{"text": "Large-scale quantitative analysis of transcriptional co-expression has been used to dissect regulatory networks and to predict the functions of new genes discovered by genome sequencing in model organisms such as yeast. Although the idea that tissue-specific expression is indicative of gene function in mammals is widely accepted, it has not been objectively tested nor compared with the related but distinct strategy of correlating gene co-expression as a means to predict gene function.PWP1 is widely expressed across different tissues but is co-expressed with many RNA-processing genes; we show that the uncharacterized yeast homolog of PWP1 is required for rRNA biogenesis.We generated microarray expression data for nearly 40,000 known and predicted mRNAs in 55 mouse tissues, using custom-built oligonucleotide arrays. We show that quantitative transcriptional co-expression is a powerful predictor of gene function. Hundreds of functional categories, as defined by Gene Ontology 'Biological Processes', are associated with characteristic expression patterns across all tissues, including categories that bear no overt relationship to the tissue of origin. In contrast, simple tissue-specific restriction of expression is a poor predictor of which genes are in which functional categories. As an example, the highly conserved mouse gene We conclude that 'functional genomics' strategies based on quantitative transcriptional co-expression will be as fruitful in mammals as they have been in simpler organisms, and that transcriptional control of mammalian physiology is more modular than is generally appreciated. Our data and analyses provide a public resource for mammalian functional genomics. Caenorhabditis elegans has established that coordinate transcriptional regulation of functionally related genes occurs on a broader scale than was previously recognized, encompassing at least half of all cellular processes in yeast Click here for additional data file175 lists of genes that are expressed in individual tissues, highest in individual tissues, or specific to individual tissuesClick here for additional data file"}
{"text": "Fundulus heteroclitus was examined. Only a small subset (31%) of tissue-specific differences was consistent in all three populations, indicating that many tissue-specific differences in gene expression are unique to one population and thus are unlikely to contribute to fundamental differences between tissue types.The expression of a selected suite of 192 metabolic genes in brain, heart and liver in three populations of the teleost fish  Fundulus heteroclitus using a highly replicated experimental design.Variation in gene expression is extensive among tissues, individuals, strains, populations and species. The interactions among these sources of variation are relevant for physiological studies such as disease or toxic stress; for example, it is common for pathologies such as cancer, heart failure and metabolic disease to be associated with changes in tissue-specific gene expression or changes in metabolic gene expression. But how conserved these differences are among outbred individuals and among populations has not been well documented. To address this we examined the expression of a selected suite of 192 metabolic genes in brain, heart and liver in three populations of the teleost fish Half of the genes (48%) were differentially expressed among individuals within a population-tissue group and 76% were differentially expressed among tissues. Differences among tissues reflected well established tissue-specific metabolic requirements, suggesting that these measures of gene expression accurately reflect changes in proteins and their phenotypic effects. Remarkably, only a small subset (31%) of tissue-specific differences was consistent in all three populations.These data indicate that many tissue-specific differences in gene expression are unique to one population and thus are unlikely to contribute to fundamental differences between tissue types. We suggest that those subsets of treatment-specific gene expression patterns that are conserved between taxa are most likely to be functionally related to the physiological state in question. The regulation of gene expression varies extensively among tissues, individuals, strains, populations and species -6 and vaAlthough tissue-specific gene expression patterns are often used as a method to identify functionally relevant genes, how conserved these differences are among outbred individuals and among populations has not been well documented. It is possible that many of these changes represent polymorphism among individuals or populations and are not specifically associated with disease. To address this we used a well established system (tissue-specific gene expression) and genes with well defined function and tissue-specific distributions (metabolic genes).Fundulus heteroclitus. A cDNA microarray was used to measure levels of expression in normal healthy male fish for 192 genes involved in central metabolic pathways. We used this compact array in order to impose a high degree of technical and biological replication . Also, this array was used because metabolic genes are essential, are known to have tissue-specific expression, especially in fish, and are often misused as controls with little characterization of variation in expression among individuals or tissues. Analysis of variance (ANOVA) was used as a statistical test to determine which genes were differentially expressed among tissues and populations. Tissue-specific patterns of gene expression were compared among populations. As expected, we detected extensive variation in gene expression among tissues. Unexpectedly, only a fraction (31%) of tissue-specific differences was conserved between all populations.Given the high variance in gene expression among individuals and populations, our goal was to examine the conservation of tissue-specific gene expression among populations of the same species. Specifically, we assessed the among-population variance of tissue-specific patterns of gene expression  in the teleost fish p < 0.05) among individuals within populations and tissues  differentially expressed among brains, hearts and livers . Selecting the \u03b1 level at which differences between treatments are considered significant is problematic because of the large number of comparisons performed. As such, we present a volcano plot to illustrate the range of expression differences between tissues and associated p-values , the proportion of significant genes is 67% (129 genes), 50% (96) and 39% (75), respectively. Significant differences in expression ranged from less than 1.2-fold to nearly 16-fold , hepatocyte nuclear factor 4-alpha (a transcription factor) was more highly expressed in liver than in other tissues (p < 0.001), and two genes involved in glycerolipid metabolism -lipoprotein lipase and phopholipase XIII A2 - were more highly expressed in liver than other tissues (p < 0.001 for both genes).Many expected tissue-specific patterns emerged. For example, the brain-specific fatty-acid-binding protein was typically more highly expressed in the brain than in other tissues . However, it should be noted that although the split-plot design is powerful for detecting differences between split-plot factors (tissues), it is considered to have low power for detecting differences between blocks (populations)  \u03b1[\u00d7 SEMSR = Qkv] \u03b1[is the studentized range [k = number of groups in the comparison , v = degrees of freedom of MStissue-by-individual within population, and SE is the standard error among tissue-by-individual samples within populations. The T-method following ANOVA was used to identify genes differentially expressed among tissues in each population. These data were then used to contrast tissue-specific and population-specific expression patterns. Robustness of ANOVA data was tested using a permutation test; means for the 27 biological samples were randomly permuted 1,000 times between population and tissue and test statistics were recalculated for differences among populations, tissues and tissue-by-population interaction. Agreement between ANOVA and permutation test results would indicate the robustness of the ANOVA model. Finally, in order to graphically illustrate expression similarity among tissues, expression distance between samples was calculated as the sum of differences of log2 expression values over all genes, and neighbor-joining trees of global similarity of expression patterns among tissues  were constructed [where the critical value Qed range , k = numstructed  for eachp-values associated with statistical tests for differences in expression between populations, tissues, tissue-by-population interaction, and among individuals within populations. Also listed are mean expression for each sample, and columns comparing differences in expression between tissues within each population. Final columns tabulate whether a tissue difference was detected for each comparison, whether this difference was consistent between populations, and whether significant interaction was detected for that gene.The following additional data are available with the online version of this paper. Additional data file The results from statistical analyses for all genesClick here for additional data file"}
{"text": "This indicates that sustained post hoc analyses in regards to efficacy of disruption for every single study group member may be required.The Cre/loxP-system has become the system of choice for the generation of conditional so-called knockout mouse strains, i.e. the tissue-specific disruption of expression of a certain target gene. We here report the loss of expression of Cre recombinase in a transgenic mouse strain with increasing number of generations. This eventually led to the complete abrogation of gene expression of the inserted Cre cDNA while still being detectable at the genomic level. Conversely, loss of Cre expression caused an incomplete or even complete lack of disruption for the protein under investigation. As Cre expression in the tissue of interest in most cases cannot be addressed  In recent years, the Cre/loxP-system has become the system of choice for the generation of conditional so-called knockout mouse strains, i.e. the tissue-specific disruption of expression of a certain target gene Any deliberately chosen DNA sequence can be flanked with loxP-elements. LoxP-sites are inserted in the intronic spacers of exons which encode vital structures of the protein of interest. Cre mediated recombination subsequently leads to the deletion of the sequence between two loxP-elements and a truncated gene product if any at all.Cre recombinase can be expressed in a given tissue or cell type under the control of a defined promoter fragment. Theoretically, expression occurs exclusively in the cell type, where the promoter usually is active The mechanisms causing these undesired effects are widely unknown. In the first place, the activity of many promoters in most cases is not fully understood. Hence, there might be developmental stages or other environmental factors affecting the activity of a promoter that have not yet been characterized. When Cre expression occurs within an early embryonic stage, all cells derived from this lineage will carry the deleted gene.Secondly, Cre transgenic mouse strains are mostly generated by random integration of a DNA construct comprising promoter and Cre cDNA into the host DNA. This may lead to unspecified genetic interactions, i.e. transactivations, at the site of integration which might be concurrently causative for unspecific Cre expression in many cell types.position-effect variegation (PEV), the phenomenon of mosaic expression has originally been described as the genetic cause of heterogeneously coloured eye-discs in mutants of Drosophila melanogasterThirdly, a number of articles on the effects of integration site on the expression pattern of a given transgene have been published. Termed Silencing is assumed to be due to site specific effects such as condensation of chromatin These previous publications altogether suggest that various processes may cause impaired expression of transgenes. We here demonstrated that this might, at least in some cases, precludes reliable prediction of tissue-specific gene disruption by tail-biopsy genotyping.Alb) have been generated Alb promoter driven expression of Cre recombinase, it has been reported, that the maximum level of recombination in hepatocytes occurs at two weeks of age bona fide knock-outs. Subsequently and to generate animals for several follow-up studies we observed inconsistencies between the phenotype initially observed Alb Cre construct.By means of site directed recombination, mouse models with a liver specific inactivation of various proteins employing Cre expression under the control of the Albumin promoter  responsible for these effects. These findings highlight the importance of sustained and comprehensive monitoring of the presence of disruption on a transcriptional or translational level for tissue-specific knock-out models.Animals were generated Isolation of genomic DNA and RNA was performed as previously described Protein samples were prepared as described"}
{"text": "A genome-wide analysis of promoters was carried out in the context of gene expression patterns in tissue surveys using human microarray and EST-based expression data. The study revealed that most genes show statistically significant tissue-dependent variations of expression level and identified components of promoters that distinguish tissue-specific from ubiquitous genes. The regulatory mechanisms underlying tissue specificity are a crucial part of the development and maintenance of multicellular organisms. A genome-wide analysis of promoters in the context of gene-expression patterns in tissue surveys provides a means of identifying the general principles for these mechanisms.We introduce a definition of tissue specificity based on Shannon entropy to rank human genes according to their overall tissue specificity and by their specificity to particular tissues. We apply our definition to microarray-based and expressed sequence tag (EST)-based expression data for human genes and use similar data for mouse genes to validate our results. We show that most genes show statistically significant tissue-dependent variations in expression level. We find that the most tissue-specific genes typically have a TATA box, no CpG island, and often code for extracellular proteins. As expected, CpG islands are found in most of the least tissue-specific genes, which often code for proteins located in the nucleus or mitochondrion. The class of genes with no CpG island or TATA box are the most common mid-specificity genes and commonly code for proteins located in a membrane. Sp1 was found to be a weak indicator of less-specific expression. YY1 binding sites, either as initiators or as downstream sites, were strongly associated with the least-specific genes.We have begun to understand the components of promoters that distinguish tissue-specific from ubiquitous genes, to identify associations that can predict the broad class of gene expression from sequence data alone. The development of an adult from the single cell of a fertilized egg requires a complex orchestration of genes to be expressed at the right time, place, and level. Basic cellular functions require the expression of certain genes in all cells and tissues  while specialized functions require restricted expression of other genes in a single or small number of cells and tissues . Both types of genes may be needed for embryonic development as well as for the function of adult cells and tissues. While the details of regulatory mechanisms will vary for individual genes, general features of promoters (and here we will restrict our focus to RNA polymerase II (Pol II) promoters) are likely to facilitate whether a gene will be expressed widely or in a restricted manner. For example, based on the limited number of genes available at the time of the analysis, promoters with CpG islands have been associated with housekeeping genes ,2. It isFurthermore, it would also be informative to examine the relationship of CpG islands to the base composition of promoters, and the distribution of motifs thought to be bound by factors closely involved with (or part of) the basal transcription complex. The distribution of major components of the core promoter, the TATA box (TBP/TFIID binding site) and initiator element  , and proInvestigators have searched for combinations of transcription-factor-binding sites that confer tissue-specific expression on particular cell types such as muscle  or liverMeasures have been developed for overall tissue specificity ,27,28 thH) measures the degree of overall tissue specificity of a gene, but does not indicate whether it is specific to a particular tissue. To quantify categorical tissue specificity, we introduce a new statistic (Q) that incorporates overall tissue specificity and relative expression level. We demonstrate that H and Q are effective metrics for ranking and selecting genes according to tissue specificity and then proceed to use them to investigate promoter features  that may be used distinguish tissue-specific genes from nonspecific genes. The association of promoter features with a quantitative assessment of tissue specificity using H and Q is an important step towards developing models for promoter function.A metric for characterizing the breadth and uniformity of the expression pattern of a gene that meets our criteria is the Shannon information theoretic measure entropy. Although entropy has been used previously to identify potential drug targets ,31 by coWe begin by defining the measurement of two kinds of tissue specificity, 'overall' tissue specificity and 'categorical' tissue specificity.  Overall tissue specificity ranks a gene according to the degree to which its expression pattern differs from ubiquitous uniform expression. We use the term 'ubiquitous' expression to mean expression at any level above background in all tissues. Categorical tissue specificity places special emphasis on a particular tissue of interest and ranks a gene according to the degree to which its expression pattern is skewed toward expression in only that particular tissue. In both cases, a gene's specificity to a tissue, cell type or other condition is decreased as the gene is more uniformly expressed in a wider variety of conditions. In addition, the categorical tissue specificity should decrease as the tissue of interest becomes a smaller component of the overall expression pattern of the gene.Given a static multi-tissue expression profile for a gene, there are at least two dimensions along which we can assess the profile to measure tissue specificity. The first dimension is the number of tissues that express the gene above some background level. It can be argued that this dimension measures tissue restriction, that is, a gene shows restricted expression if it is expressed in only a subset of tissues. The second dimension is the uniformity of expression over all tissues that express the gene. A gene that shows significant non-uniform expression is exhibiting tissue-dependent regulation, in addition to any tissue restriction that may be occurring. We assume that a gene that exhibits no tissue-specific regulation will be expressed at the same level in every tissue. We do not assert that such genes are not regulated, only that they are regulated in a way that is not sensitive to tissue.The term 'most tissue-specific' will refer to the range of genes that are closer to the extreme of expression in a single tissue than to the extreme of ubiquitous uniform expression. We will refer to genes close to the uniform and ubiquitous end as either 'least tissue-specific' or 'nonspecific' though the latter term may not be strictly true. The range in the middle will be termed 'semi-tissue specific'. The term 'housekeeping' has been applied to genes that are widely expressed and may show little tissue-specific changes in expression level. We can use such genes as an example of genes that will tend to be ubiquitously and uniformly expressed and thus ought to be nonspecific on average. We will use the phrase 'gene sharing' to refer to the situation that occurs when a gene is tissue-specific, and is expressed in a small number of tissues that can be said to share the gene.N tissues, we defined the relative expression of a gene g in a tissue t as pt|g = wg,t/\u2211t \u2264 N1 \u2264 wg,t where wg,t is the expression level of the gene in the tissue. The entropy [Hg = \u2211t \u2264 N 1 \u2264 - pt|g log2(pt|g). Hg has units of bits and ranges from zero for genes expressed in a single tissue to log2(N) for genes expressed uniformly in all tissues considered. The maximum value of Hg depends on the number of tissues considered so we will report this number when appropriate. Because we use relative expression the entropy of a gene is not sensitive to the absolute expression levels. To measure categorical tissue specificity we define Qg|t = Hg - log2(pt|g). The quantity -log2(pt|g) also has units of bits and has a minimum of zero that occurs when a gene is expressed in a single tissue and grows unboundedly as the relative expression level drops to zero. Thus Qg|t is near its minimum of zero bits when a gene is relatively highly expressed in a small number of tissues including the tissue of interest, and becomes higher as either the number of tissues expressing the gene becomes higher, or as the relative contribution of the tissue to the gene's overall pattern becomes smaller. By itself, the term -log2(pt|g) is equivalent to pt|g. Adding the entropy term serves to favor genes that are not expressed highly in the tissue of interest, but are expressed only in a small number of other tissues. As described earlier, we want to consider such genes as categorically tissue-specific since their expression pattern is very restricted. Figure Hg and Qg|t. The top five genes specific to mouse amygdala, lymph node, and liver as assessed by this data are listed in Table Hg and Qg|t values for all genes in all tissues in the GNF-GEA datasets are available in Additional data files 1 and 2.We used two gene-expression datasets to evaluate our methods; Affymetrix-based data from the GNF Gene Expression Atlas (GNF-GEA)  and the  entropy  of a genHg as shown in Figure Hg \u2265 4 bits, which implies expression in at least 16 tissues and typically corresponds to wider, but uneven, expression. Only 87 (2%) of genes had Hg \u2264 1.5 bits, which corresponds to expression in as few as three tissues. Both microarray- and EST-based data yielded similar overall curves. The EST curve peaked at a lower Hg than the microarray curve. This was due to the small numbers of EST sequences in some of the tissues we considered; EST counts for tissues ranged from 1,933 in the adrenal gland to 331,582 in the central nervous system (CNS). Genes that are ubiquitously expressed may not have ESTs from several of the lightly sequenced tissues, making them appear to have more restricted expression, and hence a lower entropy, than they really do. Figure Hg derived from microarray and EST data. Visual inspection of the plot reveals that while there are no strong contradictions between the two methods, quantitative agreement is limited. Detailed analysis shows that the standard deviation of the difference of paired Hg values is 0.61 bits. Under the null hypothesis that the estimates from the two data sources are totally uncorrelated the average standard deviation was found to be 0.91 bits. We can reject the null hypothesis (P < 10-5 as estimated by Monte Carlo methods). The distribution of Qg|t for selected tissues is shown in Figure To compare results from microarray and EST-based expression data we mapped the tissues from the GNF-GEA study to the hierarchical controlled vocabulary of anatomical terms used by DoTS and chose a set of 45 tissue terms grouped into 32 groups shown in Table Hg and Qg|t statistics can be estimated from a dataset to determine the smallest meaningful difference in scores and to guide interpretation of gene rankings. To assess the standard deviations of and Hg and Qg|t, we sampled from the replicates in the GNF-GEA microarray data to compute a large number of Hg values for each probe set. We found that the standard deviation for Hg was less than 0.2 bits for 97% of genes. Qg|t was not estimated as well; the standard deviation was 1 bit or less for 95% of gene and tissue pairs. This was probably due to the high standard deviation of the -log2(pt|g) term for low expressing gene-tissue pairs. We found much more variation when we measure reproducibility by considering genes that have two or more probe sets (and therefore two or more different transcripts) in the microarray data. In this case, the standard deviation of Hg estimates was as high as 1 bit for 97% of the genes but less than 0.3 bits for about 70-80% of the genes. We chose a minimum of 1 bit for Hg bins and 2 bits for Q bins in the rest of the analyses that require binning. This bin size ensured that most of the genes are in the proper bin and thus the bin could be reliably used to determine associations with the tissue specificity of a class of genes.It is important to determine how well the Hg and Qg|t statistics is to determine values for a set of nonspecific genes such as housekeeping genes. A list of 797 human housekeeping genes [Hg = 4.6 \u00b1 0.27 bits in a set of 27 tissues with a maximum H = lg(27) = 4.75 bits; thus they are nonspecific as expected. Interestingly, a small number of these genes did show some degree of tissue specificity yet were ubiquitously expressed. For example, the median expression of NM_021983 the major histocompatibility complex, class II DR beta 4 gene (32035_at) is approximately 200 AU, but it shows much higher expression in a small set of tissues , which lowered its entropy. A more extreme case is NM_001502 glycoprotein 2 (zymogen granule membrane protein 2), which is expressed between 250 and 1,000 AU in all tissues except pancreas, where it is expressed at 34,183 AU. This is a ubiquitously expressed gene that entropy categorizes as specific since it showed such extreme tissue-specific induction. The housekeeping genes had a mean Qg|t = 9.5 \u00b1 0.14 bits in the same set of tissues. The expected Q value for a uniformly and ubiquitously expressed gene is 2 lg(27) = 9.5 bits. Thus, the Hg and Qg|t statistics successfully captured the expected expression properties of housekeeping genes.A test of the ng genes  was evals = 0.5, which allows for a relatively large amount of variation; up to 1.4-fold tissue-to-tissue variation around the mean expression level in about 63% of tissues and larger changes in the remaining tissues. As a threshold for selecting genes with tissue-dependent expression, we choose Hg = 4.52 bits which has a p-value of 0.005 under the null hypothesis that all genes are uniform. We then find that 5,837/8,703 (67%) of human genes have entropies less than this and so are probably regulated in a tissue-dependent manner. If we use a more stringent definition of uniform expression that allows half as much variation in tissue-to-tissue expression levels (s = 0.25), then the threshold is Hg = 4.62 bits and we find that 7,584/8,703 (87%) of human genes show evidence of tissue-dependent regulation. Similar results are found in mouse using all 42 distinct tissues, where the corresponding thresholds are Hg = 5.24 bits (s = 0.5) and Hg = 5.35 bits (s = 0.25) and the fractions of genes showing tissue-dependent expression are 5,467/7,913 (69%) and 7,482/7,913 (94%) respectively. Thus we conclude that most genes show evidence of tissue-dependent expression levels.Although the housekeeping genes assessed above have relatively high entropies, they do show some small degree of overall tissue specificity. We therefore sought to determine how many genes show evidence of tissue-dependent regulation. Since random biological and experimental variation introduce fluctuations in the expression levels of genes, we made a probability model of the effect of these fluctuations on the observed entropy. The experimental variability was estimated from the GNF-GEA data using all normal tissues. The random tissue-to-tissue biological variability was modeled by assuming that each gene has an average expression level across all tissues and that the log base 2 of the tissue-dependent fold changes from the average level follow a normal distribution with mean equal to zero and some unknown, but 'small', standard deviation(s). We obtain a conservative estimate of the number of genes showing evidence of tissue-dependent regulation by using Qg|t with respect to specific genes is to evaluate the tissues in which they rank highly  for consistency. This was accomplished by clustering tissues with similar tissue-specific genes and inspecting the clusters formed. We used 27 normal human tissues and, separately, 39 tissues from the GNF-GEA data for mouse and selected the genes  that express at least 200 AU in at least one tissue and have Qg|t = 7 in at least one tissue. With these genes, we made a consensus hierarchical clustering of the tissues as shown in Figure Qg|t is correctly identifying tissue-specific genes. Interestingly, testis is an outlier in both trees, indicating that the collection of genes expressed in testis are distinct from any other tissue or organ. Furthermore, Hg and Qg|t can also be used in conjunction with a tissue hierarchy to answer more complex questions about the tissue distribution of genes such as 'what genes are specific to the brain but are widely expressed throughout the brain?' In Table A test of Hg. We considered only predicted CpG islands that span the start of transcription . Therefore, a gene expressed in the adult was 2.8 (= 0.39/0.14) times more likely to be expressed in the early embryo if it contained a start CpG island. Furthermore, the most tissue-specific genes expressed in the adult were four times more likely to have been expressed in the early embryo if their promoter contained a start CpG island. These results strongly suggest that CpG islands are promoter features for both embryonic and the least tissue-specific genes.Another group of genes observed to be associated with CpG islands are those expressed in the early embryo  from theHg \u2264 3.5 bits) and low (4.4 \u2264 Hg \u2264 4.71 bits) tissue-specificity genes. We considered CGI+ and CGI- genes separately, as it is clear the presence of a CpG island will strongly influence the base composition and that the fraction of start CpG islands varies with entropy. In addition, the presence of a start CpG island may indicate a different regulation mechanism related to either tissue specificity or embryonic expression (or both). The number of promoters from DBTSS in these four classes that were used in the analysis were: 310 CGI- and 129 CGI+ high specificity; 342 CGI- and 1,501 CGI+ low specificity. Genes that have only non-start CpG islands represented a minor component and were not included in this analysis. We used the full set of normal tissues in the first GNF-GEA microarray study for human and mouse. Base composition profiles with 10 base-pair (bp) windows are shown in Figure 10 which is equivalent to 0.001. Promoters of CGI+ genes  region for all classes but was most pronounced in the tissue-specific promoters Figure . These sHg calculated from the GNF-GEA data. Second, we searched for core motif consensus sites in promoters of genes selected using Qg|t calculated from EST data.We next examined the distribution of basic core promoter features: the TATA box, the initiator element, and two binding sites for selected ubiquitous transcription factors, Sp1 and YY1, to see if their presence in the proximal promoter was correlated with the tissue specificity of a gene. Two approaches were taken using different datasets and motif-searching methods that gave similar results, providing independent confirmation of results. First, we searched for core motifs using weight matrix hits in promoters of genes selected using We grouped the human genes that expressed at least 200 AU  in the GNF-GEA data by entropy and start CpG island status. The number of genes in each category is shown in Table P \u2248 0 exact binomial). Similar numbers are found in mouse (52%/11% = 4.7) This trend also holds within CGI- genes and CGI+ genes. The most specific CGI- genes were three times more likely to have a TATA box than the least specific CGI- genes . While less common in CGI+ genes, TATA boxes were still almost four times as likely to be found in the most specific CGI+ genes than the least specific CGI+ genes . Thus TATA boxes are clearly associated with tissue-specific genes and provide a second axis (with CpG islands) for distinguishing between the most and least specific genes.We searched for the TATA box in the -45, -10) region where the average observed/expected ratio for the TATA box was 3.1. As shown in Table , -10 regIn contrast, the frequency of occurrences of the initiator element (Pol II binding site) was roughly constant across all tissue-specificity classes for both CGI+ and CGI- genes. We searched for the initiator element in the  region. It occurred in 762 of 1,118 (68%) of CGI- genes and 1,273 of 2,434 (52%) of CGI+ genes. Similarly, it occurred in 149 of 215 (69%) of the most specific genes and 388 of 607 (64%) of CGI+ genes. The observed frequency of TATA+/Inr+ promoters was not significantly different from the expected rate assuming independence of the two individual features (data not shown).Sp1 ,38 is a P = 0.016). Similar numbers are found in the mouse; 38% of the least specific and 26% of the most specific promoters have Sp1 sites. Thus, although Sp1 shows a preference for the least tissue-specific promoters, it is not a strong predictor of the tissue specificity of a gene.Sp1 sites are associated with CpG islands but are an important component of GGI- promoters as well. Considering just the  region, Sp1 sites occurred in 1,105/2,434 (45%) of human CGI+ gene promoters, and 316/1,118 (28%) of CGI- genes at about 2.5 to 3.0 times the expected frequency in both cases. Frequencies in mouse are 927/2075 (45%) of CGI+ promoters and 464/1652 (28%) CGI- promoters. Sp1 sites were also weakly associated with the least specific genes occurring in 1,105/2,679 (41%) of these genes as compared to 94/271 (32%) in the most tissue-specific genes (r) were preferentially located in the  region but with some elevated levels to +80 bp. Start positions of sites in the forward orientation (YY1f) showed a very sharp preference for -3 bp, which probably represents a YY1-like initiator sequence reviewed elsewhere [f initiator sites are rare; only 55/2,679 (2%) were found above background in human low-specificity genes. The rate in mouse, 22/2,832 (0.8%) of low-specificity promoters, is even lower. The YY1r sites are more common and were found above background in 217 (8%) of the 2,679 least specific genes. YY1r sites were more common in CGI+ genes than in CGI- genes  versus 15/607 (2%) P = 3.7 \u00d7 10-9 two-population binomial). The corresponding rates in mouse confirm these observations; 178/2,832 (6%) for all low-specificity genes and 152/1,779 (9%) in CGI+ and 26/1,053 (2%) of CGI- low-specificity promoters. These YY1-like sites therefore constitute a feature strongly associated with the least specific genes and may partially explain the observed G > C ratio in the  region.The transcription factor YY1 -8 is alslsewhere . Both orhe +1, +2 region bQ and is robust to using EST data as well as promoters that did not specifically rely on full-length cDNA clones. The definition of Q implies that genes with a particular Q-value can have a variety of Hg values and thus it may be more difficult to identify features related to tissue specificity. We tabulated all DoTS genes that contained at least two ESTs from an islet-cell library then ranked the genes by Qpancreas computed using EST counts. We used Qpancreas \u2264 7 bits as the criterion for selecting pancreas-specific genes which we grouped into 2-bit Q intervals. For comparison we selected 50 genes with Qpancreas = 8.5 bits, and 50 genes with 10 \u2264 Qpancreas \u2264 10.6 bits. Genes with high specificity for the pancreas  preferentially had TATA boxes (8 of 9) with half of these also having an initiation element  across all specificity classes  is also found for the same set of genes in another mammal. We also added bins of genes with higher Q-values that represent more widely expressed genes. For each human gene, the orthologous mouse gene was determined  and analyzed as described above. Overall, 18.8% of the human genes and 22.9% of the mouse genes that were analyzed carry the TATA box motif. Except for the last group (Q >10 bits) the percentage of the genes with TATA box motifs decreases with the increase in the Q-value. This is to be expected since genes with high Q may be specific to other tissues and hence are more likely to have a TATA box. Discrepancies between human and mouse promoters were noted for only about 10% of all human-mouse pairs analyzed and may reflect sequence differences and possible annotation discrepancies for the transcription start site. Nevertheless, there is overall excellent agreement for the presence of TATA motifs in human and mouse genes. Thus, our assessment of preferential presence of transcription regulatory motifs in the human pancreas-expressed genes also applies to their mouse orthologs. We conclude that genes expressed with restricted tissue-distribution may be preferentially regulated via TATA-mediated transcription, and that genes with broader expression profiles are more likely to be regulated by non-TATA mediated mechanisms (such as YY1).The consistency of findings for the TATA box with human islet genes based on Since the presence or absence of a start CpG island and a TATA box appear to be the primary sequence feature that correlate with tissue specificity, we consider them in more detail. We observe that CpG islands and TATA boxes are not mutually exclusive features of promoters and so we consider all possible combinations of these features.Hg in human  of TATA+ genes express at least 1,000 AU in one or more tissues, whereas only 1,321/3,773 (35%) of TATA- genes express that highly . A second group of CGI-/TATA+ that is common, but with a p-value just over the p-value cutoff are the muscle contraction-related genes, actin, troponin and members of the myosin family. Products of these genes are also required in large amounts to create the contractile apparatus but are only produced in a few cell types. The biological processes that are enriched in the CGI-/TATA+ class differ between human and mouse, but nearly all of them are descendants of the GO term 'response to stimulus' (GO:0050896).Products of genes in the CGI-/TATA+ class were often (70/198) located extracellularly. Examples of such genes are the insulin-like growth factor family, serum albumin and chymotrypsin. Some extracellular CGI-/TATA+ genes, such as luteinizing hormone beta (LHB) and bone morphogenetic protein 10 (Bmp10) in the mouse, have a high Hg \u2264 5.57 bits), we find cellular locations (including the nucleus) and biological processes that match the human results.The CGI+/TATA- promoters produce proteins that are typically located in the cell, especially in the cytoplasm and mitochondrion. These locations are consistent with many housekeeping functions. The human results for biological process suggests a large number of housekeeping processes, but these were not confirmed in the mouse using all CGI+/TATA- genes. When we consider just the least specific CGI+/TATA- mouse genes  and support signaling and response to the environment. Such products, for example, bradykinin receptor B2, prolactin receptor or protocadherin 9, may be expressed in a tissue-specific pattern, but not at the high levels required for secreted proteins. The exact biological process GO terms that are statistically significant vary between mouse and human, but a common core includes defense response (GO:0006952), immune response (GO:0006955) and response to stimulus (GO:0050896). Thus these genes are similar to CGI-/TATA+ genes in that they are involved in response, but are not  required to be expressed at such high levels.Q to assess the categorical specificity of a gene for a particular tissue. We have evaluated the performance of entropy on microarray-and EST-based estimates of tissue-specific expression and found that it correctly identifies both tissue-specific and housekeeping genes. Ranking and binning genes by entropy allowed us to begin to deconstruct core promoters into features directing when and where the gene will be expressed. We verified and extended previous observations [We have applied Shannon entropy as a novel measure of overall tissue specificity of gene expression and have created a new statistic rvations  about thHg and Q have allowed us to discover fundamental properties of mammalian Pol II promoters and should allow serve to aid understanding of expression in particular tissues of interest.The identification of an association between promoter type and cellular location and biological function, while an important step in a fundamental understanding of biology, also has practical significance, as the genes in the CGI-/TATA+ and CGI-/TATA- classes are enriched for tissue-specific extracellular and cell surface proteins. Such genes are likely to be useful drug targets. Thus entropy Qg|t is properly identifying genes that are specific to a tissue. The GNF-GEA expression data we analyzed was processed with the MAS4 [H, in the RMA-processed data compared to the reported values. Although this affects some of the precise values of numbers we have reported it does not alter any of the fundamental trends or results. We include tissue specificities based on both analyses in Additional data files 1 and 2.The validity of our approach is supported by findings in other work and by the fact that they are robust with respect to the algorithm used to process the expression data. Our finding that most genes are regulated in a tissue-dependent manner is consistent with another analysis of gene expression , which fthe MAS4  algoriththe MAS4 . This alOur analysis focused on only a few sequence features and although we found good correlations, two aspects of our results indicate that there are other regulatory mechanisms not yet identified. First, there is a gradual transition in the frequency of the TATA box and CpG islands between the most and least tissue-specific genes. Second, while these features are strong indicators of high and low specificity, they are far from perfect predictors. Indeed, the middle range of entropies contains a mix of all promoter classes in large numbers, indicating that it is possible to achieve tissue-specific expression with any promoter class. YY1 may be an example of such a supplementary mechanism. While occurring in only 16% of genes, it is very strictly confined to low-specificity genes and is a better indicator of low specificity than CpG islands. We expect that other such signals will be found.Anatomical resolution is an issue with the datasets used in this study. For example, the pancreas consists of exocrine cells, ductal cells and islet cells of several types. The bulk pancreas was used to generate the GNF-GEA data, so the reported expression level is the average mRNA concentrations weighted by the cell-type count. This approximation reduces the maximum possible entropy and, more significantly, can make the apparent entropy different from the true entropy. Genes highly and specifically expressed in a cell type with a small population may currently appear to be ubiquitous with very low overall expression. Genes expressed in a few tissues may be revealed to be less tissue specific as more cell types are measured in detail. Genes that appear to be ubiquitously expressed may turn out to not to be expressed in a few cell types. It will be interesting to see whether data with higher anatomical resolution will help to increase the accuracy of the rules we have identified here for identifying tissue-specific and nonspecific promoters.in situ hybridization data. SAGE has the advantage of sensitivity, as these studies generally sequence to much greater depths than EST libraries [In situ hybridization data may increase the anatomical resolution of the data. Qualitative intensities, for example, '0', '+', or '+++', can be converted to representative numeric values as appropriate. Our method can also be applied to other collections of conditions beside normal tissues, for example, different types of cancers or samples of the same cancer from multiple patients. Modification of our method to account for temporal changes in tissue specificity represents another direction for future work.Our method can be also applied to other sources of expression data including SAGE, reverse transcription PCR (RT-PCR) and ibraries . In situThe analysis presented here focuses on genes rather than on transcripts generated from different promoters from the same gene. The rate of the occurrence of alternative transcription start sites is at least 9%  and may Our results for CpG island frequency in very tissue-specific genes are lower than recent reports  that werThese results present an initial look at the correlation between tissue specificity, CpG islands and binding sites for selected transcription factors that interact with the basal transcription apparatus. Using a novel approach with entropy-based metrics, we have begun to lay out the framework for promoter function by identifying strong correlations between tissue-specific or ubiquitous expression and a number of these sequence features. We plan to extend this work in several ways. First, we plan to identify correlations with other known transcription-factor-binding sites and novel motifs identified as over-represented in promoter regions . Second,We have used Shannon entropy to quantify and rank the tissue specificity of genes using tissue-survey data. First, this has allowed us to assess the prevalence of tissue-specific regulation; we find that most genes show evidence of some degree of tissue-dependent variation in expression levels. It has also allowed us to find and evaluate associations between promoter features and tissue specificity. We have verified and extended understanding of known associations between, on the one hand, CpG islands and the least tissue-specific genes and, on the other hand, the TATA box and the most tissue-specific genes. However, they are not the sole determinants of tissue-specific expression, as indicated by mid-specificity genes that exhibit a mix of all promoter classes. The class of CGI-/TATA- promoters has emerged as the second most common class of promoter overall and the most common promoter class in mid-specificity genes. Therefore, additional determinants of tissue specificity remain to be found. We have identified one potential determinant, a downstream YY1 site, which is very strongly associated with the least tissue-specific genes but is a relatively rare feature of these promoters. Finally, we have also been able to associate trends in the localization and function of protein products of genes according to their promoter class. Many of the CGI-/TATA+ genes code for highly expressed, very tissue specific, extracellular proteins involved in a cell's response to the environment. CGI-/TATA- genes are also involved in response to the environment, but are found more uniformly across the spectrum of tissue specificity, are not as highly expressed as CGI-/TATA+ genes, and very often code for membrane-bound proteins. CGI+/TATA- genes are more likely to be located in the cytoplasm or nucleus and, as expected, carry out housekeeping functions. All of the results we report are found in both human and mouse and so may reflect general principles of all mammalian species.N tissues we define pt|g = wg,t/\u2211t \u2264 N1 \u2264 wg,t where wt is the expression level of the gene g in tissue t. DoTS, available through the AllGenes [g. To accommodate the great disparity in sampling depth across tissues we normalized EST counts by tissue. To avoid artificially low entropies for genes that contain relatively few ESTs we used pseudocounts to smooth the data. The expression level of a gene in a tissue is computed as wg,t = /(Nt + Ng) where ng,t is the number of ESTs from libraries for a tissue included in a gene, Nt is the total number of ESTs from a tissue assembled into genes, and Ng is the number of genes. We used different sets of tissues depending on the task. Hg and Q measures in Figure The GNF-GEA data are processed as described . Given aAllGenes  site, coH and Q, we took advantage of tissue replicates in the GNF-GEA data. Using the mouse dataset, we repeatedly sampled one of the measurements from each pair of replicates and computed H for each gene. We then computed the variance of the distribution of the estimates of H for each gene and show the survivor distribution function in Figure Q was computed in a similar manner.To estimate the variance in Q scores for the set of mouse genes with Qg|t \u2264 7 for at least one tissue and expressing at least 200 AU in at least one tissue in the GNF-GEA data. There were 1,786 Affymetrix probe sets selected. The tree in Figure Clustering was based on the Qg,n for the gene at the node. Using Qg,n we can rank genes by specificity to a cluster of tissues just as we can for an individual tissue.The total entropy of all tissues under a node can be computed at each node in the hierarchy using a generalization of the grouping theorem . If the We predicted CpG islands using the program NEWCGREPORT in the EMBOSS  package N CGI+ genes, ne of which are expressed in the embryo, that is, marked as special. The NA tissue-specific genes in the adult are considered a random sample from the original N and we compute the probability of finding that at least (or at most) nae of these were expressed in the embryo.We computed statistical significance of differences between all embryonic-expressed genes and adult-specific rates using a hypergeometric distribution. We start with a collection of s). The standard deviation can be adjusted to control the amount of biological variation a 'uniformly' expressed gene is allowed to show. For example, setting s = 0.5 means that about 68% of the fold changes between a particular tissue and the nominal level are within 1.4 up or down from the nominal level, that is, a twofold change from the lowest to the highest levels. Larger fold changes are expected to occur in 32% of tissues. This model allows significant variation and so is arguably close to the upper limit of variation allowable for a gene that shows no tissue specificity. We also used s = 0.25 as a more stringent definition of uniform expression. We sampled mean expression levels from the distribution of observed mean expression levels and sampled entropy values from the probability model. An entropy threshold was estimated by sampling approximately 5,000 random expression profiles and determining the value for a p-value of 0.002. This process was repeated 10 times and the corresponding thresholds and fraction of genes were computed. The thresholds spanned a range of less than 0.01 bit. The tissue-dependent gene fractions never varied by more than one percentage point in either direction.To model the effect of experimental variability, we computed the distribution of the difference between expression levels of individual replicates for each gene and tissue and the mean expression level across replicates as a function of the mean expression level. This distribution was well fit by an exponential distribution with a parameter that depends on the mean expression level. Thus, given an 'ideal' expression level, we can estimate what the experimental variability will be. To model a uniformly expressed gene, we assume that a gene has some average expression level across all tissues and then allow the expression levels in individual tissues to follow a narrow distribution of random fold changes from that level. Specifically, we assumed that the log base 2 of the fold changes is distributed according to a normal distribution with mean equal to 0 and a standard deviation  n12 hits in a random selection of n2 promoters from a pool of N promoters where n1 of them are 'special'.We estimated the statistical significance of the co-occurrence of motifs using the hypergeometric distribution. Given two motifs with occurrence counts N1 and N2 and positive observations n1 and n2 in each, we computed the probability that the underlying rates are different using an exact calculation of the binomial distribution to compute the probability of seeing at least (or no more) than ni matches in Ni trials where the rate is assumed to be r = nj/Nj. We estimated r using the larger of the two sets.Given two sets of size z-score.We used the normal approximation to the difference of the proportions normalized by their variance to compute a H-based set of analyses used links from Affymetrix probe sets to RefSeq identifiers to select alignments from the DBTSS promoter sequences covering the  region downloaded from the DBTSS website [Q-based analyses of TATA box and initiator elements used genomic locations of DoTS genes on UCSC Golden Path release mm3 [We obtained promoter sequence in two ways. The  website . The Q-bease mm3 ,61 to idease mm3 . The mouH-based analysis used core promoter element models from EPD [Q-based analyses of core motifs used the TATA box motif (TATAA) and initiator element (YYANWYY). Motif searches were carried out using the tool patternmatch from the biological workbench 3.2 [The from EPD ,63. The ench 3.2 . Only thWe used an AlignACE-derived weight matrix  or 0.05/8972 = 0.000006  using the number of GO terms for the corresponding GO divisions in a Bonferroni correction.We submitted Affymetrix probe set ids of interest to the DAVID website ,46 and cWe obtained CEL files for the GNF-GEA study from and re-quantified them using the gcrma package  in the BTwo additional data files are available with the online version of this article. They contain H and Q values for all normal tissues in the GNF-GEA data set for both human (Additional data file A table showing H and Q values for all normal human tissues in the GNF-GEA dataset. H and Q values for all normal tissues in the GNF-GEA dataset for human using both the original MAS4 quantification and our RMA re-quantification. The RMA data were normalized to yield common medians of 3.75 prior to the H and Q calculation. The data for each tissue are placed in separate worksheets. Each worksheet contains H- and Q-values, the expression value of the gene in the worksheet's tissue, and its maximum expression across all tissues in the file, the gene symbol, RefSeq, SwissProt, and Unigene ID, and a description. The rows in each worksheet are sorted by increasing values of Q using the RMA data. Thus the top of each worksheet displays the genes most specific to that worksheet's tissue.Click here for fileA table showing H and Q values for all normal mouse tissues in the GNF-GEA dataset. H and Q values for all normal tissues in the GNF-GEA dataset for mouse using both the original MAS4 quantification and our RMA re-quantification. The RMA data were normalized to yield common medians of 3.22 prior to the H and Q calculation. The data for each tissue are placed in separate worksheets. Each worksheet contains H- and Q-values, the expression value of the gene in the worksheet's tissue, and its maximum expression across all tissues in the file, the gene symbol, RefSeq, SwissProt, and Unigene ID, and a description. The rows in each worksheet are sorted by increasing values of Q using the RMA data. Thus the top of each worksheet displays the genes most specific to that worksheet's tissue.Click here for file"}
{"text": "A microaaray analysis of mouse gene expression combined with the proteins functional and phyletic classification suggests that phyletic age (and not function) is the dominant factor shaping the expression profle of a protein. The combination of complete genome sequence information with expression data enables us to characterize the relationship between a protein's evolutionary origin or functional category and its expression pattern. In this study, mouse proteins were assigned into functional and phyletic groups and the gene expression patterns of the different protein groupings were examined by microarray analysis in various mouse tissues.Our results suggest that the proteins that are universally distributed in all tissues are predominantly enzymes and transporters. In contrast, the tissue-specific set is dominated by regulatory proteins . An increased tendency to tissue-specificity is observed for metazoan-specific proteins. As the composition of the phyletic groups highly correlates with that of the functional groups, the data were tested in order to determine which of the two factors - function or phyletic age - is dominant in shaping the expression profile of a protein. The observed differences in expression patterns of genes between functional groups were found mainly to reflect their different phyletic origin. The connection between tissue specificity and phyletic age cannot be explained by the recent rate of evolution. Finally, although metazoan-specific proteins tend to be tissue-specific compared with phyletically conserved proteins present in all domains of life, many such 'universal' proteins are also tissue-specific.The minimal cellular transcriptome of the metazoan cell differs from that of the ancestral unicellular eukaryote: new functions were added (metazoan-specific proteins), whilst other functions became specialized and no longer took place in all cells (tissue-specific pre-metazoan proteins). Higher animals are characterized by differentiated tissue types, where each tissue has its own unique cellular composition and physiological function. Comparative genomic studies have shown that the evolution of the metazoan lineage involves the expansion of those specific protein families known to participate in cellular communication and transcriptional regulation ,2. HowevRecent studies have related several characteristics of a protein to its expression profile. Subramanian and Kumar  have shoFinally, we wanted to verify that the phyletic age of a protein is indeed a major factor in shaping its expression profile rather than merely a reflection of the level of conservation in a protein - a factor that has already been shown to play a role in determining expression -7. To ruIn order to tackle these questions we have studied expression patterns in 14 mouse tissues. Gene expression patterns  were related to the evolutionary origin of the protein as reflected in the distribution of proteins in different phyla. Firstly, we have assigned mouse proteins to one of four functional categories: two regulatory categories  and two metabolic categories (enzymes and transporters). Next, the proteins were assigned to a phyletic category: mammalian-specific proteins, metazoan-specific proteins, eukaryote-specific proteins and universal proteins - present in prokaryote species. Then we compared the expression pattern of the different categories within various mouse tissues and studied the tendency of proteins within these groups to be tissue-specific or ubiquitous. The assignment process is described in Figure For each tissue we counted the number of expressed probe sets. The fraction of probe sets expressed in each tissue ranges from 0.35 (muscle) to 0.55 (eye). Nearly a constant fraction (~60%) of the probe sets in each tissue is mapped to proteins. Similarly a constant fraction (~45%) of the proteins in each tissue can be assigned a Gene Ontology (GO) annotation Figure . We compAs the tissues seem to have almost identical overall composition of functional categories Figure , tissue We further studied the contribution of different functional and phyletic groups to tissue variation. Are some functional categories more tissue-specific than others? We examined the expression profile of proteins from the four functional categories within 14 different mouse tissues. For each group, we calculated the fraction of its protein members expressed in one tissue, two tissues, and so on Figure . SurprisSignal transduction proteins and transcription factors are known to be the main functional categories that were expanded in the metazoa lineage while enzymes and transporter proteins are usually more highly conserved between the different domains of life ,2. Therep value 0.04), suggesting that most of the relationship observed between function and tissue specificity is accounted for by the age of the gene. The relationship between phyletic age and tissue specificity is not explained by a gene's function , nor is the relationship between phyletic age and function explained by the tissue specificity . Therefore, the results imply that enzymes tend to be ubiquitously expressed mainly due to their phyletic universal origin .In order to identify whether a protein's expression pattern better reflects function or age, the inter-relationship between these three factors was compared statistically. After phyletic age was taken into account, only a weak dependence between function and tissue specificity was detected  is one example of a universal enzyme whose expression is limited to few cell types in mammals. Ldh participates in anaerobic glycolysis - a nearly universal pathway that converts glucose into pyruvate. The sequence of reactions in the pathway is similar in all organisms and in all cell types. In contrast, the fate of pyruvate is variable. In a variety of microorganisms, lactate is normally formed from pyruvate in a reaction catalyzed by Ldh. In higher organisms, most cells do not convert pyruvate to lactate and the reaction is limited to few tissues [Ldhc (testis-specific expression). The expression of Ldhc is an example of a function occurring in the ancestral unicellular cell that becomes tissue-specific in multicellular species.Yet, although pre-metazoan proteins tend to be more widely expressed, less than one-third of the pre-metazoan metabolic proteins are expressed in all tissues.  tissues . In germ tissues , we obseG6pd-2) and phosphoglycerate kinase 2 (Pgk-2) - provides a different example for a specific expression of universal enzymes. G6pd-2 and Pgk-2 are believed to arise from their isoenzymes, G6pd and Pgk-1, respectively, by a gene duplication event. G6pd and Pgk-1 are essential, widely expressed, X chromosome-encoded genes. The absence of those two enzymes during the inactivation of the X chromosome in postmeiotic spermatogenic cells is compensated for by the expression of their autosomal testis-specific isoenzymes G6pd-2 and Pgk-2 [The testis-specific expression of two other universal enzymes in our dataset - glucose-6-phosphate dehydrogenase 2 . The chi-squared test statistic for the independence of age and tissue expression given rate in our data was 226.5, whereas the maximum observed statistic in 10,000 random draws, generated as described in Methods, was 84.3. The connection between phyletic age and tissue specificity that we observed in our data cannot be explained purely in terms of both factors' mutual correlation with the recent rate of evolution.Tissue-specific genes tend to evolve more rapidly than broadly expressed ones -7. ThereIt is important to remember that our analysis is based only on those proteins that are present on the Affymetrix chip and have GO annotation. Our dataset covers approximately one-quarter of mouse proteins. Clearly, a better coverage for the expression and annotation of proteins is desirable and could change the conclusion presented below. In order to decrease the probability that our results are arbitrary, we repeated the experiment with a different set of tissues . The results obtained are compatible with the observations we report here (data not shown).We show here that multicellular specific proteins tend to be more tissue-specific than 'ancient' universal proteins. Most of the 'late' evolutionary proteins are transcription factors and signal transduction proteins, categories that have previously been suggested to play a crucial role in tissue differentiation. However, our analysis suggests that more recent enzymes and transporters also contribute to tissue diversity as many of them are tissue-specific Figure . The selDespite this trend, many metazoan-specific proteins are ubiquitous and many universal proteins are tissue-specific. The minimal cellular transcriptome of the metazoan cell differs from that of the ancestral unicellular eukaryote: new functions were added (metazoan-specific proteins), whilst other functions became specialized and no longer took place in all cells (tissue-specific pre-metazoan proteins). The extent of the cellular specialization can be implied from the observation that only one-third of the proteins are expressed in all tissues examined. In some of these cases, functions occurring in the unicellular cell become tissue-specific in multicellular species. In other cases, universal genes that have been duplicated become specific to a tissue whilst a second copy maintains its original expression pattern. Only about one-third of the pre-metazoan metabolic enzymes are expressed in all tissues. Tissue differentiation is at least in part achieved by tissue specialization of metabolism - either by differentially expressing two-thirds of the ancient metabolic proteins, or by encoding new metabolic proteins. Presumably, the additional transcription-related proteins provide the necessary control. We aim to further characterize the expression patterns of processes that exist in the ancestral metazoa and those that are specific to metazoa. In particular, we are interested in studying the contribution of function differentiation versus gene duplication to tissue diversity in multicellular species.Tissues were dissected and snap frozen from 8-12-week old C57/BL6 male mice with the exception of the ovaries, which were taken from females. Tissue was pooled from between four to six animals, the RNA extracted and 10 mg of total RNA was labeled and then hybridized to the Affymetrix U74AV2 GeneChip using standard protocols ; complete experimental details for each of these stages are given at . ExpressP value < 0.075 for absent/present flags labeling has no effect on the analysis. Only absent/present calls were used to define tissue-specificity and expression levels have not been a factor in this analysis.A subset of 14 samples representing distinct non-redundant organs was chosen out of the complete dataset. The tissues are listed in Figure Out of 12,487 probe sets, 8,218 were mapped into EnsEmbl mouse transcripts using Ensmart ). MappinA total of 4,918 proteins were assigned with a GO annotation . For simWe used four categories to describe the evolutionary origin of mouse proteins: universal proteins, that is, ubiquitous in the three domains of life , eukaryote-specific proteins, metazoan-specific proteins and mammalian-specific proteins. The 6,242 mouse proteins were classified into the phyletic categories according to the results of a BLAST  databaseThe observations reported here are maintained using different cut-offs within the range of 1e-10 < e-score < 1e-1. The observations are also maintained when a universal protein is defined as a protein with a hit in at least a single prokaryote species or when it defined as a protein with a hit in at least ten prokaryote species . Additional tests were performed in order to assure that the phyletic distribution truly describes a complete sequence distribution rather than domain distribution. The classification of a protein to a phyletic group was done when additional filters were added. This was in order to discard those cases where a match between query and hit is based only on recognition of a conserved domain rather than a complete sequence (e-score <1e-3). Firstly, pfam domain composition: all query-hit pairs that do not share an identical pfam domain composition were discarded from our dataset. Secondly, full coverage: all query-hit pairs where the alignment does not cover the full length (80%) of both proteins were discarded from our dataset.When repeating the analysis with the filtered data, the results confirm that the trends reported here are maintained (not shown). Similar results were also obtained when using the homologous clusters database STRING  for a pha (the number of non-synonymous substitutions per non-synonymous site) to Ks (the number of synonymous substitutions per synonymous site) was calculated using the codeml program from the PAML 3.13d package [Ka/Ks ratio could not be reliably estimated. These sequences were discarded from the analysis. In total, the Ka/Ks ratio was calculated for 4,056 mouse proteins from the 5,501 proteins classified to a phyletic category and expressed in at least a single tissue  and then shuffling the phyletic ages within each group, sample sets of data can be created which have no connection between phyletic age and tissue expression other than through their common connection to recent rate of evolution. The connection between rate and tissue specificity in each of these sample sets is identical to the observed data and, because all genes in each bin have a similar rate of evolution, the connection between age and rate is similar to the observed data. By generating random samples in the manner as described above, the expected contingency table of age/expression dependence and the null distribution of the chi-squared test statistic can be estimated. Using the estimated expected table, the chi-squared statistic for the observed data can be calculated. The significance of the observation was assessed by comparing the observed test statistic with those from 10,000 sets of data, of equal size to the observed data, randomly generated according to the expected contingency table (and so satisfying the null hypothesis).By grouping the genes into equal bins of similar recent rates of evolution (The relationship between tissue specificity and phyletic age and function was investigated using a contingency table test under the null hypothesis that function and specificity are independent of given age. Conceptually, the genes are divided up according to age and a separate contingency table for specificity and function is formed for each group. The chi-squared test statistic  for indeThe following additional data are available with the online version of this paper. Additional data file Functional assignments of the proteins used in the analysis. Functional assignments of the proteins used in the analysisClick here for filePhyletic assignments of the proteins used in the analysis. Phyletic assignments of the proteins used in the analysisClick here for fileThe sequences of the proteins used in the analysis. The sequences of the proteins used in the analysisClick here for file"}
{"text": "UDP-glucuronosyltransferases 1A isoforms belong to a superfamily of microsomal enzymes responsible for glucuronidation of numerous endogenous and exogenous compounds. The nine functional UGT1A isoforms are encoded by a single UGT1A gene locus with multiple first exons. The expression of the UGT1A transcripts was measured by quantitative RT-PCR in 23 normal human tissues. The tissue-specific expression patterns were observed in 13 tissues. To understand the regulation mechanism that is responsible for the tissue-specific expression patterns, we scanned the DNA sequence alignments of the putative promoter regions, exon 1 sequences and intron 1 sequences for those expression-pattern-linked nucleotides. Using one of the expression-pattern-linked nucleotides for livers as an example, we showed that a database comprised of these expression-pattern-linked nucleotides could be used to generate focused hypotheses on the problem of tissue-specific expression, which is critical for tissue-specific pharmacodynamics of anticancer drugs. Human UDP-glucuronosyltransferase (UGT) 1A is a subfamily of UGT enzymes that glucuronidate xeno-/endobiotics and many other substrates such as steroids and bilirubin to make the metabolic products more easily excreted from the body via the urinary and biliary tracts in silico approach to search for the expression-pattern-linked nucleotides. Due to the unique structure of UGT1A locus, specific nucleotides in promoter regions, exon 1 sequences, intron 1 sequences may (jointly) contribute to the observed tissue-specific expression patterns. Some possible mechanisms include promoter efficiency through transcription factor binding and alternative or false splicing. Specifically, we analyzed the putative promoter regions, exon 1 sequences and intron 1 sequences for nucleotides associated with tissue-specific expression, focusing on the eleven tissues that had more than two expressed UGT1A isoforms. The resulting database or pool of the expression-pattern-linked nucleotides then could be used to generate focused hypotheses on the regulation of the tissue-specific expression of UGT1A isoforms.Reports regarding UGT1A mRNA expression profiles indicate that each tissue contains a selective complement of UGT1A gene products We measured the expression levels of the nine functional UGT1A isoforms in 23 normal tissues. UGT1A genes were not expressed in 10 tissues , while the tissue-specific expression patterns were observed in other 13 tissues, among which placenta and lung had only one expressed isoform (UGT1A6) . Some exUGT1A isoforms showed specific expression pattern in different tissues. For example, in livers, only 6 UGT1A isoforms  had expression detected at different levels. Our major aim was to explore an approach to study the mechanism responsible for the observed tissue-specific expression patterns. Due to the unique structure of the UGT1A cluster, we hypothesized that the nucleotides that were linked to the expression patterns might (jointly) contribute to the regulation of expression in different tissues. A database or pool of expression-pattern-linked nucleotides was constructed by scanning the putative promoters, intron 1 sequences as well as exon 1 sequences of the nine functional UGT1A isoforms. The CLUSTAL Wth bp in the multiple alignment of 3447 bp of the putative promoters for the six UGT1A isoforms with hepatic expression and either a gap or a G for the three UGT1A isoforms not expressed in liver . The Match program identified a TFBS for AP-1 (activator protein 1) for three of the six hepatically-expressed UGT1A isoforms . A testable hypothesis then could be that the binding site for AP-1 close to the TSS may be contributing to the expression in liver for these three isoforms, but not the other three hepatically-expressed isoforms. Of course, this doe not necessarily mean that this particular transcription factor is the only determinant for hepatic expression. The example just showed that we could now use the database to prioritize our efforts and guide further studies based on these specific nucleotides. Besides promoter efficiency, other mechanisms such as alternative splicing may also contribute to the observed tissue-specific expression patterns. To generate such focused hypotheses, we could search the tissue-specific nucleotides in our database for potential exonic or intronic splicing enhancers To show an example, we used the Match http://home.uchicago.edu/\u223cwzhang1/PONE/UGT1A/and will be deposited into PharmGKB (http://www.PharmGKB.org).The supplemental materials can be accessed at Complementary DNA (cDNA) from a total of 23 human normal tissues was purchased from Clontech . These tissues include human brain, placenta, skeletal muscle, kidney, pancreas, spleen, thymus, prostate, testis, ovary, small intestine, uterus, mammary gland, thyroid, pituitary body, bone marrow, bladder, tonsil, lymph node, leukocyte, blood fractions, liver and lung.The expression of the UGT1A transcripts was measured in the 23 human normal tissues by PCR using TITANIUM Taq DNA Polymerase (Clontech). Briefly, PCR was set up in a 50 \u00b5l vol reaction with 3 \u00b5l of cDNA as template. Primers for each exon 1 were 5\u2032-aacaaggagctcatggcctcc-3\u2032 (UGT1A1), 5\u2032-tgttgaacaatatgtctttggtcta-3\u2032 (UGT1A3), 5\u2032-gaaggaatttgatcgcgttac-3\u2032 (UGT1A4), 5\u2032-ggtggtggtcctcaccctg-3\u2032 (UGT1A5), 5\u2032-cagctgtcctcaagagagatgtgga-3\u2032 (UGT1A6), 5\u2032-gttgcgaactgactttgttttggag-3\u2032 (UGT1A7), 5\u2032-ggtcttcgccaggggaatagg-3\u2032 (UGT1A8), 5\u2032-ttctccaaacacctgttacggag-3\u2032 (UGT1A9), 5\u2032-cctctttcctatgtccccaatga-3\u2032 (UGT1A10). The reverse primer (5\u2032-ccaatgaagaccatgttgggc-3\u2032) was shared by all UGT1A genes. PCR reactions were denatured initially at 95\u00b0C for 1 min, and then cycled 35 times at 95\u00b0C for 30s, annealing and extension at 65\u00b0C for 3 min. GAPDH gene was amplified with same conditions as above by using primers 5\u2032-tgaaggtcggagtcaacggatttggt-3\u2032 and 5\u2032-catgtgggccatgaggtccaccac-3\u2032 and served as an internal control for cDNA quantity and quality.The GenBank/NCBI reference sequence for human UDP-glucuronosyltransferase 1 family, polypeptide A cluster on chromosome 2 (NG_002601) was used to retrieve the following regions for the UGT1A isoforms.Promoter regions; The putative promoter regions of the nine functional UGT1A isoforms are defined as the sequences of 1-3000 bp upstream of the transcription start sites (TSS).Intron 1 sequences; Because the shortest intron 1 (UGT1A1's) is less than 6 kb and the 3\u2032 ends of the intron 1 sequences are shared among the isoforms, we scanned the 5 kb segments immediately downstream of the first exons of the nine functional UGT1A isoforms.Exon 1 sequences: The exon 1 sequences of the nine functional UGT1A isoforms are distinct, so they were included in the analysis.http://www.ebi.ac.uk/clustalw/). The alignments and the original DNA sequences are provided in the supplemental materials. The multiple alignments were then scanned for those nucleotides that were linked to a particular expression pattern for each isoform and each tissue type. Therefore, the expression-pattern-linked nucleotides are in the form of an ordered vector tN\u200a=\u200a, where tN represents the vector of specific nucleotides for tissue t, n is a particular nucleotide, p is an integer for the position in an alignment. The elements of tN are [nj(pj):\u03c8(pj)], where \u03c8 represents the set of conserved nucleotides of UGT1A isoforms with expression in a particular tissue at a particular position p. The identified nucleotides and their flanking sites (25 bp upstream/downstream) were then output as entries of the database.The nucleotide sequences of the UGT1A isoforms were aligned using CLUSTAL W http://www.gene-regulation.com/) to predict the transcription factor binding sites (TFBS) in the regions that contain one of the liver-specific nucleotides. The Match program searches the TRANSFAC database To show an example that the database comprised of expression-pattern-linked nucleotides could be used to generate focused hypotheses on tissue-specific expression, we used the Match"}
{"text": "A systematic survey of gene expression in 115 human tissue samples using cDNA microarrays provides a dataset that can be used as a baseline for comparison with expression in diseased tissue. Numerous studies have used DNA microarrays to survey gene expression in cancer and other disease states. Comparatively little is known about the genes expressed across the gamut of normal human tissues. Systematic studies of global gene-expression patterns, by linking variation in the expression of specific genes to phenotypic variation in the cells or tissues in which they are expressed, provide clues to the molecular organization of diverse cells and to the potential roles of the genes.Here we describe a systematic survey of gene expression in 115 human tissue samples representing 35 different tissue types, using cDNA microarrays representing approximately 26,000 different human genes. Unsupervised hierarchical cluster analysis of the gene-expression patterns in these tissues identified clusters of genes with related biological functions and grouped the tissue specimens in a pattern that reflected their anatomic locations, cellular compositions or physiologic functions. In unsupervised and supervised analyses, tissue-specific patterns of gene expression were readily discernable. By comparative hybridization to normal genomic DNA, we were also able to estimate transcript abundances for expressed genes.Our dataset provides a baseline for comparison to diseased tissues, and will aid in the identification of tissue-specific functions. In addition, our analysis identifies potential molecular markers for detection of injury to specific organs and tissues, and provides a foundation for selection of potential targets for selective anticancer therapy. DNA microarrays ,2 have bAt present there is relatively little data on gene expression across the diversity of normal human tissues -20. HereTo survey gene expression across normal human tissues, we analyzed 115 normal tissue specimens representing 35 different human tissue types, using cDNA microarray representing 26,260 different genes . To explore the relationship among samples and underlying features of gene expression, we applied an unsupervised two-way  hierarchical clustering method using the 5,592 cDNAs  whose eThe two-way unsupervised analysis also identified clusters of coexpressed genes , complement components , lipid  and metal transport proteins , and proteins for detoxification , amino acid metabolism  and carbohydrate metabolism , other intriguing genes, for example, WRNIP1 (Werner helicase interacting protein 1), BIRC5 (survivin), ANGPTL3 (angiopoietin-like 3), and CNTNAP1 (contactin associated protein 1), were also identified as selectively expressed in liver. The new connections these results might make between our knowledge of the gene and its product on the one hand, and our knowledge of the physiological functions, cellular characteristics and pathologies of a specific organ, on the other, are a step towards better understanding of both the genes and the organs. Interestingly, we also identified a smaller number of genes displaying selectively decreased expression in some organs, for example, splicing factor SF3B1 in the liver  method , see Mat includedr Figure : we specRecent efforts by the Gene Ontology (GO) Consortium have resulted in the systematic annotation of genes, ascribing genes to specific biological processes, cellular components and molecular functions . This anDNA microarray experiments are often performed as comparative two-color hybridizations, permitting precise quantification of the ratio of each gene's expression between two samples. In the experiments reported here, each tissue sample was compared by hybridization to the same 'common reference' mRNA , a standard experimental design permitting the comparison of expression across all samples . TherefoTo estimate transcript levels for our dataset, we used microarray hybridization to compare the common reference mRNA against normal female genomic DNA. We reasoned that, for each gene on the microarray, the ratio of mRNA to genomic DNA should reflect the relative level of transcript in the common reference compared to normal genomic DNA (for which each gene is present in two copies per cell). For each tissue sample in our study, the ratio of expression for each gene in that sample versus common reference mRNA, multiplied by the ratio for that gene in common reference mRNA versus normal genomic DNA, would then approximate transcript abundance. To test our approach, we compared our estimates of transcript levels for a single prostate specimen, calculated either indirectly using the common reference mRNA versus genomic DNA ratios, or calculated through a direct hybridization comparison of prostate sample mRNA versus normal female genomic DNA. Our results show high concordance for the prostate sample Figure ; comparaRDH11 was highly expressed in prostate and was expressed at lower levels in other tissues, while STEAP2 was expressed at low levels in prostate and displayed very little or no expression in other tissues. For each of the tissue types, transcripts identified as both highly abundant and tissue specific are displayed in Additional data files 5 and 8 .The utility of this approach is illustrated for the cluster of prostate-specific genes . Of particular importance, the function of uncharacterized ESTs might be deduced by virtue of their inclusion in one of these clusters. Supervised analysis also identified genes selectively expressed in each of the tissues types studied, and the analysis of functionally annotated gene sets provided information on the tissue distribution of specific biological processes, cellular components and molecular functions.We have also reported here the application of mRNA versus genomic DNA hybridizations for estimating transcript abundances for expressed genes. Knowledge of transcript abundance should prove useful in prioritizing candidate genes for use as diagnostic markers or therapeutic targets, for which more highly expressed genes might be more tenable candidates. It is worth pointing out that our approach for estimating absolute transcript levels should be applicable to any cDNA microarray study incorporating a common reference mRNA.While many investigators have been using DNA microarrays to profile gene expression in cancer and other human diseases, scant data exist on profiles of gene expression across the diversity of normal human tissues. Our cDNA-microarray-based survey of gene expression in normal human tissues provides a publicly accessible dataset which can be used in future analyses aimed at better understanding the physiology of various normal tissues; developing a baseline for comparison to diseased tissues, including cancer; identifying tissue-specific diagnostic markers that signify tissue injury; discovering tissue-specific therapeutic targets ; and identifying tumor-specific diagnostic markers and therapeutic targets, for which minimal expression in the collection of normal adult human tissues is desirable.We have used cDNA microarrays to survey gene expression across a diverse set of normal human tissues. Using unsupervised and supervised analyses, we have identified tissue-specific patterns of gene expression. Furthermore, by comparative hybridization to normal genomic DNA, we were able to estimate transcript abundances and identify the subsets of abundantly expressed tissue-specific genes. Our dataset provides a baseline for comparison to diseased tissues, as well as a basis for identifying molecular markers of injury to specific organs and tissues, and for anticancer therapy.+ mRNA fraction was then isolated from total RNA using FastTrack2.0 kit (Invitrogen), and quantified by UV spectrophotometry.Normal human tissue specimens were obtained from surgery  or from autopsy, with institutional review board approval. Specimens were frozen on dry ice within 30 minutes of surgical removal or procurement and stored at -80\u00b0C. Histological evaluations were performed by H&E staining of frozen sections, and a pathologist (J.H. and/or M.vdR.) reviewed all slides to confirm the anatomical site of origin and histological normalcy . In total, we selected for study 115 tissue samples representing 35 different human tissues . Total RNA was isolated from tissues using TRIzol Reagent (Invitrogen) according to the manufacturer's instruction, and RNA quality was assessed by the integrity of rRNA bands following gel electrophoresis. The poly(A)Gene-expression profiling was performed essentially as reported previously , and dett-test statistic and sample-label permutations to evaluate statistical significance. The false-discovery rate (FDR), an estimate of the fraction of falsely called tissue-selective genes, varied by tissue, but in all cases was less than 5% . For tissue-selective genes, only tissue types with two or more samples were considered for analysis, and we only considered genes that were well-measured in more than 50% of the samples for the selected tissue type analyzed. GO annotations were assigned to arrayed genes using the AmiGO browser [Fluorescence ratios were normalized by mean-centering genes for each array , and then by mean centering each gene across all arrays. We included for analysis only well-measured genes whose expression varied, as determined by: signal intensity over background more than twofold in either test or reference channels in at least 75% of samples; and a fourfold or more ratio variation from the mean in at least two samples (unless otherwise indicated). Hierarchical clustering was performed and displayed using Cluster and TreeView software . Tissue- browser  to selec browser  to identThe following additional data are available with the online version of this paper. Additional data file A table listing the normal tissue specimens included in microarray analysisClick here for fileSheet 1: Dataset represented in Fig. Sheet 2: Variably expressed genes which are well-measured in \u2265 75% of samples, with \u2265 2-fold ratio variation from the mean in at least 2 samples; samples ordered by anatomic site. Sheet 3: Variably expressed genes which are well-measured in \u2265 25% of samples, with \u2265 4-fold ratio variation from the mean in at least 2 samples; samples ordered by anatomic site. Sheet 4: Same dataset as sheet 1, but here ratios represent relative transcript abundance . Sheet 5: Same dataset as sheet 2, but here ratios represent relative transcript abundance . Sheet 6: Same dataset as sheet 3, but here ratios represent relative transcript abundance A table listing the variably expressed genes. Click here for fileA table listing tissue-specific transcriptsClick here for fileA table listing functionally annotated gene setsClick here for fileA table listing highly abundant tissue-specific transcriptsClick here for filea, brain; b, salivary gland; c, esophagus; d, stomach; e, small bowel; f, colon; g, pancreas; h, liver; i, heart; j, skeletal muscle; k, lung; l, kidney; m, bladder;n, prostate; o, seminal vesicle; p, testis; q, ovary; r, fallopian tube; s, uterus; t, cervix, u, thyroid; v, parathyroid; w, adrenal; x, lymph node; y, tonsil; z, thymus; aa, spleen; bb, buffy coatA figure showing tissue-specific gene expression. Variably-expressed genes determined to be expressed in a tissue-selective fashion using the SAM method are depicted as described in the legend to manuscript Figure Click here for filea, tyrosine kinase (activity); b, kinase (activity); c, G-protein coupled receptor (activity); d, transcription factor activity; e, ion channel (activity); f, extracellular matrix (component), g, cell adhesion (process); h, programmed cell death (process)A figure showing expression of functionally annotated gene sets. Hierarchical cluster of 115 normal tissue specimens and annotated gene sets representing examples of specific molecular functions, cellular components, or biological processes. Click here for filea, brain; b, salivary gland; c, esophagus; d, stomach; e, small bowel; f, colon; g, pancreas; h, liver; i, heart; j, skeletal muscle; k, lung; l, kidney; m, bladder;n, prostate; o, seminal vesicle; p, testis; q, ovary; r, fallopian tube; s, uterus; t, cervix, u, thyroid; v, parathyroid; w, adrenal; x, lymph node; y, tonsil; z, thymus; aa, spleen; bb, buffy coatA figure showing highly abundant tissue-specific gene expression. Highly-abundant tissue specific transcripts were defined for each tissue type as the top (capped at 50 genes) tissue specific transcripts, identified using the SAM method, from the 1000 most abundantly expressed transcripts in the full dataset. Click here for file"}
{"text": "This study aims to characterize the housekeeping and tissue-specific genes in 15 mouse tissues by using the serial analysis of gene expression (SAGE) strategy which indicates the relative level of expression for each transcript matched to the tag.Here, we identified constantly expressed housekeeping genes, such as eukaryotic translation elongation factor 2, which is expressed in all tissues without significant difference in expression levels. Moreover, most of these genes were not regulated by experimental conditions such as steroid hormones, adrenalectomy and gonadectomy. In addition, we report previously postulated housekeeping genes such as peptidyl-prolyl cis-trans isomerase A, glyceraldehyde-3-phosphate dehydrogenase and beta-actin, which are expressed in all the tissues, but with significant difference in their expression levels. We have also identified genes uniquely detected in each of the 15 tissues and other tissues from public databases.These identified housekeeping genes could represent appropriate controls for RT-PCR and northern blot when comparing the expression levels of genes in several tissues. The results reveal several tissue-specific genes highly expressed in testis and pituitary gland. Furthermore, the main function of tissue-specific genes expressed in liver, lung and bone is the cell defence, whereas several keratins involved in cell structure function are exclusively detected in skin and vagina. The results from this study can be used for example to target a tissue for agent delivering by using the promoter of tissue-specific genes. Moreover, this study could be used as basis for further researches on physiology and pathology of these tissues. Housekeeping genes are constitutively expressed in all tissues to maintain cellular functions . MoreoveThe invention and application of SAGE method have paralleled those of microarray/chip technologies. Whereas hybridization-based technologies may allow for shorter detection times and high throughput expression analysis, the SAGE method not only identifies unknown genes but also quantifies the gene expression level relatively to the total mRNA population. Indeed, the SAGE method can be performed to accurately measure the abundance of both known and novel transcripts on global scale . This meA total count of 1,834,621 SAGE tags were analyzed for the 15 tissues representing 320,624 tag species. For each tissue, approximately 130,000 tags were sequenced, except for testis, ovary, mammary gland, vagina and bone which had approximately 50,000 tags.This study has identified 1,111 ubiquitously expressed transcripts. These genes are expressed in all the tissues and therefore are likely candidates as the genes responsible for cellular maintenance also known as housekeeping genes. Among the ubiquitous genes identified, 280 genes are constantly expressed in all tissues. The rest (831 transcripts) are not expressed at the same level in all the 15 tissues. The 280 transcripts are detected at similar level in each of the 15 tissues and can be useful as a set of controls. In the Table We have also identified the genes uniquely detected in each of the 15 tissues. These genes are critical for the specific functions that characterize and distinguish the testis, prostate, ovary, mammary gland, uterus, vagina, skin, liver, adipose tissue, lung, bone, skeletal muscle, cerebral cortex, hypothalamus, and pituitary gland. The specific genes are expressed in only one tissue. Table Quantitative gene expression data are often normalized to the expression levels of control or so-called housekeeping genes. An inherent assumption in the use of housekeeping genes is that expression of the genes remains constant in the tissues under investigation. Housekeeping genes do not vary in their expression levels during cell development, treatment, or disease state anomalies . About 4According to this study, the tissue-specific genes were observed in higher proportion in testis than any other tissues. The top 8 most abundant tissue-specific transcripts, namely protamine 2, transition protein 1, t-complex-associated testis expressed 3, the novel transcript GTGCCAGGAGA, tubulin alpha 3, diazepam binding inhibitor-like 5, lactate dehydrogenase 3 C chain sperm specific, and outer dense fiber of spermtails 2 are also the top 8 most abundant transcripts in this organ. These tissue-specific genes are all expressed in the specific stage of spermatogenesis. Other tissue-specific genes such as spermatogenic Zip 1  and glycWe have identified some prostate specific genes such as microseminoprotein (beta-MSP), seminal vesicle protein secretion 2, seminal vesicle antigen (SVA) and mucin 10 (MUC10) which are involved in protein secretion, cell signalling and spermatogenesis. In addition, one novel transcript was observed to be solely expressed in the prostate. Beta-MSP, also known as prostate secretory protein of 94 amino acids (PSP94), is an abundant secretory protein of the prostate gland and is generally considered to be prostate tissue-specific . ResultsOnly two transcripts with unknown function and a novel transcript with sequence tag GTCAACACAGG were specifically detected in ovary. We report two transcripts, namely glycosylation cell adhesion molecule 1 (Glycam1) and the novel transcript with sequence tag TCCGGAGAAAA, which are expressed only in the mammary gland. Glycam1 has a protein binding activity and previous studies have reported that prolactin induced Glycam1 expression in primary mammary epithelial cell of mice .In uterus, three transcripts namely proline-rich acidic protein 1 (Prap1), hydroxysteroid 11-beta dehydrogenase 2 (Hsd11b2) and chloride channel calcium activated 3 (clca3) were characterized as tissue-specific. Northern analyses have demonstrated that Prap1 also known as pregnancy-specific uterine protein expression is limited to the pregnant uterus . In the Two novel transcripts were observed to be tissue-specific to the vagina. Furthermore, the keratins such as keratin intermediate filament 16a, keratin complex 1 acidic gene 13 and keratin complex 2 basic gene 6 g, members of a family of fibrous structural proteins were also detected in high proportions in the vagina. Surprisingly, retinol binding protein 2, which functions in the intracellular transport of retinol, is detected only in vagina. According to the UniGene and EST databases, retinol binding protein 2 is also expressed in intestine tissue.The majority of transcripts specifically detected in the skin represent keratin. Moreover, the S100 calcium binding protein 17 and G protein-coupled receptor family C group 5 member D, both involved in cell signalling, were also specific to the skin. In addition, lymphocyte antigen 6 complex locus G6C, involved in cell defence, was also exclusively observed in the skin.The transcripts exclusive to the liver are involved in several functions such as cell defence, protein and steroid hormone synthesis, as well as transport and amino acid metabolism. We report in the current study that inter-alpha-trypsin inhibitor-4 (Itih-4) was exclusively detected in the liver. This result is in agreement with the report that Itih-4 is a liver-restricted member of the serine protease inhibitors family, with diverse functions such as anti-apoptotic action and matrix stabilization molecule that are important throughout development . The preTwo transcripts, leptin and lectin galactose binding soluble 12 , were exclusively detected in adipose tissue. Leptin is a peptide hormone produced predominantly by white adipose tissue. Beside its key role in the regulation of food intake and energy expenditure, leptin is also involved in the pathogenesis of inflammatory and autoimmune disease . On the The transcripts specific to the lung are involved in cell defence, except claudin 18 which participates in cell signalling. The surfactant-associated proteins A (SP-A) and SP-D are members of a family of collagenous host defence lectins, designated collectins. The lung is the main site of SP-A and SP-D synthesis . They arThe transcripts exclusively detected in the bone are involved in transport, cell structure, signalling and defence. The tissue-specific genes ascribed to proteoglycan 2 bone marrow and solute carrier family 4 (anion exchanger) member1 are highly and solely expressed in the bone. The other exclusive transcripts such as proteinase 3, neutrophil elastase, eosinophil peroxidase, cathepsin G and carbonic anhydrase 1 are involved in cell defence. Evidence from northern analysis has shown that proteinase 3 expression is primarily confined to the promyelocytic/myelocytic stage of bone marrow development . The higIn the current study, the transcripts exclusively detected in skeletal muscle are novel transcripts except tropomyosin 3 gamma (Tpm3) and myosin light chain phosphorylatable fast skeletal muscle (MLC2) which are involved in cell structure. In the mice, the Tpm3 mRNA is found exclusively in the skeletal muscle but not in the cardiac tissue at any development stage, whereas, in human, Tpm3 is found in both adult heart and skeletal muscle ,62. The The current study reports that solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter) member 7, also known as vesicular glutamate transporters (Vglut1), and synaptic vesicle glycoprotein 2 b (SV2B) as well as gene model 748 were exclusively expressed in cerebral cortex. This result is consistent with the report that Vglut1 mRNA is strongly expressed in the hippocampus and cerebellar cortex . Vglut1 We report that cocaine and amphetamine regulated transcript (CART), calbindin 2, hypocretin and RIKEN cDNA A230109K23 gene were exclusively detected in the hypothalamus. The protein calbindin 2 buffers intracellular calcium is speculated to be involved in the integration of neuronal signalling. CART encodes a hypothalamic neuropeptide precursor protein which has been identified and characterized in rat brain and later in human brain ,67. FurtThe transcripts exclusively expressed in the pituitary gland were also highly expressed in this gland. Except growth hormone, pro-opiomelanocortin-alpha, prolactin, luteinizing hormone beta (LH beta) and thyroid stimulating hormone beta subunit (TSH beta) also known as thyrotropin beta which are involved in cell signaling, the other specific genes to this gland had no match in public databases and therefore may represent novel transcripts. LH beta is essential for ovulation and reproductive fitness, and is well known to be synthesized specifically in pituitary gonadotropes . In addiUsing SAGE strategy, this study has shown the housekeeping genes and the tissue-specific genes expressed in 15 intact tissues. The identified housekeeping genes can represent appropriate controls for RT-PCR and northern blot when comparing the expression levels of genes in several tissues. Several transcripts exclusively detected in a tissue are known to be tissue-specific genes according to previous studies. Furthermore, we have identified several new tissue-specific genes. These genes show well the specialty and particularity of each tissue. The tissue-specific genes can be used as a targeting agent in order to reach a particular tissue/organ. In addition, the current data can contribute significantly to comparative genomics in general and gene expression and regulation among different mouse tissues. Further studies will be needed to investigate other tissues to confirm the specific or housekeeping gene expressions. In addition, this study can serve as a basis for future studies on the novel transcripts and the transcripts with unclear functions despite their tissue specificity.C57BL6 mice (12\u201315 week old) were obtained by Charles River Laboratories . They were housed in an air-condition room (19\u201325\u00b0C) with controlled lighting from 07:15 to 19:15 h and were given free access to food (Lab Rodent Diet No. 5002) and water. The GDX and ADX groups had surgery 7 days before death. The intact, GDX and ADX groups received vehicle solution (0.4% (w/v) Methocel A15LV Premium/5% ethanol) 24 hours before sacrifice. DHT (0.1 mg) was injected 3 h prior to killing in GDX+DHT groups. ADX mice received sodium chloride (0.9 g/dl) in their drinking water after the surgery. Gcc  was subcutaneously injected into ADX mice, and the tissues were harvested 3 h after the injection. All animal experimentation was conducted in accord with the requirements of the Canadian Council on Animal Care. All the tissues were from male mice except for female sexual tissues. The tissues were dissected from 15\u201351 mice, frozen in liquid nitrogen and stocked at -80\u00b0C until analysis.18 primer and cDNA synthesis kit (Invitrogen Canada Inc.). The cDNA libraries were digested with the restriction enzyme NlaIII . The 3'-terminal cDNA fragments were captured using streptavidin-coated magnetic beads . After ligation of 2 annealed linker pairs, the cDNA fragments were digested with BsmFI (New England Biolabs Inc.). The blunting kit from Takara Bio Inc.  was used for the blunting and ligation of the two tag populations. The resulting ligation products were amplified by PCR and digested with NlaIII. The band containing the ditags was extracted from the 12% polyacrylamid gel. Using T4 ligase (Invitrogen Canada Inc.), the ditags were self-ligated to form concatemers that were cloned into SphI site of pUC19. White colonies were screened by PCR and agarose gel to select long inserts for automated sequencing . The data discussed in this publication have been deposited in NCBIs Gene Expression Omnibus [III restriction site (CATG) at the 3' end of a given transcript. To overcome the lower quality of some EST sequences, the tags that did not identify a well-characterized mRNA were required to match at least two ESTs in the same UniGene Cluster including one EST with a known polyA tail. To identify the transcripts, the sequences of 15 bp SAGE tags were matched with public databases. The tag numbers normalized by 100000 are shown in Tables Total RNA was isolated from tissues by using the RNA extraction kit . Approximately 5 \u03bcg of mRNA was extracted with Oligotex mRNA Mini Kit . The SAGE method was performed as previously described ,14. In b Omnibus  and are The SAGE method has very good reproducibility . HoweverKEK has participated in the SAGE analyses including the bioinformatic analysis and wrote the paper with assistance from YN and JFCG. MY contributed to the conception and design of the project and drafted the manuscript. JSA directed the study, contributed to the conception and design of the project, analysis and interpretation of the data and drafted the manuscript. All the authors edited, read and approved the final manuscript."}
{"text": "One of the important goals of microarray research is the identification of genes whose expression is considerably higher or lower in some tissues than in others. We would like to have ways of identifying such tissue-specific genes.We describe a method, ROKU, which selects tissue-specific patterns from gene expression data for many tissues and thousands of genes. ROKU ranks genes according to their overall tissue specificity using Shannon entropy and detects tissues specific to each gene if any exist using an outlier detection method. We evaluated the capacity for the detection of various specific expression patterns using synthetic and real data. We observed that ROKU was superior to a conventional entropy-based method in its ability to rank genes according to overall tissue specificity and to detect genes whose expression pattern are specific only to objective tissues.ROKU is useful for the detection of various tissue-specific expression patterns. The framework is also directly applicable to the selection of diagnostic markers for molecular classification of multiple classes. A major challenge of microarray analysis is to detect genes whose expression in a single or small number of tissues is significantly different than in other tissues. Accurate identification of such tissue-specific genes can allow researchers to deduce the function of their tissues and organs at the molecular level .Q) based on entropy to estimate the degree of a gene's specificity on a particular tissue, the issue of redundancies remains where top-ranked genes as specific to tissue A are also top-ranked as specific to tissue B. We assert such genes are not specific to A or B, but rather are genes specific to both A and B. For example, we observed that two of the top five probesets specific to liver were also found in the top five probesets specific to gall bladder [Several methods have been used for this purpose -5. Of th bladder . The iss bladder , when thUnlike ranking-based methods, methods based on outlier detection are free from the issue of redundancies because they identify tissues corresponding to both over- and under-expressed outliers for each gene ,5. ThereThis complementary relationship between ranking-based and outlier-based methods led us to develop a combined approach, ROKU. ROKU analyzes any type of tissue-specific genes  in two steps. First, it ranks genes according to overall tissue-specificity using Shannon entropy, and second, for each gene, it identifies specific tissues whose observations are regarded as outliers using a method of Kadota et al. . We applWe first show typical examples of various types of gene expression patterns. We here divided tissue-specific genes into two levels, a narrow sense and a broad sense. Genes over-expressed in a small number of tissues but unexpressed or slightly expressed in others, such as those shown in Figs. x =  is given, the entropy H(x) can be calculated by equation 1 (See Methods). The range of H is from 0 whose gene expression is perfectly restricted in a single tissue  whose gene expression pattern is flat in all the interrogated tissues . The entropy H for each gene vector x is given by the number in black above the figures. Clearly, direct calculation of the entropy for raw gene vector x works well only for detecting tissue-specific genes in a narrow sense  and cannot identify those genes as 'tissue-specific'.When one gene vector sue Fig.  to log2. The Tukey biweight yields a robust weighted mean able to resist 50% of outliers [H(x'), for the processed vectors to obvious tissue-specific genes in a broad sense  become high after data processing. For example, the value (0.04) for tissue 3 in Fig. N, N = 10) in this case, such high values decisively contribute low entropy to the gene expression pattern. Also, entropy scores, H(x') and H(x), to non-specific (or randomly expressed) genes are quite similar and close to the maximum (3.32)  Figs.  and 1h. x', (2) calculates the entropy H(x'), and (3) assigns specific tissues to each probeset whose observations are detected to be 'outliers' (see Methods). We compared the performance of ROKU to that of Schug's method, which directly uses the original/non-processed vector x for measuring the entropy H(x) [H(x') and H(x)) for all probesets are available in the additional file [see To further investigate the validity of our method (ROKU), we applied the method to a public gene expression matrix consisting of 36 normal human tissues and 22,283 probesets . Brieflyopy H(x) . The twofile see .H(x') - H(x)) calculated by the two methods. Since ROKU outputs relatively low entropy to each probeset compared to Schug's method as a whole [see H(x') - H(x)) tends to be negative: -0.425 .To compare the agreement of top-ranked probesets between ROKU and Schug's method we analyzed the percentage of common probesets in a top-ranked set of ~22,283 probesets. About 80% of ~3,000 top-ranked probesets are common, indicating that ROKU does not change the rank of probesets drastically (data not shown). One way to compare the effect of the data processing used in ROKU to that used in Schug's method is to sort probesets in order of increasing magnitude by the difference between the two entropy scores  - H(x)) valued probesets and Fig. H(x') = 1.950 and H(x') <H(x)) for the probeset '206319_s_at' and a high entropy (H(x') = 4.729 and H(x') > H(x)) for the probeset '201131_s_at'. This is quite reasonable because visual evaluation admits the former to be tissue-specific and the latter to be non-specific. Schug's method, however, gives quite similar values (4.235 for the former and 4.228 for the latter) for the two probesets: the entropy for the former is higher than that for the latter.Table H(x') > H(x): processed expression vectors are less tissue-specific than the original vectors. Visual evaluation for those probesets showed no probeset exists whose entropy score is improperly assigned, i.e., no obvious tissue-specific probesets exist. These results demonstrate the data processing strategy used in ROKU successfully estimated/ranked probesets by their overall tissue specificity on real data. We verified such trends in other microarray datasets (data not shown).There are 858 probesets satisfying N/2 tissues and low expression in other tissues. ROKU gives the processed expression pattern as 'flat' and H(x') = log2(N). Accordingly, ROKU cannot distinguish such differential expression patterns from constant expression patterns because it gives the same entropy scores for the two patterns. In other words, H(x') is not useful for identifying non-specific genes. Nevertheless, this disadvantage is not a problem for detecting the tissue-specific expression patterns we focused on. We also observed that there was no probeset suffer from this disadvantage in the real data set.Note that ROKU is inferior to Schug's method  in rare cases. For example, consider a gene expression pattern of constant high expression in As mentioned earlier, the entropy does not indicate which tissues are specific though it can rank genes according to their degrees of overall tissue specificity. To identify such specific tissue when they exist, ROKU employs an outlier-detection-based method proposed by Kadota et al.  (see MetH(x'): ROKU can rank genes with particular tissue-specific patterns by their overall tissue specificity. We compared the performance of ROKU to that of Schug's Qt(x) statistic [t.For example, ROKU identifies 59 probesets specific to lung and 291 probesets specific to fetal lung and of course no redundancies exist between the two sets by virtue of the advantage of the original method . Since Rtatistic  which caH(x') statistic and Schug's Qt(x) statistic [Qt(x) statistic for a tissue t in a gene expression vector x is defined as Qt(x) = H(x) - log2(pt) (see Methods for details). Clearly, ROKU can detect probesets whose expression patterns are specific only to each of the objective tissues  while Schug's Q statistic cannot. This is because a low Qt(x) statistic indicates that gene x is relatively highly expressed in a small number of tissues including tissue t, but does not always indicate whether the expression pattern of x is specific only to the tissue t. Indeed, both probesets  identified by Schug's Qt(x) statistic include another tissue in addition to the objective tissue. We analyzed this trend in the top-ranking probesets  for the detection of genes with tissue-specific expression patterns. ROKU was developed to compensate for the disadvantages of two conventional methods ,4 by comPublicly available Affymetrix U133A oligonucleotide microarray data for 22,283 genes in 36 various normal human tissues  were dowx =  for N tissues and an observation xt for tissue t. The entropy of the gene is calculated asThe use of Shannon entropy  to rank pt is the relative expression of xt for tissue t defined as H ranges from zero to log2(N), with the value 0 for genes expressed in a single tissue  for genes expressed uniformly in all the interrogated tissues Tbw is the one-step Tukey biweight, a popular statistic robust against outliers. It provides as much robustness as a median and is also used to estimate the expression signal from each probe set in the Affymetrix Micro Array Suite (MAS 5.0) software package [Tbw are the same as those adopted in the tukey.biweight function in R package 'affy'  [x' of a gene, while Schug et al. [x, to calculate the gene's entropy (H(x') and H(x)) as a measure of the overall tissue specificity.where  package ,13. The  0.0001) . Our metg et al.  uses theU for identifying outliers is defined asAs mentioned above, the entropy does not indicate which tissues are specific, but is a measure of the overall tissue specificity of a gene. We imagine observations in specific tissues to be easily visualized as outliers on the over- and/or under-expressed side if any exist. We used an outlier-detection-based method proposed by Kadota et al.  to detecn and s denote the numbers of non-outlier and outlier candidates, and \u03c3 denotes the standard deviation (SD) of the observations of the n non-outlier candidates. The procedure is first, normalize the gene vector x =  for N (=n+s) tissues by subtracting the mean and dividing by the SD; second, sort the normalized values  by order; third, calculate the statistics U for various combinations of outlier candidates starting from both sides of the values; finally, regard tissues corresponding to outliers detected in the combination of the minimum U as 'specific'.where KK invented the method and wrote the paper. JY made critical comments in light of the current algorithm. YN, TT, and KS provided critical comments and led the project.Full information analyzed by ROKU for dataset of Ge et al. (2005). For the original gene expression matrix, an outlier matrix  is provided. It also contains two entropy scores measured by ROKU and Schug's method and their ranks.Click here for file"}
{"text": "Human adipose tissue is a major site of expression of inhibin beta B (INHBB) which homodimerizes to form the novel adipokine activin B. Our aim was to determine if molecules needed for a local action of activin B are expressed in adipose tissue.n\u00a0=\u00a090) compared to obese (n\u00a0=\u00a090) subjects (p\u00a0=\u00a04\u00a0\u00d7\u00a010\u221231). Adipose tissue ALK7 expression correlated with several measures of body fat, carbohydrate metabolism and lipids. In addition, ALK7 and INHBB expression correlated but only in lean subjects and in subjects with normal glucose tolerance.Microarray analysis showed that adipose tissue expressed activin type I and II receptors and that the expression of activin receptor-like kinase 7 (ALK7) was adipose tissue specific. In obesity discordant siblings from the SOS Sib Pair study, adipose tissue ALK7 expression was higher in lean (We conclude that activin B may have local effects in adipose tissue and thereby influence obesity and its comorbidities. Activins were first described as gonadal hormones and their effects on reproduction have been extensively studied. Recent studies show that activins are also produced by extragonadal tissues where they have diverse effects Adipose tissue secretes a large variety of bioactive molecules, often referred to as adipokines. The adipokines have local effects or signal to other tissues, and they may play a central role in obesity-related morbidities such as diabetes, cardiovascular disease, cancer and dyslipidemia Activins belong to the TGF-\u03b2 family of growth factors Activins interact with receptor complexes consisting of two receptors, type I and II, both of which are serine/threonine kinases Subjects. The SOS Sib Pair study includes 154 nuclear families with BMI discordant sibling pairs (BMI difference \u2a7e10\u00a0kg/m2) resulting in a study population of 732 subjects. In this study, the most extreme siblings according to BMI were chosen in each family. Gender discordant sib pairs were excluded, resulting in 78 pairs of sisters and 12 pairs of brothers.For tissue distribution, adipose tissue biopsies from six healthy volunteers (BMI range 22.4\u201329.3) were obtained. Adipocytes were isolated as previously described Tissue distribution of gene expression. DNA microarray expression profiles  from 65 human tissues were acquired from the GEO database . Each tissue was represented by profiles from 3 to 9 subjects and these were used to calculate an average expression profile. For inhibin genes and activin receptor genes, the average expression in the 65 tissues was calculated and used for comparison with the adipose tissue expression. Probe sets were identified using Nettaffx  and for each gene, the probe set with the highest signal was used. The following probe sets were used; INHA (210141_s_at), INHBA (210511_s_at), INHBB (205258_at), INHBC (207687_at), INHBE (210587_at), ALK7 (1552519_at), ALK4 (205209_at), ActRII (205327_s_at) and ActRIIB (236126_at).For verification of tissue distribution, RNA from adipose tissue and adipocytes  and from the Human Total RNA Master Panel II , was reversed transcribed using the High Capacity cDNA RT kit . Reagents for real-time PCR analysis of ALK7 (Hs00377065_m1) and peptidyl-prolyl isomerase A  were from Applied Biosystems. cDNA corresponding to 10\u00a0ng RNA per reaction was used for real-time PCR in the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems). Serial dilution of cDNA synthesized from pooled RNA was used to generate standard curves. PPIA expression was used to normalize ALK7 expression between samples. All samples were analyzed in triplicate.Microarray analysis in the SOS Sib Pair study. Adipose tissue was obtained by needle aspirations in the paraumbilical area. Total RNA, cDNA and hybridization  was performed as previously described Measurements in the SOS Sib Pair study. Measurements of anthropometry, fat mass (FM), fat-free mass (FFM), blood pressure (BP), fasting glucose, total cholesterol, triglycerides, high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), serum insulin, serum C peptide, and highly sensitive C-reactive protein (hs-CRP) were performed at the Sahlgrenska University Hospital. Dual-energy X-ray absorptiometry (DEXA) was performed with LUNAR DPX-L . The DEXA generates a three-compartment model consisting of FM, lean tissue mass (LTM), and bone mineral content (BMC). The FFM was calculated as LTM\u00a0+\u00a0BMC.Statistics. Statistical analyses were performed using SPSS  and SAS (version 9.1). Values are given as means\u00a0\u00b1\u00a0SD unless stated otherwise. Correlation between ALK7, INHBB expression and anthropometric and biochemical markers were performed using the Spearman rank correlation test. Partial correlation was used to control for sex, age and fat mass when appropriate. In order to obtain approximate normal distributions of expression data, microarray signals in the whole SOS Sib Pair study offspring cohort (n\u00a0=\u00a0359) were transformed using Box\u2013Cox power transformations. Subsequently, expression data were standardized to mean\u00a0=\u00a00 and variance\u00a0=\u00a01. Differences in gene expression between lean and obese siblings were assessed using a paired t-test. A P value less than 0.05 (two-sided) was considered statistically significant. Linear relationships between ALK7 and INHBB transcript levels that differed between subgroups  were assessed in generalized linear models in which subgroup class was included as a covariate beside the transcript level. A p-value <0.05 for the interaction between subgroup class and transcript level was taken as evidence of a significantly different linear relationship between subgroup classes.Adipose tissue expression levels of inhibin genes and activin receptor genes were measured and compared with the mean expression levels of these genes in 65 different human tissues, hereafter referred to as reference tissues. In line with our previous results Among the type I activin receptor genes, ALK4 and ALK7 are known to mediate activin B action Of the type II receptors, the adipose tissue expression of the ActRII gene was slightly above and the adipose tissue expression of the ActRIIB gene was slightly below the mean expression in the reference tissues.p\u00a0=\u00a04\u00a0\u00d7\u00a010\u221231). In contrast, INHBB expression levels were increased in the obese compared to the lean siblings (p\u00a0=\u00a06\u00a0\u00d7\u00a010\u221213).The high expression of genes encoding the activin receptor ALK7 and the activin subunit INHBB in human adipose tissue opens the possibility that locally produced activin B influences adipose tissue function. We therefore examined ALK7 and INHBB expression in relation to obesity and components of the metabolic syndrome. In the SOS Sib Pair study, adipose tissue ALK7 expression was markedly decreased in the obese compared to the lean siblings , and this persisted after controlling for sex and age . In the obese subjects, there was no correlation , and the slope was significantly different for the lean vs obese  and no correlation in the obese group . There were also several differences in the relation between gene expression levels and measures of carbohydrate metabolism in the two groups (p\u00a0<\u00a02\u00a0\u00d7\u00a010\u22125 for each of the three quartiles after adjusting for sex and age). Since HOMA-IR is derived from glucose and insulin levels, we next performed the same calculations for insulin and glucose quartiles. For insulin, the pattern was strikingly similar to that seen for HOMA-IR, i.e. a loss of correlation between ALK7 and INHBB expression in the highest quartile  and significant correlations in the remaining quartiles . Hence, the slope was significantly different between the subjects from the three lowest insulin quartiles compared to the subjects from the highest insulin quartile .When the relationship between ALK7 mRNA and INHBB mRNA was analyzed there was a negative correlation in the lean group (o groups . We therIn this study, we have extended our previous observation that the beta B subunit, which homodimerizes to form activin B, is predominantly expressed in human adipose tissue Activins are involved in various physiological processes, such as cell proliferation, immune function, wound repair and reproduction, and exert their effects in many tissues ALK7 expression has previously been detected in the brain, pancreas and colon, however, adipose tissue was not included in the analysis in vitro also support our hypothesis that the activin B receptor ALK7 is implicated in the regulation of metabolism and adipose tissue function. ALK7 is specifically expressed during the late phase of adipocyte differentiation Recent studies in rodents and In conclusion, human adipose tissue expresses receptors required for paracrine or autocrine effects of activin B. The effects of obesity on adipose tissue expression of ALK7 and INHBB genes, the strong correlations with markers of the metabolic syndrome and the dysregulation between ligand and receptor transcripts in subjects with glucose intolerance indicate that the adipokine activin B has hitherto unrecognized metabolic effects."}
{"text": "The chicken is an important agricultural and avian-model species. A survey of gene expression in a range of different tissues will provide a benchmark for understanding expression levels under normal physiological conditions in birds. With expression data for birds being very scant, this benchmark is of particular interest for comparative expression analysis among various terrestrial vertebrates.We carried out a gene expression survey in eight major chicken tissues using whole genome microarrays. A global picture of gene expression is presented for the eight tissues, and tissue specific as well as common gene expression were identified. A Gene Ontology (GO) term enrichment analysis showed that tissue-specific genes are enriched with GO terms reflecting the physiological functions of the specific tissue, and housekeeping genes are enriched with GO terms related to essential biological functions. Comparisons of structural genomic features between tissue-specific genes and housekeeping genes show that housekeeping genes are more compact. Specifically, coding sequence and particularly introns are shorter than genes that display more variation in expression between tissues, and in addition intergenic space was also shorter. Meanwhile, housekeeping genes are more likely to co-localize with other abundantly or highly expressed genes on the same chromosomal regions. Furthermore, comparisons of gene expression in a panel of five common tissues between birds, mammals and amphibians showed that the expression patterns across tissues are highly similar for orthologuous genes compared to random gene pairs within each pair-wise comparison, indicating a high degree of functional conservation in gene expression among terrestrial vertebrates.The housekeeping genes identified in this study have shorter gene length, shorter coding sequence length, shorter introns, and shorter intergenic regions, there seems to be selection pressure on economy in genes with a wide tissue distribution, i.e. these genes are more compact. A comparative analysis showed that the expression patterns of orthologous genes are conserved in the terrestrial vertebrates during evolution. The chicken is an important model species for evolutionary and developmental biology, immunology, genetics, as well as for agricultural science. The completion of a draft sequence of the chicken genome Several studies, using chicken as a model, have compared gene expression differences under different infection treatments using microarrays Regions of IncreasedGene Expression). RIDGEs were reported to be associated with higher expression, higher gene density, shorter gene introns, shorter genes, and some other genomic features in chicken Furthermore, clustering of highly expressed genes within specific chromosomal regions has been reported in human Evolutionary changes in gene expression account for most phenotypic differences between different species. Studies on conservation of global gene expression patterns between human and apes To summarize, the objectives of this study are to address the following questions: 1) what is the distribution of gene expression in chicken? 2) Do genes with distinct breadth of expression (number of tissues where a gene is expressed) show a correlation with certain structural genomic features in chicken? 3) Are the expression patterns of orthologous genes conserved among species?Normalized intensities were used as gene expression levels and genes were defined as being expressed only when their expression was higher than 99% quantile value of the expression of all negative control spots across all the arrays in this study  as descrThe significant  GO terms (BP) of housekeeping genes indicate that these widely expressed genes are mainly involved in a number of essential biological processes for maintaining a cell . GO term\u221213, Wilcoxon Rank Sum Test), coding sequence length , average intron length , and intergenic region length  were found between housekeeping and tissue-specific genes, housekeeping genes have, on average, shorter average exon length than tissue-specific genes, but the difference is not statistically significant   . These rA chicken transcriptome map is described previously, and regions with clusters of the most highly expressed genes, covering about 10% of the chicken genome, so called \u201cRIDGEs\u201d, are identified Conservation of gene expression was compared by checking the 3,892 1\u22361\u22361 orthologous genes in mouse, chicken and frog . Pair-wiBesides testing conservation of gene expression of orthologous genes between species, we also tested whether homologous tissues  are more similar to each other compared to non-homologous tissues. After transforming gene expression intensities to relative expression ratios (RA) across the same panel of tissues, a comparison between global gene expression profiles among tissues in different species was possible. The rank correlation coefficient among different tissues showed that homologous tissues in three different species are more similar compared to non-homologous tissues ; especiaThe main objective of this study was to survey gene expression profiles across a set of eight normal chicken tissues. We present a microarray expression dataset surveying about 8,792 chicken Ensembl genes across 8 different chicken tissue types in 5-fold . For most genes the distribution of expression is observed across several different tissues . For 723The on average smaller size observed for the housekeeping genes is due to both a shorter coding sequence as well as a shorter intron length. Furthermore, the smaller size of the intergenic region also contributes to a higher gene density of the areas containing the housekeeping genes, suggesting a selection for compactness, which has also been reported in human The hypothesis for the existence of RIDGEs is that evolution favors highly expressed genes to be co-localized, as transcription of one gene would help the chromatin of neighboring genes to \u201copen up\u201d during transcription. The favorable distribution of housekeeping genes within RIDGEs again indicates that these genes need to be expressed at relative higher levels  and at aIn contrast to direct sequence comparisons of orthologous genes, the comparison of the gene expression profiles of orthologous genes has a number of caveats. First of all, the expression levels of genes are dynamic and change with developmental and physiological state. Secondly, for all downloaded gene expression survey data, the tissue samples surveyed in mouse, chicken and frog Nevertheless, the expression of orthologous genes is generally well conserved as compared to random gene pairs . If genehttp://www.ncbi.nlm.nih.gov/geo/) (accession number: GSE17108), the data was published in a previous study describing a transcriptome map in the chicken genome The microarray data was downloaded from GEO (We used R/Bioconductor All the genes having a chicken Ensembl gene ID were mapped to their 1-to-1 human orthologous genes using bioconductor package biomaRt Mus musculus), chicken , and frog  were downloaded from Ensembl. The normalized gene expression data for mouse and frog were downloaded from the functional landscape of mouse gene expression website (http://hugheslab.med.utoronto.ca/Zhang) and the Conservation of Core Gene Expression in Vertebrate Tissues: Supplementary Data website (http://hugheslab.ccbr.utoronto.ca/supplementary-data/vertebrate_expression), respectively. The expression data of chicken in this study was normalized using the same method as used in these two previous studies Orthologous genes for mouse (Table S1Expression data of 8908 genes in eight chicken tissues.(1.82 MB XLS)Click here for additional data file.Table S2Lists of tissue specific genes and housekeeping genes.(0.20 MB XLS)Click here for additional data file.Table S3GO enrichment results of tissue-specific genes.(0.02 MB XLS)Click here for additional data file.Table S4GO enrichment result of housekeeping genes.(0.02 MB XLS)Click here for additional data file.Table S5List of 3,892 1\u22361\u22361 orthologous genes in mouse, chicken and frog downloaded from Ensembl database via biomaRt package.(1.15 MB XLS)Click here for additional data file."}
{"text": "Alternative splicing is an important mechanism that increases protein diversity and functionality in higher eukaryotes. Affymetrix exon arrays are a commercialized platform used to detect alternative splicing on a genome-wide scale. Two probe summarization algorithms, PLIER (Probe Logarithmic Intensity Error) and RMA (Robust Multichip Average), are commonly used to compute gene-level and exon-level expression values. However, a systematic comparison of these two algorithms on their effects on high-level analysis of the arrays has not yet been reported.In this study, we showed that PLIER summarization led to over-estimation of gene-level expression changes, relative to exon-level expression changes, in two-group comparisons. Consequently, it led to detection of substantially more skipped exons on up-regulated genes, as well as substantially more included  exons on down-regulated genes. In contrast, this bias was not observed for RMA-summarized data. By using a published human tissue dataset, we compared the tissue-specific expression and splicing detected by Affymetrix exon arrays with those detected based on expressed sequence databases. We found the tendency of PLIER was not supported by the expressed sequence data.We showed that the tendency of PLIER in detection of alternative splicing is likely caused by a technical bias in the approach, rather than a biological bias. Moreover, we observed abnormal summarization results when using the PLIER algorithm, indicating that mathematical problems, such as numerical instability, may affect PLIER performance. Alternative splicing (AS) contributes greatly to protein diversity throughout the evolution of complex organisms. According to Johnson et al. , about 7The Affymetrix GeneChip Human Exon 1.0 ST array has an extremely high probe density. The platform contains over 1.4 million probesets, each of which contains four perfect match (PM) probes that cover over 1 million exons. While this design has added new capacity to the microarray platform, it also poses new challenges in data analysis. First of all, gene-level and exon-level expression values need to be estimated using probe signals. This process is called summarization and several algorithms have been proposed for this purpose (for example ). The mot as a target response which represents the abundance of the target mRNA, and f a feature response which represents the affinity of the probe. The model of RMA  is specified asBoth of the two algorithms implement a multiplicative error model. While RMA assumes that the error is proportional to the normalized and background-adjusted probe intensity, PLIER assumes that the error is proportional to the PM intensity without background correction. Define i = 1,... I represents different arrays and j = 1,..., J represents different probes. eij is an error term which follows the log-normal distribution. The model of PLIER iswhere BKGij is the background value specific for array i and probe j.where ti) and log(fj). In contrast, PLIER algorithm works on the PM intensities directly without log-transformation. It defines rij = log(eij). In order to down-weigh outliner probes with large absolute values of rij, the loss function is specified as z is a tuning constant for robustness. Newton's method is applied to find the values of f and t that minimize the loss function. The IterPLIER method, which is an extension of PLIER algorithm, generates gene-level signals based on consecutive exons 12]. For For the human tissue dataset, similar filtering steps were performed. First, we defined a probeset as present in a tissue if its DABG p < 0.05 in at least 2 samples (out of 3) of that tissue. Since there are a total of 11 tissues in the dataset, we filtered for: (1) probesets present in either the test tissue or five of the other tissues; (2) genes present both in the test tissue and in five of the other tissues; (3) probesets with type 1 cross-hybridization. In addition, we retained only genes for which the mean expression ranked in the top 50% for both IterPLIER and RMA, since genes with low expression levels may associate with higher false positive rates in the detection of AS .i in gene j, NI is denoted as As mentioned before, NI was calculated for each exon and used in statistical tests. For exon Ei and Gj are the expression values of exon i and gene j, respectively.where i in gene j, when comparing samples A and B, SI is denoted as NI represents the inclusion rate of an exon in a sample, while the splicing index, SI, measures the difference in NI between two samples. For exon For the colon cancer dataset, paired t-tests on gene-level signals were used to detect differential expression between normal and cancer samples. Paired t-tests on NI were used to detect differential splicing between the two groups. For the human tissue dataset, two sample t-tests were used on gene-level signals to detect tissue-specific expression . Two sample t-tests were used on NI to detect tissue-specific splicing .http://tisa.kribb.re.kr/AGC. Genes and exons in the database were mapped to transcripts and probesets on the exon array based on physical position. For each tissue in the TISA database, we counted the number of exons located on tissue-specific genes and with reported tissue-specific splicing. Then we conducted the chi-square test to determine whether the ratio of relatively skipped exons to relatively included exons was different from 1:1 to see if there is an enrichment of skipped exons on the tissue-specific genes. Tissue-specific expression and splicing events detected using the human tissue dataset were compared to the TISA database , we defined SI for the two datasets separately. For the colon cancer dataset, we defineSI represents the difference in NI for exon i in gene j in the kth sample pair, and \u0394G represents the difference in expression levels of gene j for the kth sample pair.where For the human tissue dataset, we defineSIij and \u0394Gj represent the mean difference in inclusion rates of exon i and in expression levels of gene j between the cerebellum vs. non-cerebellum tissues, respectively.where G for PLIER-summarized data, while SI and \u0394G were correlated to a much lesser extent  for RMA-summarized data. Person and Spearmen correlations between SIi, j, k and \u0394Gj, k in the colon cancer dataset were as large as -0.492 and -0.456, respectively, for the PLIER-summarized data. In contrast, the correlations were 0.048 and 0.045 for the RMA-summarized data. Similarly, in the human tissue dataset, the Person and Spearmen correlations between SIi, j and \u0394Gj were -0.58 and -0.60 when using PLIER, and -0.021 and 0.055 when using RMA, respectively.In both datasets, we found that SI was strongly negatively correlated with \u0394G > 1, (2) -1 \u2264 \u0394G \u2264 1, (3) \u0394G < -1. For PLIER in both datasets when \u0394G > 1, SI is relatively negatively distributed; when -1 \u2264 \u0394G \u2264 1, the distribution of SI centers at zero; and when \u0394G < -1, SI is relatively positively distributed. However, the distributions of SI in the three cases for RMA are all centered around zero.The negative correlations indicate that PLIER summarization leads to detection of more included exons on down-regulated genes, as well as more skipped exons on up-regulated genes. This is illustrated in Figure Table G is that PLIER leads to over-estimation of gene-level expression changes between the sample groups, relative to the exon-level expression changes. Since by definition,Another point that can be inferred from the negative correlation between SI and \u0394Gj, A - Gj, B| > |Ej, A - Ei, B| for most of the exons in gene j), leads to the negative correlation between SI and \u0394G. Figure proportion of probesets whose absolute mean expression difference is smaller than the corresponding absolute mean gene expression difference between the sample groups under consideration . This figure clearly shows the tendency of PLIER to over-estimate gene-level expression differences, relative to exon-level expression differences.so SI actually compares the magnitude of exon-level expression changes with the corresponding gene-level expression change between samples. Over-estimation of gene-level expression change, . This observation helps to explain what we have observed for PLIER gene-level estimation.We demonstrated that PLIER tended to \"weigh\" highly expressed probesets more heavily and over-estimate gene expression differences. These two observations can be linked together if probesets with higher expression are likely to be associated with larger exon-level expression differences. As shown in Figure fj is independent of signal intensity is probably not completely hold either, which may also have an influence on gene-level estimation.One possible reason for the observed difference between PLIER and RMA summarization is that, the multiplicative error model may not be completely hold for probes with low intensities. As it is generally thought that low intensity features are likely to be associated with larger coefficients of variation, lowly expressed probesets are typically filtered out in microarray analysis. So to minimize the loss function Noh et al. used mRNA and EST sequences from public databases to identify tissue-specific gene expression and splicing in humans and mice. The work flow of their study was thoroughly described in  and theiThe TISA database contains 46 tissues. A total of 4,527 exons were found to be involved in the 3,695 tissue-specific splicing events (with p < 0.05), while 1,753 of these exons were located on genes that were specifically expressed in the same tissue (an exon may be counted multiple times if it is involved in more than one tissue-specific splicing event). Nine exons with inconsistent tissue specificity  were removed, and the remaining 1,744 exons were kept for further analysis.G. So we believe the tendency of PLIER to predict these events is due to technical bias, as opposed to a biological bias.  splicing forms. The TISA database contains 8 splicing forms, of which 3 splicing forms, 'cassette exon', 'multiple cassette exon' and 'mutual exclusive exon' are most readily detectable by the exon array, while splicing forms such as 'intron retention' may not be detectable; (2) tissue content. The TISA database contains 46 tissues, while the human tissue dataset contains only 11 tissues. If only exactly matched tissue names are considered, 10 tissues  are present in both cases; (3) mapping between the two platforms. Only core probesets on the exon array were considered in this study. This may result in a bias in the mapping, since tissue-specific exons in the TISA database may be present in smaller number of mRNAs and thus may be less likely to be mapped to core probesets. By considering combinations of the 3 factors, we listed a total of 8 cases in Table This study compared gene- and exon-level tissue specificity identified using the exon arrays with the TISA database to assess reliability of the exon array platform and the performance of PLIER and RMA. The mapping between the two platforms showed reasonable agreement in gene- and exon-sequence clustering. At the gene level, we observed significant consistency between the two platforms in detection of tissue-specific expression for both PLIER- and RMA-summarized data. RMA performing slightly better than PLIER in distinguishing \"true positives\" from \"true negatives\", where the tissue-specific expression reported in TISA were assumed to be true events. However, at the exon-level, the consistency between the two platforms was not significant, regardless of the summarization method. In addition, the difference between the two methods was not significant. Due to the lack of significant agreement between the TISA database and the tissue dataset, we did not reach a conclusion as to which method was better  for calculation of gene-level or exon-level expression, while the 'pm-gcbg' method corrects the PM signal by subtracting a GC-content specific background signal. Thus, we expected the gene-level or exon-level signals computed with the 'pm-gcbg' option to be slightly smaller than those computed with the 'pm' option. Although this was true for the vast majority of genes and exons, to our surprise, the expression values computed with the 'pm-gcbg' option for a small proportion of genes and exons were much greater than those computed with the 'pm' option. Figure Since the IterPLIER algorithm is based on PLIER, and PLIER relies on Newton's method to find the best solution for parameters, the observed phenomena may be due to numerical instability, which can cause the algorithm to be trapped in a local maximum, resulting in retrieval of an abnormal solution for the parameters. By using the APT software (Affymetrix Power Tools) and choosing different parameters for controlling the PLIER algorithm, similar problems can be avoided in some cases, but not in all (data not shown).In this study, we found that the two commonly used summarization algorithms, PLIER and RMA, behaved differently in detection of AS. Due to different gene-level estimation, PLIER showed a strong tendency to detect relatively skipped exons on up-regulated genes and relatively included exons on down-regulated genes, while this tendency was not observed when using RMA. To determine whether this tendency of PLIER represents a real biological situation, we used tissue-specific expression and splicing events that have been identified with sequence data and summarized in the TISA database as references. The TISA data did not show significant enrichment of skipped exons on genes with tissue-specific expression, a finding that did not support the tendency of PLIER. So we concluded that the observed tendency of PLIER is due to technical bias. We also compared the performance of RMA and PLIER in detection of AS by using tissue-specific splicing events in the TISA database as true positives. The consistency between the exon array data and the TISA database was low for both summarization methods, and the difference between the two methods was not significant. Given the observed bias of PLIER, this result may suggest that the efficacy of the RMA algorithm can be further improved as well. More sophisticated methods that incorporate sequence information or other characteristics of the probes may help to achieve more accurate estimation of gene- and exon-level expression .AS: (Alternative Splicing); PLIER: (Probe Logarithmic Intensity Error); RMA: (Robust Multichip Average); DABG: (Detection above Background); NI: ; SI: (Splicing Index); TISA: (Tissue-specific Alternative splicing).The work presented here was carried out in collaboration between all authors. YC and YQ defined the research theme. YQ, YC and FH designed methods and experiments, analyzed the data, interpreted the results and wrote the paper. All authors have contributed to, seen and approved the manuscript.Comparison of the analysis results of the human tissue dataset and the TISA database. Detailed description on how the tissue-specific genes and exons identified with the human tissue dataset were compared to those reported in TISA database in this study.Click here for file"}
{"text": "Vertebrates share the same general body plan and organs, possess related sets of genes, and rely on similar physiological mechanisms, yet show great diversity in morphology, habitat and behavior. Alteration of gene regulation is thought to be a major mechanism in phenotypic variation and evolution, but relatively little is known about the broad patterns of conservation in gene expression in non-mammalian vertebrates.We measured expression of all known and predicted genes across twenty tissues in chicken, frog and pufferfish. By combining the results with human and mouse data and considering only ten common tissues, we have found evidence of conserved expression for more than a third of unique orthologous genes. We find that, on average, transcription factor gene expression is neither more nor less conserved than that of other genes. Strikingly, conservation of expression correlates poorly with the amount of conserved nonexonic sequence, even using a sequence alignment technique that accounts for non-collinearity in conserved elements. Many genes show conserved human/fish expression despite having almost no nonexonic conserved primary sequence.cis-regulatory restructuring.There are clearly strong evolutionary constraints on tissue-specific gene expression. A major challenge will be to understand the precise mechanisms by which many gene expression patterns remain similar despite extensive  Vertebrates all share a body plan, gene number and gene catalog -4 inhericis- and trans-regulatory mechanisms, and they are often used as a starting point for the identification of regulatory mechanisms. One estimate, using collinear multiple-genome alignments, suggested that roughly a million sequence elements are conserved in vertebrates  [cis-regulatory potential of the most highly conserved nonexonic elements  -29, withebrates) , and a sexample, ,29,30). example,  found thturnover ,33, and turnover . As furtturnover  that accTrans-acting factors (transcription factors or TFs) also show examples of striking conservation, such as among the homeotic factors, and diversifying selection [trans-regulatory architecture as a driving evolutionary mechanism [Drosophila developmental transition, expression of transcription factor genes is more evolutionarily stable than expression of their targets, on average [election . Studieselection ,38, suppechanism . On the  average . The fac average ,42.cis-regulatory sequence and relationships between the two are not completely understood [cis-regulatory 'lexicon'  remains mostly unknown, testing individual enhancers is tedious and expensive, and many vertebrates are not amenable to genetic experimentation. These issues are of both academic and practical consequence: in addition to our curiosity about the origin and distinctive characteristics of the human species, primary sequence conservation is widely used to identify regulatory mechanisms. We reasoned that expression profiling data from species spanning much greater phylogenetic distance than humans and mice, and thus having greater opportunity for both neutral drift and positive selection, would allow assessment of the degree of conservation of tissue gene expression among all vertebrates, and a comparison of the conservation of expression to the conservation of nonexonic primary sequence. Here, we describe a survey of gene expression in adult tissues and organs in the main vertebrate clades: mammals, avians/reptiles, amphibians and fish. Our analyses demonstrate that core tissue-specific gene expression patterns are conserved across all major vertebrate lineages, but that the correspondence between conservation of expression and amount of conserved nonexonic sequence is weak overall, at least at a level that is detectable by current alignment approaches.Global trends in conservation of gene expression, conservation of derstood ,39,41, pGallus gallus), frog  and pufferfish (Tetraodon nigroviridis). Details of the experiments are found in the Materials and methods; lists of tissues are found in Additional data file 1. Clustering analyses of each dataset separately  shows that prominent tissue-specific expression patterns are found in all vertebrates.To examine gene expression in a broad range of vertebrates, we collected a compendium of gene expression datasets, consisting of previously published datasets for human  and mousr) = 0.63), consistent with a previous study comparing human and chimpanzee [r = 0.21), possibly reflecting evolution of kidney function (see Discussion). A dendrogram for the ten common tissues  shows clear segregation of the data for heart/muscle, eye, central nervous system (CNS), spleen, liver and stomach/intestine. Only the testis and kidney datasets are split, each into two groups, with pufferfish and/or frog forming the outlying group. Additional data file 4 shows that, among these 3,074 genes, the Gene Ontology (GO) processes enriched in tissues are also generally conserved across the five species. We conclude that programs of tissue-specific expression are broadly conserved among vertebrates.To ask whether tissue-specific gene expression patterns are conserved among vertebrates, we focused on 1-1-1-1-1 orthologs (genes that are present in a single unambiguous copy in each of the five genomes), because genes that have undergone duplication events are subject to different constraints from singletons ,46. Amonimpanzee . The relimpanzee . In contWe next sought to quantify the conservation of expression of individual genes. We used two conceptually simple measures intended to capture different aspects of conservation of expression. The first asks how often specific gene expression events (instances in which gene X is expressed in tissue Y) are conserved across all vertebrates. We refer to this as the 'binary measure' because, to simplify statistical analysis, we considered a fixed proportion of the normalized, ranked microarray intensities of genes in each tissue to be expressed ('1'), and analyzed the data using several such proportions . We then asked how often a gene is expressed in all species in a given tissue . The proportion of conserved expression events at different thresholds ranges from 3% to 19.3% of all possible expression events, among the 3,074 1-1-1-1-1 orthologs Figure , and ther = 0.4, the apparent false discovery rate is similar to that obtained with the 1/3 cutoff using the binary measure (27.4% versus 34.5%), as is the number of genes classified as having conserved expression . The overlap between these two sets of genes is higher than expected at random (417 versus 291 at random); however, it is far from absolute, indicating that the definition of conserved expression influences conclusions regarding conservation of expression.The second measure we used was Pearson correlation across the ten common tissues. As with the binary measure, we found that gene expression across tissues between real 1-1-1-1-1 orthologs is more similar than randomly matched genes in pairwise comparisons between species , 48.4% of all 1-1-1-1-1 orthologs  scored as having conserved expression at about 30% apparent false discovery rate. Thus, in just the ten common tissues we analyzed, gene expression is at least partially conserved for at least a third of all unique orthologs (48.4% \u00d7 0.7 = 33.9%) by at least one of our two definitions of conservation. The expression of these 1,488 genes in modern-day lineages is shown in Figure Although the focus of our study was to identify conserved gene expression patterns, our data are consistent with previous findings that divergence of gene expression scales with evolutionary time ,18 when We next asked what gene properties correlate with conservation of expression among the 3,074 measured unique orthologs. We considered the following gene properties: those that are contained in our data, that is, median expression level and Shannon entropy as a measure of tissue specificity and preferential expression in individual tissues; GO annotations; and sequence properties, that is, length of gene, size of encoded protein, presence of a DNA-binding domain (for known and predicted TFs), sequence conservation of encoded protein (pairwise BLASTP bit score) and amount of conserved nonexonic sequence  .p-values 1.55 \u00d7 10-4, 2.36 \u00d7 10-3, 2.24 \u00d7 10-3 and 4.98 \u00d7 10-5, respectively; Additional data file 8). In contrast, we did not find any evidence that the expression of TFs  is more or less conserved than that of non-TFs, in contrast to previous reports of both higher [Several observations emerged from this analysis. First, the genes with the highest expression similarity between species are most often genes expressed in a highly tissue-specific manner in tissues with specialized functions. Although the Pearson correlation is heavily influenced by extreme values, thus giving higher weight to tissue-specific pairs, most of these high scoring genes were also classified as conserved by our binary measure. Among the 50 genes with highest median pairwise Pearson correlation of expression are structural components of the eye lens, liver-synthesized proteins involved in the complement system and blood coagulation, and neurotransmitter receptors and transporters. This observation is supported by the GO categories enriched among genes with high expression similarity, such as synaptic transmission (GO:0007268), visual perception (GO:0007601), wound healing (GO:0042060) and muscle development (GO:0007517) (Wilcoxon-Mann-Whitney test (WMW) h higher  and loweh higher  rates ofcis-regulatory function, and it follows that a larger amount of conserved nonexonic sequence might correlate with a higher probability of conserved expression. However, we found that the correspondence was very weak: for example, for the binary model, we obtained Spearman correlations of -0.086 and 0.0029 with the number of nonexonic bases in Phastcons conserved regions [It is widely believed that conserved nonexonic sequence often serves a  regions  and in u regions , respect regions .cis-regulatory elements, particularly in pufferfish. In order to address this possibility, we developed a technique similar to that of Sanges et al. [We reasoned that pervasive shuffling might obscure most of the s et al.  to detecs et al.  , most (102) have no nonexonic conserved sequence in fish, on the basis of our SCEs. The expression of these 102 genes in the ten common tissues in the representatives of all modern lineages is shown in Figure We also examined the correlations between nonexonic sequence conservation and expression correlation at varying evolutionary distances from human. Although correlations remain weak Figure , we did p = 0.24, Kolmogorov-Smirnov test; see Materials and methods and Additional data file 9) and there is almost no correlation between EEL score and conservation of expression . We conclude that the regulatory architecture of the vast majority of genes has diverged beyond recognition by any current approaches, despite the apparently very similar regulatory output in many cases, and the likelihood that at least some orthologous TFs are functioning in the same tissues.Because TF binding sites are degenerate, it is conceivable that these genes have a high number of conserved TF binding sites, despite their lack of primary sequence conservation. To examine this possibility we used Enhancer Element Locator (EEL)  to alignOur data provide a resource of large-scale gene expression data in tissues of three non-mammalian vertebrates and demonstrate that there is conservation of core vertebrate tissue gene expression. Our analysis almost certainly underestimates the proportion of genes with conserved expression patterns, because our analysis focused on only ten large adult tissues in mature animals in captivity. Nonetheless, our results already provide an index of several thousand highly conserved tissue gene expression events and a picture of core gene expression in major tissues and organs of the common progenitor of all vertebrates, which most likely resembled the expression patterns shown in Figure Drosophila [In our analysis, some biological processes emerged as more highly conserved than others. Genes involved in the more conserved processes on the whole tend to be preferentially expressed in tissues with a limited number of cell types  that carry out specialized functions particular to those tissues. This finding is consistent with the notion that mechanisms underlying important biological processes should be conserved across taxa . It is losophila  and primosophila , and conosophila .cis-regulatory 'lexicon' [cis-regulatory, is functioning as cis-regulatory in a context that we have not measured and/or regulates neighboring genes. What is most striking is that many genes with the highest conserved tissue-specific expression have almost no nonexonic conserved sequence outside mammals. Divergence in trans-regulatory architecture does not provide a satisfying explanation for this observation: although there are examples in which the binding specificity of TFs evolves [Our finding that the correlation between the amount of conserved nonexonic sequence and conservation of gene expression is low underscores the apparent malleability of the lexicon' ,35,57. I evolves ,59, as a evolves , and DNA evolves . The fac evolves .cis-regulatory modules shared by coexpressed genes, indicating that there are many ways to achieve the same expression output. We propose that our catalog of conserved (and non-conserved) expression will be useful to test ideas regarding enhancer definition. In particular, we predict that the small size of pufferfish genes and knowledge of the expression of TFs in each tissue may facilitate searches for enhancers on the basis of density and arrangement of TF binding sites, rather than primary sequence alignment [Understanding the mechanisms underlying conservation of expression patterns is a major challenge in our understanding of evolution, and of genome function and gene regulation: even within a single genome, it is difficult to find lignment ,62. ThesData tables including microarray data, probe sequences, the 1-1-1-1-1 ortholog list, Phastcons information, UCE information, GO annotations and novel non-collinear alignments are found in the Additional data files and also on our project website .Tetraodon nigroviridis. The fish were fed frozen brine shrimp twice a day.Five chickens  were obtained from Sunnybrook Health Sciences Centre, Toronto, Canada. The bursa of Fabricius and thymus were dissected from the young females. The oviduct and ovaries were dissected from the in-lay adult female and the testis dissected from the rooster. Approximately 75 adult female and five adult male frogs were obtained from Nasco , housed in 20 L aquariums at 20\u00b0C and fed a diet of Aquamax Grower 600 trout food . Exactly 100 green spotted pufferfish, of unknown age and sex, described as caught wild in Malaysia, were purchased from Aquarium Services Warehouse Outlets  and housed in a single 120 gallon (453 L) aquarium tank at room temperature. Their markings, size (about 6\u20137 cm) and behavior matched descriptions of Animal handling and euthanization procedures were performed according to protocols approved by the University of Toronto. Tissue processing and mRNA extraction were as described previously . TissuesX. tropicalis, v3.0) corresponding to 24,877, 25,594 and 25,937 known and predicted loci in Tetraodon, chicken and X. tropicalis, respectively, using 41,533, 41,534 and 41,523 probes. cDNA synthesis, labeling reactions and microarray processing procedures were performed as described previously [Oligonucleotide microarrays (60-mer) were custom-designed by us and manufactured by Agilent Technologies to survey the expression of a set of known and predicted mRNAs compiled from Ensembl  version eviously . Each tieviously , 72%, 77eviously ,65. Our eviously  and 60 heviously  were doweviously . Expresseviously .et al. [Inparanoid  was usedet al. .Tetraodon) were further supplemented by mapping the corresponding mouse annotations by any type of orthology as defined by Ensembl. Annotations were up-propagated and terms with few or too many annotated genes were removed as described previously [GO annotations were downloaded from Ensembl BioMart  for eacheviously . All GO We split each set of orthologs in each tissue in each species on the basis of their measured normalized expression intensities according to the following thresholds: top 1/2, top 1/3, top 1/4, top 1/5 and top 1/6. Because the human and mouse datasets were designed independently from those of the other three species, there were orthologous genes with missing measurements. In order to facilitate comparison between as many unique orthologs between the five species as possible, we applied variance stabilizing normalization  to the het al. [g in a tissue t relative to its expression given in N tissues is defined as pt|g = wg, t/\u03a3t \u2264 N 1 \u2264 wg, t, where wg, t is the expression level of the gene g in tissue t. The Shannon entropy of a gene's expression distribution is then calculated as Hg = \u03a3t \u2264 N 1 \u2264 -pt|glog2pt|g. This value is expressed in bits and ranges from zero to log2(10) genes expressed in a single tissue and uniformly expressed in all the common tissues examined, respectively.Shannon entropy, which measures the degree of overall tissue specificity of a gene, was calculated as described by Schug et al. . Brieflyet al. [Locations of Phastcons elements  and UCEset al. . The nump-value, and these are also given in Additional data file 7 and shown graphically in Additional data file 12. Comparisons of categorical properties were made by WMW p-value and are given in Additional data file 8.A measure of protein sequence conservation between two species was derived by performing pairwise BLASTP  between All repeat-masked intronic, 3' untranslated region and intergenic non-coding sequence upstream and downstream of protein-coding sequences in orthologous groups that we have identified using the Inparanoid algorithm  were dowet al. [Tetraodon) as the base).We initially applied a conservation cutoff of 55% in a 50 nucleotide window to search for conserved regions between the human and the orthologous genomes. After removing conserved elements that were annotated as exonic, we extracted each sequence element in the alignment that was conserved only in a subset of the genomes and built the most parsimonious ancestral reconstruction of each of the sequences using Fitch's algorithm, treating the gap character as a fifth symbol. This was then used to search against the other orthologous genome(s) using the CHAOS aligner  with veret al. , we trieet al. [Tetraodon sequence to the common ancestor of human and chicken genomes than to either genome individually.Through the procedure described above, our approach takes advantage of the conservation of order of the conserved elements when no rearrangements have taken place, and the flexibility of aligning less conserved regions that have been shuffled around in the genome. By running Fitch's algorithm on the aligned sequences  of all EEL scores are non-random by subtracting the proportion of random scores above 175 (39.8%) from the proportion of real scores above 175 (41.1%).We scanned the nonexonic sequence associated  with 4,804 human/fish ortholog pairs for conserved TF binding sites by applying EEL  using thr  below the value shown on the horizontal axis, for real orthologs (green) and randomly matched genes (blue). Additional data file p-values. Additional data file p-values for categorical gene attributes, with ranks determined by relative conservation of gene expression by median Pearson correlation for each species against Tetraodon. Additional data file p-values for comparisons of gene expression conservation versus other gene properties. Additional data file p-values of genes associated with GO biological process annotations expressed within each tissue of each species .The following additional data files are available. Additional data file The tissues at the top, highlighted in color, are those considered to be among the ten common tissue types. Those with identical coloring were combined  for the analysis of conservation of gene expression among the ten common tissues. Click here for fileClustergrams show the microarray datasets in chicken, frog and pufferfish, displayed as relative expression ratio  of each gene within each of the 20 tissues profiled. Rows and columns were ordered independently for each dataset, and high-level branches broken and rearranged to obtain a diagonal appearance as described in .Click here for fileDendrogram of correlations among ten common tissues, using 1 \u2013 Pearson correlation and average linkage over 3,074 genes.Click here for fileSelected GO biological process categories enriched amongst genes highly expressed within each of the ten common tissues in each species are shown. The tissue and GO category order were manually arranged in the heat map. .Click here for filer  below the value shown on the horizontal axis, for real orthologs (green) and randomly matched genes (blue).The cumulative distributions show the proportion of all 3,074 genes with Pearson Click here for filep-values.Feature matrix used to compare conservation of expression measures to other attributes of individual genes, with Spearman correlations and Click here for filep-values for categorical gene attributes, with ranks determined by relative conservation of gene expression by median Pearson correlation for each species against Tetraodon.WMW Click here for fileCumulative distribution of EEL scores for real and permuted orthology between human and pufferfish.Click here for fileBreakdown of the proportion of all genes in each species that are expressed within each tissue.Click here for fileList of genes classified as TFs on the basis of containing a known DNA binding domain.Click here for filep-values for comparisons of gene expression conservation versus other gene properties.Clustergrams showing Spearman correlations and Click here for filep-values of genes associated with GO biological process annotations expressed within each tissue of each species (full matrix used to create Additional data file SWMW enrichment Click here for file"}
{"text": "In recent years, the maturation of microarray technology has allowed the genome-wide analysis of gene expression patterns to identify tissue-specific and ubiquitously expressed ('housekeeping') genes. We have performed a functional and topological analysis of housekeeping and tissue-specific networks to identify universally necessary biological processes, and those unique to or characteristic of particular tissues.We measured whole genome expression in 31 human tissues, identifying 2374 housekeeping genes expressed in all tissues, and genes uniquely expressed in each tissue. Comprehensive functional analysis showed that the housekeeping set is substantially larger than previously thought, and is enriched with vital processes such as oxidative phosphorylation, ubiquitin-dependent proteolysis, translation and energy metabolism. Network topology of the housekeeping network was characterized by higher connectivity and shorter paths between the proteins than the global network. Ontology enrichment scoring and network topology of tissue-specific genes were consistent with each tissue's function and expression patterns clustered together in accordance with tissue origin. Tissue-specific genes were twice as likely as housekeeping genes to be drug targets, allowing the identification of tissue 'signature networks' that will facilitate the discovery of new therapeutic targets and biomarkers of tissue-targeted diseases.A comprehensive functional analysis of housekeeping and tissue-specific genes showed that the biological function of housekeeping and tissue-specific genes was consistent with tissue origin. Network analysis revealed that tissue-specific networks have distinct network properties related to each tissue's function. Tissue 'signature networks' promise to be a rich source of targets and biomarkers for disease treatment and diagnosis. The issue of tissue and cell-type specificity of gene expression is central to human biology and biomedicine. It impacts such fundamental problems as tissue ontogenesis, evolution and carcinogenesis. It is generally believed that the most relevant disease biomarkers and drug targets predominantly are found among proteins specific for the tissue the disease affects. In 1965 Watson et al. described genes universally expressed to maintain cellular functions as 'housekeeping' (HK) genes -8, identHere we report the identification of 2374 HK genes, based on a novel study of gene expression in 31 human tissues on a whole-genome ABI array. We set up a definitive 'HK baseline' for gene expression across tissues, and compared previously published HK data sets with ours. We also identified gene sets uniquely expressed in individual tissues and groups of tissues, and generated tissue-specific merged metabolic/signaling 'signature networks'. Both HK and tissue-specific genes were subjected to a comprehensive, three-phase functional analysis, including gene set enrichment across four ontologies, network topology analysis and tissue-specific network analysis. We clustered tissues into groups according to expression patterns and network parameters, and revealed associations between HK and tissue-specific genes with human diseases and drug targets.Whole-genome gene expression was analyzed in 31 human tissues using an ABI human genome array with probe sets for 27,868 individual human genes. A relatively conservative ten-fold 'signal-to-noise' ratio (SN10) across all three replicate arrays for each tissue was applied to identify the transcripts present in all tissues . The SN10 HK set comprised 2374 genes  were defined as tissue specific. Tissue-specific sets varied in size from four genes for thymus to 484 genes for testis, with an average size of 43.8 genes, or 30.9 genes for somatic tissues only (excluding testis) Table . The gen cut-off t-test, was also applied to identify tissue-specific genes. Functional analysis showed striking similarities in the biological processes encompassed in the genes specific to each tissue between the t-test and the threshold-based methods . This vital, ATP-yielding pathway is the terminal part of cellular respiration, in which electrons are transferred through the electron transport chain (ETC). Almost all subunits of the ETC protein complexes were expressed in the HK set . Ubiquitin-proteasomal proteolysis was among the highest scored GG process networks (p < 10\u201326), with virtually all essential proteins included in the HK gene set  and breast neoplasm (p < 10\u201314) were the top-scored diseases  processes, GeneGo (GG) process networks, and diseases, using the hypergeometric distribution  and Genet Figure . The sect Figure . GG proct Figure , with mas p < 10\u20136, with ves Table .Using the GSEA procedure  across tp-value distributions of top-scored pathways, processes and diseases were strikingly consistent with the tissue of origin. For instance, 190 retina-specific genes were enriched for eye-specific categories in all four ontologies  and slightly lower in the IN and OUT component than a random gene set of the same size ; intestine and adult kidney in OUT component (p < 0.03 and p < 0.07), and skin (p < 0.1) in IN component . Intestine, liver and adrenal gland featured the highest fraction of enzymes. Fetal tissues were highly enriched in transcription factors, and retina and brain in membrane receptors  network algorithm in MetaCore. AN is a version of the 'shortest path' algorithm, optimized for larger data sets. AN generates overlapping sub-networks of up to 50 nodes and calculates enrichment of the networks with input data and canonical pathways ,18. UnliTissue gene expression patterns were clustered by Euclidean distance across the average normalized probe intensities of the replicate hybridizations for each tissue  Figure . Most tiWe compared the distribution of drug targets between HK and tissue-specific protein sets. Two sets of drug targets were compiled: 'therapeutic targets' \u2013 a set of 104 direct protein targets of commercially available drugs, and 'xenobiotic targets' \u2013 518 proteins known to interact with xenobiotics. Therapeutic drugs are defined as key proteins or genes directly affected by a marketed or withdrawn drug from the market. Xenobiotic targets are proteins and genes known for physical interactions with a large set of bioactive compounds including drugs, drug candidates and lead compounds.On average, therapeutic targets were twice as prevalent among tissue-specific proteins than HK proteins   and statistical measures such as ANOVA and nly used ,20. Renenly used ,22 follonly used . It was t-test) methods to determine tissue specificity of gene expression. Although the resulting datasets did not overlap well in gene content (6% on average), they were highly similar by functional analysis. Importantly, the intersections between distributions of entities within functional ontologies for SN10 and t-test sets were substantially larger than between genes  and statistical , and many of these genes belong to our HK set, confirming the functional integrity and completeness of the HK set.Recently it was shown in line with our results that the number of HK genes is larger than previously reported ,25. Our p-values or GSEA analyses were employed. This important observation adds confidence to the conclusions drawn from the analysis of tissue-specific gene expression, and can be applied similarly to other studies of differentially expressed genes and proteins. It also will facilitate the development of a comprehensive set of 'meta-ontologies' derived from an understanding of the interplay and crossover between the different types of ontological categories available, leading to improved understanding of biological systems, and the identification of biologically meaningful biomarkers and new therapeutic targets.Ontology enrichment in tissue-specific genes was strikingly different from HK genes, and in most cases strikingly consistent with the tissue's function. Retina genes were enriched with such processes as visual perception, detection of visible light, detection of light stimulus and eye disease-related genes, and testis genes scored highest for reproductive processes, cell cycle, cell division and male reproductive diseases, for example. Importantly, almost all tissues featured a high level of consistency between the highest-scored categories in different ontologies. Further, consistency was observed whether hypergeometric Network analysis  showed tp-values  should be considered valid, although such ad hoc cut-offs may eliminate many condition-relevant genes from analysis. Functional analysis provides a different level of validation for such datasets by consideration of functional biological units. For instance, the retina-specific gene set is enriched in vision-related pathways, GO and GG ontologies, and diseases. The same set is enriched with OUT network component, and the protein class 'receptors'. Self-assembling retina-specific networks reconstruct rhodopsin-stimulated signal transduction and key steps in the metabolism of rhodopsin and its co-factors. Although the retina gene set is too small to achieve p-values < 0.01 in most of these analyses, the combination of independent functional evidence builds a strong case for its relevance and importance as a highly likely source of specific biomarkers for eye conditions and ophthalmic drug response. The comprehensive biological interaction data in MetaCore allows multiple 'high-content' data types to be mapped onto networks. Gene expression data, proteomic, single nucleotide polymorphism and metabolomic data all can be addressed, visualized and used in network construction and analysis, independently or in concert ['Multi-dimensional' functional analysis of gene expression data adds to the ongoing debate on proper statistical procedures for gene set selection. A 'rule of thumb' opinion is that only gene sets and distributions with low  concert , making Tissue-specific gene sets  were twice as enriched in drug targets as the HK set. 'Therapeutic' targets comprised up to 25% of mammary gland and thymus-specific proteins. Most of the identified tissue-specific drug target genes are targets to drugs whose mechanism are consistent with the tissues. For example, three brain-specific proteins identified to have at least one drug target are GABA-A receptor beta-2 subunit, Na (V) I alpha and SCN10A. GABA-A receptor beta-2 subunit is a target for clomethiazole (sedative and anticonvulsant), Na (V) I alpha is a target for drugs such as levetiracetam (epilepsy), tetrodotoxin (anesthetics), toprimate (anticonsulvant) and SCN10A is target for bupivacaine racemic (anesthetics) and lidocaine (anesthetics).Tissue-specific proteins and their pathways and networks are therefore a potentially rich source of targets and biomarkers for disease treatment and diagnostics. The addition of data on which network components are detectable in blood and other readily accessible body liquids makes tissue-specific networks exceptionally attractive for the identification of putative biomarkers of tissue-specific disease, drug-response or toxicity.RNA from 31 normal human tissue RNAs (Table The Applied Biosystems Human Genome Survey Microarray (P/N 4337467) contains 31,700 60-mer oligonucleotide probes representing 27,868 individual human genes. Digoxigenin-UTP labeled cRNA was generated and amplified from 1 \u03bcg of total RNA from each sample using Applied Biosystems Chemiluminescent RT-IVT Labeling Kit v 1. 0 (P/N 4340472) according to the manufacturer's protocol P/N 4339629). Fifteen micrograms of DIG-labeled cRNA was hybridized for 16 hrs at 55\u00b0C and chemiluminescence detection, image acquisition and analysis were performed using Applied Biosystems Chemiluminescence Detection Kit (P/N 4342142) and Applied Biosystems 1700 Chemiluminescent Microarray Analyzer (P/N 4338036) following the manufacturer's protocol (P/N 4339629). Images were auto-gridded and the chemiluminescent signals were quantified, background subtracted, and finally, spot- and spatially-normalized using the Applied Biosystems 1700 Chemiluminescent Microarray Analyzer software v 1. 1 (P/N 4336391). Probe signals were normalized using the Limma method [. FifteenA 'stringent' set of HK genes expressed in each of the 31 tissues was identified by applying cut-off to the ABI-calculated signal-to-noise (S/N) for each probe. The S/N is a metric that captures the confidence of the measurement 'detectability' above all known sources of noise. S/N is commonly used to bin genes or probes as 'Present' or 'Absent' at a desired level of confidence. Since the S/N expresses the number of standard deviations, the associated confidence can be looked up from a probability table for a normal distribution. For example, signals with S/N \u2265 3 have > 99.9% confidence in the measurement. For our purposes in determining whether a gene was expressed in a given tissue, we additionally took into account the inflection points where the slope of the S/N curve significantly changes. We applied the threshold across all three replicate hybridizations on a probe-by-probe basis to identify the genes expressed in each tissue with a high level of confidence. The overlap between all 31 sets, that is, genes consistently expressed in all tissues, defines the HK set /2 is the maximum number of such links, the clustering coefficient is a number between 0 and 1. The average clustering coefficient is obtained by averaging over the clustering coefficient of individual nodes. A network with high clustering coefficient is characterized by highly connected sub-graphs.where The enrichment levels of the HK genes and tissue-specific genes in the different parts of the network  and in different protein classes were calculated using the hyper-geometric distribution:p-value corresponding to the enrichment-level according toWe calculated the k or more marked elements in a sample of size n by random selection.which gives the probability of having The authors declare that they have no competing interests.TN, YN and ZD conceived the study and designed research. ZD drafted and YN wrote the final manuscript. RJB contributed to writing and editing of the manuscript. ZD, WS and ES performed the statistical analysis of the data. TS, DD, AB, AG, ES, ZD and YN performed research. ER contributed with making the figures in the manuscript. KL, JB, RRS designed and carried out the experimentList of all housekeeping genesClick here for fileList of all tissue-specific genesClick here for fileTable for intersection between genes, ontologiesClick here for fileComplete enrichment analysis for all housekeeping setsClick here for fileCanonical pathway maps and GeneGo networks essential for growth and viabilityClick here for fileEnrichment analysis of the unique parts of the housekeeping gene setsClick here for fileComplete enrichment analysis of all tissues in all four ontologiesClick here for fileGene Set Enrichment Analysis for selected tissues, ontologiesClick here for fileNetwork topological properties of all housekeeping setsClick here for fileTissue-specific connectivityClick here for fileTable for interactions mechanismsClick here for fileTable for component analysis, protein class analysis for all tissuesClick here for fileMC legend with protein classesClick here for fileList of genes specific for tissue pairs and tripletsClick here for fileDrug targetsClick here for fileTissue-specificity distribution of all genesClick here for fileDefinition of tissue specific and housekeeping genesClick here for file"}
{"text": "Assessing conservation/divergence of gene expression across species is important for the understanding of gene regulation evolution. Although advances in microarray technology have provided massive high-dimensional gene expression data, the analysis of such data is still challenging. To date, assessing cross-species conservation of gene expression using microarray data has been mainly based on comparison of expression patterns across corresponding tissues, or comparison of co-expression of a gene with a reference set of genes. Because direct and reliable high-throughput experimental data on conservation of gene expression are often unavailable, the assessment of these two computational models is very challenging and has not been reported yet. In this study, we compared one corresponding tissue based method and three co-expression based methods for assessing conservation of gene expression, in terms of their pair-wise agreements, using a frequently used human-mouse tissue expression dataset. We find that 1) the co-expression based methods are only moderately correlated with the corresponding tissue based methods, 2) the reliability of co-expression based methods is affected by the size of the reference ortholog set, and 3) the corresponding tissue based methods may lose some information for assessing conservation of gene expression. We suggest that the use of either of these two computational models to study the evolution of a gene's expression may be subject to great uncertainty, and the investigation of changes in both gene expression patterns over corresponding tissues and co-expression of the gene with other genes is necessary. The biological functions of a gene, not only rely on its molecular composition and structure, but also on its spatiotemporal expression pattern. For example, duplicate genes, which are usually associated with highly consistent coding sequences but diverse biological functions, have only a weak correlation between rates of sequence and expression divergences Thanks to advances in microarray technology, the conservation/divergence of gene expression across species has been extensively and systematically assessed. However, results of such studies are often conflicting. Yanai et al. Some of these conflicting conclusions on gene expression evolution may be due, in part, to improper comparisons of gene expression across genomes, such as direct comparisons of expression levels across probes or platforms, as suggested by Liao and Zhang The aforementioned methods represent two computational models for assessing conservation/divergence of gene expression across species: 1) comparison of gene expression patterns across corresponding tissues, and 2) comparison of co-expression of a gene with a reference set of genes. Although the separate application of either model has yielded significant biological insights In this study, we assessed one corresponding tissue based method: Liao and Zhang's method http://symatlas.gnf.org/SymAtlas/ (GEO accession number: GSE1133) http://www.affymetrix.com). To assign the Ensembl ID for each gene, the annotation files  were downloaded from the Uniprot FTP site at ftp://us.expasy.org/databases/uniprot/current_release/knowledgebase/taxonomic_divisions. The orthologous gene pairs between humans and mice were downloaded from the Ensembl FTP site (ftp://ftp.ensembl.org). Only 1-1 orthologs were considered in this study. The number of available 1-1 orthologous gene pairs was 7182, out of which 3142 had multiple probe sets. For a gene with multiple probe sets, the selection of a probe set that best represents the gene's expression profile according to a general rule has not been resolved yet A public human and mouse expression dataset was downloaded from GNF SymAtlas V1.2.4. at n is the number of common tissues, H represents humans , M represents mice, and i in human and mouse tissue j, respectively. The expression conservation (EC) for human-mouse orthologous pair i is calculated as:The expression data of 26 common tissues from two species were extracted and normalized by their relative abundance (RA) values calculated as:A and B, in species A and B respectively, are restricted to genes for which 1-1 orthology relationships have been identified and ordered accordingly :i of 1-1 orthologs for species A and B, respectively, and k is the number of 1-1 orthologous gene pairs.Expression datasets with different dimensions under different conditions between any two species, A and B, can be compared. The expression matrices, A and B are then converted into two pair-wise correlation matrices (PCMs), r) between the expression profiles of each pair of genes over all conditions in each species separately:k, any row i as:i is computed as:r greater than a certain quantile x of the background correlation distribution, in both humans and mice) were selected as nodes of CCNs. Because the correlation cutoff value may affect the number of CNN nodes and in order to fully assess Essien et al.'s method, we varied the correlation coefficient threshold. Out of 4040 pairs of human-mouse 1-1 orthologs, 3390, 2424 and 1246 pairs were found as nodes of CCNs when the correlation threshold was set to 0.95, 0.975 and 0.99 quantile of the background distribution, respectively.To apply Essien et al.'s method, the nodes of CCNs between humans and mice should be identified first. In this study, the identification of the nodes in CCNs, was performed via determination of conserved pair-wise co-expression between species, i.e. the expression profiles of a pair of genes are significantly correlated in both species. Intra-species background distributions of correlations were first constructed based on 20,000 random gene pairs. All two gene combinations were assessed for potential conserved co-expression. Gene pairs whose expression profiles were significantly correlated  the similarity of gene expression profiles over only 26 common tissues may not reflect the expression conservation over all available tissues, and 2) common tissues are not the same tissues, i.e. tissues evolve between humans and mice.Because there are no means of applying Liao and Zhang's method to the whole human and mouse tissue data, to quantify the effects of using the microarray data over only common tissues, we adopted an indirect approach: comparing co-expression based methods using the whole microarray data with the expression data over only common tissues (the same data used by Liao and Zhang's method), with the hypothesis that if the results on expression conservation do not differ significantly between the two types of expression data, the use of the expression data over common tissues should not be a factor affecting the assessment of expression conservation, which should be also true to Liao and Zhang's method. However, we found that the properties of EC distributions generated by co-expression based methods differ greatly between these two types of expression data , and thar>0.9), suggesting that even if the same data are used, corresponding tissue based methods and co-expression based methods may still give different estimations of ECs.By applying co-expression-based methods to the expression data of 26 common tissues between humans and mice, i.e. the same data used by Liao and Zhang's method, a maximum agreement between corresponding tissue based methods and co-expression based methods can be estimated. Using this dataset, the ECs of all human-mouse 1-1 orthologs generated by different co-expression based methods were correlated with those generated by Liao and Zhang's method. Though these correlations were increased from (0.48\u20130.50) to (0.69\u20130.74), a maximum correlation of 0.74 is still far from a high agreement  is recommended. However, the two assessed computational models, which mainly capture the information on the global changes in gene expression patterns over orthologous tissues and in gene co-expression networks, reveal only part of the whole picture of gene expression evolution. Additionally, besides expression abundance as an indicator of gene expression behavior, expression breadth and specificity are also worth investigating"}
{"text": "Tissue gene expression is generally regulated by multiple transcription factors (TFs). A major first step toward understanding how tissues achieve their specificity is to identify, at the genome scale, interacting TFs regulating gene expression in different tissues. Despite previous discoveries, the mechanisms that control tissue gene expression are not fully understood.We have integrated a function conservation approach, which is based on evolutionary conservation of biological function, and genes with highest expression level in human tissues to predict TF pairs controlling tissue gene expression. To this end, we have identified 2549 TF pairs associated with a certain tissue. To find interacting TFs controlling tissue gene expression in a broad spatial and temporal manner, we looked for TF pairs common to the same type of tissues and identified 379 such TF pairs, based on which TF-TF interaction networks were further built. We also found that tissue-specific TFs may play an important role in recruiting non-tissue-specific TFs to the TF-TF interaction network, offering the potential for coordinating and controlling tissue gene expression across a variety of conditions.The findings from this study indicate that tissue gene expression is regulated by large sets of interacting TFs either on the same promoter of a gene or through TF-TF interaction networks. Transcriptional regulation in eukaryotic organisms is a fundamental process to determine a gene's spatial and temporal expression. One of the main events involved in this process is the binding of TFs to short DNA motifs, called transcription factor binding sites (TFBSs), on the promoter regions of genes, activating or repressing the transcription machinery. In mammalian tissues most TFs do not act alone, but work through combinatorial regulation ,2, in whcis-regulatory modules in liver [cis-regulatory modules based on recognizable sequence features from either highly expressed genes [cis-regulatory modules by enrichment analysis for motifs discovered de novo in tissue-specific promoters relative to other promoters from the same species [Early attempts to identify interacting TFs controlling tissue gene expression came from the use of experimental approaches such as gel retardation assay , site-diin liver ,16 and min liver  tissues.ed genes  or genesed genes -21 derived genes  or have ed genes . Others In this study, rather than using sequence features of promoters from genes that are expressed only in a particular tissue -21, we ucis-regulatory modules involved in tissue gene regulation, we also performed analysis to identify interactions of 3 TFs.The application of the function conservation approach to the most highly expressed genes has led to the prediction of hundreds of interacting TFs from each of the 79 human tissues. Based on these predictions, TF pairs associated with a certain tissue were identified. The validity of these discovered TF pairs has been evaluated by both known interacting and liver-specific TFs. We further extended our study to find interacting TFs controlling gene expression in a broad spatial and temporal manner by looking for TF pairs common to the same type of tissues, from which TF-TF interaction networks were further built. As a first step to elucidating The overall analysis procedures are shown in Additional File We next filtered out the TF pairs in a particular tissue common to those from housekeeping genes Figure . The remUsing the function conservation approach  and tisshttp://www.ncbi.nlm.nih.gov/ to annotate human genes whose promoters contained the target TFBS pairs, as TFs control cellular biological processes via transcriptional regulation of groups of genes with similar functions. Significant  biological processes for tissue TF pairs were obtained by comparing the number of TF target genes involved in a particular biological process to the number of genes for the same biological process in the whole human genome . All tissue and tissue-unique TF pairs as well as their potential biological functions are listed in Additional File Overall, we identified 2549 tissue and 803 tissue-unique TF pairs for the 79 human tissues. These results indicate that tissue gene expression is regulated by large sets of interacting TFs. Furthermore, the relative small number of tissue-unique TF pairs out of all tissue TF pairs suggests that identical tissue TF pairs in different tissues may play different functional roles, which prompted us to investigate their biological function. For this purpose, we used Gene2go \u00ae 10.4 [\u00ae database contains 180 experimentally proven composite elements of two or more binding sites which were previously identified by individual wet lab studies from others. Of the180 composite elements, 105 were mapped to the 23,005 (214*215/2) possible combinations of 2 TFs from the 214 non-redundant position weight matrices (PWMs). We first investigated the statistical significance for the occurrence of known interacting TFs in both predicted TF pairs (before filtering) and tissue TF pairs in each of the 79 tissues. Figure p = 3.2 \u00d7 10-2 to 6.8 \u00d7 10-6 vs. p = 4 \u00d7 10-2 to 3.4 \u00d7 10-4). We also computed the occurrence of known interacting TFs in all predicted TFs pairs (before filtering) and all tissue TF pairs from the 79 tissues. We found that 40 (38.1%) of the 105 known interacting TFs were in both predicted TF pairs  and tissue TF pairs .Although the function conservation approach has been proven to be a successful means for predicting interacting TFs , we soug\u00ae 10.4  to detercis-regulatory systems for both individual TF binding and synergistic actions have been thoroughly studied [p = 2.3 \u00d7 10-14) where both TFs were liver-specific. For the 27 liver-specific known interacting TFs, we found 8 (30%) in both the predicted TF pairs  and tissue TF pairs  from liver tissue. These include HNF4ALPHA:HNF4ALPHA, NF1:COUP_DR1, CEBPGAMMA:HNF4ALPHA, CEBPA:HNF3B, HNF3:HNF4ALPHA, HNF3:PPARA, CEPBA:GATA4, and HNF1:OCT1. All of them are key elements in liver specific transcriptional regulation. GO enrichment analyses indicated that genes whose promoters contained the predicted liver-specific TFBS pairs were mainly involved in liver specific functions [To further verify our prediction, we next compared the tissue TF pairs to known tissue-specific TFs from liver, for which the  studied ,4,25,26.unctions , includiIt is important to note that the 79 human tissues represent only part of the temporal and spatial conditions from which the 105 known interacting TFs were discovered, and therefore it is unlikely to have all known interacting TFs in our predicted list. Nevertheless, our results indicate that the use of function conservation approach and tissue-expressed genes was able to reliably identify to a great extent known interacting TFs, thus presenting very strong evidence for the validity of the identified tissue TF pairs. These results also indicate that filtering the TF pairs of housekeeping genes from those in each tissue is an important step to eliminate TFs playing a ubiquitous role, thereby the resulting TF pairs are more tissue-specific.a priori knowledge was available for the number of groups for each tissue type. The results are shown in Figure One of the goals of this study is to find interacting TFs controlling gene expression in a broad spatial and temporal manner such as interacting TFs common to the same type of tissues. This can be achieved by searching tissue TF pairs common across all tissues of the same type such as the 7 muscle tissues. However, the use of all tissues may reduce the power for tissue-type TF pair identification, since the contents of tissue TF pairs and even the function of a common tissue TF pair may be different between tissues of the same type. Therefore, we sought to first classify tissues into smaller but more closely related groups based on tissue TF pairs, from which representative tissues for the same tissue type could be obtained. Accordingly, we used hierarchical clustering to group tissues, as no We extended our analysis to investigate conservation for tissue TF pairs between tissues of the two muscle groups. We computed overlap for both tissue TF pairs and their biological functions between tissues using hypergeometric distribution. We found little or no overlap for both tissue TF pairs and their functions among tissues between these two groups, which was especially true for the function of tissue TF pairs (data not shown). On the other hand, both tissue TF pairs and their functions showed significant overlap between tissues within the same group Figure . These rBased on the clustering results, we selected 11 tissue-type groups, each having 2 to 16 tissues, for tissue-type TF pair discovery. A cutoff threshold of tissue TF pairs common in at least 50% tissues from the same group was set up for searching tissue-type TF pairs. In addition to the TF level, we also searched for tissue-type TF pairs based on their function using the same criteria of > 50% tissues in the same group. To this end, we were able to identify tissue-type pairs for all tissue groups as listed in Table In an effort to reveal TF relationships in controlling tissue gene expression, we performed analysis to reconstruct TF-TF interaction networks. Using tissue-type TF pairs, we first looked for those with one shared TF between each other in the same tissue, from which TF-TF interaction networks were built by joining 2 or more TF pairs Figure . TF-TF iUnlike the tissue TF pairs, we did not find any common tissue-type TF-TF interaction networks between different tissue types. In light of this, we performed a search to see if any single TFs played central roles in controlling tissue gene expression across different tissues, and looked for internal TFs in multiple tissue-type TF-TF interaction networks. To this end, we found that AP2, PPARA, PAX4, FAC1, ZIC3, and SPZ1 served as internal TFs in 8, 8, 8, 6, 5, and 4 tissue-type TF-TF interaction networks, respectively, suggesting their role as central hubs in tissue-type TF-TF interaction networks. Whereas FAC1 acts as the internal TF in 6 tissue-type TF-TF interaction networks from immune systems and cancer, SPZ1 mainly serves as the internal TF in tissue-type TF-TF interaction networks from testis, and the rest in 5 to 6 tissue-type TF-TF interaction networks from different tissue types. These results indicate that FAC1, when serving as the internal TF, is restricted to the two related tissue types, and that SPZ1, a bHLH-Zip protein, has an important role in testis ,30. The p < 10-20). By contrast, the total number of liver-specific TFs in these 7 tissue-type TF-TF interaction networks was not enriched . These results suggest that liver-specific TFs, other than initiating liver-specific transcriptional event, may play an important role in recruiting non-liver-specific TFs to the tissue-type TF-TF interaction network, thus offering the potential for coordinating and controlling gene expression across a variety of conditions.It is interesting to note that no single TFs serve as the central hub for tissue-type TF-TF interaction networks from liver tissue. However, we observed that 6 of 7 tissue-type TF-TF interaction networks had at least one known liver-specific TF serving as the internal TF as shown in Figure cis-regulatory modules involved in tissue gene regulation, we extended our analysis to the interactions of 3 TFs (named as multiple interacting TFs). Using tissue TF pairs from each of the 79 tissues, we performed a two-step analysis of TFBS conservation and enrichment of overlapping orthologous genes between human and mouse (see Methods). Although it is likely that multiple interacting TFs may be under estimation by the use of tissue TF pairs instead of all predicted TF pairs, the predicted multiple interacting TFs are tissue-specific. Therefore, these predictions most likely represent cis-regulatory modules involved in tissue gene regulation. To this end, we identified 1735 unique interactions of 3 TFs for the 79 human tissues, ranging from 9 multiple interacting TFs for testis interstitial to 72 multiple interacting TFs for caudate nucleus  whose 3 TFs were all liver-specific, 18  with at least 2 liver-specific TFs, and 28  with at least 1 liver-specific TF. These results provide evidence for the enrichment of liver-specific TFs in the predicted multiple interacting TFs, which in turn demonstrated the validity of the prediction.The validity of these predicted multiple interacting TFs was assessed by using liver-specific single TFs from TRANSCFAC11.4 , as few We next searched for all predicted multiple interacting TFs and their potential functions that are common between tissues. The results indicated that, although common multiple interacting TFs existed between most tissues, the highest overlap was within brain tissues and between brain and gland tissues. By contrast, there was little overlap for the functions of multiple interacting TFs, except within brain and cancer and between these 2 tissue types  for all 79 tissues. This reduction for TF pairs was, however, significantly larger when individual tissues were concerned (39% to 59%), indicating that a large number of overlapping TF pairs had ubiquitous roles among different tissues. The remaining interacting TFs in each tissue were more tissue-specific, which was best evidenced by the result that the predicted TF pairs from liver tissue contained the same number of known liver-specific interacting TFs before and after the filtering. The relative small number of tissue-unique TF pairs out of all tissue TF pairs and the findings from conservation analysis for the functions of tissue TF pairs between tissues of two muscle groups from this study also indicate that tissue TF pair with identical 2-TF combination might play different functional roles in different tissues.et al. [et al. [Our findings show that tissue gene expression is controlled by a variety of interacting TFs either on the promoter of a gene or through TF-TF interaction networks. These identified TF interactions may constitute a large part of interacting TFs in each tissue but is not a complete list. To fully understand the mechanisms controlling tissue gene expression requires additional study, which has been best evidenced from the comparison of interacting TFs in liver tissue between Yu et al.  and ours [et al.  who haveOne of the goals of this study was to find interacting TFs controlling tissue gene expression in a broad spatial and temporal manner. We performed analysis to identify tissue-type TF pairs for 11 selected tissue-type groups. While, as described above, each specific tissue may reflect only a small portion of all spatial and temporal conditions where tissue TF pairs play their regulation roles, tissue-type TF interactions provide a general view of their roles in multiple conditions. The analysis process has also led to other findings that the same type of tissues may have significant differences in both the contents of tissue TF pairs and the TF functional roles, which has been demonstrated by the conservation analysis of tissue TF pairs and their functions from muscle tissues. Tissue-type TF-TF interaction networks have provided not only lines of information on how tissue transcriptional programs are constructed but also new findings of potential roles for tissue-specific TFs in TF-TF interaction networks from liver tissue.In this study, we successfully employed our previously developed function conservation approach , to predet al [et al [The GNF Atlas2 gene expression database (gnfAtlas2) , which cet al  we selecl [et al . Redundal [et al . To redul [et al ,36. It i\u00ae program [The procedures for predicting TF pair are basically the same as previously described  Additio. Briefly program , for whi program . To dete program ,38. This program , but als program . Enrichmq-value < 0.05 was applied. TF pairs are those passing the cutoff and common between human and mouse.A two-step analysis procedure was employed to compute the enrichment of overlapping orthologous genes for a particular TFBS pair. First, a cutoff threshold of at least 10% overlapping orthologous genes between mouse and human was set up for selecting genes whose promoters contained the TFBS pair. The enrichment of overlapping orthologous genes was then estimated by computing the ratio of overlapping orthologous genes from real promoter sequences against those from shuffled sequences. This analysis was performed for each distance constraint. The integration of function conservation for each TF pair was achieved by estimating the correlation (Pearson correlation coefficients) between the 10 enriched TFBS pairs and 10 corresponding enriched overlapping orthologous genes from the same distance constraint. Permutation tests were employed to estimate the statistical significance of correlation by randomly matching the 10 TFBS pair ratios with the 10 overlapping orthologous gene ratios. For multiple test correction, a cutoff threshold of We next filtered TF pairs of housekeeping genes from those in each tissue Figure . This waR statistical package [To group tissues based on their tissue TF pairs, a 2549 (tissue TF pairs) \u00d7 79 (tissues) matrix with binary numbers was first built for all tissue TF pairs in the 79 human tissues. The presence of a tissue TF pair in the matrix was labeled with 1 and the absence was labeled with 0. A distance matrix was then built using the \"binary\" method, and hierarchical clustering was subsequently performed using the \"complete\" agglomeration method. All analysis was performed using the  package .p = 3 \u00d7 10-2 to < 10-36 and q < 0.05).A two-step analysis of TFBS conservation and enrichment of overlapping orthologous genes was performed to predict interactions of 3 TFs. For TFBS conservation, the identified tissue TFBS pairs were first used to construct all possible 3-TFBS combinations by searching paired tissue TFBS pairs with one shared TFBS between each other on exactly the same location of a gene's promoter Figure  in a parTwo main statistical methods were employed for estimating the significance of enrichment in this study. For validating predicted TF pairs and tissue TF pairs by known interacting TFs, the binomial distribution probability, as shown below, was used to determine if known interacting TFs were present more often in the predicted TF pairs or tissue TF pairs than in a randomly selected group from a given list of TFs.n is the number of known liver-specific interacting TFs in the predicted tissue TF pairs from this study; N the number of tissue TF pairs from liver tissue; and pf the background probability of liver-specific TF pairs in all possible combinations of 2 TFs from 214 PWMs.For example, in the case of estimating the statistical significance of known liver-specific interacting TFs in our predicted tissue TF pairs from liver tissue, the The statistical significance was computed using the hypergeometric distribution to estimate (1) the enrichment of overlapping tissue TF pairs and their overlapping functions between muscle tissues, and (2) overlapping orthologous genes in predicting multiple interacting TFs.c is the number of orthologous gene pairs containing conserved 3-TFBS combination between human and mouse; N the number of tissue-expressed genes for a particular tissue; S1 and S2 are the numbers of tissue-expressed genes with 3-TFBS combinations corresponding to those in c for human and mouse, respectively. The resulting p-value is the probability of observing c or more orthologous gene pairs containing conserved 3-TFBS combination from two sets of size S1 and S2 drawn from a set of N tissue-expressed genes.In the case of overlapping orthologous genes in predicting multiple interacting TFs, for example, TF: transcription factor; TFBS: transcription factor binding site; PWM: position weight matrices.ZH initiated and designed the study, conceived the analysis procedure, carried out data analysis, and wrote the manuscript. SG helped write Perl scripts to process data. Both authors read and approved the final manuscript.Flowchart of analysis procedure for TF pair prediction.Click here for fileLists tissue and tissue-unique TF pairs and their potential functions for the 79 human tissues.Click here for fileLists tissue-type TF pairs for the 11 selected tissue groups.Click here for fileShows the 84 tissue-type TF-TF interaction networks from the 11 tissue-type groups.Click here for fileLists multiple interacting TFs (3 TFs) and their potential functions for the 79 human tissues.Click here for fileOverlap matrix for multiple interacting TFs. The overlap of multiple interacting TFs between the 79 human tissues is depicted in the upper right panel and overlap of function for multiple interacting TFs in the lower left panel. The degree of overlap is indicated by color with red showing the greatest overlap and yellow showing less overlap.Click here for file"}
{"text": "Gene duplication is a major driver of evolutionary innovation as it allows for an organism to elaborate its existing biological functions via specialization or diversification of initially redundant gene paralogs. Gene function can diversify in several ways. Transcription factor gene paralogs in particular, can diversify either by changes in their tissue-specific expression pattern or by changes in the DNA binding site motif recognized by their protein product, which in turn alters their gene targets. The relationship between these two modes of functional diversification of transcription factor paralogs has not been previously investigated, and is essential for understanding adaptive evolution of transcription factor gene families.Based on a large set of human paralogous transcription factor pairs, we show that when the DNA binding site motifs of transcription factor paralogs are similar, the expressions of the genes that encode the paralogs have diverged, so in general, at most one of the paralogs is highly expressed in a tissue. Moreover, paralogs with diverged DNA binding site motifs tend to be diverged in their function. Conversely, two paralogs that are highly expressed in a tissue tend to have dissimilar DNA binding site motifs. We have also found that in general, within a paralogous family, tissue-specific decrease in gene expression is more frequent than what is expected by chance.While previous investigations of paralogous gene diversification have only considered coding sequence divergence, by explicitly quantifying divergence in DNA binding site motif, our work presents a new paradigm for investigating functional diversification. Consistent with evolutionary expectation, our quantitative analysis suggests that paralogous transcription factors have survived extinction in part, either through diversification of their DNA binding site motifs or through alterations in their tissue-specific expression levels. Gene or even whole genome duplication provides the essential spare parts for evolutionary innovationvia several distinct pathways. Paralogous genes (genes within a species evolutionarily-related by gene duplication events) that survive extinction often diversify by either assuming an entirely novel function, or specializing in some aspects of their original function while losing other functionsAlthough mutations directly alter the genome, the resulting functional change is what drives evolutionary selection. A comparison of various diversification pathways in terms of their functional consequences is thus likely to reveal relationships among these pathways. For instance, mutations in the DNA binding domain of a TF gene are likely to alter the TF's DNA binding site motif. Availability of DNA binding site motifs of a vast number of human TFsBy analyzing a large collection of human paralogous TF pairs, we show for the first time that the paralogous pairs whose DNA binding site motifs are similar tend to have diverged expression patterns so that in any particular tissue at most one of the paralogs is expressed at a high level. Conversely, the paralogs that are highly expressed in a tissue tend to have dissimilar DNA binding site motifs. Our work represents a first attempt to quantify the biological expectation that paralogous TFs must diversify in one or more aspects of their function in order to survive extinction. We have extended our pair-wise analysis to TF families, demonstrating that in any given tissue there is a large separation in expression level between the family members with similar DNA binding site motifs. Furthermore, our finding is independent of the age of paralogs. TF paralogs with diverged binding site motifs tend to be diverged in their functions, as measured by GO terms. We also found that a decrease in tissue-specific gene expression is more frequent than what is expected by chance.Using a stringent sequence similarity criteria as in Consider two paralogous TF genes that are highly expressed in a particular tissue. If these two TFs recognize similar DNA binding site motifs then it is possible that these genes may interfere with each other's activity or they may potentially serve compensatory rolesX, Y) is commonly measured using the Pearson Correlation Coefficient (PCC) between X\u00ca and Y\u00ca, where X\u00ca and Y\u00ca represent the vectors of expressions for genes X and Y, respectively, in multiple tissues. Employing PCC as a measure of expression divergence yielded no significant correlation  between expression similarity and DNA binding site motif similarity , we computed \u2202E as defined above. We additionally computed the DNA binding site motif similarity \u00a7B between the PWMs corresponding to the two TFs using a previously benchmarked motif similarity measure based on the Pearson Correlation between PWM columns and Smith-Waterman un-gapped alignment of the PWMs\u2202E and \u00a7B values for each paralogous TF pair, we computed the Kendall's tau rank correlation between \u2202E and \u00a7B values and estimated its significance based on 1000 permutations of the expression data. Using other measures of correlation such as Pearson or Spearman does not change the results  of the tissues show significance, and 9 (39%) of the tissues show significance at a 0.001 p-value threshold. The mean and standard deviation of the correlations  in the significant cases were 0.21 and 0.05, respectively. As a control, we repeated the above experiment after randomizing the expression data and found a significant correlation only in 4.5% of the tissues. By random chance, we expect 5% of the tissues to show significance at p-value threshold of 0.05. We also repeated our analysis using paralogous TF-pairs obtained from the KOG data (www.ncbi.nlm.nih.gov/COG/), for which we obtained 242 paralogous pairs with 99 unique genes. This analysis yielded 67.1% tissues significant at the 0.05 p-value threshold and 54.4% tissues at a 0.01 threshold corresponding to a 13- to 54-fold enrichment. Thus, our overall conclusions are robust across different definitions of paralog genes. We have performed a number of additional analyses to ensure the robustness of our general conclusions. These include (1) investigating the effect of excluding paralogous pairs with low expressions, (2) using alternative measures of expression divergence, and (3) using several way of aggregating multiple probe data and multiple PWMs. All these analyses yielded consistent results and the details are provided in Given the expression data for a tissue, for each paralogous TF pair (ults see . We repe\u00a7B. Median Absolute Deviation (MAD) statistic. The median absolute deviation for a data sample MAD\u200a=\u200amedian(|iY \u2013 median(iY)|), where |Yi| is the absolute value of Yi. The MAD statistic is preferred over the traditional z-score normalization (mean of 0 and standard deviation of 1) if the data is not normally distributed, because in the latter case the mean and standard deviation are severely affected by outliers\u00a7B towards the top of the list), there are very few cases where both paralogs are expressed at high levels, while this pattern is a relatively common occurrence among paralogs with low DNA binding similarity. At a glance, there is more homogeneity of high expression as the binding similarity of the TF pair decreases, reinforcing that the amount of expression divergence increases as the binding similarity increases. We next sorted the 95 pairs of paralogous TF genes in decreasing order of their DNA motif similarity \u00a7B) are likely to be a result of recent duplication events and indeed if this were the case, the conservation in DNA binding site motif (and presumably in DNA binding domain of the gene) would merely be a reflection of divergence time. To test this hypothesis, for the entire set of TF paralogs we compared their BLAST-based percent identity score over the entire coding region (a high score is likely to correspond to recent duplication) with their \u00a7B values. The Kendal tau correlation was 0.063 with p-value\u200a=\u200a0.36. We have repeated this analysis by substituting the BLAST-based percent identity with the synonymous substitution rate, Ks, using PAML \u2202E and \u00a7B are independent of the age of the paralogs. Because of the stringency of our criteria for paralogy, the TF pairs are likely to be recent paralogs. Therefore, we next investigated whether or not a greater DNA binding similarity is a simple reflection of shorter divergence time since duplication. In other words, it is expected that paralogs with similar DNA binding site motifs  represent the set of GO terms associated with X. We only consider terms at the functional hierarchy level of 3 or higher in order to exclude ubiquitous terms. For paralogs X and Y, we define functional coherence between the paralogs using the Jaccard's coefficient as FC\u200a=\u200a|(F(X) \u2229 F(Y)| / |(F(X) \u222a F(Y)|, which represents the number of shared GO terms normalized by the total number GO terms annotated for the two genes X and Y. For the list of paralogs, sorted by decreasing order of \u00a7B, FC. We found that FC values were higher for TF pairs with higher binding similarity and gradually decreased as the binding similarity decreased. The Kendall tau correlation coefficient is 0.165 with p-value\u200a=\u200a0.02. This indicates that paralogs with diverged DNA binding site motifs, and presumably different target genes, are more likely to serve distinct functional roles. Our results were consistent when we substituted the Jaccard's coefficient with a hypergeometric distribution based p-value to capture the overlap . This result further reinforces that paralogs with diverged DNA binding site motifs are more likely to serve distinct functional roles.Next, we quantified the shared functions between paralogous TF pairs in order to determine if there is a correlation between DNA binding site motif similarity and biological function for a TF pair. For gene tissue coherence between the paralogs as TC\u200a=\u200a|(T(X) \u2229 T(Y)|/(T(X) \u222a T(Y)|. T(X) represents the set of tissues in which X is expressed above median expression value for that tissue. In the list of paralogs sorted by decreasing order of \u00a7B  and each tissue T, we computed the ratio R\u200a=\u200a(maxE-simE)/(maxE-minE), where maxE and minE represent the maximum and the minimum expression levels, respectively, among the family members in tissue T. Thus, the R value is normalized for family-specific and tissue-specific gene expression. If iTF has the maximum expression maxE, then simE is the expression level of the family member whose DNA binding site motif is most similar to that of iTF. This ratio effectively indicates how much the highest expressed gene in a family has diverged in expression relative to the gene with the most similar DNA binding site motif. Therefore, a ratio of R\u200a=\u200a1 would indicate that the highest expressed gene in a family for a given tissue has most diverged in expression from the gene with which it shares the most binding similarity. In order to reduce the chances of considering irrelevant tissues , we only considered the tissues in which the maximum expression among the family members was greater than the median expression of all TF genes in that tissue. We then compared the R values computed from our dataset with that for 10000 random groupings of the TF genes in families, matched for family size of the actual dataset. Using the Mann-Whitney one-sided test we compared the R values of the foreground set with the random set given the null hypothesis that the R values in the foreground set are less than or equal to the R values in the random set. For the families constructed using clustering methods, the null hypothesis was rejected with a p-value\u200a=\u200a6.84e-10. In the case of the families constructed using KOG data, the null hypothesis was not rejected when all families were used. However some of the families are very large (up to 16 members) and exclusion of large families yields significant results. For instance, when we only include families of size 3 and 4, the null hypothesis is rejected with a p-value\u200a=\u200a1.3e-9. This result suggests that for all families with greater than two members and for all 23 non-redundant tissues, in general, exactly one family member is expressed highly, among the members with similar DNA binding site motif.The above results suggest that among the paralogous TF pairs with similar DNA binding site motifs, at most one TF is expressed at a high level in any given tissue. Hence, we next extend our analysis to TF families. We computed families using two methods, the first is a complete-linkage agglomerative clustering of the 98 pair-wise paralogy relationships, which resulted in 39 paralog families with 28 families of size 2, 7 of size 3 and 4 of size 4; the rest are singletons which could not be placed in a family. We have repeated the family analysis for BLAST alignable coverage of 50%, 60%, 70% and 80%. The results are consistent for all four choices of alignable coverage, including criteria identical to that of Makova and Li, but we only report the statistics for the 70% coverage threshold. The second method is based on KOG data and in terms of families, we obtained 24 families, 9 of size 2, 6 of size 3, and 9 of size greater than or equal to 4. The family-wise analysis was done for (i) the 11 families consisting of greater than two TFs constructed using clustering methods and (ii) the 15 families computed using KOG data. For a TF family we expect at most one member of the family among the members with similar DNA binding site motif to have high expression in any tissue. In order to test this hypothesis, for each family with Median Absolute Deviation or more than the median expression for that particular tissue. Low expression is the complement of high expression. We say that a family has a selective decrease in expression if all but one of the family members has high expression. Conversely, a family is deemed to have a selective increase in expression if all but one of the family members has low expression. We found that 38% of all cases were of expression increase and 20% cases of expression decrease. As a control, if we randomize the expression data, we found 48% of the cases were of expression increase and 16% were of expression decrease. The one-tailed Fisher exact test comparing decrease versus increase of expression for the true and random sets yields a p-value of 0.02, indicating that there is an excess of expression decrease in the actual data. If we repeat the analysis using families derived from KOG data, we find that 35% of the cases were of expression increase and 40% were of expression decrease. By comparison in the cases generated by randomizing the expression data, we found that 40% of the cases were of expression increase and 24% of the expression cases were of expression decrease. The one-tailed Fisher exact test comparing decrease versus increase of expression for the actual and random sets yields a p-value of 8.5e-7. This result further reinforces our findings that there is a significant tendency towards expression decrease in the families of TFs.We next investigated the relative prevalence of expression increase and expression decrease in a tissue among members of a paralogous family, irrespective of their DNA binding site motif similarities. Using the 11 families with greater than two members identified above, for each TF family and each tissue we enumerated the cases for which all but one family member have high expression and one member has low expression. High expression is defined as an expression value that is one 1F, 2F, \u2025, k)F and each tissue T, we computed the ratio RI\u200a=\u200a(maxE-max2E)/(maxE-minE), where maxE and minE represent the maximum and the minimum expression levels and max2E represents the second highest expression among the family members in tissue T. The ratio RI captures the increase in expression, i.e., high value of RG represents an expression increase. Similarly, define RD\u200a=\u200a(min2E-minE)/(maxE-minE), where min2E represents the second lowest expression among the family members in tissue T. The ratio RD captures decrease in expression, i.e., high value of RL represents an expression decrease. We computed RI and RD values for all TF family-tissue pairs and did the same for 10000 randomly generated families of TFs of the same size as the true set of families for families defined using the BLAST criterion and families defined using KOG data. We found that the RI values (increase) in the actual data were significantly smaller than those for the randomized families . In contrast, the RD values (decrease) in the actual data were greater than those for the randomized families. However, the Mann-Whitney one-sided test p-value was at the cusp of significance  for families defined using BLAST criterion. For families defined using KOG data, we found that RD values (decrease) were significantly less than those for randomized families  and DNA binding site motif similarity (\u00a7B). We preferred Kendall's tau to another non-parametric correlation measure \u2013 Spearman's rho, because Kendall's tau has better statistical properties and is more directly interpretable \u2202E and \u00a7B values cannot be assumed to be independent. To avoid biases caused by within-sample dependence, we estimated the significance of Kendall's tau by randomly permuting the expression values among the TFs and our results remain statistically significant. Thus, our overall results remain significant across a comprehensive set of combinations of experimental design parameters - (i) multiple ways of probe aggregation for a gene or a transcript (ii) multiple PWM aggregation for a gene or a transcript, (iii) multiple measures of correlation, and (iv) multiple ways of estimating significance.We have taken a number of precautions to ensure the robustness of our conclusions. For instance, Pearson's correlation coefficient is a standard measure for quantifying correlations between two data samples. However, PCC is applicable only when the data are normally-distributed. Consequently, we have chosen the more appropriate but conservative Kendall's tau to measure correlation between the tissue-specific expression divergence (\u2202E) in a context-specific manner. In fact when we replace tissue-specific \u2202E value with an overall measure of expression divergence using Pearson's correlation coefficient between the expression profiles across the 79 (or 23) tissues, we do not observe a significant correlation with DNA binding site motif similarity as shown in Prior investigations of functional diversification among paralogs have only considered sequence divergence in the entire coding portion of the genebecause there are potentially many rate determinants \u2026\u2026 it is not unexpected that the observed correlation coefficients are not very high\u201dGiven the multitude and complexity of attributes affecting evolution, most of which are not completely understood, we expect that most individual correlations will be weak. Strong correlations are indeed scarce in biological literature. Liao et al. studied the correlations between evolutionary rates of mouse paralogs and several genic parameters and remarked that \u201cExpression pattern and the DNA binding site motif represent two distinct aspects of TF function. There are others, such as interaction partners, and these distinct functional aspects are often encoded in distinct sequence domains. For instance, the DNA binding site motif is encoded largely within the DNA binding domain of the gene. In the human Forkhead (FKH) domain containing family of TFs, the sequence similarity in DNA binding FKH domain is significantly correlated with the DNA binding site motif similarity . Because selection pressure operates at the level of function, which is encoded in distinct domains, it is reasonable to study the relationship between diversification in distinct domains. Again, in the human FKH family, where the DNA binding domain is highly conserved across family members, the rest of the protein domains exhibit an accelerated divergence relative to the DNA binding domain immediately after duplication (data not shown). A specific comparison of divergence in the TF's interaction domain with either the divergence in DNA binding similarity or the expression divergence or both, would be a natural extension of the current work. However, the interaction domains of TF proteins are currently not as well characterized as the DNA binding domains. As a proxy for divergence in interaction domain, one can consider the overlap in known interaction partners. However, such an investigation is currently limited by the availability of complete interaction data. Our work generalizes the previous studies of diversification of paralogs that have focused on divergence in protein coding sequence in its entirety without distinguishing among functional protein domains and without quantifying the functional consequence of mutations in the coding sequence.As a pragmatic concern, current genomic approaches to analyzing transcriptional regulation are confounded by the fact that multiple TFs, typically closely related paralogs, bind to similar binding sites. For instance, previous analysis of motifs enriched in promoters of genes that are differentially expressed in adult failing hearts identified the FKH family. However, to implicate specific members of the Forkhead family of TFs, directed experiments such as PCR and immunohistochemistry in specific cell types are neededwww.ensembl.org). For each of the TFs, the corresponding positional weight matrix (PWM) representing their DNA binding site motif was obtained from TRANSFAC.A total of 390 distinct human TFs were obtained from TRANSFAC 10.2I\u22650.06n+4.8LL/1000)]\u22120.32[1+exp. Because multiple probes are mapped to a single gene or transcript, the probe-level data needs to be aggregated in order to obtain a gene-level or transcript-level expression value, which invariably raises issues of accuracy. Probe-level expression analysis bypasses these issues and yield reliable resultsHuman gene expression data was obtained from the Novartis human tissue survey On the Affymetrix chip underlying the genome-wide expression studies, genes are often represented by multiple probe sets and thus, have multiple expression values. Several solutions have been posed to contend with this issue: (i) only choosing probe sets with a one-to-one correspondence with genesPearson correlation coefficient (PCC) is a standard measure of interdependence between two random variables. PCC is applicable only when we wish to measure a linear relationship between two variables and the variables are from bivariate normal distributions. Because we cannot assume normally-distributed data in our case, we require a nonparametric measure of correlation. The two most common choices are Spearman's rank order correlation (Spearman rho) and Kendall tau correlation. Both measures offer similar sensitivity in detecting associations and almost always lead to the same conclusions. However, we use Kendall's tau because it has better statistical properties and there is a direct interpretation of Kendall's tau in terms of probabilities of observing concordant and discordant pairs\u2202E values for the paralogous TF pairs. We compute the Kendall's tau for 1000 such permutations and use the fraction of permutations in which the tau value exceeds the observed tau value (for the un-shuffled data) as an estimate of the p-value.Our choice of correlation measure inherently assumes that the input data consists of independent samples. In our application, this assumption is not necessarily true and consequently employing the theoretical p-value estimation of Kendall' tau is potentially erroneous. Therefore, we chose to use a permutation-based method for computing the p-value for Kendall's tau. In a given tissue sample, we pool all expression values for all TFs in our dataset, and then randomly assign expression values to each TF. This procedure effectively shuffles the TF expression values and hence shuffles the corresponding ftp://ftp.ncbi.nih.gov/pub/COG/KOG/. The proteins were mapped to Ensembl transcript and gene ids using data from www.ensembl.org. The KOG data resulted in 242 paralogous pairs with 99 unique genes. In terms of families, we obtained 24 families, 9 of size 2, 6 of size 3, and 9 of size greater than or equal to 4.KOG data and the associated gi identifiers were obtained from Nucleotide coding sequences were obtained from Ensembl for all TFs, and the pairwise Ks rates computed using the bp_pairwise_kaks.pl script from BioPerlData File S1This file contains supplementary results(0.22 MB DOC)Click here for additional data file.Data File S2This contains supplementary data in two worksheets(0.04 MB XLS)Click here for additional data file."}
{"text": "Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation.The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation). The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM) detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes.We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at . A detailed understanding of how genes are expressed and regulated in different tissues can help elucidate the molecular mechanisms of tissue development and function. The approximately 25,000 genes in the human genome demonstrate dramatic diversity in terms of expression levels, both temporally and spatially. Despite this diversity, the expression of all genes is controlled by a relatively small number  of transcription factors (TFs). These TFs usually work in specific combination to regulate individual genes . A numbeTo address this need, we have developed a new database called TiGER (Tissue-specific Gene Expression and Regulation) based on our previous analyses of tissue-specific genes, TFs and cis-regulatory modules (CRMs) for 30 human tissues . TiGER s\u2022 A large set of data on both tissue-specific genes and tissue-specific transcriptional regulatory elements: The database contains tissue-specific expression profiles for ~20,000 UniGene genes, combinatorial regulation for 7,341 interacting TF pairs, and 6,232 cis-regulatory modules for tissue-specific genes.\u2022 Flexible search capability: The database provides three views  to allow users to conveniently retrieve information about genes, TFs or tissues of interest. For example, users can simply type a gene ID  to retrieve the EST profile and CRM detections. Users can also select a tissue name to retrieve a list of genes preferentially expressed in the tissue.\u2022 Convenient accessibility: The database provides visualizations of the gene expression profiles, TF interactions and CRM detections. Sortable summary tables, links to raw data and links to external databases are also provided for user reference.The rest of the paper will describe the database content and illustrate the utility of the database in tissue-specific gene regulation.TiGER contains three types of data including tissue-specific gene expression profiles, TF interactions and CRMs. The data are organized as a relational database with a user-friendly interface. The following is a detailed description of the database content.The ~5.3 millions human EST sequences map to ~54,000 UniGene clusters . Previou10(p) values for the 307 eye-specific TF interactions. The most significant is the interaction between FOXJ2 and POU3F2, with a p-value less than 10-39. These two TFs together regulate many eye-specific genes, including RPE65.We have developed a method to identify interacting TFs based on patterns of co-occurrence of pairs of DNA binding sites . This meCRMs are the central cis-elements that control gene expression . PreviouFigure TiGER is constructed for free access and use. The downloadable data formats include standard .txt text files and .png images. The data contents are configured into three views (saved queries): gene view, TF view, and tissue view, to allow users to conveniently retrieve information relevant to genes, TFs or tissues of interest.There are three major database entities in the gene view: (1) \"EST\" entity that stores enrichment values in 30 tissues for each gene; (2) \"CRM\" entity that stores the conservation profile, the density profile, and the energy profile used for CRM detections in the promoter region of each gene; and (3) \"GeneCode\" entity that stores the mapping between UniGene, RefSeq and gene symbol.The gene view allows users to retrieve information through a simple search engine by entering a UniGene gene, a RefSeq gene or a gene symbol. The query results include a gene description, a plot of the EST profile, a list of tissues in which the gene is preferentially expressed, a plot of the three profiles used in CRM detection, and download links to the EST and CRM profiles. Links to external databases such as NCBI, UCSC Genome Browser, and GeneCard, are also included for user references.10(p)) of the interaction.There is one major database entity called \"TF-Partner\" in the TF view. This entity stores all factors that interact with a given TF, the tissue in which the interaction occurs and the significance  \"TSS-Genes\" entity that stores genes preferentially expressed in each of the 30 tissues; (2) \"TSS-TFs\" entity that stores interactions between TFs in each of the 30 tissues; and (3) \"TSS-CRMs\" entity that stores CRM modules in the promoter regions of tissue-specific genes. More specifically, the \"TSS-Genes\" entity contains four attributes including RefSeq gene ID, gene symbol, enrichment values, and descriptions. The \"TSS-TFs\" entity contains three attributions including the two participating TFs and the significance of interaction. The \"TSS-CRMs\" entity contains eight attributes including the chromosome ID, RefSeq gene ID, CRM start and end positions, transcription start position and orientation, minimum energy, and a list of TFs that regulate the gene.To retrieve information for a specific tissue, users can simply select a tissue from a drop-down menu provided in the tissue view. The query results include a summary table of genes specific to the tissue, a summary table of TF interactions and a summary table of CRM modules. These tables are instances of \"TSS-Genes\", \"TSS-TFs\", and \"TSS-CRMs,\" respectively. Links to the gene view and the TF view are embedded in the summary tables to provide an integrated environment of query and visualization  are implemented as Java servlets which dynamically query the underlying database entities. TiGER operates under an Apache web server and an Apache Tomcat engine on a SuSe Linux system. The plots of gene expression profiles, TF interactions and CRM detections are pre-generated in Matlab.We performed a large-scale analysis of gene expression, TF interaction and CRM detection in 30 human tissues. The results are stored in a web-enabled database called TiGER and configured so as to permit users to visualize or download the results through a standard web browser.There are fundamental issues relating to the computational prediction of human gene regulation. Future research will include both prediction models on gene regulation and analysis tools for interpreting prediction results. As more experimental data accumulates related to the nature of TF-DNA interactions, we plan to further develop our predictions on tissue-specific TF interactions. We also plan to extend our work on CRM detection by relating regulatory elements with temporal  and spatial  attributes. As new predictions on tissue-specific gene regulation accumulate, the TiGER database will need to be further expanded and modified. We will update the content of the database on a regular basis. We also plan to develop tools relating TiGER data to other available gene expression and regulation data for integrative analysis.Project name: TiGERProject home page: Operating system(s): Platform independent.Programming language: none.License: no restriction.Any restrictions to use by non-academics: no restriction.XL, XY and JQ conceived the construction of the database. XL developed the database interface. XY generated the data. JQ supervised the development and implementation. DJZ and HZ helped to interpret the results. XL and JQ drafted the paper, and all authors read and approved the final manuscript."}
{"text": "Artificial selection has resulted in animal breeds with extreme phenotypes. As an organism is made up of many different tissues and organs, each with its own genetic programme, it is pertinent to ask: How relevant is tissue in terms of total transcriptome variability? Which are the genes most distinctly expressed between tissues? Does breed or sex equally affect the transcriptome across tissues?In order to gain insight on these issues, we conducted microarray expression profiling of 16 different tissues from four animals of two extreme pig breeds, Large White and Iberian, two males and two females. Mixed model analysis and neighbor \u2013 joining trees showed that tissues with similar developmental origin clustered closer than those with different embryonic origins. Often a sound biological interpretation was possible for overrepresented gene ontology categories within differentially expressed genes between groups of tissues. For instance, an excess of nervous system or muscle development genes were found among tissues of ectoderm or mesoderm origins, respectively. Tissue accounted for ~11 times more variability than sex or breed. Nevertheless, we were able to confidently identify genes with differential expression across tissues between breeds (33 genes) and between sexes (19 genes). The genes primarily affected by sex were overall different than those affected by breed or tissue. Interaction with tissue can be important for differentially expressed genes between breeds but not so much for genes whose expression differ between sexes.Embryonic development leaves an enduring footprint on the transcriptome. The interaction in gene \u00d7 tissue for differentially expressed genes between breeds suggests that animal breeding has targeted differentially each tissue's transcriptome. Drosophila [Fundulus fish [It is now feasible to carry out large scale characterization of transcription activity using microarrays. This technology has opened new avenues to characterize and to dissect the transcriptome's genetic basis. It is a complementary approach to the classical ascertainment of the genetic architecture of complex traits, such as quantitative trait loci studies. There is now overwhelming evidence that the levels of mRNA are affected by a number of environmental, physiological and genetic factors, much the same as for any other quantitative, complex trait ,2. The eosophila , whereaslus fish . The stulus fish ,5.vs. healthy, by analyzing a single tissue in several individuals. Some studies have also compared different breeds or strains, again focussing on one or very few tissues in order to gain insight as to how much phenotypic variability correlates with differences at the transcriptome level; see for instance Reiner-Benaim et al. [Pubmed[In many microarray studies so far, the goal has been to compare two physiological statuses, e.g., disease m et al. . Neverthm et al. -10 and om et al. , whereas. [Pubmed as of Novs. sex) has not been quantified. The variability between tissues is not as well studied as that within tissues and some tissues remain poorly characterized, all the more in livestock species. The transcriptome of some tissues like liver and muscle have been analyzed extensively, well over a thousand citations in Pubmed[In order to contribute to answering these questions, here we study the variability in a large number of tissues pertaining to a reduced number of individuals. By allocating more experimental resources to a much larger number of tissues than usual, we aim at better characterizing the transcriptome variability across the whole organism. Although some studies have compared the transcriptome across different tissues -16, the in Pubmed as of NoBiceps femoris muscle, back fat tissue, abdominal fat tissue, stomach, liver, ileum and whole blood.The aim of this work was to study the global transcripome across tissues in two highly divergent pig breeds. We report a mixed model analysis of 16 tissues pertaining to four pigs, two Large White (LW) and two Iberian (IB), one male and one female per breed. These two breeds are phenotypically extreme for most traits of economic relevance, e.g., growth, fatness, reproductive performance. The tissues studied were olfactory bulb, hypothalamus, pineal gland, adenohypophysis, neurohypophysis, adrenal cortex, adrenal medulla, thyroid gland, diaphragm, 2) between the samples, after normalizing the raw data with the RMA procedure [biceps femori) but less clearly within each muscle. As for fat, the similarity was larger between tissues than between breeds, and samples of both back and abdominal fat origins were clustered together. The same was observed between cortex and medulla from adrenal gland. In this case, contamination between both tissues cannot be ruled out because of the irregular limits of the medulla that make not easy to separate that region neatly from the cortex collecting rapidly enough amount of tissue for analysis. Other authors have described previously contamination of medulla in the cortex sample when mechanical separation is performed[Clustering is a useful starting exploratory tool to visualize highly dimensional data, and has been widely used to microarray data since the seminal paper of Eisen and cols. . Here werocedure , as detaperformed. Thus, tAs expected, both UPGMA and NJ methods provided identical clustering at the first coalescence level. However, there were some interesting differences at higher levels. NJ identified four groups of tissues. The first group comprised brain tissues, including hypophysis; the second group, thyroid and adrenal endocrine glands; the third, muscle and fat tissues; whereas stomach, ileum, blood and liver were in the last group. In contrast, UPGMA clustered blood, liver and muscles in separate groups, while brain tissues were grouped together with fat, thyroid and adrenal glands; blood and liver were in distinct groups. It is well known that NJ have better properties than UPGMA when reconstructing evolutionary trees because it does not assume a constant evolutionary rate . But is Probe \u00d7 Tissue solutions obtained from model (2), as these solutions are corrected for 'noisy' factors such as sex, breed and global tissue effects. Thus we constructed a NJ-tree of tissue transcriptomes using the 1-extreme probe as a probe for which all four mRNA levels of the tissue were either smaller or larger than the remaining mRNA levels . In contrast, the two adrenal tissues and both fats were the closest pair of tissues. The brain is not a uniform organ, and this well known fact [The trees depicted in Figure om model , as thesown fact -23 was cInterestingly, there was a relation between embryonic origin and clustering. Most tissues with the same embryonic origin clustered together in the NJ-tree Figure . All braWe sought to investigate more in detail the genetic basis of the tissue arrangement by embryonic layers, and to pick up genes that can be differentially expressed in concerted action within each embryonic layer. To that end, we obtained the extreme gene probes differentiating the ectoderm tissues , mesoderm (muscle and fat), and endoderm . An extreme probe for each embryo layer was defined as for individual tissues, i.e., a probe whose all expression levels for that group of tissues were either smaller or larger than the levels for the rest of tissues . We excluded thyroid and adrenal glands for being mixed tissues and blood, for outlier. The complete list in additional file Pubmed, 'the function of this family member is unknown, mouse studies suggest that it represents a class of tissue-specific factors interacting with chromatin to regulate neuronal cell proliferation'. Our results strongly suggest that NAP1L2 is involved in neuronal system and that the function is maintained across species.Neverheless, some interesting results appeared. For instance, genes with ontologies like nervous development and ion transport \u2013 clearly related to central nervous system \u2013 were more frequent than expected within ectoderm extreme genes, as were genes involved in development Figure . In partIn parallel to results for ecctoderm tissues, the most significant enriched ontology was muscle development in the mesoderm Figure . Here, sbiceps femori (glycolytic muscle) extreme genes were often related to the production of ATP by glycolysis and sugar pathway. The liver extreme genes were in the urea cycle pathway and bile acid and amino acid metabolisms; blood genes pertained to hematopoietic processes and signaling pathway systems.We also obtained the extreme probes for each of the individual tissues. The main over represented biological process per tissue is in Table global variance estimates, when all probes were considered jointly. It does not follow that sex or breed were not associated to changes in gene expression. The relative importance of sex or breed did increase when we restricted the analysis to a data subset. For instance, the percentage of total variance explained by breed or sex increased to 25% or 48% when we used the 100 most differentially expressed genes between breeds or between sexes, respectively  and between zb scores and the standard deviation of the probe \u00d7 tissue solutions (bottom figure). If there were a relation, we would see the dots around a diagonal rather than close to the axes. Thus, each of the factors studied here, sex and breed, influence the transcriptome through different genetic programmes.At a false discovery rate FDR < 0.05, we identified 19 and 33 genes differentially expressed between sexes and breeds, respectively. The complete lists together with tentative annotations  are in TWe performed a clustering of probes and samples using only the differentially expressed genes from Tables The list of differentially expressed genes between sexes comprised eight X or Y linked genes, based on the localization of orthologous human genes Table . Note thet al., unpublished results). Thirteen genes (mesenteric lymph node) and ten genes (lung) were also in Table We found a good concordance with the list of differentially expressed genes obtained with the same microarray in lung and mesenteric lymph node by our group in a separate experiment , annotated as CLOCK gene , by realThe list of probe sets corresponding to differentially expressed genes at FDR < 0.05 between LW and IB breeds is in Table across all tissues. This follows from the specification of models (1\u20134), where all probes were analyzed simultaneously and where the tissue effect was included in the models as just an additional effect. Thus, it is important to bear in mind that other genes could show larger differential expressions in a specific tissue than those listed in Tables It should be noted that the differentially expressed genes reported here Tables  and 4 wef models \u20134, wherezb and zs scores for each of the tissue groups. Table z-scores. The pattern shown was highly illuminating. For sex, there seemed to be little interaction, as zs-scores were highly correlated across groups of tissues. Correlation coefficients were always > 0.9. In contrast, correlations between zb scores were much more variable and, importantly, much lower overall. Thus, whereas the correlation between brain and metabolic tissues was 0.91 for sex z-scores, it was only 0.34 for breed z-scores. This means that most differentially expressed genes between sexes were shared across tissues whereas this was much more unlikely when comparing two distant breeds like Iberian and Large White. It is interesting to note that the clusters in Figure i.e., more uniform \u2013 within sexes than within breeds. This result may have important implications. It suggests that physiological changes responsible for breed differences have targeted differentially the transcriptome across tissues. Not all tissues have been equally affected. It remains to be studied on which of the tissues the effect of breed differentiation has been the largest. Our current data set does not allow us to respond to this question accurately: the probe \u00d7 tissue heritabilities . As a result, the discussion should be considered as tentative or provisional. Nevertheless, we found defense genes to be over represented for both sex and breed specific genes. For sex, there was a significant excess of transcription and translation related genes. Some of these genes are sex linked , as mentioned above, so an over representation of this ontology is not unexpected. The GO biological processes were more scattered for breed than for sex  than that explained by sex or breed, which were comparable Table , we wereAlthough more work is needed to calibrate the actual relevance of breed or genetic differences to the pig's transcriptome (or in any other species), it seems difficult that the importance of breed or sex differences exceeds that of tissue. Thus, the argument that regulatory rather than structural mutations are a more important source of phenotypic variability  needs thi.e., LWM, LWF, IBM and IBF.Four animals, two Large White (LW) and two Iberian (IB) piglets were bought from two breeding companies and transferred to the University experimental farms at weaning, i.e., aged one month approximately. Pigs were housed simultaneously, fed the same diets during the fattening period, that lasted two months, and were weighed at weekly intervals. At the time of slaughter, the average ages were 87 and 89 days for LW and IB, respectively. Their mean live weights at that time were 37.5 (LW) and 29.1 kg (IB). The four animals were identified as LW or IB and male (M) or female (F), Biceps femoris (BIFE), back fat tissue (FATB), abdominal fat tissue (FATA), stomach (STOM), liver (LIVR), ileum (ILEU) and whole blood (BLOO). Adrenal cortex and medulla were separated by a sharp knife. The hypothalamus included the mamillary body and grey tubercle but excluded the chiasma opticum. The nomenclature for organs and tissues was used according to the Nomina Anatomica Veterinaria[Universitat Aut\u00f2noma de Barcelona, in accordance with the guidelines of the Good Experimental Practices.Animals were euthanized by an overdose of intravenous sodium thiobarbital. At necropsy, samples of 16 tissues were collected, snap frozen in liquid nitrogen and stored at -80\u00b0C. The average time gap between euthanasia and tissue collection was ~15 minutes, maximum time was 25 minutes. The tissues collected were olfactory bulb (OLFB), hypothalamus (HYPO), pineal gland (PING), adenohypophysis (AHYP), neurohypophysis (NHYP), adrenal cortex (ADGC), adrenal medulla (ADGM), thyroid gland (THYG), diaphragm (DIAP), M. terinaria. More deTotal RNA was extracted from 100 mg tissue using the RiboPure\u2122 kit  according to the manufacturer's protocol. RNA was quantified with the NanoDrop ND-1000 spectrophotometer  and the RNA integrity was assessed by Agilent Bioanalyser 2100 and RNA Nano 6000 Labchip kit . Due to high variation in concentrations of the total RNA obtained in different tissues, all samples were concentrated and cleaned using the RNAeasy MiniElute Cleanup kit  obtaining final concentrations between 500 and 1000 ng/\u03bcl.Institut de Recerca Hospital Universitari Vall d'Hebron . Briefly, the cDNA synthesis was undertaken with 5 \u03bcg of total RNA, labelled with biotin and hybridized to individual high-density oligonucleotide microarray chips (GeneChip\u00ae Porcine) from Affymetrix (Santa Clara CA) containing a total of 23,937 probe sets , representing 20,201 Sus scrofa genes, 11,265 of these genes were annotated by Tsai et al. (2006). The hybridization was done according to Affymetrix standard protocols and microarray expression data were generated with GeneChip Operating Software (GCOS). As the annotation provided by the manufacturer is not too detailed, the results in this work are based in the annotation developed by [A total of 64 microarrays  were hybridized and scanned at the S. scrofa Beta-2-microglobulin (GenBank accession number NM_213978.1) was used as endogenous control. Primers were designed using the PrimerExpress 2.0 software  and are shown in additional file We used quantitative real time PCR (QRT-PCR) to validate differential expression between sexes of one of the probes (Ssc.4897.1.A1_at) annotated as CLOCK gene . Express\u0394\u0394CT method for relative quantification (RQ) of gene expression [\u0394\u0394CT method for relative quantification. The High Capacity cDNA Transcription Kit  was used to synthesize cDNA from 1 \u03bcg of backfat tissue RNA following the manufacturer's instructions. PCR amplifications were performed in a total volume of 20 \u03bcl containing 5 \u03bcl of cDNA sample diluted 1:2000 or 1:20. Primers were used at 300 nM each and at 600 nM each for Ssc.4897.1.A1_at and microglobulin genes, respectively. Each sample was analyzed by triplicate. The thermal cycle was: 10 min at 95\u00b0C and 40 cycles of 15 sec at 95\u00b0C and 1 min at 60\u00b0C. A dissociation curve was performed in order to assess that there were not primer dimer formation. The sample of lowest expression level was used as calibratorWe used the 2-pression , a compaAffy package of bioconductor [Quality control of CEL files was done with the onductor : RNA degonductor . This sor2, where r is the correlation coefficient across all pairs of probe levels between pairs of samples. To gain further insight, we relied on mixed model methods. These have been long being used in Animal Breeding [An initial visual appraisal of the data was carried out drawing neighbor \u2013 joining (NJ) and UPGMA trees with Mega 4.0 . The paiBreeding , and havBreeding . We fittygijk refers to the expression level of the g-th Probe  at i-th tissue  from animal of breed j  and sex k . Note that a given gene may be represented by more than one probe. However, different probes of the same gene can behave differently due to at least two reasons: alternative splicing and poor annotation. Thus, here we used the probe rather than the annotated gene in the model. Preliminary studies (results not shown) shown that including the probe rather than the gene explained a larger part of the variance. Nevertheless, we refer to differentially expressed gene to mean the gene (if known) corresponding to the probe that shows a significant differential hybridization. All Tissue, Breed and Sex were treated as fixed effects, whereas Probe was random with variance was used for initial exploratory analysis. Above andAll interactions above were treated as random. The ratio of variances th Qxpak  and VCE th Qxpak on a Linui and j is the squared correlation across probes between the Probeg \u00d7 Tissuei and Probeg \u00d7 Tissuej solutions obtained from model (2). Again, NJ-trees were drawn with Mega 4 to visualize the results. An additional measure of distance between tissues can be provided by the number of extreme probes that separated a given tissue (or a group of tissues) from the rest. An extreme probe for the i-th tissue was defined as a probe for which all four mRNA levels of the i-th tissue were either smaller or larger than the remaining 60 observations pertaining to the remaining 15 tissues. The same procedure applies when Simulations showed that the probability of having such an arrangement was very small (P ~10-4) for random normal variates.We also explored the biometric relationship between tissues. The average distance between tissues was obtained from 1-i.e., for gene g PBgj is the prediction of the interaction between probe g and breed j (Probeg \u00d7 Breedj) obtained from model (3), and \u03c3\u0394 is the standard deviation of the numerator. Similar notation applies to Further, we examined the effects of breed and sex on gene expression. To do that, we computed the z-score, defined as the standardized difference of gene expression predictions between breeds  was estimated taking into account all information available. Thus, all estimates should have high accuracy, provided that the models adjust to the data. We discuss this issue in the results and discussion section below.Note that all data available were utilized simultaneously in the mixed model analyses just presented,vs. GO class frequencies in a target lits, e.g., the most differentially expressed genes between sexes or breeds or extreme genes in embryonic layers. False discovery rates are reported.We obtained the gene ontology (GO) process using the onto-express platform . This plFDR: False Discovery Rate; GO: Gene Ontology; IB: Iberian pig breed; LW: Large White pig breed; NJ: Neighbor \u2013 Joining; RMA: Robust Multiarray Average; QRT-PCR: Real Time Quantitative Reverse Transcription Polymerase Chain reaction; UPGMA: Unweighted Pair-Group Method with Arithmetic Mean.MPE conceived the research. MPE, MLB and JMF supervised research, all carried out the research. ALJF and MPE analyzed the data. ALJF and MPE wrote the first version of the manuscript.The data used in this study have been deposited in GEO under accession numbers GSE10898.List of extreme probes for each of the tissues grouped according to the three embryonic layers. Ectoderm tissues were olfactory bulb, both hypophyses, pineal gland and hypothalamus; mesoderm comprised fat and muscle tissues; and endoderm, liver, stomach and ileum. An extreme probe for a given group was defined as one where all expression values in the tissue group were either higher or lower than the values in the rest of tissues . The marginal difference is the difference between the maximum value of the extreme probe in the group of tissues under consideration and the minimum value in the rest of tissues  or between the minimum value in the group and the maximum value in the rest of tissues (a positive difference). Thus, a negative marginal diference means that the gene is underexpressed; a positive marginal difference, overexpressed. There are two sets of columns for negative and positive marginal differences, respectively.Click here for fileList of extreme genes for each of the 16 tissues studied. Notation is identical to that in additional file Click here for filePrimers used for QRT-PCR.Click here for file"}
{"text": "P = 0.0343) and that of distant metastasis . In respect of MT protein expression, the frequency of distant metastasis was more common in MT-positive tumours than in MT-negative tumours . The survival rate of the patients with MT protein-negative tumours was significantly better than that of the patients with MT protein-positive tumours (P = 0.0340). There was a positive correlation between the expression of MT protein and that of proliferating cell nuclear antigen (P = 0.0018). Therefore, we conclude that MT expression, both at the mRNA and protein levels, may be a potential marker predicting metastatic and proliferative activities of oesophageal SCC. \u00a9 1999 Cancer Research CampaignThe goal of this study is to clarify whether the expression of metallothionein (MT) could affect the prognosis and the metastatic potential of squamous cell carcinoma (SCC) of the oesophagus. In paraffin-embedded specimens resected from 57 patients, MT mRNA and protein expressions were detected by in situ hybridization and immunohistochemistry respectively. The expression of MT was evaluated in respect of clinicopathologic variables and patients' survival. MT mRNA expression was significantly associated with the proportion of lymph node metastasis (71% in MT mRNA-positive tumours vs 42% in MT mRNA-negative tumours;"}
{"text": "Paclitaxel (Taxol\u00ae) is a widely used chemotherapeutic agent that has a major dose limiting side-effect of painful peripheral neuropathy. Currently there is no effective therapy for the prevention or treatment of chemotherapy-induced painful peripheral neuropathies. Evidence for mitochondrial dysfunction during paclitaxel-induced pain was previously indicated with the presence of swollen and vacuolated neuronal mitochondria. As mitochondria are a major source of reactive oxygen species (ROS), the aim of this study was to examine whether pharmacological inhibition of ROS could reverse established paclitaxel-induced pain or prevent the development of paclitaxel-induced pain. Using a rat model of paclitaxel-induced pain , the effects of a non-specific ROS scavenger, N-tert-Butyl-\u03b1-phenylnitrone (PBN) and a superoxide selective scavenger, 4-hydroxy-2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPOL) were compared. Systemic 100 mg/kg PBN administration markedly inhibited established paclitaxel-induced mechanical hypersensitivity to von Frey 8 g and 15 g stimulation and cold hypersensitivity to plantar acetone application. Daily systemic administration of 50 mg/kg PBN (days \u22121 to 13) completely prevented mechanical hypersensitivity to von Frey 4 g and 8 g stimulation and significantly attenuated mechanical hypersensitivity to von Frey 15 g. Systemic 100 mg/kg TEMPOL had no effect on established paclitaxel-induced mechanical or cold hypersensitivity. High dose (250 mg/kg) systemic TEMPOL significantly inhibited mechanical hypersensitivity to von Frey 8 g & 15 g, but to a lesser extent than PBN. Daily systemic administration of 100 mg/kg TEMPOL (day \u22121 to 12) did not affect the development of paclitaxel-induced mechanical hypersensitivity. These data suggest that ROS play a causal role in the development and maintenance of paclitaxel-induced pain, but such effects cannot be attributed to superoxide radicals alone. Paclitaxel is a taxane-derived chemotherapeutic used alone, or in combination therapy, for the treatment of ovarian, breast and advanced non-small cell lung cancers, and AIDS-related Kaposi's sarcoma. Paclitaxel binds to \u03b2-tubulin of microtubules 2\u2212, hydroxyl radical OH., are by-products of oxidative phosphorylation and usually decomposed by specialised cellular enzymes e.g.superoxide dismutases, peroxidases. In the 1990s, the role of ROS in neuropathic pain was demonstrated with the inhibition of CCI-evoked heat hyperalgesia by novel antioxidants 4-hydroxy-2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPOL) Reactive oxygen species (ROS) e.g. superoxide radical OOur interest in the role of ROS in chemotherapy-induced pain developed after finding swollen/vacuolated mitochondria in peripheral sensory nerves of paclitaxel-treated rats, in the absence of axonal degeneration ad libitum. Bedding/cages were changed twice a week and only rats were housed in the same room. Prior to any behavioural testing, rats were habituated to the testing environment for 30 minutes on two or three separate days.All experiments were carried out in strict accordance with the UK Animals (Scientific Procedures) Act 1986 and the ethical guidelines issued by the International Association for the Study of Pain Following habituation to the behavioural testing environment and baseline measurements of mechanical sensitivity (see Section 2.2), rats were injected intraperitoneally (i.p.) with 2 mg/kg paclitaxel on four alternate days  as previously described Animals were placed on an elevated platform of small metal rods (spaced 8 mm apart) in individual Perspex boxes (dimensions 15 cm\u00d716 cm\u00d721 cm). Animals were allowed to acclimatise for 5\u201310 minutes before testing. Mechanical hypersensitivity was assessed using three von Frey filaments with bending forces of 4 g, 8 g and 15 g, in ascending order of force, as previously described N-tert-Butyl-\u03b1-phenylnitrone  was dissolved in sterile 0.9% saline for injection  resulting in a clear, colourless solution. PBN was administered intraperitoneally (i.p.) in either a treatment or prophylactic dosing paradigm, to test if PBN could treat established paclitaxel-induced pain or prevent the development of paclitaxel-induced pain.Following habituation and baseline testing, all rats received paclitaxel as described above and the emergence of mechanical hypersensitivity was monitored. On day 26 post paclitaxel initiation, von Frey testing was performed on all rats and rats were then divided into two groups displaying similar levels of mechanical hypersensitivity. Rats then received an i.p. injection of 100 mg/kg PBN (n\u200a=\u200a9) or an equivalent volume of vehicle . Rats were tested again for mechanical hypersensitivity at one hour, three hours and 24 hours following PBN/vehicle administration. This process was repeated for the next two consecutive days i.e. Day 27 & Day 28 post paclitaxel treatment. Thus rats with established paclitaxel-induced mechanical hypersensitivity received either three daily injections of 100 mg/kg PBN or saline, with each injection followed 1, 3 and 24 hours later by von Frey testing. Throughout the experiment, behavioural testing was performed under blind conditions by a single experimenter (MF). Injections were performed by another scientist. PBN/vehicle treatments were randomised within the equal groups of 6 animals being tested in a given session. These methods provided a concurrent vehicle-treated group throughout the experiments to control for potential variety in behavioural response due to the time of day. Following completion of the experiment, the identity of the treatment received by each rat was revealed and the data analysed.Following habituation and four baseline measurements, rats were divided into two groups based on their responses to von Frey stimulation providing two groups with similar average baseline mechanical sensitivity. Rats received daily i.p. doses of either 50 mg/kg PBN (n\u200a=\u200a8) or an equivalent volume of vehicle  for 15 consecutive days (day -1 through to day 13). On days 0, 2, 4 & 6 when paclitaxel was also administered, rats received PBN/vehicle injection before the paclitaxel injection. 50 mg/kg PBN was used in this experiment as opposed to 100 mg/kg due to concerns over tolerability to large injection volumes during an extended period. Mechanical sensitivity was then assessed in the mornings on days 7, 10, 14, 17, 19, 21, 25, 28, 31, 34, 38, 41 and 45 following the initiation of paclitaxel treatment (day 0). Throughout the experiment, behavioural testing and PBN/vehicle administration was performed under blind conditions by a single experimenter (MF). Following completion of the experiment, the identity of the treatment received by each rat was revealed and the data analysed.4-Hydroxy-2,2,6,6-tetramethylpiperidine 1-oxyl  dissolved in sterile 0.9% saline for injection  resulting in an orange solution. TEMPOL was administered intraperitoneally (i.p.) in either a prophylactic or treatment dosing paradigm to test if TEMPOL could treat established paclitaxel-induced pain or prevent the development of paclitaxel-induced pain.Following habituation and baseline testing, all rats received paclitaxel as described above and the emergence of mechanical hypersensitivity was monitored. On day 27 post paclitaxel initiation, von Frey testing was performed on all rats and rats were then divided into three groups displaying similar levels of mechanical hypersensitivity. Rats then received an i.p. injection of either 100 mg/kg TEMPOL (n\u200a=\u200a8), 250 mg/kg TEMPOL (n\u200a=\u200a8) or an equivalent volume of vehicle . Rats were tested again for mechanical hypersensitivity at one hour, three hours and 24 hours following TEMPOL/vehicle administration. Throughout the experiment, behavioural testing was performed under blind conditions by a single experimenter (SJLF). Injections were performed by another scientist. TEMPOL/vehicle treatments were randomised within the equal groups of 8 animals being tested in a given session. These methods provided a concurrent vehicle-treated group throughout the experiments to control for potential variety in behavioural response due to the time of day. Following completion of the experiment, the identity of the treatment received by each rat was revealed and the data analysed. Initially this TEMPOL treatment dosing paradigm was intended to run over three consecutive days (as performed for PBN). However due to significant side-effects  observed immediately following 250 mg/kg administration the experiment was curtailed. These side-effects were not evident at the one hour testing time point.In the prophylactic paradigm, following habituation and baseline testing, rats were divided into two groups based on their responses to von Frey stimulation providing two groups with similar baseline mechanical sensitivity. Rats received daily i.p. doses of either 100 mg/kg TEMPOL (n\u200a=\u200a9) or an equivalent volume of vehicle  for 14 consecutive days (day \u22121 through to day 12). On days 0, 2, 4 & 6 when paclitaxel was also administered, rats received TEMPOL/vehicle injection before the paclitaxel injection. Mechanical sensitivity was then assessed in the mornings on days 7, 13, 17, 20, 24, 27, 33, 39 and 45 following the initiation of paclitaxel treatment (day 0). Throughout the experiment, behavioural testing and TEMPOL/vehicle administration was performed under blind conditions by a single experimenter (SJLF). Following completion of the experiment, the identity of the treatment received by each rat was revealed and the data analysed. As TEMPOL dissolved to give an orange solution, blinding procedures were more challenging than in PBN experiments. KCL Biological Services Unit staff kept SJLF blind to treatment received by randomisation of rat order within the elevated testing environment (at day 7) and by renumbering rats from day 12 onwards.0\u200a=\u200ano response, 1\u200a=\u200aquick withdrawal, flick or stamp of the paw, 2\u200a=\u200aprolonged withdrawal or repeated flicking (\u22653) of the paw, 3\u200a=\u200arepeated flicking of the paw with licking directed at the ventral side of the paw. Acetone was applied alternately three times to each paw and the responses scored categorically. At least 12 minutes had elapsed before the next application of acetone was applied to the same hind paw. Cumulative scores were then generated by adding the 6 scores for each rat together, the minimum score being 0  and the maximum possible score being 18 . All testing was performed on rats when they were alert, not grooming and with all four paws in contact with the platform.Animals were placed on an elevated platform of small metal rods (spaced 8 mm apart) in individual Perspex boxes (dimensions 15 cm\u00d716 cm\u00d721 cm). Animals were allowed to acclimatise for 5\u201310 minutes before testing. Cold hypersensitivity was assessed using acetone, as previously described Following habituation and baseline testing, 24 rats received paclitaxel as described above and the emergence of cold hypersensitivity was monitored. Due to time constraints, this experiment using 24 rats was conducted on two separate days. On day 27 post paclitaxel initiation, acetone testing was performed on 15 rats and rats were then divided into three groups (n\u200a=\u200a5) displaying similar levels of cold hypersensitivity. Rats then received an i.p. injection of either 100 mg/kg PBN, 100 mg/kg TEMPOL or an equivalent volume of vehicle . Rats were tested again for cold hypersensitivity at one hour, three hours and 24 hours following PBN/TEMPOL/vehicle administration. On day 30 post paclitaxel initiation, acetone testing was performed on the remaining 9 rats and rats were then divided into three groups (n\u200a=\u200a3) displaying similar levels of cold hypersensitivity. Similarly, rats then received an i.p. injection of either 100 mg/kg PBN, 100 mg/kg TEMPOL or an equivalent volume of vehicle . Rats were tested again for cold hypersensitivity at one hour, three hours and 24 hours following PBN/TEMPOL/vehicle administration. Throughout the experiment, behavioural testing was performed under blind conditions by a single experimenter (LAG). Injections were performed by another scientist. PBN/TEMPOL/vehicle treatments were randomised within the groups of animals (7\u20139) being tested in a given session. These methods provided a concurrent vehicle-treated group throughout the experiments to control for potential variety in behavioural response due to the time of day for example. Following completion of the experiment, the identity of the treatment received by each rat was revealed and the data pooled from each part of the experiment resulting in n\u200a=\u200a8 for each treatment group.One tailed unpaired t-tests with Bonferroni correction were used to compare the effects of repeated PBN treatment to vehicle treatment on established paclitaxel-induced mechanical hypersensitivity . One wayA cumulative dose of 8 mg/kg paclitaxel administered in four i.p. injections resulted in significant mechanical and cold hypersensitivity, assessed by responses to von Frey 4 g, 8 g and 15 g stimulation and acetone application, respectively. Maximal mechanical hypersensitivity was observed around day 27 post paclitaxel initiation as previously described Prophylactic PBN administration before, during and after paclitaxel administration  had a marked preventative effect on the development of paclitaxel-induced mechanical hypersensitivity . No sign2\u2212) using TEMPOL, a superoxide dismutase mimetic. Given these inhibitory effects on paclitaxel-induced pain of global ROS inhibition by PBN, we investigated whether these inhibitory effects could be replicated with selective inhibition of superoxide radicals  are illustrated in Paclitaxel is also known to induce cold hypersensitivity in humans in vivo. We have observed the effects of systemic administration of a non-specific ROS scavenger, PBN, and a superoxide-specific scavenger, TEMPOL, in both treatment and prophylactic dosing paradigms. The rationale for these experiments was to test if PBN and/or TEMPOL could reverse established paclitaxel-induced pain and/or prevent the development of paclitaxel-induced pain, as both scenarios have significant clinical relevance.In this study, we have examined the role of ROS in the maintenance and development of paclitaxel-induced painful peripheral neuropathy The first administration of PBN markedly inhibited established paclitaxel-induced mechanical hypersensitivity to von Frey 8 g and 15 g stimulation for over three hours. Similarly, repeated bolus PBN treatment on the following two days also significantly inhibited this mechanical hypersensitivity, but to a lesser extent, perhaps indicating tolerance to repeated PBN administration. Mechanical hypersensitivity to von Frey 4 g was unaffected by PBN treatment, which could suggest a lack of anti-allodynic effect by PBN or the relatively small window of hypersensitivity to von Frey 4 g in this cohort of rats to elicit a statistically significant inhibition. PBN also significantly inhibited paclitaxel-induced cold hypersensitivity. In comparison, prophylactic PBN dosing completely prevented the development of mechanical hypersensitivity to von Frey 4 g & 8 g stimulation through to day 45 post paclitaxel initiation. Prophylactic PBN dosing also delayed the appearance of, and reduced the magnitude of mechanical hypersensitivity to von Frey 15 g. These effects demonstrate that ROS play a role in both the maintenance and development of paclitaxel-induced pain.The effects of TEMPOL on paclitaxel-induced mechanical hypersensitivity we observed were quite different to the inhibitory effects of PBN. The same dose of TEMPOL (100 mg/kg) did not inhibit established paclitaxel-induced mechanical hypersensitivity. High dose (250 mg/kg) TEMPOL inhibited mechanical hypersensitivity to von Frey 8 g and 15 g at one hour, but to a lesser extent than observed with PBN and these effects were not present at three hours post administration. Similar to PBN, TEMPOL had no effect on established mechanical hypersensitivity to von Frey 4 g. However, in marked contrast to PBN, prophylactic TEMPOL showed no inhibitory effects on the development of paclitaxel-induced mechanical hypersensitivity through to day 45 post paclitaxel initiation. Prophylactic TEMPOL was administered at twice the prophylactic PBN dose that prevented development of paclitaxel-induced mechanical hypersensitivity. It is possible that higher doses of TEMPOL may have an inhibitory effect on the development of paclitaxel-induced pain. However, given the side-effects observed in the minutes following 250 mg/kg TEMPOL administration in the established pain study, we decided that 100 mg/kg was the maximally tolerated dose for repeated prophylactic dosing. The overall lack of effect of TEMPOL in this study suggests that superoxide radicals do not play a role in the maintenance or development of paclitaxel-induced pain. The lack of parallel effects of PBN and TEMPOL in paclitaxel-induced pain provides further evidence that chemotherapy-induced painful peripheral neuropathies have different causal mechanisms to other pain states. Previously, both PBN and TEMPOL at similar doses have been shown to inhibit SNL-evoked heat and mechanical hypersensitivity in a similar manner A recent study has examined the effects of PBN on paclitaxel-induced mechanical hypersensitivity The causal mechanism(s) for chemotherapy-induced painful peripheral neuropathy are unclear. Various rodent models of paclitaxel-induced painful peripheral neuropathy have been reported using different systemic dosing schedules and cumulative doses of paclitaxel The inhibitory effects of a non-specific ROS scavenger reported here indicate that ROS has a causal role in paclitaxel-induced pain. While we have provided evidence to suggest superoxide radicals do not play a major role in paclitaxel-induced painful peripheral neuropathy, further study could address the contribution of other free radicals such as hydrogen peroxide, peroxynitrite and hydroxyl radicals. Considering that mitochondria are a major source of ROS, this perhaps demonstrates a consequential mechanism of how the atypical mitochondria in peripheral sensory axons lead to paclitaxel-induced pain. Alternatively, as superoxide radicals are predominantly derived from mitochondria, it is possible that the ROS responsible for paclitaxel-induced pain are generated from other sites in the cell. In this model of paclitaxel-induced painful peripheral neuropathy, atypical mitochondria were observed at day 7 (where no pain behaviour is observed) and day 27 (peak pain severity) In conclusion, this study demonstrates that global inhibition of ROS can inhibit established paclitaxel-induced pain and prevent the development of paclitaxel-induced pain, whereas selective inhibition of superoxide radicals was mostly ineffective. The causal role of ROS in paclitaxel-induced painful peripheral neuropathy highlights a potential novel therapeutic strategy for the prevention and treatment of this major dose-limiting side-effect."}
{"text": "EGFR overexpression in head and neck squamous cell carcinoma (HNSCC). For this reason, expression/mutation of EGFR were analyzed in 30 dysplastic head and neck lesions and 148 HNSCC samples of Indian patients along with 3 HNSCC cell lines. In addition, deletion/methylation/mutation/expression of SH3GL2 (associated with EGFR degradation) and CDC25A (associated with dephosphorylation of EGFR) were analyzed in the same set of samples. Our study revealed high frequency of EGFR overexpression (66\u201384%), low frequency of gene amplification (10\u201332.5%) and absence of functional mutation in the dysplastic lesions and HNSCC samples. No correlation was found between protein overexpression and mRNA expression/gene amplification status of EGFR. On the other hand, frequent alterations (deletion/methylation) of SH3GL2 (63\u201377%) and CDC25A (37\u201364%) were seen in the dysplastic and HNSCC samples. Two novel single nucleotide polymorphism (SNPs) were found in the promoter region of SH3GL2. Reduced expression of these genes showed concordance with their alterations. Overexpression of EGFR and p-EGFR were significantly associated with reduced expression and alterations of SH3GL2 and CDC25A respectively. In-vitro demethylation experiment by 5-aza-2\u2032-deoxycytidine (5-aza-dC) showed upregulation of SH3GL2 and CDC25A and downregulation of EGFR expression in Hep2 cell line. Poor patient outcome was predicted in the cases with alterations of SH3GL2 and CDC25A in presence of human papilloma virus (HPV) infection. Also, low SH3GL2 and high EGFR expression was a predictor of poor patient survival. Thus, our data suggests that overexpression of EGFR due to its reduced degradation and dephosphorylation is needed for development of HNSCC.The aim of this study is to understand the mechanism of  EGFR) protein, deletion in chromosome 9p21, p16/p14 inactivation, trisomy of chromosome 7 and telomerase activation were suggested to be associated with the development of hyperplastic lesions of head and neck EGFR is quite important due to its regulation of multiple cell signaling cascades. Nowadays, multiple therapeutic targets have been made against EGFR to treat this tumor, but success is still far behind Head and neck squamous cell carcinoma is the sixth most common cancer worldwide and it accounts for 30\u201340% of all cancer types in the Indian subcontinent EGFR protein was seen in HNSCC yet amplification of this locus was not prevalent (10\u201330%) EGFR in HNSCC. It was evident that binding of EGF to EGFR triggered a series of biochemical events including autophosphorylation of specific tyrosine residues  in its kinase domain SH3GL2 interaction SH3GL2 (located at chromosome 9p22.2) have been reported in head and lesions SH3GL2 interacts with CIN85, whereas the LPAAT domain of SH3GL2 is associated with lysophophatydic acid acyl tyransferase activity which converts lysophosphotidic acid (LPA) into phosphatidic acid (PA) needed for membrane curvature for encapsulation of EGFRSH3GL2 and EGFR in HNSCC has not yet been studied. On the other hand, Shang, et al CDC25A, a dual phosphatase, could regulate the activity of EGFR through dephosphorylation of the tyrosine residues. Its frequent deletion (53%) and reduced expression (64%) have been reported in HNSCC SH3GL2, association of CDC25A with EGFR in HNSCC has not yet been studied.Though, frequent (80\u201390%) overexpression of EGFR protein overexpression, we analyze the alterations of EGFR, SH3GL2 and CDC25A in the same set of HNSCC samples. At first, alterations  of EGFR were analyzed in primary head and neck lesions of Indian patients and some HNSCC cell lines. Then, alterations (deletion/promoter methylation/mutation/expression) of SH3GL2 and CDC25A were analyzed in these samples. Our data suggests that overexpression of EGFR protein might be due to the impairment of the SH3GL2 associated endocytosis mechanism, whereas down regulation of CDC25A in this tumor might lead to the EGFR protein in its active state.Thus, to understand the molecular mechanism of The Institutional Ethical board of Chittaranjan National Cancer Institute, Kolkata approved the usage of Human specimens in this study. The above board approved usage of these human clinical samples specifically in this study, related to the involvement of the study of EGFR homeostasis in HNSCC. The tumor specimens were collected from the hospital section of Chittaranjan National Cancer Institute, Kolkata, after obtaining written, informed consent of the concerned patients, in stipulated format, approved by the above mentioned Institutional Ethical board of Chittaranjan National Cancer Institute, Kolkata, India. Blood samples were collected from healthy control with written informed consent as approved by the Institutional ethical Board.Total 178 tumor tissue samples of head and neck lesions as well as matched adjacent normal tissues were collected from Chittaranjan National Cancer Institute, Kolkata, India. The primary tumors were collected from patients after surgical resection having no previous treatment record. All these tumors were graded and staged according to UICC TNM classification. Samples were frozen immediately after collection at -80\u00b0C until use. Part of the freshly operated tissues was directly collected in TRIzol reagent  for RNA isolation and another part was fixed in formalin and embedded in paraffin for immunohistochemical analysis. Clinicopathological information of the patients (n\u200a=\u200a178) were presented in The contaminant normal cells in the head and neck lesions were removed by microdissection procedure from cryosections (5 \u00b5m) using surgical knives under a dissecting microscope . The representative sections from different regions of the specimens were stained with hematoxylin and eosin for diagnosis as well as for marking of the dysplastic epithelium/tumor rich regions. The samples containing >60% dysplastic epithelium/tumor cells were taken for isolation of DNA according to the standard procedure EGFR, SH3GL2 and CDC25A was done by immunohistochemical analysis in 50 primary tumor samples and by immunoflorescence analysis in Hep2, KB, SCC084 according to the standard procedure as describe earlier CDC25A (sc-6947), SH3GL2 (sc-10874), EGFR (sc-03) and p-EGFR (sc-57541) at a dilution of 1\u223680 at 4\u00b0C. HRP conjugated rabbit anti-goat (sc-2020), goat anti rabbit (sc-2004) and goat anti mouse (sc-2005) secondary antibody was added 1\u2236500 dilutions. The slides were developed using 3\u20133\u2032 diaminobenzidine (DAB) as the chromogen and counterstained with hematoxylin and photographed in Bright Field microscope . The staining intensity  and the percentage of positive cells  were detected by 2 observers independently and by combining the two scores, final evaluation of expression was done  The protein expression of For immunofluroscence analysis, cover slip culture of Hep2, KB and SCC 084 cell lines were reacted with the same dilution of primary antibody of these genes after permeabilisation with 0.5% Triton X-100 and blocking with 5% BSA. After washing, the coverslips were incubated with FITC conjugated corresponding secondary antibody goat anti mouse (sc-2010), goat anti rabbit (sc-2012) and rabbit anti goat (sc-2777) at 1\u2236500 dilution and mounted with glycerol after thorough washing. Imaging of the cover slip was performed in florescence microscope .EGFR amplification was carried out using differential polymerase chain reaction (DPCR) method EGFR gene was selected for amplification analysis. The dopamine D2 receptor gene (DRD2) gene was used as internal control due to low frequency of alterations reported in HNSCC A quantitative measurement of EGFR and SH3GL2 was screened in 30 dysplastic lesions, 148 invasive samples and 3 oral cancer cell lines by single strand conformation polymorphism (SSCP) analysis using [\u03b1-P32] dCTP as described by Tripathi el al EGFR. For mutation analysis of SH3GL2, important enzymatic domain and alternating splice site of the gene were selected. Exon 9 & exon-10 encoded the SH3domain and exon-1 & exon-2 encoded the lysophosphatydic acid acyl transferase enzymatic domain of the gene. The alternating splice sites were located in exons 3, 4, &5. All these exons were selected for mutation analysis of SH3GL2. Primer sequences and locations were presented in The mutation of http://www.ensembl.org, Release-49). An intragenic microsatellite marker D9S157 located 17.61 Mb from p-ter of chr. 9 was taken for analysis of SH3GL2 and D3S3560 locus located 48.16 Mb from p-ter of chr. 3 and 4.8 Kb telomeric of the gene was taken for deletion analysis of CDC25A. Details of the markers was shown in In microsatellite based deletion mapping, a standard polymerase chain reaction (PCR) containing [\u03b3-P32] ATP end labeled forward primer was done in a 20 \u00b5l reaction volume according standard procedure as describe earlier SH3GL2 and CDC25A was analyzed by PCR-based methylation sensitive restriction analysis (MSRA) method using MspI/HpaII restriction enzymes  using standard procedure as describe previously The promoter methylation of the candidate genes SH3GL2, CDC25A and EGFR were analyzed in 22 primary HNSCC samples and their corresponding normal head and neck tissues and 3 cell lines  using primers as mentioned in mRNA expression of In our previous analysis of 5-aza-dc experiment at different concentrations (5\u201350 \u00b5M) it was evident that the cell viability was unaltered up to 5 days of 5-aza-dc treatment at 20 \u00b5M concentration. For this reason, the 5-aza-dc concentration was taken upto 20 \u00b5M in Hep2 cell line. Subconfluent cultures of Hep2 was treated with 5 M, 10 M and 20 M demethylating agent, 5-aza-dC  for 5 days. Controls without 5-aza-dC were cultured concomitantly in the same manner. After completion of treatment, cells are harvested and proceeded for next experiment.For kinetic study, subconfluent cultures of Hep2 cell line were treated with 20 \u00b5m 5-aza-dc in six Petri dish and the cells were harvested at different time point like 0 hour, 24 hours, 48 hours, 72 hours, 96 hours and 120 hours after aza treatment and protein was isolated from the cells. For immunoflorescence analysis after aza treatment, Hep2 cells were grown over night on cover slip and treated with 20 \u00b5m 5-aza-dc for 72 hour. Then the cells were fixed with chilled methanol and used for immunoflorescence analysis.5 cells were plated in 35 mm petri dish. After 24 hour, media was replaced with serum and antibiotic free media and siRNAs were transfected using Lipofectamin 2000 (Invitrogen) according to the manufacturer protocol. The siRNA of SH3GL2 (SC-35304), CDC25A (SC-29254) and scrambled control (SC-37007) were purchased from Santa Cruz Biotechnology, CA, USA and were used at a final concentration of 80 pmole. After siRNA transfection, cells were harvested at different time point like 24 hour, 48 hour, 72 hour and 96 hour for each gene and RNAs were isolated to find out the time point for maximum gene knock down by real time quantitation. After characterizing the time for optimum gene knock down, cells were again treated with siRNA and harvested after particular time to isolate the protein.The siRNA mediated knock down of SH3GL2 and CDC25A experiment was done in oral cancer cell line SCC084 according to standard procedure EGFR, p-EGFR(sc-12351), SH3GL2, CDC25A, Actin (sc-8432) and alpha-tubulin (sc-5286) and HRP-tagged secondary antibodies and developed with luminol . The signal intensities were scanned by densitometric scanning (Bio-Rad GS-800). The same membrane was used for incubation with different antibodies after stripping with 0.2M NaOH (See Supplementary method for details of the protocol Proteins were extracted from cells by using standard protocol Presence of HPV in the head and neck lesions was detected by PCR using primers (MY09 and MY11) from the consensus L1 region followed by typing of HPV 16/18 in the L1 positive samples as described previously Fisher\u2019s exact test was used to determine the association between tumors genetic profile and different clinicopathological features. All statistical tests were 2-sided and considered significant at probability value, p<0.05. Survival curves were calculated according to Kaplan\u2013Meier method in 148 HNSCC samples. For this method, p values were evaluated by the log rank test for censored survival data. A Cox-proportional hazards regression model was used to test the statistical significance of several potential prognostic factors like clinical stage, tumor site, tobacco exposure, HPV infection and alterations of the candidate TSGs that were jointly predictive of overall survival of the patients. From this model we estimated the hazard ratio (HR) for each potential prognostic factor with a 95% confidence interval (CI) in univariate and a multivariate fashion. All the statistical analysis was performed using statistical programs Epi Info 6.04 b, SPSS 9.0 .20. Transcription factor binding site of SH3GL2 promoter was analyzed uising on line server Alibaba 2.1 TF Binding Prediction software 21.All the oligonucleotides primers used in different experiment were designed using primer-3 software EGFR was seen in basal layer followed by gradual decrease in parabasal and spinous layers  of dysplastic lesions. In invasive HNSCC tumor, overexpression of EGFR was observed in 84% (37/44) samples irrespective of tumor stages  of the head and neck lesions showed fication . Gradualfication . No amplfication . Thus, EEGFR is a rare event in HNSCC.In SSCP analysis, about 13% (24/178) and 20% (35/178) of the HNSCC samples showed altered bands in exon-18 and exon-20 respectively , c, d. NEGFR mRNA with mean fold expression of 1.46 (\u00b110.58)  of the HNSCC samples showed overexpression of (\u00b110.58) . The mRN(\u00b110.58) . No overSH3GL2 and 60 of 178 at CDC25A locus), high frequency of deletion was observed in SH3GL2  and CDC25A  loci (SH3GL2 and CDC25A were observed in 27% (7/26) and 37% (6/16) dysplastic lesions respectively. Comparable frequency of SH3GL2 deletion (30\u201346%) was observed in subsequent stages, while deletion frequencies of CDC25A (37\u201341%) were comparable upto stage-I/II followed by significant increase (61\u201364%) in stage-III/IV of the HNSCC samples (SH3GL2 and CDC25A loci in varying frequencies (4\u201316%)  in tumor samples (After excluding non-informative tumor samples (21 of 178 at 08) loci . The del samples . In addi (4\u201316%) . This in samples .SH3GL2 gene in HNSCC lesions  of methylation in subsequent stages of HNSCC  in dysplastic lesions and became comparable (64%\u201377%) in subsequent stages of tumor progression  of promoter methylation was seen in the  lesions . No proms report  [14]. Inn of DNA . Concordn of DNA . In dyspof HNSCC . Thus itgression .In SSCP analysis, altered bands in exon-1 were seen in 18% (32/178) HNSCC samples and also in their respective normal samples . No otheSH3GL2 is a rare event in HNSCC.To identify the nature of observed sequence variations, sequencing analysis of these variants was done in 52 control DNA samples. The \u221231 heterozygous allele variant (C>T) was observed in 4% (2/52) control samples , c. On tSH3GL2 mRNA expression with 6.4 (\u00b113.5632) mean fold reduction (CDC25A reduced expression was seen in 60% (15/25) of the samples with 2.4 (\u00b114.41543) mean fold reduction   (It was evident that 80% (20/25) primary HNSCC samples showed \u22652 fold reduction of eduction . In caseeduction . No chan0.00278) .SH3GL2, CDC25A and p-EGFR in the basal/parabasal/spinous cells of normal oral epithelium  of the samples  (SH3GL2 showed significant association (p\u200a=\u200a0.0011) with overexpression of EGFR in the samples (CDC25A was observed in 70% (35/50) of the samples. Cytoplasmic and perinuclear expression of CDC25A was seen in the cell lines with low expression in Hep2 (CDC25A was concordant with its deletion pattern of the samples (p\u200a=\u200a0.011)  of the samples (p-EGFR was seen in the cell lines (p-EGFR in the tumors showed correlation with reduced expression of CDC25A (p\u200a=\u200a0.0117 )  . In addi samples . In the  in Hep2 , b, c. T=\u200a0.011) . In case samples . Cytoplall lines , b, c. I0.0117 ) .SH3GL2 and CDC25A mediated regulation of EGFR/p-EGFR demethylation experiment in presence of 5-aza-dc was done in Hep2 cell line. It was evident that the mRNA expression of SH3GL2 and CDC25A was gradually increased with increasing concentration of 5-aza-dc with significant increase of SH3GL2 at higher concentration . In concordance with mRNA expression, protein expression of SH3GL2 and CDC25A was significantly reduced after 72 hour of siRNA treatment  c &d. InInfection by HPV is considered as one of the important etiological factors for HNSCC development. HPV typing was done in this study to analyze the frequency of high-risk HPVs in our samples. HPV DNA was detected in 52.2% (93/178) of the tumors. Among the HPV positive samples, 92.5% (86/93) were HPV-16-positive and 7.5% (7/93) were HPV-18 positive. HPV infection was found to be significantly associated with tobacco consumption (p\u200a=\u200a0.0341) .CDC25A and SH3GL2 (p\u200a=\u200a0.02). The patients having alterations in both SH3GL2 and CDC25A had the worse overall survival indicating prognostic significance of these genes among the HNSCC patients    whereas,\u200a0.0461) . Interesnfection  and ii) n tumors . On the d p-EGFR .SH3GL2, EGFR amplification and absence of HPV infection showed hazardous to survival of the patient  and EGFR amplification  in absence of HPV infection  were significant predictors for hazardous life and poor survival of patients  of dysplastic and HNSCC samples (EGFR locus amplification (10\u201330%) has also been reported in HNSCC EGFR related to lung cancer, we did not find any such mutations. Like our data, infrequent mutation of EGFR has been reported in HNSCC EGFR overexpression in this tumor having absence of genetic alterations in EGFR has not yet been elucidated. Although, a significant correlation was seen between gene amplification and mRNA expression, protein overexpression did not correlate with mRNA expression status of EGFR  of SH3GL2 and CDC25A genes associated with EGFR homeostasis. Frequent deletion/methylation of SH3GL2  was evident in the head and neck lesions with comparable frequencies (63% to 77%) in dysplastic lesions and HNSCC samples  in the promoter region of this gene  of CDC25A and expression of p-EGFR were done in same set of the head and neck lesions. Frequent deletion of CDC25A was seen in dysplastic lesions and subsequent stages as seen our previous report  in varying frequencies in numerous human cancer CDC25A was seen in HNSCC samples as seen in our earlier study CDC25A (30\u201380%) has been reported in different carcinomas in liver, esophagus, colon, breast including head and neck CDC25A was observed in our samples, the upregulation of this gene by 5-aza-dc in Hep2 cell line suggests the presence of methylation in the some other regulatory regions Click here for additional data file.Figure S2Molecular alterations of SH3GL2.(TIF)Click here for additional data file.Figure S3ICC analysis of EGFR, p-EGFR, SH3GL2 and CDC25A in presence and absence of 5-aza-dc.(TIF)Click here for additional data file.Figure S4Alterations(deletion/methylation) pattern of SH3GL2 and CDC25A in dysplasia and HNSCC samples.(TIF)Click here for additional data file.Figure S5Demethylation experiment of SH3GL2 and CDC25A in Hep2 cell line.(TIF)Click here for additional data file.Table S1Clinical information of control samples.(DOC)Click here for additional data file.Table S2Primer profile used in different experiment.(DOC)Click here for additional data file.Table S3Information of microsatellite markers.(DOC)Click here for additional data file.Table S4Correlation between DPCR and QPCR.(DOC)Click here for additional data file.Table S5Molecular alterations of EGFR.(DOC)Click here for additional data file.Table S6Association of alterations of genes with different clinicopathological parametres.(DOC)Click here for additional data file.Table S7Compilation of mutation analysis of SH3GL2.(DOC)Click here for additional data file.Table S8Effect of 5-aza-dc treatment on expression of EGFR, SH3GL2 and CDC25A.(DOC)Click here for additional data file.Doc S1Supplementary methods.(DOC)Click here for additional data file."}
{"text": "Fusarium oxysporum G12 was cloned together with its native preprosequence and a C-terminal His-tag, and successfully expressed both in Escherichia coli and Pichia pastoris. The enzyme was subsequently purified and characterized. Among all tested substrates, the highest catalytic efficiency (kcat/Km) was found with 1-methyl-\u03b2-D-galactopyranoside (2.2 mM\u22121 s\u22121). The Michaelis constant (Km) for D-galactose was determined to be 47 mM. Optimal pH and temperature for the enzyme activity were 7.0 and 40\u00b0C, respectively, and the enzyme was thermoinactivated at temperatures above 50\u00b0C. GalOx contains a unique metalloradical complex consisting of a copper atom and a tyrosine residue covalently attached to the sulphur of a cysteine. The correct formation of this thioether bond during the heterologous expression in E. coli and P. pastoris could be unequivocally confirmed by MALDI mass spectrometry, which offers a convenient alternative to prove this Tyr-Cys crosslink, which is essential for the catalytic activity of GalOx.A gene coding for galactose 6-oxidase from  Fusarium graminearum (formerly classified as Dactylium dendroides) being perhaps the best studied representative. GalOx catalyzes the oxidation of primary alcohols  to aldehydes, accompanied by the reduction of molecular oxygen to hydrogen peroxide Galactose oxidase  is a member of the radical copper oxidase family GalOx is characterized by a broad substrate tolerance, yet strict stereospecificity, for various alcohol substrates F. graminearum GalOx, Tyr272, one of the copper ligands, is covalently linked at C\u03b5 to the sulphur atom of Cys228. This bond seems to have partial double-bond character with C\u03b2 of Cys228 lying in the same plane as the ring of Tyr272 \u2022-Cys redox cofactor in GalOx is a self-processing reaction requiring only the apoprotein, copper, and dioxygen; no other proteins or enzymes are required for the processing and assembly of the catalytically active enzyme II, Tyr\u2022) and the reduced form  are involved in the catalytic cycle. The semi-reduced form  is catalytically inactive but can be oxidized to the catalytically active oxidized form Typically, wild-type fungal GalOx is produced as a prepro form carrying a N-terminal signal sequence, which is removed upon secretion, yielding the immature proform. The prosequence in this form was suggested to function as an intramolecular chaperone supporting copper binding and cofactor formation F. graminearum has been cloned and expressed in E. coli with low yields P. pastorisA. nidulansWild type GalOx of F. oxysporum both in E. coli and P. pastoris. We investigated the biochemical properties of the enzyme, and for the first time confirmed the formation of the unique thioether bond in both expression systems directly using mass spectrometry.In this study, we report the successful heterologous expression of a novel, not-yet-characterized GalOx from E. coli strain BL21 (DE3) and P. pastoris strain X-33 were purchased from Invitrogen . E. coli NEB 5-alpha was from New England BioLabs. The HisPrep FF 16/10 column was from GE Healthcare Bioscience AB . F. oxysporum strain G12 was kindly provided by Gerhard Adam .All chemicals were reagent-grade or better and purchased from Sigma-Aldrich  unless otherwise stated. 2,2\u2032-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) was obtained from Amresco . Restriction enzymes, ligase and standards for Agarose gel electrophoresis (GeneRuler DNA Ladder Mix) were obtained from Fermentas  while the Phusion polymerase was from New England BioLabs . SDS-PAGE protein standard (Precision Plus Protein prestained standard) was from BioRad . The cloning vector pJET 1.2 was purchased from Fermentas and the expression vector pET21a from Novagen . The expression vectors pPICZB and pPICZ\u03b1A, Fusarium oxysporum strain G12 was cultivated in shaken flasks for 2 days at 25\u00b0C and 110 rpm in Sabouraud medium . Fungal mycelium was collected by centrifugation  and washed. Subsequently, genomic DNA was isolated from 100 mg of frozen mycelia ground in liquid nitrogen using the Wizard SV Genomic DNA Purification System . The GalOx gene including its prepro sequence was amplified by PCR using primers based on the published genome of F. oxysporum5\u2032-ATGAAGCCCCTTTGGACACTTGC-3\u2032 and 5\u2032-CTACTGAGTAACGAGAAGAGTACTCGC-3\u2032. The resulting PCR product of approximately 2 kb was purified from the agarose gel using the Wizard SV Gel & PCR CleanUp System (Promega) and ligated into the pJET 1.2 vector using the CloneJET PCR Cloning Kit (Fermentas).E. coli NdeI and SalI restriction sites were introduced by PCR using the following Primers (restriction sites underlined): CATATGAAGCCCCTTTGGACAC-3\u20325\u2032-CAGTG and GTCGACCTGAGTAACGAGAAGAG-3\u20325\u2032-CGAA. After digestion with NdeI and SalI the PCR product was ligated into the multiple cloning site of the expression vector pET21a in frame with the C-terminal His6-tag and transformed into E. coli BL21 (DE3). To confirm the correct sequence, the recombinant plasmid was analyzed by restriction digestion and sequenced by VBC Biotech . Two different vectors were constructed for expression in P. pastoris. The first vector contained the full-length GalOx cDNA including the native prepro signal. In the second vector this sequence was replaced by the \u03b1-factor of S. cerevisiae, which serves as secretion signal for the mature protein. For the first construct the full-length GalOx cDNA was cloned into the expression vector pPICZB under control of the methanol-inducible AOX promoter and in frame with a C-terminal His6-tag. To this end, the restriction sites EcoRI and NotI were introduced by PCR , and after digestion the PCR product was ligated into the vector using the Quick Ligation Kit (New England BioLabs). The ligation product was transformed into the electrocompetent E. coli strain NEB 5-alpha, and positive clones were selected on Low Salt LB agar plates containing 25 \u00b5g mL\u22121 Zeocin. Plasmid DNA was isolated using the Pure Yield Plasmid Miniprep System (Promega) and linearized with SacI within the 5\u2032 AOX1 region to promote integration. The restriction enzyme was heat inactivated and the plasmid purified with the Wizard SV Gel and PCR Clean-Up System (Promega). Electrocompetent P. pastoris X-33 cells were prepared and transformed with the linearized plasmid according to the operating instructions and applications guide of the MicroPulser electroporation apparatus (BioRad). Transformants were selected for growth on YPD plates containing 100 \u00b5g mL\u22121 Zeocin. In the second construct the prepro sequence of the mature GalOx cDNA was replaced with the \u03b1-mating factor of S. cerevisiae. To produce the truncated cDNA a different forward primer was used for PCR (5\u2032-TCGCAGAATTCATGGCCTCAGCTCCCATCG-3\u2032) and the resulting PCR product was ligated into the pPICZ\u03b1A vector as described above.For expression in E. coli BL21 (DE3) for production of the recombinant enzyme was performed in double concentrated LB medium  containing 50 mg L\u22121 ampicillin to maintain the expression plasmid. E. coli was grown in baffled shaking flasks at 37\u00b0C until an OD600 of 0.4\u20130.6 was reached. Recombinant protein production was induced by the addition of 5% lactose and cultivation was continued at 25\u00b0C for 16 h Cultivation of P. pastoris was also carried out in baffled shaken flasks. Precultures (20 mL) were grown at 30\u00b0C in YPD medium containing 25 \u00b5g mL\u22121 Zeocin. After 16 h the precultures were used to inoculate 1-L baffled shaken flasks containing 200 mL of BMMY medium (buffered methanol complex medium) and further incubated at 30\u00b0C. After 3 days a linear methanol feed (2% per day) was started. Samples were taken every day, clarified by centrifugation, and protein concentrations as well as GalOx activities were assayed in the supernatant.Production of recombinant GalOx in E. coli biomass and the P. pastoris supernatant, respectively. E. coli biomass was resuspended in phosphate buffer  after harvesting the cells by centrifugation . Cell disruption was performed by addition of lysozyme (1 mg mL\u22121) and incubation for 30 min at 37\u00b0C, followed by sonication, as previously described Pichia cultivations was purified from the culture supernatant as described above after cells had been removed by centrifugation .Recombinant GalOx was purified from both, the SDS-PAGE was performed as described by Laemmli F. oxysporum were recorded using a Chirascan CD Spectrophotometer  in the wavelength range of 180 to 260 nm. The instrument was flushed with nitrogen and the conditions were set as follows: path length was 1 mm, spectral bandwidth 3 nm and the scan time per point was set to 10 s. CD measurements were performed with 0.5 mg mL\u22121 GalOx in 5 mM potassium phosphate buffer (pH 7.0).Far UV electronic circular dichroism (CD) spectra of GalOx from Coomassie brilliant blue stained protein bands were excised from the gel, cut into small pieces and washed with 50 mM 4-ethylmorpholine acetate (pH 8.1) in 50% acetonitrile (MeCN). After complete destaining, the supernatant was removed and the gel was partly dried in a SpeedVac concentrator. The protein digestion using 100 ng of sequencing-grade trypsin  was performed overnight at 37\u00b0C in a cleavage buffer containing 25 mM 4-ethylmorpholine acetate (pH 8.1) and 5% MeCN. Alternatively, the proteins were digested sequentially by trypsin (as described above) and Asp-N protease  as well as using the sequence Asp-N and trypsin, always in the same cleavage buffer. The digestions were stopped by addition of 5 \u00b5L of 5% trifluoroacetic acid in MeCN. An aliquot of the peptide mixture (0.5 \u00b5L) was deposited on the MALDI target and allowed to air-dry at room temperature. After complete evaporation, 0.5 \u00b5L of the matrix solution  was added.+ ions of trypsin autoproteolytic fragments (842.5 and 2211.1 Da).MALDI mass spectra were measured on an Ultraflex III MALDI-TOF/TOF instrument  equipped with LIFT technology for MS/MS analysis. MALDI mass spectra were also obtained on a high accuracy APEX-Qe FT-ICR instrument equipped with a 9.4 T superconducting magnet and a Combi ESI/MALDI ion source . The spectra were acquired in the mass range of 700\u20135000 Da and calibrated internally using the monoisotopic [M + H]4 for 30 min and 25\u00b0C . The activity was determined with the chromogenic 2,2\u2032-azinobis(3-ethylbenzthiazolinesulfonic acid) (ABTS) assay 420\u200a=\u200a43.2 mM\u22121 cm\u22121). One Unit of GalOx activity was defined as the amount of enzyme that is necessary for the oxidation of 2 \u00b5mol of ABTS per min, which equals the consumption of 1 \u00b5mol of O2 per min, under the conditions described above. A substantially identical activity assay was used for determination of the substrate specificity of GalOx, however, galactose was replaced by 100 \u00b5mol of the respective substrate in the reaction mixture. Protein concentrations were determined by the dye-binding method of Bradford Prior to activity measurements GalOx was activated by incubation with 1 mM CuSOE. coli at 30\u00b0C in 20 mM potassium phosphate buffer (pH 7.0) for different sugar substrates. D-galactose (1\u2013500 mM), 1-methyl-\u03b2-D-galactopyranoside (5\u2013200 mM), melibiose (1\u2013250 mM), as well as raffinose, lactose, 1-methyl-\u03b1-D-pyranoside, lactulose, 2-deoxy-D-galactose and lactitol, each varied over a range of 10\u2013250 mM, were used as substrates. All kinetic constants were calculated using non-linear least-square regression by fitting the observed data to the Michaelis-Menten equation . Turnover numbers (catk) were calculated using a theoretical molecular mass of 73.9 kDa.Kinetic constants were determined for GalOx produced in A pH-activity profile was determined in the range of pH 2.5 to 10.0 using the buffer system citric acid (pH 2.5\u20136.0), potassium phosphate (pH 6.0\u20138.0) and Tris (pH 8.0\u201310.0), each at a concentration of 50 mM. Activity measurements were performed otherwise as described above for the standard assay.4. Differential scanning calorimetric (DSC) measurements were performed using a MicroCal VP-Capillary DSC system  controlled by the VP-viewer program and equipped with an active cell volume of 130 \u00b5L. To check the influence of different buffers on the stability of the protein the studies were made with 4 \u00b5M GalOx in 20 mM citric acid, phosphate, and Tris buffer each at pH 7. Samples were analyzed using a heating scan rate of 60\u00b0C h\u22121 over a temperature range of 15\u2013100\u00b0C. Collected DSC data were corrected for baseline with the corresponding buffer. Data analysis was performed with the MicroCal Original software.Determination of the temperature optimum of GalOx was achieved by measuring the activity with the standard assay at different temperatures in the range of 30 to 65\u00b0C. Thermal stability of GalOx was determined by incubating the protein at 30, 40, 50 and 60\u00b0C. Samples were taken at various time points, cooled on ice, and residual GalOx activity was measured using the standard ABTS assay after reactivating the enzyme by incubation with CuSOgao gene encoding GalOx was successfully amplified together with its signal sequence from genomic DNA of the fungus F. oxysporum G12. The gene consists of an open reading frame of 2043 bp encoding a polypeptide of 681 amino acids. The sequence (accession number KF601698) contains no introns and shows 99% similarity to the published amino acid sequence for GalOx from F. oxysporumgao gene has 96%, 62%, and 67% similarity with the gaoA (BK007071), gaoB (BK007067) and gaoC (BK007074) gene from F. oxysporum f. sp. lycopersici, respectively gao gene from F. oxysporum belongs to the gaoA cluster of GalOx genes. The similarity to the protein sequence of GalOx from F. graminearumgao gene was found under the conditions used.The F. oxysporum gao gene was used to generate a sequence alignment with the published sequence of F. graminearum using Clustal Omega F. graminearumF. oxysporum (F. graminearum (data not shown) F. graminearumThe amino acid sequence derived from the xysporum  and compgao gene in E. coli and P. pastoris was compared to find a suitable host for the production of recombinant GalOx. For expression in E. coli suitable restriction sites were introduced, and the full-length gene including the prepro sequence was cloned into the vector pET21a, which adds a C-terminal His-tag. After transformation of the plasmid into E. coli BL21 (DE3) the expression host was cultivated in double-concentrated LB medium and 5% lactose was used as inducer for expression of the gao gene. Routinely 5.7 mg L\u22121 of active, soluble GalOx  were obtained in shaking flask cultivations after incubation at 25\u00b0C for 16 h. This translates to a space-time yield of 0.36 mg L\u22121 h\u22121, which is tenfold higher than the yield reported for native GalOx from F. graminearum expressed in E. coligao gene without its prepro sequence in E. coli (data not shown).Expression of the P. pastoris two different strategies were used. To test whether P. pastoris is able to recognize the secretion signal of F. oxysporum the full-length gao cDNA  was cloned into the vector pPIZB, adding again a C-terminal His-tag. After 8 days of growth in BMMY medium with methanol feed the activity in the supernatant reached a maximum volumetric activity of 700 U L\u22121, corresponding to 10.6 mg of recombinant enzyme per L medium. This translates to a space-time yield of 0.06 mg L\u22121 h\u22121, which is significantly lower than the yield obtained in E. coli. No detectable GalOx activity was found in the biomass after cell disruption. In a second approach the native signal sequence of GalOx was replaced with that of the \u03b1-factor of S. cerevisiae in the pPICZ\u03b1A vector. In this case a volumetric activity of 200 U L\u22121  was found in the supernatant after 8 days of cultivation. Again no GalOx activity was detectable in the biomass. P. pastoris is therefore not only able to recognize the GalOx signal peptide but the production of active enzyme is also >3-fold increased compared to when the \u03b1-factor signal sequence is used. This is in contrast to a previous report on the expression of recombinant GalOx from F. graminearum in P. pastorisF. graminearum in different host a threefold increase in volumetric productivity was found for expression in P. pastoris compared to E. coliFor expression in Based on the His-tag, which is provided by all three expression vectors, the protein could be conveniently purified by IMAC followed by a polishing step of size-exclusion chromatography. The His-tag was added C-terminally since this will position the tag away from the active site of the enzyme  in contrE. coli is summarized in \u22121 was obtained for the purified enzyme. The two-step purification procedure yielded an apparently homogenous protein, as judged by SDS-PAGE .A typical purification procedure of GalOx expressed in SDS-PAGE . Full-leE. coli rather than a 74-kDa band predicted by the DNA sequence including the prepro signal sequence and the His-tag  as well as 266\u2013274/312\u2013323 (2237.9 m/z) were observed when a trypsin/Asp-N digestion was applied . The ideF. oxysporum expressed and purified from the cell extract of E. coli. GalOx exhibited a broad pH optimum  of GalOx calculated from these data was 52\u00b0C. Additionally, calorimetric studies of the thermal denaturation of GalOx were performed. Using phosphate buffer at pH 7 the DSC gave a single endothermic peak with a Tm of 64.6\u00b0C. To test if different buffer systems have an influence on the temperature stability of the enzyme DSC measurements were performed with citric acid and Tris buffer, each at pH 7. A Tm of 63.7\u00b0C and 63.9\u00b0C was measured for citric acid and Tris buffer, respectively. Hence these buffer systems have only a small effect on the stability of the enzyme. Based on our studies, the thermostability of GalOx from F. oxysporum expressed in E. coli is significantly lower than the thermostability of the enzyme from other Fusarium strains kcat/Km) was found for 1-methyl-\u03b2-D-galactopyranoside (2.2 mM\u22121 s\u22121) followed by D-galactose (2.0 mM\u22121 s\u22121). Both substrates give similar Km values . The Km value for D-galactose of recombinant GalOx from F. oxysporum is comparable to that of recombinant GalOx from F. graminearum (35 mM) E. coli. These values are lower than the data for native GalOx from F. graminearum with 67 mM m) than to D-galactose but due to an increased kcat value the catalytic efficiency is lower for raffinose. Previous studies P. circinatus  as well as the recombinant GalOx from F. oxysporum  although the Km value for D-galactose is five-times higher for P. circinatus (240 mM). The activity of the enzyme with raffinose, lactose, melibiose, 1-methyl-\u03b2-D-galactopyranoside, 1-methyl-\u03b1-D-galactopyranoside, lactitol and lactulose indicates that GalOx can oxidize galactose derivatives with substitutes at the carbon-1 site, as previously reported by Alberton et al.F. graminearum produced by a fungal host against D-talose and D-galactosamine, respectively. Because of the high sensitivity of GalOx to the stereo configuration of the C4 hydroxyl group D-glucose is not a substrate for the enzyme. The here reported substrate specificity is in good agreement with previously published results F. oxysporum does not interfere with the catalytic activity. The relatively high Km values for different substrates for GalOx seem to be a consequence of the broad substrate specificity of the enzyme resulting in an active site capable of binding a range of different substrates, but therefore being relatively weak at binding any particular substrate GalOx has a broad substrate specificity, which is one of the most important characteristics of the enzyme gao gene coding for GalOx from F. oxysporum can be easily expressed in the preeminent microbial expression hosts E. coli and P. pastoris even without codon optimization or further amino acid substitutions that have been reported to improve expression in E. coliF. oxysporum is very well comparable in its biochemical and catalytic properties to other fungal GalOx, which is not surprising when considering the well-conserved geometry of the active site and the substrate-binding site in these different enzymes.GalOx is of interest for various biotechnological applications, ranging from biosensors to diagnostic use in medicine as well as biocatalysis Mass spectrometry as a tool for the detection of the Tyr-Cys crosslink could find wider application in the characterization of this unique protein cofactor in GalOx but also in related enzymes. Mass spectrometry does not provide quantitative data for these crosslinks, but is a rapid and standard methodology widely established by now, and thus could replace the indirect methods that are commonly used to characterize unequivocally the formation of the unique protein cofactor in GalOx as well as in related enzymes."}
{"text": "Fusarium sambucinum cultures and overexpressed in Escherichia coli yielding 4.4\u00a0mg enzyme per L of growth culture with a specific activity of 159\u00a0U\u00a0mg\u22121. By adding a C-terminal His-tag the enzyme could be easily purified with a single affinity chromatography step with high recovery rate (90%). The enzyme showed a single band on SDS\u2013PAGE with an apparent molecular mass of 68.5\u00a0kDa. The pH optimum for the oxidation of galactose was in the range of pH 6\u20137.5. Optimum temperature for the enzyme activity was 35\u00a0\u00b0C, with a half-life of 11.2\u00a0min, 5.3\u00a0min, and 2.7\u00a0min for incubation at 40\u00a0\u00b0C, 50\u00a0\u00b0C, and 60\u00a0\u00b0C, respectively. From all tested substrates, the highest relative activity was found for 1-methyl-\u03b2-galactopyranoside (226\u00a0U\u00a0mg\u22121) and the highest catalytic efficiency (kcat/mK) for melibiose (2700\u00a0mM\u22121\u00a0s\u22121). The enzyme was highly specific for molecular oxygen as an electron acceptor, and showed no appreciable activity with a range of alternative acceptors investigated. Different chemicals were tested for their effect on GalOx activity. The activity was significantly reduced by EDTA, NaN3, and KCN.A gene encoding a galactose oxidase  was isolated from  Because of this specificity, various analytical techniques are based on GalOx, such as the determination of lactose in milk and dairy products d-galactose to food-grade cross-linking agents Galactose oxidase  is the most extensively studied Aspergillus nidulansAspergillusoryzae and Fusarium venenatumPichia pastorisEscherichia coliThe enzyme is secreted by a number of fungal species, of which gao gene without its prepro sequence from Fusarium sambucinum in E. coli. Furthermore, the purification and biochemical characterization of the enzyme are reported. Alternative electron acceptors, and possible activators as well as inhibitors were tested for their effect on GalOx activity.In the present paper we describe cloning and recombinant expression of a new E.coli strain BL21 (DE3) was purchased from Invitrogen , the cloning vector pJET 1.2 was from Fermentas and the expression vector pET21a was from Novagen . The HisPrep FF 16/10 column was from GE Healthcare Bioscience AB . SDS\u2013PAGE protein standard (Precision Plus Protein prestained standard) was from BioRad . The electron acceptors ferrocenium (FcPF6), guaiacol, 2,6-dimethoxyphenol, caffeic acid, p-coumaric acid, ferulic acid, sinapic acid, Thioflavin T, 2-(4\u2032-methylaminophenyl)benzothiazole, 1,1\u2032-diethyl-2,2\u2032-carbocyanine iodide, 1,4-benzoquinone, 2,6-dichloro-indophenol, and ferricyanide were purchased from Sigma\u2013Aldrich. F.sambucinum (synonym Gibberella pulicaris) strain MA1886 was kindly provided by Gerhard Adam .Chemicals for enzyme assays, buffers and media were purchased from Sigma\u2013Aldrich  and were of the highest purity available. 2,2\u2032-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) was purchased from Amresco . Restriction enzymes, dNTP mix, Rapid DNA Ligation Kit and standard for Agarose gelelectrophoresis (GeneRuler DNA Ladder Mix) were from Fermentas  and the Phusion polymerase was from New England BioLabs . Synthetic oligonucleotides were synthesized by VBC-Biotech . F. sambucinum MA1886 was cultivated in 50\u00a0mL Sabouraud medium  in shaken flasks at 25\u00a0\u00b0C and 110\u00a0rpm for 3\u00a0days. Fungal mycelia were collected by centrifugation at 4\u00a0\u00b0C and 5000\u00d7g for 15\u00a0min and the pellet was washed in 50\u00a0mL saline solution . Genomic DNA was isolated from 100\u00a0mg of frozen mycelia ground in liquid nitrogen by the phenol\u2013chloroform-extraction as described by Chomczynski and Sacchi gao gene coding for GalOx was amplified by PCR using degenerated primers based on the published sequences from related organisms (Accession Number: FGSG_11032.3/M86819/FOXG_09956.2/FVEG_08555.3): 5\u2032-GCCTCAGCA/TCCC/TA/CTCGG-3\u2032 and 5\u2032-CTGAGTAACGA/CGAAG/TA/CGT-3\u2032, purified by agarose gel electrophoreses and subcloned into the pJET 1.2 cloning vector using the CloneJET PCR Cloning Kit (Fermentas). Restriction sites were introduced using the following forward primers: 5\u2032-TCGCACATATGTACCTTTTGTCACTCGCTC-3\u2032 and 5\u2032-GCTGACATATGGCCTCAGCACCCATTGGA-3\u2032 for gao with and without the prepro sequence, respectively, and 5\u2032-GCTACGCGGCCGCCTGAGTAACGCGAAT-3\u2032 as the reverse primer (restriction sites underlined). Subsequent, the PCR product was digested with NdeI and NotI and cloned in the equally treated expression vector pET21a in frame with the C-terminal His6-tag by the Rapid DNA Ligation Kit. The resulting plasmid was transformed into E. coli BL21 (DE3) by electroporation. DNA sequencing was performed as a commercial service . The amino acid sequence derived from the GalOx gene was used to generate a three-dimensional model based on the published structure of GalOx from F. graminearumE. coli BL21 (DE3) for production of the recombinant enzyme was performed in 30\u00a0mL of double concentrated LB medium  with 50\u00a0mg\u00a0L\u22121 ampicillin in 125-mL baffled flasks. Cells were grown at 37\u00a0\u00b0C and 120\u00a0rpm until reaching an OD600 of 0.4\u20130.6. Then recombinant protein expression was induced by addition of 5% lactose and cultivation was continued at 25\u00a0\u00b0C and 130\u00a0rpm overnight. The cell pellet after centrifugation was resuspended in 20\u00a0mM potassium phosphate buffer pH 7.0, and an aliquot of 500\u00a0\u03bcL was homogenized by Precellys24 . The cell homogenate was tested for the presence of GalOx activity. Large scale cultivation was done in 1-L baffled flasks containing 300\u00a0mL medium Cultivation of g for 20\u00a0min and 4\u00a0\u00b0C, and resuspended in phosphate buffer . After disruption in a French Press at 100\u00a0MPa the crude cell extract was separated from cell debris by centrifugation  and used for protein purification by Immobilized Metal Affinity Chromatography (IMAC) with a 20\u00a0mL Ni-charged Sepharose 6 Fast Flow column . Before loading the sample the column was equilibrated with 10 column volumes (CV) of buffer A . After the protein sample was applied to the column, it was washed with 3 CV of the same buffer, and eluted in a linear gradient from 0.01 to 1\u00a0M imidazole in 10 CV. Fractions containing GalOx activity were pooled and the purity of the purified GalOx was checked by electrophoresis. SDS\u2013PAGE was performed in principle as described by Laemmli The biomass from these cultivations was harvested by centrifugation at 4000\u00d74 for 30\u00a0min at 800\u00a0rpm and 25\u00a0\u00b0C. GalOx was measured with the chromogenic ABTS ) assay \u03b5420\u00a0=\u00a043.2\u00a0mM\u22121\u00a0cm\u22121) was recorded at 30\u00a0\u00b0C for 180\u00a0s. The standard assay mixture  contained 1\u00a0\u03bcmol of ABTS in 20\u00a0mM potassium phosphate buffer (pH 7.0), 2\u00a0U horseradish peroxidase, 100\u00a0\u03bcmol d-galactose, and a suitable amount of GalOx sample. One Unit of GalOx activity was defined as the amount of enzyme that is necessary for the oxidation of 2\u00a0\u03bcmol of ABTS per min, which equals the consumption of 1\u00a0\u03bcmol of O2 per min, under the conditions described above. Protein concentrations were determined at 595\u00a0nm by the Bradford assay Prior to activity measurement GalOx was activated by incubation with 1\u00a0mM CuSOA pH\u2013activity profile was determined in the range of pH 2.5\u201310.0 using the buffer systems citric acid (pH 2.5\u20136.0), potassium phosphate (pH 6.0\u20138.0) and Tris (pH 8.0\u201310.0), each at a concentration of 50\u00a0mM. Activity measurements were performed otherwise as described for the standard assay.4.Determination of the temperature optimum of GalOx was achieved by measuring the activity with the standard assay at different temperatures in the range of 30\u201370\u00a0\u00b0C. Thermal stability of GalOx was determined by incubating the protein at 30, 40, 50 and 60\u00a0\u00b0C. Samples were taken at various time points, cooled on ice, and residual GalOx activity was measured using the standard ABTS assay after reactivating the enzyme by incubation with CuSOd-Galactose (1\u2013500\u00a0mM), 1-methyl-\u03b2-galactopyranoside (5\u2013200\u00a0mM), melibiose (1\u2013250\u00a0mM), raffinose (10\u2013250\u00a0mM), and lactose (5\u2013250\u00a0mM) were used as substrate. Kinetic constants were calculated by nonlinear least-square regression, fitting the data to the Henri\u2013Michaelis\u2013Menten equation .Steady-state kinetic constants were measured for GalOx for different electron donor substrates. All kinetic measurements were performed at 30\u00a0\u00b0C in 20\u00a0mM phosphate buffer (pH 7.0). Measurement of kinetic constants for various sugar substrates were done with oxygen (air saturation) and the standard ABTS assay. The enzyme reactions were carried out in a glove box  and were followed spectrophotometrically using an Agilent 8453 UV\u2013visible spectrophotometer  at 30\u00a0\u00b0C, and quantified at wavelengths indicated later in the manuscript . To elim6), 1,4-benzoquinone, 2,6-dichloro-indophenol (DCIP), and ferricyanide. The activity test was performed with 0.2 U GalOx as with the standard assay, but using the respective electron acceptor instead of oxygen. The reaction stoichiometry is one for the two-electron acceptors  and two for the one-electron acceptors (ferrocenium ion and ferricyanide). Furthermore, the oxidized, radical forms of the ABTS cation, the phenols guaiacol, 2,6-dimethoxyphenol (DMP), caffeic acid, p-coumaric acid, ferulic acid and sinapic acid, the benzothiazoles thioflavin T and 2-(4\u2032-methylaminophenyl)benzothiazole (BTA-1) and the cyanine dye 1,1\u2032-diethyl-2,2\u2032-carbocyanine iodide were tested as electron acceptors. Due to the short lifetime of these radicals they were produced immediately before the analyses. The oxidation of the corresponding compound to the radical was performed by recombinant laccase from Botrytis aclada expressed in P.pastorisd-galactose and 1.5\u00a0U laccase in 20\u00a0mM potassium phosphate buffer pH 6.5 in a final volume of 2.7\u00a0mL. The reaction was followed spectrophotometrically. After the oxidation was completed, laccase was inhibited by adding 300\u00a0\u03bcL 10\u00a0mM NaF solution, oxygen was removed by flushing with nitrogen, and the reaction was started immediately by adding 0.2\u00a0U GalOx to 1\u00a0mL of the radical solution. The negative control was performed without GalOx. For a positive control ascorbate (1.25\u00a0mM) was added instead of GalOx.As possible alternative electron acceptors for GalOx, the following compounds were tested: ferrocenium ion  contains no introns and a 37 amino acid prepro sequence. The similarity to the protein sequences of GalOx from F. graminearumFusarium oxysporumF. sambucinum gao gene was used to generate a three-dimensional homology model based on the published structure of mature GalOx (1gog) from F. graminearumMycelium of NdeI and NotI were constructed. The gene was cloned with and without its prepro sequence into the expression vector pET21a, adding a C-terminal His6 tag to the protein. After transformation of the plasmids into E. coli BL21(DE3) different clones were selected, cultivated on a small scale in double-concentrated LB medium, and 5% of lactose was used as inducer for expression of the gao gene with and without its prepro sequence. No active enzyme was found in the clones containing the full-length gao gene containing its prepro sequence. From the clones containing the gao gene without its prepro sequence the best producer was selected and used for larger scale production of GalOx in 1-L shaking flasks. Routinely, 4.4\u00a0mg\u00a0L\u22121 of active, soluble GalOx  were obtained in shaking flask cultivation after incubation at 25\u00a0\u00b0C for 16\u00a0h. This translates to a space\u2013time yield of 0.28\u00a0mg\u00a0h\u22121\u00a0L\u22121.Based on the determined nucleotide sequence, modified oligonucleotide primers containing restriction sites for \u22121. The purification procedure yielded an enzyme preparation that was apparently homogenous as judged by SDS\u2013PAGE  was found for melibiose (2700\u00a0M\u22121\u00a0s\u22121) followed by raffinose (2500\u00a0M\u22121\u00a0s\u22121) whereas the corresponding value for d-galactose was 3-fold lower. The lowest catalytic efficiency was measured for lactose as a result of an unfavorably high Michaelis constant of 683\u00a0mM. The lowest measured mK value, 16\u00a0mM for melibiose, is still rather high when compared to other carbohydrate-active enzymes, which seems to be due to the broad substrate specificity for GalOx GalOx has a broad substrate specificity, which is one of the most interesting characteristics of the enzyme It is of interest to know whether GalOx can transfer electrons to other acceptors than oxygen. To answer this question we tested a range of alternative electron acceptors, some of which are used by other copper-containing oxidoreductases. The one-electron acceptors included also different organic radicals. Due to the short life span of these radicals they were produced directly prior to their use by oxidation with laccase, which was inhibited with fluoride when the radical-forming reaction was completed. GalOx did not show significant activity with any of the tested electron acceptors . These r2+, K+, Na+, NH4+, and Mn2+ showed no significant effect on the enzyme activity. The nonionic detergent Tween80 and fluoride had also no effect on GalOx activity. The enzyme activity was reduced to less than 50% by EDTA. This result is different to published data Fusarium acuminatum, Gibberella fujikuroi and Polyporus circinatus, respectively, where EDTA did not inhibit activity significantly. As expected other metallo-enzyme inhibitor such as azide and cyanide completely inactivated GalOx.The effect of various compounds, mainly various metal ions, on GalOx activity was determined . Monovalgao gene coding for GalOx from F. sambucinum can be easily expressed in the bacterial expression host E. coli even without codon optimization. A simple one step affinity purification is sufficient to purify the protein with a yield of 90%. GalOx from F. sambucinum is very well comparable in its biochemical and catalytic properties to other fungal GalOx, which is not surprising when considering the well-conserved geometry of the active site and the substrate-binding site in these enzymes. Because of its similar biochemical properties and its simple and efficient purification protocol this new enzyme could be an alternative for GalOx from other sources.GalOx is of interest for a number of biotechnological applications. Because of this interest, more detailed knowledge about GalOx from different sources is important since this might reveal novel or improved areas of application. The The authors declare no conflict of interest."}
{"text": "Since some bacteria are capable of vigorous \u03b3-PGA biosynthesis from renewable biomass, \u03b3-PGA is considered a promising bio-based chemical and is already widely used in the food, medical, and wastewater industries due to its biodegradable, non-toxic, and non-immunogenic properties. In this review, we consider the properties, biosynthetic pathway, production strategies, and applications of \u03b3-PGA. Microbial biosynthesis of \u03b3-PGA and the molecular mechanisms regulating production are covered in particular detail. Genetic engineering and optimization of the growth medium, process control, and downstream processing have proved to be effective strategies for lowering the cost of production, as well as manipulating the molecular mass and conformational/enantiomeric properties that facilitate screening of competitive \u03b3-PGA producers. Finally, future prospects of microbial \u03b3-PGA production are discussed in light of recent progress, challenges, and trends in this field.Poly-\u03b3-glutamic acid (\u03b3-PGA) is a naturally occurring biopolymer made from repeating units of The online version of this article (doi:10.1186/s13068-016-0537-7) contains supplementary material, which is available to authorized users. At present, there exist four methods for \u03b3-PGA production: chemical synthesis, peptide synthesis, biotransformation, and microbial fermentation [Bacillus anthracis, \u03b3-PGA has since been found in species from all three domains of life  [Poly-\u03b3-glutamic acid (\u03b3-PGA) is an unusual anionic homopolyamide made from d groups  (Additioentation . Comparearyotes) , 4. MostUnlike most proteinaceous materials, \u03b3-PGA is synthesized in a ribosome-independent manner; thus, substances that inhibit protein translation (such as chloramphenicol) have no effect on the production of \u03b3-PGA . FurtherAlthough the microbial production of \u03b3-PGA is well established, the cost of production, including the cost of substrates as well as process costs, remains high. Most recent research on \u03b3-PGA production is therefore focused on optimizing growth conditions to increase yield, manipulate enantiomeric composition, and alter the molecular mass. Surprisingly, only a small number of mini reviews on the biosynthesis and applications of \u03b3-PGA have been published to date , 6\u20139. Thl or d enantiomers is soluble in ethanol, whereas \u03b3-PGA containing equimolar amounts of l and d precipitates in ethanol [Generally, \u03b3-PGA adopts five conformations; \u03b1-helix, \u03b2-sheet, helix-to-random coil transition, random coil, and enveloped aggregate. The conformation can be changed by altering environmental conditions such as pH, polymer concentration, and ionic strength . For exa ethanol . Manipul ethanol .5\u20138\u00a0\u00d7\u00a0106\u00a0Da), which can limit industrial applications due to high viscosity, unmanageable rheology, and difficult modification [The molecular mass of \u03b3-PGA can also influence its properties and efficacy for specific applications. Microbial-derived \u03b3-PGA generally has a relatively high molecular weight  [Recently, information about the genes and enzymes involved in \u03b3-PGA synthesis has been reported and has contributed to the design of production systems , 8. As secursor) . Biosyntd- or l-glutamate alone, or from both l and d enantiomers together [d-glutamate into the growing l-chain, l-glutamate (exogenous or endogenous) is first converted into d-glutamate by a racemization reaction. In B. subtilis, two homologs of the glutamate racemase gene (racE/glr and yrpC) have been identified, and glr is essential for converting l-glutamate into d-glutamate for the synthesis of \u03b3-PGA [l-form, but neither are responsible for the synthesis of \u03b3-PGA [Generally, \u03b3-PGA is synthesized from together , 20. Howof \u03b3-PGA . Interesof \u03b3-PGA . The funof \u03b3-PGA , 23.pgsB, C, A, and E) and their homologs in Bacillus species are ywsC, ywtAB, and capBCA [2+ in B. subtilis [As shown in Fig.\u00a0d capBCA , 24. Recd capBCA . PgsB and capBCA . The rold capBCA . Howeversubtilis . This masubtilis .Fig.\u00a02ArdegQ prevents the synthesis of \u03b3-PGA and effectively downregulates the production of degradation enzymes [\u03b3-PGA synthesis is regulated by two signal transduction systems: the ComP-ComA regulator, and the two-part DegS-DegU, DegQ, and SwrA system . The rol enzymes . However enzymes . In cont enzymes . Overall enzymes .Bacilli: endo-\u03b3-glutamyl peptidase and exo-\u03b3-glutamyl peptidase [B. subtilis and B. licheniformis, where it is able to cleave high molecular weight \u03b3-PGA into fragments of 1000\u00a0Da to 20\u00a0kDa, which decreases dispersity as a function of depolymerization time [B. subtilis, the genes encoding endo-\u03b3-glutamyl peptidase  are located directly downstream of, and in the same orientation as, the pgsBCA operon  and a cleavage site (30A-E-A32) proximal to the N-terminus, indicating that the mature enzyme is secreted into the medium [There are two enzymes capable of degrading \u03b3-PGA in eptidase . Endo-\u03b3-ion time , 34, 35.e medium .B. anthracis, but not for \u03b3-PGA synthesis [2O, resulting in transpeptidation or hydrolysis, respectively [B. subtilis, ggt and capD are located on the chromosome distant from the pgsBCA cluster and expressed during the stationary phase under the control of the ComQXPA quorum-sensing system, but are located on a plasmid directly downstream from the pgsBCA cluster in B. anthracis [Exo-\u03b3-glutamyl peptidase (Ggt) is a key enzyme in glutathione metabolism, and catalyzes the formation of \u03b3-glutamic acid di- and tripeptides in vitro, but does not appear to be involved in \u03b3-PGA synthesis in vivo , 37. Forynthesis . As a meectively . GTTs diectively . In B. snthracis .B. subtilis strains deficient in exopeptidase are unable to cleave \u03b3-PGA into fragments smaller than 105\u00a0kDa, and they sporulate earlier than wild-type strains [As mentioned above, \u03b3-PGA can be anchored to the bacterial surface or released into the medium, and CapD catalyzes the anchorage of \u03b3-PGA to the peptidoglycan, whereas PgsS catalyzes its release. Therefore, inhibiting or knocking down \u03b3-PGA hydrolase can result in the production of high molecular weight \u03b3-PGA . Indeed, strains .Bacillus species, Fusobacterium nucleatum, and some archaea and eukaryotes [Bacillus species are used most widely to study biological \u03b3-PGA production. Bacteria are either l-glutamate-dependent  or non-tilis C1  and B. aiens LL3 ) produceuctivity . TherefoB. amyloliquefaciens [B. subtilis [E. coli [To this end, most research on \u03b3-PGA fermentation has focused on optimizing growth conditions to improve \u03b3-PGA yield, alter the enantiomeric composition, and manipulate the molecular mass of \u03b3-PGA . Additioefaciens , B. subtsubtilis , and E. [E. coli  has alsoBacillus species have been established as \u03b3-PGA producers, and native strains can produce more than 20\u00a0g/L of \u03b3-PGA in fermentation processes. As shown in Table\u00a0Bacillales. Most \u03b3-PGA producers can therefore be divided into two groups: Group I\u00a0=\u00a0Bacillus species; Group II\u00a0=\u00a0other bacteria.Numerous Bacillus subtilis is a Gram-positive, endospore-forming, rod-shaped bacteria that has generally been recognized as having a safe (GRAS) status and can therefore be used to produce enzymes such as alpha amylase and proteases that are used in the food and medicine industries. Isolation of B. subtilis strains with excellent \u03b3-PGA production abilities has been achieved due to its ubiquitous and sporulating nature. As shown in Table\u00a0B. subtilis strains have been widely used for producing \u03b3-PGA, and B. subtilis CGMCC 1250 produces 101.1\u00a0g/L \u03b3-PGA, demonstrating the potential this organism has for \u03b3-PGA production [Bacillus licheniformis, Gram-positive, endospore-forming bacterium, shares many similarities with B. subtilis, and this non-pathogenic organism has also been exploited for the production of \u03b3-PGA.oduction . More imBacillus species discussed above, Bacillus methylotrophicus SK19.001 should also be noted, because it yields a high level of \u03b3-PGA with an ultrahigh molecular weight [B. anthracis and Bacillus thuringiensis also have the capacity for \u03b3-PGA production [B. anthracis is not viable owing to its toxicity [Other than the two r weight . Other soduction , but thetoxicity .With the development of metabolic engineering, homologous hosts have been engineered for \u03b3-PGA production Table\u00a0. HoweverEscherichia coli is the most commonly used host for \u03b3-PGA biosynthesis, and the \u03b3-PGA synthase genes pgsBCA and racE from B. licheniformis NK-03 and B. amyloliquefaciens LL3 were, respectively, cloned and co-expressed in E. coli JM109 to evaluate \u03b3-PGA production [l-glutamate, and co-expression of the racE gene further increased the production of \u03b3-PGA to 0.65\u00a0g/L. Another similar study was carried out using Corynebacterium glutamicum as the host, clone, and expression of the \u03b3-PGA synthase genes pgsBCA from Bacillus subtilis TKPG011. The production of \u03b3-PGA reached 18\u00a0g/L when the combinant was cultured with the limitation of biotin [Expression of \u03b3-PGA-producing genes in heterologous hosts has been attempted Table\u00a0. Escherioduction . The engf biotin . Those sAs shown in Fig.\u00a0Other than glucose which is the most successful carbon substrate for \u03b3-GPA production from a variety of biomass materials, cane molasses, xylose, agro-industrial wastes, rapeseed meal, soybean residue, fructose,corncob fibers, hydrolysate, and crude glycerol have also been tested Tables\u00a0, 2. Alth4)2SO4 or NH4Cl [2+ in particular can improve cell growth, prolong cell viability, and assist the utilization of different carbon sources, as well as significantly alter the stereochemical and enantiomeric composition of \u03b3-PGA, and increase \u03b3-PGA production [Additionally, much work has been carried out on the nutritional requirements for cell growth to improve \u03b3-PGA productivity and modify the D/L composition of the polymer. For an exogenous glutamate-independent producer, yeast extract proved to be an excellent nitrogen source for bacterial cell growth and \u03b3-PGA production, but the high cost is a barrier to commercial production . Therefoor NH4Cl  Table\u00a0142SO4 or oduction .Efficient and effective control of fermentation depends on an understanding of the key biological and chemical parameters , and disB. subtilis batch fermentation process, and 0.3\u00a0% n-heptane increased to 39.4\u00a0g/L and molecular weight 19.0\u00a0\u00d7\u00a0105\u00a0Da [Oxygen is essential in aerobic fermentation and affects cell growth, carbon source utilization, biosynthesis of products, and NAD(P)H recycling . Various\u00d7\u00a0105\u00a0Da .Table\u00a03AB. licheniformis ATCC 9945A [B. subtilis IFO 3335 [Culture pH is another important environmental factor in \u03b3-PGA fermentation . A pH ofCC 9945A , whereasIFO 3335 . HoweverIFO 3335 .In industrial fermentation, the choice of reactor operation mode may be vital for achieving optimal process design. A series of operation modes should be tested at small scale, such as batch, fed-batch, continuous culture, cell recycling, and cell immobilization, all of which may have their own advantages and disadvantages. For example, continuous culture can be operated at a steady state with continuous feeding, which can enhance productivity and/or lower labor intensity, but a high yield may be difficult to achieve. For \u03b3-PGA production, batch and fed-batch are the most common fermentation strategies and, overall, the batch mode has tended to achieve a higher product yield and productivity and is the most promising method for industrial-scale \u03b3-PGA fermentation Table\u00a0.l-glutamic acid, symbiotic fermentation was also proposed and developed, in which the l-glutamate-dependent B. subtilis was co-cultured with Corynebacterium glutamicum using glucose and sucrose as a mixed carbon source. Thus, integrated bioprocesses have advantages that included shortening the fermentation time and reducing the production cost, and produced \u03b3-PGA with an average molecular mass of 1.24\u00a0\u00d7\u00a0106\u00a0Da [To avoid the addition of exogenous \u00d7\u00a0106\u00a0Da .During microbial fermentation, downstream processing is always a key issue for improving process economy. As discussed above, \u03b3-PGA fermentation is influenced by various nutritional and environmental parameters, and the effects of these variables on product recovery should be assessed. For example, excessive use of complex raw materials will pose difficulties for product isolation.2+, Al3+, Cr3+, and Fe3+, and Cu2+ is the most efficient metal ion for selectively precipitating \u03b3-PGA, even at a low concentration [There exist three fundamentally different approaches to recovering \u03b3-PGA from the culture broth: precipitation by complex formation, precipitation by reducing water solubility, and filtration . In all ntration . The resntration . Comparentration . Finallyntration . For exantration .Due to being water soluble, biodegradable, edible, and non-toxic, \u03b3-PGA and its derivatives have been applied in a broad range of industrial fields, including food, cosmetics, agriculture, medicine, and bioremediation Table\u00a0.Table\u00a04Anatto (fermented soybeans), but also as a food supplement, osteoporosis-preventing agent, texture enhancer, cryoprotectant, and oil-reducing agent , and this significantly improved both the safety and efficiency of the drug (compared with standard paclitaxel) by enhancing its pharmacokinetic profile and water solubility. Furthermore, this improved tumor selectivity via enhanced accumulation and retention in tumor tissue [As shown in Table\u00a0r tissue .6\u00a0Da appears to be superior to many conventional flocculants used in wastewater treatment plants operating downstream of food processing fermentation processes [5\u00a0Da could effectively remove 98\u00a0% of basic dyes from aqueous solution at pH 1 and could then be re-used [Due to its non-toxic and biodegradable properties, \u03b3-PGA offers an eco-friendly alternative for wastewater treatment. \u03b3-PGA with a molecular weight of ~5.8\u20136.2\u00a0\u00d7\u00a010rocesses . More in re-used .\u03b3-PGA has also been explored for use in cosmetics as a hydrophilic humectant to increase the production of natural moisturizing agents such as urocanic acid, pyrrolidone carboxylic acid, and lactic acid . Many otDuring more than 70\u00a0years of \u03b3-PGA-related research, great insight has been gained regarding its production, metabolic regulation, and applications. Owing to its biodegradability and non-toxic and non-immunogenic properties, it is used widely in the food, medicine, and wastewater industries. Biotechnological production of natural \u03b3-PGA from renewable biomass continues to be of significant interest, especially in the face of decreasing fossil fuels and a need to reduce carbon emissions.A lot of research has been carried out on the molecular biology  of \u03b3-PGA and its biosynthesis in different organisms, some of which have been applied to improving its production , 8, 73. The specific properties of \u03b3-PGA determine its applications, and \u03b3-PGA produced by different bacteria or culture conditions may therefore be suited to different uses. Optimization of the cost of production, molecular mass, and conformational/enantiomeric properties is crucial if the potential of \u03b3-PGA is to be fully realized . For insWith the increasing trend in using biomass as a carbon source for fermentation processes, much research into the biological production of \u03b3-PGA has aimed at improving the cost-effectiveness and the efficiency of recovery. To realize better industrial production of \u03b3-PGA from renewable biomass, further effort should be made in this area. For example, high-throughput screening of potential new producers should include thermo- and salt-tolerant bacterial extremophiles . AdditioA greater understanding of the molecular regulatory mechanisms of \u03b3-PGA biosynthesis and control of stereoisomers would undoubtedly prove valuable. Therefore, a systems approach that combines synthetic biology, metabolic engineering, and traditional fundamental research will likely lead to improved fermentative production of \u03b3-PGA from renewable biomass."}
{"text": "Anopheles stephensi mosquito thereby preventing transmission, an essential component of the parasite life cycle. Such vaccines are envisioned as complements to vaccines that target human infection, such as RTS,S as well as drug treatment, and vector control strategies. A number of conserved proteins, including Pfs25, have been identified as promising TBV targets in research or early stage development. Pfs25 is a 25\u00a0kDa protein of Plasmodium falciparum expressed on the surface of zygotes and ookinetes. Its complex tertiary structure, including numerous cysteines, has led to difficulties in the expression of a recombinant protein that is homogeneous, with proper conformation, and free of glycosylation, a phenomenon not found in native parasite machinery.Transmission-blocking vaccines (TBVs) have become a focus of strategies to control and eventually eliminate malaria as they target the entry of sexual stage into the While the expression and purification of Pfs25 in various systems, has been previously independently reported, here a parallel analysis of Pfs25 is presented to inform on the biochemical features of Pfs25 and their impact on functionality. Three scalable expression systems were used to express, purify, and evaluate Pfs25 both in vitro and in vivo, including the ability of each protein to produce functional antibodies through the standard membrane feeding assay.Escherichia coli was not achieved, while Pichiapastoris presented Pfs25 as an inhomogeneous product with glycosylation. In comparison, baculovirus produced a pure, monomeric protein free of glycosylation. The glycosylation present for Pichia produced Pfs25, showed no notable decrease in the ability to elicit transmission reducing antibodies in functional evaluation, while a reduced and alkylated Pfs25 (derived from plant and used as a control) was found to have significantly decreased transmission reducing activity, emphasizing the importance of ensuring correct disulfide stabilized conformation during vaccine design and production.Through numerous attempts, soluble, monomeric Pfs25 derived from Pichia showed promise as candidates for vaccine development.In this study, the biochemical features of Pfs25, produced from different expression systems, are described along with their impact on the ability of the protein to elicit functional antibodies. Pfs25 expressed using baculovirus and  Plasmodium falciparum is responsible for nearly a half million deaths annually, based on the estimates from the WHO [Malaria caused by  the WHO . The eme the WHO . Particu the WHO . Such tr the WHO . To advaPlasmodium parasite to the gut of the female Anopheles stephensi mosquito after feeding on an infected human. In the mosquito gut, the Plasmodium parasite undergoes sexual-stage development, replication, and invasion of the mosquito salivary glands leading to infectious sporozoites capable of infecting humans during the mosquito\u2019s next blood meal [Plasmodium parasite [Malaria transmission requires transport of the ood meal . As therparasite . Severalparasite .P. falciparum, which is expressed on the surface of zygotes and ookinetes [Plasmodium parasites lack the N-linked glycosylation machinery, and Pfs25 contains multiple potential glycosylation sites that could then be aberrantly glycosylated when expressed in recombinant eukaryotic systems [One of the primary targets for TBV development is the Pfs25 protein, an approximate 25\u00a0kDa sexual stage protein of okinetes \u20138. Pfs25okinetes , 9. Therokinetes . An addi systems . WhetherEscherichia coli [E. coli, Pichia pastoris, and baculovirus), which have been used for large-scale production of recombinant proteins, were used. Further, the purified proteins were evaluated using in vitro and in vivo tests using a previously reported plant-expressed Pfs25 [Immunogenicity of Pfs25 has been reported in both animals and in human clinical trials , 13. Thehia coli  and algahia coli  along wihia coli . The objed Pfs25  as an adE. coli, Pichia, and baculovirus. The GPI anchor sequence functions poorly in heterologous eukaryotic system and was not included [The Pfs25 sequence from 3D7 clone (ACCESSION P13829) Ala 22 to Thr 193, lacking the native signal sequence and GPI-anchor was used to produce recombinant Pfs25 in included . Codon oErwinia carotovora) and with 5\u2032 NdeI and 3\u2032 XhoI restriction sites was cloned into pET41a (Novagen) via standard cloning procedures. Resulting plasmids denoted as pET41a-peri-Pfs25  and pET41a-Pfs25 , were sequenced and verified.Pfs25 with and without additional N-terminal periplasmic signal sequence  agar plates at 30\u00a0\u00b0C for 3\u00a0days. Approximately 100 clones were screened for the expression of Pfs25 and an additional 2000 clones on G418 plates screened for multi-copy integrants.Briefly, two mutations were introduced (N112Q and N187Q) to avoid N-glycosylation . The resPichia, with an additional N-terminal secretion signal (MKFLVNVALVFMVVYISYIYAD from Honeybee Melittin) was cloned into pFastBac vector (Invitrogen) with BamHI (5\u2032) and EcoRI (3\u2032) sites and the resulting plasmid pFastBac-Pfs25 was sequence verified. The generation of recombinant virus followed Users\u2019 Manual of Bac-to-Bac system (Invitrogen). Briefly, pFastBac-Pfs25 was transformed into E. coli DH10Bac to generate recombinant bacmid and colonies grown at 37\u00a0\u00b0C for 48\u00a0h on LB agar plates containing Tetracycline (10\u00a0\u03bcg/ml), kanamycin (50\u00a0\u03bcg/ml), gentamycin (7\u00a0\u03bcg/ml), IPTG (40\u00a0\u03bcg/ml) and X-Gal , according to users\u2019 manual. The bacmids from selected colonies were confirmed by PCR and sequencing, then used to transfect Super Sf9 cells (Oxford Expression Technologies) for the generation of recombinant baculovirus stock (P1), using CellFECTIN II (Invitrogen) following Bac-to-Bac manual. P1 virus (approximately 14\u00a0ml) was harvested and stored at 4\u00a0\u00b0C protected from light. Two-milliliters of the P1 virus was used to amplify P2 baculovirus after infecting fresh super Sf9 cells at 27\u00a0\u00b0C for approximately 90\u00a0h and similarly to produce high titer P3 virus; remaining P1 baculovirus supernatant was stored at \u221280\u00a0\u00b0C. A P3 virus volume of 400\u00a0ml for further expression was harvested and titered using BacPAK titer kit (Clontech).Synthetic pfs25 containing N112Q and N187Q mutations as described in E. coli were used including cell lines BL21 (DE3) and BLR(DE3), co-expression of protein disulfide bond isomerase (DsbC), expression in lower temperature (20\u00a0\u00b0C), and IPTG concentrations (1 and 0.25\u00a0mM). All of which did not yield sufficient quantity of soluble, monomeric Pfs25 for further purification. Briefly, pET41a-Pfs25 (cytoplasmic) and pET41a-peri-Pfs25 (periplasmic) plasmids were transformed in BL21 (DE3) and BLR (DE3), respectively, and clones were selected and verified. Expression induction at 37 and 20\u00a0\u00b0C was carried out for 3 and 16\u00a0h, respectively at an optical density A600 of 0.8. Induced cultures were harvested by centrifugation for 10\u00a0min at 4\u00a0\u00b0C. The cell pellet was collected and lysed using BugBuster Protein Extraction Reagent (Novagen) per the manufacturer\u2019s instructions. Soluble and insoluble fractions were separated via centrifugation.Several methods to express soluble Pfs25 in Pichia pastoris were screened for protein expression in 2\u00a0ml deep well plates with 2\u00a0ml complex medium containing 2\u00a0% dextrose for 2\u00a0days. Medium was then removed and replaced with 2\u00a0ml of complex medium with 1\u00a0% methanol for 3\u00a0days, with 1\u00a0% methanol feed once a day. Samples were collected on the third day post induction. Three high-yield clones were identified by analyses with reducing SDS-PAGE (Pfs25 expression band at 20\u00a0kDa), and evaluated with anti-His (Qiagen) or anti-Pfs25 mAb 4B7 [Approximately 100 clones of pMBL003-Pfs25 in  mAb 4B7 , 22, 23 In parallel, clones were screened on YPD (Yeast peptone dextrose) agar in the presence of G418  in 96-well plates\u2014corresponding to potential increased copies of gene of interest and hence, likely increased protein yield. G418 positive clones, including ten clones by 0.5\u00a0mg/ml G418, eight by 1\u00a0mg/ml G418, and two by 2\u00a0mg/ml G418 were subjected to small-scale expression as described earlier, which led to identification of slightly better protein expressers. A selection of ten clones was then evaluated in 100\u00a0ml BMGY (Buffered Glycerol complex medium) and induced with BMMY (Buffered Methanol complex Medium) using 1\u00a0% methanol feeding per day for 3\u00a0days followed by analysis (reducing SDS-PAGE). Two colonies, C6 and H4, produced similar yield and quality of Pfs25, and C6 was arbitrarily selected for 800\u00a0ml expression and further purification.Supernatant from G418 (clone C6) was purified using Ni\u2013NTA resin (Qiagen) using standard protocol. Briefly, 200\u00a0ml supernatant was adjusted to 1000\u00a0ml with 50\u00a0mM Tris\u2013HCl (pH 8.0), 150\u00a0mM NaCl, applied to column and washed  with 5\u00a0mM Imidazole in 50\u00a0mM Tris\u2013HCl (pH 8.0), 150\u00a0mM NaCl. Proteins were eluted with 300\u00a0mM Imidazole in 50\u00a0mM Tris\u2013HCl (pH 8.0), 150\u00a0mM NaCl, analysed, pooled, and dialyzed into PBS buffer, pH 7.4. The pool was concentrated and further purified by gel filtration (Superdex 75).Using Super Sf9 cells, three different MOI\u2019s  were screened at a 30\u00a0ml scale as well as uninfected cells (negative control). Post infection (48 and 72\u00a0h), 1\u00a0ml of culture was collected and centrifuged for 5\u00a0min. The supernatant was analysed via reducing and non-reducing SDS-PAGE and Western blot. Based on analysis of Pfs25 post infection of 72\u00a0h, no significant difference between the three MOI\u2019s tested was seen and further expression proceeded with MOI\u00a0=\u00a01 at 100\u00a0ml and 72\u00a0h.Supernatant was used for batch binding overnight with ~2\u00a0ml of Ni\u2013NTA resin  at 4\u00a0\u00b0C on table top rocker platform. Two washing steps were used: Wash buffer (1): 1x PBS with 10\u00a0mM Imidazole, pH 7.2 (10 CV) and wash buffer (2): 1x PBS with 20\u00a0mM Imidazole, pH 7.2 (10 CV). Protein was eluted via a step gradient with elution buffers (1): 1x PBS with 50\u00a0mM Imidazole, pH 7.2 and Elution buffer and (2): 1x PBS with 500\u00a0mM Imidazole, pH 7.2. Elution fractions were then analysed and those containing Pfs25 were pooled, concentrated, and further purified on Superdex 75 column.Nicotiana benthamiana was provided by Fraunhofer CMB  and utilized as a control antigen. The soluble protein, termed Pfs25MF1E, and encompassing amino acid 23\u2013193 of the Pfs25 sequence, with a theoretical mass of 20,021 daltons is fully described in [Pfs25 derived from ribed in . The proribed in .The samples were used with either (1) 4X non-reducing NuPAGE LDS (Lithium dodecyl sulfate) sample buffer (non-reducing and non-boiled) or with reducing agent and heated to 95\u00a0\u00b0C for 5\u00a0min or (2) 4X SDS sample buffer and boiled for 10\u00a0min at 99\u00a0\u00b0C (reducing and boiled). SDS-PAGE gels (4\u201312\u00a0% NuPAGE Bis\u2013Tris or 15\u00a0% Tris\u2013glycine) were loaded in a final volume of 20\u00a0\u03bcl/well and run at 150\u2013200\u00a0V for 35\u201350\u00a0min in 1X MES or 1X SDS running buffer.Following SDS-PAGE, proteins were transferred onto PVDF membrane and blocked in 5\u00a0% skim milk  at room temperature for 1\u00a0h. Primary antibodies were prepared at 1:5000 dilutions of Penta His antibody (Qiagen Cat No:- 34460), 1:2000 dilution of Anti-Pfs25 mAb 4B7 (BEI), or 1:1000 dilutions of 1G2  in 1\u00a0% skim milk in 1X TBS buffer containing 0.05\u00a0% Tween-20 (TBS-T). Blots were incubated in the primary antibody solution for 1\u00a0h at room temperature or overnight at 2\u20138\u00a0\u00b0C. Membranes were washed with 1X TBS-T buffer (3X for 10\u00a0min) and secondary antibody 1:1000 dilution of goat anti mouse IgG-HRP (Santa Cruz) or 1:4000 goat anti mouse IgG Alkaline Phosphatase (BioRad) in 1\u00a0% skim milk (1X TBS-T buffer) was added and incubated at room temperature for 1\u00a0h. Membranes were then again washed with 1X TBS-T buffer (3X for 10\u00a0min). HRP labeled blots were developed with TMB  substrate. Alkaline Phosphatase labeled blots were developed using Bio-Rad Alkaline Phosphatase Conjugate Substrate Kit.Spectramax plus spectrophotometer (kinetic endotoxin assay) was used to quantify endotoxin content of purified Pfs25, with EndoSafe Endotoxin standard (Charles River), EndoSafe Lysate (Charles River), and EndoSafe LAL Reagent Water (Charles River).P. falciparum NF54 gametocyte/zygote/ookinete parasites. The human serum and red blood cells used for the gametocyte cultures (extract preparation and SMFA) were purchased from Interstate Blood Bank .Mature gametocyte cultures were prepared as reported previously . From thPichia and baculovirus was performed on a BioAssist G3SWxl column  with a Shimadzu Prominence UFLC HPLC system at a flow rate of 0.7\u00a0ml/min in 0.2\u00a0M sodium phosphate pH 6.8. A gel filtration standard  was used in column calibration.SE-HPLC analysis for purified Pfs25 proteins from Pichia protein).Samples of Pfs25 were analysed using an Ultimate 3000 UHPLC system (Thermo Scientific) with a 2.6\u00a0\u00b5m, 2.1\u00a0\u00d7\u00a0150\u00a0mm C-18 column (Thermo Scientific) at a flow rate of 0.2\u00a0ml/min. C-18 column and auto-sampler temperatures were set at 60 and 5\u00a0\u00b0C, respectively. The elution of Pfs25 was monitored using absorbance (214\u00a0nm). Mobile phase (A) consisted of water with 0.1\u00a0% trifluoroacetic acid (TFA) and mobile phase (B) consisted of acetonitrile with 0.1\u00a0% TFA with a gradient of: 1\u00a0% B (5\u00a0min), 1\u201320\u00a0% B (2\u00a0min), 20\u201350\u00a0% B (30\u00a0min), 50\u201399\u00a0% B (2\u00a0min), 99\u00a0% B (3\u00a0min), 99\u20131\u00a0% B (2\u00a0min), and 1\u00a0% B (5\u00a0min). The Pfs25 samples were also run without column to determine sample recovery (82\u00a0\u00b1\u00a02\u00a0% for baculovirus protein and 70\u00a0\u00b1\u00a03\u00a0% recovery for 2\u00a0=\u00a00.983) was constructed using known concentrations of reduced glutathione. Fluorescence was measured using a SpectraMax M5 plate reader .Free thiol (number of free cysteine residues) in each protein sample was measured using Measure iT free thiol assay kit  following manufacturer\u2019s instructions. Samples were diluted in either ultrapure water or 2\u00a0M guanidine-HCl and 50\u00a0\u03bcg of each Pfs25 sample was used for non-denaturing conditions and 25\u00a0\u03bcg of each Pfs25 sample was used for denaturing conditions. A standard curve  were measured using a SYNAPT G2 hybrid quadrupole/ion mobility/TOF mass spectrometer  with the assistance of the Mass Spectrometry and Analytical Proteomics Laboratory at the University of Kansas. The instrument was operated in a sensitivity mode with all lenses optimized on the MH\u00a0+\u00a0ion from the control Leucine Enkephalin and sample cone voltage of 40\u00a0eV. Argon was admitted to the trap cell operated at 4\u00a0eV for maximum transmission. Spectra were acquired at 9091\u00a0Hz pusher frequency covering the mass range from 100 to 3000 unified atomic mass unit and accumulating data for two seconds per cycle. Time to mass calibration was made with NaI cluster ions acquired under the same conditions. Mass spectra of [Glu2O, 0.1\u00a0% formic acid) and B  over a short gradient from 1 to 70\u00a0% B in 4\u00a0min with a flow rate of 20\u00a0\u00b5l/min. MassLynx 4.1 software (Waters Corporation) was used to collect data and deconvolute the protein spectra for molecular weight determination.Samples were desalted via reversed phase PRP-1 column, 1\u00a0cm, 1\u00a0mm I.D.  using a NanoAcquity chromatographic system (Waters Corporation) and solvents A  and 9-fluorenylmethyl chloroformate (FMOC).Pfs25 protein derived from plant at 1\u00a0mg/ml, pH 8.0 was reduced with 20\u00a0mM DTT at 60\u00a0\u00b0C for 30\u00a0min and alkylated with 40\u00a0mM iodoacetamide at 37\u00a0\u00b0C for 30\u00a0min in the dark; alkylation was quenched with large excess of \u03b2-mercaptoethanol. The extent of modified cysteines was analysed by amino acid analysis (AAA) at AI BioTech  with pre-column derivation using Pichia produced Pfs25; Group 3, positive control (plant produced Pfs25 [intramuscularly) on day 0 and 21. On day 42 sera were collected and individual sera were tested by ELISA. In addition, sera were pooled, IgG affinity purified and tested at 0.75\u00a0mg/ml as well as three-fold dilutions  for SMFA activity [P. falciparum NF 54 gametocytes and purified IgG from mice immunized with Pfs25 were fed to female Anopheles stephensi mosquitoes. Mosquitoes were then dissected 8\u00a0days after the feeding and the number of oocysts counted to measure transmission reduction activity.To produce anti-Pfs25 sera in CD-1 mice for SMFA, 10\u00a0\u00b5g of Pfs25 was formulated with ISA720 (Montanide) for each of the following groups: Group 1, baculovirus produced Pfs25; Group 2, ed Pfs25 ); Group activity . BrieflyBasic methodology of ELISA has been described by Miura et al. . All ELIE. coli, and as secreted proteins in Pichia and baculovirus (super Sf9) at small scale and purified by Ni\u2013NTA chromatography and gel filtration for subsequent evaluation. In E. coli, the majority of Pfs25 expressed was present in inclusion bodies and, therefore, sufficient soluble monomeric Pfs25 from E. coli lysates for analysis was not achievable.Recombinant His-tagged Pfs25 was produced as an intracellular protein in E. coli protein. Hereafter, Pfs25 solely from the Pichia and baculovirus expression systems were used for further biochemical in vitro and functional in vivo analysis. A well-characterized Pfs25, derived from plant [It has been reported that it is possible to conduct refolding of Pfs25  however om plant , was proPichia gave rise to a major protein migrating at ~20\u00a0kDa and a minor band at ~21\u00a0kDa present at approximately 50\u00a0% of the intensity of 20\u00a0kDa band , which implicated the presence of 11 pairs of disulfides [As shown in the same intact mass analysis Fig.\u00a0 the Pichsulfides . The intsulfides . This trsulfides .Table\u00a01PPichia and baculovirus) contained <0.1\u00a0% free thiol, as no fluorescence signal was detected above the buffer control, supporting the observations that all 22 cysteines were oxidized and disulfide paired as suggested by the intact mass observations described above  assay was utilized to further quantify the inhomogeneity Fig.\u00a0 of the PPichia-expressed Pfs25, whether this modification would affect the biological activity of Pfs25, was investigated. While a previous study utilizing DNA vaccination showed limited detrimental effects of glycosylation on transmission reducing activity [After observing glycosylation in activity , data onactivity . Before For the immunizations, the plant protein was used as a positive control and a reduced alkylated form of the plant protein was used as a negative control to confirm the importance of disulfide bond formation of Pfs25. Further analysis of the reduced alkylated Pfs25 preparation via amino acid composition analysis recovered 13 carboxymethylated cysteine, indicating at least 13 out of 22 cysteines were modified by alkylation.Pichia expressed Pfs25 (Group 2), glycosylation did not apparently affect the transmission reducing activity as detected here, with results comparable to Pfs25 produced from baculovirus (Group 1) or plant (Group 3) that each exhibited little or no glycosylation  were not statistically different between the Pfs25 groups as determined through a non-parametric Kruskal\u2013Wallis test and Dunn\u2019s multiple comparisons test Fig.\u00a0. Statiston Table\u00a0 and yielPichia and baculovirus systems. In the E. coli system, in spite of numerous attempts, soluble, monomeric Pfs25 was not achieved. While it may be possible to generate native configuration Pfs25 using refolding methods from the generated inclusion bodies [Pichia and baculovirus expression resulted in proteins with many characteristics consistent with the expected structure of the native Pfs25. In Pichia, the expressed Pfs25 was likely glycosylated, despite mutations of probable N-linked sites, and consequently resulted in multiple molecular weight forms. The baculovirus expressed Pfs25 presented a non-glycosylated and homogeneous recombinant protein. Through multiple methods, including the free thiol assay and intact mass analysis, both Pichia and baculovirus produced Pfs25 proteins contained 11 pairs of disulfides as expected. Two transmission blocking monoclonal antibodies 4B7 [Pichia produced Pfs25 protein suggesting proper folding of the purified proteins.In the search for a transmission blocking vaccine based on Pfs25, the malaria community has been guided by the concept that an immunogen should mimic as much as possible the Pfs25 found on the surface of the parasite. In the current studies, Pfs25 was expressed, purified, and characterized in the n bodies , this wadies 4B7 , 23 and dies 4B7 , also biP. falciparum apparently lacks such modifications, glycosylation has been a concern in the development of recombinant antigens for use as TBV and other malaria vaccine candidates. In this study, the evidence of limited glycosylation present in Pichia produced Pfs25 did not appear to diminish the ability to elicit transmission blocking antibodies and was consistent with findings carried out with Pfs25 DNA vaccines evaluating glycosylation of Pfs25 [The ability to elicit functional transmission blocking antibodies is the most important characteristic of any protein preparation to be considered for the generation of a vaccine. Given that of Pfs25 . It is iPichia, baculorvirus as well as the control plant produced protein showed evidence of no free cysteines by two methods, free thiol and mass spectrometric analysis. When these disulfide bonds are disrupted by reduction and alkylation the elicitation of functional antibodies (as measured by SMFA) was diminished, demonstrating that at least some of the disulfide bonds are essential for the function of the Pfs25 protein as an immunogen. Taken together, these results indicate that both Pichiapastoris and baculovirus expression systems have potential for the production of Pfs25 based transmission-blocking vaccines.Lastly, the status of the disulfide bonds formed in the recombinant proteins was investigated. Proteins produced in"}
{"text": "PgsBCA was expressed under the action of a P43 promoter in the pWB980 plasmid. Our results showed that the recombinant bacteria had the capacity to synthesize \u03b3-PGA. The expression product was secreted extracellularly into the fermentation broth, with a product yield of 1.74\u2009g/L or higher. \u03b3-PGA samples from the fermentation broth were purified and characterized. Hydrolysates of \u03b3-PGA presented in single form, constituting simple glutamic acid only, which matched the characteristics of the infrared spectra of the \u03b3-PGA standard, and presented as multimolecular aggregates with a molecular weight within the range of 500\u2013600\u2009kDa. Expressing the \u03b3-PGA synthetase gene pgsBCA in B. subtilis system has potential industrial applications.To clone and express the  It is an anionic polypeptide formed by the condensation of amide linkages between \u03b1-amino and \u03b3-carboxylic acid groups of the D- and/or L-glutamate in microorganisms. It has nontoxic, edible, adhesive, film-forming, and moisture retention properties [\u03b3-PGA and its derivatives can be used as drug carriers and bioadhesive materials that have been widely used in pharmaceutical, cosmetics, food, agriculture, and sewage treatment industries and have become one of the most interesting topics in biopolymer research [Gamma-polyglutamic acid  and are classified as glutamate-dependent or glutamate nondependent types based on their needs for glutamate [\u03b3-PGA-producing strains have unstable heritability, easily leading to a reduction or loss in the ability to synthesize \u03b3-PGA during fermentation, undergo \u03b3-PGA degradation, and produce extracellular polysaccharide by-products, thereby lowering product yield. Compared to traditional mutation breeding, genetic engineering technologies have been expected to become an effective method to create \u03b3-PGA high-yield strains. Ashiuchi et al. [ pgsB, pgsC, and pgsA are three essential genes involved in \u03b3-PGA synthesis in glutamate-dependent strains. Urushibata et al. [ pgsBCA gene through different methods of fusion expression and further transformed the plasmids into Escherichia coli to obtain positive clones that were capable of producing \u03b3-PGA. E. coli, a gram-negative bacterium, has been reported as the primary host strain for transforming the recombinant vector of the \u03b3-PGA synthase gene. However, its synthase gene is mainly derived from Bacillus subtilis (gram-positive bacteria). The membrane structures and protein secretion systems of both types of bacteria vary, which in turn may result in poor positioning of the recombinant expressed \u03b3-PGA synthase system on the bacterial cell membrane [\u03b3-PGA in the host strain is lower; and the amount of \u03b3-PGA obtained from positive clones is only within the range of 0.024\u20130.134\u2009g/L [ B. subtilis, as a prokaryotic expression host for food safety, carries some excellent features in expressing \u03b3-PGA that E. coli does not possess. For example, B. subtilis is capable of expressing the soluble and nonfusion proteins, as well as preferentially expressing the nonpathogenic and nonapparent codons [ pgsBCA in B. subtilis was comparatively scarce. To date, the expression of the \u03b3-PGA synthase gene pgsBCA still need D-xylose and L-arabinose induced, generally with poor expression yield and low molecular weight (only 200\u2013500\u2009kDa) [ pgsBCA gene was reconstructed and highly expressed in B. subtilis as to improve the yield and molecular weight of \u03b3-PGA. B. subtilis 168 has been widely used in the study of \u03b3-PGA regulation. It is one of the few bacterial strains that has a complete set of \u03b3-PGA synthase genes but does not produce \u03b3-PGA [ B. subtilis 168 as DNA template to amplify the \u03b3-PGA synthase gene pgsBCA and to further clone the pgsBCA gene into the B. subtilis expression vector pWB980 to transform into type strain B. subtilis WB600. We constructed a recombinant B. subtilis expression system for \u03b3-PGA synthesis, which may serve as a foundation for the high-yield industrial production of \u03b3-PGA based on an engineered B. subtilis expression system.Traditionally, entation . Bacterilutamate . Wild-tyi et al.  and Tarui et al.  confirmea et al.  and Jiana et al.  construcmembrane . Therefo.134\u2009g/L . B. subtt codons . In addi500\u2009kDa) , indicatB. subtilis 168 and B. subtilis WB600 were purchased from Shanghai Genemy BioTech Co., Ltd. ; E. coli JM109 was prepared and preserved at our laboratory and described in a previous study. pMD19-T vector and B. subtilis expression vector pWB980 were purchased from TakaRa Biotechnology  Co., Ltd. . Taq DNA polymerase, dNTPs, DNA ladder marker, and protein molecular weight markers, were purchased from TakaRa Biotechnology  Co., Ltd. Plasmid extraction and agarose DNA extraction kits were purchased from Tiangen Biotech (Beijing) Co., Ltd. . Bacterial genomic DNA extraction kits were purchased from and primers were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd. . Silica gel plates for thin layer chromatography (TLC) were purchased from Qingdao Jiyida Silica Reagent Factory .All restriction endonucleases, T4 DNA ligase, E. coli and B. subtilis transformants were selected with 50\u2009\u03bcg/mL ampicillin (Ampr) and 30\u2009\u03bcg/mL kanamycin (Kmr), respectively. Fermentation broth for the genetically engineered recombinant bacteria contained 40\u2009g/L glucose, 0\u2013100\u2009g/L sodium glutamate, 6\u2009g/L (NH4)2SO4, 2\u2009g/L K2HPO4, and 0.2\u2009g/L MgSO4 (pH 7.5).Lysogeny broth (LB) was prepared using 10\u2009g/L tryptone, 5\u2009g/L yeast extract, and 10\u2009g/L NaCl (pH 7.0) and 2.0% (W/V) agar powder to solidify the medium. pgsB, pgsC, and pgsA coding gene sequences of B. subtilis 168 were designed as follows: BAC1: 5\u2032-CGCGGATCCATGTGGTTACTCATFATAGCC-3\u2032 (restriction site of BamHI endonuclease is underlined); BAC2: 5\u2032-CCCA AGCTTTTATTTAGATTTTAGTTTGTCA C-3\u2032 (restriction site of HindIII endonuclease is underlined).With reference to the NCBI database, the upstream and downstreamB. subtilis 168 genomic DNA was used as template. BAC1 and BAC2 primers were used to amplify the gene. The PCR reaction system included 2\u2009\u03bcL of DNA template, 10\u2009\u03bcL of 5x buffer, 2\u2009\u03bcL of dNTPs, 2\u2009\u03bcL of individual primers of BAC1 and BAC2, 0.5\u2009\u03bcL of 5x Primer STAR, and sterile double-distilled water to prepare a final volume of 50\u2009\u03bcL. Reaction conditions were as follows: 94\u00b0C for 3\u2009min, followed by 30 cycles of 94\u00b0C for 30\u2009s, 55\u00b0C for 15\u2009s, and 72\u00b0C for 3\u2009min, and a final 72\u00b0C extension for 10\u2009min. One percent agarose gel electrophoresis was used to identify the PCR reaction products. PCR products were recovered using a DNA rapid recovery reagent and ligated into the pMD19-T vector, which was followed by transformation into E. coli JM109 competent cells using CaCl2 methods. The selected single colonies were inoculated into liquid LB to expand the plasmid. Intermediate vectors pMD-pgsBCA were then obtained and identified using BamHI and HindIII double digestion as well as sequencing.BamHI and HindIII double digestion was performed to cut the intermediate vector pMD-T-pgsBCA and pWB980 plasmid, followed by ligating these into the recombinant expression vector, pWB980-pgsBCA  [\u03b3-PGA samples underwent infrared spectroscopy using Shimadzu's IR Prestige-21 infrared spectrometer, Shimadzu (China) Co., Ltd. . Potassium bromide (KBr) was used as reference material [\u03b3-PGA was determined by SDS-PAGE [y (HPLC) . The purmaterial . The molSDS-PAGE . pgsBCA fragment, 2.8\u2009kb, was in agreement with our expected results. An agarose DNA extraction kit was used to recover and purify the PCR products. After confirming with DNA sequencing, the DNA sequence of the PCR products was determined to be 100% identical with the sequence of the reported gene of B. subtilis 168.The target gene was amplified by PCR. pgsBCA, into competent cells, the plasmids were collected and identified using BamHI and HindIII restriction enzyme digestions.  pgsBCA PCR products, thereby initially confirming the successful construction of the recombinant expression vector, pWB980-pgsBCA.After transforming the constructed recombinant expression vectors, pWB980-\u03b3-PGA was enhanced. However, when glutamate concentration was >50\u2009g/L, the synthetic yield of \u03b3-PGA declined. This result suggested that pgsBCA was secreted by B. subtilis WB600. The expressed product, \u03b3-PGA, could be secreted into extracellular fermentation broth. Using a lower substrate concentration, we observed that the recombinant bacteria did not synthesize \u03b3-PGA, indicating that an excess amount of substrate was necessary for the recombinant bacteria to synthesize \u03b3-PGA. Therefore, from the perspective of economic efficiency, we identified that a substrate concentration of 50\u2009g/L was optimal to synthesize the highest possible amount of \u03b3-PGA (1.74\u2009g/L).\u03b3-PGA, no other band was observed on the silica gel plates but only single spots of uniform color intensity. Its retention (Rf) value was consistent with that of the standard, glutamate spots, indicating that the hydrolysates had no other amino acids and other protein impurities. These hydrolysates were in single form, solely consisting of pure glutamic acid. \u03b3-PGA. The absorption peak at 3,421\u2009cm\u22121 was the symmetric stretching vibration band of N-H; and the absorption peak at 1,649\u2009cm\u22121 was the asymmetric stretching vibration band of an amide group, -CONHR. Both peaks were the main indicators used in the identification of amides and for the presence of amide groups in \u03b3-PGA molecules. The absorption peak at 1,408\u2009cm\u22121 was the symmetric stretching vibration band of COOH; the absorption peak at 1,076\u2009cm\u22121 was the hallmark peak representing the presence of aliphatic hydrocarbons, -CH2 or -CH3 , in the molecular structure; and the absorption peaks within the range of 1,000\u2009cm\u22121\u2013500\u2009cm\u22121 were caused by the (CH2)n (n > 4) planar rocking vibration, as well as in-plane bending vibration. The spectral characteristics of recombinant \u03b3-PGA in fermentation broth was consistent with those of the standard \u03b3-PGA's IR spectroscopy, indicating that the sample obtained in the present study contained the N-H and C=O functional groups, as well as the aliphatic hydrocarbon structure (CH2)4 of the \u03b3-PGA [\u03b3-PGA. The molecular weight of the \u03b3-PGA sample obtained after the fermentation, isolation, and separation of recombinant strain Bacillus WB600-pgsBCA was determined using SDS-PAGE. \u03b3-PGA was between 500 and 600\u2009kDa and occurred as aggregates of a multimolecular mass, but not of a single molecular composition.he \u03b3-PGA , thereby\u03b3-PGA synthase gene pgsBCA in B. subtilis and used plasmid pWB980 to construct the recombinant expression vector, pWB980-pgsBCA, and to further transfer the recombinant expression vector into B. subtilis WB600. The P43 promoter of pWB980 induced the expression of pgsBCA; then the host cells of this expression vector showed a capacity to synthesize \u03b3-PGA, and the product yield of \u03b3-PGA reached \u22651.74\u2009g/L. The isolated and purified \u03b3-PGA sample from the fermentation broth was confirmed to have a single form of hydrolysates that solely consisted of pure glutamic acid. This result matched the characteristics of the standard \u03b3-PGA's IR spectroscopy and showed the aggregates of a multimolecular mass, with a molecular weight ranging between 500 and 600\u2009kDa.The present study evaluated the cloning and expression of  B. subtilis as the expression host, and the pgsBCA gene originated and was expressed in B. subtilis. The \u03b3-PGA synthase system is better positioned in the cell membrane , D-xylose, and L-arabinose as an inducer to secrete the pgsBCA into the extracellular fermentation broth is circumvented using the methodology developed in the present study. This technique may also be potentially used in industrial production as it can increase the stability of products, simplify the purification work, and have more obvious application potential advantage.The present study usedficiency \u201320. The g report \u201324. The  Bacillus WB600-pgsBCA showed the capacity to synthesize \u03b3-PGA, our results still could not match the highest synthetic yield of \u03b3-PGA (40\u201350\u2009g/L) that is induced by the fermentation of mutated bacteria [\u03b3-PGA and to increase the bacterial concentration, oxygen uptake, or endogenous synthase expression, thereby ultimately increasing \u03b3-PGA yield [\u03b3-PGA-producing strains to reduce \u03b3-PGA degradation, thereby increasing \u03b3-PGA yield [\u03b3-PGA yield, thereby laying the foundation for the industrial production of high-yielding \u03b3-PGA engineered bacteria based on the B. subtilis expression system.Although the constructed recombinant bacteriabacteria , 26. TheGA yield , 28. AltGA yield . Therefo"}
{"text": "Mental disorders are always remained a neglected public health problems in low and middle-income countries (LMICs), most people with mental disorders never receive effective care and there is a large treatment gap. In order to solve the problem integration of mental health into primary health care is recommended and in Ethiopia implementation of the scale of mental health services at primary health care level was started in 2014. For the success of the integration of mental health into primary health care, primary care health professionals are the key personnel who are responsible for the management of mental, neurologic and substance use disorders. However, proper training and education of primary care health professionals is mandatory for an optimal performance and success of integration. This interventional study was conducted to assess the effectiveness of mental health training course for scale up of mental health services at primary health care level in Ethiopia.t test with p values was performed to test the differences between the pre- and post-test. In additions mean and standard deviation of the responses were calculated. Overall the response rate was 100% at the end of the intervention.This quasi-experimental pre- and post-study design was conducted in Ethiopia from October to December 2016 using quantitative data collection methods. A total of 94 primary health care professionals were included in the study. The intervention was conducted by psychiatry professionals using standardized World Health Organization (WHO) Mental Health Gap Action Programme (mhGAP) guide prepared for scaling up of mental health care through integration into primary health care (PHC) and general medical services. Pre- and post intervention assessment was done for knowledge, attitude and practice (KAP); and statistically analyzed. A paired sample The study resulted in a significant improvement in knowledge, attitude and practice (KAP) of PHC workers about all the four mental, neurologic and substance use disorders during the post intervention survey (p\u00a0<\u00a00.05). Post intervention the knowledge of health professionals increased by 53.19% for psychosis, 42.56% for depression, 19.25% for epilepsy and 54.22% for alcohol use disorders. Similarly, post intervention attitude increased by 55.32% for psychosis, 40.42% for depression, 36.17% for epilepsy and 43.6% for alcohol use disorders. In addition, post intervention case identification rate increased by 62.78% for psychosis, 55.46% for depression, 21.35% for epilepsy and 41.49% for alcohol use disorders with significant p value (p\u00a0<\u00a00.05).The study results suggest that mental health training could be an effective intervention for improving knowledge, attitudes, and practices among primary health care professionals regarding mental, neurologic and substance use disorders. Training is a prerequisite and vital to enhance the knowledge, attitude, and practice of primary care professionals which plays a significant role for the easy success of integrated care and treatment of mental, neurologic and substance use disorders into the existing general health care services. Mental, neurological and substance use (MNS) disorders constitute a huge global burden of disease, and there is a large treatment gap, particularly in low- and middle-income countries (LMICs) and they are major contributors to morbidity and premature mortality . MNS disDespite the high morbidity and premature mortality due to mental disorders in LMICs, which are often comorbid with physical diseases, there is a scarcity of mental health specialists , 12, 13.Scaling up of mental health care through integration into PHC and general medical services in Ethiopia was implemented in 2014 , 17. TheOne of the major challenges of successful integration of mental health into PHC is the lack of adequate knowledge, positive attitude, and skills for mental health service of primary health care professionals participating in care and treatment of peoples at primary health care levels . This paQuasi-experimental a single group pre-test/post-test design was used in order to evaluate the effect of training on knowledge, attitude and practice of health professionals working at primary health care level in Ethiopia from October to December 2016. We carried pre-intervention measurements of knowledge, attitude and practice among participates of the total sample and we assessed post training knowledge and attitude of the same participants after 5\u00a0days of training. Post training practice was assessed after 3-month work experience at the primary health care level by reviewing charts and records.The study is conducted in Ethiopia. In Ethiopia mhGAP scale upfor people suffering from MNS disorders was implemented in different regions in 2014. The main aim of mhGAP program is implementation and Scaling up care for MNS disorders in PHC facilities  by non-specialized professionals (working at first- and second-level facilities) , 19. SelThe training programme is the result of cooperation between the Federal ministry of health of Ethiopia, Addis Ababa Health Bureau, and Amanuel Mental specialized Hospital. Training was given on four selected WHO mhGAP priority MNS disorders for scale up service in Ethiopia , 19. TraAlcohol use disordersDepressionPsychosisEpilepsyHere are the four selected WHO mhGAP priority disorders:The training was given in four rounds and 23, 24, 24 and 23 health professionals participated in the first, second, third and fourth round training respectively.We used non-probability sampling technique and all participant who came for the training were included in the study. A total of 94 primary health care professionals  selected from different primary health care levels were included in the study.Data were collected using a self-completed questionnaire that contained three sections.Questionnaires were asked about vignette case identification after Vignette descriptions of common priority MNS disorders such as psychosis, depression, epilepsy and alcohol use disorders both pre- and post training. WHO study design with case vignettes has also been used in a study Butajira to assess attitude about mental disorders , on EthiSelf-report of years of clinical experience and whether or not the respondent had received pre-service training in mental health care and whether or not the patient had experience in diagnosis and treatment of common mental, neurologic and substance use disorders. In addition, cases identified and treated post training at primary health care level by trained primary health care professionals were collected by the chart review after 3\u00a0months of the training.A structured questionnaire to investigate knowledge and attitudes of PHC workers towards mental illness was developed for the purpose of the study. The questionnaire drew on previous research in this area from LMIC settings \u201327. KnowGenetic exposure causes the disorderUse of psychoactive substance causes the disorderNeurochemical imbalance causes the disorderLoss of loved one causes the disorderConflict in marriage causes the disorderAcademic failure causes the disorderDivorce causes the disorderPhysical or sexual abuse causes the disorderUnemployment causes the disorderWork overload causes the disorderFinancial constraints cause the disorderEvil eye causes the disorderEvil spirit causes the disorderCurse causes the disorderDue to sins committed causes the disorderWill of God causes the disorderMagic causes the disorderThe condition is treatableThe condition has good outcome in most patientsThe person treated in the same health center with the general patient. What about you?Traditional healers are better in effectiveness than our medical care in treating this condition? What about you?The person can marry and may bring children\u2019s?The person can be employed and able to work effectively.The person can leave with others in society?The data were cleaned before final analyses by looking at the distribution of the data, identifying outliers and checking back against the original data. Data analysis was carried out using SPSS version 23 for Windows. Most of the responses to the structured questionnaire were analyzed descriptively, as percentages or summary measures of central tendency. Sociodemographic and other factors were analyzed and reported by using words and table. A paired sample t test was performed to test the differences between the pre- and post-test. In additions mean and standard deviation of the responses were calculated.Ethical clearance was obtained from the research ethics committee of Amanuel mental specialized hospital research and training department. Informed, written consent was obtained from each study participant. The right to withdraw from the research process at any point in time was respected. Privacy and strict confidentiality were maintained during the interview process.A total of 94 participants were included in the study which makes the response rate 100%. The mean age of the respondents was 27.80 (\u00b1\u00a0standard deviation\u00a0=\u00a011.70) years.Among total participants, more than two-third of them 66 (70.21%) were females, 34 (36.14%) were married, 44 (46.81%) were between the ages of 25\u201330\u00a0years.More than one-third of the study participants 44 46.81%) were health officers, the majority of the participants, 70 (74.47%) were Orthodox Christians and around forty-two participants 44.68% were Oromo by ethnicity. Majority of participants, 72 (76.60%) had taken psychiatry courses during under graduate training and more than half of them had 4\u20137\u00a0years of experience  for psychosis, 95.74% (p\u00a0=\u00a00.001), for depression 89.36% (p\u00a0=\u00a00.002) for epilepsy and 90.42% (p\u00a0=\u00a00.001) for alcohol use disorders showed favorable attitude  disorders, post- intervention the participant\u2019s case detection and treatment showed significant improvement, which was assessed after three-month practice at primary health care level. Post intervention case identification of the participants increased from 9.53 to 20.84% (p\u00a0=\u00a0001) for psychosis, and 15.87\u201318.75% (p\u00a0=\u00a00.001) for depression. Similarly, post- intervention case identification of the participants showed significant improvement for epilepsy and alcohol use disorders  countries due to lack of attention, problems related to of awareness and negative attitude by health care professionals , 17, 18.Consistent with previous research , 18, priAccording to the current study the participants showed significant increase post- intervention in proportion of knowledge about mental, neurologic and substance use. Pre- and post-training evaluation indicated that post-intervention proportion of the participant\u2019s knowledge about mental, neurologic and substance use disorders showed significant improvement. Post intervention knowledge of the participants about psychosis increased from 34.04 to 87.23% (p\u00a0=\u00a0000). Similarly, greatest improvement was observed after training on participant\u2019s knowledge about depression, epilepsy and alcohol use disorders. This result indicates that training has significant effect on knowledge primary health care workers related to mental, neurologic and substance use disorders which is vital for success of integrated services. This findings are in line with other studies done in Nigeria  and otheThis study demonstrated that training has significant effect on attitude of primary health care workers about mental, neurologic and substance use disorders. The effect is higher for psychosis followed depression and alcohol use disorders. Post-intervention the majority of the participants, 89.36% (p\u00a0=\u00a00.000) for psychosis, 95.74% (p\u00a0=\u00a00.001), for depression 89.36% (p\u00a0=\u00a00.002) for epilepsy and 90.42% (p\u00a0=\u00a00.001) for alcohol use disorders showed favorable attitude. This findings are in agreement with other studies done in Nigeria  and otheWe found a change in the practice of primary health care professionals about mental, neurologic and substance use disorders after the training. This findings suggests that effectiveness of mental health training on practice of primary health care workers and continues training and education is vital for success of mental health integration into general health care services. Post- intervention the participants case detection and treatment showed significant improvement, which was assessed after three-month practice at primary health care level. Post intervention case identification of the participants increased from 9.53% to 20.84% (p\u00a0=\u00a0001) for psychosis, and 15.87 to 18.75% (p\u00a0=\u00a00.001) for depression. Similarly, post- intervention case identification of the participants showed significant improvement for epilepsy and alcohol use disorders. This findings are in agreement with other studies done in Nigeria , 29.This study also indicated that there is statically significant difference in vignette case identification of primary health care workers pre- and post-training. The intervention had a large impact on case identification of primary health care workers, which is essential for the success of the integration of mental health into primary health care services. The vignette case identification of trainees increased from 31.92 to 94.68% (p\u00a0=\u00a0000) for psychosis, 34.04 to 90% (p\u00a0=\u00a0001) for depression, 75.45 to 96.80% (p\u00a0=\u00a0003), for epilepsy and 53.19 to 94.68% (p\u00a0=\u00a0002) for alcohol use disorder. This findings are in agreement with other studies done in Nigeria  and otheThe study resulted in a significant improvement in KAP of PHC workers about all the four mental, neurologic and substance use disorders during the post intervention survey. PHC workers showed significant increase post intervention in proportion of knowledge, attitude and practice related to common mental, neurologic and substance use disorders selected and implemented for scale and integration of mental health services into primary health care in Ethiopia. Training is a prerequisite and vital to enhance the knowledge, attitude, and practice of primary care professionals which plays a significant role for the easy success of integrated care and treatment of mental, neurologic and substance use disorders into the existing general health care services.The mail limitations of this study was failure discuss and compare the results with other previous studies due to lack adequate studies in the area."}
{"text": "A high\u2010fibre diet and one rich in fruit and vegetables have long been associated with lower risk of chronic disease. There are several possible mechanisms underpinning these associations, but one likely important factor is the production of bioactive molecules from plant\u2010based foods by the bacteria in the colon. This links to our growing understanding of the role of the gut microbiome in promoting health. Polyphenolic\u2010rich plant foods have been associated with potential health effects in many studies, but the bioavailability of polyphenol compounds, as eaten, is often very low. Most of the ingested molecules enter the large intestine where they are catabolised to smaller phenolic acids that may be the key bioactive effectors. Dietary fibres, present in plant foods, are also fermented by the bacteria to short\u2010chain fatty acids, compounds associated with several beneficial effects on cell turnover, metabolism and eating behaviour. Polyphenols and fibre are often eaten together, but there is a lack of research investigating the interaction between these two groups of key substrates for the colonic bacteria. In a project funded by the Biotechnology and Biological Sciences Research Council Diet and Health Research Industry Club, we are investigating whether combining different fibres and polyphenol sources can enhance the production of bioactive phenolic acids to promote health. This could lead to improved dietary recommendations and to new products with enhanced potential health\u2010promoting actions. There has been intense interest in the role of the gut microbiome in human health over the last decade. The ability to describe the genetic repertoire of bacterial populations without the need to isolate, culture and characterise each organism has revolutionised our ability to understand the complexity of this important ecosystem. It is becoming increasingly evident that our gut bacteria have important influences on several functions of the human body. The diversity and composition of the gut microbiota has been associated with a wide variety of disorders and pathologies including obesity  study. In Mediterranean countries, flavonoids were the main polyphenolic contributors but were only the second contributor in non\u2010Mediterranean Europe where phenolic acids were the main contributor. In Mediterranean countries, the main food sources were coffee, fruit and then wine. In non\u2010Mediterranean countries, the order of contribution was coffee, tea and then fruit. Fruit was the main source of flavonoids in Mediterranean countries, whereas tea was the main source in the non\u2010Mediterranean countries. Flavonoids include flavonols, flavones, flavanones, isoflavones, flavanols and anthocyanins. However, most of these parent polyphenols are not well absorbed in the small intestine  thus complicating the interpretation of plasma and urine phenolic acid measurements. One of the main intermediate metabolites of rutin catabolism, 3,4\u2013dihydroxy phenyl acetic acid , exhibited greater inhibition of anti\u2010platelet aggregation , which are expressed on a wide array of cell types . In previous pilot studies, we have shown that combining fermentable carbohydrates and polyphenols in an in\u00a0vitro model of colonic fermentation speeded up the breakdown of the polyphenol rutin  Diet and Health Research Industry Club (DRINC) initiative, we are exploring the interactions between dietary fibres and colonic polyphenol catabolism in a systematic fashion. Starting with in\u00a0vitro fermentation models, using human faecal bacteria, a range of fibres has been combined at different doses with a range of polyphenols, so that the relative effects of (1) fibre on individual polyphenol catabolism and (2) the polyphenols on SCFA production can be estimated. The results of these fermentations will then inform the choice of two fibre\u2010polyphenol mixtures to be studied in acute bioavailability studies in humans. Phenolic acid production will be measured in urine over 24\u00a0hours after a test meal. Finally, a 6\u2010week feeding study will explore the longer term interactive effects of the fibre and polyphenol mixture on phenolic acids and also biomarkers of inflammation and health. We are using stable isotope\u2010labelled polyphenols and foods to confirm the source of phenolic acids in these studies. Thus, the results of this project should inform clearer dietary recommendations and may lead to new product designs for enhancing the positive actions of the dietary polyphenols.In our project We have no conflict of interest to declare."}
{"text": "Cognitive impairment (CI) has been described in 3\u201380% of Systemic lupus erythematosus (SLE) patients but only short-term studies evaluated its over-time changes, suggesting that CI is usually a stable finding. We aimed at evaluating the changes of SLE-related CI in a 10-years prospective single center cohort study.We evaluated 43 patients  at baseline (T0) and after 10 years (T1). A test battery designed to detect fronto-subcortical dysfunction across five domains  was administered. A global cognitive dysfunction score (GCD) was obtained and associated with clinical and laboratory features.Prevalence of CI was 20.9% at T0 and 13.9% at T1 (P = NS). This impairment was prevalently mild at T0 (55.5%) and mild or moderate at T1 (36.3% for both degrees). After 10 years, CI improved in 50% of patients, while 10% worsened. Impaired memory (P = 0.02), executive functions (P = 0.02) and abstract reasoning (P = 0.03) were associated with dyslipidemia at T0. Worsening of visuospatial functions was significantly associated with dyslipidemia and Lupus Anticoagulant (P = 0.04 for both parameters). Finally, GCD significantly correlated with chronic damage measured by SLICC/damage index at T0  and T1 .For the first time, we assessed CI changes over 10-years in SLE. CI improved in the majority of the patients. Furthermore, we observed an improvement of the overall cognitive functions. These results could suggest that an appropriate management of the disease during the follow-up could be able to control SLE-related CI. Systemic Lupus Erythematosus (SLE) is an autoimmune disease characterized by a multifactorial etiology, in which genetic and environmental factors determine disease development . The proAmong the different clinical manifestations, neuropsychiatric involvement can affect up to 90% of SLE patients.\u20139 A wideCognitive impairment (CI) represents one of the most common neuropsychiatric feature in SLE patients, with a prevalence ranging from 3% to 80%. \u201315 This From a pathogenic point of view, NPSLE development has been related to the presence of autoantibodies and cytokine-mediated neuronal dysfunctions, vasculopathy, and coagulopathy. Several With regard to the assessment of SLE-related CI, the ACR Ad Hoc Committee on Neuropsychiatric Lupus nomenclature proposed in 1999 a brief research battery able to quantify these dysfunctions. So far, the studies assessing cognitive impairment in SLE patients are mostly cross\u2010sectional, without providing information about over-time changes.To the best of our knowledge, only four longitudinal studies have been conducted, with a maximum follow-up of 5 years. \u201325 TakenThus, in the present 10-year prospective study, we aimed at evaluating the changes of CI in a single center SLE cohort. Secondly, we evaluated the correlations between CI and clinical and laboratory SLE-related features.Fifty-eight adult patients affected by SLE according to the ACR revised criteria, were enrolled consecutively in this longitudinal study at the Lupus Clinic, Sapienza University of Rome. Written informed consent was obtained from each patient and the local ethic committee approved the study design. The baseline features of this cohort were described in a previous study. According to the study protocol, the patients were evaluated at baseline (T0) and after 10 years (T1).Study protocol included complete physical examination and blood drawing. The clinical and laboratory data were collected in a standardized computerized electronically filled form including demographics, past medical history with date of diagnosis, co-morbidities, and previous and concomitant treatments.Crithidia Luciliae (titer \u22651: 10), ENA  by ELISA assay considering titers above the cut-off of the reference laboratory, anti-cardiolipin (anti-CL) (IgG/IgM isotype) by ELISA, in serum or plasma, at medium or high titers , anti-\u03b22 Glycoprotein-I (anti-\u03b22GPI) (IgG/IgM isotype) by ELISA, in serum (above the 99th percentile), and lupus anticoagulant (LA) according to the guidelines of the International Society on Thrombosis and Hemostasis. Finally, C3 and C4 serum concentrations were determined by means of radial immunodiffusion.Each subject underwent peripheral blood sample collection. The study protocol included the determination of autoantibodies and the evaluation of C3 and C4 serum levels. Specifically, ANA has been determined by means of indirect immunofluorescence (IIF) on HEp-2 , anti-dsDNA with IIF on Disease activity was assessed by using the SLE Disease Activity Index 2000 (SLEDAI-2K).  AccordinThe Systemic Lupus International Collaborative Clinics/American College of Rheumatology (SLICC/ACR) Damage Index (SDI) was applied to evaluate the chronic damage. All patients underwent a comprehensive cognitive-behavioral neuropsychological assessment, performed by the same neurologist (CM) at baseline and after 10 years of follow-up.Neurocognitive assessment was performed during a 1-hour interview and included standardized testing for five domains: memory, attention, abstract reasoning, executive and visuospatial functions. This assessment included those tests from the ACR and the CSI standardized in an Italian population, and was specifically designed to detect the fronto-subcortical dysfunction typical of SLE.A Minnesota Multiphasic Personality Inventory (MMPI) was administered to all the patients in order to exclude the influence of behavioral abnormalities on cognitive dysfunction.  The follMini Mental State Examination (MMSE) for general cognitive status , 33, 34.Rey Auditory Verbal Learning Test and Digit Span forward, two efficient neuropsychological instruments for testing verbal memory;Immediate Visual Memory Test  and Corsi Block-Tapping Test forward, used to measure visuospatial memory;Copying of Drawings with and without elements of programming, two common tools to evaluate visuospatial abilities;Attentive Matrices for both selective and sustained attention;Raven\u2019s Progressive Matrices, a widely used non-verbal intelligence test for abstract reasoning;Digit Span backward, Corsi Block-Tapping Test backward, Phonological Verbal Fluency Test, Trail Making Test A, Trail Making Test B, Wisconsin Card Sorting Test, Analogies Test and Time and Weight Estimation Test, STEP, to investigate deeply the presence of executive dysfunctions. Unadjusted analysis was performed as previously described. , 35Briefly, for each patient, the raw scores from each test were compared with published norms  and transformed into Z scores to express the deviation from the normal mean [Z = (raw data2test mean)/test standard deviation]. Mean domain Z scores (MDZs) were defined as the average of the Z scores from the tests comprising each domain. To indicate cognitive function as a composite score, the Z score for each domain was transformed into a Domain Cognitive Dysfunction score (DCDs), with higher values representing more impairment in a particular domain. The sum of all DCDs across the five domains resulted in the Global Cognitive Dysfunction score (GCDs), which was transformed into a Global Cognitive Dysfunction category (GCDc).This method was summarized in 2) test or Fisher\u2019s exact test where appropriate. Two-tailed P values were reported, P values less than or equal to 0.05 were considered significant. GCDs were compared in patients grouped by antibody level. The binary outcomes variable for the antibody testing were serum autoantibody status, defined either as present versus absent or low/absent versus high. The results were verified through analysis of the domain Z scores and single-test Z scores. Descriptive statistics were computed for all study variables. Multivariable logistic regression analysis was performed including only variables that achieved P value <0.100 in the univariate analysis were included for calculation.The statistical calculations were performed using Statistical Package for Social Sciences 13.0  and GraphPad 5.0 . Normally distributed variables were summarized using the mean\u00b1SD, and non-normally distributed variables by the median and interquartile range. Wilcoxon\u2019s matched pairs test and paired t-test were performed. Univariate comparisons between nominal variables were calculated using chi-square  were re-evaluated: at baseline, these patients showed a mean age of 36.7\u00b110.0 years (range 19\u201358 years), a mean disease duration of 110.9\u00b173.6 months, a mean \u00b1SD duration of scholar education of 12.2\u00b13.5 years.Considering the 15 SLE patients lost to follow-up, 13 refused to participate to the second evaluation, and two patients died (one for complicated infection and one for cardiovascular event). No significant differences between re-evaluated and missing patients were observed as regards demographic, clinical and laboratory features. In myasthenia gravis. In With regard to other autoimmune diseases, eleven patients (25.6%) were affected by anti-phospholipid syndrome (APS), six (13.9%) by Sj\u00f6gren\u2019s Syndrome. Furthermore, the presence of comorbidity was registered: arterial hypertension was identified in 21 patients (48.8%), thyroid pathology in 15 (34.9%), dyslipidemia, defined as raised plasma triglycerides (\u2265 150 mg/dl) and/or low HDL-C (<40 mg/dl in men and <50 mg/dl in women) , in 11  at T0 and in 13.9% (6 patients) at T1 (P = NS). This impairment was prevalently mild at T0 (55.5%) and mild or moderate at T1 (36.3% for both degrees).Considering patients with CI at baseline, 55.5% experienced an improvement, while the other patients remained stable. Only one patient among the 34 without CI at baseline experienced a neurocognitive dysfunction with mild impairment.The mean domain Z scores were graphically represented in All the domains showed an improvement over-time, with a significant difference from baseline for executive function (P = 0.04). After transforming the MDZs into DCDs, the percentage of patients with impairment in the different domains was calculated as shown in The domain referring to executive functions was the most frequently involved at baseline ; this frequency was significantly reduced at the follow-up, when the domain was compromised in six patients . Of note, after 10 years the frequency of impairment was reduced in all the domains evaluated even if without reaching significant difference.Moreover, the presence of dyslipidemia, considered in our statistical analysis as a categorical variable, resulted significantly associated with memory impairment (P = 0.02), executive functions (P = 0.02) and abstract reasoning (P = 0.03) at the baseline, and with visuospatial functions (P = 0.009) and abstract reasoning (P = 0.004) at T1. Of note, worsening of visuospatial functions was significantly associated with dyslipidemia and positivity for LA (P = 0.04 for both parameters). Finally, the GCDs significantly correlated with SDI value at the baseline  and at T1 .No correlations between CI and demographical characteristics (including age and education level), SLE clinical features, ongoing and past treatments , comorbidities, activity and damage indices were observed in the present SLE cohort at baseline and follow-up.Moreover, all the lupus features  and ongoing and past medications  were considered in the multivariate logistic regression analysis, without identifying significant association.Moreover no significant associations were identified between CI and behavioral abnormalities evaluated by MMPI scales.In the present longitudinal study, the CI changes after 10 years of follow-up were evaluated in a cohort of Caucasian SLE patients. We observed an improvement of this manifestation in the majority of patients evaluated, with a worsening in only 10% of subjects. Furthermore, all cognitive functions improved and a statistically significant difference was achieved for the executive functions.Interestingly, the same operator performed the neurocognitive assessment at baseline and after 10 years, safeguarding the reliability of the results and reducing the risk of performance bias. At the same time, the patients were followed constantly in our Lupus Clinic during the 10 years follow-up, suggesting that clinical decisions among this time lapse were homogenous.Despite the high number of studies evaluating SLE-related CI, few data have analyzed its over-time changes, with a maximum follow-up of 5 years. To sum up, in most of the studies a fluctuating or stable trend was identified more frequently than worsening. \u201325The one-year follow-up study of Carlomagno and colleagues demonstrated a stable trend in more than 90% of SLE-patients. The 5-yeaWe previously evaluated a 58-patients SLE cohort in order to assess the CI prevalence and the possible association with other clinical and laboratory SLE-related features. We observed a mild GCDs impairment in 19% of patients, moderate (GCDs 4\u20135) in 7% and severe in 5%.15) In this cohort, the impairment of visuospatial domain resulted the most compromised and significantly associated with aCL IgM levels. Moreover, disease activity and chronic damage correlated with different domains. [ In this In the present study, we re-evaluated 43 out of 58 patients (74.1%), observing a reduction of the CI prevalence from 20.9to 13.9% after 10-yearfollow-up. Specifically, half of patients with CI at the baseline showed an improvement and only 10% a worsening. These results reinforce those obtained in above-described studies: in our cohort, even the majority of patients experienced an improvement of cognitive functions, differently from the stable trend previously described. We could hypothesize that the improved management of SLE patients and new therapeutic strategies allowed these results. In fact, previous studies were conducted more than 10 years ago and a wider knowledge on the SLE management as well as of therapeutic arrows can be expected in this time interval. , 38This suggestion was confirmed indirectly by the comparison of treatments at baseline and after 10 years. Of note, a significantly lower mean weekly dosage of GC was documented at the follow-up, with a significant increase of percentage of patients assuming dosage lower than 35mg/weekly of prednisone equivalents. Moreover, in our cohort we observed a significant increase of immunosuppressant drugs administration  and the appearance of biological drugs usage. Of note, in the last years a growing use of Mycophenolate was registered in Lupus cohorts, demonstrating the efficacy of this drug in other than renal involvement features, such as neurological manifestations. Furthermore, all patients were treated by antimalarial drugs and/or immunosuppressant and, in case of positivity for aPL antibodies, by anti-thrombotic therapy. Taken together, these treatments could influence the different inflammatory and thrombotic pathogenic mechanisms potentially determining CI. Nonetheless, it should be considered that the low mean age at the baseline (lower than 40 years) and the high scholar level of our cohort could influence the ability to perform neurocognitive assessment.Furthermore, we evaluated the association between CI and the different clinical/laboratory SLE-related features, as well as cardiovascular comorbidities. We observed a significant association between dyslipidemia and CI in all the domains, except for the attention, at baseline and after 10 years. Moreover, this comorbidity significantly correlated with the worsening of visuospatial functions. These results are in agreement with previous evidences: in particular, a multicenter Italian study including about 1.000 SLE patients identified dyslipidemia as a risk factor for the presence of CI. We could hypothesize, as a possible pathogenetic explanation, a concurrent subclinical vascular injury in both dyslipidemic and cognitive impaired patients which may justify this association.In addition, our analysis confirms the possible pathogenic role of aPL in the CI development: a significant correlation between LA positivity and the worsening in visuospatial functions was identified in our cohort. This finding suggests that aPL may act determining not only a focal damage (at level of thrombotic event), but also a more diffuse damage, with a direct mechanism on neural cells. , 42 MoreWe would highlight that generally MMPI is not an optimal battery to evaluate mood disorders. However, since at baseline evaluation, performed about 10 years ago, MMPI has been chosen to exclude the influence of behavioral abnormalities on cognitive dysfunction, we decided to keep the same protocol in order to maintain continuity and consistency of our longitudinal study. Nonetheless we observed that the assessment by MMPI depression scale indeed confirmed the presence of this mood disorder in the same patients previously diagnosed by a neuropsychiatrist specialist. Thus, all MMPI scales were included in the multivariate analysis but did not correlate with CI identified.In conclusion, the present study provides data concerning the changes over-time of SLE-related CI, by considering for the first time a follow-up of 10 years. Our data demonstrated a stability of cognitive functions, with a trend to the improvement in all the evaluated domains. The risk factors for a worse prognosis resulted the positivity for aPL, in particular LA, and the presence of a concomitant dyslipidemia. Moreover, the prevention of disease relapse and chronic damage development is mandatory in order to prevent CI worsening."}
{"text": "Neurons recorded in behaving animals often do not discernibly respond to sensory input and are not overtly task-modulated. These non-classically responsive neurons are difficult to interpret and are typically neglected from analysis, confounding attempts to connect neural activity to perception and behavior. Here, we describe a trial-by-trial, spike-timing-based algorithm to reveal the coding capacities of these neurons in auditory and frontal cortex of behaving rats. Classically responsive and non-classically responsive cells contained significant information about sensory stimuli and behavioral decisions. Stimulus category was more accurately represented in frontal cortex than auditory cortex, via ensembles of non-classically responsive cells coordinating the behavioral meaning of spike timings on correct but not error trials. This unbiased approach allows the contribution of all recorded neurons \u2013 particularly those without obvious task-related, trial-averaged firing rate modulation \u2013 to be assessed for behavioral relevance on single trials. Neurons encode information in the form of electrical signals called spikes. Certain neurons increase the rate at which they produce spikes under specific circumstances, e.g., whenever an animal hears a particular sound. These neurons are said to be 'classically responsive'. But not all neurons behave in this way. Others produce spikes at a variable rate that does not obviously relate to the animal's behavior. These neurons are said to be 'non-classically responsive'. They are often omitted from analyses, despite typically outnumbering their classically responsive counterparts. So, what are these neurons doing?To find out, Insanally et al. trained rats to respond to sounds. The animals learned to poke their nose into a window whenever they heard a specific tone, and to avoid responding whenever they heard any other tone. As the rats performed the task, Insanally et al. recorded from neurons in two areas of the brain, the frontal cortex and the auditory cortex. A computer then analyzed the activity of individual neurons during each trial.As expected, the firing rate of non-classically responsive cells did not relate to the animals' behavior. But the timing of this firing did. The interval between spikes contained information about which tone the animals had heard and/or how they had responded. The cells worked together in groups to encode this information. Over the course of each trial, every neuron in the group varied the interval between its spikes. Eventually, the group reached a consensus, with all neurons using the same interval to represent information relevant to the task. Groups of neurons in the frontal cortex encoded more information about the category of the tone than those in the auditory cortex.By including all neurons \u2013 both classically and non-classically responsive \u2013 this model offers a more comprehensive view of how neural activity relates to behavior. This may in turn help us understand the variable and complex neural activity seen in people with sensory and cognitive disorders. Spike trains recorded from the cerebral cortex of behaving animals can be complex, highly variable from trial-to-trial, and therefore challenging to interpret. A fraction of recorded cells typically exhibit trial-averaged firing rates with obvious task-related features and can be considered \u2018classically responsive\u2019, such as neurons with tonal frequency tuning in the auditory cortex or orientation tuning in the visual cortex. Another population of responsive cells are modulated by multiple task parameters (\u2018mixed selectivity cells\u2019) and have recently been shown to have computational advantages necessary for flexible behavior . HoweverHow do these non-classically responsive cells relate to behavioral task variables on single trials? While there are sophisticated approaches for dissecting the precise correlations between classically responsive cells and task structure , there iWe trained 15 rats on an audiomotor frequency recognition go/no-go task  that reqTo correctly perform this task, animals must first recognize the stimulus and then execute an appropriate motor response. We hypothesized that two brain regions important for this behavior are the auditory cortex (AC) and frontal cortical area 2 (FR2). Many but not all auditory cortical neurons respond to pure tones with reliable, short-latency phasic responses . These nWe first asked if activity in AC or FR2 is required for animals to successfully perform this audiomotor task. We implanted cannulas into AC or FR2 , and infOnce animals reached behavioral criteria , they were implanted with tetrode arrays in either AC or FR2 . After rGiven that the majority of our recordings were from non-classically responsive cells, we developed a general method for interpreting neural responses even when trial-averaged responses were not obviously task-modulated which allowed us to compare coding schemes across different brain regions . The algorithm is agnostic to the putative function of neurons as well as the task variable of interest .Our algorithm empirically estimates the interspike interval (ISI) distribution of individual neurons to decode the stimulus category (target or non-target) or behavioral choice (go or no-go) on each trial via Bayesian inference. The ISI was chosen because its distribution could vary between task conditions even without changes in the firing rate \u2013 building on previous work demonstrating that the ISI distribution contains complementary information to the firing rate . The disFor each recorded neuron, we built a library of ISIs observed during target trials and a library for non-target trials from a set of \u2018training trials\u2019. Two different cells from AC are shown in Importantly, while the probabilities of observing particular ISIs on target and non-target trials were similar , small dThe algorithm uses the statistical prevalence of certain ISI values under particular task conditions , to infer the task condition for each trial. Each trial begins with equally uncertain probabilities about the stimulus categories (i.e. p(target)=p(non-target)=50%). As each ISI is observed sequentially within the trial, the algorithm applies Bayes\u2019 rule to update p(target|ISI) and p(non-target|ISI) using the likelihood of the ISI under each stimulus category (p(ISI|target) and p(ISI|non-target) . As thesCan we uncover task information from non-classically responsive cells? We found that non-classically responsive cells in both AC and FR2 provided significant spike-timing-based information about each task variable . The abiWe also observed that task information was distributed across both AC and FR2, and neural spike trains from individual units were multiplexed in that they often encoded information about both stimulus category and choice simultaneously , Table 1AC\u00a0=\u00a00.016, pstim\u00a0=\u00a00.0013, Mann-Whitney U test, two-sided). Both of these observations would not have been detected at the level of the PSTH, as most cells in AC were non-classically responsive for behavioral choice , yet our decoder revealed that these same cells were as informative as choice classically responsive cells . Moreover, comparing single trial decoding outcomes demonstrated weak to no correlations between the ISI-based decoder and the conventional rate decoder, further underscoring that these two methods rely on different features of the spike train to decode  Poisson decoder , which aWe hypothesize that ISI-based decoding is biologically plausible. Short-term synaptic plasticity and synaptic integration provide powerful mechanisms for differential and specific spike-timing-based coding. We illustrated this capacity by making whole-cell recordings from AC neurons in vivo and in brain slices , as wellMoreover, we note that this type of coding scheme requires few assumptions about implementation, and does not require additional separate integrative processes to compute rates or form generative models. Thus, ISI-based decoding coding could be generally applicable across brain areas, as demonstrated here for AC and FR2.AC\u00a0=\u00a05\u00a0\u00d7\u00a010\u22126, pPFC\u00a0<0.0002, Mann-Whitney U test, two-sided). This surprising result demonstrates that our algorithm generalizes to novel datasets, and may be used to uncover coding for cognitive variables beyond those apparent from conventional trial-averaged, rate-based analyses. Furthermore, these results indicate that as task complexity increases non-classically responsive cells are differentially recruited for successful task execution.To further demonstrate the generalizability and utility of our approach, we applied our decoding algorithm to neurons that were found to be non-classically responsive in a previously published study . In thisAC stim=0.04, pFR2 stim=1\u00d710\u22125, pAC\u00a0=\u00a00.29, pFR2 choice=7\u00d710\u22125, Mann-Whitney U test, two-sided). This was not a trivial consequence of using more neurons, as the information provided by individual ISIs on single trials can be contradictory  and p(go | ISI)) on each trial . Analyzi\u22125, for four-member ensembles: p=0.03, Mann-Whitney U test, two-sided). Interestingly, decoding with an increasing number of non-classically responsive cells improved error prediction in both AC and FR2 .Can our decoding method predict errors on a trial-by-trial basis? In general, trial-averaged PSTHs did not reveal systematic differences between correct and error trials . HoweverWhile improvements were seen in decoding performance with increasing ensemble size, the ISI distributions/ISI-based likelihood functions were highly variable across individual ensemble members. Thus, we wondered if there was task-related structure in the timing of population activity that evolved over the course of the trial to instantiate behavior. To answer this question, we examined whether local ensembles share the same representation of task variables over the course of the trial. Do they \u2018reach consensus\u2019 on how to represent task variables using the ISI ? WithoutWe examined how ensembles coordinate their activity moment-to-moment over the course of the trial by quantifying the similarity of the LLRs across cells in a sliding window. Similarity was assessed by summing the LLRs of ensemble members, calculating the total area underneath the resulting curve, and normalizing this value by the sum of the areas of each individual LLR. We refer to this quantified similarity as \u2018consensus\u2019; a high consensus value indicates that ensemble members have similar LLRs and therefore have a similar representation of task variables . We shout\u00a0=\u00a00 to 0.42 s, pSNR\u00a0=\u00a03.9\u00a0\u00d7\u00a010\u22124 Wilcoxon test with Bonferroni correction, two-sided). Sensory classically responsive ensembles in AC increased consensus beyond stimulus presentation, reaching a maximum\u00a0~750 ms after tone onset on correct trials . For choice-related activity, choice non-classically responsive ensembles in both regions as well as choice classically responsive ensembles in FR2 each reached consensus within 500 ms of the behavioral response . Importantly, this temporally precise pattern of consensus building is not present on error trials. On error trials, stimulus consensus dynamics decreased over the course of the trial whereas choice dynamics did not display a systematic increase with the exception of choice non-classically responsive ensembles in AC which remained systematically lower than correct trials . The observed increases in ensemble consensus on correct trials  suggests that achieving a shared ISI representation of task variables may be relevant for successful task execution.While the conventional trial-averaged PSTH of non-classically responsive ensembles recorded in AC and FR2 showed no task-related modulation, our analysis revealed structured temporal dynamics of the LLRs . On correct trials, we observe a trajectory of increasing consensus at specific moments during the trial signifying a dynamically created, shared ISI representation of task variables. In FR2, sensory non-classically responsive ensembles (ensembles in which at least two out of three cells were not tone-modulated) encode stimulus information using temporally-precise stimulus-related dynamics on correct trials. The stimulus representation of sensory non-classically responsive ensembles reached consensus rapidly after stimulus onset followed by divergence  the LLRs of each cell within an ensemble are completely dissimilar or (2) they are \u2018out of phase\u2019 with one another \u2013 the LLRs partition the ISIs the same way . For exat\u00a0=\u00a00 to 0.89 s, p=1.7\u00a0\u00d7\u00a010\u22125 Wilcoxon test, two-sided). Non-classically responsive ensembles in AC and FR2 also increased their unsigned consensus immediately before behavioral response . This pattern of consensus-building was only present on correct trials. On error trials unsigned consensus values did not systematically increase  suggesting that behavioral errors might result from a general lack of consensus between ensemble members. In summary, we have shown that cells which appear unmodulated during behavior do not encode task information independently, but do so by synchronizing their representation of behavioral variables dynamically during the trial.Using this metric, we found that the unsigned consensus pattern for non-classically responsive ensembles  were shared between AC and FR2 \u2013 increasing until\u00a0~750 ms after tone onset on correct trials  while this information is reflected in a more complex and distributed manner throughout AC.We have identified task-informative non-classically responsive neurons recorded while animals performed a frequency recognition task or a task-switching paradigm. This does not preclude the possibility that these cells are driven by other acoustic stimuli or in other behavioral contexts; however, determining the significance of non-classically responsive activity must ultimately be considered in the specific behavioral context in question, as their role may be dynamic and context dependent.The finding that the ISI-based approach of our algorithm is not reducible to rate despite their close mathematical relationship raises the question of how downstream regions could respond preferentially to specific ISIs. Our whole-cell recordings from both AC and FR2 demonstrate that different postsynaptic cells can respond differently to the same input pattern with a fixed overall rate, emphasizing the importance of considering a code sensitive to precise spike-timing perhaps via mechanisms of differential short-term plasticity such as depression and facilitation . FurtherOur consensus results reveal dynamic changes in the relationship between the LLRs of ensemble members. How might such a downstream resonator interpret a given ISI in the context of these dynamics? Our consensus analysis provides one possible answer: downstream neurons may be attuned to the ISIs specified by the consensus LLR of an ensemble. In such a model, an ensemble would have the strongest influence on downstream activity when they reach high consensus. We additionally hypothesize that mechanisms of long-term synaptic plasticity such as spike-timing-dependent plasticity can redistribute synaptic efficacy, essentially changing the dynamics of short-term plasticity independent from overall changes in amplitudes . Thus, aIt is still unclear what the relevant timescales of decoding might be in relation to phenomena such as membrane time constants, periods of oscillatory activity, and behavioral timescales. Given that our ISI-based decoder and conventional rate-modulated decoders reveal distinct information, future approaches might hybridize these rate-based and temporal-based decoding methods to span multiple timescales. Other recent studies have also contributed to our understanding of non-classically responsive activity, by evaluating firing rates or responses from calcium imaging to demonstrate how correlations with classically responsive activity may contribute to the linear separability of ensemble responses .We have shown that underlying the task-relevant information encoded by each ensemble is a rich set of consensus-building dynamics that is invisible at the level of the PSTH. Ensembles in both FR2 and AC underwent stimulus and choice-related consensus building that was only observed when the animal correctly executed the task. Moreover, non-classically responsive cells demonstrated temporal dynamics synchronized across regions which were distinct from classically responsive ensembles. These results underscore the importance of measuring neural activity in behaving animals and using unbiased and generally\u00a0applicable analytical methods, as the response properties of cortical neurons in a behavioral context become complex in ways that challenge our conventional assumptions .All animal procedures were performed in accordance with National Institutes of Health standards and were conducted under a protocol approved by the New York University School of Medicine Institutional Animal Care and Use Committee. We used 23 adult Sprague-Dawley male and female rats (Charles River) in the behavioral studies. Animals were food restricted and kept at 85% of their initial body weight, and maintained at a 12 hr light/12 hr dark cycle.Animals were trained on a go/no-go audiomotor task . OperantAnimals were rewarded with food for nose poking within 2.5 s of presentation of the target tone (4 kHz) and given a short 7 s time-out for incorrectly responding to non-target tones . Incorrect responses include either failure to enter the nose port after target tone presentation  or entering the nose port after non-target tone presentation . Tones were 100 ms in duration and sound intensity was set to 70 dB SPL. Tones were presented randomly with equal probability such that each stimulus category was presented. The inter-trial interval delays used were 5, 6, 7, or 8 s.For experiments involving muscimol, we implanted bilateral cannulas in either FR2  of seven animals or AC  of three animals. We infused 1 \u03bcL of muscimol per side into FR2 or infused 2 \u03bcL of muscimol per side into AC, at a concentration of 1 mg/mL. For saline controls, equivalent volumes of saline were infused in each region. Behavioral testing was performed 30-60 min after infusions. Power analysis was performed to determine sample size for statistical significance with a power of \u03b2: 0.8; these studies required at least three animals, satisfied in the experiments of Figure 1-figure supplement 3B,E. For motor control study, animals could freely nose poke for food reward without presentation of auditory stimuli after muscimol and saline infusion.Animals were implanted with microdrive arrays  in either AC  or FR2  after reaching behavioral criteria of d\u2019\u22651.0. For surgery, animals were anesthetized with ketamine (40 mg/kg) and dexmedetomidine (0.125 mg/kg). Stainless steel screws and dental cement were used to secure the microdrive to the skull, and one screw was used as ground. Each drive consisted of eight independently adjustable tetrodes. The tetrodes were made by twisting and fusing four polyimide-coated nichrome wires . The tip of each tetrode was gold-plated to an impedance of 300\u2013400 kOhms at 1 kHz .ratio sorting quality metrics. To be initially included for analysis, cells had to have\u00a0>3 spikes per trial for 80% of trials to ensure that there were enough ISIs to reliably estimate the ISI probability density functions.Recordings in behaving rats were performed as previously described\u00a0. After tWe used two positive statistical tests for non-classical responsiveness: one to establish a lack of tone-modulation, the other to establish a lack of ramping activity. To accommodate the possibility of tone onset and offset responses, we performed our tone-modulation test on a 100 ms long tone presentation window as well as the 100 ms window immediately after tone presentation. The test compared the number of spikes during each of these windows to inter-trial baseline activity as measured by three sequential 100 ms windows preceding tone onset. Three windows were chosen to account for variability in spontaneous spike counts. Given that spike counts are discrete, bounded, and non-normal, we used subsampled bootstrapping to evaluate whether the mean change in spikes during tone presentation was sufficiently close to zero (in our case 0.1 spikes). We subsampled 90% of the spike count changes from baseline, calculated the mean of these values, and repeated this process 5000 times to construct a distribution of means. If 95% of the subsampled means values were between \u22120.1 and 0.1, we considered the cell sensory non-classically responsive (p<0.05). The range of mean values from \u22120.1 to 0.1 were included to account for both tone-evoked (increases in spike count) and tone-suppressed (decreases in spike count) activity. The value of 0.1 spikes was chosen to be conservative as it is equivalent to an expected change of 1 spike every 10 trials. This is a conservative, rigorous method for establishing sensory non-classical responsiveness that is commensurate with more standard approaches for establishing tone responsiveness such as the z-score.31. First, the trial averaged firing rate was determined in 50 ms bins leading up to the behavioral response. We then calculated the slope of a linear regression in a 500 ms long sliding window beginning 850 ms before behavioral response. The maximum value of these slopes was used as the \u2018ramp index\u2019 for each cell. Cells were classified as choice non-classically responsive if the ramp index did not indicate an appreciable change in the firing rate (less than 50% change) established via subsampled bootstrapping. Cells that were shown to be both sensory and choice non-classically responsive were considered non-classically responsive overall  were delivered in pseudo-random sequence. Primary AC location was determined by mapping multiunit responses 500\u2013700 \u00b5m below the surface using tungsten electrodes. In vivo whole-cell voltage-clamp recordings were then obtained from neurons located 400\u20131100 \u00b5m below the pial surface. Recordings were made with an AxoClamp 2B (Molecular Devices). Whole-cell pipettes (5\u20139 M\u03a9) contained (in mM): 125 Cs-gluconate, 5 TEACl, 4 MgATP, 0.3 GTP, 10 phosphocreatine, 10 HEPES, 0.5 EGTA, 3.5 QX-314, 2 CsCl, pH 7.2. Data were filtered at 2 kHz, digitized at 10 kHz, and analyzed with Clampfit 10 (Molecular Devices). Tone-evoked excitatory postsynaptic currents were recorded at \u201370 mV.\u22121) with oxygenated ACSF at 33\u00b0C. Somatic whole-cell current-clamp recordings were made from layer five pyramidal cells with a Multiclamp 700B amplifier (Molecular Devices) using IR-DIC video microscopy (Olympus). Patch pipettes (3\u20138 M\u03a9) were filled with intracellular solution containing (in mM): 120 K-gluconate, 5 NaCl, 10 HEPES, 5 MgATP, 10 phosphocreatine, and 0.3 GTP. Data were filtered at 2 kHz, digitized at 10 kHz, and analyzed with Clampfit 10 (Molecular Devices). Focal extracellular stimulation was applied with a bipolar glass electrode . Spike trains recorded from AC and FR2 units during behavior were then divided into 150\u20131000 msec fragments, and used as extracellular input patterns for these recordings.Acute brain slices of AC or FR2 were prepared from 2 to 5 month old Sprague-Dawley rats. Animals were deeply anesthetized with a 1:1 ketamine/xylazine cocktail and decapitated. The brain was rapidly placed in ice-cold dissection buffer containing (in mM): 87 NaCl, 75 sucrose, 2.5 KCl, 1.25 NaH2PO4, 0.5 CaCl2, 7 MgCl2, 25 NaHCO3, 1.3 ascorbic acid, and 10 dextrose, bubbled with 95%/5% O2/CO2 (pH 7.4). Slices (300\u2013400 \u00b5m thick) were prepared with a vibratome (Leica), placed in warm dissection buffer (32\u201335\u00b0C) for 10 min, then transferred to a holding chamber containing artificial cerebrospinal fluid at room temperature . Slices were kept at room temperature (22\u201324\u00b0C) for at least 30 min before use. For experiments, slices were transferred to the recording chamber and perfused  parameterized distribution. We used 10-fold cross validation to estimate the bandwidth of the Gaussian kernel in a data-driven manner. Finally, the use of the ISI was also motivated by previous work demonstrating that the ISI can encode sensory information  and thatIndividual trials were defined as the time from stimulus onset to the response time of the animal . Trials were divided into four categories corresponding to each of the four possible variable combinations . Approximately 90% of each category was set aside as a training set in order to determine the statistical relationship between the ISI and the two task variables .Each ISI observed was sorted into libraries according to the stimulus category and behavioral choice of the trial. The continuous probability distribution of finding a particular ISI given the task condition of interest  was then inferred using nonparametric Kernel Density Estimation with a Gaussian kernel of bandwidth set using a 10-fold cross-validation . BecauseThe remaining 10% of trials in the test set are then decoded using the ISI likelihood function described in the previous section. Each trial begins with agnostic beliefs about the stimulus category and the upcoming behavioral choice (p(target)=p(non-target)=50%). Each time an ISI was observed, beliefs were updated according to Bayes\u2019 rule with the four probability distributions obtained in the previous section serving as the likelihood function. To update beliefs in the probability of the target tone when a particular ISI has been observed, we used the following relationship:On the left hand side are the updated beliefs about the probability of a target. When the next ISI is observed this value would be inserted as p on the right side of the equation and updated once more. Using the probability normalization, p can be determined,Similarly, for choice,As the likelihood functions were estimated in 1 s long sliding windows recalculated every 100 ms, Each ISI was assessed using the likelihood function that placed the final spike closest to the center of the sliding window.Continuing this process over the course of the trial, we obtain four probabilities \u2013 one for each of the variable outcomes \u2013 as a function of time during the trial: p, p, p, and p. At each moment, the total probability of both stimuli and both choices are 1. The prediction for the entire trial was assessed at the end of the trial, using the overall likelihood function. Given our independence assumption, the overall likelihood for a spike train is simply equal to product of the likelihoods for each ISI observed over the course of the trial,We used 10-fold cross-validation, meaning the trials in the four stimulus categories were randomly divided into ten parts and each part took a turn acting as the test set with the remaining 90% of trials acting as a training set. To estimate the statistical certainty of these results we used bootstrapping with 124 repetitions (except in the case of the null hypotheses where 1240 repetitions were used).t from neuron j with a likelihood pj:Ensemble decoding proceeded very similarly to the single-unit case. The ISI probability distributions for each neuron in the ensemble were calculated independently as described above. However, while decoding a given trial, the spike trains of all neurons in the ensemble were used to simultaneously update the beliefs about stimulus category and behavioral choice. In other words, p and p were shared for the entire ensemble but each neuron updated them independently using Bayes\u2019 rule whenever a new ISI was encountered. Correlations between neurons were ignored and each of the ISIs from each cell were assumed to were assumed to be independent. For example, if an ISI is observed at time This process is repeated every time a new ISI is encountered from any cell in the ensemble.j is the likelihood of observing a given set of ISIs from neuron j.The joint likelihood of observing a set of ISIs during a trial is then the product of the likelihoods of each neuron independently. For example, for a two neuron ensemble, the combined likelihood, To test the null hypothesis that the ISI-based single-trial Bayesian decoder performance was indistinguishable from chance, synthetic spike trains were constructed for each trial of a given unit by randomly sampling with replacement from the set of all observed ISIs regardless of the original task variable values  and the exponential term represents the probability of silence in the periods between spikes. For comparison with our method, we can reformulate this equation using interspike intervals, if we first break up the exponential integral into domains that span the observed interspike intervals.To decode using the trial-averaged firing rate, we implemented a standard method\u00a0 which us process . Just asi\u0394t is the time difference between spikes it and i+1t. The interpretation of each term in the product is straightforward: it is the infinitesimal probability of observing a spike a time \u0394t after a spike at time t multiplied by the probability of observing no spikes in the intervening time. In other words, it is simply\u00a0t, as predicted by the assumption of a rate-modulated Poisson process. We can easily verify that this term is normalized which allows us to write,Collecting the first and last terms relating to trial start and trial end asWith the exception of the terms relating to trial start and end, we can then view the likelihood of a spike train as resulting from the likelihood of the individual ISIs (just as with our ISI-decoder),t, so we multiply by the probability of observing a spike at time t, To compare the ISI distribution inferred using non-parametric methods to one predicted by a rate-modulated Poisson process, we use the relationship above to calculate the predicted probability of observing an ISI of given length within the 1 s window used for our non-parametric estimates. The formula above assumes a spike has already occurred at time t and t\u00a0+\u00a0ISI with silence in between.In other words, the probability of observing an ISI beginning at time t is simply the probability of observing spikes at times any time within a time window spanning iw to fw is simply the integral of this ISI probability as a function of time across the window. To ensure the final spike occurs before fw the integral spans iw to (fw - ISI),C is a normalization constant which ensures p integrates to 1,The probability of observing an ISI at and choice decoding probabilities were primarily a result of true behavioral choice.For each cell, we fit a Logit model for both the stimulus and choice decoding probabilities on individual trials with the true stimulus category and behavioral choice as regressors. We then calculated the extent to which the stimulus decoding probability was determined by true stimulus category by subtracting the regression coefficient for stimulus from that of choice  was calculated by first calculating the conditional ISI probabilities and then taking the difference of the logarithm of these distributions. For stimulus,The weighted LLR weights the LLR according to the prevalence of a given ISI. For stimulus,The consensus value evaluates the extent to which the LLR (or weighted LLR) is shared across an ensemble. It is the norm of the sum of the LLRs (W. LLRs) divided by the sum of the norms. In principle, the functional norm can be anything but in this case we used the The for an n-member ensemble, the consensus is thenunsigned consensus, we first generate every permutation of the LLRs used and their inverses, -LLR, up to an overall sign. For example, for a pair of LLRs there are only two options,For the The consensus is then calculated over each these sets and the maximum value is taken to be the value of the unsigned consensus.scipy.interpolate.InterpolatedUnivariateSpline .To generate the consensus curves in Using our novel ISI-based decoding algorithm, we analyzed cells found to be non-classically responsive in a previously published study . BrieflyWe established that cells were non-classically responsive for the stimulus location or pitch using our own positive statistical criteria for non-classical responsiveness (described above) by comparing the average spiking activity in the 250 ms stimulus period and the 250 ms following stimulus to inter-trial baseline activity. Cells were also determined to be non-classically responsive for ramping using the same criteria as with our own data. We confirmed that cells were non-classically responsive for the selection rule by comparing their average spiking activity in the 100 ms immediately preceding stimulus onset across contexts.To determine whether non-classically responsive cells also encoded task information , we decoded each variable on single-trials using our ISI-based decoding algorithm. Selection rule information was only assessed in the pre-stimulus hold period, whereas stimulus and choice information was assessed in the period after stimulus onset prior to behavioral response (as with our own data). Cells shown in All statistical analyses were performed in Python, MATLAB, or GraphPad Prism 6. Datasets were tested for normality, and appropriate statistical tests applied as described in the text .https://github.com/badralbanna/Insanally2017\u00a0. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Timothy Behrens as the Senior Editor. The reviewers have opted to remain anonymous.Thank you for submitting your article \"Nominally non-responsive frontal and sensory cortical cells encode task-relevant variables via ensemble consensus\" for consideration by The reviewers found the work interesting, making a substantive and impactful contribution to the field. They have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.Summary:Insanally et al. ask how information about auditory stimuli and behavioral choices, are reflected within the spiking patterns of neurons in the auditory cortex (AC), and frontal cortical area 2 (FR2) of rat. The subjects were presented with octave spaced tones, and required to select go/no-go to the presence of a target tone. The work focuses on neurons whose firing rates (PSTH) show no change in response to the auditory stimulus, and/or no ramping activity preceding the decision. The main finding is that timing information in the ISIs of these neurons can be decoded to determine the stimulus and/or choice. The work demonstrates this using a nonparametric decoding method. Specifically, the authors develop a novel method for quantifying the difference in ISI distributions corresponding to different task-conditions. They use this method to provide a posterior probability of task-condition given the ISIs in a single trial. The median decoding performance is moderate but statistically significant, and superior to rate/PSTH-based metrics.Essential revisions:1) The paper refers to neurons with no stimulus-dependent firing rate modulation as \"nominally non-responsive\", however, these neurons clearly do respond to the stimulus (by changing their ISI distributions). Indeed, this is the basis for the decoding analysis. Consequently, it seems like the main result is that the spike timing contains information that is missed if one only looks for stimulus dependence in the firing rates. This is an important point and worth making, but is lost by labeling these neurons as non-responsive. The paper would be much clearer if the authors would be more upfront in the title, Abstract, Results, etc., about what their data show: timing information is there even when the PSTH looks uninformative.2) The neural network model in Figure 7 lacks some relevance to the data. A rate-based model is used, in which some neurons have stimulus-locked rate modulations, and some don't, and show that inactivating these \"non-responsive\" neurons changes task performance (presumably due to the effects of those inactivations on the rest of the network through the recurrent connectivity). In the experimental data, however, the authors show that, even when the neurons' rates don't have obvious stimulus dependence, the timing information still does, and any effects of inactivating subsets of neurons are left untested. To make the model relevant, it would need to use spiking neuron models, and recapitulate the basic phenomenon from the experiments: spike timing information is present even when there's no rate information. Alternatively, the authors could do inactivation experiments  to test the main prediction of the current model, which would make it relevant. This experiment would probably be hard to do, it is suggested instead that the authors revise or remove the computational model.3) Relatedly, the conjecture in the last paragraph of the subsection \u201cEnsemble consensus-building dynamics underlie hidden task information\u201d, and again somewhat in the last paragraph of the Discussion, that the NR cells are a separate functional network from the responsive ones contradicts the modeling result. If they are separate networks, silencing the NR cells wouldn't affect the responsive ones. To retain the claim about separate functional networks, it seems necessary to do optogenetics, or some other manipulation of activity, and show that changing NR cells' activity doesn't affect responsive ones. Otherwise, the authors should remove this unsupported claim.4) The decoder is quite nice, but it makes several independence assumptions that are not borne out in real neural populations. This point should be made much more upfront in the Materials and methods and the Results: stating that this decoder approximates Bayesian inference, by ignoring all forms of correlation. Doing this will ensure that readers don't mistakenly think these simple expressions are exact. Alternatively, the decoder could be updated to include the correlations discussed below.Correlations: in the subsection \u201cDecoding\u201d the first, third and sixth equations, and the equation in the subsection \u201cEnsemble decoding\u201d, assume that each ISI is independent for a given neuron, which is not generally true, due to AHP currents among other things. The paper also assumes that ISIs are independent between neurons, which is generally not true in simultaneous neural recordings, due to noise correlations, etc.5) Two other recent works, listed below, showed a stronger form of the claim advanced in the title and Abstract: that neurons with no stimulus dependence can still contribute to the neural code. There, the non-responsive neurons individually contain no stimulus information, although through correlations with other cells, they still contribute to population-wide neural coding.The current paper's results are distinct from those, since they consider timing information, whereas the other papers consider rates. However, it would be worth making that distinction somewhere in the paper.a) Leavitt et al., 2017.b) Zylberberg, 2017.6) From the Materials and methods (subsection \u201cTraining probabilistic model\u201d), it looks like the ISI distributions used for the decoder are recalculated for different time points during the integration period. This is not clear at all from the text in the Results section, but is a crucial point, as it puts severe limits on how a downstream neural circuit could read out this information: the downstream circuit would need to continually change its readout \"decoder\" somehow. The decoder and analysis still have a lot of merit. They show that the stimulus information is present in the timing, and show how it could be extracted . But the time dependence needs to be made clear in the Results section, and the biological plausibility or implausibility should be discussed.7) Please expand the Materials and methods and Results sections to clarify the following points:a) Temporal resolution. It seems like the ISI distributions are estimated in a 1s window (subsection \u201cTraining probabilistic model\u201d). Sliding by what amount? How is it decided which 1s windows each ISI contributes? Only those that contain the 2 spikes enclosing the ISI? Are predictions are evaluated at the end of each of these 1s windows ?b) Clarify where the formula for the likelihood of the full spike train  is used. From reading the manuscript, it seems that the formulas for updating the posterior only consider likelihoods for a given ISI.c) Ensemble decoding. Please be more explicit and include a mathematical formula for how the updating of the posterior is done in this case.d) Subsection \u201cEnsemble consensus-building dynamics underlie hidden task information\u201d, second paragraph. Sliding window for consensus. Is this the same 1s sliding window above? Probably not, given the time-varying nature of the curves and the fact that they start at zero. Please add explanatory text about the time windows used in the consensus section in the methods. Please also describe in more detail how the curves in Figure 8E-H were calculated?e) Furthermore, is it correct that the Poisson process estimator takes into account the full duration of the stimulus-response interval? There is some asymmetry in the information available with the ISI approach (which takes into account the 1+ seconds following stimulus onset) and the PSTH . Were there any firing rate differences over the longer interval that would predict responses?8) Please add a careful discussion of whether the animal's choice can be cleanly dissected from stimulus encoding, particularly given the very high performance of these animals on the task, the long duration between stimulus and response, and the late build-up of stimulus prediction/consensus. There is plenty of literature on the effects of attention, behavior, and working memory on cortical synchronization and timing, albeit mostly in hippocampus. It is possible that the AC responses simply reflect the choice/memory already decided. The manuscript attempts to disambiguate the choice from the stimulus with a log linear regression, but this is dependent upon prediction information from the decoder analysis that itself may already contain mixed information.9) Title: Please consider revising your title to either omit or make more intuitive what \"ensemble consensus\" means and to clarify \"nominally non-responsive\", given the concerns of some of the reviewers about this terminology. One suggested revision \"Response timing in frontal and sensory cortical neurons encodes task-relevant variables even when average responses are uninformative\". Essential revisions:1) The paper refers to neurons with no stimulus-dependent firing rate modulation as \"nominally non-responsive\", however, these neurons clearly do respond to the stimulus (by changing their ISI distributions). Indeed, this is the basis for the decoding analysis. Consequently, it seems like the main result is that the spike timing contains information that is missed if one only looks for stimulus dependence in the firing rates. This is an important point and worth making, but is lost by labeling these neurons as non-responsive. The paper would be much clearer if the authors would be more upfront in the title, Abstract, Results, etc., about what their data show: timing information is there even when the PSTH looks uninformative.To avoid possible confusion, we have taken the reviewer\u2019s suggestion and we have modified the manuscript  to better describe these neurons. We have changed all references to \u201cnominally non-responsive\u201d neurons to \u201cnon-classically responsive\u201d neurons. Our title now reads: \u201cSpike-timing-dependent ensemble encoding by non-classically responsive cortical neurons.\u201d We have also modified the text to emphasize that spike timing reveals task-related information in non-classically responsive neurons even when the PSTH does not .2) The neural network model in Figure 7 lacks some relevance to the data. A rate-based model is used, in which some neurons have stimulus-locked rate modulations, and some don't, and show that inactivating these \"non-responsive\" neurons changes task performance (presumably due to the effects of those inactivations on the rest of the network through the recurrent connectivity). In the experimental data, however, the authors show that, even when the neurons' rates don't have obvious stimulus dependence, the timing information still does, and any effects of inactivating subsets of neurons are left untested. To make the model relevant, it would need to use spiking neuron models, and recapitulate the basic phenomenon from the experiments: spike timing information is present even when there's no rate information. Alternatively, the authors could do inactivation experiments  to test the main prediction of the current model, which would make it relevant. This experiment would probably be hard to do, it is suggested instead that the authors revise or remove the computational model.We agree with the reviewer and, following their suggestion, we have removed the neural network model from this manuscript. The suggestion to make the model more relevant by using spiking neurons has inspired us to instead include it in a separate, follow-up study where we can more extensively investigate network dynamics.3) Relatedly, the conjecture in the last paragraph of the subsection \u201cEnsemble consensus-building dynamics underlie hidden task information\u201d, and again somewhat in the last paragraph of the Discussion, that the NR cells are a separate functional network from the responsive ones contradicts the modeling result. If they are separate networks, silencing the NR cells wouldn't affect the responsive ones. To retain the claim about separate functional networks, it seems necessary to do optogenetics, or some other manipulation of activity, and show that changing NR cells' activity doesn't affect responsive ones. Otherwise, the authors should remove this unsupported claim.We agree that this point requires further clarification and substantiation and have removed this claim. To clarify, we did not intend the term \u201cseparate\u201d to indicate that nominally non-responsive ensembles are independent from responsive ensembles, only that they may play a differential role during behavior .4) The decoder is quite nice, but it makes several independence assumptions that are not borne out in real neural populations. This point should be made much more upfront in the Materials and methods and the Results: stating that this decoder approximates Bayesian inference, by ignoring all forms of correlation. Doing this will ensure that readers don't mistakenly think these simple expressions are exact. Alternatively, the decoder could be updated to include the correlations discussed below.Correlations: in the subsection \u201cDecoding\u201d the first, third and sixth equations, and the equation in the subsection \u201cEnsemble decoding\u201d, assume that each ISI is independent for a given neuron, which is not generally true, due to AHP currents among other things. The paper also assumes that ISIs are independent between neurons, which is generally not true in simultaneous neural recordings, due to noise correlations, etc.We have added text to the Results section and Materials and methods (subsection \u201cTraining probabilistic model\u201d) to clarify this point. The Results section now reads, \u201cThese ISI likelihood functions consider each ISI to be independent of previous ISIs and therefore ignore correlations between ISIs\u201d. The decision to exclude correlations was made on practical grounds: we had initially attempted to include correlations between an ISI and the preceding ISI in the likelihood function, but in order to properly estimate this conditional likelihood function using non-parametric methods  would require a much larger number of trials than what our dataset allows. The same issue applies when estimating the joint probability of ISIs between neurons. In earlier implementations of our ensemble decoder, we instead tried including relative spike timing between cells  but this factor did not result in significantly better decoding performance overall.5) Two other recent works, listed below, showed a stronger form of the claim advanced in the title and Abstract: that neurons with no stimulus dependence can still contribute to the neural code. There, the non-responsive neurons individually contain no stimulus information, although through correlations with other cells, they still contribute to population-wide neural coding.The current paper's results are distinct from those, since they consider timing information, whereas the other papers consider rates. However, it would be worth making that distinction somewhere in the paper.a) Leavitt et al., 2017.b) Zylberberg, 2018.We appreciate the suggestion to put our work in context of these two studies; we now cite both of these papers. In the Discussion section, we have added text on the complementarity of their results with our own which reads, \u201cOther recent studies have also contributed to our understanding of non-classically responsive activity, by evaluating firing rates or responses from calcium imaging to demonstrate how correlations with classically responsive activity may contribute to the linear separability of ensemble responses .\u201d6) From the Materials and methods (subsection \u201cTraining probabilistic model\u201d), it looks like the ISI distributions used for the decoder are recalculated for different time points during the integration period. This is not clear at all from the text in the Results section, but is a crucial point, as it puts severe limits on how a downstream neural circuit could read out this information: the downstream circuit would need to continually change its readout \"decoder\" somehow. The decoder and analysis still have a lot of merit. They show that the stimulus information is present in the timing, and show how it could be extracted . But the time dependence needs to be made clear in the Results section, and the biological plausibility or implausibility should be discussed.We thank the reviewer for pointing this out, as this is an important detail that should be made clear. We included a moving window to take into account non-stationarity in the ISI distributions over the course of the trial and interestingly this decision did improve decoding performance in practice. The observed dynamics of the ISI distributions both in our decoding results and our consensus building results raise the question of how a downstream cell would interpret the ISIs of these cells. Assuming this downstream cell was attuned to properly interpret one set of ISI distributions, which set should it choose? Our consensus results suggest an answer: it may be that downstream cells interpret upstream activity in terms of the consensus LLRs \u2013 that way when ensemble members disagree on a representation their activity is unlikely to drive activity in the downstream cell, but when their representation is aligned with each other and the downstream cell they can reliably influence downstream activity.We hypothesize that long-term synaptic plasticity can adapt spike timings during the initial phases of behavioral training, leading to stable representations and ISI distributions across cortical networks. One of the major predictions of our algorithm is that forms of short-term synaptic plasticity  are important aspects of downstream decoding of complex spike trains. This is supported by past theoretical and experimental work . Furthermore, mechanisms of long-term synaptic plasticity such as spike-timing-dependent plasticity can redistribute synaptic efficacy, essentially changing the dynamics of short-term plasticity independent from overall changes in amplitudes . Thus we wouldn\u2019t necessarily expect that the downstream circuit needs to continually change the readout mechanism \u2013 rather, the upstream and downstream components might be modified together over the course of behavioral training, to set the ISI distributions appropriate for firing of task-relevant downstream neurons, which would ensure that ensemble consensus is reached for correct sensory processing in highly-trained animals.We have clarified the time dependence of the ISI distributions in the Results section by adding text that reads, \u201cTo accommodate any non-stationarity, these ISI distributions were calculated in 1 second long sliding windows over the course of the trial.\u201d We have also added text regarding the biological plausibility in the Discussion section. It now reads: \u201cOur whole-cell recordings from both AC and FR2 demonstrate that different postsynaptic cells can respond differently to the same input pattern with a fixed overall rate, emphasizing the importance of considering a code sensitive to precise spike-timing perhaps via mechanisms of differential short-term plasticity such as depression and facilitation\u201d, and \u201cOur consensus results reveal dynamic changes in the relationship between the LLRs of ensemble members. [\u2026] This would set the ISI distributions appropriate for firing of task-relevant downstream neurons, which would ensure that ensemble consensus is reached for correct sensory processing in highly-trained animals.\u201d7) Please expand the Materials and methods and Results sections to clarify the following points:a) Temporal resolution. It seems like the ISI distributions are estimated in a 1s window (subsection \u201cTraining probabilistic model\u201d). Sliding by what amount? How is it decided which 1s windows each ISI contributes? Only those that contain the 2 spikes enclosing the ISI? Are predictions are evaluated at the end of each of these 1s windows ?The algorithm calculated the ISI distributions in 1 second windows recalculated every 100 ms. Every time an ISI was encountered, the algorithm consulted the distribution generated in a window as close to centered around the final spike as possible and evaluated the prediction update at the time of the final spike. As mentioned above to point #6, we have clarified this point in the Results section, \u201cTo accommodate any non-stationarity, these ISI distributions were calculated in 1 second long sliding windows recalculated every 100 ms over the course of the trial.\u201d And in the Materials and methods section \u201cThese distributions were estimated in a 1 second long sliding window .\u201db) Clarify where the formula for the likelihood of the full spike train  is used. From reading the manuscript, it seems that the formulas for updating the posterior only consider likelihoods for a given ISI.Our method updates sequentially every time an ISI is encountered. The formula for the overall likelihood function was included for conceptual clarity: to calculate the final prediction for the entire trial  using the likelihood function for the entire trial is sufficient. We have added text to the Materials and methods to clarify this point: \u201cThe prediction for the entire trial was assessed at the end of the trial, using the overall likelihood function.\u201dc) Ensemble decoding. Please be more explicit and include a mathematical formula for how the updating of the posterior is done in this case.t from neuron j with a likelihood pj:We have clarified this by adding text and including a mathematical formula in the Materials and methods section, \"For example, if an ISI is observed at time This process is repeated every time a new ISI is encountered from any cell in the ensemble.\u201d.d) Subsection \u201cEnsemble consensus-building dynamics underlie hidden task information\u201d, second paragraph. Sliding window for consensus. Is this the same 1s sliding window above? Probably not, given the time-varying nature of the curves and the fact that they start at zero. Please add explanatory text about the time windows used in the consensus section in the methods. Please also describe in more detail how the curves in Figure 8E-H were calculated?scipy.interpolate.InterpolatedUnivariateSpline .\u201dYes, the intuition is correct, the sliding window used was not the same as for the above. To achieve improved temporal precision, we used a 750 ms sliding window to calculate the LLRs and the consensus values every 100 ms. The consensus values calculated were assigned to the middle of the window and the series of values were interpolated with a third-degree univariate spline for visual clarity . Figure 8E-H represent the means and standard deviations of these curves for the relevant region and ensemble type. We have clarified these points in the Materials and methods section, \u201cTo generate the consensus curves in Figure 8,LLRs are calculated using a 750 ms sliding window recalculated every 100 ms. [\u2026] For visual clarity, these values were interpolated by a third-degree univariate spline calculated using the python package e) Furthermore, is it correct that the Poisson process estimator takes into account the full duration of the stimulus-response interval? There is some asymmetry in the information available with the ISI approach (which takes into account the 1+ seconds following stimulus onset) and the PSTH . Were there any firing rate differences over the longer interval that would predict responses?Yes, both the Poisson process estimator and the ISI-based decoder took into account the full trial activity . We clarified this in the Materials and methods: \u201cJust as with this ISI-based decoder, we decoded activity from the entire trial.\u201d8) Please add a careful discussion of whether the animal's choice can be cleanly dissected from stimulus encoding, particularly given the very high performance of these animals on the task, the long duration between stimulus and response, and the late build-up of stimulus prediction/consensus. There is plenty of literature on the effects of attention, behavior, and working memory on cortical synchronization and timing, albeit mostly in hippocampus. It is possible that the AC responses simply reflect the choice/memory already decided. The manuscript attempts to disambiguate the choice from the stimulus with a log linear regression, but this is dependent upon prediction information from the decoder analysis that itself may already contain mixed information.assumption of this approach was that the decoding results may contain mixed information, and the objective was to evaluate the extent to which a decoder\u2019s predictions  were correlated with not only the relevant behavioral variable  but also the other variable . While the results from this analysis demonstrated that the decoder\u2019s output correlated with both variables, it was more strongly predicted by the relevant variable for multiplexed cells. The question of whether the choice information we observe is actively processed in auditory cortex or is a reflection of activity from another region is an interesting open question that goes beyond the scope of this study. We now say in the results: \u201cGiven the strong correlation between stimulus and choice variables in the task design, it is difficult to fully separate information about one variable from information about the other. [\u2026] This analysis establishes that a certain degree of separability is possible and demonstrates that the multiplexing observed in our decoding results is unlikely to be a trivial byproduct of correlations in the task variables.\u201dWe thank the reviewer for the opportunity to address this point. For the reasons the reviewer mentions, a clean dissection of stimulus and choice variables is a challenging endeavor. This is less of a concern for uniplexed neurons which only contain information about one of the two variables, which is why our multiple regression analysis focused on establishing that the multiplexed neurons were not simply a trivial byproduct of correlations between the behavioral variables. The 9) Title: Please consider revising your title to either omit or make more intuitive what \"ensemble consensus\" means and to clarify \"nominally non-responsive\", given the concerns of some of the reviewers about this terminology. One suggested revision \"Response timing in frontal and sensory cortical neurons encodes task-relevant variables even when average responses are uninformative\".We have revised our title according to the reviewer\u2019s suggestion. It now reads: \u201cSpike-timing-dependent ensemble encoding by non-classically responsive cortical neurons.\u201dReferences:Abbott LF1, Varela JA, Sen K, Nelson SB. Synaptic depression and cortical gain control. Science. 1997 Jan 10;275(5297):220-4. DOI: 10.1126/science.275.5297.221"}
{"text": "Vascular inflammation and endothelial dysfunction are thought to contribute to arterial stiffening and hypertension. This study aims to test this hypothesis with longitudinal data in the context of type 1 diabetes.1c, serum creatinine, total cholesterol, urinary AER, insulin treatment dose and mean arterial pressure.We investigated, in an inception cohort of 277 individuals with type 1 diabetes, the course, tracking and temporal inter-relationships of BP, specifically pulse pressure  and hypertension, and the following biomarkers of systemic and vascular inflammation/endothelial dysfunction: C-reactive protein (CRP), soluble intracellular adhesion molecule-1 (sICAM-1), soluble vascular cellular adhesion molecule-1 (sVCAM-1) and soluble E-selectin (sE-selectin). These biomarkers and other risk factors were measured at baseline and repeatedly up to 20\u00a0years after the onset of type 1 diabetes. Data were analysed with generalised estimating equations including adjustments for age, sex, smoking status, BMI, HbAIncreases were noted in all biomarkers except sE-selectin, which decreased over time. Levels differed from baseline at 2\u20134\u00a0years and preceded the increase in pulse pressure, which occurred at 8\u201310\u00a0years after the onset of type 1 diabetes. Higher levels of sICAM-1 and sVCAM-1, but not CRP or sE-selectin, at baseline and throughout the 20\u00a0year follow-up, were significantly associated with higher (changes in) pulse pressure at subsequent time points. Higher levels of sVCAM-1 at baseline and during follow-up were also significantly associated with the prevalence  and incidence  of hypertension. We also investigated the longitudinal associations between BP or hypertension as determinants of subsequent (changes in) levels of CRP, sICAM-1, sVCAM-1 and sE-selectin, but did not find evidence to support a reverse causality hypothesis.These findings support the involvement of vascular endothelial dysfunction and inflammation in the development of premature arterial stiffening and hypertension in type 1 diabetes.The online version of this article (10.1007/s00125-017-4470-5) contains peer-reviewed but unedited supplementary material, which is available to authorised users. Individuals with type 1 diabetes are characterised by accelerated arterial ageing , a mechaThe pathobiological mechanisms underlying the increases in pulse pressure in individuals with diabetes are, however, not clear. Diabetes is characterised by systemic and vascular inflammation and endothelial dysfunction \u20139, mechaWe have therefore investigated the longitudinal course of BP and markers of systemic and vascular inflammation and endothelial dysfunction  and their temporal inter-relationships, in a cohort of individuals with type 1 diabetes who were followed over 20\u00a0years, since the onset of disease.n\u00a0=\u00a0286), which has been described in detail previously ); whenever more than one reading was available, median values were calculated when aggregating the data.All clinical data obtained from 6\u00a0months after the onset of diabetes  up to 21.5\u00a0years thereafter (the maximum follow-up duration) were aggregated within 2\u00a0year time intervals. The number of readings available on the participants\u2019 records varied per variable within each 2\u00a0year time interval  were imputed conditional on all information available at the same and immediately adjacent t. We used a window of t\u00a0\u00b1\u00a04\u00a0years and specified study entry and exit times for each participant so that imputations were not done outside these , which would assume an immortal cohort. Instead, in our study the target of inference was the mortal cohort (where only the surviving participants were included at each wave), hence the method chosen to impute the missing data ) was regressed on the entire subsequent levels of the same variable during follow-up  and 1 (perfect correlation).To analyse tracking of biomarkers and BP over the 20\u00a0year period, we used a model in which the initial value of each of these variables . Finally, we investigated the extent to which inter-individual differences in main determinants at t predicted subsequent intra-individual changes in outcomes (i.e. between t\u00a0+\u00a02 and t\u00a0+\u00a04) using a time-lagged (changes) GEE model  and BP (main outcomes), all modelling the levels of main determinants at time intervals prior to those of the outcomes, to minimise the possibility of overlap of the determinants and outcomes assessment times and enable inferences of causality. First, we examined the extent to which individual differences in biomarkers at baseline predicted individual differences in BP and the prevalence and incidence of hypertension over the entire follow-up period . In analyses with pulse pressure as main outcome, we additionally adjusted for MAP to ascertain if any observed associations could be attributed to arterial stiffness independently of peripheral resistance [e transformed because of their right-skewed distribution. In analyses with these variables as main determinants of BP, longitudinal linear regression coefficients or ORs are therefore expressed as differences in BP (in mmHg) or odds of hypertension per doubling of each biomarker. In analyses of BP variables as main determinants of biomarkers , longitudinal linear regression coefficients are expressed as per cent difference in biomarker per 10\u00a0mmHg increase in BP variable.All analytical models were first adjusted for time, and age at onset of diabetes, sex and smoking history (as time-independent covariates) and, second, for HbAsistance . BiomarkCharacteristics of the study participants at baseline are shown in Table p\u00a0<\u00a00.001). The estimated prevalence of hypertension over the 20\u00a0year follow-up is shown in Fig. BP increased significantly over the 20\u00a0year longitudinal period Fig. a. When ap\u00a0<\u00a00.05).Markers of low-grade inflammation and endothelial dysfunction also changed significantly over time Fig. a\u2013d. WhenThe increases in levels of biomarkers (except sE-selectin) were observed early; levels already differed from baseline at 2\u20134\u00a0years after onset of disease and preceded the increases in BP, which differed significantly from baseline at 8\u201310\u00a0years after the onset of type 1 diabetes  and 0.36 (SBP and MAP)  and for the baseline levels of the other risk factors (model 2), higher levels of sICAM-1 and sVCAM-1, but not of CRP or sE-selectin, at baseline were significantly associated with higher pulse pressure during the 20\u00a0years of follow-up  but also the main exposures (biomarkers), and after adjustments for age, sex and smoking status (model 1), CRP, sICAM-1 and sVCAM-1 were all significantly associated with higher subsequent pulse pressure: 0.75\u00a0mmHg , 3.93\u00a0mmHg  and 5.13\u00a0mmHg  per doubling in each biomarker, respectively , higher levels of sICAM-1 and sVCAM-1, but not of CRP or sE-selectin, also predicted subsequent changes in pulse pressure: 2.47\u00a0mmHg  and 2.54\u00a0mmHg  per doubling in sICAM-1 and sVCAM-1, respectively  levels of CRP, sICAM-1, sVCAM-1 and sE-selectin, but did not find evidence to support a reverse causality hypothesis (ESM Table 2) observed in the course of follow-up  was the single common determinant of subsequent pulse pressure , prevalence of hypertension , incidence of hypertension  and subsequent levels of CRP .Given that CRP and BP were associated with each other but seemingly not in a causal fashion, we examined an alternative hypothesis: that both CRP and BP were, instead, determined by (a) common factor(s). After adjustments for the time-independent and time-dependent covariates, we found that (changes in) BMI albuminuria status or time revealed no consistent effect modification by any of these factors.We examined the longitudinal course of BP and biomarkers of endothelial dysfunction and inflammation, and their inter-relationships, in a cohort of individuals with type 1 diabetes who had been followed for 20\u00a0years since the onset of disease. Our main findings were as follows: (1) increases in levels of CRP, sICAM-1 and sVCAM-1 occurred early in the course of disease and preceded the increases in BP; (2) all variables tracked considerably over time, particularly sICAM-1, sVCAM-1 and sE-selectin; (3) higher sICAM-1 and sVCAM-1, at baseline and during follow-up, predicted the subsequent (changes in) levels of pulse pressure; higher levels of sVCAM-1, at baseline and during follow-up, predicted the prevalence and incidence of hypertension; (4) notably, these associations were independent of age, sex, smoking history and other relevant risk factors and (5) we found no evidence for a reverse causation hypothesis (i.e. that higher levels of BP or hypertension determined subsequent increases in these biomarkers). The unique characteristics of this study were the repeated assessment of biomarkers, BP and important covariates over the natural course of disease during a period of 20\u00a0years. This allowed us to examine, for the first time with a truly longitudinal design, the temporal relationships between biomarkers and BP  in individuals with type 1 diabetes. As such, the present study provides the strongest evidence regarding the involvement (or lack thereof) of CRP, sICAM-1, sVCAM-1 and sE-selectin in the pathogenesis of elevated pulse pressure and of hypertension, over the course of disease in individuals with type 1 diabetes.Tracking of BP and CRP levels over the 20\u00a0year follow-up period was moderate but was very high for sICAM-1, sVCAM-1 and sE-selectin. Interpretation of the tracking coefficients reported here requires consideration of a number of factors . First, Epidemiological evidence to support the concept of arterial stiffness/widened pulse pressure and hypertension as a consequence of vascular/systemic inflammation has been controversial , 26\u201329. Our findings suggest that, in contrast to CRP (and sE-selectin), both CAMs may causally underlie arterial stiffening. This contention holds inasmuch as arterial stiffness can be depicted by pulse pressure and may be too strong given that stroke volume (not measured) is also likely to explain a part of the variance in pulse pressure, particularly among young individuals. Our findings also suggest that sVCAM-1 seems to causally underlie the development of hypertension. This observation is in striking agreement with the only prospective study thus far that has examined CAMs and pro-inflammatory cytokines as predictors of incident hypertension among individuals with type 1 diabetes . Indeed,We used brachial, not central, pulse pressure as a crude estimate of arterial stiffness, reflecting the data that was accessible from clinical records. The technology enabling non-invasive measurement of central pulse pressure and aortic pulse wave velocity, that would allow better characterisation of the aetiology of arterial stiffening, was not available during the 20\u00a0year period covered by the present study. Nevertheless, brachial pulse pressure still provides valuable risk prediction information: in a meta-analysis , central pulse pressure tended to be more strongly associated with incident CVD and mortality than brachial pulse pressure but the added value of central pulse pressure in risk prediction was only marginal ; a similThere are some additional limitations to our study. Findings were confined to individuals with type 1 diabetes and therefore may not generalise to the background population. Measurement errors around BP measurements are likely to have led to an underestimation of the associations estimates reported in the present manuscript. We only measured CRP, sICAM-1, sVCAM-1 and sE-selectin, which reflect just a part of the complex and multifaceted process of arterial remodelling induced by endothelial dysfunction and inflammation . Still, In conclusion, in individuals with type 1 diabetes, increases in sICAM-1 and sVCAM-1 precede, and are associated with, subsequent increases in pulse pressure and hypertension throughout the course of the disease, supporting the involvement of endothelial dysfunction/inflammation in the development of premature arterial stiffening. The lack of support for a causal link between CRP and BP, and the observation that both derive from a common antecedent (BMI), suggests that weight gain should be monitored during treatment of individuals with type 1 diabetes. Targeting endothelial dysfunction/inflammation in the early stages of diabetes may slow down the accelerated arterial ageing characteristic of this disease and prevent related cardiovascular sequelae. Given that both CAMs tracked very highly, measuring their levels and changes soon after the onset of type 1 diabetes may enable identification of individuals at a high risk and who may need intensified/tailored treatment.ESM(PDF 209\u00a0kb)"}
{"text": "Dpt) that combined the podophyllotoxin (Ptox) structural unit (etoposide) with the dithiocarbamate unit (iron chelator) through the hybridization strategy. The resulting PtoxDpt inherited characteristics from parent structural units, acting as both the p53 inducer and topoisomerase II inhibitor. In addition, the PtoxDpt exhibited significant inhibition in migration and invasion, which correlated with downregulation of matrix metalloproteinase (MMP). More importantly, PtoxDpt could inhibit EMT in the absence or presence of TGF-\u03b21, concomitant to the ROS production, and the additional evidence revealed that PtoxDpt downregulated AKT/mTOR through upregulation of p53, indicating that PtoxDpt induced EMT inhibition through the p53/PI3K/AKT/mTOR pathway.Epithelial-mesenchymal transition (EMT) involves metastasis and drug resistance; thus, a new EMT reversing agent is required. It has shown that wild-type p53 can reverse EMT back to epithelial characteristics, and iron chelator acting as a p53 inducer has been demonstrated. Moreover, recent study revealed that etoposide could also inhibit EMT. Therefore, combination of etoposide with iron chelator might achieve better inhibition of EMT. To this end, we prepared di-2-pyridineketone hydrazone dithiocarbamate S-propionate podophyllotoxin ester (Ptox Metastasis is a hallmark of cancer and one of the urgent tasks to be solved in a clinical practice. During metastasis, the malignant cells spread from the primary tumor to distant sites, which cause failure of vital organs, consequently leading to the death of patients. In addition, concomitant to the metastasis, the cells acquire an ability to resist conventional treatments . Therefop53 is well characterized as a tumor suppressor gene ; the wilDpt), exhibited significant Topo II inhibition and acted as a p53 inducer. A growth inhibition assay against hepatocellular carcinoma cells in vitro revealed that PtoxDpt displayed a better antiproliferative effect than the parent compounds, 4\u2032-demethylepipodophyllotoxin and etoposide. Moreover, PtoxDpt exhibited a significant antimetastatic effect, which likely correlated with matrix metalloproteinase (MMP) inhibition and concomitant to the mTOR downregulation. As expected, PtoxDpt could also reverse TGF-\u03b21-induced EMT in hepatocellular carcinoma cells. In addition, ROS are involved in the EMT process [\u03b21 or combination with PtoxDpt, revealing that both EMT and EMT reversion involved ROS production. Further study demonstrated that PtoxDpt-induced EMT reversal was through p53-mediated PI3K/AKT/mTOR pathways; this feature is first reported for an etoposide derivative.Since EMT is associated with metastasis and drug resistance , EMT inh process , but theDpt was prepared through a four-step reaction  was obtained from the RCSB Protein Data Bank. To ensure the accuracy of our docking protocol, etoposide was redocked into the Topo-DNA complex based on the recommended procedure. The conformation of etoposide in the Topo-DNA complex derived from molecular docking could be almost fully superimposed on the native cocrystallized structure, indicating that the protocol was appropriate. As shown in Fig. Dpt was docked into the Topo II complex following similar protocol . However, a slight differential effect on the cell lines was observed; similar growth inhibition was achieved at a lower concentration (IC50 \u2264 3\u03bcM) for Bel-7402 and HepG2 cells  and ~84% inhibition at 1.50 \u03bcM PtoxDpt treatment were observed based on quantitative analysis ; a quantitative analysis is presented in Dpt on the migration of HCCLM3 cells was determined. As shown in Figures Dpt in a dose-dependent manner. Furthermore, matrix metalloproteinases (MMPs) as key players are involved in tumor invasion and metastasis [Dpt-induced migration and invasion inhibition might correlate with MMP inhibition; thus, the Western blotting and gelatin zymography analyses were further conducted. As shown in Dpt treatment significantly reduced both MMP-2 and MMP-9 expression  and mesenchymal cells (vimentin) were investigated. The immunofluorescence technique is widely used to visualize the alteration in membrane proteins; thus, the vimentin (in red) and E-cadherin (in green) were labeled individually  or combination of TGF-\u03b21 and PtoxDpt  with PtoxDpt, implying that PtoxDpt owned a powerful ability in EMT inhibition.TGF-ell line . To veriablished . Next, tal state , support Figures  and acco Figures  compared PtoxDpt . There w6 folds, ; those igulation , which aDpt-induced migration and invasion inhibition might involve mTOR inhibition or stem from the alteration of the PI3K/AKT/mTOR pathway [Dpt treatment, hinting that downregulation of p-AKT may stem from the downregulated AKT. A similar trend for mTOR, a downstream target of AKT, was also observed, indicating that the metastasis and invasion inhibition correlated with downregulation of mTOR that led to lower abundances of mTORC1 and mTORC2 complexes. The quantitative analysis of the proteins is shown in Dpt-induced downregulation of both AKT and mTOR had significant statistical significance (p < 0.05 or 0.01). On the other hand, in addition to migration and invasion inhibition, PtoxDpt also inhibited EMT, whether the PI3K/AKT/mTOR pathway was similarly involved in the EMT inhibition. To this end, the level of markers of the epithelium and mesenchymal cells, as well as AKT/mTOR, in the absence or presence of AKT inhibitor, LY294002, was further determined by Western blotting. As shown in Dpt and LY294002 downregulated vimentin (snail and slug) and contrarily upregulated E-cadherin, indicating that they acted in a similar way in EMT inhibition. Moreover, PtoxDpt also downregulated AKT and mTOR as LY294002 did  involves the metastatic process of cancer; targeting EMT is one of the options in cancer therapy; thus, the novel EMT reversal agents are required. It has been demonstrated that the alterations in abundance of epithelial-mesenchymal proteins, such as E-cadherin, N-cadherin, and vimentin determine EMT status. On the other hand, to keep cancer cells thriving, higher abundances of DNA topoisomerases (Topo) and iron are needed; thus, either downregulation (or inhibition) of topoisomerase or depletion of iron can slow down the proliferation of cancer cells. Recent studies demonstrated that some Topo II inhibitors, including etoposide, could inhibit EMT and attenuate metastasis , 25, whitoposide . A theorlex Fig. , supporthibition  and migrhibition , in accoDpt induced a downregulation of MMPs, it might inhibit EMT. To test the hypothesis, the alterations in epithelial-mesenchymal markers both in immunofluorescence and in the protein level were investigated. Immunofluorescence analyses in Dpt inhibited EMT through upregulation of E-cadherin and downregulation of vimentin; additional evidence from Western blotting  is associated with increase of matrix metalloproteases (MMPs) ; downregblotting  supporteoduction ; a similoduction , 47; how Figures ; the res Figures , B4. To ures Dpt , B4, ind\u03b21, almost no change for ROS after 24 h . Fetal bovine serum was purchased from Every Green Zhejiang Tianhang Technology Co. Ltd. . Antibodies of vimentin, slug, snail, and p53 were purchased from Boster . Antibodies of AKT, p-AKT, mTOR, p-mTOR, E-cadherin, and Gapdh were purchased from EnoGene . 4\u2032-Demethylpodophyllotoxin was purchased from Shanghai PureOne Biotechnology .MTT, PFT-Dpt was prepared by using a four-step reaction: preparation of 2,2\u2032-dipyridineketone hydrazone dithiocarbamate S-propionic acid : 14.98, 8.87, 8.63, 8.01, 7.54 , 7.00, 6.95, 6.76, 6.56, 6.33, 6.01, 5.64,4.75, 4.52, 4.36, 4.16, 3.69, 2.93. 13CNMR:199.77, 179.25, 175.24, 169.82, 155.02, 151.93, 149.24, 148.94, 147.66, 146.79, 146.73, 145.23,140.66, 138.35, 137.91, 133.26, 130.81, 128.12, 126.94, 125.85, 124.97, 124.02, 109.49, 106.48, 104.92, 101.32, 68.00, 65.95, 65.39, 60.23, 56.47, 56.26, 45.46, 43.15, 33.20, 28.97. ESI-MS (C36H32N4O9S2K): m/z: 767.1268 .The PtoxDpt on DNA Topo II activity was conducted based on the protocol described previously [\u03bcg) was added to the Topo reaction buffer (10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 1 mM ATP, 150 mM NaCl, 0.1% BSA, and 5% glycerol) that contained 0.4 \u03bcg supercoiled pUC18 plasmid DNA and 1-3 \u03bcL of PtoxDpt (1 mM in 8% DMSO) in a final volume of 20 \u03bcL. Following an additional incubation at 37\u00b0C for 30 min., 5 \u03bcL of stopping buffer  was added to terminate the reaction. The resulting products were separated by electrophoresis using a 1% agarose gel in a TBE buffer  containing 0.1% SDS and ethidium bromide (0.5 \u03bcg/mL) at 45 V for 3 h. The bands were visualized on a Tocan 360 gel scanner (excited at ~340 nm) . The assay was performed in duplicate.The assay of inhibition of Ptoxeviously . To initDpt and Topo II, the PDB file of the structure of human type II Topo (3QX3) was downloaded from the RCSB Protein Data Bank. The structure of PtoxDpt was generated by ChemDraw. Then, the 3QX3 and PtoxDpt in PDB were transformed in PDBQT format by the AutoDock Tool using the default parameters. PyMOL and LigPlot were used to display the conformation and interactions [To simulate the potent interaction between Ptoxractions , 52.Dpt was set to 22, 24, and 28 for the x-, y-, and z-axes, respectively.Molecular docking studies were performed by using AutoDock Vina . To opti3/mL) were seeded into a 96-well plate, and the varied concentrations of PtoxDpt were added to the wells after the cells were adhered. Following 48 h incubation at 37\u00b0C in a humidified atmosphere of 5% CO2, 10 \u03bcL of MTT solution (5 mg/mL) was added into each well, and a further incubation was conducted. Finally, 100 \u03bcL DMSO was added to each well to dissolve the formazan crystals after removing the cell culture. The measurement of the solution absorbance was performed on a microplate reader  at 570 nm. The percent absorbance inhibition that correlates with percent growth inhibition was obtained. The same assay was performed in triplicate.The proliferative inhibition of the agent was determined by the MTT method as described previously . BrieflyDpt at dose of 1/40 or 1/20 IC50 was added. Fourteen days later, colonies were fixed in 3.7% paraformaldehyde, stained with 0.1% crystal violet. Colonies containing 50 cells at least were counted under an inverse microscope , and the clone numbers were analyzed subsequently.The HepG2 cells in the exponential phase were trypsinized and seeded in 6-well plates at the density of 500 cells/well. PtoxDpt was determined using a wound-healing migration assay [Dpt was then added. The cells were photographed (time 0). After 24 h incubation at 37\u00b0C, the cells were photographed again (24 h).The inhibition of tumor cell migration by Ptoxon assay . Briefly\u03bcm pore membranes coated with Matrigel were used to perform the invasion assay. Briefly, after overnight pretreatment with PtoxDpt in a 6-well plate, the HCCLM3 cells were starved for 12 h in serum-free medium. Following this, the cells were collected and resuspended as a single cell suspension. In total, 3 \u00d7 104 cells in 100 \u03bcL of serum-free medium were added to the upper chamber, and 600 \u03bcL of complete medium was added to the lower chamber. Following incubation for 18 h at 37\u00b0C, the invading cells were fixed in 4% paraformaldehyde, stained with 0.1% crystal violet, and photographed under a microscope . The percentage of inhibition was expressed using control wells as 100% , followed by a 24 h incubation with developing buffer . The gel was then stained with 0.25% Coomassie blue R-250 for 1 hour and destained with 10% methanol with 5% acetic acid. Clear bands against a dark blue background indicated where the protease had digested the gelatin and were taken to be indicative of protease activity.Gelatin zymography was performed as previously described . ConditiDpt treatment for additional 24 h, cells were first fixed with 4% paraformaldehyde in PBS for 15 min at 37\u00b0C and then permeabilized with 0.5 % Triton X-100 in PBS for 20 min. After blocking with 3% BSA in PBS for 60 min, the cells were incubated with combined vimentin with E-cadherin (EnoGene) primary antibody based on protocol recommended by the company; at 4\u00b0C, the plate was shaken overnight. Next, removing the primary antibodies and washing with PBS, the cells were further incubated with fluorescence-labeled secondary antibody for 3 h at room temperature. After removing the secondary antibody, the cells were further counterstained with DAPI. Finally, a confocal laser scanning microscope  was used to visualize the cells; the representative cells were selected and photographed.HepG2 cells were first cultured in a 24-well plate with cover glass overnight. Following PtoxDpt or other agent for 24 h. Next, the cells were treated by trypsin digestion and collected. Following washing, the cells were stained with H2DCF-DA . The intracellular ROS assay was conducted on a flow cytometry .HepG2 cells were placed in a six-well plate, once the cells were adhered and subjected to treatment with PtoxDpt were scraped in lysis buffer (RIPA lysis buffer), and the cell suspension in the EP tube was incubated on ice for 30 min and mixed by turning upside down occasionally, followed by centrifugation at 14,000 \u00d7g. The clear supernatant was stored at -80\u00b0C. Protein concentration was determined using a colorimetric BCA assay. Proteins (20 \u03bcg) were loaded on a 13% sodium dodecyl sulfate-polyacrylamide gel at 120 V (20 mA) for 2 h. The separated proteins were subsequently transferred onto a PVDF membrane at 120 V (200 mA) for 90 min. The membrane was washed with Tris-buffered saline (TBS) and then blocked for 2 h in TBS containing 0.1% Tween-20 and 5% nonfat skimmed milk. The membrane was incubated at 4\u00b0C overnight with the appropriate primary antibody used at a dilution recommended by the company. The membrane was then washed several times with TBST and subsequently incubated with the appropriate HRP-conjugated secondary antibody for 2 h at room temperature. Finally, the protein bands were detected using a super sensitive ECL solution  and visualized on a Syngene G:BOX imager . Quantification of protein band intensities was performed using ImageJ software.The protein extracts were prepared based on the company recommended protocol (Solarbio). Briefly, the HepG2 cells treated with or without Ptoxt-test. Comparisons between multiple groups were performed by one-way ANOVA with Dunnett post hoc correction. All statistical tests were conducted by using IBM SPSS Statistics (version 19 software). p < 0.05 was accepted as significant.Results are presented as the mean \u00b1 SEM. Comparisons between two groups were carried out using two-tailed Student's"}
{"text": "Moreover, the ROS production correlated with ferritin degradation. The upregulation of LC3-II and NCOA4 from immunofluorescence and Western blotting analysis revealed that the occurrence of ferritinophagy contributed to ROS production. Furthermore, DpdtpA could induce an alteration both in morphology and in epithelial-mesenchymal markers, displaying significant EMT inhibition. The correlation analysis revealed that DpdtpA-induced ferritinophagy contributed to the EMT inhibition, implying that NCOA4 involved EMT process, which was firstly reported. To reinforce this concept, the ferritinophagic flux (NCOA4/ferritin) in either treated by TGF-\u03b21 or combined with DpdtpA was determined. The results indicated that activating ferritinophagic flux would enhance ROS production which accordingly suppressed EMT or implementing the EMT suppression seemed to be through \u201cfighting fire with fire\u201d strategy. Taken together, our data demonstrated that ferritinophagic flux was a dominating driving force in EMT proceeding, and the new finding definitely will enrich our knowledge of ferritinophagy in EMT process.Epithelial-mesenchymal transition (EMT) contributes to metastasis and drug resistance; inhibition of EMT may attenuate metastasis and drug resistance. It has been demonstrated that ferritinophagy involves the process of many diseases; however, the relationship between EMT and ferritinophagy was not fully established. Some iron chelators show the ability to inhibit EMT, but whether ferritinophagy plays a role in EMT is largely unknown. To this end, we investigated the effect of a novel iron chelator, DpdtpA , on EMT in the CT26 cell line. The DpdtpA displayed excellent antitumor (IC Epithelial-to-mesenchymal transition (EMT) is a cellular process allowing epithelial cells to undergo several biochemical alterations that permit a polarized epithelium switches to a highly invasive mesenchymal phenotype , accordiEMT is considered as a driving force in tumor progression, while compelling evidence reveals reactive oxygen species (ROS) as crucial conspirators in EMT engagement . ROS areSince redox regulates epithelial-mesenchymal transition of tumor cell, scavenging ROS favors restoration of MET , which may efficiently slow dissemination of tumor cells , 19. A lLabile iron pool (LIP) is regulated by ferritin, a highly conserved iron storage protein which is composed of two subunits, H-ferritin and L-ferritin, and the twelve pairs of subunits binding head to foot form the 24 subunit ferritin cages . When th50: 1.5 \u00b1 0.2\u2009\u03bcM). Next, the cellular ROS level was measured by flow cytometry as described previously [2,2 \u2032-Di-pyridineketone hydrazone dithiocarbamate propionic acid DpdtpA,  displayeeviously . As showp < 0.05 or 0.01); however, the apoptosis induction could be attenuated by addition of NAC  staining, which measures externalization of phosphatidylserine on the cell surface of apoptotic cells specifically. n of NAC , A4, indAs described above, DpdtpA-induced growth inhibition involved ROS production; thus, the potential sites of ROS production were further explored. As well documented, ferritin degradation triggers Fenton reaction that is an important contributor in ROS production; therefore, the level of ferritin was determined; Next, we determined the site of ferritin degradation; it may occur in proteasomes. To this end, the levels of ferritin either in the condition of DpdtpA treatment alone or its combination with a proteasomes inhibitor, MG132, were determined. Beyond our expectation, the addition of MG132 did not attenuate the ferritin downregulation induced by DpdtpA , indicatDpdtpA displayed significant growth inhibition for CT26 cells; the effect of it on cellular morphology was further determined. As shown in Figures \u03b21 is the most powerful EMT inducer; thus, the CT26 cells were pretreated with TGF-\u03b21 for 48 h, which resulted in obviously morphological alteration. As shown in \u03b21. Immunofluorescence analysis revealed that TGF-\u03b21 markedly reduced the level of E-cadherin in the CT26 cells  through lowering ferritinophagic flux, contrarily DpdtpA inhibited EMT  through elevating ferritinophagic flux . Currently, NCOA4 function differently depends on the cancer context, while robust evidence for the role of ferritinophagy in tumorigenesis is lacking [It was interesting that the EMT inhibition was accompanied by upregulation of LC3 and NCOA4 and downregulation of ferritin , which h lacking ; here, w\u03b21 or combined with DpdtpA was investigated. TGF-\u03b21 indeed induced rising of ROS in the CT26 cells, in accordance with reported previously [\u03b21, seeming to support that DpdtpA induced EMT inhibition through a \u201cfighting fire with fire\u201d strategy , indicating that NCOA4 played an important role in EMT process. In addition, DpdtpA induced EMT inhibition through producing massive ROS that were due to occurrence of ferritinophagy. However, the effect of ferritinophagic flux on EMT in different cell lines 2DCF-DA), desferoxamine (DFO), 4 \u2032,6-diamidino-2-phenylindole (DAPI), Roswell Park Memorial Institute (RPMI) 1640, and other chemicals were purchased from Sigma-Aldrich. Antibodies of vimentin , LC3 (14600-1-AP), NCOA4 (E11-17114C), N-cadherin (22018-1-AP), and Gadph (E12-052) for Western blotting were obtained from Proteintech Group Inc. . Antibodies of E-cadherin (3195), ferritin , secondary antibodies , and cathepsin D were purchased from Cell Signaling Technology (USA). Ferritin antibody (SC-376594) for immunofluorescence was obtained from Santa Cruz Biotechnology . NCOA4 antibody (HPA0512) for immunofluorescence was purchased from Atlas Antibody (Sweden). Secondary antibodies for Western blotting were obtained from EarthOx, LLC .All chemicals used were analytical reagents (AR) grade. 3--2,5-diphenyltetrazolium bromide (MTT), monodansylcadaverine (MDC), 3-methyladenine (3-MA), chloroquine, dichlorofluorescein  was added and further incubated for 4 h; next, 100 \u03bcl DMSO was added in each well to dissolve the formazan crystals after removing cell culture. The measurement of absorbance of the solution was performed on a microplate reader  at 570 nm. Percent growth inhibition was defined as percent absorbance inhibition within appropriate absorbance in each cell line. The same assay was performed in triplet.The stock solution of DpdtpA (10 mM) was prepared in 70% DMSO and diluted to the required concentration with 70% DMSO. The CT26 cells were cultured in RPMI 1640 medium supplemented with 10% fetal calf serum (FCS) and antibiotics. The cells in the exponential phase were collected and seeded equivalently into a 96-well plate; next, the varied DpdtpA (or in the presence of NAC) was added after the cells adhered. Following 48 h incubation at 37\u00b0C in a humidified atmosphere of 5% CO\u03bcM DpdtpA) for 24 h. Then, the cell culture was removed, following PBS washing, trypsin digestion; finally, the annexin V and propidium iodide  were added as recommended by the company. The stained cells were subjected to flow cytometer analysis . Similar to apoptosis assay, the CT26 cells were resuspended in H2DCF-DA containing serum-free culture medium and incubated for 30 min. Next, after removing the H2DCF-DA contained medium by centrifugation, washing with PBS, finally resuspended the cells in PBS. The intracellular ROS assay was performed on a flow cytometer .Cells were seeded into a 6-well plate and treated as described in the section of cytotoxicity assay. The cells were treated with different concentrations of the agent , or combined with LC3 (or NCOA4 (Atlas Antibodies)), or vimentin combined with E-cadherin  primary antibody based on the protocol recommended by the company; at 4\u00b0C, the plate was shaken overnight. Next, removing the primary antibodies and washing with PBS, the cells were further incubated with fluorescence-labeled secondary antibody for 3 h at room temperature. After removing the secondary antibody, the cells were further counterstained with DAPI. Finally, a confocal laser scanning microscope  was used to visualize the cells; the representative cells were selected and photographed.The alteration of LMP was assayed as previously described . For det7 CT26 cells that treated with or without DpdtpA were scraped in lysis buffer  on ice for 30 min., followed by centrifugation at 14,000 \u00d7 g. The clear supernatant was stored at -80\u00b0C. Protein concentration was determined using a colorimetric Bio-Rad DC protein assay using the MK3 microplate reader at 570 nm. Proteins (30 \u03bcg) were separated on a 13~15% sodium dodecyl sulfate-polyacrylamide gel at 200 V for 3 h. The separated proteins were subsequently transferred onto a PVDF membrane at 60 V for 2 h. The membrane was washed with Tris-buffered saline (TBS) and then blocked for 2 h in TBS containing 0.1% Tween-20 and 5% nonfat skimmed milk. The membrane was incubated at 4\u00b0C overnight with the appropriate primary antibody. The membrane was then washed several times with TBST and subsequently incubated with the appropriate HRP-conjugated secondary antibody  for 1 h at room temperature. Following washing with TBST, the protein bands were detected using a super sensitive ECL solution  and visualized using a Syngene G:BOX imager . Quantifications of protein band intensities and fluorescence intensity were performed using ImageJ software.The protocol for Western blotting was followed as described previously ; brieflyt-test. Results are presented as the mean \u00b1 SEM. A p value < 0.05 was considered statistically significant.Data were analyzed with Prism 5.0 . Comparisons were made using a one-way analysis of variance or a two-tailed"}
{"text": "Background:Clostridium difficile infection (CDI) is prevalent in healthcare settings. The emergence of hypervirulent and antibiotic resistant strains has led to an increase in CDI incidence and frequent outbreaks. While the main virulence factors are the TcdA and TcdB toxins, antibiotic resistance is thought to play a key role in the infection by and dissemination of C. difficile.Methods: A CDI outbreak involving 12 patients was detected in a tertiary care hospital, in Lisbon, which extended from January to July, with a peak in February, in 2016. The C. difficile isolates, obtained from anaerobic culture of stool samples, were subjected to antimicrobial susceptibility testing with Etest\u00aestrips against 11 antibiotics, determination of toxin genes profile, PCR-ribotyping, multilocus variable-number tandem-repeat analysis (MLVA) and whole genome sequencing (WGS).Results: Of the 12 CDI cases detected, 11 isolates from 11 patients were characterized. All isolates were tcdA-/tcdB+ and belonged to ribotype 017, and showed high level resistance to clindamycin, erythromycin, gentamicin, imipenem, moxifloxacin, rifampicin and tetracycline. The isolates belonged to four genetically related MLVA types, with six isolates forming a clonal cluster. Three outbreak isolates, each from a different MLVA type, were selected for WGS. Bioinformatics analysis showed the presence of several antibiotic resistance determinants, including the Thr82Ile substitution in gyrA, conferring moxifloxacin resistance, the substitutions His502Asn and Arg505Lys in rpoB for rifampicin resistance, the tetM gene, associated with tetracycline resistance, and two genes encoding putative aminoglycoside-modifying enzymes, aadE and aac(6\u2032)-aph(2\u2033). Furthermore, a not previously described 61.3 kb putative mobile element was identified, presenting a mosaic structure and containing the genes ermG, mefA/msrD and vat, associated with macrolide, lincosamide and streptogramins resistance. A substitution found in a class B penicillin-binding protein, Cys721Ser, is thought to contribute to imipenem resistance.Conclusion: We describe an epidemic, tcdA-/tcdB+, multidrug resistant clone of C. difficile from ribotype 017 associated with a hospital outbreak, providing further evidence that the lack of TcdA does not impair the infectious potential of these strains. We identified several determinants of antimicrobial resistance, including new ones located in mobile elements, highlighting the importance of horizontal gene transfer in the pathogenicity and epidemiological success of C. difficile. Clostridium difficile, recently renamed as Clostridioides difficile ; some strains additionally produce a binary toxin, CDT, while others produce only TcdB  was used to determine the genetic relatedness of the strains and whole-genome sequencing (WGS) to identify determinants of resistance.Here we describe a multidrug resistant clone from PCR ribotype 017 \u00aekit, were collected between January and July 2016, during an outbreak in a hospital from the Lisbon Metropolitan Area, and sent to the National Reference Laboratory for Gastrointestinal Infections, hosted in the Portuguese National Institute of Health, for laboratory-based epidemiological surveillance of CDI. As described previously, stool samples were inoculated onto ChromID C. difficile agar  after ethanol shock and incubated under anaerobic conditions for 48 h at 37\u00b0C  breakpoints were used (Table Minimum inhibitory concentrations (MICs) of chloramphenicol, clindamycin, erythromycin, gentamicin, imipenem, metronidazole, moxifloxacin, rifampicin, tetracycline, tigecycline and vancomycin were determined with Etest strips (bioM\u00e9rieux), according to the manufacturer\u2019s instructions. Plates were incubated under anaerobic conditions for 48 h at 37\u00b0C. The European Committee on Antimicrobial Susceptibility Testing (EUCAST) breakpoints established for ed Table .Multilocus variable-number tandem-repeat analysis was carried out following the method developed by van den Berg et al. to amplify the loci A6, B7, C6, E7, G8, and CDR60 , with an1) and improvement, (Trimmomatic v0.36), draft genome sequences were de novo assembled using SPAdes (version 3.10.1) (2 (3 was used for in silico Multilocus Sequence Typing (MLST) and allele determination. Core-genome single nucleotide polymorphism (SNP)-based analysis was performed using Snippy v3.14. Only variant sites with minimum mapping quality of 60, minimum of > 10 reads covering the variant position and > 90% reads differing from the reference genome were considered. Putative antimicrobial resistance (AMR) genes were identified using both CARD5 and ResFinder6 (7 (8 against the non-redundant (nr) and wgs databases were performed to identify the presence (and similarity level) of determinants of resistance in other available genomes. The genome of strain M68 from ribotype 017 (Acc. No. NC_017175) was used as reference. Raw sequence reads of the three C. difficile isolates subjected to WGS were deposited in Sequence Read Archive under the Bioproject accession number PRJNA478136.Three strains   followed10.1)  was PCR amplified using primers ermG850D (5\u2032 GGATTCGGAGAGGTTATAATGAACAAAG 3\u2032) and ermG1660R (5\u2032 ATAGTTTAGCGGCCGCATTTTAACTTATGCTACCCTACC 3\u2032) and genomic DNA from strain A  and the resulting strains used to transfer the plasmids, by conjugation, into C. difficile 630\u0394erm with selection for thiamphenicol resistance (15 \u03bcg/ml) as described before , erythromycin (>256 mg/L), gentamicin (>256 mg/L), imipenem (>32 mg/L), moxifloxacin (>32 mg/L), rifampicin (>32 mg/L), and tetracycline (16 mg/L), being susceptible to metronidazole, vancomycin, chloramphenicol and tigecycline , and a disrupted tcdA with a 1.8 kb deletion at the 3\u2032 end and an early stop codon at amino acid 47, which is typical of ribotype 017. Regarding the accessory genes of the PaLoc, no mutations were found in tcdE, coding a holin-like protein necessary for toxin secretion, or in the putative negative regulator of toxin production tcdC . The transcriptional regulator tcdR, which has a frameshift mutation in the reference strain M68 (locus CDM68_RS03600) due to a deletion at nucleotide 165 that leads to an early stop codon, is in frame, and predicted as functional, in our strains.The 11 isolates shared a high genetic proximity, as determined by MLVA, and therefore only three, representing the outbreak period and belonging to different MLVA types, isolates A (from January), B  and K (from July), were selected for WGS , of which 33 distinguished the strain M68 from the outbreak strains, being that isolates A and B had no differences between each other and isolate K had 2 SNPs distinguishing it from isolates A and B, which is consistent with nosocomial transmission.aadE (aminoglycoside 6-adenylyltransferase) and aac(6\u2032)-Ie-aph(2\u2033)-Ia -Ie/aminoglycoside O-phosphotransferase APH(2\u2033)-Ia), were found in the sequenced isolates. BLASTn search against the nr database showed that aadE and aac(6\u2032)-Ie-aph(2\u2033)-Ia, which are homologous to the loci CDM68_RS08230 and CDM68_RS08245, respectively, in the reference strain M68, are not frequent in C. difficile genomes. On the other hand, they are common in other bacterial genera. The gene aadE is found with 100% coverage and identity in several Campylobacter coli genomes, as well as in a few genomes of Campylobacter jejuni, Streptococcus agalactiae and Enterococcus faecalis, among others. The gene aac(6\u2032)-Ie-aph(2\u2033)-Ia found in our isolates is present with 100% coverage and identity in many Staphylococcus spp. genomes, but also Enterococcus spp. and Campylobacter spp, among others.WGS data revealed the presence of several determinants of resistance Table . Two gentetM , homologous to the locus CDM68_RS01945 in strain M68, was also present in our isolates and was identified in the conjugative transposon Tn916 (Acc. No. KC414929).The tetracycline resistance determinant rpoB, leading to the amino acid substitutions His502Asn and Arg505Lys , both known to be associated with rifampicin resistance, were present in the three sequenced isolates.The substitution Thr82Ile in GyrA , which is responsible for fluoroquinolones resistance, and two mutations in Furthermore, we found the mutation 2162G > C in the homolog of locus CDM68_RS05670, which codes for a penicillin-binding protein (PBP), PBP3 . This muermG gene was identified in a cluster of genes associated with macrolide, lincosamide and streptogramins (MLS) resistance that also included the genes mefA and msrD, both associated with macrolide efflux resistance, and vat, coding for a Streptogramin A acetyltransferase  and strains 7499-CF/ST37 and VL_0008, both belonging to ST37 . Another strain, VL_0387 (Acc. No. FALC01000010), also from ST37, contains a highly similar element  but in which the region containing the ermG and the transposase is inverted, when comparing to the isolates from this study. Seven other C. difficile draft genomes  harbor a similar element (86% coverage and 98.4% sequence identity) that does not contain the MLS resistance portion, which points to the mosaic origin of this element. Likewise, the genome of C. difficile strain M120 (ribotype 078) exhibits a \u223c40 kb region  with 62.8% coverage and 90.6% sequence identity with the element present in our strains, while not containing the flanking RM system nor the MLS resistance cluster.An e Figure . This cle Figure . This ree Figure . Three oC. difficile genomes. For instance, the genomic region spanning the RM system and the prophage has a high homology with two genomes of Thermoanaerobacter sp., covering 70% of the element with 88% sequence identity (Acc. Nos. NC_014538 and NC_010320). The proteins coded by the RM system are common in the class Clostridia and are also found in Enterococcus cecorum. The prophage region is found with 89% sequence identity, covering 62% of the element, in the genome of Clostridium bornimense strain M2/40T (Acc. No. HG917868) and the cluster of MLS resistance genes is found in three genomes of Enterococcus cecorum with 98.5% sequence identity, covering 9% of the element .The 61.3 kb putative mobile element has homology with other non-mefA and msrD present in this element are found with >99% coverage and >95% sequence identity in many bacterial species, most of which are Streptococcus spp., mainly S. pneumoniae and S. pyogenes, but also in E. cecorum, Neisseria gonorrhoeae and Acinetobacter junii, among other species. The vat gene is present in a few C. difficile genomes and is also found with >96% coverage and >91% sequence identity in several E. cecorum, E. faecium and Streptococcus suis genomes.The genes ermG gene present in this element is found in multiple species with a sequence coverage and identity \u226599%, including Lysinibacillus sphaericus (Acc. Nos. NG_047827 and M15332), E. cecorum (mentioned above), E. faecium (Acc. No. CP003351), Bacteroides spp.  and nine C. difficile genomes , among which is the non-toxinogenic strain C. difficile Z31.The ermG-containing region is absent in reference strain M68 , is present in strain M68, while being absent in all the isolates from this study.The 61.3 kb ermG and confirmed its presence in the remaining outbreak isolates.The primer pair ermG-F (5\u2032 TCACATAGAAAAAATAATGAATTGCATAAG 3\u2032) and ermG-R (5\u2032 CGATACAAATTGTTCGAAACTAATATTGT 3\u2032) was used to amplify a 652 bp amplicon of ermG is located in a region showing evidence of other HGT events . This 72 kb region covers 90% of CTn5 with 99% sequence identity but in the isolates of this study it is interrupted by two genetic insertions of 8 and 22 kb , while \u223c10 kb of the 22 kb insertion has 99.9% sequence identity with regions of three genomes, namely Flavonifractor sp., Enterococcus faecium and C. difficile .The element containing the s Figure , such asermG-inducible C. difficile 630\u0394erm strain was subjected to antimicrobial susceptibility testing by diffusion gradient with Etest strips against erythromycin and clindamycin. Confirming that the expression of ermG confers resistance to MLS antibiotics, the MICs of erythromycin and clindamycin were both of >256 mg/L in the C. difficile 630\u0394erm conjugant expressing the ermG, when comparing with the MICs observed for C. difficile 630\u0394erm ermG- strain .The C. difficile clone from ribotype 017 implicated in a CDI outbreak and identified several determinants of resistance through WGS data analysis. Two novel mechanisms of resistance were described here, namely, the ermG gene, which mediates the resistance to MLS antibiotics and is carried by a putative mobile element exhibiting a mosaic structure, and a mutation in a PBP that is likely associated with imipenem resistance.In the present work, we studied a multidrug resistant TcdA-negative C. difficile strain and has been considered a recently emerging type, being associated with outbreaks in some European countries (C. difficile main pathogenicity factors (TcdA) does not seem to affect the spreading or infectious potential of these strains.Ribotype 017 is the most prevalent TcdA-negative ountries . In a feountries . As suchC. difficile. According to a pan-European study, most clinical isolates in Europe are susceptible to imipenem, although ribotype 027 showed elevated MICs compared to other ribotypes -Ie-aph(2\u2033)-Ia, that seem to have a low prevalence in C. difficile but are widespread in Enterococcus spp., Campylobacter spp., Staphylococcus spp. or Streptococcus spp. Anaerobes, such as C. difficile, however, are naturally resistant to aminoglycosides    and hencuman gut . This paC. difficile multidrug resistant clone implicated in a hospital outbreak presenting new resistant determinants that seemingly promoted the spreading success of this clone. Our data show that C. difficile is continually evolving through HGT and indicate that antibiotic selective pressure continues to be a major driving force in the development and emergence of new epidemic strains.In summary, in this study we described a All authors contributed to the work described in the paper, as well to the writing and revision of the document.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "OBJECTIVES: Oxidative stress results from an imbalance between the generation and elimination of oxidant species. This condition may result in DNA, RNA and protein damage, leading to the accumulation of genetic alterations that can favor malignant transformation. Persistent infection with high-risk human papillomavirus types is associated with inflammatory responses and reactive oxygen species production. In this context, oxidative stress, chronic inflammation and high-risk human papillomavirus can act in a synergistic manner. To counteract the harmful effects of oxidant species, protective molecules, known as antioxidant defenses, are produced by cells to maintain redox homeostasis. In recent years, the use of natural antioxidants as therapeutic strategies for cancer treatment has attracted the attention of the scientific community. This review discusses specific molecules and mechanisms that can act against or together with oxidative stress, presenting alternatives for cervical cancer prevention and treatment. Oxidative stress (OS) results from an imbalance in the formation and elimination of oxidant species. Accumulation of these molecules may lead to cell dysfunction as a consequence of accumulated oxidative modifications in several biomolecules To maintain redox homeostasis, protective molecules called \u201cantioxidant defenses\u201d act to preserve the balance between formation and removal of ROS and RNS. Cellular antioxidant systems are currently divided into enzymatic and non-enzymatic groups. The enzymatic group comprises catalase, superoxide dismutase (SOD), glutathione peroxidase (Gpx) and glutathione-S-transferase (GST). The non-enzymatic group is composed of molecules such as vitamins C and E, lipoic acid, carotenoids, flavonoids and others Excess levels of unneutralized free radicals and cellular active intermediates are the major cause of OS Persistent infection with high-risk HPV types (HR-HPV) is the main etiological cause for the development of several epithelial tumors at different anatomic locations. The most strongly HPV-associated malignancy is cervical carcinoma, where almost all tumors are positive for HR-HPV DNA In addition to HPV infection, several cofactors contribute to cervical cancer development. These include low socioeconomic status, early sexual initiation, multiple sexual partners, smoking, multiparity, immunosuppression and use of oral contraceptives E6 and E7 viral oncoproteins have a central role in tumor development. In high-grade lesions and tumors, these proteins are upregulated mainly due to the loss or disruption of the viral E2 gene (see below), which normally restricts the expression of viral oncogenes Alterations in expression and activity of some antioxidant proteins, including peroxiredoxins, catalase, quinone oxidoreductase-1 and superoxide dismutase (SOD) family proteins, can be detected in pre-neoplastic and neoplastic tissues associated with HPV infections. For example, expression of SOD2, a crucial antioxidant enzyme responsible for controlling the redox status of normal and tumor cells, is upregulated in several HPV-associated tumors, including penile and cervical carcinomas Inflammasomes are cytosolic multiprotein complexes that assemble after exposure to pathogens or danger-associated molecular patterns, leading to caspase activation and, consequently, secretion of inflammatory cytokines and cell death. Although different inflammasome complexes have been described, with unique activation triggers, they typically consist of a cytosolic pattern recognition receptor (PRR) such as RIG-I-like receptor (RLR), AIM2-like receptor (ALR) or nucleotide-binding domain and leucine-rich repeat-containing (NLR) protein, an adaptor protein (ASC) and pro-caspase-1. The OS generated during HPV infections can be modulated by the infected keratinocytes as well as by activated neutrophils and macrophages Furthermore, protein absent in melanoma-2 (AIM2) activates caspase-1 and inflammasomes by binding to foreign cytoplasmic double stranded DNA (dsDNA) and its adaptor ACS Nuclear factor-kappa B (NF-\u03baB) is a pleiotropic transcription factor composed of dimers of five different members of the Rel transcription factor family that include p105/p50, p100/p52, RelA, RelB and cRel NF-\u03baB plays a central role in inflammation and immune responses but also acts in different cellular processes, including development, cell growth, survival and proliferation. Furthermore, this transcription factor has a role in many pathological conditions, including cancer, where it may be involved in tumor growth and metastasis ROS levels can be affected by NF-\u03baB activity through its influence on the expression of antioxidant proteins, including SOD1, SOD2, Ferritin Heavy Chain (FHC), Glutathione S-transferase pi (GST-pi), Glutathione peroxidase-1 (Gpx1) and Dihydrodiol dehydrogenase (DDH1). However, ROS may activate or inhibit NF-\u03baB signaling depending on the signaling pathway step (upstream or downstream) and cell type analyzed NF-\u03baB activation by free radicals or enzymes is a complex event and can cause various biological effects. For example, its activation by SOD2 has been associated with lung adenocarcinoma progression and poor prognosis Interestingly, curcumin, a natural antioxidant that is discussed below, could prevent tumor-induced thymic atrophy, restoring NF-\u03baB activity, and thus acted as an immunorestorative compound A crucial event in HPV-mediated malignant transformation is the integration of HR-HPV DNA into the cell genome. This event results in E6 and E7 oncogene overexpression, which leads to the destabilization of p53 and pRb tumor suppressor proteins, respectively Genome oxidative damage was previously shown to be strongly involved in epigenetic alterations DNA repair pathways can be affected by HPV oncoproteins, resulting in the inactivation of important groups of genes, such as base excision repair (BER), nucleotide excision repair (NER), DNA mismatch repair (MMR), microhomology-mediated end joining (MMEJ), Fanconi anemia (FA), ataxia-telangiectasia mutated (ATM), and the ATM and Rad3-related (ATR) genes During HR-HPV infection, apoptosis is hindered by disruption of many regulatory pathways, which results in altered cell proliferation associated with accumulation of mutations and alterations in gene expression Recently, natural compounds with chemopreventive and chemotherapeutic properties, which have antioxidant features, have received increased attention Curcuma longa - Zingiberaceae family) rhizome Curcumin, also known as diferuloylmethane , is one in vivo, inhibiting the activity of proangiogenic molecules, such as fibroblast growth factor 2 (FGF-2), matrix metalloproteases and COX2, as noted previously Moreover, curcumin downregulates other crucial transcription factors responsible for controlling cell growth and survival pathways, including signal transducer and activator of transcription 3 (STAT3), cyclooxygenase 2 (COX2), Akt, antiapoptotic proteins and activator protein 1 (AP1) Due to its biological properties and low toxicity, curcumin is an interesting alternative to therapeutic agents used for the treatment of several types of cancer In addition, curcumin was shown to downregulate HPV18 transcription in HeLa cells, inhibiting the AP1 pathway and reversing the expression patterns of the c-fos and fra-1 transcription factors Another important polyphenol with anticancer properties is epigallocatechin-3-gallate (ECGC). This compound  it is thEGCG is a potent inhibitor of the Akt/NF-\u03baB and mammalian target of rapamycin (mTOR) signaling pathways inducing apoptosis and cell survival mechanisms. Moreover, EGCG can cause NRF2-mediated antioxidant induction and reduce inflammation A recent study showed that EGCG exhibits free radical scavenging properties in cells isolated from cervical cancer biopsies, decreasing cell proliferation and increasing the activity of antioxidant enzymes, such as SOD and Gpx Interestingly, EGCG can act synergistically with cisplatin, inhibiting the growth of cervical cancer-derived cell lines. This finding suggests that cisplatin treatment is potentiated with EGCG in HeLa cells, regulating pathways involved in cell survival and apoptosis. This combination may improve cervical cancer treatment, especially in the context of chemoresistance to cisplatin A clinical trial was carried out to verify the efficacy of two green tea extract-derived compounds, EGCG and polyphenon E, in a study involving ninety women with HPV-related cervical lesions. These patients were divided in four different groups, according to the following regimens: local application of a polyphenon E ointment, daily oral dose (200 mg) of polyphenon E, both local and oral polyphenon E and 200 mg daily oral dose of EGCG. Patients treated with EGCG or polyphenon E responded positively to the treatment, with a reduction in HPV DNA copies and regression of virus-associated lesions, while the majority of the untreated group showed no improvement Resveratrol or 3,5,4-trihydroxystilbene , a phytoResveratrol exhibits antiproliferative effects on cervical cancer-derived cell lines. This effect was characterized by accumulation of cells in the S-phase of the cell cycle The chemopreventive efficacy of resveratrol has already been demonstrated in hepatocellular, skin, prostate and lung cancers, through several regulatory pathways Pyridoxal-5\u2032-phosphate (PLP) is the bioactive form of vitamin B6 . There aVitamin B6 is required as a co-enzyme for many biochemical reactions, including amino acid synthesis and catabolism, bioactive amine synthesis , hemoglobin synthesis, and glycogenolysis Vitamin B6 could sensitize several cancer cell lines to apoptosis after cisplatin-mediated DNA damage by depleting intracellular glutathione. Furthermore, low PDXK expression was associated with poor prognosis in two independent cohorts of non-small cell lung cancer patients In a cohort of thirty-three hepatocellular carcinoma patients that randomly received placebo or vitamin B6 (50 mg/d), the results indicated that vitamin B6 improved the antioxidant capacity by reducing homocysteine levels in patient plasma Recent data have shown that vitamin C, also known as ascorbic acid , is anotp53-mediated pathway. Therefore, low concentrations of cisplatin were required to induce cancer cell death. Hence, it is tempting to speculate that, in combination with vitamin C, low amounts of cisplatin could be used in cancer patients, reducing its side effects In SiHa cells, the association of vitamin C and cisplatin enhanced cisplatin-mediated apoptosis induction through a Interestingly, ascorbyl stearate (ASC-S), a fatty acid ester derivative from ascorbic acid, exhibits a potent proapoptotic activity. Recently, Mane et al. Finally, the direct impact of ascorbic acid on cervical carcinogenesis has been suggested. A cross-sectional study published by Hwang et al. in vivo. In addition, the maintenance and regeneration of \u03b1-tocopheryl quinone (a non-oxidized form of \u03b1-tocopherol) may also have an important role in CIN and in cervical cancer. However, further investigations of \u03b1-tocopheryl quinone as a potential marker of OS in precancerous lesions and cervical cancer are strongly needed Results from previous studies suggest the existence of an association between plasma levels of vitamin E, also known as \u03b1-tocopherol or 5,7,8-trimethyltocol , and HPVDespite the positive results with the use of the antioxidant compounds described above, traditional cancer chemotherapy still relies on the induction of OS triggered by ROS levels higher the than tumor elimination capacity, which contributes to tumor cell death One of the most important systems involved in cell protection against elevated levels of free radicals, including those induced by chemotherapy and radiotherapy, is composed of glutathione (GSH) and GSH-related enzymes An alternative treatment for cervical cancer involves molecules capable of inhibiting antioxidant pathways. For example, exposure of HeLa cells to pinostrobin, a dietary bioflavonoid, was associated to reduced cell viability and downregulated GSH and NO2- levels. Pinostrobin-associated cell death involves upregulation of apoptotic extrinsic and intrinsic pathways components, as well as DNA and mitochondrial damage, probably as a consequence of ROS accumulation Another compound, auranofin, an inhibitor of thioredoxin reductase, can also trigger apoptosis while depleting GSH and increasing ROS intracellular levels. In addition, its effect on cervical cancer cell lines can be intensified in combination with a GSH synthesis inhibitor, L-buthionine sulfoximine alfa and beta, and c-Kit The use of enzyme inhibitors such as tyrosine kinase inhibitors (TKIs) to modulate ROS effects constitutes an important alternative to cancer therapies currently under investigation. Sunitinib, for instance, is the most common TKI administered in clinical medicine, and it effectively blocks VEGF receptors According to some published data, sunitinib could have antioxidant activity due to the improved lipid peroxidation and increased GSH levels observed after cisplatin treatment, reducing OS-triggered side effects and improving chemotherapeutic efficacy Another approach involving enzyme inhibitors was applied in a study that developed a new radiosensitization technique using a hydrogen peroxide solution (Oxydol) named KORTUC (Kochi Oxydol-Radiation Therapy for Unresectable Carcinomas). This approach aimed to treat patients with local advanced unresectable neoplasms, through tumor antioxidative enzyme blockage, leading to tumor sensitization to radiotherapy Oxidative stress is a consequence of an imbalance between pro- and antioxidant factors. The antioxidant system maintains the oxidative process within physiological limits, preventing injuries that can culminate in irreparable systemic damage and diseases.Signaling pathways related to redox control in HPV-mediated carcinogenesis represent promising targets for cancer treatment. Some antioxidant molecules, including natural compounds, may be useful preventive or therapeutic alternatives. Despite the positive results of antioxidant compounds, OS induction is still an effective therapeutic approach used in traditional chemotherapy. This approach aims to enhance reactive species production to levels that overcome the tumor elimination capacity, leading to tumor cell death. However, evidence has shown that an increase in antioxidant enzymes by cancer cells has an important role in OS control and possibly in drug resistance.in vitro or animal model studies, relatively few clinical trials have been carried out. These trials are essential for the establishment of new therapies targeting oxidative stress, including those using natural compounds.Current knowledge indicates that several molecules and enzyme inhibitors act to modulate ROS and that they are some of the most significant therapeutic targets for anticancer compound development and should be extensively studied. Despite several lines of evidence based on Silva GA contributed to the abstract, introduction, figures, therapeutic approaches and conclusion and revised the text and references. Nunes RA contributed to preparation and revision of the text. Morale MG contributed to the introduction and revised the text and references. Aguayo F and Boccardo E revised the text. Termini L prepared and revised the text."}
{"text": "The current outbreak of viral pneumonia, caused by novel coronavirus SARS-CoV-2, is the focus of worldwide attention. The WHO declared the COVID-19 outbreak a pandemic event on Mar 12, 2020, and the number of confirmed cases is still on the rise worldwide. While most infected individuals only experience mild symptoms or may even be asymptomatic, some patients rapidly progress to severe acute respiratory failure with substantial mortality, making it imperative to develop an efficient treatment for severe SARS-CoV-2 pneumonia alongside supportive care. So far, the optimal treatment strategy for severe COVID-19 remains unknown. Intravenous immunoglobulin (IVIg) is a blood product pooled from healthy donors with high concentrations of immunoglobulin G (IgG) and has been used in patients with autoimmune and inflammatory diseases for more than 30 years. In this review, we aim to highlight the known mechanisms of immunomodulatory effects of high-dose IVIg therapy, the immunopathological hypothesis of viral pneumonia, and the clinical evidence of IVIg therapy in viral pneumonia. We then make cautious therapeutic inferences about high-dose IVIg therapy in treating severe COVID-19. These inferences may provide relevant and useful insights in order to aid treatment for COVID-19. Recently, the outbreak of a febrile respiratory disease caused by a novel beta-coronavirus, designated SARS-CoV-2, has become the focus of worldwide attention. The event was declared a Pandemic by the WHO on Mar 12, 2020, and the number of confirmed cases is still climbing worldwide. Typical clinical features of COVID-19 include fever, respiratory symptoms such as dry cough and shortness of breath, and fatigue , 4. HoweThe severity of respiratory viral infections depends on a fine balance between the virulence of the pathogen and the inflammatory response of the host's immune system . AlthougBased on the previous clinical experience in China, it was proposed that early initiation of high-dose intravenous immunoglobulins (IVIg) and low-molecular-weight heparin might be effective in improving the prognosis of severe and critically ill COVID-19 patients , 17. TheIVIg is a blood preparation isolated and concentrated from healthy donors consisting of over 95% of IgG and trace amounts of IgA or IgM. IVIg has been used in clinical practice for many years. Different doses of IVIg serve diverse medical indications, and the clinical efficacy of IVIg differs with dosage . At low 2 fragment (the dimeric antigen-binding fragment), which is responsible for specific antigen binding, and the Fc fragment , responsible for Fc receptor (FcR) and complement binding. Several hypotheses have been proposed to explain the immunomodulatory mechanisms of high-dose IVIg, including the F(ab)\u20322-mediated and the Fc-mediated mechanisms \u2032chanisms .2 fragment provide the basis for passive immunity that allows for immediate protection against microbes in immunodeficient patients. In vitro and preclinical experiments confirmed that IVIg contains multivalent pathogen-specific neutralizing IgG antibodies against common opportunistic pathogens and toxins  \u2032 toxins) \u201326. Vari toxins) \u201329.2-mediated neutralization of inflammatory cytokines, chemokines, and complement fragments, along with regulation of immune cell apoptosis might contribute to the conversion of pro-inflammatory to anti-inflammatory conditions. Meanwhile, a possible explanation for the fact that only high-dose IVIg can exert anti-inflammatory effects is that a sufficient amount of antigen-specific IgG is required to achieve therapeutic activity.In addition to microbial binding, a wide range of endogenous antigen-specific IgG are also present in IVIg preparations. These endogenous antigens may include: inflammatory cytokines , chemokines , apoptosis-related molecules , complement fragments (C3a and C5a), and anti-idiotypic antibodies  \u201341. F\u2032 therapy \u201344. TherThe Fc fragment of IgG is responsible for binding to Fc receptors (FcRs) and complement . IgG-specific Fc receptors (Fc\u03b3Rs) belong to type I FcRs and are classified into activating Fc\u03b3Rs  and an inhibitory Fc\u03b3R (Fc\u03b3RIIB), depending on their intracellular motif and the function they mediate. Type II FcRs, including C-type lectins , type I lectins (CD22), and non-classical FcRs, such as FcRn and FCRL, also act as effector targets of IVIg . The Fc-Given the central role of activating Fc\u03b3Rs in mediating excessive antibody-dependent effector functions, a possible explanation of the potential anti-inflammatory function of high-dose IVIg lies in that it significantly raises the concentration of IgG above the normal plasma levels and contributes to a functional blockade of Fc\u03b3Rs, limiting access of immune complexes to these activating receptors. Moreover, IgG from IVIg preparations has been proven to be active through inhibitory ITAMi signaling in immune regulation .The role of dimeric IgG in IVIg preparations is emphasized by an enhanced understanding of the optimal IgG form to interact with activating Fc\u03b3Rs. In physiological conditions, monomeric IgG1 is more likely to bind Fc\u03b3RI with high affinity rather than to other Fc\u03b3Rs with low affinity . AlthougEndogenous pathogenic autoantibodies, mainly IgG, play a predominant role in the immunopathogenesis of many autoimmune and infectious diseases. A hallmark characteristic of long serum half-life of endogenous pathogenic IgG is mainly due to FcRn. FcRn is a non-classical FcR that can interact with IgG in a pH-dependent manner, which is sufficient in rescuing IgG from lysosomal degradation and recycling it to the cell surface , 53. HigA balance between activating and inhibitory Fc\u03b3Rs is critical for a well-regulated immune response, and a disbalance markedly influences immunopathology in autoimmune and infectious diseases. Fc\u03b3RIIB is the only ITIM-containing Fc\u03b3R and negatively regulates many aspects of immune and inflammatory responses. After efficient high-dose IVIg therapy, an upregulation of Fc\u03b3RIIB on immune cells is considered to contribute to the anti-inflammatory process , 60, 61.via direct interaction with myeloid regulatory cells expressing SIGN-R1 (mice) or DC-SIGN (human)  , 62, 63.or cells , 65. Howor cells , 67. Moror cells \u201372. It s2-mediated neutralization of complement C3a and C5a, the interaction between the Fc fragment and complement C1q, C3b, and C4b in a dose-dependent manner, contributes to immunomodulatory effects of IVIg on the classical complement pathway \u2032 pathway \u201375. The  pathway , 77. The pathway .2-mediated mechanisms and unspecific Fc-mediated mechanisms are not mutually exclusive, but is more likely to regulate the immune system in synergy, giving rise to the immunomodulatory effects of high-dose IVIg in specific clinical settings.As an extremely complex preparation, IVIg contains a large number of bioactive moieties, and the entirety of effects from IVIg is therefore not fully understood yet. The proposed antigen-specific F(ab)\u2032Although an active immune response is essential for pathogen elimination in acute respiratory viral infections, excessive defensive reactions might wreak havoc on healthy cells and tissues. Complications or mortality of respiratory viral infections are often associated with excessive production of pro-inflammatory cytokines and ensuing multiple organ dysfunction. Although the immunopathogenesis of SARS-CoV-2 has not yet been fully described, the histopathological evidence strongly suggests a critical role of an excessive immune response in mediating extensive damage of the lung and other organs, similar to previous observations in SARS, MERS, influenza, and RSV disease, where hyper-inflammatory responses have been shown to be involved in the lung pathology. In this section, we review how a dysfunctional immune response may cause immunopathology in severe viral pneumonia, resulting in the current understanding of IVIg therapy in modulating the hyper-inflammatory conditions.The cytokine storm syndrome is a form of systemic inflammatory response common to severe acute viral pneumonias, and its presence has also been suggested in severe cases of COVID-19. There is a correlation between severity of the cytokine storm and prognosis of severe illnesses . At the Endothelial cells can secrete inflammatory mediators, including cytokines, chemokines, histamine, matrix metalloproteinases, and adhesion molecules, which can lead to inflammatory cell infiltration and tissue damage, and plays an essential role in inflammation, hemostasis, and angiogenesis.SARS-CoV-2 infects host cells using the ACE2 receptor, which is widely expressed on endothelial cells. Endothelial cell infection and endotheliosis have been observed in some COVID-19 patients . Direct Although vasculitis and autoantibodies against endothelial cells have been reported and detected in SARS patients, direct endothelial cell infection hasn't been demonstrated yet \u201384. Thesin vitro observations. High-dose IgG has been shown to specifically and completely inhibit TNF-\u03b1-induced secretion of pro-inflammatory cytokines  and production of E-selectin in cultured human coronary artery endothelial cells  are antigen-presenting cells of the innate immune system. Plasmacytoid dendritic cells (pDCs) are unique sentinel cells that can recognize a virus through PRRs, and enhance the secretion of IFN , 92.Data from COVID-19 patients and a ferret model reveal low levels of IFN with contrastingly high levels of IL-6 and a strong chemokine response, suggesting a similar hyper-inflammatory response pattern to SARS and MERS . SeveralThe immunomodulatory effects of IVIg on DCs differ depending on dosage. IVIg accelerates maturation at physiological doses, but inhibits the maturation, activation, and function at therapeutic doses . High-doWhether infiltrating inflammatory monocyte-macrophages (IMM) are beneficial or deleterious after a viral infection is mainly dependent on their ability to secrete inflammatory cytokines and chemokines. A dysregulated cytokine response can also promote excessive activation of IMM, leading to immunopathological effects on healthy tissues.Macrophage activation syndrome (MAS) was reported in several COVID-19 patients with severe respiratory failure, and the production of associated pro-inflammatory cytokines (IL-6 and TNF\u03b1) might contribute to hyper-inflammatory conditions . It was Increased pathogenic IMM influx has been consistently observed in severe or lethal SARS patients, along with mice and Chinese rhesus macaque models , 110. ThIn vitro, IVIg inhibits the production of pro-inflammatory cytokines by M1 macrophages and triggers macrophage polarization via Fc\u03b3RIII-mediated mechanisms , and neutrophil extracellular traps (NET) by neutrophils can help to neutralize pathogens. Paradoxically, however, neutrophil reactivity can also enhance tissue damage in hyper-inflammatory conditions such as severe virus infection.Excessive neutrophils and NET production are considered a potential predictor of prognosis in influenza , 123. Si2 fragments account for the anti-inflammatory activity on neutrophils. In patients with Kawasaki disease, IVIg therapy reduces the activation and nitric oxide production of neutrophils \u20322-mediated mechanisms (in vitro as well as in rat models (Both Fc and F(ab)\u2032trophils . In vivochanisms . Furtherchanisms , 129. Int models .Natural killer (NK) cells are innate lymphocytes that play an essential role in the control of respiratory viral infections. Within days after a respiratory viral infection, NK cells are activated, recruited to the lung, and act as effector cells in a classical Fc\u03b3R-mediated function, namely antibody-dependent cytotoxicity (ADCC). However, a dysfunction of NK cells may also be responsible for immunopathogenesis during infection.Increased inhibitory receptor NKG2A expression on NK cells and reduced production of CD107a, IFN-\u03b3, IL-2, and TNF-\u03b1, indicate a functional exhaustion of NK cells during SARS-CoV-2 infection, similar to that observed in SARS . In patiAfter high-dose IVIg therapy, a reduction in number and cytotoxic activity of NK cells is observed in patients with autoimmune diseases \u2013137. TheCytokines secreted by different subclasses of CD4+ T cells trigger the immune response to pathogens and maintain immune homeostasis. However, an imbalance of Th1, Th2, Th17, and Treg subclasses is associated with dysfunctional cytokine responses during severe viral infections.The profiles of serum cytokines revealed an increased concentration of Th17 cells in COVID-19 patients , 140. Inin vitro experiments \u20322 fragments and inhibits the differentiation and expansion of Th17 cells  and cytotoxic granules in CD8+ T cells are commonly observed in COVID-19 patients , 168. AnIn vitro and animal model studies report similar inhibitory effects (via their F(ab)\u20322 fragment \u20322-mediated mechanisms  and Fc-mediated mechanisms acting on inhibitory FcRs , as well as the TLR-9 signaling cascade.Effects of IVIg on B cells vary with the dosage: at low doses, IVIg induces proliferation of B cells and the production of antibodies , 184. OnFc\u03b3RIIB is the only classical Fc\u03b3R expressed on B cells, and its elevated expression levels after effective high-dose IVIg therapy may be involved in inhibitory effects of IVIg on B cells , 186. Hode novo B cell activation. This is consistent with the immunomodulatory functions of IVIg at low doses . ADE has been implicated widely in flavivirus infections, such as WNV and DENV, and high-dose IVIg is commonly used in treating WNV encephalitis with satisfactory effect. However, little is known about ADE in respiratory virus infection \u2013199.ADE is currently being considered as a potential contributor to the immunopathology of SARS. People who succumbed to SARS had significantly higher S glycoprotein-specific neutralizing antibodies in serum during the early stage of infection, indicating the possible presence of ADE . Similarin vivo evidence of ADE in MERS is lacking, it has been shown that MERS-CoV infections depended on monoclonal antibody (MAb) concentration, binding affinity of MAb for the viral receptor DPP4, and tissue expressions of DPP4 and Fc\u03b3R, providing a molecular basis of ADE in MERS-CoV  were empirically used . AlthougIn a randomized controlled trial, IVIg therapy efficiently improved the serum IgG concentration of severe SARS patients compared to the control group . HoweverApart from hypogammaglobulinemia, two further common features of severe SARS are leukopenia and thrombocytopenia, and these features seemed to improve in SARS patients upon IVIg therapy , 234. ThInterestingly, an IgM-enriched IVIg preparation also showed significant beneficial effects in deteriorating SARS patients who failed corticosteroid and ribavirin treatment . A signiMERS is a highly fatal respiratory disease caused by MERS-CoV, with two major historic outbreaks in 2012 and 2015. The rapid deterioration of health in a large number of patients made it unrealistic and unethical to perform randomized controlled treatment trials. Therefore, the current availability of strong evidence is minimal, and only a few case series reported administration of IVIg late in the course of MERS. These studies discussed the possible efficacy of IVIg in reversing severe thrombocytopenia through immunomodulatory mechanisms , 236.Although influenza has been around for centuries, severe influenza remains a health challenge for humans. The complications or deaths are usually associated with the extensive induction of pro-inflammatory cytokines in severely affected influenza patients . ImmunomIn a previous randomized controlled trial, patients infected with the severe 2009 pandemic influenza A (H1N1) were randomized to receive 0.4 g/kg for one dose of Flu-IVIg (anti-influenza hyperimmune intravenous immunoglobulin with high HAI antibodies level) or IVIg therapy . PatientIn contrast, other RCTs using IVIg treatment at high doses have shown improved survival. In two similar studies, pediatric patients with the severe 2009 pandemic influenza A (H1N1) were randomized to receive standard care or standard care plus 1 g/kg/d high-dose IVIg for 2 days , 229. SiRSV is a major respiratory pathogen that causes extensive respiratory symptoms, including both upper and severe lower respiratory tract infection (URTI/LRTI) in infants, the elderly, and immunocompromised individuals . AvailabA study showed that hypogammaglobulinemia was a significant risk factor for fatal outcomes of RSV infections in a hematology and transplant unit, and treatment with IVIg at regular doses was unable to reverse the poor prognosis . By contSeveral published studies suggest that a combined therapy of RBV and IVIg improves the outcome of HSCT and leukemia patients with RSV-URTI, and additional recommendations are given for high-risk patients with RSV-LRTI \u2013242. HowIn summary, IVIg therapy exhibits different levels of potential clinical benefits in SARS, MERS, influenza, and RSV infections, though currently there is no high-level evidence to support IVIg use in these infections. Of note, the presented results are partly limited to pediatric and immunocompromised patients, and the clinical benefits of IVIg therapy may vary in different patient populations . It is also noteworthy that most studies for these viral infections show possible benefits from IVIg therapy at higher doses, which indicates that a high dosage might be key for clinical efficacy. Considering the immunomodulatory effects of high-dose IVIg on the excessive immune cascade, high-dose IVIg therapy, as stated above, may be considered a potential adjunctive treatment for severe COVID-19 patients.The national diagnosis and treatment protocol for COVID-19  and recommendations from the Peking Union Medical College Hospital have suggested the application of IVIg therapy in severe and critically ill COVID-19 patients , 18. Sevn = 58) in China included severe and critical ill COVID-19 patients that were administered IVIg therapy after admission  and corticosteroid (160 mg/d) succeeded in reversing the deteriorating condition of severe COVID-19 patients who had previously failed low-dose IVIg (10 g/d) and corticosteroid treatment . HoweverThe administration of IVIg therapy (25 g/d for 5 days) at the time of initiation of respiratory distress of severe COVID-19 patients may improve the prognosis . It is nBased on these clinical observations, the administration of high-dose IVIg therapy at the appropriate point may be able to prevent disease progression and improve the prognosis of patients with severe COVID-19. Currently ongoing randomized controlled trials of high-dose IVIg therapy in severe COVID-19 patients are evaluating the benefit of IVIg compared to standard care (NCT04261426 and NCT04350580) and will be able to further provide more information about the clinical effects of IVIg therapy in COVID-19.Although a large number of clinical trials have demonstrated that IVIg therapy is well-tolerated, various side effects have been reported . The maj2 and Fc mediated mechanisms and the known clinical effects in treating severe virus pneumonia such as SARS, MERS, influenza, and RSV disease, the early application of high-dose IVIg therapy may be considered in the management of severe COVID-19 patients. Currently, limited clinical practice of high-dose IVIg in treating SARS-CoV-2 infection has been reported to show potential clinical benefits. Still, more research is needed but these inferences may provide relevant and useful insights and help in confronting the COVID-19 epidemic.The IVIg preparation is a widely used pooled human blood product that can provide passive immunity and modulate the immune functions. Although, for COIVD-19 the pathogen-specific effects of IVIg are not relevant yet, since available preparations were collected from healthy donors without pre-existing immunity early before the pandemic began. The anti-inflammatory and immunomodulatory effects on the various immune cells of high-dose IVIg may account for its clinical benefits. Based on these potential supportive F(ab)\u2032XL conceived and wrote the manuscript and prepared figures. WC and TL contributed to the modification and revision of the manuscript. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Using the convex structure of positive operator value measurements and several quantities used in quantum metrology, such as quantum Fisher information or the quantum Van Trees information, we present an efficient numerical method to find the best strategy allowed by quantum mechanics to estimate a parameter. This method explores extremal measurements thus providing a significant advantage over previously used methods. We exemplify the method for different cost functions in a qubit and in a harmonic oscillator and find a strong numerical advantage when the desired target error is sufficiently small. Motivated by the fact that quantum systems can offer an important advantage over classical systems in precision when estimating a parameter6, there has been intense theoretical and experimental advances in the area in the last years8. Moreover, precision in the estimation of parameters has several applications in the development of quantum technologies10 and quantum state manipulation11.One of the goals of metrology is to provide an optimal strategy to measure the value of a parameter under certain fixed conditions. For completeness, both an approximate value of the parameter and an estimation of the error must be given. If the physical system from which the parameter is to be estimated is analyzed within the framework of quantum mechanics, we shall speak about To estimate a parameter of a physical system one acquires data through measurements; the estimation of the parameter is obtained by applying a function, known as the estimator, to the data. The probability distribution of measurement outcomes can be modelled using a statistical model of the experiment: the probability distribution of outcomes conditioned to the value of the parameter. This statistical model might describe, say, a noisy measurement apparatus. In this article we specialize to the case of quantum mechanics, where the probability distribution is given by the Born rule and the statistical model is obtained once it is decided which operator is going to be measured. In addition to the random component of measurement, we also consider classical noise, which we include through the density matrix formalism.12.The cost function that quantifies the error of the parameter estimation of a quantum system (for example the mean square error) depends on both the measurement to be performed and the estimator; the optimal measurement strategy consists of the quantum measurement and the estimator that extremizes it. However, finding the extreme of a cost function over all possible quantum measurements and estimators is not simple. Alternatively, when a Cram\u00e9r-Rao type inequality exists, the problem can be reduced to find the extreme of another cost function (for example the Fisher information) over all the quantum measurements. This simplifies the problem because it is not longer necessary to maximize over the space of estimators. One still has to deal with extremizing a cost function over all quantum measurements, which in general is difficult. However, under special circumstances, such as symmetries, the problem can be simplifiedpositive operator value measures (POVMs), evaluate the cost function on this sample, and keep the maximum value obtained. This method, that we call the random sampling method (RSM), is very inefficient since the POVM space is large.It is possible, though very costly, to numerically find the maximum over all quantum measurements of cost functions. The straightforward way to solve the problem is to randomly sample the space of all 13, in a way that is orders of magnitude faster than using the RSM. We rely on the following: (i) the cost functions of interest in quantum metrology are convex with respect to the POVMs and (ii) the set of POVMs is convex14. Therefore, following the maximum principle16, the maximum over the POVMs must be on an extremal point of the POVM set. Our approach is simply to sample randomly extremal POVMs and get the highest value of the appropriate cost function. It is easy to produce efficiently a general POVM from a random unitary matrix, however, it is not trivial to produce randomly extremal POVMs. For this we used the algorithm proposed by Sent\u00eds et al.17.In this paper, we show how to numerically find the maximum over all quantum measurements of the Fisher information and the Bayesian version of this bound, the Van Trees boundrandom extreme sampling method (RESM). The techniques presented here can be used, for example, to find numerically the maximum value of the quantum Van Trees information18, the quantum Fisher information (even if the input state is not pure), or any convex cost function. Together with the maximum, the corresponding quantum measurement is obtained. The method can also be applied to the case of multivariable convex cost functions, and thus used to find the optimal measurement in the estimation of several parameters. For example: Given a multivariable statistical model we can construct the Fisher matrix, its diagonal elements gives a bound on the variance of each parameter. We can use our method to find the quantum measurement that maximizes any convex cost function of the diagonal elements.We call our method the 19. The problem is the following: we have a set of possible decisions, from which one\u00a0is chosen depending on the outcome of a quantum system measurement. The distribution probability for the decisions is given by a quantum measurement. We look for the best decision.\u00a0How good is the decision is rated by a cost function defined in the space of quantum measurements. The problem of finding the best decision is mapped to the problem of maximizing this cost function over all the quantum measurements. Note that quantum parameter estimation can be cast as a problem of statistical decision theory, where the decision to be chosen is an estimation of the parameter.Our approach can also be used in other areas different from quantum metrology, where a maximization over POVMs is required. An example is statistical decision theoryIn this section we first introduce some convex cost functions that give bounds to the error of parameter estimation. Then we present our main result: a numerical algorithm that allow us to find the maximum over all quantum measurement of any convex cost. We finish with examples of interest where we apply the algorithm.We discuss how to get bounds for the error made in an estimation process. We use two error measures: the mean squared error and the Bayesian mean squared error, which is used when some information is known about the parameter. This discussion is general and just assumes that a statistical model is given. We also discuss how to apply these ideas for a quantum system.In this section, we introduce some basic quantities needed to develop further the discussion. LetThe uncertainty of the estimator is given by the mean squared error, defined asWe say that the measurement strategy is optimal if the estimator minimizes the mean squared error. Finally, let us define the Fisher information21:If the estimator is unbiased (i.e. if Eq.  holds), 22.Note that fixed time. The dynamics of the system depends on the parameters of the Hamiltonian; after the evolution, the state of the system depends on the parameter we want to estimate: We want to find the best measurement strategy to estimate a parameter, General measurements in quantum mechanics are described by the positive operator valued measure (POVM) formalism, which we briefly recall in order to fix the notation. If In order for Eq.  to be a Notice that 23Fixing the POVM and thinking of  as the d1; we call this POVM the optimal POVM. If the quantum state is pure there are analytical formulas for finding The quantity Equation . Since EEquation  is validWe consider the case where we have some partial knowledge of the parameter to be estimated. An example: We want to estimate the velocity of one particle in a dilute gas at temperature The Bayesian Cram\u00e9r-Rao inequality can be used to decide what is the best estimator in the situation where we have partial knowledge of the parameter. We model the parameter as the random variable 13,It can be shown that the error is bound from below by the Cram\u00e9r-Rao type inequalityThe first term of the sum is the expectation value of the Fisher information; the second term is the Fisher information of the probability distribution of the possible values of the parameter. The last term codifies what we already know about the parameter. As can be seen from the previous equation, the generalized Fisher information is larger than the Fisher information due to the knowledge we already have of the parameter. This has a simple interpretation: we can use mentclasspt{minimaIf we want to estimate the outcomes of a random variable, the problem of finding the best strategy is exactly the same as discussed in this section. In this case the experiment is repeated several times with the values of the parameter satisfying the probability distribution of the random variable. An example: measure the velocity of several particles in thermal equilibrium in a dilute gas. The velocities for the classical particles obey a Maxwell-Boltzmann distribution.24, a review of bayesian inference in physics.In this context, we found usefulWe want to estimate the parameter ough Eq. , and theThe POVM, ormation , togetheWe call 18.If we want to minimize the error in the parameter estimation, and we codify what we know about the parameter in the probability distribution The calculation of cost functions such as 25 and the Fisher information are convex. Fisher information can be rewritten as F. From these two observations, we infer that the Van Trees information is also convex, as the integral of convex functions is also convex.The quantum Van Trees information is convex; this follows directly noticing that the set of POVMsSince the maximum of the convex cost functions lies on the extremal points of all POVMs, we only need to search in this subset simplifying greatly the optimization task. A way to sample randomly such a set is presented in the following sub-section.26.The outline of the algorithm is as follows: We produce a random POVM, and decompose it in extremals. We then evaluate the cost function using extremal POVMs and choose the one which yields the highest value. We repeat the procedure several times and keep the optimal POVM. We provide an implementation in an online repository27 backwards, which transforms a general POVM into a usual projective measurement in an enlarged space.To produce a random POVM, we use the purification algorithm14, nothing is gained if the dimension of the ancilla space is larger than The first step is to produce a random unitary matrix that acts on both the original space and an ancilla Hilbert space. The dimension of this ancilla space is the number of outputs of the initial POVM. Because the extremal POVMs have at most circular unitary ensemble (CUE)28. The easiest way to construct a representative member of the CUE is to construct a member of the Gaussian unitary ensemble (GUE)28, the ensemble of hermitian matrices invariant under unitary conjugation subject to the condition that the ensemble average of the trace of the square of the matrices is fixed. Generating a member 26.The aforementioned unitary matrix is chosen with a measure invariant with respect to multiplication by unitary operators, i.e., with the Haar measure. The ensemble induced by the aforementioned measure is called the 27. Equation \\documentNumerical algorithm to estimate the quantum Fisher information and the quantum Van Trees information. In the examples we observe a computational speedup when using the algorithm presented here compared with methods that randomly sample the whole POVMs space.In this section we apply the method described in the section We use the algorithm to calculate the quantum Fisher information for estimating a parameter encoded in a pure qubit state. We use known analytical results to benchmark our numerical method.30.We consider a spin 1/2 particle in the state,Given a set of states parametrized by Each of these POVMs has two elements that corresponds to the outcomes Using Eq.  we find 23. In this example the quantum Fisher information is the maximum of The Fisher information for this probability distribution isFRSM and FRESM are the Fisher information numerically calculated using the RSM and RESM respectively. In Fig.\u00a0In order to evaluate the performance of the proposed algorithm, we apply the RSM and RESM methods and compare their performance with the exact result . We defiNow we consider that we have some information about equality . We assu\u03c0 in Eq. . First w by Eqs.  and 25)\\documentBecause we are using a subset of all the POVMS  see Eq. . This imNow we apply RESM to calculate We observed that surprisingly, almost any extremal POVM is useful for finding the maximum ween Eq.  and the We calculate the Van Trees information for the phase estimation problem, one of the workhorses of quantum metrology. Since for this case no analytical solutions are known, this is an interesting testbed for our method.18 for a similar calculation. We probe the system with a coherent state, such that one path yields the state \u03b1 a complex number) and the otherWe want to estimate the phase difference \u03c0/4 and trimmed at the edges (0 and 2\u03c0). Using RESM, we calculate the quantum Van Trees information for different values of Assume that we know, with some error, the size and the refractive index of the object that creates the phase difference. We can make an initial estimation of the phase difference between the two paths because it is proportional to the length travelled inside the object. We can model this situation assuming that \u03b8) is encoded. For the Fig.\u00a0\u03c0/4.As a final example, we consider estimating a parameter, chosen from a given distribution, encoded in a non-pure state. Again, there are no analytical expressions for the quantum Fisher information for this case. We calculate he state . Let32\\dIn Fig.\u00a0ome POVM  with \\do see Eq. . We see deration  is a mixThe random extreme sampling method (RESM) can be used to find efficiently the maximum of a cost function over all possible quantum measurements. Particularly it is useful for finding limits in the precision of parameter estimation, through the cost function known as the quantum Fisher information, when the state to be measured is a mixed state. It can also be used to find the optimal measurement strategy by a given convex cost function by finding the POVM that maximizes it, at a considerable lower computational cost.26. To reproduce the results presented in 2.3.1, set the flag -o to Qubit and vary the flag --EtaAngle from 0 to \u03c0. For the results in sections 2.3.2 and 2.3.2, set the flag -o to CohPlusTherGaussian and to DispTherGaussian respectively. We also set the temperature with -T 0.001, the number of times to sample the space with -s 150 , the dimension of the Hilbert space to describe the system with --HilbertDim 7 and the number of outcomes of the POVM with --Outcomedim 10. For the pure state, as in 2.3.2, set -o CohPlusTherGaussian --MixConstant 1. The squared norm of \u03b1 is set with the option --MeanPhotonNumb, which can be varied to reproduce the plots. The whole data set can be obtained with the command make all.The code implementation can be obtained in the repository"}
{"text": "Background: O6-methylguanine-DNA methyltransferase (MGMT) methylation status affects tumor chemo-resistance and the prognosis of glioblastoma (GBM) patients. We aimed to investigate the role of MGMT methylation in the regulation of GBM immunophenotype and discover an effective biomarker to improve prognosis prediction of GBM patients.Methods: A total of 769 GBM patients with clinical information from five independent cohorts were enrolled in the present study. Samples from the Cancer Genome Atlas (TCGA) dataset were used as the training set, whereas transcriptome data from the Chinese Glioma Genome Atlas (CGGA) RNA-seq, CGGA microarray, GSE16011, and the Repository for Molecular Brain Neoplasia (REMBRANDT) cohort were used for validation. A series of bioinformatics approaches were carried out to construct a prognostic signature based on immune-related genes, which were tightly related to the MGMT methylation status. In silico analyses were performed to investigate the influence of the signature on immunosuppression and remodeling of the tumor microenvironment. Then, the utility of this immune gene signature was analyzed by the development and evaluation of a nomogram. In vitro experiments were further used to verify the immunologic function of the genes in the signature.Results: We found that MGMT unmethylation was closely associated with immune-related biological processes in GBM. Sixty-five immune genes were more highly expressed in the MGMT unmethylated than the MGMT-methylated group. An immune gene-based risk model was further established to divide patients into high and low-risk groups, and the prognostic value of this signature was validated in several GBM cohorts. Functional analyses manifested a universal up-regulation of immune-related pathways in the high-risk group. Furthermore, the risk score was highly correlated to the immune cell infiltration, immunosuppression, inflammatory activities, as well as the expression levels of immune checkpoints. A nomogram was developed for clinical application. Knockdown of the five genes in the signature remodeled the immunosuppressive microenvironment by restraining M2 macrophage polarization and suppressing immunosuppressive cytokines production.Conclusions:MGMT methylation is strongly related to the immune responses in GBM. The immune gene-based signature we identified may have potential implications in predicting the prognosis of GBM patients and mechanisms underlying the role of MGMT methylation. Glioma is a type of central nervous system (CNS) neoplasms and accounts for the majority of intracranial malignant tumors in adults. Glioblastoma (GBM), which is defined as the World Health Organization (WHO) grade IV glioma, shows a highly aggressive, heterogeneous, and lethal phenotype. Currently, the etiology of GBM is still largely unknown. Although surgical resection combined with chemotherapy or radiotherapy has been widely used as a routine clinical treatment, the prognosis of patients has even not improved significantly, with a median overall survival fewer than 15 months  catalyzes the DNA repair process by removing the alkylation of the O6 position of guanine  in recurrent GBM (NCT02017717) was launched in 2014. A recent clinical trial indicated that the neoadjuvant PD-1 blockade could upregulate the amount of T cells, promote the expression of interferon-\u03b3-related genes, and further offer a promising survival benefit in recurrent GBM  mutation status was closely associated with immune response in GBM, and a prognostic model based on IDH mutation was further developed to predict the clinical outcomes of patients . The microarray gene expression profile matrix files of the GSE16011 project (including 159 GBM samples) and the Repository for Molecular Brain Neoplasia (REMBRANDT) database (including 220 GBM samples) were downloaded from the Gene Expression Omnibus (GEO) database (www.ncbi.nlm.nih.gov/geo/). The corresponding profiles comprising detailed clinicopathological characteristics were also generated from each data source. The TCGA RNA-seq dataset was used as the training set and the CGGA RNA-seq dataset as the validation set. Furthermore, the CGGA microarray profile, as well as the GSE16011 and REMBRANDT datasets, were used to test the prognostic value of the risk model developed in the TCGA cohort.We retrospectively collected a large-scale profile composed of five independent datasets involving 769 GBM patients . The RNAwww.immport.org), and 1,100 immune-related genes were extracted from the \u201cIMMUNE_RESPONSE\u201d gene set . Finally, after combining these two independent gene sets, 1,763 immune-related genes were selected for the next analyses  between different MGMT methylation status in the CGGA RNA-seq cohort were identified using the \u201climma\u201d R package  were screened for further analyses.Hundred and thirty-seven GBM patients with data on gene expression and MGMT methylation status was selected in the TCGA cohort, and the differentially expressed genes (DEGs) between MGMT unmethylated and methylated samples were identified using the \u201cDESeq2\u201d R package  regression model with 10-fold cross-validation was adopted to select the most useful prognostic factors for GBM patients. The optimal lambda value was estimated based on the minimum criteria. Then, the risk score for each sample was calculated using the expression levels of genes and corresponding regression coefficients obtained from the multivariable Cox regression analysis. The formula of the risk score model was as follows:N is the number of genes in the signature, \u03b2genei is the regression coefficient, and expgenei represents the expression value of a specific gene in a single sample. The cutoff for classifying GBM patients into high and low-risk groups was determined using X-title 3.6.1 software , immature DCs (iDCs), activated DCs (aDCs), neutrophils, mast cells, eosinophils, and macrophages, as well as those associated with cells of the adaptive immune system, including B, T central memory (Tcm), CD8+ T, T effector memory (Tem), T follicular helper (Tfh), T\u03b3\u03b4, Th1, Th2, Th17, and Treg cells, were included in the gene list. A numeric matrix consists of the enrichment score of each immune cell type in a single sample was obtained via ssGSEA. For the specific macrophage subtype (M2 macrophage), the xCell algorithm, a novel gene signature-based method, was performed to infer the contents .We used the computational method of Tumor Immune Dysfunction and Exclusion (TIDE)  score, IDH mutation status, and risk score. A combined nomogram was generated as a quantitative tool for predicting the likelihood to die of each patient using the \u201cregplot\u201d R package. The concordance index (C-index) was calculated to assess the consistency between model prediction and actual clinical outcomes of patients. The calibration plot was generated to evaluate the accuracy of the prediction for 1-, 2-, and 3-year overall survival using this nomogram by the \u201crms\u201d R package.Multivariable Cox proportional hazards regression analysis was applied with the following clinical-relevant covariates: gender, age, Archival paraffin-embedded GBM tissues were collected from 15 patients who underwent surgery at the First Affiliated Hospital of Nanjing Medical University. The diagnosis of GBM was confirmed by two experienced pathologists. This study was approved by the ethics committee of the First Affiliated Hospital of Nanjing Medical University. All samples were collected under protocols approved by the institutional review boards of Nanjing Medical University, and all donors provided informed consent.MGMT promoter of these samples was assessed using the pyrosequencing (PSQ) assay. Briefly, genomic DNA was extracted from the tumor tissues using the QIAamp DNA Mini Kit according to the manufacturer's instructions , and then DNA was treated with the EpiTect bisulfite kit to convert cytosine to uracil . Bisulfite-treated DNA was amplified using the specific PSQ primer 5\u2032-YGTTTTGYGTTTYGAYGTTYGTAGGTTTTYGYGGTGYGTA-3\u2032 and then treated with the PyroMark Q24 MGMT kit . The methylation status was determined by the mean value of the methylated alleles percentage, and the value over 10% was regarded as MGMT methylation . U87 and U251 cells were grown in Dulbecco's modified Eagle's medium  supplemented with 10% fetal bovine serum , 2 mM L-glutamine, and 1% penicillin\u2013streptomycin. THP-1 cells were maintained in RPMI-1640  supplemented with 10% FBS. All cells were cultured with 5% COTHP-1 cells were treated with 100 ng/mL phorbol 12-myristate 13-acetate  for 24 h to simulate a macrophage-like (M0) phenotype. Following treatment, the M0 macrophages were polarized into M2 macrophages by incubating with 20 ng/mL IL-4  for 24 h.GAPDH primers, forward: 5\u2032-AGAACATCATCCCTGCCTCTACTG-3\u2032, reverse: 5\u2032-ACGCCTGCTTCACCACCTTC-3\u2032; CD68 primers, forward: 5\u2032-GGAAATGCCACGGTTCATCCA-3\u2032, reverse: 5\u2032-TGGGGTTCAGTACAGAGATGC-3\u2032; CD14 primers, forward: 5\u2032-ACGCCAGAACCTTGTGAGC-3\u2032, reverse: 5\u2032-GCATGGATCTCCACCTCTACTG-3\u2032; CD206 primers, forward: 5\u2032-TCCGGGTGCTGTTCTCCTA-3\u2032, reverse: 5\u2032-CCAGTCTGTTTTTGATGGCACT-3\u2032; CD163 primers, forward: 5\u2032-TTTGTCAACTTGAGTCCCTTCAC-3\u2032, reverse: 5\u2032-TCCCGCTACACTTGTTTTCAC-3\u2032; IL-10 primers, forward: 5\u2032-GACTTTAAGGGTTACCTGGGTTG-3\u2032, reverse: 5\u2032-TCACATGCGCCTTGATGTCTG-3\u2032; VDR primers, forward: 5\u2032-GTGGACATCGGCATGATGAAG-3\u2032, reverse: 5\u2032-GGTCGTAGGTCTTATGGTGGG-3\u2032; GATA3 primers, forward: 5\u2032-GCGGGCTCTATCACAAAATGA-3\u2032, reverse: 5\u2032-GCCTTCGCTTGGGCTTAAT-3\u2032; TNFSF9 primers, forward: 5\u2032-GGCTGGAGTCTACTATGTCTTCT-3\u2032, reverse: 5\u2032-ACCTCGGTGAAGGGAGTCC-3\u2032; TNFRSF9 primers, forward: 5\u2032-AGCTGTTACAACATAGTAGCCAC-3\u2032, reverse: 5\u2032-GGACAGGGACTGCAAATCTGAT-3\u2032; LILRA5 primers, forward: 5\u2032-TCACGGCTGAGATTCGACAG-3\u2032, reverse: 5\u2032-CCTGCGAGAGCCATAGCATC-3\u2032.Total RNA from cells was extracted using TRIzol reagent , and complementary DNA (cDNA) was synthesized using a reverse transcription-PCR Kit . RT-PCR was performed using SYBR qPCR Master Mix  and operated with LightCycler 480 System . The primer sequences used in this study were listed as follows: VDR, GATA3, TNFSF9, TNFRSF9 siRNA reagents, and a pool of three LILRA5-targeting siRNAs , were transfected into U87, U251 cells, and polarized M2 macrophage at the concentration of 50 nM with Lipofectamine 3000 reagent . The target sequences were as follows: GATA3, 5\u2032-GGGCUCUACUACAAGCUUCTT-3\u2032; VDR, 5\u2032-CCCACCUGGCUGAUCUUGUCAGUUA-3\u2032; TNFSF9, 5\u2032-UAUUCCGACCUCGGUGAAGGG-3\u2032; TNFRSF9, 5\u2032-AAGCAGTTACTACAAGGATCC-3\u2032; LILRA5-siRNA1, 5\u2032-GUCCUUGGGAUUCUGAUAUTT-3\u2032; LILRA5-siRNA2, 5\u2032-GGAAUACCGUCUGGUUAAATT-3\u2032; LILRA5-siRNA3, 5\u2032-GUGACAGGAUUCUACAACATT-3\u2032. Cells were harvested for the next assay after incubated for 48 h.The VDR, GATA3, TNFSF9, TNFRSF9, and LILRA5 siRNA for 48 h, blocked with 5% BSA and 0.01% Triton-X 100 before incubation with primary antibodies. The cells were treated with primary antibodies at 4\u00b0C overnight and then incubated with fluorescence-conjugated secondary antibodies. DAPI (Invitrogen) was applied to stain the nuclei before capturing by a fluorescence confocal microscope . The primary antibodies used in the IF assay were listed as follows: CD68 , CD163 , CD206 . For IHC staining, the assay was conducted by following the manufacturer's protocol as previously published , VDR , TNFSF9 , TNFRSF9 , LILRA5 . IHC staining of GBM tissues for individual target protein was assessed by measuring the ratio of the integrated optical density (IOD) using Image-pro plus software (version 6.0). Images were captured from six random fields, and the final score was set as an average per field.The polarized M2 macrophages were treated with GATA3, VDR, TNFSF9, TNFRSF9, and LILRA5 for 48 h. The culture supernatants were collected, and then the protein expression levels of VEGFA, TGF-\u03b2, and CCL2 were detected using the ELISA kits. All the ELISA kits were purchased from Proteintech. The procedures were performed according to the supplier's protocol.U87 and U251 cells were seeded in six-well plates and treated with siRNAs-targeting www.r-project.org) was used for all statistical analyses.The LASSO Cox regression analysis was carried out using the \u201cglmnet\u201d R package. Restricted mean survival (RMS) represents the loss in average life expectancy for patients, and the RMS, as well as time ratio for the risk model in each dataset, were calculated using the \u201csurvRM\u201d R package. Tumor purity, which represents the heterogeneity of each tumor sample, was estimated by the \u201cESTIMATE\u201d R package  and MGMTM (MGMT methylated) groups in these two cohorts, respectively. GSEA analysis showed that immune-related biological processes, such as humoral immune response , T cell activation involved in immune response , adaptive immune response , cytokine production involved in immune response , and regulation of innate immune response , were significantly enriched in the MGMTU group in the TCGA cohort , such as CXC motif chemokine ligand , immunoglobulin kappa variable family , and immunoglobulin heavy constant gamma cluster .To further investigate the potential immune pathways and key immune-related genes driving this phenomenon, differentially expressed genes between the entified . Sixty-fTNFSF9), TNF receptor superfamily member 9 (TNFRSF9), interleukin 1 receptor type 1 (IL1R1), vitamin D receptor (VDR), CD70, leukocyte immunoglobulin-like receptor A5 (LILRA5), GATA-binding protein 3 (GATA3), and CXC motif chemokine ligand 13 (CXCL13) were selected as independent factors associated with the overall survival of GBM patients : 1.75\u20133.87, P < 0.001] . Time-dependent ROC curves were generated to evaluate the efficiency of this risk signature in predicting 1-, 2-, and 3-year survival of GBM patients, and the risk model showed considerable predictive potential in different cohorts . The HRs for the signature in the univariate and multivariate analyses were 3.107  and 2.476 , respectively. The risk model was further validated in the CGGA RNA-seq cohort, with HRs of 1.896  and 1.644 , respectively  > 0.4, P < 0.05] in the TCGA and CGGA RNA-seq cohorts (P < 0.05) (P < 0.05)  . Similar < 0.05) .R = \u22120.6, P < 0.0001 in TCGA, and R = \u22120.4, P < 0.0001 in CGGA RNA-seq)  .P < 0.05) (P < 0.05). Similarly, high-risk patients in the CGGA RNA-seq cohort had significantly higher quantities of pro-tumor immune cells, except for pDCs and mast cells (P < 0.05) , immature dendritic cells (iDCs), CD56dim natural killer cells, macrophages, neutrophils, regulatory T cells (Tregs), and mast cells ( < 0.05) . At the  < 0.05) , were hi < 0.05) . Therefovia changes in the expression of immunosuppressors.To investigate the potential mechanisms underlying the correlation between the genes related to the immune response and the risk score, we assessed the relationship between the risk score and glioma-associated immunosuppressors. The gene list of glioma-related immunosuppressors, including immunosuppressive cytokines and checkpoints, tumor-supportive macrophage chemotactic and skewing molecules, immunosuppressive signaling pathways, and immunosuppressors were obtained from the published literature   were found to be positively associated with the risk score in both the TCGA and CGGA RNA-seq cohorts ( < 0.05) . These rTIM-3, TIGIT (except in the CGGA RNA-seq cohort), LAG-3, PD-1, CTLA-4, CD80, PD-L1, PD-L2, B7-H3, and IDO1  was significantly more likely to benefit from treatment with immune checkpoint inhibitors than the low-risk group  (P < 0.001) (P = 0.024)  . SubMap < 0.001) . Here, S= 0.024) .MGMT methylation status on the chemosensitivity to TMZ in GBM patients. Since the immune-gene-based signature was built based on the MGMT methylation status, we investigated whether this risk model can be used as an effective indicator for stratifying patients into different subgroups which may show distinct sensitivities to TMZ treatment. In both the TCGA and CGGA RNA-seq cohorts, whole GBM samples were divided into two groups according to their TMZ-based chemotherapy history, and then survival analyses for patients with high and low risk were carried out. In the TCGA cohort, patients who received TMZ treatment showed significantly better prognosis than those without chemotherapy in the high-risk group  (P > 0.05)  (P > 0.05) (P < 0.001) and CGGA RNA-seq  cohorts (There is a large body of work implicating the influence of = 0.003) , while n > 0.05) . As we m= 0.027) , while n > 0.05) . As for  cohorts , while n cohorts . These fTo develop a quantitative tool for predicting the prognosis of GBM patients in the TCGA cohort, we established a nomogram by integrating clinicopathological risk factors and immune gene signature based on the multivariable Cox proportional hazards model . The poiIn silico analysis revealed that all these five key genes in the risk signature were more highly expressed in the MGMTU GBM samples. Here, we further validated the protein expression levels of these genes in our clinical specimens. Fifteen GBM samples were divided into MGMTM (n = 8) and MGMTU (n = 7) groups according to the MGMT promoter methylation status. The detailed PSQ results of the samples were illustrated in MGMTU groups compared with the MGMTM samples   . These re scores .CD68 and CD14  than those of the control group  and Th1 cells by binding to its native ligand TNFSF9  signaling and further suppresses the development of pancreatic ductal adenocarcinoma  was carried out to test the efficacy and safety of nivolumab alone vs. bevacizumab , CGGA (http://www.cgga.org.cn/), and GEO database (https://www.ncbi.nlm.nih.gov/geo/).Publicly available datasets were analyzed in this study. These data can be found here: TCGA (The studies involving human participants were reviewed and approved by the ethics committee of the First Affiliated Hospital of Nanjing Medical University. The patients/participants provided their written informed consent to participate in this study.PZ, LZ, and JZ: conception and design. PZ: administrative support. LZ, SX, and YW: provision of study materials or patients. LZ, SX, JZ, and ZL: collection and assembly of data. LZ and JZ: data analysis and interpretation. All authors: contributed manuscript writing and final approval of manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Pancreatic cancer is refractory to most current treatment options. Immunotherapy emerges as an effective and novel therapeutic strategy for several solid tumors. However, most of the clinical trials on immunotherapy have failed in pancreatic cancer. Understanding the underlying mechanism that drives immune evasion of pancreatic cancer is critical for overcoming resistance to therapy. Recently, Dr. He Ren and colleagues proposed a novel concept that a subset of epithelial cells in pancreatic cancer mimics the phenotype and function of regulatory T cells, named as \u201cquasi-regulatory T cells.\u201d These cells contribute to enhanced immune evasion, angiogenesis, and metastasis of pancreatic cancer, thus providing potential therapeutic targets to improve the sensitivity of immunotherapy for this devastating disease. This ground-breaking concept will advance our understanding on the immune evasion of pancreatic cancer and chart novel paths towards the development of personalized treatment for pancreatic cancer. Pancreatic adenocarcinoma (PDAC) remains the most lethal cancer with an overall 5-year survival rate of 10%. Current standard therapies for PDAC have rarely achieved long-term remission even in patients at early stages. Moreover, PDAC appears to be refractory to the immunotherapy, partially due to the tumor immunosuppressive microenvironment (TIM) [+Tregs to mediate immune evasion. This study uncovered the interaction between different types of FOXP3+ cells and indicated that the tumor-intrinsic factors could serve as potential biomarkers to predict the response of treatments that target Tregs [+ T cells. Thus, c-FOXP3 represents a key factor in reprogramming the tumor immune microenvironment [Dr. He Ren and colleagues have recently published a series of papers focusing on understanding the role of immune regulatory factors derived from malignant epithelial cells \u20137. They et Tregs . Immune-Interleukin 35 (IL-35) is a potent immune inhibitory cytokine primarily expressed by Tregs. Ren and collaborators found that IL-35 was highly expressed in the malignant epithelial cells of PDAC and associated with poor prognosis. Meanwhile, IL-35 stimulated ICAM1 expression via STAT-1 and mediated PDAC extravasation and metastasis . This fiTGF-\u03b2 is a classic immune inhibitory cytokine, expressed by multiple cell types including pancreatic cancer cells. Ren has recently found that EHF, one of the epithelium-specific ETS (ESE) transcription factors, negatively regulated the transcription of TGF-\u03b2 . In pancTaken together, Ren and colleagues described the characteristics of cell-intrinsic factors that mimic the phenotype and function of Tregs. They firstly showed that a subtype of \u201cquasi-regulatory T cells\u201d exist during pancreatic tumorigenesis. These cells increased the secretion of several critical immune regulatory factors by the upregulation of FOXP3 and downregulation of EHF. In addition, overexpression of PD-L1 and loss of E-Cadherin could be used as the surface marker of \u201cquasi-regulatory T cells.\u201d Previous studies of TIM mainly focused on the infiltrating immune cells and stromal cells. This ground-breaking concept will advance our understanding on the immune evasion of pancreatic cancer and chart novel paths towards the development of personalized treatment for pancreatic cancer (Fig.\u00a0In future studies, several key questions need to be answered to better understand the underlying mechanisms of \u201cquasi-regulatory T cells\u201d driven immune evasion of PDAC. First of all, during the development of pancreatic cancer, what is the master regulator that controls the formation of \u201cquasi-regulatory T cells\u201d? Secondly, how to identify the biological effect of \u201cquasi-regulatory T cells\u201d during pancreatic tumorigenesis? Last but not the least, what is the difference between the transcriptomic networks of quasi-regulatory T cells and regulatory T cells in the same PDAC tissue? Through further investigation of those questions, we should be able to better understand the biology of PDAC, especially on immune evasion, and develop novel therapeutic targets to improve the effectiveness of immunotherapy in PDAC."}
{"text": "Ptyodactylus guttatus) ranging in body mass between 4.2\u201311.5\u2009g.\u00a0We then\u00a0 used this calibrated\u00a0 DXA measurements to determine the best linear measurement calculated CI for this species. Condition indices (CIs) are used in ecological studies as a way of measuring an individual animal\u2019s health and fitness. Noninvasive CIs are estimations of a relative score of fat content or rely on a ratio of body mass compared to some measure of size, usually a linear dimension such as tarsus or snout-vent length. CIs are generally validated invasively by lethal fat extraction as in a seasonal sample of individuals in a population. Many alternatives to lethal fat extraction are costly or time consuming. As an alternative, dual-energy X-ray absorptiometry (DXA) allows for non-destructive analysis of body composition and enables multiple measurements during an animal\u2019s life time. DXA has never been used for ecological studies in a small, free-ranging lizard before, therefore we calibrated this method against a chemical extraction of fat from a sample of 6 geckos . Fat percentage regressed with body mass significantly predicted the DXA fat percentage . Live wet mass was significantly correlated with predicted fat mass  for specimens more than 4.8\u2009g. Among the five calculated non-invasive CIs that we tested, the best was mass/SVL.We found that fat mass measured with DXA was significantly correlated with the mass of chemically extracted fat for specimens more than 4.8\u2009g  for both sexes. Branta bernicla bernicla, [Neochmia phaeton, [Odocoileus virginianus, [Suricata suricatta, [Callospermophilus lateralis, [Chelonia mydas, [Zootoca vivipara, [Body condition is a term used by ecologists to rank the \u2018quality\u2019 of an individual animal, usually in relation to the amount of energy reserves  an animal has available . Many anernicla, ), reprodphaeton, ), foragiinianus, ; meerkatricatta, ), survivteralis, ), diseasa mydas, ) and disivipara, ). It is ivipara, . In popuivipara, , 34.Body fat, due to its high energy content, is the best measure of body condition of an animal . Body faBioelectrical Impedance Analysis (BIA) appears to be a better predictor of body fat than body condition estimates calculated from mass and SVL . HoweverMacaca mulatta ; measuridation, ), identiidation, ), determviduals, ) and chaviduals, ). In repviduals, , 37 whicviduals, , 28). Inviduals, ).\u00a0The usPtyodactylus guttatus inhabited the premises [The study was conducted at Midreshet Ben-Gurion in the northern Negev desert, Israel (30\u00b051\u20328.27\u2033N 34\u00b047\u20320.24\u2033E) from summer 2003 until autumn 2004. The study site was a complex of guest rooms surrounded by a two-meter high wall over an area 13x150m. A dense population of the Israeli fan-toed gecko premises . The Isrpremises , 45\u00a0Zlotpremises  in the fpremises , 47, 201premises , 46).Ohaus digital scale to 0.1\u2009g precision, snout-vent length (SVL), using digital calipers, and the width at the base of the tail. Six additional individuals were captured and euthanized for the calibration necessary for this study  The smallest gecko (55.6\u2009mm) with body mass 4.2\u2009g was excluded to improve accuracy from 55 to 8.5% error. The snout vent length (SVL) of these geckos was 61.5\u201391.7\u2009mm and their body mass 4.8\u201311.5\u2009g. We killed only six geckos in order to minimize destructive sampling as much as possible.Fifty-five geckos were hand captured, measured (morphometrics) and scanned (DXA) and released at the site of capture. Of these, 30 gecko\u2019s scan data were included in the comparison, since their body mass was above the lowest possible accurate reading with minimal body mass (>\u20094.8\u2009g) as indicated in the results Table\u00a0. The snoGeckos were anesthetized using cotton balls wet with Isofluran which was inserted with the gecko in a sealed jar for a minute or less until the gecko stopped moving. To obtain the DXA measurements, each gecko was scanned twice using a Lunar PIXImus\u00ae 2 densitometer . Each sThe DXA machine protocol was designed for 10\u201350\u2009g. laboratory mice , but it R2 and P values. For statistical analysis, we used SPSS (version 20).We used backward selection mode of a step-wise regression to test the relation between DXA values of body mass and the values determined from the chemical analysis of body composition. Single and multivariate regression models were then constructed to predict the fat mass from DXA readings. We report the results of our statistical analysis in terms of their N\u2009=\u20096, R2\u2009=\u20090.834, P\u2009=\u20090.011; Fig.\u00a0N\u2009=\u20095, R2\u2009=\u20090.995, P\u2009<\u20090.001; Fig. R2\u2009=\u20090.995) and a lack of significant difference between fat content by chemical extraction and by DXA estimation .Six geckos were used for the validation portion of this study Table . The valN\u2009=\u200930, R2\u2009=\u20090.984, P\u2009<\u20090.001; Fig. N\u2009=\u20095, R2\u2009=\u20090.995, P\u2009<\u20090.001.To determine the accuracy of the DXA in calculating mass compared to actual weighed mass, we compared all lizards above 4.8\u2009g. The DXA body fat readings were highly correlated to live wet mass (linear regression: P\u2009=\u00a00.045) but the percentage of explained variation was low (R2\u2009=\u20090.136). We regressed a multivariate regression model, constructed with mass and DXA machine fat percentage  as variants to predict the correct fat percentage: N\u2009=\u200930, R2\u2009=\u20090.847, R2adj.\u2009=\u20090.836, P\u2009<\u20090.001; y\u2009=\u2009\u2212\u200930.412\u2009\u00b1\u20093.669\u2009+\u20091.523\u2009\u00b1\u20090.157(xFat%)\u2009+\u20091.289\u2009\u00b1\u20090.151(xMass) \u2009+\u20091.903\u2009\u00b1\u20090.179(xMass).A simple linear regression of calculated  vs. DXA machine\u2019s predicted fat percentage was significant ( R2\u2009=\u20090.16. We regN\u2009=\u200929), and did not significantly depart from a normal distribution . Females tended to have a higher percentage of their body mass as fat  compared to males (7.94\u2009\u00b1\u20094.19); however, this difference was not significant .Average total body wet mass was 11.1\u2009\u00b1\u20097.0% body fat  mass/SVL3.We applied five different morphological condition indices that are commonly used on reptiles to the 30 geckos in the dataset in order to determine their accuracy. The indices tested were 1) width of tail base; 2) ordinary least squares (OLS) linear regression of body mass (g) against SVL (mm); 3) mass/SVL; 4) mass/SVLP\u2009<\u20090.05). The correlations between calibrated body fat percentage and body condition indices was largest for the mass/SVL index. The correlation coefficient was highest for the Mass/SVL index > mass/SVL2\u2009>\u2009width of tail base > Mass/SVL3\u2009>\u2009OLS  and not significant for females.All body indices were highly correlated with each other , a non-destructive method that accurately measures fat mass in humans and other mammals, could be used to determine the fat mass in the small, common Israeli fan-toed gecko. We found that the lowest value for body mass calculation by the DXA machine and that was still accurate was 4.8\u2009g. Thus, when we exclude the smallest gecko (4.2\u2009g), we found that DXA and chemical extraction of fat mass were significantly correlated. It should be stressed that the validation sample size was small and there were not enough individuals to explore sex differences, so further exploration of the technique is warranted. Regression equations using DXA values were able to predict the fat mass and total gravimetric body mass accurately with an average error of 8.55 and 3.5% respectively. Using the predicted DXA values, we were able to test common body condition indices against both actual and predicted DXA values and show that mass/SVL was the most accurate method for estimating the condition index of these small lizards. Measuring the tail base width was not correlated with females body percentage; however for males, it was more accurate than mass/SVL. Females and males may differ in their patterns of fats storage, which might explain why the tail base width was not correlated with fat percentage in females, while it was the best indicator for fat percentage in males.2) predict the fat mass of diamondback water snakes (Nerodia rhombifer) with significantly different values from the DXA and chemical analysis results (mean error ranging from 20 to 41%). Weatherhead & Brown [N. sipedon). Other methods for the estimation of fat percentage  have been fairly successful in predicting body condition, but again they lack accuracy  and DXA (this study). The mean error percentage for fat mass we calculated for using DXA was 8.55% when the animal body mass was more than 4.8\u2009g. This percentage designated the difference between the fat mass predicted by the model and the fat mass that was extracted chemically. The mean error of the wet body mass was even lower, at 3.5%. Thus, the body index method we used\u2014measurement\u00a0of body fat% by DXA\u2014 was proved to be most reliable and highly correlated to chemically extracted\u00a0body fat.Previous work on reptile body condition indices and non-destructive sampling have been notoriously inaccurate. Secor and Nagy  found th & Brown  found anccuracy . Total ote that  found thWe found that DXA was a reliable rapid and accurate means to predict fat mass and body mass in live small lizards. It enables a researcher to accurately track seasonal and ontogenetic changes in an individual and to correlate these changes to fitness traits. The DXA machine and software were easy to use, and such machines are widely available due to DXA use in human medicine. The cost for such a machine solely for use on wildlife would be prohibitive , but as a secondary use for machines already purchased for medical or veterinary laboratories, DXA becomes a cost-effective option. While cost is always a drawback for DXA, we suggest its primary benefit is to select the most accurate CI of the non-invasive methods. A validation study is required to generate the predictive models necessary to know which CI is the most accurate; the sacrifice of study animals becomes then a serious liability for studies on rare species. Another disadvantage is the necessity that subjects remain absolutely still, which requires anesthesia. In a pilot trial, we attempted to place the lizards in the freezer prior to the trial to prevent them from moving during the scanning phase, but this proved unreliable and had to be substituted with an anesthesia which can prove fatal in overdose.r\u2009=\u20090.961). This result concerning tail width should be explored in other species of lizards in order to understand if this specific measurement is a general basic physiological difference between the sexes.As a final note on practicalities, when comparing five common traditional CI\u2019s, we found that mass/SVL was the index with the highest correlation coefficient to the DXA estimates. We conclude that when DXA is not available, mass/SVL is the most reliable alternative index for this species and should be used unless actual fat mass is required. In situations where more accuracy is needed, DXA is a suitable method for small lizards. An interesting question raised here is the insignificant correlation between females tail base width and fat percentage, while in males it was the best predictor ("}
{"text": "C-reactive protein (CRP) is a commonly used serum biomarker for detecting sepsis in neonates. After the onset of sepsis, serial measurements are necessary to monitor disease progression; therefore, a non-invasive detection method is beneficial for neonatal well-being. While some studies have shown a correlation between serum and salivary CRP levels in septic neonates, the causal link behind this correlation remains unclear. To investigate this relationship, CRP was examined in serum and saliva samples from 18 septic neonates and compared with saliva samples from 22 healthy neonates. While the measured blood and saliva concentrations of the septic neonates varied individually, a correlation of CRP levels between serum and saliva samples was observed over time. To clarify the presence of active transport of CRP across the blood\u2013salivary barrier (BSB), transport studies were performed with CRP using in vitro models of oral mucosa and submandibular salivary gland epithelium. The results showed enhanced transport toward saliva in both models, supporting the clinical relevance for salivary CRP as a biomarker. Furthermore, CRP regulated the expression of the receptor for advanced glycation end products (RAGE) and the addition of soluble RAGE during the transport studies indicated a RAGE-dependent transport process for CRP from blood to saliva. Neonatal sepsis and other neonatal infections account for 0.88% of all disability adjusted life years worldwide, demonstrating similar percentages compared with motor vehicle road injuries 0.98%) and asthma 0.91%) [% [1]. Ne8% and asFor the detection of neonatal sepsis CRP measurement has a sensitivity of 74\u201398% and a specificity of 71\u201394% performed at least 12 h after the onset of symptoms . Serial Recent developments in salivary biomarker analysis favor the usage of saliva as a non-invasively collected diagnostic fluid. As the serum/salivary ratio of biomarker concentrations varies between biomarkers , sensitiWhile previous clinical studies with neonates indicated a positive correlation of salivary CRP with serum CRP concentrations ,17, a thSince local inflammation of the oral mucosa may contribute to elevated CRP levels in saliva ,24, diffThis prospective observational part was conducted at the Division of Neonatology, Pediatric Intensive Care and Neuropediatrics at the Medical University Vienna/General Hospital Vienna, a tertiary care academic center, consisting of two separated neonatal intensive care units , two separated neonatal intermediate care units , and 38 beds on the maternity ward with rooming-in care. This part of the study was approved by the Ethics Committee of the Medical University of Vienna  and was performed in two phases. Phase one focused on determining the salivary CRP values in healthy neonates. This was limited to randomly selected neonates born at \u226533 weeks of gestational age and a birthweight of \u22651500 g admitted to the maternity ward without chromosomal aberrations, congenital malformations or inborn metabolic disorders upon obtaining parental informed consent. Saliva sampling was performed at earliest 12 h after birth and earliest 30 min after feeding in clinically healthy neonates. Phase two consisted of evaluation of a correlation between CRP values in saliva and blood. Neonates between 23 and 42 weeks of gestational age admitted to the NICUs or NIMCUs with serum CRP measurements were randomly selected and parental informed consent was obtained. Saliva sampling was performed at the earliest timepoint within 10 h of serum CRP determination and at a minimum of 30 min after feeding without any residues of food present. This time point was chosen based on the time needed for significant changes in CRP values after onset of sepsis of more than 10\u201312 h and to allow for ideal implementation in the care of critically ill preterm and term infants .In all patients, saliva was collected using the PediaSAL device  especially developed for preterm and term infants. This device is designed as \u201cpacifier\u201d with a passive collecting system based on a sponge. This allows to obtain saliva samples of neonates enabling a non-invasive painless sampling with minimal stress. Due to different age and bodyweight of the included neonates, the sponge was used for collection to allow for optimum patient-oriented sampling.Saliva sampling was most efficient when performed 60\u2013120 min after feeding. To maximize the amount of collected saliva, the following technique proved to be useful: The neonate\u2019s head was placed to the left or right, independent of supine or prone position. A pacifier of according size was offered for 5 min prior to sampling. An increase in the saliva production was achieved by gently stroking the lips with the pacifier or the device. After at least five minutes with the pacifier, the sampling device was placed in the downward cheek of the neonate, where the produced saliva collected. If the amount of saliva was not sufficient, swapping to the pacifier for another 2 min and then back to the sampling device helped. This was sometimes repeated several times. After sampling, the samples were continuously cooled. Saliva was stored within 15 min at \u221220 \u00b0C and subsequently 2 h at \u221280 \u00b0C until transport to the laboratory. Transportation was performed under continuous cooling at \u221278 \u00b0C using dry ice.\u00ae 250/350 and VITROS\u00ae 5600 System  or using the Cobas 6000 Chemistry Analyzer .Determination of CRP concentration in serum was performed by the Department of Laboratory Medicine of the Medical University Vienna, Vienna, Austria using the VITROS\u00ae Systems was performed with VITROS\u00ae CRP slides  and VITROS\u00ae Chemistry Products Calibrator Kit 7 . For detection based on an HRP conjugated monoclonal anti-CRP antibody a drop of sample was applied on the slides and measured at wavelength 670 nm upon preparation according to the manufacturer\u2019s instructions. Measurement was performed at a concentration range of 5\u201390 \u00b5g/mL with a limit of detection determined as 2.72 \u00b5g/mL by the manufacturer.Analysis of CRP using the VITROSFor detection of serum CRP concentrations with Cobas 6000 Chemistry Analyzer the CRP-hs reagent kit  was used according to the manufacturer\u2019s instruction. Serum was separated from the cells within one hour of collection and stored at \u221270 \u00b0C until measurement. Samples were thawed at room temperature, homogenized, and centrifuged at 2000 rcf for 10 min prior to applying 100 \u00b5L for measurement using the c501 module based on a photometric and ion-selective electrode determination. For quality controls an internal pooled serum sample and Precipath U Plus Control  was used. Detection limit was determined as 0.15 \u00b5g/mL for an analytical measurement range up to 20 \u00b5g/mL according to the manufacturer.CRP concentration in saliva was determined using ELISAs by the Molecular Diagnostic Unit at AIT, the Austrian Institute of Technology, Vienna, Austria, and is described in detail in \u00ae, 690175) in Dulbecco\u2019s Modified Eagle Medium , supplemented with 10% Fetal Calf Serum  and 1% Penicillin/Streptomycin  at 37 \u00b0C, 5% CO2, 95% air atmosphere, and 95% humidity. Media change was performed every 2\u20133 days and cells were propagated weekly at a cell seeding concentration of 9.33 \u00d7 103/cm2. For transport studies TR146 were seeded at a cell density of 4.29 \u00d7 104/cm2 in 300 \u00b5L DMEM supplemented with 10% FCS and 1% Pen/Strep (DMEM media) on 24-well ThinCerts  with 900 \u00b5L DMEM media provided on the basolateral compartments in 24-well plates . To isolate protein, TR146 were seeded at a cell density of 4.29 \u00d7 104/cm2 in 2 mL DMEM media on 6-well ThinCerts  with 3.5 mL DMEM media provided on the basolateral side. As soon as cells reached confluency on day 5 or 8 the cultivation condition was switched from submerged to airlift and basolateral DMEM media was changed to DMEM media supplemented with 1% Human Keratinocytes Growth Supplements . Media change was performed every 2\u20133 days for four weeks. Cells were used from passage 13\u201338 for the experiments. The human buccal carcinoma cell line, TR146, was purchased from Sigma-Aldrich  and cultured in T25 flasks  was cultivated in T25 flasks in McCoy\u2019s 5A , supplemented with 10% FCS and 1% Pen/Strep, termed as McCoy media, at 37 \u00b0C, 5% COclone B2 . Cells wOn the day of experiment, cell layers of TR146 were washed twice on the apical (300 \u00b5L) and basolateral (900 \u00b5L) side with Hank\u2019s Balanced Salt Solution , while cell layers of the B2 clone were washed twice with basal McCoy media (McCoy\u2019s 5A without supplements). TEER was measured in both models , sRAGE was dissolved in PBS  to 100 \u00b5g/mL and subsequently diluted 1:20 in HBSS or basal McCoy containing 1% TRIS, 5% PBS, and 10 \u00b5g/mL CRP shortly before the experiment. Media composition was adapted accordingly for all samples and controls during transport studies. Samples on the apical and basolateral side were collected after 24 h and stored at 4 \u00b0C until quantification with ELISA. Cell layers of two 24-well ThinCert were lysed with 350 \u00b5L RA1 buffer  supplemented with 1% \u00df\u2014Mercaptoethanol and pooled as one biological sample for RNA isolation.Transparent high-binding 96-well plates  were coated with 100 \u00b5L 2 \u00b5g/mL Human CRP antibody  in PBS  overnight at 4 \u00b0C under orbital shaking conditions sealed with aluminum foil. Prior to usage on the next day, each well was washed three times with 300 \u00b5L PBS containing 0.05% Tween 20  and blocked with 300 \u00b5L/well carbonate-bicarbonate buffer  containing 1% BSA  for 1.5 h at room temperature under orbital shaking conditions sealed with aluminum foil. Consecutively, wells were washed three times with 300 \u00b5L/well 0.05% Tween 20/PBS prior to applying the samples.TM Ultra TMB-ELISA substrate solution  was added and the plate was incubated in the dark for 20 min at room temperature.Samples from the transport studies of the receiving compartment were diluted 1:50; applied CRP or CRP/sRAGE stock solutions 1:2000 in HBSS or basal McCoy containing 1% TRIS for transport studies with CRP and in HBSS or McCoy containing 1% TRIS and 5% PBS for transport studies with CRP and sRAGE. A calibration curve  with Human CRP Standard Antigen  was prepared in the respective HBSS or basal McCoy composition used for the dilution of the samples. The diluted samples and the samples for the calibration curve were additionally diluted 1:2 in PBS containing 1% BSA and 20 mM EDTA  in a non-binding 96-well plate  and applied as duplicates with 100 \u00b5L/well on the previously coated high binding 96-well plate. The plate was incubated for 1 hour at room temperature sealed with aluminium foil under orbital shaking conditions. Afterwards, wells were washed three times with 300 \u00b5L/well 0.05% Tween 20/PBS following an incubation step with 100 \u00b5L/well of 30 ng/mL detection antibody  diluted in PBS containing 1% BSA (1% BSA/PBS) for 1 h at room temperature sealed with aluminum foil under shaking conditions. After further washing steps, applying 300 \u00b5L/well 0.05% Tween 20/PBS for three times, 100 \u00b5L/well streptavidin-HRP , diluted 1:200 in 1% BSA/PBS, was added and incubated for 20 min under shaking conditions sealed with aluminum foil at room temperature. After washing three times with 0.05% Tween 20/PBS, 100 \u00b5L/well 1-Step\u00ae 2300 Multimode Plate Reader . Permeability coefficient was calculated as apparent permeability values (Papp) in [cm/s] using the formula shown below (Equation (1)) with crec as a measured concentration in the receiving side in \u00b5g/mL, Vrec the volume on the receiving compartment in mL, A as the area in cm2, c0 as the stock solution in \u00b5g/mL, and t as duration in seconds.To stop the reaction 50 \u00b5L/well of 1 M HCl  was added and absorbance was measured at 450 nm with the EnSpire\u00ae 2300 Multimode Plate Reader  at 450 nm as described above. Due to the small saliva volumes of neonates in the range of 30\u2013100 \u00b5L, the ELISA method from TM Sybr Green Kit . Primer sequences are shown in For RNA isolation of cell lysates, the NucleoSpin RNA Kit  was used according to the manufacturer\u2019s instruction and eluted with 40 \u00b5L nuclease-free water . For cDNA synthesis with the Multiscribe Reverse Transcriptase Kit  200 ng RNA were applied for clone B2 while 1000 ng RNA were applied for TR146. Quantitative real-time PCR was performed as triplicates in white 96-well plates  with 20 \u00b5L reaction volume consisting of 4 \u00b5L 1:10 in nuclease-free water diluted cDNA, 2.8 \u00b5L 3 \u00b5M primer pairs, 3.2 \u00b5L nuclease-free water, and 10 \u00b5L PowerUpThe program for qPCR was set for 20 sec at 95 \u00b0C for activation, running 40 cycles for 3 s at 95 \u00b0C, and 30 s at 60 \u00b0C, following a melting stage of 15 s at 95 \u00b0C, 1 min at 60 \u00b0C, and 15 s at 95 \u00b0C using the LightCycler 480 II . Data was acquired with the LightCycler480 V1.5 software .For data analysis, \u0394Ct values were calculated by subtracting Ct vales of the endogenous control from the respective Ct values of the analyzed target. \u0394Ct values of treated samples were normalized to untreated samples upon exponentiating by 2 as shown with the formula below (Equation (2)).On the day of the experiments, cell layers seeded on 6-well ThinCert were washed twice with HBSS (TR146) or basal McCoy (clone B2) on the apical and basolateral side prior to the incubation with HBSS or basal McCoy containing 10 \u00b5g/mL CRP or 1% 20 mM TRIS and 280 mM NaCl on the apical and basolateral side for 24 h. Afterwards, cell layers were washed twice with pre-cooled PBS and incubated for 5 min in PBS after the last washing step on ice. For lysis, 50 \u00b5L RIPA buffer , supplemented with complete ULTRA protease inhibitor cocktail and PhosphoSTOP minitablet  was added for 30 min on ice. Protein lysates were collected with a cell scraper, and protein concentration was determined with Pierce BCA assay kit  according to the manufacturer\u2019s instructions.Western blotting was performed as described in detail previously ,28. In st-test, or two-way ANOVA followed by post-hoc Holm-Sidak test with \u03b1 = 0.05, p < 0.05 *, p < 0.01 **, p < 0.001 ***.Results are shown as mean \u00b1 SEM unless otherwise indicated. Graphs and statistical analysis were illustrated or performed with SigmaPlot 14.0 . Statistical analysis was performed as Mann-Whitney Rank Sum test, Student\u2019s In this study, 18 neonates  undergoing sepsis were investigated on their CRP levels in serum and saliva  resulting in a median ratio between salivary and serum concentration of 1600 . However, comparing all measured saliva to serum concentrations (n = 33) led to a highly significant correlation between clinical saliva and serum values  as shown in Estimated values of CRP in serum and saliva at time point of sepsis varied with 76.40 \u00b1 79.79 \u00b5g/mL in serum and 93.70 \u00b1 161.01 ng/mL in saliva .For comparison of salivary CRP concentrations from septic neonates to baseline saliva levels, samples from 22 healthy neonates .To study a possibly directed transport in more detail, 10 \u00b5g/mL CRP was applied on the basolateral (B/A) or apical side (A/B) for 24 h in the oral mucosa and the salivary gland epithelium model. Significant barrier properties of both in vitro models were confirmed by TEER values of 238.88 \u00b1 54.92 \u2126 \u00d7 cmapp values for the oral mucosa model resulted in a 2.58 \u00b1 0.39-fold higher permeability of CRP from B/A upon normalization to Papp values from A/B , shown in p < 0.001; A/B Papp: 0.013 \u00b1 0.001 \u00d7 10\u22126 cm/s, B/A Papp: 0.029 \u00b1 0.003 \u00d7 10\u22126 cm/s). In summary, these data clearly indicated the presence of a directed transport mechanism for CRP across the in vitro models of the BSB.Apparent permeability PPrevious literature indicated the involvement of RAGE in inflammatory response upon treating endothelial progenitor cells with CRP , followeapp values described above. To examine a possible involvement and regulation of RAGE by CRP, cell samples from the transport studies were analyzed and compared to untreated cell samples at the mRNA and protein level. As a result, the mRNA regulation showed a similar tendency as the Pp = 0.56). On the contrary, applying CRP in the salivary gland model on the basolateral (B/A) side led to a significant downregulation to 0.85 \u00b1 0.06-fold for RAGE compared to an upregulation of 2.14 \u00b1 0.65-fold upon applying CRP on the apical (A/B) side , 1.41 \u00b1 0.22-fold (A/B), /B) side A,B.p < 0.05) compared to control samples with 1.00 \u00b1 0.04 (mean \u00b1 SEM)  E,F.p < 0.01, Papp: A/B 0.12 \u00b1 0.017 \u00d7 10\u22126 cm/s, B/A 0.22 \u00b1 0.030 \u00d7 10\u22126 cm/s), similar to above. Upon normalization to Papp values from A/B, the addition of sRAGE led to a similar apparent permeability value of CRP from A/B , but decreased the transport of CRP from B/A significantly to 1.50 \u00b1 0.08-fold  in comparison to transport of CRP from B/A without addition of sRAGE.To investigate the role of RAGE on the transport of CRP, transport studies with 5 \u00b5g/mL soluble RAGE (sRAGE) and 10 \u00b5g/mL CRP on the basolateral or apical side were performed and compared to the permeability of CRP alone in both models for each experiment. In the oral mucosa model, transport of CRP from B/A showed a 2.22 \u00b1 0.21-fold higher permeability compared to A/B  compared to CRP alone from A/B . In case of the transport B/A, addition of sRAGE resulted in a significantly upregulated permeability of CRP ) compared to CRP alone   .CRP is widely used as an inflammatory biomarker in serum and associated with cardiovascular diseases at levels >10 \u00b5g/mL . Recentl2 of 0.53 \u00b1 0.23, comparable to the result of our study with a R2 value of 0.52  were concordant to the corresponding TEER values of the models and confirmed the stronger paracellular tightness of the salivary gland model.For this purpose, we applied 10 \u00b5g/mL CRP in our oral mucosa and salivary gland model, as CRP concentrations of >8.7 \u00b5g/mL are associated with infections (together with high temperature), and clinically relevant concentrations of 10\u201320 \u00b5g/mL have also been used for studies with in vitro models of the blood\u2013brain barrier previously ,46. WhilSince literature data indicated a linkage between RAGE and CRP ,47, we tThis revealed that mRNA levels of RAGE are subject to regulation by CRP in an exposure side dependent manner. With regulation of RAGE after CRP treatment on the protein level, we decided to examine the possible involvement of RAGE in the transport of CRP. For this, we added soluble RAGE (sRAGE) to CRP for further transport studies.In the oral mucosa model, this resulted in a significantly decreased permeability of CRP from B/A, while addition of sRAGE in the salivary gland model led to a significantly enhanced transport from B/A . In detaCorresponding to the detected correlation of CRP in saliva and serum samples of neonates undergoing sepsis, both in vitro models of the BSB showed an elevated transport of CRP in the direction of saliva. While the favorable transport to saliva was shown in this study and the influence of RAGE on CRP transport was described, further studies regarding the underlying mechanisms would improve our current knowledge about the causal link between serum and salivary CRP and strengthen the relevance of CRP as a salivary biomarker in general. Future studies could aim at the identification of the responsible transporters, for example, by immunoprecipitation followed by mass analysis to screen for proteins binding to CRP in the cellular membrane fraction.In this study on measurement of serum and salivary CRP levels, clinical data suggest that studying individual ratios and progression is more useful than relying on the measurement of a single time-point. Additionally, in vitro data using established models of the BSB show that CRP is preferentially transported to the direction of saliva, enhancing its feasibility as a salivary marker. Moreover, RAGE seems to be involved in the transport of CRP across the BSB. Future studies could focus on elucidation of the details of the transport mechanism of CRP across the BSB."}
{"text": "Cinchona alkaloids is widened by 6\u2032-Amino-cinchonine and 6\u2032-Amino-cinchonidine, novel compounds which incorporate a primary amino function in the quinolinic ring system. These key intermediates open the field for a range of fruitful chemistry. Here is described a short and direct pathway for the synthesis of triazole containing derivatives of the above-mentioned substances using the [3 + 2] Huisgen cycloaddition. For this purpose, the amines were first converted into the corresponding azides. Based on this, non-substituted and silyl-protected triazoles were synthesized as examples. Furthermore, didehydrated derivatives of quincorine and quincoridine were used as addition partners, resulting in compounds that carry the quinuclidine ring of the cinchona alkaloids at both ends. Some of these compounds were examined radiographically to investigate the position of the quinuclidine ring to the triazole. The solid-state structures of compounds 10, 11 and 28 were determined by X-ray diffraction analyses.The substance class of the well-known  The protocol could also be successfully applied to amines 2 to 6 with similarly good yields .Azides 22 and didehydrocincorine 23 . Two trends can be observed. The yields in the cinchonidine series  were better than in the cinchonine series . Although the difference is not strikingly large, it cannot be ignored. Furthermore, in three pairs, the yields of the hydrogenated compounds were higher than the yields of the corresponding vinyl species.The synthesis of compounds 10 and 11  can be generated by desilylation of the compounds 14, 16, 18, 20. Overall, all reactions proceeded with good purity and good to very good yields. The aim of future work will be to investigate the potential of these compounds in, for example, catalysis or medicinal chemistry. In terms of structural chemistry, the intramolecular cyclisation of azide alkynes 5 and 6 is a challenge for every synthetic chemist.The aim of this work was to investigate the synthetic potential of 6\u2032-Amino-cinchonine 1, 6\u2032-Amino-cinchonidine g azides . Since tAll reagents were purchased from commercial sources  and used without further purification. The solvents used were of analytical grade. The 1H and 13C NMR spectra were recorded at room temperature on a Bruker Avance 300, Bruker Avance 400 or Bruker Avance 600, operating at 300 MHz, 400 MHz or 600 MHz for 1H and 75 MHz, 100 MHz or 150 MHz for 13C. Chemical shifts (\u03b4) were reported as relative to the tetramethylsilane peak set at 0.00 ppm. In the case of multiplets, the signals were reported as intervals. The signals were abbreviated as s, singlet; d, doublet; t, triplet; q, quadruplet; and m, multiplet. Mass spectra were recorded on a Finnigan MAT 8400-MSS and Finnigan MAT 4515. High resolution mass spectra were recorded on a Finnigan MAT 95 XP. The reactions were monitored by TLC and performed on silica gel plates 40 \u00d7 80 mm Polygram Sil G/UV254 (Macherey-Nagel). Visualization on TLC was achieved by UV light. Column chromatography was performed with Merck silica gel 60 (70\u2013200 mesh).Cinchona core followed the rules of Paul Rabe, with the side chain numbered based on the IUPAC rules.The numbering of the 2 (1.2 eq) in H2O (0.33 g/mL) was added to a mixture of Cinchona amine (1.0 eq) and 15% HCl (0.1 g amine/mL) cooled at \u22125 \u00b0C. After the addition was complete, the reaction mixture was stirred at this temperature for 60 min. A solution of NaN3 (1.7 eq) in H2O (0.2 g/mL) was added dropwise to the reaction mixture at 0 \u00b0C. After the addition was finished, the reaction mixture was maintained at 0 \u00b0C for 2 h and then stirred at room temperature for 12 h. The product was precipitated by addition of NaOH (20%) until pH 10. Upon filtration, the solid was washed with distilled water and dried. Crystallization from DCM presented the Cinchona azides as yellow solids in good yields (70\u201390%)General procedure: a dropwise a solution of NaNO(S)-(6-Azidoquinolin-4-yl)-5-vinylquinuclidin-2-yl)methanol (8): the title compound was synthesized from 1  to afford 8  as a yellow-orange solid. 1H-NMR  \u03b4 8.79 , 8.08 , 7.82 , 7.74 , 7.52 , 6.17 , 5.66\u20135.52 , 5.17\u20135.08 , 3.50\u20133.43 , 3.35\u20133.32 , 2.96\u20132.74 , 2.37\u20132.29 , 2.23\u20132.16 , 1.93\u20131.68 , 1.66\u20131.51 , and 1.31\u20131.18 ; 13C-NMR  \u03b4 151.27 , 150.32 , 146.64 ; 141.73 ; 140.31 , 132.14 , 128.03 , 123.87 , 120.87 , 115.15 , 112.90 , 72.49 , 61.27 , 50.82 , 50.19 , 41.29 , 29.65 , 27.20 , and 22.25 ; H,H-Cosy, HSQC and HMBC were made. Melting point: the substance decomposed at T = 173 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.60; IR: see spectrum in the supporting information; HR-MS  was calculated for C19H21N5O1 + H+: 336.18189 Da, found 336.18185 Da.(R)-(6-Azidoquinolin-4-yl)-5-vinylquinuclidin-2-yl)methanol (9): the title compound was synthesized from 2  to afford 9  as a yellow-orange solid. 1H-NMR  \u03b4 8.76 , 8.05 , 7.82 , 7.71 , 7.52 , 5.78 , 5.53\u20135.49 , 5.02\u20134.94 , 3.61\u20133.51 , 3.12\u20132.94 , 2.72\u20132.49 , 2.48\u20132.18 , 1.93\u20131.81 , 1.80\u20131.78 , and 1.72\u20131.50 ; 13C-NMR  \u03b4 151.22 , 150.27 , 146.62 ; 142.78 ; 140.24 , 132.15 , 127.95 , 123.25 , 120.93 , 114.90 , 112.99 , 72.40 , 61.53 , 57.59 , 43.82 , 40.95 , 29.18 , 28.25 , and 22.61 ; H,H-Cosy, HSQC and HMBC were made. Melting point: the substance decomposed at T = 144 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.62; IR: see spectrum in the supporting information; HR-MS  was calculated for C19H21N5O1 + H+: 336.18189 Da, found 336.18183 Da.(S)-(6-Azidoquinolin-4-yl)-5-ethylquinuclidin-2-yl)methanol (10): the title compound was synthesized from 3  to afford 10  as a yellowish solid. 1H-NMR  \u03b4 8.78 , 8.04 , 7.86 , 7.54 , 7.48 , 5.20\u20135.16 , 2.96\u20132.88 , 2.68\u20132.62 , 2.52\u20132.44 , 2.00\u20132.76 , 1.65\u20131.62 ; 1.53\u20131.30 , and 0.86 ; 13C-NMR  \u03b4 150.30 , 149.50 , 145.62 , 136.85 , 131.70 , 126.94 , 121.56 , 119.76 , 112.15 , 70.73 , 61.14 , 49.89 , 49.11 , 37.08 , 27.11 , 26.01 , 25.03 , 24.01 , and 11.90 ; H,H-Cosy, HSQC and HMBC were made. Melting point: the substance decomposed at T = 191 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.50; IR: see spectrum in the supporting information; HR-MS  calculated for C19H23N5O1 + H+: 338.19754 Da, found 338.19756 Da.(R)-(6-Azidoquinolin-4-yl)-5-ethylquinuclidin-2-yl)methanol (11): the title compound was synthesized from 4  to afford 8  as a yellow solid. 1H-NMR  \u03b4 8.78 , 8.05 , 7.91 , 7.55 , 7.51 , 5.18\u20135.13 , 3.21\u20132.98 , 2.87\u20132.77 , 2.45\u20132.31 , 2.18\u20132.06 , 1.71\u20131.50 , 1.40\u20131.15 , and 0.86 ; 13C-NMR  \u03b4 149.87 , 149.50 , 145.75 ; 136.92 , 131.79 , 126.87 , 121.45 , 119.97 , 112.73 , 71.44 ,60.59 , 57.53 , 41.64 , 37.14 , 28.18 , 27.20 , 25.14 , 24.35 , and 12.04 ; H,H-Cosy, HSQC and HMBC were made. Melting point: the substance decomposed at T = 163 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.54; IR: see spectrum in the supporting information; HR-MS  calculated for C19H23N5O1 + H+: 338.19754 Da, found 338.19757 Da.(S)-(6-Azidoquinolin-4-yl)-5-ethynylquinuclidin-2-yl)methanol (12): the title compound was synthesized from 5  to afford 12  as a yellow solid. 1H-NMR  \u03b4 8.73 , 8.07 , 7.68 , 7.53 , 7.36 , 5.58\u20135.48 , 3.28\u20133.20 , 3.18\u20133.09 , 3.03\u20132.94 , 2.84\u20132.74 , 2.68\u20132.55 , 2.51\u20132.44 , 2.28\u20132.16 , 2.15 , 2.07\u20131.93 , and 1.60\u20131.41 ; 13C-NMR  \u03b4 149.50 , 147.93 , 146.11 , 138.16 , 132.22 , 126.81 , 121.60 , 119.47 , 111.73 , 87.31 , 72.01 , 69.31 , 60.25 , 50.28 , 49.41 , 28.03 , 27.86 , 25.11 , and 23.51 ; H,H-Cosy, HSQC and HMBC were made. Melting point: the substance decomposed at T = 112 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.55; IR: see spectrum in the supporting information; HR-MS  calculated for C19H19N5O1 + H+: 334.16624 Da, found 334.16647 Da.(R)-(6-Azidoquinolin-4-yl)-5-ethynylquinuclidin-2-yl)methanol (13): the title compound was synthesized from 6  to afford 13  as a yellow solid. 1H-NMR  \u03b4 8.74 , 8.06 , 7.95 , 7.51 , 7.21 , 5.61\u20135.55 , 3.42\u20133\u20133.34 , 3.24\u20133.16 , 2.98\u20132.88 , 2.75\u20132.61 , 2.61\u20132.48 , 2.44\u20132.37 , 2.16 , 2.06\u20131.94 , 1.90\u20131.89 , and 1.81\u20131.59 ; 13C-NMR  \u03b4 149.65 , 148.02 , 146.31 , 138.27 , 131.97 , 126.86 , 121.53 , 119.67 , 111.68 , 87.26 , 71.87 , 69.21 , 60.62 , 56.31 , 49.42 , 28.17 , 27.96 , 24.94 , and 23.47 ; H,H-Cosy, HSQC and HMBC were made. Melting point: the substance decomposed at T = 96 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.57; IR: see spectrum in the supporting information; HR-MS  calculated for C19H19N5O1 + H+: 334.16624 Da, found 334.16633 Da.Cinchona azide (1 eq.) and trimethylsilyl acetylene (1.5 eq.) were suspended in an H2O: MeOH (1:1) mixture to deliver a substrate concentration of 0.1 M Cu2SO4  and sodium ascorbate . The reaction mixture was stirred at room temperature until complete conversion of the azide (12\u201324 h). After that, the reaction was quenched by adding an aqueous solution of ammonium chloride and ammonium hydroxide (pH 10/12). The mixture was extracted with DCM (three times), and the combined organic layers were dried over anhydrous sodium sulphate, filtered and concentrated in vacuo. The residues obtained were purified by flash column chromatography using MTBE: MeOH as a gradient elution to afford the corresponding TMS-triazole derivatives.General procedure: in a round-bottom flask the corresponding (S)-(6-(4-(Trimethylsilyl)-1H-1,2,3-triazol-1-yl)quinolin-4-yl)-5-vinylquinuclidin-2-yl)methanol (14): the title compound was synthesized from 8  to afford 14  as a colourless wax. 1H-NMR  \u03b4 8.77 , 8.49 , 8.10\u20138.06 , 7.87 , 7.35 , 6.32 , 6.06 , 5.24\u20135.18 , 4.22\u20133.96 , 3.34\u20133.08 , 3.05\u20132.88 , 2.58\u20132.42 , 2.37\u20132.21 , 1.96\u20131.87 , 1.85\u20131.71 , 1.69\u20131.54 , 1.15\u20131.00 , and 0.93\u20130.79  0.46 3); 13C-NMR  \u03b4 150.13 , 147.41 , 146.93 , 146.62 ; 137.55 ; 134.68 , 131.88 , 128.35 , 124.52 , 121.47 , 119.27 , 116.78 , 110.91 , 67.67 , 60.37 , 49.61 , 48.71 , 38.28 , 27.67 , 24.31 , 19.00 , and -1.06 ; H,H-Cosy, HSQC and HMBC were made. Melting point: the substance decomposed at T = 147 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.19; IR: see spectrum in the supporting information; HR-MS  calculated for C24H31N5O1Si1 + H+: 434.23706 Da, found 434.23733 Da.(R)-(6-(4-(Trimethylsilyl)-1H-1,2,3-triazol-1-yl)quinolin-4-yl)-5-vinylquinuclidin-2-yl)methanol (16): the title compound was synthesized from 9  to afford 16  as a colourless wax. 1H-NMR  \u03b4 8.61 , 8.34 , 8.28 , 7.97 , 7.90 , 7.52 , 5.87\u20135.75 , 5.69 , 5.00\u20134.85 , 3.77\u20133.57 , 3.17\u20133.03 , 2.78\u20132.62 , 2.41\u20132.28 , 1.92\u20131.79 , 1.62\u20131.48 , 0.92\u20130.81  0.41 3); 13C-NMR  \u03b4 150.44 , 149.23 , 147.56 , 146.96 ; 140.20 ; 134.34 , 131.78 , 127.79 , 125.50 , 121.54 , 119.57 , 115.03 , 112.93 , 69.83 , 60.52 , 56.12 , 43.07 , 39.15 , 29.63 , 27.52 , 21.12 , and -1.14 ; H,H-Cosy, HSQC and HMBC were made. Melting point: the substance decomposed at T = 113 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.15; IR: see spectrum in the supporting information; HR-MS  calculated for C24H31N5O1Si1 + H+: 434.23706 Da, found 434.23742 Da.(S)-(6-(4-(Trimethylsilyl)-1H-1,2,3-triazol-1-yl)quinolin-4-yl)-5-ethylquinuclidin-2-yl)methanol (18): the title compound was synthesized from 10  to afford 18  as a colourless honey-type liquid. 1H-NMR  \u03b4 8.77 , 8.47 , 8.13\u20138.09 , 7.81 , 7.34 , 6.38 , 4.19\u20133.92 , 3.28\u20133.04 , 3.08\u20132.91 , 2.52\u20132.37 , 2.31\u20132.17 , 1.92\u20131.85 , 1.81\u20131.70 , 1.61\u20131.49 , 1.29\u20131.15 , 0.95\u20130.83  0.79 , and 0.42 3); 13C-NMR  \u03b4 150.20 , 148.27 , 147.43 , 146.70 ; 134.39 , 131.74 , 128.03 , 124.98 , 121.33 , 119.33 , 111.88 , 68.77 , 60.33 , 50.42 , 49.67 , 36.38 , 26.88 , 25.58 , 24.69 , 19.48 , 11.75 , and -1.15 ; H,H-Cosy, HSQC and HMBC were made. Melting point: the substance decomposed at T = 166 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.11; IR: see spectrum in the supporting information; HR-MS  calculated for C24H33N5O1Si1 + H+: 436.25271 Da, found 436.25296 Da.(R)-(6-(4-(Trimethylsilyl)-1H-1,2,3-triazol-1-yl)quinolin-4-yl)-5-ethylquinuclidin-2-yl)methanol (20): the title compound was synthesized from 11  to afford 20  as a honey-type liquid. 1H-NMR  \u03b4 8.63 , 8.35 , 8.24 , 8.00 , 7.95 , 7.51 , 5.84\u20135.73 , 5.69 3.73\u20133.57 , 3.16\u20133.02 , 2.77\u20132.63 H-6), 2.47\u20132.33 , 1.93\u20131.77 , 1.57\u20131.40 , 1.29\u20131.15 , 0.78 , and 0.43 3); 13C-NMR  \u03b4 150.50 , 149.18 , 147.58 , 147.04 ; 134.45 , 131.89 , 127.83 , 125.49 , 121.64 , 119.53 , 112.84 , 69.96 , 60.36 , 57.97 , 43.23 , 36.95 , 27.39 , 27.37 , 25.18 , 20,76 , 11.88 , and -1.11 ; H,H-Cosy, HSQC and HMBC were made. Melting point: the substance decomposed at T = 136 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.16; IR: see spectrum in the supporting information; HR-MS  calculated for C24H33N5O1Si1 + H+: 436.25271 Da, found 436.25305 Da.Cinchona TMS-triazole (1.00 eq.) was suspended in a mixture tBu-OH/H2O (1:1 ratio) and K2CO3 (2.0 equiv) was added. The reaction mixture was rigorously stirred for 48 h. Upon completion of the reaction, EtOAc was added and the organic layer was separated, washed with water, brine, dried over Na2SO4, filtered and concentrated in vacuo. The residues obtained were purified by flash column chromatography using MTBE: MeOH as a gradient elution to afford the corresponding triazole products.General procedure: a purified (S)-quinolin-4-yl)-5-vinylquinuclidin-2-yl)methanol (15): the title compound was synthesized from 14  to afford 15  as a white solid. 1H-NMR  \u03b4 8.68 , 8.34 , 8.23 , 8.04 , 7.93 , 7.77 , 7.58 , 6.04 , 5.69\u20135.66 , 5.08\u20135.01 , 3.33\u20133.25 , 3.06\u20133.00 , 2.88\u20132.78 , 2.72\u20132.64 , 2.26\u20132.19 , 2.12\u20132.03 , 1.80\u20131.75 , 1.56\u20131.45 , and 1.28\u20131.20 ; 13C-NMR  \u03b4 150.71 , 150.24 , 147.13 ; 140.30 ; 134.54 , 134.22 , 131.86 , 125.78 , 122.07 , 121.41 , 119.60 , 114.73 , 113.70 , 71.11 , 60.25 , 49.73 , 49.11 , 39.78 , 28.01 , 26.16 , and 21.42 ; H,H-Cosy, HSQC and HMBC were made. Melting point: the substance decomposed at T = 117 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.56; IR: see spectrum in the supporting information; HR-MS  calculated for C21H23N5O1 + H+: 362.19754 Da, found 362.19785 Da.(R)-quinolin-4-yl)-5-vinylquinuclidin-2-yl)methanol (17): the title compound was synthesized from 16  to afford 17  as a white solid. 1H-NMR  \u03b4 8.59 , 8.49 , 8.37 , 8.00 , 7.95 , 7.74 , 7.59 , 5.77\u20135.68 , 5.70 , 4.96\u20134.85 , 3.67\u20133.53 , 3.12\u20132.98 , 2.73\u20132.58 , 2.35\u20132.25 , 1.92\u20131.76 , and 1.60\u20131.48 ; 13C-NMR  \u03b4 150.19 , 150.09 , 146.62 ; 140.77 ; 134.14 , 134.12 , 131.31 , 125.31 , 122.07 , 121.14 , 119.27 , 114.41 , 112.73 , 70.03 , 60.22 , 56.06 , 42.70 , 39.06 , 27.29 , 26.73 , and 20.92 ; H,H-Cosy, HSQC and HMBC were made. Melting point: the substance decomposed at T = 92 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.63; IR: see spectrum in the supporting information; HR-MS  calculated for C21H23N5O1 + H+: 362.19754 Da, found 362.19796 Da.(S)-quinolin-4-yl)-5-ethylquinuclidin-2-yl)methanol (19): the title compound was synthesized from 18  to afford 19  as an off-white solid. 1H-NMR  \u03b4 8.54 , 8.26 , 8.35 , 8.98 , 7.65 , 7.98 , 7.94 , 5.87\u20135.77 , 3.31\u20133.20 , 3.11\u20133.08 , 2.85\u20132.73 , 2.69\u20132.58 , 2.21\u20132.15 , 2.32\u20132.23 , 1.85\u20131.80 , 1.51\u20131.40 , 1.22\u20131.14 , and 0.81 ; 13C-NMR  \u03b4 13C-NMR  \u03b4 150.81 , 149.80 , 147.27 , 134.62 , 134.30 , 132.07 , 125.75 , 122.12 , 121.40 , 119.60 , 113.56 , 70.93 , 60.38 , 50.74 , 49.87 , 37.12 , 26.76 , 26.02 , 25.08 , 21.09 , and 11.92 ; H,H-Cosy, HSQC and HMBC were made. Melting point: Substance decompose at T = 143 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.45; IR: see spectrum in the supporting information; HR-MS  calculated for C21H25N5O1 + H+: 364.21319 Da, found 364.21347 Da.(R)-quinolin-4-yl)-5-ethylquinuclidin-2-yl)methanol (21): the title compound was synthesized from 20  to afford 21  as an off-white solid. 1H-NMR  \u03b4 8.68 , 8.37, 8.29 , 8.05 , 7.96 , 7.80 , 7.57 , 5.69\u20135.59 , 3.47\u20133.41 , 3.11\u20132.96 , 2.65\u20132.55 , 2.35\u20132.29 , 1.79\u20131.71 , 1.60\u20131.41 , 1.34\u20131.18 , and 0.79 ; 13C-NMR  \u03b4 150.79 , 150.07 , 147.25 ; 134.60 , 134.36 , 132.01 , 125.80 , 122.27 , 121.49 , 119.65 , 113.51 , 70.85 , 60.39 , 58.18 , 43.03 , 37.20 , 27.88 , 27.52 , 25.27 , 21.70 , and 11.96 ; H,H-Cosy, HSQC and HMBC were made. Melting point: the substance decomposed at T = 106 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.58; IR: see spectrum in the supporting information; HR-MS  calculated for C21H25N5O1 + H+: 364.21319 Da, found 364.21358 Da.2(1.2 eq) in H2O (0.33 g/mL) was added to a mixture of Cinchona amine (1.0 eq) and 15% HCl (0.1g amine/mL) cooled at \u22125 \u00b0C. After the completion of the addition, the reaction mixture was stirred at this temperature for 60 min. A solution of NaN3 (1.7 eq) in H2O (0.2 g/mL) was added dropwise to the reaction mixture at 0 \u00b0C. After the addition was finished, the reaction mixture was maintained at 0 \u00b0C for 2 h and then stirred at room temperature for 12 h. The product was precipitated by the addition of NaOH (20%) until pH 10. Upon filtration, the solid was washed with distilled water and dried. Crystallization from DCM presented the Cinchona azides as yellow solids in good yields (70\u201390%).General procedure: a dropwise a solution of NaNO(S)--6-(Hydroxymethyl)quinuclidin-3-yl)-1H-1,2,3-triazol-1-yl)quinolin-4-yl)-5-vinylquinuclidin-2-yl)methanol (24): the title compound was synthesized from 8  to afford 24  as a reddish solid. 1H-NMR  \u03b4 8.87\u20138.72 (1 H), 8.41\u20138.28 (2 H), 8.39\u20137.54 (2 H), 7.69\u20137.58 (1 H), 6.27\u20136.56 (1 H), 5.73\u20135.65 (1 H), 5.21\u20135.11 (2 H), 3.75\u20133.29 (4 H), 3.11\u20132.75 (6 H), 2.89\u20132.75 (2 H), 2.46\u20132.33 (1 H), 2.11\u20132.01 (2 H), 1.78\u20131.35 (7 H), 1.29\u20131.15 (1 H), and 0.89\u20130.76 (1 H); 13C-NMR  \u03b4 151.20 (Cq), 150.54 (CH), 150.34 (Cq), 146.96 (Cq); 140.45 (CH), 134.55 (CH), 131.79 (CH), 125.49 (Cq), 121.19 (CH), 119.36 (CH), 119.22 (CH), 114.73 (CH2), 112.50 (CH), 70.67 (CH), 62.64 (CH2), 59.94 (CH), 57.30 (CH), 49.83 (CH2), 49.30 (CH2), 48.89 (CH2), 49.77 (CH2), 39.98 (CH), 33.36 (CH), 28.15 (CH), 27.55 (CH2), 26.35 (CH), 26.16 (CH2), 23.71 (CH2), and 20.08 (CH2); Melting point: the substance decomposed at T = 126 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.21; IR: see spectrum in the supporting information; HR-MS  calculated for C29H36N6O2 + H+: 501.29725 Da, found 501.29739 Da.(S)--6-(Hydroxymethyl)quinuclidin-3-yl)-1H-1,2,3-triazol-1-yl)quinolin-4-yl)-5-vinylquinuclidin-2-yl)methanol (25): the title compound was synthesized from 8  to afford 25  as a pink solid. 1H-NMR  \u03b4 8.71\u20138.64 (1 H), 8.37\u20138.25 (2 H), 8.00\u20137.88 (2 H), 7.62\u20137.56 (1 H), 6.16\u20136.04 (1 H), 5.82\u20135.70 (1 H), 5.13\u20135.01 (2 H), 3.64\u20133.19 (4 H), 3.16\u20132.82 (6 H), 2.80\u20132.69 (2 H), 2.32\u20132.21 (1 H), 2.19\u20132.08 (2 H), 1.82\u20131.43 (7 H), 1.25\u20131.13 (1 H), and 0.94\u20130.83 (1 H); 13C-NMR  \u03b4 151.73 (Cq), 150.36 (CH), 150.24 (Cq), 146.82 (Cq); 140.17 (CH), 134.35 (CH), 131.42 (CH), 125.60 (Cq), 121.08 (CH), 119.35 (CH), 119.12 (CH), 114.71 (CH2), 112.86 (CH), 70.3 (CH), 63.33 (CH2), 59.59 (CH), 57.28 (CH), 54.75 (CH2), 49.61 (CH2), 49.20 (CH2), 40.44 (CH2), 39.75 (CH), 33.02 (CH), 27.96 (CH), 27.20 (CH2), 27.06 (CH), 25.97 (CH2), 24.89 (CH2), and 20.92 (CH2). Melting point: the substance decomposed at T = 119 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.20; IR: see spectrum in the supporting information; HR-MS  calculated for C29H36N6O2 + H+: 501.29725 Da, found 501.29742 Da.(R)--6-(Hydroxymethyl)quinuclidin-3-yl)-1H-1,2,3-triazol-1-yl)quinolin-4-yl)-5-vinylquinuclidin-2-yl)methanol (26): the title compound was synthesized from 9  to afford 26  as a light red solid.1 H-NMR  \u03b4 8.61\u20138.54 (1 H), 8.67\u20138.54 (2 H), 8.13\u20137.87 (2 H), 7.68\u20137.46 (1 H), 6.96\u20136.64 (1 H), 5.34\u20135.23 (1 H), 5.17\u20135.03 (2 H), 3.78\u20133.35 (4 H), 3.26\u20132.92 (6 H), 2.63\u20132.46 (2 H), 2.39\u20132.26 (1 H), 2.12\u20132.01 (2 H), 1.76\u20131.32 (7 H), 1.19\u20131.07 (1 H), and 0.97\u20130.85 (1 H); 13C-NMR  \u03b4 152.08 (Cq), 150.67 (CH), 148.43 (Cq), 147.67 (Cq); 141.21 (CH), 133.96 (CH), 132.54 (CH), 126.31 (Cq), 122.45 (CH), 120.08 (CH), 119.23 (CH), 115.76 (CH2), 111.47 (CH), 69.93 (CH), 62.48 (CH2), 61.13 (CH2), 60.67 (CH), 57.79 (CH2), 56.36 (CH2), 54.76 (CH2), 42.98 (CH2), 40.54 (CH), 34.65 (CH), 27.87 (CH), 26.03 (CH), 25.53 (CH2), 24.52 (CH2), 21.73 (CH), and 19.26 (CH2). Melting point: the substance decomposed at T = 110 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.16; IR: see spectrum in the supporting information; HR-MS  calculated for C29H36N6O2 + H+: 501.29725 Da, found 501.29747 Da.(R)--6-(Hydroxymethyl)quinuclidin-3-yl)-1H-1,2,3-triazol-1-yl)quinolin-4-yl)-5-vinylquinuclidin-2-yl)methanol (27): the title compound was synthesized from 9  to afford 27  as a pink solid. 1H-NMR  \u03b4 8.71\u20138.64 (1 H), 8.37\u20138.25 (2 H), 8.00\u20137.88 (2 H), 7.62\u20137.56 (1 H), 6.16\u20136.04 (1 H), 5.82\u20135.70 (1 H), 5.13\u20135.01 (2 H), 3.64\u20133.19 (4 H), 3.16\u20132.82 (6 H), 2.80\u20132.69 (2 H), 2.32\u20132.21 (1 H), 2.19\u20132.08 (2 H), 1.82\u20131.43 (7 H), 1.25\u20131.13 (1 H), and 0.94\u20130.83 (1 H); 13C-NMR  \u03b4 151.99 (Cq), 150.65 (CH), 147.30 (Cq), 147.26 (Cq); 140.48 (CH), 133.16 (CH), 132.17 (CH), 125.47 (Cq), 121.58 (CH), 119.79 (CH), 119.33 (CH), 115.07 (CH2), 112.09 (CH), 69.33 (CH), 63.43 (CH2), 60.54 (CH2), 60.34 (CH), 57.43 (CH2), 55.89 (CH2), 54.16 (CH2), 43.25 (CH2), 40.19 (CH), 33.11 (CH), 27.49 (CH), 26.96 (CH), 26.79 (CH2), 24.71 (CH2), 21.00 (CH), and 19.88 (CH2). Melting point: the substance decomposed at T = 103 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.12; IR: see spectrum in the supporting information; HR-MS  calculated for C29H36N6O2 + H+: 501.29725 Da, found 501.29753 Da.(S)--6-(Hydroxymethyl)quinuclidin-3-yl)-1H-1,2,3-triazol-1-yl)quinolin-4-yl)-5-ethylquinuclidin-2-yl)methanol (28): the title compound was synthesized from 10  to afford 28  as an off-white solid. 1H-NMR  \u03b4 8.75\u20138.54 (1 H), 8.28\u20138.14 (2 H), 8.01\u20137.82 (2 H), 7.59\u20137.54 (1 H), 5.73\u20135.61 (1 H), 3.79\u20133.27 (4 H), 3.21\u20132.88 (6 H), 2.81\u20132.61 (2 H), 2.41\u20132.32 (1 H), 2.26\u20132.18 (2 H), 1.89\u20131.31 (9 H), 1.21\u20131.12 (1 H), and 0.99\u20130.81 (4 H); 13C-NMR  \u03b4 152.71 (Cq), 150.98 (CH), 150.37 (Cq), 147.63 (Cq), 135.01 (CH), 132.23 (CH), 126.29 (Cq), 121.78 (CH), 119.73 (CH), 118.61 (CH), 113.93 (CH), 71.35 (CH), 62.67 (CH2), 60.59 (CH), 58.79 (CH), 55.23 (CH2), 50.69 (CH2), 49.13 (CH2), 41.65 (CH2), 40.72 (CH), 33.19 (CH), 28.17 (CH), 27.64 (CH2), 27.13 (CH), 26.27 (CH2), 25.93 (CH2), 24.63 (CH2), 21.47 (CH2), and 12.65 (CH3). Melting point: the substance decomposed at T = 145 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.19; IR: see spectrum in the supporting information; HR-MS  calculated for C29H38N6O2 + H+: 503.31290 Da, found 503.31304 Da.(S)--6-(Hydroxymethyl)quinuclidin-3-yl)-1H-1,2,3-triazol-1-yl)quinolin-4-yl)-5-ethylquinuclidin-2-yl)methanol (29): the title compound was synthesized from 10  to afford 29  as an off-white solid; 1H-NMR  \u03b4 9.03\u20138.73 (1 H), 8.41\u20138.29 (2 H), 8.13\u20137.91 (2 H), 7.68\u20137.59 (1 H), 6.23\u20135.81 (1 H), 3.69\u20133.23 (4 H), 3.17\u20132.81 (6 H), 2.75\u20132.34 (2 H), 2.32\u20132.23 (1 H), 2.16\u20132.01 (2 H), 1.87\u20131.34 (9 H), 1.27\u20131.14 (1 H), and 0.91\u20130.87 (4 H); 13C-NMR  \u03b4 151.54 (Cq), 151.12 (CH), 150.27 (Cq), 146.12(Cq), 135.69 (CH), 130.19 (CH), 125.94 (Cq), 121.98 (CH), 120.15 (CH), 119.72 (CH), 113.26 (CH), 71.3 (CH), 63.99 (CH2), 60.57 (CH), 57.52 (CH), 55.75 (CH2), 49.69 (CH2), 49.13 (CH2), 41.64 (CH2), 40.73 (CH), 33.92 (CH), 27.56 (CH), 27.21 (CH2), 27.16 (CH), 25.47 (CH2), 25.22 (CH2), 24.83 (CH2), 21.62 (CH2), and 12.35 (CH3). Melting point: the substance decomposed at T = 138 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.21; IR: see spectrum in the supporting information; HR-MS  calculated for C29H38N6O2 + H+: 503.31290 Da, found 503.31298 Da.(R)--6-(Hydroxymethyl)quinuclidin-3-yl)-1H-1,2,3-triazol-1-yl)quinolin-4-yl)-5-ethylquinuclidin-2-yl)methanol (30): the title compound was synthesized from 11  to afford 30  as an off-white solid. 1H-NMR  \u03b4 8.62\u20138.49 (1 H), 8.38\u20138.27 (2 H), 7.99\u20137.81 (2 H), 7.71\u20137.60 (1 H), 5.89\u20135.65 (1 H), 5.17\u20134.89 (2 H), 3.73\u20133.29 (4 H), 3.21\u20132.94 (6 H), 2.81\u20132.73 (2 H), 2.54\u20132.36 (1 H), 2.28\u20132.17 (2 H), 1.93\u20131.49 (9 H), 1.29\u20131.14 (1 H), and 0.97\u20130.73 (4 H); 13C-NMR  \u03b4 152.21 (Cq), 151.25 (CH), 147.91 (Cq), 146.66 (Cq); 133.73 (CH), 131.17 (CH), 125.97 (Cq), 122.68 (CH), 120.19 (CH), 119.13 (CH), 112.34 (CH), 69.78 (CH), 64.41 (CH2), 61.64 (CH2), 60.52 (CH), 58.67 (CH2), 56.37 (CH2), 54.73 (CH2), 44.87 (CH2), 40.36 (CH), 33.57 (CH), 28.19 (CH), 27.91 (CH), 26.71 (CH2), 25.52 (CH2), 24.11 (CH2), 21.68 (CH), 20.18 (CH2), and 12.37 (CH3). Melting point: the substance decomposed at T = 132 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.14; IR: see spectrum in the supporting information; HR-MS  calculated for C29H38N6O2 + H+: 503.31290 Da, found 503.31312 Da.(R)--6-(Hydroxymethyl)quinuclidin-3-yl)-1H-1,2,3-triazol-1-yl)quinolin-4-yl)-5-ethylquinuclidin-2-yl)methanol (31): the title compound was synthesized from 11  to afford 31  as an off-white solid. 1H-NMR  \u03b4 8.89\u20138.71 (1 H), 8.39\u20138.31 (2 H), 8.23\u20138.12 (2 H), 7.73\u20137.66 (1 H), 5.79\u20135.65 (1 H), 5.56\u20135.23 (2 H), 3.81\u20133.39 (4 H), 3.25\u20132.93 (6 H), 2.85\u20132.71 (2 H), 2.54\u20132.35 (1 H), 2.23\u20132.13 (2 H), 1.97\u20131.51 (9 H), 1.33\u20131.21 (1 H), and 0.89\u20130.68 (4 H); 13C-NMR  \u03b4 152.00 (Cq), 150.69 (CH), 150.35 (Cq), 147.34 (Cq); 135.10 (CH), 132.16 (CH), 125.65 (Cq), 121.59 (CH), 119.93 (CH), 119.42 (CH), 112.46 (CH), 69.27 (CH), 63.47 (CH2), 60.59 (CH2), 60.33 (CH), 57.67 (CH2), 57.43 (CH2), 54.13 (CH2), 40.22 (CH2), 36.83 (CH), 33.10 (CH), 27.40 (CH), 27.00 (CH), 26.89 (CH2), 25.16 (CH2), 24.79 (CH2), 20.99 (CH), 20.10 (CH2), and 11.83 (CH3). Melting point: the substance decomposed at T = 121 \u00b0C; TLC (TBME: MeOH: ammonia 25%/100:10:1): rf-value = 0.14; IR: see spectrum in the supporting information; HR-MS  calculated for C29H38N6O2 + H+: 503.31290 Da, found 503.31306 Da.\u03b1 radiation. The reflections were indexed, integrated, and appropriate absorption corrections were applied as implemented in the CrysAlisPro software package [10 and 11, whilst for 28 geometrical restraints and constraints for the displacement parameters were employed. For 28, the structure contains a partly occupied HCl and two partly occupied units of water. The absolute structure parameter suggests numerically a very small contribution of an inversion twined component. As the only heavy atom (Cl1) is only partly occupied, a twin refinement was considered not reliable and was not conducted. During refinement and analysis of the crystallographic data, the programs OLEX2 and Diamond were used [The single crystals were mounted on a Hampton loop using perfluoroether oil and placed in the cold nitrogen gas stream on the diffractometer . The dat package . The str package ,32. Carbere used ,34. Unle"}
{"text": "The utility of this method is illustrated by way of an XP Screen against CYP121A1, a cytochrome P450 enzyme from Mycobacterium tuberculosis (Mtb) championed as a validated drug discovery target. A focused screening set was synthesized and tested by such means, with several members of the set showing promising activity against Mtb strain H37Rv. One compound was observed as an X-ray hit against CYP121A1 and showed improved activity against Mtb strain H37Rv under multiple assay conditions (pan-assay activity). Data obtained during X-ray crystallographic screening were utilized in a structure-based campaign to design a limited number of analogues (less than twenty), many of which also showed pan-assay activity against Mtb strain H37Rv. These included the benzo[b]oxazine derivative (MIC90 6.25\u00a0\u03bcM), a novel hit compound suitable as a starting point for a more involved hit to lead candidate medicinal chemistry campaign.There is a pressing need for new drugs against tuberculosis (TB) to combat the growing resistance to current antituberculars. Herein a novel strategy is described for hit generation against promising TB targets involving X-ray crystallographic screening in combination with phenotypic screening. This combined approach (XP Screen) affords both a validation of target engagement as well as determination of   \u2022M.tuberculosis has been previously shown to be a crucial target for the survival of the mycobacteria.CYP121 from \u2022M.tuberculosis.Strategies previously employed have identified high affinity inhibitors however these have lacked activity on \u2022The strategy reported here uses a combination of X-ray crystallography and phenotypic screening (XP Screen) to identify compounds.\u2022M.tuberculosis (up to 6.25\u00a0\u03bcM).The XP screen approach identified a number of compounds which show good affinity (up to 3.2\u00a0\u03bcM) and MIC against  Compounds 51\u201365 were screened for in\u00a0vitro activity against CYP121A1 using UV\u2013Vis spectroscopy. As with the initial X-ray hit 14, none of these direct analogues showed any discernible effect (no Soret band shift), suggesting that, like 14, they bind to CYP121A1 without direct contact to the heme. Likewise, a number of the compounds were examined by ITC, but it proved difficult to generate affinity data for these molecules using ITC due to inadequate solubility in aqueous buffers.Compounds 14 were screened against Mtb  were moderate inhibitors, and like 14, showed activity in all three of the growth media tested. Bridged bicyclic derivative 58 was active, but showed much reduced potency in BSA rich medium. N-Acetyl derivative 64 had essentially lost all activity, whereas the corresponding N-methyl derivative 57 was one of the compounds that exhibited pan-assay activity. It was noted that the most potent derivative against Mtb was 61 (MIC90 6.25\u00a0\u03bcM), a compound that had been designed based upon the overlap of X-ray crystal structures for 14 and 31, where the ligand in 31 had been positioned in an alternative orientation, with the ligand rotated 180\u00b0 in the active site, so suggesting the idea of appending an aromatic ring onto the morpholine moiety.Despite this, a number of analogues of inst Mtb . Severalin cellulo active compounds is perhaps not too surprising. Despite there being numerous CYP121A1 crystal structures deposited in the PDB, the majority are with ligands that either have low cLogP or make direct contact with the iron atom of the heme group. As the substrate for the enzyme (cYY) has a cLogP of 0.82, the enzyme is clearly designed to accommodate substrate and product that are highly hydrophilic in nature. Recent studies recording imidazolyl- and triazolyl-derived pyrazoles as inhibitors of CYP121A1 have shown that, whilst compounds with higher lipophilicity (cLogP >4) showed better activity in cellulo, only some of those with much lower cLogP (1.44 and 2.68) afforded useable crystal structures pyrimidine or pyridopyrimidine. This scaffold morphing approach entailed the relocation of a pyrimidine nitrogen to the alternative ring position where it was suitably positioned to be able to interact with the sidechain hydroxyl group of Thr77 of the protein via an additional hydrogen bond, thereby potentially gaining additional affinity -mixture. When prepared via an alternative route over five steps from indole using known chemistry -isomer (olefinic coupling constant: J\u00a0=\u00a019\u00a0Hz). The added length of synthesis required to generate 74 resulted in only the three derivatives 81\u201383 with lowest cLogP values (1.22\u20131.77) being targeted. Thus chlorides 66\u201368 were reacted with 74  to afford 75\u201377 as the (E)-isomers (olefinic coupling constants: J\u00a0=\u00a016\u201317\u00a0Hz). Reduction of 75\u201377 with hydrogen over palladium on carbon in ethyl acetate yielded 78\u201380 (after chromatography on silica to remove over-reduced by-products) which, upon deprotection under acidic conditions, gave 81\u201383  , 74 wase salts) .Scheme 281\u201383 behaved, as expected, like all of the pyrimidine derivatives in this series in that we were unable to determine the affinities for these compounds against CYP121A1 by UV\u2013Vis spectroscopy. This was reassuring, as it effectively ruled out the possibility of a change of binding mode in which interaction with the heme iron atom might conceivably occur via the cyclic secondary amine functionalities. Likewise, determination of potency by ITC proved difficult for these derivatives (in common with a number of the pyrimidines described above). Despite a significant reduction in cLogP values, it again proved impossible to collect satisfactory X-ray structures for 81\u201383. Nevertheless, the much improved solubility of 81\u201383 in aqueous media allowed the use of differential scanning fluorimetry to probe the binding affinities of 81\u201383 . Addition of all three bicyclic derivatives to solutions of CYP121A1 in aqueous buffer (1\u00a0mM ligand with 5\u00a0\u03bcM protein) resulted in increases to the melting temperature (Tm) of the protein  and 82 (+2.4\u00a0\u00b0C), with the ring expanded homologue 83 (+1.0\u00a0\u00b0C) showing a lesser effect (akin to that of aminopyrimidine 45 used as positive control). The original screening set, together with the set of advanced derivatives (as outlined above), were also subsequently screened by these means. Most compounds gave inconclusive results as a result of aggregation, due to limited ligand solubility in the aqueous buffer. Compounds with lower cLogP proved to be less problematic, with both 10 (an X-ray hit) and 55 (the 5-hydroxy derivative of the key X-ray hit 14) also showing evidence of activity (protein melting temperature shifts of\u00a0+3.5\u00a0\u00b0C and\u00a0+0.5\u00a0\u00b0C respectively).Fused bicyclic compounds  protein . This su7\u201310, 14, 21, 31, 33, 41\u201344, 51, 53, 55, 57, 60, 61, 63, 81\u201383) were tested in an LC-MS based activity assay, to determine their ability to inhibit the turnover of cYY into mycocyclosin relative to clotrimazole, a known azole derived inhibitor of CYP121A1. All compounds tested were either X-ray crystallographic hits, or had yielded encouraging data in UV\u2013Visible spectroscopy, differential scanning fluorimetry, isothermal titration calorimetry or antimycobacterial activity assays (as described above). Under the conditions used, no CYP121A1 mediated turnover of the experimental compounds was observed, indicating that none of the compounds were substrates for CYP121A1. As expected, in samples containing both cYY and clotrimazole, a large amount of cYY (>50-fold over the positive control) remained present following incubation , a general trend towards inhibition of CYP121A1 was noted, thus confirming inhibitory activity of CYP121A1 as a general property of a number of key derivatives within the series of compounds. In particular, 14  and 61 (with pan-assay activity against whole cell Mtb) both markedly reduced the production of mycocyclosin  under the assay conditions.Given their respective positions within the medicinal chemistry campaign, the propensity of compounds on assay . In the  control . The pre3in cellulo or in\u00a0vivo activity, with compounds being progressed that lack acceptable cell permeability, or poor ADMET properties.X-ray crystallographic screening is a frequently used technique for hit generation in the field of fragment-based drug discovery ,28 with Mtb have involved open-source initiatives utilizing the diverse array of compounds residing within corporate collections to provide lead compounds. These efforts have identified a series of 2-thiophenyl morpholines oxazine derivative 61, is a novel lead compound of moderate molecular mass (Mr\u00a0=\u00a0356) suitable as a starting point for a more thorough lead-to-clinical candidate phase, that inhibits the CYP121A1 mediated turnover of cYY to mycocyclosin, and shows favorable activity against Mtb strain H37Rv  in comparison with a number of azole anti-fungal drugs  4,   4,   4, 4, 4, + 257, 259 . HRMS: [M\u00a0+ H]+ 257.0837. Calcd for C15H1435ClN2+: 257.0840. \u0394\u00a0=\u00a0\u22121.2.od for 8  from 2-v5-Chloro-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole (12). Prepared as per the method for 11 + 292, 294, 296 . HRMS: [M\u00a0+ H]+ 292.0403. Calcd for C14H1235Cl2N3+: 292.0403. \u0394\u00a0=\u00a00.d for 11  from 2-cd for 11  and 5-ch5-Bromo-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole (13). Prepared as per the method for 11 + 336, 338, 340 . HRMS: [M\u00a0+ Na]+ 357.9716. Calcd for C14H1179Br35ClN3Na+: 357.9717. \u0394\u00a0=\u00a0\u22120.3.H-indole . Prepared for 11  and 5-br4-(4-(2-(1H-Indol-3-yl)ethyl)pyrimidin-2-yl)morpholine (14). A mixture of 3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 11  and morpholine (1\u00a0mL) in ethanol (6\u00a0mL) was stirred and held at reflux for 4\u00a0h and allowed to cool to room temperature. The solvent was removed in vacuo and the residues partitioned between dichloromethane and water. The organic layer was separated, the solvent removed in vacuo and the residues subjected to column chromatography on silica. Elution with 0\u2013100% ethyl acetate in petroleum ether (b.p. 40\u201360\u00a0\u00b0C) afforded 4-(4-(2-(1H-indol-3-yl)ethyl)pyrimidin-2-yl)morpholine 14  as a pale yellow solid. 1H NMR: \u03b4 10.75 , 8.24 , 7.53 , 7.33 , 7.11 , 7.06 , 6.97 , 6.61 , 3.70 , 3.66 , 3.08 , 2.93 . 13C NMR: \u03b4 170.9 (C), 161.8 (C), 158.0 (CH), 136.7 (C), 127.5 (C), 122.8 (CH), 121.3 (CH), 118.7 (CH), 118.6 (CH), 114.2 (C), 111.8 (CH), 110.0 (CH), 66.5 (CH2), 44.3 (CH2), 38.2 (CH2), 23.9 (CH2). LC-MS: [M\u00a0+ H]+ 309 . HRMS: [M\u00a0+ H]+ 309.1714. Calcd for C18H21N4O+: 309.1710. \u0394\u00a0=\u00a0+1.2.4-(4-(2-(1H-Indol-3-yl)ethyl)pyrimidin-2-yl)thiomorpholine (15). Prepared as per the method for 14 from 3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 11 and thiomorpholine. Yield 74%. Colorless solid. 1H NMR: \u03b4 10.77 , 8.23 , 7.51 , 7.32 , 7.11 , 7.06 , 6.97 , 6.58 , 4.07 , 3.07 , 2.94 , 2.59 . 13C NMR: \u03b4 171.0 (C), 161.2 (C), 158.1 (CH), 136.7 (C), 127.5 (C), 122.8 (CH), 121.3 (CH), 118.7 (CH), 118.6 (CH), 114.1 (C), 111.8 (CH), 109.6 (CH), 46.3 (CH2), 38.1 (CH2), 26.4 (CH2), 24.0 (CH2). LC-MS: [M\u00a0+ H]+ 325 . HRMS: [M\u00a0+ H]+ 325.1478. Calcd for C18H21N432S+: 325.1481. \u0394\u00a0=\u00a0\u22121.0.3-(2-(2-(4-Methylpiperazin-1-yl)pyrimidin-4-yl)ethyl)-1H-indole (16). A mixture of 3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 11  and N-methylpiperazine (1\u00a0mL) in ethanol (6\u00a0mL) was stirred and held at reflux for 4\u00a0h and allowed to cool to room temperature. The solvent was removed in vacuo and the residues partitioned between dichloromethane and water. The organic layer was separated, the solvent removed in vacuo and the residues triturated with a mixture of n-hexane and dichloromethane. The solids were collected by suction filtration to afford 3-(2-(2-(4-methylpiperazin-1-yl)pyrimidin-4-yl)ethyl)-1H-indole 16  as a pale yellow solid. 1H NMR: \u03b4 10.75 , 8.20 , 7.52 , 7.32 , 7.11 , 7.06 , 6.97 , 6.56 , 3.74 , 3.07 , 2.92 , 2.35 , 2.21 . 13C NMR: \u03b4 170.8 (C), 161.7 (C), 158.0 (CH), 136.7 (C), 127.5 (C), 122.8 (CH), 121.3 (CH), 118.7 (CH), 118.6 (CH), 114.2 (C), 111.8 (CH), 109.6 (CH), 54.9 (CH2), 46.4 (CH3), 43.7 (CH2), 38.2 (CH2), 23.9 (CH2). LC-MS: [M\u00a0+ H]+ 322 . HRMS: [M\u00a0+ H]+ 322.2023. Calcd for C19H24N5+: 322.2026. \u0394\u00a0=\u00a0\u22121.0.3-piperazin-1-yl)pyrimidin-4-yl)ethyl)-1H-indole (17). Prepared as per the method for 31 from 3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 11 and 1-piperazine dihydrochloride. Yield 67%. Colorless solid. 1H NMR: \u03b4 10.75 , 8.22 , 7.53 , 7.33 , 7.12 , 7.06 , 6.97 , 6.58 , 3.75 , 3.22 , 3.07 , 2.92 , 2.67 . 13C NMR: \u03b4 170.9 (C), 161.6 (C), 158.0 (CH), 136.7 (C), 127.5 (C), 126.5 , 122.8 (CH), 121.3 (CH), 118.7 (CH), 118.6 (CH), 114.2 (C), 111.8 (CH), 109.7 (CH), 57.4 , 53.4 (CH2), 43.8 (CH2), 38.2 (CH2), 24.0 (CH2). 19F NMR: \u03b4\u00a0\u221267.8. LC-MS: [M\u00a0+ H]+ 390 . HRMS: [M\u00a0+ H]+ 390.1902. Calcd for C20H23F3N5+: 390.1900. \u0394\u00a0=\u00a0+0.5.4-(4-(2-(5-Chloro-1H-indol-3-yl)ethyl)pyrimidin-2-yl)morpholine (18). Prepared as per the method for 14 from 5-chloro-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 12 and morpholine. Yield 44%. Pale yellow solid. 1H NMR: \u03b4 10.97 , 8.22 , 7.52 , 7.33 , 7.20 , 7.04 , 6.59 , 3.70 , 3.65 , 3.06 , 2.91 . 13C NMR: \u03b4 170.7 (C), 161.8 (C), 158.0 (CH), 135.1 (C), 128.7 (C), 124.8 (CH), 123.4 (C), 121.2 (CH), 118.1 (CH), 114.2 (C), 113.3 (CH), 110.1 (CH), 66.5 (CH2), 44.3 (CH2), 38.2 (CH2), 23.6 (CH2). LC-MS: [M\u00a0+ H]+ 343, 345 . HRMS: [M\u00a0+ H]+ 343.1318. Calcd for C18H2035ClN4O+: 343.1320. \u0394\u00a0=\u00a0\u22120.2.4-(4-(2-(5-Chloro-1H-indol-3-yl)ethyl)pyrimidin-2-yl)thiomorpholine (19). Prepared as per the method for 14 from 5-chloro-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 12 and thiomorpholine. Yield 66%. Pale orange solid. 1H NMR: \u03b4 10.97 , 8.21 , 7.50 , 7.33 , 7.20 , 7.04 , 6.55 , 4.07 , 3.06 , 2.90 , 2.58 . 13C NMR: \u03b4 170.9 (C), 161.2 (C), 158.1 (CH), 135.1 (C), 128.7 (C), 124.8 (CH), 123.4 (C), 121.2 (CH), 118.0 (CH), 114.2 (C), 113.3 (CH), 109.7 (CH), 46.3 (CH2), 38.2 (CH2), 26.4 (CH2), 23.6 (CH2). LC-MS: [M\u00a0+ H]+ 359, 361 . HRMS: [M\u00a0+ H]+ 359.1088. Calcd for C18H2035ClN432S+: 359.1092. \u0394\u00a0=\u00a0\u22121.2.5-Chloro-3-(2-(2-(4-methylpiperazin-1-yl)pyrimidin-4-yl)ethyl)-1H-indole (20). Prepared as per the method for 16 from 5-chloro-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 12 and N-methylpiperazine. Yield 70%. Pale yellow solid. 1H NMR: \u03b4 10.97 , 8.19 , 7.52 , 7.33 , 7.20 , 7.04 , 6.54 , 3.73 , 3.03 , 2.89 , 2.34 , 2.21 . 13C NMR: \u03b4 170.6 (C), 161.7 (C), 158.0 (CH), 135.1 (C), 128.7 (C), 124.8 (CH), 123.4 (C), 121.2 (CH), 118.1 (CH), 114.3 (C), 113.3 (CH), 109.7 (CH), 54.9 (CH2), 46.3 (CH3), 43.7 (CH2), 38.2 (CH2), 23.6 (CH2). LC-MS: [M\u00a0+ H]+ 356, 358 . HRMS: [M\u00a0+ H]+ 356.1631. Calcd for C19H2335ClN5+: 356.1636. \u0394\u00a0=\u00a0\u22121.5.4-(4-(2-(5-Bromo-1H-indol-3-yl)ethyl)pyrimidin-2-yl)morpholine (21). Prepared as per the method for 14 from 5-bromo-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 13 and morpholine. Yield 65%. Colorless solid. 1H NMR: \u03b4 10.98 , 8.22 , 7.66 , 7.29 , 7.19 , 7.15 , 6.59 , 3.71 , 3.65 , 3.06 , 2.90 . 13C NMR: \u03b4 170.7 (C), 161.8 (C), 158.0 (CH), 135.3 (C), 129.4 (C), 124.6 (CH),. 123.8 (CH), 121.1 (CH), 114.2 (C), 113.8 (CH), 111.3 (C), 110.1 (CH), 66.5 (CH2), 44.3 (CH2), 38.2 (CH2), 23.5 (CH2). LC-MS: [M\u00a0+ H]+ 387, 389 . HRMS: [M\u00a0+ H]+ 387.0818. Calcd for C18H2079BrN4O+: 387.0815. \u0394\u00a0=\u00a0+0.7.4-(4-(2-(5-Bromo-1H-indol-3-yl)ethyl)pyrimidin-2-yl)thiomorpholine (22). Prepared as per the method for 14 from 5-bromo-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 13 and thiomorpholine. Yield 47%. Off-white solid. 1H NMR: \u03b4 10.98 , 8.21 , 7.63 , 7.29 , 7.18 , 7.15 , 6.55 , 4.07 , 2.58 , 3.05 , 2.90 . 13C NMR: \u03b4 170.8 (C), 161.2 (C), 158.1 (CH), 135.3 (C), 129.5 (C), 124.6 (CH), 123.8 (CH), 121.1 (CH), 114.2 (C), 113.8 (CH), 111.3 (C), 109.7 (CH), 46.2 (CH2), 38.2 (CH2), 26.4 (CH2), 23.6 (CH2). LC-MS: [M\u00a0+ H]+ 403, 405 . HRMS: [M\u00a0+ H]+ 403.0581. Calcd for C18H2079BrN432S+: 403.0586. \u0394\u00a0=\u00a0\u22121.3.5-Bromo-3-(2-(2-(4-methylpiperazin-1-yl)pyrimidin-4-yl)ethyl)-1H-indole (23). Prepared as per the method for 16 from 5-bromo-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 13 and N-methylpiperazine. Yield 63%. Orange oil. 1H NMR: \u03b4 10.98 , 8.19 , 7.65 , 7.29 , 7.18 , 7.15 , 6.54 , 3.73 , 3.05 , 2.89 , 2.34 , 2.21 . 13C NMR: \u03b4 170.6 (C), 161.7 (C), 158.0 (CH), 135.3 (C), 129.5 (C), 124.6 (CH), 123.8 (CH), 121.1 (CH), 114.2 (C), 113.8 (CH), 111.3 (C), 109.7 (CH), 54.9 (CH2), 46.4 (CH3), 43.7 (CH2), 38.2 (CH2), 23.6 (CH2). LC-MS: [M\u00a0+ H]+ 400, 402 . HRMS: [M\u00a0+ H]+ 400.1123. Calcd for C19H2379BrN5+: 400.1132. \u0394\u00a0=\u00a0+2.2.5-Bromo-3-piperazin-1-yl)pyrimidin-4-yl)ethyl)-1H-indole (24). Prepared as per the method for 31 from 5-bromo-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 13 and 1-piperazine dihydrochloride. Yield 75%. Pale yellow solid. 1H NMR: \u03b4 10.98 , 8.20 , 7.66 , 7.29 , 7.19 , 7.16 , 6.56 , 3.75 , 3.25 , 3.06 , 2.90 , 2.67 . 13C NMR: \u03b4 170.8 (C), 161.6 (C), 158.0 (CH), 135.3 (C), 129.5 (C), 126.5 , 124.6 (CH), 123.8 (CH), 121.1 (CH), 114.2 (C), 113.8 (CH), 111.3 (C), 109.8 (CH), 57.4 , 53.4 (CH2), 43.8 (CH2), 38.2 (CH2), 23.6 (CH2). 19F NMR: \u03b4\u00a0\u221267.8. LC-MS: [M\u00a0+ H]+ 468, 470 . HRMS: [M\u00a0+ H]+ 468.0996. Calcd for C20H2279BrF3N5+: 468.1005. \u0394\u00a0=\u00a0\u22122.0.tert-Butyl 4-(4-(2-(5-bromo-1H-indol-3-yl)ethyl)pyrimidin-2-yl)piperazine-1-carboxylate (25). Prepared as per the method for 16 from 5-bromo-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 13 and tert-butyl piperazine-1-carboxylate. Yield 77%. Pale yellow solid. 1H NMR: \u03b4 10.98 , 8.22 , 7.66 , 7.29 , 7.19 , 7.15 , 6.58 , 3.72 , 3.39 , 3.06 , 2.91 , 1.43 . 13C NMR: \u03b4 170.8 (C), 161.6 (C), 158.0 (CH), 154.4  scale\" fill=\"currentColor\" stroke=\"none\"><path d=\"M0 440 l0 -40 480 0 480 0 0 40 0 40 -480 0 -480 0 0 -40z M0 280 l0 -40 480 0 480 0 0 40 0 40 -480 0 -480 0 0 -40z\"/></g></svg>O), 135.3 (C), 129.5 (C), 124.7 (CH), 123.8 (CH), 121.1 (CH), 114.2 (C), 113.8 (CH), 111.3 (C), 110.1 (CH), 79.5 (C), 43.6 (CH2), 40.7 (CH2), 38.2 (CH2), 28.6 (CH3), 23.6 (CH2). LC-MS: [M\u00a0+ H]+ 486, 488 . HRMS: [M\u00a0+ Na]+ 508.1318. Calcd for C23H2879BrN5O2Na+: 508.1310. \u0394\u00a0=\u00a00.5-Bromo-3-(2-(2-(piperazin-1-yl)pyrimidin-4-yl)ethyl)-1H-indole hydrochloride (26). Prepared as per the method for 37 from tert-butyl 4-(4-(2-(5-bromo-1H-indol-3-yl)ethyl)pyrimidin-2-yl)piperazine-1-carboxylate 25. Yield 70%. Pale orange solid. 1H NMR: \u03b4 11.07 , 9.39 , 8.28 , 7.66 , 7.30 , 7.19 , 7.16 , 6.70 , 3.99 , 3.15 , 3.07 , 2.95 . 13C NMR: \u03b4 171.6 (C), 160.7 (C), 157.5 (CH), 135.4 (C), 129.5 (C), 124.7 (CH), 123.8 (CH), 121.1 (CH), 114.0 (C), 113.8 (CH), 111.3 (C), 110.8 (CH), 42.8 (CH2), 40.8 (CH2), 38.2 (CH2), 23.5 (CH2). LC-MS: [M\u00a0+ H]+ 386, 388 . HRMS: [M\u00a0+ H]+ 386.0979. Calcd for C18H2179BrN5+: 386.0975. \u0394\u00a0=\u00a0+1.0.4-(4-(2-(5-Bromo-1H-indol-3-yl)ethyl)pyrimidin-2-yl)piperazin-2-one (27). Prepared as per the method for 16 from 5-bromo-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 13 and piperazin-2-one. Yield 50%. Colorless solid. 1H NMR: \u03b4 10.99 , 8.25 , 8.08 , 7.66 , 7.29 , 7.19 , 7.16 , 6.62 , 4.19 , 3.92 , 3.27 , 3.07 , 2.93 . 13C NMR: \u03b4 170.9 (C), 167.6 (CO), 160.9 (C), 158.1 (CH), 135.3 (C), 129.4 (C), 124.6 (CH), 123.8 (CH), 121.1 (CH), 114.1 (C), 113.8 (CH), 111.3 (C), 110.3 (CH), 48.2 (CH2), 40.7 (CH2), 40.6 (CH2), 38.2 (CH2), 23.6 (CH2). LC-MS: [M\u00a0+ H]+ 400, 402 . HRMS: [M\u00a0+ H]+ 400.0757. Calcd for C18H1979BrN5O+: 400.0768. \u0394\u00a0=\u00a0\u22122.8.2-(4-(2-(1H-Indol-3-yl)ethyl)pyrimidin-2-yl)isoxazolidine (28). Prepared as per the method for 31 from 3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 11 and isoxazolidine hydrochloride. Yield 82%. Off-white solid. 1H NMR: \u03b4 10.76 , 8.37 , 7.50 , 7.32 , 7.11 , 7.06 , 6.96 , 6.89 , 3.81 , 3.09 , 3.00 , 2.14 . 13C NMR: \u03b4 171.6 (C), 165.9 (C), 158.3 (CH), 136.7 (C), 127.5 (C), 122.9 (CH), 121.4 (CH), 118.7 (CH), 118.6 (CH), 113.9 (C), 113.8 (CH), 111.8 (CH), 67.2 (CH2), 49.6 (CH2), 38.2 (CH2), 27.8 (CH2), 24.2 (CH2). LC-MS: [M\u00a0+ H]+ 295 . HRMS: [M\u00a0+ H]+ 295.1553. Calcd for C17H19N4O+: 295.153. \u0394\u00a0=\u00a00.2-(4-(2-(5-Chloro-1H-indol-3-yl)ethyl)pyrimidin-2-yl)isoxazolidine (29). Prepared as per the method for 31 from 5-chloro-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 12 and isoxazolidine hydrochloride. Yield 76%. Colorless solid. 1H NMR: \u03b4 10.98 , 8.37 , 7.49 , 7.33 , 7.20 , 7.05 , 6.89 , 3.81 , 3.07 , 2.98 , 2.14 . 13C NMR: \u03b4 171.4 (C), 165.9 (C), 158.2 (CH), 135.1 (C), 128.7 (C), 124.9 (CH), 123.4 (C), 121.3 (CH), 118.0 (CH), 114.0 (C), 113.9 (CH), 113.3 (CH), 67.2 (CH2), 49.6 (CH2), 38.2 (CH2), 27.8 (CH2), 23.9 (CH2). LC-MS: [M\u00a0+ H]+ 329, 331 . HRMS: [M\u00a0+ H]+ 329.1159. Calcd for C17H1835ClN4O+: 329.1163. \u0394\u00a0=\u00a0\u22121.3.2-(4-(2-(5-Bromo-1H-indol-3-yl)ethyl)pyrimidin-2-yl)isoxazolidine (30). Prepared as per the method for 31 from 5-bromo-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 13 and isoxazolidine hydrochloride. Yield 73%. Off-white solid. 1H NMR: \u03b4 10.99 , 8.37 , 7.63 , 7.29 , 7.18 , 7.15 , 6.89 , 3.81 , 3.07 , 2.98 , 2.14 . 13C NMR: \u03b4 171.4 (C), 165.9 (C), 158.2 (CH), 135.3 (C), 129.4 (C), 124.7 (CH), 123.8 (CH), 121.0 (CH), 113.9 (CH), 113.8 (CH), 111.4 (C), 67.2 (CH2), 49.6 (CH2), 38.2 (CH2), 27.8 (CH2), 23.9 (CH2). LC-MS: [M\u00a0+ H]+ 373, 375 . HRMS: [M\u00a0+ Na]+ 395.0473. Calcd for C17H1779BrN4ONa+: 395.0478. \u0394\u00a0=\u00a0\u22121.3.3-(2-(2-(3-Methoxyazetidin-1-yl)pyrimidin-4-yl)ethyl)-1H-indole (31). A mixture of 3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 11 , 3-methoxyazetidine hydrochloride  and anhydrous sodium carbonate  in ethanol (3\u00a0mL) was stirred and held at reflux for 8\u00a0h and allowed to cool to room temperature. The solvent was removed in vacuo and the residues partitioned between dichloromethane and water. The organic layer was separated, the solvent removed in vacuo and the residues subjected to column chromatography on silica. Elution with 0\u2013100% ethyl acetate in petroleum ether (b.p. 40\u201360\u00a0\u00b0C) afforded 3-(2-(2-(3-methoxyazetidin-1-yl)pyrimidin-4-yl)ethyl)-1H-indole 31  as an off-white solid. 1H NMR: \u03b4 10.76 , 8.20 , 7.52 , 7.32 , 7.12 , 7.06 , 6.97 , 6.62 , 4.30 , 4.21 , 3.83 , 3.25 , 3.05 , 2.91 . 13C NMR: \u03b4 171.0 (C), 163.3 (C), 158.0 (CH), 136.7 (C), 127.5 (C), 122.8 (CH), 121.4 (CH), 18.7 (CH), 118.6 (CH), 114.1 (C), 111.8 (CH), 110.1 (CH), 69.9 (CH), 57.3 (CH2), 55.8 (CH3), 38.1 (CH2), 24.1 (CH2). LC-MS: [M\u00a0+ H]+ 309 . HRMS: [M\u00a0+ H]+ 309.1720. Calcd for C18H21N4O+: 309.1710. \u0394\u00a0=\u00a0+3.2.5-Chloro-3-(2-(2-(3-methoxyazetidin-1-yl)pyrimidin-4-yl)ethyl)-1H-indole (32). Prepared as per the method for 31 from 5-chloro-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 12 and 3-methoxyazetidine hydrochloride. Yield 72%. Pale yellow solid. 1H NMR: \u03b4 10.97 , 8.19 , 7.53 , 7.33 , 7.20 , 7.05 , 6.61 , 4.29 , 4.20 , 3.83 , 3.26 , 3.03 , 2.89 . 13C NMR: \u03b4 170.9 (C), 163.3 (C), 158.0 (CH), 135.1 (C), 128.7 (C), 124.8 (CH), 123.4 (C), 121.3 (CH), 118.1 (CH), 114.2 (C), 113.3 (CH), 110.2 (CH), 69.9 (CH), 57.3 (CH2), 55.8 (CH3), 38.0 (CH2), 23.7 (CH2). LC-MS: [M\u00a0+ H]+ 343, 345 . HRMS: [M\u00a0+ H]+ 343.1312. Calcd for C18H2035ClN4O+: 343.1320. \u0394\u00a0=\u00a0\u22122.4.5-Bromo-3-(2-(2-(3-methoxyazetidin-1-yl)pyrimidin-4-yl)ethyl)-1H-indole (33). Prepared as per the method for 31 from 5-bromo-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 13 and 3-methoxyazetidine hydrochloride. Yield 82%. Off-white solid. 1H NMR: \u03b4 10.99 , 8.19 , 7.66 , 7.29 , 7.19 , 7.16 , 6.61 , 4.30 , 4.20 , 3.83 , 3.25 , 3.03 , 2.89 . 13C NMR: \u03b4 170.9 (C), 163.3 (C), 157.9 (CH), 135.3 (C), 129.5 (C), 124.6 (CH), 123.8 (CH), 121.1 (CH), 114.1 (C), 113.8 (CH), 111.3 (C), 110.2 (CH), 69.9 (CH), 57.3 (CH2), 55.8 (CH3), 38.1 (CH2), 23.7 (CH2). LC-MS: [M\u00a0+ H]+ 387, 389 . HRMS: [M\u00a0+ H]+ 387.0802. Calcd for C18H2079BrN4O+: 387.0815. \u0394\u00a0=\u00a0\u22123.4.3-(2-(2-(4-(Trifluoromethoxy)phenyl)pyrimidin-4-yl)ethyl)-1H-indole (34). A mixture of 3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 11 , (4-(trifluoromethoxy)phenyl)-boronic acid , -dichloropalladium(II)  and anhydrous sodium carbonate  in water (0.5\u00a0mL), ethanol (1\u00a0mL) and toluene (2\u00a0mL) was degassed with nitrogen for 5\u00a0min and stirred and held at 90\u00a0\u00b0C in a sealed tube for 6\u00a0h and allowed to cool to room temperature. The mixture was diluted with ethyl acetate and water, the organic layer was separated, the solvent removed in vacuo and the residues subjected to column chromatography on silica. Elution with 0\u201350% ethyl acetate in petroleum ether (b.p. 40\u201360\u00a0\u00b0C) afforded 3-(2-(2-(4-(trifluoromethoxy)phenyl)pyrimidin-4-yl)ethyl)-1H-indole 34  as a pale yellow solid. 1H NMR: \u03b4 10.77 , 8.76 , 8.53 , 7.57 , 7.52 , 7.37 , 7.33 , 7.14 , 7.07 , 6.97 , 3.21 . 13C NMR: \u03b4 171.0 (C), 162.2 (C), 157.9 (CH), 150.6 , 137.0 (C), 136.7 (C), 130.2 (CH), 127.5 (C), 122.9 (CH), 121.5 (CH), 121.4 (CH), 120.5 , 119.6 (CH), 118.8 (CH), 118.7 (CH), 113.9 (C), 111.8 (CH), 38.2 (CH2), 24.1 (CH2). 19F NMR: \u03b4\u00a0\u221256.6 (OCF3). LC-MS: [M\u00a0+ H]+ 384 . HRMS: [M\u00a0\u2212\u00a0H]- 382.1164. Calcd for C21H15F3N3O\u2212: 382.1172. \u0394\u00a0=\u00a0\u22122.1.2-Chloro-3-(2-(2-(4-(trifluoromethoxy)phenyl)pyrimidin-4-yl)ethyl)-1H-indole (35). A stirred solution of 3-(2-(2-(4-(trifluoromethoxy)phenyl)pyrimidin-4-yl)ethyl)-1H-indole 34  in tetrahydrofuran (2\u00a0mL) was treated with N-chlorosuccinimide  and the resulting mixture was stirred and held at reflux for 5\u00a0h and allowed to cool to room temperature. The solvent was removed in vacuo and the residues partitioned between dichloromethane and water. The organic layer was separated, the solvent removed in vacuo and the residues subjected to column chromatography on silica. Elution with 0\u201330% ethyl acetate in petroleum ether (b.p. 40\u201360\u00a0\u00b0C) afforded 2-chloro-3-(2-(2-(4-(trifluoromethoxy)phenyl)-pyrimidin-4-yl)ethyl)-1H-indole 35  as a pale orange solid. 1H NMR: \u03b4 11.59 , 8.73 , 8.49 , 7.52 , 7.51 , 7.26 , 7.25 , 7.10 , 7.00 , 3.19 , 3.12 . 13C NMR: \u03b4 170.3 (C), 162.2 (C), 157.9 (CH), 150.6 , 137.0 (C), 135.0 (C), 130.2 (CH), 127.2 (C), 122.0 (CH), 121.4 (CH), 121.1 (C), 120.5 , 119.7 (CH), 119.6 (CH), 118.4 (CH), 111.3 (CH), 109.6 (C), 37.6 (CH2), 23.0 (CH2). 19F NMR: \u03b4\u00a0\u221256.6 (OCF3). LC-MS: [M\u00a0+ H]+ 418, 420 . HRMS: [M\u00a0\u2212\u00a0H]- 416.0781. Calcd for C21H1435ClF3N3O\u2212: 416.0783. \u0394\u00a0=\u00a0\u22120.5.2-Bromo-3-(2-(2-(4-(trifluoromethoxy)phenyl)pyrimidin-4-yl)ethyl)-1H-indole (36). A stirred solution of 3-(2-(2-(4-(trifluoromethoxy)phenyl)pyrimidin-4-yl)ethyl)-1H-indole 34  in dichloromethane (2\u00a0mL) was treated with N-bromosuccinimide  and the resulting mixture was stirred and held at room temperature for 4\u00a0h. The mixture was diluted with dichloromethane and water, the organic layer was separated, the solvent removed in vacuo and the residues subjected to column chromatography on silica. Elution with 0\u201330% ethyl acetate in petroleum ether (b.p. 40\u201360\u00a0\u00b0C) afforded 2-bromo-3-(2-(2-(4-(trifluoromethoxy)phenyl)pyrimidin-4-yl)ethyl)-1H-indole 36  as a pale pink solid. 1H NMR: \u03b4 11.59 , 8.73 , 8.50 , 7.52 , 7.51 , 7.27 , 7.24 , 7.08 , 6.98 , 3.18 , 3.11 . 13C NMR: \u03b4 170.3 (C), 162.2 (C), 157.9 (CH), 150.6 , 137.0 (C), 136.6 (C), 130.3 (CH), 127.4 (C), 122.0 (CH), 121.4 (CH), 120.5 , 119.7 (CH), 119.6 (CH), 118.3 (CH), 112.8 (C), 111.2 (CH), 109.1 (C), 37.8 (CH2), 24.0 (CH2). 19F NMR: \u03b4\u00a0\u221256.6 (OCF3). LC-MS: [M\u00a0+ H]+ 462, 464 . HRMS: [M\u00a0\u2212\u00a0H]- 460.0270. Calcd for C21H1479BrF3N3O\u2212: 460.0278. \u0394\u00a0=\u00a0\u22121.8.3-(2-(2-(Pyridin-2-yl)pyrimidin-4-yl)ethyl)-1H-indole hydrochloride (37). A mixture of 3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 11 , 4-methyl-8-(pyridin-2-yl)dihydro-4\u03bb [4],8\u03bb [4]-oxazaborolooxazaborole-2,6-dione , tris(dibenzylideneacetone)dipalladium(0) , 2-dicyclohexylphosphino-2\u2032,4\u2032,6\u2032-triisopropylbiphenyl (XPhos) , copper(II) acetate  and anhydrous potassium carbonate  in N,N-dimethylformamide (3\u00a0mL) and isopropanol (0.8\u00a0mL) + 401 . HRMS: [M\u00a0+ H]+ 401.1972. Calcd for C24H25N4O2+: 401.1972. \u0394\u00a0=\u00a00.tert-butyl 3-(2-(2-(pyridin-2-yl)pyrimidin-4-yl)ethyl)-1H-indole-1-carboxylate 38  in diethyl ether (2\u00a0mL) and methanol (1\u00a0mL) and the mixture was stirred and held at 45\u00a0\u00b0C for 3\u00a0h and allowed to cool to room temperature. The solvent was removed in vacuo and the residues triturated with diethyl ether to afford 3-(2-(2-(pyridin-2-yl)pyrimidin-4-yl)ethyl)-1H-indole hydrochloride 37  as a brown solid. 1H NMR: \u03b4 10.82 , 8.95 , 8.92 , 8.77 , 8.54 , 8.01 , 7.64 , 7.58 , 7.34 , 7.16 , 7.07 , 6.98 , 3.28 . 13C NMR: \u03b4 172.3 (C), 158.2 (CH), 157.7 (C), 148.9 (C), 145.7 (CH), 145.2 (CH), 136.7 (C), 128.4 (CH), 127.5 (C), 125.7 (CH), 123.1 (CH), 122.4 (CH), 121.4 (CH), 118.8 (CH), 118.7 (CH), 113.6 (C), 111.9 (CH), 38.1 (CH2), 24.1 (CH2). LC-MS: [M\u00a0+ H]+ 301 . HRMS: [M\u00a0+ Na]+ 323.1271. Calcd for C19H16N4Na+: 323.1267. \u0394\u00a0=\u00a0+1.2.Hydrogen chloride (2\u00a0M in diethyl ether) (0.5\u00a0mL) was added to a stirred solution of 5-Fluoro-3-(2-(pyridin-2-yl)ethyl)-1H-indole (39). Prepared as per the method for 8 + 241 (1.25 100). HRMS: [M\u00a0+ Na]+ 263.0953. Calcd for C15H13FN2Na+: 263.0955. \u0394\u00a0=\u00a0\u22120.8.od for 8  from 2-v5-Iodo-3-(2-(pyridin-2-yl)ethyl)-1H-indole (40). Prepared as per the method for 8 + 349 . HRMS: [M\u00a0+ H]+ 349.0183. Calcd for C15H14IN2+: 349.0196. \u0394\u00a0=\u00a0\u22123.8.od for 8  from 2-v5-Iodo-3-(2-(pyridin-4-yl)ethyl)-1H-indole (42). Prepared as per the method for 8 + 349 . HRMS: [M\u00a0+ H]+ 349.0207. Calcd for C15H14IN2+: 349.0196. \u0394\u00a0=\u00a0+3.1.od for 8  from 4-v3-(2-(Pyridin-4-yl)ethyl)-5-(trifluoromethoxy)-1H-indole (44). Prepared as per the method for 8 + 307 . HRMS: [M\u00a0+ H]+ 307.1061. Calcd for C16H14F3N2O+: 307.1053. \u0394\u00a0=\u00a0+2.6.od for 8  from 4-v3-(2-(2-Chloropyrimidin-4-yl)ethyl)-5-fluoro-1H-indole: (46). Prepared as per the method for 11 - 274, 276 . HRMS: [M\u00a0\u2212\u00a0H]- 274.0544. Calcd for C14H1035ClFN3\u2212: 274.0553. \u0394\u00a0=\u00a0\u22123.3.d for 11  from 2-cd for 11  and 5-fl3-(2-(2-Chloropyrimidin-4-yl)ethyl)-5-methoxy-1H-indole (47). Prepared as per the method for 11 - 286, 288 . HRMS: [M\u00a0+ Na]+ 310.0718. Calcd for C15H1435ClN3ONa+: 310.0717. \u0394\u00a0=\u00a0+0.3.d for 11  from 2-cd for 11  and 5-me3-(2-(2-Chloropyrimidin-4-yl)ethyl)-5-(trifluoromethoxy)-1H-indole (48). Prepared as per the method for 11 - 340, 342 . HRMS: [M\u00a0\u2212\u00a0H]- 340.0457. Calcd for C15H1035ClF3N3O\u2212: 340.0470. \u0394\u00a0=\u00a0\u22123.9.d for 11  from 2-cd for 11  and 5-(t5-(Benzyloxy)-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole (49). Prepared as per the method for 11 + 364, 366 . HRMS: [M\u00a0+ Na]+ 386.1031. Calcd for C21H1835ClN3ONa+: 386.1031. \u0394\u00a0=\u00a00.d for 11  from 2-cd for 11  and 5-(b3-(2-(2-Chloropyrimidin-4-yl)ethyl)-1-methyl-1H-indole (50). Prepared as per the method for 11 + 272, 274 . HRMS: [M\u00a0+ Na]+ 294.0767. Calcd for C15H1435ClN3Na+: 294.0769. \u0394\u00a0=\u00a0\u22120.7.d for 11  from 2-cd for 11  and 1-me4-(4-(2-(5-Fluoro-1H-indol-3-yl)ethyl)pyrimidin-2-yl)morpholine (51). Prepared as per the method for 14 from 3-(2-(2-chloropyrimidin-4-yl)ethyl)-5-fluoro-1H-indole 46 and morpholine. Yield 83%. Pale yellow solid. 1H NMR: \u03b4 10.86 , 8.23 , 7.31 , 7.26 , 7.20 , 6.89 , 6.60 , 3.70 , 3.65 , 3.05 , 3.05 . 13C NMR: \u03b4 170.8 (C), 161.8 (C), 158.0 (CH), 157.1 , 133.3 (C), 127.8 , 125.0 (CH), 114.5 , 112.7 , 110.1 (CH), 109.4 , 103.4 , 66.5 (CH2), 44.3 (CH2), 38.1 (CH2), 23.8 (CH2). 19F NMR: \u03b4\u00a0\u2212125.7. LC-MS: [M\u00a0+ H]+ 327 . HRMS: [M\u00a0+ H]+ 327.1618. Calcd for C18H20FN4O+: 327.1616. \u0394\u00a0=\u00a0+0.6.4-(4-(2-(5-Methoxy-1H-indol-3-yl)ethyl)pyrimidin-2-yl)morpholine (52). Prepared as per the method for 14 from 3-(2-(2-chloropyrimidin-4-yl)ethyl)-5-methoxy-1H-indole 47 and morpholine. Yield 81%. Yellow solid. 1H NMR: \u03b4 10.59 , 8.23 , 7.21 , 7.07 , 6.94 , 6.70 , 6.60 , 3.75 , 3.70 , 3.65 , 3.05 , 2.92 . 13C NMR: \u03b4 171.1 (C), 161.9 (C), 158.0 (CH), 153.4 (C), 131.9 (C), 127.9 (C), 123.5 (CH), 114.0 (C), 112.4 (CH), 111.5 (CH), 110.1 (CH), 100.6 (CH), 66.5 (CH2), 55.8 (CH3), 44.3 (CH2), 38.2 (CH2), 24.0 (CH2). LC-MS: [M\u00a0+ H]+ 339 . HRMS: [M\u00a0+ H]+ 339.1810. Calcd for C19H23N4O2+: 339.1815. \u0394\u00a0=\u00a0\u22121.5.4-(4-(2-(5-(Trifluoromethoxy)-1H-indol-3-yl)ethyl)pyrimidin-2-yl)morpholine (53). Prepared as per the method for 14 from 3-(2-(2-chloropyrimidin-4-yl)ethyl)-5-(trifluoromethoxy)-1H-indole 48 and morpholine. Yield 77%. Pale yellow solid. 1H NMR: \u03b4 11.06 , 8.22 , 7.44 , 7.40 , 7.27 , 7.02 , 6.59 , 3.69 , 3.65 , 3.08 , 2.92 . 13C NMR: \u03b4 170.7 (C), 161.8 (C), 158.0 (CH), 141.8 , 135.1 (C), 127.7 (C), 125.4 (CH), 120.9 , 115.0 (C), 114.9 (CH), 112.8 (CH), 111.2 (CH), 110.1 (CH), 66.5 (CH2), 44.3 (CH2), 38.2 (CH2), 23.6 (CH2). 19F NMR: \u03b4\u00a0\u221256.8. LC-MS: [M\u00a0+ H]+ 393 . HRMS: [M\u00a0+ H]+ 393.1534. Calcd for C19H20F3N4O2+: 393.1533. \u0394\u00a0=\u00a0+0.2.4-(4-(2-(5-(Benzyloxy)-1H-indol-3-yl)ethyl)pyrimidin-2-yl)morpholine (54). Prepared as per the method for 14 from 5-(benzyloxy)-3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 44 and morpholine. Yield 72%. Off-white solid. 1H NMR: \u03b4 10.62 , 8.24 , 7.48 , 7.40 , 7.32 , 7.22 , 7.08 , 7.06 , 6.78 , 6.59 , 5.07 , 3.70 , 3.64 , 3.03 , 2.90 . 13C NMR: \u03b4 171.0 (C), 161.8 (C), 158.0 (CH), 152.4 (C), 138.3 (C), 132.0 (C), 128.8 (CH), 128.1 (CH), 128.0 (CH), 127.8 (C), 123.6 (CH), 114.0 (C), 112.4 (CH), 112.1 (CH), 110.1 (CH), 102.2 (CH), 70.3 (CH2), 66.5 (CH2), 44.3 (CH2), 38.3 (CH2), 24.0 (CH2). LC-MS: [M\u00a0+ H]+ 415 . HRMS: [M\u00a0+ H]+ 415.2133. Calcd for C25H27N4O2+: 415.2129. \u0394\u00a0=\u00a0+0.9.3-(2-(2-Morpholinopyrimidin-4-yl)ethyl)-1H-indol-5-ol (55). A mixture of 4-(4-(2-(5-(benzyloxy)-1H-indol-3-yl)ethyl)pyrimidin-2-yl)morpholine 54 , 10% palladium on carbon (50\u00a0mg) in methanol (5\u00a0mL) and water (0.5\u00a0mL) was degassed with nitrogen for 5\u00a0min and then stirred and held at room temperature under an atmosphere of hydrogen gas for 2\u00a0h. The mixture was filtered, the catalyst rinsed with methanol (5\u00a0mL) and the organic solvent removed in vacuo. The residues were partitioned between dichloromethane and water, the organic layer separated, and the solvent removed in vacuo to afford 3-(2-(2-morpholinopyrimidin-4-yl)ethyl)-1H-indol-5-ol 55  as a colorless foam. 1H NMR: \u03b4 10.44 , 8.59 , 8.25 , 7.11 , 7.01 , 6.83 , 6.60 , 6.59 , 3.71 , 3.66 , 2.98 , 2.89 . 13C NMR: \u03b4 171.0 (C), 161.8 (C), 158.0 (CH), 150.6 (C), 131.3 (C), 128.2 (C), 123.3 (CH), 113.2 (C), 112.2 (CH), 111.7 (CH), 110.0 (CH), 102.7 (CH), 66.5 (CH2), 44.3 (CH2), 38.1 (CH2), 24.1 (CH2). LC-MS: [M\u00a0+ H]+ 325 . HRMS: [M\u00a0+ H]+ 325.1658. Calcd for C18H21N4O2+: 325.1659. \u0394\u00a0=\u00a0\u22120.4.4-(4-(2-(1H-Indol-3-yl-5-d)ethyl)pyrimidin-2-yl)morpholine (56). A mixture of 4-(4-(2-(5-bromo-1H-indol-3-yl)ethyl)pyrimidin-2-yl)morpholine 21 , 10% palladium on carbon (50\u00a0mg) and 3\u00a0M aqueous potassium hydroxide  in methanol (5\u00a0mL) was degassed with nitrogen for 5\u00a0min and then stirred and held at room temperature under an atmosphere of deuterium gas for 1\u00a0h. The mixture was filtered, the catalyst rinsed with methanol (10\u00a0mL) and the organic solvent removed in vacuo. The residues were partitioned between dichloromethane and water, the organic layer separated, the solvent removed in vacuo and the residues subjected to column chromatography on silica. Elution with 0\u2013100% ethyl acetate in petroleum ether (b.p. 40\u201360\u00a0\u00b0C) afforded 4-(4-(2-(1H-indol-3-yl-5-d)ethyl)pyrimidin-2-yl)morpholine 56  as a colorless solid. 1H NMR: \u03b4 10.75 , 8.24 , 7.53 , 7.33 , 7.11 , 7.06 , 6.61 , 3.70 , 3.66 , 3.08 , 2.93 . 13C NMR: \u03b4 170.9 (C), 161.8 (C), 158.0 (CH), 136.7 (C), 127.5 (C), 122.8 (CH), 121.3 (CH), 118.6 (CH), 114.2 (C), 111.8 (CH), 110.0 (CH), 66.5 (CH2), 44.3 (CH2), 38.2 (CH2), 23.9 (CH2) [one signal missing]. LC-MS: [M\u00a0+ H]+ 310 . HRMS: [M\u00a0+ H]+ 310.1774. Calcd for C18H20DN4O+: 310.1772. \u0394\u00a0=\u00a0+0.6.4-(4-(2-(1-Methyl-1H-indol-3-yl)ethyl)pyrimidin-2-yl)morpholine (57). Prepared as per the method for 14 from 3-(2-(2-chloropyrimidin-4-yl)ethyl)-1-methyl-1H-indole 50 and morpholine. Yield 84%. Off-white solid. 1H NMR: \u03b4 8.24 , 7.54 , 7.37 , 7.13 , 7.11 , 7.01 , 6.61 , 3.72 , 3.70 , 3.65 , 3.07 , 2.92 . 13C NMR: \u03b4 170.8 (C), 161.8 (C), 158.0 (CH), 137.1 (C), 127.9 (C), 127.3 (CH), 121.5 (CH), 119.0 (CH), 118.7 (CH), 113.6 (C), 110.0 (CH), 110.0 (CH), 66.5 (CH2), 44.4 (CH2), 38.3 (CH2), 32.7 (CH3), 23.8 (CH2). LC-MS: [M\u00a0+ H]+ 323 . HRMS: [M\u00a0+ H]+ 323.1864. Calcd for C19H23N4O+: 323.1866. \u0394\u00a0=\u00a0\u22120.7.3-(4-(2-(1H-Indol-3-yl)ethyl)pyrimidin-2-yl)-8-oxa-3-azabicyclo[3.2.1]octane (58). Prepared as per the method for 31 from 3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 11 and 8-oxa-3-azabicyclo[3.2.1]octane hydrochloride. Yield 60%. Off-white solid. 1H NMR: \u03b4 10.75 , 8.20 , 7.52 , 7.32 , 7.11 , 7.06 , 6.96 , 6.58 , 4.40 , 4.22 , 3.07 , 3.03 , 2.92 , 1.81 , 1.63 . 13C NMR: \u03b4 170.7 (C), 162.6 (C), 157.8 (CH), 136.7 (C), 127.6 (C), 122.8 (CH), 121.3 (CH), 118.7 (CH), 118.6 (CH), 114.2 (C), 111.8 (CH), 109.9 (CH), 73.4 (CH), 49.9 (CH2), 38.2 (CH2), 28.0 (CH2), 23.9 (CH2). LC-MS: [M\u00a0+ H]+ 335 . HRMS: [M\u00a0+ H]+ 335.1873. Calcd for C20H23N4O+: 335.1867. \u0394\u00a0=\u00a0+1.8.3-(4-(2-(5-Fluoro-1H-indol-3-yl)ethyl)pyrimidin-2-yl)-8-oxa-3-azabicyclo[3.2.1]octane (59). Prepared as per the method for 31 from 3-(2-(2-chloropyrimidin-4-yl)ethyl)-5-fluoro-1H-indole 46 and 8-oxa-3-azabicyclo[3.2.1]octane hydrochloride. Yield 92%. Yellow oil. 1H NMR: \u03b4 10.86 , 8.19 , 7.30 , 7.26 , 7.20 , 6.89 , 6.58 , 4.40 , 4.22 , 3.04 , 3.02 , 2.90 , 1.80 , 1.63 . 13C NMR: \u03b4 170.6 (C), 162.6 (C), 157.8 (CH), 157.0 , 133.3 (C), 127.8 , 125.0 (CH), 114.5 , 112.6 , 109.9 (CH), 109.4 , 103.4 , 73.4 (CH), 49.9 (CH2), 38.1 (CH2), 28.0 (CH2), 23.8 (CH2). 19F NMR: \u03b4\u00a0\u2212125.7. LC-MS: [M\u00a0+ H]+ 353 . HRMS: [M\u00a0+ H]+ 353.1775. Calcd for C20H22FN4O+: 353.1772. \u0394\u00a0=\u00a0+0.8.4-(4-(2-(1H-Indol-3-yl)ethyl)pyrimidin-2-yl)-1,4-oxazepane (60). Prepared as per the method for 31 from 3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 11 and 1,4-oxazepane. Yield 88%. Colorless solid. 1H NMR: \u03b4 10.75 , 8.19 , 7.51 , 7.32 , 7.10 , 7.06 , 6.96 , 6.53 , 3.85 , 3.70 , 3.59 , 3.07 , 2.92 , 1.85 . 13C NMR: \u03b4 170.8 (C), 161.5 (C), 158.0 (CH), 136.7 (C), 127.6 (C), 122.7 (CH), 121.3 (CH), 118.7 (CH), 118.6 (CH), 114.2 (C), 111.8 (CH), 109.1 (CH), 69.6 (CH2), 69.5 (CH2), 49.3 (CH2), 45.6 (CH2), 38.3 (CH2), 29.6 (CH2), 24.0 (CH2). LC-MS: [M\u00a0+ H]+ 323 . HRMS: [M\u00a0+ H]+ 323.1869. Calcd for C19H23N4O+: 323.1866. \u0394\u00a0=\u00a0+0.9.4-(4-(2-(1H-Indol-3-yl)ethyl)pyrimidin-2-yl)-3,4-dihydro-2H-benzo[b]oxazine (61). A mixture of 3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 11  and 3,4-dihydro-2H-benzo[b]oxazine (0.1\u00a0mL) in ethanol (0.5\u00a0mL) was stirred and held at 120\u00a0\u00b0C in a sealed tube for 3\u00a0h and allowed to cool to room temperature. The solvent was removed in vacuo and the residues partitioned between dichloromethane and water. The organic layer was separated, the solvent removed in vacuo and the residues subjected to column chromatography on silica. Elution with 0\u2013100% ethyl acetate in petroleum ether (b.p. 40\u201360\u00a0\u00b0C) afforded 4-(4-(2-(1H-Indol-3-yl)ethyl)pyrimidin-2-yl)-3,4-dihydro-2H-benzo[b]oxazine 61  as a colourless solid. 1H NMR: \u03b4 10.76 , 8.38 , 7.97 , 7.53 , 7.33 , 7.10 , 7.07 , 6.98 , 6.94 , 6.87 , 6.85 , 6.81 , 4.24 , 4.19 , 3.13 , 3.02 . 13C NMR: \u03b4 171.2 (C), 159.6 (C), 158.0 (CH), 146.4 (C), 136.8 (C), 127.9 (C), 127.5 (C), 124.3 (CH), 123.9 (CH), 122.8 (CH), 121.4 (CH), 119.8 (CH), 118.7 (CH), 118.6 (CH), 117.0 (CH), 114.0 (C), 112.7 (CH), 111.8 (CH), 65.9 (CH2), 42.4 (CH2), 38.1 (CH2), 24.0 (CH2). LC-MS: [M\u00a0+ H]+ 357 . HRMS: [M\u00a0+ H]+ 357.1528. Calcd for C22H21N4O+: 357.1529. \u0394\u00a0=\u00a0\u22120.3.4-(4-(2-(5-Fluoro-1H-indol-3-yl)ethyl)pyrimidin-2-yl)-3,4-dihydro-2H-benzo[b]oxazine (62). Prepared as per the method for 61 from 3-(2-(2-chloropyrimidin-4-yl)ethyl)-5-fluoro-1H-indole 62 and 3,4-dihydro-2H-benzo[b]oxazine. Yield 58%. Yellow oil. 1H NMR: \u03b4 10.87 , 8.38 , 7.95 , 7.32 , 7.26 , 7.18 , 6.94 , 6.90 , 6.87 , 6.85 , 6.81 , 4.24 , 4.19 , 3.09 , 3.00 . 13C NMR: \u03b4 171.1 (C), 159.5 (C), 158.0 (CH), 157.1 , 146.3 (C), 133.4 (C), 127.9 (C), 127.8 , 125.1 (CH), 124.3 (CH), 123.9 (CH), 119.7 (CH), 117.0 (CH), 114.3 , 112.7 , 112.6 (CH), 109.4 , 103.4 , 65.9 (CH2), 42.4 (CH2), 38.0 (CH2), 23.8 (CH2). 19F NMR: \u03b4\u00a0\u2212125.6. LC-MS: [M\u00a0+ H]+ 375 . HRMS: [M\u00a0+ H]+ 375.1616. Calcd for C22H20FN4O+: 375.1616. \u0394\u00a0=\u00a00.4-(4-(2-(1H-Indol-3-yl)ethyl)pyrimidin-2-yl)-6-bromo-3,4-dihydro-2H-benzo[b]oxazine (63). A mixture of 3-(2-(2-chloropyrimidin-4-yl)ethyl)-1H-indole 11  and 6-bromo-3,4-dihydro-2H-benzo[b]oxazine  in ethanol (0.5\u00a0mL) was stirred and held at 160\u00a0\u00b0C with microwave irradiation for 1\u00a0h and allowed to cool to room temperature. The solvent was removed in vacuo and the residues partitioned between dichloromethane and water. The organic layer was separated, the solvent removed in vacuo and the residues subjected to column chromatography on silica. Elution with 0\u201360% ethyl acetate in petroleum ether (b.p. 40\u201360\u00a0\u00b0C) afforded 4-(4-(2-(1H-indol-3-yl)ethyl)pyrimidin-2-yl)-6-bromo-3,4-dihydro-2H-benzo[b]oxazine 63  as a pale orange solid. 1H NMR: \u03b4 10.77 , 8.45 , 8.44 , 7.57 , 7.33 , 7.13 , 7.11 , 7.06 , 6.97 , 6.91 , 6.87 , 4.27 , 4.21 , 3.16 , 3.05 . 13C NMR: \u03b4 171.2 (C), 159.2 (C), 158.2 (CH), 145.6 (C), 136.7 (C), 129.4 (C), 127.5 (C), 126.1 (CH), 126.0 (CH), 122.8 (CH), 121.4 (CH), 118.9 (CH), 118.8 (CH), 118.7 (CH), 114.0 (C), 113.3 (CH), 111.8 (CH), 111.0 (C), 65.8 (CH2), 42.2 (CH2), 38.1 (CH2), 23.9 (CH2). LC-MS: [M\u00a0+ H]+ 435, 437 . HRMS: [M\u00a0+ H]+ 435.0802. Calcd for C22H2079BrN4O+:435.0815. \u0394\u00a0=\u00a0\u22123.0.1-(3-(2-(2-Morpholinopyrimidin-4-yl)ethyl)-1H-indol-1-yl)ethan-1-one (64). A solution of 4-(4-(2-(1H-indol-3-yl)ethyl)pyrimidin-2-yl)morpholine 14  in acetic anhydride (2\u00a0mL) was stirred and held at reflux for 32\u00a0h and allowed to cool to room temperature. The solvent was removed in vacuo and the residues partitioned between dichloromethane and an aqueous solution of sodium carbonate. The organic layer was separated, the solvent removed in vacuo and the residues subjected to column chromatography on silica. Elution with 0\u2013100% ethyl acetate in petroleum ether (b.p. 40\u201360\u00a0\u00b0C) followed by rinsing of the solids with 25% diethyl ether in petroleum ether (b.p. 40\u201360\u00a0\u00b0C) afforded 1-(3-(2-(2-morpholinopyrimidin-4-yl)ethyl)-1H-indol-1-yl)ethan-1-one 64  as a pale yellow solid. 1H NMR: \u03b4 8.31 , 8.27 , 7.68 , 7.63 , 7.33 , 7.28 , 6.66 , 3.70 , 3.65 , 3.07 , 2.99 , 2.61 . 13C NMR: \u03b4 170.3 (C), 169.6 (CO), 161.8 (C), 158.2 (CH), 135.6 (C), 130.8 (C), 125.2 (CH), 124.1 (CH), 123.6 (CH), 121.4 (C), 119.5 (CH), 116.4 (CH), 109.9 (CH), 66.5 (CH2), 44.3 (CH2), 36.9 (CH2), 24.3 (CH3), 23.4 (CH2). LC-MS: [M\u00a0+ H]+ 351 . HRMS: [M\u00a0+ H]+ 351.1816. Calcd for C20H23N4O2+: 351.1816. \u0394\u00a0=\u00a00.4-(4-(2-(1-(Methylsulphonyl)-1H-indol-3-yl)ethyl)pyrimidin-2-yl)morpholine (65). Methanesulphonyl chloride  in benzene (0.6\u00a0mL) was added dropwise to a rapidly stirred mixture of 4-(4-(2-(1H-indol-3-yl)ethyl)pyrimidin-2-yl)morpholine 14  and tetra-n-butylammonium hydrogen sulphate  in benzene (0.6\u00a0mL) and 50% w/w aqueous sodium hydroxide solution (0.6\u00a0mL) + 387 . HRMS: [M\u00a0+ H]+ 387.1481. Calcd for C19H23N4O332S+: 387.1486. \u0394\u00a0=\u00a0\u22121.3.(0.6\u00a0mL)  and the tert-Butyl 4-morpholino-2-vinyl-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate (70). A mixture of tert-butyl 2-chloro-4-morpholino-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate 66 pyrimidine-6-carboxylate 70  as a colorless solid. 1H NMR: \u03b4 6.60 , 6.41 , 5.62 , 4.73 , 4.39 , 4.37 , 3.67 , 1.46 . 13C NMR: \u03b4 166.6 (C), 166.1 (C), 162.5 (C), 158.1 (CO), 137.3 (CH), 123.0 (CH2), 108.9 (C), 79.8 (C), 66.5 (CH2), 45.4 (CH2), 28.6 (CH3) [two signals missing]. LC-MS: [M\u00a0+ H]+ 333 . HRMS: [M\u00a0+ Na]+ 355.1741. Calcd for C17H24N4O3Na+: 355.1740. \u0394\u00a0=\u00a0+0.2.ylate 66  -2-vinyl-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate (71). Prepared as per the method for 70 from tert-butyl 4-(8-oxa-3-azabicyclo[3.2.1]octan-3-yl)-2-chloro-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate 67 . LC-MS: [M\u00a0+ H]+ 359 . HRMS: [M\u00a0+ H]+ 359.2077. Calcd for C19H27N4O3+: 359.2078. \u0394\u00a0=\u00a0\u22120.3.ylate 67  and 4,4,tert-Butyl 4-morpholino-2-vinyl-5,8-dihydropyridopyrimidine-7(6H)-carboxylate (72). Prepared as per the method for 70 from tert-butyl 2-chloro-4-morpholino-5,8-dihydropyridopyrimidine-7(6H)-carboxylate 68 . LC-MS: [M\u00a0+ H]+ 347 . HRMS: [M\u00a0+ H]+ 347.2069. Calcd for C18H27N4O3+: 347.2078. \u0394\u00a0=\u00a0\u22122.6.ylate 68  and 4,4,tert-Butyl 4-(8-oxa-3-azabicyclo[3.2.1]octan-3-yl)-2-vinyl-5,8-dihydropyridopyrimidine-7(6H)-carboxylate (73). Prepared as per the method for 70 from tert-butyl 4-(8-oxa-3-azabicyclo[3.2.1]octan-3-yl)-2-chloro-5,8-dihydropyridopyrimidine-7(6H)-carboxylate 69 . LC-MS: [M\u00a0+ H]+ 373 . HRMS: [M\u00a0+ H]+ 373.2231. Calcd for C20H29N4O3+: 373.2234. \u0394\u00a0=\u00a0\u22120.9.ylate 69  and 4,4,tert-Butyl (E)-3-vinyl)-1H-indole-1-carboxylate (74) + 370 . HRMS: [M\u00a0+\u00a0H\u2013C4H8]+ 314.1552. Calcd for C17H21BNO4+: 314.1564. \u0394\u00a0=\u00a0\u22123.9.ate (74) . Prepareborolane  from terboxylate  and 4,4,tert-Butyl (E)-2-(2-(1-(tert-butoxycarbonyl)-1H-indol-3-yl)vinyl)-4-morpholino-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate (75). Prepared as per the method for 70 from tert-butyl 2-chloro-4-morpholino-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate 66 and tert-butyl (E)-3-vinyl)-1H-indole-1-carboxylate 74. Yield 73%. Colorless solid. 1H NMR: \u03b4 8.17 , 8.15 , 8.01 , 8.00 , 7.42 , 7.37 , 7.12 , 4.75 , 4.42 , 4.40 , 3.72 , 1.66 , 1.48 . 13C NMR: \u03b4 166.6 (C), 166.1 (C), 163.3 (C), 158.2 (CO), 149.3 (CO), 136.0 (C), 128.6 (CH), 128.3 (C), 128.0 (CH), 127.8 (CH), 125.5 (CH), 124.0 (CH), 120.8 (CH), 117.9 (C), 117.8 (C), 115.5 (CH), 84.8 (C), 74.0 (C), 66.6 (CH2), 45.6 (CH2), 28.2 (CH3), 25.4 (CH3) [two signals missing]. LC-MS: [M\u00a0+ H]+ 548 . HRMS: [M\u00a0+ H]+ 548.2870. Calcd for C30H38N5O5+: 548.2873. \u0394\u00a0=\u00a0\u22120.6.tert-Butyl (E)-4-(8-oxa-3-azabicyclo[3.2.1]octan-3-yl)-2-(2-(1-(tert-butoxycarbonyl)-1H-indol-3-yl)vinyl)-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate (76). Prepared as per the method for 70 from tert-butyl 4-(8-oxa-3-azabicyclo[3.2.1]octan-3-yl)-2-chloro-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate 67 and tert-butyl (E)-3-vinyl)-1H-indole-1-carboxylate 74. Yield 35%. Pale yellow solid. 1H NMR: \u03b4 8.17 , 8.15 , 8.00 , 7.99 , 7.43 , 7.38 , 7.12 , 4.76 , 4.45 , 4.40 , 4.05 , 3.24 , 1.82 , 1.66 , 1.48 . 13C NMR: \u03b4 167.5 (C), 166.2 (C), 163.5 (C), 159.4 (CO), 149.3 (CO), 136.1 (C), 128.7 (CH), 128.6 (CH), 128.0 (C), 127.8 (CH), 125.5 (CH), 124.0 (CH), 120.8 (CH), 117.9 (C), 115.5 (CH), 107.8 (C), 84.8 (C), 79.7 (C), 73.5 (CH), 50.8 (CH2), 28.6 (CH3), 28.2 (CH3) 27.9 (CH2) [two signals missing]. LC-MS: [M\u00a0+ H]+ 574 . HRMS: [M\u00a0+ H]+ 574.3029. Calcd for C32H40N5O5+: 574.3029. \u0394\u00a0=\u00a00.tert-Butyl (E)-2-(2-(1-(tert-butoxycarbonyl)-1H-indol-3-yl)vinyl)-4-morpholino-5,8-dihydropyridopyrimidine-7(6H)-carboxylate (77). Prepared as per the method for 70 from tert-butyl 2-chloro-4-morpholino-5,8-dihydropyridopyrimidine-7(6H)-carboxylate 68 and tert-butyl (E)-3-vinyl)-1H-indole-1-carboxylate 74. Yield 35%. Tan solid. 1H NMR: \u03b4 8.18 , 8.16 , 8.00 , 7.99 , 7.43 , 7.38 , 7.14 , 4.45 , 3.75 , 3.53 , 3.47 , 2.67 , 1.66 , 1.46 . 13C NMR: \u03b4 164.6 (C), 161.4 (C), 161.0 (C), 154.2 (CO), 149.3 (CO), 136.0 (C), 128.4 (CH), 128.3 (C), 128.0 (CH), 127.8 (CH), 125.5 (CH), 124.1 (CH), 120.8 (CH), 117.8 (C), 115.5 (CH), 110.1 (C), 84.9 (C), 79.8 (C), 66.6 (CH2), 48.4 (CH2), 28.5 (CH3), 28.2 (CH3) [three signals missing]. LC-MS: [M\u00a0+ H]+ 562 . HRMS: [M\u00a0+ H]+ 562.3024. Calcd for C31H40N5O5+: 562.3029. \u0394\u00a0=\u00a0\u22120.9.tert-Butyl 2-(2-(1-(tert-butoxycarbonyl)-1H-indol-3-yl)ethyl)-4-morpholino-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate (78). A mixture of tert-butyl (E)-2-(2-(1-(tert-butoxycarbonyl)-1H-indol-3-yl)vinyl)-4-morpholino-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate 75 , 10% palladium on carbon (30\u00a0mg) in ethyl acetate (5\u00a0mL) was degassed with nitrogen for 2\u00a0min and then stirred and held at room temperature under an atmosphere of hydrogen gas for 4\u00a0h. The mixture was filtered, the catalyst rinsed with ethyl acetate (5\u00a0mL) and the solvent removed in vacuo. The residues were partitioned between dichloromethane and water, the organic layer separated, the solvent removed in vacuo and the residues subjected to column chromatography on silica. Elution with 0\u201380% ethyl acetate in petroleum ether (b.p. 40\u201360\u00a0\u00b0C) afforded tert-butyl 2-(2-(1-(tert-butoxycarbonyl)-1H-indol-3-yl)ethyl)-4-morpholino-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate 78  as a colorless solid. 1H NMR: \u03b4 8.03 , 7.60 , 7.43 , 7.32 , 7.25 , 4.70 , 4.37 , 4.34 , 3.64 , 3.61 , 3.11 , 3.06 , 1.62 , 1.46 . 13C NMR: \u03b4 168.5 (C), 166.5 (C), 166.1 (C), 158.2 (CO), 149.6 (CO), 135.2 (C), 130.7 (C), 124.8 (CH), 123.0 (CH), 122.9 (CH), 120.8 (C), 120.7 (C), 119.6 (CH), 115.1 (CH), 83.8 (C), 79.8 (C), 66.5 (CH2), 45.4 (CH2), 38.1 (CH2), 23.0 (CH2), 28.6 (CH3), 28.2 (CH3) [two signals missing]. LC-MS: [M\u00a0+ H]+ 550 . HRMS: [M\u00a0+ H]+ 550.3026. Calcd for C30H40N5O5+: 550.3029. \u0394\u00a0=\u00a0\u22120.6.tert-Butyl 4-(8-oxa-3-azabicyclo[3.2.1]octan-3-yl)-2-(2-(1-(tert-butoxycarbonyl)-1H-indol-3-yl)ethyl)-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate (79). Prepared as per the method for 78 from tert-butyl (E)-4-(8-oxa-3-azabicyclo[3.2.1]octan-3-yl)-2-(2-(1-(tert-butoxycarbonyl)-1H-indol-3-yl)vinyl)-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate 76. Yield 52%. Off-white solid. 1H NMR: \u03b4 8.02 , 7.59 , 7.43 , 7.32 , 7.24 , 4.70 , 4.37 , 4.33 , 3.92 , 3.12 , 3.04 , 1.78 , 1.66 , 1.62 , 1.46 . 13C NMR: \u03b4 168.3 (C), 168.1 (C), 166.1 (C), 159.3 (CO), 149.6 (CO), 135.2 (C), 130.7 (C), 124.8 (CH), 123.1 (CH), 122.9 (CH), 119.7 (CH), 115.1 (CH), 107.7 (C), 107.3 (C), 83.9 (C), 79.7 (C), 73.3 (CH), 50.7 (CH2), 38.1 (CH2), 28.6 (CH3), 28.2 (CH3), 27.7 (CH2), 23.0 (CH2) [two signals missing]. LC-MS: [M\u00a0+ H]+ 576 . HRMS: [M\u00a0+ H]+ 576.3192. Calcd for C32H42N5O5+: 576.3186. \u0394\u00a0=\u00a0+1.0.tert-Butyl 2-(2-(1-(tert-butoxycarbonyl)-1H-indol-3-yl)ethyl)-4-morpholino-5,8-dihydropyridopyrimidine-7(6H)-carboxylate80). Prepared as per the method for 78 from tert-butyl (E)-2-(2-(1-(tert-butoxycarbonyl)-1H-indol-3-yl)vinyl)-4-morpholino-5,8-dihydropyridopyrimidine-7(6H)-carboxylate 77. Yield 43%. Colorless solid. 1H NMR: \u03b4 8.02 , 7.58 , 7.44 , 7.31 , 7.24 , 4.37 , 3.66 , 3.48 , 3.36 , 3.12 , 3.06 , 2.61 , 1.62 , 1.44 . 13C NMR: \u03b4 166.1 (C), 166.0 (C), 164.4 (C), 154.1 (CO), 149.5 (CO), 135.2 (C), 130.8 (C), 124.8 (CH), 123.0 (CH), 122.9 (CH), 120.8 (C), 119.7 (CH), 115.2 (CH), 113.1 (C), 83.9 (C), 79.8 (C), 66.6 (CH2), 48.3 (CH2), 38.1 (CH2), 28.5 (CH3), 28.2 (CH3), 23.1 (CH2) [three signals missing]. LC-MS: [M\u00a0+ H]+ 564 . HRMS: [M\u00a0+ H]+ 564.3181. Calcd for C31H42N5O5+: 564.3186. \u0394\u00a0=\u00a0\u22120.9.4-(2-(2-(1H-Indol-3-yl)ethyl)-6,7-dihydro-5H-pyrrolopyrimidin-4-yl)morpholine hydrochloride (81). Prepared as per the method for 37 from tert-butyl 2-(2-(1-(tert-butoxycarbonyl)-1H-indol-3-yl)ethyl)-4-morpholino-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate 78. Yield 78%. Pale tan solid. 1H NMR: \u03b4 10.84 , 10.57 , 7.55 , 7.34 , 7.15 , 7.07 , 6.98 , 4.70 , 4.44 , 3.74 , 3.68 , 3.18 . 13C NMR: \u03b4 160.8 (C), 157.7 (C), 146.9 (C), 136.8 (C), 127.5 (C), 123.0 (CH), 121.4 (CH), 118.7 (CH), 118.7 (CH), 113.5 (C), 111.9 (CH), 106.8 (C), 66.4 (CH2), 49.4 (CH2), 48.4 (CH2), 46.2 (CH2), 37.1 (CH2), 23.2 (CH2). LC-MS: [M\u00a0+ H]+ 350 . HRMS: [M\u00a0+ H]+ 350.1980. Calcd for C20H24N5O+: 350.1981. \u0394\u00a0=\u00a0\u22120.3.3-(2-(2-(1H-Indol-3-yl)ethyl)-6,7-dihydro-5H-pyrrolopyrimidin-4-yl)-8-oxa-3-azabicyclo[3.2.1]octane hydrochloride (82). Prepared as per the method for 37 from tert-butyl 4-(8-oxa-3-azabicyclo[3.2.1]octan-3-yl)-2-(2-(1-(tert-butoxycarbonyl)-1H-indol-3-yl)ethyl)-5,7-dihydro-6H-pyrrolopyrimidine-6-carboxylate 79. Yield 70%. Brown solid. 1H NMR: \u03b4 10.83 , 10.47 , 7.54 , 7.33 , 7.14 , 7.07 , 6.98 , 4.70 , 4.41 , 4.03 , 3.29 , 3.16 , 1.80 , 1.62 . 13C NMR: \u03b4 159.2 (C), 159.1 (C), 159.1 (C), 136.7 (C), 127.5 (C), 122.9 (CH), 121.4 (CH), 118.7 (CH), 118.7 (CH), 113.5 (C), 111.9 (CH), 106.8 (C), 73.4 (CH), 51.4 (CH2), 49.5 (CH2), 48.4 (CH2), 27.5 (CH2), 23.2 (CH2) [one signal missing]. LC-MS: [M\u00a0+ H]+ 376 . HRMS: [M\u00a0+ H]+ 376.2137. Calcd for C22H26N5O+: 376.2137. \u0394\u00a0=\u00a00.4-(2-(2-(1H-Indol-3-yl)ethyl)-5,6,7,8-tetrahydropyridopyrimidin-4-yl)morpholine hydrochloride (83). Prepared as per the method for 37 from tert-butyl 2-(2-(1-(tert-butoxycarbonyl)-1H-indol-3-yl)ethyl)-4-morpholino-5,8-dihydropyridopyrimidine-7(6H)-carboxylate 80. Yield 75%. Tan solid. 1H NMR: \u03b4 10.87 , 10.07 , 7.54 , 7.34 , 7.18 , 7.08 , 6.99 , 4.32 , 3.74 , 3.69 , 3.27 , 3.18 , 2.94 . 13C NMR: \u03b4 159.1 (C), 155.6 (C), 153.1 (C), 136.7 (C), 127.4 (C), 123.1 (CH), 121.5 (CH), 118.9 (C), 118.8 (CH), 118.7 (CH), 111.9 (CH), 109.9 (C), 66.5 (CH2), 48.4 (CH2), 40.2 (CH2), 23.1 (CH2), 23.0 (CH2) [two signals missing]. LC-MS: [M\u00a0+ H]+ 364 . HRMS: [M\u00a0+ H]+ 364.2138. Calcd for C21H26N5O+: 364.2137. \u0394\u00a0=\u00a0+0.2.4.26-tagged construct of CYP121A1 was also expressed and purified to homogeneity as reported previously [via a superloop onto a HisTrap FF affinity column  that had been equilibrated in 50\u00a0mM potassium phosphate, 50\u00a0mM KCl, 10% (v/v) glycerol, pH 8. After washing the column with twenty column volumes of equilibration buffer, CYP121A1 was eluted at 5\u00a0mL/min with equilibration buffer containing imidazole (using a stepped gradient of 0\u2013200\u00a0mM imidazole in 40\u00a0mM steps) and collected as 4\u00a0mL fractions with monitoring for both protein and heme (respective absorbances at A280 and A417). The purity of fractions collected was assessed by SDS-PAGE gels. Pure fractions were combined and dialyzed overnight at 4\u00a0\u00b0C into fresh buffer  using a Slide-A-Lyser\u2122 dialysis cassette , concentrated to around 500\u00a0\u03bcM in a bench top centrifuge  using a Vivaspin  ultrafiltration column , apportioned into small aliquots, flash frozen with liquid nitrogen and stored at\u00a0\u221280\u00a0\u00b0C until required. Final protein concentrations were determined using a NanoDrop 2000c spectrophotometer  by monitoring for heme absorbance at 417\u00a0nm .Untagged CYP121A1 was expressed and purified to homogeneity as reported previously ,38. A Hieviously  with min4.3Untagged CYP121A1 was expressed and purified to homogeneity as described above with an additional final polishing step utilizing a HiLoad Superdex 75 preparative grade 16/600 . The column was equilibrated with 10\u00a0mM Tris, 100\u00a0mM KCl, pH 7.8\u00a0at 4\u00a0\u00b0C (adjusted with KOH/HCl) and CYP121A1 was eluted isocratically according to the manufacturer's instructions. Fractions with a calculated Reinheitszahl (Rz) ratio of \u223c2 were pooled and concentrated using a Vivaspin 20 10,000 MWCO centrifugal concentrator . A modified form of the Rz ratio can be derived as follows:4)2SO4  as the precipitant and 1\u00a0M MES pH 5\u20136.5  as the buffer system in three lens microplates . Precipitant concentration and pH ranged between 1.5 and 2.5\u00a0M and 5\u20136.5 respectively. Sitting drops were set up with a Mosquito Crystal  using 20\u00a0mg/mL CYP121A1 in 1\u00a0\u03bcL drops with a 1:1 ratio of protein to mother liquor. Plates were incubated at 4\u00a0\u00b0C and crystallogenesis took between 3 and 7 days to occur. Mature crystals were approximately 1\u00a0mm in length with an arrowhead morphology. Crystals were either soaked with saturated compound solutions made up in fresh DMSO or solid compound was added directly to the drops. In both cases, 1\u00a0\u03bcL of mother liquor was removed from the reservoir and transferred to the drop containing crystals to prevent desiccation. During soaks with DMSO-solubilized compound, 1\u00a0\u03bcL of compound solution was introduced to the reservoir and thoroughly mixed before 0.5\u00a0\u03bcL was transferred to the drop, mixed and removed. The transfer process was performed a total of three times. Soaked crystals were periodically removed (up to\u00a0\u223c\u00a06 months), preserved in Parabar 10312  and flash-cooled in liquid nitrogen. Crystals were irradiated at the Diamond Light Source  using the i03, i04 or i04-1 beamlines using standard collection parameters. Data were automatically indexed, integrated, scaled and merged using the xia2 dials [The crystallization conditions identified previously  were usea2 dials  and xia2a2 dials ,42. Dataa2 dials , molecula2 dials  , 14 (7NQN) and 21 (7NQO) have been deposited with the RCSB Protein Data Bank (www.rcsb.org) and will be released upon publication.Accession codes and atomic coordinates for the X-ray structures of complexes of CYP121A1 with compounds 4.4Mycobacterium tuberculosis laboratory strain H37Rv was routinely cultured in Middlebrook 7H9 broth  supplemented with 10% (v/v) Albumin Dextrose Catalase (ADC) enrichment , 0.05% (v/v) tyloxapol and 0.02% (v/v) glycerol (c7H9). Liquid cultures were grown at 37\u00a0\u00b0C in 50\u00a0mL centrifugation tubes with rotation at 40\u00a0rpm until mid-exponential phase (OD600 \u223c1). For drug susceptibility testing, two additional broth-based media were used: Middlebrook 7H9 broth with low BSA supplemented with 10% (v/v) of ADN enrichment (0.05% (w/v) Albumin, 2% (w/v) Dextrose, and 0.85% (w/v) NaCl), 0.05% (v/v) tyloxapol and 0.02% (v/v) glycerol (7H9-Low BSA) and Mycobacterial Minimal Medium with cholesterol consisting of 0.5\u00a0g/L l-asparagine, 1\u00a0g/L KH2PO4, 2.5\u00a0g/L Na2HPO4, 50\u00a0mg/L ferric ammonium citrate, 0.5\u00a0g/L MgSO47H2O, 0.5\u00a0mg/L CaCl2, 0.1\u00a0mg/mL ZnSO4, 0.2% (v/v) tyloxapol, 0.2% (v/v) ethanol and 0.01% (v/v) cholesterol (MMM-Ch). Prior to the antimycobacterial activity testing, Mtb cultures were pre-adapted in the different test conditions by washing 1\u00a0mL of culture suspension twice with c7H9, 7H9-Low BSA or MMM-Ch and resuspended in 10\u00a0mL of the same medium. Bacterial cultures were then incubated at 37\u00a0\u00b0C in 30\u00a0mL square bottles  and allowed to stand for eight days. Compounds in powder form were dissolved in DMSO at 50\u00a0mM prior to assay. A modified resazurin based colorimetric assay was performed in a 96 well plate format in the three different media . Compounds were serially diluted column-wise to give a range of testing concentrations from 400\u00a0\u03bcM to 0.78\u00a0\u03bcM. Quality controls of drug only and bacteria only wells were also included with every plate. Rifampicin (1st line anti-TB drug) and DMSO controls were also included. Plates were inoculated with about 105\u00a0CFUs of bacteria, sealed and incubated at 37\u00a0\u00b0C for one week (for c7H9 and 7H9-Low BSA media) or two weeks (for MMM-Ch medium). Following incubation, a solution containing 0.02% (w/v) resazurin dye  was added to all the wells and incubated for a further day. Minimum inhibition concentrations (MIC90) were calculated using visual determination of the lowest concentration of drug at which there was no change in the resazurin colour.4.5Interactions of compounds with untagged CYP121A1 were analyzed by UV\u2013Visible spectroscopy. Protein fractions with Rz ratio of \u223c2 were used for titrations. Compound stock solutions were made up to 30\u00a0mM in fresh DMSO. Titrations with clear colorless compound solutions were performed at 28\u00a0\u00b0C using either a single-beam Cary 60 UV\u2013Visible spectrophotometer  or a dual-beam Cary 300 Bio UV\u2013Visible spectrophotometer  recording between 240 and 800\u00a0nm. Temperature control was achieved using a Cary single or dual cell peltier accessory  and a Julabo AWC100 recirculating cooling bath . Titrations were performed in 1\u00a0cm path length quartz cuvettes  using a matched pair when necessary. A solution of CYP121A1  was used per titration in sterile-filtered 100\u00a0mM HEPES, 100\u00a0mM KCl, 0.005% Tween-20, pH 7.8\u00a0at 28\u00a0\u00b0C (adjusted with KOH/HCl) to a final volume of 1\u00a0mL. Final DMSO concentrations were kept below 1% v/v. Prior to each titration, a baseline correction and zero was performed with buffer alone. Following this, CYP12A1 was added and the cuvette was incubated for 5\u00a0min to allow for temperature equilibration. A compound-free absorbance spectrum was recorded and then small volumes of compound  were introduced using a Hamilton syringe fitted with a syringe guide . Following each compound addition an absorbance spectrum was recorded and this was repeated until no further spectral changes were observed. The data were baseline corrected and the difference plot  at 25\u00a0\u00b0C. Ligands were initially prepared as 25\u00a0mM stock solutions in DMSO\u2011d6 (and further diluted into DMSO\u2011d6 when necessary). Both ligands and CYP121A1 were diluted into identical buffer  to generate mixtures containing 10% (v/v) DMSO\u2011d6, a final ligand concentration of either 0.5 or 2.5\u00a0mM (depending on ligand solubility) and a CYP121A1 concentration of 50\u00a0\u03bcM. Ligand titrations consisted of a small (0.2\u00a0\u03bcL) initial injection (that was discarded during data processing) followed by nineteen further injections (each of 2\u00a0\u03bcL) at 120\u00a0s intervals. Control titrations were also performed (adding ligand into buffer in the absence of protein) to measure any heats of dilution or buffer mismatch and were subtracted from ligand titrations during data processing. Titration isotherms were integrated to afford the enthalpy change of each injection and were plotted against the molar ratio of added ligand. Titrations were fitted using a one-site binding model using Origin Analysis Software by setting the stoichiometry (N) to one (for weak binding compounds) or allowing stoichiometry to vary (for more potent compounds).ITC experiments to measure binding affinity of ligands to 4.7d6 or 4% (v/v) of 25\u00a0mM stock solutions of ligands in DMSO\u2011d6 . Experiments for samples giving a positive shift in protein melting temperature were repeated in triplicate under identical conditions and the collected data were averaged (over the four runs).DSF was performed using a Bio-Rad CFX Connect system , scanning from 25\u00a0\u00b0C to 95\u00a0\u00b0C in 0.5\u00a0\u00b0C increments each of 30\u00a0s duration. Samples were run in 96-well plates, with each well containing a final volume of 25\u00a0\u03bcL. Screening was conducted in 100\u00a0mM potassium phosphate pH 6.9, 2.5\u00a0\u00d7\u00a0Sypro Orange, and with 5\u00a0\u03bcM Mtb CYP121A1 containing either 4% (v/v) DMSO\u20114.8Escherichia coli flavodoxin NADP\u00a0+\u00a0oxidoreductase (FLDR) was expressed and purified as previously reported [Spinacia oleracea ferredoxin (FDX), Leuconostoc mesenteroides glucose-6-phosphate dehydrogenase (G6PDH), glucose-6-phosphate (G6P) and NADPH were purchased from Sigma\u2013Aldrich (UK). Reaction mixtures comprising of 5\u00a0\u03bcM CYP121A1, 4.6\u00a0\u03bcM FLDR, 10\u00a0\u03bcM FDX, 2 units of G6PDH, 10\u00a0mM\u00a0G6P and 2\u00a0mM NADPH were run in 50\u00a0mM Tris-base, 150\u00a0mM KCl, pH 7.6\u00a0at 28\u00a0\u00b0C in a final volume of 500\u00a0\u03bcL. Reactions were run in amber, silanized glass vials . Positive and negative controls were prepared containing either 100\u00a0\u03bcM cYY  or with none respectively. For experimental samples, either 100\u00a0\u03bcM of compound or 100\u00a0\u03bcM compound and 100\u00a0\u03bcM cYY were used. The amount of DMSO was normalized across all samples to 1.6% v/v. For the positive control and experimental samples, compound and/or cYY was introduced prior to CYP121A1 to allow for proper equilibration. Reactions were started with the introduction of a mastermix comprising G6PDH, G6P and NADPH. Samples were incubated at 28\u00a0\u00b0C and 220\u00a0rpm for 2\u00a0h before reactions were stopped by the addition of 1\u00a0mL DCM via glass pipette. Samples were then briefly vortexed and then centrifuged for 10\u00a0min (466\u00d7g), the resulting lower organic phase was extracted using a glass pipette. This process was repeated once more, the organic phases were pooled and dried overnight in a fumehood. Following this, samples were further dried for 20\u00a0min in an EZ-2 centrifugal evaporator  set to aqueous mode with the lamp off. Samples were resuspended in 150\u00a0\u03bcL ACN  supplemented with 0.1% formic acid . LC\u2013MS analysis was performed on an Agilent 1290 uHPLC system coupled to an Agilent 6545XT LC-QTOF controlled by MassHunter 10 . Columns used were either an EclipsePlus C18 RRHD 1.8\u00a0\u03bcm 2.1\u00a0mm\u00a0\u00d7\u00a0150\u00a0mm  or a BonusRP RRHD 1.8\u00a0\u03bcm 2.1\u00a0mm\u00a0\u00d7\u00a050\u00a0mm  eluting at 0.45\u00a0mL/min at 60\u00a0\u00b0C. Mobile phases were either water supplemented with 0.1% formic acid (A) or acetonitrile supplemented with 0.1% formic acid (B). A gradient of 3\u201340% B over 6\u00a0min was used for separation. Signal acquisition was achieved using MS1 mode scanning from 100 to 3000\u00a0Da at 4\u00a0Hz. Data were analyzed on MassHunter Qualitative 10 and Quantitative 10 .Untagged CYP121A1 was expressed and purified to homogeneity as previously reported ,38. Eschreported ,51. Spin4.914 and 61\u00a0at 100\u00a0mM and a 30\u00a0mM cYY stock solution were prepared in fresh DMSO for competition assays. A titration with cYY alone was performed as a control using a stock solution at 15\u00a0mM prepared in fresh DMSO. Assays were performed on a dual-beam Cary 300 UV\u2013Visible spectrophotometer . Following introduction of 5\u00a0\u03bcM CYP121A1, 100\u00a0\u03bcM of either compound 14 or 61 was introduced in two equal additions and spectra recorded. The second spectrum taken was used as the starting point for a titration with cYY. Reverse competition assays were performed using a spectrum with 100\u00a0\u03bcM cYY present as the starting point for a titration with compound 14 or 61. A 100\u00a0mM cYY stock solution and 30\u00a0mM compound stock solutions were prepared in fresh DMSO for the reverse competition assay. Final DMSO concentrations were kept below 1% v/v. Titrations were performed and data processed as previously described. Data were fit to the Hill equation to derive the Compound stock solutions of both In the Hill equation, One of the authors, Professor Chris Abell, died suddenly during the preparation of this manuscript. His fellow authors wish to dedicate this paper to his memory.Chemistry , expression and purification of CYP121A1 , X-ray crystallography , antimycobacterial activity assays , UV-vis spectroscopy (IRS), DSF and ITC (MF), LC-MS activity assay and competition assay , manuscript preparation , concpts and experimental design , project management and supervision .The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper."}
{"text": "Sense of coherence (SOC), a concept that refers to individuals\u2019 abilities to manage, comprehend, and find meaning in their lives and the world around them, has been shown to be an important predictor of health outcomes. While SOC was initially hypothesized to be static after early-adulthood, there is growing evidence that health interventions can strengthen SOC. In this study, we accordingly examined whether SOC could be strengthened among adults in the context of a physical activity intervention.0) and after eighteen months (T3), with information on 117 participants in both of these waves. To assess the change in SOC between T0 and T3, ordered logistic regressions were performed, as well as mixed ordered logistic regressions with random intercepts for group and program location.This intervention, Communities on the Move, was conducted in the Netherlands, and was primarily targeted at older adults from socially vulnerable backgrounds. Four cohorts were followed for 18\u00a0months each, between 2012 and 2016. The SOC-3 questionnaire was used to collect data on SOC at baseline , while those with moderate or strong SOC at baseline reported a median change of zero points between T0 and T3. Further, based on the results of the regression analyses, those with weaker SOC scores were most likely to have stronger SOC at T3: having a weak SOC at baseline was associated with a 76% probability of stronger SOC, and a 4% probability of weaker SOC at T3. These results indicated that SOC may be strengthened in vulnerable older adults, particularly when their SOC is initially low.This study found evidence that SOC significantly changed from T ResearcHow might SOC be strengthened? According to the salutogenic perspective of health, this occurs via Generalized Resistance Resources (GRRs). GRRs are social and individual resources that \u2018help to manage stress and to thrive, moving towards the positive end of an ease/dis-ease continuum\u2019 . GRRs caOne pathway to strengthen GRRs, and consequently SOC, is experiential learning, as argued by However, it is not yet clear what type of interventions are most effective at engaging in experiential learning, and ultimately at strengthening SOC. To date, interventions have ranged from those focused on nutrition ; care faIn this study, we therefore investigated whether SOC may have strengthened in the context of a Dutch community-based physical activity intervention aimed at vulnerable older adults. We hypothesized that this was indeed the case, particularly among individuals whose SOC at baseline was weak.22.1This study focuses on the intervention, Communities on the Move. In the intervention, participants were, via purposive sampling, recruited in collaboration with the Knowledge Center for Sport & Physical Activity Netherlands, and with representatives from local programs. These local program representatives were approached through the Knowledge Center for Sport & Physical Activity Netherlands network, information meetings, training sessions, field visits and snowball procedures. Participation was on a voluntary basis. Most participants in the intervention were from low SES backgrounds, and/or were immigrants to the Netherlands . MoreoveExperiential learning was embedded in Communities on the Move. Participants gave input into recruitment, program design, and tailoring physical activities to their needs. Participants practiced what they learned, and actively involved their social and physical environments, in order to sustain their behavior change . This meThe data used in this study came from the evaluation study of Communities on the Move . Partici0, T1 at six months, T2 at twelve months, and T3 at 18\u00a0months. At T3, there were 117 participants with complete covariate information. Data were collected via pen and paper questionnaires and were in Dutch, the working language of Communities on the Move. Socio-demographic factors and measurements of health, including SOC, were measured at baseline. SOC was measured again only at T3.The structure and duration of the programs varied. While some lasted for a fixed duration (10\u201313\u00a0weeks), other programs took the form of ongoing physical education classes. These exercises included outdoor activities  and indoor activities  . At base2.22.2.10). We derived SOC scores from the SOC-3 questionnaire, comprised of three questions, with one each aimed at manageability, comprehensibility, and meaningfulness (ibid.). Each question was scored by the participant from 1 to 3, whereby a score of 1 was associated with a strong SOC, and a score of 3 with a weak SOC. The combined SOC score therefore had a minimum of 3 (very strong SOC) and a maximum of 9 (very weak SOC). However, given this study\u2019s small sample size, the condensed, three-category version of SOC-3 at T0 was used as the key predictor in regressions. Here, a score of 3 was considered strong, a score of 4 or 5 was considered moderate, and a score of 6 through 9 was considered weak (ibid.).Our key predictor was SOC at baseline (Tgfulness . These q3) and at baseline (T0). This more extended scale was used in 0 and T3.The outcome of this study was change in SOC score. This was measured by differencing SOC at the final wave of the study  for those who dropped out of Communities on the Move. Out of the initial 268 participants, only 117 finished the program. It may be that those who dropped out were systematically different from those who finished the intervention. To assess whether this was the case, logistic regressions were performed, in order to test if SOC at baseline was associated with an increased odds of dropping out.We did not have information on SOC at T33.10), 16% of participants had strong SOC scores (scores of 3). Fifty-six percent of participants had moderate SOC scores (scores of 4 or 5) at T0. Further, 27% of participants had weak SOC scores (scores of 6 through 9). At T3, the largest share of participants (65%) reported no change in SOC. This is followed by 21% reporting stronger SOC scores. An additional 14% reported weaker SOC scores.Sample characteristics are presented in 0 (with scores between 6 and 9) experienced the largest strengthening of SOC: these individuals\u2019 SOC scores strengthened (decreased) by a median score of one point. In comparison, participants with strong SOC scores (with scores of 3) or moderate SOC scores (with scores of 4 or 5) at baseline reported a median change of zero points between T0 and T3.3.23, relative to the reference group of having a moderate SOC score (scores of 4 or 5) at T0. Conversely, having a weak SOC score at baseline (scores of 6 through 9) was strongly, significantly associated with a decreased odds of SOC weakening at T3. 3, and a 4% probability of weaker SOC at T3. There was therefore evidence in support of this study\u2019s hypothesis that SOC score strengthened during Communities on the Move.Regarding the results of the mixed ordinal regression, the variance component parameters of group and program location were both 0.000. Also, based on the results of a likelihood-ratio test, the mixed model was not a better fit than the ordinal logistic regression. Therefore, group and program location do not appear to have played a role in the change in SOC score.3.3After adjusting for covariates, SOC score at baseline was not significantly related to the odds of dropping out of Communities on the Move. However, receiving income assistance, and giving no response to this question were significantly associated with an increased odds of dropping out of Communities on the Move. Being older and being born in the Netherlands were associated with lower odds of dropping out of Communities on the Move. These results are available on request.43, and that program group and location did not explain the variance in changes in SOC. These findings chimed with existing research, which has argued that there is more potential to change SOC among vulnerable groups, because these groups have the most to gain  compared other indicators collected during Communities on the Move, including physical activity levels, health-related quality of life, self-efficacy and enjoyment outcomes, measured at 12\u00a0months in the program, between drop-outs and non-drop outs. This previous study found that, when comparing other indicators of well-being, those who dropped out tended to score less positively. Moreover, in the present study, receiving income assistance (or not reporting a response) and being born abroad were significantly associated with the likelihood of dropping out. Ultimately, we found some evidence that more vulnerable participants were more likely to drop out.Similarly, this study had a high rate of drop-outs: 43% of participants at TThis pattern of drop-outs is by no means unique to Communities on the Move: in general, more vulnerable individuals are both less likely to be recruited for health promotion interventions, and are less likely to complete interventions once they are involved . Communi5In this study, we offered further insights into how and why SOC may be strengthened during a physical activity intervention. We found that SOC strengthened over the course of Communities on the Move, with those with the weakest SOC scores at baseline experiencing the largest strengthening in SOC. This study therefore provided evidence that SOC may be possible to strengthen among adults, particularly among those whose SOC scores are initially low. Based on the fact that change in SOC did not vary across groups and programs with different physical activity content, we argued that the intervention itself \u2013 rather than program-specific factors \u2013 played a larger role in strengthening SOC. Ultimately, SOC, as a subjective measures of well-being, may be an important complementary indicator to health promotion interventions.The completed evaluation study of Communities on the Move was funded by the ZonMW project, \u201cEffectiveness and cost-effectiveness of the Communities on the Move program\u201d (project number: 200130010).Kristina Thompson: Methodology, Formal analysis, Writing \u2013 original draft, Writing \u2013 review & editing, Visualization. Marion Herens: Conceptualization, Project administration, Data collection, Writing \u2013 original draft, Writing \u2013 review & editing. Johan van Ophem: Conceptualization, Writing \u2013 review & editing. Annemarie Wagemakers: Conceptualization, Project administration, Supervision, Writing \u2013 review & editing.The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper."}
{"text": "Knowledge of the level and duration of protective immunity against SARS\u2010CoV\u20102 after primary infection is of crucial importance for preventive approaches. Currently, there is a lack of evidence on the persistence of specific antibodies. We investigated the generation and maintenance of neutralizing antibodies of convalescent SARS\u2010CoV\u20102\u2010afflicted patients over a ten\u2010month period post\u2010primary infection using an immunofluorescence assay, a commercial chemiluminescent immunoassay and an in\u2010house enzyme\u2010linked neutralization assay. We present the successful application of an improved version of the plaque\u2010reduction neutralization assay which can be analysed optometrically to simplify data interpretation. Based on the results of the enzyme\u2010linked neutralization assay, neutralizing antibodies were maintained in 77.4% of convalescent individuals without relevant decay over ten months. Furthermore, a positive correlation between severity of infection and antibody titre was observed. In conclusion, SARS\u2010CoV\u20102\u2010afflicted individuals have been proven to be able to develop and maintain neutralizing antibodies over a period of ten months after primary infection. Findings suggest long\u2010lasting presumably protective humoral immune responses after wild\u2010type infection. A year after the pandemic began and there is still a lack of data on the persistence of the immunologic footprint left in a convalescent SARS\u2010CoV\u20102 afflicted patient. Moreover, the first publications reported discrepancies concerning the persistence of specific IgG antibodies  post\u2010infection.To obtain a reliable overview of the development of antibodies over time, we chose to compare three different serologic methods with different diagnostic targets. Specifically, we detected IgG antibodies targeting Spike 1 and 2 via chemiluminescent immunoassay, polyclonal IgG and IgM antibodies via immunofluorescence assay, and neutralizing antibodies using an in\u2010house enzyme\u2010linked neutralization assay (ELNA). A technique similiar to ELNA was recently used for SARS\u2010CoV\u20102 serology by different research groups  were followed over 10\u00a0months post\u2010infection. Ethical approval to use residual routinely taken serum samples for retrospective antibody analyses was obtained by the Ethics Committee of the University Hospital Wuerzburg (no. 20201105_01). All participants provided written informed consent and the study was performed according to the principles of the declaration of Helsinki 2013.Following the initial baseline data collection, we conducted serological follow\u2010up examinations to evaluate seroconversion rates. First blood draw occurred 21\u201343\u00a0days  after the onset of symptoms in the first week of April 2020 , T3 (three months post\u2010infection), at T5 (five months post\u2010infection) and a final blood draw at 10\u00a0months post\u2010infection in February 2021, called T10. Clinical data were obtained using a standardized data collection form.Disease severity for each patient was assessed clinically using a standardized questionnaire including age, gender, pre\u2010existing as well as acute physical condition  and enzyme\u2010linked neutralization assay (ELNA).The presence of different types of antibodies was analysed in follow\u2010up serum samples by three different serologic methods to ensure validity of results: IgG in\u2010house immunofluorescence assay (IFA), IgM in\u2010house IFA, CLIA IGG2.2Nasopharyngeal swabs were taken by trained healthcare personnel. Immediately after collection, viral RNA was extracted using the Indimag Pathogen kit  and tested for SARS\u2010CoV\u20102 by RT\u2010qPCR using the Bio\u2010Rad CFX96 system (Roche) with a LightMix Modular Assay kit in accordance with the modified Charit\u00e9 guidelines  method  was used for the neutralization assay.Isolation of SARS\u2010CoV\u20102 was attempted from RT\u2010qPCR positive nasopharyngeal swabs by inoculation on VeroB4  in T25 tissue culture flasks for 1\u00a0hr at 35\u00b0C. After incubation, the sample was removed and Medium199 (Gibco) with 2.5% foetal calf serum  and a mixture of antibiotics  was added. We monitored virus cultures daily for cytopathic effects and tested for specific viral RNA every three days. Isolation was considered successful when the cytopathic effect was 80%\u2013100% in passage 0 as well as passage 1 and/or Ct value in qPCR was lower than 20. Highly positive supernatants were harvested, centrifuged at 3,400\u00a0In\u2010house immunofluorescence assays (IFA) were assembled as described elsewhere  (LIAISON) is a CLIA (Chemiluminescent Immunoassay) which detects IgG antibodies reactive with the spike protein (S1/S2 domain). The assay was performed on the LIAISON\u00ae XL Analyzer according to the manufacturer's instructions. The diagnostic sensitivity was 97.9%  according to the manufacturer, the specificity in laboratory routine was 99.0% .The LIAISON2.46 cells/ml to give a confluent monolayer. Next day, an infectivity titration was carried out to determine 100 tissue culture infectious dose 50% (100 TCID50)  were seeded in flat\u2010bottom 96 well plates with Medium199 (Thermo Scientific Gibco) and 10% foetal calf serum (Thermo Scientific Gibco) at a density of about 10) Vihay,\u00a0. Sera we) Vihay,\u00a0. To eval5 TCID50) and serum dilutions in Medium199 were mixed and subsequently incubated for 1\u00a0hr at 35\u00b0C in U\u2010bottom 96 well plates . After incubation, a pre\u2010seeded flat\u2010bottom 96 well plate with confluent VeroB4 cells was used, medium was discarded, the incubated mixture of patient's serum and defined virus solution was transferred to each corresponding well of the flat\u2010bottom plate and the plate was incubated for 24\u00a0hr at 35\u00b0C. Incubation was stopped by discarding supernatant, cells were washed in PBS twice, fixed with ice\u2010cold acetone\u2010methanol (1:1) and frozen for at least 15\u00a0min. All steps were performed under strict observation and in compliance with biosafety level 3. The analysis was carried out like an enzyme\u2010linked immunosorbent assay using a BEP III (Siemens) according to the following steps: blocking , washing 3\u00d7 , anti\u2010SARS\u2010CoV\u20102 nucleocapsid protein IgG , washing 3\u00d7, adding of horseradish\u2010peroxidase\u2010conjugated goat anti\u2010mouse IgG , washing 3\u00d7, adding substrate tetramethylbenzidine (TMB) and stop solution (Siemens). The cut\u2010off titre was set by titrating defined negative human sera from volunteers out of healthy Tyrolean blood donors from the year 2009 and was set at 1:4 in combination with the viral dose of 1\u00a0\u00d7\u00a0105 TCID50 and calculated as median optic density minus the standard deviation. A sample was considered positive when the given optic density was higher than the cut\u2010off titre.With these evaluated sera, we adapted the PRNT to an ELNA without the need of an apparent cytopathic effect (CPE) and a shorter incubation period of <24\u00a0hr. For ELNA, sera were titrated in duplicate in twofold dilution steps, starting at a dilution of 1:4 in Medium199 containing 3% foetal calf serum. Equal volumes of virus  and time point 10 (T10) was defined as an increase or decrease of the titre. In the IgG CLIA assay, the development of antibodies was defined as a change in chemoluminescence of more than 50%.2.6n\u00a0<\u00a060) . A two\u2010sided significance level of p\u00a0=\u00a0.05 was used for determining statistical significance. The Spearman's rank correlation coefficient was used to analyse correlation of titres between CLIA and ELNA . To determine the predominant titres in a group of patients, the median was calculated  according to McHugh, Dichotomous data were tested by a chi\u2010squared test or Fisher's exact test in the case of small group size  were asymptomatically infected with SARS\u2010CoV\u20102, 20 patients (58.8%) showed a mild, six (17.6%) a moderate and five (14.7%) a severe course of the disease.p\u00a0=\u00a0.11), although only one (5.6%) female had a severe course compared to four male patients (25.0%).In total, the group consisted of 18 women and 16 men. There were no gender\u2010related differences in the course of disease (SD\u00a0=\u00a016.4). Due to expected differences in disease course  of SARS\u2010CoV\u20102\u2010positive patients in the convalescent phase (>21\u00a0days after symptom onset) tested had seroconverted at T1 in April 2020 and in total, 77.4% of the patients (24/31 samples) had seroconverted until February 2021 (T10), as determined by ELNA  of patients seroconverted one month post\u2010infection and 81.4% (26/31) stayed positive in this test method ten months later without a significant decrease in measurable units of IgG, as shown in Figure 3.5p\u00a0=\u00a0.003) and to 33.3% (10/30 tested patients) after 10\u00a0months (p\u00a0<\u00a0.0001).The highest number of positive individuals was found in the IFA IgG one month post\u2010infection , which dropped significantly to 65.6% (21/32 tested patients) within the study period of 5\u00a0months (3.6Both methods showed that specific antibodies stayed constant over the observation period and that greater disease severity led to a more stable antibody response.CLIA IgG recognized two sera from the first time point as positive (5.9%), which turned out as negative in ELNA. This result is aligned with the manufacturer's reported diagnostic accuracy . Repeated serologic investigations at T5 resulted in one patient (3.0%) false negative in CLIA IgG compared to the ELNA method. Ten months post\u2010infection, the CLIA IgG method recognized 83.9% positive samples (26/31 samples). Two samples that proved positive in CLIA but negative in ELNA had low titres of specific antibodies in CLIA.3.7n\u00a0=\u00a018). Two of the seven sera, which proved negative in IFA, were also negative in ELNA, the others were borderline positive with titres around 1:4 in ELNA, as shown in Table\u00a0Immunofluorescence assay gave 94.0% positive results at T1 and the strongest decrease of antibodies until T10 with a decrease of positive patients of 60.7% , the lowest number of seroconversions was found in CLIA IgG . In 11 cases (32.4%), IgM was detectable by IFA 28\u201341\u00a0days (T1) after the onset of symptoms.SD = 12.4) with a mild course of disease did not develop SARS\u2010CoV\u20102 specific antibody responses over the study period and eleven patients developed only weak antibody responses five months post\u2010infection.Four patients  of patients, the neutralizing antibody titres against SARS\u2010CoV\u20102 stayed constant and did not change significantly during the ten\u2010month follow\u2010up period. Two patients were negative in the CLIA IgG assay but showed weak neutralizing activities with antibody titres of 1:4.3.9p\u00a0<\u00a0.05) (Mann\u2013Whitney U\u2010test).Symptomatic patients showed significantly higher AU/ml at T1 and T3 (p\u00a0=\u00a0.07).Our data also revealed a relationship between the severity of infection and neutralizing activity by ELNA. Neutralizing titres were compared in a group of 3 asymptomatic versus 31 symptomatic patients, the symptomatic group had higher neutralizing titres approaching significance (p\u00a0=\u00a0.03). There was no significant difference in neutralization activities between asymptomatic and mild courses of disease (p\u00a0=\u00a0.17). Interestingly, 60% of the patients who experienced severe infections (3/5) developed low (titres of 1:4) of neutralizing antibodies  or neutralizing antibodies and disease severeity (k = \u2212.0951), nor did we observe a significant predominance of severe cases in oder age groups or male patients (p = .53). The mean age of severe cases was 46.0  versus 49.0 years  in cases of other severity categories. All patients with severe infections had neutralizing antibodies at T1. However, only 2 (40%) maintained neutralizing antibodies until T5, and 60% (n\u00a0=\u00a03) in this group showed low titres (<1:8) 5\u00a0months post\u2010infection (T5).There was no correlation between age and disease severity , three (T3), five (T5) and ten months (T10) post\u2010PCR\u2010confirmed infection using three different serologic tools ELNA, IFA and CLIA. Our data showed the persistence of specific IgG antibodies during the follow\u2010up period of ten months and a significant positive correlation between disease severity at initial presentation and neutralization activity. Overall, 77.4% of patients (24/31) maintained specific neutralizing antibodies in ten months post\u2010infection. More than three\u2010quarters  of symptomatic patients and a third  of asymptomatic patients maintained neutralizing antibodies over the ten\u2010month observation period. Investigations of IgG levels and neutralizing antibodies in the early phase of convalescence gave a similar result in earlier work  were significantly higher than those in the asymptomatic group . Two of these asymptomatic patients were negative in the early stage of the convalescent phase four weeks post\u2010infection (T1). One patient had a mild course of disease and stayed negative in all tests, whereas another patient with asymptomatic infection developed a weak neutralization response in the late convalescent phase (T5). These findings are aligned with published data, where milder courses of disease may require longer periods to generate specific antibodies and in a low number of cases, patients did not seroconvert at all after infection with SARS\u2010CoV\u20102 . Indeed, ELNA can be carried out 24\u00a0hr post\u2010infection by enzyme\u2010link using the structural protein N as a target due to its adequate abundance in infected cells, which is an approach that has also been used by others  as the assay's high binding possibilities to the polyclonal reconvalescent serum and the rapid decline of specific IgG antibodies in IFA with the lower sensitivity of this test system ."}
{"text": "Pomegranate is widely cultivated across China, and the phenolics in its peel are principal components associated with health benefits. Ultra-high performance liquid chromatography coupled to a quadrupole time-of-flight mass spectrometer (UHPLC-QTOF-MS) and ultra-performance liquid chromatography coupled to a triple quadrupole mass spectrometer (UPLC-QQQ-MS) were used in this study, aiming at profiling the total phenolic composition in pomegranate peel from nine selected cultivars in 7 production areas. Sixty-four phenolic compounds were identified or annotated, and 23 of them were firstly reported in pomegranate peel. Principal component analysis (PCA) plots show differences and similarities of phenolics among nine cultivars. Furthermore, 15 phenolic compounds were quantified with the standards, and punicalagin, ellagic acid, gallocatechin, punicalin, catechin, and corilagin were found to be dominant. Punicalagin weighed the highest content (28.03\u2013104.14 mg/g). This study can provide a deeper and more detailed insight into the phenolic composition in pomegranate peel and facilitate the health-promoting utilization of phenolics. Punica granatum L.) has been cultivated with a wide geographical global distribution, namely, China, India, Russia, Iran, Uzbekistan, Afghanistan, Spain, Italy, Greece, Morocco, and America  experiments  with optimized conditions under MRM mode. With nine cultivars to be investigated and the use of UHPLC-QTOF-MS, more phenolic compounds are expected to be discovered or understood in this study.Methanol , ethanol , acetonitrile , and formic acid (LC/MS grade) were all purchased from Thermo Fisher Scientific Technology Co., Ltd. . Standard compounds, namely, punicalagin, punicalin, corilagin, ellagic acid, gallic acid, catechin, epicatechin, epicatechin gallate, gallocatechin, epigallocatechin, epigallocatechin gallate, kaempferol-3-O-glucoside, isoquercitrin, luteolin-7-O-glucoside, naringenin-7-O-glucoside, and rutin, were all purchased from Yuanye Biotechnology Co., Ltd. .There were seven main production areas in China and we selected the cultivars from all seven production areas with the most representativeness. Nine cultivars of pomegranate fruit, Red agate (RA) from Huaiyuan County , Tunisian Soft Seed (TSS) from Yingyang city , Sweet With Green Seed (SGS) from Mengzi County , Green Peel Soft Seed (GPSS) from Huili County , Green Peel (GP) from Zaozhuang city , Net Skin Sweet (NSS) from Lintong district , Piyaman (PYM) from Hetian prefecture , Acidic Pomegranate (AP) from Kashgar prefecture , Sweet Pomegranate (SP) from Kashgar prefecture  were collected. The analysis of phenolic composition among nine cultivars was performed using the UHPLC-QTOF-MS  and the method of Xu et al.  was refePreliminary separation was performed by UHPLC at the flow rate of 0.4 ml/min with the column  maintained at 40\u00b0C and samples maintained at 4\u00b0C. Mobile phase A was 0.2% formic acid aqueous solution and B was acetonitrile. The solvent gradient was as followed: 0\u201311.50 min, 5\u201330% B; 11.50\u201311.51 min, 30\u2013100%; 11.51\u201315.00 min, 100\u2013100% B; 15.00\u201315.01 min, 100\u20135%; and 15.01\u201318.00 min, 5\u20135% B. The injection volume was 2 \u03bcl for all samples.m/z range of 50\u20131,200 and the acquisition rate of 2 spectra/s. The quality control (QC) sample, a mixture of aliquots from every sample, was inserted into the queue every 5 samples to ensure the stability and repeatability of the system. Reference ions were 121.050873 and 922.009798 for positive ion mode, and 112.9855 and 1033.9881 for negative ion mode.The MS conditions for positive and negative ion modes were the same in gas temperature (325\u00b0C), drying gas flow (7 L/min), spray voltage (35 psi), sheath gas temperature (350\u00b0C), sheath gas flow (11 L/min), and fragmentation voltage (380 V). The capillary voltage for positive ion mode was 3,500 V and for negative ion mode was 3,000 V, while the nozzle voltage for positive ion mode was 0 and positive ion mode was 1,500 V, respectively. Data acquisition was performed by TOF MS mode with the The MS/MS was performed under the auto MS/MS mode with QTOF only. The mass acquisition range was 30\u20131,200 with an acquisition rate of 4 spectra/s. The four highest responding parent ions were selected to be fragmented in every acquisition cycle. Separately, the samples of TSS cultivar were acquired three times under the collision energy of 10, 20, and 40 eV with other conditions the same as those under MS conditions.The quantification of main phenolic compounds was performed using a UPLC-QQQ-MS .Chromatographic separation was firstly carried out using a UPLC at the flow rate of 0.3 ml/min with the column  maintained at 40\u00b0C and samples maintained at 8\u00b0C. Mobile phase A was 0.3% formic acid aqueous solution and B was acetonitrile. The solvent gradient was as followed: 0\u201310.00 min, 5\u201327.5% B; 10.00\u201312.50 min, 27.5\u201355% B; 12.50\u201313.50 min, 55\u2013100% B; 13.50\u201316.50 min, 100\u2013100% B; 16.50\u201316.51 min, 100\u20135% B; and 16.51\u201320.00 min, 5\u20135% B. The injection volume was 2 \u03bcl for all samples.R2 > 0.999.Under both MRM mode and negative ion mode, the optimization for quantification, especially the parameters of cone voltage and collision energy, was performed by both Intellistart and manual tuning with desolvation gas temperature of 500\u00b0C, desolvation gas flow of 1,000 L/h, and capillary voltage of 2.0 kV. All standard compounds were dissolved in appropriate solvents shown in  and dilum/z.Based on the reference of Xu et al.  with somhttps://www.metaboanalyst.ca/)   and SIMCStatistical analysis was performed by SPSS Statistics 25.0 for the one-way ANOVA, and the bubble plot and the waterfall plot were performed by Origin 2019b.m/z, and every colored bubble, graded by intensity value with log transformed, represented one feature of m/z appearing at a specific time. All the colored bubbles distribution in the figure reflected the case of acquired data. Most bubbles were yellow and orange under the positive mode, while they were orange and green or even blue under the negative mode, indicating that the samples had a better response intensity under the negative mode.m/z and retention time were imported for further identification. Finally, a total of 64 compounds were annotated by UHPLC-QTOF-MS  and 5 other phenolic compounds  were identical to this study. Ambigaipalan et al. , increase the accuracy of m/z and fragments (compared with LC-MS/MS with low resolution), improve the range of detected compounds, strengthen the confirmation of main phenolic compounds with the standards, and save the time and solvents.The phenolic composition was one of the popular fields in pomegranate peel investigations, and differences were shown in references for compounds annotation or identification. El-Hadary and Ramadan  identifin et al.  analyzedn et al. . Abdullan et al.  did the It is noteworthy to have an insight into these compounds. Punicalagin and punicalin are ellagitannins . For ellTwo reasons could explain the differences of phenolic compounds in classes from pomegranate peel. One reason was mainly dependent on the characteristics of cultivars cultivated under different natural conditions. The cultivars in this study covered all the main production areas in China, which are various and different from the cultivars in references. Apart from thymol and olivetonide, the other 21 compounds annotated for the first time were all flavonoids in this study. The various derivatives of the initial phenylpropanoid scaffold play important roles in the plant, such as structural integrity, reproduction, UV photoprotection, and internal regulation of plant cell physiology and signaling . Nine sePeak areas of the compounds  were extIn the PCA score plot, the points in the same color represented the repeated samples for one cultivar. The separations were observed among the cultivars, and the distance among them symbolized the degree of similarity. AP (from Kashgar prefecture) and PYM (from Hetian prefecture) were very close to each other. However, SP, also from Kashgar prefecture, was far from AP or PYM. The three cultivars were all from Xinjiang Uygur Autonomous Region. The results showed that AP and PYM were more similar to each other in phenolic composition, while SP was significantly different from the other two cultivars. RA, GP, GPSS, NSS, and TS were in a big cluster, indicating that these five cultivars were relatively similar in phenolic composition. The unique one was SGS, from Mengzi County, Yunnan Province. It was very far from any other cultivars in the scores plot, showing its specificity in phenolic composition. The relation between cultivars and phenolic compounds was displayed by the combination of the loading plot and the PCA score plot. AP and PYM showed high positive scores along PC1 and the observations in the loading plot indicated that the two cultivars could be positively associated with maritimetin-6-O-glucoside, eriodictyol-7-O-glucoside, pelargonidin-3-O-glucoside, eriodictyol, pelargonidin-3,5-di-beta-D-glucoside, ellagic acid, \u03b2-punicalagin, cyanidin-3,5-di-O-glucoside, \u03b1-punicalagin, gallic acid, granatin B, and dihydrokaempferol. SGS was highly associated with kaempferol-3-glucoside-3\u201d-rhamnoside, fisetin, kaempferol-3-O-glucoside, kaempferol-3-O-arabinoside, cyanidin-3-O-alpha-arabinoside, luteolin 4'-O-glucoside, hyperoside, bracteatin, quercetin-3-O-xyloside, isoquercitrin, delphinidin 3-galactoside, and rutin. All these phenolic compounds related to SGS were flavonoids and this fact could account for the unique separation in PCA score plot of SGS. In addition, it could be deduced that the cultivar from Yunnan Province had the potential for the use of flavonoids. Li et al.  investigFifteen phenolic compounds are quantified by UPLC-QQQ-MS under negative ion mode with the optimized condition of cone voltage and collision energy, as shown in supporting information As shown in Li et al.  investigSixty-four phenolic compounds in pomegranate peel from nine selected cultivars were identified or putatively annotated, and 23 of them were firstly annotated. Thymol and undulatoside A were not detected in all cultivars. Cultivars were well-separated by PCA. For quantification, punicalagin, ellagic acid, gallocatechin, punicalin, catechin, and corilagin dominated among all the phenolic compounds. Punicalagin possessed the highest content with the range from 28.03 to 104.14 mg/g. These results confirmed that the nine cultivars and the use of UHPLC-QTOF-MS were helpful for the discovery and understanding of more phenolic compounds in pomegranate peel. The variety of phenolic compounds revealed the potential of these valuable compounds and the results could be used as the database for pomegranate peel. For absolutely quantified compounds with relatively high contents, more attention should be paid, and further investigations and developments of them are still needed such as extraction, bioactivity, or function.The original contributions presented in the study are included in the article/GM and LX contributed to methodology, investigation, and formal analysis. LX, XL, and ZX contributed to reviewing and editing. GM did data curation and original draft writing. XL helped in supervision and resources. All authors contributed conceptualization to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Cancer and its treatment pose challenges that affect not only patients but also their significant others, including intimate partners. Accumulating evidence suggests that couples\u2019 ability to communicate effectively plays a major role in the psychological adjustment of both individuals and the quality of their relationship. Two key conceptual models have been proposed to account for how couple communication impacts psychological and relationship adjustment: the social-cognitive processing (SCP) model and the relationship intimacy (RI) model. These models posit different mechanisms and outcomes, and thus have different implications for intervention. The purpose of this project is to test and compare the utility of these models using comprehensive and methodologically rigorous methods. Aims are: (1) to examine the overall fit of the SCP and RI models in explaining patient and partner psychological and relationship adjustment as they occur on a day-to-day basis and over the course of 1 year; (2) to examine the fit of the models for different subgroups ; and (3) to examine the utility of various methods of assessing communication by examining the degree to which baseline indices from different measurement strategies predict self-reported adjustment at 1-year follow up. The study employs a longitudinal, multi-method approach to examining communication processes including: standard self-report questionnaires assessing process and outcome variables collected quarterly over the course of 1 year; smartphone-based ecological momentary assessments to sample participant reports in real time; and laboratory-based couple conversations from which we derive observational measures of communicative behavior and affective expression, as well as vocal indices of emotional arousal. Participants are patients with stage II-IV breast, colon, rectal, or lung cancer and their spouses/partners, recruited from two NCI-designated comprehensive cancer centers. Results will be published in scientific journals, presented at scientific conferences, and conveyed to a larger audience through infographics and social media outlets. Findings will inform theory, measurement, and the design and implementation of efficacious interventions aimed at optimizing both patient and partner well-being. Patients with cancer often report disease- and treatment-related side effects including fatigue, pain, and cognitive impairment . Emotionand partners to the illness experience  model, lack of cognitive processing is the primary mechanism linking communication difficulties to psychological distress. Individuals who perceive their partner as unreceptive to discussing cancer-related concerns talk less about them with their partner, reducing cognitive processing needed to assimilate and accommodate the cancer experience into their world view, leading to increased psychological distress . The prohave demonstrated mediating paths, for example, that mutual avoidance is associated with greater psychological distress through decreased intimacy . Similar to facial expressions, features of the voice contain significant information about internal emotional experiences  women with a higher f0 overall displayed more behaviors likely to elicit positive support (such as stating their needs clearly), and (b) women displayed fewer adaptive support-eliciting behaviors when their partners exhibited higher overall f0. These findings suggest that it may be adaptive for female patients to experience and express emotional arousal during conversations of cancer-related concerns, but that high emotional arousal on the part of their partners may interfere with this process. The findings, while preliminary, suggest that this is a promising approach with the potential to inform measurement and theory of the processes through which communication affects adaptation to cancer. In addition to examining overall levels of emotional arousal, this approach lends itself to a more detailed examination of how arousal evolves across the interaction, providing further insights into communication-related processes.Another promising objective approach to studying couples\u2019 communication is the assessment of expressed emotional arousal during couples\u2019 interactions eriences . f0 is ted pitch , and is ed pitch . It is aed pitch . To dateThe purpose of the present project is to provide a comprehensive and methodologically rigorous evaluation of both the SCP and RI models, including delineation of mediators (how they work) and moderators (for whom they work). Specific aims are: (1) To examine the overall fit of the SCP and RI models in explaining patient and partner psychological and relationship adjustment as they occur on a day-to-day basis and over the course of 1 year. (2) To examine the fit of the models for different subgroups: males vs. females, and patients vs. partners. (3) To examine the utility of the various methods of assessing communication  by examining the degree to which each of these baseline indices predicts self-reported psychological and relationship adjustment at 1-year follow up.via actor effects, and that the RI model will predict individual psychological adjustment via actor effects and relationship adjustment via both actor and partner effects (aim 1). It is also likely that the strength of these associations will vary between individuals or subgroups (aim 2). While there are numerous variables that could potentially moderate these mediating effects, based on the literature and potential clinical relevance, we chose to examine gender and role (patient vs. spouse). With regard to gender, stronger positive associations between perceived social constraints and distress have been found among male vs. female cancer patients  a dThe study design is longitudinal, with repeated questionnaire-based assessments at baseline and 4, 8, and 12 months post-baseline to capture quarterly reports across a 1-year follow-up period without undue participant burden. Patients are recruited from the Duke Cancer Institute in Durham, NC and the Seattle Cancer Care Alliance in Seattle, WA, two NCI-designated comprehensive cancer care centers. Inclusion criteria for patients are:\u2022age 18 or older\u2022stage II-IV breast, colon, rectal, or lung cancer\u2022currently receiving or having received a form of systemic therapy (or hormone therapy for breast cancer) within 2 years of diagnosis of current stage\u2022life expectancy of at least 6 months per primary oncologist\u2022ability to speak and comprehend English\u2022being married or in a committed, cohabiting relationship with a same- or opposite-sex partnerWe chose to focus on breast, colorectal, and lung cancers because they are relatively common solid tumor cancers and because, with the exception of breast cancer, occur frequently in both males and females.Inclusion criteria for partners are:\u2022age 18 or older\u2022ability to speak and comprehend English\u2022being married to or in a committed, cohabiting relationship with the patientExclusion criteria are provider non-approval (patients), cognitive impairment prohibiting completion of study assessments (patients and partners), and logistical constraints preventing participation (patients and partners).Patients identified as meeting initial medical inclusion criteria per medical records are sent a study brochure and letter signed by their primary oncologist introducing the study and informing them that they will be contacted by a research team member by phone (with opt-out instructions in case they do not want to be contacted). Those contacted and deemed fully eligible based on further screening confirmation during the recruitment phone call  are provided a detailed description of the study aims, procedures, risks and benefits, and probed for understanding. If the patient decides that they would like to participate, the research team member obtains permission to speak with the partner. If permission is granted, the research team member describes the study aims, procedures, risks and benefits to the partner. If a given patient declines, their partner is not contacted. If both dyad members agree to participate, the in-person baseline assessment visit is scheduled. This visit commences with a formal face-to-face consent process  and signing of consent documents.via REDCap at 4, 8, and 12 months post-baseline. Each activity is described in turn below. Participation is estimated at approximately 8 h total: a 2-h baseline assessment visit, twice-daily EMA surveys 5\u201310 min each for 14 days, and 3 follow-up questionnaires (30\u201345 min each).Study participation lasts for 12 months and is depicted in Data are extracted from medical record summary, oncology, and clinic visit notes to obtain screening and follow-up information: cancer site, current cancer stage, confirmation of current cancer stage within 2 years, current or previous therapies (systemic and/or hormone) and surgeries, primary oncologist, gender, primary language, year of birth, and marital/partner status.via email for all follow-up questionnaire administrations.All questionnaires are administered using Research Electronic Data Capture (REDCap), a secure web-based tracking and on-line data acquisition system . Our proSupplemental measures added after the commencement of enrollment and designed to answer ancillary questions include the Revised Adult Attachment Scale , the ParWe developed a study-specific smartphone application using the LifeData platform. The app is free to use and compatible with both iOS and Android devices. Participants are asked to download the app during the baseline laboratory session, with guidance from an experimenter. They are also given a user instruction and FAQ document to take home and refer to as needed; study contact information is included for assistance.Participants use their own smartphones to complete the EMA unless they either do not own one or own a device with a different operating system. Those without an appropriate smartphone borrow a study iPod Touch device for this activity. The app interface across these systems is comparable.EMA is to commence following the laboratory-based visit. Participants receive a push notification to complete EMA twice daily over the course of 14 days: once at 12:00 p.m. and once at 8:00 pm, both times within a 2-h active window. Push notifications begin immediately after app download, so depending upon the time of day of the baseline assessment, participants begin receiving notifications either that afternoon or that evening. This timing, frequency, and duration was based on pilot work conducted with a non-medical sample . If partAt each EMA, patients and partners are asked to answer a series of questions. Branching logic minimizes participant burden. First, participants are asked if they talked to their partner during a given time frame (since awakening for the 12:00 p.m. time point or since the last assessment for the 8:00 p.m. time point). If no, a single item designed to assess reasons for not talking is posed . If yes, questions designed to assess perceptions of the conversation follow. These are listed in Couples are asked to participate in a 15-min cancer-related conversation that is video-recorded for later coding. Separate audio-recordings afford analysis of vocally encoded emotional arousal as described below. To assist participants in selecting topics of discussion for these conversations, we provide a list of cancer-related issues known to be relevant based on past research . These tCouples are asked to sit in chairs placed approximately two feet apart and facing one another at a slight angle. They are instructed to speak to one another vs. the camera, and to allow the conversation to flow as it normally would outside of the research setting.0 baseline for analyses of vocally encoded emotional arousal. In this task, one dyad member is handed a picture and asked to describe what is depicted in it  to their partner. After 1 min, the experimenter hands three pictures to the partner and asks them to select the one that was described. Roles are then reversed with a different set of pictures.Prior to picking the topic and the conversation, couples engage in a modified DiapixUK task  designedTwo independent yet complementary coding systems are used to characterize participants\u2019 communicative behaviors and affective expressions captured during the 15-min couple conversations: (1) the Asymmetric Behavior Coding System  and (2) Coding is being conducted in two waves with separate coding teams for the two systems, each consisting of 4\u20136 trained raters. For both systems, ratings are made independently by each coder and for each 3-min segment of the 15-min conversation. Separate passes are made for patients and partners. Order of viewing is randomized across coders, with approximately 30% of cases rated by all coding team members to assess inter-rater reliability. Coding teams meet weekly by videoconference to address problematic (highly discrepant) codes or cases.The Asymmetric Behavior Coding System (ABCS) was adapted for this project to measure communicative behavior in the context of conversations regarding cancer. The ABCS consists of 24 behavior codes that load onto four higher-level factors as shown in the upper half of While the ABCS focuses on the content and function of specific communicative behaviors, the Relational Affective Topography System (RATS) focuses on the affective quality of expressions. The RATS involves three steps. First, coders record whether positive emotions, negative emotions, and flat emotions as defined in the lower half of 0) mean from the couple conversations as a marker of expressed emotional arousal during the interaction for each dyad member. Audio recordings are made using Lavalier microphones (Shure BLX88 and Tascam DR-40 Linear PCM recorder), with each microphone targeting one dyad member and recording onto a separate channel, resulting in relative differences in volume depending on who is speaking at a given time. We then extract f0 as a continuous measure across the 15-min conversation in estimated values  for every quarter-second using Praat ; plots are visually inspected for outliers, and observations are removed as needed . All data management procedures are conducted using Stata 16 , the proportion of patient-partner dyads agreeing to participate (50%), disease-specific survival rates, and drop-out over time (30%). Based on power calculations for indirect effects (via measures of cognitive processing and intimacy (Ms) comprising small-to-moderate constituent  associations of r \u2265 0.25, assuming moderate confounding of X\u2192M and M\u2192Y associations (R2 = 0.15).We project a complete-case sample of approximately 264 dyads for the questionnaire portion of the study, in other words, 264 dyads for which  effects  conducteAssociations hypothesized under the SCP and RI models will be examined with structural equation models (SEMs) separately for questionnaire data from T1-T4 and data from the EMA phase, primarily in a longitudinal actor-partner interdependence model (APIM) framework, with patients and partners treated as distinguishable dyad members . To examAll SEMs will be estimated in Mplus 8.7. Bootstrap standard errors for direct and indirect effects will be estimated, except for multilevel SEMs, where a Monte Carlo simulation approach will be used  within an APIM framework, in which measures from both dyad members  are included in each analysis. In these SEMs, a proposed latent factor with 6 indicators  reflecting overall communication will prospectively predict either a cognitive processing (avoidance and intrusive thoughts) composite (under the SCP model) or intimacy (under the RI model), which will, in turn, prospectively predict measures of psychological distress  and relationship adjustment . Prior to estimating the full SEMs for the questionnaire data, a measurement model for the proposed communication factor will be developed and refined using a confirmatory factor analysis approach. The degree of measurement invariance  for this proposed latent factor between patients and partners (and between men and women) will be evaluated in a sequential fashion. Non-invariance at each step in the sequence will be assessed using likelihood ratio tests (with \u03b1 = 0.05) and changes in CFI (target \u2264 0.01). Potential sources of non-invariance  will be investigated and the measurement model will be modified accordingly .patient communication predicting patient intimacy) and prospective partner  effects  will be estimated along with autoregressive  associations. Mediators and outcomes will be treated as manifest variables in these models. Latent person-level intercept factors will be included to account for random between-person variability in mean levels of model constructs. Within-couple indirect associations of communication and outcomes  via mediators  will be estimated using a product-of-coefficients approach  effects  nested within couples (level 2 units). Each study day observation will have values for patient and partner reports of afternoon communication  as exogenous predictors, afternoon reports of cognitive processing  or intimacy as mediators, and evening reports of psychological distress (POMS TMD composite) or relationship satisfaction as outcomes, all from the same day\u2019s afternoon and evening assessments. In addition, autoregressive associations are included such that afternoon reports of mediators are predicted from the preceding evening\u2019s reports of the same variables  and each evening outcome variable is predicted by the immediately preceding observation on the same variable. See To examine potential differential functioning of the SCP and RI models across gender  and role (patient vs. partner), we will employ two different modeling approaches within an APIM framework. For gender, we will add gender \u00d7 communication and gender \u00d7 mediator  terms to the standard \u201cmain effects\u201d APIM models described above. For example, we would examine patient gender \u00d7 patient communication, partner gender \u00d7 partner communication, patient gender \u00d7 patient intimacy, and partner gender \u00d7 partner intimacy terms in a single model. To examine differential functioning by role, we will examine how individual cross-role equality constraints for parallel APIM actor and partner effects  affect model fit and test between-role differences in indirect effects. These models will be supplemented by exploratory analyses examining purely within-person  models to examine indirect effects and model fit in gender and role group subsamples.Finally, to examine how communication measured early in the study predicts questionnaire measures of psychological and relationship adjustment at follow-up, we will estimate separate SEMs (again in an APIM framework), each of which uses a measure derived from each of the three different assessment methods  used in the study. First, we will estimate dyadic SEMs with actor and partner direct effects of early communication on each measure of adjustment at 12-month follow-up, adjusting for the person\u2019s baseline assessment on the corresponding adjustment construct. In models based on questionnaire-measured communication, the general communication latent variable described above will be used. Objectively assessed communication, treated as a manifest variable, will be used in a parallel fashion in dyadic SEMs. Models based on EMA-measured communication will be estimated using two-level dyadic SEMs, with (the between-dyad variability in) repeated assessments of each patient\u2019s and partner\u2019s communication measure predicting psychological or relationship adjustment at follow-up, adjusting for the person\u2019s baseline level on the outcome variable.0 relates to psychological and relationship adjustment will include examination of how the trajectory of change in f0 over the course of the 15-min conversations predicts changes in psychological and relationship adjustment across the 1-year follow-up. First, trajectories of f0 across the conversation will be estimated for each partner by estimating a three-level  multilevel growth curve model where f0 is regressed onto time (within conversation) and time2. Estimates will be generated for each person\u2019s f0 intercept  and effect of time and time2 . These values will be decomposed into within- and between-couple components. STATA will be used to analyze the primary models of interest in which longitudinal psychological and relationship adjustment separately are regressed on gender (as a covariate), role (patient vs. partner), f0 parameters within- and between-couple, wave (from baseline to 12 month), and their interactions. Model influence diagnostics and sensitivity analyses  will be conducted to ensure stability of model results.Analyses examining how fAnalytic plans for the supplemental measures  will be used to examine associations between patient and partner parenting concerns and measures of communication, psychological distress, and relationship adjustment. This will build on findings from prior studies indicating that, among patients, parenting concerns are associated with higher levels of psychological distress .This measure will be used to characterize the sample with regard to financial distress, both overall and as a function of sociodemographic and medical variables (cancer type and stage). We will also examine concordance or lack thereof in financial distress within couples and the trajectory of financial distress over time, from baseline to 1-year follow-up.This measure contains items designed to assess the extent to which the pandemic has caused change in multiple life domains: routines, family income/employment, food access, medical health care access, mental health treatment access, and access to extended family and non-family social supports. Additional items assess personal and family diagnoses of COVID, and perceived severity of pandemic-related stress and stress and discord in the family . We will utilize descriptive statistics to characterize the sample with regard to COVID diagnoses and impacts on the life domains listed above. We will also conduct APIM analyses to examine concurrent intra- and inter-personal associations between pandemic-related stress and self-reported measures of communication (such as holding back) and well-being as measured by the FACT-GP.From the Revised Adult Attachment Scale, we will derive subscales of anxious and avoidant attachment styles for each participant. For analyses involving this measure, we will apply an Actor Partner Interdependence Mediation Model to APIM couples\u2019 self-reported attachment, communication (disclosure and holding back), and physical well-being as measured by the FACT-GP. Indirect associations between a dyad member\u2019s attachment (either anxious or avoidant) and their partner\u2019s physical well-being are proposed as mediated by the dyad member\u2019s own communicative behavior. We will examine model fit as described in the analytic overview above. Direct and indirect associations will be evaluated using 95% bootstrap confidence intervals.To our knowledge, this is the first multi-method longitudinal study of couples\u2019 communication in the context of cancer. Results will provide evidence to enable testing models of how couples\u2019 communication is associated with adjustment to the cancer experience. Our long-term goal is to use these results to design and refine interventions that will improve couples\u2019 communication and relationship functioning, alleviate cancer-related distress, reduce caregiver burden, and optimize patient and partner recovery from the rigors of cancer. Empirical support for the SCP model would indicate that interventions should focus on strategies that enhance cognitive processing. While these could include couple-based interventions that facilitate couples\u2019 discussion of cancer-related issues, they may also include individual interventions that provide the opportunity for cognitive processing through disclosure to supportive others  or in non-social forms such as expressive writing. In contrast, support for the RI model would indicate that couple-based interventions are needed and should focus on enhancing intimacy through strategies to increase partners\u2019 feelings of closeness and caring . Moderation analyses will examine whether these models may differentially apply depending on sex or role (patient or partner), or on the outcome targeted. Identifying differences in associations for these different subgroups will inform clinical application of the findings.Use of technology in this study, specifically for EMA, will yield information regarding patients\u2019 and partners\u2019 smartphone access and their willingness to use the devices for research-based information and intervention delivery. Delivery of intervention content could occur using ecological momentary intervention or other types of real-time, mhealth methods.Study limitations include a focus on patients with a subset of cancer diagnoses and the exclusion of patients either in the earliest stage of disease or facing death within 6 months. In addition, couples electing to participate may be unrepresentative of the larger group of patients with cancer and their spouses, as patients experiencing significant effects of disease or treatment might decline participation on that basis or for other reasons. Couples might also be hesitant to engage in the video-recorded conversation, or be reluctant to discuss topics related to cancer and its treatment, as these might result in emotional discomfort.While the multi-modal nature of the assessments used in the study are a strength, as they provide multiple sources of information from both patient and partner, it is possible that some of the study procedures could be reactive and potentially affect responses to others. For example, engagement in the EMAs or the conversation could conceivably affect responses to other assessments by heightening perceptions or awareness of certain issues. We attempt to mitigate this in part by collecting the baseline self-report measures prior to the conversation and EMA. It is also possible that couples might discuss their responses to the EMA or other portions of the study, reducing the independence of their responses. We attempt to mitigate this by asking couples not to discuss their responses with each other. We believe this potential threat to internal validity is relatively low, and is offset by the benefits of collecting data in real time and in naturalistic settings.Results will be published in scientific journals, presented at scientific conferences, and conveyed to a larger audience through infographics and social media outlets. We will also share findings with key stakeholders  to inform intervention planning and implementation.The studies involving human participants were reviewed and approved by the Arizona State University Institutional Review Board and Duke Health Institutional Review Board. The patients/participants provided their written informed consent to participate in this study. Reliance agreements were established to cover human subjects activities at the University of Washington and the Fred Hutchinson Cancer Research Center, with reliance on Arizona State University\u2019s Institutional Review Board.LP, SL, FK, JR, TS, KS, JBu, DB, JBr, NB, JG, VS, KW, and SZ obtained funding for the study, LP and SL as Multiple Principal Investigators. LP and SL were as Multiple Principal Investigators. LP, SL, FK, JR, TS, KS, JBu, DB, JBr, and NB contributed to study conception. LP, SL, FK, JR, TS, KS, JBu, DB, JBr, NB, JG, VS, MT, BB, MF, DW, and KL contributed to study design. SL wrote the first full draft of the manuscript. LP, NG, JR, MT, MF, DW, DB, BB, KR, and KL wrote sections of the manuscript. All authors contributed to manuscript revision, read, and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "More recently in statistical quality control studies, researchers are paying more attention to quality characteristics having nonnormal distributions. In the present article, a generalized multiple dependent state (GMDS) sampling control chart is proposed based on the transformation of gamma quality characteristics into a normal distribution. The parameters for the proposed control charts are obtained using in-control average run length (ARL) at specified shape parametric values for different specified average run lengths. The out-of-control ARL of the proposed gamma control chart using GMDS sampling is explored using simulation for various shift size changes in scale parameters to study the performance of the control chart. The proposed gamma control chart performs better than the existing multiple dependent state sampling (MDS) based on gamma distribution and traditional Shewhart control charts in terms of average run lengths. A case study with real-life data from ICU intake to death caused by COVID-19 has been incorporated for the realistic handling of the proposed control chart design. One of the important techniques for improving manufactured product quality and for reducing the manufacturing costs is statistical quality control (SQC). Since the pioneer work by Shewhart A. Walter during 1920s in Bell Telephone Laboratories, wide varieties of control chart techniques have been constructed and extensively implemented in SQC. The main feature of control charting is to identify the amount of assignable cause(s) and hence rectify it by taking necessary action on the production process before sending the outcome of the products into the market. This control charting helps to avoid nonconforming products from being manufactured by the company. More details about Shewhart control charts can be seen in Montgomery [t-chart.Usually, control charts are being designed and operating under the assumption of the normality for the variable of interest. Nevertheless, these assumptions may not be true for various realistic situations and other distributions away from normality had been considered and discussed by many authors in the literature . The Several researchers have developed diversified sampling designs to obtain more efficient control charts. Recently, researchers focused on multiple dependent state (MDS) sampling in the creation of a control chart. Wortham and Baker  proposedMore recently, Raza and Aslam , Rao et X be a random variable from a gamma distribution with shape parameter \u03b1 and scale parameter \u03b2. The cumulative distribution function (cdf) of the gamma distribution is given byThe proposed control chart for a gamma distribution using gamma to normal transformation is discussed. Let X follows a gamma distribution with specific parameters, then the transformed variable X\u2217 = X1/3 can be distributed approximately as normal with mean \u03bcX\u2217 and variance \u03c3X\u22172, whereWilson and Hilferty  recommenk1 and k2 are the chart constants to be found when the in-control ARL is approximately equal to preassigned value r0. The convenient form of the above control limits is given as follows: UCL1 = \u03b21/3UL1, UCL2 = \u03b21/3UL2, LCL1 = \u03b21/3LL1, and LCL2 = \u03b21/3LL2, whereThe proposed gamma control chart using GMDS sampling comprises the two pairs of control chart limits. The inner lower control limit (LCL) and upper control limit (UCL) are denoted by subscript 1, and the outer lower control limit (LCL) and upper control limit (UCL) are denoted by subscript 2. The four control limits are given byX. Compute the transformed variable X\u2217 as X\u2217 = X1/3Obtain quality measurement from the manufacturing process, and denote the quality characteristic by 2 \u2264 X\u2217 \u2264 UCL2, and the process can be considered out-of-control if X\u2217 \u2265 UCL1\u2009or\u2009X\u2217 \u2264 LCL1. Or else, go to Step 3The process can be considered under control if LCLk out of m proceeding subgroups have been declared as under control, that is, LCL2 \u2264 X\u2217 \u2264 UCL2; otherwise, the output of the product can be considered out-of-control and go back to Step 1The process can be considered under control whenever The operation of the proposed control chart using GMDS scheme is described as follows:The probability of declaring as in-control for the proposed control chart when the process is actually in-control is given as follows:Therefore, the in-control average run length (ARL) when the process is under control is given by\u03b2 = \u03b20 to \u03b2 = \u03b21 = s\u03b20, where s is the shift value.Assume the gamma scale parameter has been changed from The probability of process is declared as in-control while the scale parameter which has been changed can be obtained as follows:The out-of-control average run length (ARL) when the process is out-of-control is given ask1 and k2 along with ARL1 are obtained using the following algorithm:r0Decide the predetermined in-control ARL as m and kFix the known values for 0 using Equation  valuesUsing the best parametric values of Equation  and hencThe proposed control chart parameters The R codes to find the design parameters of the control chart are given in the appendix.0 and ARL1. These ARL values are used to know the effectiveness of the developed control chart. The developed chart is said to be efficient if it shows larger in-control ARL and smaller out-of-control ARL. Using the aforementioned algorithm in k1 and k2 are obtained. The out-of-control ARLs and SDRL are computed for a choice of shift values, s from 1.0 to 2.0 with an interval of 0.1 and 2.0 to 4.0 with an interval of 0.5. The values of m considered are 4, 5, and 6 and \u03b10 = 5, 10, and 20. r0 = 370 and \u03b10 = 5, r0 = 370 and \u03b10 = 10, r0 = 370 and \u03b10 = 20, r0 = 500 and \u03b10 = 5, r0 = 500 and \u03b10 = 10, and r0 = 500 and \u03b10 = 20.The performance of the proposed gamma control chart using GMDS sampling is considered based on ARL, such as ARLs) of the manufacturing process increasesThe out-of-control ARL and SDRL values decline speedily when the shift . It also observed the same inclination over the other parametric combinations and ARL0 = 370 and 500From the tables, it is noticed that ARL1 and SDRL are small for k = m-2 and these values are increasing from k = m-2 to k = m for fixed values of m. In addition, noticed that ARL1 and SDRL values are large at k = m as compared to the values at k = m-1 and k = m-2 . Hence, it is concluded from the results that gamma control chart using GMDS sampling is an enormous amount of accurate than gamma control chart using MDS samplingIt is interesting to observe from the results that the values of ARLWe pointed out the following several noteworthy comments from Tables 10 = 370 and ARL0 = 500; the shape parameter of gamma distribution is given as \u03b10 = 5, 10, and 20 to compare the developed gamma control chart under GMDS with the existing MDS and Shewhart type control chart at various shift values. These comparisons are presented in 0 = 370 and m = 4 and in 0 = 500 and m = 5 at various shape parameters of the gamma distribution.In this part, a comparison is made between the developed control chart and the existing Shewhart type control chat and MDS control chart for gamma distribution. Also, the application of developed control chart and its dominance over available control chart schemes studied using real data set is presented. In addition, through a simulation study, the supremacy of the developed control chart when compared with the existing control charts is examined. The performance of the developed control chart is studied through ARL values and we know that a control chart with smaller ARL values is more desirable. In this investigation, we studied when ARL1 values as compared with the MDS and Shewhart type control charts at various shifts (s) values and various parametric values studied in this article. At a glance, when ARL0 = 370, \u03b10 = 5 and s = 1.4 from 1 = 27.17 whereas ARL1 = 31.10 for MDS scheme and ARL1 = 38.44 from the Shewhart type control chart. Similarly, for ARL0 = 500, \u03b10 = 10, and s = 1.5 from 1 = 5.67 while ARL1 = 7.22 for the MDS control chart and ARL1 = 14.28 from the Shewhart type control chart. The graphical presentation is given to show the performance of developed control chat over the existing MDS and Shewhart type control charts along with various shift values . The data is reported in Xi\u2217 = Xi1/3. The control chart coefficients at m = 5, \u03b10 = 5, and ARL0 = 500 are available in m = 5 and k = 5 is provided in m = 5 and k = 3 is depicted in m = 5) Xi\u2217 values are displayed between the inner control limits, then the process is considered to be under control while for proposed gamma control chart under GMDS, the process is said to be declared as under control if no less than 3 out of 5 previous (since k = 3 and m = 5) Xi\u2217 values are within the interior control limits.In order to investigate the implementation of the planned control chart over the available control charts, a simulation study is conducted. In this investigation, 30 samples are generated from the gamma distribution with shape parameter From Figures p value is 0.7322. In the present section, the developed gamma control chart using GMDS sampling is applied to the monitoring of Coronavirus (COVID-19) outbreak in China. The data set is borrowed from Li et al. , and the\u03b10 = 2 and m = 4 are k1 = 3.1035 and k2 = 1.4645 for a developed control chart, k1 = 3.7525 and k2 = 2.1935 for MDS control chart, and L = 2.8828 for Shewhart type control chart. The chart limits of the developed control chart, MDS, and Shewhart type control charts for days from ICU intake to death data are given in Figures 77X\u2217. Using days from ICU intake to death data, the developed control chart can be exemplified as follows: declare the process as in-control when 4 earlier values of X\u2217 fall in the inner control limits of the developed gamma control chart using the MDS plan. While in the case of the developed gamma control chart using GMDS scheme, the process can be expected as in-control when at least 2 out of 4 earlier values of X\u2217 fall in the inner control limits.The chart constants at the estimated shape parameter of 2 are obtained using a simulation procedure given in It is clearly noticeable from 0) and out-of-control ARL (ARL1) of the proposed gamma control chart using GMDS sampling. The performance of the proposed control chart is investigated using simulation for the various shifts in the scale parameter. Tables of chart parameters alongside out-of-control ARL (ARL1) for various shift values for specified shape parameters are displayed. Furthermore, a comparative study is also carried out with the developed gamma control chart based on GMDS sampling over the existing MDS and Shewhart type gamma control charts using the ARLs. The results display that the developed gamma control chart based on GMDS sampling shows reduced ARL1 values as compared with the existing two gamma control chart discussed in this article.We developed the gamma control chart based on GMDS sampling. The computational methodology is also discussed for ARL and SDRL when the process is in-control and out-of-control. The control chart parameters for the proposed control chart are obtained using in-control average run length (ARLThe implementation of the developed control chart is demonstrated using simulation study as well as tangible data from ICU intake to death cause by COVID-19 and it is shown that designed gamma control chart using GMDS sampling detected out-of-control samples whereas the MDS and Shewhart type gamma control charts failed to detect the out-of-control signal. Hence, we conclude that the gamma control chart based on GMDS is a superior methodology as compared to the existing control charts considered in this study to detect a shift in the parameter. The developed control chart method in this paper can be used in different industrial and medical situations specifically when the researcher would like to discover a small and moderate shift in quality characteristics. Future research maybe considered as control charts for some nonnormal distributions and cost consideration using GMDS sampling design."}
{"text": "Though effective in theoretical simulation, the established traffic control models and optimization algorithms will result in model mismatch or even control strategy failure in actual application. However, they are commonly adopted in traffic signal control research, resulting in the unavailability of many exceptional control algorithms in practice. Simulation should function as a bridge between theoretical research and actual application, allowing the gap between the two to be communicated and made up for. However, an effective connection between the two has yet to be established to enable simulation methods in existing traffic control research. To this end, we designed and developed a simulation platform for \"Online Application\u2014HILS (Hardware-in-the-Loop Simulation)\u2014Practice\" integration over traffic signal control. In this paper, the architecture and characteristics of the integrated simulation platform were described. Besides, the function of each module of the platform was detailed, followed by listing simulation examples for six complex scenarios, with the active control scenario being selected for simulation comparison analysis. The findings demonstrated extensive road network simulation with the integrated simulation platform, multidimensional control variables, control strategies with support, as well as stable and reliable operation. It can be used to verify several sorts of traffic control simulation with variable dimensions. It has served as a key measure to ease traffic congestion and solve traffic problems. For this reason, advanced traffic signal control systems such as SCOOT2, SCATS3, and series of excellent traffic control algorithms including model-driven algorithm4, data-driven algorithm5, and artificial intelligence6 have emerged throughout nearly a century of development, which functioned as staunch supporters of the rapid development of urban traffic control.As a longstanding academic concern in this field, intelligent urban transportation has witnessed plenty of theoretical and technological innovations and applications8. Control algorithm verification with tools such as Matlab at a given input and output is common in a class of research on traffic control using the control theory9. HILS was developed by combining commercial traffic simulation software with traffic control hardware10.Using simulation to analyze and verify traffic control algorithms is an important element of traffic control research. Related research in China started in the 1980s, which marked the earliest introduction and use of commercial traffic simulation software for the main, followed by the secondary development based on commercial software such as VISSIM and Paramics to verify control algorithmsExisting traffic control simulation fails to realize the real-time connection between simulation and actual traffic control on-site, making real-time simulation, verification, and evaluation unavailable.Currently, most traffic control simulation adopts traditional passive traffic control theory as the foundation for the underlying architecture design, which provides insufficient support for advanced control models and algorithms, resulting in the lack of effective and practical simulation results. It presents deficiencies in supporting the simulation of multi-variable and multi-dimensional active traffic control for future ICVs and autonomous driving environments.Although existing research have yielded fruitful results, the following two issues remained to be addressed:The construction of control models, strategies, and optimization methods faces ideal assumptions and broad constrains as various possible problems in the actual scenario are not considered.The simulation should serve as a link between theoretical research and practical application, bridging the gap between the two, which has yet to be achieved by the current simulation methods for traffic control.Therefore, in traffic control research adopting the above traditional simulation methods, the constructed control models and optimization algorithms often result in problems such as model mismatch and control strategy failure in practice, despite their evident effects in theoretical simulation. Consequently, many excellent traffic control algorithms are impractical as they fail to follow the requirements for the practical application of traffic control.To address these issues, an \"Online Application\u2014HILS\u2014Practice\" simulation integration platform for real-time testing and verification of active traffic control has been designed and developed. It established its field traffic controller and detector and online simulation to enable effective connection by directly building a data channel in the field, and the real-time verification for the advanced traffic control algorithm was implemented to ensure security and validity. It enabled the transition from traditional passive traffic control to active traffic control, increased the dimension of control variables via resource definition, and improved the flexibility and control capabilities of traffic control models and strategies.The following is how the rest of the paper is organized: a literature review of relevant work is presented in \u201c11, intersection control is the most important issue in the field of urban traffic, even in the future vehicle\u2013road collaboration and popular autonomous driving, making it a great concern of many scholars. Traffic simulation functions as an important means of traffic control research as it encourages the rapid development of the field. Two main traffic control simulation methods are currently available:As an age-old challenge that dates back to the 1950s12. As a result, researchers often collect historical data to perform repeated tests with the simulation software. Once the effectiveness of the control strategy is recognized, the traffic engineer goes through a series of procedures necessary to load it into an operational traffic control system or traffic controller13, to avoid possible safety problems. Secondary development modules are available in commonly used commercial traffic simulation software, including VISSIM, CORSIM, TransModeler, and SimTraffic17. Then an advanced control strategy can be developed to send the detector data generated by the simulation software to the simulator, which outputs the signal state and evaluates the traffic condition based on this information. Some traffic control studies adopted classical control theory, and usually used development tools such as Matlab to verify the rigor of theoretical proof by simple examples9.Microtraffic simulation software is often employed to evaluate the effectiveness of traffic control strategies as it is unsafe and impractical to test them directly in the field18. The basic idea of this concept was to create a link between traffic controllers and simulation software with a controller interface device (CID), which sent detector data obtained from the simulation software to the physical traffic signal controller. At the same time, the traffic signal controller determined the signal state according to the predetermined signal time control strategy and detector data from the simulation software. The device also transmitted real-time signal state from the physical traffic signal controller to the simulation software23. Although HILS brought the simulation closer to reality, previous studies have shown that each controller in HILS corresponded to a dedicated CID, and the control strategy in the simulation could not be directly loaded into the field traffic controller through CID.The concept of HILS was firstly proposed by Sisle in the 1980s to evaluate the performance of an active missile from prelaunch to interception26. However, the abundance of traffic control data benefited from the development of information technology, and the theory of traffic control may therefore be changed. Therefore, some studies have proposed active traffic control. At present, there are two main types of research on active traffic control at intersections: One is the active control based on traffic flow prediction, which is realized by building a traffic flow prediction model combined with traditional traffic control30. The other is active control based on cooperative vehicle infrastructure, which combines vehicle speed guidance and traffic control to achieve active control through the use of cooperative vehicle infrastructure information35.Traditional traffic control has developed over many yearsHowever, to the best of our knowledge, the various traffic simulation methods used in current traffic control research have not effectively linked theoretical research with practical application, with the gap between the two remaining the primary impediment to the practical availability of traffic control algorithms. Considering other practical factors, the original control methods such as time control are still applied in the field.The simulation integration platform based on resource description, taking the three levels of simulation, control, and calculation into consideration, defines and encapsulates the three resources to form a resource pool. It can flexibly schedule simulation, control, and computing resources based on demand during simulation verification, as shown in Fig.\u00a0The simulation integration platform was driven by scene, simulation, and control engines. During simulation verification, the scene engine applied to the message queue service to call traffic detector and traffic controller state data. It encapsulated the data according to the input data requirements of the scene recognition algorithm before sending it to the scene recognition module to identify the current traffic scene, and then delivered the identification results to the control strategy module as input. If only the basic control strategy was required for the current traffic scene, the basic control strategy generated control parameters and transmitted them to the control engine, which merged and encapsulated the control parameters and basic parameters before sending them to the traffic controller for execution. If advanced control strategies were required for the current traffic scene, the simulation engine applied to the message queue service to invocate traffic detector and traffic controller state data. It encapsulated the data according to the input data requirements for the simulation before sending it to the simulation engine. At the same time, the advanced control strategy transmitted the generated control parameters to the simulation engine to form a simulation subroutine and obtained a definite control through simulation. The parameters were sent to the control engine, which merged and encapsulated the control parameters and basic parameters before sending them to the traffic controller for execution, as shown in Fig.\u00a0It built a resource-based basic library that allowed for flexible scheduling of three resources, i.e., simulation, control, and calculation. The nature of changes in road network traffic flow lies in matching traffic demand and the resources of time and space. Traffic control is used to allocate time and space resources on the premise of traffic safety. The resource description-based simulation integration platform took the three levels of simulation, control, and calculation into consideration in a unified manner, defined and encapsulated the three as resources to form a resource pool. It could flexibly schedule simulation, control, and compute resources based on demand during simulation verification. Among them, the control resource mainly referred to the resource definition of control variables in traffic control. Computing resources were applied to meet the requirements including (1) computing power for larger-scale simulation calculations; (2) computing power for advanced control and optimized algorithms; (3) computing power for modeling more complex traffic scenarios; (4) computing power for simultaneous online simulation for multiple users; and (5) requirements for real-time/historical data collection, transmission, and storage.It enables the dual integration of model-driven and data-driven approaches, with the support of scene-driven approach. The simulation integration platform can be used to construct complex traffic scenarios and encapsulate basic simulation parameters. It supports both model-driven and data-driven simulations, with the former including car-following models, queuing models, and traffic flow distribution models . The data-driven simulation drives the traffic flow through real-time or historical data, which comes from on-site traffic detection data, and dynamic simulation parameters are calibrated through real data.It upgraded passive traffic control to active traffic control by increasing the dimension of control variables. The fundamental problem for urban traffic control lies in the allocation of road time and space resources as it starts from the 'physical resource problem' of ' cars occupying physical space' on the timeline of road traffic. Therefore, the concept of generalized traffic control was taken into account. It transformed the traditional passive traffic control with cycle and green-signal ratio adjustment as the core into a section with controllable vehicle speed, variable lanes, adjustable phase and sequence, and chain-like connection characteristics. Active traffic control was achieved by increasing the dimension of control variables. Due to its diverse control variables, active traffic control could meet current and future traffic control needs in fully automated driving, unmanned driving, vehicle\u2013road coordination, and other complex and special scenarios to a greater extent.It enabled the high-efficient reachability from control model to control strategy then to controller by bridging the gap between simulation and reality. (1) Scene setting and parameter calibration were synchronously loaded into the traffic controller for parameter protection in accordance with the requirements of the protection mechanism. (2) The traffic control engine shared the same system with the on-site traffic control system, which could abstract the control variables/language of the traffic controller to form a mapping relationship with those of the simulation control engine, directly driving the traffic through the simulation control engine. By doing so, the designer of the control strategy could be free of focusing on the difference between the simulation controller and the on-site traffic controller. (3) It supported traffic controllers by abstracting and decoupling the relationship between basic protection parameters and control variables, as well as a variety of advanced traffic controllers. (4) The platform leveraged real data to calibrate simulation parameters, allowing the control strategy to be trained and implemented in an environment close to the scene. It could effectively solve the problem that the existing control strategy simulation is effective in theory but cannot be applied in the field. (5) It also freed traffic control engineers by providing control strategy programmer and API, allowing them to focus on the design of the control strategy rather than programming skills.The four main characteristics of the simulation integration platform adopting the \"Online Application\u2014HILS\u2014Practice\" fusion architecture are as follows:36 to visualize traffic flow, calibrate dynamic parameters of traffic flow, and basic road network parameters, as illustrated in Fig.\u00a0Being designed to quickly analyze and verify new control strategies, the \"Online Application\" simulation module took the traffic flow from the meso perspective as the main body and the intersections and road sections from the microscopic perspective as the control core, with a focus on the shape of simulated traffic flow under the influence of control strategy, to encourage iterative control strategy optimization. The simulation engine was designed with reference to SUMOAuto-calibration of simulation parameters: It is important to note that the dynamic characteristics of a single vehicle, as well as the manual calibration of simulation parameters, were intentionally ignored in the design of the simulation system. The system adopted detector data and GIS data to automatically calibrate static data , dynamic data , velocity distribution, steering ratio, headway time, etc. At the same time, traffic flow and car-following characteristics were based on the accumulation of historical detection data, and real-time detection data were corrected.In the data preparation part, the test data was encapsulated as standard input and output variables, and the signal control, vehicle, and variable sign were stored as control variables in the database.In the control strategy part, various virtual scenes were constructed based on different traffic demands, and control strategies were designed for different scenes. The set of control strategies was called agency, and control strategy was called the agent. That is to say, the new control strategy designed by researchers was defined as an agent, and the corresponding agent run under given conditions in the simulation.The device driver connected the simulation and the scene, through which a new control strategy could be directly pushed to the on-site control equipment once it presented to be reliable, allowing the implementation in the real environment at the right time. The virtual controller was used to set the basic parameters of traffic control, which were then loaded into the entity of the traffic controller for basic control. The designed complex traffic control strategy was written by the control strategy programmer, and the traffic controller was driven for execution through API, as shown in Fig.\u00a0Architecture of control strategy and API design: The architecture of the simulation integration platform supported the development of advanced control strategies, which consisted of three parts: data preparation, control strategy, and device driver.As demonstrated in Fig.\u00a0Figure\u00a0The simulation integration platform covered over 30 complex scenarios and the application of numerous advanced control strategies, including intersection control, area control, vehicle\u2013road coordinated control, special vehicle control, and other trending research directions in the field. The paper presents six complex traffic scenarios in Fig.\u00a037 and traditional traffic control38 is presented in Fig.\u00a0The comparative analysis of active traffic control34 had a significantly better control effect than the paper35.According to the comparative analysis of simulation under undersaturated and oversaturated scenarios as shown in Fig.\u00a0The application of traditional traffic simulation methods in traffic control research often results in the problem that the constructed traffic control models and optimization algorithms face model mismatch and control strategy failure in the actual application, despite their obvious effects in theoretical simulations. This can be explained by: (1) ideal conditions and broad constraints. In the traffic control models, strategies, and optimization methods established in many studies, various possible problems in actual application were not considered; and (2) The existing simulation methods failed to connect theory and practice, with the gap between the two remaining the greatest obstacle to the practicability of the control algorithm, which, along with other basic problems, caused most primitive control methods such as time control and induction control to be unavailable in practice.39 pointed out that \u2018In fact, simulation refers to the construction of a system similar to the real world. A controller that is feasible for simulation calculations on this simulation system should have the same effect after being connected to the real control object.\u2019 This paper describes the design and development of an \"Online Application\u2014HILS\u2014Practice\" simulation integration platform for urban traffic control, which combines practical engineering experience and in-depth consideration of the problems in traffic control simulation. It is based on resource nation and describes simulation, control, and calculation as resources, allowing them to be flexible and schedulable. The dimension of the control variables has been increased, which enabled the output of multiple control variables, including green light, phase, phase sequence, lane, and vehicle speed. On this basis, various functions of \"Online\" simulation, \"Online-HILS\" parallel simulation, and \"Online-HILS-Practice\" integration were studied in detail. The virtual signal machine and standard protocol converter made the traffic controller a bridge connecting the \"Online\" simulation, \"HILS\" simulation, and practical applications. Finally, six simulation examples for complex scenarios were listed. The two methods of active control and passive control were simulated, compared, and analyzed with the simulation integration platform under two typical undersaturated and oversaturated scenario. The research results showed that the simulation integration platform can not only perform large-scale road network simulation, but also realize a variety of complex control strategies from vehicle speed control and lane control to phase and phase sequence control, with stable, reliable, and real-time simulation.Paper"}
{"text": "AIM: The ERAS protocol consists of multiple items that aim to improve the outcomes of patients receiving surgery. Adhering to the protocol is difficult. We wondered whether surgeons practicing the ERAS protocol in a group would improve patient outcomes. Methods: All patients who underwent colorectal resection for benign disease or malignancy from November 2017 to December 2018 were collected and reviewed retrospectively. According to the physician\u2019s ward round strategy, the patients were categorized into two groups, either by solo practice or group practice. Results: This study enrolled 724 patients and divided them into two groups according to the practice method: group practice (n = 256) and solo practice (n = 468). The group practice cohort had less postoperative morbidity  and shorter postoperative hospital stays  than the solo practice cohort. Group practice (p < 0.001), natural orifice specimen extraction (NOSE) procedure (p < 0.001), and blood loss >50 mL (p = 0.039) significantly affected discharge within 5 days postoperatively in multivariate analyses. Conclusions: Group practice based on a modified ERAS protocol shortens postoperative hospital stays with fewer morbidities compared with solo practice in which patients receive elective minimally invasive colorectal surgery. ERAS checklists for minimally invasive surgery have recently been shown to have a distinct impact on recovery in patients with CRC. However, the influence of medical practice on ERAS compliance is unknown. Here, we show that group practice based on a modified ERAS protocol shortens hospital stays compared to solo practice.\u00ae) is a protocol to improve the results of patients who receive all aspect of colorectal surgery. It is based on published evidence and has been found to shorten the length of hospital stay and decrease postoperative morbidities, costs, and readmissions following colorectal surgeries [Enhanced Recovery After Surgery . There are two common types of medical practice: solo practice and group practice. Solo practice is a standard and effective method led by an attending surgeon, including outpatient diagnosis and treatment, surgery, and related care after surgery . A groupAfter the Mayo brothers started their first group in the mid-1880s, physicians worldwide formed various groups that desired to provide the best services for their patients. Although these groups are constructed differently, group practices share similar characteristics. First, group practice improves patient satisfaction and experience by reducing wait times and increasing access to care. Second, group practice also increases the quality of care by increasing adherence to guidelines through easier knowledge sharing and access to information among group members . In addiThis study aimed to clarify whether the type of medical practice affects the adherence rate of the ERAS protocol for minimally invasive colorectal surgery. We evaluated the short-term outcomes of patients who underwent colorectal surgery following a modified ERAS protocol by group-practice surgeons compared with single-practice surgeons at a single tertiary care centre.Detailed information on patients who underwent elective colorectal resection for benign disease or malignancy in a single medical institute, Chang Gung Memorial Hospital, from November 2017 to December 2018 was collected prospectively and reviewed retrospectively. All the data came from patients\u2019 medical records, and we obtained informed consent from all patients for use of their data in this study. The institutional review board approved this study (IRB No.202201164B0).The inclusion criteria were (1) a segment of bowel resection, including colon and rectum resection, (2) minimally invasive surgery, and (3) an American Society of Anaesthesiologists (ASA) physical status score less than or equal to 3. Patients who received laparotomy and conversion of laparoscopic to open surgery were excluded.Solo practice is a traditional ward round led by a single attending surgeon with fellows, residents, or nurse practitioners. The single surgeon supervises and is responsible for all aspects of a patient\u2019s care, including clinics, admission, surgical intervention, and postoperative care.Group practice in this study refers to multiple physicians with single specialties in colorectal disease, including four attending surgeons.The difference between solo and group practice is primarily regarding the ward round and decision making. The single attending surgeon would provide one ward round per day, including weekdays and weekends, to the patients in the solo practice. In group practice, four attending surgeons would take turns providing one ward round per day when his or her clinical workload permitted. Each group practice surgeon would see his or her patients and those of the other three physician\u2019s patients. More information about the solo and group practice is provided in We did not entirely apply all the ERAS protocol components in our institute because no standardized multidisciplinary consensus has yet been achieved about implementing the whole ERAS protocol . The comMeasurement outcomes included short-term postoperative complications, recovery, pain score, and readmission. Postoperative complications were defined as morbidity or mortality occurring within 30 days and were graded according to the Clavien\u2013Dindo classification.Postoperative recovery evaluation was based on blood test reports, pain intensity, and the length of hospital stay. We also collected postoperative 30-day hospital readmission data. Pain intensity was estimated using a numeric rating scale (NRS) from 0 to 10, with 10 indicating the worst unbearable pain. The mean postoperative pain scores of patients were used for further evaluation.t test. Univariate and multivariate analyses were performed using binary logistic regression. A two-tailed p value < 0.05 was considered statistically significant.All data analyses were performed using IBM SPSS Statistics, Version 24.0 . Clinicopathological characteristics with categorical variables are shown as frequencies and proportions and were compared using the chi-square test. Continuous variables are presented as the means and standard deviations and were analysed using Student\u2019s n = 256) and solo practice (n = 468) (p = 0.037). The preoperative blood tests for white blood cell (WBC) count, CRP and CEA were similar in both groups, but haemoglobin and albumin levels were slightly higher in the solo practice patients. There was no difference in previous abdominal surgery and neoadjuvant therapy in either group.From November 2017 to December 2018, a total of 928 patients received major colorectal surgery at Chang Gung Memorial Hospital. There were 194 patients who underwent laparotomy and 10 patients who tried laparoscopic surgery first but then converted to laparotomy. This study enrolled 724 patients and divided them into two groups according to practice method: group practice (n = 468) . The demp = 0.043), a higher robotic-assisted method , less postoperative morbidity , and a shorter postoperative hospital stay  than the solo practice patients. Regarding the postoperative blood test, the group practice patients had a higher WBC count  and haemoglobin level . The pain score was also lower among the group practice patients than the solo practice patients postoperatively .p < 0.001), NOSE procedure , operative method, especially low anterior resection , neoadjuvant therapy , tumour > 4 cm , blood loss > 50 mL , preoperative CEA > 5 , and preoperative CRP > 5  were associated with discharge within 5 days postoperatively in univariate analysis. After multivariate adjustment, group practice , NOSE procedure , and blood loss > 50 mL  were still significant factors affecting discharge within 5 days postoperatively.The results of univariate and multivariate analyses of discharge within 5 days postoperatively are shown in The discharge day distributions of the group practice and solo practice patients are shown in This study assessed the short-term outcomes of group practice patients based on a modified ERAS protocol compared with solo practice patients. Our data showed that group practice patients had shorter hospital stays and fewer surgical complications than solo practice patients.Group practice is one of several kinds of medical practices that include solo practice, employed physician practice, and direct primary care . This stWe started our group practice, with multiple physicians in a single specialty in 2017. The group initially consisted of four attending surgeons, and later, several younger attending physicians joined. Each day, one of four staff members takes turns conducting ward rounds, giving orders in the morning and setting daily goals for patients. The original attending physicians would later visit the patient whenever possible. In this way, staff avoided splitting their time among ward rounds, clinics, operating rooms, and examinations and delaying patient care. In addition, the team built an excellent electronic medical record platform for shift handovers that rotating residents updated. Based on the medical records and documentation, the staff can exchange various opinions with team members through this platform. Overall, team members were satisfied with this system of group practice. Based on our real-world experiences, this group practice is safe and effective in performing the modified ERAS protocol for minimally invasive colorectal surgery. It is up to team members, not necessarily the individual patient\u2019s surgeon, to make objective decisions based on daily ERAS goals that prevent individual subjective limitations. The results may align with the tenets of objective and protocol-based patient care. However, we did not assess patient satisfaction during this period.Enhanced recovery after surgery (ERAS) is an evidence-based multispecialty and multidisciplinary approach to surgical patient care that must involve multiple professionals ,2. DanisThe ERAS society was then formed to develop perioperative care and improve recovery through research, education, auditing, and implementation of this evidence-based program . CurrentThe latest guidelines for the ERAS program released in 2018 have a total of 24 items, which are categorized into preadmission, preoperative, perioperative, and postoperative periods [However, the real-world application of ERAS is bound to have modifications. Our institution also has certain limitations, so we applied and modified several program elements at various phases, as shown in Brady et al.  reviewedIn this study, the mean postoperative hospital stay was 6.6 days in the group practice arm and 8.6 days in the solo practice arm. Compared to other investigations, this study\u2019s hospital stay duration seems to be delayed by approximately 1 to 2 days ,34. We sSecond, our pain control strategies are also different from the guidelines. According to the guidelines, multimodal analgesia combined with epidural analgesia and avoiding opioids are suggested ,36. In oThird, we usually use surgical drains and Foley catheters. The Jackson-Pratt drain is generally placed over the pelvis for left-sided colectomy, and the Morrison pouch is used for right-sided colectomy. The primary purpose is to evacuate postoperative collections, bleeding, and residual accumulation of gas by laparoscopic pneumoperitoneum. The drain is removed approximately 2 to 3 days after surgery. Once the patient can get out of bed and move well, the Foley catheter can be removed. According to the essence of the standard ERAS protocol, routine drainage is not recommended .A fundamental basis for the success of ERAS implementation is the compliance rate of implementers. The tendency of traditional physicians to give medical orders during ward rounds seems to be related to habit and experience. Some ERAS programs were challenging for traditionally trained surgeons to follow, which may account for the slower recovery of patients in the solo group in this study. The attending surgeons commonly work with patients operated on by other members of the group practice. They give medical orders more often based on the ERAS checklist, which can increase adherence to the ERAS guidelines.Natural orifice specimen extraction (NOSE) is the opening of a hollow viscus that is already communicating with the outside world, such as the vagina or distal gastrointestinal tract, to remove the surgical specimen ,39. In oIn the future, we may set clear discharge criteria and inform patients before admission . After tThis study has several limitations. First, the retrospective design was the principal weakness of the current research, and the decision to adopt the modified ERAS protocol was not random. Second, we could not evaluate the adherence rate of each component of the modified ERAS protocol. Third, there is a high variation in physician decisions, especially in the solo group, because our institute employs more than ten attending surgeons. Each physician has his or her personal preferences in decision-making, which causes modified ERAS components to be inconsistent. Fourth, there are still some differences between the modified ERAS protocol and the actual ERAS protocol, especially concerning carbohydrate loading before surgery. Fifth, the surgical techniques and strategies adopted by surgeons, such as robotic surgery and the NOSE procedure, might have some influence on the outcomes and the length of the hospital stay for patients.In conclusion, a group practice based on a modified ERAS protocol reduces hospitalization length of stay and improves outcomes without increasing morbidity in patients undergoing minimally invasive colorectal surgery. According to our experiences, group practice can enhance ERAS performance adherence and prevent old habits and empirical tendencies of traditional surgical doctrines that occur in solo practice."}
{"text": "Low-dose lipopolysaccharide (LPS) exacerbated liver injury in CCl4-induced mice. Significant apoptosis, HNF1\u03b1 upregulation, and nuclear factor kappa B (NF-\u03baB) activation were observed in human-derived hepatocytes during ER stress. Knockdown of Rela, NF-\u03baB p65, inhibited the HNF1\u03b1 upregulation. Following CCl4 treatment ER stress, apoptosis, HNF1\u03b1 expression and RelA phosphorylation were significantly increased in mice. HNF1\u03b1 knockdown reduced activating transcription factor 4 (ATF4) expression, and aggravated ER stress as well as hepatocyte apoptosis in vivo and in vitro. The double fluorescent reporter gene assay confirmed that HNF1\u03b1 regulated the transcription of ATF4 promoter. LPS aggravated CCl4-induced liver injury and reduced HNF1\u03b1, and ATF4 expression. Therefore, in combination, HNF1\u03b1 and ER stress could be mutually regulated forming a feedback loop, which helps in protecting the injured liver by down-regulating hepatocyte apoptosis. Low-dose LPS aggravates hepatocyte apoptosis and promotes the SAE of liver injury by interfering with the feedback regulation of HNF1\u03b1 and ER stress in acute liver injury.Hepatocyte nuclear factor alpha (HNF1\u03b1), endoplasmic reticulum (ER) stress, and hepatocyte apoptosis contribute to severe acute exacerbation (SAE) of liver injury. Here, we explore HNF1\u03b1\u2013ER stress-hepatocyte apoptosis interaction in liver injury. LO2, HepG2 and SK-Hep1 cells were treated with thapsigargin (TG) or tunicamycin (TM) to induce ER stress. Carbon tetrachloride (CCl Despite advances in treatment strategies, patients with liver failure have high morbidity and mortality rates due to late diagnosis, severe complications in the advanced disease stage, and the limited availability of donor organs3. Therefore, understanding the mechanism of SAE in liver injury and its early symptoms could result in a timely diagnosis that could improve the patient prognosis. The SAE of liver diseases is usually attributed to various risk factors that include underlying medical conditions, bacterial or fungal infection, and alcohol consumption5. In addition, the aggravation of hepatocyte damage is correlated to the severity of liver injury6. Hepatocyte death controls the development and outcome of most liver diseases7. Therefore, improving hepatocyte resistance to apoptotic signals could be crucial for maintaining liver function and delaying the SAE of liver injury. Hepatocyte nuclear factor 1\u03b1 (HNF1\u03b1) and endoplasmic reticulum (ER) stress contribute to a protective response in hepatocytes9, which might influence the SAE of liver injury.Severe acute exacerbation (SAE) of liver diseases is an early stage of the acute or chronic form of liver failure that often results from cirrhosis following viral infection, excessive alcohol consumption, or exposure to toxins10. ER stress involves the unfolded protein response (UPR) that is triggered by the aggregation of unfolded or misfolded proteins in the ER lumen11. Similarly, ER stress promotes an inflammatory response, such as the activation of nuclear factor kappa B (NF-\u03baB)13. Activated transcription factor 6 (ATF6), inositol requiring enzyme 1 (IRE1), and protein kinase R-like kinase (PERK) are crucial for the regulation of UPR14. On ATF6 activation, X-box binding protein-1 (XBP1) is upregulated15. Subsequently, XBP1 mRNA is alternatively spliced by the active IRE1 that results in the translation of the spliced XBP1 form (XBPls), which then promotes ER stress-related gene expression16. PERK activation phosphorylates the eukaryotic translational initiation factor 2 alpha (eIF2\u03b1), which attenuates the overall protein translation and decreases the ER burden17. In addition, eIF2\u03b1 selectively initiates the expression of activated transcription factor 4 (ATF4), which induces glucose-regulated protein 78 (GRP78) expression. Under physiological conditions, GRP78 inhibits the activation of IRE1, PERK, and ATF6 signaling pathways19. Previously, it has been reported that ER stress increases multidrug-resistance protein 2 (MRP2) expression by activating NF-\u03baB signaling20. The upregulation of MRP2 controls acute liver injury through a negative feedback mechanism that reduces ER stress. In addition, the inhibition of eIF2\u03b1 dephosphorylation reduced hepatocyte apoptosis by alleviating ER stress in acute liver injury21. In combination, the regulation of ER stress could alleviate the pathological progression of liver injury. Thapsigargin (TG) and tunicamycin (TM) are known ER stress inducers that interrupt the intracellular calcium balance and inhibit protein glycosylation in the ER cavity, respectively22.ER stress is induced by various injury factors, and it is correlated to liver disease pathology23. Following acute inflammation, HNF1\u03b1 participates in the regulation and repair of acute liver inflammation by promoting the expression of C-reactive protein24. To date, the impact of HNF1\u03b1 on ER stress in liver injury remains unclear. Therefore, the impact of HNF1\u03b1 on ER stress and apoptosis in human-derived hepatocytes and mice will be investigated.HNF1, which is a transcription factor enriched in the liver, is crucial for glucose metabolism, detoxification, and plasma protein synthesisp\u2009<\u20090.05). In addition, it increased the expression of HNF1\u03b1, UPR signaling proteins , cleaved caspase-3, and RelA phosphorylation in LO2 cells at 12, 24, and 48\u00a0h . Treatment of LO2 cells with different TG concentrations  for 24\u00a0h revealed that the TG significantly reduced the viability of the LO2 cells in a dose-dependent manner . In addition, the treatment of LO2 cells with 1.0\u00a0\u03bcg/mL TM, another ER stress inducer, reduced LO2 viability  and significantly upregulated HNF1\u03b1, ATF4, and cleaved caspase-3 expression and RelA phosphorylation . Similarly, treatment of HepG2 cells with 1.0\u00a0\u03bcmol/L TG significantly decreased HepG2 viability  and increased HNF1\u03b1, ATF4, and cleaved caspase-3 expression and RelA phosphorylation . Similar results were observed in SK-Hep1 cells after treatment with 0.25\u00a0\u03bcmol/L TG .In vitro, the addition of 1.0\u00a0\u03bcmol/L TG significantly decreased the viability of LO2 cells at 24 and 48\u00a0h  and related protein expression was analyzed 48\u00a0h later. Transfection of HNF1A shRNA significantly reduced the expression of HNF1\u03b1 protein . HNF1A shRNA reduced the viability of LO2 cells , which was more obvious after 36-h TG treatment. In addition, the expression of HNF1\u03b1, ATF4, and GRP78 proteins decreased with or without TG . However, it significantly increased the expression of ATF6, XBP1s, and cleaved caspase-3, and RelA phosphorylation.To determine the role of HNF1\u03b1 in hepatocyte apoptosis and ER stress in vitro, LO2 cells were transfected with ATF4 promoter. Compared with the control group, HNF1\u03b1 had an enhanced transcriptional regulation on either the wild-type ATF4 promoter or mutant ATF4 promoter (p\u2009<\u20090.01). Of interest, the transcriptional activity of HNF1\u03b1 on wild-type ATF4 promoter was stronger than that on mutant ATF4 promoter . The knockdown of ATF4 significantly reduced LO2 viability , downregulated the expression of ATF4, GRP78 proteins, and increased the expression of cleaved caspase-3 in LO2 cells with or without TG . However, knockdown of ATF4 did not alter HNF1\u03b1 expression and RelA phosphorylation.The downregulation of ATF4 protein was confirmed 48\u00a0h post-ATF6 expression in LO2 cells by ATF6 shRNA did not alter the expression of HNF1\u03b1 protein . However, knockdown of RELA reduced the expression of HNF1\u03b1 protein . Of note, knockdown of RELA reduced the viability of LO2 cells with or without TG treatment , and decreased TG-induced the expression of HNF1\u03b1, ATF4, and GRP78 proteins, but increased the expression of cleaved caspase-3 . In addition, bioinformatic analysis using JASPAR (http://jaspar.genereg.net/) predicted the presence of fifteen binding sites in HNF1A promoter for human RELA, based on the relative profile score of \u2265\u200980% (Table Knockdown of 4) had significantly increased levels of serum alanine aminotransferase (ALT) and total bilirubin (TBil) at different time points . The area of necrotic tissue in the liver increased significantly at 12, 24, and 48\u00a0h . Compared with the control group, HNF1\u03b1 expression, protein levels in the UPR pathway , cleaved caspase-3 expression, and the phosphorylation of RelA significantly increased at 12, 24, and 48\u00a0h after CCl4 injection . The peak expression of HNF1\u03b1 was observed at 48\u00a0h, and the peak expression of proteins involved in the ER stress pathway was observed 24\u00a0h after CCl4 injection. Similarly, the apoptotic index was significantly elevated at 12, 24, and 48\u00a0h after CCl4 injection, peaking at 24\u00a0h .Compared with the control group (olive oil), mice that were injected with 1.0\u00a0mL/kg carbon tetrachloride  was analyzed at 24\u00a0h post-CCl4 injection. Compared with the control group, serum ALT and TBil levels as well as the necrotic tissue area significantly increased in a dose-dependent manner . The protein expression of HNF1\u03b1, UPR signaling , cleaved caspase-3, and RelA phosphorylation increased in a dose-dependent manner in liver tissue . Similarly, the apoptotic index was significantly elevated after CCl4 injection . The expression of HNF1\u03b1 and GRP78 was significantly upregulated in the injured liver tissue . Compared with the CCl4 group (control shRNA\u2009+\u2009CCl4), Hnf1a downregulation resulted in a significant reduction in the serum ALT level , increased the serum TBil level  and the necrotic liver tissue area  in Hnf1a shRNA\u2009+\u2009CCl4 group. In addition, Hnf1a knockdown before CCl4 injection decreased the expression of HNF1\u03b1, ATF4, and GRP78, but significantly increased the expression of caspase-12, cleaved caspase-3, and p-RelA , as well as the elevated apoptotic index .Mice were transfected with p\u2009>\u20090.05), the necrotic liver tissue area , the expression of ATF4, GRP78, caspase-12, cleaved caspase-3, and p-RelA , and the apoptotic index  in mice. However, 2.5 and 5.0\u00a0mg/kg LPS significantly increased the serum levels of ALT and TBil post-injection . In addition, the necrotic liver tissue area significantly increased in the 2.5 or 5.0\u00a0mg/kg LPS . Similarly, the same LPS doses increased the expression of ATF4, GRP78, caspase-12, cleaved caspase-3, and RelA phosphorylation , and the apoptotic index , but decreased the expression of HNF1\u03b1 in the liver.The dose-dependent impact of the intraperitoneal administration of lipopolysaccharide  on hepatic injury was examined. The low dosage of LPS (0.1 and 0.5\u00a0mg/kg) did not significantly alter the serum levels of ALT and TBil , a significant increase in the serum TBil level , and the necrotic liver tissue area  in the LPS\u2009+\u2009CCl4 group. This combination significantly downregulated the expression of HNF1\u03b1, ATF4, and GRP78 increased the expression of caspase-12 and cleaved caspase-3, the phosphorylation of RelA , and the apoptotic index in model mice .Compared with the CCl4. In addition, knockdown of RelA significantly inhibited the upregulation of HNF1\u03b1 in vitro. Taken together, these results suggest that ER stress enhanced HNF1\u03b1 expression in liver injury and might be involved in activating NF-\u03baB signaling. Furthermore, the downregulation of HNF1\u03b1 in vitro showed that apoptosis was aggravated. Of interest, the proteins involved in ER stress signaling were differentially expressed: the expression of ATF4 and GRP78 was significantly downregulated while ATF6 and XBP1 expression was upregulated. Similar results were observed in vivo, as well as enhanced ER stress-related apoptosis. In addition, the double fluorescent reporter gene assay confirmed that HNF1\u03b1 regulated the transcription of ATF4 promoter; knockdown of ATF4 decreased GRP78 expression and aggravated apoptosis in TG-treated LO2 cells. This interesting result implied potential crosstalk between HNF1\u03b1 and ER stress through a feedback loop to alleviate hepatocyte apoptosis in liver injury.In this study, we examined the regulatory mechanism of HNF1\u03b1 and ER stress and their impact on apoptosis in SAE of liver injury. Our results show that ER stress inducer TG or TM treatment induced apoptosis, and increased HNF1\u03b1 expression in LO2, HepG2, and SK-Hep1 cells. Similarly, the upregulation of HNF1\u03b1 expression, ER stress, and hepatocyte apoptosis were observed in the liver injury mouse model induced by CCl4-induced HNF1\u03b1, ATF4, and GRP78 expression and further aggravated ER stress-related hepatocyte apoptosis and liver injury. The ability of low-dosage LPS in inducing apoptosis and hence promoting the SAE of liver injury could be possibly attributed to the interference with the feedback loop between HNF1\u03b1 and ER stress.Spontaneous peritonitis aggravated liver injury by LPS was partially simulated. The results demonstrated that LPS induced liver injury, hepatocyte apoptosis, and ER stress, but inhibited the expression of HNF1\u03b1 in a dose-dependent manner. Treatment with low dosage LPS (0.1\u00a0mg/kg) selectively decreased CCl26. In this study, liver injury was induced by CCl4 or LPS. Liver injury was evaluated by the levels of serum ALT and TBil, and the necrotic area of the liver tissue. In the liver, CCl4 is converted into carbon trichloride that causes oxidative stress, inflammation, and ER stress28. LPS causes liver injury by activating inflammatory pathways or directly damaging hepatocytes29. In this study, CCl4 and LPS increased serum ALT and TBil levels, as well as the area of liver tissue necrosis, in a dose-dependent manner. This suggests the successful establishment of different severity degrees of liver injury models.Hepatocyte degeneration and necrosis are fundamental in the pathogenesis of various liver diseases. This can cause the leakage or release of ALT, and irregular bilirubin metabolism in hepatocytes30. Caspase plays a crucial role in apoptosis signal transduction31. Caspase-12 is related to ER-stress-mediated apoptosis32. Degradation of DNA into fragments of about 180\u2013200\u00a0bp is a prominent morphological change marking apoptosis. In this study, hepatocyte apoptosis was comprehensively evaluated by analyzing the protein expression of caspase-12 and cleaved caspase-3. The apoptosis index was measured by TUNEL staining. Our results demonstrated that hepatocyte apoptosis significantly increased in CCl4-induced liver injury. Aggravation of liver injury by LPS increased hepatocyte apoptosis. This agreed with previous reports, where hepatocyte apoptosis was associated with the severity of liver injury33. Therefore, enhancing the resistance of hepatocytes towards apoptosis might be a feasible strategy to prevent liver injury.Hepatocyte apoptosis is closely related to liver injury34. Simultaneously, ER stress inhibits the overall protein synthesis through PERK/eIF2\u03b1 signaling and upregulates the expression of molecular chaperones, such as GRP78 through ER stress-related transcription factors, such as ATF6, ATF4, and XBP121. In this study, the expression of ATF4, ATF6, XBP1s, GRP78, and caspase-12 were analyzed to monitor ER stress. Results demonstrated that ER stress was associated with hepatocyte apoptosis and liver injury that was induced by CCl4 or LPS. In addition, TG or TM induced ER stress and apoptosis in LO2, HepG2, and SK-Hep1 cells. Accumulating evidence suggests that targeted regulation of ER stress may change the progression of liver injury by altering hepatocyte apoptosis35.ER stress promotes intracellular homeostasis through UPR response, but excessive ER stress activates apoptosis signaling pathways36. In rats, downregulating HNF1\u03b1 promoted the development of liver fibrosis and the overexpression of HNF1\u03b1 significantly reduced liver fibrosis in rats37. Following acute inflammation, HNF1\u03b1 regulates the repair of acute liver inflammation by promoting C-reactive protein expression39. In this study, it was demonstrated that HNF1\u03b1 expression increased in TG-induced ER stress. Similarly, the upregulation of HNF1\u03b1 expression in CCl4-induced liver injury in mice and HNF1\u03b1 expression was positively correlated with the severity of liver injury. Immunohistochemistry indicated elevated HNF1\u03b1 expression and ER stress. These results imply that ER stress can induce HNF1\u03b1 expression, as well as hepatocyte apoptosis, in liver injury both in vivo and in vitro.HNF1\u03b1 is a transcription regulator that is essential for normal liver function19. ATF4 plays an essential role in stress signaling, which includes ER stress, hypoxia, amino acid deletion, and oxidative stress40. In particular, ATF4 is involved in the transcriptional regulation of amino acid synthesis, protein folding and degradation, redox balance, autophagy, and apoptosis42. Mutations in ATF4 significantly altered glucose homeostasis and energy consumption43 .The activation of ATF6 upregulates the expression of ER stress-related proteins, which include XBP1 and GRP78, and enhances the ability of cells to eliminate misfolded proteins45. NF-\u03baB signaling refers to a family of nuclear transcription factors, which includes RelA (NF-\u03baB p65), RelB, c-Rel, NF-\u03baB1/p50, and NF-\u03baB2/p529. In this study, ATF4, ATF6 and RelA were knocked down to analyze the impact of ER stress on HNF1\u03b1. The knockdown of RelA reduced the expression of HNF1\u03b1 in TG-treated LO2 cells; however, ATF4 and ATF6 knockdown did not downregulate HNF1\u03b1 expression. These results suggest that the activation of NF-\u03baB might be one of the ways by which ER stress mediates the upregulation of HNF1\u03b1.In ER stress, IRE1, PERK/eIF2\u03b1/ATF4, and ATF6 signaling are activated which promotes the downstream signaling cascades. On the other hand, HNF1\u03b1 knockdown aggravated the CCl4-induced liver damage as indicated by increased TBil levels, apoptosis, and necrotic liver area. Of note, serum ALT levels did not increase, which might be attributed to the regulatory role of HNF1\u03b1 on numerous liver-specific genes46. ALT is a metabolic enzyme; therefore, knocking down HNF1\u03b1 might decrease liver ALT levels and decrease serum ALT These results suggest that HNF1\u03b1 upregulation mitigates liver injury by reducing hepatocyte apoptosis. Further, knockdown of HNF1\u03b1 differentially affects the expression of ER stress-related proteins. Specifically, it significantly downregulated the expression of ATF4 and GRP78, but increased ATF6, XBP1s, and caspase-12 expression in vivo and in vitro. In addition, this confirmed that HNF1\u03b1 regulated the transcription of ATF4 promoter. These results suggest that HNF1\u03b1 may reduce hepatocyte apoptosis through mitigating ER stress during acute phase liver injury.However, to the best of our knowledge, the regulatory role of HNF1\u03b1 in ER stress and apoptosis in hepatocytes is unknown. In this study, the knockdown of HNF1\u03b1 increased TG-induced apoptosis in vivo50. These results suggest that HNF1\u03b1 may reduce ER stress-mediated hepatocyte apoptosis through upregulating the expression of ATF4 and GRP78.The knockdown of ATF4 reduced GRP78 levels and increased apoptosis in TG-treated LO2 cells. This suggested that ATF4-mediated GRP78 expression in ER stress is beneficial to alleviate apoptosis, which agrees with previous research52. Endotoxins, which are the main toxic effect component is LPS, are a cell wall component of Gram-negative bacteria. Under normal physiological conditions, a small amount of LPS produced by Gram-negative bacteria in the intestine can reach the liver via the portal circulation53. Most LPS is cleared by Kupffer cells without damaging hepatocytes. Compromised intestinal barrier function increases LPS leakage and this eventually leads to hepatocyte damage54. LPS causes liver inflammation, hepatocyte apoptosis, and aggravates liver cell injury56. Blood endotoxin levels are positively correlated with the degree of hepatocyte apoptosis58. In this study, the effect of spontaneous peritonitis aggravated liver injury by LPS injection was partially simulated. Our results demonstrated that LPS dose-dependently induced liver injury, hepatocyte apoptosis, and ER stress, but inhibited the expression of HNF1\u03b1 during liver injury. In addition, low-dose LPS did not cause liver damage, and its preintervention could alleviate the liver injury59. However, low-dose LPS aggravates the liver injury, hepatocyte apoptosis and ER stress, inhibits the mutual regulation of HNF1\u03b1 and ATF4, and reduces GRP78 expression in the CCl4-induced liver injury model. Therefore, LPS treatment can have different outcomes depending on the baseline status of the liver. Under physiological conditions, low-dose LPS is not enough to cause liver damage but it significantly increases the hepatocyte sensitivity towards apoptotic signaling mediated by ER stress after liver damage has occurred. Intestinal endotoxemia is common in severe liver injury60. However, the role of low-level LPS in promoting the SAE of the liver in future studies needs to be determined.Viral and bacterial infections are common risk factors that are associated with severe liver injury61. The results of this study agree with previous research and support the existence of multiple regulatory modes of HNF1\u03b1 in liver injury. The expression level of HNF1\u03b1 might not correlate with the degree of injury, but the effective upregulation of HNF1\u03b1 in liver injury could be beneficial in controlling liver injury.It has been demonstrated that HNF1\u03b1 expression was not correlated with chronic liver failureIn conclusion, following liver injury, hepatocyte HNF1\u03b1 and ER stress are mutually regulated to form a feedback loop, which can help reduce the severity of liver injury by regulating hepatocyte apoptosis. Whereas ER stress upregulates the expression of HNF1\u03b1 by activating NF-\u03baB signaling and the upregulated HNF1\u03b1 reduces ER stress through selective regulation of ATF4 increasing GRP78 expression. In addition, high-dose LPS can directly cause liver injury, hepatocyte apoptosis as well as ER stress and inhibit the expression of HNF1\u03b1. Low-dose LPS alone cannot cause liver damage; however, it reduces the tolerance of hepatocytes to apoptosis in liver injury and leads to the deterioration of liver injury through interfering with the feedback regulation of HNF1\u03b1 and ER stress Fig.\u00a0.Figure 962.Human-derived hepatocytes LO2, HepG2, and SK-Hep1 cells were purchased from The Cell Bank of Type Culture Collection of Chinese Academy of Sciences  and were maintained in RPMI-1640 that was complemented with 10% fetal bovine serum and 1% antibiotics. To induce UPR, LO2, HepG2, or SK-Hep1 cells were treated for 12, 24, and 48\u00a0h with either dimethyl sulfoxide , phosphate buffer saline , TG (Sigma), or TM (Sigma). Alternatively, LO2 cells were treated with different concentrations of TG  and samples were analyzed after 24\u00a0h. To analyze the impact of HNF1\u03b1 downregulation in vitro, LO2 cells were transfected with the target shRNA or control shRNA using a plasmid vector according to the manufacturer protocols and protein expression was analyzed 48\u00a0h later Table . Similar4\u2013105 cells/mL) were seeded in the inner wells of a 96 well plate. Each experimental condition was seeded in quadruplicate and wells around the edges were filled with sterile PBS to maintain humidity in the 96-well plate. The following day, cells underwent different interventions. At the end of the experiment, MTS assay solution was added to each well and incubated at 37\u00a0\u00b0C for 4\u00a0h. Finally, the colorimetric signal was observed at 490\u00a0nm on a microplate reader . The activity of the experimental control group was set to100%.The percentage of living cells was assessed using an MTS assay, [3--5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] assay  according to the manufacturer protocol. Briefly, 100\u00a0\u03bcL of LO2, HepG2, or SK-Hep1 cells  were obtained from the Animal Center of Zunyi Medical University . Mice were maintained under temperature and humidity-controlled conditions  with food and water available ad libitum. Following acclimatization, mice were randomly assigned to different experimental groups . The experimental protocol was reviewed and approved by the Animal Experimental Ethics Committee, Zunyi Medical University (ZMC-LS [2020] No. 2-321) according to the animal care and research guidelines4 dissolved in olive oil (CCl4: olive oil ratio\u2009=\u20091:4). Mice in the CCl4 model group received 1.0\u00a0mL/kg CCl4 injection for 12, 24, or 48\u00a0h whereas mice in the control group received the same volume of olive oil. Otherwise, mice in the CCl4 model group received either 0.5, 1.0, or 2.0\u00a0mL/kg CCl4 injections and the control group mice received the same dose of olive oil. Mice were not allowed to consume food or water 6\u00a0h before the injection. Alternatively, acute liver injury was induced by LPS; whereas mice in the model group were given an intraperitoneal injection of LPS  dissolved in PBS for 24\u00a0h. Mice in the solvent control group received the same volume of PBS and mice in the normal control group were untreated. Mice in the combination group (LPS and CCl4) received LPS (0.1\u00a0mg/kg) and CCl4 (1.0\u00a0mL/kg) for 24\u00a0h. Mice were not allowed to consume food or water 6\u00a0h before injection. The degree of liver injury was evaluated by detecting biochemical liver function indices, and histopathological changes in liver tissues. Further, liver injury was monitored at 12, 24, and 48\u00a0h. Mice were sacrificed by CO2 euthanasia. Mice were placed in a 4000-mL euthanasia box and the box chamber air was replaced with 100% CO2 at a rate of 30% of chamber volume/min64. Following the loss of consciousness, tissue and blood were harvested when blood circulation was maintained.Acute liver injury was induced by a single intraperitoneal injection of CClHnf1a shRNA , control shRNA group (n\u2009=\u200912), and Hnf1a shRNA group (n\u2009=\u200912). Then, the role of HNF1\u03b1 in liver injury was explored. Mice were randomly assigned to a control , Hnf1a shRNA , CCl4 , Hnf1a shRNA\u2009+\u2009CCl4 group (n\u2009=\u200912). Mice in the control and Hnf1a shRNA groups received olive oil injections (same volume of CCl4 as previously); whereas mice in the control shRNA\u2009+\u2009CCl4 and Hnf1a shRNA\u2009+\u2009CCl4 groups received 1.0\u00a0mL/kg CCl4 injection for 36\u00a0h.Recombinant serotype 8 adeno-associated virus (rAAV8) that carried LO2, HepG2, SK-Hep1 cells, or liver tissues were homogenized in immunoprecipitation assay lysis buffer . Liver lysates (40\u00a0\u00b5g) were separated on a 10% sodium dodecyl sulfate\u2013polyacrylamide gel and transferred to polyvinylidene fluoride membranes . Following blocking, membranes were probed with mouse monoclonal antibodies against ATF6 , eIF2\u03b1 , GAPDH , HNF1\u03b1 , p-RelA , or RelA , rabbit monoclonal antibodies against ATF4 , cleaved caspase-3 , GRP78 , XBP1s , or p-eIF2\u03b1 , or rabbit polyclonal antibody against caspase-12 , protein bands were detected with enhanced chemiluminescent and images were processed using Quantity One software . Densitometric analysis was used to detect the level of each protein relative to the control.Following fixation, liver tissues were dehydrated, paraffin-embedded and sliced at 4\u00a0\u03bcm thickness. Tissue samples were stained with hematoxylin\u2013eosin (H&E) according to standard protocols and scanned on a sliced Panoramic scanner  and CaseViewer2.2 software .65.Otherwise, sections were immunostained using monoclonal antibodies against HNF1\u03b1  and GRP78 . Then, sections were visualized under a light microscope (OLYMPUS CX31). Each H&E section was independently scored by two experienced pathologists using the Histology Activity Index\u2013Knodell score as detailed previously66. Positive staining was examined using a fluorescent microscope with 4\u2032,6-diamidino-2-phenylindole (DAPI) counterstaining. The apoptotic index was calculated from six randomly selected fields according to the following formula: apoptotic index\u2009=\u2009number of positive cells/total number of cells\u2009\u00d7\u2009100%.Hepatocyte apoptosis was detected using a TUNEL kit . Deoxyribonucleotide terminal transferase (TdT) and deoxyribonucleotide derivative digoxigenin [(digoxigenin)-11-dUTP] were mixed at 2:28, added to the paraffin-embedded liver sections and incubated in a humidified chamber for 2\u00a0h according to standard protocols67.Serum ALT and TBil levels were measured using the rate method and diazonium, respectively according to the standard protocols ATF4 (https://genome.ucsc.edu/). The binding site of HNF1\u03b1 to the ATF4 promoter sequence was predicted through JASPAR (http://jaspar.genereg.net/). Then, the ATF4 promoter sequence was synthesized. Next and cloning it on the firefly luciferase gene, constructing as an ATF4-promoter-wt plasmid. In addition, the HNF1\u03b1 binding site on the ATF4 promoter sequence was mutated to serve as the ATF4-promoter-mt plasmid. The nucleotide sequence that corresponded to HNF1A was cloned into the pcDNA3.1 vector. The pcDNA3.1 empty vector was used as a control. HEK 293FT cells (ATCC) were cultured and seeded into 24-well plates and grown for 10\u201324\u00a0h (80% confluence). Cells were cotransfected with the reporter gene plasmid, and the transcription factor expression plasmid, and the Renilla luciferase plasmid . Following cell lysis and protein extraction, luciferase activity was detected by firefly luciferase and Renilla luciferase detection reagents  to determine the relative light unit (RLU). The RLU value (Fluc) obtained by the firefly luciferase assay was divided by the RLU (Rluc) value obtained by the Renilla luciferase assay as an internal reference. According to the obtained ratio, the activation degree of the target reporter gene between the different groups was compared68.The search engine of the University of California, Santa Cruz Genomics Institute was used to find the promoter sequence of p-value\u2009<\u20090.05 was statistically significant.One sample Kolmogorov-Smirnow test was used to test whether the continuous variables satisfied a normal distribution. Quantitative data that satisfied a normal distribution were shown as mean\u2009\u00b1\u2009standard deviation  according to the animal care and research guidelines. All procedures were performed following the relevant guidelines and regulations.Supplementary Information 1.Supplementary Information 2."}
{"text": "The frequency of remaining nystagmus during walking was further modulated in a manner that depended on the specific phase of the gait cycle (p\u2009=\u20090.015). These attenuating effects on nystagmus intensity during walking suggest that ocular-motor control disturbances are selectively suppressed during locomotion in DBN. This suppression is potentially mediated by locomotor efference copies that have been shown to selectively govern gaze stabilization during stereotyped locomotion in animal models.Downbeat nystagmus (DBN) is a common form of acquired fixation nystagmus related to vestibulo-cerebellar impairments and associated with impaired vision and postural imbalance. DBN intensity becomes modulated by various factors such as gaze direction, head position, daytime, and resting conditions. Further evidence suggests that locomotion attenuates postural symptoms in DBN. Here, we examined whether walking might analogously influence ocular-motor deficits in DBN. Gaze stabilization mechanisms and nystagmus frequency were examined in 10 patients with DBN and 10 age-matched healthy controls with visual fixation during standing vs. walking on a motorized treadmill. Despite their central ocular-motor deficits, linear and angular gaze stabilization in the vertical plane were functional during walking in DBN patients and comparable to controls. Notably, nystagmus frequency in patients was considerably reduced during walking compared to standing ( Downbeat nystagmus (DBN), a frequent form of acquired fixation nystagmus, is characterized by a spontaneous upward drift of the eyes compensated by fast resetting saccades directed downwards. Patients suffer from visual disturbance due to vertical oscillopsia, to-and-fro vertigo, postural ataxia, and an increased risk of falling , 24, 29.The intensity of DBN-related symptoms is known to be modulated by a variety of factors. Accordingly, nystagmus intensity depends on the direction of gaze, the orientation of the head relative to gravity, and illumination , 18, 25.It is unknown whether and how locomotion might also affect ocular-motor symptoms in DBN. Symptoms could either improve in a manner analogous to postural stability or even be further aggravated due to the hypothesized central VOR deficits in DBN. Since visual disturbance during walking presents a major risk factor for falling , the preN\u2009=\u20092) or episodic ataxia type 2 (N\u2009=\u20091). Ten healthy, age-matched subjects  without any auditory, vestibular, neurologic, cardio-vascular or orthopedic disorders served as controls. All participants had normal or corrected-to-normal vision. Ten patients with DBN  participated in the study . DBN patients were secured with a safety belt. Subjects were asked to visually fixate on the red point at all times and to\u00a0minimize eye blinks during recordings. Recordings during standing and walking were performed in randomized order to control for potential habituation effects.Horizontal and vertical eye movements during standing and walking were captured at a sampling rate of 220\u00a0Hz using a monocular head-mounted video-oculography system  as described previously . The monWalking performance of each participant was estimated by calculating the following gait cycle parameters: gait velocity, the mean and the coefficient of variation (CV) of stride length, stride time, base of support as well as the percentage of double support and swing phases with respect to the total gait cycle duration.Eye movement recordings were initially screened for potential motion artifacts . Eye blivs head velocity; see [For the VOR gain calculation, eye velocity was low-pass filtered using a fourth-order Butterworth filter with a cutoff frequency of 10\u00a0Hz to remove fast phase eye movements, such as during nystagmus. Angular head velocity and linear head acceleration were filtered analogously. For each locomotion trial, the eye velocity and head angular/linear velocity traces were segmented for successive gait cycles and resampled to the average gait cycle duration of the recording. To quantify VOR responses during walking, the angular and linear VOR gain  were caDBN intensity is usually quantified as the mean velocity of the slow upward drift of the eyes . Since during locomotion the DBN-related slow phase eye motions are superimposed by slow, VOR-driven eye movements, it is impossible to determine the exact slow phase velocity of DBN during walking. Thus, to quantify the intensity of DBN symptoms during locomotion, we focused on the mean frequency of DBN quick phases  . As a fit-test. Activity-dependent differences of nystagmus frequency in patients were analyzed using Student's paired two-sample t-test. Statistical analysis was performed using IBM SPSS . Results were considered significant at p\u2009<\u20090.05.Descriptive statistics are reported as mean\u2009\u00b1\u2009standard deviation (SD). Differences in gait performance, VOR gains, and nystagmus frequency were analyzed using Student's independent two-sample p\u2009=\u20090.041) and increased spatiotemporal gait variability . Other spatiotemporal gait characteristics were comparable between patients and controls .Patients and controls showed comparable self-chosen speeds (0.8\u2009\u00b1\u20090.24\u00a0m/s vs. 0.84\u2009\u00b1\u20090.18\u00a0m/s) and step frequencies (107.4\u2009\u00b1\u200918.8 steps/min vs. 99.0\u2009\u00b1\u200914.1 steps/min) while walking on the treadmill. Patients exhibited walking alterations typically observed in (sensory)-ataxic gait disorders, with an increased base of support   Fig.\u00a0B. In heap\u2009=\u20090.015). This phase-dependent modulation of DBN frequency resulted in frequency peaks across the gait cycle that closely matched the timing of vertical aVOR gain peaks  compared to the double support phase (DSP) of the gait cycle Fig.\u00a0A\u2013C (p\u2009=\u2009see Fig.\u00a0C, D.Fig.Here we studied the impact of locomotion on general gaze stabilizing mechanisms and nystagmus characteristics in patients with DBN. During walking at preferred pace and velocity, patients exhibited a broad-based, staggering stepping pattern compatible with a sensory and/or cerebellar gait disorder . In contSpontaneous, downwards directed fixation nystagmus is the primary source for visual disturbance and oscillopsia in DBN. Nystagmus intensity is known to be influenced by static changes in head position relative to gravity , 26. So Alternatively, walking-induced attenuation of DBN symptoms could directly arise from locomotor-activity itself. In a previous study we could demonstrate that postural imbalance in DBN becomes attenuated during locomotion in particular during fast stereotyped walking . AnalogoA detailed investigation of the timing of remaining nystagmus occurrence during walking further demonstrated that the degree of DBN attenuation during locomotion depends on the specific gait cycle phase. These phasic changes in nystagmus intensity across the gait cycle parallel the phasic modulation of the VOR Fig.\u00a0C and vesIn conclusion, the present findings demonstrate that while DBN has profound effects on patients walking ability, it does not impair general gaze stabilizing mechanisms during locomotion. However, walking in turn has an attenuating effect on nystagmus intensity in DBN. This observation parallels previous reports of a locomotion-induced mitigation of sensory ocular-motor and balance deficits during walking. We propose that a common mechanism based on a predictive feed-forward regulation of posture and gaze might explain this attenuation of peripheral and central sensorimotor balance and ocular-motor deficits. Subsequent studies should examine whether, in analogy to postural stability, walking-related attenuation of DBN becomes even more pronounced at non-preferred, fast walking modes. Besides, further investigations are required to explore the functional consequences of the present findings in particular related to the dynamic visual acuity and risk of falling in patients with DBN."}
{"text": "The effects of air oxidation and ammonia solution heat treatment on the pore structure and surface chemistry of the carbon spheres were studied for catalytic oxidation of CH3SH. The structure property and surface chemistry of the obtained carbon spheres were characterized by N2 adsorption\u2013desorption, FTIR, scanning electron microscopy, XRD, elemental analysis, X-ray photoelectron spectroscopy and Boehm titration, and then thermal analysis and gas chromatography-mass spectrometry were applied to investigate the catalytic oxidation product. Results show that the as-prepared microporous carbon spheres through direct ammonia treatment have a high surface area value of 1710 m2 g\u22121 and a total pore volume of 0.83 cm3 g\u22121. Moreover, the preoxidation-assisted nitrogen enrichment strategy not only increases the surface area and total pore volume of the carbon spheres, but also introduces more active nitrogen species such as pyridinic nitrogen and quaternary nitrogen, leading to the highest nitrogen content of 7.13 wt% and the highest CH3SH capacity of 622.8 mg g\u22121 due to the pyridinic nitrogen and quaternary nitrogen as function of catalysts. In addition, water and oxygen have a beneficial effect on CH3SH oxidation over the nitrogen modified carbon spheres, and the basic oxidation product is CH3SSCH3 that can be further oxidized into CH3SO2SCH3 according to DTG and GC/MS analysis. The great recycling stability after ten cycles with a reserved CH3SH capacity of 97% demonstrates that the porous carbon spheres obtained by preoxidation-assisted enriched nitrogen strategy are promising for catalytic oxidation of CH3SH.Porous carbon spheres with high surface area and microporous structure were synthesized from alkyl phenols and formaldehyde  via suspension polymerization and steam activation.Porous carbon spheres with high surface area and microporous structure were synthesized from alkyl phenols and formaldehyde  More research activities have been developed to remove CH3SH efficiently. For instance, the mature commercial technology is hydrodesulfurization that has been widely used in the traditional refineries with good removal results, but it has serious drawbacks such as high hydrogen consumption and energy requirements.8,9 Therefore, extensive research has been carried out to propose alternative technologies focused on convenient conditions without hydrogen.It is well known that methyl mercaptan  is beneficial for the adsorption of S compounds through either polar or acid\u2013base interactions, and pyridinic N and pyrrolic N improve the effects of S interaction with CNT and the capacitance, respectively. Liu23et al. prepared nitrogen-doped coconut shell activated carbon catalysts for the removal of CH3SH by impregnating urea or melamine with subsequent heat treatment. The results showed that the CH3SH removal capacity increased with the nitrogen content, especially pyridinic nitrogen and quaternary nitrogen. Moreover, the exhausted nitrogen-rich activated carbon can be easily regenerated with a reserved CH3SH capacity of 88.33% after four cycles.These alternative technologies are related to adsorption, decomposition, catalytic adsorption/oxidation, and photocatalytic oxidation.24,25 leading to the widespread technological applications in chemical protective clothing, blood purification, catalyst support and adsorption processes.26\u201328 Various polymers such as petroleum pitch, sulfonated poly(styrene-divinylbenzene) and phenolic resins have been mainly adopted to prepare porous carbon spheres by carbonization and activation. Romero-Anaya29et al. obtained the carbon spheres from petroleum pitch by CO2 or steam activation with high microporosity and low surface oxygen groups content that show a positive influence on the adsorption application of non-polar volatile organic compounds (VOCs) at low concentrations, and thus leading to toluene adsorption capacities as high as 46 g toluene/100 g carbon spheres. Wickramaratne30et al. synthesised phenolic resin spheres with diameters from 200 to 420 nm by the one-pot modified St\u00f6ber method, and the high CO2 adsorption capacities reached 4.55 and 8.05 mmol g\u22121 on these AC spheres at 1 bar and two temperatures, 25 and 0 \u00b0C, respectively. Sun31et al. prepared activated carbon beads with desirable spherical forms from phenolic resins using a novel hydrothermal process coupled with a range of post-preparation treatments, and found that the well-developed porous system is important to obtain a higher CO2 capture capacity at both ambient and elevated pressures. Sulfur-doped microporous carbon spheres were synthesized from poly(styrene-divinylbenzene) through the sulfonation, carbonization, and KOH activation for CO2 adsorption, and the CO2 uptake presents 4.21 mmol g\u22121 and 2.54 mmol g\u22121 at both 25 \u00b0C and 50 \u00b0C under ambient pressure, respectively. The high capacity has been attributed to abundant ultramicropores and high contents of oxidized sulfur functional groups.32Porous carbon spheres as one kind of the carbon-based materials show many charming advantages over powdered and granular activated carbon, such as suitable ball size, smoother surface, better fluidity, high mechanical strength, and high adsorption capacity,33,34 Resin based carbon spheres with high surface area and different porous structure were prepared by adjusting two organic additives such as ethylene glycol and polyethylene glycol for dibenzothiophene adsorption in our previous works,24 and the carbon spheres were proposed as promising adsorbents for deep desulfurization of liquid hydrocarbons. In the present work, we firstly prepared resin spheres from mixture of isopropylphenol and formaldehyde by suspension polymerization, and then obtained carbon spheres with high surface area and microporous structure from these resin spheres via steam activation. Furthermore, the effects of air oxidation and ammonia solution heat treatment on the pore structure and surface chemistry of carbon spheres were investigated for efficient catalytic oxidation of CH3SH. Moreover, N2 adsorption\u2013desorption, Fourier transform infrared spectroscopy (FT-IR), X-ray diffractometer (XRD), scanning electron microscope (SEM), elemental analysis, X-ray photoelectron spectroscopy (XPS) and Boehm titration were applied to characterize samples, and then thermal analysis (DTG) and gas chromatography-mass spectrometry (GC/MS) were carried out to investigate the created oxidation product in the process of catalytic oxidation. In addition, the stability and regeneration activity were evaluated by cycling tests. Finally, the possible mechanism of adsorption/oxidation of CH3SH over modified carbon spheres was discussed according to the experiment and characterization results.What's more, phenolic resins are considered as promising polymeric precursors to prepare high surface area and desired pore structure of carbon spheres for their low level of inorganic impurities and negligible ash content.2.2.1Isopropylphenol (99%), formaldehyde (37 wt% in water), triethanolamine, poly, hexamethylene tetraamine and ammonia absolute (25 wt% in water) were purchased from Tianjin Tianli Chemical Corp. All solvents and other chemicals were AR grade and utilized without further purification.2.224,25 Firstly, resin spheres were prepared from isopropylphenol and formaldehyde by suspension polymerization. In a typical synthesis, the polymerization reaction was carried out in a 1000 mL round-bottomed four-neck reaction vessel with a Teflon stirrer, a reflux condenser, and a thermocouple. The isopropylphenol was polymerized with an aqueous solution  of formaldehyde in a molar ratio of 1\u2009:\u20095 in the presence of triethylamine , followed by dispersing the resulting mixture into 300 mL of deionized water via stirring at 600 rpm. Then, poly  was added to the above mixture at 96 \u00b0C by stirring at 600 rpm for 30 min. Afterwards, hexamethylene tetraamine  was added to reaction vessel and polymerization reaction was carried out at the same temperature and fixed agitation rate (600 rpm) for 4 h. After cooling to room temperature, resin spheres were obtained via solid\u2013liquid separation. And then they were further carbonized at 850 \u00b0C for 45 min under nitrogen atmosphere and activated at the same temperature with steam for 1.5 h. The obtained carbon spheres will be denoted as ACS. Furthermore, the prepared ACS was oxidized by dry air with a flow rate of 60 mL min\u22121 for 2 h at 350 \u00b0C, and denoted as ACSO.Series of millimeter porous carbon spheres were prepared from alkyl phenol and formaldehyde according to the recipe reported previously.\u22121, the temperature was increased with a ramp rate of 3 \u00b0C min\u22121. When the temperature attained 800 \u00b0C, the ammonia solution was introduced at a flow rate of 10 mL min\u22121 for 1 h, and then cooled down to room temperature. The obtained samples were named as ACSN and ACSON, respectively. In addition, the commercialized activated carbon spheres (CACS) was purchased from Taiyuan New Process Technology Corp  for comparison.The ACS and ACSO were separately further functionalized by heat treatment with ammonia solution. In a typical run, the sample was placed in a vertical cylindrical furnace under nitrogen flow rate of 60 mL min2.326,27 The textural parameters of all the studied ACSs were carried out by N2 adsorption/desorption at \u2212196 \u00b0C using a ASAP 2020 instrument. The samples were separately degassed at 250 \u00b0C in a vacuum environment for a period of at least 4 h prior to measurements. Experimental adsorption data at the relative pressure (P/P0) less than 0.3 was used to calculate surface area values using the standard Brunauer, Emmett, and Teller (BET) equation. The pore size distribution (PSD) was determined by applying density functional theory (DFT) method based on nitrogen adsorption data. FT-IR spectra of activated carbon samples were obtained utilizing a PerkinElmer Spectrum 100 FT-IR spectrometer. A disk made of pure KBr was used as a reference sample for background measurements. The carbon spheres\u2013KBr mixtures at a ratio of 1\u2009:\u2009300 were ground in an agate mortar and then pressed under vacuum conditions in a hydraulic press. Before the spectrum of a sample was recorded, the background line obtained was arbitrarily and automatically subtracted. The spectra were recorded from 4000 to 400 cm\u22121 at a scan rate of 0.2 cm s\u22121, and the number of interferograms with a nominal resolution of 4 cm\u22121 was fixed at 100. The spectra were recorded in the range of 400\u20134000 cm\u22121 at a resolution of 4 cm\u22121. The surface morphology of the samples was observed on a Hitachi S-4800 field emission scanning electron microscope (SEM) operating at 3 kV. The crystallinity information on the surface of samples was determined by a X-ray diffraction-meter  using a Cu K\u03b1 radiation source . Surface chemistry was evaluated using the Boehm titration method. For the purpose of this research, 1 g of carbon sample was placed in 50 mL of 0.05 N sodium hydroxide or hydrochloric acid. The vials are sealed and shaken for 24 h and then 10 mL of each filtrate was pipetted and the excess of base or acid was titrated with HCl or NaOH. The numbers of acidic sites were calculated under the assumption that NaOH neutralizes acidic groups and HCl neutralizes basic groups. The chemical composition of the activated carbon samples was measured by an Elementar Vario Macro EL Cube microanalyzer. XPS was measured on a PHI5300 X-ray photoelectron spectrometer. Monochromatic Al K\u03b1 source (1486.6 eV) was used at a power of 210 W. The resolution of the instrument is 0.55 and 0.70 eV for Ag 3d and Au 4f peaks, respectively. Survey scans were collected for binding energy ranging from 1100 eV to 0 with an analyzer pass energy of 160 eV with a step of 0.6 eV for a dwell time of 150 ms. For the high-resolution spectra, the pass-energy was 20 eV with a step of 0.1 eV and dwell time of 200 ms. 0.4 g carbon powder was placed in 20 mL of water and equilibrated during the night. Then the pH of the suspension was measured by a pH meter  for comparison. For exhausted samples, the pH is denoted as pHE. 1 mL methanol and 0.5 mL carbon powder were mixed in a flask and warmed at 60 \u00b0C for 1 h. Then, the suspension liquid was analyzed by gas chromatography-mass spectrometry (GC/MS) experiments using a PerkinElmer gas chromatograph/mass spectrometer.Materials characterizations were carried out reference to our previous publications.2.43SH removal under wet conditions.18 Adsorbent samples were ground and packed into a glass column, and prehumidified with moist air (relative humidity 80% at 25 \u00b0C) for 1 h. The amount of water adsorbed was estimated from the increase in the sample weight. Moist air (relative humidity 80% at 25 \u00b0C) containing 0.3% (3000 ppm) CH3SH was then passed through the column of adsorbent at 0.5 L min\u22121. The breakthrough of CH3SH was monitored using a Micromax monitoring system with an electrochemical sensor calibrated with CH3SH. The test was stopped at the breakthrough concentration of 20 ppm. After the adsorption test, the exhausted samples were designated with the letter E. To study the roles of water and oxygen in the removal of CH3SH, contrast experiments were also tested using dry air and dry nitrogen as carrier gases for ACS and ACSON, and denoted as ACS-A, ACS-N, ACSON-A, and ACSON-N, where A and N represent dry air and dry nitrogen, respectively. The adsorption capacities of each sorbent in terms of mg of CH3SH per gram of carbon were calculated by integration of the area above the breakthrough curves, and from the CH3SH concentration in the inlet gas, flow rate, breakthrough time, and mass of sorbent. In addition, the process of regeneration of exhausted samples was carried out as follows, 6 mL exhausted sample was mixed with 300 mL of ethanol for 5 h at 50 \u00b0C and then filtered. Ten cycles were performed, and then the carbon sample was heated at 500 \u00b0C for 1 h under a nitrogen atmosphere. Finally denoted as ACSON-10 ,25,26 Furthermore, all of the carbon spheres show pore size distribution around 4 nm in Fig. S1(b),2 adsorption/desorption isotherms.The N2 and NH under high temperature (800 \u00b0C).35,36 Moreover, partial gasification reaction between the carbon spheres and the generated free radicals from the above thermal decomposition also makes a contribution to the porous development. Therefore, the highest surface area, total pore volume and micropore volume can attain 1710 m2 g\u22121, 0.83 cm3 g\u22121 and 0.74 cm3 g\u22121 for the direct ammonia treated sample ACSN, respectively. It can also been observed that the ammonia thermal treatment shows an evident contribution to the increase of micropore volume compared to the virgin carbon spheres, which can be ascribed to the above partial gasification reaction between the carbon spheres and the generated free radicals that exerts an active influence on the major microporosity domain by producing new micropore sites.37,38It is well known that the porous structure parameters such as BET surface area, total pore volume and micropore volume are favourable implements to study the pore characteristics, and the corresponding results are listed in 2, and eventually some micropores or/and mesopores became expanded or collapsed in different extent, resulting in the decrease of micropore volume.39,40 However, when the preoxidized carbon spheres are subjected to the ammonia thermal treatment under 800 \u00b0C, the oxygen surface groups firstly give rise to decomposition that creates the vacant sites in the pores, which provide more opportunities to increase reaction probability with created free radicals under the simultaneous ammonia treatment at 800 \u00b0C. It has been also reported that gasification with ammonia has a profitable to recover its porosity blocked by preoxidization, and increase the porous structure parameters over that of the oxidized sample.41,42 Moreover, the carbon spheres (ACSON) obtained by the preoxidation-assisted ammonia thermal treatment show bigger BET surface, total pore volume and microporous volume than those of the direct oxidized carbon spheres.It can be seen that the BET surface are, total pore volume and micropore volume decrease in some degree after thermal air oxidization compared to the virgin carbon spheres. The results can be probably attributed to the partial collapse of some pore walls or the recession of some pore channels by the reaction related to O2 g\u22121, 0.64 cm3 g\u22121 and 0.46 cm3 g\u22121 after the oxidation, respectively. On the contrary, the BET surface area, total pore volume and microporous volume considerably become bigger after subsequent ammonia thermal treatment than those of the oxidized carbon spheres, and present 1592 m2 g\u22121, 0.71 cm3 g\u22121 and 0.61 cm3 g\u22121, respectively. Moreover, the carbon spheres have a higher micropore ratio (\u226570%) except for CACS. In addition, the average pore size of all carbon spheres is less than 2 nm, which is in accordance with the characteristic of N2 adsorption/desorption. Therefore, the performance of these carbon spheres in catalytic oxidation of CH3SH may be primarily ascribed to the different surface chemical properties.It can be observed from the data in 3.2\u22121 appeared in the FTIR spectrum of virgin carbon spheres, which were related to O\u2013H stretching vibration, \u2013CH2\u2013 stretching vibration, C PBM data was replaced with SVG by xgml2pxml:<glyph-data id=\"z.dbd\" format=\"PBM\" resolution=\"300\" x-size=\"8\" y-size=\"10\" xml:space=\"preserve\">00000000000000000000000000000000111111110000000011111111000000000000000000000000</glyph-data><svg xmlns=\"http://www.w3.org/2000/svg\" version=\"1.0\" width=\"13.200000pt\" height=\"16.000000pt\" viewBox=\"0 0 13.200000 16.000000\" preserveAspectRatio=\"xMidYMid meet\"><metadata>Created by potrace 1.16, written by Peter Selinger 2001-2019</metadata><g transform=\"translate scale\" fill=\"currentColor\" stroke=\"none\"><path d=\"M0 440 l0 -40 320 0 320 0 0 40 0 40 -320 0 -320 0 0 -40z M0 280 l0 -40 320 0 320 0 0 40 0 40 -320 0 -320 0 0 -40z\"/></g></svg>O groups, CC groups, aromatic ring, C\u2013O stretching vibrations and C\u2013H groups, respectively.37,43 It can be found that a sharp peak is located at 1716 cm\u22121 for oxidized carbon spheres ACSO compared to the ACS and other samples, which can be attributed to the carboxylic structure induced by thermal air oxidization.25 These oxygen surface groups can have a contribution to introduce the nitrogen containing functional groups into the carbon spheres during the subsequent ammonia treatment.The carbon spheres were subjected to the FTIR measurements in order to investigate the nature of the functional groups, and the FTIR analysis results of virgin carbon spheres and modified samples are shown in \u22121, which can be corresponding to CN stretching vibrations, C\u2013N stretching vibrations and N\u2013H stretching vibrations for all ammonia modified carbon spheres, respectively.44,45 Furthermore, another two obvious peaks at 881 and 753 cm\u22121 related to amine or amides functionalities can be found only in the in the spectra of ACSN and ACSON, which can be due to the formation of hydrogen bonds between the free radicals (such as NH2 and NH) and surface groups.46,47 These bands indicate that nitrogen containing functional groups can be effectively incorporated on the surface of carbon spheres by facile ammonia thermal treatment. It is noticeable that intensities of these bands related to the nitrogen containing functional groups are increased by the preoxidization-assisted ammonia thermal treatment compared to the direct ammonia modification. For instance, oxygen chemisorption, carboxylic species and cyclic anhydrides generated from preoxidization appear on the surface of carbon spheres, when the oxidized carbon spheres are subjected to the ammonia thermal treatment, the generated free radicals such as NH2 and NH can easily react with these oxygen functional groups to form amine or amide structures by dehydration reaction in the process of ammonia treatment, making a great contribution to the increase of bands intensity corresponding to these nitrogen containing functional groups.37 In addition, it can be seen that the peak related to carboxylic structure at 1716 cm\u22121 considerably diminished after ammonia thermal treatment, which can be due to the reaction that the generated free radicals give rise to attack to the surface oxides and active sites on the surface of carbon spheres to form nitrogen containing functional groups. And or decomposition of oxygen containing surface groups during higher temperature.35 Therefore, the band intensities related to nitrogen containing species exhibited an evident increase for oxidized carbon spheres following ammonia treatment compared to the direct ammonia treated carbon spheres, indicating that preoxidation-assisted ammonia treatment under high temperature significantly incorporates nitrogen containing species onto the surface of carbon spheres, which will be favorable for enhancement of CH3SH adsorption.It can be observed that some changes have been created after ammonia thermal treatment in the spectra of ACSN and ACSON. Compared to the ACS and CACS, the new peaks can be seen at 1458, 1225 and 1104 cm3.32 departure, the pores expansion or collapse, and the formation of new oxygen containing groups.25,40 These consequences are consistent with the FTIR analysis and N2 adsorption. Furthermore, it can be observed that the surface of carbon spheres obtained by direct ammonia thermal treatment shows much more rough with stable sphericity than that of oxidized carbon spheres in 3 molecules are smaller and easier to diffuse into the pore channels, and the created free radicals  gradually reacted with the carbon surface or pore walls under high temperature, resulting in the surface etching and the expandation of pore structure or formation of new microporosity.37 As a result, the higher BET surface area and pore volume were shown for ACSN, and also generated obvious nitrogen containing groups in the FTIR spectrum. It is noticeable that the exterior surface of ACSON obtained by preoxidation-assistant ammonia thermal treatment shows considerable roughness and much big pores in 37,39 in which the surface oxygen functional groups to create vacant sites through thermal decomposition, and free radicals  react with these vacant sites or surface oxygen functional groups to develop pore structure, leading to the increase of BET surface area and pore volume and simultaneously the introduction of nitrogen containing functional groups in the ACSON. On the contrary, CACS from commercial activated carbon is very different, the exterior surface shows some big cracks with roughness in The surface morphology of the obtained activated carbon spheres were measured through SEM, and the SEM images are shown in 3.4\u03b8 = 26.58 \u00b0and 44.21\u00b0 for all the prepared carbon spheres from the above XRD patterns, and no other obvious peaks appear in the spectra, which can be ascribe to the characteristics of porous carbon materials.48,49 In our work, the suspension polymerization is used to prepare the resin spheres precursor, afterwards, the resin spheres were carbonized and activated under high temperature with steam as a function of active agent that can react with the carbon. The primary reaction equations in the activation process are as follows to create the main carbon containing product, leading to the formation of the carbon network structure and the development of pore channel.The as-obtained porous carbon spheres were subjected to the XRD measurement to investigate the crystal structure information, and the corresponding XRD analysis spectra were carefully recorded and shown in 2O reaction.50 In our study, the primary component is carbon with small other composition, although the virgin carbon spheres were modified by different procedures. Therefore, the characteristics of XRD analysis spectra is highly consistent with reported porous carbon materials.Furthermore, it has been proposed that the etching action of steam is generally completed accompanied by the decomposition of volatile components and the formation of new pores in the process of continuous C\u2013H3.53SH removal of porous carbon materials, and the Boehm titration method is widely used to evaluated the surface chemistry of activated carbon. Therefore, the chemical analysis of all the porous carbon spheres was completed by means of the Boehm titration, and the corresponding surface pH values and amounts of acidic and basic groups related to the surface of the obtained porous carbon spheres are summarized in \u22121 among of all samples. On the contrary, the amount of basic groups nearly decreases to zero (0.02 mmol g\u22121) after thermal air oxidation compared to the virgin carbon spheres ACS. Our previous study has proposed that the reaction between thermal air and the surface of activated carbon spheres was created in the process of air oxidation under 400 \u00b0C by means of the surface and pore channels related to the diffusion and etching action, finally resulting in the increase of oxygen containing groups, especially the surface oxygen groups of carbonyl group with strong acidity.25 As a result, the larger the number of acidic groups the smaller the pH of the carbon spheres surface. However, when the carbon spheres were subjected to the ammonia heat treatment, no matter direct treatment or preoxidation-assistant modification made a significant contribution to the amount of basic groups for ACSN and ACSON, which can be attributed to the incorporation of basic nitrogen-containing groups by means of decomposition of oxygen containing surface groups and the reaction between the generated free radicals and the surface oxides or active sites.37,43 As expected, the pH values and number of basic groups considerably increase compared with ACS and ACSO, and such basic nitrogen-containing on the surface of porous carbon spheres could accounted for the dissociation of CH3SH or oxidation of CH3S\u2212 ions to disulfides. Moreover, these basic groups may take advantage of weak acid\u2013base interactions to attract CH3SH. In addition, the amount of acidic groups is almost equivalent to the number of basic groups for CASC with the pH of 7.09.It has been proposed that the surface chemistry is an important role in the CH3.62 departure, pores expansion or collapse, and the formation of new oxygen containing groups, finally leading to the increase of oxygen containing groups, especially the oxygen content of the oxidized carbon spheres.25,39 Furthermore, the virgin and oxidized carbon spheres were separately treated by ammonia thermal treatment, and the reactions between the created free radicals during ammonia decomposition and the surface of carbon spheres considerably introduced nitrogen into the carbon structure. For example, the nitrogen content increased to 5.21 wt% and 7.13 wt% for ACSN and ACSON compared with the ACS (0 wt%), respectively. Moreover, it can be observed that the ACSON shows higher nitrogen content than that of ACSN, which may be ascribe to the method of incorporating nitrogen at high temperatures. The nitrogen content differences between the ACSN and ACSON samples suggested that the oxygen functional groups that existed on the surface of carbon spheres played an important role in the process of ammonia treatment by controlling the amount of nitrogen incorporation to the carbon surface, and preoxidation treatment obviously improved the degree of nitrogen incorporation in the process of ammonia treatment.In order to investigate the element contents and the species of the surface functional groups, the prepared carbon spheres were subjected to the Elemental and XPS analysis. As can be seen in 41,51In the process of subsequent ammonia thermal treatment, these oxygen containing groups can give rise to thermal decomposition, resulting in the formation of active sites that react with ammonia molecules or free radicals to introduce the nitrogen containing functionalities. For instance, the ammonia molecules react with carboxylic acid sites on the surface of carbon spheres, and ammonium salts are firstly formed. Furthermore, the created ammonium salts transform into amides and/or nitriles groups by dehydration reactions. On the other hand, the reaction of ammonia molecules by the substitution of OH groups can easily create amines on the carbon spheres surface. In addition, the surface oxygen containing groups like ether can be replaced by \u2013NH\u2013 in the process of ammonia thermal treatment under high temperature, and imine and finally the pyridine functional groups incorporate on the carbon surface by dehydrogenation reactions. The related reaction equations are as follows.52,53 Furthermore, 23 It can be also found that the relative amounts of N-6 and N-Q in the ACSN obtained by direct ammonia treatment show a little higher than those of ACSON prepared by preoxidation-assistant ammonia modification. However, the preoxidation-assistant ammonia modification introduces more nitrogen on the ACSON. As a result, the overall contents of N-6 and N-Q in the ACSON increase when the preoxidation-assistant ammonia modification is adopted for incorporation nitrogen.In order to investigate the nature of the functional groups created by the above reactions, the elemental speciation and surface binding of the prepared carbon spheres were analyzed by XPS. 3.73SH over the virgin and modified carbon spheres were evaluated in a fixed bed reactor, and the corresponding breakthrough curves were shown in 3SH breakthrough capacities shown in 3SH capacity is 181.1 mg g\u22121 and 132.2 mg g\u22121 for the virgin carbon spheres and commercial carbon spheres, respectively. However, the CH3SH breakthrough capacity of ACSO is only 87.7 mg g\u22121, which can be due to the lower surface area and pore volume caused by the air oxidation, especially the negative influence of acidic oxygen species on the surface of ACSO. Furthermore, the higher amounts of nitrogen, the higher CH3SH capacities for ammonia modified carbon spheres, and the CH3SH capacity is 534.3 mg g\u22121 and 622.8 mg g\u22121 for ACSN and ACSON, respectively. The ACSON shows the highest CH3SH capacity with the highest nitrogen content of 7.13 wt%, and the CH3SH breakthrough capacity is higher or similar to other reported adsorbents. Therefore, it is critical to introduce the basic nitrogen containing functional groups for enhancement of the CH3SH removal.The adsorption/oxidation performances of CH21,54 As can be seen from the XPS analysis, the envelope N 1s peak of the ACSN and ACSON were composed of four different nitrogen containing functional groups, and they presented different relative contents. Thus, the correlation between the CH3SH capacities of the ACSN and ACSON and the contents of N-6 and N-Q according to XPS results is also discussed to investigate the effects of the two nitrogen containing species on the CH3SH removal as illustrated in the reported literatures. It can be observed that the relative amounts of N-6 and N-Q in the ACSON prepared by preoxidation-assistant ammonia modification show a little smaller than those of ACSN obtained by direct ammonia treatment. However, the preoxidation-assistant ammonia modification introduces more nitrogen on the ACSON with a high nitrogen content of 8.02 at%. As a result, the overall contents of N-6 and N-Q in the ACSON are bigger than those of ASCN, and the CH3SH capacity increases with the contents of pyridinic nitrogen and quaternary nitrogen as shown in 3SH oxidation. Therefore, we conclude that the contents of N-6 and N-Q play an important role on the catalytic oxidation of CH3SH over carbon spheres.It has been reported that the two nitrogen containing groups of pyridinic nitrogen and quaternary nitrogen with strong electron transfer ability have a profit for the oxidation of sulfurs species.3SH, thus, the absence of water and oxygen in the mixed gas is implemented for ACS and ACSON, and the results are shown in 3SH breakthrough capacity of ACS decreases by around two times under the absence of moisture compared with the presence of moisture. Furthermore, it is noticeable that oxygen has a different effect on the adsorption/oxidation of CH3SH for ACS and ACSON. For instance, the CH3SH breakthrough capacity is 53.8 mg g\u22121 for ACS-A without moisture, while the ACS-N shows the similary CH3SH breakthrough capacity of 51.2 mg g\u22121 in the absence of oxygen. The two conditions indicate that moisture and oxygen have no obvious discrepancy for ACS. On the contrary, the CH3SH breakthrough capacity is 313.9 mg g\u22121 for ACSON-A in the presence of dry air, while the ACSON-N has the CH3SH breakthrough capacity of 203.6 mg g\u22121 without oxygen. It can be seen that a considerable discrepancy exits in the ACSON. On the one hand, the moisture can create a thin water film on the surface of carbon spheres while the fed gas is in the presence of water, and the adsorbed CH3SH can dissolve into the water film, and further dissociate to the thiolate ion that can be easily oxidized to CH3SSCH3. On the other hand, when the fed gas has no water, the gaseous CH3SH is firstly adsorbed onto the surface of carbon spheres, afterwards the adsorbed CH3SH is also further oxidized to CH3SSCH3 in absence of moisture. According to the above results, it can be observed that the CH3SH capacity of ACS in dry air and dry nitrogen show little difference, indicating that no oxygen participates in the CH3SH removal under air condition, which can be ascribe to the lack catalytic activity sites like nitrogen containing species. However, the CH3SH capacity under dry air is bigger than that in dry nitrogen for ACSON, which demonstrates the nitrogen containing functional groups  give rise to the strong catalytic oxidation performance on the surface of ammonia modified carbon spheres. As a result, it can be deduced that water and oxygen have a profit for the CH3SH removal over the nitrogen-enriched carbon spheres.It has been also essential to study the effect of various gas conditions on the removal of CH23,55 The corresponding DTG curves are shown in 2O. It has been proposed that the desorption of CH3SSCH3 created by the oxidation of CH3SH is completed in range of 100 \u00b0C and 300 \u00b0C. Therefore, the sharp peak located at about 280 \u00b0C is ascribe to removal of CH3SSCH3 for the exhausted samples. In addition, another mild peak located between 300 \u00b0C and 400 \u00b0C is related to the deeper oxidation product, and the peak becomes obvious accompanied by the nitrogen content of the samples.In order to investigate the created product on the surface of the exhausted carbon spheres, the exhausted samples were subjected to the thermal analysis (TA) experiments, and it can provide the information of related sulfur species through the weight loss in range of certain temperatures.3SSCH3 and methyl methane thiosulfonate appear in the spectra. Combining with the above DTG results, the sharp peak around 280 \u00b0C may be also created by the desorption of methyl methane thiosulfonate. It has been observed that further oxidation of sulfur species took place over the ammonia modified carbon spheres under wet air conditions, and the decrease of pH in the exhausted carbon spheres also indicated the formation of acidic oxidation products compared with the fresh samples in 3SH can be catalytically oxidized by the nitrogen containing active species of ACSON, resulting in the highest CH3SH breakthrough capacity. In addition, no peak related to the water is found, indicating that the surface or pore channel of carbon spheres were easily covered by more created CH3SSCH3 other than water.The GC/MS spectra for species extracted from ACSON-E is measured by gas chromatography-mass spectrometry (GC/MS) experiments, and the GC/MS results are shown in 3SH removal, since it can reflects the economy and practicability of porous carbon adsorbents. It is well known that CH3SSCH3 is the basic oxidation product of CH3SH, and it can be easily removed from the surface of carbon adsorbents. Furthermore, the exhausted carbon spheres was regenerated by means of ethanol scrubbing and heat treatment, and 3SH removal. It can be observed that no noticeable loss of the CH3SH capacity appears for ACSON even after ten cycles, and the CH3SH capacity of ACSON reserved as high as 97%. Furthermore, the discrepancies of pore structure and chemical properties were investigated to analysis the cause for fresh ACSON and regenerated ACSON-10. According to the pore structural parameters shown in 2 g\u22121, 0.69 cm3 g\u22121 and 0.56 cm3 g\u22121 compared with the fresh ACSON, respectively. And ACSON-10 also keeps a high micropore rate of 81.15%. Moreover, it can be seen that the nitrogen content of ACSON-10 reserves as high as 7.87 at%, and the relative contents of N-6 and N-Q slightly decrease to 47.82% and 14.05%, respectively. Only a slight decrease is shown compared to those of fresh ACSON in 3SH adsorption/oxidation performance.Another important factor is stable cyclic operation performance relation to the actual application of an adsorbent for CH3.83SH adsorption/oxidation over the nitrogen enriched porous carbon spheres. Firstly, a thin water film is formed on the surface of carbon spheres with the introduction of a moist gas, and then CH3SH molecules are adsorbed on the surface and dissolve into the water film. Hereafter, they dissociate into protons and thiolate ions. As suggested by Bandosz and Liu, the N-6 (pyridinic nitrogen) and N-Q (quaternary nitrogen) act as the Lewis basic sites and promote the electrons transfer in the adsorption/oxidation of CH3SH for the nitrogen doped carbon materials.21,23 Afterwards, the dissociation of CH3SH to thiolate ions become more easier after the introduction of N-6 with a lone electron pair that play an important role on Lewis basic sites. Later, the extra electrons in the functional groups of N-6 and N-Q, give rise to the transmission between the thiolate ion and the adsorbed oxygen, leading to the formation of thiolate radicals and superoxide ions. Simultaneously, the imported water reacts with the created superoxide ions, and thus hydroxyl radicals are formed in the intermediate process. Next, as the created actives species such as oxygen radicals and hydroxyl radicals also provide benefit conditions for oxidation, the oxidation product of CH3SSCH3 is further oxidized into CH3SO2SCH3, which is consistent with the results of DTG and GC/MS and other reported literatures,21,23 and the oxidation process attains balance states until the oxidation products occupy all the pores with nitrogen active species. Finally, the exhausted carbon spheres are regenerated through ethanol exaction and heat treatment, and the CH3SH capacity shows a reserved CH3SH capacity of 97% for ten cycles after the slight decrease in BET surface area, total pore volume and nitrogen content of carbon spheres.Based on the above results, the possible mechanism is proposed to depict the CH4.via suspension polymerization and steam activation, and then the effects of air oxidation and ammonia solution heat treatment on the pore structure and surface chemistry of carbon spheres were investigated for efficient catalytic oxidation of CH3SH. The results showed that the obtained porous carbon spheres were mainly microporous, and the carbon spheres showed a high surface area value of 1710 m2 g\u22121 and a total pore volume of 0.83 cm3 g\u22121 after the direct ammonia treatment. However, the surface area and total pore volume of carbon spheres after air oxidation decreased from 1636 m2 g\u22121 to 1397 m2 g\u22121 and 0.77 cm3 g\u22121 to 0.64 cm3 g\u22121 compared with virgin carbon spheres, respectively. Moreover, the preoxidation followed by enriched nitrogen strategy not only increased the surface area and total pore volume of carbon spheres, but also incorporated more active nitrogen species of pyridinic nitrogen and quaternary nitrogen, which demonstrated in this study that the two nitrogen containing functional groups promoted a better catalytic oxidation of CH3SH as function of catalysts. Furthermore, the carbon spheres obtained from preoxidation-assisted enriched nitrogen presented the highest CH3SH capacity of 622.8 mg g\u22121 with the highest nitrogen content of 7.13 wt%, and the CH3SH capacity increased with the contents of pyridinic nitrogen and quaternary nitrogen. In addition, water and oxygen have a profit for the CH3SH removal over the nitrogen-enriched carbon spheres. The results of DTG and GC/MS demonstrated that the basic oxidation product is CH3SSCH3 that can be further oxidized into CH3SO2SCH3. Finally, the exhausted carbon spheres showed a great recycling stability after ten cycles without obvious decrease of the CH3SH capacity, which demonstrates that the preoxidation-assisted nitrogen enriched porous carbon spheres are promising for catalytic adsorption/oxidation of CH3SH.In summary, millimeter resin-based porous carbon spheres with high surface area and microporous structure were firstly prepared from 3-isopropylphenol and formaldehyde There are no conflicts to declare.RA-010-D0RA07375J-s001"}
{"text": "Blautia and Coprococcus were lower in the HLA-B27+ offspring, while Faecalibacterium prausnitzii was higher. HLA-B27+ offspring without arthritis were compared to children with treatment-na\u00efve HLA-B27+ SpA. After adjustments, clustering by diagnosis was present. A total of 21 OTUs were significantly associated with diagnosis state, including Bacteroides (higher in SpA patients) and F. prausnitzii (higher in controls). Thus, our data confirmed associations with B. fragilis and F. prausnitzii with juvenile SpA, and also suggest that the mechanism by which HLA-B27 is associated with SpA may not involve alterations of the microbiota.Multiple studies have shown the microbiota to be abnormal in patients with spondyloarthritis (SpA). The purpose of this study was to explore the genetic contributions of these microbiota abnormalities. We analyzed the impact of HLA-B27 on the microbiota of children at risk for SpA and compared the microbiota of HLA-B27+ pediatric offspring of ankylosing spondylitis (AS) patients with that of HLA-B27+ children with SpA. Human DNA was obtained from the offspring for determination of HLA-B27 status and polygenic risk score (PRS). Fecal specimens were collected from both groups for sequencing of the V4 region of the 16S ribosomal RNA gene. Among the offspring of AS patients, there was slight clustering by HLA-B27 status. After adjusting for multiple comparisons, five operational taxonomic units (OTUs) representing three unique taxa distinguished the HLA-B27+ from negative children:  Spondyloarthritis (SpA) has a prevalence of about 1\u20132% of the adult population  comparedIt has been hypothesized that HLA-B27 itself mediates disease, at least in part, by acting upon the microbiota . To testThis was a cross-sectional study that first compared the contents of the fecal microbiota among HLA-B27+ versus HLA-B27- offspring of patients with AS, and subsequently compared the microbiota of treatment-na\u00efve children with HLA-B27+ SpA with that of the healthy HLA-B27+ offspring.Controls were a sample of children of patients with AS identified by a single rheumatologist (LG) as per the modified New York criteria . ChildreJuvenile SpA subjects were either children with enthesitis-related arthritis as per the International League of Associations for Rheumatology criteria  or who mThis was conducted as previously reported . Briefly2 fold change between the two groups, while correcting for multiple comparisons with the Benjamini\u2013Hochberg false discovery rate (FDR) test [The purified DNA (~100 ng) underwent PCR amplification using primers designed to amplify the conserved region flanking the V4 region from the 16S ribosomal RNA (rRNA) gene, as described previously ,17. ResuDR) test  with a cAs a complementary tool to tease out which taxa were most essential in distinguishing the two groups of subjects, we used the random forest algorithm , which iDifferences in total read counts and in alpha diversity were evaluated using the Student\u2019s t-test, with an alpha of 0.05. Differences in the PRS by HLA-B27 status were assessed with the nonparametric Kruskal\u2013Wallis test.HLA-B27 imputation was performed with SNP2HLA [Calculation of the PRS was performed as recently described by our group , using t SNP2HLA  against  SNP2HLA .A total of 56 offspring of AS patients met inclusion criteria for the current study and submitted a fecal specimen. The PRS was obtained on 55 of the offspring, although we were still able to impute HLA-B27 status on the subject without a PRS. One of the subjects was diagnosed with SpA at the research exam on the basis of arthritis, enthesitis, and clinical sacroiliitis. That subject was found to be HLA-B27+ by genotyping, subsequently confirmed through clinical testing, and was, therefore, included in the SpA group. Of the 56 offspring, 32 (57%) were found to be HLA-B27 positive. A description of the probands with AS is included in p = 0.022). There likewise was association between the PRS and the structure of the microbiota . However, a major driver of the PRS is HLA-B27 itself; the PRS of the HLA-B27- offspring was \u22120.25 , while that of HLA-B27+ offspring was 0.22 . There was no association between the PRS and the structure of the microbiota when the analyses were performed separately on HLA-B27+ and HLA-B27- offspring. For HLA-B27+ subjects, the F-score was 1.5 (p = 0.081) and, for their HLA-B27- counterparts, the F score was 1.1 (p = 0.345).There were no differences in alpha diversity of raw read counts between HLA-B27+ and HLA-B27- offspring . OrdinatF. prausnitzii had higher abundance in the HLA-B27+ subjects, while Coprococcus and three OTUs from the Blautia genus were all higher in the HLA-B27- subjects.Next, we used the DeSeq2 program  to perfoF. prausnitzii , which remained significant following adjustment for NSAID use, age, and sex . DeSeq2 analysis demonstrated 21 OTUs that distinguished the patients from controls  was higher in the SpA patients versus the HLA-B27+ siblings, while the other (Coprococcus) was lower in the SpA patients. As discussed above with respect to the random forest plot, several organisms appear more than once, due to multiple entries representing species or strains that cannot be distinguished at the 16S level.Alpha diversity analyses demonstrated that the SpA patients had decreased richness (Chao1 test) and evenness (Shannon test) as compared to the controls, although a second test of evenness (inverse Simpson) did not demonstrate any differences between the two groups . Ordinatcontrols . ConsistThis is the first study to compare the contents of the fecal microbiota of HLA-B27+ versus HLA-B27- offspring of AS patients and is also the first to compare that of HLA-B27+ pediatric subjects with and without SpA. Several important messages emerged from this work.Blautia among the HLA-B27+ subjects. In the current study, a key organism distinguishing HLA-B27+ from negative subjects was F. prausnitzii, which, despite being depleted in juvenile SpA patients  but not limited to SpA [Finally, this study appears to underscore the importance of age or disease state in the nature of the microbial abnormalities. We have previously demonstrated that the fecal abundance of nile SpA , while id to SpA ,11,37,38d to SpA ,34,39,40d to SpA .This study has limitations, including the potential for differences due to the age differences between the HLA-B27+ offspring and the SpA patients. We do not suspect this difference to be problematic, as the microbiota appears to stabilize after age 3 . Age didA novel aspect of this work is that of comparing both HLA-B27+ and HLA-B27- offspring who are well-balanced for age, sex, and geographic factors, and also comparing HLA-B27+ SpA patients to HLA-B27+ controls. Prior studies of SpA patients ,31,34,39"}
{"text": "The correct data is 13.4\u00a0\u00b1\u00a012.5 instead of 413.4\u00a0\u00b1\u00a012.5.In the paper by Oh The publisher apologizes for this error."}
{"text": "Cities and urban environments can do peculiar things to biodiversity that shares them with us. How cities affect their invited and uninvited inhabitants has become an increasingly important question. More than half of the world's population dwells in urban areas, and these environments will keep expanding considerably. Understanding how this relatively recent, rapid, and pervasive form of landscape modification influences the ecology and evolution of organisms that cannot escape, or may benefit from it, is an emerging field of biology. Although we are aware of how some birds, mammals or plants respond to urban environments, less is known about insects and invertebrates in general. In this issue of Molecular Ecology, Blumenfeld et al. (2022) bring new remarkable insights into how a common ant species adjusts to urban settings across the United States by changing its social structure and behaviour. Using a large\u2010scale molecular, chemical and behavioural dataset, they document how the odorous house ant Tapinoma sessile differs in its colony organisation and dispersal strategy between rural and urban habitats. In each of the study regions and continent\u2010wide, rural and urban colonies are genetically and chemically differentiated, suggesting that urban settings act as potent agents of selection and isolation. The novelty and importance of this study are that it documents multiple independent transitions toward the same social organisation and the apparent effect of habitat on the life history of a eusocial insect species. Traits which make ants successful invaders are mainly known and often shared across unrelated species. They are linked to reproduction and dispersal strategies such as polygyny (multiple reproductive queens), dependent colony foundation (budding) or parthenogenesis such as thelytoky. Others consist of behavioural shifts, such as loss of aggression among non\u2010nestmates, increased hostility towards other species or changes in foraging activity. Finally, ecology\u2010related features can involve shifts in habitat or food preferences. Many of these traits facilitate easy dispersal and high competitiveness. When combined with polydomy, in which a single colony inhabits multiple nests, polygyny may lead to unicoloniality. Unicolonial populations form a network of interconnected nests among which workers move freely and lack aggression, despite having low genetic relatedness. In their extreme form, called supercolonies, they can reach extraordinary densities, span hundreds of kilometres and effectively outcompete other invertebrates. In ant invaders, some of these traits are linked to reduced genetic variability, or inbreeding or reduced nestmate discrimination capacity caused by their introduction.T.\u00a0sessile populations. Named the odorous house ant, this species native to North America is highly adaptable and found across many habitats, including cities. The authors knew from earlier research that the urban colonies are larger, polygynous and potentially polydomous, unlike most colonies in natural settings.Encountering some of these links was what Blumenfeld et al.\u00a0 expectedT.\u00a0sessile. They confirmed with microsatellite markers that the colony structure is indeed flexible and linked to a habitat. The polygynous colonies were much more common in urban settings, while monogynous colonies were prevalent in natural habitats. Surprisingly, polydomy was relatively rare and detected only on a few occasions. And perhaps more remarkable is that polygyny has not only independently and repeatedly arisen under the urban settings on such a large scale but also that both types of colonies were consistently highly distinct genetically and chemically (in their cuticular hydrocarbons), confirming that habitat is a strong driver of divergence.Using a large\u2010scale sampling and smartly integrating phylogeographical, population genetic, chemical and behavioural methods, Blumenfeld et al. disentangled the social structure of Formica). While these nonurban species are often monogynous and monodomous, they can be polygynous and polydomous in highly fragmented environments, such as small forest patches in agricultural areas (Seifert et al.,\u00a0A similar polymorphism has been documented, for example, in European wood ants (T.\u00a0sessile is probably a result of the adoption of daughter queens to the maternal colony. Instead of flying off and founding colonies independently, the daughter queens of T.\u00a0sessile use budding\u2014a dependent colony foundation with the help of the worker ants of the maternal colony. To prevent inbreeding, which this reproduction mode may lead to, T.\u00a0sessile probably favours male\u2010biased dispersal to avoid sib\u2010mating. Such strategies were proposed by theoretical models and also documented in ants on islands or in patchy, isolated habitats. Whether this is a response to dispersal limitation, the high unpredictability of nesting sites or the patchiness of food sources in urban settings is a pending question.What Blumenfeld et al.  found inBy performing a detailed mapping of social and population structures as done by Blumenfeld et al., we can better assess the effect of ecological conditions on various life\u2010history traits. The authors placed their results into a broader perspective on how disturbance and urban environments can affect different taxa. They also propose reliable scenarios of how particular conditions in cities could lead to the specific traits and strategies encountered in urban odorous ant populations. Their work provides another excellent example of urban\u2010mediated shifts or adaptations and opens an array of questions to be addressed with follow\u2010up studies.Lasius niger, workers in urban colonies had more diverse cytochrome gene families and DNA repair systems, while the olfactory systems were reduced (Konorov et al.,\u00a0For example, genomic comparisons could map if there is selection towards specific sets of traits at the level of individuals. In the ant T.\u00a0sessile in urban vs. natural settings also deserves further attention. While another study of tiny acorn ant Temnothorax nylanderi did not reveal signatures of urbanization on population demography and structure (Khimoun et al.,\u00a0T.\u00a0sessile, we can look into the mechanisms reinforcing the urban and natural habitat barriers and the chances for human\u2010mediated dispersals. Robust markers should assess the population divergence among more habitats and spatial scales. Isolation by environment can regularly produce considerable population structuring; therefore, comparing the differentiation levels across diverse habitats would help us assess the contribution of urban\u2010specific factors to population divergence in T.\u00a0sessile.The substantial differentiation found among populations of Tapinoma and across unrelated clades with similar life features would help assess the contribution of different factors for succeeding in disturbed environments.Finally, a macroevolutionary perspective may provide helpful insights into what traits are primary preadaptations for exploiting urban environments or becoming invasive. Ancestral shifts in preference to open and disturbed habitats in several South Pacific ants increased their macroevolutionary dispersal rates. These lineages then successfully colonized remote islands and broadened their distribution considerably, including giving rise to several invasive species (Matos\u2010Marav\u00ed, Clouse, et al.,\u00a0Organisms may respond to many different aspects of the urban environments, and these phenotypic and genotypic differences do not always imply adaptation (McDonnell & Hahs,\u00a0CONACYT DICB 282471.None.The author declare no conflict of interest.None."}
{"text": "The optimization of pretreatment parameters is crucial for obtaining the maximum CNF yield. The response surface methodology was used to design the pretreatment conditions for preparing CNFs. This method consists of four factors: pretreatment time , pretreatment temperature , liquid-to-solid ratio , and PIL content . The predicted CNF yield (Y) followed a quadratic multinomial regression equation represented by Y = 84.43 + 3.59A + 8.22B + 2.22C \u2212 2.13D \u2212 0.85AB + 2.83AC + 5.95AD + 0.43BC \u2212 2.98BD + 4.25CD \u2212 6.04A2 \u2212 18.23B2 \u2212 4.98C2 \u2212 7.39D2. The regression equation exhibited high model fit to the experimental CNF yields as evidenced by a determination coefficient of 0.9764. Results showed that a maximum CNF yield of 86.2% was obtained in the case with the following conditions: pretreatment temperature of 112 \u00b0C, pretreatment time of 3.2 h, liquid-to-solid ratio of 83 g g\u22121, and PIL content of 29%. CNFs with high crystalline index (64.0%) and thermal stability (Tmax = 348 \u00b0C) were prepared. This work favors the development of low cost PIL-based pretreatment systems for the clean production of CNFs.Pretreatments with aqueous protic ionic liquid (PIL)\u2013ethanolamine bis ([MEA][(HOA)(H 2OA)]), combined with ultrasonic disintegration, were employed in cellulose nanofibril (CNF) production from pulp fibers.Pretreatments with aqueous protic ionic liquid (PIL)\u2013ethanolamine bis ([MEA][(HOA)(H Cellulose is easily obtainable, inexpensive, nonpolluting, and nontoxic; hence, it exhibits the possibility of addressing many problems, including energy shortage, resource scarcity, and environmental pollution.2 Given its highly linear internal structure, cellulose is strongly influenced by inter- and intramolecular hydrogen bonds; structurally, the coexistence of supramolecular structures in the crystalline and noncrystalline regions encompasses a large number of reactive groups, such as hydroxyl groups, reducing the accessibility of cellulose to reactions and hindering its further industrial application.3 The crystalline region of cellulose has a dense structure and stable properties compared with its noncrystalline region. By physically or chemically removing some of the noncrystalline regions of cellulose while retaining its crystalline regions, nanocellulose can be isolated from micron-scale cellulose materials, considerably expanding the industrial applications of cellulose.4Cellulose is a biopolymer composed of \u03b2-As a special class of nanocellulose, cellulose nanofibrils (CNFs) have a diameter of 5\u201360 nm, a length of several micrometers, and a high length-to-diameter ratio. Their raw material is natural cellulose, and thus, CNFs have renewable and degradable properties. CNFs also exhibit the advantages of nanomaterials, such as high specific surface area, high mechanical strength, low thermal expansion coefficient, chemical stability, ultrafineness, and ultralightness. CNFs have a wide range of applications in many fields, such as in construction, coatings, paper, automobile, food and medicine.5 ILs exhibit the advantages of stable physical and chemical properties, low vapor pressure, and structure designability. Compared with the traditional pretreatment, IL pretreatment demonstrates advantages in solvent recoverability and morphological control of CNFs.6At present, the primary production method for CNFs is as follows: cellulose materials are first chemically pretreated, and then treated through mechanical processing. The traditional CNF preparation method suffers from high energy consumption, low yield, environmental pollution, and other problems because of the use of high concentrations of acid or other chemical reagents. Considering these problems, the use of ionic liquids (ILs), which are environment-friendly solvents, as pretreatment solvents/swelling agents/catalysts in preparing CNFs has been explored.et al.7 prepared CNFs by integrating ultrafine milling into a two-step process with SO2-switched diazabicyclic monoethanolamine IL (SIL) pretreatment. The energy consumption of SIL pretreatment was reduced by 50% compared with that of the conventional process. Zhao et al.8 used acidic ILs-1-butyl-3-methylimidazole hydrogen sulfate ([C4C1im]HSO4)-catalyzed organic solvent pretreatment and ultrasonic disintegration two-step method to extract CNFs from wood flour. The yield, morphology, crystallinity, chemical structure, and thermal stability of CNFs were investigated. The results showed that the yield of CNFs was 41.82% after pretreatment with 1,4-butanediol aqueous solution-[C4C1im]HSO4, and their thermal stability and film-forming properties were superior to those of the products obtained using the concentrated acid hydrolysis method. Although the pretreatment of ILs provides a promising development in the preparation of CNFs, its high price poses a limitation to the practical application of ILs.Berglund 9 During the synthesis of PILs, the addition of an excess amount of acid (relative to a base) results in the formation of dimerization, oligomeric anions, and even anionic clusters, which increase the acidity of PILs. PILs with oligomeric anions have been used in catalysis and biomass pretreatment.10 On the basis of 1-methylimidazole and the anionic cluster [(HSO4)(H2SO4)x] , Paredes et al.11 synthesized a series of PILs for the acid hydrolysis of cellulosic materials to produce cellulose nanocrystals . CNC yields were 60\u201373% at 40 \u00b0C and 2\u20133 h. Treatment conditions were milder, and the thermal stability of the prepared CNC was better compared with those of sulfuric acid and other PIL treatments in the literature. However, this PIL suffers from the high toxicity of imidazole cation and the high cost of raw materials.Inexpensive proton-based ILs (PILs), which are suitable for industrial applications, can be prepared using nitrogen-containing bases and varying amounts of Br\u00f8nsted acid. The acidity of PILs is modulated by varying the amount of acid added to prepare a strongly acidic system.2OA)]\u2212) followed by ultrasonic disintegration was investigated. The cation type, i.e., [ethanolamine ([MEA]+), diethanolamine ([DEA]+), and triethanolamine ([TEA]+)], and water addition considerably influenced CNF yields. Under the pretreatment conditions of 110 \u00b0C and 3 h, CNF yields with different PIL-based systems exhibited the following order: [MEA][(HOA)(H2OA)] > [DEA][(HOA)(H2OA)] > [TEA][(HOA)(H2OA)]. Overall, CNF yields with PIL\u2013water pretreatments were higher than that with oxalic acid\u2013water pretreatments. PIL\u2013water is an efficient pretreatment system due to its inhibitory actions on excessive cellulose hydrolysis. Thus, the PIL, ([MEA][(HOA)(H2OA)]), was used to pretreat cellulose materials for producing CNFs in the current study. Compared with imidazolium-based ILs, the advantages of [MEA][(HOA)(H2OA)] are lower cost and toxicity.In the preliminary experiment, the preparation of CNFs with the pretreatment that used alkanolamine-based PILs with dimeric oxalic acid anions ([(HOA)(H2OA)] content. Thus, the optimization of the pretreatment parameters for CNF production is crucial for obtaining maximum yield,12 improving the feasibility of commercial applications for the produced CNFs.Pretreatment plays important roles in producing nanofibrils and influencing the properties of the prepared CNFs. The preparation of CNFs is considerably influenced by various pretreatment parameters, such as liquid-to-solid ratio, temperature, time, and [MEA]-based systems for CNF production under the pre-optimized conditions of ultrasonic disintegration. RSM was used to optimize the effect of pretreatment parameters on the yield of CNFs. The most significant parameter was identified in the optimization. The physicochemical properties of the prepared CNFs were analyzed via X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FTIR), and thermogravimetric (TG) analysis. To the best of our knowledge, no report has yet been made about the optimization of PIL pretreatment based on dimeric oxalic acid anions for CNF production. This work is beneficial for the commercial application of CNFs with the use of low-cost PILs.Ultrasonic disintegration considerably influences CNF production and pretreatments. However, considering the complexity of optimization to all affecting factors, this study focused on pretreatments that used [MEA]. Then, 63.3 g (about 0.5 mol) of oxalic acid dihydrate was dissolved in an appropriate amount of ethanol with stirring in a 500 mL round bottom flask. Thereafter, 15.3 g (about 0.25 mol) of ethanolamine was added dropwise with vigorous stirring; dropwise addition was performed in an ice water bath.15 After dropwise addition, the mixture was continuously stirred at room temperature (25 \u00b1 1 \u00b0C) until a homogeneous and stable liquid phase was formed, followed by spin-drying at 35 \u00b0C to remove ethanol. The synthesized IL was placed in a vacuum oven (with built-in phosphorus pentoxide) at 60 \u00b0C for 48 h to remove water. Deionized water was added to the synthesized IL, and aqueous solutions of [MEA][(HOA)(H2OA)] (hereafter abbreviated as PIL\u2013water) with different mass concentrations (10\u201350%) were prepared under magnetic stirring conditions.IL was prepared by reacting ethanolamine and oxalic acid dihydrate as the starting material in a molar ratio of 1\u2009:\u20092, The resulting product was called [MEA] aqueous solution system exhibits good pretreatment capability. The CNFs are filamentous in the TEM images, and lengths are difficult to measure due to mutual entanglement. However, all values are known to reach the micron level, indicating that the lengths of the prepared CNFs are relatively small. This finding indicates that the prepared CNFs have relatively large length and diameter, with a length-to-diameter ratio of 104.7. This result is comparable with the isolation of carboxylated nanocellulose length-to-diameter ratio from skimmed cotton by using oxalic acid as determined by Lin et al.26The SEM and TEM images of the CNFs are shown in 3.5.2Cellulose crystal structure is one of the important parameters for determining the physical properties of CNFs. The XRD spectra of CNF and pulp fibers are shown in 3.5.3\u22121 are attributed to the stretching vibration of \u2013OH.27 The absorption peaks near 1636 cm\u22121 are attributed to H\u2013O\u2013H planar bending vibration, which is due to the hygroscopic property of cellulose.28 The peaks at 1440\u20131400 cm\u22121 are attributed to \u2013CH2 vibration and C\u2013H stretching, which are correlated with the crystallinity of the fiber material. The peaks near 2880 cm\u22121 are attributed to C\u2013H.29 The peaks near 1165 cm\u22121 are attributed to cellulose C\u2013O\u2013C vibrations at the glycosidic linkage.30 The peaks near 890 cm\u22121 are attributed to the vibration of C1.31 The above characteristic peaks are considered typical absorption peaks of cellulose, indicating that PIL\u2013water did not introduce any new functional groups during the pretreatment of pulp fibers, and no derivatization reaction occurred.The FTIR spectra of the pulp fibers and CNFs are shown in 3.5.432 The 370\u2013600 region mass change rate decreased. This stage involves carbon residue decomposition into gas products. As shown in Tmax of CNFs (348.4 \u00b0C) was slightly lower than that of pulp fibers (359.2 \u00b0C). This phenomenon might be caused by the breakage of cellulose chains, the smaller size of CNFs, increased surface area, and increased heat transfer rate during pretreatment and sonication. Moreover, the large amount of free hydroxyl groups on the surface of CNFs accelerated the decomposition of cellulose glycosyl units.The TG curves of pulp fibers and CNFs are depicted in 42OA)]\u2013water, followed by ultrasonic disintegration. The operating parameters, including pretreatment time, pretreatment temperature, liquid-to-solid ratio, and PIL content, were considered the major influencing factors of CNF yield. The designed response surface experiments confirmed that the four single factors exerted significant effects on the response values. The interaction of IL content with pretreatment time, pretreatment temperature, and liquid-to-solid ratio was significant. The CNF yield of 85.0% produced by the fitted optimal pretreatment conditions was nearly identical to the actual values of 86.2%, indicating that RSM can provide a theoretical basis for optimizing CNF yield. Compared with pulp fibers, CNFs with higher CrI, length-to-diameter ratio, and thermal stability were prepared under the optimized conditions. This work revealed that pretreatment with aqueous [MEA][(HOA)(H2OA)] solutions exhibits considerable potential for high CNF yield in terms of low cost and clean production.CNFs were successfully prepared from pulp fibers with pretreatments that used [MEA][(HOA)(HXincheng Peng: conceptualization, methodology, software, formal analysis, writing \u2013 original draft. Deqin Zhu: methodology, software, formal analysis, writing \u2013 original draft. Jingjing Liu: formal analysis, investigation. Ligang Wei: supervision, writing \u2013 review & editing. Na Liu: formal analysis, investigation. Li Wei: formal analysis, investigation. Guolin Shao: writing \u2013 review & editing. Qingda An: funding acquisition, supervision.The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.RA-013-D3RA06930C-s001"}
{"text": "More specifically, the b\u2010TiO2 treated with sodium borohydride produced excessive oxygen vacancies resulting in oxygen vacancy band that narrowed the b\u2010TiO2 band gap, and the small band gap led to NIR\u2010II region wavelength (1064\u00a0nm) absorbance. Furthermore, the combination of defect energy level trapping carrier recombination heat generation and conjugate heat generation mechanism, significantly improved the photothermal performance of the PTT agent based on b\u2010TiO2. The photothermal properties characterization indicated that the proposed dual\u2010PTT agent possesses excellent photothermal performance and ultra\u2010high photoconversion efficiency of 64.9% under 1064\u00a0nm laser irradiation, which can completely kill esophageal squamous cells. Meanwhile, Gd2O3 nanoparticles, an excellent magnetic resonance imaging (MRI) agent, were introduced into the nanosystem with similar dotted core\u2013shell structure to enable the nanosystem achieve real\u2010time MRI\u2010monitored cancer therapeutic performance. We believe that this integrated nanotherapeutic system can not only solve the application of PTT in the NIR\u2010II region, but also provide certain theoretical guidance for the clinical diagnosis and treatment of esophageal cancer.Photothermal therapy (PTT), as an important noninvasive and effective tumor treatment method, has been extensively developed into a powerful cancer therapeutic technique. Nevertheless, the low photothermal conversion efficiency and the limited tissue penetration of typical photothermal therapeutic agents in the first near\u2010infrared (NIR\u2010I) region (700\u2013950\u00a0nm) are still the major barriers for further clinical application. Here, we proposed an organic/inorganic dual\u2010PTT agent of synergistic property driven by polydopamine\u2010modified black\u2010titanium dioxide  agent application. Here, an efficient organic/inorganic dual\u2010PTT agent guided by MRI was proposed. It is proved the oxygen vacancy band narrowed its band gap that led to NIR\u2010II region absorb. Furthermore, the defect energy level trapping carrier and conjugate synergistic heat generation result in high photoconversion efficiency. However, TiO2 can only absorb energy in the ultraviolet region (272\u2013390\u00a0nm) owing to its large band gap (\u223c3.0\u00a0eV). Ultraviolet light lacks deep tissue penetration and poses side effects to normal tissues, thus greatly limiting the application of TiO2 in the clinic. Therefore, many efforts have been made to further expand its absorption range from the ultraviolet to the near\u2010infrared (NIR) region, such as hydrogenation reduction, doping, and other methods  to optimize its electronic energy level structure, shorten the forbidden band width, and improve optical performance. For instance, Ren et\u00a0al. first presented a black hydrogenated TiO2 (H\u2010TiO2), where white TiO2 reacted with hydrogen plasma at a high\u2010power density introducing Ti3+ and oxygen defect that turned it into black H\u2010TiO2. Consequently, the black H\u2010TiO2 exhibited NIR light\u2010triggered photothermal performance with excellent photothermal conversion for tumor therapy, which was referred to its dramatically enhanced nonradiative recombination. In order to achieve diagnostic and therapeutic multi\u2010functions, Wang et\u00a0al. synthesized a Fe@\u03b3\u2010Fe2O3@H\u2010TiO2 nanocomposite by one\u2010step hydrogen reduction that showed outstanding photoconversion efficiency under 808\u00a0nm laser irradiation resulting from the narrow band gap (1.971\u00a0eV) of H\u2010TiO2 and multiple circuit loops for electron transitions between H\u2010TiO2 and \u03b3\u2010Fe2O3. Notably, the nanocomposite possessed magnetic resonance imaging, PTT, and tumor targeting functions. It is noteworthy that the photothermal therapeutic agents based on black TiO2 (b\u2010TiO2) nanocomposites are mainly applied in the first NIR (NIR\u2010I) region (700\u2013950\u00a0nm), which requires a high laser density (2 W cm\u22122) due to the limitation of light absorption and scattering by tissues. However, this laser density exceeds the maximum allowable skin exposure set by the American National Standards Institute , and has potential damages to the surrounding normal tissues. Hence, the PTT therapeutic efficacy and safety of b\u2010TiO2 need to be further improved.Photothermal therapy (PTT), as a novel cancer treatment method with high selectivity, minimal invasiveness, and strong operability, has been extensively developed into a powerful cancer therapeutic technique over the past decades. In particular, photothermal therapeutic agents can locally generate hyperthermia to ablate tumor cells in the diseased area when activated by a special wavelength.1 Tita2\u2010based photothermal therapeutic agents responsive in the second NIR (NIR\u2010II) region (1000\u20131500\u00a0nm) has garnered significant interest, due to long wavelength light with higher maximum allowable skin exposure  and deeper tissue penetration depth because of less tissue scattering. For example, Guo et\u00a0al. used mild hydrogenation with NaBH4 method to synthesize b\u2010TiO2 with abundant oxygen vacancies on its surface that display high photoconversion efficiency of 29.44% in the NIR\u2010II region, which exhibit precise potential for photoacoustic image\u2010guided tumor\u2010targeted PTT. Han et\u00a0al. constructed core/shell\u2010structured b\u2010TiO2\u2010x nanocomposites via aluminum\u2010reduction method. The results showed that oxygen\u2010deficient TiO2\u2013x layer can also enhance the photothermal conversion efficiency (39.8%) of b\u2010TiO2 nanoparticles under 1064\u00a0nm laser for photothermal hyperthermia. These studies successfully developed the photothermal agents based on b\u2010TiO2 to be excitable in the NIR\u2010II region and effectively caused the death of cancer cells under photothermal treatment, which solved the drawback of shallow tissue penetration and low maximum permissible exposure. However, the existing b\u2010TiO2\u2010based photothermal therapeutic agents generally show a very broad absorption and low photothermal conversion efficiencies. Consequently, it is urgent to develop b\u2010TiO2\u2010based photothermal therapeutic agents with excellent photoconversion efficiency in the NIR\u2010II region, which can alter more light energy to thermal energy for efficient PTT.Recently, the development of b\u2010TiOattering.10 For PDA nanoparticles exhibit excellent photothermal conversion properties and are emerging as a novel PTT agent for tumor. Specifically, the polymer contains a \u03c0\u2010\u03c0 conjugated structure, similar to many aromatics and conjugated molecules, which is conducive to the migration of free electrons and carriers, so that it has broad\u2010spectrum absorption of light in the ultraviolet\u2010near infrared region. Based on this, we believe that combining PDA with b\u2010TiO2 can not only improve the biocompatibility of the photothermal therapeutic agent based on b\u2010TiO2 nanoparticles, but also significantly improve its photo\u2010absorption performance and photothermal conversion capacity in the NIR\u2010II region through the synergistic photothermal effect of b\u2010TiO2 and PDA, to achieve a highly efficient photothermal therapeutic agent for tumors. Meanwhile, the single diagnosis or treatment strategies have been difficult to achieve the clinical requirements. The combination of various diagnosis and therapy technologies to build a diagnosis and treatment platform is the key research direction currently. Therefore, gadolinium oxide (Gd2O3) with appreciable biocompatibility and magnetic resonance (MR) imaging performance can be introduced into b\u2010TiO2 that realizes the MR image\u2010guided therapy for cancer.Dopamine, a neurotransmitter in the human brain, has good biocompatibility and easily oxidation and self\u2010aggregated to form polydopamine (PDA) under alkaline conditions (pH\u00a0=\u00a08.5).14 PDA2 was prepared by one\u2010step hydrogenation reduction method, while Gd2O3/b\u2010TiO2 composite nanoparticles with dotted core\u2010shell were prepared by polyol method. On this basis, Gd2O3/b\u2010TiO2@PDA nanoprobes with core\u2010shell structure were obtained by the oxidative self\u2010aggregation of dopamine hydrochloride. The nanoprobes not only extended the light absorption of b\u2010TiO2 to 1064\u00a0nm that solved the shallow tissue penetration depth in NIR\u2010I region, but also provided extremely high photoconversion efficiency of 64.9% at the laser irradiation density of 1 W cm\u22122 that evaded the irradiation laser density exceeding maximum allowable skin exposure. In addition, the constructed nanoprobes were applied to esophageal squamous cell carcinoma cancer model, and the results showed that the nanoprobes could offer high\u2010signal MR imaging on the tumor region and had a significant therapeutic effect on the tumor cells. Further, the application of these multifunctional nanoprobes not only reflects the advantages of integrated diagnosis and treatment technology at the NIR\u2010II region, but also promotes the research on the diagnosis and treatment technology of esophageal squamous cell carcinoma.In this work, b\u2010TiO22.12O3/b\u2010TiO2@PDA nanoparticles is shown in Scheme\u00a02 nanoparticles, on this basis, Gd2O3/b\u2010TiO2 nanoparticles were prepared by a polyol method. In order to increase the biocompatibility of the materials, Gd2O3/b\u2010TiO2@PDA nanoparticles were obtained by oxidative self\u2010aggregation of dopamine hydrochloride. As shown in HRTEM image  of anatase phase TiO2 , the weak peaks belonged to the rutile phase TiO2 , indicating the anatase crystal structures was the majority phase in b\u2010TiO2 and Gd2O3/b\u2010TiO2. In addition, there were no obvious characteristic peaks in XRD spectrum, representing that the Gd2O3 existed in Gd2O3/b\u2010TiO2 nanoparticles in the amorphous form because of the small size. The Gd (3d) XPS spectra of the Gd2O3/b\u2010TiO2 showed that the characteristic peaks of Gd 3d3/2 and 3d5/2 at 1219.78 and 1187.42\u00a0eV, respectively, corresponding to the different binding energies with different spin orbits of Gd in Gd2O3  in PDA, respectively  with a poor crystal form and the atomic arrangement was in a highly disordered state , Raman spectroscopy, and XPS. Specifically, the GPA result indicated that the P25 disorder degree was approximately zero and the image color was uniform, indicating that the crystal form of the particles was complete and the atomic arrangement was highly ordered Figure\u00a0. Howevere Figure\u00a0. The ress Figure\u00a0, mainly igure\u00a03+.23 In s Figure , which c2, it can be obtained that the band gap widths of P25 and b\u2010TiO2 were 2.91 and 1.19\u00a0eV, respectively  and concentration of Gd, which represented the efficiency of the nanoprobes as contrast agents. As shown in Figures\u00a01 values of Gd2O3/b\u2010TiO2 and MAGNEVIST were 7.05 and 4.81\u00a0mM\u22121 s\u22121, respectively. The r1 value of Gd2O3/b\u2010TiO2 was much higher than that of MAGNEVIST, indicating that Gd2O3/b\u2010TiO2 had a stronger shortening T1 effect and more suited for positive MRI contrast agents. The r2/r1 value of Gd2O3/b\u2010TiO2 was 1.61, indicating that the Gd2O3/b\u2010TiO2 nanoparticles had excellent T1 MR imaging performance. The T1\u2010weighted MR imaging showed that the imaging signal was strongest when the concentration of Gd at 0.5\u00a0mM  contrast compared with higher concentration of Gd in MR images. Compared with the commercial MAGNEVIST, the nanoprobes had a stronger imaging signal at low concentrations, which indicated the nanoprobes had higher safety. Meanwhile, the MR imaging signal of Gd2O3/b\u2010TiO2@PDA was highly consistent with that of the Gd2O3/b\u2010TiO2, indicating that the PDA encapsulation does not affect the imaging performance  was directly observed using a three\u2010dimension (3D) soft X\u2010ray microscopy. Due to the large size of a single KYSE\u2010150 cell, Video 2.52O3/b\u2010TiO2@PDA nanoprobes in vitro, the cell survival rate was evaluated on KYSE\u2010150 cells under corresponding conditions. As shown in Figure\u00a02O3/b\u2010TiO2@PDA  were collected after treatment for the H &E staining. As shown in Figure\u00a02O3/b\u2010TiO2@PDA had no obvious damage to the tissue, indicating the nanoprobes had appreciable biocompatibility in vivo. To further analyze the safety of the nanoprobes, the blood was collected after treatment for hematological analysis and blood biochemical analysis. As the results shown in Figure 2O3/b\u2010TiO2@PDA and saline had no significant change in the indicators of hematological and blood biochemical analysis, revealing that the nanoprobes having good biocompatibility ensure its possibility of clinical application.The biocompatibility of the Gd2.71\u2010weighted MR imaging was performed on the KYSE\u2010150 tumor\u2010bearing nude mice by using a 3.0 T MAGNETOM Prisma MR device. Figure\u00a02O3/b\u2010TiO2@PDA nanoprobes possessed excellent T1 enhanced MR imaging performance in vivo. The thermal imaging of mice treated with the nanoprobes and saline was significantly different, indicating the nanoprobes exhibited considerable photothermal performance and combined with MR imaging can provide a dual\u2010modal imaging system  2019\u20100005).Supporting InformationClick here for additional data file.Supplemental Video 1Click here for additional data file."}
{"text": "Varroa mites) and pathogens . We also correlated the expression of genes linked to immune functioning, oxidative stress, and buffering against temperature and air quality stressors. High daily temperatures are associated with poorer air quality, and they are both associated with lowered immune system functions and increased oxidative stress protection against pests and diseases. Higher Varroa mite loads are correlated with the lower potential ability of honey bees to buffer against temperature stress. Our study provides insights into interactions between climate change-related abiotic stressors and their relation to biotic stressors, which underlie a decline in honeybee health.Climate change is associated with warmer and drier weather on average in central California. At the same time, honeybees are being transported from all over the United States to California for the completion of pollination services that ensure increased yields for a variety of crops, resulting in bees experiencing ambient abiotic stressors. Higher temperatures can reduce air quality, further exacerbating honeybee health challenges. We investigated the relationship between higher daily temperatures and poor air quality and demonstrated associations with incidences of pests , which is tied to immune system strength; however, a higher gene expression level of Vitellogenin (Vg) is tied to oxidative stress. There was a positive relationship between Varroa mites and N. ceranae pathogen loads, and a negative correlation between Varroa mites and Heat Shock Protein 70 (HSP70) gene expression, suggesting the limited ability of mite-infested colonies to buffer against extreme temperatures. Histological analyses did not reveal overt signs of interaction between pathology and abiotic stressors, but N. ceranae infections were evident. Our study provides insights into interactions between abiotic stressors, their relation to common biotic stressors, and the expression of genes related to immunity and oxidative stress in bees.Climate change-related extreme weather events have manifested in the western United States as warmer and drier conditions with an increased risk of wildfires. Honeybees, essential for crop pollination in California, are at the center of these extreme weather events. We associated the maximum daily temperature and air quality index values with the performance of colonies placed in wildfire-prone areas and determined the impact of these abiotic stressors on gene expression and histopathology. Our results indicate that poor air quality was associated with higher maximum daily temperatures and a lower gene expression level of Prophenoloxidase ( Apis mellifera) is crucial for pollination in natural and agricultural ecosystems, with annual economic contributions estimated to be over $200 billion globally [Ongoing changes to climatic conditions are resulting in frequent extreme temperature fluctuations and a rise in weather-related natural disasters, which, in turn, affect ecosystems, and the species within . Wildfirglobally ,9 and ovglobally ,11. In rglobally ,14,15,16globally ,17. For globally . Beekeepglobally ,20, decrglobally ,22.Another direct consequence of extreme weather events  in relatVarroa destructor, affect brood and adult bees, and chronic infections from the pathogen, Nosema ceranae, affect adult bees and are critically important. The challenges from these biotic stressors may be compounded as bees adapt to abiotic stressors resulting from changing weather patterns. Our goal in this study is to assess the relationship between two main abiotic factors\u2014temperature and air quality\u2014and explore their relation to the two above-mentioned biotic stressors. Specifically, we investigated how daily maximum temperatures and poor air quality relate to each other and to N. ceranae and V. destructor: the chronic biotic stressors. While N. ceranae is relatively less virulent, it suppresses the immune system and causes energetic stress and metabolic dysregulation that could potentially be compounded by other stressors [Varroa mites, on the other hand, are central to declines in bee health as they nutritionally deplete the honeybee by directly feeding on them [Of the several biotic stressors that affect honeybees, parasitic mites, such as tressors ,16,30,31 on them  and vect on them .Heat Shock Protein 70 (HSP70), a general marker for the ability of bees to buffer against stress from extreme temperature changes [Prophenoloxidase (ProPO), a marker for immune upregulation in response to disease stress [Vitellogenin (Vg), a general physiological stress marker known to be a master regulator with ties to oxidative stress, immune functioning, development, and metabolism [N. ceranae incidence as secondary measures of the potential adverse impacts of temperature and poor air quality. Histologic imaging, which involves the microscopic evaluation of tissues and cells, has more recently gained the attention of honeybee researchers [We then assayed the gene expression of stress biomarkers that are activated in response to different stress pathways with the goal of gaining mechanistic insight into the interactions between abiotic and biotic stressors as they impact honeybee health. We measured the gene expression for  changes , Prophene stress  and Vitetabolism . We furtearchers ,40,41,42https://www.farmersalmanac.com/long-range-weather-forecast, accessed on 15 February 2023) and the air quality index (AQI) for each sampling date was noted from AirNow.gov .This study was conducted from June to November of 2021 with 12 standard Langstroth hives consisting of a total of 18 frames and a 5.68 L  feeder. The hives were equalized in strength and were placed near areas that were known to be prone to wildfires, including six different locations in the Napa, Yolo, and Solano counties of central California . Hives iVarroa mite loads for each colony were also measured via the standard alcohol wash method [Varroa mites in the hive. Colonies with mite levels at over 3% of the threshold received mite control treatments [The monthly, detailed assessments included recording the Frames of Bees (FOB), the presence of a laying queen as indicated by the presence of eggs, and measuring the amount of brood, pollen, nectar, honey, and the amount of empty space on a frame, on a scale of 0\u201310. h method . Approxieatments . The fraIn-hive and forager bees were placed in separate 50 mL falcon tubes and were thawed, macerated, and homogenized in 5 mL of nuclease-free water  per 30 collected bees, using a 50 mL disposable tissue grinder . The bee homogenate was then aliquoted as a 200 \u00b5L volume into three different 1.5 mL microcentrifuge tubes, which were stored in a \u221280 \u00b0C freezer until further analysis.Nosema infection loads was adapted from [Nosema and the identification of the species from a melt curve analysis were performed following [N. apis and N. ceranae positive control as well as a negative control. The samples were run in the Biorad CFX384 qPCR thermocycler  in technical duplicates. If the standard deviation between duplicates was greater than one, the samples were re-run. The amount of Nosema DNA that was quantified was converted to the total number of Nosema copies using the standard curves provided [DNA extraction to quantify ted from . Brieflyollowing . The 25 provided . All primer set sequence information used for gene expression analysis can be found in Heat Shock Protein 70 (HSP70), Vitellogenin (Vg), and Prophenoloxidase (ProPO), were quantified relative to the reference gene Ribosomal Protein S5 (RpS5). The following qPCR protocols were used for each target. For the quantification of the Vg and RpS5 expression, the final volume of the reaction was 10 \u00b5L which consisted of 5 \u00b5L of qPCR 2x Promega  master mix (no ROX), 0.2 \u00b5L (10 \u00b5M) of either the Vg-F or Vg-R primers or the RpS5-F and RpS5-R primers, respectively, including 2 \u00b5L of template cDNA, and 2.6 \u00b5L of nuclease-free water. The qPCR thermocycler program was: 95\u2009\u00b0C for 5 min, 45 cycles of 95\u2009\u00b0C for 10 s, and 60\u2009\u00b0C for 20 s, with a final extension step of 72\u2009\u00b0C for 30 s [A blend of random hexamers and an oligo dT SensiFAST cDNA Synthesis Kit  was used following the manufacturer\u2019s instructions to generate cDNA from the extracted RNA standardized to 700 ng. A 20 \u00b5L cDNA synthesis reaction was carried out involving 4 \u00b5L of a 5x TransAmp Buffer, 1 \u00b5L of reverse transcriptase, and 15 \u00b5L of extracted RNA. The relative gene expression of a total of three targets, for 30 s . For Profor 30 s . For HSPfor 30 s . Each ruMethods were adapted from Cook et al. (In press). Briefly, honeybees were collected and stored in 10% neutral buffered formalin (NBF) and were fixed for a minimum of 24 h. The head, thorax, and abdomen were separated using spring scissors  or a steel surgical blade . The head and thorax were subsequently sectioned transversely, and the abdomen was sectioned in a sagittal orientation along the midline using a carbon steel surgical blade . Blades were replaced with at least every three samples to prevent dulling, and all tissues were placed with their cut surface down in either one or two tissue cassettes (Tissue-Tek). All cassettes were stored in 10% NBF until further routine laboratory processing, including routine paraffin embedding, sectioning at 4 \u00b5M sections, mounting onto glass slides, and stained with hematoxylin and eosin (H&E). Two consecutive sections of all three body segments were mounted onto a single glass slide for light microscopic evaluation and subsequent image analysis. Based on the results of molecular analysis for gene expression, targeted groups were evaluated via light microscopy and image analysis. For microscopic evaluation, all body segments and tissues were assessed, and any lesions were documented. For image analysis, the total surface area for hypopharyngeal glands located dorsal to the central nervous system within the head section was calculated, as was the mandibular gland surface area. For mandibular glands, if both left and right glands were in the plane section of the slide, then both sides were measured and divided by two to obtain an average for one side. If only one side was in the section, then just that half was measured. The surface area of the glands was measured using Adobe Photoshop (v 24.1.1).Nosema. Bees were sampled monthly from June to November 2021. Six sites were sampled from June to September, and 10 nurse and 10 forager bees from each site were processed . One site was discontinued in September as the colonies died, and the remaining five sites were sampled similarly in October and November (100 bees for each time point). Finally, each bee was histologically evaluated for Nosemosis to compare the prevalence diagnosed histologically with the molecular quantification of N. ceranae load, air quality index, maximum daily temperature, the normalized gene expression of HSP70, ProPO, and Vg, FOB, Varroa mite counts, adult bees, the amount of the brood, the amount of honey, the amount of nectar, the amount of pollen, and the amount of empty space in the hive) did not follow a normal distribution. All count data were over-dispersed. Therefore, a generalized linear negative binomial regression model was used where the date of collection, the apiary sampled, and whether the bees collected were foragers or in-hive bees were included in the full model as random effects. The apiary, date, and age class of the bee had significant random effects when analyzing the gene expression of biomarkers for N. ceranae and Varroa mite loads. These random effect variables were then removed from the models due to the resultant lower AIC values when analyzing relationships between diseases and gene expression markers.All statistical analyses were carried out using JMP Pro v. 16  or GraphPad Prism . Data visualization was carried out using GraphPad Prism . All numeric variables  in relationship with gene expression markers and diseases were accounted for in a multivariate Spearman rank correlation analysis.N. ceranae load was analyzed within foragers and in-hive bees in relation to the other numeric variables using a negative binomial generalized linear regression. For N. ceranae and Varroa mites, the date and apiary had significant random effects on the previous negative binomial regression analysis. Therefore, N. ceranae and Varroa mite loads were further analyzed across apiaries and time with Wilcoxon pairwise comparisons after applying relevant post hoc adjustments for multiple comparisons.The Vg, ProPO, and HSP70), the date had a significant random effect in the previous negative binomial regression analysis. Therefore, each gene target was further analyzed across time with Wilcoxon pairwise comparisons.For each gene expression target (N. ceranae and Varroa mites), and gene expression measures . Lastly, a multivariate Spearman rank correlation analysis was performed to determine the association between the detailed assessment measurements , environmental measures , the disease and pest loads . For the quantitative analysis of the histologically determined surface area of hypopharyngeal glands and mandibular glands, Student\u2019s p = 0.027; ProPO and Vg genes   . Among fperature . Air quaperature .N. ceranae and Varroa mites, were related to the gene expression levels of ProPO and HSP70  that were near apiaries that did not receive any hive management measures to control these stressors . Varroa mite loads were positively associated with ProPO gene expression within forager bees . However, there was a negative relationship between Varroa mite loads and forager bee HSP70 gene expression  were all positively correlated with one another and negatively correlated with empty space in the hive. Pollen was positively correlated with adult bees, the frames of bees, and brood. Varroa and N. ceranae loads, levels ProPO, Vg, HSP70). No trends or significant differences in gland sizes were identified for any group comparison  on honeybee health parameters, including common biotic stressors\u2014response ; therefooa mites . In geneoa mites  in honeyVarroa mites were found to be correlated with a potentially lowered ability of foragers to buffer against high temperatures. The lowered expression of HSP70 genes in our analysis suggests exacerbated challenges for honeybees if atmospheric temperatures continue to move toward the extremes in the future. Heat shock proteins were highly conserved across organisms and upregulated in response to temperature and other stressors. These HSP proteins chaperone the assembly, disassembly, folding, and unfolding of protein complexes so that their function can be preserved under stress [HSP70 gene expression, temperature stress, when combined with drought, may reduce pollen production in plants, thus limiting pollen availability for foraging bees [Furthermore, r stress . The roling bees ,53. ThusN. ceranae or Varroa mites is not necessarily associated with a weak colony but instead may be dependent on other factors related to abiotic parameters, implying that colony-level indicators might not always be reliable. These discrepancies could relate to the differences in the seasonality of N. ceranae infections, where spore loads peak in the spring and are lowest in the fall [N. ceranae loads in the spring, but we detected the highest levels in the fall and relatively stable levels throughout the rest of the beekeeping season, suggesting a chronic colony-level infection with this pathogen. The constant higher temperatures and poorer air quality year-round in the Central Valley of California during the study years might suppress the immune system of honeybees, as indicated by the lowering of the ProPO gene expression. This lowered expression could explain the higher disease loads observed year-round in this climate in comparison to more temperate climates, where N. ceranae levels are more seasonal [N. ceranae here is similar to that reported in Spain, where N. ceranae is known to be particularly virulent [N. ceranae infections in Spain are found year-round in colonies with a lack of seasonality for this pathogen [Our results on the colony performance metrics indicate that the presence of the fall , but wheseasonal . The seavirulent . Spain ipathogen . Thus, opathogen . N. ceranae in forager bees versus in-hive bees is also supported by previous findings [N. apis in any of the samples based on the melt curve analysis, supporting the notion that N. ceranae is displacing N. apis throughout the world [ProPO gene expression in forager bees, suggesting that these bees, in an unfavorable environment, may have a decreased ability to combat infections and mount a strong immune response. Poor air quality showed a positive relationship with Vg expression in forager bees and increased Vg through upregulations, which is known to protect workers from oxidative stress, suggesting that poor air quality further stresses honeybee foragers. However, this trend does not hold in nurse bees which may be because they typically already have high levels of Vg expression [ProPO and HSP70 gene expression and not with any of the other stressors. These physiological changes in forager bees from poor air quality exposure may be further exacerbated by maximum daily temperatures, which have been shown to have a strong positive association with poor air quality [The higher amount of findings . This difindings . It is ohe world . Our respression . The nur quality . Our resVarroa is known to suppress the immune system in newly emerged bees [ProPO gene expression in forager bees. Varroa mites and N. ceranae were also positively correlated in this study. Therefore, this and other diseases present in Varroa-infested hives may likely cause a net increase in the innate immune response of forager bees. Supporting this notion, Varroa is known to vector viruses such as the Deformed Wing Virus (DWV) [ProPO expression [ProPO gene in forager bees with a heavy disease burden. Thus, ProPO could serve as a dependable immune marker gene that reflects the ability of bees to fight and fend off potential infections.Despite evidence that ged bees , we founus (DWV) , which bpression . TherefoVarroa mites being negatively correlated with HSP70 gene expression in forager bees, there is a strong likelihood of further hampering the ability of bees to tolerate extreme temperatures [Varroa mites were found to have significantly lower HSP70 gene expression levels [Varroa mite infestation caused a decrease in HSP70 gene expression [Varroa is known to vector virulent viruses, including fungal diseases such as stone brood, feed on fat body and hemolymph, as well as suppress the immune system [Varroa mite loads in hives is indicative of some cautious optimism that the higher temperatures predicted in the future for this region might have benefits, as previous research demonstrated that Varroa mites were indeed sensitive to higher temperatures [Varroa mite loads. However, this comes with several caveats, depending on the levels of high temperatures that honeybees can tolerate. However, it can be noted here that there are several heat shock proteins involved in proteostasis, and our study did not measure the capacity of bees to handle heat stress. Bees are known to have a slightly higher tolerance to high temperatures compared to Varroa mites, but it is also likely that this small beneficial impact could become minimal over an extended time as the parasite adapts to changing environmental conditions [Climate change for our study region is projected to lead to sustained increases in maximum daily temperatures in the future , which ieratures . Furthern levels ; howeverpression . Varroa e system ,33,48,66eratures . Bee heanditions . N. ceranae infections is dependable and the loads detected followed similar trends to the molecular quantification analysis, the relationships between high temperature and poor air quality with expression levels of stress genes were weak. These abiotic stressors did not result in immediate signs of pathological damage to hypopharyngeal or mandibular glands that are indicators of honeybee health [Histological analyses are gradually regaining center stage in research related to honeybee health, but our analyses show that histologic imaging may not be reliable to measure the impact of abiotic stressors on honeybees. While the pathological damage from e health . In summary, poor air quality is a serious environmental stressor impacting honeybees . Air pol"}
{"text": "Leishmania genus, poses significant challenges in treatment, including administration difficulty, low efficacy, and parasite resistance. Novel compounds or associations offer alternative therapies, and natural products such as oregano essential oil (OEO), extracted from Origanum vulgare, have been extensively researched due to biological effects, including antibacterial, antifungal, and antiparasitic properties. Silver nanoparticles (AgNp), a nanomaterial with compelling antimicrobial and antiparasitic activity, have been shown to exhibit potent leishmanicidal properties. We evaluated the in vitro effect of OEO and AgNp-Bio association on L. amazonensis and the death mechanisms of the parasite involved. Our results demonstrated a synergistic antileishmanial effect of OEO + AgNp on promastigote forms and L. amazonensis-infected macrophages, which induced morphological and ultrastructural changes in promastigotes. Subsequently, we investigated the mechanisms underlying parasite death and showed an increase in NO, ROS, mitochondrial depolarization, accumulation of lipid-storage bodies, autophagic vacuoles, phosphatidylserine exposure, and damage to the plasma membrane. Moreover, the association resulted in a reduction in the percentage of infected cells and the number of amastigotes per macrophage. In conclusion, our findings establish that OEO + AgNp elicits a late apoptosis-like mechanism to combat promastigote forms and promotes ROS and NO production in infected macrophages to target intracellular amastigote forms.American tegumentary leishmaniasis, a zoonotic disease caused by the  Leishmania amazonensis is one of the main causative agents of American tegumentary leishmaniasis (ATL), which is a zoonotic disease that affects humans and several species of wild and domestic animals and is characterized by chronic inflammation of the skin and mucous membranes [Lutzomyia spp., and its pathogenesis depends on factors such as the virulence of the parasite and the host\u2019s immune response [embranes . ATL is response .\u00ae and Pentostam\u00ae), which have been used since 1920 [The current treatment of ATL is based on the elimination of amastigote forms, with pentavalent antimonials  has been used in medicine for at least six millennia because of its efficiency in preventing microbial infections. Silver nanoparticles (AgNp) have been shown as potential antimicrobials, causing disruption of the cell integrity, inhibiting ATP synthesis, enhancing ROS production leading to oxidative stress, and disturbing the process of its replication and cell division . RecentlL. amazonensis, both in free promastigote forms and intra-macrophagic amastigote forms.Different therapeutic strategies for the treatment of leishmaniasis patients have been explored, including new natural and synthetic compounds, a combination of compounds, and nanomaterials ,20. TherL. amazonensis (MHOM/BR/1989/166MJO) were maintained in culture medium 199  supplemented with 10% fetal bovine serum (FBS) , 1 M HEPES buffer, 1% human urine, 1% L-glutamine, streptomycin and penicillin , and 10% sodium bicarbonate. The cell culture was maintained in a B.O.D at 25 \u00b0C in a 25 cm2 culture flask. In all experiments, promastigote forms in the stationary growth phase were used (5-day culture).Promastigotes of The BALB/c mice were kindly supplied by the Carlos Chagas Institute/Fiocruz-PR, Curitiba, Brazil. The animals were kept under sterile conditions in the Vivarium of the Department of Pathological Sciences of the State University of Londrina until they reached an approximate weight of 25\u201330 g and age between 6\u20138 weeks, with controlled light and temperature. The study was approved, and the animals were used according to the rules of the Animal Experimentation Ethics Committee of the State University of Londrina (UEL) n\u00ba 8595.2018.89.The OEO was obtained from Ferquima Industry and Commerce of Essential Oils . This oil (batch 224) was extracted by steam distillation, and its density (0.954 g/mL) and composition  were described in a technical report. A 50% OEO stock solution was prepared in dimethylsulfoxide (DMSO) . The maximum concentration of DMSO in the tests was 1%.Fusarium oxysporum was grown in a medium containing malt extract (2%) and yeast extract (0.5%) at 28 \u00b0C for 6 consecutive days. The grown biomass was filtered and resuspended in sterile water. Approximately 10 g of the fungal suspension was transferred to a conical flask containing 100 mL of distilled water, maintained for 72 h at 28 \u00b0C. AgNO3 was added , and the solution was maintained for several hours at 28 \u00b0C for the synthesis of the nanoparticles. The recovered silver nanoparticles were characterized through scanning electron microscopy (SEM), X-ray diffraction analysis (XRD), energy dispersive spectroscopy (EDS) demonstrated by Picoli et al. (2016) [The biogenic silver nanoparticles (AgNp-bio) were obtained according to Dur\u00e1n et al.  ,22. Brie. (2016) , nanopar. (2016) , the dyn. (2016) , plasmon. (2016) .L. amazonensis (106) were treated with different concentrations of OEO , AgNp-bio  and the proportions of the OEO + AgNp associations: 80%/20% , 60%/40% , 50%/50% , 40%/60%  ,and 20%/80% . The parasites were evaluated in a Neubauer chamber after 24 h of treatment. As a negative control, L. amazonensis promastigotes kept in an untreated culture medium were used, and as vehicle control, DMSO 0.1% was used.The promastigote forms of 5 cells/mL) were recovered from the peritoneal cavity with ice-cold PBS supplemented with 3% FBS and then cultured in 24-well plates with 500 \u00b5L of RPMI 1640 medium and 10% FBS for 24 h at 37 \u00b0C and 5% CO2. The adherent cells were incubated with different concentrations of OEO , AgNp-bio , and the proportions of the association: 80%/20% , 60%/40% , 50%/50% , 40%/60%  and 20%/80%  for 24 h in the same conditions. Subsequently, the cells were washed with PBS, and MTT (5 mg/mL) was added to the wells, followed by further incubation for 4 h. The MTT product  was diluted with 300 \u00b5L of DMSO, transferred to a 96-well plate, and read on a spectrophotometer  at 550 nm. As a negative control, untreated macrophages were used, while the positive control was cells treated with 4% H2O2. The results were expressed as a percentage of viability compared to the control group and calculated using the following formula: % (viable macrophages) = sample from the treated group/mean from the untreated control) \u00d7 100.To evaluate a possible cytotoxic effect of OEO, AgNp-bio, and the associations of both, the MTT assay -2,5-diphenyltetrazolium bromide) (Sigma-Aldrich) was performed, which measures the metabolic activity of the mitochondria, as described by Mosmann (1983). Macrophages (5 \u00d7 1050) and cytotoxicity concentration of 50% of the peritoneal macrophages (CC50) of each proportion of the OEO/AgNp association. For this, the association of OEO/AgNp was evaluated in the following proportions:  that correspond to the doses of . Thus, was constructed an isobologram for anti-leishmania activity and one for the viability of macrophages, where on the x-axis of the graph the AgNp dose was placed and on the y-axis the OEO dose, drawing an additivity line between the values of the isolated substances, wherein points below the line indicate a synergistic effect, points on the line indicate an additive effect, and points above the line indicate an antagonistic effect described by Zhao, Wientjes, and Au (2004) [The interaction dynamics of AgNp and OEO were studied by the method of fixed proportions described by SEIFERT and CROFT, 2006 , to obtau (2004) .50 combined OEO/IC50 OEO alone) +  for activity in promastigotes and CI =  +  for cytotoxicity on peritoneal macrophages, where CI < 1, =1, and >1 indicate a synergistic, additive, and antagonistic effect described by Chou and Talalay (1984) [The value and efficiency of this association can be demonstrated through mathematical calculations using tools such as the combination index (CI) previously described by Hall, Middleton, and Westmacott (1983) . The CI y (1984) .L. amazonensis (106) were treated with the association in the chosen dose (OEO 9.6 \u03bcg/mL and AgNp 0.08 \u03bcg/mL) and incubated for 24 h. Afterward, the parasites were collected by centrifugation, washed in PBS 0.01 M pH 7.2, and fixed by immersion in 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer. For evaluation of morphological changes by SEM, promastigotes were fixed with glutaraldehyde adhered to coverslips covered with poly-L-lysine for 60 min. Afterward, they were washed with 0.1 M sodium cacodylate buffer dehydrated in increasing concentrations of ethanol (30\u2013100%), dried at a critical point by replacing ethanol with CO2, coated with gold, and analyzed using a high-resolution double beam electron microscope FEI SCIOS.Promastigote forms of 2 in 0.1 M sodium cacodylate buffer at room temperature and protected from light. After, the samples were washed with 0.1 M sodium cacodylate buffer, dehydrated in increasing concentrations of acetone (50\u2013100%), included in EPON resin, and polymerized at 60 \u00b0C for 72 h. Ultrathin sections were made in an ultramicrotome, deposited on a copper grid, and contrasted with uranyl acetate and lead citrate for 20 and 10 min, respectively. The analysis was performed using a JEOL JEM 1400 transmission electron microscope.For evaluation of ultrastructural changes by TEM, promastigotes fixed with glutaraldehyde were transferred to microtubes, washed three times with 0.1 M sodium cacodylate buffer, and post-fixed in a solution of 1% osmium tetroxide, 0.8% potassium ferrocyanide, and 10.0 mM CaCl6) were treated with an association at the chosen dose (OEO 9.6 \u03bcg/mL + AgNp 0.08 \u03bcg/mL) for 24 h. After, the parasites were washed with PBS and loaded with 10 \u00b5M of the probe 2\u2032,7\u2032-dichlorodihydrofluorescein diacetate (H2DCFDA) (Sigma-Aldrich) and incubated in the dark for 30 min at 25 \u00b0C. As a positive control, 4% H2O2 was used for 30 min. ROS was measured as an increase in fluorescence caused by the conversion of the non-fluorescent dye to the highly fluorescent 2\u2032,7\u2032-dichlorofluorescein (DCF), in a spectrofluorimeter , at excitation and emission wavelengths of 488 and 530 nm, respectively.Promastigote forms (103PO4) 5%) was added. After 10 min of incubation at room temperature, the samples were placed in 96-well microplates. A standard curve was made using serial dilutions of NaNO2, and the absorbance was determined at 550 nm in a microplate reader .Nitrite levels (NO) were determined by the Griess method as an estimation of the nitric oxide produced. Briefly, 60 \u03bcL aliquots of supernatants from the anti-promastigote or anti-amastigote assay were recovered, and 60 \u03bcL of Griess reagent (1% sulfanilamide and 0.1% of naphthyltylamidine amino acid in orthophosphoric hydrochloride (H6) were treated with an association at the chosen dose (OEO 9.6 \u03bcg/mL and AgNp 0.08 \u03bcg/mL) for 24 h to assess the potential of the internal mitochondrial membrane (\u0394\u03a8m). The treated parasites were washed and incubated with 2.5 \u03bcM tetramethylrhodamine ethyl ester (TMRE) (Sigma-Aldrich) for 30 min at 25 \u00b0C and analyzed in a spectrofluorimeter  at excitation wavelengths of 480 and emission of 580 nm.Promastigote forms (106) treated with an association at the chosen dose (OEO 9.6 \u03bcg/mL + AgNp 0.08 \u03bcg/mL) were harvested and washed twice in PBS and stained with 10 \u03bcg/mL of Nile red (Sigma-Aldrich) for 30 min at 25 \u00b0C. The presence of cytoplasmic lipid bodies was detected in a spectrofluorimeter  at excitation and emission wavelengths of 530 and 635 nm, respectively.Promastigote forms . The parasites were washed twice in PBS, incubated with 5 \u03bcL of monodansilcadaverine (MDC) (Sigma-Aldrich) for 1 h at 25 \u00b0C, and analyzed using a spectrofluorimeter  at excitation and emission wavelengths of 380 and 525 nm, respectively.6) treated with the combination at the chosen dose (OEO 9.6 \u03bcg/mL + AgNp 0.08 \u03bcg/mL) for 24 h were washed and resuspended in 100 \u03bcL of 1x assay buffer , followed by adding a mixture containing 1 \u03bcL of annexin V/FITC  and 1 \u03bcL of propidium iodide (PI) (Santa Cruz Biotechnology). Data analysis was performed using a BD Accuri\u2122 C6 Plus flow cytometer. A total of 10,000 events were acquired. Cells negative for annexin V and PI were considered viable, cells stained with annexin V (positive or negative for PI) were considered apoptotic, and cells positive for PI (and negative for annexin V) were classified as necrotic [Promastigote forms (10necrotic .5) were cultured in 24-well plates containing glass coverslips, incubated with 500 \u03bcL of RPMI 1640 medium for 24 h at 37 \u00b0C and 5% CO2. The adhering macrophages were infected with promastigote forms of L. amazonensis (2.5 \u00d7 106) for 2 h. After infection, the non-internalized promastigote forms were removed by washing with PBS, and the adherent cells were treated with the combination of the compounds of the chosen proportion (OEO 9.6 \u03bcg/mL and AgNp 0.08 \u03bcg/mL), RPMI 1640 medium (negative control), 0.1% DMSO (vehicle), amphotericin B 1 \u00b5M (positive control) for 24 h at 37 \u00b0C and 5% CO2. Then, the cells were stained with methylene blue eosin solution according to Leishman (Leishman\u2019s dye) . A total of 20 fields were analyzed by immersion at 1000x magnification using an optical microscope .Peritoneal macrophages from BALB/c mice  at excitation and emission wavelengths of 488 and 530 nm, respectively.Macrophages infected with amastigote forms were treated with the dose of the chosen proportion (OEO 9.6 \u03bcg/mL + AgNp 0.08 \u03bcg/mL) for 24 h. After this period, the cells were washed with PBS and loaded with 10 \u00b5M of Hp-value \u2264 0.05 was considered statistically significant.The statistical analyzes were determined by ANOVA, followed by the Tukey test for multiple comparisons. Three independent experiments were carried out, each with datasets in triplicate. The data were expressed as mean \u00b1 standard error of the mean. The data were analyzed using GraphPad Prism statistical software . 50) values of the separate compounds, which were the concentration of 16.0 \u00b1 0.05 \u03bcg/mL to OEO and 0.2 \u00b1 0.06 \u03bcg/mL to AgNp (After 24 h of treatment with different doses of OEO (3.12\u2013100 \u00b5g/mL) and AgNp (0.1\u201310 \u00b5g/mL), we verified that the compounds reduced the viability of promastigote forms by 7.61, 36.11, 46.37, 54.03, 86.7, 98.11% for 3.12, 6.25, 12.5, 25, 50, 100 \u00b5g/mL of OEO and 33.87, 61.56, 96.95, 100 and 100% for 0.1, 0.5, 1.0, 5.0, 10.0 \u00b5g/mL of AgNp, respectively. From these results, it was possible to calculate the half maximal inhibitory concentration , P2 = 7.4/0.06 (\u00b10.04), P3 = 8.0/0.10 (\u00b10.02), P4 = 5.1/0.09 (\u00b10.03), and P5 = 2.5/0.13 (\u00b10.03) OEO/AgNp \u03bcg/mL , and the results showed that the proportions P2 = 60%/40%, P4 = 40%/60%, and P5 = 20%/80% of OEO/AgNp presented a CI > 1 , P2 = 90.48/0.75 (\u00b10.02), P3 = 105.90/1.32 (\u00b10.03), P4 = 82.01/1.53 (\u00b10.02), and P5 = 41.06/2.05 (\u00b10.03) \u03bcg/mL OEO/AgNp), and the CI value was calculated, with antagonistic results showing CI > 1 , SEM and TEM were performed to determine the morphological and ultrastructural changes induced by the treatment in promastigote forms. Untreated parasites showed normal characteristics compatible with an elongated body, flagellum proportional to body size, smooth and intact cell surface, and well-preserved structures A,E. MeanBased on previous results, we decided to evaluate the production of ROS and NO, the main microbial molecules, in OEO-AgNp-treated parasites. Our results demonstrated that the association induced an increase in both ROS and NO in promastigotes when compared with the control A,B.As TEM analysis indicated mitochondrial damage in treated parasites, we also aimed to confirm that parasite mitochondria were affected by the treatment. As expected, we found a decreased total TMRE fluorescence of 21.7% in the treated group when compared to the control, indicating a loss of mitochondrial membrane potential C.Analysis by TEM also showed an accumulation of lipid-storage bodies in the cytoplasm; thus, we investigated their presence in parasites treated with the association by staining with Nile red, a fluorescent dye with a high affinity to neutral lipids . Our resAdditionally, it was observed by TEM that treatment with association triggered the intense formation of autophagic vacuoles in promastigotes. Thus, we also evaluated whether the treatment induced an increase in autophagic vacuoles, which may precede cell death. Parasites treated and marked with MDC presented an increase in fluorescence of 180% concerning the control, suggesting the formation of autophagy vacuoles E.Knowing that OEO + NpAg treatment induces ROS and NO production, which leads to mitochondrial dysfunction, lipidic bodies storage, and autophagic vacuole formation, we aimed to identify the type of death triggered by this cascade of processes. For this, we performed the co-labeling of annexin V and propidium iodide (PI). Our data showed that the proportion of viable parasites decreases in OEO + NpAg-treated promastigotes, while the annexin V+ and annexin V+/PI+ subpopulation enhanced significantly when compared to the control A,B, indiWe also evaluated the promastigote size, where we found that the OEO + NpAg treatment was able to significantly reduce the size of parasites when compared to the control C,D, confSince amastigotes are intracellular forms, we investigated the effect of the association on infected macrophages. For this, the production of NO and ROS in these cells was evaluated. The results showed a significant increase in NO and ROS compared to the control .p \u2264 0.0001), similar to the positive control, AmB, which induced a reduction of the 46% \u00b1 1.39 (p \u2264 0.0001) when compared to the control. With regard to the number of amastigotes per macrophage, the association has also shown a similar effect to the standard drug (AmB), presenting a reduction of 30.7% (p \u2264 0.01)  .Leishmania spp. parasites, without side effects, is increasing. OEO exhibited a potential leishmanicidal effect on L. amazonensis promastigote forms, resulting in a combination of autophagic, apoptotic, and necrotic events [The current treatment of leishmaniasis has some flaws, such as difficulty in administration, toxicity leading to adverse effects, and parasite resistance, which drives us to search for new treatment strategies for leishmaniasis . In thisc events .The use of nanotechnology has also shown to be a promising strategy, since it is a delivery system that carries drugs to specific targets ,23,33. MIn our study, an important synergistic leishmanicidal effect of the association of OEO + AgNp was demonstrated, since some proportions showed CI values < 1, and in the isobologram, some proportions were below the additivity line. Similar results were observed by Scandorieiro et al. (2016) , which sL. amazonensis. Previous studies using different natural or synthetic compounds on L. amazonensis promastigotes reported similar changes to those observed in our study [SEM and TEM showed that the association induced several morphological and ultrastructural changes in promastigotes of ur study ,9,10,12.Leishmania spp. are its single mitochondria, and the survival of this parasite depends on the perfect functioning of this organelle [We also showed the likely mechanism by which this association exerts its antileishmanial effects. We initially focused our studies on investigating alterations in mitochondria. Notable characteristics of rganelle .We observed an increase in the production of ROS in treated promastigotes. ROS are molecules derived from the incomplete one-electron reduction in molecular oxygen, and high concentrations might induce oxidative damage . The assL. amazonensis mitochondria have been published, showing changes in \u0394\u03a8m [Increases in oxidant species induce mitochondrial dysfunction, such as mitochondrial swelling and alterations in the mitochondrial membrane potential \u0394\u03a8m . In thiss in \u0394\u03a8m ,8,10,41.L. amazonensis were exposed to 4-hydrazinoquinoline analog, these results being compatible with those found in our study.Since mitochondrial dysfunctions, such as mitochondrial depolarization, induce an increase in lipid bodies, the association of OEO + AgNp also increased lipid droplets formation in the cytoplasm, revealed here by the Nile red and TEM . AntinarL. amazonensis, revealed by electron microscopy, and all of the morphological, ultrastructural, and biochemical alterations induced by the association suggest apoptosis-like cell death.The mitochondrial depolarization associated with the accumulation of lipid bodies in the cytoplasm is an event characteristic of the occurrence of apoptosis-like cell death. It is well described in the literature that apoptosis is characterized by several morphological features, among which are cell rounding, cell shrinkage, chromatin condensation, nuclear fragmentation, ultrastructural modifications of cytoplasmic organelles, and plasma membrane modifications with the maintenance of its integrity membrane ,44. Our In this way, we used phosphatidylserine, a phospholipid naturally present in the inner plasma membrane leaflet that switches to the outer leaflet during apoptosis; annexin V, a marker that binds in phospholipid classes ; and PI,The presence of autophagy vacuoles was also observed in our study by MDC labeling. The increase in the formation of autophagic vacuoles can be mainly induced by the increases in cellular ROS levels ,31,38. AL. amazonensis amastigotes forms and reduced the number of infected macrophages [Amastigotes are obligatory intracellular parasites localized in parasitophorous vacuoles of phagocytic cells of the host . AgNp-Birophages .L. amazonensis, since a reduction in the percentage of infected macrophages and the number of intracellular parasites was observed. An increase in ROS and NO in infected macrophages was also observed after treatment with the association. Several studies also describe similar results, demonstrating that the probable mechanism of death of Leishmania spp. is through molecules such as ROS and NO released by infected macrophages [In our study, we observed the anti-amastigote effect of the OEO + AgNp association in macrophages infected by rophages ,9,10.L. amazonensis was not observed by Fanti et al. (2018) [However, the increase in ROS and NO in infected macrophages with amastigotes of . (2018) , which u. (2018) ,35,36 anL. amazonensis through the association of OEO and AgNp, accomplished via metabolic, morphologic, and structural events that induce late apoptosis. In addition, this combination exhibited a remarkable reduction in cytotoxicity in peritoneal macrophages while concurrently eliciting a potent leishmanicidal effect in intracellular amastigotes, possibly via the induction of ROS and NO. These results serve as a powerful impetus to continue our efforts in unraveling the intricate mechanisms of action underpinning the death of this parasite. This combination therapy study determined the mechanisms involved in in vitro OEO + AgNp association against L. amazonensis-infected macrophages and highlights a new and innovative therapeutic approach that can be explored as a candidate for future investigations in drug development in leishmaniasis treatment.Our research findings reveal a strikingly synergistic leishmanicidal effect in vitro on promastigote forms of"}
{"text": "We examined the surface wettability, morphology, composition, oil absorption capacity, oil/water separation performance, flux rate, chemical stability, and mechanical stability of the S.P membrane. Our findings indicate that the developed CQD-based S.P membrane possesses excellent S.P properties, displaying high water contact angles of 163\u00b0 and low water sliding angles of 1\u00b0. The membrane demonstrated superior oil absorption capacity, separation efficiency, and flux rate towards three different oils\u2014petroleum ether, n-hexane, and silicone oil. Petroleum ether has the highest separation efficiency (99.5%), and flux rate , while silicone oil has the lowest. However, silicone oil has the highest absorption capacity (218.9 g/g) and petroleum ether has the lowest (194.8 g/g). For the absorption capacity and separation efficiency, a one-way ANOVA test was conducted. The statistical analyses revealed significant differences in absorption capacity and separation efficiency for the three oils, highlighting the efficacy of the superhydrophobic membrane for tailored oil/water separation. Additionally, the S.P membrane exhibited good mechanical (the membrane maintains its superhydrophobicity until an abrasion length of 850 cm) and chemical stability (the membrane maintains its superhydrophobicity in pH range 1\u201313), withstanding abrasion and immersion in solutions of varying pH values. The CQD-based S.P membrane shows great potential as a promising material for oil/water separation applications, with excellent performance and stability under various environmental conditions.The efficient separation of oil and water is a significant challenge worldwide due to the increasing frequency of industrial oily wastewater. Previous work by our group utilizes biological metal\u2013organic framework-based superhydrophobic (S.P) textile fabric for oil/water separation. However, this system is limited due to the low mechanical stability, so there is a need for producing a more robust S.P membrane for oil/water separation. In this study, we report on the synthesis of carbon quantum dots (CQD) from banana leaves via a hydrothermal process and their application in producing a robust S.P coating on textile fabric for oil/water separation. The CQDs were characterized using various techniques including TEM, XRD, absorbance spectroscopy, and the BET method. The TEM images showed that the CQDs were circular in shape with a size of 4.4 nm, while the XRD micrograph indicated that the CQDs were crystalline in nature. The UV\u2013vis graph showed a peak at a wavelength of 278 nm, suggesting strong absorption in the ultraviolet region. The BET-specific surface area of the prepared CQDs is 845 m Modern human society faces a critical and difficult requirement for a sustainable supply of clean water. The discharge and leakage of oily waste materials into several water streams  have become a significant challenge due to the industrial revolution ,2. The pVarious conventional methods have been utilized to separate mixtures of O-W. These methods include physical techniques such as ultrasonic separation, dissolved air floatation, centrifugation, and gravity separation, as well as chemical techniques such as flocculation separation, neutralization, and coagulation ,8,9,10. Researchers have conducted extensive studies on wettable membranes inspired by nature for O-W separation ,16. ReceS.P materials have demonstrated significant potential in various applications, including corrosion protection of metals and alloys, drag reduction, self-cleaning, anti-icing, and O-W separation ,19,20,21In recent times, different techniques such as plasma etching, chemical vapor deposition, the hydrothermal method, electrodeposition, and atomic layer deposition process have been employed to create S.P membranes ,24,25. HCarbon quantum dots (CQDs) are nanomaterials with carbon skeleton structures that have functional groups on their surfaces and are often spherical in shape and less than 10 nm in size ,28. CQDsFluorinated chemicals, such as fluorocarbon molecules or fluorosilane, are commonly used to create S.P coatings due to their extremely low surface energy . HoweverPrevious work by our group utilized metal\u2013organic framework-coated textiles for oil/water separation . HoweverThe experiment employed analytical-grade sulfuric acid, sodium hydroxide, n-hexane (n-H.E), petroleum ether (P.E), silicone oil (S.O), bromothymol blue, and stearic acid (S.A), which were purchased from Chematek company (Egypt). The pristine textile fabric (TF) and banana leaves were bought from a nearby marketplace.The typical procedure involved washing 2 g of banana leaves with distilled water twice and air-drying them. The dried leaves were then finely powdered using a mortar and pestle. The resulting powder was mixed with 30 mL of distilled water and stirred at room temperature for 15 min. The solution was then transferred into a Teflon autoclave and heated at 200 \u00b0C for 3 h. After cooling to room temperature, a carbonaceous solution was obtained and centrifuged at 10,000 rpm for 15 min to remove larger and undissolved particles, and the supernatant solution was collected. The supernatant solution was then passed through a 0.22 \u03bcm syringe filter, resulting in a light brown solution that was further diluted with ultrapure water for subsequent use.A circular TF measuring 10.5 mm in diameter was placed in a solution of carbon quantum dots (CQDs) and left to soak for one hour. The TF was then air-dried for 2 h at room temperature and subsequently dried for 2 h at a temperature of 100 \u00b0C. Next, the TF was submerged in an ethanolic solution containing 0.01 M S.A for 0.5 h. The resulting superhydrophobic textile fabric, TF@CQD@S.A, was air-dried for 2 h at room temperature and then dried for 2 h at a temperature of 60 \u00b0C.The absorption behavior of the prepared CQD was investigated using a UV\u2013vis spectrophotometer with a scan range of 200 to 400 nm. Before measuring the spectra, the samples were diluted in distilled water. All measurements were conducted at room temperature. The size and shape of CQS were determined using a transmission electron microscope . A Bruker D2 Phaser X-ray diffractometer was utilized to perform an X-ray diffraction examination using Cu K radiation with a monochromatic source. The composition of the prepared CQD was analyzed using Fourier-transform infrared spectroscopy (FTIR) (model: Bruker Tensor 37 FTIR). The Brunauer\u2013Emmett\u2013Teller method  was used to investigate the textural properties of the prepared CQD.To examine the morphological changes in the TF following S.P coating, a JEOL JSM-200 IT scanning electron microscope (SEM) was utilized. The elemental composition of the TF before and after S.P coating was analyzed using Fourier-transform infrared spectroscopy (FTIR) (model: Bruker Tensor 37 FTIR). We utilized an energy-dispersive X-ray spectrometer  to determine the elemental composition of the CQDs, and the TF before and after S.P coating. The water contact angle (WCA) and water sliding angle (WSA) were measured with a Rame-hart WCA instrument (model 190-F2) using 5 \u00b5L water droplets, and the reported WCA values are the average of four tests conducted at different locations on the prepared STF surface. The pH of the water droplets was adjusted using sulfuric acid and sodium hydroxide.To evaluate the mechanical stability of the prepared STF, an abrasion test was performed. The STF was placed on 800-mesh sandpaper and dragged with a weight that exerted a pressure of 5 kPa, and the WCA and WSA were measured every 5 cm. The chemical stability of the STF was assessed by immersing several fabricated samples in solutions with a pH range of 1 to 13 for one hour, and the impact on the WCA and WSA values was evaluated. The reported mechanical and chemical stability data represent the average of three tests and the standard deviation error bar is represented in the graphs.0 (g). The STF was then placed in oil or organic solvents until it reached adsorption saturation, and it was reweighed again as M1 (g). The adsorption capacity  of the STF was calculated using Equation (1) [When evaluating absorbing materials, absorption capacity is a crucial factor in practice. To determine the adsorption capacity of the STF, a typical absorption test was conducted. Initially, the weight of a clean STF was recorded in the air as Mtion (1) :Q = M1/M0) and after (m1) separation was measured to determine the separation efficiency (\u03b7) using Equation (2) [To assess the oil/water separation performance of the STF, a mixture of 20 mL organic solvent and 20 mL water (bromothymol blue was added to the distilled water to provide color) was poured onto a self-built gravity-driven laboratory device. While the TF as a filtration membrane allows the passage of both oil and water, the STF as a filtration membrane allows the passage of oil only and so separation of O-W mixture. Upon introducing oily wastewater into the separation system, the STF facilitated the passage of oil, which accumulated in the lower container, while the water was retained in the upper container. The weight of the oil before (mtion (2) .\u03b7 =  was employed .Flux = 2) is the contact area, and t (h) represents the recorded oil permeation time. The oil absorption capacity and oil/water separation performance tests were conducted three times and the standard deviation error bar is represented in the graphs. A schematic illustration of the synthesis of CQD and fabrication of STF and its utilization in the separation procedure is presented in Here, V (L) denotes the volume of oil permeation, S  of 0.05 was chosen to assess the results. If the p-value was less than this significance level, it was considered statistically significant, leading to the rejection of the null hypothesis.The statistical analysis for the absorption capacity and separation performance tests for the prepared STF toward the three oils was performed using descriptive statistics and a one-way analysis of variance (ANOVA) test. The data obtained for each trial  of absorption capacity and separation performance for each oil were recorded and analyzed. The control group consisted of pristine textile fabric without any superhydrophobic coating. Descriptive statistics were used to calculate the mean and standard deviation of the absorption capacity and separation performance for each oil. This helped in summarizing the data and understanding the differences in absorption capacity between the superhydrophobic fabric and the control group. To determine if there were significant differences in the absorption capacity and separation performance between the three oils, a one-way ANOVA test was conducted. The null hypothesis (H0) stated that there were no significant differences between the means of the groups, while the alternative hypothesis (HA) hypothesized significant differences between the means. The ANOVA results provided an F-value and a 2 adsorption/desorption isotherm. 2/g, the pore volume is 0.33 cm3/g, and the mean pore diameter of 1.62 nm. When CQDs are grafted onto a substrate, a larger BET surface area of the CQDs will result in the creation of more roughness on the substrate surface (the roughness is the parameter for creating an S.P surface). The yield of prepared CQDs is 13.5%.The CQDs were characterized using TEM, XRD, absorbance spectroscopy, and the BET method, \u22121 is likely due to the presence of O-H stretching vibrations [\u22121 and 2861 cm\u22121 correspond to C-H stretching vibrations, while the peak at 2072 cm\u22121 is likely due to C\u2261C stretching vibrations [\u22121 and 1442 cm\u22121 correspond to C=C stretching vibrations, while the peak at 1126 nm is due to C-O stretching vibrations. The peaks at 754 cm\u22121 and 550 cm\u22121 correspond to C-H bending vibrations [FTIR is a commonly used spectroscopic technique that provides information on the chemical bonds present in a material. The FTIR results for CQDs, TF, and STF are shown in brations . The peabrations . The peabrations .\u22121 is attributed to the N-H stretching vibrations. The peaks at 2930 cm\u22121 and 2862 cm\u22121 are due to the symmetric and asymmetric stretching vibration of CH. The peak at 1643 cm\u22121 is likely due to C=C stretching vibrations. The peaks at 1305 cm\u22121 and 1159 cm\u22121 are due to the C-N stretching vibration. The peak at 989 cm\u22121 is attributed to the bending of C-H. The peak at 764 cm\u22121 is due to the out-of-plane bending of N-H while the peak at 595 cm\u22121 may correspond to C-H out-of-plane bending vibrations [The FTIR results for the TF show various peaks which correspond to various functional groups that are present in the TF. The peak at 3414 cmbrations .The FTIR results for the STF show similar peaks to that of CQDs and TF with a small shift in peak position indicating that the TF is successfully grafted with CQDs and stearic acid.The EDX technique is utilized to investigate the composition of the CQD, TF, and STF, The morphology of both the TF and STF membrane was examined using SEM, as depicted in To assess the wetting behavior of the TF and STF, the WCA and WSA were measured. The TF exhibited hydrophilic properties, with a WCA value equal 0 degrees. This caused water droplets to adhere to the surface without sliding off, even when the fabric was tilted. In contrast, the STF demonstrated remarkable S.P properties, with a WCA value of 163\u00b0 \u00b1 0.7\u00b0 and a WSA value of 1\u00b0 \u00b1 0.1\u00b0.To evaluate the stability of the STF, its absorption capacity towards the three oils was measured ten times. After each cycle, the oil absorption capacity was determined, and the STF was compressed to ensure complete desorption of the organic solvent. The absorption capacity of the STF towards the three oils remained constant after ten cycles of absorption and desorption. This suggests that the STF is stable and can be reused multiple times without losing its oil absorption capacity. The prepared STF has superior absorption capacities compared to previously known absorbents ,42.p-value is less than the significance level (\u03b1 = 0.05), indicating that there is strong evidence to reject the null hypothesis. This means that there are significant differences in absorption capacity between the three oils.The separation efficiency of the STF decreased gradually with the number of cycles, and the separation efficiency reached a minimum value of approximately 95% after ten separation cycles. This decrease in separation efficiency could be due to the accumulation of oil on the surface of the STF, which can clog the pores and reduce its ability to repel water. Additionally, repeated cycles of absorption and desorption can cause wear and tear on the coating, leading to a decline in its performance over time. The O-W separation efficiency of the STF is higher than that of previously reported absorbents ,44.p-value is less than the significance level (\u03b1 = 0.05), indicating strong evidence to reject the null hypothesis. Thus, it can be concluded that there are significant differences in separation performance between the three oils.The mechanical stability of the developed STF was examined by evaluating the impact of abrasion length on the WCA and WSA on the STF, as shown in The chemical stability of the developed STF under different pH conditions was studied, \u22122 h\u22121, followed by n-H.E with a value of 13,100 L m\u22122 h\u22121, and S.O with a value of 11,900 L m\u22122 h\u22121. This suggests that the membrane has higher permeability towards P.E due to its lower viscosity and surface tension and viscosity compared to the other oils.The flux rate of the developed STF towards three different oils, namely n-H.E, P.E, and S.O, was examined. The results indicate that the flux rate of the STF towards P.E is the highest among the three oils, with a value of 13,500 L m\u22122 h\u22121, n-H.E to 12,600 L m\u22122 h\u22121, and S.O to 11,100 L m\u22122 h\u22121. This decrease in flux rate could be attributed to the accumulation of oil on the surfasce of the coating, which can clog the pores and reduce their permeability. The flux rates of the STF are superior to those of many previously reported absorbents [The impact of repeated separation cycles on the flux rate of the membrane was investigated. The results reveal that after ten separation cycles, the flux values for the three oils have slightly decreased, with the flux rate for P.E decreasing to 12,850 L msorbents .The separation of oil and water is an important challenge due to industrial oily wastewater. Prior work by our group used metal\u2013organic framework (MOF)-coated textiles fabric for oil/water separation. However, the mechanical stability was low. In this work, a robust CQDs-based S.P coating was successfully fabricated on textile fabric for O-W separation. The CQDs were prepared using banana leaves as a raw material by the hydrothermal method.2/g, a pore volume of 0.33 cm3/g, and a mean pore diameter of 1.62 nm. The surface composition, morphology, wettability, O-W separation performance, oil absorption capacity, flux rate, mechanical stability, and chemical stability of the membrane were investigated. The results indicate that the developed STF membrane exhibits excellent S.P properties, with a high WCA of 163 degrees and a low WSA of 1 degree. The membrane also shows good oil absorption capacity, separation efficiency, and flux rate towards three different oils, namely n-H.E, P.E, and S.O. The P.E has the highest separation efficiency and flux rate, while the S.O has the lowest. On the other hand, the S.O has the highest absorption capacity, and the P.E has the lowest. The statistical analyses were performed using a one-way ANOVA test on both the absorption capacity and separation efficiency data. The obtained p-values were significantly lower than the predetermined significance level, indicating robust evidence supporting the presence of significant differences among the three oils. These findings highlight the effectiveness of the superhydrophobic membrane for oil/water separation, with varying performance depending on the type of oil. This information is crucial in the development of efficient and tailored separation materials for specific oil/water separation applications. The membrane also demonstrates good mechanical and chemical stability, with the ability to withstand abrasion and immersion in solutions of different pH values for varying immersion times.The prepared CQDs were characterized using multiple techniques, including transmission electron microscopy (TEM), X-ray diffraction (XRD), absorbance spectroscopy, and the BET method. TEM analysis revealed that the CQDs exhibited a circular shape with an average size of 4.4 nm. XRD analysis indicated that the CQDs possessed a crystalline structure. The UV\u2013vis spectrum exhibited a pronounced peak at 278 nm, suggesting strong absorption in the ultraviolet region. Furthermore, the BET analysis determined that the prepared CQDs had a specific surface area of 845 m"}