in preventing the EBV lytic cycle Fig. , supportway Fig. , short-t"}
{"text": "Epstein-Barr virus (EBV) replication contributes to\u00a0multiple human diseases, including infectious mononucleosis, nasopharyngeal carcinoma, B cell lymphomas, and oral hairy leukoplakia. We performed systematic quantitative analyses of temporal changes in host and EBV proteins during lytic replication to gain insights into virus-host interactions, using conditional Burkitt lymphoma models of type I and II EBV infection. We quantified profiles of >8,000 cellular and 69 EBV proteins, including >500 plasma membrane proteins, providing temporal views of the lytic B cell proteome and EBV virome. Our approach revealed EBV-induced remodeling of cell cycle, innate and adaptive immune pathways, including upregulation of the complement cascade and proteasomal degradation of the B cell receptor complex, conserved between EBV types I and II. Cross-comparison with proteomic analyses of human cytomegalovirus infection and of a Kaposi-sarcoma-associated herpesvirus immunoevasin identified host factors targeted by multiple herpesviruses. Our results provide an important resource for studies of EBV replication.  \u2022Unbiased global analysis of host and EBV proteome remodeling in lytic replication\u2022Temporal profiles of >8,000 host and 69 viral proteins, using type I and II EBV\u2022Both EBV types target the B cell receptor complex for degradation\u2022Conserved EBV and HCMV lytic cycle host targets are identified Ersing et\u00a0al. present a temporal proteomic map of EBV B cell lytic replication. Tandem-mass-tag-based proteomics uncover extensive remodeling of the human proteome by EBV, conserved across the two major EBV strains. Cell-cycle, innate, and adaptive immune pathways are modulated, complement is upregulated, and the B cell receptor is degraded by infection. Epstein-Barr virus (EBV) is a gamma-herpesvirus that establishes persistent infection in >95% of adults worldwide. Two distinct strains of EBV have been identified, referred to as type I and II . FollowiEBV is the etiologic agent of infectious mononucleosis and is closely linked to the pathogenesis of multiple human malignancies, with 200,000 EBV-associated cancers reported annually . Lytic vUpon lytic reactivation, EBV genes are sequentially expressed in immediate-early (IE), early  and late (L) phases. The immediate early transcription factors ZTA (encoded by BZLF1) and RTA (encoded by BRLF1) jointly trigger the EBV lytic cycle. EBV early genes are synergistically induced by ZTA and RTA and encode the viral polymerase and replication machinery. Late viral genes encode structural proteins that encapsidate and mediate release of infectious virions .mRNA expression profiling has provided important information on the kinetics of viral gene expression upon lytic cycle induction in Burkitt lymphoma cell lines . LikewisWe used tandem-mass-tag (TMT)-based MS3 mass spectrometry to perform quantitative temporal proteomic analysis of EBV replication in human Burkitt lymphoma B cells latently infected by type II EBV, prior to and at four time points after induction of lytic replication . Selecti+ Burkitt lymphoma cell line P3HR1 to quantify changes in PM and whole cell lysate (WCL) protein expression by 10-plex TMT and MS3 mass spectrometry at three reference time points after induction of lytic EBV replication , including 6,307 proteins in all three replicates. We additionally quantified 69 EBV proteins . In experiment PM1, 550 PM proteins were quantified B. We obs+ Akata cells are highly permissive for EBV lytic replication in response to anti-immunoglobulin G (IgG) cross-linking  . DAVID sPrior proteomic analyses of EBV lytic protein expression have identified 16 or 44 EBV proteins at single time points of viral reactivation . A partiWe quantified 63 canonical EBV-encoded proteins in all three P3HR1 WCL samples. We used a \u201cproteomic ruler\u201d approach  to estim+ cells, we searched our data against a six-frame translation of the P3HR1 genome  and immunofluorescence, suggests that both PM and intracellular BCR pools are targeted. Further studies are required to identify whether soluble Ig isoforms are also targeted, and to characterize the ubiquitin-proteasome pathway by which EBV downmodulates these BCR pools. One candidate is EBV BDLF3, an early factor that targets cell-surface and intracellular MHC class I molecules for ubiquitin-mediated proteasome degradation .Targeting of the BCR during EBV B cell lytic replication may be conserved across EBV strains, since we observed a similar degree of Ig loss in Akata and P3HR1 B cells, which harbor type I and II EBV, respectively. We hypothesize that EBV targets the BCR to facilitate EBV B cell replication for one of the following reasons. First, a subset of lytic B cells may produce Ig reactive to antigen present on virions. BCR degradation would then enable EBV to avoid becoming trapped by binding to these antibodies within the secretory pathway or at the cell surface. Second, EBV lytic replication is thought to occur in tonsillar plasma cells, which are loaded with Igs. Plasma cells secrete Igs at the rate of approximately 2,000 molecules per second . Ig degrAdditional pathways were selectively downregulated during lytic viral reactivation, including multiple components of the cell-cycle machinery. Protein downregulation in some cases may involve the EBV host shutoff protein BGLF5, which was expressed early in infection B. As BGLMultiple aspects of the EBV life cycle are intimately linked with the complement system. The EBV entry protein gp350 has homology with the C3 complement component cleavage product C3dg . gp350 aEBV establishes latent infection upon B cell entry, and the tonsillar plasma cell population harbors lytic EBV in ex\u00a0vivo studies. These observations support a model in which plasma cell differentiation provides a cue that stimulates EBV replication. Interestingly, our findings suggest that EBV lytic replication may likewise facilitate plasma cell differentiation, through suppression of TFs that maintain germinal center state and through upregulation of factors that promote plasma cell differentiation. Key germinal center B cell TFs downmodulated by EBV lytic replication included BCL6, ETS1, IRF8, ID3, and MYC, whereas the antibody secreting cell-inducing TFs IRF4, ZBTB20, FOS, and FosB were strongly upregulated. Thus, rather than passively activating as a bystander of plasma cell differentiation, EBV may play a more active role in remodeling the B cell environment to favor lytic replication.To persist in an infected individual lifelong, herpesviruses have developed multiple strategies to modulate innate and adaptive immunity. One benefit is that we can use the overlap between proteins targeted by different herpesviruses to discover molecules particularly important in host defense. By comparing EBV, CMV, and KSHV, we identified downregulation of several members of the same protein family including Neuroligins and human leukocyte antigen (HLA) molecules. EBV and CMV both targeted Protocadherin \u03b3C3 for downregulation suggesting that this molecule, other members of the same family, and the Neuroligins might be activating NK ligands, as we previously demonstrated for Protocadherin FAT1 .\u2013 cells compared to gp350+ cells, depending on the time point studied after induction .TMT-based analysis was performed as described previously . AlkylatWe performed mass spectrometry as described previously using an Orbitrap Fusion or Orbitrap Lumos  and quanFurther information and reagent requests may be directed to the corresponding authors.I.E., M.P.W., and B.E.G. designed the experiments. I.E., L.N., J.A.P., Y.N., and M.P.W. performed proteomics experiments; I.E., L.W.W., C.W.A., and C.J. performed biochemical experiments; and I.E., L.N., M.P.W., and B.E.G wrote the manuscript. L.N., L.S., J.A.P., S.P.G., and M.P.W. analyzed the proteomics data, and N.E.G. provided EBV genome sequence data and bioinformatic support. Y.M. and N.E.G. performed additional bioinformatic analyses; E.K. provided helpful scientific discussions; and I.E., L.N., S.P.G., M.P.W., E.K., and B.E.G. edited the manuscript. M.P.W. and B.E.G. supervised all research."}
{"text": "We investigate the dynamics of two-dimensional soft vesicles filled with chiral active particles by employing the overdamped Langevin dynamics simulation. The unidirectional rotation is observed for soft vesicles, and the rotational angular velocity of vesicles depends mainly on the area fraction (\u03c1) and angular velocity (\u03c9) of chiral active particles. There exists an optimal parameter for \u03c9 at which the rotational angular velocity of vesicle takes its maximal value. Meanwhile, at low concentration the continuity of curvature is destroyed seriously by chiral active particles, especially for large \u03c9, and at high concentration the chiral active particles cover the vesicle almost uniformly. In addition, the center-of-mass mean square displacement for vesicles is accompanied by oscillations at short timescales, and the oscillation period of diffusion for vesicles is consistent with the rotation period of chiral active particles. The diffusion coefficient of vesicle decreases monotonously with increasing the angular velocity \u03c9 of chiral active particles. Our investigation can provide a few designs for nanofabricated devices that can be driven in a unidirectional rotation by chiral active particles or could be used as drug-delivery agent. A great many biological and physical systems can be referred to as active matter systems, including molecular motors6, swimming bacteria8, self-propelled colloids11, motile cells13, and macroscopic animals15. Previous works have demonstrated that active particles which perform spontaneous and sustained motion are fundamentally different from passive particles in thermal equilibrium systems. In other words, active matter systems move actively by gaining energy from an external source under non-equilibrium conditions. Hence, active particles with suitably designed constructions are able to convert energy into desired control of function, which have wide potential applications in a diversity of fields, such as drug delivery in medicine17. More details about microswimmers, propulsion mechanism and application prospects can be found in excellent review articles19.Active matter is a rapidly growing subject which has been studied theoretically and experimentally over the past few years22, confirming that asymmetric environments can rectify the random motion of self-propelled particles and extract energy accordingly. That is, external confinement has a crucial impact on the motion of active particles. In addition, a great number of biological systems are confined in finite regions, leading to novel phenomena such as swarming25, swimming in a spiral vortex26, accumulating at walls28, and so on. Meanwhile, recent studies have also paid more attention to flexible boundaries enclosing active swimmers instead of rigid walls. For instance, the interesting case of active Brownian particles constrained within a deformable boundary has been deeply investigated, exhibiting obvious shape and displacement fluctuations in soft vesicles filled with active particles30.In recent years, there are tremendous researches from experiments and computer simulations focused on the nanofabricated objects immersed in a bath of randomly swimming bacteria31. However, asymmetries in self-propulsion mechanism can generate a more complex behaviour, the direction of motion and that of the force are no longer aligned and the active particles tend to execute circular motion. Such chiral active particles have attracted mounting interest over the last few years35. Microscopy images show that non-tumbling E. coli bacteria swim in circular trajectories near planar glass surfaces34, indicating the motion of bacteria close to surfaces differs from the run-and-tumble motion in free solution. Active colloidal cell driven by gear-like spinners has also been observed35, which mainly focus on the shape control and compartmentalization of cells. Here, we choose spherical self-propelled and self-rotated particles without any special design as chiral active particles, and reveal more general organization principles of this class of active particles confined by a vesicle.As mentioned above, dynamics of self-propelled particles has captured the growing interest of various groups. In the models of self-propelled particles, it is assumed that the active particles possess uniaxial symmetry and that the direction of the self-propulsion is along the axis of symmetry of the particle. Thus active particles tend to orient along the active force and move in a straight line26. In fact, short-range forces and noise dominate the interactions between swimming organisms, and the influence of hydrodynamic interactions is negligible36. Only for swimmers in close contact with a surface, the hydrodynamic effects become important, favouring long residences time along the walls. However, this effect is given also by self-propulsion36. Therefore, hydrodynamic interactions should not change the phenomenology qualitatively, and the active particles obey overdamped Langevin dynamics without the hydrodynamic interactions42. That is, we employ the overdamped Langevin dynamics simulations to study the dynamical behaviours of soft vesicles filled by spherical self-propelled and self-rotated particles. And the aim of this work is to explore how the additional angular velocity of chiral active Brownian particles affects the dynamics of soft vesicles. Owing to the presence of angular velocity for chiral active particles, active particles collide with the vesicle edge and consequently drive the vesicles into unidirectional rotation. The rotational angular velocity of vesicles depends mainly on the area fraction (\u03c1) as well as the angular velocity (\u03c9) of chiral active particles. Meanwhile, the mean square displacement of the center of mass of vesicles filled with chiral active particles shows that the diffusion of vesicles is accompanied by the oscillation at short timescales, and its oscillation period is consistent with the rotation period of chiral active particles.Active particles use a wide variety of mechanisms to achieve self-propulsion in liquid environments, and swimming at the macroscopic scale heavily relies on the inertia of the surrounding fluid. Hydrodynamic interactions between active particles and their detached vertical structures are the basis of higher swimming (or flying) efficiency\u03c3. Each chiral active particle moves with a translational velocity V0 for self-propulsion and a counterclockwise angular velocity \u03c9 for self-rotation, performing a circular active Brownian motion. The overdamped dynamics is governed by Langevin equations for the position ri and the orientation \u03b8i of the polar axis \u03b8i, sin\u03b8i) of the center of the i-th active particle inside the vesicle42\u03b3 is the friction coefficient, V0 is the self-propulsion velocity of chiral active particles, and U is the configurational energy. D0 and D\u03b8 denote the translational and rotational diffusion coefficients respectively. There exist the relations of \u03b3\u2009=\u2009kBT/D0 and D\u03b8\u2009=\u20093D0/\u03c32\u200942. \u03beiT(t) and \u03beiR(t) are Gaussian white noise with zero mean and satisfy\u2009<\u2009\u03bei\u03b1T(t)\u03bej\u03b2T(s)\u2009>\u2009=\u2009\u03b4ij\u03b4\u03b1\u03b2\u03b4(t-s)  and\u2009<\u2009\u03beiR(t)\u03bejR(s)\u2009>\u2009=\u2009\u03b4ij\u03b4(t-s), respectively43. Here\u2009<\u2009\u2026.\u2009>\u2009donates an ensemble average over the distribution of the noise, and \u03b4 is the Dirac delta function.Molecular dynamics simulations are employed to study the dynamical behaviors of vesicles filled with chiral active particles. Chiral active particles are modelled as Lennard-Jones (LJ) spheres with a bead diameter of ULJ is used for chiral active particles as the configurational energy U in eqn  in two-dimensional vesicle model. The equation of motion can also be described as eqn )\u22121\u03c3 and the area fraction of chiral active particles for the initial vesicle is determined by \u03c1\u2009=\u2009N\u03c32/(4R02)29. Here N is the number of chiral active particles within the vesicle, and for example, N\u2009=\u20091596 for L\u2009=\u2009150 and \u03c1\u2009=\u20090.7. MD simulations are carried out by performing Langevin dynamics with the open source software, LAMMPS45. We nondimensionalize the equations of motion using \u03c3 and \u03b5 as basic units of length and energy, and \u03c40\u2009=\u2009\u03c32/D0 as the unit of time. And the time step is set to be \u03c4\u2009=\u20090.0001\u2009\u03c40. Meanwhile, the parameters are chosen to be D0\u2009=\u20090.01, D\u03b8\u2009=\u20090.03, \u03b3\u2009=\u2009100, and V0\u2009=\u20090.5. We have performed the simulations with various vesicle perimeters of L\u2009=\u200950, 100, and 150, and various area fractions of active particles from \u03c1\u2009=\u20090.05 to 0.7. Moreover, the angular velocities of chiral active particles are selected from \u03c9\u2009=\u20090 to 1.0. The total simulation time for each run in our results is not less than 2\u2009\u00d7\u2009108\u03c4. In addition, all the simulation snapshots are captured using the Visual Molecular Dynamics (VMD) package46.The vesicle moves in the x-y plane of 200\u03c3\u2009\u00d7\u2009200\u03c3 with periodic boundary conditions. The initial configuration of the vesicle is a circle of radius Rt. Here L\u2009=\u200950. The straight back lines are linear fitting curves and the slopes of these lines are also given in Fig.\u00a0i(t) for i-th monomer of the vesicle at time t. The average rotation angle \u03b2(t) for the vesicle is defined asi(t) means the cumulative rotation angle of i-monomer at time t. Figure\u00a0t, and the slope of line increases monotonically with \u03c1 increasing. However, there is an exception for the case of \u03c1\u2009=\u20090, in which the cumulative rotation angle oscillates slightly near zero under thermal interference of a vesicle without any chiral active particles which can drive the vesicle to rotate counterclockwise. Moreover, we also study the dependence of cumulative angular angle \u03b2 on time t with various angular velocities of chiral active particles, and the results are shown in Fig.\u00a0In our simulation, the chiral active particles perform the counterclockwise motion with \u03c9\u2009>\u20090. These active particles can resemble molecular motors, and the collision with the vesicle membrane results in the rotational motion of vesicle in the same direction. Figure\u00a0op at which \u03c9\u2019 reaches its maximum value. Figure\u00a0op always appears about \u03c9op\u2009\u2248\u20090.04, which seems to be independent of the area fraction \u03c1 and the vesicle perimeter L. In order to explain the novel non-monotonic behaviour of \u03c9\u2019 in Fig.\u00a0S\u2009>\u2009of chiral active particles stacked to the vesicle membrane, and the results are shown in Fig.\u00a040. The larger the angular velocity \u03c9 is, the smaller the radius of circular trajectory is40. Since the occurrence of collision with the membrane is rare for chiral active particles with large \u03c9, the rotation of the vesicle is very slow for large \u03c9, especially at a lower area fraction of \u03c1\u2009=\u20090.2. We also measure the average tangential force\u2009<\u2009F\u03c4\u2009>\u2009per monomer of the membrane with different angular velocities for various area fractions and various vesicle perimeters respectively, and the results are given in Fig.\u00a0\u03c4\u2009>\u2009in Fig.\u00a0op\u2009\u2248\u20090.04). Therefore, the average tangential force\u2009<\u2009F\u03c4\u2009>\u2009plays an important role in the appearance of optimum angular velocity. By means of the schematic illustrations in Fig.\u00a047. For self-propelled active particles, the asymmetry boundary is a basic ingredient, as observed in many other thermal ratchet mechanisms48, and self-starting micromotors with asymmetric boundary can be observed in a bacterial bath47. However, at a moderate angular velocity of \u03c9\u2009=\u20090.04, there exists the higher collision probability with the membrane for chiral active particles because the radius of circular trajectory for chiral active particles is very large and the chiral active particles usually are aggregated near the membrane, as shown in Fig.\u00a0\u03c4\u2009>\u2009or rotation angular velocity \u03c9\u2019 only exists for high collision synchronization and high collision probability. As for the case of \u03c9\u2009=\u20091.0, since the radius of circular trajectory for chiral active particles is fairly small, the collisions with the membrane occur rarely. Consequently, although the collision also produces the counterclockwise tangential force  and different angular velocities (\u03c9) in Fig.\u00a0et al.29. Four detailed configurations of vesicle are also shown in Fig.\u00a00, and probability distributions P(\u03ba) are normalized. Here, \u03ba0 represents the curvature of initial circular configuration, and \u03ba is the local curvature29. The reduced local curvatures follow Gaussian distributions centered near \u03ba/\u03ba0\u2009\u2248\u20091 with decreasing widths, as the area fraction \u03c1 increases gradually. The chiral active particles are distributed homogeneously for \u03c9\u2009=\u20091.0, and they slowly stretch the membrane with increasing \u03c1. Combining with Fig.\u00a00.To analyze the deformation of vesicle shape, we quantify the asphericity of vesicle (\u0394)Rg\u2013R0)/Rg as a function of the actual area fraction \u03c1R02/Rg2 with different vesicle perimeters. For active particles with \u03c9\u2009=\u20090.0, (Rg\u2013R0)/Rg scale linearly with the packing fraction, especially for L\u2009=\u2009100. Deviations of the (Rg\u2013R0)/Rg from the linear regime are visible at high area fraction \u03c1 due to the excluded volume effects51. However, for vesicles filled with chiral active particles, most of the quantities (Rg\u2013R0)/Rg are less than zero at the low packing fractions. In fact, (Rg\u2013R0)/Rg is proportional to the average pressure exerted by the active particles51. We also measure the average pressure\u2009<\u2009Pn\u2009>\u2009exerted by the active particles on the membrane, and the results are shown in Fig.\u00a0g and produces a negative value of (Rg\u2013R0)/Rg for \u03c9\u2009=\u20091.0, see the inset of Fig.\u00a0Figure\u00a053.cm(t) and ycm(t) are the coordinates of the center of mass of vesicles filled with chiral active particles. Soft vesicles perform a random walk under the action of collision arising from chiral active particles. Since active particles and monomers of vesicle have the same size and mobility, the velocity of the center of mass 29\u03bc is the mobility. The center of vesicle moves as a body of reduced mobility \u03bc/(N\u2009+\u2009L) under the action of the total force on the active particles. The corresponding velocity-velocity correlation function is given by29Dynamical behaviors of vesicles are investigated through calculating the mean square displacement (MSD) of the center of mass of vesicles filled with chiral active particles, which is given byFor chiral active particles with an angular velocity of \u03c9, forces are uncorrelated and the corresponding force-force correlation function is29. Here, we also neglect the translational noise for the direct comparisons with the theoretical results in our simulation. The mean square displacement (MSD) of the center of mass of vesicles is calculated by a double time integration of eqn (13)29If \u03c9\u2009=\u20090, eqn  becomes A, D and cos\u2009\u03c60 are given byThe parameter 3(t) follows the expression very well,Comparing with the theoretical results given by eqn , we findA and cos\u03c60 are given by eqns A and cosD and Deff is made in Fig.\u00a0D and Deff are obvious. However, Deff is in good agreement with the theoretical results of D for \u03c9\u2009<\u20090.2. In fact, for \u03c9\u2009=\u20090, eqn  is close to 0. Of course, the corresponding force-force correlation function of eqn 59. When active particles touches the membrane, although all interactions between active particles and monomers of the membrane are center to center, the collision angle \u03b1 between the active particles and the monomers of the membrane isn\u2019t always equal to \u03c0/2 because of the counterclockwise rotation for chiral active particles. Accordingly, there exists net tangential forces for monomers of vesicle, and the rotating movement for vesicle occurs. Meanwhile, rotational angular velocity of vesicle depends mainly on the angular velocity (\u03c9) and area fraction (\u03c1) of chiral active particles, and there exists an optimal parameter for \u03c9 at which the rotational angular velocity of vesicle takes its maximal value. Our results highlight that asymmetric environments can produce a spontaneous and directional rotation of vesicles filled with chiral active particles. Moreover, the shape of vesicle also relies on the area fraction (\u03c1) and angular velocity (\u03c9) of chiral active particles as well as the vesicle perimeter (L). At low concentration the continuity of curvature is destroyed seriously for chiral active particles with large \u03c9, and at high concentration the chiral active particles cover the vesicle almost uniformly, resulting in fairly homogeneous curvature and nearly circular vesicle shape. The center-of-mass mean square displacement for vesicle is accompanied by oscillations at short timescales, and the oscillation period of diffusion is consistent with the rotation period of chiral active particles. Meanwhile, the diffusion slows down significantly with the additional angular velocity for chiral active particles by about two orders, especially for high concentration. Our investigation can provide a few designs for nanofabricated devices with asymmetric environments that can be driven in a unidirectional rotation by chiral active particles.We have investigated numerically the dynamical behaviors of vesicles filled with chiral active particles using 2D Langevin dynamics simulations. In fact, the behavior of vesicles filled with chiral active particles bears some resemblance with the directed migration of Eukaryotic cells, as observed in would healing assays or in the presence of chemotactic cuesSupplementary Information: Rotational Diffusion of Soft Vesicles Filled by Chiral Active ParticlesVideo S1. Diffusion behavior of a soft vesicle filled by active particles with \u03c9=0.Video S2. Diffusion behavior of a soft vesicle filled by chiral active particles with \u03c9=0.7.Video S3. Diffusion behavior of a soft vesicle filled by chiral active particles with \u03c9=0.04."}
{"text": "The antioxidative transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE), as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17) but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems  In the periphery, immature dendritic cells (DCs) survey their environment and capture soluble antigens, like microbes and cell debris. Since they are barely immunogenic, immature DC express only low levels of major histocompatibility complex (MHC) II and costimulatory molecules but display marked phagocytic capacity which renders them critical for maintaining peripheral T cell tolerance , 2. Activia proteasomal degradation by Kelch-like ECH-associated protein 1 (Keap1) -like 2 (Nrf2) was described as critical regulator responsible for maintenance of DC redox homeostasis, differentiation, and maturation by modulating the expression of cytoprotective genes, such as heme oxygenase 1 (Hmox1), NAD(P)H: quinone oxidoreductase 1 (Nqo1), and glutathione \u201312. In g (Keap1) , 21. App (Keap1) , 23, inc (Keap1) . In cont (Keap1) .via NF-\u03baB signaling pathways in vitro  and its primary active metabolite monomethyl fumarate (MMF), have been shown to activate the Nrf2-ARE pathway by altering the ability of Keap1 to interact with Nrf2  and reduin vitro \u201331. In Ein vitro , 32. Simin vitro , 34. Thuin vitro as well as in T cell-mediated autoimmunity of the central nervous system in vivo. We show that Nrf2 deficiency fosters a proinflammatory phenotype in murine and human DC, while Nrf2 activation promotes rather tolerogenic functions by significantly modulating cytokine production and expression of costimulatory molecules.Here, we focus on the effect of Nrf2 signaling on DC maturation, function and subsequent T cell responses Nuclear factor (erythroid-derived 2)-like 2-fl/fl mice were a kind gift from Prof. Pi, China Medical University, Shenyang, China. CD11c-Cre mice were obtained from Prof. Steinkasserer, University of Erlangen-N\u00fcrnberg, Erlangen, Germany. Mice harboring a transgenic MOG-specific T cell receptor [2D2 mice ]; were ain vivo studies but MMF for in vitro stimulation experiments.Mice received 15\u2009mg/kg body weight DMF  in 0.8\u2009mg/ml hydroxypropyl methylcellulose (Sigma-Aldrich) twice daily by oral gavage, while control mice obtained 0.8\u2009mg/ml hydroxypropyl methylcellulose. Mice were adapted to DMF treatment 2\u2009weeks before EAE induction. Since the majority of DMF is rapidly metabolized to MMF by esterases in the intestine and only MMF can be detected in the systemic circulation , 37, we 5 DC, cultured in vitro for 10\u2009days with or without 200\u2009\u00b5M MMF (Sigma-Aldrich) and stimulated with 1\u2009\u00b5g/ml lipopolysaccharide (LPS) (Sigma-Aldrich) for 24\u2009h, were injected intraperitoneally at d2 and d7 after EAE induction together with 200\u2009ng pertussis toxin .Induction of active EAE was performed as previously described , 39. Forl-glutamine) containing granulocyte macrophage colony-stimulating factor (GM-CSF)  and interleukin (IL)-4  for 10\u2009days with/without 200\u2009\u00b5M MMF (Sigma-Aldrich). Cells were matured on day 8 with 1\u2009\u00b5g/ml LPS (Sigma-Aldrich). For flow cytometry, cells were stained with \u03b1CD11c , \u03b1CD80 , \u03b1CD86 , and \u03b1MHCII .Bone marrow cells were obtained from tibias and femurs and maintained in R10 medium . After 20\u2009h of incubation, cells were subjected to flow cytometry and phagocytic cells were detected in the FITC channel.Phagocytosis was assessed by stimulating DC with 1\u2009\u00b5g/ml LPS (Sigma-Aldrich) for 48\u2009h before adding opsonized FluoresbriteThe migratory capacity of DC was investigated using a modified Boyden chamber assay and transwell inserts with a 5\u2009\u00b5m porous bottom . Mature DC were seeded into the migration chamber in medium containing 0.5% FCS. The lower chamber was supplemented with 10% FCS medium. After 20\u2009h of migration, cells residing in the lower chamber (transmigrated fraction) were stained for CD11c and quantified by flow cytometry .35\u201355 peptide (20\u2009\u00b5g/ml) for 1\u2009h and seeded with naive transgenic T cells harboring a MOG specific TCR at a ratio of 1:6. Naive MOG-specific transgenic T cells were isolated form the spleen of 2D2 mice by magnetic activated cell sorting using the \u201cNaive CD4+ T Cell Isolation Kit, mouse\u201d according to the manufacturer\u2019s instructions . For Th17 differentiations, cocultured cells were additionally stimulated with IL-6  and transforming growth factor beta (TGF\u03b21) . For Th1 differentiations, cells were cultured in the presence of IL-12p70  and anti-IL-4 . For Treg differentiations, TGF\u03b21  was added to culture media. T cell frequencies were analyzed by flow cytometry  using the antibodies listed in the section \u201cMature DC were loaded with MOG+CD62L+CD44lowCD25\u2212) were stimulated by plate-bound anti-CD3  and soluble anti-CD28  and cultured for 4\u2009days in the presence of IL-6  and TGF\u03b21  for Th17, IL-12p70  and anti-IL-4  for Th1 or TGF\u03b21  alone for Treg differentiation. T cell frequencies were analyzed by flow cytometry  using the antibodies listed in the section \u201cDifferentiation of murine T cells was performed as previously described . SplenicSpinal cords were disrupted with a 5\u2009ml glass homogenizer followed by Percoll  density gradient centrifugation. Cell frequencies were analyzed by flow cytometry  using the antibodies listed in the section \u201c\u00ae780 . Nonspecific Fc-mediated interactions were blocked by addition of 0.5\u2009\u00b5l \u03b1CD16/32 . For surface staining, cells were treated with the respective fluorochrome-conjugated antibodies: \u03b1CD4-BV510 , \u03b1CD11c-FITC , \u03b1CD25-APC , \u03b1CD80-APC , \u03b1CD86-PerCP/Cy5.5 , and \u03b1MHCII-BV510 .As previously described , dead ceFor intracellular cytokine staining, cells were stimulated for 4\u2009h with ionomycin  and PMA  in the presence of monensin , fixed with 1% paraformaldehyde and made permeable by saponin buffer treatment. Intracellular cytokines were stained with the respective fluorochrome-conjugated antibodies: \u03b1Foxp3-PE , \u03b1IFN\u03b3-APC , and \u03b1IL-17A-PE . Samples were measured with a flow cytometer .l-glutamine (Sigma-Aldrich), and 10\u2009mM Hepes (Lonza) as well as 800\u2009IU/ml (day 0) or 400\u2009IU/ml (day 3) recombinant human GM-CSF and 250\u2009IU/ml (days 0 and 3) recombinant IL-4 (both Miltenyi). Maturation of DC was induced by adding a maturation cocktail consisting of 200\u2009U/ml IL-1\u03b2, 1,000\u2009U/ml IL-6 , 10\u2009ng/ml tumor necrosis factor alpha (TNF-\u03b1) , and 1\u2009\u00b5g/ml PGE2  for 48\u2009h. DC were analyzed by flow cytometry for activation marker expression: \u03b1CD80-PE , \u03b1MHCII-PE/Cy5 , \u03b1CD25-FITC , \u03b1CD86-PE , \u03b1MHCI-FITC , \u03b1CCR7-APC , \u03b1ILT-4-FITC , and \u03b1CD83-PE .For the generation of monocyte-derived DCs from leukoreduction system chambers of healthy donors (HDs) the positive vote from the local ethics committee has been obtained (Re.-Nr.: 4556). Generation of human monocyte-derived DC was performed as previously described . Periphe6\u2009cells/ml in MLR medium consisting of RPMI 1640 (Lonza) supplemented with 5% heat-inactivated human serum type AB (Sigma-Aldrich), 1% Penicillin/Streptomycin/l-glutamine (Sigma-Aldrich), and 10\u2009mM HEPES (Lonza). Afterward, triplicates of 2\u2009\u00d7\u2009105 allogeneic T cells were cocultured in 96-well flat cell culture plates  with allogeneic DCs at different ratios for 72\u2009h in MLR medium, and were finally pulsed with [3H]-thymidine (1\u2009\u03bcC/well) for 8\u201316\u2009h. Cultures were harvested onto glassfiber filtermates using an ICH-110 harvester  and filters were counted in a 1450 microplate counter .Mature human DC were generated as described above  and wereDetermination of cytokines  secreted by human DC and/or T cells into the supernatant was assessed by Human Inflammation LEGENDplex\u2122  according to the manufacturer\u2019s protocol.Cytokine concentrations in murine cell culture supernatants were analyzed by ELISA for the secretion of IL-6, TNF-\u03b1, IL-23, and IL-12 (R&D Systems) according to the manufacturer\u2019s instructions.actb/\u03b2-Actin or gapdh as housekeeping gene. The following TaqMan\u00ae real-time PCR assays from Thermo Fisher Scientific were used: actb (\u03b2-Actin) Mm00607939_s1, nfe2l2 (nrf2) Mm00477784_m1, il6 Mm99999064_m1, nqo1 Mm01253561_m1, hmox1 Mm00516005_m1, il10 Mm01288386_m1, il12a Mm00434169_m1, arg1 Mm00475988_m1, tgfb Mm01178819_m1, nqo1 Hs02512143_s1, akr1c1 Hs04230636_sH, hcar2 Hs02341584_s1, and gapdh Hs02758991_g1.RNA isolation, reverse transcription and PCR reactions were performed as previously described . RelativCultured cells were harvested in 1\u00d7 Ripa lysis buffer . Protein concentration was determined using the BC Assay Protein Quantitation Kit . Protein was detected using a rabbit polyclonal Nqo1 antibody . Mouse anti-\u03b2-Actin  was obtained from Abcam (ab8226). Donkey antirabbit Alexa Fluor 488-conjugated and goat antimouse Alexa Fluor 647-conjugated secondary antibodies  were used. Detection was performed using a Fusion Capt Advance FX7 .in vitro and ex vivo data were analyzed by either one-/two-way ANOVA followed by Tukey\u2019s posttest, unpaired t-test or Mann\u2013Whitney test after checking for normal distribution (unless otherwise indicated). EAE data were analyzed by Mann\u2013Whitney U-test. Data are presented as mean\u2009\u00b1\u2009SEM; *p\u2009<\u20090.05, **p\u2009<\u20090.01, or ***p\u2009<\u20090.001 were considered to be statistically significant.Statistical testing was performed using GraphPad Prism . All in vitro. Yet CD11c+ cell frequencies were not altered in MMF-treated cell cultures  or starting at the day of LPS stimulation  to analyze if the time point of Nrf2 activation is crucial for its effect on DC maturation and surface marker expression. First, we examined whether activation of Nrf2-dependent signaling pathways influences BMDC generation + cells did not differ between bone marrow obtained from wt, Nrf2KO, or CD11c-Cre/Nrf2-fl/fl mice and treatment with 200\u2009\u00b5M MMF did not influence the generation of BMDC in the cell culture  or conditional DC specific knockout mice (CD11c-Cre/Nrf2-fl/fl) with MMF. Again, the yield of CD11cin vitro.In conclusion, modulation of the Nrf2 signaling pathway critically affects the activation status of DC in vitro. As shown in Figure Next, we assessed the influence of Nrf2 on different essential BMDC functions in vitro. In turn, Nrf2 activation not only induced its antioxidative target genes nqo1 and hmox1 but also the anti-inflammatory cytokine il10 , nqo1, and hmox1 expression was almost undetectable in Nrf2-deficient BMDC and tgfb expression levels were also significantly lower compared to wt BMDC , a marker for tolerogenic DC  as well as an increased expression of the tolerogenic surface receptor Ig-like transcript (ILT)-4  in human monocyte-derived DC analogously to murine BMDC , a niacin receptor involved in the regulation of inflammation and oxidative stress independently from Nrf2 signaling . For the generation of monocyte-derived DCs from leukoreduction system chambers of healthy donors, the positive vote from the local ethics committee at the University Erlangen-N\u00fcrnberg has been obtained (Re.-Nr.: 4556).AnH, AW, IK, EZ, JB, SJ, KK, and CD planned and performed experiments and analyses. RL designed the study and planned as well as supervised the research. AnH, AW, and RAL wrote the manuscript. AS and JP provided genetic engineered mice. AS, RG, AiH, AB, JP, and DL supervised the research and edited the manuscript. All authors read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Percutaneous transluminal renal angioplasty (PTRA) improves blood pressure (BP) and renal function only in selected patients with atherosclerotic renovascular disease (ARVD). Hyperuricemia is associated with elevated risk for hypertension and chronic renal disease, but its role in renovascular hypertension is unclear. We hypothesized that hyperuricemia negatively impacts renal and BP outcomes among patients with ARVD undergoing PTRA. This retrospective, observational cohort study included 94 patients with ARVD and preserved systolic cardiac function, who underwent PTRA at Mayo Clinic, Rochester, Minnesota. Renal, BP, and mortality outcomes were compared among patients according to their serum uric acid (SUA) levels. Multivariate analysis was used to determine significant predictors of renal, BP, and mortality outcomes after PTRA.\u03b2: 26.0; 95% confidence interval, 13.9 to 38.1). Compared to patients with normal basal SUA levels (\u22645.7\u2009mg/dl), patients with very high SUA (\u22658.7\u2009mg/dl) had lower baseline estimated glomerular filtration rate (eGFR), more extensive use of antihypertensive and diuretic drugs, increased baseline systolic blood pressure (SBP), and elevated left ventricular mass index. After PTRA, multiple logistic regression analysis showed that, compared to normal SUA, very high SUA was associated with decreased odds ratio (OR) of change in eGFR , but not of change in SBP. In multivariate linear analysis SUA independently predicted delta urine protein/creatinine ratio ( Severe hyperuricemia in patients with AVRD may have a negative impact on outcomes of renal revascularization. Atherosclerotic renovascular disease (ARVD) is a common and progressive disease with manifestation of renovascular hypertension. It affects 7% of individuals older than 65 years and accounts for 90% of cases of renal artery stenosis, resulting in a reduction of renal blood flow (RBF) to the affected kidney . In addiIncreasing evidence over the past century has supported a strong association between serum uric acid (SUA) and hypertension, independent of traditional risk factors . NotablyThe mechanisms responsible for essential hypertension differ from those contributing to renovascular hypertension, yet the role of SUA in hypertension and renal injury in renovascular disease has not been elucidated. SUA is elevated in patients with ARVD compared to healthy controls , but wheAfter receiving approval from the Institutional Review Board of the Mayo Clinic, 94 patients above 18 years of age at Mayo Clinic, Rochester, Minnesota, USA, were enrolled in the present study. Informed written consent was obtained. Patients identified with significant ARVD, using entry criteria analogous to enrolment in CORAL , were reBaseline clinical parameters were recorded at the time of PTRA. Follow-up was achieved via the electronic medical records within 3 years and with the censored point at the last observed clinical visit at Mayo Clinic, the end of the study period, or death. All echocardiograms were performed by certified technicians following standard clinical procedures and read by level III certified echocardiographers. EF was measured by the quantitative 2-dimensional biplane volumetric Simpson method. Some of the data were only available for some patients, such as level of urine protein/creatinine ratio (PCR) . Cardiov t-test) and nonparametric  tests were used to compare continuous variables among the groups and paired t-tests within groups. Pearson's chi-squared test was used for categorical data. We defined improvement of systolic BP (SBP) as mean reduction by more than \u22655\u2009mmHg after PTRA compared to baseline, which is clinically and statistically meaningful, as done before [Statistical analysis was performed using JMP version 13.0 . Continuous variables are expressed as mean\u00b1SD and skewed variables as median (range). Parametric , in which the change in SBP was greater than in the normal group , p<0.05.Significant falls in eGFR were observed only in very high SUA group , p<0.01,\u03b1-blocker had a greater change in urine PCR compared to nonusers (p<0.01). A multivariate linear analysis revealed that SUA independently predicted delta PCR , as did use of \u03b1-blockers  . Patients using o -61.0) .Timing of the last follow-up after revascularization was similar among the groups . A univaWe evaluated the associations of serum uric acid levels with outcomes of renal revascularization in AVRD patients. Our study shows that renal function in patients with severe hyperuricemia may benefit less from renal revascularization than those with normal SUA, given that very high SUA was associated with a decreased odds ratio of a rise in eGFR. Our findings in renovascular disease are consistent with the role of hyperuricemia as a risk factor for incident or progression of CKD . On the Renovascular hypertensive patients with severe hyperuricemia had higher BP and left ventricular hypertrophy, indicated by increased LVMI, which may result from activation of the renin-angiotensin system , reducti2) in a subgroup of patients with an initially lower eGFR. In another prospective, single-arm, multicenter clinical study [2). Conversely, in the present study we observed a significant fall in eGFR in patients with very high SUA group, whose baseline eGFR (41.2\u00b115.8\u2009ml/min/1.73m2) was very close to the previous studies. Severe hyperuricemia was associated with greater renal dysfunction following renal artery revascularization even after adjustment for baseline renal function. These findings imply that UA may blunt renal recovery in renovascular hypertensive patients independent of baseline renal function. Renal function in normal SUA group was unchanged, although we cannot rule out that PTRA improves GFR in stenotic and decreases it in contralateral, nonstenotic kidneys [In several studies, renal function in patients with ARVD that was deteriorating before PTRA stabilized thereafter. Ramos et al.  studied al study , and PTR kidneys .\u03b1-blocker usage was associated with decreased PCR after PTRA, consistent with previous study in which doxazosin reduced proteinuria by 34% [Furthermore, SUA remained an independent predictor for increased proteinuria after adjustment. Proteinuria not only predicts worse renal outcome but is also associated with an increased risk for cardiovascular disease . Severala by 34%  in patieWe also found that baseline SUA was associated with, but did not independently predict, all-cause mortality after PTRA. A relationship between UA and mortality has been previously shown in stages 3-5 CKD patients , but ourThis study has some limitations. First, this small single-center retrospective study included primarily Caucasian patients, limiting the generalizability of the results. Second, although we observed no significant difference in follow-up time from revascularization to the outcomes studied among groups, the pertinent conclusion would have been more robust had the outcomes been studied with a scheduled timetable. Furthermore, we excluded patients with severe cardiac dysfunction, which may introduce selection bias, because UA is associated with increasing incident heart failure in elderly people  and seveThis study shows that severe hyperuricemia may be associated with greater residual renal dysfunction and increased proteinuria after PTRA in ARVD patients, whereas no significant relationship between hyperuricemia and BP outcome was observed. Thus, severe hyperuricemia in AVRD patients may have a negative impact on the outcomes of renal revascularization, although this preliminary finding requires confirmation in larger clinical trials. Further studies are needed to explore the use of severe hyperuricemia as an exclusion criterion for PTRA, or the utility of a UA lowering drug before intervention."}
{"text": "Escherichia coli is one of the most favorable hosts for this purpose. Although a number of strategies for optimizing protein production have been developed, the effect of gene overexpression on host cell growth has been much less studied. Here, we performed high-throughput tests on the E. coli a complete set of E. coli K-12 ORF archive (ASKA) collection to quantify the effects of overexpressing individual E. coli genes on its growth. The results indicated that overexpressing membrane-associated proteins or proteins with high abundances of branched-chain amino acids tended to impair cell growth, the latter of which could be remedied by amino acid supplementation. Through this study, we expect to provide an index for a fast pre-study estimate of host cell growth in order to choose proper rescuing approaches when working with different proteins.Recombinant protein production plays an essential role in both biological studies and pharmaceutical production.  After the whole-genome sequences of thousands of organisms have been well documented, overexpressing genes to get highly pure proteins for further characterization and engineering becomes an indispensable part of biochemistry, molecular biology, cell biology, and synthetic biology. Moreover, among the 239 US-FDA (Food and Drug Administration) approved therapeutic peptides and proteins, as well as their 380 drug variants, the majority are manufactured by recombinant protein production . Escherichia coli is one of the most widely-used hosts to express recombinant proteins due to a number of advantages. First, it grows quickly, with a doubling time of about 20 min in rich growth media [13 cells could be obtained from 1 L of liquid Lysogeny broth (LB) medium [E. coli such as the LB medium and the Terrific Broth (TB) medium. Fourth, the genetics of E. coli is well known, and it is convenient to remove certain genes from the genome for different purposes [E. coli by plasmid transformation. Last but not least, a large number of vectors, fusion tags, and mutant strains have been developed for optimal expression of target proteins in E. coli. Several review articles have been published recently to cover these topics [In both basic research and drug production, e topics ,5.A commonly encountered problem for recombinant protein production is impeded cell growth or reduced biomass accumulation. There are two major reasons for this phenomenon. The first is the general metabolic burden, which could be explained as the competition between biomass accumulation and recombinant protein production for metabolic materials such as cellular energy, ATP, and substrates, amino acids, . This coE. coli K-12 ORF archive (ASKA) collection, which is a complete set of E. coli strains for overexpressing individual E. coli K-12 genes [E. coli genes on its own cell growth and combined the results with bioinformatical analyses to identify shared features of proteins, which could hamper cell growth. For this purpose, we utilized the a complete set of gfp was constructed by the HiFi DNA Assembly Cloning Kit (New England BioLabs) with the F primer: 5\u2032-gaattcattaaagaggagaaattaactatgagcaagggcgaagaactgtttacgg-3\u2032 and the R primer: 5\u2032-ctaattaagcttggctgcaggtcgacccttaatgatgatgatgatgatgtgagcctttatacag-3\u2032. The gene of green fluorescent protein (GFP) was expressed under the control of the same promoter used for the ASKA strains. The E. coli AG1 strain, which is the host strain of the ASKA collection was purchased from Agilent Technologies .The ASKA (\u2212) collection was obtained originally from the Coli Genetic Stock Center at Yale University. The no insert control of pCA24N was constructed by the Q5 Site-Directed Mutagenesis Kit , with the F primer: 5\u2032-taagggtcgacctgcagccaagc-3\u2032 and the R primer: 5\u2032-atccgtatggtgatggtgatggtgagatcc-3\u2032. The plasmid pCA24N-600nm = 0.15 with a total volume 150 \u00b5L of fresh LB media with 50 \u00b5g/mL chloramphenicol. Each plate had three biological replicates. The 96-well plates were sealed with oxygen-permeable membranes . The cell growth was monitored by reading the absorbance at 600 nm with microplate readers at 37 \u00b0C continuously. The doubling time was calculated by the equation: Doubling time = lg2/lgX. X is the growth rate in the exponential phase, which was automatically provided by Gen5 software designed for the BioTek microplate reader . The monitoring of GFP expression by fluorescence followed previous studies [Individual plates of the ASKA collection were replicated by inoculating 3 \u00b5L stock culture into 150 \u00b5L fresh LB media with 50 \u00b5g/mL chloramphenicol in each well of 96-well plates, and incubated at 37 \u00b0C overnight. The absorbance at 600 nm of each well was then read by the microplate reader. The overnight culture in each well was diluted to OD studies ,14.The software and online resources used for bioinformatical analyses were described in each subsection of Results and Discussion.d-1-thiogalactopyranoside (IPTG) for high-throughput growth tests. We monitored both recombinant protein production by the fluorescence intensity (600nm (p < 0.01 by the t-test), while commonly used concentrations of IPTG (0.5 to 1 mM) decreased the GFP expression significantly , leucine (Leu), and valine  are significantly increased in proteins which had severe effects on cell growth  of Ile, Leu, and Val. Most of the strains had improved growth, indicating that overexpressing proteins with high abundance of BCAAs could indeed impair cell growth, which could be then remedied by adding those BCAAs in growth media. b. We alsE. coli K12 proteins and in the group with severe growth effects was compared . For cellular localization, most of them are associated with membranes, which is consistent with the previous analysis of amino acid compositions, since membrane proteins tend to have higher abundances of nonpolar amino acids, including BCAAs due to their interactions with membrane lipids. Compared with the analysis of all the E. coli genes (p < 0.01 by the t-test). For biological processes, they span on all essential cellular processes. Compared with the analysis of all the E. coli genes (p < 0.01 by the t-test).For molecular functions, those proteins are distributed evenly in the three major categories: Enzymes, transporters, and binding proteins. Compared with the analysis of all the li genes , the frali genes , the frali genes , the frahttp://string-db.org) [Next, we analyzed the functional interaction network of proteins in the severe growth group by STRING database (-db.org)  (Figure asmB, lptD, lptG, dppC, lptF, and ftsQ. LptD, LptF, and LptG are three essential proteins in the lipopolysaccharide transport system [One cluster includes t system ,30,31. Dt system . FtsO ist system . AsmB ispheT, rplQ, rpsD, rpsG, and rnc. RplO, RpsD, and RpsG are components of ribosomes [Phe and editing activity [Another cluster contains ibosomes ,35,36. Ribosomes . PheT isactivity . Overexpactivity .bglH, mdtO, yciQ, yegI, and yihF. BglH is a carbohydrate-specific outer membrane porin [The last cluster includes ne porin . MdtO isne porin . YciQ isne porin . YihF anne porin . Again, ne porin .E. coli genes on its cell growth. Overexpression of membrane-associated proteins, or proteins with high BCAA abundances, tended to hinder cell growth. For recombinant protein production, it is suggested that the first thing is to check BCAA abundances, and supplementing BCAAs in growth media could recover cell growth when overexpressing proteins with high BCAA abundances. For membrane-associated proteins or proteins related to protein biosynthesis, it is recommended to reduce the rate of protein production with lower inducer concentrations, weaker promoters, or lower copy numbers of vector to improve cell growth for an increased total protein yields. In summary, we quantified the effect of overexpressing individual"}
{"text": "The aims of this study were to (1) determine the association between diet quality using the Dietary Approaches to Stop Hypertension (DASH) score and cardiometabolic risk in a British working population and (2) identify employee characteristics associated with reporting a poorer quality dietary pattern.n\u2009=\u20095527) were included for sex-specific cross-sectional analyses. Dietary intakes were measured using 7-day food records. DASH score was calculated to determine diet quality. Logistic regression evaluated associations between (1) diet quality and increased cardiometabolic risk , and (2) poor diet quality (lowest fifth of DASH score distribution) and employee characteristics.British police employees enrolled (2007\u20132012) into the Airwave Health Monitoring Study  of increased cardiometabolic risk independent of established risk factors  and BMI: men OR 1.50 (95% CI 1.12\u20132.00), women: OR 1.84 (95% CI 1.19\u20132.97) compared to the healthiest diet group. Characteristics associated with reporting a poor quality diet were employment in Scotland vs. England: men OR 1.88 (95% CI 1.53\u20132.32), women: OR 1.49 (95% CI 1.11\u20132.00), longer working hours (\u2265\u200949 vs. \u226440\u00a0h) men: OR 1.53 (95% CI 1.21\u20131.92) women: OR 1.53 (95% CI 1.12\u20132.09). For men, job strain (high vs. low) was associated with reporting a poor diet quality OR 1.66 (95% CI 1.30\u20132.12).The general population disparities in diet quality between England and Scotland were reflected in British police employees. The association of longer working hours and job strain with diet quality supports the targeting of workplace nutritional interventions.The online version of this article (doi:10.1007/s00394-017-1562-4) contains supplementary material, which is available to authorized users. Employment is considered beneficial to health and well-being when occupational hazards are controlled . Two typIt has been estimated that about a third of daily calorie intake is consumed in the workplace . TherefoThe two foremost food-based dietary patterns that have shown to be beneficial in the management of cardiometabolic disease risk are the Mediterranean diet and the dietary approaches to stop hypertension diet (DASH) . DietaryTo manage the increasing burden of cardiometabolic disease, public health strategies need to take account of wider environmental exposures as well as individual health behaviours. There is, therefore, a growing need to understand the relative influence of factors within different environments, such as the workplace, on dietary choice . Researcn\u2009=\u200915,404). The aims of this paper are to (1) measure the sex-specific association between diet quality determined Dietary Approaches to Stop Hypertension (DASH) score and cardiometabolic risk and (2) identify employee characteristics associated with reporting a dietary pattern associated with elevated cardiometabolic disease risk.The British police force employs over 250 000 men and women  across an\u2009=\u2009322) as these diseases may affect cardiometabolic markers of interest. The present study sample (n\u2009=\u20095527) was comparable across key characteristics the total study sample  [We conducted a cross-sectional study using baseline data collected as part of the Airwave Health Monitoring Study between 2007 and 2012. The Airwave Health Monitoring Study was open to all police forces in Great Britain, recruitment procedures and baseline characteristics have been described previously . For the\u200942,112) . The AirDietary intake was measured using 7-day estimated weighted food diaries. Participants were provided with written instructions and requested to provide details on cooking methods, brand names and portion sizes. To aid portion size estimation, photographs based on those developed by Nelson et al. were provided . CalculaMean daily intakes were calculated for \u2018positive\u2019 and \u2018negative\u2019 food groups (g/day) and sodium (mg/day) for each participant  Supplementary Table S1 details the food group descriptions. The DASH scores were calculated as described by Fung et al. . Partici2). Waist circumference was measured between the lower rib margin and the iliac crest in the mid-axillary line using a Wessex-finger/joint measure tape .Enrolled participants attended a regional health-screening clinic. Trained research nurses used a standard protocol to conduct all clinical examinations as described previously . BrieflyFor each participant, cardiometabolic risk was estimated based on the presence (yes/no) of five established risk parameters: (1) central adiposity (waist circumference\u2009\u2265\u200994\u00a0cm for men and \u2265\u200980\u00a0cm for women), (2) dyslipidaemia , (3) elevated blood pressure , (4) inflammation (Hs-CRP\u2009\u2265\u20093\u00a0mg/L\u2009<\u200910\u00a0mg/L) and (5) impaired blood glucose control (HbA1c\u2009\u2265\u20095.7% and/or prescribed medication for glucose control). Increased cardiometabolic risk was defined as having three or more of these risk factors. Medication descriptions were matched to British National Formulary category and clinical indication determined.Information on occupational, lifestyle, medical history, socioeconomic and, demographic factors was collected during the health-screen visit using a structured on-line questionnaire. Total working hours  was classified into categories  based on previous research . Job dest tests were used for data with a normal distribution (mean and standard deviation presented) and Mann\u2013Whitney U tests were used otherwise (median and inter quartile range presented). Associations across categorical variables were analysed using Chi-Squared test (\u03c72) with post-hoc comparisons conducted to determine the difference between subgroups [Ptrend) across the five ascending categories of DASH score (based on quintile ranges presented in Supplementary Table\u00a03) and the association of having three or more cardiometabolic risk markers. Orthogonal polynomial coefficients (SAS function: PROC IML) were generated and applied to the contrast statement to correct for the unequal spacing between median values of each quintile of DASH score. Established confounding variables were included in the two models: (1) minimally adjusted: age (continuous), (2) fully adjusted: age plus categorical variables: physical activity, smoking status, education, TV viewing, job strain, menopause status (women only) and continuous variables: mean energy intake and mean alcohol g/day. Where a high level of collinearity was indicated between confounding variables  the variable explaining the greatest amount of variability was retained in the model. Due to the level of missing data for employment rank and work environment, these variables were not included in the multivariable analyses to maintain analytical sample size. Body mass index (BMI) was included in a separate model (continuous variable) as it potentially lies on the causal pathway between diet and markers of cardiometabolic health. Second, we used logistic regression to investigate the employee characteristics associated with consuming a poor quality diet (classified in the lowest DASH score group). Initially, we conducted bivariate logistic regression to determine the relationship between poor diet quality  with each covariate. We then adjusted for established predictors of diet quality based on previous studies . Odds ratios (OR) are presented with corresponding 95% confidence intervals (95% CI).All statistical analyses were undertaken using SAS version 9.3 . To assess differences between two groups, independent ubgroups . To corrp\u2009<\u20090.0001. There were significant differences between men and women for all occupational characteristics measured, with men more likely to be in higher rank , and have mobile job roles  and work 49\u00a0h or more per week . Women were more likely to be classified as having no markers of cardiometabolic risk compared to men (9.1 vs. 18.0%), while men were more likely to be classified as having three or more elevated risk markers (41.4 vs. 24.8%). Of those participants that had three or more risk factors, 84% men and 95% women, had central adiposity as one of the risk factors. Waist circumference was strongly correlated with BMI for men and women .The characteristics of the population sample by sex are shown in Table\u00a0p\u2009<\u20090.0001) and non-milk extrinsic sugars , while men obtained more energy from alcohol . With the exception of whole grains and sodium, there were significant differences between energy-adjusted intakes across all food groups and dietary fibre, Table\u00a0There were significant differences between sources of energy intake between men and women. Women derived more energy from carbohydrates , Table\u00a0Logistic regression analyses showed a dose\u2013response relationship across quintiles of DASH score and the odds of having three or more markers of cardiometabolic risk for men and women (Ptrend = 0.037).In bivariate logistic regression household income was associated with poor diet quality (lowest fifth of DASH score distribution) in men but not in women, though in men the negative association observed in the highest income brackets did not remain significant after adjustment for established predictors of diet quality . Advancing age was associated with reduced odds of having a poor diet as was being in the highest category for physical activity. The highest category of education (bachelor degree or higher) was negatively associated with poor diet quality, and remained significant after adjustment . For men and women geographical region and smoking status were positively associated with poor diet quality , Table\u00a0The present study demonstrated that diet quality determined by DASH score to be negatively associated with cardiometabolic risk within British police force employees. Employees in the lowest fifth of DASH score distribution had increased odds of cardiometabolic risk independent of other lifestyle factors and BMI. This study has also identified that a poor dietary score was also associated with other negative lifestyle behaviours . Furthermore, employees reporting long working hours and high job strain (for men) had increased odds of reporting a dietary intake that was associated with cardiometabolic risk.Previous studies in German and US police officers have observed the prevalence of metabolic syndrome to be higher in this occupational group compared to the general population , 25. In There were clear dietary differences across men and women, with female police employees more likely to report a diet with a higher concentration of fruit and vegetables, and lower concentration of processed and red meat. This observation supports a previous study that also reported that women more likely make healthier choices (higher fruit and vegetable intake with lower intake of high fat foods) compared to men . The difDespite DASH being commonly applied to US cohorts and its recommendation by the American Heart Association, to date the DASH score has not been widely applied to UK cohorts to determine cardiometabolic health . In the n\u2009=\u2009247) observed that fruit and vegetable intake was positively associated with physical activity [In agreement with previous studies in European populations, we observed advancing age  and highactivity . In the activity .We observed that the number of weekly working hours had a positive association with odds of recording a poor quality diet a relationship that was independent of age, education and region of employment for men. Previous studies investigating dietary intake and number of working hours have mainly used food frequency questionnaires or food surveys to collect dietary data \u201340, therThe strengths of the present study are the large-scale collection of 7-day estimated weighted diet records from a young single occupational group who are potentially at higher risk of cardiometabolic disease compared to the general population , 25. TheIn conclusion, this study has profiled the dietary intakes and measured the diet quality (using the DASH score) of British police force employees. The novel aspect to this study has been the application of 7-day food diaries in the investigation of occupational exposures and diet quality. In general, the observed differences in diet quality across different employee characteristics  in the police force reflect those within the general British population. Our findings suggest that for male police force employees longer duration of weekly working hours and higher job strain are associated with reporting a diet quality indicative of increased cardiometabolic risk. These findings potentially support the suggestion that dietary differences may contribute to variation in cardiometabolic disease risk observed across employees working longer hours or with high job strain. To test this hypothesis, future longitudinal studies are required to investigate if diet quality meditates the relationship between these occupational exposures and cardiometabolic disease. Additionally, further investigation to examine the barriers to healthy eating amongst male employees working extended hours or with high job strain is warranted. Gaining an understanding of why this cohort of employees are more likely to consume a diet associated with increased cardiometabolic risk will assist nutritional and occupational practitioners in targeting workplace nutritional interventions.Below is the link to the electronic supplementary material.Supplementary material 1 (DOCX 71 KB)"}
{"text": "The maternal mortality rate in Lao PDR (Laos) is still the highest in Southeast Asia, at 197 per 100,000 live births. Antenatal care (ANC) could contribute to maternal and child mortality reduction. The quality of ANC service remains inadequate and little information is available on the quality of health education and counseling services of health providers in Laos. This study aims to gain insight into the perceptions of stakeholders on both supply and demand sides of public ANC services in Laos and evidence for recommendations to improve the quality of ANC services.Semi-structured interviews were conducted with 50 participants from different stakeholder groups; on the demand side, couples with a currently pregnant woman and mothers with children under one year of age and a family member; and on the supply side, health providers, managers, policy makers of the Ministry of Health, and development partners. The interviews were voice recorded and transcribed verbatim for analysis by open and thematic coding, using the MAXQDA software program.All respondents reported that the number of pregnant women who visit ANC services has increased. However, an analysis of the supply side identified issues related to the quality of ANC that need to be improved in the areas of facilities, human resources, privacy and confidentiality, providers\u2019 behavior, attitudes, and ineffective communication skills when it comes to providing health education and counseling to pregnant women and their family members. The analysis of the demand side mainly emphasized the issues of providers\u2019 behavior, attitude, communication and unequal treatment, and the lack of privacy. Both sides also suggested solutions to the problems, such as training, effective materials, rewarding good role models, and building a feedback system.The number of public ANC services has increased, but both supply and demand sides experienced challenges with the quality of ANC. All respondents proposed possible solutions to improve quality of ANC service in public health facilities in Laos. Maternal and child mortality and morbidity are major health concerns worldwide . Ninety-The WHO prepared a framework for improvement of quality of care that requires effective provision of care and positive experience of care; it includes supply of competent, motivated staff and essential physical resources , 5. A syEffective pre-, intra-, and post-natal care interventions play an important role in reducing child mortality and morbidity \u201310. ReceThe quality of ANC services influences women\u2019s healthcare seeking behavior , 13. EffIn Laos, the quality of ANC provision in general remains inadequate. However, little is known about the health education and counseling given to clients during ANC consultation. Previous studies suggested that ANC quality was poor in rural areas due to the lack of equipment and materials and weak health care provider skills , and thaThis study aims to fill that gap, by looking into the quality of communication, specifically health education and counseling in the context of ANC in Laos. Stakeholders at all levels in the health system, from central to community, were invited to give their views. The specific objectives were 1) to explore the provision of care and experiences from supply and demand sides with reference to a quality of care framework that included routine care, providing information, effective communication, respect and dignity, emotional support, competence, motivation, and essential physical resources, and 2) to gain perspectives of different stakeholders on ways to improve the quality of ANC in public healthcare facilities in Laos. The results of this research could provide health policy makers and planners with insights from practice to improve the quality of ANC services particularly in the development and implementation of the new Lao ANC guidelines.This was a qualitative study with semi-structured interviews, conducted from April to July 2017 with key informants from different stakeholder groups using guidelines with open questions. At the same time as the interviews, we made on-the-spot observations of the healthcare facilities we were visiting.We identified four stakeholder groups for this study. On the supply side: 1) directors and academic staff from each of the Department of Hygiene and Health Promotion, the Nutrition Centre, and the Information Education and Communication (IEC) Centre of the Ministry of Health (MoH) currently working in the area of nutrition, maternal and or child health; 2) health providers currently practicing at the ANC services, with at least one year\u2019s experience in providing care to pregnant women, in the central, provincial, and district hospitals, as well as health centers; 3) representatives of development partners such Save the Children, WHO, UNICEF, UNFPA, Plan International, and World Food Program, staff currently working in the area of nutrition and/or maternal and child health; and on the demand side: 4) currently pregnant women, mothers with children under one year of age, and their family members (parent/husband/grandmother).Study sites were selected using both purposive and random selection. Vientiane Capital was purposively selected as the location of policy makers and development partners as well as the central level hospitals. Of the four provinces  in Southern Laos, where ANC services have been developed to a similar standard , two wern\u00a0=\u200916); four couples of Lao Loum group, which is the majority ethnic group in Laos (two couples with currently pregnant women and two couples with mothers having children under one year of age) and four couples of an ethnic minority group (two Laven and two Brao (Lavae) couples with currently pregnant women, and mothers with children under one year of age) , one expatriate Master student (MJ), and two field research assistants. The interviewers were provided with a three-day training course prior to data collection. The interview guides were piloted in the central and provincial levels with two MoH staff, four health providers and two mothers, which led to reformulation of several questions to finalize the guides.Before the interview started, the interviewers explained the aim of the study and the general topics that would be discussed. They were told that the records would be anonymous and that they could withdraw at any moment without giving a reason. Written consent was obtained before each interview. Most of the providers were interviewed in English by MJ with the support of the local academic researcher (SP) who translated when needed. The service users were interviewed directly in the Lao language by SP. All interviews were recorded. The time of interviews ranged from 32 to 113\u2009min (average 68). Notes were made while conducting the interviews, for the summary afterwards. During the interview, spot observational field notes were made which were included in the summary of the interview.The recordings and interview notes were used to generate verbatim written transcripts for the data analysis, which were analyzed using the software program MAXQDA. The research team read the transcripts a few times and discussed the open coding process together to reach consensus on the code tree. Then, using the concepts of the quality of care of WHO framework , 5 all mThe findings related to provision of care, experience of care, essential physical and human resources, staff competence, and outcomes, are described based on the concepts of quality of care as defined by WHO . In TablI think some young staff are not able to provide ANC service properly. They cannot identify the status of the fetus.\u201d \u201cThe majority of participants mentioned that health providers could not always perform routine care correctly, which may be partly attributed to the lack of training, materials, and guidelines. For example, providers mentioned that (young) staff may have to perform their tasks without having had any specific training, so they lacked competence to measure the position and heartbeat of the fetus when performing obstetrical examination, or were not trained to provide health education on nutrition, physical activities, and danger signs for health care seeking during pregnancy and postpartum period, as illustrated by the quote below.\u201cI was not very happy when I visited the health center. The doctor did not provide me any medicine, but told me to buy it outside at a drug store. So it is better to go to district hospital and provincial hospital.\u201d There were different understandings of how routine care should be provided, which can be seen from the diversity of guidelines observed as present in facilities. A few facilities developed their own clinical guidelines or SOPs, when a national standard guideline was not available. Another issue in routine care was a lack of essential medicines. For example, several respondents on the demand side mentioned that the health facilities had no medicine for them.Some providers did not know how to explain properly to women and family members, due to lack of training and materials. I myself have never been trained for health education and counseling.\u201d \u201cThe respondents of both supply and demand sides alike mentioned that effective communication, especially in relation to counseling, was far from optimal. The main reasons given were similar as mentioned above: lack of time, guidelines, materials, and training. Counseling is not a stand-alone activity and is often given during physical examination. It was characterized by one-way provision of information rather than a mutual communication process. In some cases, health education was given to a group of several women and family members together at one time.I only accompanied my wife to the hospital and just waited outside the room. When I asked my wife about what the doctor told her, she said that the doctor talked very little and quickly during the physical exam, then asked her to go out, and she did not know and could not remember what the doctor talked about.\u201d \u201cAll health providers mentioned that time limitation did not allow them to provide sufficient information, because other clients were waiting outside. Some providers felt shy to speak with the women too much, because it is not their cultural habit to do so. Some providers did not ask the women about their needs, because they were afraid of not being able to fulfill the needs, which would be unacceptable for them. Service users also reported that very limited information was provided, and only to women \u2013 not to their family members, as illustrated by the following quote:\u201cSome clients may want to talk more, but sometimes they are afraid that if they talk more to the provider, he/she may not provide very good care to them. So they only talk about small issues even if they have a problem.\u201d In some situations, providers explained that it is not their culture to have a discussion. Women see the doctor as an authority that should tell them what to do because of their knowledge. In addition, some healthcare providers noticed that even if women did have the opportunity to ask a question, they remained silent. Also, although it does not seem to be a hierarchical issue, the clients are sometimes reluctant to discuss their health problems with health providers since they may be afraid that the provider may become angry with them if they ask (too many) questions.\u201cThe issue is that they do not do counseling, while counseling is needed to bridge the gap between telling someone what to do or having a slogan or poster, and actually helping them [with tailor made advice] to achieve change.\u201d According to development partners, participants at the MoH and some providers, when women do not ask questions or explain their personal issues to the healthcare providers, the provider cannot give appropriate counseling to the needs of the client. The development partners and the participants from the MoH all assumed that this way of providing information would result in better outcomes for both mother and newborn.Inadequate behavior and attitude of health providers was described as reflecting the problems of poor respect, lack of dignity and emotional support for users of ANC. Most participants mentioned that negative interpersonal interactions between health providers and service users occurred at all health facilities. For example, some providers were aggressive, unwelcoming, impolite, and unfriendly, spoke too loudly, used rude words, and did not smile to women and family members. Some service users mentioned that they experienced inappropriate behavior and negative attitude of health providers at least one time when they accessed ANC services in their community.\u201cI used to go for ANC at the health center; the staff blamed me that my body was unclean, smelly , and shouted at me that next time I must take a bath before coming. The second time, when I went to district hospital for my child\u2019s vaccination, a health provider scolded me, asking \u201cwhere were you when our staff went to provide vaccination in the village?\u201d I was scared and sad; I am a poor person but do not wish to meet this kind of person.\u201d Some participants of the supply side tried to explain the reasons for such inappropriate behavior and negative attitude of health providers. Poor working environment resulting in stress, fatigue, frustration and poor job satisfaction were mentioned. These were caused by high workloads with long working hours, lack of supportive supervision, and insufficient salaries without additional incentives. Most providers indicated that they and their colleagues do not always comply with behavioral norms, such as speaking in a soft voice and properly greeting clients. Clients indeed indicated that some providers talked very loudly and this was seen as very inappropriate.lack of privacy. It was observed, and confirmed in interviews, that it is common that several women were examined in the same room at the same time, at all levels of health facilities. Several service users also mentioned that sharing a room for physical examination was not appropriate, and they felt very ashamed if other people saw their bodies.\u201cI felt very ashamed during physical examination, because other women were in the same room with me, and the window was also open, so people outside the room might see my body.\u201d Another issue was the Furthermore, people in waiting areas could easily overhear conversations held in the examination room. For example, the windows towards the waiting area were open, there were no closed walls between the different rooms of the ANC services, and in some facilities, and these services were provided in the waiting room itself.\u201cI hesitated to visit ANC because I was afraid of paying more money to the provider. If I did not pay additional money or bring something to the health care worker, she may not treat me as well as she did others, especially her own family, those she knows well, and the richer people.\u201d Moreover, most service user respondents reported unequal treatment, mainly at the lower level of health facilities, as a challenge. For example, providers paid more attention and were more polite to their own relatives, to more affluent users and to those who paid extra money to them.The majority of the respondents clearly felt that poor provision and experience of care is caused by a number of factors concerning weak physical and human resources, including staff numbers, staff competence, materials, medicines, and physical space. Supply-side participants suggested four reasons for lack of (competent) staff: 1) experienced staff was assigned to work at another ward; 2) qualified staff volunteers to move where better incentives are available; 3) experienced staff was retired, and 4) new staff lacks experience and specific training.Supply-side participants also noted the lack of specific health education materials and standard guidelines to be used at health facilities at all levels, possibly explained by problems with financial support, distribution mechanisms and development. For example, many participants mentioned that materials were sent from central to provincial level, at government expense, but then the provincial level has to send it on to district hospitals and health centers without any financial support. So materials that should have been available did not reach health providers at the lower levels. Several participants, particularly IEC academic staff, reported that most existing IEC materials were developed with support from development partners or government. IEC centers themselves have no specific budget to develop specific materials and were not involved in the development of clinical guidelines.\u201cOur service is better than it has ever been; we have the rooms and place to provide the ANC service. Also the number of pregnant women who visit the ANC increased recently in our hospital.\u201d Although we did not specifically ask about health outcomes, most participants referred to outcome indicators when discussing the quality of care. According to most participants from the supply side, utilization of ANC services has recently increased:However, some respondents, on supply and demand sides alike, stated that if the overall quality is not adequate, this increased utilization is not going to be sustainable.Abundant suggestions were made about how to improve the quality of ANC service with respect to inadequate provision of care, poor experience of care, and inadequate human and physical resources. The most relevant proposals are discussed based on the responses of the study participants and how these are linked to the problems noted above.\u201cBesides integrating communication skill into the curriculum in medical school, I think we must continue to provide medical ethics training to health care providers, to repeat and remind them, because the existing curriculum of the university may not be complete.\u201d .All participants on the supply side suggested that training would be the first option to improve the health staff competency and increase awareness of medical ethics. For example, short course training, particularly for new staff, on routine care and effective communication skills would help to refresh health providers\u2019 knowledge and skills. Also they strongly recommended that refresher training on medical ethics should be done at least once a year for health providers at all levels, which might help to reduce the problems of lack of privacy/confidentiality and unequal treatment in the public health facilities. In addition, they also suggested that there is a need for more substantial, long-term training. For example, effective communication skills, particularly counseling skills and a comprehensive medical ethics course, should be integrated into the curriculum of medical schools, and offered as extra-curricular courses to providers, as one health manager said.\u201cI think other pregnant women would also like to get very good material with clear and very nice pictures to bring home to tell family members; for myself, I would get more support from them about my health and about child care.\u201d Besides the training, nearly all participants on both supply and demand sides suggested that national standard guidelines and effective materials should be available to health providers at all levels, to help provide more effective ANC services with a constant standard. Participants of both sides specified that effective materials must be clear, with attractive pictures, for both health providers and service users. Many participants, the IEC staff in particular, proposed that the design of materials should involve the clients or health care users as well as providers, from community level up. Most participants also suggested providing specific material for clients to bring home to increase the knowledge of service users, and possibly to influence other people living in the same family and community. For example, many demand side participants mentioned that it would be good if women could be given effective materials that they could share with others, particularly husbands and elderly people who have more authority in their communities.\u201cOne way is to learn from colleagues abroad, specifically healthcare services in neighboring Thailand, which has similar culture and language, that would be the most effective way to increase health providers\u2019 motivation to act differently.\u201d All participants on the supply side mentioned that having good role models would be one of the most important ways to change health providers\u2019 behavior and attitudes. For example, health providers could learn from and exchange experiences of best practices with other health providers, which might help them to gain more emotional control and increase confidence. Most participants on the supply side suggested that a good role model could be a person in their own health facilities, from other provinces, or even neighboring countries.Additionally, the majority of respondents strongly advised that one of the most important solutions, with low cost and simple implementation, would be a peer-feedback system, for example, a routine (weekly or monthly) feedback system among providers. There should also be individual feedback immediately by the manager. A feedback box should be more available and accessible for service users to give their feedback.The study aimed to analyze the current quality of ANC provision within the public healthcare system in Laos and ways to improve it, with a focus on the need for good health education and counseling. This was done by exploring perspectives of a range of supply and demand side actors using the WHO\u2019s Quality of Care Framework . We founfree delivery vouchers for maternal and child health care [Although ANC utilization has recently increased, there are serious issues with quality of care, which was, without hesitation, made clear by both health providers and policy makers and confirmed by reports of service users. The increase in use can likely be attributed to the recent policy implementation of lth care , 22. Thelth care . In anotlth care , howeverThe results indicated that essential physical and human resources remain poor in most health facilities at all levels. These findings are consistent with other research reports , 25, 26 A lack of incentives for healthcare providers in their routine ANC service was identified as another major concern in most health facilities, which is found elsewhere, especially in China, where it was recently revealed that lack of incentives for health staff is a major concern, because they could not afford to increase payments for the staff . A systeIn addition to inadequate job performance skills, the unavailability of materials and healthcare guidelines limited effective performance by health providers . Having Most respondents felt that poor staff competencies and the limited attention to medical ethical issues might be improved by training. The \u201cHealth Sector Reform Strategy and Framework\u201d also stated that increasing staff competency and medical ethics through training helps to improve quality of care . Taking Many study participants suggested that having role models of good practices is probably one good way to improve the interpersonal interactions between health providers and health users. Appropriate behavior and a positive attitude of health providers could become the normal practice at health facilities when health workers follow a good role model. Friendly, respectful and caring health providers can encourage health care utilization and client satisfaction . It woulAlthough ANC service users mentioned that they experienced inappropriate behavior of health providers, both supply and demand sides might not be aware of the full potential of the negative effect of that problem. A study in Hong Kong demonstrated that emotional or psychological abuse during pregnancy resulted in a greater risk of postnatal depression, higher risk of thinking of harming themselves, and significantly poorer mental health-related quality of life . TherefoIt is well-known that a good quality of care plays an important role in reducing child mortality and morbidity . Recent Since this study was conducted within the framework of a research to policy program, the specific information needs for ANC guideline development were taken into account. Additionally, future medical ethics and communication trainings are planned to be developed and integrated into the curriculum of the University of Health Sciences, Lao PDR.Since this qualitative study was only carried out in the two southern provinces of the country, we cannot generalize the findings to the whole country. However, according to the perceptions of the respondents from the central level, many issues arising in this study would be similar in other geographical areas of the country. Another issue is that some participants were interviewed in English with questions and answers translated back and forth between English and Lao, which could limit natural conversation between interviewers and interviewees. Respondents at community level were interviewed only in Lao, while some of them were from another ethnic group whose mother language was not Lao. However, dialect translation was done in some cases. All respondents appeared to express their opinions openly and recordings ensured that all information was collected for analysis.Although utilization of ANC services in Laos has recently increased, the quality of ANC service remains inadequate. The following actions should be taken by the Lao government: investing in the development of effective IEC materials for counseling and ANC guidelines; training on ANC routine care, counseling and medical ethics; increasing motivation for health care providers by providing direct incentives; and essential physical resources . Additionally strengthening the feedback system and building exposure to good role models into both pre-service and in-service training are strongly recommended. Additional information to deepen understanding of the communication issues could be gained from a participant observation study and program implementation."}
{"text": "In this work, the physicochemical properties and in vitro bioactivity and cellular viability of two commercially available bovine bone blocks  with different fabrication processes (sintered and not) used for bone reconstruction were evaluated in order to study the effect of the microstructure in the in vitro behavior. Scanning electron microscopy, X-ray diffraction, Fourier transform infrared spectrometry, mechanical resistance of blocks, mercury porosimetry analysis, in vitro bioactivity, and cell viability and proliferation were performed to compare the characteristics of both allograft materials against a synthetic calcium phosphate block used as a negative control. The herein presented results revealed a very dense structure of the low-porosity bovine bone blocks, which conferred the materials\u2019 high resistance. Moreover, relatively low gas, fluid intrusion, and cell adhesion were observed in both the tested materials. The structural characteristics and physicochemical properties of both ceramic blocks (sintered and not) were similar. Finally, the bioactivity, biodegradability, and also the viability and proliferation of the cells was directly related to the physicochemical properties of the scaffolds. In severely atrophic jaws, reconstructive bone surgery needs block grafting, especially in cases where the resorption of the edentulous maxilla can create a reverse maxillomandibular relation or an increased vertical distance between the jaws . In thesGiven the morbidity associated with using autografts, there is growing interest in developing animal or synthetic bone graft substitutes ,2,3. AltA good bone substitute should exhibit a similar morphology to a lost bone by displaying an internal architecture that allows the perfusion, adhesion, growth, and maturation of cells. It should also be highly hydratable to maintain an isosmotic environment that allows suitable mobility and growth of angiogenic factors, as well as low immunogenicity and being able to be fixed surgically with screws or wires. Besides that, the bone substitute should also be absorbed during a time that is compatible with bone formation ,10,11. FHydroxyapatite ceramics manufactured from natural materials, such as coral or bone, shows the advantage that they inherit some properties of the raw materials such as the pore structure ,15,16. THowever, the process of treating materials for bone grafts, and their ideal composition, have been discussed and are subject to discrepancies. For example, the sintering process can either be used or not when preparing bone grafting substitutes to promote physicochemical effects in these materials ,16,21. CSome authors studied five commercially available bone graft blocks, DIZG (Advancing the world of tissue transplantation) Human-Spongiosa, Tutobone, Puros Allograft Spongiosa, OsteoBiol Sp, and Bio-Oss were histologically studied. Three out of the five bone blocks contained organic/cellular remnants, as revealed by histology stated that their blocks were free of such remnants. These remnants could result in an unexpected and undesired immune response, inducing a foreign body reaction, and thus compromise the safety, biocompatibility and function of these three bone substitute materials . TutobonWe compared these materials with a synthetic tricalcium-phosphate (TCP), evaluated as a negative control of the analysis process, by analyzing the porosity, chemical, and mineralogical composition and sample microstructure. Hence, the objective of the present study was to evaluate the effect of the microstructure , on the in vitro behavior of the two commercially available mineralized bovine bone blocks prepared by two different processes: sintered and not sintered, in a simulated body fluid, and the differential cell proliferation of a mouse preosteoblastic cell line (MC3T3 cells) growing on these surfaces.\u00ae  called bovine bone 1, treated by a physicochemical process, e.g., the material was subjected to high-temperature deproteinization for sintering (950 \u00b0C), treated with organic solvent, and sterilized  + Ca2+ + 2OH\u2212 \u2192 Ca10(PO4)6(OH)2, and leads the nucleation on the surface of the globular particles of Ca\u2013P powders that by that time transforms into a new Ca\u2013P rich layer. This precipitate was growing with exposure time . The bovine bone 1 with an intermediate behavior showed some precipitation, but the dissolution of the material was still the dominant process (1.2% of the weight was lost). This behavior can be correlated with the crystallinity of the materials.The precipitation process was dominant in high crystalline a material and the dissolution process will be dominant in materials with poor crystallinity. The mechanism of bioactivity is a competitive process of dissolution\u2013precipitation where it is possible to model the behavior of the materials changing the physicochemical characteristic of the graft materials through the manufacturing conditions, so we can design materials with specific needs.The biological behavior of the materials can be studied by cells cultures over your surface. In this way, several researches have been carried out to investigate the interaction between cells and biomaterials ,52. In tWithin the limitations of this study and in view of the results obtained, we cannot say which of the two materials (sintered or not sintered) is better. Each material can be used in a specific clinical application in reconstructive surgery of bone pathology. Bovine bone 1 (sintered), which represents the moderate dissolution pattern, allows implementation in situations requiring partial replacement by autologous bone with a matrix in place over the longer time. Bovine bone 2 (not sintered) with a faster dissolution rate allows its use in situations requiring rapid replacement by autogenous bone. The control material with of slow resorption pattern is suitable in the situation where dimensional stability of the implant is required.In conclusion, the data from this study reveal that variations in physical properties, like phases, crystallinity, and porosity of calcium phosphate-based materials of either a natural or synthetic origin, strongly depend on manufacturing procedures. The bovine bone materials are monophasic with high porosity and medium-high crystallinity, except for bovine bone 2, whose crystallinity is lower due to the presence of a bigger quantity of collagen mixed with the hydroxyapatite matrix. As expected, the best crystallinity corresponds to the synthetic material. Pore size is similar for the studied materials of a natural origin, with certain advantages for the synthetic TCP material in relation to external pores and micropores interconnection. The viability and proliferation of the cells growing in direct contact with the bovine bone blocks are relatively low in comparison to the control group."}
{"text": "Global usage of electronic nicotine delivery systems (ENDS) has been increasing in the last decade. ENDS are non-combustible tobacco products that heat and aerosolize a liquid containing humectants, with added flavorings and often nicotine. Though ENDS are promoted as a less harmful alternative to smoking, current evidence links their use to a wide range of deleterious health effects including acute and chronic lung damage. ENDS can elicit an inflammatory response and impair the innate immune response in the lungs. Exposure to ENDS flavorings results in abnormal activation of the lung epithelial cells and \u03b2-defensins, dysfunction of the macrophage phagocytic activity, increased levels of mucin (MUC5AC) and abnormal activation of the neutrophilic response (NETosis). ENDS menthol flavorings disrupt innate immunity and might be associated with allergies and asthma through activation of transient receptor potential ankyrin 1 (TRAP1). Recent studies have expanded our understanding of the relationship between the homeostasis of lung innate immunity and the immunomodulatory effect of the host-microbiota interaction. Alterations of the normal respiratory microbiota have been associated with chronic obstructive pulmonary disease (COPD), asthma, atopy and cystic fibrosis complications which are strongly associated with smoking and potentially with ENDS use. Little is known about the short-and long-term effects of ENDS on the respiratory microbiota, their impact on the innate immune response and their link to pulmonary health and disease. Here we review the interaction between the innate immune system and the respiratory microbiota in the pathogenesis of ENDS-induced pulmonary dysfunction and identify future areas of research. Global usage of electronic nicotine delivery systems (ENDS) has increased in the last decade, especially among youth and young adults . The preThe recent outbreak of electronic cigarettes, or vaping, product use-associated lung injury (EVALI) raised national concern about the harmful effects of ENDS products and constituents . SimilarThe respiratory microbiota has also shown to play a crucial role in the lung innate immunity and inflammatory response in health and disease . Recent Prevotella spp.), Firmicutes (including Streptococcus spp. and Veillonella spp.), Proteobacteria, and Actinobacteria  and viral communities (Anelloviridae family)  .Tropheryma whipplei in the LRT  microbial immigration from the oropharynx  ; (b) mic the LRT  and the  the LRT . A unifi the LRT .The airways epithelium provides a biophysical protective barrier  and a siHaemophilus species in patients diagnosed with COPD. Thus, the respiratory microbiota interacts with the airway epithelium and phagocytic cells in a positive feedback loop to develop immunological tolerance and prevent exaggerated inflammatory responses. Further research is needed to elucidate specific mechanisms explaining immunological tolerance in the respiratory tract and to identify potential intervention targets in respiratory pathologies.According to The production of mucus and antimicrobial peptides and proteins is a key element of the innate immune system of the lung. The airway surface liquid facilitates the mucociliary transport of toxicants, microorganisms, or particulates; lubricates and hydrates the airways; and, contributes to the epithelial barrier . The muc2, immunoglobulin A, lung, and nasal epithelium clone protein, collectins (surfactant protein A and surfactant protein D), mannan-binding lectin, cathelicidins, and \u03b2-defensins  in the airways (Nicotine has been shown to increase mucin production and mucus viscosity through activation of the \u03b1 airways . Nicotin airways . However airways . Inhaled airways . Further airways . Thus, nin vitro model. Moreover, ENDS flavoring chemicals play a major role on the cytotoxic effects of e-liquids and e-liquid aerosols . ExposurStaphylococcus aureus, Streptococcus epidermidis, and Micrococcus luteus (Additionally, Clapp et al. showed that exposure to cinnamaldehyde-containing ENDS might decrease the mucociliary escalator motility by reducing bioenergetic activity  and may s luteus  and membs luteus . ENDS mes luteus , arthrits luteus , and asts luteus . Though in vitro, animal, and human studies are increasingly showing a link between the pathophysiology of respiratory disease and the exposure to ENDS aerosols (Little is known about the short- and long-term effects of ENDS on the respiratory microbiota, their impact on the innate immune response and their link to pulmonary health and disease. Preliminary studies have expanded our understanding of the relationship between the homeostasis of lung innate immunity and the immunomodulatory effect of the host-microbiota interaction. Existing and emerging evidence from aerosols . Relatedaerosols , asthma aerosols , and cysaerosols , which aFew studies have focused on the relationship between the respiratory microbiota and the immune response to air pollutants and toxicants in the respiratory tract. in vitro and in vivo models for the realistic evaluation of the respiratory microbiota-lung innate immune response in the context of immunotoxicity studies. Further research on the pathogenesis of flavor-vaping induced lung injury must consider the respiratory microbiota as a potential mediator of the immune and the inflammatory response after exposure to toxicants.The recent EVALI outbreak in the US, coinciding with a surge in youth vaping, generated a movement in the research community to establish research priorities and address challenges to support the Food and Drug Administration and World Health Organization efforts to regulate and control ENDS . ElucidaZQT, DJO, and IR initiated the idea for writing the manuscript, reviewed the literature, and edited the manuscript. ZQT drafted the manuscript. ZQT, DJO, IR, DC, DL, and SG revised, edited, and approved the final version of the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Does the inclusion of a randomized inter-trial interval (ITI) impact performance on an Attentional Blink (AB) task? The AB phenomenon is often used as a test of transient attention ; howeverMage= 21.5, SD\u00a0=\u00a07.4) completed both versions of the task, in counterbalanced order.Thirty university students (21 female; age range 18\u201357, No significant difference in performance was found between the standard AB task and the AB task with the random ITI. Bayesian analyses suggested moderate evidence for the null.Temporal unpredictability did not appear to impact task performance. This suggests that the standard AB task has cognitive properties with regards to task difficulty, engagement, and motivation, that are inherently similar to tasks that employ a randomized ITI to measure sustained attention (e.g., the Psychomotor Vigilance Task; PVT;  Given the important role attention plays in behavioural outcomes , many reThe AB occurs when an observer has a reduced ability to perceive a second target (T2) within a set of distractors when it is presented within 800 ms of an initial target T1; see . The phePast research has investigated many factors thought to influence performance on the AB task, including individual differences . AlthougIn the context of AB, foreperiod refers to the time between trial commencement and presentation of T1. The impact of foreperiod on AB was investigated by lag 1 sparing, a robust feature of the AB  refers to the length of time in milliseconds between the presentation of T1 and T2. In AB tasks this is commonly referred to as the \u201clag\u201d, which denotes the number of distractors between T1 and T2. Lag is arguably the strongest predictor of T2 perception: T2 is reliably perceived when presented immediately after T1 , making it resistant to the AB effect. This is known as f the AB . The abif the AB .Introducing a consistent lag or TOA  improves AB task performance, especially when participants are made explicitly aware of the consistency . Even whITI refers to the time between a participant\u2019s response on a trial N\u22121, and the start of the next trial N. Although AB tasks classically employ a fixed ITI, the present research seeks to explore the role that the ITI plays in shaping task performance. The time between one trial ending and the next trial commencing may be crucial with regard to preparation and anticipation, and as yet these intervals have not been investigated in relation to the AB. This would be particularly relevant to research investigating the role of pre-stimulus alpha .Although historically it has been assumed that ITI does not affect AB performance, ITI has been found to influence both reaction time and accuracy in vigilance tasks, such as the Psychomotor Vigilance Task PVT;  and the increases the AB by reducing temporal predictability, thus lessening readiness for the task.Previous studies investigating the temporal predictability of the AB have manipulated temporal attributes within the RSVP stream. Usually this is achieved by identifying a temporal aspect which is typically variable , and applying a fixed duration, to see if this attenuates the AB. However, the current research seeks to investigate this by taking a temporal attribute of the task which is usually fixed (ITI) and varying it, to see if greater variability Mage\u00a0=\u00a021.5, SD\u00a0=\u00a07.4) provided written informed consent and participated voluntarily. Most were psychology undergraduates who were received course credit. Ethical aspects of the research were approved by the Australian National University Human Research Ethics Committee (protocol 2015/184), in accordance with the ethical standards of the 2008 Declaration of Helsinki.Thirty observers  with a refresh rate of 120 Hz and a resolution of 1,920\u00a0\u00d7\u00a01,080 pixels. Behavioural responses for the AB were collected using a Cedrus RB-8 SUBJECT response box, with buttons labelled 2, 3, 4, 7, 8, and 9. Two buttons were left blank to enable participants to indicate if T2 did not appear or they did not perceive it. Experimental stimuli were created using Psychophysics Toolbox (version 3) for MATLAB R2012b .2) on a grey (17.3 cd/m2) background. Items were presented using an RSVP stream in 1.23\u00b0 Helvetica font. Each trial commenced with a fixation cross and contained between 18 and 22 stimuli. Targets were numerals  and distractors were uppercase letters, excluding those that could be confused with numbers . Each stimulus in the stream appeared for exactly 100 ms (12 frames at 120 Hz). Most trials included two targets (T1 and T2), with some \u2018blank\u2019 trials including only one target. T1 appeared with a jitter of \u00b12 items, after 4-8 distractors, and T2 was presented at either lag 3 or lag 8. In both conditions, 30 trials were presented for each lag, with lags randomly interleaved. When each AB trial had concluded, participants were allocated 3.5\u00a0s in which to respond. If participants did not respond within the time frame, a non-response was recorded, and the next trial commenced. The ITI commenced immediately after the participant had keyed in their answer for T2, or after the time limit had elapsed.Stimuli were displayed in white .During the Participants were given two AB practice blocks with auditory feedback. Both practice trials used a fixed ITI. A high-pitched beep indicated that the participant gave the correct response, while a low-pitched beep indicated that the participant gave an incorrect response. The first practice block involved 12 trials at half speed (24 frames per second). The second practice block was at full speed. Following this, participants completed the two experimental blocks in counterbalanced order. Experimental trials took place in a darkened room to avoid peripheral distractions. To ensure consistency and minimise distraction, the experimenter was not present during the experimental trials. After completing both versions of the task, participants were asked verbally if they had detected any difference between the two versions of the task. Qualitative verbal responses were recorded. After answering this question, participants were verbally debriefed.lag8\u00a0\u2212\u00a0T2|T1lag3), and was compared between fixed-ITI and random-ITI conditions. T1 accuracy was also compared between conditions, to ensure that the blink magnitude results could not be attributable to systematic differences in T1 identification. Statistical analyses were conducted in jamovi, version 9.5.15 , which in simple terms gives an odds ratio of how much more likely the null is than the alternative hypothesis  for the fixed-ITI condition and .87  for the random-ITI condition. A Wilcoxon Signed Rank Test indicated there was no systematic difference in T1 accuracy between conditions, W\u00a0=\u00a0167, p\u00a0=\u00a0.829, M (diff) = .01, SE (diff) = .03, 95% CI [\u2212.04\u2013.03], \u03b4\u00a0=\u00a0.07. In addition, we carried out a Bayesian paired-samples t-test analysis using JASP  = .03, 95% CI [.11\u2013.23], \u03b4\u00a0=\u00a01.02, and the random-ITI condition, W\u00a0=\u00a0446, p\u00a0<\u00a0.001, M (diff) = .15, SE (diff) = .03, 95% CI [.10\u2013.21], \u03b4\u00a0=\u00a01.02.t-test  indicated that blink magnitude did not significantly differ between fixed-ITI (M\u00a0=\u00a0.18 SD\u00a0=\u00a0.14%) and random-ITI  blocks, t(29)\u00a0=\u00a0.49, p\u00a0=\u00a0.631, M (diff) = .01, SE (diff) = .03, 95% CI [\u2212.04\u2013.07], \u03b4\u00a0=\u00a0.09. A follow-up Bayesian paired-samples t-test using JASP showed moderate evidence for the null, using a Cauchy prior of .707, BF01 = 4.61, error % = .007.A paired F\u00a0=\u00a00.3, p\u00a0=\u00a0.617, \u03b72p = .009, or order, F\u00a0=\u00a01.7, p\u00a0=\u00a0.202, \u03b72p = .057, and no significant interaction between trial order and ITI, F  = 3.5, p\u00a0=\u00a0.072, \u03b72p = .11. However, it should be noted that this analysis had low power, as it was not initially included as part of our experimental design, so would be worth exploring in further research. The results are plotted in As the trial order was randomised (either random ITI first or fixed ITI first), order effects were analysed in the results using a mixed ANOVA on blink magnitude, with ITI as the within-subjects factor and order as the between-subjects factor. There was no significant main effect of ITI (fixed vs. random), t-test  indicated that median reaction time (in seconds) did not significantly differ between fixed-ITI (M\u00a0=\u00a01.001 SD\u00a0=\u00a0.199) and random-ITI  blocks, t (29) = .30, p\u00a0=\u00a0.769, M (diff) = .008, SE (diff) = .026, 95%CI [\u2212.045\u2013.06], \u03b4\u00a0=\u00a0.05. A follow-up Bayesian paired-samples t-test using JASP showed moderate evidence for the null, using a Cauchy prior of .707, BF01 = 4.94, error % = .011.Since reaction times are occasionally used as an indirect measure of task engagement . Only two participants correctly detected that one version of the task had randomised intervals between trials; one of these participants had extensive prior exposure of the original AB task through other research participation. This suggests that most participants were not consciously aware of the temporal difference between AB blocks.This finding does not show evidence that randomising the ITI affects performance in the AB task. A post-hoc Bayesian analysis shows moderate evidence for the null. This result expands upon findings made by Our analysis on order effects in the data was suggested by a reviewer, but since it was a post-hoc analysis we note that it is somewhat underpowered, so these results should be interpreted with caution. However, it is interesting to note that the learning effect from the first to the second session seems somewhat less in the random-first compared to the fixed-first group see . This woThese findings have useful implications for future research, as it provides confirmation that the standard AB task, typically used as a measure of transient attention, has similar levels of interest and difficulty to those tasks which employ a random ITI. Such tasks are typically used as a measure of sustained attention ; The method adopted in the present experiment can be summarised as being a highly pared-back version of the AB task, in conjunction with a brief but randomised ITI, akin to the PVT, though considerably reduced in length. The decision to use the simplified version of the AB task was mainly practical; fewer lags required fewer trials overall, increasing the number of trials possible for each lag and thus giving increased signal-to-noise ratio. However, the rationale for the use of the random interval was more complex.Although most experimental paradigms involving a PVT use longer randomised intervals of 2 to 10\u00a0s, this was deemed too long in the current experiment, which instead used a randomised ITI of 0.1 to 3.1\u00a0s. Firstly, the inclusion of a longer ITI would drastically alter the length of the two versions of the task, potentially rendering them incomparable. Secondly, it was believed that the use of a longer ITI might appear too obvious in contrast with the fixed ITI, and that this noticeable difference might consciously influence participants\u2019 performance. Indeed, it appeared that the abridged ITI of 0.1 to 3.1\u00a0s did successfully evade detection in most cases.It is possible that, during the randomised ITI condition, participants may have performed differently during longer compared to shorter ITIs \u2013there is certainly precedent for this in the literature  had a measurable effect on task performance and engagement in the SNARC effect .Click here for additional data file.10.7717/peerj.8677/supp-2Supplemental Information 2Click here for additional data file.10.7717/peerj.8677/supp-3Supplemental Information 3Click here for additional data file.10.7717/peerj.8677/supp-4Supplemental Information 4This folder contains the MATLAB code necessary to replicate the experiment and analyse the raw data from the paper.Click here for additional data file.10.7717/peerj.8677/supp-5Supplemental Information 5Click here for additional data file.10.7717/peerj.8677/supp-6Supplemental Information 6Each data point represents the proportion of correct responses for T2 given that T1 was identified correctly, from 30 trials.Click here for additional data file.10.7717/peerj.8677/supp-7Supplemental Information 7This analysis in jamovi shows that removing non-responses to T2 from all the analyses produces extremely similar results to those reported in the paper (where non-responses were scored as incorrect).Click here for additional data file.10.7717/peerj.8677/supp-8Supplemental Information 8This file should enable the reader to replicate all the statistical analyses in the paper using any statistical programClick here for additional data file."}
{"text": "For this purpose, we have recently developed a new concept of device based on Electrodes Array for Sampled-Current Voltammetry (EASCV), which is compatible with miniaturization and portability. In this work, to improve the sensitivity of the analytical method, we added a preconcentration step before EASCV analysis, combining sampled-current voltammetry with anodic stripping voltammetry. Lead was chosen as analyte for this probe of concept owing to its high toxicity. The conditions for electrodeposition of lead on gold were optimized by means of under potential deposition. Current intensities 300 times higher than with linear sweep anodic stripping voltammetry were obtained, showing the interest in the method. The value of the sampling time directly affected the sensitivity of the sensor given by the slope of the linear calibration curve. The sensor exhibited a limit of detection of 1.16 mg L Heavy metals such as lead, mercury and cadmium are very toxic even at trace level with European drinking water guidelines set at 10, 1 and 5 \u03bcg/L, respectively . To faciElectrochemical studies on this field focused on more sensitive, reproducible and selective systems. The improvement of the detection of heavy metals at trace level requires the optimization of anodic stripping voltammetry. Thus, Krowa-Eisner et al. used Subtractive Anodic stripping voltammetry (SASV) ,19. Thisversus the applied potential. Thus, the renewal of the electrode surface was assured and a fresh solution was always available close to the electrode surface. Since the data acquisition that does not require the use of a potential ramp was simplified, the device can be portable and cost-effective. Our previous studies focused on the interest in the method to mimic dropping mercury electrodes and to circumvent the problem of passivation during analysis.We have previously reported a new analytical method called Electrodes Array for Sampled-Current Voltammetry (EASCV) based on sampled-current voltammetry performed on an electrode array ,23. A poThe aim of this new study is to combine an electrodeposition step with EASCV for heavy metal detection. The use of an electrode array in EASCV allows a coupling of methods that was not possible before with dropping mercury electrodes. Since a new electrode covered by the same amount of metal will be analyzed at each applied potential, high current intensities will be expected with a simplified data processing for an easier adaptation to portable device. Lead detection was chosen in this work as an example of application.3 solution followed by ultra-pure water before use to avoid metal contamination.Lead (II) nitrate or Lead (II) chloride 99% were purchased from Acros and Aldrich, France, respectively. All solutions were prepared with ultra-pure water . All glassware and the electrochemical cell were rinsed with a 10% HNOThe electrodes prepared by photolithography ,24 were 3 69%. After rinsing abundantly with ultra-pure water, the electrode array was washed in several baths of ultra-pure water with slow stirring (50 rpm).After analysis, the electrodes were regenerated in HNOThe electrochemical analyses were performed in a standard three-electrode configuration, with a platinum wire counter electrode, a saturated calomel reference electrode (SCE) and a gold electrode depending on the experiment:2) inserted in a tube of glass (polished before each experimentation)(1) A gold bar ((2) An electrode array  under deaerated conditions in an electrochemical cell adapted to the electrode Concerning the homemade electrode array the electrochemical experiments were performed in a homemade electrochemical cell  22]. Th. Th22]. \u00ae Model potentiostat/galvanostat with a versaSTAT LC Low Current Interface (Princeton Applied Research) and the versaStudio Software.Cyclic voltammetry and chronoamperometry experiments were carried out with a VersaSTAT3 AMETEK\u22121 sodium chloride or 0.01 mol L\u22121 KNO3 potassium nitrate as supporting electrolyte according to the nature of the lead salts.The electrochemical analysis was performed in ultra-pure water, containing either 0.1 mol LThe electrochemical signal of lead depends on the nature of the electrode. In this study, gold was chosen as a good alternative to mercury ,13,14 anTwo cathodic peaks beginning at \u22120.025 V/SCE (1) for UPD1 and \u22120.275 V/SCE (2) for UPD2 appeared at more positive potentials than the lead equilibrium potential (\u22120.46 V/SCE). This phenomenon called UPD occurs when a metal is deposited on an electrode of different nature. Thus, the metal is deposited at a potential higher than its equilibrium potential due to a difference in affinity between the metal and the surface of the electrode compared with the metal-metal interaction. The interactions between the metal and the electrode surface are stronger than the metal-metal interactions. Therefore the energy required to reduce the first layer of metal is less important than that required for multilayer formation . The appThe UPD signal in stripping voltammetry analysis offers several advantages . First, Different electrodeposition potentials (Ed) were tested ranging from \u22120.3 V/SCE to \u22120.7 V/SCE for the same deposition time (td = 60 s) .The peak current increased when the electrodeposition potential was more negative. A first peak was observed at \u22120.075 V/SCE. The presence of a shoulder at \u22120.25 V/SCE for Ed = \u22120.35 V/SCE showed the appearance of a second peak, which was clearly visible when Ed = \u22120.5 V/SCE. Finally, a third peak appeared for Ed = \u22120.7 V/SCE. This peak probably corresponded to the multilayer deposition of lead since it occurred at \u22120.53 V/SCE under these conditions . It has \u22127 mol L\u22121 lead chloride was electrodeposited at a potential of \u22120.5 V/SCE on a gold electrode of the array.To study the effect of the electrodeposition time, a solution of 5 \u00d7 10d.d up to 90 s. A decrease was observed when higher electrodeposition times were used (120 s), probably due to a weak adherence between lead and the gold electrode surface. A time of 90 s was then chosen in further experiments as a good compromise between the analysis time and the current intensity.\u22129 mol cm\u22122 [The surface area occupied by lead on a flat gold surface has been estimated to be 1.6 \u00d7 10mol cm\u22122 . For a gThis corresponds to a charge of:This value is 33 times higher than the experimental value, showing that a submonolayer was obtained after an electrodeposition step of 90 s. It confirmed the UPD electrodeposition of lead on the electrode surface.3, followed by extensive rinsing with ultra-pure water.After each analysis, the electrode array was electrochemically oxidized and then washed in concentrated HNO\u22121 of lead chloride. versus time with and without blank subtraction. The potentials applied to the electrodes of the array were incremented by 0.03 V between \u22120.25 V/SCE and 0.15 V/SCE. A current peak was observed at short times, which has been previously linked to the response time of the potentiostat [A first test was carried out for a concentration of 15 \u03bcmol Lntiostat . HoweverThe variation of the current was higher in the presence of lead compared with the blank, with current values about seven times higher than in the absence of lead a,b.versus time. In The onset potential corresponding to the oxidation of lead was around \u22120.2 V/SCE, which corresponded to the potential of UPD1 in To show the interest of the method compared to linear sweep anodic stripping voltammetry, an analysis of a lead solution was carried out under the same electrodeposition conditions and with the same electrode surface .As expected, the current intensity of the peak obtained by linear voltammetry was at least 300 times lower than the maximum value obtained by EASCV. The difference was more pronounced if the sampling time was shorter. Indeed, in linear voltammetry, lead deposited on the electrode surface began to be reoxidized from \u22120.45 V/SCE and when the potential of the peak was reached, a high amount of lead was already oxidized. In EASCV, each electrode was independent of each other and the same initial amount of lead was present on the electrode surface when a new potential was applied. The high current intensities is an advantage of EASCV since the method does not require a Faraday cage and it is also very promising for application with ultramicroelectrodes.2 was performed on the same electrode array.To simplify, the variation of the current as a function of lead concentration was studied by applying three potentials close to the maximum of current observed in \u03b8: 0.005 s and 0.007 s. In This experiment was repeated three times and the average obtained is shown in For highest concentrations of lead, the current decreased when the potential increased, probably due to the higher kinetics of the oxidation reaction. Therefore, the calibration curves were plotted from the current values obtained at 0.07 V/SCE. These calibration curves for the two different sample times are given in With \u22121 for \u03b8 = 0.005 s and 1.41 mg L\u22121 for 0.007 s. These data clearly demonstrate the influence of the sampling time on the results. First, a shorter sampling time led to higher current intensities and to a higher slope of the calibration curve  was similar to those of EASCV. For comparison, the limit of detections LOD of sensors with gold working electrodes reported in literature are given in \u22121 in EASCV and 1.02 mg L\u22121 in linear voltammetry). It underlines that the performances of the sensor should be improved by changing the nature and size of the working electrodes of the array.The sensitivity was significantly lower than for EASCV owing to the lower current range. Owing to this low current range, a Faraday cage was necessary to obtain a good precision of the current values. It is also interesting to note that significantly lower sensitivities were previously reported for anodic stripping voltammetry of lead performed on gold electrode (0.043  and 0.01\u22121 L ). HoweveThe aim of this article being the effect of coupling EASCV with an electrodeposition step on the current signal, the selectivity of the device was not studied and similar interferents already reported for anodic stripping voltammetry on gold electrode ,13,14,33\u22121, which was similar to those of anodic stripping voltammetry on a single electrode. This value is high to measure lead in drinking water (10 \u03bcg L\u22121), but it is close to the limit of 0.5 mg L\u22121 for industrial wastewater according to the decree of 2 February 1998 [This study proposes a new analytical technique for the detection of trace metals by coupling EASCV with anodic stripping voltammetry. As a first advantage, the simplicity of the method would allow analyses on field with a portable system. Since a high electrochemical signal was expected with this method, under potential deposition of lead on the gold electrode array was used to simplify the electrochemical signal. Interestingly, the comparison of this technique with linear voltammetry showed that the maximum current intensity was 300 times higher for a same concentration. It results in a significantly higher sensitivity of the sensor given by the slope of the linear calibration curve. This result is very promising since it underlines the interest of coupling EASCV with a preconcentration step. The application of this first sensor for lead detection led to a limit of quantification of 1.16 mg Lary 1998 . An impr"}
{"text": "Instead of having affiliations The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
{"text": "Instead of \u201cThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
{"text": "An incomplete disclaimer was used.In the original article, there was an error. Disclaimer:A correction has been made to Disclaimer: The findings and conclusions in this publication are those of the author(s) and should not be construed to represent any official USDA or U.S. Government determination or policy. Mention of any trade name, proprietary product or specific equipment does not constitute a guarantee or warranty by USDA-ARS and does not imply its approval to the exclusion of other products that may also be suitable. The USDA-ARS is an equal opportunity and affirmative action employer and all agency services are available without discrimination.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
{"text": "Background and Objectives: Metabolic syndrome (MetS) is a multiple risk factor for atherosclerosis, cardiovascular disease, type 2 diabetes and strokes. One-third of middle-age women are at risk of MetS, which predisposes them to type 2 diabetes and cardiovascular disease. Changes in the regulation of anti-inflammatory cytokines\u2015which play an important role in pathologic processes\u2015may contribute to inflammatory disorders. Cytokine polymorphisms are known to have an impact on gene expression. The purpose of this study was to search for the relationship between the IFNG polymorphisms and the levels of proinflammatory cytokines. Materials and Methods: This study, conducted in West Pomeranian Voivodeship, Poland, involved 416 women. Of these women, 33.6% of them had primary education, 44.8% lived in cities with a population of over 100,000, and 82.7% were married. Of the participants, 28.4% met the criteria for MetS. The study involved: interview performed to collect sociodemographic and medical data, anthropometric measurements, as well as venous blood collection for biochemical analysis, genetic testing and the measurement of inflammatory markers. Results: The link between the IFNG (rs2430561) polymorphism and serum PIC (proinflammatory cytokines) levels was tested with regard to MetS. In the MetS+ subgroup, the T/T and A/T genotypes of the IFNG gene were accompanied by higher IL-6 levels than in the MetS\u2212 subgroup. Conclusion: Our study has not confirmed a direct link between the IFNG polymorphisms and the levels of inflammatory biomarkers. Nevertheless, the T/T and A/T genotypes of the IFNG gene may predispose to elevated IL-6 levels. Metabolic syndrome (MetS) is a multiple risk factor for atherosclerosis, cardiovascular disease, type 2 diabetes and strokes. It is a worldwide health problem; whose incidence rate ranges from 13.8% to over 60% in different populations . MetS coAs a result of reduced sex hormone secretion in the perimenopausal period\u2015a natural consequence of gonadal dysfunction and aging\u2015 many women develop chronic diseases from the sixth decade onwards, which affects their quality of life. As defined by the stages of reproductive aging workshop (STRAW) criteria, perimenopause is the time between the first major changes in the length of the menstrual cycle  and the period of 12 consecutive months without menstruation . PotentiOne-third of middle-age women are at risk of developing MetS, which predisposes them to type 2 diabetes and cardiovascular disease (CVD) ,15,16.Obesity, insulin resistance and type 2 diabetes entail chronic inflammation, resulting from abnormal levels of cytokines, acute phase reactants and other inflammatory signaling markers . MetS isIFNG +874 A/T single nucleotide polymorphism (SNP) located at the position +874 of intron 1 can affect the secretion of IFN\u03b3. The IFN\u03b3 production is determined by the polymorphic IFNG (rs2430561) gene, which includes the T allele, contributing to high IFN\u03b3 production and the A allele responsible for low IFN\u03b3 production. Average levels of IFN\u03b3 cytokines are higher in healthy carriers of the T allele than in those with the A allele. It has been clearly demonstrated that the T-to-A polymorphism has a direct effect on the level of IFN\u03b3 production [Changes in the regulation of anti-inflammatory cytokines\u2015which play an important role in pathologic processes\u2015may contribute to inflammatory disorders. Cytokine polymorphisms are known to have an impact on gene expression. Interferon gamma (IFN\u03b3) is the main proinflammatory cytokine. Studies show that the oduction .IFNG polymorphisms and the levels of proinflammatory cytokines  in women aged 45\u201360 years.The purpose of this study was to analyze the relationship between the This study, conducted in West Pomeranian Voivodeship (Poland), involved 416 women, whose mean age was 53.5 years. The inclusion criteria were female sex, the age of 45\u201360 years, using MHT and no history of inflammatory, psychiatric or neoplastic diseases. All participants were non-smokers, drank less than 20 g of pure alcohol per day or drank occasionally no more than 40 g of pure alcohol and abstained from alcohol at least two days per week. Of the participants, 33.6% had primary education, 27.7% had tertiary education, 44.8% lived in cities with a population of over 100,000, almost 40% lived in rural areas, 82.7% of the women were married, 28.4% met the criteria for MetS. Each participant gave informed written consent to take part in this study.The study was carried out in accordance with ethical standards and the Declaration of Helsinki. The protocol was approved by the bioethical committee of the Pomeranian Medical University, Szczecin, Poland on 19 June 2017 .IFNG (rs2430561) polymorphism. The biologic material for DNA analysis was stored and transported in accordance with the quality management system of the Genetic Laboratory, Clinic and Department of Psychiatry .The study involved: interview performed to collect sociodemographic and medical data ; anthropometric measurements ; venous blood collection for biochemical analysis, genetic testing and the measurement of inflammatory markers in accordance with the procedures for sampling and transport of the biologic material. Blood was taken between 7.00 and 9.30 a.m. after overnight fasting and ten-minute rest in a sitting position. Blood was collected to two Vacutainer tubes : a tube containing 1-g/L dipotassium (K2) ethylenediaminetetraacetic acid (EDTA) and a tube for biochemical serum analysis (7 mL). The levels of triglycerides, HDL and glycemia after overnight fasting were determined. Next, DNA was isolated for genetic analysis of the Additionally, the levels of inflammatory markers  were determined.n = 118) comprising respondents who met the criteria for MetS based on the International diabetes federation (IDF) classification [n = 298)\u2014including those who did not meet the above-mentioned criteria. The respondents were assigned to the MetS+ subgroup if they had at least three out of the five components of MetS: waist size \u226580 cm; glycemia on an empty overnight fasting \u2265100 mg/dL (5.6 mmol/L) or related pharmacotherapy; the levels of triglycerides \u2265150 mg/dL (1.7 mmol/L) or related pharmacotherapy; HDL cholesterol \u226450 mg/dL (1.3 mmol/L) or related pharmacotherapy; systolic blood pressure \u2265130 and/or diastolic blood pressure \u226585 mmHg or related pharmacotherapy.Based on the results of laboratory and anthropometric measurements, the women were qualified to two subgroups: the MetS+ subgroup (fication  and the p < 0.05. All tests were two-tailed. The two groups (MetS+ and MetS\u2212) were compared using the Student\u2019s t-test in the case of normal data distribution and the Mann\u2013Whitney U test in the case of skewed data distribution. To assess the link between MetS and particular genotypes, four inheritance models were tested with the Bayesian information criterion (BIC) in order to select the best one. An effect of particular variables and alleles on the development of MetS was calculated using odds ratio (OR) with 95% confidence interval (CI).Statistical analysis was performed using Statistica 13.0 PL  and R software (R Core Team (2013). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria). Statistical significance was set as The results presented in this manuscript are a part of the larger project performed by a team of researchers.p < 0.001) between waist size, the levels of glycemia after overnight fasting, triglycerides and cholesterol, systolic and diastolic blood pressure and MetS. A statistically significant relationship (p < 0.05) was also noticed between Mets and the level of IL-6. MetS was not statistically significantly related to the levels of IL-1\u03b1, IL-1\u03b2, TNF\u03b1 and IFN\u03b3  polymorphism with regard to MetS. The T/T genotype was found in 45% of the participants, the A/T genotype in 39% and the A/A genotype in 16%. The T allele was more common (64%) than the A allele (36%). There were no significant differences in the distribution of the genotypes and alleles between the participants who met the criteria for MetS and those who did not. We tested the link between the IFNG (rs2430561) polymorphism and serum PIC levels with regard to MetS. In the MetS+ subgroup, the T/T and A/T genotypes of the IFNG gene were accompanied by higher IL-6 levels than in the MetS\u2212 subgroup.We analyzed the distribution of the genotypes and alleles of the IFNG gene in any of the MetS subgroups  in older women with and without MetS, found that those with MetS had higher levels of cytokines and risk factors for cardiovascular disease  [ificant) . Other aificant) . In a stificant) .IFNG +874 T polymorphism has an effect on the expression of this gene. The A/A genotype was accompanied by lower levels of IFN\u03b3 than the T/T genotype and the heterozygous T/A genotype entailed average IFN\u03b3 levels [IFNG +874 T/A polymorphism was linked to lower levels of total cholesterol and triglycerides [In our study, MetS was significantly related to the levels of IL-6, but not to the levels of IL-1\u03b1, IL-1\u03b2, TNF\u03b1 and IFN\u03b3. The results show that the \u03b3 levels . IFN\u03b3 ta\u03b3 levels . Polymor\u03b3 levels . It was ycerides .IFNG +874 polymorphism on the levels of selected inflammatory biomarkers in patients with and without MetS. Respondents having no history of inflammatory, psychiatric or cancerous diseases and not using MHT were qualified to participate in the study. All participants were non-smokers and did not drink excess alcohol. The results did not reveal significant differences in the distribution of genotypes and alleles between the Mets+ and the Mets\u2212 subgroups. However, in the MetS+ subgroup, the T/T and A/T genotypes of the IFNG gene were accompanied by higher IL-6 levels than in the MetS\u2212 subgroup. There were no significant differences in the levels of other biomarkers .We analyzed the influence of the IFNG gene on the level of IL-6. The study by Kim et al. demonstrated that the risk of cardiovascular disease, estimated using the Framingham risk score (FRS \u2265 10%), was associated with the socioeconomic status of the respondents more than with Mets [The study presented here has some limitations. Due to the substantial influence of sociodemographic factors and health behaviors on the respondents\u2019 health status, we are not able to clearly determine the influence of the T/T and A/T genotypes of the ith Mets . Anotherith Mets . It is aith Mets . Furtherith Mets .IFNG polymorphisms and the levels of the inflammatory biomarkers in perimenopausal women analyzed with regard to MetS. However, the presence of the T/T and A/T genotypes of the IFNG gene may predispose to elevated IL-6 levels.Our study has not confirmed a direct link between the"}
{"text": "Mugilogobius myxodermus is an endemic freshwater fish in china. Herein, we sequenced and assembled the first complete mitogenome of M. myxodermus. The total length of the mitogenome is 16,495\u2009bp, containing 13 protein-coding genes, two ribosomal RNAs (rRNA), two non-coding regions (control region and origin of light-strand replication), and 22 transfer RNAs (tRNA). The overall base composition of M. myxodermus is 26.76% T, 28.97% C, 27.81% A, and 16.45% G, respectively. A phylogenetic tree showed that M. myxodermus clustered closest to M. abei. The complete mitogenome of M. myxodermus provides a resource for studies on biogeography and evolution of this gobiid fish.The  Mugilogobius myxodermus . The specimens of M. myxodermus were collected from the Lake Tai at Wuxi, China  and identified by morphology (Larson http://www.lasdr.cn/pages/resdata_dataview.jsp?id=10069100). Total genomic DNA was extracted from the tail fin with the HiPure Tissue DNA Mini Kit . The versatile primers were designed on the basis of the mitogenome sequence of Mugilogobius abei (GenBank Accession No. NC_023353) , two non-coding regions (control region and origin of light-strand replication), and 22 transfer RNAs (tRNA). Except for the eight tRNAs  and ND6 genes encoded on the L-strand, all other mitochondrial genes are encoded on the H-strand. The overall nucleotide composition of M. myxodermus is 26.76% T, 28.97% C, 27.81% A, and 16.45% G, respectively. All 13 protein-coding genes start with ATG except COXI which starts with GTG. Most of the protein-coding genes (10 of 13 genes) end with TAA, TAG, and AGG, the other three genes  have T or TA incomplete stop condon, which are very typical in many other gobiid fishes (Chen and Wen M. myxodermus contains two non-coding regions: the control region (D-loop) is 850\u2009bp in length, which is located between ProtRNA and PhetRNA genes; another small non-coding region, which is a 36\u2009bp fragment and the origin of light-strand replication (OL), is located between the AsntRNAand CystRNAgenes. The gene content, structure, and arrangement of mitogenome in M. myxodermus are similar to those observed in other fishes  were mined from GenBank. A maximum likelihood phylogenetic analysis was conducted using the software Mega 6 (M. myxodermus was phylogenetically placed near the M. abei and M. chulae, with a very short branch length. The complete mitochondrial genome of M. myxodermus will be useful for further evolution and biogeography studies of gobiid fishes.All available full mitogenome sequences of subfamily Gobionellinae and two non-percomorph outgroups (e Mega 6  (Tamura e Mega 6 . M. myxo"}
{"text": "Exercise stress testing (EST) is routinely used to diagnose CPVT, but it is ineffective for CRDS. There is currently no effective diagnostic tool for CRDS in humans. An alternative strategy to assess the risk for CRDS is to directly determine the functional impact of the associated RyR2 mutations. To this end, we have functionally screened 18 RyR2 mutations that are associated with idiopathic ventricular fibrillation (IVF) or sudden death. We found two additional RyR2 LOF mutations E4146K and G4935R. The E4146K mutation markedly suppressed caffeine activation of RyR2 and abolished store overload induced Ca2+ release (SOICR) in human embryonic kidney 293 (HEK293) cells. E4146K also severely reduced cytosolic Ca2+ activation and abolished luminal Ca2+ activation of single RyR2 channels. The G4935R mutation completely abolished caffeine activation of and [3H]ryanodine binding to RyR2. Co-expression studies showed that the G4935R mutation exerted dominant negative impact on the RyR2 wildtype (WT) channel. Interestingly, the RyR2-G4935R mutant carrier had a negative EST, and the E4146K carrier had a family history of sudden death during sleep, which are different from phenotypes of typical CPVT. Thus, our data further support the link between RyR2 LOF and a new entity of cardiac arrhythmias distinct from CPVT.Mutations in cardiac ryanodine receptor (RyR2) are linked to catecholaminergic polymorphic ventricular tachycardia (CPVT). Most CPVT RyR2 mutations characterized are gain-of-function (GOF), indicating enhanced RyR2 function as a major cause of CPVT. Loss-of-function (LOF) RyR2 mutations have also been identified and are linked to a distinct entity of cardiac arrhythmia termed RyR2 Ca All of the PCR products were purified using the QIA quick PCR Purification Kit. cDNA fragments containing the desired mutations were removed from the PCR products and used to replace the corresponding wildtype (WT) fragments in the full-length mouse RyR2 cDNA in the expression plasmid pcDNA5 ryanodine binding to cell lysates was performed as described previously [3H]ryanodine at 37\u00b0C for 2 h in 300 \u00b5l of a binding solution containing 500 mM KCl, 25 mM Tris, 50 mM HEPES (pH 7.4). Free [Ca2+] (0.1 nM to 100 \u00b5M) was adjusted by EGTA and CaCl2 solutions using the computer program of Fabiato and Fabiato [3H]ryanodine retained in filters was determined by liquid scintillation counting. Specifically bound [3H]ryanodine was calculated by subtracting nonspecific binding that was determined in the presence of 50 \u00b5M unlabeled ryanodine. All binding assays were performed in duplicate. [3H]ryanodine binding data were fitted with the Hill equation using the Prism 8 .Equilibrium ryanodine binding to RyR2. Similarly, we found that the G4935R mutation completely abolished Ca2+ dependent activation of [3H]ryanodine binding to RyR2 when it was expressed alone  and SCD result from GOF defects of the RyR2 channel . However2+ waves under conditions of SR Ca2+ overload such as during physical and emotional stress [2+ waves are well-known cause of DADs, which, in turn, can lead to triggered activity, triggered arrhythmia, and SCD [2+ alternans, EADs, and re-entrant activities [The existence of both GOF and LOF RyR2 mutations has profound implication for the understanding of RyR2-associated cardiac arrhythmias. The GOF RyR2 mutations are believed to enhance the propensity for spontaneous Cal stress . These s and SCD ,31\u201333. Htivities . TherefoGiven these fundamental differences in their functional impact, the diagnosis and treatment strategies for ventricular arrhythmias associated with GOF or LOF RyR2 mutations would have to be different. EST is widely used for the diagnosis of typical CPVT, which is associated with GOF RyR2 mutations. However, such a test would be ineffective in identifying patients carrying LOF RyR2 mutations because of their lack of response to exercise stress test . In thisIt is of interest to note that although mutations G4935R, S4938F, and R4959Q are all located in the CTD, their impact on RyR2 channel activation is very different. R4959Q does not significantly alter caffeine activation of RyR2, while S4938F markedly suppresses caffeine activation, and G4935R completely abolishes caffeine activation. Thus, it would be challenging to predict whether a mutation will impact channel function solely based on the domain it is located in.2+ oscillations in RyR2-E4146K mutant expressing HEK293 cells. On the other hand, high concentrations of caffeine induced a single peak of Ca2+ release in RyR2-WT expressing HEK293 cells. The exact mechanism underlying this difference is not completely understood. We have shown previously that caffeine induces Ca2+ release/Ca2+ oscillations in RyR2-expressing HEK293 cells by reducing the threshold for SOICR [2+ oscillations in the absence of caffeine. Whereas, in the presence of 10 mM caffeine, the SOICR threshold in RyR2-E4146K expressing HEK293 cells would be reduced to a level at which spontaneous Ca2+ oscillations can now occur. On the other hand, the normal SOICR threshold in RyR2-WT expressing HEK293 cells would be dramatically reduced by 10 mM caffeine, resulting in the depletion of ER Ca2+ stores, which may explain the lack of Ca2+ oscillations in RyR2-WT expressing HEK293 cells in the presence of 10 mM caffeine [Another interesting observation is that the presence of caffeine (10 mM), but not the absence of caffeine, induced Caor SOICR . The obscaffeine .In summary, the present study reveals novel LOF RyR2 mutations associated with IVF and SCD with negative exercise stress test. IVF and SCD associated with loss of RyR2 function represents a new entity of ventricular arrhythmias distinct from CPVT. Different strategies and protocols will be required for the diagnosis and treatment of ventricular arrhythmias associated with enhanced or suppressed RyR2 function.Click here for additional data file."}
{"text": "Ciona robusta Oc protein to show its requirement for ciliary PRC differentiation. Then, transcriptome profiling between the trans-activation and trans-repression Oc phenotypes identified differentially expressed genes that are enriched in exocytosis, calcium homeostasis, and neurotransmission. Finally, comparison of RNA-Seq datasets in Ciona and mouse identifies a set of Oc downstream genes conserved between tunicates and vertebrates. The transcription factor Oc emerges as a key regulator of neurotransmission in retinal cell types.Photoreceptor cells (PRC) are neurons highly specialized for sensing light stimuli and have considerably diversified during evolution. The genetic mechanisms that underlie photoreceptor differentiation and accompanied the progressive increase in complexity and diversification of this sensory cell type are a matter of great interest in the field. A role of the homeodomain transcription factor Onecut (Oc) in photoreceptor cell formation is proposed throughout multicellular organisms. However, knowledge of the identity of the Oc downstream-acting factors that mediate specific tasks in the differentiation of the PRC remains limited. Here, we used transgenic perturbation of the  Onecut (Oc) gene family of transcription factor coding genes plays key roles in the development of the vertebrate eye  for its expression during neurogenesis  have been organized in many different manners in order to enable organisms to perceive light and recognize light direction and, in vertebrates, form high-resolution imaging Lamb, . PRC conOc genes have maintained neurogenic roles described in non-vertebrates, evolving novel functions according to the increased complexity of the nervous system  by miR-9 binding is essential for eye angiogenesis , retinal ganglion cells (RGC), PRC, and amacrine cells (AC) was evidenced by loss-of-function studies in mice . Animals were acclimatized at ~20\u00b0C for 2\u20133 days in open system tanks and fed every day with a solution of marine microalgae concentrates (Shellfish Diet 1800\u2122 Instant Algae\u00ae). Subsequently, they were exposed to continuous lighting for a few days in order to accumulate mature gametes and to prevent gamete spawning.Adult specimens of Ciona OC full-length coding sequence fused in frame with the Vp16 activator or WRPW repressor domains . Each electroporation experiment was repeated at least 10 times and GFP-positive embryos (corresponding to 80\u201390% of the developed ones) were used partly for statistical analyses and partly were collected and treated for subsequent experiments . For phenotypic analyses of transgenic larvae, about 80 GFP-positive larvae (stage 26), in three experimental replicates, were analyzed under a light microscope and evaluated for their phenotypic alterations of pigmented sensory organs. A total of 233 and 243 transgenic larvae were counted and used for the percentage calculation of the more representative phenotypes observed in the OC::Act and OC::Rep conditions . The mapping of paired-end reads was performed using the bioinformatics tool STAR (version 2.5.0a) . The reference genome version was the assembly Ciona_intestinalis.KH.78 . All the Ensembl gene name codes were shortened for simplicity . Genes were considered differentially expressed (DEGs) when count filtered for padj <0.05 and FC >|1.5|.Cell dissociation and magnetic-activated cell sorting (MACS) were performed as described , transcript sequences were aligned vs. the UniProt Swiss-Prot database (version of November 2016) using BLASTx   were also blasted  vs. the UniProt TrEMBL database (at https://www.uniprot.org/uniprot/?query=reviewed:no version of November 2016).To confirm or update the function associated to https://blast.ncbi.nlm.nih.gov/Blast.cgi) vs. the \u201cnon-redundant\u201d (nr) protein database of NCBI, and then we searched for domains using INTERPRO (https://www.ebi.ac.uk/interpro/)  .Ciona and mouse were identified performing (i) a tBLASTx  of Ciona transcripts vs. mouse transcripts, (ii) a tBLASTx  of mouse transcripts vs. Ciona transcripts, and (iii) the Transcriptologs approach : Opsin1 (CiGC28m24), Arrestin (CiGC28m09), Pax3/7 (CiGC42e20), and Synaptotagmin (CiGC26m18). PCR amplification of the other transcription templates was performed with oligos shown in Ciona embryos were performed as previously described by Pezzotti et al.  and WRPW (constitutively repressive) domains under the control of the Gsx promoter, with the aim to investigate the phenotypic consequences on PRC precursor development. Following electroporation of the pGsx>GFP2x construct, control larvae displayed the wild-type head phenotype, in which two pigmented sensory organs are clearly distinguishable, i.e., the otolith, which is a gravity sensory organ located ventrally in the anterior region of the sensory vesicle, and the photosensing ocellus more dorsally, in the wall of the vesicle (Ciona larvae carrying the constitutively repressive form pGsx>OC::WRPW (OC::Rep), 45% of them showed only one apparently normal pigmented cell in the sensory vesicle , which is essential for melanocyte differentiation  and larva stage  and subjected to Illumina HiSeq2500 sequencing (Stranded RNA-Seq). We identified 9,967 Ciona genes whose expression was detected in the two transgenic conditions with at least one match with a protein present in the UniProt Swiss-Prot database. Ciona transgenic transcriptomes revealed about 500 genes with a significant change in expression level (DEGs), 469 of which were found in the OC::Act condition and 36 in the OC::Rep one  showed upregulation in OC::Act and downregulation in OC::Rep, lending themselves as candidate targets in the Oc genetic pathway implicated in PRC differentiation in Ciona. Other five DEGs were downregulated in both conditions  gene encodes a serotonin transporter protein. In vertebrates, Slc7a14 codes for a glycosylated, cationic amino acid transporter protein that has recently been found to underlie the autosomal recessive retinitis pigmentosa  codes for a soluble protein that interacts with the SNARE complex, the molecular machinery of synaptic vesicle exocytosis  belongs to a small GTPase Ras superfamily that regulates many signaling pathways in neuronal functions, including neurotransmitter transmission, cell migration, neurite outgrowth, and neuron proliferation  encodes an endoplasmic reticulum tetratricopeptide repeat-containing adapter protein involved in calcium homeostasis that has been associated with primary open-angle glaucoma  codes for a Ca++-sensor synaptotagmin protein that mediates the exocytotic fusion between vesicle and plasma membranes during synaptic transmission , ENS_05701 (Scgn-like), ENS_02864 (GTPase Rab11a), and ENS_20001 (FKBP25/3) genes encode for factors involved in different steps of neurotransmission as described in Slc6a4b/mouse Slc6a2), whose vertebrate orthologous genes are expressed in the retina . Neither the BLASTx- nor the INTERPRO-based analyses provided any useful information for the annotation of the considered transcripts, except for two genes, ENS_23151 and ENS_21806, downregulated in both transgenic conditions. ENS_23151 encodes a protein with a signal peptide and a non-cytoplasmic domain based on the INTERPRO analysis, indicating a possible translocation across membranes, while ENS_21806 encodes a protein carrying a Slc6sbd_SERT-like domain, the solute-binding domain of serotonin neurotransporters (data not shown)  that were differentially expressed in both species  or downregulated  only under the OC::Act transactivating form. All these genes are expressed in different territories of the vertebrate eye and encode factors involved in synaptogenesis, calcium signaling, or retinal cell specification . The murine ortholog of ENS_04039 Neurogenin gene is involved in rod PRC differentiation (NeuroD4) .To identify conserved fication . In the Ciona. Mab21 (ENS_08580) and Opsin1 (ENS_01146) were significantly downregulated in OC::Rep condition . Mab21 belongs to the male abnormal gene family whose members  play important roles in regulating ocular development in vertebrates  was significantly upregulated (+2.95 log2FC) in the OC::Act condition . This gene belongs to a group of Na+-dependent monoamine transporters encoded by the SLC6 gene family  with two mouse genes that belong to the same gene family of solute carrier 6 (Slc6a1 and Slc6a4) and that are differentially expressed in mouse Oc1/Oc2\u2212/\u2212. Extending this analysis to all Ciona and mouse DEGs, we greatly increased the number of Oc targets shared across chordates. We found that 45 mouse DEGs are paralogs or orthologs of DEGs in Ciona (\u221250), we can assume that even if ENS_07757 and ENS_09380 are not the computationally defined orthologs of Slc6a1 and Slc6a4, they share a high similarity level, which may be the reason for preserving the same functionality between paralogous.Considering the significant phylogenetic distance between nditions , while iin Ciona , 4. SincOc and DEG expression patterns (double WISH)  showed no detectable mRNA signal in WISH, while some other riboprobes did not work in double WISH experiments. However, we show that four DEGs  are specifically co-expressed with Oc, while one DEG (ENS_23151) is expressed in tissues adjacent to OC-expressing cells  were overexpressed in the progenitor cells of the sensory vesicle of OC::Act embryos and downregulated in OC::Rep, in agreement with log2FC in RNA-Seq datasets  and for spatial correlation between le WISH) . We geneng cells . Importadatasets . Expressteration .Prox1 and Lhx5, which are dysregulated in our RNA-Seq dataset and in that of mouse Oc1/Oc2\u2212/\u2212 double mutant retinas  and reduced (Lhx5) transcript staining in the sensory vesicle of OC::Act transgenic tailbud stage 22 embryos in comparison with controls (Lhx5 upregulation in OC::Rep embryos that is not supported by RNA-Seq data (Ciona Pax3/7 (ENS_13561) and Mab21 (ENS_08580), orthologous genes of two important factors for PRC formation , which shows a negative log2FC in both OC::Act and OC::Rep RNA-Seq datasets, is downregulated only in the sensory vesicle of OC::Rep embryos and is upregulated in OC::Act embryos , neurotransmission , opsin transport , and calcium homeostasis . Given the activating or inhibitory role of Oc on gene expression, we propose that Ciona Oc serves as a regulator of proteins that mediate synaptic activities. Furthermore, Oc itself and some of these DEG genes with neurosynaptic activity are not restricted to PRC, suggesting that Oc could use the same target genes to promote neural cell type differentiation in various regions of the nervous system , PRC differentiation , inhibition of M\u00fcller cell differentiation and positive regulation of optic nerve projections (Ebf1), ciliogenesis (Mak), synapsis formation, and GABA release  , and of the rhodopsin-transporter Rab11a (ENS_02864) decreased under a predominantly repressive Oc regulation (OC::Rep) , the gene coding for the delta subunit of rod-specific photoreceptor phosphodiesterase (Pde6d), a key enzyme in the phototransduction cascade, dropped under the transactivating condition  can be found at: QV, AF, GF, VN, and FB did the molecular experiments. CC did the bioinformatics analyses. QV, CC, AL, and PS drafted the manuscript and prepared the figures. RK, AL, and PS supervised the experiments. MC supervised the bioinformatics analyses. PS and AL edited and revised the manuscript. All authors approved the manuscript for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Neglecting oral hygiene in adolescents negatively affects dental caries and periodontal diseases, in addition to social and emotional well-being. Thus, the TikTok platform as a social media could be a powerful channel to provide health-related information and educational content. This study aims to assess the quality of the TikTok videos corresponding to #oralhealtheducation. Sixty-nine videos were identified. Three oral health professionals (OHP), three health education professionals (HEP), and ten of TikTok\u2019s target audience watched and evaluated the videos from a qualitative questionnaire. OHP detected false or incorrect information in 11.6% (8/69) of the videos. At least two HEPs reported being unable to detect this type of content or whether the video met dental ethics standards in both the videos. Disagreement was observed among the professionals themselves. The evaluation indicated that TikTok\u2019s target audience was satisfied with the products viewed with an average score of >2.5, unlike the professionals, whose average score was <2.5 on a scale of 0 to 5. Users are advised to think critically and to consider the content of TikTok oral health videos with caution. The involvement of health professionals in the writing and validation of the videos could be an added value to positively respond to the needs of the adolescents. Oral diseases represent a significant health burden for individuals and populations . The advOral health care education represents a public health care priority since maintaining a good level of oral hygiene is an essential part of overall health . Oral diThe change in health behaviors has undergone a revolution with the growth of the digital environment . Mobile Health-related audiovisual content can impact society. Regardless of the content, dramatic means are used in social network videos to capture the short attention span of the audience and to compensate for the almost endless supply of other videos. Different categories of videos may attract different users and thus have different characteristics . The conTikTok, formerly known as musical.ly was created in September 2016 in China . The govAlthough less popular than female reproductive health, and acne treatment, information on oral hygiene is present on the platform. Also, it is generally accepted that nutrition and diet should be included for a holistic health program since they are common risk factors for oral diseases . The queThe aim of this study is to assess the quality of the content related to oral health education on TikTok platform, as well as to evaluate its possible impact on the young population.This study was designed as an observational retrospective study based on the content of TikTok videos. As a social media platform, TikTok provides access to short videos, from 3 to 60 s, shared by TikTok users. The videos are accessible from a mobile application or accessible online on a website without a necessary user account. The TikTok version was 20.2.5 (3 July 2021). This study did not require any regulatory approval. All respondents were informed of the process and purpose of the study. This research was performed in accordance with the STROBE guidelines .A total of 203 TikTok videos were extracted with the hashtag #oralhealtheducation, which was associated with 6.8 million views on 28 September 2021 . Next, tTwo academic researchers  specifically created an online questionnaire for the purpose of this study. This questionnaire was elaborated using the DISCERN instrument developed for judging the quality of written consumer health information on treatment choices , and froThe version was tested with a random selection of 10 videos, adjusted and finally approved by an oral health professional (DB) and a public health professional (DT). The final version of the questionnaire is available in After watching the 69 selected videos, two academic researchers  completed The online questionnaire was constructed to be sure that all the raters provided an answer to each question; no missing data were allowed. For the categorical item, we provided the number of agreements  and the number of \u201cyes\u201d per agreement for categorical variables (yes/no). For the ordinal item, we provided the number of agreements on the five-item responses  and the number of raters who agree (score: 4) or strongly agree (score: 5).p-value indicates whether the calculated kappa is significantly different from zero and thus different from a random agreement; if the p-value is less than or equal to 5%, we conclude that the agreement between raters is significantly different from the value that would be obtained by chance.To measure the inter- and intra-rater reliability between OHP and HEP, the Kappa of Fleiss (Kf) between categorical variables was used. A poor agreement corresponds to Kf < 0, a slight agreement to 0 <Kf < 0.2, a weak agreement to 0.2 < Kf < 0.4, an average agreement to 0.4 < Kf < 0.6, a good agreement to 0.6 < Kf < 0.8 and an excellent agreement to Kf > 0.8. The For the ordinal variables, the intra-class coefficient (ICC) and its 95% confidence interval were calculated. An ICC close to 1 indicates high similarity between responses in the same group, while an ICC close to zero means that values in the same group are not similar.Statistical analysis was performed using the package \u201cirr\u201d of the R Project for Statistical Computing (version 4.1.1. 2021-08-10).The oldest video was posted 515 days ago, on 1 May 2020. We estimated that one video with the hashtag #oralhealtheducation was shared every two weeks. The median length of the included videos was 20 s , with 44.9% of videos (31/69) that mentioned at least one commercial brand. The median number of likes was seven . Only 6 videos received more than 1000 likes , including 4 videos posted in the last 6 months.Among the included videos, 88.4% featured at least one person (61/69) and 11.6% did not feature anyone (8/69). Only one video featured more than five people. The main character presented himself as a health professional  due to his pseudonym in 24.6% of the included videos (15/61) or due to his professional outfit when at least one person is featured in 54.1% (33/61). The scene took place in a dental office in 15.9% of the videos (11/69) and 27.5% of the videos presented dummy material  (19/69).Concerning the staging of videos, 73.9% had a musical background (51/69), 17.4% were entirely subtitled (12/69) and 84.0% were composed of key text-messages (58/69). The humor tone was used in less than 6% of the videos (4/69). The video setting and staging characteristics are described in Oral care products presented or used in the videos are described in p-values when comparing the whole responses, regardeless of OHP and HEP groups.The analysis of the objectives of the video in relation to oral health education are presented in The OHP and HEP agreed to concerning the three main objectives of the TikTok videos corresponding to #oralhealtheducation . The firThe target audience for the TikTok videos corresponding to #oralhealtheducation is summarized in The public targeted by Tiktok videos was clearly identified in only 13% of videos (9/69) for OHP and in 4% of videos (3/69) for HEP.According to OHP, the oral health subject was mastered in 28,9% (20/69) of videos and the vocabulary used was appropriated in 36.2% (25/69) of videos. They agreed that 42.0% (29/69) of videos complied with dental ethics or dental professionals and 28.9% (20/69) of videos applied official recommendations. They detected false or erroneous information in 11.6% (8/69) of videos. HEP evaluated that the oral health subject was mastered in 4.3% (3/69) of videos but at least one HEP answered \u201cDo not know\u201d in 84.1% (58/69) of videos. They judged that vocabulary used was appropriate in 8.7% (6/69) of videos but at least one HEP didn\u2019t know in 68.1% (47/69) of cases. For all the videos, at least two of the three HEP declared to be unable to detect false or erroneous information or to know if the video respected dental ethics or dental professionals.The subjective evaluation of the quality was realized by OHP, HEP and TikTok\u2019s target audience. The results are presented in The average score given by TikTok\u2019s target audience was always higher than OHP which was always higher than HEP. The average score given by the TikTok\u2019s target audience was always higher than 2.5 whereas for the OHP end the EHP, the average score was always lower than 3. For the TikTok\u2019s target audience, the videos were able to increase awareness of the importance of oral health and to provide relevant information related to oral health.Social media use among teens is nearly ubiquitous . TikTok,The choice of the hashtag #oralhealtheducation allowed us to focus our research on videos that focused on oral health promotion and were targeted to the general population. The #oralhealth that reached a larger audience was not specific enough to the oral health promotion that was the focus of this article. It referred to numerous videos dealing with the curative aspect  or the aesthetic aspect and was very often addressed to professionals and not to the general population.Oral health education will not be a major target of the TikTok Health platform in 2021. The hashtag #oralhealtheducation corresponded to 203 TikTok videos and only 69 were in English or French and related to human oral health education. These videos received 141,720 \u201clikes\u201d, were commented 1358 times and shared 3295 times. Compared with other health-related topics, oral health education doesn\u2019t appear to be of high interest for TikTokers and viewers. For example, the keyword \u201cdiabetes\u201d referred to 199 TikTok videos which received 2.75 million \u201clikes\u201d and were commented on and shared thousands of times .Our research is relevant to analyze oral health education-related videos on TikTok as well as their potential effect on behavior. TikTok users are often adolescents and therefore belong to a potentially vulnerable and influenceable group of individuals . MoreoveIn some cases, such as childhood caries, general population interventions  have been shown to be more successful than population-specific and individual interventions . TikTok The TikTok videos were mainly focused on oral hygiene tips which is a one key element of the prevention of oral diseases ,44,45. TFifty percent of the videos included images of toothbrushes, with manual toothbrushes being overrepresented (74.3%). However, basic messages such as the indication of type of toothbrushes including the hardness of the filaments ,52 and oAmong the oral hygiene components, the interdental thread is presented (30.4%). As previously described, there is a lack of criteria on the indications, choice and methods of use of the product. The floss is the interdental device the more present in the videos . Cochrane Review on flossing underlined there is some evidence that flossing added to toothbrushing in adults may reduce gum disease and plaque compared to toothbrushing alone. But, overall, the evidence was low to very low- certainty . MoreoveConcerning tongue cleaning, the description of tongue scraper in the videos corresponding to hashtag #oralhealtheducation is interesting due to the fact that its efficiency was proven to fight against halitosis and gingivitis ,65. The use of chemical agents such as toothpaste and mouthwash was also presented in the videos (47.8%). Broadly speaking, there are two types of mouthwash: cosmetic and therapeutic. Cosmetic mouthwash may temporarily control bad breath and leave behind a pleasant taste, but have no chemical or biological application beyond their temporary benefit. Therapeutic mouthwash, by contrast, has active ingredients intended to help control or reduce conditions like bad breath, gingivitis, plaque, and tooth decay. This product contains active molecules that can help to fight against oral diseases such as caries or periodontal diseases but can help to fight against systemic diseases such as COVID-19 ,67,68,69In terms of oral health education, nutrition and diet should be included in a global health program as they constitute common risk factors for non-communicable diseases ,72. ReviFrom our analysis of the dental hygiene products contained in TikTok, it appears that even professionals have difficulty distinguishing whether the information contained in the videos comes from reliable sources. To stay safe from false or harmful content, creators on TikTok should clearly indicate where their information comes from, and users should remain vigilant . LikewisEvaluation criteria are needed regarding the quality of the video that is uploaded by each video uploader about oral health education on TikTok, with the hope that viewers can receive useful information, good quality content. The videos analyzed were mainly made by a TikToker that was presented as a health professional (65.5%) due to his pseudonym or his professional outfit. Moreover, the scene took place in a dental office in 15.9% of the videos. Although TikTok has no means of monitoring to confirm that contributors are accredited health professionals, it was found that the number of health professionals using TikTok for health communication and awareness campaigns was increasing . Even if the content of the TikTok videos related to oral health education is interesting, it is important to analyze how the message was delivered. The OHP evaluated that the subject was mastered in less than one third of the videos and the vocabulary appropriated in a little more than a third of the videos. The HEP evaluated that the subject and the vocabulary was correct in respectively 4.3% and 1.4% of the videos. This difference between the professionals demonstrated the difficulty to evaluate the TikTok videos contain. OHP did not agree concerning the fact that TikTok videos applied or not official recommendation (49.3% of agreement) and the fact that false or erroneous information was presented or not (46.4% of agreement). The evaluation of other TikTok videos in other health areas, such as \u201cdiabetes\u201d or \u201cacne\u201d, has already shown serious shortcomings as well as the risk of spreading misinformation ,78.In addition, the subjective evaluation demonstrated that TikTok\u2019s target audience and professionals have totally different demands and expectations in terms of content and staging. The TikTok\u2019s target audience were satisfactory with the TikTok videos corresponding to #oralhealtheducation whereas the professionals were not. The TikTok\u2019s target audience quoted the videos as (i) attractive, (ii) able to increase awareness of the importance of oral health, (iii) to provide relevant information related to oral health, and (iv) able to change oral hygiene habits. So, TikTok\u2019s target audience that have no formation in the oral health domain cannot differentiate between reliable content and potentially biased content and should be more careful with the content of the videos related to oral health education.Future audiovisual productions should be oriented to professional and domestic environments. In the oral healthcare sector, several fundamental trends are driving the adoption of advanced digital solutions to continue in the process of excellence. Advances in technology, prevailing patient preferences and dental school curriculums, as well as emerging treatment guidelines, are accelerating the adoption of future audiovisual productions with a simplified digital format. Access to quality continuing education, targeted to the specific needs of practitioners, is fully compatible with the principles that guide social media. They will also reduce inequalities in access to training for dentists. Social media must continue to be developed in the domestic environment with tools, such as TikTok, targeting teens and the nomad population. The framework is to empower, promote oral health and knowledge in the detection and self-management of the most common oral symptoms or diseases with a universal language, both of which are currently lacking. The content will have to evolve towards more rigor and scientific quality and evidence-based information, with full transparency regarding conflicts of interest.There are several strengths to our analysis. This study is the first to analyze the TikTok videos corresponding to the hashtag #oralhealtheducation. Moreover, the point of view of three different groups of viewers  was compared. However, this study also has limitations. First, the videos were only identified using #oralhealtheducation, and additional hashtags such as #toothbrushing, #mouthwash, #teethcleaning, among other related hashtags, often co-occurring with #oralhealtheducation, might yield subsets of videos with differing content, sentiment, and levels of incorrect content and misinformation. Secondly, the videos were included only if they were in French or in English, which probably excluded some interesting videos. Thirdly, due to the fact that the health-related audiovisual can impact the society, it could have been interesting to add a group of audiovisual communication professionals and some more specific questions. Fourthly, it is not possible to know if the TikToker is an oral health professional since only his pseudonym or outfit could give some indication but without real evidence. Fifthly, teenagers are not probably the only targeted audience. Although the videos are intended for teenagers, the video metrics  do not determine whether the audience figures are teenagers or other target audiences. Sixthly, unlike other content platforms, such as Youtube, that have their own campaigns, the TikTok application does permit the evaluation of the impact of the content. Finally, this study included only 10 young adults and the questionnaire had few questions regarding subjective evaluation. It might be interesting to conduct another study with a larger panel of users and targeted questions about their perception and knowledge of oral hygiene before and after viewing TikTok videos.Our results indicate that the content of TikTok videos corresponding to the hashtag #oralhealtheducation is not always reliable, as has already been demonstrated in other studies of health-related videos. Moreover, our study showed the difference of opinion between the professionals themselves but also with the users. Thus, we recommend that users be careful and critical about the content of videos related to oral health. The involvement of health professionals in the writing and validation of the videos could be an added value to positively respond to the needs of adolescents."}
{"text": "IntroductionIn this study, we evaluated the scope of acute non-specific back pain (ANSBP) content available on TikTok  in 2021. It is plausible that TikTok\u2019s popularity among teenagers, adolescents, and young adults may influence decision-making about what constitutes appropriate ANSBP self-care among a younger age cohort.MethodsWe examined 157 of the most viewed videos available through the hashtag #backpain available on TikTok in September 2021. We examined the following research questions: (1) What are the metadata characteristics of the videos in the final data set?, (2) What are the creator identities reflected in the final data set in this study?, (3) What are the ANSBP self-care content themes in the final data set?, and (4) What are the characteristics of the data set based on a low back pain reference checklist based on consensus guidelines?.ResultsWe identified clear differences based on TikTok creator identity in our data set of most popular videos. We examined videos created by chiropractors, fitness professionals, influencers, physicians, physiotherapists, and other creator identities. We found that the TikTok videos created by chiropractors were consistently among the most\u00a0viewed, most commented, and most shared. Conversely, chiropractic TikTok videos consistently had the lowest self-care reference checklist scores relative to all other disciplines. That is, TikTok videos created by chiropractors were least likely to reflect the scientific consensus on treating ANSBP.DiscussionTikTok is an increasingly popular medium for disseminating short health messages. The main cohort using TikTok is young and at risk of ANSBP. However, we postulate that the messages reaching young TikTok users overall do not generally reflect the self-care advice described in consensus guidelines.\u00a0ConclusionTikTok is a popular social media channel among young people. However, the most viewed TikTok videos about ANSBP are not produced by mainstream health professionals and the videos featuring the #backpain hashtag do not generally reflect contemporary evidence-based practice. There is considerable scope for mainstream health professionals to provide evidence-informed self-management and self-care content for ANSBP on TikTok. This exploratory study aims to increase the understanding of acute non-specific back pain (ANSBP) content available on TikTok . This paper will also examine whether approaches used to analyse YouTube  health videos can be applied to TikTok health content. Low back pain imposes a high social and financial burden in all countries across the globe .\u00a0In the Epidemiology of ANSBP in younger populationsAcute low back pain is generally regarded as lasting less than six weeks . In mostSelf-management and self-care of low back painMost people manage their low back pain with minimal assistance from health care providers.\u00a0Independent management without assistance from health care providers is generally referred to as self-care . By contAbout TikTokTikTok\u00a0is a video-sharing focused social networking service launched in 2018 ,13. TikTHealth information on TikTokGoogle Scholar suggests scientific engagement with TikTok began in 2018. In 2021, health content on TikTok had still not been widely examined in scientific literature. In 2021, there was nascent literature on analysing TikTok videos for health self-care.\u00a0Among the health care conditions researched were COVID-19 , diabeteTikTok has been associated with misinformation in the mass media. In 2021, media monitoring organisation NewsGuard reported COVID-19 vaccine misinformation directed at children aged under 13 on TikTok . The creApproaches to TikTok Health Video AnalysisTikTok in 2021 was a relatively novel medium for health content. The limited peer-reviewed health literature on TikTok in 2021 revealed heterogeneous approaches to research into this social media platform.\u00a0However, by 2021, there was a larger body of research describing the use of YouTube videos to reach specific groups with condition-specific health messages. In 2021, YouTube was the second most popular social medium and the most popular video social medium . The appSeveral investigators have examined the methods used to analyse YouTube health content. Drozd and colleagues noted that most researchers develop independent scoring systems and that no commonly agreed on methods exist . SystemaResearchers have adopted the methods used for analysing YouTube videos for analysing TikTok health content. These approaches include analysis of information quality using the DISCERN instrument, by creator professional background, by expert clinical review, or by metadata  ,21,33. TThis exploratory study aimed to evaluate the scope of ANSBP content available on TikTok in September 2021.\u00a0In order to evaluate the scope of ANSBP TikTok content, we examined the following research questions (RQs). RQ1: What are the metadata characteristics of the videos in the final data set?, RQ2: What are the creator identities reflected in the final data set in this study?, RQ3: What are the ANSBP self-care content themes in the final data set?, and RQ4: What are the characteristics of the data set based on a low back pain reference checklist?.We modified the methods developed by Zheluk and Maddock for their analysis of YouTube videos about acute non-specific low back pain (ALBP) . First, Data collection and cleansing to obtain the final data setWe first identified ANSBP TikTok videos for analysis through three steps.Step 1: Selection of Search Terms for Content DiscoveryUsers can access TikTok videos through the TikTok algorithm or hashtags (#). The TikTok algorithm will serve individualised content to each TikTok user . HashtagStep 2: Raw Data SetWe initially identified a raw data set of the 200 most viewed TikTok videos by searching for #backpain in the TikTok app on September 30, 2021. These 200 TikTok videos were our raw data set, which represented approximately 47% of all TikTok views for #backpain as of September 2021 .\u00a0Second,Step 3: Cleansing the Raw Data to Produce the Final Data SetOf the 200 TikTok videos identified, 43 non-English, duplicate, and not relevant TikTok videos unrelated to back or spinal pain were excluded. The final data set consisted of 157 TikTok videos in English that were relevant to ANSBP. Relevant videos were those that featured spinal pain as the primary theme. The final data set represented approximately 46% of all TikTok videos tagged with #backpain as of September 2021.Research QuestionsWe used the final data set in order to answer four RQs.RQ1: What are the Metadata Characteristics of Videos in the Final Data Set?We used the metadata obtained via the TSDT to answer this question.\u00a0Zheluk and Maddock used descriptive statistics to examine length of YouTube videos, the number of views, and channel names . In thisRQ2: What are the TikTok Creator Identities in the Final Data Set?We coded the 157 unique TikTok videos in the final data set according to the creator\u2019s identity.\u00a0We used\u00a0the same author identities as Zheluk and Maddock did in their analysis of back pain YouTube videos . We usedRQ3:\u00a0What are the Intervention Themes in the Final Data Set?We first coded each TikTok video according to one of three intervention themes: education, real-time exercise, or real-time treatment. See Table RQ4: What are the Characteristics of the Final Data Set Based on a Reference Checklist?We analysed the final data set based on the ALBP reference checklist originally developed for the analysis of YouTube videos by Zheluk and Maddock . See TabIntercoder reliabilityCoding was conducted by the three authors of this study. Intercoder reliability was achieved through intercoder consensus ,42. FollWe identified clear differences based on the creator\u2019s identity in the TikTok final data set. We found that the TikTok videos created by chiropractors were consistently among the\u00a0most viewed, most commented and most shared. Conversely, chiropractic TikTok videos generally had the lowest self-care reference checklist scores relative to all other disciplines. That is, TikTok videos created by chiropractors were least concordant with the reference checklist and, thus, these were least likely to reflect scientific consensus on treating ANSBP.Metadata characteristics of the videos in the final data setWe examined six different metadata characteristics Table . We founTikTok creator identities in the final data setWe coded the 157 TikTok videos in the final data set into six creator identities Table . ChiroprIntervention themes in the final data setWe examined TikTok videos in the final data from the perspective of three types of intervention: education, exercises, or treatment Table . The salCharacteristics of the final data set based on a reference checklistWe analysed the final data set based on the reference checklist. We found differences in the self-care advice contained in TikTok videos based on creator identity Table .\u00a0Most noTikTok is an increasingly popular medium for disseminating short health messages. This exploratory study aimed to evaluate the scope of ANSBP content available on TikTok as of September 2021. The main cohort using TikTok is young and at risk of ANSBP. However, we suggest that the messages reaching young TikTok users overall do not generally reflect the self-care advice described by Foster et al. ,40. We fMetadataThe metadata for the final data set revealed that chiropractic TikTok videos were consistently the most viewed, commented, and shared in our data set. Zheluk and Maddock  similarly found chiropractic videos were consistently the most commonly viewed and most commented videos on YouTube\u00a0. We did Creator identitiesChiropractors were the main creator identity identified in our study. Chiropractic TikTok videos in our data set were the oldest of all identities, with an average (mean) of 316 days since publication. This suggests chiropractors have been early adopters of TikTok as a medium.\u00a0Chiropractic TikTok videos were also the most popular. The higher average age of chiropractic TikTok videos may partially account for their higher view counts. Zheluk and Maddock similarly found a high number of ANSBP videos on YouTube were created by\u00a0chiropractors [Intervention themesWe examined education, exercise, and treatment as potential intervention themes. The most common intervention theme in our data set was exercise. The limited information about duration, frequency, progression of exercises, and precautions suggest that individuals using this information may be more likely to gain little benefit or risk further pain and injury from conducting these exercises. The short mean duration of TikTok videos in our dataset  compared to YouTube ALBP videos may influence content considerations. TikTok videos in our final dataset frequently featured a single activity. Activities included an exercise, a discussion of pain, or chiropractic manipulation. By contrast, YouTube videos generally offer a slower-paced and more comprehensive examination of low back pain topics. Influencers describing pain and activities of daily living were another notable finding. We coded these influencer TikTok videos as education.Reference checklistOverall, we found limited concordance between popular chiropractic and fitness TikTok videos and the ANSBP reference checklist. Most notably, few videos carried any information about when to visit a medical professional or any other precautionary information. This suggests that by excluding disclaimer information, the short duration of TikTok videos may expose creators to some medicolegal risk. Most identities similarly demonstrated limited concordance with the reference checklist. However, TikTok offers creators the option of creating three and five-minute videos. We found some of the longer videos offered greater scope for presenting content similar to YouTube. This suggests that TikTok has the potential to offer guideline-concordant content and more complex advice. Conversely, these longer videos may be less appealing to TikTok audiences\u00a0.Translation of methods from YouTube to TikTokWe believe that methods translated from YouTube, as described in this paper, may also be appropriate for the analysis of ANSBP video content on TikTok. Specifically, the methods that may be applied to TikTok videos include: (1) the analysis by creator identity to analyse TikTok metadata. The constantly changing popularity of individual TikTok videos suggests individual videos may not offer the optimal unit of analysis. We suggest an analysis of data sets aggregated by creator identity may provide a more consistent approach to the analysis of broader trends in TikTok health information; (2) The analysis of TikTok videos by intervention themes such as education, treatment, and exercise, in combination with creator identity and metadata appears to offer insights into the scope of health information available beyond simple description. These themes should be grounded themes, i.e., they should be based on analysis of the specific data set;\u00a0and (3) the use of a reference checklist to assess TikTok videos against consensus guidelines as an approach to evaluating ANSBP content across social media.LimitationsThis paper had several limitations. First, we did not examine the literature on digital health interventions. This study examined the scope of ANSBP\u00a0TikTok videos\u00a0available in 2021. By conducting this study we also aimed to extend the methods used for the analysis of\u00a0TikTok\u00a0videos.\u00a0Second, we did not examine TikTok videos from the perspective of misinformation. Suarez and colleagues define health misinformation as a \u201chealth-related claim that is based on anecdotal evidence, false, or misleading owing to the lack of existing scientific knowledge\u201d . In thisFurther researchIn this paper, we made limited comparisons between YouTube and TikTok from the perspective of translating methods for analysing videos across social media platforms. We believe further research that examines the optimal use of the unique features of each popular social media platform by various health disciplines is merited.Second, there appear to be several opportunities for health professionals seeking to use TikTok for the dissemination of ANSBP information. We identified a potential demand for information about ADL based on TikTok videos produced by influencers.\u00a0We suggest that the limited presence of mainstream health professionals such as physicians and physiotherapists offer opportunities to reach younger age cohorts with health messages about ANSBP and other health conditions. The use of TikTok by younger age cohorts to self-care and self-manage ANSBP thus\u00a0also merits further research.Third, we believe chiropractic TikTok videos merit further research. Chiropractic TikTok videos featuring young women and ASMR represent a novel health marketing phenomenon. We found TikTok videos created by chiropractors to be consistently rated poorly by coders against the ANSBP reference checklist.\u00a0This marketing phenomenon may be influencing future expectations of what constitutes appropriate ANSBP care among younger TikTok users.\u00a0Fourth,\u00a0content analysis cannot examine the actual impact of TikTok videos on individual decision making. Future research may establish this causal relationship. In summary, TikTok is a popular social medium that is under-researched.\u00a0This paper contributes to the TikTok methods literature and to the understanding of the scope of ANSBP information available on TikTok.TikTok is a popular social media channel among young people and it is plausible that it may influence decision making about what constitutes appropriate ANSBP self-care in young people. However, we found that most messages reaching younger people about ANSBP self-care do not reflect evidence-informed guidelines. The most viewed TikTok videos about ANSBP are not produced by mainstream health professionals. There is scope for mainstream health professionals to provide evidence-informed self-management and self-care content for ANSBP. This requires that mainstream health professionals adopt creative approaches to transmit their ideas effectively via the novel TikTok social media platform."}
{"text": "The treatment of dentin before the use of self-adhesive cements is still a crucial point to achieve the best bond strength values. The objective of this study was to evaluate the bond strength between dentin and composite resin using different adhesion strategies with self-adhesive resin cement. Forty healthy third human molars were randomly divided into 4 groups (n = 10): CA (control); application of self-adhesive cement , AD + CA: only application of conventional adhesive  + self-adhesive cement, AC + AD + CA; conditioning with 37% phosphoric acid for 15 seconds + application of conventional adhesive + self-adhesive cement and AC + CA; conditioning with 37% phosphoric acid for 15s + self-adhesive cement. Blocks made of composite resin  were cemented over dentin. The samples were stored for 24h in distilled water at 37\u00baC and then were sectioned on a metallographic cutter to obtain tooth picks with approximately 1.0 mm2 in cross section. A universal testing machine was used with a speed of 0.5 mm/min to test the microtensile bond strength,. The fracture patterns were classified as adhesive, cohesive and mixed failures. The data (MPa) were analyzed statistically by One-way ANOVA and Holm-Sidak test (\u03b1=5%). The AC + AD + CA and AC + CA groups had the highest averages, while the CA and AD + CA groups had the lowest bond strength values. Adhesive failure was prevalent in all groups. Conditioning with 37% phosphoric acid for 15s increases the adhesion of the self-adhesive resin cement to the dentin, regardless of the use of dental adhesive system. Key words:Resin cement, microtensile bond strength, acid conditioning. Self-adhesive cements, by simplifying the number of steps in the technique, make the cementation procedure less sensitive to errors, unlike what happens with conventional cements, with more clinical stages -5. AnothThe manufacturer\u2019s recommendation does not require the prior stage of conditioning the dental substrates, and washing with application of primer and adhesive, as self-adhesive cements are capable of modifying the smear layer and incorporating it into the hybrid layer -10. Thiset al. , extracted and preserved in 0.1% Timol at 4\u00baC, were sectioned in the occlusal third of the crown, in the mesio-distal direction, perpendicularly along the long axis of the tooth and another cut parallel to this was made in the third of the crown exposing the dentin fully. Pumice stone prophylaxis was performed on the surfaces and the cut teeth were washed and kept in distilled water at 37\u00b0C in an oven.They were randomly divided into 4 groups (n = 10);Group CA (control): application of self-adhesive cement Rely-X U200 only following the manufacturer\u2019s recommendations;Group AD + CA: application of Adper Single Bond 2 adhesive  on the dentin surface with microbrush, photopolymerized for 30 seconds, prior to the application of the self-adhesive cement Rely-X U200;Group AC + AD + CA: conditioning with 37% phosphoric acid for 15s flushing with running water from the triple syringe for 30s, lightly drying the dentin surface with a cotton ball, in order to maintain a slight shine on the surface, applying the Adper Single Bond 2 adhesive prior to the application of the Rely-X U200 self-adhesive cement;Group AC + CA: conditioning with 37% phosphoric acid for 15s and application of self-adhesive cement Rely-X U200.After the application of the resin cement, blocks made of light-cured resin  were cemented over the dentin. The photoactivation of the resin cement was carried out by a Radii photopolymerizer , with LED application for 60s, with 1200 mW/cm\u00b2. Then, the samples were stored for 24 hours in distilled water at 37\u00b0C.After that time, the samples were sectioned in a metallographic cutter (Isomet) to obtain toothpicks with approximately 1.0 mm\u00b2 of cross section. For the microtensile test, a universal testing machine (EMIC - DL2000) with a speed of 0.5 mm/min was used. The failure pattern was analyzed under an optical microscope and classified into adhesive, cohesive and mixed failures. Prior to the analyzes, fracture resistance data were assessed for normality using the Kolmogorov-Smirnov test. The data (MPa) were analyzed statistically by One-way ANOVA and Holm-Sidak test (5%).Analysis of variance at one criterion showed that there was a statistically significant difference in the strength values of the Bonding between the protocols used. According to the Holm Sidak test, AC + AD + CA and AC + CA demonstrated the highest bond strength values, which did not differ. While AD + CA and CA showed the lowest values of bond strength with no difference between them.The predominant failure pattern among all evaluated techniques was the adhesive type failure. AD + CA obtained the highest number of adhesive failures 100%) and AC + CA the lowest (86%)  positively influences the adhesion of the cementation process of self-adhesive materials. However, because there are still contradictions in the literature on the subject, self-adhesive cementation and its protocols need more research, both in the laboratory and, especially, in clinical trials.Etching with 37% phosphoric acid for 15s increases the adhesion of the self-adhesive resin cement to the dentin substrate, regardless of the use of an intermediate adhesive system."}
{"text": "Escherichia coli bioparticles, and (c) mitogen-induced leukocyte proliferation and cytokine release. In men, lower childhood socioeconomic status predicted decrements in immunological performance across functional assays, along with greater spontaneous cytokine release from PBMCs. These changes co-occurred with elevations in plasma testosterone levels. Similar effects were not observed for other sources of stress, nor were they found in women (with the exception of spontaneous cytokine release). These findings provide evidence that low childhood socioeconomic status has a lasting negative impact on multiple aspects of immune function, particularly in men.Early life stress increases one\u2019s risk for health problems later in life, and many studies find that these effects are sex-differentiated. Here, we examined relationships between multiple sources of early life stress and adult immune function in humans across several functional assays. Adult participants provided retrospective information about their childhood (a) socioeconomic status, (b) household unpredictability, and (c) exposure to adverse experiences. Participants\u2019 peripheral blood mononuclear cells (PBMCs) were then isolated for use in functional assays of immune performance: (a) tumor cell lysis by natural killer cells, (b) phagocytosis of  This propensity is found to operate independently of an individual\u2019s adult economic circumstances7, suggesting that the impact of early life environments on health is long-lasting and not easily reversed. For example, one study found that exposure to childhood socioeconomic disadvantage predicted an increased risk of cardiovascular disease in a cohort of male physicians, despite their achieved adult socioeconomic status far exceeding that of the average American6.Over the last three decades, a considerable body of research has demonstrated that individuals exposed to stressors during childhood exhibit an increased risk for a number of chronic health problems later in life, including metabolic disorders7, the myriad environmental and biological pathways through which one\u2019s early life experiences impact adult health outcomes are only beginning to be understood. Initial clues about contributors to this relationship have surfaced in research demonstrating a link between early life adversity and the tendency to exhibit an exaggerated inflammatory response to immunological stimulation8. Individuals exposed to abuse and parental absence during childhood also tend to have higher peripheral levels of inflammatory biomarkers in adulthood, such as C-reactive protein, interleukin-6 (IL-6), and tumor necrosis factor-alpha (TNF-\u03b1)9. Moreover, many have proposed that chronic inflammation plays a mediating role in the relationship between early life trauma and adult disease states . Additional clues are found in research demonstrating that adults who report lower childhood socioeconomic status (SES) exhibit increased susceptibility to an experimentally-induced viral infection relative to those reporting higher childhood SES4. However, little is known about the broader immunological context in which such tendencies emerge  or the extent to which individual-level factors buffer or exacerbate the impact of adverse childhood environments.Despite the well-established link between childhood conditions and adult health7, many studies find these effects are sex-differentiated16. For example, early life exposure to infection and nutritional stress are often found to have an asymmetrically negative impact on men\u2019s physical development and health compared to women\u2019s18. Additionally, intervention programs aimed at improving health in the context of poverty are often disproportionately beneficial for boys compared to girls21. On the other hand, research also finds that certain early life stressors, such as maltreatment during childhood, more negatively impact the physical and mental health of women than men (e.g.16). Together, such results suggest that sex differences exist in health-related developmental plasticity, for better and for worse.One individual-level factor that is likely to moderate the relationship between early life environments and immunological function is biological sex. Indeed, although much research finds that developmental experiences can have a lasting impact on both men\u2019s and women\u2019s health12) and stronger canalization of bodily growth in women than men14. Others have proposed that sex differences in behavior play a role in this context, such as the greater tendency for men to engage in health-harming behaviors in stressful environments compared to women22. Further, research in the evolutionary sciences suggests that such differences reflect sex-differentiated energetic investments in mating effort vs. somatic development and repair34.Existing explanations for sex differences in susceptibility to the health consequences of early life stress include factors such as sex differences in hormone levels  What are the critical features of stressful early life environments that drive the association between childhood stress and adult immune function?, (b) How do the effects of these environmental stressors manifest themselves across qualitatively distinct aspects of immunological function?, and (c) Are these patterns sex-differentiated?a, the relative impact of three related, but distinct, sources of childhood stress on immune function were examined, including: (1) resource availability , (2) unpredictability36, and (3) adverse childhood experiences (ACEs37). Isolating the unique impact that each of these environmental correlates of stress has on adult immune function will yield needed insights into the types of environmental interventions that are likely to have a lasting positive impact on adult health outcomes.To address question b, much of the previous work linking childhood environments to adult immune function has focused primarily on inflammatory processes10. In the current research, data were collected on a variety of immunological endpoints, many of which were measured at multiple time-points or at multiple effector-to-target (E:T) cell ratios. These measures included: (1) proliferation of peripheral blood mononuclear cells (PBMCs) in response to, and in the absence of, stimulation by lipopolysaccharide (LPS), phytohemagglutinin (PHA), and polyinosinic:polycytidylic acid (poly (I:C)) measured at 24, 48, and 72\u00a0h post-plating; (2) natural killer (NK) cell lysis of target tumor cells at 100:1, 50:1, 25:1, and 12.5:1 E:T ratios; (3) phagocytosis of opsonized Escherichia coli (E. coli) bioparticles; and (4) PBMC release of the pro-inflammatory cytokines interleukin-1\u03b2 (IL-1\u03b2), IL-6, and TNF-\u03b1 in response to LPS stimulation, as well as in the absence of stimulation , at 2, 24, 48, and 72\u00a0h post-plating. Additionally, plasma levels of total testosterone were also assayed to test whether diminished immune function co-occurs with increased investment in mating effort.Regarding question c, in line with the National Institute of Health\u2019s recent policy on accounting for sex as a biological variable38, a number of steps were taken during study design, data collection, and data analysis to allow for targeted tests of sex differences in the impact of early life stress on immune function. These included recruiting equal numbers of men and women , testing interactions between each predictor and sex in all analyses , and clearly presenting sex-differentiated results , sex, and each dependent measure were tested in separate models for each environmental predictor. The results of these models are reported below as the primary analyses  were regressed on the childhood environmental factor, sex, and the interaction between sex and the childhood environment factor. Per convention, if no significant interaction was found, main effects were reported without inclusion of the interaction term. Where significant interactions were found, direct effects of the childhood factor(s) on the dependent immunological measures within each sex  were examined. Sex differences at high and low levels  of childhood factors involved in a significant interaction with sex in the initial models  were also probed. Given that the primary objective of the current study was to test whether the impact of childhood environmental factors on immune function differed by sex, only the simple slopes within each sex are reported in the main text. Regions of significance analysis can be found in the Supplementary Information and Figs. Given that the proliferation (time collected), NK cell cytotoxicity (E:T ratios), and cytokine release (time collected) data all contained nested structures, complex multilevel modeling (cytokine release data) and latent curve models  were used to analyze these data. First, unconditional models for each of the dependent measures  were tested to assess model fit to linear change across repeated measures . Note that while neither of these two childhood variables significantly predicted any immunological outcome in the primary models or models controlling for covariates, results of the partial effects model revealed significant interactions between each of these variables and sex in predicting PHA-stimulated proliferation. Further, there was a main effect of childhood unpredictability on spontaneous cytokine release by PBMCs. These results were not included in the main text as they only emerged in the partial effects model; full results can be found in the Supplementary Information. Additionally, no factors or interactions emerged as significant predictors of unstimulated PBMC proliferation or stimulated cytokine release in vitro.Results of all models revealed good model fit , phagocytosis of E. coli bioparticles, \u03b2\u2009=\u2009\u2009\u2212\u20090.64, SE\u2009=\u20090.27, t\u2009=\u2009\u2009\u2212\u20092.35, p\u2009=\u20090.02, and testosterone levels, \u03b2\u2009=\u20090.38, SE\u2009=\u20090.14, t\u2009=\u20092.73, p\u2009=\u20090.006.As predicted based on research indicating greater male susceptibility to adverse health effects of early life stress, results revealed significant interactions between childhood SES and sex in predicting NK cell cytotoxicity , and lower levels of testosterone, \u03b2\u2009=\u2009\u2009\u2212\u20090.24, SE\u2009=\u20090.06, t\u2009=\u2009\u2009\u2212\u20093.79, p\u2009<\u20090.001. For women, childhood SES did not significantly predict phagocytosis, \u03b2\u2009=\u2009\u2009\u2212\u20090.09, SE\u2009=\u20090.12, t\u2009=\u2009\u2009\u2212\u20090.22, p\u2009=\u20090.82, NK cell cytotoxicity , or testosterone levels, \u03b2\u2009=\u2009\u2009\u2212\u20090.11, SE\u2009=\u20090.13, t\u2009=\u2009\u2009\u2212\u20090.87, p\u2009=\u20090.38. Notably, although only reaching statistical significance at the highest E:T ratio , \u03b2\u2009=\u20090.21, SE\u2009=\u20090.09, t\u2009=\u20092.44, p\u2009=\u20090.02, but not the slopes of proliferation over time in these conditions (ps\u2009>\u20090.27). These effects were no longer significant after controlling for covariates  and should thus be interpreted with caution. Lastly, there was a main effect of childhood SES on the latent factor of spontaneous in vitro proinflammatory cytokine release by PBMCs , \u03b2\u2009=\u2009\u2009\u2212\u20090.22, SE\u2009=\u20090.07, t\u2009=\u2009\u2009\u2212\u20093.12, p\u2009=\u20090.002, but not stimulated cytokine release, \u03b2\u2009=\u20090.04, SE\u2009=\u20090.05, t\u2009=\u20090.86, p\u2009=\u20090.39. Specifically, higher childhood SES predicted a diminished tendency to release proinflammatory cytokines in the absence of overt immunological stimulation. These results remained significant when controlling for both covariates and the effects of the other childhood environmental factors.In addition to these sex-differentiated results, significant main effects of childhood SES  were found predicting the intercept of PBMC proliferation  in response to stimulation by LPS, p-values in ascending order and comparing each p-value to the product of the alpha value  and the quotient of the rank divided by the total number of tests yielding a significant result . If the ranked p-value is less than the above product, the null hypothesis is rejected. This analysis revealed that all significant p-values passed this test  procedure. This method involves rank ordering the significant 10, particularly for men21. The current research sought to extend this work by addressing three key questions that have been heretofore unexplored in the context of a single investigation: (a) What are the critical features of early life stress that drive the association between childhood stress and adult health outcomes?, (b) How do these factors manifest themselves across qualitatively distinct aspects of immunological function?, and (c) Are these patterns sex-differentiated?See Supplementary Information for additional discussion. Considerable research indicates that early life experiences have a lasting impact on adult healthResults revealed that men exposed to lower childhood SES exhibited a diminished immune response across each measure of immunological function, as well as increased spontaneous pro-inflammatory cytokine release by PBMCs, compared to men with a higher childhood SES. Conversely, with the exception of the effects of childhood SES on stimulated PBMC proliferation and spontaneous cytokine release (both effects not sex-differentiated), the measured childhood environmental factors did not significantly predict immunological function in women. Further, with the exception of the relationship between childhood SES and stimulated PBMC proliferation, significant effects were not attenuated when controlling for adult SES , suggesting that these differences are primarily the result of developmental processes rather than current resource availability.10, as well as research demonstrating sex differences in key immunological outcomes28. Further, consistent with research and theory suggesting that androgens play an important in mediating sex-differentiated patterns of immunological investment44, results revealed that, in men, reduced immune performance co-occurs with higher testosterone levels. The results of the current research suggest that men who grow up in conditions of low SES may be more vulnerable to poor health outcomes later in life due to diminished investment in immune function. Moreover, the current results suggest that these differences might emerge in response to differential resource access, per se, as there was little evidence of a negative impact of childhood unpredictability or other adverse experiences  on immune function in either sex. It is important to note that others have found that the relationship between early life disadvantage and markers of poorer health  are driven by alternative features of such environments, such as abuse and parental neglect11, and that these factors may even more negatively impact the physical and mental health of girls relative to boys in certain contexts (see e.g.16). Accordingly, additional research is needed to understand the conditions in which each type of developmental stress is likely to negatively impact immunological development in each sex. Future studies may find, for example, that the timing of stress exposure influences both the magnitude of decrements in immune function, as well as differences in the extent to which men and women are affected. These questions could not be answered in the current study given its cross-sectional design and reliance on retrospective accounts of stress exposure across a wide period of early life.The present results are consistent with a growing body of research demonstrating a negative relationship between early life adversity on adult health45 and levels of these hormones are impacted by early life stress46.There are limitations of the current research that should be considered. First, although several components of immune function were measured in the current study, together they capture only a narrow range of the tremendous complexity that comprises immune function. Accordingly, future research might find that, in women, early life experiences play an important role in influencing other aspects of immune function, such as adaptive immunity. Further, the current research did not experimentally examine the proximate biological mechanisms driving the observed relationships between early life stress and adult immune function. One possibility is that glucocorticoids and other adrenal hormones ) play an important role in this context, as they have immunomodulatory propertiesIt is also important to consider that the majority of the participants in the current study were healthy college students. As a consequence, the low amount of variability in the adult SES variable may have limited our ability to detect effects of participants\u2019 current socioeconomic circumstances on the key immunological outcomes. The present sample\u2019s exposure to certain types of early life stress may also have been lower than that of the general population. Moreover, all of measures of early life stress used in this study were retrospective. Thus, a key direction for future research will be to examine, prospectively, the effects of childhood SES and multiple types of early life adversity on adult immune function in a more diverse sample using a longitudinal design. Such research would minimize the interpretability issues that arise from cross-sectional research using retrospective accounts of early life environments, which is a weakness of the current work. Future research may also benefit from utilizing longitudinal designs to track sex differences in the impact of early life conditions on immune function across multiple stages of development.The current research provides important evidence of sex differences in the impact of early life SES on multiple facets of immune function. Together, these findings suggest that, for men in particular, early life experiences become immunologically embedded in ways that may have a lasting impact on health. These results have important implications for interventions targeted at reducing the negative impact of early life disadvantage on health, and lay the groundwork for future research examining sex differences in relationships between childhood environments and immune function across the lifespan.Mage\u2009=\u200920.17\u00a0years, SD\u2009=\u20092.75). Restriction criteria were: (1) participants must have no history of chronic medical problems, including mental illness, (2) must be of healthy weight \u2009<\u200930), (3) must be free from acute illness for at least two weeks prior to participation, (4) women must not be on hormonal contraceptives, (5) must be willing to abstain from steroidal and non-steroidal anti-inflammatory medications, exercise, and alcohol use for at least 2\u00a0days before participating, and (6) must fast the morning of the session. Additional characteristics of the sample are published elsewhere47. Women participated 4\u20137\u00a0days after the start of their most recent menstrual cycle . In exchange for participation, participants were given the choice of partial course credit or a $50 gift card.A total of 159 individuals from Texas Christian University or the surrounding community, participated in exchange for $25 or experimental research credit . The study was conducted in accordance with the protocol approved by the review board.On the day of their sessions, participants arrived at the laboratory at 7:30 AM, provided informed consent, and answered study compliance questions . Next, for the purpose of a larger study, participants completed a series of behavioral tasks and questionnaires. Finally, participants were led into an adjoining room, in which 85\u00a0mL of blood was collected by venipuncture into heparinized (or EDTA-containing) Vacutainer tubes .Escherichia coli (E. coli) bioparticles, (3) PBMC proliferation in response to, and in the absence of, mitogen/toll-like receptor stimulation, and (4) PBMC release of proinflammatory cytokines in response to, and in the absence of, mitogen stimulation.Peripheral blood mononuclear cells (PBMCs) were immediately isolated from whole blood using density gradient centrifugation in Ficoll Paque Plus ). PBMCs were used in four functional immunoassays: (1) natural killer (NK) cell lysis of target tumor cells, (2) PBMC phagocytosis of fluorescent dye-labelled l-glutamine, 1\u00a0mM sodium pyruvate, 100 U of penicillin/mL, 100\u00a0\u00b5g of streptomycin/mL, and 0.25\u00a0\u00b5g of amphotericin B/mL . In addition, plasma was collected at the time of blood processing and frozen at\u2009\u2212\u200980\u00a0\u00b0C. Additional information about each assay follows, below.For each assay, PBMCs were brought to the plating density appropriate for the assay in RPMI-1640 supplemented with 10% heat-inactivated fetal bovine serum (FBS), 2\u00a0mM 48. This measure was chosen to capture the extent to which participants felt they did or did not have access to resources during their childhood. Participants indicated their childhood SES by responding to three statements about their life before age 12  using a 7-point Likert scale . The items together yielded acceptable reliability (\u03b1\u2009=\u20090.81) and were formed into a mean composite, with a higher score indicating greater resource availability/a higher SES during childhood .First, participants\u2019 childhood socioeconomic status (SES) was assessed using a previously validated scale36, consisting of three statements about chaos and uncertainty within the home . Participants reported agreement with how well each statement described their lives before age 12 using a 7-point scale . Together, the items yielded acceptable reliability (\u03b1\u2009=\u20090.74) and were formed into a mean composite with a higher score indicating greater experience with unpredictability during childhood .Next, childhood unpredictability was measured with a scale used in previous research37. This questionnaire assesses experience with adversity during childhood across five domains: abuse, family dysfunction, and peer, community, and collective violence/war. Given the nature of the present sample, which was primarily composed of college students, a truncated version of the survey was administered, removing the collective violence, sexual abuse, and secondary household abuse questions, and leaving a total of 20 items. Continuous items were recoded as binary, per convention, and all items were then summed into a composite measure of cumulative exposure to adverse experiences during childhood .Finally, participants\u2019 experience with other types of adversity during childhood were also measured using the well-validated Adverse Childhood Experience International Questionnaire (ACE-IQ), developed by research teams from the World Health Organization51Cr-release assay. K-562 target tumor cells  were grown inside T-25 flasks  in RPMI-1640 growth medium supplemented with 10% FBS, 2\u00a0mM l-glutamine, 1\u00a0mM sodium pyruvate, 100 U of penicillin/mL, 100\u00a0\u00b5g of streptomycin/mL, and 0.25\u00a0\u00b5g of amphotericin B/mL  and incubated at 37\u00a0\u00b0C, 5% CO2, and 100% humidity.NK cell cytotoxicity was measured using the classic 51Cr  for one hour before plating them at a density of 1\u2009\u00d7\u2009104 cells/well in a 200 \u00b5L final volume into Corning V-bottom plates . PBMCs were plated with target tumor cells, in triplicate, at the following effector:target (E:T) cell ratios: 100:1 (1\u2009\u00d7\u2009106 PBMCs/well), 50:1 (5\u2009\u00d7\u2009105 PBMCs/well), 25:1 (2.5\u2009\u00d7\u2009105 PBMCs/well), and 12.5:1 (1.25\u2009\u00d7\u2009105 PBMCs/well). Spontaneous/background lysis controls  and maximal lysis controls ) were plated in sextuplicate. Plates were incubated for four hours at 37\u00a0\u00b0C, 5% CO2, and 100% humidity.Target tumor cells were labeled with 1\u00a0\u00b5Ci 51Cr release on a CAPRAC-t gamma counter . Percent maximal lysis of target tumor cells by participant NK cells was calculated at each E:T ratio by dividing 51Cr release by maximal release after subtracting spontaneous release from both values and multiplying by 100.After brief centrifugation of the V-bottom plate, supernatants were collected into glass scintillation vials and quantified E. coli\u00a0BioParticles  that were opsonized using 1\u00a0mg/mL of manufacturer-provided opsonization buffer. PBMCs were plated in triplicate with E. coli bioparticles into BrandTech black, flat-bottom microplates  at a density of 5\u2009\u00d7\u2009105 cells/well in a 200 \u00b5L final volume. Negative controls (bioparticles plated with media only in 200 \u00b5L volume) and positive controls ) were plated in triplicate. Plates were incubated for two hours at 37\u00a0\u00b0C, 5% CO2, and 100% humidity before being read on a fluorescence plate reader  at FITC dye settings of 490\u00a0nm excitation/520\u00a0nm emission. Percent maximal fluorescence was computed by dividing experimental fluorescence by maximal fluorescence , after subtracting fluorescence in the negative controls from both, and multiplying by 100.The phagocytic capability of participants\u2019 PBMCs was assessed using fluorescent pHrodo Green\u00a05 cells/well in a 200 \u00b5L final volume for four conditions: (1) with media only , (2) with 1\u00a0\u00b5g/mL of lipopolysaccharide (LPS) obtained from E. coli , (3) with 5\u00a0\u00b5g/mL of phytohemagglutinin , and (4) with 50\u00a0\u00b5g/mL of polyinosinic:polycytidylic acid (poly (I:C); high molecular weight; InvivoGen, San Diego, CA). Plates were incubated at 37\u00a0\u00b0C, 5% CO2, and 100% humidity.PBMCs were isolated as described above, and plated into Falcon 96-well tissue culture plates . PBMCs were plated in triplicate at a final density of 2.5\u2009\u00d7\u200910Approximate cell density was measured at three time-points: 24, 48, and 72\u00a0h post-plating using the CellTiter 96 AQueous Non-Radioactive Cell Proliferation Assay . Each plate was read on a plate reader  at 490\u00a0nm.5 cells/well, in a 200 \u00b5L final volume. PBMCs were plated both in media only (unstimulated condition), as well as with 1\u00a0\u00b5g/mL of LPS, obtained from E. coli , and were incubated for up to three days at 37\u00a0\u00b0C, 5% CO2, and 100% humidity. Cell culture supernatants were collected at 2, 24, 48, and 72\u00a0h post-plating, and then stored them at\u2009\u2212\u200980\u00a0\u00b0C until assays were conducted.PBMC release of proinflammatory cytokines was measured in vitro both in response to LPS stimulation, as well as in the absence of stimulation. After isolation, PBMCs were plated in triplicate at a density of 2.5\u2009\u00d7\u200910Cell culture supernatants were later thawed and assayed in duplicate for levels of a trio of proinflammatory cytokines: interleukin-1beta (IL-1\u03b2), interleukin-6 (IL-6), and tumor necrosis factor-alpha (TNF-\u03b1) using a MILLIPLEX MAP Human Cytokine Panel magnetic bead kit , and read using a Luminex MAGPIX fluorescent detection system  and xPONENT software . Intra-assay coefficients of variation (CVs) were 8.20% (IL-6), 6.97% (IL-1\u03b2), and 5.98% (TNF-\u03b1). Inter-assay coefficients of variation (CVs) were 17.27% (IL-6), 10.53% (IL-1\u03b2), and 11.62% (TNF-\u03b1).47). No compromised samples were assayed, and thus data from these samples were not included in any analysis. All other biological samples from these participants  were stored elsewhere and were thus unaffected by the freezer failure.Due to a freezer failure on November 5, 2016, cell culture supernatant samples were compromised for 32 participants . Plates were read on a plate reader  at a wavelength of 450\u00a0nm. The intra-assay CV was 2.48% and the inter-assay CV was 13.45%.Several variables that may influence relationships between early life conditions, sex, and immune function were measured. These included race, age, exercise, sleep, BMI, stress, loneliness, recent illness, season, and adult SES. See Supplementary Information for more details.Supplementary Information."}
{"text": "Periplaneta americana) which are solitary foragers: naive , conditioned , and mixed . The robustness of the consensus is not affected by the naive individuals' proportion, but the rate and the frequency of selection of the odorous shelter are correlated to this proportion. In mixed groups, the naive individuals act as influencers. Simulations based on the mechanisms highlighted in our experiments predict that the consensus emerges only for intermediate group sizes. The universality of these mechanisms suggests that such phenomena are widely present in social systems.Many social species are able to perform collective decisions and reach consensus. However, how the interplay between social interactions, the diversity of preferences among the group members and the group size affects these dynamics is usually overlooked. The collective choice between odourous and odorless shelters is tested for the following three groups of social cockroaches (  \u2022Consensus is group size dependent\u2022Consensus is not affected by an aversive group conditioning\u2022Consensus is robust regardless the diversity of individual preferences in a group\u2022Group choice is controlled by the preference of a minority of individuals Biological sciences; Ecology; Ethology, Social behaviour Aggregation, which results in an uneven distribution of individuals through space, is a widespread behavior occurring in living organisms, from unicellular organisms to mammals . In arthDuring decision-making, animals respond to biotic  and abiotic  cues to guide themselves through the environment . The strThe outcome of collective decisions, in response to the environmental cues and to the conspecifics, modifies the structure of the group in space  and in time  . Still, Collective decisions wherein group members cannot be coerced into their decisions by others are part of many social animals, ranging from (eu)social arthropods to mammals. In these groups, individuals influencing each other may have different behaviors or preferences. In such heterogeneous groups this influence can, lead to social learning . MoreoveIn democratic groups, the consensus is reached by choosing the most frequent preference of the group members . In nondPeriplaneta americana), we test the capacity of naive, conditioned , and mixed groups  to reach a consensus during settlement. The insects, like many others, individually explore the environment and choose to settle between one shelter without odor (hereafter CS) and one with peanut butter odor (hereafter PS) (see In a binary choice experiments with groups of 10 nymphs (L6-L7 instar) of the American cockroach ( PS) see . Cockroa PS) see , the att PS) see . Indeed, PS) see  and ther PS) see . The hyp PS) see  and theiP.\u00a0americana. Conditions differed on the ratio of naive/conditioned individuals: for the naive condition is 10/0 ; for the conditioned condition is 0/10 ; and for the mixed condition is 4/6  for more details see vs mixed) and between 10 and 180\u00a0min (naive vs conditioned and conditioned vs mixed)  . After 2ps - Ncs) over time, where Nps (Nps) is the number of individuals in the PS(CS). Bimodal distributions of the difference between the sheltered populations (Nps - Ncs) are observed from particular time steps  until the end of experiments for all conditions  after 10\u00a0min for naive and mixed condition and after 30\u00a0min for conditioned condition  . In addition, a survival analysis on the values of Tw shows no significant difference between the selected shelter (PS vs CS) for the three conditions . This correlation suggests an absence of complete deconditioning of the conditioned individuals (for the conditioned and the mixed condition) during the trials.At 24 h, 97% of the experiments end with 90% or more of the total sheltered population in the same shelter . This shows that the level of consensus  is independent of the shelter type. These collective choices can actually be predicted at 180\u00a0min, as the population inside the selected shelter at 180\u00a0min is positively correlated to the one at 24\u00a0h . Nonetheless, the proportion in the PS between conditions is significantly different . A nonlinear least squares fit of At 24 h, the proportion of trials that ended with 90% or more of the total sheltered population within the PS(CS) is 0.8(0.2) for the naive, 0.37(0.63) for the conditioned, and 0.64(0.36) for the mixed . In this\u03c72 test shows that during the experiment, the fraction of naive sheltered individuals is larger than the fraction of conditioned ones, from 30 to 170\u00a0min of the trials. Moreover, at each time step (except at t\u00a0= 20\u00a0min), the fraction of naive sheltered individuals is linearly correlated to the fraction of conditioned sheltered individuals .In the mixed condition, groups are composed of 4 naive and 6 conditioned individuals marked with red and black dots, respectively, on their pronotum , it is the relative individual response to the quality of the shelter PS (CS). As for the leaving probability at every time step, it depends on the shelter quality as well as on its population. Like many other gregarious animals, cockroaches are retained by conspecifics and the probability of leaving decreases with the sheltered population (\u03c1ps(\u03c1cs) is the leaving probability when individuals are isolated by unit of time , \u03c2ps(\u03c2cs) is the social strength, and Xps (Xcs) is the number of individuals present in the shelter.The sheltering dynamics result from the entries to the shelters and the exits from them, which depend on the individual probabilities of joining and leaving the shelters. Usually, these probabilities depend on the qualities of this shelter and its housed individuals. Based on previous works , the propulation . Here, wpulation :. The fitting of the total sheltered population with such simplification gives the minimal value of \u03bc, \u03c1, and \u03c2) and identify their extremes values  are in the same ranges of values, but not \u03bc. Although this analysis is compatible with the experimental results at 24 h, it is only partially consistent with the full dynamics.A first approach to approximate the values of of \u03b8 see . Moreoves values  that ares values  of our m\u03bc, \u03c1, and \u03c2), we performed dynamical stochastic simulations of the model . We summarize hereafter the different steps of the simulations:\u2022t\u00a0= 0, all individuals are outside.At \u2022Jps or Jcs (At each time step (second), individuals outside the shelters have a probability s or Jcs  to find \u2022Qps or Qcs  and for 10,000 realizations.To further approximate the parameters of the model  and CS (\u03bccs) were kept equal, regardless of the type of individual, the simulated data were significantly different from the experimental data . Finally, Keeping the experimental proportions of the three groups 100% naive (naive), 40% of naive (mixed), and 0% naive (conditioned), we perform stochastic simulations  based on the mechanisms described previously, to study the effect of the population size on the consensus at 24 h. P.\u00a0americana). In these cockroaches, like in many other arthropods, the interactions between individuals are linked to specifics activities, in particular, the collective choice of a resting site  ended up with the selection of a particular shelter (consensus for the PS or the CS) at the third h which is stabilized or is increased further until the 24th h. This suggests that no memory loss occurs during the duration of the experiments, which is in agreement with previous works showing that cockroaches can retain acquired memories up to one week . HoweverThe selection of the winning shelter appears early in time, indicating that the process of decision-making is fast and irreversible. The relatively small area of our setup partially contributes to this high rate . Nonethe\u03c2) and the number of sheltered individuals is not large enough to retain them and to lead to a consensus. Reaching a consensus at large population sizes is also less frequent but for a different reason. In this case, the probability to find numerous conspecifics inside both shelters is large  A. The mois large  leading As seen in multiple studies, a leader can either be an individual with a low threshold  or an experienced one with accurate information   King an. The colFrom an adaptive point of view, the fact that individuals in mixed groups may choose an option which does not fit their preference or their needs, strongly suggests that benefits associated with settling with many other individuals offset the costs of a nonoptimal choice , a largeHere, we tackled an important phenomenon in social organisms: groups dynamics and decision-making when individuals possess unshared preferences. We highlighted how group dynamics are linked to the interindividual variability . FinallyThe results described in this article and the examples provided previously clearly suggest that the collective behaviors generated by the conflict between individual preferences and cooperative feedbacks are a widespread phenomenon. In this context, we proposed a generic script that can be at work whatever the origin of diversity be it within the same species  or in heterospecific situations.All animals came from ten-year-old rearing cages, thus, consanguinity could play an important role in the cohesiveness observed between individuals. For this reason, it could be interesting to use cockroaches from other strains in the experiments. Furthermore, in this study, the controlled individual variability is induced adversely (electroshocks), and it is therefore not known if the conditioned cockroaches are less stress outside thus, their displacement is slower or if they are physiologically affected by the electricity. Among the important issues, that are not addressed here, are the ones related to the roles of starvation on social strength and of the loss of the conditioned memory during the experiments. Indeed, although there is no indication that a memory loss occurs in the short term , in the mcalvoma@ulb.ac.be).Information and requests for resources should be directed to and will be fulfilled by the lead contact, Mariano Calvo Mart\u00edn  ad libitum. Groups of 10 nymphs (L6-L7 instar of both sexes) were kept in a box (15.5\u00a0\u00d7 11\u00a0\u00d7 6\u00a0cm) with water and food for 24\u00a0h before being conditioned or tested. Cockroaches did not have access to water or food during the experiments. The sex of L6-L7 instar of this species is not recognizable at naked eye, and therefore, the ratio male/female is unknown. However, there is no behavioral differences between the sexes at these life stage cycle.Cockroaches of the species Rosco E+ # 019 - fire). This dark shelter contains a cup filled with peanut butter (Boni) covered with a perforated plastic layer so that the individuals can only scent the peanut butter. The bottom of the shelter is an electric plate (silicate plate with copper strips) linked to a power source. A group of individuals is placed in the illuminated part and when an individual enters the shelter, an electric shock (7.5\u00a0V and 2 A) is manually delivered after 2 s. This delay allows the animal to associate the odor and the shelter. The shocked cockroach always runs out of the shelter. The procedure is applied for at least 30\u00a0min and is then continued until no individual enters the shelter for 5 consecutive min. At the end of the procedure, cockroaches were aggregated outside the shelter, this suggest that sociality is not affected by the conditioning. Thus, they are doubly conditioned: to lose their inherent preference for the odor and to spend more time outside. For example, for the conditioned condition, the group received a mean\u00a0\u00b1 sd of electric shocks of 55.26\u00a0\u00b1 14.4, with a mean\u00a0\u00b1 sd duration of a conditioning trial of 2469\u00a0\u00b1 376 s. Finally, the number of shocks administrated decreased over time  and are disposed symmetrically in a rectangular arena , whose bottom is covered with a white paper layer covering the floor as well inside the shelters, this is changed after every trial. A light source (8 fluorescent tubes lamps \u2013 80 W/T5 SYLVANIA), placed 190\u00a0cm above the arena, provides a homogeneous illumination intensity at the ground level . The shelters are as described in the conditioning procedure section. Under each shelter, there is a cup (diameter: 0.16\u00a0cm) covered with a plastic film perforated with a needle, to prevent cockroaches to have direct contact with the interior of the cups. One of the shelters' cups is filled with peanut butter (Boni), this being the odorous shelter (PS). For the other, the control shelter (CS), the cup is empty. The group is released into the center of the arena all at once and left to explore and seek shelter for 24\u00a0hr.For the experiments, we used 69 groups of 10 cockroach nymphs without any external damage. The groups are divided into 3 conditions: 15 groups of individuals without training, the naive condition (naive); 19 groups of conditioned individuals, the conditioned condition (conditioned); and 35 groups composed of 4 naive individuals and 6 conditioned individuals (mixed). For the mixed condition, conditioned individuals were marked on their pronotum with a black color dot and naive individuals with red color dot, after they were taken from their breeding box. Each group is tested in only one trial, which consists of a binary choice set-up . This inhttps://www.r-project.org/) and Fortran90 (https://www.fortran90.org/).Simulations are performed using R studio , located over the set-up, at 17 frames per s for the first 3\u00a0h of the trial. The red filter covering the shelter, allow the video camera to detect the cockroaches inside the shelters. The distribution of individuals among the shelters is recorded every time-step (10\u00a0min) during the first 3\u00a0h and 24\u00a0h after the beginning of the trial by counting the number of individuals in each shelter.Trials are recorded by a video camera (https://www.r-project.org/). The significance of the statistical tests is fixed to \u03b1\u00a0= 0.05. As the dynamics of sheltering process of gregarious and social insects are usually nonlinear and/or their variances vary over time, we used permutation and resampling tests . A survival analysis (log rank test) is performed on this variable. Indeed, the inverse of Tw can be viewed as the mean probability per unit time that a shelter becomes the most populated one until the end. Moreover, we use the Spearman correlation tests to quantify the correlation between the population of a winning shelter of times 180 and 1440\u00a0min and for the mixed condition, the correlation between the numbers of naive and conditioned individuals present in the same shelter. We use permutation tests  to compare the sheltered population between the PS and CS within each condition and at each time step : at eachps\u00a0+ Ncs) per unit of time is proportional to \u03b8 and to the number of individuals outside the shelters. The inferior limit of \u03b8 can be approximated if we neglect the exits from the shelters (\u03c1\u00a0= 0). Thus, the mean total sheltered population as a function of time based on Our model assumes that the total number of entering individuals in both shelters (Nbased on N(1\u2212e\u2212\u03b8t)equation  and alloequation .P which at time t, i is the number of individuals sheltered in PS and j in CS . Each differential equation P that the system occupies the state . The equation counts the transitions leading the system to the state and those removing it from this state. In our case, the transitions depend on both the probabilities of joining the shelters PS or CS (The system of differential equations This system of equations is particularly effective for quickly obtaining the theoretical distribution of the different states. Indeed, by numerically integrating the master equation In the case of \u0269\u00a0= 0, Probability to be out of the shelters: Probability to be within the CS: Probability to be within the PS: Further approximation of the parameter values, from"}
{"text": "Fibrosarcomas are rare, malignant neoplasms of mesenchymal origin. Fibrosarcomas appear to be sporadic, but cases of fibrosarcomas secondary to radiation of nasopharyngeal carcinomas have been reported. Paranasal sinus fibrosarcomas (PNFS) are even rarer with few cases being reported since the 1950s. There have been several retrospective cohort studies examining PNFS; however, to our knowledge, no comprehensive review exists. This review aims to summarize the findings of all published cases of PNFS from the 1950s to the 2020s. We hope that a comprehensive review will assist in accurate and early diagnoses of PNFS, and help guide treatment as early treatment is associated with a favorable prognosis.This systematic review reports results following the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. A search was conducted on PubMed, Embase, and Cochrane Library. Studies were screened using established inclusion/exclusion criteria. A total of 26\u00a0studies were included for data extraction, and relevant data were collected and analyzed.In our study, the most common study type was case reports (n = 19). The most common presentation for PNFS included male gender (n = 17) with maxillary sinus (n = 57) involvement. Patients commonly presented with complaints of nasal obstruction (n = 15), epistaxis (n = 11), and facial fullness/pain (n = 9). Surgical resection was the mainstay treatment, with the use of chemotherapy or radiation depending on surgical margins and resectability. The diagnosis was commonly made with histological analysis.\u00a0This review of the literature provides a summary and reference of important presenting factors, elements of diagnosis, and treatment options regarding PNFS to help bring awareness and guide the treatment of such a rare disease. Moving forward, there is a greater need for larger standardized studies that can further complement our findings, as well as more consistent reporting of cases. Fibrosarcomas are rare, malignant neoplasms of mesenchymal origin that comprise 7-10% of all head and neck sarcomas . ParanasAs with other nasal cavity and paranasal sinus pathologies, PNFS often presents with unilateral nasal obstruction and epistaxis, sometimes being mistaken as a papilloma . PreviouPNFS is associated with a high risk of local recurrence and a low risk of distant metastasis . Due to This review aims to summarize the findings of all published cases of PNFS from the 1950s to the 2020s. A total of 109 cases from 26 articles were collected from PubMed, Embase, and Cochrane. This review covers study characteristics, presentation of symptoms, location of the tumor, pathological findings, diagnosis, treatment, and complications. We hope that a comprehensive review will assist in accurate and early diagnoses of PNFS, as early treatment is associated with a favorable prognosis.MethodsThis systematic review reports results following the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines . A searcStudy SelectionTitles and abstracts of studies retrieved were screened for inclusion by two independent reviewers, and a separate third reviewer resolved all conflicts. The full text of included studies was subsequently reviewed. Studies were screened for inclusion using the Medical Subject Heading (MeSH) terms related to fibrosarcoma of the paranasal sinuses. Inclusion criteria included studies of patients with fibrosarcomas in the paranasal regions. Articles that were non-English, non-human studies, review articles, books, and studies unrelated to fibrosarcoma of the paranasal sinuses were excluded. Twenty-six studies were included for data extraction.Data ExtractionData extraction was conducted using a Microsoft Excel spreadsheet . Patient demographics were collected, such as age and gender. Study characteristics, including study type, year of publication, and authorship, and the number of patients in the study were collected. Clinical data regarding presenting symptoms, location of the fibrosarcoma, use of chemotherapy and/or radiation, surgical interventions, and histopathology characteristics were gathered. Comments regarding patient outcomes were collected including survival and mortality. The collected data were then organized into graphical figures and tables.ResultsGeneral OverviewA preliminary search yielded 632 articles after duplicates were removed, with 26 ultimately meeting inclusion criteria and were included in our study. No previous systematic reviews related to fibrosarcomas of the paranasal sinuses were identified. Articles ranged in publication date from 1952 to 2019. A total of 109 patients were derived from 19 case reports, four case series, and three retrospective cohort studies. All included studies are listed in Table Clinical Characteristics AnalysisThe described data for clinical characteristics can be found in Table Type of Treatment AnalysisThe aggregate data for treatment and outcome of patients with fibrosarcoma can be found in Table DiscussionTo the best of our knowledge, no comprehensive review of PNFS exists. Consequently, a consensus on PNFS demographics, presentation, diagnosis, treatment, and prognosis has not been found. This is significant because only a few cases of PNFS have been reported since the 1950s and an early diagnosis is associated with a more favorable outcome. We include our recommendations below.Demographics and SymptomsCancer of the paranasal sinuses is a rare condition alone, with one case occurring in every 100,000 people. Studies have shown that paranasal sinus tumors tend to occur at an average age between 50 and 60 years . ParanasIn our review, the most common presenting symptom was nasal obstruction followed by epistaxis and facial fullness/pain. These symptoms are consistent with other cancers of the paranasal sinus. These presenting symptoms are common with many other conditions and can oftentimes be overlooked. The presence of unilateral symptoms that do not improve with treatment should raise the suspicion of a possible mass such as a fibrosarcoma and should warrant further workup .Diagnostic MethodsIn routine clinical practice, paranasal fibrosarcoma is commonly misdiagnosed as other neoplasms due to its rarity and non-specific symptomatology. Therefore, it is critical to be familiar with the imaging features that differentiate paranasal fibrosarcoma from other malignancies . AdditioWhen suspecting PNFS, there are particular findings found on certain modalities that may rule in or out other diagnoses on the differential . One stuTreatment and MortalityAn accepted mainstay treatment of fibrosarcoma of the sinuses currently does not exist. It is important to recognize that local recurrence is common for PNFS, and distant metastasis rarely occurs as well. According to analyzed studies, the most commonly used type of treatment was surgical management, as shown in Table Additional research is required to give a definitive statement on indications and contraindications in the use of endoscopic surgeries in fibrosarcoma removal. According to the analyzed studies, it is suggested that surgeons are opting to mainly treat with surgical management as opposed to a multimodal type of management. We recommend that surgeons approach fibrosarcomas with local excision and large surgical border, followed by chemotherapy and radiotherapy, especially if the tumor cannot be fully removed or if surgical border involvement on pathology report is revealed. In addition, for tumors that are unresectable, it is suggested that preoperative chemotherapy should be used to decrease tumor size followed by resection.Our results suggest that PNFS is associated with a high rate of mortality, with death occurring within one year of treatment in 35% n = 18) of cases. However, mortality information was only available for 47% (n = 52) of patient cases. Studies that include long-term patient outcomes are needed to better assess PNFS prognosis. Published data have suggested that prognosis is associated with the degree of histological differentiation [ of casesLimitationsThere are several notable limitations worth mentioning. Since there were no prospective studies found, all data are based on retrospective research. Additionally, the majority of studies were case studies and series, and there were no randomized controlled trials comparing various treatment approaches, making it difficult to compare the efficacies of treatment approaches. The use of solely one primary treatment was not explicitly in the articles, which may skew the results. The mortality data were gathered from sources that mentioned any mortality information within the article. Since timeframes varied greatly for reporting the death and postoperative prognosis of patients, the mortality results may be skewed. Furthermore, the reporting of larger studies oftentimes grouped varying tumors as well as locations other than the paranasal sinuses in analysis, making some data difficult to extract. Across studies, there was not a uniform way in which data were presented, causing some information to be unavailable. To address these limitations, it would be important for larger and more standardized studies to further support our findings. Furthermore, more consistent reporting of patient progress following treatment will help with the assessment of optimal treatment options.Fibrosarcoma of the paranasal sinuses is a rare but dangerous disease. By conducting this study, we aim to provide physicians with a comprehensive review to assist in the management of PNFS. Physicians should maintain a high index of suspicion when presented with a patient with non-specific symptoms, such as nasal obstruction and facial fullness and pain, which are unresolved. Nasal endoscopy can be utilized to visualize the mass, and the use of CT and MRI can aid in further diagnosis. Ultimately, histology can confirm the final diagnosis. The mainstay of treatment is surgical excision with the use of radiation or chemotherapy depending on resectability and surgical borders. With a high rate of mortality, early identification and treatment are essential."}
{"text": "Ketoprofen exhibits different binding-site preferences when interacting with mammalian albumins from different species. The drug-binding properties of albumins cannot easily be predicted based only on a complex of albumin from another species even when the drug-binding sites exhibit a high degree of conservation between species. Serum albumin is a circulatory transport protein that has a highly conserved sequence and structure across mammalian organisms. Its ligand-binding properties are of importance as albumin regulates the pharmacokinetics of many drugs. Due to the high degree of structural conservation between mammalian albumins, nonhuman albumins such as bovine serum albumin or animal models are often used to understand human albumin\u2013drug interactions. Ketoprofen is a popular nonsteroidal anti-inflammatory drug that is transported by albumin. Here, it is revealed that ketoprofen exhibits different binding-site preferences when interacting with human serum albumin compared with other mammalian albumins, despite the conservation of binding sites across species. The reasons for the observed differences were explored, including identifying ketoprofen binding determinants at specific sites and the influence of fatty acids and other ligands on drug binding. The presented results reveal that the drug-binding properties of albumins cannot easily be predicted based only on a complex of albumin from another organism and the conservation of drug sites between species. This work shows that understanding organism-dependent differences is essential for assessing the suitability of particular albumins for structural or biochemical studies. S1), the drug-binding properties of albumin are typically expected to be similar across mammals. Nevertheless, significant differences in the effects of some drugs in humans compared with other animals have been reported, and it has been suggested that this may be due to differences in albumin binding . The crystallization plate was incubated at room temperature for three months and then at 37\u00b0C for several days until the first crystals were observed. Harvested crystals were flash-cooled without any additional cryoprotectant.Crystallization was performed in 96-well plates  that were set up using a Mosquito crystallization robot (TTP Labtech). Prior to crystallization, HSA solution at concentration of 162\u2005mg\u2005ml2.4.HKL-3000 - or (R)-enantiomers of ketoprofen were chosen by careful evaluation of the fit of each candidate to the 2mFo \u2212 DFc and mFo\u00a0\u2212\u00a0DFc omit maps . Each choice was supported by comparing the fit to the maps after refinement, the resulting ADP values and the interactions with the protein . Partial occupancy was evaluated for the (R)-ketoprofen molecule in drug site 9, which resulted in the appearance of positive electron density and comparatively low ADP values; therefore, the occupancy was kept at 100%. The ACHESYM server  and ChemSketch were used for figure generation. The DALI server , for which electron density was not observed. The electron density revealed the binding of one (S)-ketoprofen molecule to drug site 2, two (S)-ketoprofen molecules to drug site 3 and one (R)-ketoprofen molecule to drug site 9 . However, it is noticeably different from a ligand-free HSA structure (PDB entry 4k2c), as can be concluded from the r.m.s.d. values between the aligned C\u03b1 atoms . Fatty acids were not added during crystallization and are most likely remnants from purification. Free cysteine was added by the manufacturer to the protein during purification to block the sole free cysteine residue in HSA and prevent albumin dimerization. Based on the observed electron density, Cys34 forms a disulfide bond with another molecule of cysteine. The quality of electron density observed for ligands in the determined structure can be inspected interactively at https://molstack.bioreproducibility.org/project/view/VW8s7hb1Z9mnCLbg3NBU/. As a control, we also determined a 2.70\u2005\u00c5 resolution structure of HSA obtained from the same crystallization conditions but not containing ketoprofen . In the control structure, all ketoprofen binding sites  remain unoccupied, Cys34 also forms a disulfide bond with another molecule of cysteine, and fatty acids bind to the same sites as in the HSA\u2013ketoprofen complex.The crystal of the complex of HSA with ketoprofen grew in space group  9 Fig. 2. All thr3.2.et al., 2020et al., 1975S)-ketoprofen molecule occupying this site is stabilized by strong hydrophobic interactions with surrounding residues  and by hydrogen bonds between its carboxylate group and the hydroxyl groups of Tyr411 and Ser489. Arg410 may also contribute a remote charge\u2013charge interaction with the carboxylate group. The residues involved in the binding of (S)-ketoprofen to HSA at drug site 2 are listed in Table 2S)-ketoprofen molecule bound to drug site 2 overlaps with the fatty acid previously reported to bind in FA4 -ketoprofen molecules bound and thus can be considered as two subsites. Subsite A overlaps with the previously characterized FA1 site -ketoprofen bound. (S)-Ketoprofen in subsite A is stabilized by strong hydrophobic interactions with residues forming a narrow binding pocket , by a salt bridge between its carboxylate group and the guanidino group of Arg117, and by a hydrogen bond from its carboxylate group to the hydroxyl group of Tyr161 (Table 2S)-ketoprofen molecule surrounded by sparse hydrophobic residues, mainly Ile142, Phe149, Leu154, Phe157, Tyr161 and the aliphatic part of the side chain of Lys190. At this subsite, the carboxylate group of (S)-ketoprofen forms a hydrogen bond to the His146 side chain (NE2 atom) and a remote charge\u2013charge interaction with Arg145. In comparison to drug site 2 and subsite A, subsite B offers a significantly smaller hydrophobicity (as can be seen by the significantly lower number of hydrophobic residues taking part in the interaction) and weaker hydrophilic interactions , which may suggest weaker binding of (S)-ketoprofen. Indeed, the high atomic ADP values observed for this ligand (Table 1S)-ketoprofen bound to the subsites within site 3 have their phenyl rings located within 4\u2005\u00c5 of each other -ketoprofen molecules and may possibly result in cooperative binding.Drug site 3, which is also called the oncological drug site and FA1 -ketoprofen molecule in the reported structure. The (R)-ketoprofen molecule is stabilized by several hydrophobic interactions ; a hydrogen bond is formed between its carboxylate group and the hydroxyl group of Tyr452 and a salt bridge between the carboxylate group and the nitrogen group of Lys436. The (R)-ketoprofen molecule has relatively high ADP values, suggesting partial occupancy or positional variability, which is also correlated with a significantly smaller hydrophobicity of this site, which is likely to result in a lower binding affinity.Drug site 9, which is located near FA8 and FA9, is a much less common drug-binding site in SA -ketoprofen at drug sites 4, 6 and 10 -ketoprofen in sites 4 and 6 may be attributed to these differences. However, all of the residues involved in the binding of (S)-ketoprofen at drug site 10 in ESA are the same in HSA, except for Ile7, which is a Val in HSA. Moreover, Ile7 in ESA only contributes to hydrophobic interactions with the drug molecule, further suggesting conservation of the site and leading to the expectation that drug site 10 in HSA may also bind (S)-ketoprofen, even though it was not observed in the structure reported here. Drug site 2, where (S)-ketoprofen binds to HSA, is occupied by a myristate molecule in the structure of the ESA\u2013ketoprofen complex, which potentially prevents drug binding. Drug sites 3 and 9 remain unoccupied in this structure.ESA (pairwise sequence identity of 76.1% to HSA) has recently been reported to bind -enantiomer modeled at this site -ketoprofen at drug site 1 are conserved between BSA and HSA  has been reported to be the only ketoprofen binding site in BSA (pairwise sequence identity of 75.6% to HSA), with the -ketoprofen at drug sites 2 and 6 -ketoprofen in both HSA and LSA, but the binding modes in these structures differ -ketoprofen molecule at drug site 2 in LSA is stabilized by hydrophobic interactions with surrounding residues and forms a salt bridge and a hydrogen bond between its carboxylate group and Lys414 and Tyr411, respectively. Most of the residues involved in these interactions are conserved (89%). In addition, the two residues that differ between LSA and HSA  do not change the character of the binding site -ketoprofen. Previously, (S)-ibuprofen was reported to bind to drug site 2 in HSA and ESA via two different respective binding modes that resemble those of (S)-ketoprofen te Fig. 5. The carS)-ketoprofen molecule binds to drug site 6 in LSA, where it is stabilized by hydrophobic interactions and by hydrogen bonds between its carboxylate group and the side chain of Asn397 (NE2 atom) and between its carbonyl group and the side chains of Asn402 (ND2 atom) and Lys545. This binding site is 82% conserved between LSA and HSA. Two residues that differ in HSA (Asn402 to Lys and Asn541 to Lys) change the overall charge of the cavity, and due to the larger size of the Lys side chains in HSA may affect the conformation of the drug or even prevent binding completely. Drug site 6 is unoccupied in the HSA\u2013ketoprofen structure. In the LSA\u2013ketoprofen structure, drug site 3 is occupied by a polyethylene glycol molecule, which may prevent drug binding to this site. An acetate ion is present in drug site 9.Another (4.S)-enantiomers at drug sites 2 and 3 (two molecules) and an (R)-enantiomer at drug site 9. We compared the HSA\u2013ketoprofen complex with previously reported ketoprofen\u2013albumin complexes from other mammals. Ketoprofen was shown to bind to drug sites 4, 6 and 10 in ESA , well conserved binding sites . The calculated r.m.s.d. values are higher in the structural comparison of complexes with fatty acids and ligand-free albumins than when comparing albumin complexes with ketoprofen and ligand-free albumins (Supplementary Table S1). These results indicate that fatty-acid binding alters the conformation of albumin more significantly than the binding of ketoprofen. Plasma fatty-acid levels are dynamic and are chronically elevated in some disease states -ketoprofen molecules (drug sites 2 and 3) and only one (R)-ketoprofen molecule (drug site 9). The shape of drug sites 2, 3 and 9 clearly supports the binding of the specific enantiomer of ketoprofen, suggesting differences in the binding affinity of HSA to the respective ketoprofen enantiomers. This observation agrees with previous reports stating that HSA can bind (R)- and (S)-enantiomers of ketoprofen with different affinities depending on the experimental conditions -\u2018profens\u2019, but its stereoselectivity is ultimately dictated by the structure of the drug and its fit to a particular binding site. The ten binding sites available on albumins have differing affinities for different stereoisomers, and some of them may go against the general trend, as is in the case of site 9, which binds (R)-ketoprofen. We believe that different stereoisomers of drugs have distinct binding affinities to various SA drug-binding sites simply because they differ in spatial structure and their binding is affected by shape complementarity.HSA is known to bind chiral drugs stereoselectively (Shen The results reported here provide insight into the molecular basis of ketoprofen transport across species and indicate a need for similar studies for other drugs. Structural determination and biochemical characterization of drug complexes relating to HSA in parallel with those involving albumin from animals used as model organisms, are necessary to evaluate the appropriateness of such models and contribute to our understanding of drug transport. In cases of high sequence similarity, the conservation of a particular ligand\u2013protein interaction across organisms is traditionally expected. However, this study shows that this assumption is not necessarily valid, at least for ketoprofen\u2013albumin complex studies. It remains to be seen whether these differences in drug binding to albumin from different species will be discovered for other drugs.human serum albumin, complex with ketoprofen, 7jwnPDB reference: 10.1107/S2052252522006820/lz5056sup1.pdfSupplementary Figures and Tables. DOI: https://doi.org/10.18430/m37jwnDiffraction images.: https://doi.org/10.1101/2021.04.03.438117A preprint of this article is available from bioRxiv.:"}
{"text": "We aim to investigate its value for target volume definition, as a prognosticator, and associations with whole-blood transcriptome liquid biopsy (WBT lbx) for which we recently reported feasibility to mirror tumor characteristics and response to particle irradiation in recurrent HGG (rHGG).Selective uptake of (18)F-fluoro-ethyl-tyrosine (18F-FET-PET data from n = 43 patients with primary glioblastoma (pGBM) and n = 33 patients with rHGG were assessed. pGBM patients were irradiated with photons and sequential proton/carbon boost, and rHGG patients were treated with carbon re-irradiation (CIR). WBT (Illumina HumanHT-12 Expression BeadChips) lbx was available for n = 9 patients from the rHGG cohort. PET isocontours  and MRI-based treatment volumes (MRIvol) were compared using the conformity index (CI) . Associations with WBT lbx data were tested on gene expression level and inferred pathways activity scores (PROGENy) and from transcriptome estimated cell fractions .vs. during radiotherapy  and in non-resected  vs. resected tumors . In rHGG, a trend toward higher SUVmax values in grade IV tumors was observed (p = 0.13). Median MRIvol was 32.34 (R 8.75\u2013108.77) cm3 in pGBM (n = 16) and 20.77 (R 0.63\u2013128.44) cm3 in rHGG patients (n = 27). The highest median CI was observed for 40%  and 50%  isodose, with 70% (40%) isodose in grade III (IV) rHGG tumors . High SUVmax was linked to shorter survival in pGBM  and rHGG . SUVmax showed associations with inferred monocyte fractions, hypoxia, and TGFbeta pathway activity and links to immune checkpoint gene expression from WBT lbx.In pGBM, median SUVmax was higher in PET acquired pre-radiotherapy  1.5\u20137.8; n = 20) 18F-FET-PET imaging on gross tumor volume (GTV) definition for particle radiotherapy warrant further evaluation. SUVmax might assist in prognostic stratification of HGG patients for particle radiotherapy, highlights heterogeneity in rHGG, and is positively associated with unfavorable signatures in peripheral whole-blood transcriptomes.The benefits of  Despite intensive research and a multimodal treatment approach, the prognosis for glioblastoma (GBM) and recurrent high-grade glioma (rHGG) remains poor , 2. TherParticle therapy might be a promising treatment strategy for glioma patients. It allows for better normal tissue sparing due to higher physical dose conformity  and deliMetabolic imaging with 18)F-fluoro-ethyl-tyrosine positron emission tomography (18F-FET-PET) has been proposed to help delineate target volumes in glioma , which iF-fluoro-Whole-blood transcriptome (WBT) liquid biopsy (lbx) data have been used as a surrogate to monitor disease states , 22. DifWith this study, we aimed to investigate the value of 18F-FET-PET for tumor delineation in treatment planning and outcome prediction in primary glioblastoma (pGBM) and rHGG treated with particle radiotherapy and to assess a link between WBT lbx readouts and 18F-FET-PET-based tumor metabolic activity quantification.All patients consented to participate in this study, and ethical approval was obtained by the IRB-Ethics Committee of the Medical Faculty of Heidelberg University .n = 76 patients with pGBM (n = 43) or rHGG (n = 33) were included in this study. All patients underwent high-precision charged particle beam radiotherapy (RT) at the Heidelberg Ion Beam Therapy Center (HIT) between 2010 and 2017. Clinical data were retrospectively recorded in the institute\u2019s own database.Patients with pGBM were treated in or analogous to the CLEOPATRA trial  for incoPatients with rHGG (n = 33) were treated in or according to the CINDERELLA trial  and receFor pGBM, 18F-FET-PET information was not considered for photon RT treatment planning but could be used for particle boost delineation. In the rHGG cohort, 18F-FET-PET information was not considered for GTV delineation but was included in clinical target volume (CTV) delineation; i.e., areas with high tracer uptake were effectively irradiated with CIR. No patient received particle RT in both the primary and recurrent settings.A static amino acid 18F-FET positron emission tomography (PET) CT scan was available before the start of particle RT for every patient. Tracer uptake and survival analyses were performed on the entire cohort (n = 76). For analyses on the impact of 18F-FET-PET on tumor delineation  in pGBM patients, 18F-FET-PET-derived isocontours were compared to MRI-based GTV for photon RT. Analyses were carried out for n = 16 (37%) pGBM patients. N = 27 patients could not be included due to one or more of the following reasons: photon RT was delivered at another institution, and RT plans were not available for further analyses (n = 14); photon RT planning MRI was not extractable from the institution\u2019s picture archiving and communication system (PACS), i.e., imaging performed at another institution (n = 8); PET showed unspecific tracer uptake without significant evidence of residual tumor (n = 6); PET was carried out >50 days prior to photon RT start (n = 2).N = 27 (82%) patients with rHGG were included in analyses on the impact of 18F-FET-PET on tumor delineation. 18F-FET-PET-derived isocontours were compared to MRI-based GTV. N = 6 patients could not be included because CIR planning MRI was not extractable from the institution\u2019s PACS (n = 3), because PET was carried out >50 days prior to CIR start (n = 1), which showed uncharacteristic low tracer uptake (n = 1), or imaging was performed at another institution and without a corresponding CT dataset needed for further data procession (n = 1).Since a relevant proportion of patients could not be included in the analyses of PET vs. MRI-based treatment volumes, it was evaluated whether the characteristics of the enrolled patients were different from those excluded (MRI showing tumor progression after particle (re)RT was available for n = 34 (79%) pGBM patients and n = 25 (76%) rHGG patients. Recurrence patterns were analyzed in a semiquantitative approach classifying tumors into one or more of the following categories: 1) recurrence in the area of initial contrast uptake in T1-MRI/MRI-based treatment volume, 2) recurrence in the area of increased PET signal, and 3) distant recurrence.Whole-blood transcriptome data (Illumina HumanHT-12 Expression BeadChips) were available for n = 9 patients of the rHGG cohort participating in a liquid biopsy study for the effect of CIR in rHGG . Blood samples were collected before the start of CIR and at different time points after CIR , between two surgeries , between surgery and start of photon RT (n = 16), and during photon RT (n = 23). In rHGG patients, PET images were acquired before CIR in all cases (n = 33), with one patient having had a partial tumor resection between PET acquisition and RT start. Most PET/CT scans were performed with Biograph 6 (n = 61). Other PET/CT devices used were Biograph 64 (n = 5), Biograph mCT Flow (n = 4), Biograph HiRes Model 1080 (n = 2), Biograph TruePoint Model 1094 (n = 2), and Biograph 40  and Gemini TF 16 .For analyses of PET imaging data, the standardized uptake value (SUV) was determined. The required parameters  were extracted from the static PET DICOM files with Loni Inspector  software. Median injected activity was 180 (R 124\u2013314) MBq and 2.2 (R 1.39\u20134.24) MBq/kg body weight for pGBM patients and 198 (R 130\u2013270) MBq and 2.49 (R 1.69\u20134.15) MBq/kg body weight for rHGG patients. The median time from injection to image acquisition was 12 min (R 5\u201342) in pGBM patients and 11 min (R 2\u201341) in rHGG patients.www.mitk.org)  , 25. In itk.org) .18F-FET-PET-based tumor volumes were generated as isocontours from SUVmax in increments of 10 from 40% to 70% within the ROI encompassing the tumor. PET images were registered to the treatment planning MRI (rigid registration). To assess differences in PET-derived isocontours (PETvol) and MRI-derived RT treatment volumes (MRIvol), different 3D structures were created and analyzed (see RNA was extracted from whole blood (PAX gene blood RNA tubes), using the PAXgene Blood RNA Kit . Expression was quantified from 200 ng of quality-controlled RNA  on Illumina HumanHT-12 Expression BeadChip array in the genomics Core Facility DKFZ . xCell  and PROGStatistical analyses were conducted with IBM SPSS Statistics Version 27  and R v 4.0.5 R . Time-toAn overview of the cohort, treatment, and patients\u2019 characteristics is shown in The median age at diagnosis of pGBM was 58 years (R 21\u201375), with a median Karnofsky Performance Score (KPS) of 90% (R 60\u2013100). Prior to RT, 33 (77%) patients underwent resection ; subtotal resection, 20 (47%)), and 10 patients (23%) underwent biopsy only. The sequential particle boost was delivered with protons (5 \u00d7 2 Gy) in 26 cases (60%) and CIR (6 \u00d7 3 GyE) in 17 cases (40%). Tumor tissue was available from all pGBM patients, and the diagnosis of glioblastoma was based on the 2007 WHO Classification of Tumors of the Central Nervous System  in most In the rHGG cohort, the median age at the time of CIR was 54 (R 22\u201371) years, and the median KPS was 90% (R 60\u2013100). For rHGG patients, tumor tissue was available for n = 15 (45%) patients at the time point of recurrence. Tumor classification was mostly based on the 2007 WHO Classification  with one case being classified according to the 2016 WHO Classification. In n = 18 (55%) patients, where no biopsy or resection was performed at recurrence, the diagnosis was based on imaging criteria suggestive of rHGG (contrast medium enhancement) and an interdisciplinary consensus (tumor board). At disease recurrence, 16 (48%) patients had a WHO grade III, and 17 (52%) patients had a WHO grade IV tumor. The initial diagnosis was determined histologically in all rHGG patients. The underlying primary tumor was low-grade glioma (LGG) in n = 10 (30%) and HGG in n = 23 (70%) cases, with n = 8 (24%) grade III vs. n = 15 (45%) grade IV gliomas. In the primary setting, classification was according to the 2007 WHO classification in n = 23 (70%) and according to previous versions in the remaining n = 10 (30%) cases. The median time from the first course of photon RT to CIR was 22 months (R 6\u2013208). Initially, n = 29 (88%) patients underwent tumor resection vs. n = 4 (12%) biopsy only. Re-resection had been performed in 15 cases (45%). The median time between the last resection and 18F-FET-PET was 14 months (R 1\u2013289). CIR was delivered at a median dose of 39 GyE (R 30\u201345) in 3-GyE fractions. Median OS in rHGG was 17.5 months (95% CI 11.3\u201327.2) with the date of death known for 23 (70%) patients. PFS was 5.0 months (95% CI 3.4\u20137.6).Tracer uptake, as quantified by SUVmax and SURmax, is shown for both cohorts in In rHGG, PET images yielded a median SUVmax of 3.09 (R 1.1\u20138.39). A trend toward higher SUVmax values in grade IV tumors was observed . SUVmax median cutoff and SUVmax optimal cutoff were also prognostic factors for OS . Other prognostic variables on the univariate analysis included age  and degree of resection, whereby partial resection  and subtotal resection  were associated with improved OS. Multivariate analysis confirmed SUVmax optimal  and age \u2265 65 years  as independent adverse prognostic markers for OS in pGBM Figure\u00a03In rHGG, SUVmax as a continuous variable was not prognostic of OS on univariate analysis Figure\u00a03SUVmax optimal cutoff was also prognostic for PFS in pGBM  and rHGG . The data are shown in Comparison of 18F-FET-PET-defined isocontours with MRI-based treatment volumes was carried out for a subset of patients due to the limited availability of data  and CTV in 3 (11%) cases, where GTV was not defined but where areas of high tracer uptake morphologically corresponded to contrast enhancement in T1-MRI. Concordance between 18F-FET-PET isocontours and MRIvol was assessed with CI 5 and DiThe highest conformity was observed for isocontour 40% in pGBM and isocontour 50% in rHGG /24.35  cm3. Its union with GTV resulted in a median 26% (R 3\u2013328)/37% (R 0.2\u20134836) increase in volume, with the median absolute volume added by \u201cbest matching isocontour\u201d being 8.35 (1.37\u2013159.04)/6.3 (R 0.13\u201373.03) cm3. Absolute volumes for each patient are visualized in Next, volumetric parameters in rHGG were evaluated (intersections of isocontour volumes and MRI-based target volumes) as well as tracer uptake metrics , where 18F-FET-PET was only utilized for boost delineation, showed n = 21 (62%) local recurrences, n = 5 (15%) distant recurrences, and simultaneous local and distant recurrences for n = 8 (24%) patients at first progression. In four cases, recurrences occurred in areas with increased tracer uptake , one of which did not show contrast enhancement on MRI and the remaining three being partially included in photon-RT MRIvol.In rHGG (subcohort of n = 25 patients with follow-up imaging showing progress), where 18F-FET-PET was used for CTV delineation, no local recurrence was observed in 18F-FET-PET-positive/MRI T1ce-negative areas. N = 3 (12%) patients showed distant recurrences, n = 17 (68%) local recurrences, and n = 5 (20%) simultaneous local and distant recurrences at first progression.We assessed if SUVmax correlates with whole-blood transcriptomes. Analysis of the most variable 10% of genes adjusted for initial tumor grade identified 38 genes as being associated with SUVmax  and 936 genes with an FDR < 0.05  MRI , 40, 41.To further examine the hypothesis that 18F-FET-PET delineates highly aggressive tumor regions, we simultaneously assessed a number of tracer uptake metrics and volumetric features derived from isocontour/target volume intersections in rHGG tumors. We observed a separation of tumors by grade, and random forest analysis identified I40 features as being able to discriminate between tumor grades. The added volume based on I40 is higher in grade III tumors vs. grade IV tumors, and accordingly, the median CI for I40 is lower for grade III vs. IV. Thus, the overlap of 18F-FET-PET and target volumes is higher in grade IV rHGG, thus supporting the hypothesis that 18F-FET-PET may be better suited for more aggressive tumors.In this line, we found significantly increased tracer uptake for non-irradiated (18F-FET-PET acquisition before RT) as well as non-resected GBM and a trend toward higher SUVmax in GBM. It seems plausible that higher metabolic activity resulting in a higher tracer uptake is observed in untreated and more aggressive tumors.Tracer uptake as a prognostic factor has been described previously. Gempt et\u00a0al. reported that a tumor-to-normal ratio (SUVmean tumor/SUVmean background) of 1.88 was best in discriminating OS in patients with primary WHO grade II to IV glioma , whereasWe confirmed that tracer uptake is associated with prognosis both in the primary (pGBM) and in the recurrent setting (rHGG). Our identified thresholds/threshold ranges leading to prognostic separation are in line with the reported data. Thus, tracer uptake may allow for prognostic stratification independent of the therapeutic situation (primary vs. recurrent tumor). However, determination of a fixed tracer uptake cutoff for prognostication is difficult, as tracer uptake not only is dependent on the tumor itself but also reflects the imaging protocol used. It is also biased by previous therapies, as shown in our analyses, and the prognosis is obviously dependent on antitumor treatment and patient-related factors as well.In our study, analyses of tracer uptake were based on SUVmax. We also calculated SURmax values, which are the SUVmax values corrected for the appropriate SUV background signal , and we Finally, using WBT profiling of a subset of the rHGG cohort, we found gene expression differences associated with SUVmax, adjusted for initial tumor grade . Among The main limitation of the present study is the limited number of patients, especially for the whole-blood transcriptome analyses. Here, further independent studies including larger cohorts should be performed to validate our findings. Technical differences (different scanners), missing data, and (molecular) heterogeneity within the group of recurrent high-grade glioma might affect the present results. In addition, dynamic 18F-FET PET might reveal additional insights into tumor metabolism.18F-FET PET has a prognostic value in both treatment-na\u00efve glioblastoma and recurrent high-grade glioma. Its value on target volume definition remains less clear, with overall low concordance between 18F-FET-PET and target volumes. High metabolic activity, as quantified by SUVmax, is linked to worse prognosis and unfavorable whole-blood transcriptome liquid biopsy readouts. Our results warrant confirmation in larger, prospective studies.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.This study was reviewed and approved by IRB-Ethics Committee of the Medical Faculty of Heidelberg University . The patients/participants provided their written informed consent to participate in this study.Conceptualization and methodology: MW, MR, JF, PS, JD, UH, MK, LK, CD, AG, AK, MD, UW, CH-M, SC, AA. Formal analysis: MW, MK. Investigation: MW, MK, CS, UW. Writing - original draft: MW, BT, AG, MK, AA. All authors contributed to the article and approved the submitted version.This research was funded by the German Research Foundation Collaborative Research Center , EU Predict, and intramural funds of the National Center for Tumor Diseases (NCT).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Editorial on the Research TopicThe Fontan Circulation: Problems and SolutionsThe Fontan circulation has been developed as a strategy for multiple, unrepairable complex cardiac malformations in which there is only one effective ventricle. Almost 50 years later, the Fontan circulation is seen as an important achievement, resulting in good hemodynamic outcome for an otherwise untreatable heart disease. At the same time, complications occur due to challenges associated with a failing circulation due to the physiological features of chronically elevated systemic pressure and decreased cardiac output, obligatory features in the absence of a sub-pulmonary ventricle. As a consequence, patients are at risk for various complications including ventricular failure, organ failure, arrhythmias, protein losing enteropathy and plastic bronchitis. Despite recent improvements in tackling these complications, patients still face a high morbidity and mortality.This special issue focuses on analyzing these challenges in a problem and potential solution framework. Fifteen manuscripts addressed various aspects of the Fontan circulation in children and adults. The contributions in this special issue articulate for practitioners and scientists what we can do today, and what we need to develop going forward.The Fontan operation is the palliative procedure of choice for single ventricle patients. It is achieved by connecting both caval veins directly to the pulmonary arteries without the interposition of a sub-pulmonary ventricle. This approach separates the systemic and pulmonary venous returns to the heart and markedly diminishes mixing of deoxygenated and oxygenated blood as well as reduces volume overload of the single ventricle. However, the resulting Fontan circulation, in which the systemic and pulmonary circulation are connected in series, is characterized by a distinct physiology with chronically elevated central venous pressure. Chronic preload deprivation of the single ventricle reduces cardiac output.Currently, we are still facing a lack of comprehensive knowledge regarding Fontan circulatory physiology which translates into a lack of effective treatment options.Van de Bruaene et al. (2022) shed light on underlying factors of Fontan failure and contributed with a comprehensive review drawing the focus on its most limiting factor: the pulmonary circulation. The systemic ventricle in a Fontan circulation lacks preload at rest and during exercise. Therefore, systemic venous return through the pulmonary circulation becomes the main determinant in the regulation of pulmonary blood flow and hence exercise capacity. Since there is no sub-pulmonary ventricle, even minimal changes in pulmonary vascular resistance cause significant changes in cardiac output. The authors suggest optimizing the Fontan conduit early in life to allow for sufficient pulmonary artery growth and later in life by stenting of the conduit to adult size. In particular, stenting of a hypoplastic left pulmonary artery if present is important. The value of physical activity-which introduces some degree of pulsatility to the pulmonary vasculature and improves filling of the ventricle with stiffness-reducing stretching- as well preventing the accumulation of risk factors for heart failure with a preserved ejection fraction phenotype  cannot be understated. In practice, pediatric cardiologists and congenital cardiac surgeons should always aim for the \u201cperfect\u201d Fontan circulation. The patient should maintain an active, healthy lifestyle avoiding weight gain and the adult congenital cardiologist should not accept suboptimal hemodynamics .Kramer et al. (2022) developed an uncomplex yet remarkably accurate score to classify Fontan failure and late mortality in adult Fontan patients to allow a timely risk stratification. The score is based on hemodynamic, clinical and laboratory findings and is composed through analysis of a cohort of 198 adult Fontan patients with a median follow-up of about 20 years. Fifteen parameters were identified associated with Fontan failure and/or mortality. The accuracy to discriminate between patients with and without late Fontan failure as well as late mortality and survival was assessed in their cohort and patients with Fontan failure had a significantly higher median Fontan Failure Score compared to non-failing Fontan patients. Mortality associated with Fontan failure was substantial (48.1%). A prospective validation and likely refinement and calibration of the score in larger and preferably multi-institutional cohorts is still required.Clinical presentation and hemodynamic phenotypes of Fontan failure are considerably variable. Laohachai et al. (2022) reviewed the impact of impaired lung function which is characterized by restrictive ventilatory patterns and a reduced lung volume. In addition, the authors report on the reduced skeletal and respiratory muscle strength in Fontan patients. Respiratory muscle training has shown potential promise to improve exercise capacity.Respiratory function plays a crucial role in Fontan circulation by having the systemic and pulmonary circulations in series. Ventilation strongly determines pulmonary blood flow and cardiac output at rest and with exercise. van der Woude et al. (2021) discussed the influence of respiration on blood flow based on insights gained from imaging-based clinical evaluations. In contrast to the healthy circulation, respiration is the main source of blood flow pulsatility in the Fontan circulation, whereas cardiac contraction mostly drives the effective forward flow rate. In particular hepatic venous flow, which contributes approximately 38% to the total Fontan tunnel flow, is strongly influenced by respiration. In essence, the higher blood flow during inspiration is countered by depressed flow rates during expiration. Since MRI examination is recommended every 2 years in Fontan patients, clinicians should be aware that most conventional MRI flow sequences do not capture the pulsatility of the blood flow as a result of respiration. Therefore, authors state that conventional ECG-gated PC-MRI acquisitions can be used for the measurement of clinical parameters based on net forward flow. Inclusion of respiratory phasic pulsatility in state-of-the-art patient-specific CFD models are recommended for evaluation of detailed, time-resolved hemodynamic metrics , continuing to provide important insights for clinicians in the function of the Fontan circulation.While respiration influences phasic pulsatility, it has a limited effect on the effective forward flow in the Fontan circulation. Interestingly, Ohuchi et al. (2022) clarified the incidence, clinical characteristics and its influence on mortality. PAVF were present in 9.2% of 391 Fontan patients investigated by pulmonary artery angiography and/or contrast echocardiography during catheterization. Most patients (83%) showed a diffuse type of PAVF, associated with a significant decrease in mean arterial blood oxygen saturation compared to the non-PAVF group. Oxygen values in these patients decreased further corresponding to the postoperative stage from 90% at 1 year to 88% in the long-term follow-up of >25 years postoperatively. Authors highlighted that discrete-PAVF had no influence on SaO2 or mortality, whereas the presence of diffuse-PAVF caused hypoxia and had an adverse impact on all-cause mortality. The incidence of PAVF increases with patient age.Pulmonary arteriovenous fistulae (PAVF) are one of the major complications after Fontan operation. Dori et al. (2022) report on the management of patients with PLE and PB, potential life-threatening diseases affecting approximately 5%\u201315% of single ventricle patients. Conservative management of PLE involves use of diuretics including high-dose aldactone and sildenafil. The role of low-fat high-protein diet is less clear. Cardiac catheterization must be performed to determine hemodynamics and any reversible Fontan pathway obstruction. Fenestration creation or recreation can also be attempted. Patients that remain symptomatic can be started on enteric steroids, however this treatment strategy should be finite and limited due to the risk of serious side-effects and complications. Interventions for protein-losing enteropathy include embolization of hepatoduodenal and periduodenal lymphatic networks and procedures to lower pressure in the lymphatic system such as thoracic duct decompression.Patients with single ventricle palliation are susceptible to a variety of lymphatic abnormalities of both the thorax and abdomen, such as protein-losing enteropathy (PLE) and plastic bronchitis (PB). Imaging the central lymphatic system by dynamic contrast MR lymphangiography allows visualization of the lumbar lymphatic networks, the cisterna chyli and the thoracic duct. Utilizing these imaging tools, Conservative management of PB involves inhaled bronchodilators, inhaled steroids and pulmonary vasodilators. If symptoms persist, medications aimed at breaking down the casts are used including inhaled tissue plasminogen activator. However, if active lymph leaking into the airway is present, lymphatic imaging and selective lymphatic duct embolization are needed. If symptoms in both entities, PLE and PB, persist despite lymphatic intervention, then thoracic duct decompression  or orthotopic heart transplant should be considered.Luo et al. (2022) identified an increased central venous pressure and intraoperative aortic cross-clamping as risk factors for postoperative and persistent liver dysfunction after day 7 postoperatively. Special attention to this patient group is suggested by the authors to prevent liver impairment.Hepatic dysfunction after Fontan operation can occur as a postoperative complication and might also develop long term. In a retrospective case control study of 409 patients after TCPC, Schleiger et al. (2021) reported on Fontan-associated liver disease in the adult population. They investigated the metabolic liver function with the liver maximum function capacity test (LiMAx\u00ae) in 39 patients and compared it to laboratory testing, elastography and ultrasound. The authors found preserved metabolic hepatic function in about 80% of the patients. Results of metabolic testing did not correlate to the severity of abnormal hepatic findings evaluated by sonography or laboratory analysis, indicating that while abnormalities are present, hepatic functionality remains relatively intact.Both studies indicate that the development and progression of liver dysfunction in Fontan patients is not a linear or uniform process. Therefore, Schleiger and colleagues suggest that the diagnostic approach during follow-up should encompass a variety of modalities in order to obtain the most comprehensive picture. More work is necessary to determine the most valuable surveillance strategy in this domain.Ritmeester et al. (2022) present an interesting review on this subject and report on abnormalities in the nervous system, pituitary, kidneys, and musculoskeletal system. The thyroid axis may be affected by pituitary edema which is related to its unique vasculature. Therefore, awareness for potential hypothyroidism is important. Renal dysfunction is frequent and might be underestimated by creatinine based renal function testing due to myopenia as both lean muscle mass and bone mineral density are decreased in most of the Fontan patients. The assessment of cystatin C for renal function is recommended by the authors.Organ dysfunction occurs beyond the heart, lungs, liver and gut in those with Fontan circulation. Rubenis et al. (2021) assessed the sexual function of men with a Fontan circulation by performing a prospective, cross-sectional study based on the data from the Australian and New Zealand Fontan registry. Self-reported erectile function of 54 men with Fontan circulation was not significantly impaired when compared with historical controls, however sexual desire and overall satisfaction were reduced. The presence of erectile dysfunction was not correlated to the Fontan type or the New York Heart classification and the proportion of the cohort who had a prior pregnancy was congruent with population data.Little is known about the sexual health in patients after Fontan operation. Calderon et al. (2022) reviewed the findings that many Fontan patients present with impaired neurodevelopmental and mental health outcomes. Patients experience difficulties in areas of cognition related to attention and executive functioning, visual spatial reasoning and psychosocial development. A high risk for mental health morbidities, particularly anxiety disorders and depression, is present. Underlying alterations in brain processes may occur during fetal development which may be further influenced by hemodynamic parameters and perioperative factors. Variables such as multiple interventions requiring a prolonged hospital stay, is shown to be associated with adverse long-term neurodevelopmental outcome. The authors emphasize the benefit of early screening for neurodevelopmental deficits to initiate adequate support, thus allowing for early interventions and support to achieve the best potential outcomes.Van Den Helm et al. (2022) addressed this topic and reviewed the nature of thromboembolism post Fontan surgery and the evidence for thromboprophylaxis management using anti-platelet and anti-coagulant agents. The authors highlight that the complex pathophysiology of the highly thrombogenic environment in a Fontan circulation is based on all 3 elements of Virchow's triad: endothelial cell dysfunction, abnormal blood flow and a hypercoagulable state caused by coagulation factor abnormalities. Further dysregulation of hemostasis can be caused by a tendency towards liver function abnormalities and associated serum protein imbalances. Subclinical cerebrovascular thromboembolic events are still underdiagnosed. Importantly, authors stated that the risk of thromboembolic events, mainly occurring in the venous system, is the highest in the first year post Fontan operation with a second peak 10 years post Fontan. Furthermore, the authors focus on the needs for an emerging consensus on prophylaxis. Fontan patients with no clinical complexities should receive life-long aspirin as thromboprophylaxis, whereas further anti-coagulation with vitamin K antagonists can be reserved for patients with special risk factors like previous thrombotic events or in the older Fontan patient. A comprehensive follow-up including monitoring and attention for bone mineral density should be provided. Currently, the use of new classes of oral anti-coagulants may hold promise but is not yet recommended as primary prevention due to the lack of evidence. Despite prophylaxis, a significant risk of thromboembolic disease post Fontan surgery remains.The Fontan circulation is associated with an increased risk of thromboembolism. To prevent patients from pulmonary embolism or ischemic stroke Fontan patients are commonly treated with anti-platelet agents and/or anti-coagulants. A markedly reduced exercise performance affects most Fontan patients. Reduced exercise capacity influences long-term quality of life and is associated with worse prognosis, although a subset of patients have high physical performance (\u201cSuper-Fontan\u201d), which may represent a unique low-risk phenotype. Typical cardiopulmonary exercise testing response in Fontan patients includes a depressed peak heart rate (HR), elevated minute ventilation /carbon dioxide production slope (ventilatory inefficiency), reduced peak work rate and an increased breathing frequency.Tran et al. (2021) studied 60 patients from the Australian and New Zealand registry with the \u201cSuper Fontan\u201d phenotype defined as having a normal exercise tolerance. When compared to a Fontan group with impaired exercise capacity, the \u201cSuper-Fontan\u201d phenotype is associated with a healthy weight, lower age at Fontan completion, better exercise self-efficacy and higher overall levels of sport and physical activity participation during physical development. This said, exercise capacity has significant implications on clinical outcome and survival. As the mechanisms underlying improvements in aerobic exercise capacity and the effects of exercise training on circulatory and end-organ function remain incompletely understood, Tran et al. (2022) focused on the need for developing adapted exercise programs. In this second manuscript, the authors present the planning of a large well designed, multi-center randomized controlled trial: The Fontan Fitness Intervention Trial which will investigate as a primary outcome the change in aerobic exercise capacity after a 4-month supervised aerobic and resistance exercise training program of moderate-to-vigorous intensity followed by an 8-month maintenance phase in children and adults. Results of this study are pending and have the potential to strongly impact clinical practice.Stating that patients with the best clinical outcome might provide important insights, Dirks et al. (2022) report on their innovative prospective study of home-based bicycle-ergometer and inspiratory muscle training for children and adults with Fontan circulation. After performing 90\u2005min of endurance training per week in addition to inspiratory muscle training (30 breaths per day) for 10 months the authors observed significant increases in maximum relative workload and in maximum inspiratory and expiratory pressures. Peak VO2 values did increase significantly as compared to baseline in a subgroup analysis of teenage/adult patients while the subjective quality of life remained unchanged under a potential influence of COVID times. This study confirms that an individually adapted home-based training program is safe and is associated with improvements in exercise test variables.In line with this therapeutic strategy, Van de Bruaene et al. (2022) the areas in need of innovation to improve the Fontan circulation include:- retraining of the pulmonary vasculature and ventricle- using right-sided assist devices prior to transplant- performing further research on implantable right-sided assist devices- reducing the risk of AV valve surgery-\u2005\u200adetermining novel pathways to improve the thrombo-inflammatory state in Fontan patients.In this issue, perspectives are highlighted to improve long-term risk stratification and the implementation of new tools for future care to effectively improve the quality and duration of life of individuals with a Fontan circulation.The contributions of research efforts and reviews in this special issue on the Fontan circulation teach us to focus on principles of management and the identification of risk factors to improve patient outcomes. There is a great need for advancing multidisciplinary health care for this unique group. Special focus should be given to optimization of cardiovascular parameters pre-Fontan e.g., the pulmonary vasculature and the lymphatic vasculature. A comprehensive follow-up surveillance program post Fontan needs to pay attention to early discovery of organ dysfunctions. An important measure to prevent or reverse negative outcome and the development of complications appears to be the maintenance of a good exercise capacity with encouragement of physical activity and regular exercise training. According to"}
{"text": "Using analytical Size-Exclusion Chromatography (SEC), Isothermal Titration Calorimetry (ITC), and SAXS we were able to unravel the mechanism of inhibition of Ru4POM. Ru4POM binds to the positively-charged substrate binding region of the enzyme through electrostatic interactions, triggering the dimerization of the enzyme which consequently is inactivated. Ru4POM is the first non-peptide molecule showing a substrate-competitive mechanism of inhibition for CK2. On the basis of SAXS data, a structural model of the inactivated (CK2\u03b1)2(Ru4POM)2 complex is presented.CK2 is a Ser/Thr protein kinase involved in many cellular processes such as gene expression, cell cycle progression, cell growth and differentiation, embryogenesis, and apoptosis. Aberrantly high CK2 activity is widely documented in cancer, but the enzyme is also involved in several other pathologies, such as diabetes, inflammation, neurodegeneration, and viral infections, including COVID-19. Over the last years, a large number of small-molecules able to inhibit the CK2 activity have been reported, mostly acting with an ATP-competitive mechanism. Polyoxometalates (POMs), are metal-oxide polyanionic clusters of various structures and dimensions, with unique chemical and physical properties. POMs were identified as nanomolar CK2 inhibitors, but their mechanism of inhibition and CK2 binding site remained elusive. Here, we present the biochemical and biophysical characterizing of the interaction of CK2\u03b1 with a ruthenium-based polyoxometalate, [Ru Protein kinase CK2 (previously known as casein kinase 2 or CK2) is a eukaryotic Ser/Thr protein kinase, ubiquitous and extremely conserved throughout evolution . Despite\u03b1 catalytic subunit (or its isoform \u03b1\u2019) and the \u03b2 \u201cregulatory\u201d subunit are associated to form the \u03b12\u03b22 tetrameric holoenzyme, the prevailing form of CK2 in cells . Yet, many of these compounds show unfavorable side effects and are convenient only when conventional treatments of cancers have been ineffective  appears to be a promising approach particularly regarding the selectivity issue. In fact, unlike most protein kinases, CK2 exclusively phosphorylates acidic substrates, with a minimum consensus sequence S/T-X-X-E/D/pX, often with acidic residues also in position n + 1 and/or n + 2  are other interesting compounds explored as CK2 inhibitors. POMs are a class of polynuclear oxo-bridged transition metal complexes, which have received extensive attention due to rich topology and tunable chemical/physical properties. In addition to the application in material design  and cataOwing to their nano-size, POMs are able to establish various types of interactions with peptides and proteins, ranging from electrostatic interaction and hydrogen bonds, also mediated by water or cations, to other weaker types of interactions . These i4(H2O)4(\u03bc-O)4(\u03bc-OH)2(\u03b3-SiW10O36)2]10\u2212 (Ru4POM)  , revealium atoms , and it um atoms .10[Ru4(H2O)4(\u03bc-O)4(\u03bc-OH)2(\u03b3-SiW10O36)2], Ru4POM (CH2)4CONH(CH2)3Si}2O]4\u2212, Biotin-SiW10 (10O36{(C16H9)SO2NH(CH2)3Si}2O]4\u2212, Trp-SiW10 12[Mo36(NO)4O108(H2O)16], Mo36POM, was also prepared . Concerning the hybrid polyoxotungstates, we observed a moderately higher activity for the lipophilic TBA salts. In addition, both the nature and the configuration of the organic ligands had an impact on the inhibitory effect. The larger polyoxomolybdate showed very weak activity on CK2. Owing to these results, we focused the rest of our study on Ru4POM.First, we analyzed the efficacy of different POMs in decreasing the catalytic activity of recombinant CK2 . We foun4POM . We then checked whether Ru4POM competes with the substrates for the CK2 binding-site. As shown by the kinetics analysis reported in 4POM exerts a competitive inhibition towards both model substrates, since it reduced the affinity , without decreasing the Vmax values.We then evaluated if the Ruin vitro conditions, namely at pH 7.5 and in the absence of NaCl. Given the high negative charge of Ru4POM, we evaluated if the inhibitory efficacy was affected by changes in pH and ionic strength. Deviation from the optimal conditions reduced the activity of the controls . Therefore, we tried to treat cells with Ru4POM in combination with increasing amounts of two different cationic transfection reagents, the stable cationic polymer polyethylenimine (PEI) and the cationic liposome JetOptimus  and the effect was potentiated by increasing the amount of the transfecting reagents, likely due to higher amounts of Ru4POM delivered into the cells. These results indicate that Ru4POM is suitable for CK2 inhibition in cell, as it can be transferred inside intact cells, and that it is able to target endogenous CK2.Next, we wanted to assess whether RutOptimus . EndogentOptimus . We obse4POM and CK2\u03b1 in vitro. SEC elution profiles , but also at 500\u00a0nm, where only the signal of Ru4POM is present (red curve). The lack of absorption of CK2\u03b1 at 500\u00a0nm (green curve) allows to unequivocally recognize the elution of Ru4POM. In 25\u00a0mM Tris, 500\u00a0mM NaCl, 1\u00a0mM DTT, pH = 8.5, free CK2\u03b1 elutes at 12.6\u00a0ml retention volume, in the monomeric form 2(Ru4POM)2 is formed.The elution profile of samples with Ru4POM, we analysed samples with increasing molar ratios in a Superdex 200 column, which has a higher MWs resolution range. The elution profiles with the unchanged buffer system, 25\u00a0mM Tris, 500\u00a0mM NaCl, 1\u00a0mM DTT, pH = 8.5, of samples with various Ru4POM/CK2\u03b1 ratios, namely 1:1, 2:1, 5:1, and 10:1, are shown in 4POM induce the formation of species with larger hydrodynamic dimensions, that is, high-order oligomeric forms of CK2\u03b1/Ru4POM complexes. Very similar elution profiles for ratios 5:1 and 10:1 indicate that the saturation is reached for such values. The large variations in the elution volumes are explained by the formation of oligomeric forms of CK2\u03b1/Ru4POM complexes rather than by the formation of species where monomeric CK2\u03b1 (MW 40\u00a0kDa) is interacting with multiple POMs units (MW 5\u00a0kDa). Overall, the SEC experiments indicate that Ru4POM induces the oligomerization of CK2\u03b1, with the formation of dimers when the ratio is 1:1 and of larger assemblies when the ratio is higher, with the saturation reached around 5:1 ratio.To further investigate the interaction between CK2\u03b1 and Ru4POM, the thermodynamic parameters of the binding were determined by isothermal titration calorimetry (ITC). In the ITC measurements, CK2\u03b1 was titrated with Ru4POM; both species were in 25\u00a0mM Tris, 500\u00a0mM NaCl, pH = 8.5. A representative experiment is shown in 4POM titration produces a typical single transition, saturation-shaped thermogram, which can be fitted by the sigmoidal binding isotherm of the one binding-site model. From two independent experiments, we derived an apparent mean KD of 2.09 \u00b1 0.36\u00a0\u03bcM for the single macroscopic dissociation constant. The derived stoichiometry for the complex is 1:1 (1.04 \u00b1 0.02), in accordance with the chromatographic data, thus supporting the formation of a stable (CK2\u03b1)2(Ru4POM)2 complex. The analysis of the thermodynamic signature for the binding of Ru4POM to CK2\u03b1 reveals the dominance of the enthalpic contribution (\u0394H = \u221232.99 \u00b1 1.42\u00a0kJ/mol) over a negligible entropic term (\u2212T\u0394S = 0.50 \u00b1 2.43\u00a0kJ/mol), and a final \u0394G = \u221232.48 \u00b1 0.46\u00a0kJ/mol (2W12O40]6\u2212 (H2W12) interacting with human serum albumin (HSA) were also characterized by enthalpically driven exothermic process, while bigger W-based POMs as [NaP5W30O110]14\u2212 (P5W30), showed an important endothermic component, mainly attributed to the unfolding of the protein  traces as functions of the SEC elution profile frames showed that the protein was monodispersed in presence of 0.5\u00a0M NaCl , on a SEC GE Superdex Increase 200 (3.2/300) column, equilibrated with buffer 25\u00a0mM Tris pH 8.5. The Rg value of 2.3\u00a0nm, corresponding to an estimated molecular weight of about 39\u00a0kDa, as expected from monomeric CK2\u03b1, in line with the MW estimation from the previous SEC experiments. The comparison between the CK2\u03b1 crystal structure and the SAXS data showed good fitting value (\u03c72 1.29)   and the \u03c72 1.29) , further4POM at 1:1\u00a0M ratio in presence of 0.5\u00a0M NaCl, and the scattering data on the single monodisperse species displayed significant structural differences compared to the free form of CK2\u03b1 2(Ru4POM)2 complex. Importantly, in accordance with the lack of a significative entropic contribution for the CK2\u03b1/Ru4POM interaction seen with ITC, SAXS data do not show any evidence of protein denaturation.We then analyzed a mixture of CK2\u03b1:Ru of CK2\u03b1 . Notablyprofiles . The Rf 3.1\u00a0nm  and a mo4POM at lower ionic strengths, i.e., 0.3 and 0.2\u00a0M NaCl, caused protein precipitation of the sample, as in the case of free CK2\u03b1, hampering the possibility of reliable SAXS analyses  traces showed the formation of soluble complexes but in a multi-component system, with different size and molecular weight species co-existing in solution (2(Ru4POM)2 complex from the available SAXS data. Starting from the evidence that Ru4POM actively induces the dimerization of CK2\u03b1, the most reasonable assumption is that Ru4POM structurally mediate the interaction between two molecules of the enzyme. This is the simpler and more plausible explanation that globally takes into account our SEC, ITC and SAXS data.Next, we monitored the effect of 2 and 10\u00a0M equivalent of Rusolution . We then4POM and CK2\u03b1, trying to identify the binding site 2(Ru4POM)2 model direct contacts between the two molecules of CK2\u03b1 are established. The predicted structural model overlays well with the DAMMIF elongated envelope obtained from CK2\u03b1-Ru4POM SAXS data analysis 2(\u03bc-O)4(H2O)4 (\u03b3-SiW10O36)2]10\u2212. Some hybrid organic-inorganic POMs belonging to the Keggin decatungstosilicate family, which share the same SiW10O36 unit of Ru4POM, were also shown to be promising. The variation of the inhibitory activity with the organic domains will thus deserve attention, for the possibility to anchor suitable recognition motifs and develop, for example, bi-specific inhibitors , indicating that the full molecule and not some decomposition fragments are active on the enzyme, as instead reported for other POMs 2(Ru4POM)2 complex, with no residual presence of the single components, indicating the formation of a strong and stable complex. SAXS experiments confirm the presence of such a complex, with dimeric CK2\u03b1 when Ru4POM is present in equimolar amount. According to SEC data, larger assemblies are formed at higher molar ratios, with the saturation reached at around 5:1 for Ru4POM:CK2\u03b1.To possibly decipher the mechanism of inhibition of Ru4POM and CK2\u03b1 with the formation of a stable complex is confirmed by ITC measurements, which indicates a macroscopic apparent mean KD of 2.09 \u00b1 0.36\u00a0\u03bcM and a 1:1 stoichiometry, in accordance with SEC and SAXS data. The observed thermodynamic parameters agree with literature data on the interaction between inorganic POMs and proteins, which are characterized by KD in the \u03bcM range 2(Ru4POM)2 complex, to see whether the structural information derived by SAXS are valid also for the tetrameric holoenzyme  and the positively charged P + 1 loop of the \u03b1-subunit of the other tetramer (Arg191\u2013Lys198). It is plausible that Ru4POM is able to interfere with the normal regulation of the enzyme activity by affecting the oligomerization process of the tetrameric form of CK2. It is also possible that Ru4POM affect the interaction of CK2 with at least some of the interacting partners of this kinase.As Ruloenzyme . Indeed,4POM binds to CK2 and induces the formation of a (CK2\u03b1)2(Ru4POM)2 complex, which is inactive because the substrate-binding site and the ATP-binding site are inaccessible to substrates and ATP, respectively. This inhibition mechanism is entirely different from the common ATP-competitive one typical for most of the known protein kinase inhibitors. Ru4POM has physical and chemical properties very different from that of conventional kinase inhibitors , and this, coupled to its ability of inhibition in cell-based assays, make this compound particularly interesting for further developments. Notably, Ru4POM is the first non-peptide molecule showing a substrate-competitive mechanism of inhibition. Atomic details of the interaction between CK2 and Ru4POM can be unravelled by the crystallographic analysis of the (CK2\u03b1)2(Ru4POM)2 complex, which would be useful to obtain information regarding the most relevant interactions that stabilize the complex. While many crystal structures of CK2 are available, alone or in complex with inhibitors (mainly ATP-competitive), complexes with substrate peptides have never been crystallized, suggesting that also the crystallization of CK2 in complex with POMs acting as substrate-competitive inhibitors could not be straightforward.In summary, we could unravel the mechanism of inhibition of a Ru-based POM, a compound stable in aqueous solution and able to inhibit CK2 in the very low nanomolar range. Cell internalization has also been addressed by using suitable transfecting agents. Ru4POM against a protein kinase panel is beyond the purpose of this study, our findings suggest that a remarkable specificity for CK2 is highly conceivable, being this compound able to function as a substrate-competitive inhibitor of a kinase, CK2, with the uncommon property of targeting negatively charged substrates.While a selectivity profile of Ru2\u03b22)  were kied as in . Briefly10[Ru4(H2O)4(\u03bc-O)4(\u03bc-OH)2(\u03b3-SiW10O36)2], Ru4POM, was prepared following a published procedure , in buffered aqueous environment  over 24\u00a0h (Narocedure . Ru4POM ver 24\u00a0h .nBu4N)3H[\u03b3-SiW10O36{(C5H7N2OS)(CH2)4CONH(CH2)3Si}2O], Biotin-SiW10 -(nBu4N)4[\u03b3-SiW10O36{(C16H9)SO2NH(CH2)3Si}2O], Trp-SiW10  enantiomer, were prepared following previously reported procedures. The corresponding sodium salts were prepared by counterion exchange as described in (4)12[Mo36(NO)4O108(H2O)16], Mo36POM, was prepared as reported in - or a 10/30 Superdex 200\u00a0GL column  equilibrated with 25\u00a0mM Tris, 1\u00a0mM DTT, pH = 8.5 and NaCl at various concentrations, namely 0.5, 0.4, 0.3, and 0.2\u00a0M. For the preparation of CK2\u03b1/POM mixtures in different ratios, a concentrated stock solution of Ru4POM (5\u00a0mM) obtained by solubilizing dry powder in 25\u00a0mM Tris, 0.5\u00a0M NaCl, 1\u00a0mM DTT, pH = 8.5 was used. CK2\u03b1 concentration varied from 200 to 300\u00a0\u03bcM, in accordance with SEC-SAXS experiments (see below).Analytical SEC analyses on isolated CK2\u03b1 and on CK2\u03b1/Ru4POM (200\u2013400\u00a0\u03bcM) samples were in 25\u00a0mM Tris, 500\u00a0mM NaCl, pH = 8.5. After baseline stabilization, a further delay of 60\u00a0s was used before the first injection. In each individual titration, a starting Ru4POM injection of 0.4\u00a0\u03bcl in 0.8\u00a0s was followed by other 12 injections of 3\u00a0\u03bcl with a duration of 6\u00a0s each. A delay of 150\u00a0s was applied between each Ru4POM injection. Wiseman plot of integrated data was automatically obtained by software analysis (excluding the heat referred to the first 0.4\u00a0\u03bcl injection) and then it was fitted by theoretical binding curve using the one site model.Isothermal titration calorimetry (ITC) experiments were performed using a Malvern PEAQ-ITC microcalorimeter, at 25\u00b0C, with a 270\u00a0\u03bcl sample cell and a computer controlled microsyringe for titrant injections. CK2\u03b1 (20\u201330\u00a0\u03bcM) and Ru4POM mixtures were measured by SEC-SAXS approaches  column. For samples measured at 0.3 and 0.2\u00a0M NaCl  CK2\u03b1 concentration was 130\u00a0\u03bcM. Samples with 200\u00a0\u03bcM CK2\u03b1 with CK2\u03b1:Ru4POM at 1:2 and at 1:10\u00a0M ratio in buffer 25\u00a0mM Tris, 1\u00a0mM DTT, pH 8.5 and 0.5\u00a0M NaCl were loaded on a Agilent AdvanceBio SEC (4.6/300) and on a GE Superose 6 Increase (3.2/300) columns, respectively. The samples were centrifuged  prior the measurements and 50\u00a0\u03bcl of sample were injected in the columns. The purifications were carried-out via a high-performance liquid chromatography device  attached directly to the sample-inlet valve of the BM29 sample changer. The columns were equilibrated with 3 CV to obtain a stable background signal before measurement. A flow rate of 0.3\u00a0ml/min was used for all sample measurements. All SAXS data were collected at a wavelength of 0.99\u00a0\u00c5 using a sample-to-detector  distance of 2.867\u00a0m. Data reduction and preliminary data processing were performed automatically using the Dahu/FreeSAS pipeline implemented at BM29. In the SEC-SAXS chromatograms, frames in regions of stable Rg were selected with CHROMIXS and averaged using PRIMUS to yield a single averaged frame for each protein sample. Analysis of the overall parameters was carried out by PRIMUS from ATSAS 3.0.4 package , were used to calculate ab initio models in P1 and P2 symmetries, respectively, with DAMMIF  as receptor. The docking resulted in 19 plausible models of a complex formed by CK2\u03b1 monomer binding a single molecule of Ru4POM bound in different positions along the entire positively charged cavity of CK2\u03b1. Symmdock . Our data showed that CK2\u03b1 never forms dimers or multimers in solution while Ru4POM induces CK2\u03b1 dimerization at 1:1\u00a0M ratio. Based on this experimental observation, only the Symmdock-generated CK2\u03b1:Ru4POM dimers, where Ru4POM mediates intermolecular contacts between two CK2\u03b1 monomer, were selected. The structures of models were ranked according to the lower \u03c72 value obtained by structure comparison between the models and the SAXS data of the CK2\u03b1-POM complex using CRYSOL (The molecular docking of Ruatchdock  using thSymmdock  was theng CRYSOL . The besg CRYSOL .50 (concentrations inducing 50% inhibition) analysis, recombinant tetrameric CK2 (\u03b12\u03b22), or C-terminal-deleted CK2\u03b1 (CK2\u03b11\u2013336), or full length CK2\u03b1 (7.5\u00a0ng) were incubated with 0.1\u00a0mM synthetic peptide substrate RRRADDSDDDDD (CK2-tide), in a phosphorylation buffer containing 50\u00a0mM Tris-HCl pH 7.5, 10\u00a0mM MgCl2, 20\u00a0\u03bcM [\u03b3-33P]ATP , in a final volume of 20\u00a0\u03bcl, with increasing concentrations of the inhibitor. In the case of tetrameric CK2, 0.1\u00a0M NaCl was also present in the phosphorylation mixture. Controls were performed in the absence of any inhibitor, but with equal volume of vehicle (H2O). Reactions were performed at 30\u00b0C for 12\u00a0min and stopped by sample absorption on phospho-cellulose papers. Papers were washed three times with 75\u00a0mM phosphoric acid and counted in a scintillation counter (PerkinElmer). In the case of casein substrate (used at 0.05\u00a0mg/ml concentration), reactions were stopped by the addition of Laemmli loading buffer, samples were analyzed by 11% SDS-PAGE, and radioactive bands were detected and quantified by digital autoradiography . IC50 calculation was obtained by analysis of the results with GraphPad Prism 7.0a software.For ICFor kinetics analysis, the assays were performed with increasing concentrations of CK2-tide or casein, in the phosphorylation buffer described above, but with 100\u00a0\u03bcM ATP concentration.2, maintained in DMEM medium (Sigma), supplemented with 10% (v/v) fetal bovine serum (FBS), 2\u00a0mM L-glutamine, 100\u00a0U/ml penicillin, and 100\u00a0mg/ml streptomycin. Cell treatments with Ru4POM were performed in the culture medium. When used, the cationic transfection reagents PEI (Thermo Scientific) or JetOpitmus (Polyplus-transfection) were mixed with Ru4POM and incubated for 1\u00a0h at room temperature, before adding the mix to the cells. After 24\u00a0h cells were lysed as previously described (HEK-293T cells (human embryo kidney fibroblasts) were cultured in an atmosphere containing 5% COescribed . ProteinEndo-cellular CK2 activity was evaluated by assessing the phosphorylation state of the CK2 substrate Akt phospho-Ser129 (Abcam) . For thiQuantitation of the signal was obtained by chemiluminescence detection on ImageQuant LAS 500  and analysis with Carestream Molecular Imaging software (Carestream).p < 0.05.Statistical significance was evaluated by One-way Anova analysis using GraphPad Prism 7 program. All values are expressed as means \u00b1 SEM. Comparisons of more than two groups were made with a one-way ANOVA using post-hoc Bonferroni\u2019s test. Comparison of two groups was obtained by the Student\u2019s t-test for unpaired data when appropriate. Differences were considered statistically significant at values of"}
{"text": "As the second most common occupational disease in China, occupational poisoning is one of the major public health problems that seriously affect workers' health. This study aimed to investigate the epidemiological and occupational characteristics of acute and chronic occupational poisoning cases in Zhejiang Province, so as to provide a scientific basis for proposing intervention measures and preventive strategies of occupational poisoning.The data on occupational poisoning cases in Zhejiang Province from 2006 to 2020 was derived from the National Occupational Disease Network Direct Report System. A descriptive statistical analysis was employed on this data utilizing R software.P < 0.05). Benzene and lead and its compounds (excluding tetraethyl lead) were the major toxicants causing occupational poisoning. More than 60% of occupational poisoning cases were reported in private enterprises. Meanwhile, over 90% of the cases were distributed in medium enterprises and small enterprises. The type of industry with the most occupational poisoning cases was the manufacturing industry.From 2006 to 2020, 1,008 occupational poisoning cases were reported in Zhejiang Province, with a downward trend since 2007. Of these cases, 81.94% were chronic poisoning and 18.06% were acute poisoning. Ningbo reported the most occupational poisoning cases among the 11 cities in Zhejiang Province, accounting for 20.34% of the total cases. Besides, the occupational poisoning cases in Wenzhou, Jiaxing, and Shaoxing also accounted for 18.15%, 18.06%, and 17.76% of the total number of cases, respectively. Occupational poisoning in male were 693 cases and in female 315 cases. Most of the occupational poisoning cases studied involved people aged between 40 and 49 years (38.19%). The length of work in chronic occupational poisoning cases was significantly higher than that of acute occupational poisoning cases (Although the cases of occupational poisoning in Zhejiang Province have declined, more comprehensive and effective prevention and control measures are still needed. More attention ought to be paid to the management of key points according to the epidemiological and occupational characteristics of occupational poisoning cases. Occupational poisoning, as the poisoning caused by exposure to toxic chemicals during work, is the occupational disease second only to pneumoconiosis in the Chinese occupational disease catalog , 2. In tShort-term high-concentration exposure of workers to toxicants in the workplace could lead to acute poisoning accidents, which can be fatal in severe cases , 7. MoreWhile occupational diseases have long been a concern, many countries lack official figures on occupational accidents and work-related illnesses due to the absence of proper recording and notification systems . In ChinThrough the analysis of occupational poisoning cases in Zhejiang Province from 2006 to 2020 collected on the direct reporting system, this study elucidates the incidence trend and characteristics of occupational poisoning in Zhejiang Province in recent 15 years, so as to provide a scientific basis for the prevention and control strategies of occupational poisoning. Many enterprises in Zhejiang Province may use or produce various chemicals in the process of product manufacturing, which greatly increases the risk of occupational poisoning incidents. Therefore, clarifying the epidemiological characteristics of occupational poisoning in Zhejiang Province in the past 15 years is of great significance for decision-makers to effectively prevent occupational poisoning.The study utilized data on occupational poisoning cases from 1 January 2006 to 31 December 2020 in Zhejiang Province via the Occupational Disease and Health Hazards Monitoring System which is part of the China information system for disease control and prevention. All data has been confirmed, reviewed, and reported by occupational disease diagnosis institutions.The descriptive analysis of occupational poisoning cases reported in Zhejiang Province from 2006 to 2020 was carried out based on factors such as general information, region, types of toxicants, enterprise ownership type and scale, industry, and occupation.Types of toxicants: 60 toxicants (including one open item) causing occupational poisoning are listed in the National Occupational Disease Classification and Catalog .Enterprise ownership type: state-owned, collectively owned, privately owned, foreign, Hong Kong/Macao/Taiwan, and others .Enterprise scale: Based on the Enterprise Scale Standard established by the State Statistical Bureau , enterprIndustry classification: The industry classification of the enterprises is based on the Industrial Classification for National Economic Activities , divided25, P75). For the categorical variables, frequencies (n), and proportions (%) were calculated. After descriptive analysis of the data, further comparison between groups was performed using Chi-square test, Student's t-test and Wilcoxon rank sum test, and differences were considered statistically significant at P < 0.05. Mann-Kendall trend test was applied to determine whether the number of occupational poisoning cases over the years has a monotonic upward or downward trend, and P < 0.01 indicated a significant trend change.The data on occupational poisoning in Zhejiang Province from 2006 to 2020 were introduced to Excel for sorting. Data management, analysis, and plotting were performed using R4.1.3. The continuous variables for the normal distribution were described as mean \u00b1 standard deviation (SD), and data with the skewed distribution were described using median and percentile , while cases involving acute poisoning were 182 (18.06%).2 = 49.24, P < 0.05). The number of occupational poisoning cases increased since 2006, and the growth rate from 2006 to 2007 reached 146.94%. From 2007 to 2010, the number of cases was generally at a high level, with a temporary decrease in 2009, after which the numbers rose again. From 2007 to 2020, although the number of occupational poisoning cases fluctuated, it showed a significant downward trend (P < 0.01). In particular, the trend of acute poisoning cases was relatively stable from 2006 to 2020, with a maximum of 22 cases in 2017. Chronic poisoning shows a similar trend to the overall occupational poisoning, with a maximum of 111 cases in 2007 and a significant downward trend since 2007 (P < 0.01).2 = 299.06, P < 0.05). Occupational poisoning exhibited different characteristics in different regions. Acute poisoning was reported the most in Quzhou with 48 cases (26.37%), followed by Taizhou with 28 cases (15.38%), Jiaxing , and Ningbo . Chronic poisoning was reported the most in Ningbo with 185 cases (22.40%), followed by Wenzhou , Shaoxing , and Jiaxing .From 2006 to 2020, occupational poisoning cases were reported in 11 cities in Zhejiang Province, of which Ningbo had the most with 205 cases (20.34%), followed by Wenzhou with 183 cases (18.15%), Jiaxing , Shaoxing , Zhoushan the least with only 1 case (0.10%) . The disAccording to the trend of occupational poisoning cases reported over the years, occupational poisoning in Shaoxing reached its peak in 2007 (74 cases), and then gradually declined and remained at a low level since 2010 . The num2 = 6.45, P < 0.05). The average age of poisoning cases was 38.83 \u00b1 9.28, of which the age of acute poisoning cases and chronic poisoning cases were 40.51 \u00b1 9.75 and 38.46 \u00b1 9.15, respectively. A statistical difference was found between the age of acute and chronic poisoning cases . The acute and chronic occupational poisoning cases were both primarily found in the age group of 40\u201349 years, accounting for 39.01% and 38.01% of all acute and chronic poisoning cases, respectively  occupational poisoning cases in males and 315 (31.25%) in females were reported in Zhejiang Province, among which the number of acute poisoning cases and chronic poisoning cases in males was 3.33 times and 2.03 times that of females, respectively. The number of male and female poisoning cases differed in a statistically significant manner ] at the onset time of occupational poisoning cases in Zhejiang Province was 3.25  years. The length of work in chronic occupational poisoning cases was 3.50  years, which was significantly higher than that of acute occupational poisoning cases with 1.06  years (P < 0.05). The acute occupational poisoning cases were mainly distributed in the group of work length at 0\u20131 years with 87 cases (47.80%), while the group of work length with the most chronic occupational poisoning cases was 1\u20134 years (336 cases), accounting for 40.68% of the total number of chronic poisoning cases , where the major toxicant that caused occupational poisoning were benzene with 309 cases (30.65%), and lead and its compounds (excluding tetraethyl lead) with 280 cases (27.78%). As shown in From 2006 to 2020, there were differences between the number of cases of different toxicants , with most of the occupational poisoning cases occurring in private enterprises and foreign enterprises, whose were 683 (67.76%) and 196 (19.44%), respectively. The enterprises with other ownership types reported 129 cases (12.80%)  . There w2 = 70.85, P < 0.05). Among the occupational poisoning cases, there were 42 cases (4.17%) in large enterprises, 551 cases (54.66%) in medium enterprises, 399 cases (39.58%) in small enterprises, 2 cases (0.20%) in micro enterprises, and 14 cases (1.39%) in enterprises with unknown size. Among them, the small enterprises had the most acute poisoning cases ; the medium enterprises had the most chronic poisoning cases   .The curve of poisoning cases from medium enterprises and small enterprises fluctuated between 2006 and 2020 . Medium 2 = 41.54, P < 0.05), with cases mainly distributed in the manufacturing industry, accounting for more than 90%  were the major toxicants of chronic poisoning, and they were also the toxicants that caused the most occupational poisoning cases, accounting for more than 50% of the total occupational poisoning cases. A study in 2018 by Wang et al. . AccordiIn recent years, the occurrence of lead and benzene occupational poisoning was severe in Zhejiang Province. Previous studies have shown that most organic solvents have chronic toxic effects, among which benzene is a known carcinogen in humans , 30. RegThere are many types of enterprises in Zhejiang Province, and many types and quantities of chemicals are used in production . This stA wide range of toxic chemicals is in heavy use, and numerous new technologies, new materials, and new products are continuously introduced in Zhejiang Province in recent years . BesidesIndustry distribution showed that occupational poisoning cases in Zhejiang Province were mainly concentrated in the manufacturing industry. Zhejiang Province is one of the earliest developing provinces of manufacturing industry in China. Since the late 1970s, after decades of rapid development, the manufacturing industry in Zhejiang Province has now developed into an important domestic manufacturing agglomeration and export base for industrial manufactured products . The sumOccupational chemical poisoning is a category of occupational diseases with high fatality rate and great harm to workers. In this study, epidemiological and occupational characteristics of occupational poisoning cases in Zhejiang Province from 2006 to 2020 were described. The results exhibited that occupational poisoning cases reported in Zhejiang Province were predominantly chronic poisoning, and acute poisoning occasionally occurred. According to the characteristics of occupational poisoning cases, classified prevention and control strategies should be implemented, and the key points should be highlighted. Lead and benzene poisoning should be listed as key occupational diseases for surveillance, and the control of these toxicants should be strengthened. Great importance should be attached to private small and medium-sized enterprises in regions with a high incidence of occupational poisoning, and the prevention and treatment of occupational poisoning shall be carried out according to the characteristics of industry distribution.The original contributions presented in the study are included in the article/The studies involving human participants were reviewed and approved by Ethics Committee of Zhejiang Provincial Center for Disease Control and Prevention (2022-026-01). The patients/participants provided their written informed consent to participate in this study.LZ: conceptualization, investigation, formal analysis, and writing original draft. FW: data curation, methodology, and formal analysis. XF: data curation and funding acquisition. YZ: formal analysis. YH: data curation and supervision. XL: conceptualization and supervision. PX: conceptualization, data curation, visualization, and writing\u2014review and editing. HZ: methodology, writing\u2014review and editing, funding acquisition, and supervision. All authors contributed to the article and approved the submitted version.This work was supported by the Medical Health Technology Project by the Health Commission of Zhejiang (Grant Number: 2019KY056), 2021 Zhejiang Provincial Center for Disease Control and Prevention for the Technology Talent Incubation Project.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Post-transplant lymphoproliferative disease (PTLD) is a serious complication occurring as a consequence of immunosuppression in the setting of allogeneic hematopoietic stem cell transplantation  or solid organ transplantation (SOT). The majority of PTLD arises from B-cells, and Epstein\u2013Barr virus (EBV) infection is present in 60\u201380% of the cases, revealing the central role played by the latent infection in the pathogenesis of the disease. Therefore, EBV serological status is considered the most important risk factor associated with PTLDs, together with the depth of T-cell immunosuppression pre- and post-transplant. However, despite the advances in pathogenesis understanding and the introduction of novel treatment options, PTLD arising after alloHSCT remains a particularly challenging disease, and there is a need for consensus on how to treat rituximab-refractory cases. This review aims to explore the pathogenesis, risk factors, and treatment options of PTLD in the alloHSCT setting, finally focusing on adoptive immunotherapy options, namely EBV-specific cytotoxic T-lymphocytes (EBV-CTL) and chimeric antigen receptor T-cells (CAR T). Post-transplant lymphoproliferative disease (PTLD) is a rare and serious complication that occurs as a result of immunosuppression in the setting of allogeneic hematopoietic stem cell transplantation  or solid organ transplantation (SOT) . The estSurvival rates of PTLD have improved with the introduction of the anti-CD20 monoclonal antibody rituximab. However, reports on the potential cure of refractory PTLD are scarce. Today, there is no consensus on how to treat rituximab refractory PTLD, especially in highly aggressive diseases. In the present review, we will focus on PTLD following alloHSCT.The histological classification  includes six types of morphological PTLD: plasmacytic hyperplasia, infectious mononucleosis-like, florid follicular hyperplasia, polymorphic, monomorphic (B-cell or T-/NK-cell types), and classical Hodgkin lymphoma PTLD. From a pathological point of view, monomorphic PTLD is not distinguishable from lymphomas with the same cell of origin in immunocompetent patients .The majority of PTLD arises from B-cells; of note, latent Epstein\u2013Barr virus (EBV) infection is present in 60\u201380% of the cases. This finding has led to intense research into the oncogenetic implications of EBV in this rare disease . EBV-posHodgkin lymphomas and PTLD of T-lineage (T-PTLD) are the rarest forms of monomorphic PTLD. Due to the rarity of T-PTLD, knowledge about pathogenesis, risk factors, therapy, and prognosis relies predominantly on case reports and small series. T-lymphocytes do not express the EBV receptor CD21; however, some T-PTLD might show aberrant T-cells, which are positive for both CD21 and EBV .The pathophysiology of EBV-positive PTLD has been described. EBV virus is a latent gamma herpes virus with known oncogenic potential. Sero-epidemiology models suggest that 90% of the adult population has been infected, making it the most ubiquitous virus in humans . PrimaryDuring the acute phase of EBV infection, oral mucosa cells and B-cells become infected, leading to a robust immunogenic response with both antibody and cellular upregulation (via specific CD8 and CD4-positive T-cells) ; by mechThe oncogenic potential of EBV, especially in its latent phase, is demonstrated by the association with several malignancies, including endemic Burkitt lymphoma, Hodgkin lymphoma, and HIV-associated lymphomas other than PTLD . MoleculLMP-1 mimics CD40 and constitutively activates important proliferative signaling pathways in the B-cell cycle, such as NF-kB, JAK/STAT, ERK MAPK, IRF, and Wnt ; it has LMP-2A interacts with the B-cell receptor signaling, and its pathway has been linked to anti-apoptosis . UltimatUnder normal circumstances, the over-expression of LMP1 and LMP-2A by B-cells with latent EBV infection promotes a robust CD4 T-cell response that prevents the development of malignancies . HoweverEBV-negative PTLD is less common, often diagnosed later in the post-transplant period, and tends to have a poorer response to immunosuppression withdrawal . The patTwo major features are related to the development of PTLD: (1) EBV serological status of transplant recipient and donor; and (2) depth of T-cell immunosuppression pre- and post-transplant. In particular, EBV serological status is considered the most important risk factor for post-SOT PTLDs  : recipieFor alloHSCT patients, ex vivo or in vivo T-lymphocyte depletion plays a major role. In fact, the use of anti-thymocyte globulin (ATG), commonly employed for matched unrelated donors, strongly affects PTLD development , similarThe role of other immunosuppressant drugs is more uncertain, partly due to different drug schedules and doses. High-intensity immunosuppression in the peri-transplant induction phase appears linked to early PTLDs, while the cumulative immunosuppressant burden in the following years affects late PTLDs . SimilarRecently, reduced intensity conditioning (RIC) regimens have been widely adopted to reduce transplant-related mortality and morbidity, allowing a widening of HSCT indications even to older patients or with a higher comorbidity index. The use of RIC regimens has been proven to be an independent risk factor for EBV-PTLD development, probably due to the more prolonged absence of normally restricting EBV-specific T-lymphocytes . SimilarAdditional risk factors have been identified, such as the presence of the highly oncogenic variant protein LMP-1 in donors, an untreated HCV infection in recipients , and non-Caucasian ethnicity ,30. MoreIt has also been hypothesized that chronic antigen stimulation from viruses other than EBV might play a potential role in EBV-negative PTLDs . In partPTLD occurrence after alloHSCT is primarily associated with the degree of HLA matching, given that more mismatches typically require stronger immunosuppression to prevent GvHD . Thus, tChronic GvHD is a potentially strong risk factor for late-onset PTLDs, both due to immune deregulation from GvHD itself and prolonged immunosuppression . Little In a review of 163 cases, alloHSCT was associated with early-onset T-PTLD, whereas late-onset occurred after immunosuppression with steroids and azathioprine without the administration of calcineurin inhibitors . The majIt is widely assumed that the reduction of the immunosuppression (RIS) is the typical first-line treatment for EBV-positive PTLD, though it may highly increase the risk of GvHD flare in alloHSCT and of rejection in SOT. Moreover, although data are scarce, RIS appears to have limited efficacy, and a specific treatment is necessary in almost the totality of cases.The monoclonal anti-CD20 antibody rituximab is the gold standard of treatment in CD20+ PTLD, polymorphic PTLD, or monomorphic diffuse large B-cell lymphoma-like PTLD resistant to RIS ,38. Howep-value 0.001), as well as its uses any time before transplant   was the histological type in 80% of cases . The maxOverall, several clinical trials are expanding the use of third-party EBV-CTL in the setting of PTLD. A phase III trial is exploring the administration of commercially available off-the-shelf, allogeneic EBV-CTL called Tabelecleucel for EBV+ PTLD patients who failed rituximab or rituximab and chemotherapy . Preliminary results showed an ORR of 50% and a median duration of response not reached in responders . AnotherChimeric antigen receptor T-cell (CAR T-cell) therapy directed against CD19 surface antigen is a novel immunotherapeutic approach that demonstrated promising activity against relapsed and refractory DLBCL ,64,65. ETo date, only one group recently reported successful treatment of PTLD after alloHSCT with donor-derived CAR T-cell therapy . The treFinally, another tumor-associated target is being explored for the treatment of EBV-positive cancers. Preclinical studies showed encouraging results using CAR T-cells directed against surface LMP1 expressed in EBV-positive cancers such as nasopharyngeal carcinoma . An earlNew insights in the pathophysiology of PTLD and in the role of EBV infection have allowed remarkable advances in the treatment and in the improvement of clinical outcomes of this rare, but life-threatening complication of alloHSCT. EBV serological status and immunosuppressive strategies for transplantation remain the most relevant predictive factor for the onset of the disease. However the recent introduction of novel, effective adoptive immunotherapies represent an encouraging option for refractory cases."}
{"text": "Furthermore, the incorporation effect of ZnO:Al (TCO) and CuSCN (HTL) nanolayers was studied for the first time. As a result, the efficiency of the solar cell was maximized from 16.04% to 17.74% by increasing the Jsc and Voc. This work will play an essential role in enhancing the performance of CdTe-based devices with the best performance.A numerical simulation is a valuable tool since it allows the optimization of both time and the cost of experimental processes for time optimization and the cost of experimental processes. In addition, it will enable the interpretation of developed measurements in complex structures, the design and optimization of solar cells, and the prediction of the optimal parameters that contribute to manufacturing a device with the best performance. In this sense, a detailed simulation study was carried out in this work by the Solar Cell Capacitance Simulator (SCAPS). In particular, we evaluate the influence of absorber and buffer thickness, absorber defect density, work function in back contact, R Still, the consumption of the material and the high manufacturing costs of these cells have prompted the search for polycrystalline absorber layers of thin films that can adequately replace silicon. One material of interest is CdTe, which has the highest efficiency in thin-film solar cells, this value being above the one reported for CIGS . CdTe is5/cm) , which e5/cm) . Althoug5/cm) ,5,6,7.3 [2O5 [x [oc [On the other hand, solar cell performance greatly depends on the energy barrier at the absorber/contact interface. Therefore, to reduce this barrier, a back contact with a low resistance and high work function (WF) is necessary. In recent years, many researchers have studied diverse materials employed as back contact layers for CdTe devices ,9,10. So3 , V2O5 [13 [2O5 , NiO [13 [2O5 [x , are use [2O5 [x . These p5 [x [oc . Moreove5 [x [oc ,18.2:F and ZnO:Al) present a good alignment of the conduction band (CB) with the CdS material and a large valence band (VB). Therefore, minimal recombination is expected at the interface, as electrons pass through smoothly and holes are blocked. However, ZnO:Al has a lower refraction index (of around 7\u20139%) than SnO2:F. Then, this quality could make it more suitable for CdS/CdTe devices because it allows for promoting more significant photon absorption in the CdTe (absorber) layer [On the other side, a transparent electrode (TCO) is used as a front contact to extract the photogenerated electrons to the external charge, usually indium tin oxide (ITO) or fluorine-doped tin oxide (FTO). Nevertheless, both materials possess a high elaboration cost, low electron mobility, and transmittance of around 80% ,20. So, r) layer ,25,26.2:F  [Another essential requirement for a material to be used as front contact is its lattice matching with the buffer layer, so structural parameters should be considered during their coupling. Lattice-matched materials can be grown on top of one another without forming a high density of nonradiative recombination. However, when the growth of lattice-mismatched materials is attempted, many defects result from the relaxation of strain in the crystal structure ,28. In t 3.18 \u00c5) .2 materials. However, several extensions have improved their application capabilities to Si and GaAs solar cells and other materials, such as perovskite [Due to the complexity of solar cells, it is crucial to understand the physics behind these technologies. A helpful tool is a numerical simulation, which allows us to solve the most critical differential equations of solar cells and design and optimize advanced cell structures. SCAPS-1D is a solar cell simulation software conceived at the University of Gent, Belgium. This program was mainly designed for the CdTe and CuInSerovskite ,31. In arovskite ,33.The present investigation yielded an extensive study about the impact of different parameters on the CdTe/CdS device structure by SCAPS-1D. Then, a new configuration proposal (CuSCN/CdTe/CdS/ZnO:Al) was studied for improving the device performance.2:F/CdS/CdTe/Carbon [2:F configuration. This work investigates a CdTe solar cell in superstrate structures to analyze the impact of different parameters on the device\u2019s performance. The reference solar cell configuration in the simulation was as follows: SnOe/Carbon . The devThe SCAPS software solves the fundamental semiconductor equations, the Poisson, the continuity equations for electrons and holes, and the drift equation . The sofTo validate our model, it was necessary to simulate a base solar cell with the typical configuration of CdTe. In this sense, the J-V and EQE curves were calculated by SCAPS and are presented in The film thickness is a critical manufacturing parameter affecting the device\u2019s cost and environmental protection properties. An improvement at thicker absorber layers is observed in the J-V curves of CdTe devices a. The besc results presented in Results show that when the CdTe thickness was increased up to 3000 nm, the Jsc increased, improving the PCE. This is because a larger CdTe layer can absorb more photons of higher wavelengths, increasing the number of charge carriers generated in it. An improvement was observed in almost all the output parameters with the increase in thickness. However, this effect on the FF was not perceived at thicknesses greater than 3000 nm, which could be attributed to a possible increase in Rs. The plotted graph of EQE vs. wavelength for different thicknesses of the CdTe layer is presented in The study of the influence of CdS thickness on the solar cell is essential to improve performance. In this sense, oc. oc from 0.87 V to 0.86 V, Jsc from 24.89 mA/cm2 to 23.22 mA/cm2, FF from 76.18% to 76.09%, and PCE from 16.53% to 15.37%.A linear decrease was observed in almost all the output parameters by the thickness increase a. Howevesc (24.86 mA/cm2 at 10 nm) presented in oc (from 0.41 V to 1.10 V), FF (from 60.6% to 77.52%), and PCE (from 5.99% to 20.12%) is observed with the increase in work function values, while the Jsc remains the same. Therefore, materials with back contact values greater than 5.7 eV are unnecessary.The energy needed to remove an electron of the highest level of the stationary Fermi distribution of a solid is known as the work function. The contacts greatly influence the performance and efficiency of solar cells because these devices are highly dependent on the front and back contact work function . Figure Charge carrier generation and recombination are decisive processes for the performance of CdTe solar cells. The first occurs when sunlight strikes the device, allowing the generation of photo-generated carriers in the absorber layer. The charge carriers are collected and transferred to the external current. However, many of these are lost due to the inadequate quality of the material. Higher defect density, commonly found in low-quality materials, increases the recombination rate, reducing the diffusion length of charge carriers and, thus, their lifetime. To determine the effect of defect density on CdTe solar cells\u2019 performance, it is important to understand the recombination mechanisms  .\u22123) in the CdTe. These simulations were performed at different defect densities from 1012 to 1017 cm\u22123  increased as the defect density of the CdTe decreased. As seen in 13 cm\u22123, which reveals that an efficiency of 17.56% could be achieved only in CdTe films with remarkably low defect densities.As mentioned above, defects in absorber solar cells have a significant impact on efficiency. In this study, numerical simulations were conducted to investigate the influence of bulk defect density (cm017 cm\u22123 . When an2 (Rs) and from 0 to 3000 \u03a9 cm2 (Rsh) (2) can also reduce the Jsc. On the contrary, the Voc remained the same for values of Rs but increased with higher Rsh. Also, as expected, the FF was mainly affected by the Rs, which directly affected the efficiency. Therefore, we need devices with low or negligible series resistances and very high shunt resistances to obtain high efficiencies.Parasitic resistances have a crucial role in a photovoltaic (PV) system. Series resistance (Rs) is generated by different bulk resistances, such as those of the semiconductor material, metallic material, and contact in the metal\u2013semiconductor . On the m2 (Rsh) . A signi15 to 1 \u00d7 1017 cm\u22123 for CdS (donor densities) and CdTe (acceptor densities), respectively. As can be seen, the main impact was at greater values of acceptor concentration nearby 10T/cm\u22123, where the utmost efficiency of 17.48% and a Voc of 2.0 V were determined  to replace the common back contact (Cu/Au) [2:F, as mentioned in the introduction section, is commonly used. However, it is necessary to emphasize the characteristics required of a front contact (TCO) for its application in CdTe/CdS solar cells, such as high transparency (>85%), a low resistivity on the order of 104 \u03a9 cm [2:F (superstrate type) which needs a deposit temperature of around 450 \u00b0C or ZnO:Al (substrate type) that has the advantage of being deposited at room temperature [2:F due to its greater transparency (cell 2). And the third one, where the CuSCN material works as HTL (cell 3). The J-V curves with different configurations are shown in Using Cu as a p-type dopant at the back contact has been the most productive approach, yielding hole densities of about 10 (Cu/Au) ,54. In a104 \u03a9 cm ,56, goodperature . Therefooc significantly increased by adding the CuSCN layer but slightly decreased in FF. This behavior is because of its high conduction band since the CuSCN operates as an electron reflector. Additionally, the CuSCN and CdTe conductivity (p-type) caused the valence band offset (CuSCN/CdTe) to be negligible. Furthermore, the CuSCN layer became a Cu source for CdTe doping (increasing hole density), which was necessary to improve the Voc in CdTe devices [The typical Cu/Au back contact becomes problematic due to Cu diffusion during device production conducting to degradation and compensation via extra Cu diffusion . For thi devices . Thus, i devices ,54.oc from 0.87 V to 0.94 V. Results by using CuSCN as HTM are in good agreement with some reports where a significant Voc (1 V) was reached [2:F (80%). Nevertheless, there was no noticeable improvement in cell 3 with the CuSCN layer.The output parameters of all CdTe devices are presented in  reached . Figure 2 to analyze their impact on the solar cell performance using the following configurations: CdTe/CdS/SnO2:F (cell 1), CdTe/CdS/ZnO:Al (cell 2), and CuSCN/CdTe/CdS/CdS/ZnO:Al (cell 3). The Rs predominantly result from the available connections or the circuit resistance across the contacts. It is desirable to guarantee a low or negligible Rs to ensure high-efficiency solar cells. However, it is still inconceivable to achieve a perfect FF because of the deficiency of the diode. The Rs were varied from 0 to 10 \u03a9 cmoc remained constant with increasing Rs values. As this value increased from 0 \u03a9 cm2 to 10 \u03a9 cm2, the efficiency decreased from 16.04% to 11.67% (Cell 1), from 16.90% to 11.72% (Cell 2), and from 17.72% to 12.09% (Cell 3). Nevertheless, better performance was shown for the device with the CuSCN layer (compared with the other devices). The effect of adding the CuSCN and ZnO:Al nanolayers in the device design is revealed in In all configurations, the V13 cm\u22123, a negligible series resistance, a shunt resistance of 3000 \u03a9 cm2, and hole carrier concentration of 1017 cm\u22123. In addition, the use of ZnO:Al and CuSCN layers was considered. The J-V curve and EQE are presented in As the last step, a new simulation was carried out considering the optimized characteristics obtained in the previous sections, such as thicknesses of 3 \u00b5m for CdTe and 25 nm for CdS, a work function of 5.7 eV, a defect density of CdTe of 102:F; cell 2, CdTe/CdS/ZnO:Al; and cell 3, CuSCN/CdTe/CdS/ZnO:Al. First, the influence of different parameters  on cell 1 was studied and explained. Then, the impact of the ZnO:Al and CuSCN was evaluated for cells 2 and 3, respectively. Promising optimized results were achieved with a conversion efficiency from 16.04% (cell 1) to 22.62% (cell 3). Finally, cell 3 demonstrated that incorporating ZnO:Al and CuSCN made it possible to obtain a superior Voc and, consequently, greater efficiency. Furthermore, the third device showed a lower adverse effect against parasitic resistance (Rs). This new proposal will guide the feasible fabrication of higher-efficiency CdTe-based photovoltaic cells.The understanding of CdTe solar cell physics is valuable for achieving greater efficiencies. In this sense, a numerical simulation (SCAPS) of the CdTe device was carried out. The incorporation of the ZnO:Al nanolayer (TCO) and CuSCN nanolayer (HTL) on solar cell performance was compared and studied. The device configurations were: cell 1, CdTe/CdS/SnO"}
{"text": "Traffic accidents caused by road icing are a serious global problem, and conventional de-icing methods like spraying chemicals have several limitations, including excessive manpower management, road damage, and environmental pollution. In this study, the carbon nanotubes reinforced de-icing coating for the road system with a self-heating function was developed as part of the development of a new system to prevent accidents caused by road icing. The electrical characteristics of the fabricated coating were analyzed, and the carbon nanotube coating heating performance experiment was conducted to measure the temperature increments by applying a voltage to the coating at a sub-zero temperature using an environmental chamber. In addition, the coating was installed on the road pavement and the applicability was investigated through a heating test in winter. As a result of the experiment, the coating made with the higher carbon nanotube concentration presented higher heating owing to its higher electrical conductivity. In addition, the coating showed sufficient heating performance, although the maximum temperature by Joule heating decreased for the entire coating at sub-zero temperatures. Finally, field tests demonstrated the potential of electrically conductive coatings for de-icing applications. Road systems face their greatest challenges during the winter season in many countries because snowfalls and icing create serious problems in the field of road systems. These challenges involve the mobility of vehicles and the assurance of driver safety. In addition, many road departments are not prepared to immediately remove snow and ice. As a result, snow and ice accumulation on road systems lead to significant financial setbacks. For example, persistent snowfall in northwestern Germany resulted in more than 2000 traffic accidents and a direct economic loss of 100 million Euros in November 2005, and traffic in the northeastern United States was paralyzed by a snowstorm for four days, with a direct economic loss of US $10 billion in January 1996 ,4,5,6. FTo address these issues, many research efforts have been devoted to finding cleaner techniques for safely deicing road systems during winter. Some of the emerging techniques involve the application of embedding electrically heated sheet/grille elements inside the road  and the In our research, we developed a novel coating comprising carbon nanotubes and an epoxy matrix capable of replacing conventional methods of de-icing road systems. We investigated the heating performance of the coating according to atmospheric temperature and its potential applicability through field experiments. We began by examining the electrical properties of the CNT/EP coatings in relation to varying CNT concentrations. Following that, we assessed the heating efficiency of the CNT/EP coating at room temperature, utilizing the Joule effect. To explore the impact of atmospheric temperatures, we measured the heating temperature of the CNT/EP coating under below-freezing conditions. Furthermore, we evaluated the coating\u2019s applicability by observing its performance during winter.3 and a viscosity of 200\u2013450 mPa\u2219s. The dispersant used acetone with a purity of 99.7% from Samchun Pure Chemical Co., Ltd. .In this study, multi-walled carbon nanotubes were adopted from Nanolab, Inc. . The CNTs have a purity of higher than 85 wt.% , a diameter of 15 nm, and a length of 5\u201320 \u00b5m. Epoxy was sourced from Easy Composites Ltd. , exhibiting a density ranging between 1.12\u20131.18 g/cmThe CNT/EP coating was fabricated following the procedure shown in 9 \u03a9. Electrical resistance was assessed based on the current\u2013voltage curves acquired by applying voltages ranging from \u221210 V to +10 V. The test coating samples were prepared in various CNT concentrations (0.63\u20135.00 wt.%) with dimensions of 50 mm \u00d7 30 mm \u00d7 2 mm. High-purity silver paint was applied to both ends of the coating samples to reduce the contact resistance between the coating and the probe point. The electrical conductivity (\u03c3) of the specimens was calculated by \u03c3 = L/RA, where L is the length of the coating (m), R is the resistance of the coating (\u03a9), and A is the area of the coating (m2) [The heating performance due to the Joule effect is based on the electrical conductivity and the applied voltage of the application. Therefore, in our study, we have set the concentration of CNTs and the applied voltage as the main parameters. The resistance of CNT/EP coatings was gauged using a Keithley 2700  for standard resistance, and a Keithley 2450  for high resistance levels exceeding 10ing (m2) ,37. The As shown in A thermal infrared camera  was used to record the heat distribution across the samples during Joule heating, resulting in thermal images. To investigate the effect of atmospheric temperature on the heating performance, the infrared thermal imaging camera and CNT/EP coating were set in the environmental chamber, and the temperature increments of the CNT/EP coating by applied voltage was measured with respect to the environmental temperature (\u221220 \u00b0C to +20 \u00b0C) as shown in \u22128 S/m are insulator, and those with electrical conductivities above 10\u22128 S/m are conductive. At low concentration, lower than 0.25 wt.% of CNTs, the coatings showed non-conductivity. The electrical conductivity of the coating rapidly increased when the CNT concentration rose to between 0.25 to 1.0 wt.% based on increases in the CNT networks. This sharp increase in the electrical conductivity of CNT/EP coating is because of the formation of a percolation threshold [The addition of CNT in the epoxy metrics can significantly improve the electrical conductivity of the coating because of the superior electrical conductivity and high aspect ratio of the CNT . The elehreshold ,40,41,42Q = I2Rt = V2t/R, where Q is Joule heat, I is current, R is resistance, V is applied voltage and t is operating time). Another important aspect of the Joule heating system is the heating ratio [According to Joule\u2019s law, the CNT/EP coating converts electric energy into thermal energy after loading voltage, which mainly shows rapidly increasing temperature stage of the coating ,44. Figung ratio ,46. FiguP = V2/R. The relationship between the applied voltage and the power is comparable to that between the maximum temperature of the coating and the voltages shown in \u22123) can be calculated as electric power per unit volumetric [To evaluate the applicability of CNT/EP coatings based on Joule heating, a deeper exploration of thermal efficiency is required, as it signifies the de-icing capability in relation to the energy consumed. lumetric ,49. Figulumetric . The slolumetric ,52,53. Alumetric ,55. ThisMany studies related to Joule heating performance of CNT composites have been conducted ,57,58,590 and t1, respectively. The resistance of EC01 and EC02 was 960 \u03a9 and 1960 \u03a9 at 20 \u00b0C, respectively. The resistance of EC02 is about twice that of EC01. The experiment was carried out during an evening in winter 2021. As a result of the heating test, the surface temperature of the coating increased above 10 \u00b0C from about \u22125 \u00b0C. After the voltage was applied, it heated up rapidly for 200 s, and the EC01 sample showed a higher temperature than EC02. It should show a similar heating pattern for the same applied voltage, but the EC01 sample showed a higher and more even temperature. This is because the dispersion of the CNTs in EC01 sample was more evenly distributed than that of the EC02 sample which can be confirmed by comparing the heating distribution of the coating as shown in To demonstrate the feasibility of the proposed method, we placed CNT/EP coating on the road pavements as shown in The aim of this study was to examine the relationship between the concentration of CNTs and supply voltage with respect to the heating and electrical performance of CNT/EP coating, and to assess the impact of atmospheric temperature on this relationship. The goal was to provide an alternative solution to the issues caused by chemical de-icing agents in road systems. By dispersing CNTs in an epoxy matrix, we have successfully fabricated highly electrically conductive coatings. Measurement of the variation of electrical conductivity with CNT concentration showed that the percolation threshold occurred when CNT concentration was between 0.5 wt.% and 1.0 wt.%. To evaluate the applicability of CNT/EP coatings based on Joule heating, thermal efficiency was investigated at room temperature, as it signifies the de-icing capability in relation to the energy consumed. Results show that the CNT/EP coating has high thermal efficiency by attaining maximum temperatures with relatively low electric power. As a result of the heating test of the CNT/EP coating according to atmospheric temperature, it was found that a decrease in atmospheric temperature reduced the heating performance of the coating. Nevertheless, it was confirmed that the heating performance of the coating remained above freezing even under sub-zero temperatures. Finally, application tests confirmed that the de-icing coating developed and verified in this study present good heating performance and applicability. As a result of the application test at sub-zero temperature, it was proved that the coating can reach the de-icing temperature and it is possible to respond according to the installation environment. Through these results, it was confirmed that the developed coating could be used not only to prevent ice on the road system as an eco-friendly coating but also may be applied to structures in various fields."}
{"text": "Dear Editors,Acute myeloid leukemia (AML) can be classified into multiple genetic subtypes based on recurrent pathogenic structural variants (SVs), copy number abnormalities (CNAs), and single nucleotide variants (SNVs) that inform prognostication and clinical management , 2. Karyn\u2009=\u200955, 52%), 23 (22%) had AML with myelodysplasia-related changes (AML-MRC), 21 (20%) had relapsed AML and 6 (6%) had therapy related AML (Supplementary Tables NUP98 (11p15.4) rearrangement and 7 had a KMT2A (11q23.3) rearrangement with gene partner MLLT10 (10p12.31) in 3 cases, ELL (19p13.11) in one case, MLLT6 (17q12) in one case and MLLT3 (9p21.3) in 2 cases. Four had t, 3 had inv(3)(q21.3q26.2) or t including a single case with inv(3) with BCR::ABL1, 3 had inv(16)(p13.1q22) or t, and a single case each with either t or KAT6A rearrangement involving 8p11.2 . In 3 other cases, MPseq missed low-level trisomy 8 found in 3\u20135% of cells by FISH and detected by karyotype  Table . Of the pe Table . Since MNUP98 rearrangement, 2 cases with a TP53 deletion, and one case each with a KMT2A::MLLT10 fusion and an inv(8) resulting in a KAT6A rearrangement, and a 7q deletion. Additionally, karyotype analysis detected 4 cases with a 17p deletion, which presumptively included loss of the TP53 locus, that were not identified by FISH or MPseq. There was 100% concordance for some AML-associated rearrangements with consistent and cytogenetically detectable breakpoints including t, t, inv(16)(p13.1q22), inv(3)(q21.3q26.2), and t , KMT2A rearrangements (75%) and trisomy 8 (81%) , FISH has increased sensitivity compared to MPseq if the abnormality is targetable by the available FISH probe.When evaluating cytogenetic results obtained by each methodology individually, the concordance between MPseq and FISH was 93.3%, between FISH and karyotype was 85.7% and between MPseq and karyotype was 82.9% Fig. . FISH mi21) Fig.  demonstrseq Fig. . Reduced1%) Fig. . FISH anOf the 5 cases with discordant results between MPseq compared to karyotype plus FISH Table , the ELNKMT2C, CUX1, and EZH2, located on 7q and the most frequently gained genes included MYC and/or CCDC26, RAD21, and TRPS1, located on chromosome 8. MECOM was the most frequently rearranged gene in our AML cohort  with focal gains identified by MPseq of 8q24 involving MYC and/or the nearby long noncoding RNA CCDC26. The partial gain of CCDC26 in 7q-55 was also associated with a cryptic ins resulting in an insertion between BCL11B into the CCDC26. We also observed 2 cases with iAMP21 by MPseq (case 5q-65 and 5q-147)  and KRAS. Rare or novel SVs were identified in 20 cases (19.0%) including case KAT6Ar-128, which was found to have a cryptic inv(8) resulting in a KAT6A::SORBS3 fusion. A single case (simple K-132) had a ZMYND11::MBTD1 fusion. SVs disrupting NF1 were found in 2 cases , RUNX1 in 2 cases , non-GATA2 MECOM rearrangements in 6 cases  and an ASXL1 rearrangement resulting in a partial deletion of the gene in one case (5q/7q-87). Finally, MPseq characterized each of 6 NUP98 rearrangements revealing KMD5A partner gene in 3 cases and NSD1 partner in 3 cases. Recurrent focal deletions of AML associated genes not appreciated by karyotyping were common , TP53 and KMT2A are used. Alterations in TP53 are associated with significantly inferior outcomes and treatment responses in AML and biallelic alteration in TP53 AML confers the worse outcomes among CK AMLs [TP53 locus is important for prognostication and may soon impact clinical management.In summary, we identified five cases 4.8%) of discordance between MPseq compared to karyotype with FISH when evaluating recurrent AML-associated genetic abnormalities. Greater discordance was identified when comparing karyotype to FISH (14.3%) or karyotype to MPseq 17.1%) individually. These findings contrast previous studies which have reported limited value of FISH in AML when an adequate karyotype is available [.1% indiv% of discNUP98 rearrangements are associated with poor outcome [NUP98 rearrangements have not yet been incorporated into ELN guidelines. Similarly, KMT2A partial tandem duplications have been reported in 10% of AML and MDS and are associated with poor outcome [MYC amplification, associated with a CK and poor outcome [BCL11B::MYC rearrangements reported as a driver in ambiguous leukemia [ZMYND11::MBTD1 fusion [Although we demonstrate that MPseq does not currently add additional prognostic value above FISH when compared to a comprehensive AML FISH panel, risk stratification guidelines will likely evolve to include novel abnormalities of prognostic significance detected by NGS. For example, growing evidence suggests  outcome , but NUP outcome . Other r outcome , BCL11B:leukemia , ZMYND111 fusion  and iAMP1 fusion .We demonstrate that karyotype analysis when combined with FISH remains a robust laboratory approach in the evaluation of AML. While the use of MPseq did not add significant value above FISH using current ELN guidelines, NGS technologies such as WGS will continue to identify novel high-risk AML subgroups, which will likely enhance future risk stratification guidelines.Supplementary MethodsSupplementary FiguresSupplementary TablesSupplementary Table 4"}
{"text": "Yamahai\u2010shubo, the source of yeast used to produce a Japanese traditional rice wine, Yamahai\u2010shikomi sake. The bacterial strains were nitrate\u2010reducing Pseudomonas sp. 61\u201002, Leuconostoc mesenteroides LM\u20101, Lactiplantibacillus plantarum LP\u20102, and Latilactobacillus sakei LS\u20104. We examined fermentation factors for Yamahai\u2010shubo and Yamahai\u2010shikomi sake samples to compare the suitability of their bacterial combination (16 variations). As a result of principal component analysis, we found that two major groups were formed; one containing strain LP\u20102 and the other containing strain LS\u20104, and that strains LP\u20102 and LS\u20104 were important in the Yamahai\u2010shikomi sake in the presence of strains 61\u201002 and LM\u20101. Then, we investigated the effects of strains LP\u20102 and LS\u20104 on the concentration of organic acids  in Yamahai\u2010shikomi sake. Only in lactic acid, a tendency to decrease with a smaller proportion of LS\u20104 strains in Yamahai\u2010shubo was observed. Subsequently, their effect on the concentration of diacetyl, crucial for aroma, was investigated between the LP\u20102 and LS\u20104 strains. The sample prepared in the absence of strain LS\u20104 exhibited the lowest concentration of diacetyl. This result was supported by the statistical analysis for the sensory scores performed for aroma of each Yamahai\u2010shikomi sake sample. In conclusion, strain LP\u20102 plays a more significant role in improving Yamahai\u2010shikomi sake quality with strains LM\u20101 and 61\u201002 rather than strain LS\u20104 in Yamahai\u2010shubo preparation and Yamahai\u2010shikomi sake brewing.This study investigated the interactions of four bacteria strains isolated from  Leuconostoc mesenteroides LM\u20101, Lactiplantibacillus plantarum LP\u20102, and Latilactobacillus sakei LS\u20104) isolated from Yamahai\u2010shubo. We examined fermentation factors for Yamahai\u2010shubo and Yamahai\u2010shikomi sake samples to compare the suitability of their bacterial combination (16 variations). In conclusion, strain LP\u20102 plays a more significant role in improving Yamahai\u2010shikomi sake quality with strains LM\u20101 and 61\u201002 rather than strain LS\u20104 in Yamahai\u2010shubo preparation and Yamahai\u2010shikomi sake brewing.This study investigated the interactions of four bacteria strains (nitrate\u2010reducing Pseudomonas sp. 61\u201002,  It is known to need more time than Sokujo\u2010shubo because lactic acid is derived from lactobacilli included Yamahai\u2010shubo, and it increases the risk of putrefaction of nonpreferable microorganisms, causing an off\u2010flavor , e.g., Leuconostoc mesenteroides, gradually and then preferentially grow, producing only a small amount of lactic acid. Subsequently, bacillus\u2010form lactic acid bacteria (bacilli\u2010LAB), e.g., Latilactobacillus sakei  by adding koji and steamed rice with water, it becomes more significant to examine the diversity of bacteria as well as yeasts in the present brewing of Yamahai\u2010shikomi sake with Yamahai\u2010shubo to maintain the quality of the sake  in Yamahai\u2010shubo preparation and showed the requirements of two strains, 61\u201002 and LM\u20101. In the evaluation process, we performed principal component analysis for samples of Yamahai\u2010shubo and Yamahai\u2010shikomi sake. Next, we examined how Lp.\u00a0plantarum LP\u20102 and Ll.\u00a0sakei LS\u20104 contributed to the quality of sake with the coexistence of Pseudomonas sp. strain 61\u201002 and Le.\u00a0mesenteroides LM\u20101 in Yamahai\u2010shikomi sake brewing. Finally, we showed the significance of Lp.\u00a0plantarum LP\u20102 over Ll.\u00a0sakei LS\u20104 and demonstrated that the quality of Yamahai\u2010shikomi sake can be controlled by LAB through studying various combinations of those strains in Yamahai\u2010shubo.With this background, 22.1Pseudomonas sp. 61\u201002 and three LAB strains ] were used in this study. They were previously isolated from Yamahai\u2010shubo described before ] and 255\u00a0mL of water with the addition of KNO3 (60\u2009mg/L). koji is a type of rice that is made from koji mold  with polished rice made by the industrial koji manufacturing system . Fermentation with koji followed the same method described before ] were prepared as follows. Strain 61\u201002 was independently cultured in PN medium  for 3\u2009days at 15\u00b0C  for 3\u2009days at 20\u00b0C and were added to the initial mixture of Yamahai\u2010shubo at a cell concentration of 103 cells/mL. Yamahai\u2010shubo preparation was totally completed in 25\u2009days with the initial mixture of Yamahai\u2010shubo after adding any of the nitrate\u2010reducing bacterial strain 61\u201002 and/or three LAB bacterial strains  added; see Table\u00a0Four bacterial strains [nitrate\u2010reducing Yamahai\u2010shubo preparation was kept at 8\u00b0C until day 4. After day 5, the preparation was warmed up by contact with hot water at 65\u00b0C to increase the temperature by one degree per day until it reached 21\u00b0C on day 16. After holding the temperature of the mixture at 21\u00b0C for another 5\u2009days, the temperature was decreased to 15\u00b0C on day 21, to 13\u00b0C on day 22, to 12\u00b0C on day 23, and was then maintained at 12\u00b0C until day 25. The yeast strain KZ\u201006\u2009U was separately cultured in koji extract (sake meter \u221260) for 2\u2009days at 30\u00b0C and added between days 10 and 15 of the preparation to reach a cell concentration of 106 cells/mL when the nitrite concentration of the Yamahai\u2010shubo preparation was less than 1.0\u00a0mg/L. The timing of yeast addition in the absence of strain 61\u201002 was the same as the timing of yeast addition in the presence of strain 61\u201002. The final preparation reached approximately 500\u00a0mL in volume and was called \u201cYamahai\u2010shubo.\u201d For use at the industrial scale, the process was considered complete at day 25, even if the disappearance of nitrite was delayed and the yeast growth period was shortened.The temperature during The cell numbers of strain 61\u201002 and three LAB strains  were determined by the method described previously  were mixed at three different times  to smoothly complete the fermentation  was carried out at 15\u00b0C from day 1 to day 2. Both the naka  and the tome  feeding procedures were carried out by adding the components at 10\u00b0C. After the tome procedure , sake brewing was monitored by measuring the weight reduction of the fermentation mixture, corresponding to CO2 evolution for 25\u2009days. The temperature of the fermentation mixture was increased by about 0.5\u00b0C for another 6\u2009days, kept at 13\u00b0C for an additional 7\u2009days, and then promptly lowered to 10\u00b0C while the temperature was maintained for an additional 12\u2009days. After sake brewing (25\u2009days), the samples were separated by centrifugation , and the supernatants were called \u201cYamahai\u2010shikomi\u201d sake samples . Diacetyl was derivatized by Shinwa DS\u2010DA  and analyzed using the same gas chromatography system. All data are the averages of two or three independent experiments.Basic fermentation factors for sake meter (SM), ethanol (Alc), total acidity (TA), amino acidity (AA), and Ultraviolet absorption (UV) were determined by the standard method established by National Research Institute of Brewing .The qualities of 2.5https://www.bellcurve.jp/), employing fermentation factors  and sensory scores at the final point (25\u2009days) of Yamahai\u2010shubo  was performed with Excel Statistical analysis 2008 software for Windows . Changes in three fermentation factors are depicted in Figure\u00a0Pseudomonas sp. 61\u201002, following the method as described in Materials and Methods. Nitrite is known to be essential in Yamahai\u2010shubo preparation process; it is converted from nitrate, which is derived from PN medium for the preparation of strain 61\u201002  and inhibits the growth of wild yeasts that are concomitant in the initial mixture for Yamahai\u2010shubo. As shown in Figure\u00a0Yamahai\u2010shubo preparation and drastically decreased before the second half. However, the coculture of strain LM\u20101 only with strain 61\u201002 was found to retard the decrease in the concentration of nitrite  in the presence and absence of strain 61\u201002 .The four bacterial strains previously found in e Figure\u00a0. It is ns Figure\u00a0. Furthers Figure\u00a0. In addi2 Figure\u00a0. HoweverYamahai\u2010shubo preparation in Table\u00a0Yamahai\u2010shubo utilizing the advantages of strain LP\u20102 without strain LS\u20104.Comparing the components at the final point (25\u2009days) of Yamahai\u2010shikomi sake similarly as Yamahai\u2010shubo , we performed principal component analysis (PCA) by using fermentation factors for 16 samples of Yamahai\u2010shubo and Yamahai\u2010shikomi sake, as shown in Tables\u00a0To investigate the suitability of the bacterial combination of the nitrate\u2010reducing Yamahai\u2010shubo preparations and Yamahai\u2010shikomi sake samples contained strains 61\u201002 and LM\u20101  in Yamahai\u2010shikomi sake and Yamahai\u2010shubo samples were determined for each sample  was higher than that of LP2\u2009+\u2009LS4 (2:1), there was no significant difference between them  isolated from Yamahai\u2010shubo samples is very important for producing Yamahai\u2010shikomi sake. In particular, the isolation of different bacteria from Yamahai\u2010shubo samples and their practical use in sake brewing make it possible to produce Yamahai\u2010shikomi sake under artificial control in the recent process.The steady supply of Yamahai\u2010shubo samples contain various kinds of identified and unidentified bacteria, and their bacterial diversities vary depending on the sources from which they are derived. It is well known that the quality of Yamahai\u2010shikomi sake depends on the diversities of those bacteria. Therefore, it is necessary to grow advantageous bacteria to prepare appropriate Yamahai\u2010shubo samples and to achieve the desired sake quality.Pseudomonas sp. 61\u201002, cocci\u2010LAB Le. mesenteroides LM\u20101, bacilli\u2010LAB Lp. plantarum LP\u20102, and bacilli\u2010LAB Ll. sakei LS\u20104) from the Yamahai\u2010shubo sample  that produces lactic acid more slowly. We clarified the turnover of those bacteria, along with the amount of nitrite, through this study.We previously isolated four bacterial strains , Yamahai\u2010shubo was diluted nearly 20 times in Yamahai\u2010shikomi sake. Thus, the higher acidity of Yamahai\u2010shubo was supposed to be unable to directly keep the acidity of Yamahai\u2010shikomi sake. On the other hand, the majority of the acids in Yamahai\u2010shikomi sake were most likely produced by yeasts coexisting during Yamahai\u2010shikomi sake brewing under higher acidic environment, resulting in increased acidity. This was consistent with the fact that the viable cell numbers of most bacteria in Yamahai\u2010shubo became extremely decreased after 25\u2009days  and Sokujo\u2010shubo affect sake qualities; e.g., yeasts grown in Yamahai\u2010shubo showed more enhanced tolerance to ethanol than those in Sokujo\u2010shubo  induction capacity .The significance of LAB as well as yeasts has been recognized in winemaking. In particular, the contribution of 5Yamahai\u2010shubo produced Yamahai\u2010shikomi sake with more favorable aromas and tastes than that of another bacilli\u2010LAB strain, LS\u20104. Furthermore, it is likely that strain LP\u20102 in Yamahai\u2010shubo played a significant role in improving sake quality by reducing diacetyl more than strain LS\u20104 in Yamahai\u2010shikomi sake brewing.We found that the addition of the nitrate\u2010reducing bacterium strain 61\u201002, the cocci\u2010LAB strain LM\u20101, and the bacilli\u2010LAB strain LP\u20102 to There is no funding to report for this submission.The authors declare no conflict of interest associated with this manuscript."}
{"text": "Bifidobacterium catenulatum subspecies kashiwanohense (B. kashiwanohense) was originally isolated from infant feces. However, only a few strains have been described, and the characteristics of this subspecies have been poorly investigated. Here, we characterized genotypes and phenotypes of 23 B. kashiwanohense-associated strains, including 12 newly sequenced isolates. Genome-based analysis clarified the phylogenetic relationship between these strains, revealing that only 13 strains are genuine B. kashiwanohense. We defined specific marker sequences and investigated the worldwide prevalence of B. kashiwanohense based on metagenome data. This revealed that not only infants but also adults and weaning children harbor this subspecies in the gut. Most B. kashiwanohense strains utilize long-chain xylans and possess genes for extracellular xylanase (GH10), arabinofuranosidase and xylosidase (GH43), and ABC transporters that contribute to the utilization of xylan-derived oligosaccharides. We also confirmed that B. kashiwanohense strains utilize short- and long-chain human milk oligosaccharides and possess genes for fucosidase (GH95 and GH29) and specific ABC transporter substrate-binding proteins that contribute to the utilization of a wide range of human milk oligosaccharides. Collectively, we found that B. kashiwanohense strains utilize both plant- and milk-derived carbohydrates and identified key genetic factors that allow them to assimilate various carbohydrates.Bifidobacteria are prominent members of the human gut microbiota throughout life. The ability to utilize milk- and plant-derived carbohydrates is important for bifidobacterial colonization of the infant and adult gut. The  Recent studies have demonstrated that their ability to utilize microbiota-accessible carbohydrates is a key factor enabling their stable persistence in the human gut.6\u20138Bifidobacteria are commonly detected as prominent members of the human gut throughout life. Bifidobacterial colonization has been associated with a reduced risk of obesity, 9\u201312 Microbiota analysis of infants and adults revealed that the bifidobacterial species colonizing the human gut change with age.14 Specifically, Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium longum subspecies infantis  are generally predominant in infants, whereas Bifidobacterium adolescentis, and B. pseudocatenulatum are prevalent in adults. B. longum subspecies longum  is distributed in both infant and adults.15To date, hundreds of bifidobacterial strains have been isolated, and the characteristics of major bifidobacterial species have been described. Most of these studies involved comparative and functional genome analyses.17 Molecular mechanisms of utilization of these plant-derived carbohydrates have only just started to be elucidated. Based on previous studies, enzymes belonging to glycoside hydrolase (GH) family 43 (GH43) and others  are involved in xylan-related glycan utilization,17 whereas enzymes belonging to GH13 are associated with starch utilization.6 Furthermore, ATP-binding cassette (ABC) transporters, usually encoded in the same operon as these GHs, also play important roles in the uptake of these oligosaccharides.17Recent studies demonstrated that adult-prevalent bifidobacterial species can utilize plant-derived carbohydrates, including xylan-based oligosaccharides , and starch-related carbohydrates .B. pseudocatenulatum possesses more abundant GH43 genes and ABC transporters for xylan-based oligosaccharides utilization than other adult-associated bifidobacteria,17 suggesting that this species assimilates a broader range of xylan-based oligosaccharides than other bifidobacterial species. On the other hand, B. adolescentis possesses numerous GH13 genes18 and accumulates in resistant starch granules in the human gut, suggesting starch preference of this species.19Homologs of the glycosidase and transporter genes are shared among adult-associated bifidobacteria. However, each adult-associated bifidobacterial species exhibits different glycan preferences. 20 HMOs are non-digestible oligosaccharides present in breast milk that include various glycan structures. Fucosyllactose  is the main component of HMO, and genetic factors responsible for its utilization  have been intensively investigated and characterized.21By contrast, the infant-associated species do not utilize plant-derived carbohydrates as well as the adult-prevalent species. However, they readily utilize human milk oligosaccharides (HMO).B. infantis utilizes HMO most efficiently compared with other Bifidobacterium species. The subspecies imports various HMOs via a number of ABC transporters, where an intracellular glycosidase subsequently hydrolyzes the imported oligosaccharides into monosaccharides.23 Consequently, B. infantis assimilates the broadest range of HMO components compared with other bifidobacteria; however, the gene maintenance costs involved with equipping various transporters may be high.24B. bifidum is the second most efficient HMO metabolizer among bifidobacteria. The species hydrolyzes HMOs using extracellular glycosidases, and the resultant mono- and di-saccharides are then taken up by its limited number of transporters.25 The species breaks down most HMOs with lower protein-equipping cost than B. infantis; however, the resultant extracellular saccharides can be utilized by other gut microbes, and B. bifidum does not assimilate HMO efficiently in competition. In contrast, B. breve cannot utilize long-chain HMOs , and only a subset of B. breve strains can utilize FL.26 The FL-utilizing B. breve strains import FL via the well-characterized ABC transporter,20 and the imported FL is subsequently hydrolyzed to lactose and fucose by an intracellular GH95 fucosidase. The utilization system is efficient since B. breve strains can utilize the main HMOs  relying on a limited number of transporters and a glycosidase.Inter- and intra-species variation in the utilization of various HMO components by bifidobacterial species and the underlying molecular mechanisms have been reported. B. kashiwanohense, which we are going to characterize in this study, was isolated from Japanese infant feces in 2011.27 The species was later reclassified as a subspecies of B. catenulatum based on digital DNA \u2013 DNA hybridization analysis.28 This subspecies has been rarely detected in humans, and only a few strains have been isolated from infant feces. Some studies have reported that B. kashiwanohense strains can utilize FL.29 However, the utilization of other carbohydrates, and the global and age-dependent prevalence of this subspecies, are not well understood.B. kashiwanohense. We performed comparative genome analyses of 23 B. kashiwanohense-associated strains, including 12 newly sequenced isolates. Based on the phylogenetic analysis, the strains were classified into four groups, and only 13 strains were sensu stricto B. kashiwanohense. Metagenome data-based investigation of worldwide prevalence revealed that while B. kashiwanohense is not often detected in infants and adults, the subspecies is predominant in some weaning children. Most B. kashiwanohense strains can utilize long-chain xylans and possess an extracellular xylanase, as well as ABC transporters and intercellular GHs known to contribute to the utilization of xylan-based oligosaccharides. We also confirmed that B. kashiwanohense can utilize short- and long-chain HMOs and investigated the underlying molecular mechanisms.In the current study, we characterized the genotypes and phenotypes of B. kashiwanohense-associated strains by analyzing their genome sequences ,27 7 strains of Bifidobacterium catenulatum subspecies catenulatum , and 3 strains that have previously been identified as B. kashiwanohense.31We assessed the phylogenetic relationship among 23 equences . Of thesB. kashiwanohense type strain JCM 15,439T and 11 newly sequenced strains. Cluster II included B. catenulatum strains . Strain PV20\u20132, reported as B. kashiwanohense by Vazquez-Gutierrez et al.,31 was not included in cluster I nor II. The average nucleotide identity (ANI) values of PV20\u20132 against the strains in cluster I (B. kashiwanohense) and II (B. catenulatum) were approximately 95% , suggesting that PV20\u20132 should be reclassified as a new subspecies of B. catenulatum (designated as cluster III). The strains N5G01 and N4G05, reported as B. kashiwanohense by Freitas and Hill,30 and 3 putative B. catenulatum strains isolated from Bangladeshi children formed 1 cluster  of 776 core genes of the 23 strains, divided the strains into four major clusters . ClusterB. catenulatum and B. pseudocatenulatum)  of 1989, which is higher than those of the closely related bifidobacterial species  . The pannulatum) . Compariectively .B. kashiwanohense using metagenome data deposited in public databases . We used two complete genome sequences to define the B. kashiwanohense-specific sequence (K-mer) using the bioinformatic tools Kraken238 and Bracken39 . We attempted to detect B. kashiwanohense-specific sequences in 1,193 sets of metagenomic data (data for 289 infants from 6 countries and 904 adults from 14 countries) deposited in the NCBI database  and 11 subjects among 289 infants (3.81%) harbored the bacteria in the gut. We did not observe any differences in the prevalence of this subspecies in different continents. Additionally, we examined the B. kashiwanohense distribution in two metagenome-assembled genomes (MAG) database41. Compared with other Bifidobacteria, fewer B. kashiwanohense MAGs were detected, which supported our result from metagenomic data showing the limited distribution of this subspecies (Supplementary data 4).Next, we examined the worldwide distribution of 14 In the present study, we detected B. kashiwanohense in 3 out of 12 infants during their first 2\u2009years of life  in the subspecies with those of other human-associated bifidobacteria. We visualized the GH gene profile of each strain using a heatmap  and adult-associated species  are separated along the PC1 axis, and B. longum was plotted at the middle of infant- and adult-association species , in comparison with that of strains of bifidobacterial species commonly found in the human gut , all B. kashiwanohense strains, and some B. pseudocatenulatum strains utilize the major HMOs  (B. adolescentis and some B. pseudocatenulatum strains) are unable to utilize these oligosaccharides . Furthermore, we confirmed that most infant-associated species (B. infantis and B. bifidum) did not efficiently utilize plant-derived carbohydrates , whereas B. kashiwanohense and adult-associated bifidobacteria utilized these carbohydrates (green box in We next investigated the growth of uman gut . We confnd 3-FL) , while min silico genome analysis . These transporters and GHs work together to utilize xylan-based oligosaccharides of different sizes and with different side residue modi\ufb01cations. In the current study, we found that all B. kashiwanohense strains possess homologs of the B. pseudocatenulatum XOS utilization genes involved in XOS uptake and hydrolysis, most of which are encoded in XOS utilization clusters 1 and 2 . The results are shown in Fig. S3. We searched for a gene whose presence corresponded with the LNFP and LNDFH utilization phenotype. No GH genes were associated with the LNFP and LNDFH utilization phenotypes , and no SBP genes were associated with the LNFP utilization phenotype . However, the presence of one SBP gene (ID1343) corresponded with the LNDFH-utilization phenotype .Previous studies have demonstrated the importance of GHs and the ABC transporter substrate-binding protein (SBP) in HMO utilization.22 According to previous studies, there are several SBP subtypes for FL (type I \u2013 IV).43 Of note, SBP associated with LNDFH utilization represented a unique subtype (type III) that was only present in B. kashiwanohense strains . In addition, we observed that the LNDFH-non-utilizing strain YIT 13,055 harbors a gene for a FL-SBP that belongs to another subtype (type I) (B. kashiwanohense strains correspond to those in their FL-SBP subtype (B. kashiwanohense (type III) is involved not only in FL but also long-chain HMO utilization (B. kashiwanohense specific FL-SBP (type III) mediates the uptake of long chain HMO, based on the phylogenetic analysis of bifidobacterial SBP.43 Our gene-trait matching approach additionally showed this gene is well conserved among B. kashiwanohense strains.ID1343 is a homolog of SBP that is essential for FL utilization. subtype . The reslization . This isB. kashiwanohense. We found that this subspecies can utilize not only short- and long-chain HMOs but also dietary fiber arabinoxylan and its derived oligosaccharides. By using the gene \u2013 trait matching approach, we found the unique metabolic pathways involved in and the key genetic factors for utilizing this wide range of substrates , we assumed that B. kashiwanohense may have a competitive advantage in the complex environment of the human gut. However, our metagenome analysis of B. kashiwanohense distribution suggested that the prevalence of this subspecies is limited in both infants and adults. This suggests that carbohydrate utilization constitutes just one aspect of the competitive advantage in the complex microbial environment, and other factors exist that underpin wide bacterial distribution and predominance in the human gut.Since B. kashiwanohense strains are detectable and predominant in the gut before and after weaning, indicating that B. kashiwanohense may have evolved to adapt to the gut environment during the weaning period. This concept is in good agreement with a recent study,49 showing that a clade of B. longum possessing both HMO- and dietary-fiber-utilizing-genes expanded during the weaning period. It will be interesting to evaluate the association between bifidobacterial carbohydrate utilization expansion during the weaning by using in vitro competitive experiments and/or assessed using future infant cohorts, to support the concept.Our analysis revealed that B. kashiwanohense strains can utilize not only FL but also long-chain HMOs, including LNFP and LNDFH, using the gene \u2013 trait matching analysis. These findings are in good agreement with a recent publication by Ojima et al.43 who analyzed the differences in substrate specificity for FL among SBPs. The authors reported that the B. kashiwanohense-specific SBP contributes to the transportation of FL, as well as LNDFH and LNFP I/II, but not LNFP III.43 In the current study, we found little remaining LNFP in the culture supernatant of some B. kashiwanohense strains with specific FL-SBP (type III)  , Fig. S2B. kashiwanohense-associated strains (including 12 new isolates), worldwide (metagenomics) prevalence analysis, and their carbohydrate utilization to characterize the subspecies. The genotype and phenotype analyses revealed that the subspecies can utilize plant-derived carbohydrates and short- and long-chain HMOs. Our detailed characterization of B. kashiwanohense suggests that each bifidobacterial species employs different and unique strategies to colonize the human gut and may contribute to our understanding of the reason for the life-long predominance of bifidobacteria (and the change in species with age).In this study, we conducted comparative genome analysis for 23 2, 5% CO2, and 7% H2, using mGAM broth  containing 0.5 w/vol% glucose and 0.5 w/vol% lactose. Evaluation of Bifidobacterium carbohydrate utilization profiles was performed at 37\u00b0C in modified ILS-PIPES  supplemented with the targeted carbohydrates (0.5 w/vol%). Growth curves were evaluated by measuring the OD600 every 30\u2009min using a microplate reader PowerWave 340  in an anaerobic chamber.The strains used in the current study were obtained from the Japan Collection of Microorganisms  and Yakult Culture Collection . The strains were routinely cultured at 37\u00b0C in an anaerobic chamber  with 88% N7 Bacteria were grown in a medium containing HMO mixtures for 72\u2009h. According to our previous report,7 the oligosaccharides remaining in the culture supernatant at the end of the experiment were labeled with p-aminobenzoic acid ethyl ester as an ultraviolet light-absorbing compound and quantified using HPLC. The labeled HMO components were separated using a Shimadzu Prominence HPLC system  with an L-column 2 ODS . Modified HMOs were eluted with a 13:87 (vol:vol) mixture of acetonitrile and 100\u2009mM ammonium acetate (pH 4.5) at 40\u00b0C and were detected using an SPD-20\u2009A ultraviolet detector (Shimadzu) at 304\u2009nm. The following oligosaccharides were used as controls: 2\u2032-FL (Advanced Protein Technologies), 3-FL , LNFP I , LNDFH I , LNDFH II , LNT , lacto-N-neotetraose , DFL , LNFP II , LNFP III , and N-acetyl glucosamine .The HMO mixture was prepared as described previously.8 A DNA library was prepared using the TrueSeq DNA PCR-Free Library Preparation Kit  and sequenced on MiSeq (Illumina) using the MiSeq Reagent kit V2 (250 bp\u2009\u00d7\u20092) (Illumina). The output paired-end reads were assembled into contigs by Unicycler (v0.4.8)50 or A5-miseq (v20160825),51 which were then aligned to the complete genome of B. kashiwanohense JCM 15,439T (accession ID: GCA_001042615.1) using Mauve (2015_02_13).53As described previously, DNA was extracted from bifidobacterial strains using a bead \u2013 phenol method.54 For genomic feature comparison among bifidobacterial species (listed in Supplementary data 1), the CDSs number was calculated using Prokka (v1.14.6).55 The number of pan-genome and core-genome genes was evaluated using Roary (v3.13.0)42 using default settings. A phylogenetic tree of B. kashiwanohense-associated strains  was visualized using clinker57 with default settings.The ANIb values between strains  were calculated using pyani (v0.2.9). strains  was cons58 and Bracken (v2.6.0)39 were used to investigate the global distribution of B. kashiwanohense from shotgun metagenomic data . B. kashiwanohense-specific K-mers were defined using B. kashiwanohense JCM 15,439 and APCKJ1. To avoid false positives, the confidence score and the relative abundance cutoff value were carefully adjusted; the confidence score was set to 0.9 and the relative abundance cutoff value to 0.49%, so that the false-positive and false-negative rate for the evaluation dataset14 were 4.9% and 8.2%, respectively. High quality Bifidobacterial MAGs were retrieved from previous reports.41 The MAGs were filtered by contamination (\u22645%), completeness (\u226590%), number of contigs (\u2264500), and contig N50 (\u226510kb). The B. kashiwanohense MAGs were defined by ANIb value (\u226597%) to the B. kashiwanohense type strain  genome.Kraken2 (v2.0.9 beta)n\u2009=\u2009350, 59 using dbCAN2.61 The CDSs were considered CAZy genes only if they were annotated using HMMER, DIAMOND, and Hotpep pipeline with default parameters. To normalize the count data of CAZy genes, the \u201cscale\u201d function in R (v4.0.5) was used. To visualize the GH profiles in a heat map format (55, BlastKoala,63 or dbCAN2.Genes in the pan-genome of all bifidobacterial strains n\u2009=\u2009350,  were annp format , the \u201cheClick here for additional data file.Click here for additional data file."}